WorldWideScience

Sample records for adenine nucleotides

  1. Labeling of mitochondrial adenine nucleotides of bovine sperm

    International Nuclear Information System (INIS)

    Cheetham, J.; Lardy, H.A.

    1986-01-01

    Incorporation of 32 P/sub i/ into the adenine nucleotide pool of intact bovine spermatozoa utilizing endogenous substrates results in a specific activity (S.A.) ratio ATP/ADP of 0.3 to 0.5, suggesting compartmentation of nucleotide pools or a pathway for phosphorylation of AMP in addition to the myokinase reaction. Incubation of filipin-permeabilized cells with pyruvate, acetylcarnitine, or α-ketoglutarate (αKG) resulted in ATP-ADP S.A. ratios of 0.5, 0.8, and 1.6, respectively, for mitochondrial nucleotides. However, when malate was included with pyruvate or acetylcarnitine, the ATP/ADP S.A. ratio increased by 400% to 2.0 for pyruvate/malate and by 290% to 2.8 for acetylcarnitine/malate, while the ATP/ADP ratio increased by less than 100% in both cases. These results may indicate that under conditions of limited flux through the citric acid cycle a pathway for phosphorylation of AMP from a precursor other than ATP exists or that ATP is compartmented within the mitochondrion. In the presence of uncoupler and oligomycin with αKG, pyruvate/malate, or acetylcarnitine/malate, 32 P/sub i/ is incorporated primarily into ATP, resulting in an ATP/ADP S.A. ratio of 4.0 for αKG, 2.7 for pyruvate/malate, and 2.8 for acetylcarnitine/malate. These data are consistent with phosphorylation of ADP during substrate level phosphorylation in the citric acid cycle

  2. Purine nucleotide synthesis from exogenous adenine and guanine in rodent small intestine

    International Nuclear Information System (INIS)

    Gross, C.J.; Karlberg, P.K.; Savaiano, D.A.

    1986-01-01

    14 C-Adenine and 14 C-guanine uptake was studied in isolated guinea pig enterocytes. Cells were incubated in Hank's buffer and separated from the medium by centrifugation through silicone oil into 1M PCA. Uptake was temperature and concentration dependent. Both compounds were incorporated into nucleotides as measured by HPLC and HVE. Adenine was more extensively incorporated into nucleotides than was guanine. Adenine nucleotides accounted for about 70% of the intracellular label after 30 min with a majority being ADP and ATP (medium concentration = 10 μM). Guanine nucleotides accounted for only 30% of the intracellular label after 30 min. Labeled intracellular free adenine or guanine were not detected. Significantly more guanine vs. adenine was converted to uric acid. After 30 min, 11.5 +/- 3.9% (n=3) and 83.0 +/- 8.4% (n=4) of the label was present as uric acid in the medium when adenine and guanine, respectively, were the substrate. After 1 min, 34.8 +/- 3.4% (n=4) of the label in the medium was present as uric acid when guanine was the substrate. Decreasing the concentration of adenine resulted in an increase in the percent of uric acid in the medium. 14 C-adenine (75 nmol) was injected into 1 gm segments of rat jejunum. After 5 min., segments were quickly flushed and the tissue homogenized in 1M PCA. Only uric acid was present after 5 min (n=6). In contrast, in animals fasted 3 to 5 days, less conversion to uric acid was observed in the intestinal content (50-80% of the same dose was still present as adenine after 5 min) and nucleotide formation was observed in the tissue. The results indicate that uric acid and nucleotide synthesis from exogenous adenine and guanine are concentration dependent and affected by nutritional state

  3. Effect of adenine nucleotides and gamma radiation on the transport of TEMPOL across the erythrocyte membrane

    Energy Technology Data Exchange (ETDEWEB)

    Jozwiak, Z.; Gwozdzinski, K.; Helszer, Z. (Lodz Univ. (Poland). Dept. of Biophysics)

    1983-09-01

    External adenine compounds bring about changes in the transport of hydrophilic molecules across control and irradiated bovine erythrocyte membranes. Changes in the transport induced by incubation of erythrocytes with nucleotides depend on the type of nucleotide and its concentration. The range of nucleotide concentrations over which the stimulatory effect on the transport occurs is established.

  4. Relation between energy production and adenine nucleotide metabolism in human blood platelets

    NARCIS (Netherlands)

    Akkerman, Jan Willem N.; Gorter, G.

    1980-01-01

    The relation between ATP production and adenine nucleotide metabolism was investigated in human platelets which were starved by incubation in glucose-free, CN−-containing medium and subsequently incubated with different amounts of glucose. In the absence of mitochondrial energy production (blocked

  5. Ethanol-induced activation of adenine nucleotide turnover. Evidence for a role of acetate

    International Nuclear Information System (INIS)

    Puig, J.G.; Fox, I.H.

    1984-01-01

    Consumption of alcohol causes hyperuricemia by decreasing urate excretion and increasing its production. Our previous studies indicate that ethanol administration increases uric acid production by increasing ATP degradation to uric acid precursors. To test the hypothesis that ethanol-induced increased urate production results from acetate metabolism and enhanced adenosine triphosphate turnover, we gave intravenous sodium acetate, sodium chloride and ethanol (0.1 mmol/kg per min for 1 h) to five normal subjects. Acetate plasma levels increased from 0.04 +/- 0.01 mM (mean +/- SE) to peak values of 0.35 +/- 0.07 mM and to 0.08 +/- 0.01 mM during acetate and ethanol infusions, respectively. Urinary oxypurines increased to 223 +/- 13% and 316 +/- 44% of the base-line values during acetate and ethanol infusions, respectively. Urinary radioactivity from the adenine nucleotide pool labeled with [8-14C] adenine increased to 171 +/- 27% and to 128 +/- 8% of the base-line values after acetate and ethanol infusions. These data indicate that both ethanol and acetate increase purine nucleotide degradation by enhancing the turnover of the adenine nucleotide pool. They support the hypothesis that acetate metabolism contributes to the increased production of urate associated with ethanol intake

  6. [Adenine nucleotides and metabolites of glycolysis in the liver in auxiliary transplantation].

    Science.gov (United States)

    Röhnert, C; Weber, K; Schuster, R; Lauschke, G; Häcker, R

    1982-07-01

    The metabolic state of the liver during preservation as well as in and after auxiliary transplantation was investigated in dogs. The biopsy was carried out by means of TRU-CUT biopsy needle. - The ATP concentration, the storage of energy, the amount of the adenine nucleotides, and the ATP/ADP quotient decrease in the preserved liver. The AMP concentration, the concentration of the hexosemonophosphates and the mass-effective quotient of the phosphofructokinase increase simultaneously. The energy supply is the glycolysis exclusively. A lactate accumulation is avoided by continuous perfusion. - The changeover of the anaerobic to the aerobic energy preparation took place by degrees after the recovery of the liver circulation. The ATP concentration, the ATP/ADP quotient, the storage of energy, and the amount of the adenine nucleotides increase in the transplanted liver. - An irreversible ischemic damage of the liver appears in the metabolic state of the organ by a massive decrease of the ATP concentration below 0.7 mmol/kg, the amount of the adenine nucleotides below 1.8 mmol/kg, and AMP concentration.

  7. Direct Visualization of Asymmetric Adenine Nucleotide-Induced Conformational Changes in MutLα

    Science.gov (United States)

    Sacho, Elizabeth J; Kadyrov, Farid A; Modrich, Paul; Kunkel, Thomas A; Erie, Dorothy A

    2010-01-01

    Summary MutLα, the heterodimeric eukaryotic MutL homolog, is required for DNA mismatch repair (MMR) in vivo. It has been suggested that conformational changes, modulated by adenine nucleotides, mediate the interactions of MutLα with other proteins in the MMR pathway, coordinating the recognition of DNA mismatches by MutSα and the activation of MutLα with the downstream events that lead to repair. Thus far, the only evidence for these conformational changes has come from x-ray crystallography of isolated domains, indirect biochemical analyses, and comparison to other members of the GHL ATPase family to which MutLα belongs. Using atomic force microscopy (AFM), coupled with biochemical techniques, we demonstrate that adenine nucleotides induce large asymmetric conformational changes in full-length yeast and human MutLα, and that these changes are associated with significant increases in secondary structure. These data reveal an ATPase cycle where sequential nucleotide binding, hydrolysis, and release modulate the conformational states of MutLα. PMID:18206974

  8. Human Adenine Nucleotide Translocase (ANT) Modulators Identified by High-Throughput Screening of Transgenic Yeast.

    Science.gov (United States)

    Zhang, Yujian; Tian, Defeng; Matsuyama, Hironori; Hamazaki, Takashi; Shiratsuchi, Takayuki; Terada, Naohiro; Hook, Derek J; Walters, Michael A; Georg, Gunda I; Hawkinson, Jon E

    2016-04-01

    Transport of ADP and ATP across mitochondria is one of the primary points of regulation to maintain cellular energy homeostasis. This process is mainly mediated by adenine nucleotide translocase (ANT) located on the mitochondrial inner membrane. There are four human ANT isoforms, each having a unique tissue-specific expression pattern and biological function, highlighting their potential as drug targets for diverse clinical indications, including male contraception and cancer. In this study, we present a novel yeast-based high-throughput screening (HTS) strategy to identify compounds inhibiting the function of ANT. Yeast strains generated by deletion of endogenous proteins with ANT activity followed by insertion of individual human ANT isoforms are sensitive to cell-permeable ANT inhibitors, which reduce proliferation. Screening hits identified in the yeast proliferation assay were characterized in ADP/ATP exchange assays employing recombinant ANT isoforms expressed in isolated yeast mitochondria and Lactococcus lactis as well as by oxygen consumption rate in mammalian cells. Using this approach, closantel and CD437 were identified as broad-spectrum ANT inhibitors, whereas leelamine was found to be a modulator of ANT function. This yeast "knock-out/knock-in" screening strategy is applicable to a broad range of essential molecular targets that are required for yeast survival. © 2016 Society for Laboratory Automation and Screening.

  9. Functional expression of human adenine nucleotide translocase 4 in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Takashi Hamazaki

    2011-04-01

    Full Text Available The adenine nucleotide translocase (ANT mediates the exchange of ADP and ATP across the inner mitochondrial membrane. The human genome encodes multiple ANT isoforms that are expressed in a tissue-specific manner. Recently a novel germ cell-specific member of the ANT family, ANT4 (SLC25A31 was identified. Although it is known that targeted depletion of ANT4 in mice resulted in male infertility, the functional biochemical differences between ANT4 and other somatic ANT isoforms remain undetermined. To gain insight into ANT4, we expressed human ANT4 (hANT4 in yeast mitochondria. Unlike the somatic ANT proteins, expression of hANT4 failed to complement an AAC-deficient yeast strain for growth on media requiring mitochondrial respiration. Moreover, overexpression of hANT4 from a multi-copy plasmid interfered with optimal yeast growth. However, mutation of specific amino acids of hANT4 improved yeast mitochondrial expression and supported growth of the AAC-deficient yeast on non-fermentable carbon sources. The mutations affected amino acids predicted to interact with phospholipids, suggesting the importance of lipid interactions for function of this protein. Each mutant hANT4 and the somatic hANTs exhibited similar ADP/ATP exchange kinetics. These data define common and distinct biochemical characteristics of ANT4 in comparison to ANT1, 2 and 3 providing a basis for study of its unique adaptation to germ cells.

  10. Functional expression of human adenine nucleotide translocase 4 in Saccharomyces cerevisiae.

    Science.gov (United States)

    Hamazaki, Takashi; Leung, Wai-Yee; Cain, Brian D; Ostrov, David A; Thorsness, Peter E; Terada, Naohiro

    2011-04-21

    The adenine nucleotide translocase (ANT) mediates the exchange of ADP and ATP across the inner mitochondrial membrane. The human genome encodes multiple ANT isoforms that are expressed in a tissue-specific manner. Recently a novel germ cell-specific member of the ANT family, ANT4 (SLC25A31) was identified. Although it is known that targeted depletion of ANT4 in mice resulted in male infertility, the functional biochemical differences between ANT4 and other somatic ANT isoforms remain undetermined. To gain insight into ANT4, we expressed human ANT4 (hANT4) in yeast mitochondria. Unlike the somatic ANT proteins, expression of hANT4 failed to complement an AAC-deficient yeast strain for growth on media requiring mitochondrial respiration. Moreover, overexpression of hANT4 from a multi-copy plasmid interfered with optimal yeast growth. However, mutation of specific amino acids of hANT4 improved yeast mitochondrial expression and supported growth of the AAC-deficient yeast on non-fermentable carbon sources. The mutations affected amino acids predicted to interact with phospholipids, suggesting the importance of lipid interactions for function of this protein. Each mutant hANT4 and the somatic hANTs exhibited similar ADP/ATP exchange kinetics. These data define common and distinct biochemical characteristics of ANT4 in comparison to ANT1, 2 and 3 providing a basis for study of its unique adaptation to germ cells.

  11. Divalent phosphate is a counterion for carboxyatractyloside-insensitive adenine nucleotide transport in rat liver mitochondria

    International Nuclear Information System (INIS)

    Nosek, M.T.; Aprille, J.R.

    1986-01-01

    Unidirectional, carboxyatractyloside(CAT)-insensitive adenine nucleotide (AdN) fluxes have been studied in isolated rat liver mitochondria (mito). Previous work has shown that ATP x Mg transport in one direction is coupled to ATP x Mg or P/sub i/ transport in the opposite direction. The purpose of this study was to determine whether divalent HPO 4 2- or monovalent H 2 PO 4 - is the transported phosphate species. The authors used the monofluorophosphate (PO 3 F 2- ) and difluorophosphate (PO 2 F 2 - ) analogues as potential counterions forAdN efflux. After a preincubation on ice with 14 C-ADP to label the matrix AdN, efflux was measured at 30 0 C, pH 7.4, in 225mM sucrose, 10mM KCl, 5mM MgCl 2 , 5mM glutamate, 5mM malate, 10mM Tris, 0.5mM P/sub i/, 1mM ATP, and 5μM CAT. With no other additions efflux was -0.62 +/- 0.20 nmole/minute/mg protein. The data supports the hypothesis that divalent but not monovalent phosphate can act as a counterion for ATPx Mg transport over this CAT-insensitive carrier

  12. Adenine nucleotide translocase 4 is expressed within embryonic ovaries and dispensable during oogenesis.

    Science.gov (United States)

    Lim, Chae Ho; Brower, Jeffrey V; Resnick, James L; Oh, S Paul; Terada, Naohiro

    2015-02-01

    Adenine nucleotide translocase (Ant) facilitates the exchange of adenosine triphosphate across the mitochondrial inner membrane and plays a critical role for bioenergetics in eukaryotes. Mice have 3 Ant paralogs, Ant1 (Slc25a4), Ant2 (Slc25a5), and Ant4 (Slc25a31), which are expressed in a tissue-dependent manner. We previously identified that Ant4 was expressed exclusively in testicular germ cells in adult mice and essential for spermatogenesis and subsequently male fertility. Further investigation into the process of spermatogenesis revealed that Ant4 was particularly highly expressed during meiotic prophase I and indispensable for normal progression of leptotene spermatocytes to the stages thereafter. In contrast, the expression and roles of Ant4 in female germ cells have not previously been elucidated. Here, we demonstrate that the Ant4 gene is expressed during embryonic ovarian development during which meiotic prophase I occurs. We confirmed embryonic ovary-specific Ant4 expression using a bacterial artificial chromosome transgene. In contrast to male, however, Ant4 null female mice were fertile although the litter size was slightly decreased. They showed apparently normal ovarian development which was morphologically indistinguishable from the control animals. These data indicate that Ant4 is a meiosis-specific gene expressed during both male and female gametogenesis however indispensable only during spermatogenesis and not oogenesis. The differential effects of Ant4 depletion within the processes of male and female gametogenesis may be explained by meiosis-specific inactivation of the X-linked Ant2 gene in male, a somatic paralog of the Ant4 gene. © The Author(s) 2014.

  13. An alternative membrane transport pathway for phosphate and adenine nucleotides in mitochondria and its possible function

    Science.gov (United States)

    Reynafarje, Baltazar; Lehninger, Albert L.

    1978-01-01

    This paper describes the properties and a possible biological role of a transport process across the inner membrane of rat liver mitochondria resulting in the exchange of ATP4- (out) for ADP3- (in) + 0.5 phosphate2- (in). This transmembrane exchange reaction, designated as the ATP-ADP-phosphate exchange, is specific for the ligands shown, electroneutral, insensitive to N-ethylmaleimide or mersalyl, inhibited by atractyloside, and appears to occur only in the direction as written. It is thus distinct from the well-known phosphate-hydroxide and phosphate-dicarboxylate exchange systems, which are inhibited by mersalyl, and from the ATP-ADP exchanger, which does not transport phosphate. During ATP hydrolysis by mitochondria, half of the phosphate formed from ATP passes from the matrix to the medium by the mersalyl-insensitive ATP-ADP-phosphate exchange and the other half by the well-known mersalyl-sensitive phosphate-hydroxide exchange. These and other considerations have led to a hypothesis for the pathway and stoichiometry of ATP-dependent reverse electron transport, characterized by a requirement of 1.33 molecules of ATP per pair of electrons reversed and by the utilization of a different membrane transport pathway for phosphate and adenine nucleotides than is taken in forward electron flow and oxidative phosphorylation. The possible occurrence of independent pathways for ATP-forming forward electron flow and ATP-consuming reverse electron flow is consonant with the fact that the opposing degradative and synthetic pathways in the central routes of cell metabolism generally have different pathways that are independently regulated. PMID:283393

  14. Transgenic overexpression of adenine nucleotide translocase 1 protects ischemic hearts against oxidative stress.

    Science.gov (United States)

    Klumpe, Inga; Savvatis, Konstantinos; Westermann, Dirk; Tschöpe, Carsten; Rauch, Ursula; Landmesser, Ulf; Schultheiss, Heinz-Peter; Dörner, Andrea

    2016-06-01

    Ischemia impairs the adenine nucleotide translocase (ANT), which transports ADP and ATP across the inner mitochondrial membrane. We investigated whether ANT1 overexpression has protective effects on ischemic hearts. Myocardial infarction was induced in wild-type (WT) and heart-specific ANT1-transgenic (ANT1-TG) rats, and hypoxia was set in isolated cardiomyocytes. ANT1 overexpression reduced the myocardial infarct area and increased the survival rate of infarcted rats. Reduced ANT1 expression and increased 4-hydroxynonenal modification of ANT paralleled to impaired ANT function in infarcted WT hearts. ANT1 overexpression improved ANT expression and function. This was accompanied by reduced mitochondrial cytochrome C release and caspase-3 activation. ANT1-TG hearts suffered less from oxidative stress, as shown by lower protein carbonylation and 4-hydroxynonenal modification of ANT. ANT1 overexpression also increased cell survival of hypoxic cardiomyocytes and attenuated reactive oxygen species (ROS) production. This was linked to higher stability of mitochondrial membrane potential and lower activity of ROS detoxifying catalase. ANT1-TG cardiomyocytes also showed higher resistance against H2O2 treatment, which was independent of catalase activity. In conclusion, ANT1 overexpression compensates impaired ANT activity under oxygen-restricted conditions. It reduces ROS production and oxidative stress, stabilizes mitochondrial integrity, and increases survival, making ANT1 a component in ROS management and heart protection during ischemia. ANT1 overexpression reduces infarct size and increases survival after infarction. ANT1 overexpression compensates restricted ANT expression and function in infarcted hearts. Increased ANT1 expression enhances mitochondrial integrity. ANT1-overexpressing hearts reduce oxidative stress by decreasing ROS generation. ANT1 is a component in ROS management and heart protection.

  15. Alkaline Phosphatase, Soluble Extracellular Adenine Nucleotides, and Adenosine Production after Infant Cardiopulmonary Bypass.

    Science.gov (United States)

    Davidson, Jesse A; Urban, Tracy; Tong, Suhong; Twite, Mark; Woodruff, Alan; Wischmeyer, Paul E; Klawitter, Jelena

    2016-01-01

    Decreased alkaline phosphatase activity after infant cardiac surgery is associated with increased post-operative cardiovascular support requirements. In adults undergoing coronary artery bypass grafting, alkaline phosphatase infusion may reduce inflammation. Mechanisms underlying these effects have not been explored but may include decreased conversion of extracellular adenine nucleotides to adenosine. 1) Evaluate the association between alkaline phosphatase activity and serum conversion of adenosine monophosphate to adenosine after infant cardiac surgery; 2) assess if inhibition/supplementation of serum alkaline phosphatase modulates this conversion. Pre/post-bypass serum samples were obtained from 75 infants alkaline phosphatase and CD73. Low and high concentration 13C5-adenosine monophosphate (simulating normal/stress concentrations) were used. Effects of alkaline phosphatase supplementation on adenosine monophosphate clearance were also assessed. Changes in serum alkaline phosphatase activity were strongly correlated with changes in 13C5-adenosine production with or without CD73 inhibition (r = 0.83; palkaline phosphatase activity (≤80 U/L) generated significantly less 13C5-adenosine, particularly in the presence of high concentration 13C5-adenosine monophosphate (10.4μmol/L vs 12.9μmol/L; p = 0.0004). Inhibition of alkaline phosphatase led to a marked decrease in 13C5-adenosine production (11.9μmol/L vs 2.7μmol/L; palkaline phosphatase or high dose bovine intestinal alkaline phosphatase doubled 13C5-adenosine monophosphate conversion to 13C5-adenosine (pAlkaline phosphatase represents the primary serum ectonucleotidase after infant cardiac surgery and low post-operative alkaline phosphatase activity leads to impaired capacity to clear adenosine monophosphate. AP supplementation improves serum clearance of adenosine monophosphate to adenosine. These findings represent a potential therapeutic mechanism for alkaline phosphatase infusion during cardiac

  16. Evaluation of Porin Interaction with Adenine Nucleotide Translocase and Cyclophilin-D Proteins after Brain Ischemia and Reperfusion

    Directory of Open Access Journals (Sweden)

    Mohammad Ali Atlasi

    2011-01-01

    Full Text Available Objective (s Porin is a mitochondrial outer membrane channel, which usually functions as the pathway for the movement of various substances in and out of the mitochondria and is considered to be a component of the permeability transition (PT pore complex that plays a role in the PT. We addressed the hypothesis that porin interacts with other mitochondrial proteins after ischemic injury.Materials and MethodsFor this purpose, we used in vivo 4-vessel occlusion model of rat brain and porin purification method by hydroxyapatite column. After SDS gel electrophoresis and silver nitrate staining, Western blotting was done for porin, adenine nucleotide translocase and cyclophilin-D proteins.Results Porin was purified from mitochondrial mixture in ischemic brain and control groups. Investigation of interaction of adenine nucleotide transposes (ANT and cyclophilin-D with porin by Western blotting showed no proteins co-purified with porin from injured tissues.Conclusion The present study implies that there may not be interaction between porin, and ANT or cyclophilin-D, and if there is any, it is not maintained during the purification procedure.

  17. Intramolecular stacking interactions in ternary copper(II) complexes formed by a heteroaromatic amine and 9-[2-(2-phosphonoethoxy)ethyl]adenine, a relative of the antiviral nucleotide analogue 9-[2-(phosphonomethoxy)ethyl]adenine

    Czech Academy of Sciences Publication Activity Database

    Fernández-Botello, A.; Holý, Antonín; Moreno, V.; Sigel, H.

    2004-01-01

    Roč. 98, - (2004), s. 2114-2124 ISSN 0162-0134 R&D Projects: GA MŠk OC D20.002 Institutional research plan: CEZ:AV0Z4055905 Keywords : adenine nucleotide analogues * intramolecular equilibria * isomeric complexes Subject RIV: CC - Organic Chemistry Impact factor: 2.225, year: 2004

  18. Effects of submaximal exercise on adenine nucleotide concentrations in skeletal muscle fibers of horses with polysaccharide storage myopathy.

    Science.gov (United States)

    Annandale, Erin J; Valberg, Stephanie J; Essen-Gustavsson, Birgitta

    2005-05-01

    To determine whether disruption of adenine triphosphate (ATP) regeneration and subsequent adenine nucleotide degradation are potential mechanisms for rhabdomyolysis in horses with polysaccharide storage myopathy (PSSM) performing submaximal exercise. 7 horses with PSSM and 4 control horses. Horses with PSSM performed 2-minute intervals of a walk and trot exercise on a treadmill until muscle cramping developed. Control horses exercised similarly for 20 minutes. Serum creatine kinase (CK) activity was measured 4 hours after exercise. Citrate synthase (CS), 3-OH-acylCoA dehydrogenase, and lactate dehydrogenase activities prior to exercise and glucose-6-phosphate (G-6-P) and lactate concentrations before and after exercise were measured in gluteal muscle specimens. Adenine triphosphate, diphosphate (ADP), monophosphate (AMP), and inosine monophosphate (IMP) concentrations were measured before and after exercise in whole muscle, single muscle fibers, and pooled single muscle fibers. Serum CK activity ranged from 255 to 22,265 U/L in horses with PSSM and 133 to 278 U/L in control horses. Muscle CS activity was lower in horses with PSSM, compared with control horses. Muscle G-6-P lactate, ATP, ADP, and AMP concentrations in whole muscle did not change with exercise in any horses. Concentration of IMP increased with exercise in whole muscle, pooled muscle fibers, and single muscle fibers in horses with PSSM. Large variations in ATP and IMP concentrations were observed within single muscle fibers. Increased IMP concentration without depletion of ATP in individual muscle fibers of horses with PSSM during submaximal exercise indicates an energy imbalance that may contribute to the development of exercise intolerance and rhabdomyolysis.

  19. Effect of gamma radiation on levels of adenine nucleotides in erythrocytes of healthy individuals after submaximum physical exertion

    International Nuclear Information System (INIS)

    Zagorski, T.; Dudek, I.; Mazurek, M.; Berkan, L.; Chmielewski, H.; Kedziora, J.

    1994-01-01

    The authors studied the effect of gamma radiation and submaximum physical exercise on adenosine-5'-triphosphate (ATP), adenosine-5'-diphosphate (ADP) and adenosine-5'-monophosphate (AMP) contents in erythrocytes of healthy males. Twenty one men aged 20-22 years were examined. They underwent physical exercise at doses of 2 w/kg body weight for 15 min. Erythrocytes were exposed to gamma radiation (500 Gy doses) from 60 Co source. The concentration of adenine nucleotides in erythrocytes was measured by the Boehringer Mannheim tests. The submaximum physical exercise was found to decrease ATP content and to increase ADP and AMP in erythrocytes. Gamma radiation at 500 Gy dose was found to decrease ATP concentration in erythrocytes both at rest and after submaximum exercise and to increase AD content. It was revealed that AMP content increased at rest and decreased after submaximum exercise in irradiated erythrocytes. (author). 20 refs, 1 tab

  20. Genetic mapping of human heart-skeletal muscle adenine nucleotide translocator and its relationship to the facioscapulohumeral muscular dystrophy locus

    Energy Technology Data Exchange (ETDEWEB)

    Haraguchi, Y.; Chung, A.B.; Torroni, A.; Stepien, G.; Shoffner, J.M.; Costigan, D.A.; Polak, M. [Emory Univ. School of Medicine, Atlanta, GA (United States); Wasmuth, J.J.; Altherr, M.R.; Winokur, S.T. [Univ. of California, Irvine, CA (United States)] [and others

    1993-05-01

    The mitochondrial heart-skeletal muscle adenine nucleotide translocator (ANT1) was regionally mapped to 4q35-qter using somatic cell hybrids containing deleted chromosome 4. The regional location was further refined through family studies using ANT1 intron and promoter nucleotide polymorphisms recognized by the restriction endonucleases MboII, NdeI, and HaeIII. Two alleles were found, each at a frequency of 0.5. The ANT1 locus was found to be closely linked to D4S139, D4S171, and the dominant skeletal muscle disease locus facioscapulohumeral muscular dystrophy (FSHD). A crossover that separated D4S171 and ANT1 from D4S139 was found. Since previous studies have established the chromosome 4 map order as centromere-D4S171-D4S139-FSHD, it was concluded that ANT1 is located on the side of D4S139, that is opposite from FSHD. This conclusion was confirmed by sequencing the exons and analyzing the transcripts of ANT1 from several FSHD patients and finding no evidence of aberration. 35 refs., 5 figs., 1 tab.

  1. A minimum structured adenine nucleotide for ADP/ATP transport in mitochondria.

    Science.gov (United States)

    Schlimme, E; Boos, K S; Renz, H

    1988-10-01

    An ADP analogue, i.e. 3H- or 14C-labeled 5'-diphosphate of 6-(beta-D-ribofuranosyl-methyl)-4-pyrimidinamine, was synthesized, the structure of which was deduced from structure-activity studies on the substrate specificity of the nucleotide-binding center of the inner mitochondrial membrane integrated ADP/ATP carrier protein. Bearing only the minimal but substrate-essential recognition structures, minimum structured ADP (msADP) is bound to the cytosol-facing active center and transported by the highly specific carrier system across the inner mitochondrial membrane.

  2. The tumour metabolism inhibitors GSAO and PENAO react with cysteines 57 and 257 of mitochondrial adenine nucleotide translocase

    Directory of Open Access Journals (Sweden)

    Park Danielle

    2012-03-01

    Full Text Available Abstract Background GSAO (4-(N-(S-glutathionylacetylamino phenylarsonous acid and PENAO (4-(N-(S-penicillaminylacetylamino phenylarsonous acid are tumour metabolism inhibitors that target adenine nucleotide translocase (ANT of the inner-mitochondrial membrane. Both compounds are currently being trialled in patients with solid tumours. The trivalent arsenical moiety of GSAO and PENAO reacts with two matrix facing cysteine residues of ANT, inactivating the transporter. This leads to proliferation arrest and death of tumour and tumour-supporting cells. Results The two reactive ANT cysteine residues have been identified in this study by expressing cysteine mutants of human ANT1 in Saccharomyces cerevisiae and measuring interaction with the arsenical moiety of GSAO and PENAO. The arsenic atom of both compounds cross-links cysteine residues 57 and 257 of human ANT1. Conclusions The sulphur atoms of these two cysteines are 20 Å apart in the crystal structures of ANT and the optimal spacing of cysteine thiolates for reaction with As (III is 3-4 Å. This implies that a significant conformational change in ANT is required for the organoarsenicals to react with cysteines 57 and 257. This conformational change may relate to the selectivity of the compounds for proliferating cells.

  3. Caffeic acid treatment alters the extracellular adenine nucleotide hydrolysis in platelets and lymphocytes of adult rats.

    Science.gov (United States)

    Anwar, Javed; Spanevello, Roselia Maria; Pimentel, Victor Camera; Gutierres, Jessié; Thomé, Gustavo; Cardoso, Andreia; Zanini, Daniela; Martins, Caroline; Palma, Heloisa Einloft; Bagatini, Margarete Dulce; Baldissarelli, Jucimara; Schmatz, Roberta; Leal, Cláudio Alberto Martins; da Costa, Pauline; Morsch, Vera Maria; Schetinger, Maria Rosa Chitolina

    2013-06-01

    This study evaluated the effects of caffeic acid on ectonucleotidase activities such as NTPDase (nucleoside triphosphate diphosphohydrolase), Ecto-NPP (nucleotide pyrophosphatase/phosphodiesterase), 5'-nucleotidase and adenosine deaminase (ADA) in platelets and lymphocytes of rats, as well as in the profile of platelet aggregation. Animals were divided into five groups: I (control); II (oil); III (caffeic acid 10 mg/kg); IV (caffeic acid 50 mg/kg); and V (caffeic acid 100 mg/kg). Animals were treated with caffeic acid diluted in oil for 30 days. In platelets, caffeic acid decreased the ATP hydrolysis and increased ADP hydrolysis in groups III, IV and V when compared to control (P<0.05). The 5'-nucleotidase activity was decreased, while E-NPP and ADA activities were increased in platelets of rats of groups III, IV and V (P<0.05). Caffeic acid reduced significantly the platelet aggregation in the animals of groups III, IV and V in relation to group I (P<0.05). In lymphocytes, the NTPDase and ADA activities were increased in all groups treated with caffeic acid when compared to control (P<0.05). These findings demonstrated that the enzymes were altered in tissues by caffeic acid and this compound decreased the platelet aggregation suggesting that caffeic acid should be considered a potentially therapeutic agent in disorders related to the purinergic system. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Myocardial overexpression of adenine nucleotide translocase 1 ameliorates diabetic cardiomyopathy in mice.

    Science.gov (United States)

    Wang, Yong; Ebermann, Linda; Sterner-Kock, Anja; Wika, Sylwia; Schultheiss, Heinz-Peter; Dörner, Andrea; Walther, Thomas

    2009-02-01

    Mitochondrial dysfunction is implicated in the pathogenesis of diabetic cardiomyopathy, a common complication of diabetes. Adenosine nucleotide translocase (ANT) translocates ADP/ATP across the inner mitochondrial membrane. Our study aimed to test the hypothesis that overexpression of ANT1 in cardiomyocytes has cardioprotective effects in diabetic cardiomyopathy induced by streptozotocin (STZ). Mice specifically overexpressing murine ANT1 in the heart were generated using alpha-myosin heavy chain promoter. Expression of ANT1 mRNA and protein in hearts was characterized by real-time polymerase chain reaction and Western blot analysis. Five- to 6-month-old male transgenic mice and their age-matched wild-type littermates were subjected to type 1 diabetes induced by STZ. Six weeks later, haemodynamic measurement was performed to assess cardiac function. Ventricular mRNA expression of atrial natriuretic peptide, a molecular marker of heart failure, was characterized by RNase-protection assay. Both ANT1 mRNA and ANT1 protein were specifically overexpressed in the heart of transgenic mice. Heart weight was decreased and cardiac function was dramatically impaired in wild-type mice 6 weeks after induction of diabetes, but ANT1 overexpression prevented these significant changes. The mRNA expression level of atrial natriuretic peptide confirmed the haemodynamic findings, being upregulated in wild-type mice receiving STZ, but showing no statistical differences in ANT1 transgenic mice. Cardiomyocyte-restricted overexpression of ANT1 prevents the development of diabetic cardiomyopathy; therefore, accelerated ADP/ATP exchange could be a new promising target to treat diabetic cardiomyopathy.

  5. Hypothesis on skeletal muscle aging : mitochondrial adenine nucleotide translocator decreases reactive oxygen species production while preserving coupling efficiency

    Directory of Open Access Journals (Sweden)

    Philippe eDIOLEZ

    2015-12-01

    Full Text Available Mitochondrial membrane potential is the major regulator of mitochondrial functions, including coupling efficiency and production of reactive oxygen species (ROS. Both functions are crucial for cell bioenergetics. We previously presented evidences for a specific modulation of adenine nucleotide translocase (ANT appearing during aging that results in a decrease in membrane potential - and therefore ROS production – but surprisingly increases coupling efficiency under conditions of low ATP turnover. Careful study of the bioenergetic parameters (oxidation and phosphorylation rates, membrane potential of isolated mitochondria from skeletal muscles (gastrocnemius of aged and young rats revealed a remodeling at the level of the phosphorylation system, in the absence of alteration of the inner mitochondrial membrane (uncoupling or respiratory chain complexes regulation. We further observed a decrease in mitochondrial affinity for ADP in aged isolated mitochondria, and higher sensitivity of ANT to its specific inhibitor atractyloside. This age-induced modification of ANT results in an increase in the ADP concentration required to sustain the same ATP turnover as compared to young muscle, and therefore in a lower membrane potential under phosphorylating - in vivo - conditions. Thus, for equivalent ATP turnover (cellular ATP demand, coupling efficiency is even higher in aged muscle mitochondria, due to the down-regulation of inner membrane proton leak caused by the decrease in membrane potential. In the framework of the radical theory of aging, these modifications in ANT function may be the result of oxidative damage caused by intra mitochondrial ROS and may appear like a virtuous circle where ROS induce a mechanism that reduces their production, without causing uncoupling, and even leading in improved efficiency. Because of the importance of ROS as therapeutic targets, this new mechanism deserves further studies.

  6. Differential effects of adenine nucleotide analogues on shape change and aggregation induced by adnosine 5-diphosphate (ADP) in human platelets.

    Science.gov (United States)

    Park, H S; Hourani, S M

    1999-07-01

    Adenosine 5'-diphosphate (ADP) induces human blood platelets to aggregate and change shape, and it has been suggested that these two responses are mediated by more than one subtype of ADP receptor. The structure-activity relationships for several analogues of adenine nucleotides in causing aggregation and shape change were measured and compared in washed platelets using an aggregometer. ADP and its analogues 2-methylthioadenosine 5'-diphosphate (2-methylthio-ADP), adenosine 5'(alpha,beta-methylene)diphosphonate (AMPCP), S(P)-adenosine 5'-O-(1-thiodiphosphate) (AD-P alphaS) and adenosine 5'-O-(2-thiodiphosphate) (ADPbetaS) were used as agonists. Adenosine 5'-triphosphate (ATP) and its analogues, P1, P5-diadenosine pentaphosphate (ApsA), adenosine (5'-(alpha,beta-methylene)triphosphonate (AMPCPP), 2-methylthioadenosine 5'-triphosphate (2-methylthio-ATP) and uridine 5'-triphosphate (UTP), as well as the trypanocidal drug suramin, were used as antagonists. In general, the structure-activity relationships for both responses were similar, but for some analogues differences were observed. ADPalphaS and ADPbetaS were much more potent agonists relative to ADP for shape change than for aggregation and indeed ADPalphaS antagonized ADP-induced aggregation with an apparent pK(B) value of 5.5+/-0.1. 2-Methylthio-ATP also had different effects in aggregation and shape change, being a much higher affinity antagonist of aggregation than of shape change with an apparent pK(B) value of 7.0+/-0.2 for aggregation and 5.2+/-0.2 for shape change. These results support the suggestion that these two responses are mediated by multiple ADP receptors on human platelets, and are consistent with shape change being mediated via one receptor (the P2Y1 receptor) with aggregation requiring the activation of two receptors (the P2Y1 and another P2Y receptor).

  7. Possible links between glucose-induced changes in the energy state of pancreatic B cells and insulin release. Unmasking by decreasing a stable pool of adenine nucleotides in mouse islets.

    OpenAIRE

    Detimary, P; Jonas, J C; Henquin, J C

    1995-01-01

    Whether adenine nucleotides in pancreatic B cells serve as second messengers during glucose stimulation of insulin secretion remains disputed. Our hypothesis was that the actual changes in ATP and ADP are obscured by the large pool of adenine nucleotides (ATP/ADP ratio close to 1) in insulin granules. Therefore, mouse islets were degranulated acutely with a cocktail of glucose, KCl, forskolin, and phorbol ester or during overnight culture in RPMI-1640 medium containing 10 mM glucose. When the...

  8. Effect of UV-irradiation in vitro on adenin nucleotides metabolism, Na+ and K+ concentration, osmotic properties and submicroscopic structure of pigeon red blood cells

    International Nuclear Information System (INIS)

    Kabat, I.A.; Sysa, J.; Leyko, W.; Kwiatkowski, B.; Sysa, A.; Zakrzewska, I.; Hlynczak, A.; Lodz Univ.; Akademia Medyczna, Lodz; Akademia Medyczna, Gdansk

    1975-01-01

    Effect of UV-irradiation in vitro on metabolism of adenine nucleotides: ADP, ATP and AXP, osmotic properties and submicroscopic structure of nucleated pigeon red blood cell was investigated. Irradiation was carried out for 60, 120, 180, 240 and 300 minutes. Hanau S-500 lamp with efficiency 4.34 x 10 8 erg/sec was used. A decrease of ATP content with a simultaneous increase of ADP and AXP contents and a rather constant level of the sum of adenine compounds was observed. UV-irradiation caused a decrease of reversal of hemolysis and osmotic resistance to hypotonic NaCl solutions. An equivalent exchange of Na + and K + ions and an increase of hematocrit value, following UV-irradiation was observed. Electron microscope studies demonstrated changes of ultrastructure concerning both cell nucleus and thickness and granulation of cell membrane. (orig.) [de

  9. Studies on the energy metabolism of opossum (Didelphis virginiana) erythrocytes: V. Utilization of hypoxanthine for the synthesis of adenine and guanine nucleotides in vitro

    International Nuclear Information System (INIS)

    Bethlenfalvay, N.C.; White, J.C.; Chadwick, E.; Lima, J.E.

    1990-01-01

    High pressure liquid radiochromatography was used to test the ability of opossum erythrocytes to incorporate tracer amounts of [G- 3 H] hypoxanthine (Hy) into [ 3 H] labelled triphosphates of adenine and guanine. In the presence of supraphysiologic (30 mM) phosphate which is optimal for PRPP synthesis, both ATP and GTP are extensively labelled. When physiologic (1 mM) medium phosphate is used, red cells incubated under an atmosphere of nitrogen accumulate [ 3 H] ATP in a linear fashion suggesting ongoing PRPP synthesis in red cells whose hemoglobin is deoxygenated. In contrast, a lesser increase of labelled ATP is observed in cells incubated under oxygen, suggesting that conditions for purine nucleotide formation from ambient Hy are more favorable in the venous circulation

  10. Studies on the energy metabolism of opossum (Didelphis virginiana) erythrocytes: V. Utilization of hypoxanthine for the synthesis of adenine and guanine nucleotides in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Bethlenfalvay, N.C.; White, J.C.; Chadwick, E.; Lima, J.E. (Fitzsimons Army Medical Center, Aurora, CO (USA))

    1990-06-01

    High pressure liquid radiochromatography was used to test the ability of opossum erythrocytes to incorporate tracer amounts of (G-{sup 3}H) hypoxanthine (Hy) into ({sup 3}H) labelled triphosphates of adenine and guanine. In the presence of supraphysiologic (30 mM) phosphate which is optimal for PRPP synthesis, both ATP and GTP are extensively labelled. When physiologic (1 mM) medium phosphate is used, red cells incubated under an atmosphere of nitrogen accumulate ({sup 3}H) ATP in a linear fashion suggesting ongoing PRPP synthesis in red cells whose hemoglobin is deoxygenated. In contrast, a lesser increase of labelled ATP is observed in cells incubated under oxygen, suggesting that conditions for purine nucleotide formation from ambient Hy are more favorable in the venous circulation.

  11. Effects of chlorogenic acid on adenine nucleotides hydrolyzing enzyme activities and expression in platelets of rats experimentally demyelinated with ethidium bromide.

    Science.gov (United States)

    Leal, Claudio A M; Leal, Daniela B R; Adefegha, Stephen A; Morsch, Vera M; Beckmann, Diego V; Castilhos, Lívia G; Thorstenberg, Maria L P; Jaques, Jeandre A Dos S; Souza, Viviane do C G; Farias, Júlia G; Martins, Caroline C; Schetinger, Maria R C

    2016-07-01

    The effects of chlorogenic acid (one of the major phenolic acid found in human diets) were investigated on the adenine nucleotides hydrolyzing enzymes; ecto-nucleotide pyrophosphatase/phophodiesterase (E-NPP), ecto-nucleoside triphosphate diphosphohydrolase (E-NTPDase), E-5'- nucleotidase and ecto-adenosine deaminase (E-ADA) activities and expression in platelets of rats experimentally demyelinated with ethidium bromide. Rats were divided into four groups of eight animals each. Group I rats were control rats; injected with saline (CT), group II rats were injected with saline and treated with chlorogenic acid (AC), group III rats were injected with 0.1% ethidium bromide (EB) and group IV rats were injected with 0.1% EB and treated with chlorogenic acid (EB+AC). The activities of the enzymes were analyzed using colorimetric methods, and the gene expression of NTPDase 1, 2 and 3 were analyzed using the polymerase chain reaction (PCR). The results revealed that there was a significant (Pchlorogenic acid significantly (P0.05) change was observed in the E-NPP activity of EB+AC group (2.19±0.08nmol p-nitrophenol released/min/mg protein) when compared to CT group (2.33±0.14nmol p-nitrophenol released/min/mg protein). In addition, there was a significant (P0.05) difference was observed in AMP hydrolysis between AC, AC+EB and CT groups. Conversely, there were no significant (P>0.05) differences in ATP and ADP hydrolyses between all the groups (AC, EB, AC+EB and CT groups). Likewise, there were no significant (P>0.05) changes in E-ADA activity and percentage platelet aggregation among all groups studied. Similarly, no significant (P>0.05) change was observed in the expression of E-NTPDase 1, 2 and 3 in all the groups tested. Our study revealed that chlorogenic acid may modulate the hydrolysis of adenine nucleotides in platelets of rats demyelinated and treated with chlorogenic acid via alteration of E-NPP and ecto-5'-nucleotidase activities. Copyright © 2016 Elsevier

  12. Pyridine nucleotide cycle of Salmonella typhimurium: isolation and characterization of pncA, pncB, and pncC mutants and utilization of exogenous nicotinamide adenine dinucleotide.

    Science.gov (United States)

    Foster, J W; Kinney, D M; Moat, A G

    1979-03-01

    Mutants of Salmonella typhimurium LT-2 deficient in nicotinamidase activity (pncA) or nicotinic acid phosphoribosyltransferase activity (pncB) were isolated as resistant to analogs of nicotinic acid and nicotinamide. Information obtained from interrupted mating experiments placed the pncA gene at 27 units and the pncB gene at 25 units on the S. typhimurium LT-2 linkage map. A major difference in the location of the pncA gene was found between the S. typhimurium and Escherichia coli linkage maps. The pncA gene is located in a region in which there is a major inversion of the gene order in S. typhimurium as compared to that in E. coli. Growth experiments using double mutants blocked in the de novo pathway to nicotinamide adenine dinucleotide (NAD) (nad) and in the pyridine nucleotide cycle (pnc) at either the pncA or pncB locus, or both, have provided evidence for the existence of an alternate recycling pathway in this organism. Mutants lacking this alternate cycle, pncC, have been isolated and mapped via cotransduction at 0 units. Utilization of exogenous NAD was examined through the use of [14C]carbonyl-labeled NAD and [14C]adenine-labeled NAD. The results of these experiments suggest that NAD is degraded to nicotinamide mononucleotide at the cell surface. A portion of this extracellular nicotinamide mononucleotide is then transported across the cell membrane by nicotinamide mononucleotide glycohydrolase and degraded to nicotinamide in the process. The remaining nicotinamide mononucleotide accumulates extracellularly and will support the growth of nadA pncB mutants which cannot utilize the nicotinamide resulting from the major pathway of NAD degradation. A model is presented for the utilization of exogenous NAD by S. typhimurium LT-2.

  13. Damage to uracil- and adenine-containing bases, nucleosides, nucleotides and polynucleotides: quantum yields on irradiation at 193 and 254 nm

    International Nuclear Information System (INIS)

    Gurzadyan, G.G.; Goerner, H.

    1994-01-01

    Photoreactions, such as base release and decomposition of the base moeity, induced by either 20 ns laser pulses at 193 nm or continuous 254 nm irradiation, were studied for a series of uracil and adenine derivatives in neutral aqueous solution. The quantum yield of chromophore loss (Φ cl ) depends significantly on the nature of the nucleic acid constituent and the saturating gas (Ar, N 2 O or O 2 ). In the case of polynucleotides the destruction of nucleotides was measured by high-performance liquid chromatography after hydrolysis; the quantum yields (Φ dn ) are comparable to those of chromophore loss or larger. The Φ cl and Φ dn of 0.04-0.1 for poly(U) and poly(dU), obtained for both wavelengths of irradiation, are due to processes originating from the lowest excited singlet state, i.e. formation of photohydrates and photodimers, and a second part from photoionization using λ irr = 193 nm. Irradiation at 193 nm effectively splits pyrimidine dimers and thus reverts them into monomers. (author)

  14. An adenine nucleotide translocase (ANT) gene from Apostichopus japonicus; molecular cloning and expression analysis in response to lipopolysaccharide (LPS) challenge and thermal stress.

    Science.gov (United States)

    Liu, Qiu-Ning; Chai, Xin-Yue; Tu, Jie; Xin, Zhao-Zhe; Li, Chao-Feng; Jiang, Sen-Hao; Zhou, Chun-Lin; Tang, Bo-Ping

    2016-02-01

    The adenine nucleotide translocases (ANTs) play a vital role in energy metabolism via ADP/ATP exchange in eukaryotic cells. Apostichopus japonicus (Echinodermata: Holothuroidea) is an important economic species in China. Here, a cDNA representing an ANT gene of A. japonicus was isolated and characterized from respiratory tree and named AjANT. The full-length AjANT cDNA is 1924 bp, including a 5'-untranslated region (UTR) of 38 bp, 3'-UTR of 980 bp and an open reading frame (ORF) of 906 bp encoding a polypeptide of 301 amino acids. The protein contains three homologous repeat Mito_carr domains (Pfam00153). The deduced AjANT protein sequence has 49-81% in comparison to ANT proteins from other individuals. The predicted tertiary structure of AjANT protein is highly similar to animal ANT proteins. Phylogenetic analysis showed that the AjANT is closely related to Holothuroidea ANT genes. Real-time quantitative reverse transcription-PCR (qPCR) analysis showed that AjANT expression is higher in the respiratory tree than in other examined tissues. After thermal stress or LPS challenge, expression of AjANT was significantly fluctuant compared to the control. These results suggested that changes in the expression of ANT gene might be involved in immune defense and in protecting A. japonicus against thermal stress. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Control of skeletal muscle mitochondria respiration by adenine nucleotides: differential effect of ADP and ATP according to muscle contractile type in pigs.

    Science.gov (United States)

    Gueguen, N; Lefaucheur, L; Fillaut, M; Vincent, A; Herpin, P

    2005-02-01

    Skeletal muscle exhibits considerable variation in mitochondrial content among fiber types, but it is less clear whether mitochondria from different fiber types also present specific functional and regulatory properties. The present experiment was undertaken on ten 170-day-old pigs to compare functional properties and control of respiration by adenine nucleotides in mitochondria isolated from predominantly slow-twitch (Rhomboideus (RM)) and fast-twitch (Longissimus (LM)) muscles. Mitochondrial ATP synthesis, respiratory control ratio (RCR) and ADP-stimulated respiration with either complex I or II substrates were significantly higher (25-30%, Prespiration. Based on mitochondrial enzyme activities (cytochrome c oxidase [COX], F0F1-ATPase, mitochondrial creatine kinase [mi-CK]), the higher ADP-stimulated respiration rate of RM mitochondria appeared mainly related to a higher maximal oxidative capacity, without any difference in the maximal phosphorylation potential. Mitochondrial K(m) for ADP was similar in RM (4.4+/-0.9 microM) and LM (5.9+/-1.2 microM) muscles (P>0.05) but the inhibitory effect of ATP was more marked in LM (Prespiration by ATP differs according to muscle contractile type and that absolute muscle oxidative capacity not only relies on mitochondrial density but also on mitochondrial functioning per se.

  16. Impairment of F1F0-ATPase, adenine nucleotide translocator and adenylate kinase causes mitochondrial energy deficit in human skin fibroblasts with chromosome 21 trisomy.

    Science.gov (United States)

    Valenti, Daniela; Tullo, Apollonia; Caratozzolo, Mariano F; Merafina, Riccardo S; Scartezzini, Paolo; Marra, Ersilia; Vacca, Rosa A

    2010-10-15

    A central role for mitochondrial dysfunction has been proposed in the pathogenesis of DS (Down's syndrome), a multifactorial disorder caused by trisomy of human chromosome 21. To explore whether and how abnormalities in mitochondrial energy metabolism are involved in DS pathogenesis, we investigated the catalytic properties, gene expression and protein levels of certain proteins involved in mitochondrial ATP synthesis, such as F1F0-ATPase, ANT (adenine nucleotide translocator) and AK (adenylate kinase), in DS-HSF (human skin fibroblasts with trisomic karyotype), comparing them with euploid fibroblasts. In DS-HSF, we found a strong impairment of mitochondrial ATP synthesis due to a reduction in the catalytic efficiency of each of the investigated proteins. This impairment occurred in spite of unchanged gene expression and an increase in ANT and AK protein content, whereas the amount of ATPase subunits was selectively reduced. Interestingly, exposure of DS-HSF to dibutyryl-cAMP, a permanent derivative of cAMP, stimulated ANT, AK and ATPase activities, whereas H89, a specific PKA (protein kinase A) inhibitor, suppressed this cAMPdependent activation, indicating an involvement of the cAMP/PKA-mediated signalling pathway in the ATPase, ANT and AK deficit. Consistently, DS-HSF showed decreased basal levels of cAMP and reduced PKA activity. Despite the impairment of mitochondrial energy apparatus, no changes in cellular energy status, but increased basal levels of L-lactate, were found in DS-HSF, which partially offset for the mitochondrial energy deficit by increasing glycolysis and mitochondrial mass.These results provide new insight into the molecular basis for mitochondrial dysfunction in DS and might provide a molecular explanation for some clinical features of the syndrome.

  17. TGF-β1 induction of the adenine nucleotide translocator 1 in astrocytes occurs through Smads and Sp1 transcription factors

    Directory of Open Access Journals (Sweden)

    Wallace Douglas C

    2004-01-01

    Full Text Available Abstract Background The adenine nucleotide translocator 1 (Ant1 is an inner mitochondrial membrane protein involved with energy mobilization during oxidative phosphorylation. We recently showed that rodent Ant1 is upregulated by transforming growth factor-beta (TGF-β in reactive astrocytes following CNS injury. In the present study, we describe the molecular mechanisms by which TGF-β1 regulates Ant1 gene expression in cultured primary rodent astrocytes. Results Transcription reporter analysis verified that TGF-β1 regulates transcription of the mouse Ant1 gene, but not the gene encoding the closely related Ant2 isoform. A 69 basepair TGF-β1 responsive element of the Ant1 promoter was also identified. Electrophoretic mobility shift assays demonstrated that astrocyte nuclear proteins bind to this response element and TGF-β1 treatment recruits additional nuclear protein binding to this element. Antibody supershift and promoter deletion analyses demonstrated that Sp1 consensus binding sites in the RE are important for TGF-β1 regulation of Ant1 in astrocytes. Additionally, we demonstrate that Smad 2, 3 and 4 transcription factors are expressed in injured cerebral cortex and in primary astrocyte cultures. TGF-β1 activated Smad transcription factors also contribute to Ant1 regulation since transcription reporter assays in the presence of dominant negative (DN-Smads 3 and 4 significantly reduced induction of Ant1 by TGF-β1. Conclusion The specific regulation of Ant1 by TGF-β1 in astrocytes involves a cooperative interaction of both Smad and Sp1 binding elements located immediately upstream of the transcriptional start site. The first report of expression of Smads 2, 3 and 4 in astrocytes provided here is consistent with a regulation of Ant1 gene expression by these transcription factors in reactive astrocytes. Given the similarity in TGF-β1 regulation of Ant1 with other genes that are thought to promote neuronal survival, this interaction may

  18. Pattern of OH radical reaction with adenine and its nucleosides and nucleotides. Characterization of two types of isomeric OH adduct and their unimolecular transformation reactions

    International Nuclear Information System (INIS)

    Vieira, A.J.S.C.; Steenken, S.

    1990-01-01

    The sm-bullet OH radical reacts in aqueous solution with adenine, 9-methyladenine, adenosine and its 3'- and 5'-mono- and 3',5'-diphosphates, and with the corresponding 2'-deoxyadenosines by addition to C4 and to C8 of the purine system. The resulting hydroxycyclohexa- or penta(aza)dienyl-type radicals A4OH sm-bullet (formed by sm-bullet OH addition at C4) and A8OH sm-bullet (by addition at C8) undergo a dehydration and a ring-opening reaction, respectively, for which the activation parameters and pH dependencies have been determined. Dehydration of A4OH sm-bullet , which yields an oxidizing N 6 -centered neutral radical, is inhibited by H + , whereas the ring opening of A8OH sm-bullet is accelerated by H + (and also by OH - ). Product analysis data on adenine concerning the effect of additives on the yield of its depletion and of formation of 8-hydroxyadenine indicate that the N 6 -centered radical is repaired by reduction by radicals derived from A8OH sm-bullet

  19. Properties of the mitochondrial carrier of adenine-nucleotide after purification. Study of the transport protein under isolated form and reincorporated form in phospho-lipidic vesicles

    International Nuclear Information System (INIS)

    Brandolin, Gerard

    1983-01-01

    The first part of this research thesis addresses the reconstitution of the ADP/ATP transport by incorporation of the specific carrier, isolated in presence of detergent, in phospholipids vesicles. Fundamental properties of the reconstituted transport are identical to that of transport in mitochondria, notably as far as the exchange stoichiometry, the turn over and the transport Km are concerned, as well as the asymmetric orientation of the carrier in the membrane. The second part of this research addresses the study of interactions of specific ligands with the ADP/ATP transport protein in presence of detergent. The study of the variations of the intrinsic fluorescence of the isolated ADP/ATP carrier highlights conformational changes exclusively induced by the presence of transportable nucleotides which are modulated in a different manner by carboxy-atractyloside or bongkrekic acid. Moreover, by using the isolated protein, a detailed analysis of binding parameters of fluorescent analogues of ATP is reported [fr

  20. Biochemical evidence of the interactions of membrane type-1 matrix metalloproteinase (MT1-MMP) with adenine nucleotide translocator (ANT): potential implications linking proteolysis with energy metabolism in cancer cells.

    Science.gov (United States)

    Radichev, Ilian A; Remacle, Albert G; Sounni, Nor Eddine; Shiryaev, Sergey A; Rozanov, Dmitri V; Zhu, Wenhong; Golubkova, Natalya V; Postnova, Tatiana I; Golubkov, Vladislav S; Strongin, Alex Y

    2009-04-28

    Invasion-promoting MT1-MMP (membrane type-1 matrix metalloproteinase) is a key element in cell migration processes. To identify the proteins that interact and therefore co-precipitate with this proteinase from cancer cells, we used the proteolytically active WT (wild-type), the catalytically inert E240A and the C-end truncated (tailless; DeltaCT) MT1-MMP-FLAG constructs as baits. The identity of the pulled-down proteins was determined by LC-MS/MS (liquid chromatography tandem MS) and then confirmed by Western blotting using specific antibodies. We determined that, in breast carcinoma MCF cells (MCF-7 cells), ANT (adenine nucleotide translocator) efficiently interacted with the WT, E240A and DeltaCT constructs. The WT and E240A constructs also interacted with alpha-tubulin, an essential component of clathrin-mediated endocytosis. In turn, tubulin did not co-precipitate with the DeltaCT construct because of the inefficient endocytosis of the latter, thus suggesting a high level of selectivity of our test system. To corroborate these results, we then successfully used the ANT2-FLAG construct as a bait to pull-down MT1-MMP, which was naturally produced by fibrosarcoma HT1080 cells. We determined that the presence of the functionally inert catalytic domain alone was sufficient to cause the proteinase to interact with ANT2, thus indicating that there is a non-proteolytic mode of these interactions. Overall, it is tempting to hypothesize that by interacting with pro-invasive MT1-MMP, ANT plays a yet to be identified role in a coupling mechanism between energy metabolism and pericellular proteolysis in migrating cancer cells.

  1. Short-hairpin RNA-induced suppression of adenine nucleotide translocase-2 in breast cancer cells restores their susceptibility to TRAIL-induced apoptosis by activating JNK and modulating TRAIL receptor expression

    Directory of Open Access Journals (Sweden)

    Kim Chul-Woo

    2010-09-01

    Full Text Available Abstract Background Tumor necrosis factor (TNF-related apoptosis-inducing ligand (TRAIL; apo2 ligand induces apoptosis in cancer cells but has little effect on normal cells. However, many cancer cell types are resistant to TRAIL-induced apoptosis, limiting the clinical utility of TRAIL as an anti-cancer agent. We previously reported that the suppression of adenine nucleotide translocase-2 (ANT2 by short-hairpin RNA (shRNA induces apoptosis of breast cancer cells, which frequently express high levels of ANT2. In the present study, we examined the effect of RNA shRNA-induced suppression of ANT2 on the resistance of breast cancer cells to TRAIL-induced apoptosis in vitro and in vivo. Results ANT2 shRNA treatment sensitized MCF7, T47 D, and BT474 cells to TRAIL-induced apoptosis by up-regulating the expression of TRAIL death receptors 4 and 5 (DR4 and DR5 and down-regulating the TRAIL decoy receptor 2 (DcR2. In MCF7 cells, ANT2 knockdown activated the stress kinase c-Jun N-terminal kinase (JNK, subsequently stabilizing and increasing the transcriptional activity of p53 by phosphorylating it at Thr81; it also enhanced the expression and activity of DNA methyltransferase 1 (DNMT1. ANT2 shRNA-induced overexpression of DR4/DR5 and TRAIL sensitization were blocked by a p53 inhibitor, suggesting that p53 activation plays an important role in the transcriptional up-regulation of DR4/DR5. However, ANT2 knockdown also up-regulated DR4/DR5 in the p53-mutant cell lines BT474 and T47 D. In MCF7 cells, ANT2 shRNA treatment led to DcR2 promoter methylation and concomitant down-regulation of DcR2 expression, consistent with the observed activation of DNMT1. Treatment of the cells with a demethylating agent or JNK inhibitor prevented the ANT2 shRNA-induced down-regulation of DcR2 and activation of both p53 and DNMT1. In in vivo experiments using nude mice, ANT2 shRNA caused TRAIL-resistant MCF7 xenografts to undergo TRAIL-induced cell death, up-regulated DR4/DR5

  2. Extent of Intramolecular p-Stacks in Aqueous Solution in Mixed-Ligand Copper(II) Complexes Formed by Heteroaromatic Amines and Several 2-Aminopurine Derivatives of the Antivirally Active Nucleotide Analog 9-[2-(Phosphonomethoxy)ethyl]adenine (PMEA)

    Czech Academy of Sciences Publication Activity Database

    Gómez-Coca, R. B.; Blindauer, C. A.; Sigel, A.; Operschall, B. P.; Holý, Antonín; Sigel, H.

    2012-01-01

    Roč. 9, č. 9 (2012), s. 2008-2034 ISSN 1612-1872 R&D Projects: GA MŠk 1M0508 Institutional research plan: CEZ:AV0Z40550506 Keywords : copper complexes * nucleotides * acyclic nucleoside phosphonates * ANPs * antiviral activity Subject RIV: CE - Biochemistry Impact factor: 1.808, year: 2012

  3. Design and synthesis of ATP-based nucleotide analogues and profiling of nucleotide-binding proteins

    NARCIS (Netherlands)

    Wolters, Justina. C.; Roelfes, Gerard; Poolman, Bert

    Two nucleotide-based probes were designed and synthesized in order to enrich samples for specific classes of proteins by affinity-based protein profiling. We focused on the profiling of adenine nucleotide-binding proteins. Two properties were considered in the design of the probes: the bait needs to

  4. Cleavage of nicotinamide adenine dinucleotide by the ribosome-inactivating protein from Momordica charantia.

    Science.gov (United States)

    Vinkovic, M; Dunn, G; Wood, G E; Husain, J; Wood, S P; Gill, R

    2015-09-01

    The interaction of momordin, a type 1 ribosome-inactivating protein from Momordica charantia, with NADP(+) and NADPH has been investigated by X-ray diffraction analysis of complexes generated by co-crystallization and crystal soaking. It is known that the proteins of this family readily cleave the adenine-ribose bond of adenosine and related nucleotides in the crystal, leaving the product, adenine, bound to the enzyme active site. Surprisingly, the nicotinamide-ribose bond of oxidized NADP(+) is cleaved, leaving nicotinamide bound in the active site in the same position but in a slightly different orientation to that of the five-membered ring of adenine. No binding or cleavage of NADPH was observed at pH 7.4 in these experiments. These observations are in accord with current views of the enzyme mechanism and may contribute to ongoing searches for effective inhibitors.

  5. Residue propensities, discrimination and binding site prediction of adenine and guanine phosphates

    Directory of Open Access Journals (Sweden)

    Ahmad Zulfiqar

    2011-05-01

    Full Text Available Abstract Background Adenine and guanine phosphates are involved in a number of biological processes such as cell signaling, metabolism and enzymatic cofactor functions. Binding sites in proteins for these ligands are often detected by looking for a previously known motif by alignment based search. This is likely to miss those where a similar binding site has not been previously characterized and when the binding sites do not follow the rule described by predefined motif. Also, it is intriguing how proteins select between adenine and guanine derivative with high specificity. Results Residue preferences for AMP, GMP, ADP, GDP, ATP and GTP have been investigated in details with additional comparison with cyclic variants cAMP and cGMP. We also attempt to predict residues interacting with these nucleotides using information derived from local sequence and evolutionary profiles. Results indicate that subtle differences exist between single residue preferences for specific nucleotides and taking neighbor environment and evolutionary context into account, successful models of their binding site prediction can be developed. Conclusion In this work, we explore how single amino acid propensities for these nucleotides play a role in the affinity and specificity of this set of nucleotides. This is expected to be helpful in identifying novel binding sites for adenine and guanine phosphates, especially when a known binding motif is not detectable.

  6. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolism...

  7. Bound anionic states of adenine

    Energy Technology Data Exchange (ETDEWEB)

    Haranczyk, Maciej; Gutowski, Maciej S; Li, Xiang; Bowen, Kit H

    2007-03-20

    Anionic states of nucleic acid bases are involved in DNA damage by low-energy electrons and in charge transfer through DNA. Previous gas phase studies of free, unsolvated nucleic acid base parent anions probed only dipole-bound states, which are not present in condensed phase environments, but did not observe valence anionic states, which for purine bases, are thought to be adiabatically unbound. Contrary to this expectation, we have demonstrated that some thus far ignored tautomers of adenine, which result from enamine-imine transformations, support valence anionic states with electron vertical detachment energies as large as 2.2 eV, and at least one of these anionic tautomers is adiabatically bound. Moreover, we predict that the new anionic tautomers should also dominate in solutions and should be characterized by larger values of electron vertical detachment energy than the canonical valence anion. All of the new-found anionic tautomers might be formed in the course of dissociative electron attachment followed by a hydrogen atom attachment to a carbon atom, and they might affect the structure and properties of DNA and RNA exposed to low-energy electrons. The discovery of these valence anionic states of adenine was facilitated by the development of: (i) a new experimental method for preparing parent anions of nucleic acid bases for photoelectron experiments, and (ii) a new combinatorial/ quantum chemical approach for identification of the most stable tautomers of organic molecules. The computational portion of this work was supported by the: (i) Polish State Committee for Scientific Research (KBN) Grants: DS/8000-4-0140-7 (M.G.) and N204 127 31/2963 (M.H.), (ii) European Social Funds (EFS) ZPORR/2.22/II/2.6/ARP/U/2/05 (M.H.), and (iii) US DOE Office of Biological and Environmental Research, Low Dose Radiation Research Program (M.G.). M.H. holds the Foundation for Polish Science (FNP) award for young scientists. The calculations were performed at the Academic

  8. Adenine phosphoribosyltransferase-deficient Leishmania donovani

    International Nuclear Information System (INIS)

    Kaur, K.; Iovannisci, D.M.; Ullman, B.

    1986-01-01

    To elucidate the relative roles of two routes for adenine salvage, the authors use biochemical genetic approaches to isolate clonal strains of Leishmania donovani promasatigotes genetically deficient in APRTase activity. The studies suggest that the metabolic rate of adenine in these organisms is initiated by deamination. The radiolabel incorporation experiments and biochemical experiments are described in which the rate of uptake of radiolabelled purine nucleobases (C 14) was determined. Results are presented

  9. Ethanol induced nucleotide catabolism in mouse T lymphoblastoid cells in vitro

    International Nuclear Information System (INIS)

    Barankiewicz, J.; Cohen, A.

    1986-01-01

    To determine whether ethanol induced nucleotide degradation in cells of immune system and in consequence may impair celular immunity, the effect of ethanol on a mouse T lymphoblastoid cell line (NSU-1) was studied. This purine nucleoside phosphorylase deficient cell line is convenient for catabolic study because the number of excreted products of nucleotide catbolism is reduced. Mouse T lymphoblastoid cells were incubated with 4 uCi of radioactive adenine for 1 hr. The unincorporated precursor was washed out and 1 x 10 6 cells containing radioactive adenine nucleotides were incubated with different concentrations for 20 min. It is shown that inhibition of purine and pyrimidine salvage and nucleotide incorporation into nucleic acids by ethanol togher with induction of nucleotide catabolism may significantly reduce nucleotide availability not only for DNA and RNA synthesis but also for other cellular processes. It maytherefore influence blastogenic transformation and lead to lymphopenia in acute alcoholism

  10. Differences in Electrostatic Potential Around DNA Fragments Containing Adenine and 8-oxo-Adenine. An Analysis Based on Regular Cylindrical Projection

    Energy Technology Data Exchange (ETDEWEB)

    Haranczyk, Maciej; Miller, John H; Gutowski, Maciej S

    2007-07-01

    Changes of electrostatic potential (EP) around the DNA molecule resulting from chemical modifications of nucleotides may play a role in enzymatic recognition of damaged sites. Effects of chemical modifications of nucleotides on the structure of DNA have been characterized through large scale density functional theory computations. Quantum mechanical structural optimizations of DNA fragments with three pairs of nucleotides and accompanying counteractions were performed with a B3LYP exchange-correlation functional and 6-31G** basis sets. The “intact” DNA fragment contained adenine in the middle layer, while the “damaged” fragment had the adenine replaced with 8-oxo-adenine. The electrostatic potential around these DNA fragments was projected on a cylindrical surface around the double helix. The two-dimensional maps of EP of the intact and damaged DNA fragments were analyzed to identify these modifications of EP that result from the occurrence of 8-oxo-adenine (8oA). It was found that distortions of a phosphate group neighboring 8oA and displacements of the accompanying countercation are clearly reflected in the EP maps. Helpful discussions Michel Dupuis are gratefully acknowledged. Authors wish to thank Marcel Swart for directing us to a compilation of van der Waals radii. This work was supported by the: (i) US DOE Office of Biological and Environmental Research, Low Dose Radiation Research Program (M.G. and M.H.), (ii) the Office of Science (BER), U. S. Department of Energy, Grant No. DE-FG03-02ER63470 (JHM), (iii) Polish State Committee for Scientific Research (KBN) Grant DS/8221-4-0140-6 (MG), (iv) European Social Funds (EFS) ZPORR/2.22/II/2.6/ARP/U/2/05 (M.H.). M.H. holds the Foundation for Polish Science (FNP) award for young scientists. The calculations were performed at the Academic Computer Center in Gdansk (TASK) and at the Molecular Science Computing Facility (MSCF) in the William R. Wiley Environmental Molecular Sciences Laboratory, a national

  11. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  12. Influence of Magnetic Microparticles Isolation on Adenine Homonucleotides Structure

    Directory of Open Access Journals (Sweden)

    Monika Kremplova

    2014-02-01

    Full Text Available The electroactivity of purine and pyrimidine bases is the most important property of nucleic acids that is very useful for determining oligonucleotides using square wave voltammetry. This study was focused on the electrochemical behavior of adenine-containing oligonucleotides before and after their isolation using paramagnetic particles. Two peaks were detected—peak A related to the reduction of adenine base and another peak B involved in the interactions between individual adenine strands and contributes to the formation of various spatial structures. The influence of the number of adenine bases in the strand in the isolation process using paramagnetic particles was investigated too.

  13. Hydrolytic cleavage of N-6-substituted adenine derivatives by eukaryotic adenine and adenosine deaminases

    Czech Academy of Sciences Publication Activity Database

    Pospíšilová, H.; Šebela, M.; Novák, Ondřej; Frébort, I.

    2008-01-01

    Roč. 28, č. 6 (2008), s. 335-347 ISSN 0144-8463 R&D Projects: GA ČR(CZ) GA522/06/0022 Institutional research plan: CEZ:AV0Z50380511 Keywords : adenine deaminase * adenosine deaminase (ADA) * aminohydrolase Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.525, year: 2008

  14. NADH peroxidase: kinetic mechanism and nucleotide specificity

    Energy Technology Data Exchange (ETDEWEB)

    Stoll, V.S.; Blanchard, J.S.

    1987-05-01

    NADH peroxidase is a flavoprotein reductase isolated from Streptococcus faecalis which catalyzes the pyridine nucleotide dependent reduction of hydrogen peroxide to water. Initial velocity, product and dead-end inhibition studies have been performed and all support a ping-pong kinetic mechanism. Further support for the ping-pong nature of the kinetic mechanism are the hydrogen peroxide independent transhydrogenase activity of the enzyme, measured either with thio-NAD or with radiolabeled NAD (isotope exchange studies). Kinetic parameters will be presented for a number of reduced pyridine nucleotide analogs. Analogs which have been modified in the adenine ring exhibit much higher K/sub m/'s relative to their adenine analogs. NADH peroxidase catalyzes the stereo-specific removal of the 4S hydrogen of NADH and primary deuterium kinetic isotope effects have been determined for a number of these substrates with 4S-deuterated molecules. There is a strong correlation between their steady-state K/sub m/ and /sup D/V/K. Small values for /sup D/V are interpreted as supporting rate-limitation in the oxidative half-reaction. These data will be discussed in terms of a kinetic and chemical mechanism proposed for NADH peroxidase.

  15. NADH peroxidase: kinetic mechanism and nucleotide specificity

    International Nuclear Information System (INIS)

    Stoll, V.S.; Blanchard, J.S.

    1987-01-01

    NADH peroxidase is a flavoprotein reductase isolated from Streptococcus faecalis which catalyzes the pyridine nucleotide dependent reduction of hydrogen peroxide to water. Initial velocity, product and dead-end inhibition studies have been performed and all support a ping-pong kinetic mechanism. Further support for the ping-pong nature of the kinetic mechanism are the hydrogen peroxide independent transhydrogenase activity of the enzyme, measured either with thio-NAD or with radiolabeled NAD (isotope exchange studies). Kinetic parameters will be presented for a number of reduced pyridine nucleotide analogs. Analogs which have been modified in the adenine ring exhibit much higher K/sub m/'s relative to their adenine analogs. NADH peroxidase catalyzes the stereo-specific removal of the 4S hydrogen of NADH and primary deuterium kinetic isotope effects have been determined for a number of these substrates with 4S-deuterated molecules. There is a strong correlation between their steady-state K/sub m/ and /sup D/V/K. Small values for /sup D/V are interpreted as supporting rate-limitation in the oxidative half-reaction. These data will be discussed in terms of a kinetic and chemical mechanism proposed for NADH peroxidase

  16. NUCLEOTIDES IN INFANT FEEDING

    Directory of Open Access Journals (Sweden)

    L.G. Mamonova

    2007-01-01

    Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.

  17. Synthesis and hybridization of oligonucleotides modified at AMP sites with adenine pyrrolidine phosphonate nucleotides

    Czech Academy of Sciences Publication Activity Database

    Rejman, Dominik; Kočalka, Petr; Pohl, Radek; Točík, Zdeněk; Rosenberg, Ivan

    2009-01-01

    Roč. 74, č. 6 (2009), s. 935-955 ISSN 0010-0765 R&D Projects: GA MŠk 2B06065; GA MŠk(CZ) LC06077; GA MŠk(CZ) LC06061; GA AV ČR KAN200520801 Institutional research plan: CEZ:AV0Z40550506 Keywords : oligonucleotide * pyrrolidine * phosphonate Subject RIV: CC - Organic Chemistry Impact factor: 0.856, year: 2009

  18. Adenine Nucleotide Metabolism and a Role for AMP in Modulating Flagellar Waveforms in Mouse Sperm1

    OpenAIRE

    Vadnais, Melissa L.; Cao, Wenlei; Aghajanian, Haig K.; Haig-Ladewig, Lisa; Lin, Angel M.; Al-Alao, Osama; Gerton, George L.

    2014-01-01

    While most ATP, the main energy source driving sperm motility, is derived from glycolysis and oxidative phosphorylation, the metabolic demands of the cell require the efficient use of power stored in high-energy phosphate bonds. In times of high energy consumption, adenylate kinase (AK) scavenges one ATP molecule by transphosphorylation of two molecules of ADP, simultaneously yielding one molecule of AMP as a by-product. Either ATP or ADP supported motility of detergent-modeled cauda epididym...

  19. Adenine nucleotide metabolism and a role for AMP in modulating flagellar waveforms in mouse sperm.

    Science.gov (United States)

    Vadnais, Melissa L; Cao, Wenlei; Aghajanian, Haig K; Haig-Ladewig, Lisa; Lin, Angel M; Al-Alao, Osama; Gerton, George L

    2014-06-01

    While most ATP, the main energy source driving sperm motility, is derived from glycolysis and oxidative phosphorylation, the metabolic demands of the cell require the efficient use of power stored in high-energy phosphate bonds. In times of high energy consumption, adenylate kinase (AK) scavenges one ATP molecule by transphosphorylation of two molecules of ADP, simultaneously yielding one molecule of AMP as a by-product. Either ATP or ADP supported motility of detergent-modeled cauda epididymal mouse sperm, indicating that flagellar AKs are functional. However, the ensuing flagellar waveforms fueled by ATP or ADP were qualitatively different. Motility driven by ATP was rapid but restricted to the distal region of the sperm tail, whereas ADP produced slower and more fluid waves that propagated down the full flagellum. Characterization of wave patterns by tracing and superimposing the images of the flagella, quantifying the differences using digital image analysis, and computer-assisted sperm analysis revealed differences in the amplitude, periodicity, and propagation of the waves between detergent-modeled sperm treated with either ATP or ADP. Surprisingly, addition of AMP to the incubation medium containing ATP recapitulated the pattern of sperm motility seen with ADP alone. In addition to AK1 and AK2, which we previously demonstrated are present in outer dense fibers and mitochondrial sheath of the mouse sperm tail, we show that another AK, AK8, is present in a third flagellar compartment, the axoneme. These results extend the known regulators of sperm motility to include AMP, which may be operating through an AMP-activated protein kinase. © 2014 by the Society for the Study of Reproduction, Inc.

  20. Raw coffee based dietary supplements contain carboxyatractyligenin derivatives inhibiting mitochondrial adenine-nucleotide-translocase.

    Science.gov (United States)

    Lang, Roman; Fromme, Tobias; Beusch, Anja; Lang, Tatjana; Klingenspor, Martin; Hofmann, Thomas

    2014-08-01

    Capsules, powders and tablets containing raw coffee extract are advertised to the consumer as antioxidant rich dietary supplements as part of a healthy diet. We isolated carboxyatractyligenin (4), 2-O-β-d-glucopyranosyl carboxyatractyligenin (6) and 3'-O-β-d-glucopyranosyl-2'-O-isovaleryl-2β-(2-desoxy-carboxyatractyligenin)-β-d-glucopyranoside (8) from green coffee and found strong inhibitory effects on phosphorylating respiration in isolated mitochondria similar to the effects of the known phytotoxin carboxyatractyloside. LC-MS/MS analysis of commercial green coffee based dietary supplements revealed the occurrence of carboxyatractyligenin, 3'-O-β-d-glucopyranosyl-2'-O-isovaleryl-2β-(2-desoxy-carboxyatractyligenin)-β-d-glucopyranoside, and 2-O-β-d-glucopyranosyl carboxyatractyligenin in concentrations up to 4.0, 5.7, and 41.6μmol/g, respectively. These data might help to gain first insight into potential physiological side-effects of green coffee containing dietary supplement. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Nicotinamide adenine dinucleotide biosynthesis promotes liver regeneration.

    Science.gov (United States)

    Mukherjee, Sarmistha; Chellappa, Karthikeyani; Moffitt, Andrea; Ndungu, Joan; Dellinger, Ryan W; Davis, James G; Agarwal, Beamon; Baur, Joseph A

    2017-02-01

    The regenerative capacity of the liver is essential for recovery from surgical resection or injuries induced by trauma or toxins. During liver regeneration, the concentration of nicotinamide adenine dinucleotide (NAD) falls, at least in part due to metabolic competition for precursors. To test whether NAD availability restricts the rate of liver regeneration, we supplied nicotinamide riboside (NR), an NAD precursor, in the drinking water of mice subjected to partial hepatectomy. NR increased DNA synthesis, mitotic index, and mass restoration in the regenerating livers. Intriguingly, NR also ameliorated the steatosis that normally accompanies liver regeneration. To distinguish the role of hepatocyte NAD levels from any systemic effects of NR, we generated mice overexpressing nicotinamide phosphoribosyltransferase, a rate-limiting enzyme for NAD synthesis, specifically in the liver. Nicotinamide phosphoribosyltransferase overexpressing mice were mildly hyperglycemic at baseline and, similar to mice treated with NR, exhibited enhanced liver regeneration and reduced steatosis following partial hepatectomy. Conversely, mice lacking nicotinamide phosphoribosyltransferase in hepatocytes exhibited impaired regenerative capacity that was completely rescued by administering NR. NAD availability is limiting during liver regeneration, and supplementation with precursors such as NR may be therapeutic in settings of acute liver injury. (Hepatology 2017;65:616-630). © 2016 by the American Association for the Study of Liver Diseases.

  2. Butyrate influences intracellular levels of adenine and adenine derivatives in the fungus Penicillium restrictum.

    Science.gov (United States)

    Zutz, Christoph; Chiang, Yi Ming; Faehnrich, Bettina; Bacher, Markus; Hellinger, Roland; Kluger, Bernhard; Wagner, Martin; Strauss, Joseph; Rychli, Kathrin

    2017-04-01

    Butyrate, a small fatty acid, has an important role in the colon of ruminants and mammalians including the inhibition of inflammation and the regulation of cell proliferation. There is also growing evidence that butyrate is influencing the histone structure in mammalian cells by inhibition of histone deacetylation. Butyrate shows furthermore an antimicrobial activity against fungi, yeast and bacteria, which is linked to its toxicity at a high concentration. In fungi there are indications that butyrate induces the production of secondary metabolites potentially via inhibition of histone deacetylases. However, information about the influence of butyrate on growth, primary metabolite production and metabolism, besides lipid catabolism, in fungi is scarce. We have identified the filamentous fungus Penicillium (P.) restrictum as a susceptible target for butyrate treatment in an antimicrobial activity screen. The antimicrobial activity was detected only in the mycelium of the butyrate treated culture. We investigated the effect of butyrate ranging from low (0.001mM) to high (30mM), potentially toxic, concentrations on biomass and antimicrobial activity. Butyrate at high concentrations (3 and 30mM) significantly reduced the fungal biomass. In contrast P. restrictum treated with 0.03mM of butyrate showed the highest antimicrobial activity. We isolated three antimicrobial active compounds, active against Staphylococcus aureus, from P. restrictum cellular extracts treated with butyrate: adenine, its derivate hypoxanthine and the nucleoside derivate adenosine. Production of all three compounds was increased at low butyrate concentrations. Furthermore we found that butyrate influences the intracellular level of the adenine nucleoside derivate cAMP, an important signalling molecule in fungi and various organisms. In conclusion butyrate treatment increases the intracellular levels of adenine and its respective derivatives. Copyright © 2017 Elsevier GmbH. All rights reserved.

  3. Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide

    Science.gov (United States)

    Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; Shock, David D.; Kim, Taejin; Schlick, Tamar; Wilson, Samuel H.

    2015-01-01

    Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2'-deoxyguanosine, which is found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate Escherichia coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerases discriminate between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities, nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine and 8-oxo-dGTP(syn) uses its Hoogsteen edge to base pair with adenine. Here we use time-lapse crystallography to follow 8-oxo-dGTP insertion opposite adenine or cytosine with human pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen-bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxo-dGTP uses charge modulation during insertion that can lead to a blocked DNA repair intermediate.

  4. The sonolysis and radiolysis of adenine and related biomolecules

    International Nuclear Information System (INIS)

    Craig, W.K.

    1979-04-01

    The sonolysis of adenine, its nucleoside adenosine and the carbohydrates glucose, fructose and ribose were investigated at 459 Hz. The insonation of air-saturated aqueous adenine solutions degrades adenine at a rate that is linear with time and independent of the initial concentration. The radiolytic decomposition of air-saturated aqueous adenine solutions were also investigated and the degradation products found to be essentially identical to those obtained by sonolysis. since the products derived from sonolysis and radiolysis were similar, a degradation mechanism can be proposed that accounts for all the observed products. The major feature of this mechanism is that the principal loci of attack are the C(8) position and the central C(4)-C(5) double bond. The sonolysis of air-saturated aqueous solutions of the carbohydrates results in the formation of products analogous to those produced by ionizing radiation. While two types of products are formed in the radiolysis of carbohydrate solutions, depending on the initial presence or absence of oxygen, the sonolysis of air-saturated carbohydrate solutions leads to the formation of both types of products. This is due to the depletion of oxygen from the solution during insonation. Existing mechanisms for the radiolytic decomposition of carbohydrates in the presence and absence of oxygen can be modified to rationalize the sonolysis products. Insonation of an aqueous solution of adenosine resulted in the production of adenine and ribose. The other products are consistent with those obtained in the ultrasonic degradation of adenine and ribose

  5. Updating our view of organelle genome nucleotide landscape

    Directory of Open Access Journals (Sweden)

    David Roy Smith

    2012-09-01

    Full Text Available Organelle genomes show remarkable variation in architecture and coding content, yet their nucleotide composition is relatively unvarying across the eukaryotic domain, with most having a high adenine and thymine (AT content. Recent studies, however, have uncovered guanine and cytosine (GC-rich mitochondrial and plastid genomes. These sequences come from a small but eclectic list of species, including certain green plants and animals. Here, I review GC-rich organelle DNAs and the insights they have provided into the evolution of nucleotide landscape. I emphasize that GC-biased mitochondrial and plastid DNAs are more widespread than once thought, sometimes occurring together in the same species, and suggest that the forces biasing their nucleotide content can differ both among and within lineages, and may be associated with specific genome architectural features and life history traits.

  6. pH dependent interaction of biofunctionalized CdS nanoparticles with nucleobases and nucleotides: A fluorimetric study

    International Nuclear Information System (INIS)

    Chatterjee, Anindita; Priyam, Amiya; Bhattacharya, Subhash C.; Saha, Abhijit

    2007-01-01

    The interaction of DNA bases and corresponding nucleotides with CdS nanoparticles (NPs), biofunctionalized by cysteine, has been investigated by absorption and fluorescence spectroscopy. Unique enhancement effect of adenine, in contrast to other nucleobases, on the luminescence of cysteine capped CdS (cys-CdS) NPs at both pH 7.5 and 10.5 was found, the extent of enhancement being much higher at pH 10.5. At the latter pH, the difference optical absorption spectra show development of new peak at 278 nm with corresponding decrease in the absorption of adenine at 260 nm, which is attributed to binding of adenine anion to the CdS surface through N7 of the purine ring. Appearance of a new band at 478 cm -1 and concomitant shift in the C 8 -N 7 vibrations to 1610 cm -1 in the FTIR spectra of cys-CdS NPs with adenine also suggest Cd-N7 binding on the particle surface. Amongst various nucleotides, ATP exhibited maximum luminescence enhancement on CdS NPs for a given change in concentration in the micro-molar range at physiological pH. A quantitative correlation between ATP concentration and PL enhancement of CdS NPs has been established, a step which in future might assist in developing new protocols for fluorescence sensing of adenine nucleotides under certain pathological conditions

  7. Kidney Disease in Adenine Phosphoribosyltransferase Deficiency.

    Science.gov (United States)

    Runolfsdottir, Hrafnhildur Linnet; Palsson, Runolfur; Agustsdottir, Inger M; Indridason, Olafur S; Edvardsson, Vidar O

    2016-03-01

    Adenine phosphoribosyltransferase (APRT) deficiency is a purine metabolism disorder causing kidney stones and chronic kidney disease (CKD). The course of nephrolithiasis and CKD has not been well characterized. The objective of this study was to examine long-term kidney outcomes in patients with APRT deficiency. An observational cohort study. All patients enrolled in the APRT Deficiency Registry of the Rare Kidney Stone Consortium. Kidney stones, acute kidney injury (AKI), stage of CKD, end-stage renal disease, estimated glomerular filtration rate (eGFR), and changes in eGFR. Serum creatinine and eGFR calculated using creatinine-based equations. Of 53 patients, 30 (57%) were females and median age at diagnosis was 37.0 (range, 0.6-67.9) years. Median duration of follow-up was 10.3 (range, 0.0-31.5) years. At diagnosis, kidney stones had developed in 29 (55%) patients and 20 (38%) had CKD stages 3 to 5, including 11 (21%) patients with stage 5. At latest follow-up, 33 (62%) patients had experienced kidney stones; 18 (34%), AKI; and 22 (42%), CKD stages 3 to 5. Of 14 (26%) patients with stage 5 CKD, 12 had initiated renal replacement therapy. Kidney stones recurred in 18 of 33 (55%) patients. The median eGFR slope was -0.38 (range, -21.99 to 1.42) mL/min/1.73m(2) per year in patients receiving treatment with an xanthine dehydrogenase inhibitor and -5.74 (range, -75.8 to -0.10) mL/min/1.73m(2) per year in those not treated prior to the development of stage 5 CKD (P=0.001). Use of observational registry data. Progressive CKD and AKI episodes are major features of APRT deficiency, whereas nephrolithiasis is the most common presentation. Advanced CKD without a history of kidney stones is more prevalent than previously reported. Our data suggest that timely therapy may retard CKD progression. Copyright © 2016 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.

  8. Theoretical study on absorption and emission spectra of adenine analogues.

    Science.gov (United States)

    Liu, Hongxia; Song, Qixia; Yang, Yan; Li, Yan; Wang, Haijun

    2014-04-01

    Fluorescent nucleoside analogues have attracted much attention in studying the structure and dynamics of nucleic acids in recent years. In the present work, we use theoretical calculations to investigate the structural and optical properties of four adenine analogues (termed as A1, A2, A3, and A4), and also consider the effects of aqueous solution and base pairing. The results show that the fluorescent adenine analogues can pair with thymine to form stable H-bonded WC base pairs. The excited geometries of both adenine analogues and WC base pairs are similar to the ground geometries. The absorption and emission maxima of adenine analogues are greatly red shifted compared with nature adenine, the oscillator strengths of A1 and A2 are stronger than A3 and A4 in both absorption and emission spectra. The calculated low-energy peaks in the absorption spectra are in good agreement with the experimental data. In general, the aqueous solution and base pairing can slightly red-shift both the absorption and emission maxima, and can increase the oscillator strengths of absorption spectra, but significantly decrease the oscillator strengths of A3 in emission spectra.

  9. NMR studies on an oligodeoxynucleotide containing 2-aminopurine opposite adenine

    International Nuclear Information System (INIS)

    Fazakerley, G.V.; Sowers, L.C.; Eritja, R.; Kaplan, B.E.; Goodman, M.F.

    1987-01-01

    A heteroduplex containing the mismatch 2-aminopurine (AP)-adenine has been synthesized and studied by proton NMR. The mismatch was incorporated into the sequence d[CGG(AP)GGC] x d-(GCCACCG). One-dimensional nuclear Overhauser effect measurements in H 2 O and two-dimensional nuclear Overhauser effect spectra in D 2 O show AP x A base pairs in a wobble structure in which both bases are in the anti conformation. The adenine is stacked well in the helix, but the helix twist between the adenine and neighboring cytosine in the 3' direction is unusually small. As a result, the aminopurine on the opposite strand is somewhat pushed out of the helix. From the measurements of the imino proton line widths, the two adjacent G x C base pairs are not found to be significantly destabilized by the presence of the purine-purine wobble pair

  10. The Role of Gene Duplication in the Evolution of Purine Nucleotide Salvage Pathways

    Science.gov (United States)

    Becerra, Arturo; Lazcano, Antonio

    1998-10-01

    Purine nucleotides are formed de novo by a widespread biochemical route that may be of monophyletic origin, or are synthesized from preformed purine bases and nucleosides through different salvage pathways. Three monophyletic sets of purine salvage enzymes, each of which catalyzes mechanistically similar reactions, can be identified: (a) adenine-, xanthine-, hypoxanthine- and guanine-phosphoribosyltransferases, which are all homologous among themselves, as well as to nucleoside phosphorylases; (b) adenine deaminase, adenosine deaminase, and adenosine monophophate deaminase; and (c) guanine reductase and inosine monophosphate dehydrogenase. These homologies support the idea that substrate specificity is the outcome of gene duplication, and that the purine nucleotide salvage pathways were assembled by a patchwork process that probably took place before the divergence of the three cell domains (Bacteria, Archaea, and Eucarya). Based on the ability of adenine PRTase to catalyze the condensation of PRPP with 4-aminoimidazole-5-carboxamide (AICA), a simpler scheme of purine nucleotide biosynthesis is presented. This hypothetical route requires the prior evolution of PRPP biosynthesis. Since it has been argued that PRPP, nucleosides, and nucleotides are susceptible to hydrolysis, they are very unlikely prebiotic compounds. If this is the case, it implies that many purine salvage pathways appeared only after the evolution of phosphorylated sugar biosynthetic pathways made ribosides available.

  11. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  12. Effect of Adenine Concentration on the Corrosion Inhibition of Aisi ...

    African Journals Online (AJOL)

    This gave a surface coverage of 0.8956 and corrosion penetration rate of 0.022132mm/yr. Hence, the best adenine concentration for the corrosion inhibition of alloys 304L in 1.0M sulphuric acid solution to obtain optimum inhibition efficiency is 0.011M. Keywords: Corrosion, AISI 304L Steel, Inhibition efficiency, Degree of ...

  13. Protection of Chinese herbs against Adenine-induced chronic renal ...

    African Journals Online (AJOL)

    The aim of the study is to evaluate the efficacy of Chinese herbs (Angelica sinensis, Ligusticum wallichii, Salvia miltiorrhiza, Rhizoma dioscoreae, Rhodiola crenilata, Astragalus membranaceus and Angelica sinensis) on adenine-induced chronic renal failure in rats. 30 age-matched male Wistar rats were divided into three ...

  14. Selective inhibition of nicotinamide adenine dinucleotide kinases by dinucleoside disulfide mimics of nicotinamide adenine dinucleotide analogues.

    Science.gov (United States)

    Petrelli, Riccardo; Sham, Yuk Yin; Chen, Liqiang; Felczak, Krzysztof; Bennett, Eric; Wilson, Daniel; Aldrich, Courtney; Yu, Jose S; Cappellacci, Loredana; Franchetti, Palmarisa; Grifantini, Mario; Mazzola, Francesca; Di Stefano, Michele; Magni, Giulio; Pankiewicz, Krzysztof W

    2009-08-01

    Diadenosine disulfide (5) was reported to inhibit NAD kinase from Listeria monocytogenes and the crystal structure of the enzyme-inhibitor complex has been solved. We have synthesized tiazofurin adenosine disulfide (4) and the disulfide 5, and found that these compounds were moderate inhibitors of human NAD kinase (IC(50)=110 microM and IC(50)=87 microM, respectively) and Mycobacterium tuberculosis NAD kinase (IC(50)=80 microM and IC(50)=45 microM, respectively). We also found that NAD mimics with a short disulfide (-S-S-) moiety were able to bind in the folded (compact) conformation but not in the common extended conformation, which requires the presence of a longer pyrophosphate (-O-P-O-P-O-) linkage. Since majority of NAD-dependent enzymes bind NAD in the extended conformation, selective inhibition of NAD kinases by disulfide analogues has been observed. Introduction of bromine at the C8 of the adenine ring restricted the adenosine moiety of diadenosine disulfides to the syn conformation making it even more compact. The 8-bromoadenosine adenosine disulfide (14) and its di(8-bromoadenosine) analogue (15) were found to be the most potent inhibitors of human (IC(50)=6 microM) and mycobacterium NAD kinase (IC(50)=14-19 microM reported so far. None of the disulfide analogues showed inhibition of lactate-, and inosine monophosphate-dehydrogenase (IMPDH), enzymes that bind NAD in the extended conformation.

  15. Energetics and metastability of the adenine dication observed in proton-adenine collisions

    Science.gov (United States)

    Moretto-Capelle, Patrick; Le Padellec, Arnaud; Brière, Guillaume; Massou, Sophie; Franceries, Frédéric

    2007-12-01

    We present here a study that deals with the correlated fragmentation of a doubly charged adenine molecular target induced by a 100keV proton beam. We have elucidated part of the dissociation dynamics for several channels and have obtained the corresponding kinetic energy released values. We have extracted activation energies by combining our experimental data with computations using the ab initio GAMESS code. We have observed metastability patterns against fragmentation, for which we have extracted the temporal mechanism (one or two steps). Subsequently, we have obtained lifetimes in the 100-200ns range. In the simplest case of two-body fragmentation with the emission of mass 28, the determination of transition states and reaction paths has showed that emission of the H-C-N-H fragment is preferred to that of C -N-H2. From the calculated activation barriers and lifetimes, we have deduced an equivalent temperature of the dication that we have compared with the existing models.

  16. Crystallization and preliminary X-ray diffraction study of recombinant adenine phosphoribosyltransferase from the thermophilic bacterium Thermus thermophilus strain HB27

    Science.gov (United States)

    Sinitsyna, E. V.; Timofeev, V. I.; Tuzova, E. S.; Kostromina, M. A.; Murav'eva, T. I.; Esipov, R. S.; Kuranova, I. P.

    2017-07-01

    Adenine phosphoribosyltransferase (APRT) belongs to the type I phosphoribosyltransferase family and catalyzes the formation of adenosine monophosphate via transfer of the 5-phosphoribosyl group from phosphoribosyl pyrophosphate to the nitrogen atom N9 of the adenine base. Proteins of this family are involved in a salvage pathway of nucleotide synthesis, thus providing purine base utilization and maintaining the optimal level of purine bases in the body. Adenine phosphoribosyltransferase from the extremely thermophilic Thermus thermophilus strain HB27 was produced using a highly efficient E. coli producer strain and was then purified by affinity and gel-filtration chromatography. This enzyme was successfully employed as a catalyst for the cascade biosynthesis of biologically important nucleotides. The screening of crystallization conditions for recombinant APRT from T. thermophilus HB27 was performed in order to determine the enzyme structure by X-ray diffraction. The crystallization conditions, which were found by the vapor-diffusion technique, were then optimized to apply the counter-diffusion technique. The crystals of the enzyme were grown by the capillary counter-diffusion method. The crystals belong to sp. gr. P1211 and have the following unitcell parameters: a = 69.86 Å, b = 82.16 Å, c = 91.39 Å, α = γ = 90°, β = 102.58°. The X-ray diffraction data set suitable for the determination of the APRT structure at 2.6 Å resolution was collected from the crystals at the SPring-8 synchrotron facility (Japan).

  17. Catalytic Mechanism and Three-Dimensional Structure of Adenine Deaminase

    Energy Technology Data Exchange (ETDEWEB)

    Kamat, S.S.; Swaminathan, S.; Bagaria, A.; Kumaran, D.; Holmes-Hampton, G. P.; Fan, H.; Sali, A.; Sauder, J. M.; Burley, S. K.; Lindahl, P. A.; Raushel, F. M.

    2011-03-22

    Adenine deaminase (ADE) catalyzes the conversion of adenine to hypoxanthine and ammonia. The enzyme isolated from Escherichia coli using standard expression conditions was low for the deamination of adenine (k{sub cat} = 2.0 s{sup -1}; k{sub cat}/K{sub m} = 2.5 x 10{sup 3} M{sup -1} s{sup -1}). However, when iron was sequestered with a metal chelator and the growth medium was supplemented with Mn{sup 2+} prior to induction, the purified enzyme was substantially more active for the deamination of adenine with kcat and kcat/Km values of 200 s{sup -1} and 5 x 10{sup 5} M{sup -1} s{sup -1}, respectively. The apoenzyme was prepared and reconstituted with Fe{sup 2+}, Zn{sup 2+}, or Mn{sup 2+}. In each case, two enzyme equivalents of metal were necessary for reconstitution of the deaminase activity. This work provides the first example of any member of the deaminase subfamily of the amidohydrolase superfamily to utilize a binuclear metal center for the catalysis of a deamination reaction. [Fe{sup II}/Fe{sup II}]-ADE was oxidized to [Fe{sup III}/Fe{sup III}]-ADE with ferricyanide with inactivation of the deaminase activity. Reducing [Fe{sup III}/Fe{sup III}]-ADE with dithionite restored the deaminase activity, and thus, the diferrous form of the enzyme is essential for catalytic activity. No evidence of spin coupling between metal ions was evident by electron paramagnetic resonance or Moessbauer spectroscopy. The three-dimensional structure of adenine deaminase from Agrobacterium tumefaciens (Atu4426) was determined by X-ray crystallography at 2.2 {angstrom} resolution, and adenine was modeled into the active site on the basis of homology to other members of the amidohydrolase superfamily. On the basis of the model of the adenine-ADE complex and subsequent mutagenesis experiments, the roles for each of the highly conserved residues were proposed. Solvent isotope effects, pH-rate profiles, and solvent viscosity were utilized to propose a chemical reaction mechanism and the

  18. Catalytic Mechanism and Three-Dimensional Structure of Adenine Deaminase

    Energy Technology Data Exchange (ETDEWEB)

    S Kamat; A Bagaria; D Kumaran; G Holmes-Hampton; H Fan; A Sali; J Sauder; S Burley; P Lindahl; et. al.

    2011-12-31

    Adenine deaminase (ADE) catalyzes the conversion of adenine to hypoxanthine and ammonia. The enzyme isolated from Escherichia coli using standard expression conditions was low for the deamination of adenine (k{sub cat} = 2.0 s{sup -1}; k{sub cat}/K{sub m} = 2.5 x 10{sup 3} M{sup -1} s{sup -1}). However, when iron was sequestered with a metal chelator and the growth medium was supplemented with Mn{sup 2+} prior to induction, the purified enzyme was substantially more active for the deamination of adenine with k{sub cat} and k{sub cat}/K{sub m} values of 200 s{sup -1} and 5 x 10{sup 5} M{sup -1} s{sup -1}, respectively. The apoenzyme was prepared and reconstituted with Fe{sup 2+}, Zn{sup 2+}, or Mn{sup 2+}. In each case, two enzyme equivalents of metal were necessary for reconstitution of the deaminase activity. This work provides the first example of any member of the deaminase subfamily of the amidohydrolase superfamily to utilize a binuclear metal center for the catalysis of a deamination reaction. [Fe{sup II}/Fe{sup II}]-ADE was oxidized to [Fe{sup III}/Fe{sup III}]-ADE with ferricyanide with inactivation of the deaminase activity. Reducing [Fe{sup III}/Fe{sup III}]-ADE with dithionite restored the deaminase activity, and thus, the diferrous form of the enzyme is essential for catalytic activity. No evidence of spin coupling between metal ions was evident by electron paramagnetic resonance or Moessbauer spectroscopy. The three-dimensional structure of adenine deaminase from Agrobacterium tumefaciens (Atu4426) was determined by X-ray crystallography at 2.2 {angstrom} resolution, and adenine was modeled into the active site on the basis of homology to other members of the amidohydrolase superfamily. On the basis of the model of the adenine-ADE complex and subsequent mutagenesis experiments, the roles for each of the highly conserved residues were proposed. Solvent isotope effects, pH-rate profiles, and solvent viscosity were utilized to propose a chemical reaction

  19. Surface-Enhanced Raman Scattering of the Complexes of Silver with Adenine and dAMP

    OpenAIRE

    Otto, Cornelis; Hoeben, F.P.; Hoeben, F.P.; Greve, Jan

    1991-01-01

    The behaviour of adenine and 2'-deoxyadenosine-5'-monophosphate (dAMP) at positive surface potentials of a silver working electrode was investigated using surface-enhanced Raman scattering (SERS). The use of positive potentials in the presence of adenine or dAMP leads to a rapid accumulation of an intense spectrum. It is proposed that complexes of adenine (dAMP) with silver generate the observed spectra. Adenine and dAMP can be distinguished spectroscopically due to various different complexe...

  20. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  1. {8-14C}-Adenine and {1-14C}-isopentenyl pyrophosphate - precursors for root-produced cytokinins in the tomato (Lycopersicon esculentum mill.)

    International Nuclear Information System (INIS)

    Dickinson, J.R.

    1985-01-01

    Following the detection of reasonable levels of biologically active cytokinin-like compounds in one-month-old tomato plants, the possible involvement of {8- 14 C}-adenine and {1- 14 C}-isopentenyl pyrophosphate in the biosynthetic pathway leading to an accumulation of free zeatin derivatives, was studied. Intact tomato plants were used for a time-course study involving the uptake of {8- 14 C}-adenine and the tentative identification of compounds into which the 14 C became incorporated. Using high performance liquid chromatography, radioactive trans-zeatin was identified as being present in the Dowex 50 root extract. The 12-hour time interval was used and the roots of the tomato plants were immersed in a more heavily radiolabelled medium. Modified separation techniques were used to achieve enhanced radioactivity recovery rates. This experiment demonstrated the presence of relatively high levels of tentatively identified radioactive zeatin in the Dowex 50 root and stem extracts. Radioactivity in the aqueous extracts was found not to be contributed by cytokinin nucleotides. A final experiment was carried out using decapitated root systems to determine if the root tissue alone could be implicated in the synthesis of cytokinins. Decapitated tomato root systems were supplied with either {8- 14 C}-adenine or {1- 14 C}-isopentenyl pyrophosphate. The ratio of incorporation of {1- 14 C}-isopentenyl pyrophosphate into identified cytokinins was higher than for {8- 14 C}-adenine. It was concluded that both adenine and isopentenyl pyrophosphate are involved in the biosynthetic pathway leading to an accumulation of free zeatin derivatives in tomato roots

  2. Molecular and Subcellular-Scale Modeling of Nucleotide Diffusion in the Cardiac Myofilament Lattice

    Science.gov (United States)

    Kekenes-Huskey, Peter M.; Liao, Tao; Gillette, Andrew K.; Hake, Johan E.; Zhang, Yongjie; Michailova, Anushka P.; McCulloch, Andrew D.; McCammon, J. Andrew

    2013-01-01

    Contractile function of cardiac cells is driven by the sliding displacement of myofilaments powered by the cycling myosin crossbridges. Critical to this process is the availability of ATP, which myosin hydrolyzes during the cross-bridge cycle. The diffusion of adenine nucleotides through the myofilament lattice has been shown to be anisotropic, with slower radial diffusion perpendicular to the filament axis relative to parallel, and is attributed to the periodic hexagonal arrangement of the thin (actin) and thick (myosin) filaments. We investigated whether atomistic-resolution details of myofilament proteins can refine coarse-grain estimates of diffusional anisotropy for adenine nucleotides in the cardiac myofibril, using homogenization theory and atomistic thin filament models from the Protein Data Bank. Our results demonstrate considerable anisotropy in ATP and ADP diffusion constants that is consistent with experimental measurements and dependent on lattice spacing and myofilament overlap. A reaction-diffusion model of the half-sarcomere further suggests that diffusional anisotropy may lead to modest adenine nucleotide gradients in the myoplasm under physiological conditions. PMID:24209858

  3. Studies on mixed ligand complexes of adenine and xanthine with some rare earth ions

    International Nuclear Information System (INIS)

    Rastogi, P.R.; Singh, Mamta; Nayan, Ram

    1993-01-01

    Interactions of 6-aminopurine (adenine, HA) and 2,6-dihydroxypurine (xanthine, HB) with trivalent rare earth ions Y, Tb, Dy, Ho, Er and Tm, have been studied by pH-titration methods in aqueous solution at 20 o (μ = 0.1 M KNO 3 ). The ligands in their mixtures with tripositive rare earth ions (M 3+ ) form a number of mixed ligand complexes, M 3+ -adenine-xanthine, M 3+ -(adenine) 2 -xanthine, M 3+ -adenine-(xanthine) 2 in addition to the binary complexes, M 3+ -(adenine), M 3+ -(adenine) 2 , M 3+ -(adenine) 3 , M 3+ -(xanthine), M 3+ -(xanthine) 2 and M 3+ -(xanthine) 3 . The stability constants of these complexes have been evaluated and the results discussed. (author). 13 refs., 1 fig., 1 tab

  4. Voltammetric study of adenine complex with copper on mercury electrode

    Czech Academy of Sciences Publication Activity Database

    Jelen, František; Kouřilová, Alena; Hasoň, Stanislav; Kizek, R.; Trnková, L.

    2009-01-01

    Roč. 21, 3-5 (2009), s. 439-444 ISSN 1040-0397 R&D Projects: GA AV ČR(CZ) IAA100040602; GA AV ČR(CZ) IAA400040804; GA AV ČR(CZ) KAN200040651 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cyclic voltammetry * elimination voltammetry * copper-adenine complex Subject RIV: BO - Biophysics Impact factor: 2.630, year: 2009

  5. Sequencing of adenine in DNA by scanning tunneling microscopy

    Science.gov (United States)

    Tanaka, Hiroyuki; Taniguchi, Masateru

    2017-08-01

    The development of DNA sequencing technology utilizing the detection of a tunnel current is important for next-generation sequencer technologies based on single-molecule analysis technology. Using a scanning tunneling microscope, we previously reported that dI/dV measurements and dI/dV mapping revealed that the guanine base (purine base) of DNA adsorbed onto the Cu(111) surface has a characteristic peak at V s = -1.6 V. If, in addition to guanine, the other purine base of DNA, namely, adenine, can be distinguished, then by reading all the purine bases of each single strand of a DNA double helix, the entire base sequence of the original double helix can be determined due to the complementarity of the DNA base pair. Therefore, the ability to read adenine is important from the viewpoint of sequencing. Here, we report on the identification of adenine by STM topographic and spectroscopic measurements using a synthetic DNA oligomer and viral DNA.

  6. Cyclic nucleotides and radioresistnace

    International Nuclear Information System (INIS)

    Kulinskij, V.I.; Mikheeva, G.A.; Zel'manovich, B.M.

    1982-01-01

    The addition of glucose to meat-peptone broth does not change the radiosensitizing effect (RSE) of cAMP at the logarithmic phase (LP) and the radioprotective effect (RPE) at the stationary phase (SP), but sensitization, characteristic of cGMP, disappears in SP and turns into RPE in LP. Introduction of glucose into the broth for 20 min eliminates all the effects of both cyclic nucleotides in the cya + strain while cya - mutant exhibits RSE. RSE of both cyclic nucleotides is only manifested on minimal media. These data brought confirmation of the dependence of the influence of cyclic media. These data brought confirmation of the dependence of the influence of cyclic nucleotides on radioresistance upon the metabolic status of the cell [ru

  7. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...

  8. Sulfur and adenine metabolisms are linked, and both modulate sulfite resistance in wine yeast.

    Science.gov (United States)

    Aranda, Agustín; Jiménez-Martí, Elena; Orozco, Helena; Matallana, Emilia; Del Olmo, Marcellí

    2006-08-09

    Sulfite treatment is the most common way to prevent grape must spoilage in winemaking because the yeast Saccharomyces cerevisiae is particularly resistant to this chemical. In this paper we report that sulfite resistance depends on sulfur and adenine metabolism. The amount of adenine and methionine in a chemically defined growth medium modulates sulfite resistance of wine yeasts. Mutations in the adenine biosynthetic pathway or the presence of adenine in a synthetic minimal culture medium increase sulfite resistance. The presence of methionine has the opposite effect, inducing a higher sensitivity to SO(2). The concentration of methionine, adenine, and sulfite in a synthetic grape must influences the progress of fermentation and at the transcriptional level the expression of genes involved in sulfur (MET16), adenine (ADE4), and acetaldehyde (ALD6) metabolism. Sulfite alters the pattern of expression of all these genes. This fact indicates that the response to this stress is complex and involves several metabolic pathways.

  9. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  10. Nonselective enrichment for yeast adenine mutants by flow cytometry

    Science.gov (United States)

    Bruschi, C. V.; Chuba, P. J.

    1988-01-01

    The expression of certain adenine biosynthetic mutations in the yeast Saccharomyces cerevisiae results in a red colony color. This phenomenon has historically provided an ideal genetic marker for the study of mutation, recombination, and aneuploidy in lower eukaryotes by classical genetic analysis. In this paper, it is reported that cells carrying ade1 and/or ade2 mutations exhibit primary fluorescence. Based on this observation, the nonselective enrichment of yeast cultures for viable adenine mutants by using the fluorescence-activated cell sorter has been achieved. The advantages of this approach over conventional genetic analysis of mutation, recombination, and mitotic chromosomal stability include speed and accuracy in acquiring data for large numbers of clones. By using appropriate strains, the cell sorter has been used for the isolation of both forward mutations and chromosomal loss events in S. cerevisiae. The resolving power of this system and its noninvasiveness can easily be extended to more complex organisms, including mammalian cells, in which analogous metabolic mutants are available.

  11. Prevention of injury by resveratrol in a rat model of adenine-induced ...

    African Journals Online (AJOL)

    The effect of 10, 15, and 20 mg/kg doses of resveratrol on the levels of parathyroid hormone, phosphorous, and fibroblast growth factor-23 (FGF-23) in rat urine samples after 2 months of adenine administration were analyzed using an auto-analyzer. Results: Resveratrol treatment significantly inhibited the adenine-mediated ...

  12. Surface-Enhanced Raman Scattering of the Complexes of Silver with Adenine and dAMP

    NARCIS (Netherlands)

    Otto, Cornelis; Hoeben, F.P.; Hoeben, F.P.; Greve, Jan

    1991-01-01

    The behaviour of adenine and 2'-deoxyadenosine-5'-monophosphate (dAMP) at positive surface potentials of a silver working electrode was investigated using surface-enhanced Raman scattering (SERS). The use of positive potentials in the presence of adenine or dAMP leads to a rapid accumulation of an

  13. Suppression of feline immunodeficiency virus infection in vivo by 9-(2-phosphonomethoxyethyl)adenine

    NARCIS (Netherlands)

    Horzinek, M.C.; Egberink, H.F.; Borst, M.; Niphuis, H.; Balzarini, J.; Neu, H.; Schellekens, H.; Clercq, H. de; Koolen, M.J.M.

    1990-01-01

    The acyclic purine nucleoside analogue 9-(2-phosphonomethoxyethyl)adenine [PMEA; formerly referred to as 9-(2-phosphonylmethoxyethyl)adenine] is a potent and selective inhibitor of human immunodeficiency virus replication in vitro and of Moloney murine sarcoma virus-induced tumor formation in mice.

  14. The family of N -adenine: New entry for adenine–benzamide ...

    Indian Academy of Sciences (India)

    sisting linker, reactive functionality and adenine nucleo- base 1, 2 and 3 were synthesized as described below. Adenine derivatives 7 and 12 were synthesized accord- ing to slightly modified literature procedures and char- acterized spectroscopically.28,29 Boc-NH(CH2CH2O)2-. CH2CH2NH2 4 was synthesized according ...

  15. IR spectroscopy of isolated neutral and protonated adenine and 9-methyladenine

    NARCIS (Netherlands)

    van Zundert, G. C. P.; Jaeqx, S.; Berden, G.; Bakker, J.M.; Kleinermanns, K.; Oomens, J.; Rijs, A.M.

    2011-01-01

    IR spectroscopy is employed to study isolated adenine and its derivative 9-methyladenine in both their neutral and protonated forms. The IR spectra of neutral adenine and 9-methyladenine are measured in a molecular beam expansion via IR-UV ion-dip spectroscopy in the 525 to 1750 cm−1 region. For

  16. IR Spectroscopy of Isolated Neutral and Protonated Adenine and 9-Methyladenine

    NARCIS (Netherlands)

    van Zundert, G. C. P.; Jaeqx, S.; G. Berden,; Bakker, J. M.; Kleinermanns, K.; Oomens, J.; Rijs, A. M.

    2011-01-01

    IR spectroscopy is employed to study isolated adenine and its derivative 9-methyladenine in both their neutral and protonated forms. The IR spectra of neutral adenine and 9-methyladenine are measured in a molecular beam expansion via IR-UV ion-dip spectroscopy in the 525 to 1750 cm(-1) region. For

  17. Charges of Nicotinamide Adenine nucleotides and Adenylate Energy Charge as regulatory parameters of the metabolism in Eschericia coli

    DEFF Research Database (Denmark)

    Andersen, Klaus Bahl; von Meyenburg, Kaspar

    1977-01-01

    NADH/(NADH+NAD), NADPH/(NADPH+NADP) and (ATP+½ADP)/(ATP+ADP+AMP) respectively has the values 0.05, 0.45 and 0.9 during steady state growth. The changes of the charges during changes of growth are examined.......NADH/(NADH+NAD), NADPH/(NADPH+NADP) and (ATP+½ADP)/(ATP+ADP+AMP) respectively has the values 0.05, 0.45 and 0.9 during steady state growth. The changes of the charges during changes of growth are examined....

  18. Decrease of serum adenine nucleotide hydrolysis in an irritant contact dermatitis mice model: potential P2X7R involvement.

    Science.gov (United States)

    Zanin, R F; da Silva, G L; Erig, T; Sperotto, N D M; Leite, C E; Coutinho-Silva, R; Batastini, A M O; Morrone, Fernanda Bueno

    2015-06-01

    Extracellular adenosine 5'-triphosphate (ATP) has significant effects on a variety of pathological conditions and it is the main physiological agonist of P2X7 purinergic receptor (P2X7R). It is known that ATP acting via purinergic receptors plays a relevant role on skin inflammation, and P2X7R is required to neutrophil recruitment in a mice model of irritant contact dermatitis (ICD).The present study investigated the effects of chemical irritant croton oil (CrO) upon ATP, ADP, and AMP hydrolysis in mice blood serum, and the potential involvement of P2X7R. The topical application CrO induced a decrease on soluble ATP/ADPase activities (~50 %), and the treatment with the selective P2X7R antagonist, A438079, reversed these effects to control level. Furthermore, we showed that CrO decreased cellular viability (52.6 % ± 3.9) in relation to the control and caused necrosis in keratinocytes (PI positive cells). The necrosis induced by CrO was prevented by the pre-treatment with the selective P2X7R antagonist A438079. The results presented herein suggest that CrO exerts an inhibitory effect on the activity of ATPDase in mouse serum, reinforcing the idea that ICD has a pathogenic mechanism dependent of CD39. Furthermore, it is tempting to suggest that P2X7R may act as a controller of the extracellular levels of ATP.

  19. 31P NMR saturation-transfer study of the in situ kinetics of the mitochondrial adenine nucleotide translocase

    International Nuclear Information System (INIS)

    Masiakos, P.T.; Williams, G.D.; Berkich, D.A.; Smith, M.B.; LaNoue, K.F.

    1991-01-01

    The exchange of intramitochondrial ATP (ATP in ) for extramitochondrial ATP (ATP out ) was measured by using 31 P NMR spectroscopy over a range of temperatures in isolated rat liver mitochondria oxidizing glutamate and succinate in the presence of external ATP but no added ADP (state 4). The rate of this exchange is more than an order of magnitude faster than rates reported previously that were determined by using isotopic techniques in the presence of oligomycin, the potent ATPase inhibitor. Differences are ascribed in part to the low levels of matrix ATP present in oligomycin-treated mitochondrial. Intramitochondrial ATP content regulates the rate of the ATP in /ATP out exchange. At 18C, the concentration of internal ATP that produces half-maximal transport rate is 6.6±0.12 nmol/mg of mitochondrial protein. The relationship between substrate concentration and flux is sigmoidal and is 90% saturated at 11.3±0.18 nmol/mg of mitochondrial protein. Since the measured rates of exchange of ATP in for ATP out are almost 10 times faster than the ATP synthase (ATP/P i ) exchange rates, the translocase cannot limit net ATP/P i exchange in state 4. It may, nonetheless, limit net synthesis of ATP under other conditions when matrix ATP concentration is lower than in state 4 and when external ADP is present at higher concentrations than in these experiments

  20. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    and briefly describe the methods that are preferred for SNP typing in forensic genetics. In addition, we will illustrate how SNPs can be used as investigative leads in the police investigation by discussing the use of ancestry informative markers and forensic DNA phenotyping. Modern DNA sequencing......Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... technologies (also called next generation sequencing or NGS) have the potential to completely transform forensic genetic investigations as we know them today. Here, we will make a short introduction to NGS and explain how NGS may combine analysis of the traditional forensic genetic markers with analysis...

  1. Statistical properties of nucleotides in human chromosomes 21 and 22

    International Nuclear Information System (INIS)

    Zhang Linxi; Sun Tingting

    2005-01-01

    In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence

  2. Distribution of 3H within purine nucleotides of Ehrlich mouse ascites tumour cells after intraabdominal injection of myo-[2-3H]inositol

    DEFF Research Database (Denmark)

    Christensen, Søren; Klenow, H.; Overgaard-Hansen, Kay

    2000-01-01

    /desorption the nucleotides were dephosphorylated, enriched with [U-14C]adenosine, and exposed to purine-nucleoside specific enzymes. Reverse phase HPLC and radioactivity measurement demonstrated that for adenosine about 82% of total stable 3H label was in ribose and thus about 18% in adenine. For guanosine about 89...

  3. Electron transfer driven decomposition of adenine and selected analogs as probed by experimental and theoretical methods

    Science.gov (United States)

    Cunha, T.; Mendes, M.; Ferreira da Silva, F.; Eden, S.; García, G.; Bacchus-Montabonel, M.-C.; Limão-Vieira, P.

    2018-04-01

    We report on a combined experimental and theoretical study of electron-transfer-induced decomposition of adenine (Ad) and a selection of analog molecules in collisions with potassium (K) atoms. Time-of-flight negative ion mass spectra have been obtained in a wide collision energy range (6-68 eV in the centre-of-mass frame), providing a comprehensive investigation of the fragmentation patterns of purine (Pu), adenine (Ad), 9-methyl adenine (9-mAd), 6-dimethyl adenine (6-dimAd), and 2-D adenine (2-DAd). Following our recent communication about selective hydrogen loss from the transient negative ions (TNIs) produced in these collisions [T. Cunha et al., J. Chem. Phys. 148, 021101 (2018)], this work focuses on the production of smaller fragment anions. In the low-energy part of the present range, several dissociation channels that are accessible in free electron attachment experiments are absent from the present mass spectra, notably NH2 loss from adenine and 9-methyl adenine. This can be understood in terms of a relatively long transit time of the K+ cation in the vicinity of the TNI tending to enhance the likelihood of intramolecular electron transfer. In this case, the excess energy can be redistributed through the available degrees of freedom inhibiting fragmentation pathways. Ab initio theoretical calculations were performed for 9-methyl adenine (9-mAd) and adenine (Ad) in the presence of a potassium atom and provided a strong basis for the assignment of the lowest unoccupied molecular orbitals accessed in the collision process.

  4. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth

    2016-05-11

    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  5. Nicotinamide adenine dinucleotide replenishment rescues colon degeneration in aged mice.

    Science.gov (United States)

    Zhu, Xudong; Shen, Weiyan; Wang, Ying; Jaiswal, Amit; Ju, Zhenyu; Sheng, Qinsong

    2017-01-01

    Susceptibility of gastrointestinal dysmotility increases with age-associated colonic degeneration. A paucity of remedies reversing colonic degeneration per se hinders the fundamental relief of symptoms. Here we discovered the correlation between colon degeneration and altered nicotinamide adenine dinucleotide (NAD) level in aged mice. Compared to 3-month-old young controls, 2-year-old mice showed a spectrum of degenerative colonic phenotypes and exhibited a significant elongated transit time and slowed stool frequency in the context of Lomotil-induced slow-transit constipation. Despite upregulated colonic tryptophan hydroxylases expression, serotonin release and expression of colon-predominant type IV serotonin receptor, reduced viability of interstitial cells of Cajal while enhanced aquaporins (Aqp1, 3 and 11) led to a less colonic motility and increased luminal dehydration in aged mice. Notably, this colonic degeneration was accompanied with reduced key NAD + -generating enzyme expression and lowered NAD + /NADH ratio in aged colon. Three-month continuous administration of beta nicotinamide mononucleotide, a NAD + precursor, elevated colonic NAD + level and improved defecation in aged mice. In contrast, pharmacological inhibition of nicotinamide phosphoribosyltransferase, the rate-limiting enzyme for NAD + biosynthesis, induced a reduction in colonic NAD content and impaired gastrointestinal function in young mice. Taken together, these findings suggest the beneficial effect of NAD + in maintaining colonic homoeostasis and reactivating NAD + biosynthesis may represent a promising strategy to counteract age-related gastrointestinal degeneration.

  6. DNA adenine methylation modulates pathogenicity of Klebsiella pneumoniae genotype K1

    Directory of Open Access Journals (Sweden)

    Chi-Tai Fang

    2017-08-01

    Conclusion: Our results support the view that DNA adenine methylation plays an important role in modulating the pathogenicity of K. pneumoniae genotype K1. The incomplete attenuation indicates the existence of other regulatory factors.

  7. Effect of adenine sulphate in the regeneration and elongation of common bean shoots

    OpenAIRE

    Lourdes R. García; Idalmis Bermúdez-Caraballoso; Novisel Veitía; Raúl Collado; Damaris Torres; Carlos Romero

    2012-01-01

    Plant regeneration and its further development of these are critical steps in tissue culture of Phaseolus vulgaris. The paper shows the effect of adenine sulfate included in the culture media on regeneration and elongation of shoots in the cultivar `CIAP 7247F'. The results showed that adenine sulfate affect plant regeneration and its elongation. The values of regenerated shoots and the plant height were increased. Keywords: in vitro culture, culture medium, Phaseolus vulgaris.

  8. Effect of adenine sulphate in the regeneration and elongation of common bean shoots

    Directory of Open Access Journals (Sweden)

    Lourdes R. García

    2012-01-01

    Full Text Available Plant regeneration and its further development of these are critical steps in tissue culture of Phaseolus vulgaris. The paper shows the effect of adenine sulfate included in the culture media on regeneration and elongation of shoots in the cultivar `CIAP 7247F'. The results showed that adenine sulfate affect plant regeneration and its elongation. The values of regenerated shoots and the plant height were increased. Keywords: in vitro culture, culture medium, Phaseolus vulgaris.

  9. Protonation mechanism and location of rate-determining steps for the Ascaris suum nicotinamide adenine dinucleotide-malic enzyme reaction from isotope effects and pH studies

    Energy Technology Data Exchange (ETDEWEB)

    Kiick, D.M.; Harris, B.G.; Cook, P.F.

    1986-01-14

    The pH dependence of the kinetic parameters and the primary deuterium isotope effects with nicotinamide adenine dinucleotide (NAD) and also thionicotinamide adenine dinucleotide (thio-NAD) as the nucleotide substrates were determined in order to obtain information about the chemical mechanism and location of rate-determining steps for the Ascaris suum NAD-malic enzyme reaction. The maximum velocity with thio-NAD as the nucleotide is pH-independent from pH 4.2 to 9.6, while with NAD, V decreases below a pK of 4.8. V/K for both nucleotides decreases below a pK of 5.6 and above a pK of 8.9. Both the tartronate pKi and V/Kmalate decrease below a pK of 4.8 and above a pK of 8.9. Oxalate is competitive vs. malate above pH 7 and noncompetitive below pH 7 with NAD as the nucleotide. The oxalate Kis increases from a constant value above a pK of 4.9 to another constant value above a pK of 6.7. The oxalate Kii also increases above a pK of 4.9, and this inhibition is enhanced by NADH. In the presence of thio-NAD the inhibition by oxalate is competitive vs. malate below pH 7. For thio-NAD, both DV and D(V/K) are pH-independent and equal to 1.7. With NAD as the nucleotide, DV decreases to 1.0 below a pK of 4.9, while D(V/KNAD) and D(V/Kmalate) are pH-independent. Above pH 7 the isotope effects on V and the V/K values for NAD and malate are equal to 1.45, the pH-independent value of DV above pH 7. Results indicate that substrates bind to only the correctly protonated form of the enzyme. Two enzyme groups are necessary for binding of substrates and catalysis. Both NAD and malate are released from the Michaelis complex at equal rates which are equal to the rate of NADH release from E-NADH above pH 7. Below pH 7 NADH release becomes more rate-determining as the pH decreases until at pH 4.0 it completely limits the overall rate of the reaction.

  10. Protonation mechanism and location of rate-determining steps for the Ascaris suum nicotinamide adenine dinucleotide-malic enzyme reaction from isotope effects and pH studies

    International Nuclear Information System (INIS)

    Kiick, D.M.; Harris, B.G.; Cook, P.F.

    1986-01-01

    The pH dependence of the kinetic parameters and the primary deuterium isotope effects with nicotinamide adenine dinucleotide (NAD) and also thionicotinamide adenine dinucleotide (thio-NAD) as the nucleotide substrates were determined in order to obtain information about the chemical mechanism and location of rate-determining steps for the Ascaris suum NAD-malic enzyme reaction. The maximum velocity with thio-NAD as the nucleotide is pH-independent from pH 4.2 to 9.6, while with NAD, V decreases below a pK of 4.8. V/K for both nucleotides decreases below a pK of 5.6 and above a pK of 8.9. Both the tartronate pKi and V/Kmalate decrease below a pK of 4.8 and above a pK of 8.9. Oxalate is competitive vs. malate above pH 7 and noncompetitive below pH 7 with NAD as the nucleotide. The oxalate Kis increases from a constant value above a pK of 4.9 to another constant value above a pK of 6.7. The oxalate Kii also increases above a pK of 4.9, and this inhibition is enhanced by NADH. In the presence of thio-NAD the inhibition by oxalate is competitive vs. malate below pH 7. For thio-NAD, both DV and D(V/K) are pH-independent and equal to 1.7. With NAD as the nucleotide, DV decreases to 1.0 below a pK of 4.9, while D(V/KNAD) and D(V/Kmalate) are pH-independent. Above pH 7 the isotope effects on V and the V/K values for NAD and malate are equal to 1.45, the pH-independent value of DV above pH 7. Results indicate that substrates bind to only the correctly protonated form of the enzyme. Two enzyme groups are necessary for binding of substrates and catalysis. Both NAD and malate are released from the Michaelis complex at equal rates which are equal to the rate of NADH release from E-NADH above pH 7. Below pH 7 NADH release becomes more rate-determining as the pH decreases until at pH 4.0 it completely limits the overall rate of the reaction

  11. REPRESSION BY ADENINE OF THE FORMYLTETRAHYDROFOLATE SYNTHETASE IN AN ANTIFOLIC-RESISTANT MUTANT OF STREPTOCOCCUS FAECALIS.

    Science.gov (United States)

    ALBRECHT, A M; HUTCHISON, D J

    1964-04-01

    Albrecht, Alberta M. (Sloan-Kettering Institute for Cancer Research, New York, N.Y.), and Dorris J. Hutchison. Repression by adenine of the formyltetrahydrofolate synthetase in an antifolic-resistant mutant of Streptococcus faecalis. J. Bacteriol. 87:792-798. 1964.-In an amethopterin-resistant mutant of Streptococcus faecalis ATCC 8043 under cultivation conditions requiring purine synthesis de novo, both the dihydrofolate reductase and the formyltetrahydrofolate synthetase were formed as constant fractions of the total protein synthesized during the exponential phase of growth. When excess adenine was added to the medium, the rate of formation of the synthetase was markedly decreased, i.e., repressed. Under these latter conditions, the synthesis of the reductase proceeded at a rate equal to that observed in the absence of adenine. The repressibility of the synthetase by adenine was demonstrated also by the decrease in rate of synthetase formation upon the addition of adenine to a culture actively synthesizing this enzyme. Guanine and hypoxanthine, like adenine, also repressed the synthetase; exogenous xanthine was less effective. Neither of the pyrimidines, thymine and uracil, at approximately 1 mug/ml, interfered with synthesis of the two enzymes.

  12. A novel approach to adenine-induced chronic kidney disease associated anemia in rodents.

    Directory of Open Access Journals (Sweden)

    Asadur Rahman

    Full Text Available To date, good experimental animal models of renal anemia are not available. Therefore, the purpose of this study was to establish a novel approach to induce chronic kidney disease (CKD with severe anemia by oral administration of adenine in rodents. Adenine was administered to 6-week-old male C57BL/6 mice (25 and 50 mg/kg body weight by oral gavage daily for 28 days. Serum creatinine and BUN as well as hematocrit, hemoglobin (Hb and plasma erythropoietin (EPO levels were monitored to assess renal function and anemia, respectively. Adenine at 25 mg/kg for 28 days slightly increased plasma creatinine levels, but did not induce anemia. In contrast, 50 mg/kg of adenine daily for 28 days showed severe renal dysfunction (plasma creatinine 1.9 ± 0.10 mg/dL and anemia (hematocrit 36.5 ± 1.0% and EPO 28 ± 2.4 pg/mL as compared with vehicle-treated mice (0.4 ± 0.02 mg/dL, 49.6 ± 1.6% and 61 ± 4.0 pg/mL, respectively. At the end of experiment, level of Hb also significantly reduced in 50 mg/kg adenine administration group. Remarkable histological changes of kidney tissues characterized by interstitial fibrosis and cystic appearance in tubules were observed in 50 mg/kg of adenine treatment group. These results have demonstrated that oral dosing with adenine at 50 mg/kg for 28 days is suitable to induce a stable anemia associated with CKD in mice.

  13. A novel approach to adenine-induced chronic kidney disease associated anemia in rodents.

    Science.gov (United States)

    Rahman, Asadur; Yamazaki, Daisuke; Sufiun, Abu; Kitada, Kento; Hitomi, Hirofumi; Nakano, Daisuke; Nishiyama, Akira

    2018-01-01

    To date, good experimental animal models of renal anemia are not available. Therefore, the purpose of this study was to establish a novel approach to induce chronic kidney disease (CKD) with severe anemia by oral administration of adenine in rodents. Adenine was administered to 6-week-old male C57BL/6 mice (25 and 50 mg/kg body weight) by oral gavage daily for 28 days. Serum creatinine and BUN as well as hematocrit, hemoglobin (Hb) and plasma erythropoietin (EPO) levels were monitored to assess renal function and anemia, respectively. Adenine at 25 mg/kg for 28 days slightly increased plasma creatinine levels, but did not induce anemia. In contrast, 50 mg/kg of adenine daily for 28 days showed severe renal dysfunction (plasma creatinine 1.9 ± 0.10 mg/dL) and anemia (hematocrit 36.5 ± 1.0% and EPO 28 ± 2.4 pg/mL) as compared with vehicle-treated mice (0.4 ± 0.02 mg/dL, 49.6 ± 1.6% and 61 ± 4.0 pg/mL, respectively). At the end of experiment, level of Hb also significantly reduced in 50 mg/kg adenine administration group. Remarkable histological changes of kidney tissues characterized by interstitial fibrosis and cystic appearance in tubules were observed in 50 mg/kg of adenine treatment group. These results have demonstrated that oral dosing with adenine at 50 mg/kg for 28 days is suitable to induce a stable anemia associated with CKD in mice.

  14. Glibenclamide improves kidney and heart structure and function in the adenine-diet model of chronic kidney disease.

    Science.gov (United States)

    Diwan, Vishal; Gobe, Glenda; Brown, Lindsay

    2014-01-01

    The development of chronic kidney disease (CKD) and associated cardiovascular disease involves free radical damage and inflammation. Addition of adenine to the diet induces inflammation followed by CKD and cardiovascular disease. NOD-like receptor protein-3 (NLRP-3) is pro-inflammatory in the kidney; glibenclamide inhibits production of NLRP-3. Male Wistar rats were fed either control rat food or adenine (0.25%) in this food for 16 weeks. Glibenclamide (10 mg/kg/day) was administered to two groups with and without adenine for the final 8 weeks. Kidney function (blood urea nitrogen/BUN, plasma creatinine/PCr, plasma uric acid, proteinuria), kidney structure (fibrosis, inflammation), cardiovascular parameters (blood pressure, left ventricular stiffness, vascular responses and echocardiography) and protein expression of markers for oxidative stress (HO-1), and inflammation (TNF-α, NLRP-3) were assessed. In adenine-fed rats, glibenclamide decreased BUN (controls: 6±0.6; adenine: 56.6±5.4; adenine+glibenclamide: 19.4±2.7 mmol/L), PCr (controls: 42±2.8; adenine: 268±23; adenine+glibenclamide: 81±10 μmol/L), proteinuria (controls: 150±7.4; adenine: 303±19; adenine+glibenclamide: 220±13 μmol/L) (all pchronic inflammatory cells, fibrosis, tubular damage and expression of HO-1, TNF-α and NLRP-3 in the kidney. Glibenclamide did not alter plasma uric acid concentrations (controls: 38±1; adenine: 63±4; adenine+glibenclamide: 69±14 μmol/L). Cardiovascular changes included decreased systolic blood pressure and improved vascular responses although cardiac fibrosis, left ventricular stiffness and hypertrophy were not reduced. Glibenclamide improved kidney structure and function in CKD and decreased some cardiovascular parameters. Inflammatory markers and cell populations were attenuated by glibenclamide in kidneys. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Dibenzotetraaza[14]annulene-adenine conjugate recognizes complementary poly dT among ss-DNA/ss-RNA sequences.

    Science.gov (United States)

    Radić Stojković, Marijana; Škugor, Marko; Tomić, Sanja; Grabar, Marina; Smrečki, Vilko; Dudek, Łukasz; Grolik, Jarosław; Eilmes, Julita; Piantanida, Ivo

    2013-06-28

    Among three novel DBTAA derivatives only the DBTAA-propyl-adenine conjugate showed recognition of the consecutive oligo dT sequence by increased affinity and specific induced chirooptical response in comparison to other single stranded RNA and DNA; whereby of particular importance is the up until now unique efficient differentiation between dT and rU. At variance, its close analogue DBTAA-hexyl-adenine did not reveal any selectivity between ss-DNA/RNA pointing out the important role of steric factors (linker length); moreover non-selectivity of the reference compound (, lacking adenine) stressed the importance of adenine interactions in the selectivity.

  16. Determination of adenine based on the fluorescence recovery of the L-Tryptophan-Cu2+ complex

    Science.gov (United States)

    Duan, Ruilin; Li, Chunyan; Liu, Shaopu; Liu, Zhongfang; Li, Yuanfang; Yuan, Yusheng; Hu, Xiaoli

    2016-01-01

    A simple and sensitive method for determination of adenine was developed based on fluorescence quenching and recovery of L-Tryptophan (L-Trp). The fluorescence of L-Trp could efficiently quenched by copper ion compared with other common metal ions. Upon addition of adenine (Ade) in L-Trp-Cu(II) system, the fluorescence was reoccurred. Under the optimum conditions, the recovery fluorescence intensity was linearly correlated with the concentration of adenine in the range from 0.34 to 25.0 μmol L-1, with a correlation coefficient (R2) of 0.9994. The detection limit (3σ/k) was 0.046 μmol L-1, indicating that this method could applied to detect trace adenine. In this study, amino acids including L-Trp, D-Trp, L-Tyr, D-Tyr, L-Phe, D-Phe were investigated and only L-Trp could well chelated copper ion. Additionally, the mechanism of quench and recovery also were discussed and the method was successfully applied to detect the adenine in DNA with satisfactory results.

  17. Quercetin Attenuates Vascular Calcification through Suppressed Oxidative Stress in Adenine-Induced Chronic Renal Failure Rats

    Directory of Open Access Journals (Sweden)

    Xue-ying Chang

    2017-01-01

    Full Text Available Background. This study investigated whether quercetin could alleviate vascular calcification in experimental chronic renal failure rats induced by adenine. Methods. 32 adult male Wistar rats were randomly divided into 4 groups fed normal diet, normal diet with quercetin supplementation (25 mg/kg·BW/d, 0.75% adenine diet, or adenine diet with quercetin supplementation. All rats were sacrificed after 6 weeks of intervention. Serum renal functions biomarkers and oxidative stress biomarkers were measured and status of vascular calcification in aorta was assessed. Furthermore, the induced nitric oxide synthase (iNOS/p38 mitogen activated protein kinase (p38MAPK pathway was determined to explore the potential mechanism. Results. Adenine successfully induced renal failure and vascular calcification in rat model. Quercetin supplementation reversed unfavorable changes of phosphorous, uric acid (UA and creatinine levels, malonaldehyde (MDA content, and superoxide dismutase (SOD activity in serum and the increases of calcium and alkaline phosphatase (ALP activity in the aorta (P<0.05 and attenuated calcification and calcium accumulation in the medial layer of vasculature in histopathology. Western blot analysis showed that iNOS/p38MAPK pathway was normalized by the quercetin supplementation. Conclusions. Quercetin exerted a protective effect on vascular calcification in adenine-induced chronic renal failure rats, possibly through the modulation of oxidative stress and iNOs/p38MAPK pathway.

  18. Bioenergetics and gene silencing approaches for unraveling nucleotide recognition by the human EIF2C2/Ago2 PAZ domain.

    Science.gov (United States)

    Kandeel, Mahmoud; Al-Taher, Abdullah; Nakashima, Remi; Sakaguchi, Tomoya; Kandeel, Ali; Nagaya, Yuki; Kitamura, Yoshiaki; Kitade, Yukio

    2014-01-01

    Gene silencing and RNA interference are major cellular processes that control gene expression via the cleavage of target mRNA. Eukaryotic translation initiation factor 2C2 (EIF2C2, Argonaute protein 2, Ago2) is considered to be the major player of RNAi as it is the core component of RISC complexes. While a considerable amount of research has focused on RNA interference and its associated mechanisms, the nature and mechanisms of nucleotide recognition by the PAZ domain of EIF2C2/Ago2 have not yet been characterized. Here, we demonstrate that the EIF2C2/Ago2 PAZ domain has an inherent lack of binding to adenine nucleotides, a feature that highlights the poor binding of 3'-adenylated RNAs with the PAZ domain as well as the selective high trimming of the 3'-ends of miRNA containing adenine nucleotides. We further show that the PAZ domain selectively binds all ribonucleotides (except adenosine), whereas it poorly recognizes deoxyribonucleotides. In this context, the modification of dTMP to its ribonucleotide analogue gave a drastic improvement of binding enthalpy and, hence, binding affinity. Additionally, higher in vivo gene silencing efficacy was correlated with the stronger PAZ domain binders. These findings provide new insights into the nature of the interactions of the EIF2C2/Ago2 PAZ domain.

  19. Nucleotide excision repair in yeast

    NARCIS (Netherlands)

    Eijk, Patrick van

    2012-01-01

    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  20. Tomenphantadenine, an unprecedented germacranolide-adenine hybrid heterodimer from the medicinal plant Elephantopus tomentosus L.

    Science.gov (United States)

    Guo, Zhi Kai; Wang, Bei; Cai, Cai Hong; Huang, Sheng Zhuo; Yuan, Jing Zhe; Mei, Wen Li; Dai, Hao Fu

    2018-03-01

    An unusual adenine-substituted germacrane sesquiterpene lactone, tomenphantadenine (1), has been isolated from the whole plant of Elephantopus tomentosus L. The structure of this compound was established by comprehensive spectroscopic analysis including high resolution (HR) ESI-MS, 1D and 2D nuclear magnetic resonance (NMR) spectroscopic data. This compound features novel hybrid pattern of germacrane sesquiterpene with adenine through C-N linkage, and a possible biosynthetic pathway for it was proposed. Compound 1 showed potent antibacterial activity against the gram-positive Staphylococcus aureus and weak acetylcholinesterase (AChE) inhibitory activity. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. DNA homoduplexes containing no pyrimidine nucleotide

    Czech Academy of Sciences Publication Activity Database

    Kypr, Jaroslav; Kejnovská, Iva; Vorlíčková, Michaela

    2003-01-01

    Roč. 32, č. 2 (2003), s. 154-158 ISSN 0175-7571 R&D Projects: GA ČR GA301/01/0590; GA AV ČR IAA4004201 Institutional research plan: CEZ:AV0Z5004920 Keywords : adenine * base pairing * circular dichroism spectroscopy Subject RIV: BO - Biophysics Impact factor: 1.769, year: 2003

  2. Synthetic models related to DNA-intercalating molecules. Interactions between 8-alkoxypsoralen and adenine

    International Nuclear Information System (INIS)

    Decout, J.L.; Lhomme, J.

    1983-01-01

    To investigate the interactions and the photoreactions between furocoumarins and adenine, compounds in which a psoralen molecule is linked by different polymethylene bridges have been synthesised. Ring-ring intramolecular interactions are observed by UV spectroscopy. Thermodynamic parameters of these hydrophobic interactions are determined by the study of the variation of the hypochromic effect with temperature. (author)

  3. Loss of Hoogsteen Pairing Ability upon N1 Adenine Platinum Binding

    Czech Academy of Sciences Publication Activity Database

    Schmidt, K. S.; Reedijk, J.; Weisz, K.; Janke, E. M. B.; Šponer, Judit E.; Šponer, Jiří; Lippert, B.

    2002-01-01

    Roč. 41, č. 11 (2002), s. 2855-2863 ISSN 0020-1669 R&D Projects: GA MŠk LN00A016; GA AV ČR IAA4040903 Institutional research plan: CEZ:AV0Z4040901 Keywords : adenine * thymine * Hoogsteen pairing ability Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.950, year: 2002

  4. The effect of caffeine and adenine on radiation induced suppression of DNA synthesis, and cell survival

    International Nuclear Information System (INIS)

    Wilcoxson, L.T.; Griffiths, T.D.

    1984-01-01

    Exposure of cultured mammalian cells to ionizing radiation or UV light results in a transient decrease in the rate of DNA synthesis. This depression in synthetic rate may be attenuated or deferred via a post-irradiation treatment with caffeine or adenine. It has been suggested that this attenuation may increase the fixation of damage and, therefore, increase radiation sensitivity. However, it has been previously reported that, for V79 cells treated with caffeine or adenine, no correlation exists between the extent of depression and cell survival. The present investigation expands upon these findings by examining the effect of caffeine or adenine post-irradiation treatment on two cell lines with normal UV sensitivity, mouse 3T3 and CHO AA8 cells, and one UV sensitive cell line, CHO UV5 cells. Both caffeine and adenine have been found to reduce, or delay, the suppression in DNA synthesis in all three cell lines. Surprisingly, caffeine appeared to induced even the UV5 cells to recover DNA synthetic ability. The amount of reduction in suppression of DNA synthesis, however, varies between the different cell lines and no consistent relationship with cell survival has emerged

  5. SERS, XPS, and DFT Study of Adenine Adsorption on Silver and Gold Surfaces.

    Science.gov (United States)

    Pagliai, Marco; Caporali, Stefano; Muniz-Miranda, Maurizio; Pratesi, Giovanni; Schettino, Vincenzo

    2012-01-19

    The adsorption of adenine on silver and gold surfaces has been investigated combining density functional theory calculations with surface-enhanced Raman scattering and angle-resolved X-ray photoelectron spectroscopy measurements, obtaining useful insight into the orientation and interaction of the nucleobase with the metal surfaces.

  6. Prevention of injury by resveratrol in a rat model of adenine-induced ...

    African Journals Online (AJOL)

    1Department of Nephrology, Heping Hospital Affiliated to Changzhi Medical College, Changzhi, Shanxi 046000, 2Clinical. Medicine ... tubule swelling and expansion induced by adenine administration. Conclusion: ... administration in a rat model of CKD by inhibiting FGF-23, parathyroid hormone, and phosphate. Thus,.

  7. Absorption by DNA single strands of adenine isolated in vacuo: The role of multiple chromophores

    DEFF Research Database (Denmark)

    Nielsen, L.M.; Pedersen, S.O.; Kirketerp, M.-B.S.

    2012-01-01

    to that for the adenine molecule and the dAMP mononucleotide. Desolvation has little effect on the bandwidth, which implies that inhomogenous broadening of the absorption bands in aqueous solution is of minor importance compared to, e.g., conformational disorder. Finally, at high photon energies, internal conversion...

  8. Kinetic analysis of Yersinia pestis DNA adenine methyltransferase activity using a hemimethylated molecular break light oligonucleotide.

    Directory of Open Access Journals (Sweden)

    Robert J Wood

    Full Text Available BACKGROUND: DNA adenine methylation plays an important role in several critical bacterial processes including mismatch repair, the timing of DNA replication and the transcriptional control of gene expression. The dependence of bacterial virulence on DNA adenine methyltransferase (Dam has led to the proposal that selective Dam inhibitors might function as broad spectrum antibiotics. METHODOLOGY/PRINCIPAL FINDINGS: Herein we report the expression and purification of Yersinia pestis Dam and the development of a continuous fluorescence based assay for DNA adenine methyltransferase activity that is suitable for determining the kinetic parameters of the enzyme and for high throughput screening against potential Dam inhibitors. The assay utilised a hemimethylated break light oligonucleotide substrate containing a GATC methylation site. When this substrate was fully methylated by Dam, it became a substrate for the restriction enzyme DpnI, resulting in separation of fluorophore (fluorescein and quencher (dabcyl and therefore an increase in fluorescence. The assays were monitored in real time using a fluorescence microplate reader in 96 well format and were used for the kinetic characterisation of Yersinia pestis Dam, its substrates and the known Dam inhibitor, S-adenosylhomocysteine. The assay has been validated for high throughput screening, giving a Z-factor of 0.71+/-0.07 indicating that it is a sensitive assay for the identification of inhibitors. CONCLUSIONS/SIGNIFICANCE: The assay is therefore suitable for high throughput screening for inhibitors of DNA adenine methyltransferases and the kinetic characterisation of the inhibition.

  9. Severe hyperparathyroidism with bone abnormalities and metastatic calcification in rats with adenine-induced uraemia.

    Science.gov (United States)

    Tamagaki, Keiichi; Yuan, Qunsheng; Ohkawa, Hiroyuki; Imazeki, Ikuo; Moriguchi, Yoshiyuki; Imai, Nobuo; Sasaki, Susumu; Takeda, Kazuo; Fukagawa, Masafumi

    2006-03-01

    Marked parathyroid hyperplasia with bone diseases and vascular calcification are unsolved issues in dialysis patients. In this study, we made azotemic model rats by adenine feeding and analyzed the development and progression of the abnormalities. Renal failure was induced in 8-week-old male Wistar rats by feeding 0.75% adenine-containing diet for 6 weeks. Serum parameters, parathyroid hyperplasia, bone changes and metastatic calcification were examined at 2, 4 and 6 weeks. Progressive increase of serum creatinine and inorganic phosphate, and decreased levels of serum calcium and 1,25(OH)2D3 were confirmed. Markedly enlarged parathyroid glands and extremely high PTH levels were observed in all adenine-fed rats compared with the control (PTH: 199.3+/-58.0 vs 10.5+/-3.0 pmol/l, Prats. Uraemic rats made by adenine diet developed severe abnormalities of calcium metabolism in a relatively short period and therefore they may serve as a useful model for the analysis of parathyroid hyperplasia and vascular calcification in chronic renal failure.

  10. Circular dichroism spectroscopy of conformers of (guanine + adenine) repeat strands of DNA

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Kypr, Jaroslav; Vorlíčková, Michaela

    2003-01-01

    Roč. 15, č. 7 (2003), s. 584-592 ISSN 0899-0042 R&D Projects: GA AV ČR IAA4004201; GA ČR GA204/01/0561 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA conformation * (guanine + adenine) repeats * homoduplexes Subject RIV: BO - Biophysics Impact factor: 1.793, year: 2003

  11. Renoprotective effect of Chinese chive polysaccharides in adenine-induced chronic renal failure.

    Science.gov (United States)

    Li, Qiang-Ming; Chena, Hao-Ran; Zha, Xue-Qiang; Lu, Chao-Qun; Pan, Li-Hua; Luo, Jian-Ping

    2018-01-01

    In this work, we investigated the effect of Chinese chive polysaccharides (CCP) on renal function in mice with adenine-induced chronic renal failure (CRF). Results exhibited that adenine treatment caused serious renal pathological damages and elevation of serum creatinine and blood urea nitrogen of mice. However, these changes could be significantly reversed by the administration of CCP in a dose-dependent manner. When CCP dosage reached 200mg/kg/day, the area of renal pathological damage was decreased by 59.2%, and the levels of serum creatinine and blood urea nitrogen were decreased by 23.9% and 34.7% compared to those of model group. Moreover, it was found that renal oxidative damage, inflammation and fibrosis of adenine-induced CRF mice could also be significantly inhibited by CCP. These results suggested that CCP could improve the kidney functions of adenine-induced CRF mice and the renoprotective effect might be associated with its antioxidant, anti-inflammatory and anti-fibrosis activities. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Photochemical Reaction Between 1,2-Naphthoquinone and Adenine in Binary Water-Acetonitrile Solutions.

    Science.gov (United States)

    Zhou, Qiaohui; Wei, Yaxiong; Liu, Xiang; Chen, Lin; Zhou, Xiaoguo; Liu, Shilin

    2018-01-01

    The photochemical reaction between 1,2-naphthoquinone (NQ) and adenine was investigated using nanosecond time-resolved laser flash photolysis. With photolysis at 355 nm, the lowest triplet state T 1 of NQ was produced via intersystem crossing from its singlet excited state. The triplet-triplet absorption of the state contributes three bands of transient spectra at 374, 596 and 650 nm, respectively, in pure acetonitrile and binary water-acetonitrile solutions. In the presence of adenine, the observation of A· + (at 363 nm) and NQ+H· radical (at 343 and 485 nm) indicates a multistep mechanism of electron transfer process followed by a proton transfer between 3 NQ* and adenine. By fitting with the Stern-Volmer relationship, the quenching rate constant k q of 3 NQ* by adenine in binary water-acetonitrile solutions (4/1, volume ratio, v/v) is determined as 1.66 × 10 9  m -1  s -1 . Additionally, no spectral evidence confirms the existence of electron transfer between 3 NQ* with thymine, cytosine and uracil. © 2017 The American Society of Photobiology.

  13. Prevention of injury by resveratrol in a rat model of adenine-induced ...

    African Journals Online (AJOL)

    Purpose: To investigate the preventive effect of resveratrol against renal pathological changes in a rat model of chronic kidney disease (CKD). Methods: CKD was induced by daily intragastric administration of adenine (200 mg/kg) for 1 month. The effect of 10, 15, and 20 mg/kg doses of resveratrol on the levels of ...

  14. The effect of activated charcoal on adenine-induced chronic renal failure in rats.

    Science.gov (United States)

    Ali, Badreldin H; Alza'abi, Mohamed; Ramkumar, Aishwarya; Al-Lawati, Intisar; Waly, Mostafa I; Beegam, Sumaya; Nemmar, Abderrahim; Brand, Susanne; Schupp, Nicole

    2014-03-01

    Activated charcoal (AC) is a sorbent that has been shown to remove urinary toxins like urea and indoxyl sulfate. Here, the influence of AC on kidney function of rats with experimental chronic renal failure (CRF) is investigated. CRF was induced in rats by feeding adenine (0.75%) for four weeks. As an intervention, AC was added to the feed at concentrations of 10%, 15% or 20%. Adenine treatment impaired kidney function: it lowered creatinine clearance and increased plasma concentrations of creatinine, urea, neutrophil gelatinase-associated lipocalin and vanin-1. Furthermore, it raised plasma concentrations of the uremic toxins indoxyl sulfate, phosphate and uric acid. Renal morphology was severely damaged and histopathological markers of inflammation and fibrosis were especially increased. In renal homogenates, antioxidant indices, including superoxide dismutase and catalase activity, total antioxidant capacity and reduced glutathione were adversely affected. Most of these changes were significantly ameliorated by dietary administration of AC at a concentration of 20%, while effects induced by lower doses of dietary AC on adenine nephrotoxicity were not statistically significant. The results suggest that charcoal is a useful sorbent agent in dietary adenine-induced CRF in rats and that its usability as a nephroprotective agent in human kidney disease should be studied. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Probing electronic coupling between adenine bases in RNA strands from synchrotron radiation circular dichroism experiments

    DEFF Research Database (Denmark)

    Nielsen, Lisbeth Munksgård; Hoffmann, Søren Vrønning; Nielsen, Steen Brøndsted

    2012-01-01

    Circular dichroism spectra (176–330 nm) of RNA adenine oligomers, (rA)n (n = 1–10, 12, 15, and 20), reveal electronic coupling between two bases in short strands. The number of interacting bases in long strands is more and larger than that reported previously for the corresponding DNA strands....

  16. Effect of AST-120 on Endothelial Dysfunction in Adenine-Induced Uremic Rats

    Directory of Open Access Journals (Sweden)

    Yuko Inami

    2014-01-01

    Full Text Available Aim. Chronic kidney disease (CKD represents endothelial dysfunction. Monocyte adhesion is recognized as the initial step of arteriosclerosis. Indoxyl sulfate (IS is considered to be a risk factor for arteriosclerosis in CKD. Oral adsorbent AST-120 retards deterioration of renal function, reducing accumulation of IS. In the present study, we determined the monocyte adhesion in the adenine-induced uremic rats in vivo and effects of AST-120 on the adhesion molecules. Methods. Twenty-four rats were divided into control, control+AST-120, adenine, and adenine+AST-120 groups. The number of monocytes adherent to the endothelium of thoracic aorta by imaging the entire endothelial surface and the mRNA expressions of adhesion and atherosclerosis-related molecules were examined on day 49. The mRNA expressions of ICAM-1 and VCAM-1 in human umbilical vein endothelial cells were also examined. Results. Adenine increased the number of adherent monocytes, and AST-120 suppressed the increase. The monocyte adhesion was related to serum creatinine and IS in sera. Overexpression of VCAM-1 and TGF-β1 mRNA in the arterial walls was observed in uremic rats. IS induced increase of the ICAM-1 and VCAM-1 mRNA expressions in vitro. Conclusion. It appears that uremic condition introduces the monocyte adhesion to arterial wall and AST-120 might inhibit increasing of the monocyte adherence with CKD progression.

  17. Adenine Enrichment at the Fourth CDS Residue in Bacterial Genes Is Consistent with Error Proofing for +1 Frameshifts.

    Science.gov (United States)

    Abrahams, Liam; Hurst, Laurence D

    2017-12-01

    Beyond selection for optimal protein functioning, coding sequences (CDSs) are under selection at the RNA and DNA levels. Here, we identify a possible signature of "dual-coding," namely extensive adenine (A) enrichment at bacterial CDS fourth sites. In 99.07% of studied bacterial genomes, fourth site A use is greater than expected given genomic A-starting codon use. Arguing for nucleotide level selection, A-starting serine and arginine second codons are heavily utilized when compared with their non-A starting synonyms. Several models have the ability to explain some of this trend. In part, A-enrichment likely reduces 5' mRNA stability, promoting translation initiation. However T/U, which may also reduce stability, is avoided. Further, +1 frameshifts on the initiating ATG encode a stop codon (TGA) provided A is the fourth residue, acting either as a frameshift "catch and destroy" or a frameshift stop and adjust mechanism and hence implicated in translation initiation. Consistent with both, genomes lacking TGA stop codons exhibit weaker fourth site A-enrichment. Sequences lacking a Shine-Dalgarno sequence and those without upstream leader genes, that may be more error prone during initiation, have greater utilization of A, again suggesting a role in initiation. The frameshift correction model is consistent with the notion that many genomic features are error-mitigation factors and provides the first evidence for site-specific out of frame stop codon selection. We conjecture that the NTG universal start codon may have evolved as a consequence of TGA being a stop codon and the ability of NTGA to rapidly terminate or adjust a ribosome. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. Ribose Supplementation Alone or with Elevated Creatine Does Not Preserve High Energy Nucleotides or Cardiac Function in the Failing Mouse Heart.

    Directory of Open Access Journals (Sweden)

    Kiterie M E Faller

    Full Text Available Reduced levels of creatine and total adenine nucleotides (sum of ATP, ADP and AMP are hallmarks of chronic heart failure and restoring these pools is predicted to be beneficial by maintaining the diseased heart in a more favourable energy state. Ribose supplementation is thought to support both salvage and re-synthesis of adenine nucleotides by bypassing the rate-limiting step. We therefore tested whether ribose would be beneficial in chronic heart failure in control mice and in mice with elevated myocardial creatine due to overexpression of the creatine transporter (CrT-OE.FOUR GROUPS WERE STUDIED: sham; myocardial infarction (MI; MI+ribose; MI+CrT-OE+ribose. In a pilot study, ribose given in drinking water was bioavailable, resulting in a two-fold increase in myocardial ribose-5-phosphate levels. However, 8 weeks post-surgery, total adenine nucleotide (TAN pool was decreased to a similar amount (8-14% in all infarcted groups irrespective of the treatment received. All infarcted groups also presented with a similar and substantial degree of left ventricular (LV dysfunction (3-fold reduction in ejection fraction and LV hypertrophy (32-47% increased mass. Ejection fraction closely correlated with infarct size independently of treatment (r(2 = 0.63, p<0.0001, but did not correlate with myocardial creatine or TAN levels.Elevating myocardial ribose and creatine levels failed to maintain TAN pool or improve post-infarction LV remodeling and function. This suggests that ribose is not rate-limiting for purine nucleotide biosynthesis in the chronically failing mouse heart and that alternative strategies to preserve TAN pool should be investigated.

  19. Profiles of the biosynthesis and metabolism of pyridine nucleotides in potatoes (Solanum tuberosum L.).

    Science.gov (United States)

    Katahira, Riko; Ashihara, Hiroshi

    2009-12-01

    As part of a research program on nucleotide metabolism in potato tubers (Solanum tuberosum L.), profiles of pyridine (nicotinamide) metabolism were examined based on the in situ metabolic fate of radio-labelled precursors and the in vitro activities of enzymes. In potato tubers, [(3)H]quinolinic acid, which is an intermediate of de novo pyridine nucleotide synthesis, and [(14)C]nicotinamide, a catabolite of NAD, were utilised for pyridine nucleotide synthesis. The in situ tracer experiments and in vitro enzyme assays suggest the operation of multiple pyridine nucleotide cycles. In addition to the previously proposed cycle consisting of seven metabolites, we found a new cycle that includes newly discovered nicotinamide riboside deaminase which is also functional in potato tubers. This cycle bypasses nicotinamide and nicotinic acid; it is NAD --> nicotinamide mononucleotide --> nicotinamide riboside --> nicotinic acid riboside --> nicotinic acid mononucleotide --> nicotinic acid adenine dinucleotide --> NAD. Degradation of the pyridine ring was extremely low in potato tubers. Nicotinic acid glucoside is formed from nicotinic acid in potato tubers. Comparative studies of [carboxyl-(14)C]nicotinic acid metabolism indicate that nicotinic acid is converted to nicotinic acid glucoside in all organs of potato plants. Trigonelline synthesis from [carboxyl-(14)C]nicotinic acid was also found. Conversion was greater in green parts of plants, such as leaves and stem, than in underground parts of potato plants. Nicotinic acid utilised for the biosynthesis of these conjugates seems to be derived not only from the pyridine nucleotide cycle, but also from the de novo synthesis of nicotinic acid mononucleotide.

  20. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  1. Communication: Site-selective bond excision of adenine upon electron transfer

    Science.gov (United States)

    Cunha, T.; Mendes, M.; Ferreira da Silva, F.; Eden, S.; García, G.; Limão-Vieira, P.

    2018-01-01

    This work demonstrates that selective excision of hydrogen atoms at a particular site of the DNA base adenine can be achieved in collisions with electronegative atoms by controlling the impact energy. The result is based on analysing the time-of-flight mass spectra yields of potassium collisions with a series of labeled adenine derivatives. The production of dehydrogenated parent anions is consistent with neutral H loss either from selective breaking of C-H or N-H bonds. These unprecedented results open up a new methodology in charge transfer collisions that can initiate selective reactivity as a key process in chemical reactions that are dominant in different areas of science and technology.

  2. Influence of gamma irradiation and benzyl adenine on keeping quality of custard apple fruits during storage

    International Nuclear Information System (INIS)

    Chouksey, Swati; Singh, Alpana; Thakur, Rajendra Singh; Deshmukh, Reena

    2013-01-01

    The custard apple (Annona squamosa) fruits were procured from local market, irradiated with radiation doses 0, 0.25, 0.50, 0.75, 1.00, 1.25, 1.50, 1.75 kGy and then treated with benzyl adenine (50 and 100 part per million) and stored at ambient temperature (25±5 °C, Relative Humidity 90±2%) for 12 days. The treated fruits were evaluated for sensory (viz; flavour, texture, internal and external colour) and chemical constituents (viz; Total Soluble Solids, titrable acidity, ascorbic acid, free soluble sugar, reducing sugar, non reducing sugar, carbohydrate) during storage. The study concluded that radiation dose of 1.5 kilo Gray along with 50 ppm benzyl adenine enhanced in shelf-life of custard apple fruits by 6 days at ambient temperature with good pulp texture, flavour, colour and nutritional quality as compared to control. (author)

  3. Adenine Synthesis in a Model Prebiotic Reaction: Connecting Origin of Life Chemistry with Biology

    OpenAIRE

    Anumukonda, Lakshmi N.; Young, Avery; Lynn, David G.; Buckley, Ragan; Warrayat, Amena; Graves, Christina L.; Bean, Heather D.; Hud, Nicholas V.

    2011-01-01

    Many high school laboratory experiments demonstrate concepts related to biological evolution, but few exist that allow students to investigate life?s chemical origins. This series of laboratory experiments has been developed to allow students to explore and appreciate the deep connection that exists between prebiotic chemistry, chemical evolution, and contemporary biological systems. In the first experiment of the series, students synthesize adenine, one of the purine nucleobases of DNA and R...

  4. Adenine ribbon stabilized by Watson–Crick and Hoogsteen hydrogen Bonds: WFT and DFT study

    Czech Academy of Sciences Publication Activity Database

    Zierkiewicz, W.; Michalska, D.; Hobza, Pavel

    2010-01-01

    Roč. 12, č. 12 (2010), s. 2888-2894 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:Wroclaw University of Technology(PL) 343974/Z0304 Institutional research plan: CEZ:AV0Z40550506 Keywords : adenine ribbon * ab initio correlated calculations * self -organization Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.454, year: 2010

  5. Long-Range Charge Transport in Adenine-Stacked RNA:DNA Hybrids.

    Science.gov (United States)

    Li, Yuanhui; Artés, Juan M; Hihath, Joshua

    2016-01-27

    An extremely important biological component, RNA:DNA can also be used to design nanoscale structures such as molecular wires. The conductance of single adenine-stacked RNA:DNA hybrids is rapidly and reproducibly measured using the break junction approach. The conductance decreases slightly over a large range of molecular lengths, suggesting that RNA:DNA can be used as an oligonucleotide wire. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Design, synthesis, and characterization of 0-D, 1-D, and 2-D Zinc–Adeninate coordination assemblies

    Energy Technology Data Exchange (ETDEWEB)

    An, Ji Hyun [Dept. of Chemistry Education, Seoul National University, Seoul (Korea, Republic of); Geib, Steven J. [Dept. of Chemistry, University of Pittsburgh, Pittsburgh (United States); Kim, Myung Gil [Dept. of Chemistry, Chungang University, Seoul (Korea, Republic of)

    2015-08-15

    In this study, we demonstrate the synthesis and characterization of zinc– adeninate coordination polymers with 0-D, 1-D, and 2-D structures. We describe methods for controlling the structure of these materials by applying different synthetic conditions and discuss their structural relationships. 0-D, 1-D, and 2-D zinc–adeninate coordination polymers with the same metal–adeninate coordination mode were synthesized and characterized. By controlling the temperature, a material with 0-D macrocycle or 1-D chain coordination polymer was prepared. A replacement of pyridine with bipyridine formed 2-D sheet structure by connecting 1-D chains with each other. They exhibited an interesting relationship between synthetic methods and structures. Further study of metal–adeninate coordination chemistry will render a precise control of the structure in synthesis and will open a new venue to new materials with fascinating properties.

  7. Adenine Synthesis in a Model Prebiotic Reaction: Connecting Origin of Life Chemistry with Biology.

    Science.gov (United States)

    Anumukonda, Lakshmi N; Young, Avery; Lynn, David G; Buckley, Ragan; Warrayat, Amena; Graves, Christina L; Bean, Heather D; Hud, Nicholas V

    2011-12-01

    Many high school laboratory experiments demonstrate concepts related to biological evolution, but few exist that allow students to investigate life's chemical origins. This series of laboratory experiments has been developed to allow students to explore and appreciate the deep connection that exists between prebiotic chemistry, chemical evolution, and contemporary biological systems. In the first experiment of the series, students synthesize adenine, one of the purine nucleobases of DNA and RNA, from plausibly prebiotic precursor molecules. Students compare their product to authentic standards using thin-layer chromatography. The second and third experiments of the series allow students to extract DNA from a familiar organism, the strawberry, and hydrolyze it, releasing adenine, which they can then compare to the previously chemically-synthesized adenine. A fourth, optional experiment is included where the technique of thin-layer chromatography is introduced and chromatographic skills are developed for use in the other three experiments that comprise this series. Concepts relating to organic and analytical chemistry, as well as biochemistry and DNA structure, are incorporated throughout, allowing this series of laboratory experiments to be easily inserted into existing laboratory courses and to reinforce concepts already included in any high school chemistry or biology curriculum.

  8. Selective self-assembly of adenine-silver nanoparticles forms rings resembling the size of cells

    Science.gov (United States)

    Choi, Sungmoon; Park, Soonyoung; Yang, Seon-Ah; Jeong, Yujin; Yu, Junhua

    2015-01-01

    Self-assembly has played critical roles in the construction of functional nanomaterials. However, the structure of the macroscale multicomponent materials built by the self-assembly of nanoscale building blocks is hard to predict due to multiple intermolecular interactions of great complexity. Evaporation of solvents is usually an important approach to induce kinetically stable assemblies of building blocks with a large-scale specific arrangement. During such a deweting process, we tried to monitor the possible interactions between silver nanoparticles and nucleobases at a larger scale by epifluorescence microscopy, thanks to the doping of silver nanoparticles with luminescent silver nanodots. ssDNA oligomer-stabilized silver nanoparticles and adenine self-assemble to form ring-like compartments similar to the size of modern cells. However, the silver ions only dismantle the self-assembly of adenine. The rings are thermodynamically stable as the drying process only enrich the nanoparticles-nucleobase mixture to a concentration that activates the self-assembly. The permeable membrane-like edge of the ring is composed of adenine filaments glued together by silver nanoparticles. Interestingly, chemicals are partially confined and accumulated inside the ring, suggesting that this might be used as a microreactor to speed up chemical reactions during a dewetting process. PMID:26643504

  9. Quantification of DNA in Neonatal Dried Blood Spots by Adenine Tandem Mass Spectrometry.

    Science.gov (United States)

    Durie, Danielle; Yeh, Ed; McIntosh, Nathan; Fisher, Lawrence; Bulman, Dennis E; Birnboim, H Chaim; Chakraborty, Pranesh; Al-Dirbashi, Osama Y

    2018-01-02

    Newborn screening programs have expanded to include molecular-based assays as first-tier tests and the success of these assays depends on the quality and yield of DNA extracted from neonatal dried blood spots (DBS). To meet high throughput and rapid turnaround time requirements, newborn screening laboratories adopted rapid DNA extraction methods that produce crude extracts. Quantification of DNA in neonatal DBS is not routinely performed due to technical challenges; however, this may enhance the performance of assays that are sensitive to amounts of input DNA. In this study, we developed a novel high throughput method to quantify total DNA in DBS. It is based on specific acid-catalyzed depurination of DNA followed by mass spectrometric quantification of adenine. The amount of adenine was used to calculate DNA quantity per 3.2 mm DBS. Reference intervals were established using archived, neonatal DBS (n = 501) and a median of 130.6 ng of DNA per DBS was obtained, which is in agreement with literature values. The intra- and interday variations were quantification were 12.5 and 37.8 nmol/L adenine, respectively. We demonstrated that DNA from neonatal DBS can be successfully quantified in high throughput settings using instruments currently deployed in NBS laboratories.

  10. An experimental and theoretical vibrational study of interaction of adenine and thymine with artificial seawaters: A prebiotic chemistry experiment.

    Science.gov (United States)

    Anizelli, Pedro R; Baú, João P T; Nabeshima, Henrique S; da Costa, Marcello F; de Santana, Henrique; Zaia, Dimas A M

    2014-05-21

    Nucleic acid bases play important roles in living beings. Thus, their interaction with salts the prebiotic Earth could be an important issue for the understanding of origin of life. In this study, the effect of pH and artificial seawaters on the structure of adenine and thymine was studied via parallel determinations using FT-IR, Raman spectroscopy and theoretical calculations. Thymine and adenine lyophilized in solutions at basic and acidic conditions showed characteristic bands of the enol-imino tautomer due to the deprotonation and the hydrochloride form due to protonation, respectively. The interaction of thymine and adenine with different seawaters representative of different geological periods on Earth was also studied. In the case of thymine a strong interaction with Sr(2+) promoted changes in the Raman and infrared spectra. For adenine changes in infrared and Raman spectra were observed in the presence of salts from all seawaters tested. The experimental results were compared to theoretical calculations, which showed structural changes due to the presence of ions Na(+), Mg(2+), Ca(2+) and Sr(2+) of artificial seawaters. For thymine the bands arising from C4=C5 and C6=O stretching were shifted to lower values, and for adenine, a new band at 1310cm(-1) was observed. The reactivity of adenine and thymine was studied by comparing changes in nucleophilicity and energy of the HOMO orbital. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Prolonged Pulmonary Exposure to Diesel Exhaust Particles Exacerbates Renal Oxidative Stress, Inflammation and DNA Damage in Mice with Adenine-Induced Chronic Renal Failure

    Directory of Open Access Journals (Sweden)

    Abderrahim Nemmar

    2016-05-01

    Full Text Available Background/Aims: Epidemiological evidence indicates that patients with chronic kidney diseases have increased susceptibility to adverse outcomes related to long-term exposure to particulate air pollution. However, mechanisms underlying these effects are not fully understood. Methods: Presently, we assessed the effect of prolonged exposure to diesel exhaust particles (DEP on chronic renal failure induced by adenine (0.25% w/w in feed for 4 weeks, which is known to involve inflammation and oxidative stress. DEP (0.5m/kg was intratracheally (i.t. instilled every 4th day for 4 weeks (7 i.t. instillation. Four days following the last exposure to either DEP or saline (control, various renal endpoints were measured. Results: While body weight was decreased, kidney weight increased in DEP+adenine versus saline+adenine or DEP. Water intake, urine volume, relative kidney weight were significantly increased in adenine+DEP versus DEP and adenine+saline versus saline. Plasma creatinine and urea increased and creatinine clearance decreased in adenine+DEP versus DEP and adenine+saline versus saline. Tumor necrosis factor α, lipid peroxidation and reactive oxygen species were significantly increased in adenine+DEP compared with either DEP or adenine+saline. The antioxidant calase was significantly decreased in adenine+DEP compared with either adenine+saline or DEP. Notably, renal DNA damage was significantly potentiated in adenine+DEP compared with either adenine+saline or DEP. Similarly, systolic blood pressure was increased in adenine+DEP versus adenine+saline or DEP, and in DEP versus saline. Histological evaluation revealed more collagen deposition, higher number of necrotic cell counts and dilated tubules, cast formation and collapsing glomeruli in adenine+DEP versus adenine+saline or DEP. Conclusion: Prolonged pulmonary exposure to diesel exhaust particles worsen renal oxidative stress, inflammation and DNA damage in mice with adenine-induced chronic

  12. Effect of 5-amino-4-imidazolecarboxamide riboside (AICA-riboside) on the purine nucleotide synthesis and growth of rat kidney cells in culture: study with [15N]aspartate.

    Science.gov (United States)

    Nissim, I; Yudkoff, M; Nissim, I; States, B

    1989-03-01

    The present investigation evaluates the effect of AICA-Riboside on the synthesis of purine nucleotides and the growth of normal rat kidney cells in culture. Experiments in the presence and absence of various concentrations of AICA-Riboside were conducted with Dulbecco's Modified Eagle's Medium supplemented with either 1 mM [15N]aspartate or [14N]aspartate. Addition of 50 microM AICA-Riboside to the incubation medium significantly stimulated intracellular adenine nucleotide concentrations following incubation for 48 hours. This stimulation was associated with augmented cell growth and DNA concentration. In contrast, with concentrations above 100 microM of AICA-Riboside in the incubation medium, there was a remarkable inhibition of cell growth and a significant depletion of intracellular pools of adenine nucleotides and DNA. Experiments with [15N]aspartate showed that the initial rate (0-24 hours) of [6-15NH2]adenine nucleotide formation from 1 mM [15N]aspartate was 38.8 +/- 9.6, 67.9 +/- 12.5, and 20.1 +/- 3.8 pmol h-1/10(6) cells in the presence of 0 (control), 50 microM and 500 microM AICA-Riboside, respectively. These observations indicate that the main effect of AICA-Riboside is on the formation of AMP from aspartate and IMP via the sequential action of adenylosuccinate synthetase and adenylosuccinate lyase. The current studies suggest that AICA-Riboside could be used as a factor mediating renal cell mitosis in culture. AICA-Riboside has a biphasic effect on the growth of renal epithelial cells in culture and on their intracellular purine nucleotides and DNA concentration.

  13. Spectral studies of lanthanide-nucleic acid component interaction: complexes of adenine, adenosine, adenosine 5'-mono-, adenosine 5'-di- and adenosine 5' tri-phosphates with praseodymium(III)

    International Nuclear Information System (INIS)

    Joseph, George; Anjaiah, K.; Misra, S.N.

    1990-01-01

    The interactions of adenine, adenosine, adenosine 5'-mono-, adenosine 5'-di-and adenosine 5'-tri-phosphates with praseodymium(III) have been studied in different stoichiometries and at varying hydrogen ion concentrations by absorption spectral studies. The sharp bands in the spectra have been individually analysed by Gaussian curve analysis, and various spectral parameters have been computed using partial and multiple regression methods on an HP-1000/45 computer. The changes in and the magnitudes of these parameters have been correlated with the degrees of outer- and inner-sphere coordination around praseodymium(III). Crystalline complexes of the type: Pr(nucleotide) 2 (H 2 O) 2 (where nucleotide = AMP, ADP and ATP) have been characterized on the basis of analytical, IR and 1 H NMR spectral data. These studies indicate that the binding of the nucleotide is through phosphoric oxygen. These complexes in aqueous medium show significant ionization which supports the observed weak 4f-4f bands, lower values of nephelauxetic effect and the parameters derived from coulombic and spin-orbit interactions. (author). 3 t abs., 28 refs

  14. Structural and Dynamic Features of the MutT Protein in the Recognition of Nucleotides with the Mutagenic 8-Oxoguanine Base*

    OpenAIRE

    Nakamura, Teruya; Meshitsuka, Sachiko; Kitagawa, Seiju; Abe, Nanase; Yamada, Junichi; Ishino, Tetsuya; Nakano, Hiroaki; Tsuzuki, Teruhisa; Doi, Takefumi; Kobayashi, Yuji; Fujii, Satoshi; Sekiguchi, Mutsuo; Yamagata, Yuriko

    2009-01-01

    Escherichia coli MutT hydrolyzes 8-oxo-dGTP to 8-oxo-dGMP, an event that can prevent the misincorporation of 8-oxoguanine opposite adenine in DNA. Of the several enzymes that recognize 8-oxoguanine, MutT exhibits high substrate specificity for 8-oxoguanine nucleotides; however, the structural basis for this specificity is unknown. The crystal structures of MutT in the apo and holo forms and in the binary and ternary forms complexed with the product 8-oxo-dGMP and 8-oxo-dGMP plus Mn2+, respect...

  15. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    The plastid genome regions of two intergenic spacers, psbA–trnH and trnL–trnF, were sequenced to study the nucleotide diversity and phylogenetic relationships among Gladiolus cultivars. Nucleotide diversity of psbA–trnH region was higher than trnL–trnF region of chloroplast. We employed Bayesian, maximum ...

  16. Expression of mitochondrial uncoupling protein 3 and adenine nucleotide translocase 1 genes in developing rat heart: putative involvement in control of mitochondrial membrane potential

    Czech Academy of Sciences Publication Activity Database

    Škárka, Libor; Bardová, Kristina; Brauner, Petr; Flachs, Pavel; Jarkovská, D.; Kopecký, Jan; Ošťádal, Bohuslav

    2003-01-01

    Roč. 35, č. 3 (2003), s. 321-330 ISSN 0022-2828 R&D Projects: GA MŠk LN00A079; GA MŠk LN00A069; GA ČR GA305/00/1659; GA MZd NE6430 Grant - others:GA UK(CZ) 56/2000; March of Dimes Birth Defects Foundation(US) 6-FY00-331 Institutional research plan: CEZ:AV0Z5011922 Keywords : development * heart * mitochondria Subject RIV: ED - Physiology Impact factor: 4.954, year: 2003

  17. Specificities and pH profiles of adenine and hypoxanthine-guanine-xanthine phosphoribosyltransferases (nucleotide synthases) of the thermoacidophile archaeon Sulfolobus solfataricus

    DEFF Research Database (Denmark)

    Hansen, Michael Riis; Jensen, Kristine Steen; Rasmussen, Mads Skytte

    2014-01-01

    Two open reading frames in the genome of Sulfolobus solfataricus (SSO2341 and SSO2424) were cloned and expressed in E. coli. The protein products were purified and their enzymatic activity characterized. Although SSO2341 was annotated as a gene (gpT-1) encoding a 6-oxopurine phosphoribosyltransfe...

  18. In vitro studies of immunoglobulin heavy-chain binding protein (BiP, GRP78). Interactions of BiP with newly synthesized proteins and adenine nucleotides

    International Nuclear Information System (INIS)

    Kassenbrock, C.K.

    1988-01-01

    Here we examine the interaction of BiP with newly synthesized polypeptides in an in vitro protein translations-translocation system. We find that BiP forms tight complexes with nonglycosylated yeast invertase and incorrectly disulfide-bonded prolactin but not with glycosylated invertase or correctly disulfide-bonded prolactin. Moreover, BiP associates detectably only with completed chains of prolactin, not with chains undergoing synthesis. We conclude that BiP recognizes and binds with high affinity to aberrantly folded or aberrantly glycosylated polypeptides in vitro, but not to all nascent chains as they are folding. BiP also binds APT and can be purified by APT affinity chromatography. We show that submicromolar levels of ATP or ADP decrease the rate of absorption of 125 I-BiP to nitrocellulose filters coated with protein or nonionic detergents. ATP and ADP also protect portions of BiP from proteolytic degradation. In contrast, micromolar levels of AMP increase the rate of adsorption and the rate of proteolytic degradation of BiP. We also show that an ATPase activity co-purifies with BiP, but its slow turnover number suggests a regulatory, rather than a functional role. The BiP-associated ATPase shares several properties with the related cytoplasmic protein, HSC70/clathrin uncoating ATPase

  19. Functional analysis of an acid adaptive DNA adenine methyltransferase from Helicobacter pylori 26695.

    Directory of Open Access Journals (Sweden)

    Arun Banerjee

    Full Text Available HP0593 DNA-(N(6-adenine-methyltransferase (HP0593 MTase is a member of a Type III restriction-modification system in Helicobacter pylori strain 26695. HP0593 MTase has been cloned, overexpressed and purified heterologously in Escherichia coli. The recognition sequence of the purified MTase was determined as 5'-GCAG-3'and the site of methylation was found to be adenine. The activity of HP0593 MTase was found to be optimal at pH 5.5. This is a unique property in context of natural adaptation of H. pylori in its acidic niche. Dot-blot assay using antibodies that react specifically with DNA containing m6A modification confirmed that HP0593 MTase is an adenine-specific MTase. HP0593 MTase occurred as both monomer and dimer in solution as determined by gel-filtration chromatography and chemical-crosslinking studies. The nonlinear dependence of methylation activity on enzyme concentration indicated that more than one molecule of enzyme was required for its activity. Analysis of initial velocity with AdoMet as a substrate showed that two molecules of AdoMet bind to HP0593 MTase, which is the first example in case of Type III MTases. Interestingly, metal ion cofactors such as Co(2+, Mn(2+, and also Mg(2+ stimulated the HP0593 MTase activity. Preincubation and isotope partitioning analyses clearly indicated that HP0593 MTase-DNA complex is catalytically competent, and suggested that DNA binds to the MTase first followed by AdoMet. HP0593 MTase shows a distributive mechanism of methylation on DNA having more than one recognition site. Considering the occurrence of GCAG sequence in the potential promoter regions of physiologically important genes in H. pylori, our results provide impetus for exploring the role of this DNA MTase in the cellular processes of H. pylori.

  20. In vitro propagation of Calla lily: adenine sulphate and 6-benzilaminopurine

    Directory of Open Access Journals (Sweden)

    Márcia De Nazaré Oliveira Ribeiro

    2014-09-01

    Full Text Available Calla lily [Zantedeschia aethiopica (L. Spreng.] belonging to the Araceae family is appreciated as cut flower and in com­position of gardens. However, the conventional propagation of this plants shows a poor productive. Thus, tissue culture besides allowing fast clonal propagation also provides healthy and uniforms plants. The aim was study the influence of the differents concentrations of 6-benzilaminopurine (BAP and adenine sulphate (AS on in vitro multiplication of Calla lily. The explants were maintained in MS medium added with BAP (0.0, 8.9, 17.8 and 26.7 μM and adenine sulphate (0, 54, 108 and 162 μM. The plants were transferred to growth room and maintained at 25±1ºC and photoperiod of 16 hours for 60 days, under luminous intensity of 35 μmol m-2 s-1, for a period of 60 days. The experimental design was entirely randomized with four repetitions of three seedlings each, resulting in twelve plants per treatment, each tube with one plant. The statistics analysis showed interactive effects for quantify of BAP and AS for leaves number and fresh mass of the aerial parts. The highest number of leaves (4.8 and fresh mass of aerial parts (0.73 g was obtained with 26.7 μM of BAP combined with 108 μM of AS, highest number of shoots (2.6 was obtained with 22,19 μM of BAP and highest lengh of sprouts (5.0 cm was observed in the absence of BAP. The addition of BAP increased the number of shoots per explant. The use of adenine sulphate in combination with BAP had a positive effect for the accumulation of fresh weight and number of leaves in vitro culture.

  1. Efficacy of Adenine in the Treatment of Leukopenia and Neutropenia Associated with an Overdose of Antipsychotics or Discontinuation of Lithium Carbonate Administration: Three Case Studies

    OpenAIRE

    Tomita, Takashi; Goto, Hidekazu; Sumiya, Kenji; Yoshida, Tadashi; Tanaka, Katsuya; Kohda, Yukinao

    2016-01-01

    Because adenine is effective for managing cases of radiation-induced and drug-induced leukopenia, it may be effective in cases of antipsychotic-induced leukopenia and neutropenia. Here, we report our experience with patients with leukopenia and neutropenia caused by an antipsychotic overdose or discontinuation of lithium carbonate, in whom adenine administration ameliorated the white blood cell and neutrophil counts. The progress of patients suggests that adenine is effective in cases of leuk...

  2. Synthesis and Characterization of Oligodeoxyribonucleotides Modified with 2'-Amino-α-l-LNA Adenine Monomers

    DEFF Research Database (Denmark)

    Andersen, Nicolai K; Anderson, Brooke A; Wengel, Jesper

    2013-01-01

    thereof. Oligonucleotides modified with these units display greatly increased affinity toward nucleic acid targets, improved binding specificity, and enhanced enzymatic stability relative to unmodified strands. Here we present the synthesis and biophysical characterization of oligodeoxyribonucleotides....... ONs modified with pyrene-functionalized 2'-amino-α-l-LNA adenine monomers X-Z display greatly increased affinity toward DNA targets (ΔTm/modification up to +14 °C). Results from absorption and fluorescence spectroscopy suggest that the duplex stabilization is a result of pyrene intercalation....... These characteristics render N2'-pyrene-functionalized 2'-amino-α-l-LNAs of considerable interest for DNA-targeting applications....

  3. No evidence for cognitive improvement from oral nicotinamide adenine dinucleotide (NADH) in dementia.

    Science.gov (United States)

    Rainer, M; Kraxberger, E; Haushofer, M; Mucke, H A; Jellinger, K A

    2000-01-01

    Reduced nicotinamide adenine dinucleotide (NADH) is advertised as an over-the-counter product or dietary supplement to treat Alzheimer's disease. We performed a 3-month open-label study with oral 10 mg/day NADH with 25 patients with mild to moderate dementia of the Alzheimer, vascular, and fronto-temporal types in addition to their current cholinomimetic drug medication. In 19 patients who completed the study, we found no evidence for any cognitive effect as defined by established psychometric tests. We conclude that NADH is unlikely to achieve cognitive improvements in an extent reported earlier, and present theoretical arguments against an effectiveness of this compound in dementia disorders.

  4. Synthesis, spectroscopic, structural and thermal characterizations of vanadyl(IV) adenine complex prospective as antidiabetic drug agent.

    Science.gov (United States)

    El-Megharbel, Samy M; Hamza, Reham Z; Refat, Moamen S

    2015-01-25

    The vanadyl(IV) adenine complex; [VO(Adn)2]⋅SO4; was synthesized and characterized. The molar conductivity of this complex was measured in DMSO solution that showed an electrolyte nature. Spectroscopic investigation of the green solid complex studied here indicate that the adenine acts as a bidentate ligand, coordinated to vanadyl(IV) ions through the nitrogen atoms N7 and nitrogen atom of amino group. Thus, from the results presented the vanadyl(IV) complex has square pyramid geometry. Further characterizations using thermal analyses and scanning electron techniques was useful. The aim of this paper was to introduce a new drug model for the diabetic complications by synthesized a novel mononuclear vanadyl(IV) adenine complex to mimic insulin action and reducing blood sugar level. The antidiabetic ability of this complex was investigated in STZ-induced diabetic mice. The results suggested that VO(IV)/adenine complex has antidiabetic activity, it improved the lipid profile, it improved liver and kidney functions, also it ameliorated insulin hormone and blood glucose levels. The vanadyl(IV) complex possesses an antioxidant activity and this was clear through studying SOD, CAT, MDA, GSH and methionine synthase. The current results support the therapeutic potentiality of vanadyl(IV)/adenine complex for the management and treatment of diabetes. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Comparative study between transcriptionally- and translationally-acting adenine riboswitches reveals key differences in riboswitch regulatory mechanisms.

    Directory of Open Access Journals (Sweden)

    Jean-François Lemay

    2011-01-01

    Full Text Available Many bacterial mRNAs are regulated at the transcriptional or translational level by ligand-binding elements called riboswitches. Although they both bind adenine, the adenine riboswitches of Bacillus subtilis and Vibrio vulnificus differ by controlling transcription and translation, respectively. Here, we demonstrate that, beyond the obvious difference in transcriptional and translational modulation, both adenine riboswitches exhibit different ligand binding properties and appear to operate under different regulation regimes (kinetic versus thermodynamic. While the B. subtilis pbuE riboswitch fully depends on co-transcriptional binding of adenine to function, the V. vulnificus add riboswitch can bind to adenine after transcription is completed and still perform translation regulation. Further investigation demonstrates that the rate of transcription is critical for the B. subtilis pbuE riboswitch to perform efficiently, which is in agreement with a co-transcriptional regulation. Our results suggest that the nature of gene regulation control, that is transcription or translation, may have a high importance in riboswitch regulatory mechanisms.

  6. Synthesis, spectroscopic, structural and thermal characterizations of vanadyl(IV) adenine complex prospective as antidiabetic drug agent

    Science.gov (United States)

    El-Megharbel, Samy M.; Hamza, Reham Z.; Refat, Moamen S.

    2015-01-01

    The vanadyl(IV) adenine complex; [VO(Adn)2]ṡSO4; was synthesized and characterized. The molar conductivity of this complex was measured in DMSO solution that showed an electrolyte nature. Spectroscopic investigation of the green solid complex studied here indicate that the adenine acts as a bidentate ligand, coordinated to vanadyl(IV) ions through the nitrogen atoms N7 and nitrogen atom of amino group. Thus, from the results presented the vanadyl(IV) complex has square pyramid geometry. Further characterizations using thermal analyses and scanning electron techniques was useful. The aim of this paper was to introduce a new drug model for the diabetic complications by synthesized a novel mononuclear vanadyl(IV) adenine complex to mimic insulin action and reducing blood sugar level. The antidiabetic ability of this complex was investigated in STZ-induced diabetic mice. The results suggested that VO(IV)/adenine complex has antidiabetic activity, it improved the lipid profile, it improved liver and kidney functions, also it ameliorated insulin hormone and blood glucose levels. The vanadyl(IV) complex possesses an antioxidant activity and this was clear through studying SOD, CAT, MDA, GSH and methionine synthase. The current results support the therapeutic potentiality of vanadyl(IV)/adenine complex for the management and treatment of diabetes.

  7. Structural and dynamic features of the MutT protein in the recognition of nucleotides with the mutagenic 8-oxoguanine base.

    Science.gov (United States)

    Nakamura, Teruya; Meshitsuka, Sachiko; Kitagawa, Seiju; Abe, Nanase; Yamada, Junichi; Ishino, Tetsuya; Nakano, Hiroaki; Tsuzuki, Teruhisa; Doi, Takefumi; Kobayashi, Yuji; Fujii, Satoshi; Sekiguchi, Mutsuo; Yamagata, Yuriko

    2010-01-01

    Escherichia coli MutT hydrolyzes 8-oxo-dGTP to 8-oxo-dGMP, an event that can prevent the misincorporation of 8-oxoguanine opposite adenine in DNA. Of the several enzymes that recognize 8-oxoguanine, MutT exhibits high substrate specificity for 8-oxoguanine nucleotides; however, the structural basis for this specificity is unknown. The crystal structures of MutT in the apo and holo forms and in the binary and ternary forms complexed with the product 8-oxo-dGMP and 8-oxo-dGMP plus Mn(2+), respectively, were determined. MutT strictly recognizes the overall conformation of 8-oxo-dGMP through a number of hydrogen bonds. This recognition mode revealed that 8-oxoguanine nucleotides are discriminated from guanine nucleotides by not only the hydrogen bond between the N7-H and Odelta (N119) atoms but also by the syn glycosidic conformation that 8-oxoguanine nucleotides prefer. Nevertheless, these discrimination factors cannot by themselves explain the roughly 34,000-fold difference between the affinity of MutT for 8-oxo-dGMP and dGMP. When the binary complex of MutT with 8-oxo-dGMP is compared with the ligand-free form, ordering and considerable movement of the flexible loops surrounding 8-oxo-dGMP in the binary complex are observed. These results indicate that MutT specifically recognizes 8-oxoguanine nucleotides by the ligand-induced conformational change.

  8. Structural and Dynamic Features of the MutT Protein in the Recognition of Nucleotides with the Mutagenic 8-Oxoguanine Base*

    Science.gov (United States)

    Nakamura, Teruya; Meshitsuka, Sachiko; Kitagawa, Seiju; Abe, Nanase; Yamada, Junichi; Ishino, Tetsuya; Nakano, Hiroaki; Tsuzuki, Teruhisa; Doi, Takefumi; Kobayashi, Yuji; Fujii, Satoshi; Sekiguchi, Mutsuo; Yamagata, Yuriko

    2010-01-01

    Escherichia coli MutT hydrolyzes 8-oxo-dGTP to 8-oxo-dGMP, an event that can prevent the misincorporation of 8-oxoguanine opposite adenine in DNA. Of the several enzymes that recognize 8-oxoguanine, MutT exhibits high substrate specificity for 8-oxoguanine nucleotides; however, the structural basis for this specificity is unknown. The crystal structures of MutT in the apo and holo forms and in the binary and ternary forms complexed with the product 8-oxo-dGMP and 8-oxo-dGMP plus Mn2+, respectively, were determined. MutT strictly recognizes the overall conformation of 8-oxo-dGMP through a number of hydrogen bonds. This recognition mode revealed that 8-oxoguanine nucleotides are discriminated from guanine nucleotides by not only the hydrogen bond between the N7-H and Oδ (N119) atoms but also by the syn glycosidic conformation that 8-oxoguanine nucleotides prefer. Nevertheless, these discrimination factors cannot by themselves explain the roughly 34,000-fold difference between the affinity of MutT for 8-oxo-dGMP and dGMP. When the binary complex of MutT with 8-oxo-dGMP is compared with the ligand-free form, ordering and considerable movement of the flexible loops surrounding 8-oxo-dGMP in the binary complex are observed. These results indicate that MutT specifically recognizes 8-oxoguanine nucleotides by the ligand-induced conformational change. PMID:19864691

  9. The chemistry of nicotinamide adenine dinucleotide (NAD) analogues containing C-nucleosides related to nicotinamide riboside.

    Science.gov (United States)

    Pankiewicz, Krzysztof W; Watanabe, Kyoichi A; Lesiak-Watanabe, Krystyna; Goldstein, Barry M; Jayaram, Hiremagalur N

    2002-04-01

    Oncolytic C-nucleosides, tiazofurin (2-beta-D-ribofuranosylthiazole-4-carboxamide) and benzamide riboside (3-beta-D-ribofuranosylbenzamide) are converted in cell into active metabolites thiazole-4-carboxamide- and benzamide adenine dinucleotide, TAD and BAD, respectively. TAD and BAD as NAD analogues were found to bind at the nicotinamide adenine dinucleotide (cofactor NAD) site of inosine monophosphate dehydrogenase (IMPDH), an important target in cancer treatment. The synthesis and evaluation of anticancer activity of a number of C-nucleosides related to tiazofurin and nicotinamide riboside then followed and are reviewed herein. Interestingly, pyridine C-nucleosides (such as C-nicotinamide riboside) are not metabolized into the corresponding NAD analogues in cell. Their conversion by chemical methods is described. As dinucleotides these compounds show inhibition of IMPDH in low micromolar level. Also, the synthesis of BAD in metabolically stable bis(phosphonate) form is discussed indicating the usefulness of such preformed inhibitors in drug development. Among tiazofurin analogues, Franchetti and Grifantini found, that the replacement of the sulfur by oxygen (as in oxazafurin) but not the removal of nitrogen (tiophenfurin) of the thiazole ring resulted in inactive compounds. The anti cancer activity of their synthetic dinucleotide analogues indicate that inactive compounds are not only poorly metabolized in cell but also are weak inhibitors of IMPDH as dinucleotides.

  10. Role of Hydrogen Bonding in the Formation of Adenine Chains on Cu(110 Surfaces

    Directory of Open Access Journals (Sweden)

    Lanxia Cheng

    2016-12-01

    Full Text Available Understanding the adsorption properties of DNA bases on metal surfaces is fundamental for the rational control of surface functionalization leading to the realisation of biocompatible devices for biosensing applications, such as monitoring of particular parameters within bio-organic environments and drug delivery. In this study, the effects of deposition rate and substrate temperature on the adsorption behavior of adenine on Cu(110 surfaces have been investigated using scanning tunneling microscopy (STM and density functional theory (DFT modeling, with a focus on the characterization of the morphology of the adsorbed layers. STM results revealed the formation of one-dimensional linear chains and ladder-like chains parallel to the [110] direction, when dosing at a low deposition rate at room temperature, followed by annealing to 490 K. Two mirror related, well-ordered chiral domains oriented at ±55° with respect to the [110] direction are formed upon deposition on a substrate kept at 490 K. The molecular structures observed via STM are rationalized and qualitatively described on the basis of the DFT modeling. The observation of a variety of ad-layer structures influenced by deposition rate and substrate temperature indicates that dynamic processes and hydrogen bonding play an important role in the self-assembly of adenine on the Cu(110 surface.

  11. Microwave-assisted stereospecific synthesis of novel tetrahydropyran adenine isonucleosides and crystal structures determination

    Science.gov (United States)

    Silva, Fábio P. L.; Cirqueira, Marilia L.; Martins, Felipe T.; Vasconcellos, Mário L. A. A.

    2013-11-01

    We describe in this article stereospecific syntheses for new isonucleosides analogs of adenine 5-7 from tosyl derivatives 2-4 accessing by microwave irradiations (50-80%). The adenine reacts entirely at the N(9) position. Compounds 2-4 were prepared in two steps from the corresponding alcohols 1, 8 and 9 (81-92%). These tetrahydropyrans alcohols 1, 8 and 9 are achiral (Meso compounds) and were prepared in two steps with complete control of 2,4,6-cis relative configuration by Prins cyclization reaction (60-63%) preceded by the Barbier reaction between allyl bromide with benzaldehyde, 4-fluorobenzaldehyde and 2-naphthaldehyde respectively under Lewis acid conditions (96-98%). The configurations and preferential conformations of 5-7 were determined by crystal structure of 6. These novel isonucleosides 5-7 present in silico potentiality to act as GPCR ligand, kinase inhibitor and enzyme inhibitor, evaluated by Molinspiration program, consistent with the expected antiviral and anticancer bioactivities.

  12. DNA adenine methylation modulates pathogenicity of Klebsiella pneumoniae genotype K1.

    Science.gov (United States)

    Fang, Chi-Tai; Yi, Wen-Ching; Shun, Chia-Tung; Tsai, Shih-Feng

    2017-08-01

    Klebsiella pneumoniae genotype K1 is a highly virulent pathogen that causes liver abscess and metastatic endophthalmitis/meningitis. Whether its pathogenicity is controlled by DNA adenine methylase (Dam), an epigenetic regulator of bacterial virulence gene expression, is yet unknown. We aimed to study the role of DNA adenine methylation in the pathogenicity of K. pneumoniae genotype K1. We identified the dam gene in the prototype tissue-invasive strain (NTUH-K2044) of K. pneumoniae genotype K1, using the strain's complete genome sequence in GenBank. We constructed a dam - mutant and compared it with the wild type, in terms of in vitro serum resistance and in vivo BALB/cByl mice inoculation. Loss of Dam activity in the mutant was verified by MboI restriction digestion of the genomic DNA and a 1000-fold increase in spontaneous mutation rate. The dam mutant lost at least 68% of serum resistance when compared with the wild type (survival ratio at 1 hour: 2.6 ± 0.4 vs. 8.2 ± 1.9; at 2 hours: 3.9 ± 1.6 vs. 17.4 ± 3.6; p values pneumoniae genotype K1. The incomplete attenuation indicates the existence of other regulatory factors. Copyright © 2015. Published by Elsevier B.V.

  13. The international nucleotide sequence database collaboration.

    Science.gov (United States)

    Karsch-Mizrachi, Ilene; Takagi, Toshihisa; Cochrane, Guy

    2018-01-04

    For more than 30 years, the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org/) has been committed to capturing, preserving and providing access to comprehensive public domain nucleotide sequence and associated metadata which enables discovery in biomedicine, biodiversity and biological sciences. Since 1987, the DNA Data Bank of Japan (DDBJ) at the National Institute for Genetics in Mishima, Japan; the European Nucleotide Archive (ENA) at the European Molecular Biology Laboratory's European Bioinformatics Institute (EMBL-EBI) in Hinxton, UK; and GenBank at National Center for Biotechnology Information (NCBI), National Library of Medicine, National Institutes of Health in Bethesda, Maryland, USA have worked collaboratively to enable access to nucleotide sequence data in standardized formats for the worldwide scientific community. In this article, we reiterate the principles of the INSDC collaboration and briefly summarize the trends of the archival content. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

  14. Nucleotide excision repair in the test tube.

    NARCIS (Netherlands)

    N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)

    1995-01-01

    textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

  15. Ab initio electron propagator calculations of transverse conduction through DNA nucleotide bases in 1-nm nanopore corroborate third generation sequencing.

    Science.gov (United States)

    Kletsov, Aleksey A; Glukhovskoy, Evgeny G; Chumakov, Aleksey S; Ortiz, Joseph V

    2016-01-01

    The conduction properties of DNA molecule, particularly its transverse conductance (electron transfer through nucleotide bridges), represent a point of interest for DNA chemistry community, especially for DNA sequencing. However, there is no fully developed first-principles theory for molecular conductance and current that allows one to analyze the transverse flow of electrical charge through a nucleotide base. We theoretically investigate the transverse electron transport through all four DNA nucleotide bases by implementing an unbiased ab initio theoretical approach, namely, the electron propagator theory. The electrical conductance and current through DNA nucleobases (guanine [G], cytosine [C], adenine [A] and thymine [T]) inserted into a model 1-nm Ag-Ag nanogap are calculated. The magnitudes of the calculated conductance and current are ordered in the following hierarchies: gA>gG>gC>gT and IG>IA>IT>IC correspondingly. The new distinguishing parameter for the nucleobase identification is proposed, namely, the onset bias magnitude. Nucleobases exhibit the following hierarchy with respect to this parameter: Vonset(A)DNA translocation through an electrode-equipped nanopore. The results represent interest for the theorists and practitioners in the field of third generation sequencing techniques as well as in the field of DNA chemistry. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Effects of nucleotides and nucleosides on coagulation

    DEFF Research Database (Denmark)

    Bune, Laurids; Thaning, Pia; Johansson, Pär I

    2010-01-01

    Nucleotides, including ADP, ATP and uridine triphosphate (UTP), are discharged profusely in the circulation during many pathological conditions including sepsis. Sepsis can cause hypotension and systemic activation of the coagulation and fibrinolytic systems in humans, which may cause disseminated...... intravascular coagulation. We investigated whether nucleotide-induced cardiovascular collapse as provoked by systemic infusion of adenosine, ADP, ATP, UTP and nitric oxide affected the haemostatic system as assessed by whole blood thromboelastography (TEG) analysis. Ten pigs received a randomized infusion...

  17. Pyridine nucleotide cycling and control of intracellular redox state in relation to poly (ADP-ribose) polymerase activity and nuclear localization of glutathione during exponential growth of Arabidopsis cells in culture.

    Science.gov (United States)

    Pellny, Till K; Locato, Vittoria; Vivancos, Pedro Diaz; Markovic, Jelena; De Gara, Laura; Pallardó, Federico V; Foyer, Christine H

    2009-05-01

    Pyridine nucleotides, ascorbate and glutathione are major redox metabolites in plant cells, with specific roles in cellular redox homeostasis and the regulation of the cell cycle. However, the regulation of these metabolite pools during exponential growth and their precise functions in the cell cycle remain to be characterized. The present analysis of the abundance of ascorbate, glutathione, and pyridine nucleotides during exponential growth of Arabidopsis cells in culture provides evidence for the differential regulation of each of these redox pools. Ascorbate was most abundant early in the growth cycle, but glutathione was low at this point. The cellular ascorbate to dehydroascorbate and reduced glutathione (GSH) to glutathione disulphide ratios were high and constant but the pyridine nucleotide pools were largely oxidized over the period of exponential growth and only became more reduced once growth had ceased. The glutathione pool increased in parallel with poly (ADP-ribose) polymerase (PARP) activities and with increases in the abundance of PARP1 and PARP2 mRNAs at a time of high cell cycle activity as indicated by transcriptome information. Marked changes in the intracellular partitioning of GSH between the cytoplasm and nucleus were observed. Extension of the exponential growth phase by dilution or changing the media led to increases in the glutathione and nicotinamide adenine dinucleotide, oxidized form (NAD)-plus-nicotinamide adenine dinucleotide, reduced form (NADH) pools and to higher NAD/NADH ratios but the nicotinamide adenine dinucleotide phosphate, oxidized form (NADP)-plus-nicotinamide adenine dinucleotide phosphate, reduced form (NADPH) pool sizes, and NAPD/NADPH ratios were much less affected. The ascorbate, glutathione, and pyridine nucleotide pools and PARP activity decreased before the exponential growth phase ended. We conclude that there are marked changes in intracellular redox state during the growth cycle but that redox homeostasis is

  18. On the existence of the H3 tautomer of adenine in aqueous solution. Rationalizations based on hybrid quantum mechanics/molecular mechanics predictions

    DEFF Research Database (Denmark)

    Aidas, Kestutis; Mikkelsen, Kurt V; Kongsted, Jacob

    2010-01-01

    The (15)N NMR spectrum of adenine in aqueous solution has been modeled using high-level combined density functional theory/molecular mechanics techniques coupled to a dynamical averaging scheme. The explicit consideration of the three lowest-energy tautomers of adenine-H9, H7 and H3-allows for a ...

  19. Modeling the high-energy electronic state manifold of adenine: Calibration for nonlinear electronic spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Nenov, Artur, E-mail: Artur.Nenov@unibo.it; Giussani, Angelo; Segarra-Martí, Javier; Jaiswal, Vishal K. [Dipartimento di Chimica “G. Ciamician,” Università di Bologna, Via Selmi 2, IT-40126 Bologna (Italy); Rivalta, Ivan [Université de Lyon, CNRS, Institut de Chimie de Lyon, École Normale Supérieure de Lyon, 46 Allée d’Italie, F-69364 Lyon Cedex 07 (France); Cerullo, Giulio [Dipartimento di Fisica, Politecnico di Milano, IFN-CNR, Piazza Leonardo Da Vinci 32, IT-20133 Milano (Italy); Mukamel, Shaul [Department of Chemistry, University of California, Irvine, California 92697-2025 (United States); Garavelli, Marco, E-mail: marco.garavelli@unibo.it, E-mail: marco.garavelli@ens-lyon.fr [Dipartimento di Chimica “G. Ciamician,” Università di Bologna, Via Selmi 2, IT-40126 Bologna (Italy); Université de Lyon, CNRS, Institut de Chimie de Lyon, École Normale Supérieure de Lyon, 46 Allée d’Italie, F-69364 Lyon Cedex 07 (France)

    2015-06-07

    Pump-probe electronic spectroscopy using femtosecond laser pulses has evolved into a standard tool for tracking ultrafast excited state dynamics. Its two-dimensional (2D) counterpart is becoming an increasingly available and promising technique for resolving many of the limitations of pump-probe caused by spectral congestion. The ability to simulate pump-probe and 2D spectra from ab initio computations would allow one to link mechanistic observables like molecular motions and the making/breaking of chemical bonds to experimental observables like excited state lifetimes and quantum yields. From a theoretical standpoint, the characterization of the electronic transitions in the visible (Vis)/ultraviolet (UV), which are excited via the interaction of a molecular system with the incoming pump/probe pulses, translates into the determination of a computationally challenging number of excited states (going over 100) even for small/medium sized systems. A protocol is therefore required to evaluate the fluctuations of spectral properties like transition energies and dipole moments as a function of the computational parameters and to estimate the effect of these fluctuations on the transient spectral appearance. In the present contribution such a protocol is presented within the framework of complete and restricted active space self-consistent field theory and its second-order perturbation theory extensions. The electronic excited states of adenine have been carefully characterized through a previously presented computational recipe [Nenov et al., Comput. Theor. Chem. 1040–1041, 295-303 (2014)]. A wise reduction of the level of theory has then been performed in order to obtain a computationally less demanding approach that is still able to reproduce the characteristic features of the reference data. Foreseeing the potentiality of 2D electronic spectroscopy to track polynucleotide ground and excited state dynamics, and in particular its expected ability to provide

  20. Modeling the high-energy electronic state manifold of adenine: Calibration for nonlinear electronic spectroscopy

    Science.gov (United States)

    Nenov, Artur; Giussani, Angelo; Segarra-Martí, Javier; Jaiswal, Vishal K.; Rivalta, Ivan; Cerullo, Giulio; Mukamel, Shaul; Garavelli, Marco

    2015-06-01

    Pump-probe electronic spectroscopy using femtosecond laser pulses has evolved into a standard tool for tracking ultrafast excited state dynamics. Its two-dimensional (2D) counterpart is becoming an increasingly available and promising technique for resolving many of the limitations of pump-probe caused by spectral congestion. The ability to simulate pump-probe and 2D spectra from ab initio computations would allow one to link mechanistic observables like molecular motions and the making/breaking of chemical bonds to experimental observables like excited state lifetimes and quantum yields. From a theoretical standpoint, the characterization of the electronic transitions in the visible (Vis)/ultraviolet (UV), which are excited via the interaction of a molecular system with the incoming pump/probe pulses, translates into the determination of a computationally challenging number of excited states (going over 100) even for small/medium sized systems. A protocol is therefore required to evaluate the fluctuations of spectral properties like transition energies and dipole moments as a function of the computational parameters and to estimate the effect of these fluctuations on the transient spectral appearance. In the present contribution such a protocol is presented within the framework of complete and restricted active space self-consistent field theory and its second-order perturbation theory extensions. The electronic excited states of adenine have been carefully characterized through a previously presented computational recipe [Nenov et al., Comput. Theor. Chem. 1040-1041, 295-303 (2014)]. A wise reduction of the level of theory has then been performed in order to obtain a computationally less demanding approach that is still able to reproduce the characteristic features of the reference data. Foreseeing the potentiality of 2D electronic spectroscopy to track polynucleotide ground and excited state dynamics, and in particular its expected ability to provide

  1. Polymerization of amino acids containing nucleotide bases

    Science.gov (United States)

    Ben Cheikh, Azzouz; Orgel, Leslie E.

    1990-01-01

    The nucleoamino acids 1-(3'-amino,3'-carboxypropyl)uracil (3) and 9-(3'-amino,3'-carboxypropyl)adenine (4) have been prepared as (L)-en-antiomers and as racemic mixtures. When 3 or 4 is suspended in water and treated with N,N'-carbon-yldiimidazole, peptides are formed in good yield. The products formed from the (L)-enantiomers are hydrolyzed to the monomeric amino acids by pronase. Attempts to improve the efficiency of these oligomerizations by including a polyuridylate template in the reaction mixture were not successful. Similarly, oligomers derived from the (L)-enantiomer of 3 did not act as templates to facilitate the oligomerization of 4.

  2. Animal models of pediatric chronic kidney disease. Is adenine intake an appropriate model?

    Directory of Open Access Journals (Sweden)

    Débora Claramunt

    2015-11-01

    Full Text Available Pediatric chronic kidney disease (CKD has peculiar features. In particular, growth impairment is a major clinical manifestation of CKD that debuts in pediatric age because it presents in a large proportion of infants and children with CKD and has a profound impact on the self-esteem and social integration of the stunted patients. Several factors associated with CKD may lead to growth retardation by interfering with the normal physiology of growth plate, the organ where longitudinal growth rate takes place. The study of growth plate is hardly possible in humans and justifies the use of animal models. Young rats made uremic by 5/6 nephrectomy have been widely used as a model to investigate growth retardation in CKD. This article examines the characteristics of this model and analyzes the utilization of CKD induced by high adenine diet as an alternative research protocol.

  3. Structural study and investigation of NMR tensors in interaction of dopamine with Adenine and guanine

    Directory of Open Access Journals (Sweden)

    Lingjia Xu

    2007-04-01

    Full Text Available The interaction of dopamine with adenine and guanine were studied at the Hartree-Fock level theory. The structural and vibrational properties of dopamine-4-N7GUA and dopamine-4-N3ADE were studied at level of HF/6-31G*. Interaction energies (ΔE were calculated to be -11.49 and -11.92 kcal/mol, respectively. Some of bond lengths, angels and tortions are compared. NBO studies were performed to the second-order and perturbative estimates of donor-acceptor interaction have been done. The procedures of gauge-invariant atomic orbital (GIAO and continuous-set-of-gauge-transformation (CSGT were employed to calculate isotropic shielding, chemical shifts anisotropy and chemical shifts anisotropy asymmetry and effective anisotropy using 6-31G* basis set. These calculations yielded molecular geometries in good agreement with available experimental data.

  4. Metal-adeninate vertices for the construction of an exceptionally porous metal-organic framework.

    Science.gov (United States)

    An, Jihyun; Farha, Omar K; Hupp, Joseph T; Pohl, Ehmke; Yeh, Joanne I; Rosi, Nathaniel L

    2012-01-03

    Metal-organic frameworks comprising metal-carboxylate cluster vertices and long, branched organic linkers are the most porous materials known, and therefore have attracted tremendous attention for many applications, including gas storage, separations, catalysis and drug delivery. To increase metal-organic framework porosity, the size and complexity of linkers has increased. Here we present a promising alternative strategy for constructing mesoporous metal-organic frameworks that addresses the size of the vertex rather than the length of the organic linker. This approach uses large metal-biomolecule clusters, in particular zinc-adeninate building units, as vertices to construct bio-MOF-100, an exclusively mesoporous metal-organic framework. Bio-MOF-100 exhibits a high surface area (4,300 m(2) g(-1)), one of the lowest crystal densities (0.302 g cm(-3)) and the largest metal-organic framework pore volume reported to date (4.3 cm(3) g(-1)).

  5. Synthesis and enzymatic incorporation of α-L-threofuranosyl adenine triphosphate (tATP).

    Science.gov (United States)

    Zhang, Su; Chaput, John C

    2013-03-01

    Threose nucleic acid (TNA) is an artificial genetic polymer in which the natural ribose sugar found in RNA has been replaced with an unnatural threose sugar. TNA can be synthesized enzymatically using Therminator DNA polymerase to copy DNA templates into TNA. Here, we expand the substrate repertoire of Therminator DNA polymerase to include threofuranosyl adenine 3'-triphsophate (tATP). We chemically synthesized tATP by two different methods from the 2'-O-acetyl derivative. Enzyme-mediated polymerization reveals that tATP functions as an efficient substrate for Therminator DNA polymerase, indicating that tATP can replace the diaminopurine analogue (tDTP) in TNA transcription reactions. Copyright © 2012 Elsevier Ltd. All rights reserved.

  6. Conducting polymer and its composite materials based electrochemical sensor for Nicotinamide Adenine Dinucleotide (NADH).

    Science.gov (United States)

    Omar, Fatin Saiha; Duraisamy, Navaneethan; Ramesh, K; Ramesh, S

    2016-05-15

    Nicotinamide Adenine Dinucleotide (NADH) is an important coenzyme in the human body that participates in many metabolic reactions. The impact of abnormal concentrations of NADH significantly causes different diseases in human body. Electrochemical detection of NADH using bare electrode is a challenging task especially in the presence of main electroactive interferences such as ascorbic acid (AA), uric acid (UA) and dopamine (DA). Modified electrodes have been widely explored to overcome the problems of poor sensitivity and selectivity occurred from bare electrodes. This review gives an overview on the progress of using conducting polymers, polyelectrolyte and its composites (co-polymer, carbonaceous, metal, metal oxide and clay) based modified electrodes for the sensing of NADH. In addition, developments on the fabrication of numerous conducting polymer composites based modified electrodes are clearly described. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Isotope effect studies of the chemical mechanism of nicotinamide adenine dinucleotide malic enzyme from Crassula

    International Nuclear Information System (INIS)

    Grissom, C.B.; Willeford, O.; Wedding, R.T.

    1987-01-01

    The 13 C primary kinetic isotope effect on the decarboxylation of malate by nicotinamide adenine dinucleotide malic enzyme from Crassula argentea is 1.0199 +/- 0.0006 with proteo L-malate-2-H and 1.0162 +/- 0.0003 with malate-2-d. The primary deuterium isotope effect is 1.45 +/- 0.10 on V/K and 1.93 +/- 0.13 on V/sub max/. This indicates a stepwise conversion of malate to pyruvate and CO 2 with hydride transfer preceding decarboxylation, thereby suggesting a discrete oxaloacetate intermediate. This is in agreement with the stepwise nature of the chemical mechanism of other malic enzymes despite the Crassula enzyme's inability to reduce or decarboxylate oxaloacetate. Differences in morphology and allosteric regulation between enzymes suggest specialization of the Crassula malic enzyme for the physiology of crassulacean and acid metabolism while maintaining the catalytic events founds in malic enzymes from animal sources

  8. Electrochemical behaviors and simultaneous determination of guanine and adenine based on graphene–ionic liquid–chitosan composite film modified glassy carbon electrode

    International Nuclear Information System (INIS)

    Niu Xiuli; Yang Wu; Ren Jie; Guo Hao; Long Shijia; Chen Jiaojiao; Gao Jinzhang

    2012-01-01

    Highlights: ► This work developed a novel electrochemical biosensors for guanine and adenine detection simultaneously. ► A disposable electrode based on graphene sheets, ionic liquid and chitosan was proposed. ► The presented method was also applied to simultaneous determination of guanine and adenine in denatured DNA samples with satisfying results. ► Easy fabrication, high sensitivity, excellent reproducibility and long-term stability. - Abstract: A graphene sheets (GS), ionic liquid (IL) and chitosan (CS) modified electrode was fabricated and the modified electrode displayed excellent electrochemical catalytic activities toward guanine and adenine. The transfer electron number (n) and the charge transfer coefficient (α) were calculated with the result as n = 2, α = 0.58 for guanine, and n = 2, α = 0.51 for adenine, which indicated the electrochemical oxidation of guanine and adenine on GS/IL/CS modified electrode was a two-electron and two-proton process. The oxidation overpotentials of guanine and adenine were decreased significantly compared with those obtained at the bare glassy carbon electrode and multi-walled carbon nanotubes modified electrode. The modified electrode exhibited good analytical performance and was successfully applied for individual and simultaneous determination of guanine and adenine. Low detection limits of 0.75 μM for guanine and 0.45 μM for adenine were obtained, with the linear calibration curves over the concentration range 2.5–150 μM and 1.5–350 μM, respectively. At the same time, the proposed method was successfully applied for the determination of guanine and adenine in denatured DNA samples with satisfying results. Moreover, the GS/IL/CS modified electrode exhibited good sensitivity, long-term stability and reproducibility for the determination of guanine and adenine.

  9. Proofreading of misincorporated nucleotides in DNA transcription

    International Nuclear Information System (INIS)

    Voliotis, Margaritis; Liverpool, Tanniemola B; Cohen, Netta; Molina-París, Carmen

    2012-01-01

    The accuracy of DNA transcription is crucial for the proper functioning of the cell. Although RNA polymerases demonstrate selectivity for correct nucleotides, additional active mechanisms of transcriptional error correction are required to achieve observed levels of fidelity. Recent experimental findings have shed light on a particular mechanism of transcriptional error correction involving: (i) diffusive translocation of the RNA polymerase along the DNA (backtracking) and (ii) irreversible RNA cleavage. This mechanism achieves preferential cleavage of misincorporated nucleotides by biasing the local rates of translocation. Here, we study how misincorporated nucleotides affect backtracking dynamics and how this effect determines the level of transcriptional fidelity. We consider backtracking as a diffusive process in a periodic, one-dimensional energy landscape, which at a coarse-grained level gives rise to a hopping process between neighbouring local minima. We propose a model for how misincorporated nucleotides deform this energy landscape and hence affect the hopping rates. In particular, we show that this model can be used to derive both the theoretical limit on the fidelity (i.e. the minimum fraction of misincorporated nucleotides) and the actual fidelity relative to this optimum, achieved for specific combinations of the cleavage and polymerization rates. Finally, we study how external factors influencing backtracking dynamics affect transcriptional fidelity. We show that biologically relevant loads, similar to those exerted by nucleosomes or other transcriptional barriers, increase error correction. (paper)

  10. Effect of adenine on bacterial translocation using technetium-99m labeled E. coli in an intestinal obstruction model in rats

    International Nuclear Information System (INIS)

    Ugur Oflaz; Fatma Yurt Lambrecht; Osman Yilmaz; Cetin Pekcetin

    2013-01-01

    This study aims to investigate effects of adenine on bacterial translocation (BT) using 99m Tc-labeled E. coli in an intestinal obstruction rat model. In the study twenty-one rats were used. The rats were divided into three groups according to different feeding patterns. The control group (CG) was fed with a standard chow diet for 7 days. Group A1 and group A2 were fed with adenine supplemented chow diet for 7 days. At the end of the feeding period, after all groups was submitted intestinal obstruction. 99m Tc-E. coli was injected into the rats' terminal ileum under anesthetic. The rats were sacrificed under aseptic conditions at 24th h after the surgery. The uptake of 99m Tc-E. coli was determined in organs such as the liver, mesenteric lymph nodes, spleen and ileum. Group A1 and group A2 results show that the uptake of 99m Tc-E. coli decreased in the blood and organs comparing to the CG. As a result, it was observed that adenine reduced the level of BT when compared with CG. The beneficial effect of adenine on BT in intestinal obstruction was observed. However, further studies are needed to more clearly assess how this benefit can be achieved. (author)

  11. The incorporation of 14C-adenine into the oocytes of Asellus aquaticus as studied by autoradiography

    NARCIS (Netherlands)

    Broek, C.J.H. van den; Tates, A.D.

    Asellus aquaticus females were injected with 8-14C-adenine, fixed after 3 hours and sectioned. In coated autoradiographs, the number of β-tracks from 14C were counted over nucleolus, nucleus and cytoplasm of the oocytes at various stages of their development. Incorporation into nucleolar RNA, being

  12. Nicotinamide adenine dinucleotide assisted shape-controlled synthesis of catalytically active raspberry-like gold nanostructures

    International Nuclear Information System (INIS)

    Das, Ashok Kumar; Layek, Rama K.; Kim, Nam Hoon; Samdani, Jitendra; Kang, Myung Chul; Lee, Joong Hee

    2015-01-01

    Graphical abstract: A facile method was developed for the synthesis of raspberry-like Au nanostructure and it was used as an electrocatalyst for the oxidation of methanol and reduction of oxygen. - Highlights: • Raspberry-like gold nanostructures have been synthesized. • Nicotinamide adenine dinucleotide plays an important role in the synthesis. • Raspberry-like Au nanostructure has an excellent electrocatalytic activity in methanol oxidation and oxygen reduction. - Abstract: We describe the shape-controlled growth of raspberry-like gold (Au) nanostructures and their application in the electrochemical oxidation of methanol and reduction of oxygen. Nicotinamide adenine dinucleotide (NAD + ) plays a vital role in the growth of raspberry-like Au nanostructures. The preferential adsorption of NAD + onto the (011) facets of Au favors the growth of raspberry-like morphology. In the absence of NAD + , icosahedral Au nanostructures were obtained. The raspberry-like Au nanostructures have been characterized by UV-visible spectroscopy, X-ray diffraction (XRD), field emission scanning electron microscopy (FESEM), and electrochemical measurements. The FESEM image shows that the raspberry-like morphology has an average size of 170 nm. The spectral profile shows a broad band between 650 and 795 nm. Compared to Au nanoseeds and icosahedral Au nanostructures that were grown in the absence of NAD + , the raspberry-like morphology has excellent catalytic activity towards the electrochemical oxidation of methanol and reduction of oxygen. On the raspberry-like nanoparticle-based electrode, the oxidation of methanol was observed at 0.35 V in alkaline pH, and the reduction of oxygen was observed at -0.06 and -0.4 V in 0.1 M PBS. The electrochemical reduction of oxygen occurs in two steps: (i) reduction of oxygen to H 2 O 2 and (ii) further reduction of electrogenerated H 2 O 2 to water. The electrochemical performance of the raspberry-like nanostructure-based electrode is highly

  13. A Nucleotide Phosphatase Activity in the Nucleotide Binding Domain of an Orphan Resistance Protein from Rice*

    Science.gov (United States)

    Fenyk, Stepan; de San Eustaquio Campillo, Alba; Pohl, Ehmke; Hussey, Patrick J.; Cann, Martin J.

    2012-01-01

    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack. PMID:22157756

  14. A nucleotide phosphatase activity in the nucleotide binding domain of an orphan resistance protein from rice.

    Science.gov (United States)

    Fenyk, Stepan; Campillo, Alba de San Eustaquio; Pohl, Ehmke; Hussey, Patrick J; Cann, Martin J

    2012-02-03

    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack.

  15. Actinides and rare earths complexation with adenosine phosphate nucleotides

    International Nuclear Information System (INIS)

    Mostapha, Sarah

    2013-01-01

    Organophosphorus compounds are important molecules in both nuclear industry and living systems fields. Indeed, several extractants of organophosphorus compounds (such as TBP, HDEHP) are used in the nuclear fuel cycle reprocessing and in the biological field. For instance, the nucleotides are organophosphates which play a very important role in various metabolic processes. Although the literature on the interactions of actinides with inorganic phosphate is abundant, published studies with organophosphate compounds are generally limited to macroscopic and / or physiological approaches. The objective of this thesis is to study the structure of several organophosphorus compounds with actinides to reach a better understanding and develop new specific buildings blocks. The family of the chosen molecules for this procedure consists of three adenine nucleotides mono, bi and triphosphate (AMP, adenosine monophosphate - ADP, adenosine diphosphate - ATP, adenosine triphosphate) and an amino-alkylphosphate (AEP O-phosphoryl-ethanolamine). Complexes synthesis was conducted in aqueous and weakly acidic medium (2.8-4) for several lanthanides (III) (Lu, Yb, Eu) and actinides (U (VI), Th (IV) and Am (III)). Several analytical and spectroscopic techniques have been used to describe the organization of the synthesized complexes: spectrometric analysis performed by FTIR and NMR were used to identify the functional groups involved in the complexation, analysis by ESI-MS and pH-metric titration were used to determine the solution speciation and EXAFS analyzes were performed on Mars beamline of the SOLEIL synchrotron, have described the local cation environment, for both solution and solid compounds. Some theoretical approaches of DFT were conducted to identify stable structures in purpose of completing the experimental studies. All solid complexes (AMP, ADP, ATP and AEP) have polynuclear structures, while soluble ATP complexes are mononuclear. For all synthesized complexes, it has been

  16. Lack of hepcidin ameliorates anemia and improves growth in an adenine-induced mouse model of chronic kidney disease.

    Science.gov (United States)

    Akchurin, Oleh; Sureshbabu, Angara; Doty, Steve B; Zhu, Yuan-Shan; Patino, Edwin; Cunningham-Rundles, Susanna; Choi, Mary E; Boskey, Adele; Rivella, Stefano

    2016-11-01

    Growth delay is common in children with chronic kidney disease (CKD), often associated with poor quality of life. The role of anemia in uremic growth delay is poorly understood. Here we describe an induction of uremic growth retardation by a 0.2% adenine diet in wild-type (WT) and hepcidin gene (Hamp) knockout (KO) mice, compared with their respective littermates fed a regular diet. Experiments were started at weaning (3 wk). After 8 wk, blood was collected and mice were euthanized. Adenine-fed WT mice developed CKD (blood urea nitrogen 82.8 ± 11.6 mg/dl and creatinine 0.57 ± 0.07 mg/dl) and were 2.1 cm shorter compared with WT controls. WT adenine-fed mice were anemic and had low serum iron, elevated Hamp, and elevated IL6 and TNF-α. WT adenine-fed mice had advanced mineral bone disease (serum phosphorus 16.9 ± 3.1 mg/dl and FGF23 204.0 ± 115.0 ng/ml) with loss of cortical and trabecular bone volume seen on microcomputed tomography. Hamp disruption rescued the anemia phenotype resulting in improved growth rate in mice with CKD, thus providing direct experimental evidence of the relationship between Hamp pathway and growth impairment in CKD. Hamp disruption ameliorated CKD-induced growth hormone-insulin-like growth factor 1 axis derangements and growth plate alterations. Disruption of Hamp did not mitigate the development of uremia, inflammation, and mineral and bone disease in this model. Taken together, these results indicate that an adenine diet can be successfully used to study growth in mice with CKD. Hepcidin appears to be related to pathways of growth retardation in CKD suggesting that investigation of hepcidin-lowering therapies in juvenile CKD is warranted. Copyright © 2016 the American Physiological Society.

  17. Pyrrolidine analogues of nucleosides and nucleotides

    Czech Academy of Sciences Publication Activity Database

    Rejman, Dominik; Pohl, Radek; Kovačková, Soňa; Kočalka, Petr; Švenková, Alžběta; Šanderová, Hana; Krásný, Libor; Rosenberg, Ivan

    -, č. 52 (2008), s. 577-578 ISSN 0261-3166. [Joint Symposium of the International Roundtable on Nucleosides, Nucleotides and Nucleic Acids /18./ and the International Symposium on Nucleic Acid Chemistry /35./. Kyoto, 08.09.2008-12.09.2008] R&D Projects: GA MŠk(CZ) LC06077; GA MŠk 2B06065; GA MZd NR9138 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50200510; CEZ:AV0Z50520514 Keywords : pyrrolidine * nucleoside * nucleotide Subject RIV: CC - Organic Chemistry

  18. Expressed sequence tags (ESTs) and single nucleotide ...

    African Journals Online (AJOL)

    Expressed Sequence Tags (ESTs) and Single Nucleotide Polymorphisms (SNPs) are providing in depth knowledge in plant biology, breeding and biotechnology. The emergence of many novel molecular marker techniques are changing and accelerating the process of producing mutations in plant molecular biology ...

  19. Retrieval and Representation of Nucleotide Sequence of ...

    African Journals Online (AJOL)

    Nigerian Journal of Basic and Applied Science (March, 2013), 21(1): 27-32. DOI: http://dx.doi.org/10.4314/njbas.v21i1.4. ISSN 0794-5698. Retrieval and Representation of Nucleotide Sequence of Saccharomyces cerevisiae Cystathionine. Gamma-Lyase (CYS3) Gene in Five Formats. *R. A. Umar, H. Abdullahi and N. Lawal.

  20. Incision Coordination in Nucleotide Excision Repair

    NARCIS (Netherlands)

    W.L. de Laat (Wouter)

    1998-01-01

    textabstractThis thesis aims to contribute to the understanding of the molecular mechanism that underlies one of the main DNA repair pathways in mammals, nucleotide excision rcpair. In chapter 1 the relevance of DNA repair in general is outlined. An overview of mammalian strategies to counteract DNA

  1. Single-nucleotide polymorphisms in peroxisome proliferator ...

    Indian Academy of Sciences (India)

    Prakash

    the metabolic syndrome (MS) and type 2 diabetes. We also investigated the correlation of these two single-nucleotide polymorphisms (SNPs) with plasma resistin levels. The C1431T SNP was associated with higher levels of plasma resistin (P = 0.017). Furthermore, C1431T was associated with resistin in different tertiles.

  2. Cross-coupling reactions of unprotected halopurine bases, nucleosides, nucleotides and nucleoside triphosphates with 4-boronophenylalanine in water. Synthesis of (purin-8-yl)- and (purin-6-yl)phenylalanines.

    Science.gov (United States)

    Capek, Petr; Pohl, Radek; Hocek, Michal

    2006-06-07

    An expeditious and highly efficient single-step methodology for the introduction of a phenylalanine moiety into position 8 and 6 of the purine scaffold was developed based on aqueous-phase Pd-catalysed Suzuki-Miyaura cross-coupling reactions of unprotected 4-boronophenylalanine with 8-bromo- or 6-chloropurines. The scope of the methodology was demonstrated by syntheses of unprotected (adenin-8-yl)phenylalanine base, nucleosides, nucleotides and nucleoside triphosphates as well as (purin-6-yl)phenylalanine base and nucleosides. All these products were obtained in high yields and in optically pure form.

  3. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator

    International Nuclear Information System (INIS)

    Fenati, Renzo A.; Connolly, Ashley R.; Ellis, Amanda V.

    2017-01-01

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded–DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP–Cytosine > TPP–Thymine > TPP–Adenine ≥ TPP–Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80–90% quenching), compared to 25–30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. - Highlights: • Fluorophores and DNA intercalators effect the rate of toehold-mediated strand displacement. • Ethidium bromide had a destabilizing effect on mismatches that contained cytosine. • A cationic fluorophore and Black Hole Quencher 1 strand displacement system was 2–3 times faster than a FRET system. • This enabled SNP detection using toehold-mediated strand displacement in 15 min.

  4. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator

    Energy Technology Data Exchange (ETDEWEB)

    Fenati, Renzo A.; Connolly, Ashley R. [Flinders Centre for Nanoscale Science and Technology, Flinders University, Sturt Road, Bedford Park, Adelaide, South Australia 5042 (Australia); Ellis, Amanda V., E-mail: amanda.ellis@flinders.edu.au [Flinders Centre for Nanoscale Science and Technology, Flinders University, Sturt Road, Bedford Park, Adelaide, South Australia 5042 (Australia); Chemical and Biomolecular Engineering, The University of Melbourne, Parkville, VIC 3010 (Australia)

    2017-02-15

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded–DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP–Cytosine > TPP–Thymine > TPP–Adenine ≥ TPP–Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80–90% quenching), compared to 25–30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. - Highlights: • Fluorophores and DNA intercalators effect the rate of toehold-mediated strand displacement. • Ethidium bromide had a destabilizing effect on mismatches that contained cytosine. • A cationic fluorophore and Black Hole Quencher 1 strand displacement system was 2–3 times faster than a FRET system. • This enabled SNP detection using toehold-mediated strand displacement in 15 min.

  5. Elimination and Utilization of Oxidized Guanine Nucleotides in the Synthesis of RNA and Its Precursors*

    Science.gov (United States)

    Sekiguchi, Takeshi; Ito, Riyoko; Hayakawa, Hiroshi; Sekiguchi, Mutsuo

    2013-01-01

    Reactive oxygen species are produced as side products of oxygen utilization and can lead to the oxidation of nucleic acids and their precursor nucleotides. Among the various oxidized bases, 8-oxo-7,8-dihydroguanine seems to be the most critical during the transfer of genetic information because it can pair with both cytosine and adenine. During the de novo synthesis of guanine nucleotides, GMP is formed first, and it is converted to GDP by guanylate kinase. This enzyme hardly acts on an oxidized form of GMP (8-oxo-GMP) formed by the oxidation of GMP or by the cleavage of 8-oxo-GDP and 8-oxo-GTP by MutT protein. Although the formation of 8-oxo-GDP from 8-oxo-GMP is thus prevented, 8-oxo-GDP itself may be produced by the oxidation of GDP by reactive oxygen species. The 8-oxo-GDP thus formed can be converted to 8-oxo-GTP because nucleoside-diphosphate kinase and adenylate kinase, both of which catalyze the conversion of GDP to GTP, do not discriminate 8-oxo-GDP from normal GDP. The 8-oxo-GTP produced in this way and by the oxidation of GTP can be used for RNA synthesis. This misincorporation is prevented by MutT protein, which has the potential to cleave 8-oxo-GTP as well as 8-oxo-GDP to 8-oxo-GMP. When 14C-labeled 8-oxo-GTP was applied to CaCl2-permeabilized cells of a mutT− mutant strain, it could be incorporated into RNA at 4% of the rate for GTP. Escherichia coli cells appear to possess mechanisms to prevent misincorporation of 8-oxo-7,8-dihydroguanine into RNA. PMID:23376345

  6. Structurally related nucleotides as selective agonists and antagonists at P2Y1 receptors

    Science.gov (United States)

    Jacobson, Kenneth A.; Moro, Stefano; Hoffmann, Carsten; Kim, Yong-Chul; Kim, Hak Sung; Ravi, R. Gnana; Harden, T. Kendall; Boyer, José L.

    2015-01-01

    The P2Y1 receptor responds to adenine nucleotides and is present in platelets, heart, smooth muscles prostate, ovary, and brain. A selective antagonist may be useful as an antithrombotic agent. We have analyzed the binding site of this G protein-coupled receptor using ligand design, site-directed mutagenesis, and homology modeling based on rhodopsin. We have designed and synthesized a series of deoxyadenosine 3′,5′-bisphosphate derivatives that act as antagonists, or, in some cases with small structural changes, as agonists or partial agonists. The 2-position accommodates Cl or thioethers, whereas the N6-position is limited to Me or Et. 2′-Substitution with OH or OMe increases agonist efficacy over 2′-H. Using molecular modeling of the binding site, the oxygen atoms of the ribose moiety were predicted to be non-essential, i.e. no specific H-bonds with the receptor protein appear in the model. We have, therefore, substituted this moiety with carbocylics, smaller and larger rings, conformationally constrained rings, and acyclics, with retention of affinity for the receptor. With simplified pharmacophores we are exploring the steric and electronic requirements of the receptor binding site, and the structural basis of receptor activation. PMID:11347970

  7. Rigid Adenine Nucleoside Derivatives as Novel Modulators of the Human Sodium Symporters for Dopamine and Norepinephrine

    Science.gov (United States)

    Tosh, Dilip K.; Eshleman, Amy J.; Jacobson, Kenneth A.

    2016-01-01

    Thirty-two congeneric rigid adenine nucleoside derivatives containing a North (N)-methanocarba ribose substitution and a 2-arylethynyl group either enhanced (up to 760% of control) or inhibited [125I] methyl (1R,2S,3S)-3-(4-iodophenyl)-8-methyl-8-azabicyclo[3.2.1]octane-2-carboxylate (RTI-55) binding at the human dopamine (DA) transporter (DAT) and inhibited DA uptake. Several nucleosides also enhanced [3H]mazindol [(±)-5-(4-chlorophenyl)-3,5-dihydro-2H-imidazo[2,1-a]isoindol-5-ol] binding to the DAT. The combination of binding enhancement and functional inhibition suggests possible allosteric interaction with the tropanes. The structure-activity relationship of this novel class of DAT ligands was explored: small N6-substition (methyl or ethyl) was favored, while the N1 of the adenine ring was essential. Effective terminal aryl groups include thien-2-yl (compounds 9 and 16), with EC50 values of 35.1 and 9.1 nM, respectively, in [125I]RTI-55 binding enhancement, and 3,4-difluorophenyl as in the most potent DA uptake inhibitor (compound 6) with an IC50 value of 92 nM (3-fold more potent than cocaine), but not nitrogen heterocycles. Several compounds inhibited or enhanced binding at the norepinephrine transporter (NET) and serotonin transporter (SERT) and inhibited function in the micromolar range; truncation at the 4′-position in compound 23 allowed for weak inhibition of the SERT. We have not yet eliminated adenosine receptor affinity from this class of DAT modulators, but we identified modifications that remove DAT inhibition as an off-target effect of potent adenosine receptor agonists. Thus, we have identified a new class of allosteric DAT ligands, rigidified adenosine derivatives, and explored their initial structural requirements. They display a very atypical pharmacological profile, i.e., either enhancement by increasing affinity or inhibition of radioligand binding at the DAT, and in some cases the NET and SERT, and inhibition of neurotransmitter uptake

  8. The C-terminal domain of the adenine-DNA glycosylase MutY confers specificity for 8-oxoguanine.adenine mispairs and may have evolved from MutT, an 8-oxo-dGTPase.

    Science.gov (United States)

    Noll, D M; Gogos, A; Granek, J A; Clarke, N D

    1999-05-18

    MutY is an adenine-DNA glycosylase with specificity for mismatches involving 8-oxoguanine (oG.A) or guanine (G.A). In addition to a 25 kDa catalytic domain common to all members of its DNA glycosylase superfamily, MutY has a 14 kDa C-terminal domain. Sequence analyses suggest that this C-terminal domain is distantly related to MutT, a pyrophosphohydrolase specific for 2'-deoxy-8-oxoguanosine triphosphate (doGTP). Here we present biochemical evidence that the MutT-like domain of MutY is the principal determinant of oG specificity. First, MutY dissociates approximately 1500-fold more slowly from oG-containing product DNA than from G-containing product, but a truncated protein lacking the C-terminal domain dissociates as rapidly from oG-DNA as the full-length protein dissociates from G-DNA. Second, MutY removes adenine from oG.A mismatches almost 30-fold faster than from G.A mismatches in a pre-steady-state assay, but deletion of the C-terminal domain reduces this specificity for oG.A to less than 4-fold. The kinetic data are consistent with a model in which binding of oG to the C-terminal domain of MutY accelerates the pre-steady-state glycosylase reaction by facilitating adenine base flipping. The observation that oG specificity derives almost exclusively from the C-terminal domain of MutY adds credence to the sequence analyses and suggests that specificity for oG.A mismatches was acquired by fusion of a MutT-like protein onto the core catalytic domain of an adenine-DNA glycosylase.

  9. Application of a new method for detecting streptococcal nicotinamide adenine dinucleotide glycohydrolase to various M types of Streptoccus pyogenes.

    Science.gov (United States)

    Lütticken, R; Lütticken, D; Johnson, D R; Wannamaker, L W

    1976-05-01

    The production of extracellular nicotinamide adenine dinucleotide glycohydrolase (NADase) by Streptococcus pyogenes can easily be demonstrated using the fluorescence of nicotinamide adenine dinucleotide in ultraviolet light occurring on addition of strong alkali. The new method described here uses microtiter plates and can be read with the naked eye. It permits the screening of large numbers of strains in a short time and with minimal amounts of reagents. The sensitivity of the new method proved to be good in comparison with the bisulfite spectrophotometric method. Culture supernatants of 177 group A streptococci were tested for NADase production by the microtiter fluorescence method. We could confirm former findings that strains within a certain M type of S. pyogenes are usually either producers or nonproducers of the enzyme. The usefulness of the test for screening of streptococcal NADase production is discussed.

  10. High-NaCl diet impairs dynamic renal blood flow autoregulation in rats with adenine-induced chronic renal failure

    DEFF Research Database (Denmark)

    Saeed, Aso; DiBona, Gerald F; Grimberg, Elisabeth

    2014-01-01

    This study examined the effects of 2 wk of high-NaCl diet on kidney function and dynamic renal blood flow autoregulation (RBFA) in rats with adenine-induced chronic renal failure (ACRF). Male Sprague-Dawley rats received either chow containing adenine or were pair-fed an identical diet without...... arterial pressure variability (SAPV), and heart rate variability were assessed by spectral analytical techniques. Rats with ACRF showed marked reductions in glomerular filtration rate and renal blood flow (RBF), whereas mean arterial pressure and SAPV were significantly elevated. In addition, spontaneous...... BRS was reduced by ∼50% in ACRF animals. High-NaCl diet significantly increased transfer function fractional gain values between arterial pressure and RBF in the frequency range of the myogenic response (0.06-0.09 Hz) only in ACRF animals (0.3 ± 4.0 vs. -4.4 ± 3.8 dB; P

  11. Synthesis of adenine, guanine, cytosine, and other nitrogen organic compounds by a Fischer-Tropsch-like process.

    Science.gov (United States)

    Yang, C. C.; Oro, J.

    1971-01-01

    Study of the formation of purines, pyrimidines, and other bases from CO, H2, and NH3 under conditions similar to those used in the Fischer-Tropsch process. It is found that industrial nickel/iron alloy catalyzes the synthesis of adenine, guanine, cytosine, and other nitrogenous compounds from mixtures of CO, H2, and NH3 at temperatures of about 600 C. Sufficient sample was accumulated to isolate as solid products adenine, guanine, and cytosine, which were identified by infrared spectrophotometry. In the absence of nickel/iron catalyst, at 650 C, or in the presence of this catalyst, at 450 C, no purines or pyrimidines were synthesized. These results confirm and extend some of the work reported by Kayatsu et al. (1968).

  12. The metabolism of N6(Δ2-isosopentenyl) [3H]adenine by different stem sections of Pisum sativum

    International Nuclear Information System (INIS)

    King, R.A.; Staden, J. van

    1990-01-01

    Serial segments of internodal stem tissue were isolated from Pisum sativum L. shoots and incubated in a medium containing N 6 (Δ 2 -isosopentenyl) [ 3 H]adenine. The recovery of radioactive derivatives separated using HPLC indicated a gradient of cytokinin metabolic activity in the stem. This gradient of activity was found to be greatest at the basal node in young seedlings but was high both at upper and lower nodes in older plants. An attempt to correlate this phenomenon with the basipetally decreasing concentration of indole-3-acetic acid in the stem led to an experiment in which stem segments were pretreated in indole-3-acetic acid solutions before incubating in a medium containing N 6 (Δ 2 -isosopentenyl) [ 3 H]adenine. Indole-3-acetic acid was found to have a marked effect on cytokinin metabolism in isolated stem segments. These results are discussed in relation to apical dominance in the shoot. (author)

  13. Time-dependent density-functional-theory investigation of the collisions of protons and α particles with uracil and adenine

    Science.gov (United States)

    Covington, Cody; Hartig, Kara; Russakoff, Arthur; Kulpins, Ryan; Varga, Kálmán

    2017-05-01

    Time-dependent density-functional theory was employed to study the effects of proton and α -particle radiation on uracil and adenine. This method has the advantage of treating nuclear motion and electronic motion simultaneously, allowing for the study of electronic excitation, charge transfer, ionization, and nuclear motion. Particle energies were surveyed in the range of 15-500 keV for protons and 100-2000 keV for α particles in conjunction with impact points both on and off carbon bonds in order to investigate the electron and nuclear dynamics of irradiated molecules and the form and quantity of transferred energy. The stopping power, energy transferred, and ionization were found, and the relationship between incident particle energy and electron density of the target molecule was characterized for proton and α -particle radiation incident on adenine and uracil.

  14. Detection of Guanine and Adenine Using an Aminated Reduced Graphene Oxide Functional Membrane-Modified Glassy Carbon Electrode

    Directory of Open Access Journals (Sweden)

    Di Li

    2017-07-01

    Full Text Available A new electrochemical sensor based on a Nafion, aminated reduced graphene oxide and chitosan functional membrane-modified glassy carbon electrode was proposed for the simultaneous detection of adenine and guanine. Fourier transform-infrared spectrometry (FTIR, transmission electron microscopy (TEM, and electrochemical methods were utilized for the additional characterization of the membrane materials. The prepared electrode was utilized for the detection of guanine (G and adenine (A. The anodic peak currents to G and A were linear in the concentrations ranging from 0.1 to 120 μM and 0.2 to 110 μM, respectively. The detection limits were found to be 0.1 μM and 0.2 μM, respectively. Moreover, the modified electrode could also be used to determine G and A in calf thymus DNA.

  15. Stimulation of nicotinamide adenine dinucleotide biosynthetic pathways delays axonal degeneration after axotomy.

    Science.gov (United States)

    Sasaki, Yo; Araki, Toshiyuki; Milbrandt, Jeffrey

    2006-08-16

    Axonal degeneration occurs in many neurodegenerative diseases and after traumatic injury and is a self-destructive program independent from programmed cell death. Previous studies demonstrated that overexpression of nicotinamide mononucleotide adenylyltransferase 1 (Nmnat1) or exogenous application of nicotinamide adenine dinucleotide (NAD) can protect axons of cultured dorsal root ganglion (DRG) neurons from degeneration caused by mechanical or neurotoxic injury. In mammalian cells, NAD can be synthesized from multiple precursors, including tryptophan, nicotinic acid, nicotinamide, and nicotinamide riboside (NmR), via multiple enzymatic steps. To determine whether other components of these NAD biosynthetic pathways are capable of delaying axonal degeneration, we overexpressed each of the enzymes involved in each pathway and/or exogenously administered their respective substrates in DRG cultures and assessed their capacity to protect axons after axotomy. Among the enzymes tested, Nmnat1 had the strongest protective effects, whereas nicotinamide phosphoribosyl transferase and nicotinic acid phosphoribosyl transferase showed moderate protective activity in the presence of their substrates. Strong axonal protection was also provided by Nmnat3, which is predominantly located in mitochondria, and an Nmnat1 mutant localized to the cytoplasm, indicating that the subcellular location of NAD production is not crucial for protective activity. In addition, we showed that exogenous application of the NAD precursors that are the substrates of these enzymes, including nicotinic acid mononucleotide, nicotinamide mononucleotide, and NmR, can also delay axonal degeneration. These results indicate that stimulation of NAD biosynthetic pathways via a variety of interventions may be useful in preventing or delaying axonal degeneration.

  16. DNA adenine methylation is required to replicate both Vibrio cholerae chromosomes once per cell cycle.

    Directory of Open Access Journals (Sweden)

    Gaëlle Demarre

    2010-05-01

    Full Text Available DNA adenine methylation is widely used to control many DNA transactions, including replication. In Escherichia coli, methylation serves to silence newly synthesized (hemimethylated sister origins. SeqA, a protein that binds to hemimethylated DNA, mediates the silencing, and this is necessary to restrict replication to once per cell cycle. The methylation, however, is not essential for replication initiation per se but appeared so when the origins (oriI and oriII of the two Vibrio cholerae chromosomes were used to drive plasmid replication in E. coli. Here we show that, as in the case of E. coli, methylation is not essential for oriI when it drives chromosomal replication and is needed for once-per-cell-cycle replication in a SeqA-dependent fashion. We found that oriII also needs SeqA for once-per-cell-cycle replication and, additionally, full methylation for efficient initiator binding. The requirement for initiator binding might suffice to make methylation an essential function in V. cholerae. The structure of oriII suggests that it originated from a plasmid, but unlike plasmids, oriII makes use of methylation for once-per-cell-cycle replication, the norm for chromosomal but not plasmid replication.

  17. Magnitude of malate-aspartate reduced nicotinamide adenine dinucleotide shuttle activity in intact respiring tumor cells.

    Science.gov (United States)

    Greenhouse, W V; Lehninger, A L

    1977-11-01

    Measurements of respiration, CO2 and lactate production, and changes in the levels of various key metabolites of the glycolytic sequence and tricarboxylic acid cycle were made on five lines of rodent ascites tumor cells (two strains of Ehrlich ascites tumor cells, Krebs II carcinoma, AS-30D carcinoma, and L1210 cells) incubated aerobically in the presence of uniformly labeled D-[14C]glucose. From these data, as well as earlier evidence demonstrating that the reduced nicotinamide adenine dinucleotide (NADH) shuttle in these cells requires a transaminase step and is thus identified as the malate-aspartate shuttle (W.V.V. Greenhouse and A.L. Lehninger, Cancer Res., 36: 1392-1396, 1976), metabolic flux diagrams were constructed for the five cell lines. These diagrams show the relative rates of glycolysis, the tricarboxylic acid cycle, electron transport, and the malate-aspartate shuttle in these tumors. Large amounts of cytosolic NADH were oxidized by the mitochondrial respiratory chain via the NADH shuttle, comprising anywhere from about 20 to 80% of the total flow of reducing equivalents to oxygen in these tumors. Calculations of the sources of energy for adenosine triphosphate synthesis indicated that on the average about one-third of the respiratory adenosine triphosphate is generated by electron flow originating from cytosolic NADH via the malate-aspartate shuttle.

  18. Studies of yeast cell oxygenation and energetics by laser fluorometry of reduced nicotinamide adenine dinucleotide

    Science.gov (United States)

    Pan, Fu-shih; Chen, Stephen; Mintzer, Robert A.; Chen, Chin-Tu; Schumacker, Paul

    1991-03-01

    It is of fundamental importance for biological scientists to assess cellular energetics. Under aerobic conditions, the tricarboxylic acid cycle (TCA cycle) is coupled with the mitochondrial electron cascade pathway to provide the cell with energy. The nicotinamide adenine dinucleotide-conjugated pair (NAD and NADH) is the coenzyme in numerous important biomedical reactions which include several important dehydrogenase reactions in the TCA cycle. Based on Le Chatelier's principle, NADH will accumulate when this energy production mechanism is impaired. The relative amounts of NAD and NADH in a cell are defined as the redox state of the cell (Williamson et.al. 1967) which provides a valuable index of cellular energetics. The sum of the amounts of NAD and NADH in a cell may be assumed to be constant during a finite time; therefore, a reliable means of measuring the NADH concentration would provide us with a useful indicator of tissue viability. Traditionally, the quantities of NADH and NAD may be measured by chemical assay methods. We can avoid these tediois analyses by exploiting the significant difference between the ultraviolet absorption spectra of this redox pair. However, because of the opacity of biological samples and the interference of other biochemicals that also absorb ultraviolet radiation, measurement of NADH and NAD+ concentrations in vivo by absorption spectroscopy is not feasible.

  19. Gas-phase spectroscopy of protonated adenine, adenosine 5′-monophosphate and monohydrated ions

    DEFF Research Database (Denmark)

    Pedersen, S.O.; Støchkel, K.; Byskov, C.S.

    2013-01-01

    . The yields of these were measured as a function of the wavelength of the light from 210 nm to 300 nm, and they were combined to obtain the total photoinduced dissociation at each wavelength (i.e., action spectrum). A broad band between 230 nm and 290 nm and the tail of a band with maximum below 210 nm (high......-energy band) are seen. In the case of AdeH+(H2O), the dominant dissociation channel after photoexcitation in the low-energy band was simply loss of H2O while photodissociation of protonated AMP revealed two dominant dissociation channels associated with the formation of either AdeH+ or loss of H3PO4....... The action spectra of AdeH+, AdeH+(H2O), and AMPH+ are almost identical in the 230–290 nm region, and they resemble the absorption spectrum of protonated adenine in aqueous solution recorded at low pH. Hence from our work it is firmly established that the lowest-energy transitions are independent...

  20. Adenosine and its Related Nucleotides may Modulate Gastric Acid ...

    African Journals Online (AJOL)

    Studies on lumen-perfused rat isolated stomachs showed that adenosine, adenosine monophosphate (AMP) and reduced nicotinamide adenine dinucleotide (NADH) inhibited histamine-induced gastric acid secretion. The inhibitions and the calcium levels of the serosal solution exhibited inverse relationship. Adenosine ...

  1. Towards a better understanding of the unusual conformations of the alternating guanine-adenine repeat strands of DNA

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Kypr, Jaroslav; Vondrušková, Jitka; Vorlíčková, Michaela

    2007-01-01

    Roč. 85, č. 1 (2007), s. 19-27 ISSN 0006-3525 R&D Projects: GA AV ČR(CZ) IAA4004201; GA AV ČR(CZ) IAA5004802 Institutional research plan: CEZ:AV0Z50040702 Keywords : CD spectroscopy * alternating guanine-adenine microsatellite * guanine quadruplex Subject RIV: BO - Biophysics Impact factor: 2.389, year: 2007

  2. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  3. Nucleotide Manipulatives to Illustrate the Central Dogma

    OpenAIRE

    Sonja B. Yung; Todd P. Primm

    2015-01-01

    The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  4. Nucleotide Manipulatives to Illustrate the Central Dogma

    Directory of Open Access Journals (Sweden)

    Sonja B. Yung

    2015-08-01

    Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  5. Pyrrolidine nucleotide analogs with a tunable conformation

    Czech Academy of Sciences Publication Activity Database

    Poštová Slavětínská, Lenka; Rejman, Dominik; Pohl, Radek

    2014-01-01

    Roč. 10, Aug 22 (2014), s. 1967-1980 ISSN 1860-5397 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : conformation * NMR * nucleic acids * nucleotide analog * phosphonic acid * pseudorotation * pyrrolidine Subject RIV: CC - Organic Chemistry Impact factor: 2.762, year: 2014 http://www.beilstein-journals.org/bjoc/single/articleFullText.htm?publicId=1860-5397-10-205

  6. Aggregation of rat neutrophils by nucleotide triphosphates.

    OpenAIRE

    Ford-Hutchinson, A. W.

    1982-01-01

    1 Adenosine 5'-triphosphate (ATP) and uridine 5'-triphosphate (UTP) at concentrations of 3 x 10(-7)M and greater cause a rapid partially reversible aggregation of rat polymorphonuclear leucocytes. 2 Other nucleotide phosphates are much less active at producing aggregation responses; the agonist potencies being UTP greater than ATP greater than guanosine 5'-triphosphate, cytidine 5'-triphosphate, thymidine 5'-triphosphate; ATP greater than adenosine 5'-diphosphate (ADP) greater than adenosine ...

  7. Kinetics and thermodynamics of the reaction between the •OH radical and adenine – a theoretical investigation

    DEFF Research Database (Denmark)

    Milhøj, Birgitte Olai; Sauer, Stephan P. A.

    2015-01-01

    The accessibility of all possible reaction paths for the reaction between the nucleobase adenine and the •OH radical is investigated through quantum chemical calculations of barrier heights and rate constants at the wB97X-D/6-311++G(2df,2pd) level with Eckart tunneling corrections. First the comp......The accessibility of all possible reaction paths for the reaction between the nucleobase adenine and the •OH radical is investigated through quantum chemical calculations of barrier heights and rate constants at the wB97X-D/6-311++G(2df,2pd) level with Eckart tunneling corrections. First...... and with the Wigner, Bell and Eckart corrections. Compared to CCSD(T)//BHandHLYP/aug-cc-pVTZ reference results, the wB97XD/6-311++G(2df,2pd) method combined with Eckart tunneling corrections provides a sensible compromise between accuracy and time. Using this method all sub-reactions of the reaction between adenine...

  8. Molecular recognition of AT-DNA sequences by the induced CD pattern of dibenzotetraaza[14]annulene (DBTAA)-adenine derivatives.

    Science.gov (United States)

    Stojković, Marijana Radić; Skugor, Marko; Dudek, Lukasz; Grolik, Jarosław; Eilmes, Julita; Piantanida, Ivo

    2014-01-01

    An investigation of the interactions of two novel and several known DBTAA-adenine conjugates with double-stranded DNA and RNA has revealed the DNA/RNA groove as the dominant binding site, which is in contrast to the majority of previously studied DBTAA analogues (DNA/RNA intercalators). Only DBTAA-propyladenine conjugates revealed the molecular recognition of AT-DNA by an ICD band pattern > 300 nm, whereas significant ICD bands did not appear for other ds-DNA/RNA. A structure-activity relation for the studied series of compounds showed that the essential structural features for the ICD recognition are a) the presence of DNA-binding appendages (adenine side chain and positively charged side chain) on both DBTAA side chains, and b) the presence of a short propyl linker, which does not support intramolecular aromatic stacking between DBTAA and adenine. The observed AT-DNA-ICD pattern differs from previously reported ss-DNA (poly dT) ICD recognition by a strong negative ICD band at 350 nm, which allows for the dynamic differentiation between ss-DNA (poly dT) and coupled ds-AT-DNA.

  9. DNA synthesis and cell survival after X-irradiation of mammalian cells treated with caffeine or adenine

    International Nuclear Information System (INIS)

    Griffiths, T.D.; Carpenter, J.G.; Dahle, D.B.

    1978-01-01

    The expression of the transient depression in the rate of DNA synthesis normally observed after exposure of randomly-dividing Chinese hamster V-79 or Chinese hamster CHO cells to ionizing radiation could be postponed by a post-irradiation treatment with 1.0 to 2.0 mM adenine or 1.5 mM caffeine. Caffeine may exert its effect by creating additional sites for replication in irradiated cells. Cells treated with caffeine or adenine for 2 or 4 hours after exposure to 3000 rad of 300 kVp X-rays exhibited depressed synthesis only after the removal of caffeine or adenine. These alterations in the timing of the X-ray-induced depression of the rate of DNA synthesis had no effect on X-ray-induced cell killing. Although a 4 hour post-irradiation treatment of randomly-dividing Chinese hamster V-79 cells with 1.0 or 2.0 mM caffeine potentiated X-ray-induced cell killing, this reduction in survival was due primarily to effects on cells not in S-phase. (author)

  10. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    International Nuclear Information System (INIS)

    Shin, Joong-Won; Bernstein, Elliot R.

    2014-01-01

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5 ′ -monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results

  11. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Joong-Won, E-mail: jshin@govst.edu [Division of Science, Governors State University, University Park, Illinois 60484-0975 (United States); Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States); Bernstein, Elliot R., E-mail: erb@lamar.colostate.edu [Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States)

    2014-01-28

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  12. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    Science.gov (United States)

    Shin, Joong-Won; Bernstein, Elliot R.

    2014-01-01

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5'-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C-C and C-O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  13. Visualization of cyclic nucleotide dynamics in neurons

    Directory of Open Access Journals (Sweden)

    Kirill eGorshkov

    2014-12-01

    Full Text Available The second messengers cAMP and cGMP transduce many neuromodulatory signals from hormones and neurotransmitters into specific functional outputs. Their production, degradation and signaling are spatiotemporally regulated to achieve high specificity in signal transduction. The development of genetically encodable fluorescent biosensors has provided researchers with useful tools to study these versatile second messengers and their downstream effectors with unparalleled spatial and temporal resolution in cultured cells and living animals. In this review, we introduce the general design of these fluorescent biosensors and describe several of them in more detail. Then we discuss a few examples of using cyclic nucleotide fluorescent biosensors to study regulation of neuronal function and finish with a discussion of advances in the field. Although there has been significant progress made in understanding how the specific signaling of cyclic nucleotide second messengers is achieved, the mechanistic details in complex cell types like neurons are only just beginning to surface. Current and future fluorescent protein reporters will be essential to elucidate the role of cyclic nucleotide signaling dynamics in the functions of individual neurons and their networks.

  14. Effects of hypokinesia on cyclic nucleotides and hormonal regulation ...

    African Journals Online (AJOL)

    PTH), calcitonin (CT), cyclic nucleotides (cAMP, cGMP) and calcium in the blood of rats, while in urine - phosphate, calcium and cyclic nucleotides. Design: Laboratory based experiment. Setting: Laboratory in the Department of Biochemistry, ...

  15. Isolation and characterization of Avibacterium paragallinarum with different nicotinamide adenine dinucleotide requirements.

    Science.gov (United States)

    Jeong, Ok-Mi; Kang, Min-Su; Jeon, Byung-Woo; Choi, Byung-Kook; Kwon, Yong-Kuk; Yoon, So-Youn; Blackall, Patrick J; Lee, Hee-Soo; Jung, Suk-Chan; Kim, Jae-Hong

    2017-06-01

    Twenty field isolates of Avibacterium paragallinarum were obtained from chickens in South Korea during 2011-2015. The isolates were identified by a HPG-2 PCR assay specific for A. paragallinarum and by biochemical tests. Growth requirements, Page serovars, carbohydrate fermentation patterns, and antimicrobial susceptibility were also examined. Most isolates (16/20) showed the typical requirement for nicotinamide adenine dinucleotide (NAD) and an enriched CO 2 atmosphere for growth. One isolate needed increased levels of NAD and serum for good growth. Three isolates showed NAD-independent growth on blood agar under aerobic conditions. In terms of carbohydrate fermentation patterns, three biochemical biovars were recognized; these varied with respect to acid production from maltose and D-xylose. The 16 typical NAD-dependent isolates were serovar A while the variants, both NAD-independent isolates and the isolate with increased NAD dependency were non-typeable. All isolates were sensitive to amoxicillin-clavulanic acid, ceftiofur, gentamicin, and spectinomycin. High rates of resistance, including intermediate resistance, to lincomycin (100%), cloxacillin (75%), and erythromycin (70%) were observed. The four variant strains (the three NAD-independent isolates and the isolate showing unusual growth requirements) were more resistant to antibiotics than the typical NAD-dependent strains. The finding of NAD-independent forms of A. paragallinarum extends the known distribution of this form, previously only reported in South Africa, Mexico and Peru. There is clearly a need for increased caution in the diagnosis and, possibly, the control of infectious coryza. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Transcriptome and Functional Genomics Reveal the Participation of Adenine Phosphoribosyltransferase in Trypanosoma cruzi Resistance to Benznidazole.

    Science.gov (United States)

    García-Huertas, Paola; Mejía-Jaramillo, Ana María; González, Laura; Triana-Chávez, Omar

    2017-07-01

    Currently, the only available treatments for Trypanosoma cruzi are benznidazole (Bz) and nifurtimox (Nfx). The mechanisms of action and resistance to these drugs in this parasite are not complete known. In order to identify differentially expressed transcripts between sensitive and resistant parasites, a massive pyrosequencing of the T. cruzi transcriptome was carried out. Additionally, the 2D gel electrophoresis profile of sensitive and resistant parasites was analyzed and the data were supported with functional genomics. The results showed 133 differentially expressed genes in resistant parasites. The transcriptome analysis revealed the regulation of different genes with several functions and metabolic pathways, which could suggest that resistance in T. cruzi is a multigenic process. Additionally, using transcriptomics, one gene, adenine phosphoribosyltransferase (APRT), was found to be down-regulated in the resistant parasites and its expression profile was confirmed by 2D electrophoresis analysis. The role of this gene in the resistance to Bz was confirmed overexpressing it in sensitive and resistant parasites. Interestingly, both parasites became more sensitive to Bz and H 2 O 2 . This is the first RNA-seq study to identify regulated genes in T. cruzi associated with Bz resistance and to show the role of APRT in T. cruzi resistance. Although T. cruzi regulation is mainly post-transcriptional, the transcriptome analysis, supported by 2D gel analysis and functional genomic, provides an overall idea of the expression profiles of genes under resistance conditions. These results contribute essential information to further the understanding of the mechanisms of action and resistance to Bz in T. cruzi. J. Cell. Biochem. 118: 1936-1945, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  17. Improving quality indices of Rosa ‘Yellow Finesse’ using methyl jasmonate and benzyl adenine

    Directory of Open Access Journals (Sweden)

    Omid Askari-Khorasgani

    2016-06-01

    Full Text Available Plant growth regulators (PGRs play a key role in regulating physiological and morphological development of plant species. Application of these PGRs can improve pre- and post-harvest quality and quantity of ornamental flowers and lessen the harmful effects of injury incurred at harvesting time. The objective of this study was to determine the appropriate spraying solution for improving pre- and postharvest quality indices of Rosa hybrida L. cv. ‘Yellow Finesse’. So, the effect of methyl jasmonate (MeJA at 0, 50, 100, or 150 mg*l-1 alone or in combination with benzyl adenine (BA at 0, 10, or 20 mg*l-1 was investigated. Plants were sprayed at a 15-day interval for two months and then harvested at a mature bud stage. The results showed that flower head diameter and leaf chlorophyll content were improved by applying 100 mg*l-1 MeJA + 20 mg*l-1 BA. The application of 100 mg*l-1 MeJA + 10 mg*l-1 BA or 10 mg*l-1 BA resulted in improving its petal carotenoid content. The plants treated with 150 mg*l-1 MeJA had the longest shelf life. The findings demonstrated that while 100 mg*l-1 MeJA + 20 mg*l-1 BA and 100 mg*l-1 MeJA + 10 mg*l-1 BA were the best preharvest spraying solutions due to the highest carotenoid content and largest flower head diameter. Particularly, 150 mg*l-1 MeJA was the best spraying solution for extending cut flower shelf life and had the potential to function as a postharvest treatment.

  18. Salt Specificity of a Reduced Nicotinamide Adenine Dinucleotide Oxidase Prepared from a Halophilic Bacterium1

    Science.gov (United States)

    Hochstein, L. I.; Dalton, B. P.

    1968-01-01

    Extracts prepared from a halophilic bacterium contained a reduced nicotinamide adenine dinucleotide (NADH2) oxidase active at high solute concentrations. The cation requirement was nonspecific, since KCl, RbCl, and CsCl replaced NaCl with little or no loss of activity, and NH4Cl was only partially effective. Only LiCl failed to replace NaCl. No specific chloride requirement was observed although not all anions replaced chloride. Bromide, nitrate, and iodide were essentially ineffective, whereas acetate, formate, citrate, and sulfate proved suitable. The presence of sulfate affected the ability of a cation to satisfy the solute requirement. Sulfate enhanced the rate of NADH2 oxidation when compared with the rate observed in the presence of chloride. Cations which were inactive as chlorides (LiCl and MgCl2 at high concentrations) satisfied the cation requirement when added as sulfate salts. Although magnesium satisfied the cation requirement, a concentration effect, as well as an anion effect, was observed. In the presence of MgCl2, little NADH2 oxidation was observed at concentrations greater than 1 m. At lower concentrations, the rate of oxidation increased, reaching a maximal value at 0.1 m and remaining constant up to a concentration of 0.05 m MgCl2. Magnesium acetate and MgSO4 also replaced NaCl, and the maximal rate of oxidation occurred at 0.05 m with respect to magnesium. There was no change in the rate of oxidation at high magnesium acetate concentrations, whereas the rate of NADH2 oxidation increased at higher concentrations of MgSO4. PMID:5636829

  19. Electrochemical oxidation of dihydronicotinamide adenine dinucleotide at nitrogen-doped carbon nanotube electrodes.

    Science.gov (United States)

    Goran, Jacob M; Favela, Carlos A; Stevenson, Keith J

    2013-10-01

    Nitrogen-doped carbon nanotubes (N-CNTs) substantially lower the overpotential necessary for dihydronicotinamide adenine dinucleotide (NADH) oxidation compared to nondoped CNTs or traditional carbon electrodes such as glassy carbon (GC). We observe a 370 mV shift in the peak potential (Ep) from GC to CNTs and another 170 mV shift from CNTs to 7.4 atom % N-CNTs in a sodium phosphate buffer solution (pH 7.0) with 2.0 mM NADH (scan rate 10 mV/s). The sensitivity of 7.4 atom % N-CNTs to NADH was measured at 0.30 ± 0.04 A M(-1) cm(-2), with a limit of detection at 1.1 ± 0.3 μM and a linear range of 70 ± 10 μM poised at a low potential of -0.32 V (vs Hg/Hg2SO4). NADH fouling, known to occur to the electrode surface during NADH oxidation, was investigated by measuring both the change in Ep and the resulting loss of electrode sensitivity. NADH degradation, known to occur in phosphate buffer, was characterized by absorbance at 340 nm and correlated with the loss of NADH electroactivity. N-CNTs are further demonstrated to be an effective platform for dehydrogenase-based biosensing by allowing glucose dehydrogenase to spontaneously adsorb onto the N-CNT surface and measuring the resulting electrode's sensitivity to glucose. The glucose biosensor had a sensitivity of 0.032 ± 0.003 A M(-1) cm(-2), a limit of detection at 6 ± 1 μM, and a linear range of 440 ± 50 μM.

  20. The GC-Rich Mitochondrial and Plastid Genomes of the Green Alga Coccomyxa Give Insight into the Evolution of Organelle DNA Nucleotide Landscape

    Energy Technology Data Exchange (ETDEWEB)

    Smith, David Roy; Burki, Fabien; Yamada, Takashi; Grimwood, Jane; Grigoriev, Igor V.; Van Etten, James L.; Keeling, Patrick J.

    2011-05-13

    Most of the available mitochondrial and plastid genome sequences are biased towards adenine and thymine (AT) over guanine and cytosine (GC). Examples of GC-rich organelle DNAs are limited to a small but eclectic list of species, including certain green algae. Here, to gain insight in the evolution of organelle nucleotide landscape, we present the GC-rich mitochondrial and plastid DNAs from the trebouxiophyte green alga Coccomyxa sp. C-169. We compare these sequences with other GC-rich organelle DNAs and argue that the forces biasing them towards G and C are nonadaptive and linked to the metabolic and/or life history features of this species. The Coccomyxa organelle genomes are also used for phylogenetic analyses, which highlight the complexities in trying to resolve the interrelationships among the core chlorophyte green algae, but ultimately favour a sister relationship between the Ulvophyceae and Chlorophyceae, with the Trebouxiophyceae branching at the base of the chlorophyte crown.

  1. Effects of nucleotides and nucleosides on coagulation

    DEFF Research Database (Denmark)

    Bune, Laurids; Thaning, Pia; Johansson, Pär I

    2010-01-01

    Nucleotides, including ADP, ATP and uridine triphosphate (UTP), are discharged profusely in the circulation during many pathological conditions including sepsis. Sepsis can cause hypotension and systemic activation of the coagulation and fibrinolytic systems in humans, which may cause disseminated...... of adenosine, ADP, ATP, UTP or nitric oxide until mean arterial pressure was reduced to approximately 40% of baseline simulating sepsis-induced hypotension. The effect of the infusions on the haemostatic system was evaluated by TEG, and endothelial release of tissue plasminogen activator and plasminogen...... activator inhibitor-1 was measured. In contrast to the other infused substrates, ADP caused a reduction in maximum amplitude (71.4 to 64.2; P

  2. High-spin ferric ions in Saccharomyces cerevisiae vacuoles are reduced to the ferrous state during adenine-precursor detoxification.

    Science.gov (United States)

    Park, Jinkyu; McCormick, Sean P; Cockrell, Allison L; Chakrabarti, Mrinmoy; Lindahl, Paul A

    2014-06-24

    The majority of Fe in Fe-replete yeast cells is located in vacuoles. These acidic organelles store Fe for use under Fe-deficient conditions and they sequester it from other parts of the cell to avoid Fe-associated toxicity. Vacuolar Fe is predominantly in the form of one or more magnetically isolated nonheme high-spin (NHHS) Fe(III) complexes with polyphosphate-related ligands. Some Fe(III) oxyhydroxide nanoparticles may also be present in these organelles, perhaps in equilibrium with the NHHS Fe(III). Little is known regarding the chemical properties of vacuolar Fe. When grown on adenine-deficient medium (A↓), ADE2Δ strains of yeast such as W303 produce a toxic intermediate in the adenine biosynthetic pathway. This intermediate is conjugated with glutathione and shuttled into the vacuole for detoxification. The iron content of A↓ W303 cells was determined by Mössbauer and EPR spectroscopies. As they transitioned from exponential growth to stationary state, A↓ cells (supplemented with 40 μM Fe(III) citrate) accumulated two major NHHS Fe(II) species as the vacuolar NHHS Fe(III) species declined. This is evidence that vacuoles in A↓ cells are more reducing than those in adenine-sufficient cells. A↓ cells suffered less oxidative stress despite the abundance of NHHS Fe(II) complexes; such species typically promote Fenton chemistry. Most Fe in cells grown for 5 days with extra yeast-nitrogen-base, amino acids and bases in minimal medium was HS Fe(III) with insignificant amounts of nanoparticles. The vacuoles of these cells might be more acidic than normal and can accommodate high concentrations of HS Fe(III) species. Glucose levels and rapamycin (affecting the TOR system) affected cellular Fe content. This study illustrates the sensitivity of cellular Fe to changes in metabolism, redox state and pH. Such effects broaden our understanding of how Fe and overall cellular metabolism are integrated.

  3. Analyzing Nicotinamide Adenine Dinucleotide Phosphate Oxidase Activation in Aging and Vascular Amyloid Pathology

    Directory of Open Access Journals (Sweden)

    Helena Radbruch

    2017-07-01

    Full Text Available In aging individuals, both protective as well as regulatory immune functions are declining, resulting in an increased susceptibility to infections as well as to autoimmunity. Nicotinamide adenine dinucleotide phosphate (NADPH oxidase 2-deficiency in immune cell subsets has been shown to be associated with aging. Using intravital marker-free NAD(PH-fluorescence lifetime imaging, we have previously identified microglia/myeloid cells and astrocytes as main cellular sources of NADPH oxidase (NOX activity in the CNS during neuroinflammation, due to an overactivation of NOX. The overactivated NOX enzymes catalyze the massive production of the highly reactive O2−, which initiates in a chain reaction the overproduction of diverse reactive oxygen species (ROS. Age-dependent oxidative distress levels in the brain and their cellular sources are not known. Furthermore, it is unclear whether in age-dependent diseases oxidative distress is initiated by overproduction of ROS or by a decrease in antioxidant capacity, subsequently leading to neurodegeneration in the CNS. Here, we compare the activation level of NOX enzymes in the cerebral cortex of young and aged mice as well as in a model of vascular amyloid pathology. Despite the fact that a striking change in the morphology of microglia can be detected between young and aged individuals, we find comparable low-level NOX activation both in young and old mice. In contrast, aged mice with the human APPE693Q mutation, a model for cerebral amyloid angiopathy (CAA, displayed increased focal NOX overactivation in the brain cortex, especially in tissue areas around the vessels. Despite activated morphology in microglia, NOX overactivation was detected only in a small fraction of these cells, in contrast to other pathologies with overt inflammation as experimental autoimmune encephalomyelitis (EAE or glioblastoma. Similar to these pathologies, the astrocytes majorly contribute to the NOX overactivation in the brain

  4. Pengaruh Berbagai Konsentrasi Benzil Adenin dan Asam Naftalen Asetat pada Kultur In Vitro Singkong (Manihot Esculenta Crantz.)

    OpenAIRE

    Ardian, Ardian; Kresna, Kresna; Agustiansyah, Agustiansyah

    2012-01-01

    Propagation of cassava through in vitro culture is needed by farmers and agro industries to fulfill the need of the best and the newest clone as soon as after it is released by government. The objective of this research was to know the effects of the application of some concentrations of benzyl adenine and naphthalene acetic acid on in vitro growth and multiplication of micro-shoot of cassava. Explants used were one-node green cuttings of cassava, which were derived from cutting seedling. Thi...

  5. In vitro plant regeneration system for common bean (Phaseolus vulgaris): effect of N6-benzylaminopurine and adenine sulphate

    OpenAIRE

    Gatica Arias,Andrés M; Muñoz Valverde,Jenny; Ramírez Fonseca,Pilar; Valdez Melara,Marta

    2010-01-01

    A method for regeneration of the commercially important common bean (Phaseolus vulgaris ) using N6-benzylaminopurine(BAP) and adenine sulphate (AS) was established. Embryogenic axes of the Costa Rican common bean cultivars Bribrí, Brunca, Guaymí, Huetar and Telire were cultured on Murashige and Skoog medium supplemented with 100 mgl-1 myo-inositol, 1 mgl-1 thiamine, 30 gl-1 sucrose, BAP (0, 5 and 10 mgl-1), AS (0, 20 and 40 mgl-1) and 8 gl-1 agar. Regardless of the concentration of BAP and AS...

  6. Identification of malic enzyme mutants depending on 1,2,3-triazole moiety-containing nicotinamide adenine dinucleotide analogs.

    Science.gov (United States)

    Hou, Shuhua; Ji, Debin; Liu, Wujun; Wang, Lei; Zhao, Zongbao Kent

    2014-03-01

    An activity screening between 1,2,3-triazole moiety-containing nicotinamide adenine dinucleotide (NAD) analogs and malic enzyme (ME) mutants identified some mutants capable of taking NAD analogs as the cofactor. One particular pair, ME-L310K/L404S and the analog B-8 had good catalytic efficiency and cofactor specificity. The new system gained about 1200-fold cofactor specificity shift from NAD toward B-8 in terms of oxidative decarboxylation of l-malate. Our results provided insightful information for the development of orthogonal redox system that is of particular important to precisely control engineered metabolic pathways. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Formation of Amino Acids and Nucleotide Bases in a Titan Atmosphere Simulation Experiment

    Science.gov (United States)

    Yelle, R.V.; Buch, A.; Carrasco, N.; Cernogora, G.; Dutuit, O.; Quirico, E.; Sciamma-O'Brien, E.; Smith, M.A.; Somogyi, Á.; Szopa, C.; Thissen, R.; Vuitton, V.

    2012-01-01

    Abstract The discovery of large (>100 u) molecules in Titan's upper atmosphere has heightened astrobiological interest in this unique satellite. In particular, complex organic aerosols produced in atmospheres containing C, N, O, and H, like that of Titan, could be a source of prebiotic molecules. In this work, aerosols produced in a Titan atmosphere simulation experiment with enhanced CO (N2/CH4/CO gas mixtures of 96.2%/2.0%/1.8% and 93.2%/5.0%/1.8%) were found to contain 18 molecules with molecular formulae that correspond to biological amino acids and nucleotide bases. Very high-resolution mass spectrometry of isotopically labeled samples confirmed that C4H5N3O, C4H4N2O2, C5H6N2O2, C5H5N5, and C6H9N3O2 are produced by chemistry in the simulation chamber. Gas chromatography–mass spectrometry (GC-MS) analyses of the non-isotopic samples confirmed the presence of cytosine (C4H5N3O), uracil (C5H4N2O2), thymine (C5H6N2O2), guanine (C5H5N5O), glycine (C2H5NO2), and alanine (C3H7NO2). Adenine (C5H5N5) was detected by GC-MS in isotopically labeled samples. The remaining prebiotic molecules were detected in unlabeled samples only and may have been affected by contamination in the chamber. These results demonstrate that prebiotic molecules can be formed by the high-energy chemistry similar to that which occurs in planetary upper atmospheres and therefore identifies a new source of prebiotic material, potentially increasing the range of planets where life could begin. Key Words: Astrochemistry—Planetary atmospheres—Titan—Astrobiology. Astrobiology 12, 809–817. PMID:22917035

  8. Formation of amino acids and nucleotide bases in a Titan atmosphere simulation experiment.

    Science.gov (United States)

    Hörst, S M; Yelle, R V; Buch, A; Carrasco, N; Cernogora, G; Dutuit, O; Quirico, E; Sciamma-O'Brien, E; Smith, M A; Somogyi, A; Szopa, C; Thissen, R; Vuitton, V

    2012-09-01

    The discovery of large (>100 u) molecules in Titan's upper atmosphere has heightened astrobiological interest in this unique satellite. In particular, complex organic aerosols produced in atmospheres containing C, N, O, and H, like that of Titan, could be a source of prebiotic molecules. In this work, aerosols produced in a Titan atmosphere simulation experiment with enhanced CO (N(2)/CH(4)/CO gas mixtures of 96.2%/2.0%/1.8% and 93.2%/5.0%/1.8%) were found to contain 18 molecules with molecular formulae that correspond to biological amino acids and nucleotide bases. Very high-resolution mass spectrometry of isotopically labeled samples confirmed that C(4)H(5)N(3)O, C(4)H(4)N(2)O(2), C(5)H(6)N(2)O(2), C(5)H(5)N(5), and C(6)H(9)N(3)O(2) are produced by chemistry in the simulation chamber. Gas chromatography-mass spectrometry (GC-MS) analyses of the non-isotopic samples confirmed the presence of cytosine (C(4)H(5)N(3)O), uracil (C(5)H(4)N(2)O(2)), thymine (C(5)H(6)N(2)O(2)), guanine (C(5)H(5)N(5)O), glycine (C(2)H(5)NO(2)), and alanine (C(3)H(7)NO(2)). Adenine (C(5)H(5)N(5)) was detected by GC-MS in isotopically labeled samples. The remaining prebiotic molecules were detected in unlabeled samples only and may have been affected by contamination in the chamber. These results demonstrate that prebiotic molecules can be formed by the high-energy chemistry similar to that which occurs in planetary upper atmospheres and therefore identifies a new source of prebiotic material, potentially increasing the range of planets where life could begin.

  9. Palindromic nucleotide analysis in human T cell receptor rearrangements.

    Directory of Open Access Journals (Sweden)

    Santosh K Srivastava

    Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

  10. Effects of High Levels of DNA Adenine Methylation on Methyl-Directed Mismatch Repair in ESCHERICHIA COLI

    Science.gov (United States)

    Pukkila, Patricia J.; Peterson, Janet; Herman, Gail; Modrich, Paul; Meselson, Matthew

    1983-01-01

    Two methods were used in an attempt to increase the efficiency and strand selectivity of methyl-directed mismatch repair of bacteriophage λ heteroduplexes in E. coli. Previous studies of such repair used λ DNA that was only partially methylated as the source of methylated chains. Also, transfection was carried out in methylating strains. Either of these factors might have been responsible for the incompleteness of the strand selectivity observed previously. In the first approach to increasing strand selectivity, heteroduplexes were transfected into a host deficient in methylation, but no changes in repair frequencies were observed. In the second approach, heteroduplexes were prepared using DNA that had been highly methylated in vitro with purified DNA adenine methylase as the source of methylated chains. In heteroduplexes having a repairable cI/+ mismatch, strand selectivity was indeed enhanced. In heteroduplexes with one chain highly methylated and the complementary chain unmethylated, the frequency of repair on the unmethylated chain increased to nearly 100%. Heteroduplexes with both chains highly methylated were not repaired at a detectable frequency. Thus, chains highly methylated by DNA adenine methylase were refractory to mismatch repair by this system, regardless of the methylation of the complementary chain. These results support the hypothesis that methyl-directed mismatch repair acts to correct errors of replication, thus lowering the mutation rate. PMID:6225697

  11. Kinetic and thermodynamic study of the reaction catalyzed by glucose-6-phosphate dehydrogenase with nicotinamide adenine dinucleotide

    International Nuclear Information System (INIS)

    Martin del Campo, Julia S.; Patino, Rodrigo

    2011-01-01

    Research highlights: → The reaction catalyzed by one enzyme of the pentose phosphate pathway was studied. → A spectrophotometric method is proposed for kinetic and thermodynamic analysis. → The pH and the temperature influences are reported on physical chemical properties. → Relative concentrations of substrates are also important in the catalytic process. - Abstract: The enzyme glucose-6-phosphate dehydrogenase (G6PD, EC 1.1.1.49) from Leuconostoc mesenteroides has a dual coenzyme specificity with oxidized nicotinamide adenine dinucleotide (NAD ox ) and oxidized nicotinamide adenine dinucleotide phosphate as electron acceptors. The G6PD coenzyme selection is determined by the metabolic cellular prevailing conditions. In this study a kinetic and thermodynamic analysis is presented for the reaction catalyzed by G6PD from L. mesenteroides with NAD ox as coenzyme in phosphate buffer. For this work, an in situ spectrophotometric technique was employed based on the detection of one product of the reaction. Substrate and coenzyme concentrations as well as temperature and pH effects were evaluated. The apparent equilibrium constant, the Michaelis constant, and the turnover number were determined as a function of each experimental condition. The standard transformed Gibbs energy of reaction was determined from equilibrium constants at different initial conditions. For the product 6-phospho-D-glucono-1,5-lactone, a value of the standard Gibbs energy of formation is proposed, Δ f G o = -1784 ± 5 kJ mol -1 .

  12. Characterization of a DNA Adenine Methyltransferase Gene of Borrelia hermsii and Its Dispensability for Murine Infection and Persistence.

    Science.gov (United States)

    James, Allison E; Rogovskyy, Artem S; Crowley, Michael A; Bankhead, Troy

    2016-01-01

    DNA methyltransferases have been implicated in the regulation of virulence genes in a number of pathogens. Relapsing fever Borrelia species harbor a conserved, putative DNA methyltransferase gene on their chromosome, while no such ortholog can be found in the annotated genome of the Lyme disease agent, Borrelia burgdorferi. In the relapsing fever species Borrelia hermsii, the locus bh0463A encodes this putative DNA adenine methyltransferase (dam). To verify the function of the BH0463A protein product as a Dam, the gene was cloned into a Dam-deficient strain of Escherichia coli. Restriction fragment analysis subsequently demonstrated that complementation of this E. coli mutant with bh0463A restored adenine methylation, verifying bh0463A as a Dam. The requirement of bh0463A for B. hermsii viability, infectivity, and persistence was then investigated by genetically disrupting the gene. The dam- mutant was capable of infecting immunocompetent mice, and the mean level of spirochetemia in immunocompetent mice was not significantly different from wild type B. hermsii. Collectively, the data indicate that dam is dispensable for B. hermsii viability, infectivity, and persistence.

  13. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H

    1996-01-01

    The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

  14. Gum Acacia Improves Renal Function and Ameliorates Systemic Inflammation, Oxidative and Nitrosative Stress in Streptozotocin-Induced Diabetes in Rats with Adenine-Induced Chronic Kidney Disease

    Directory of Open Access Journals (Sweden)

    Mohammed Al Za’abi

    2018-03-01

    Full Text Available Background/Aims: The effect of treatment with gum acacia (GA, a prebiotic shown previously to ameliorate chronic kidney disease (CKD, in diabetic and non – diabetic rats with adenine – induced CKD has been investigated using several conventional and novel physiological, biochemical, and histopathological parameters. Methods: Diabetes mellitus was induced in rats by a single injection of streptozotocin (STZ. Diabetic and non – diabetic rats were randomly divided into several groups, and given either normal food or food mixed with adenine (0.25% w/w, for five weeks to induce CKD. Some of these groups were also concomitantly treated orally with GA in the drinking water (15% w/w. Results: Rats fed adenine alone exhibited physiological (decreased body weight, increased food and water intake and urine output, biochemical (increase in urinary albumin/creatinine ratio, plasma urea and, creatinine, indoxyl sulfate and phosphorus, inflammatory biomarkers (increased in neutrophil gelatinase-associated lipocalin, transforming growth factor beta -1, tumor necrosis factor alpha, adiponectin, cystatin C and interleukin-1β, oxidative biomarkers (8-isoprostane, 8 -hydroxy -2-deoxy guanosine, nitrosative stress biomarkers (nitrite and nitrate and histopathological (increase in tubular necrosis and fibrosis signs of CKD. STZ - induced diabetes alone worsened most of the renal function tests measured. Administration of adenine in STZ – diabetic rats further worsened the renal damage induced by adenine alone. GA significantly ameliorated the renal actions of adenine and STZ, given either singly or in combination, especially with regards to the histopathological damage. Conclusion: GA is a useful dietary agent in attenuating the progression of CKD in rats with streptozotocin-induced diabetes.

  15. Cyclic nucleotide specific phosphodiesterases of Leishmania major

    Directory of Open Access Journals (Sweden)

    Linder Markus

    2006-03-01

    Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range

  16. Adenine sulfate effect on shoot formation of Phaseolus vulgaris L. cultivar `CIAP7247F' via indirect organogenesis

    OpenAIRE

    Novisel Veitía; Lourdes R García; Amanda Martirena Ramírez; Idalmis Bermúdez Caraballoso; Raúl Collado; Damaris Torres; Carlos Romero

    2015-01-01

    This study aimed to determine the effect of adenine sulfate in plant regeneration from callus of Phaseolus vulgaris L. cultivar `CIAP 7247F'. To this, it was added two concentrations (20 and 40 mg l-1) adenine sulfate to the regeneration culture medium and it was included a control to form a total of three treatments. The number of formed shoots was quantified by treatment in the regeneration culture medium and the height of shoot was measured in elongation medium. It was determined that the ...

  17. Crystal structure of a complex between lumiflavin and 2,6-diamino-9-ethylpurine: a flavin adenine dinucleotide model exhibiting charge-transfer interactions.

    Science.gov (United States)

    Scarbrough, F E; Shieh, H; Voet, D

    1976-11-01

    The x-ray structure of the deep red crystalline complex lumiflavin-2,6-diamino-9-ethylpurine has been determined. The flavin and adenine derivatives form hydrogen-bonded base pairs of the Watson-Crick type. The molecules in the crystal also associate via extensively overlapped flavin/adenine and flavin/flavin stacking interactions in which there are several contacts that are closer than van der Waals distances. This, together with the red color of the crystals, is indicative of the formation of a charge-transfer complex.

  18. Genotype-dependent variability in flow cytometric evaluation of reduced nicotinamide adenine dinucleotide phosphate oxidase function in patients with chronic granulomatous disease.

    Science.gov (United States)

    Vowells, S J; Fleisher, T A; Sekhsaria, S; Alling, D W; Maguire, T E; Malech, H L

    1996-01-01

    We studied phagocyte reduced nicotinamide adenine dinucleotide phosphate function to evaluate production of reactive oxygen species in both X-linked and autosomal forms of chronic granulomatous disease. We found a consistent and significant difference between the activated granulocyte response of the X-linked (gp91-phagocyte oxidase) form of chronic granulomatous disease (n = 18) and that of the most common autosomal recessive (p47-phagocyte oxidase) form of the disease (n = 17). The data indicate that mutations in the p47-phagocyte oxidase component of the reduced nicotinamide adenine dinucleotide phosphate oxidase component do not completely prevent oxidation despite severe defects in superoxide generation.

  19. Genetic Control of Biosynthesis and Transport of Riboflavin and Flavin Nucleotides and Construction of Robust Biotechnological Producers†

    Science.gov (United States)

    Abbas, Charles A.; Sibirny, Andriy A.

    2011-01-01

    Summary: Riboflavin [7,8-dimethyl-10-(1′-d-ribityl)isoalloxazine, vitamin B2] is an obligatory component of human and animal diets, as it serves as the precursor of flavin coenzymes, flavin mononucleotide, and flavin adenine dinucleotide, which are involved in oxidative metabolism and other processes. Commercially produced riboflavin is used in agriculture, medicine, and the food industry. Riboflavin synthesis starts from GTP and ribulose-5-phosphate and proceeds through pyrimidine and pteridine intermediates. Flavin nucleotides are synthesized in two consecutive reactions from riboflavin. Some microorganisms and all animal cells are capable of riboflavin uptake, whereas many microorganisms have distinct systems for riboflavin excretion to the medium. Regulation of riboflavin synthesis in bacteria occurs by repression at the transcriptional level by flavin mononucleotide, which binds to nascent noncoding mRNA and blocks further transcription (named the riboswitch). In flavinogenic molds, riboflavin overproduction starts at the stationary phase and is accompanied by derepression of enzymes involved in riboflavin synthesis, sporulation, and mycelial lysis. In flavinogenic yeasts, transcriptional repression of riboflavin synthesis is exerted by iron ions and not by flavins. The putative transcription factor encoded by SEF1 is somehow involved in this regulation. Most commercial riboflavin is currently produced or was produced earlier by microbial synthesis using special selected strains of Bacillus subtilis, Ashbya gossypii, and Candida famata. Whereas earlier RF overproducers were isolated by classical selection, current producers of riboflavin and flavin nucleotides have been developed using modern approaches of metabolic engineering that involve overexpression of structural and regulatory genes of the RF biosynthetic pathway as well as genes involved in the overproduction of the purine precursor of riboflavin, GTP. PMID:21646432

  20. Genetic control of biosynthesis and transport of riboflavin and flavin nucleotides and construction of robust biotechnological producers.

    Science.gov (United States)

    Abbas, Charles A; Sibirny, Andriy A

    2011-06-01

    Riboflavin [7,8-dimethyl-10-(1'-d-ribityl)isoalloxazine, vitamin B₂] is an obligatory component of human and animal diets, as it serves as the precursor of flavin coenzymes, flavin mononucleotide, and flavin adenine dinucleotide, which are involved in oxidative metabolism and other processes. Commercially produced riboflavin is used in agriculture, medicine, and the food industry. Riboflavin synthesis starts from GTP and ribulose-5-phosphate and proceeds through pyrimidine and pteridine intermediates. Flavin nucleotides are synthesized in two consecutive reactions from riboflavin. Some microorganisms and all animal cells are capable of riboflavin uptake, whereas many microorganisms have distinct systems for riboflavin excretion to the medium. Regulation of riboflavin synthesis in bacteria occurs by repression at the transcriptional level by flavin mononucleotide, which binds to nascent noncoding mRNA and blocks further transcription (named the riboswitch). In flavinogenic molds, riboflavin overproduction starts at the stationary phase and is accompanied by derepression of enzymes involved in riboflavin synthesis, sporulation, and mycelial lysis. In flavinogenic yeasts, transcriptional repression of riboflavin synthesis is exerted by iron ions and not by flavins. The putative transcription factor encoded by SEF1 is somehow involved in this regulation. Most commercial riboflavin is currently produced or was produced earlier by microbial synthesis using special selected strains of Bacillus subtilis, Ashbya gossypii, and Candida famata. Whereas earlier RF overproducers were isolated by classical selection, current producers of riboflavin and flavin nucleotides have been developed using modern approaches of metabolic engineering that involve overexpression of structural and regulatory genes of the RF biosynthetic pathway as well as genes involved in the overproduction of the purine precursor of riboflavin, GTP.

  1. The conformation of 23S rRNA nucleotide A2058 determines its recognition by the ErmE methyltransferase

    DEFF Research Database (Denmark)

    Vester, B; Hansen, L H; Douthwaite, S

    1995-01-01

    The ErmE methyltransferase confers resistance to MLS antibiotics by specifically dimethylating adenine 2058 (A2058, Escherichia coli numbering) in bacterial 23S rRNA. To define nucleotides in the rRNA that are part of the motif recognized by ErmE, we investigated both in vivo and in vitro...... the effects of mutations around position A2058 on methylation. Mutagenizing A2058 (to G or U) completely abolishes methylation of 23S rRNA by ErmE. No methylation occurred at other sites in the rRNA, demonstrating the fidelity of ErmE for A2058. Breaking the neighboring G2057-C2611 Watson-Crick base pair...... and it was shown that the A2057 and U2611 mutations alone and in combination alter the reactivity of A2058 and adjacent bases. However, mutagenizing position G-->A2032 in an adjacent loop, which has been implicated to interact with A2058, alters neither the ErmE methylation at A2058 nor the accessibility...

  2. Molecular dynamics and binding selectivity of nucleotides and polynucleotide substrates with EIF2C2/Ago2 PAZ domain.

    Science.gov (United States)

    Kandeel, Mahmoud; Kitade, Yukio

    2018-02-01

    RNA interference (RNAi) constitutes a major target in drug discovery. Recently, we reported that the Argonaute protein 2 (Ago2) PAZ domain selectively binds with all ribonucleotides except adenine and poorly recognizes deoxyribonucleotides. The binding properties of the PAZ domain with polynucleotides and the molecular mechanisms of substrates' selectivity remains unclear. In this study, the binding potencies of polynucleotides and the associated conformational and dynamic changes in PAZ domain are investigated. Coinciding with nucleotides' binding profile with the PAZ domain, polyuridylate (PolyU) and polycytidylate (PolyC) were potent binders. However, K dPolyU and K dPolyC were 15.8 and 9.3μM, respectively. In contrast, polyadenylate (PolyA) binding was not detectable. Molecular dynamics (MD) simulation revealed the highest change in root mean square deviation (RMSD) with ApoPAZ or PAZ domain bound with experimentally approved, low affinity substrates, whereas stronger binding substrates such as UMP or PolyU showed minimal RMSD changes. The loop between α3 and β5 in the β-hairpin subdomain showed the most responsive change in RMSD, being highly movable in the ApoPAZ and PAZ-AMP complex. Favorable substrate recognition was associate with moderate change in secondary structure content. In conclusion, the PAZ domain retains differential substrate selectivity associated with corresponding dynamic and structural changes upon binding. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

    African Journals Online (AJOL)

    Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

  4. Supplementary Material for: The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara

    2016-01-01

    Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  5. Condensing the information in DNA with double-headed nucleotides

    DEFF Research Database (Denmark)

    Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

    2017-01-01

    A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

  6. Nucleotide-Induced Conformational Changes in Escherichia coli DnaA Protein Are Required for Bacterial ORC to Pre-RC Conversion at the Chromosomal Origin.

    Science.gov (United States)

    Saxena, Rahul; Vasudevan, Sona; Patil, Digvijay; Ashoura, Norah; Grimwade, Julia E; Crooke, Elliott

    2015-11-24

    DnaA oligomerizes when bound to origins of chromosomal replication. Structural analysis of a truncated form of DnaA from Aquifex aeolicus has provided insight into crucial conformational differences within the AAA+ domain that are specific to the ATP- versus ADP- bound form of DnaA. In this study molecular docking of ATP and ADP onto Escherichia coli DnaA, modeled on the crystal structure of Aquifex aeolicus DnaA, reveals changes in the orientation of amino acid residues within or near the vicinity of the nucleotide-binding pocket. Upon limited proteolysis with trypsin or chymotrypsin ADP-DnaA, but not ATP-DnaA generated relatively stable proteolytic fragments of various sizes. Examined sites of limited protease susceptibility that differ between ATP-DnaA and ADP-DnaA largely reside in the amino terminal half of DnaA. The concentration of adenine nucleotide needed to induce conformational changes, as detected by these protease susceptibilities of DnaA, coincides with the conversion of an inactive bacterial origin recognition complex (bORC) to a replication efficient pre-replication complex (pre-RC) at the E. coli chromosomal origin of replication (oriC).

  7. Nucleotide-Induced Conformational Changes in Escherichia coli DnaA Protein Are Required for Bacterial ORC to Pre-RC Conversion at the Chromosomal Origin

    Directory of Open Access Journals (Sweden)

    Rahul Saxena

    2015-11-01

    Full Text Available DnaA oligomerizes when bound to origins of chromosomal replication. Structural analysis of a truncated form of DnaA from Aquifex aeolicus has provided insight into crucial conformational differences within the AAA+ domain that are specific to the ATP- versus ADP- bound form of DnaA. In this study molecular docking of ATP and ADP onto Escherichia coli DnaA, modeled on the crystal structure of Aquifex aeolicus DnaA, reveals changes in the orientation of amino acid residues within or near the vicinity of the nucleotide-binding pocket. Upon limited proteolysis with trypsin or chymotrypsin ADP-DnaA, but not ATP-DnaA generated relatively stable proteolytic fragments of various sizes. Examined sites of limited protease susceptibility that differ between ATP-DnaA and ADP-DnaA largely reside in the amino terminal half of DnaA. The concentration of adenine nucleotide needed to induce conformational changes, as detected by these protease susceptibilities of DnaA, coincides with the conversion of an inactive bacterial origin recognition complex (bORC to a replication efficient pre-replication complex (pre-RC at the E. coli chromosomal origin of replication (oriC.

  8. Isolation of adenine salts in the gas phase from a liquid beam of aqueous solutions by IR laser irradiation

    Science.gov (United States)

    Kohno, J.-Y.; Mafuné, F.; Kondow, T.

    2002-09-01

    A continuous liquid flow in a vacuum (a liquid beam) of an aqueous solution of adenine salt containing hydrochloric acid or sodium hydroxide was irradiated with an intense pulsed IR laser at 3 μm, which is resonant to a vibrational mode related to the OH stretch vibration of H2O. Neutral species isolated into the vacuum were ionized by a pulsed UV laser at 270 nm, and the product ions were mass-analyzed by a time-of-flight mass spectrometer. It is found that AH2^{2+}{\\cdot}2Cl^- and [ A iH] ^{i-}{\\cdot} iNa^+ (i=1 3) are isolated in the vacuum from the aqueous acidic and alkaline solutions, respectively, under irradiation of the IR laser, and undergo four-photon ionization involving decomposition and proton transfer of the intermediate species under irradiation of the UV laser.

  9. Function of Ubiquinone in Electron Transport from Reduced Nicotinamide Adenine Dinucleotide to Nitrate and Oxygen in Aerobacter aerogenes

    Science.gov (United States)

    Knook, D. L.; Planta, R. J.

    1971-01-01

    The possible role of quinones in the electron transport system of Aerobacter aerogenes was investigated. The only quinone found in measurable amounts in bacteria grown in minimal media under both aerobic and anaerobic conditions was ubiquinone-8. Membrane-bound ubiquinone-8 could be removed by extraction with pentane, or destroyed by ultraviolet irradiation, with a concomitant loss of both reduced nicotinamide adenine dinucleotide (NADH) oxidase and NADH-linked respiratory nitrate reductase activity. In the extracted membrane preparations, these enzymatic activities could be restored, both to the same degree, by incorporation of ubiquinone-6, -8, or -10, but not by incorporation of menaquinones. The NADH oxidation and the nitrate reduction were sensitive to the respiratory inhibitors dicoumarol, lapachol, and cyanide. The results obtained indicate that ubiquinone-8 mediates the electron transport between NADH and oxygen as well as between NADH and nitrate. Branching of the electron transport chain to oxygen and nitrate occurs after an initial common pathway. PMID:4100202

  10. Simultaneous quantitation of nicotinamide riboside, nicotinamide mononucleotide and nicotinamide adenine dinucleotide in milk by a novel enzyme-coupled assay.

    Science.gov (United States)

    Ummarino, Simone; Mozzon, Massimo; Zamporlini, Federica; Amici, Adolfo; Mazzola, Francesca; Orsomando, Giuseppe; Ruggieri, Silverio; Raffaelli, Nadia

    2017-04-15

    Nicotinamide riboside, the most recently discovered form of vitamin B3, and its phosphorylated form nicotinamide mononucleotide, have been shown to be potent supplements boosting intracellular nicotinamide adenine dinucleotide (NAD) levels, thus preventing or ameliorating metabolic and mitochondrial diseases in mouse models. Here we report for the first time on the simultaneous quantitation of nicotinamide riboside, nicotinamide mononucleotide and NAD in milk by means of a fluorometric, enzyme-coupled assay. Application of this assay to milk from different species revealed that the three vitamers were present in human and donkey milk, while being selectively distributed in the other milks. Human milk was the richest source of nicotinamide mononucleotide. Overall, the three vitamers accounted for a significant fraction of total vitamin B3 content. Pasteurization did not affect the bovine milk content of nicotinamide riboside, whereas UHT processing fully destroyed the vitamin. In human milk, NAD levels were significantly affected by the lactation time. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Effects of low-molecular-weight-chitosan on the adenine-induced chronic renal failure rats in vitro and in vivo

    Science.gov (United States)

    Zhi, Xuan; Han, Baoqin; Sui, Xianxian; Hu, Rui; Liu, Wanshun

    2015-02-01

    The effects of low-molecular-weight-chitosan (LMWC) on chronic renal failure (CRF) rats induced by adenine were investigated in vivo and in vitro. Chitosan were hydrolyzed using chitosanase at pH 6-7 and 37° for 24 h to obtain LMWC. In vitro, the effect of LMWC on the proliferation of renal tubular epithelial cells (RTEC) showed that it had no cytotoxic effect and could promote cell growth. For the in vivo experiment, chronic renal failure rats induced by adenine were randomly divided into control group, Niaoduqing group, and high-, medium- and low-dose LMWC groups. For each group, we detected serum creatinine (SCR), blood urea nitrogen (BUN), and total superoxide dismutase (T-SOD), glutathione oxidase (GSH-Px) activities of renal tissue, and obtained the ratio of kidney weight/body weight, pathological changes of kidney. The levels of serum SCR, BUN were higher in the adenine-induced rats than those in the control group, indicating that the rat chronic renal failure model worked successfully. The results after treatment showed that LMWC could reduce the SCR and BUN levels and enhance the activities/levels of T-SOD and GSH-PX in kidney compared to control group. Histopathological examination revealed that adenine-induced renal alterations were restored by LMWC at three tested dosages, especially at the low dosage of 100 mg kg-1 d-1.

  12. Effect of aqueous extract and anthocyanins of calyces of Hibiscus sabdariffa (Malvaceae) in rats with adenine-induced chronic kidney disease.

    Science.gov (United States)

    Ali, Badreldin H; Cahliková, Lucie; Opletal, Lubomir; Karaca, Turan; Manoj, Priyadarsini; Ramkumar, Aishwarya; Al Suleimani, Yousuf M; Al Za'abi, Mohammed; Nemmar, Abderrahim; Chocholousova-Havlikova, Lucie; Locarek, Miroslav; Siatka, Tomas; Blunden, Gerald

    2017-09-01

    The aim of this work was to assess the possible beneficial effects of aqueous extracts of Hibiscus sabdariffa L. calyces and anthocyanins isolated therefrom in an adenine-induced chronic kidney disease (CKD) model. Rats were orally given, for 28 consecutive days, either adenine alone or together with either aqueous extract of H. sabdariffa calyces (5 and 10%) or anthocyanins (50, 100 and 200 mg/kg of anthocyanin concentrate). For comparative purposes, two groups of rats were given lisinopril (10 mg/kg). When either H. sabdariffa aqueous extract or the anthocyanins isolated from it was administered along with adenine, the adverse effects of adenine-induced CKD were significantly lessened, mostly in a dose-dependent manner. The positive effects were similar to those obtained by administration of lisinopril. The results obtained show that both H. sabdariffa and its anthocyanins could be considered as possible promising safe dietary agents that could be used to attenuate the progression of human CKD. This could have added significance as H. sabdariffa tea is widely consumed in many parts of Africa and Asia and is thus readily available. © 2017 Royal Pharmaceutical Society.

  13. Application of elimination voltammetry to the resolution of adenine and cytosine signals in oligonucleotides. I. Homooligodeoxynucleotides dA9 and dC9

    Czech Academy of Sciences Publication Activity Database

    Trnková, L.; Jelen, František; Postbieglová, Irena

    2003-01-01

    Roč. 15, č. 19 (2003), s. 1529-1535 ISSN 1040-0397 R&D Projects: GA AV ČR IAA1163201; GA ČR GA203/02/0422 Institutional research plan: CEZ:AV0Z5004920 Keywords : adenine * cytosine * oligonucleotides Subject RIV: BO - Biophysics Impact factor: 1.811, year: 2003

  14. The effect of swimming exercise on adenine-induced kidney disease in rats, and the influence of curcumin or lisinopril thereon.

    Directory of Open Access Journals (Sweden)

    Badreldin H Ali

    Full Text Available Patients with chronic kidney disease (CKD have been reported to benefit from different types of exercises. It has also been shown that the ACE inhibitor lisinopril, and the natural product curcumin are also beneficial in different models of CKD in rats. We assessed the influence of moderate swimming exercise (SE on rats with adenine-induced CKD, and tested the possible effects of lisinopril and/or curcumin thereon using several physiological, biochemical, histopathological and immunohistochemical parameters. Rats (either sedentary or subjected to SE were randomly divided into several groups, and given for five weeks either normal food or food mixed with adenine (0.25% w/w to induce CKD. Some of these groups were also concomitantly treated orally with curcumin (75 mg/kg, or lisinopril (10 mg/kg and were subjected to moderate SE (45 min/day three days each week. Rats fed adenine showed the typical biochemical, histopathological signs of CKD such as elevations in blood pressure, urinary albumin / creatinine ratio, and plasma urea, creatinine, indoxyl sulfate and phosphorus. SE, curcumin or lisinopril, given singly, significantly ameliorated all the adenine-induced actions. Administering curcumin or lisinopril with SE improved the histopathology of the kidneys, a salutary effect not seen with SE alone. Combining SE to the nephroprotective agents' curcumin or lisinopril might offer additional nephroprotection.

  15. Synthetic Nucleotides as Probes of DNA Polymerase Specificity

    Directory of Open Access Journals (Sweden)

    Jason M. Walsh

    2012-01-01

    Full Text Available The genetic code is continuously expanding with new nucleobases designed to suit specific research needs. These synthetic nucleotides are used to study DNA polymerase dynamics and specificity and may even inhibit DNA polymerase activity. The availability of an increasing chemical diversity of nucleotides allows questions of utilization by different DNA polymerases to be addressed. Much of the work in this area deals with the A family DNA polymerases, for example, Escherichia coli DNA polymerase I, which are DNA polymerases involved in replication and whose fidelity is relatively high, but more recent work includes other families of polymerases, including the Y family, whose members are known to be error prone. This paper focuses on the ability of DNA polymerases to utilize nonnatural nucleotides in DNA templates or as the incoming nucleoside triphosphates. Beyond the utility of nonnatural nucleotides as probes of DNA polymerase specificity, such entities can also provide insight into the functions of DNA polymerases when encountering DNA that is damaged by natural agents. Thus, synthetic nucleotides provide insight into how polymerases deal with nonnatural nucleotides as well as into the mutagenic potential of nonnatural nucleotides.

  16. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Directory of Open Access Journals (Sweden)

    Simon Reed

    2012-09-01

    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  17. Cyclic nucleotide content of tobacco BY-2 cells.

    Science.gov (United States)

    Richards, Helen; Das, Swadipa; Smith, Christopher J; Pereira, Louisa; Geisbrecht, Alan; Devitt, Nicola J; Games, David E; van Geyschem, Jan; Gareth Brenton, A; Newton, Russell P

    2002-11-01

    The cyclic nucleotide content of cultured tobacco bright yellow-2 (BY-2) cells was determined, after freeze-killing, perchlorate extraction and sequential chromatography, by radioimmunoassay. The identities of the putative cyclic nucleotides, adenosine 3',5'-cyclic monophosphate (cyclic AMP), guanosine 3',5'-cyclic monophosphate (cyclic GMP) and cytidine 3',5'-cyclic monophosphate (cyclic CMP) were unambiguously confirmed by tandem mass spectrometry. The potential of BY-2 cell cultures as a model system for future investigations of cyclic nucleotide function in higher plants is discussed.

  18. Overview of the application of nucleotide in aquaculture

    Directory of Open Access Journals (Sweden)

    Hoang Do Huu

    2016-10-01

    Full Text Available Although long history application in infant formula, dietary nucleotide supplementation has been used only recently in the evaluation of growth performance, stress and pathogen resistance in aquaculture species. This paper addresses the present knowledge of the use of nucleotide supplemented in the diet for culture species. Research reveals that dietary nucleotide may have significant impact and is recommended to add to the feed of aquatic species to get better performance. However, more studies should also be conducted to have better understandings on dose requirement, duration of application, impact on different life stage and under different environmental stress and pathogens. Further study should also examine the effects of dietary nucleotide supplementation of intestinal microbiota and gut morphology, and immune response of aquaculture species.

  19. Enzymatic Incorporation of Modified Purine Nucleotides in DNA.

    Science.gov (United States)

    Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet

    2017-12-14

    A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Complete nucleotide sequence and organization of the mitogenome ...

    African Journals Online (AJOL)

    Phylogenetic reconstruction using the concatenated 13 amino acid and nucleotide sequences of the protein-coding genes (PCGs) consistently supported a close relationship between Bombycoidea and Geometroidea among six available lepidopteran superfamilies (Tortricoidea, Pyraloidea, Papilionoidea, Bombycoidea, ...

  1. Extracellular nucleotide derivatives protect cardiomyctes against hypoxic stress

    DEFF Research Database (Denmark)

    Golan, O; Issan, Y; Isak, A

    2011-01-01

    assures cardioprotection. Treatment with extracellular nucleotides, or with tri/di-phosphate, administered under normoxic conditions or during hypoxic conditions, led to a decrease in reactive oxygen species production. CONCLUSIONS: Extracellular tri/di-phosphates are apparently the molecule responsible...

  2. Nucleotide Metabolism and its Control in Lactic Acid Bacteria

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal

    2005-01-01

    Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including...... the interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods...... for manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....

  3. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin

    2013-01-01

    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from...

  4. Microsporidia: Why Make Nucleotides if You Can Steal Them?

    Directory of Open Access Journals (Sweden)

    Paul Dean

    2016-11-01

    Full Text Available Microsporidia are strict obligate intracellular parasites that infect a wide range of eukaryotes including humans and economically important fish and insects. Surviving and flourishing inside another eukaryotic cell is a very specialised lifestyle that requires evolutionary innovation. Genome sequence analyses show that microsporidia have lost most of the genes needed for making primary metabolites, such as amino acids and nucleotides, and also that they have only a limited capacity for making adenosine triphosphate (ATP. Since microsporidia cannot grow and replicate without the enormous amounts of energy and nucleotide building blocks needed for protein, DNA, and RNA biosynthesis, they must have evolved ways of stealing these substrates from the infected host cell. Providing they can do this, genome analyses suggest that microsporidia have the enzyme repertoire needed to use and regenerate the imported nucleotides efficiently. Recent functional studies suggest that a critical innovation for adapting to intracellular life was the acquisition by lateral gene transfer of nucleotide transport (NTT proteins that are now present in multiple copies in all microsporidian genomes. These proteins are expressed on the parasite surface and allow microsporidia to steal ATP and other purine nucleotides for energy and biosynthesis from their host. However, it remains unclear how other essential metabolites, such as pyrimidine nucleotides, are acquired. Transcriptomic and experimental studies suggest that microsporidia might manipulate host cell metabolism and cell biological processes to promote nucleotide synthesis and to maximise the potential for ATP and nucleotide import. In this review, we summarise recent genomic and functional data relating to how microsporidia exploit their hosts for energy and building blocks needed for growth and nucleic acid metabolism and we identify some remaining outstanding questions.

  5. Recognition and repair of the CC-1065-(N3-Adenine)-DNA adduct by the UVRABC nuclease

    International Nuclear Information System (INIS)

    Tang, M.; Lee, C.S.; Doisy, R.; Ross, L.; Needham-VanDevanter, D.R.; Hurley, L.H.

    1988-01-01

    The recognition and repair of the helix-stabilizing and relatively nondistortive CC-1065-(N3-adenine)-DNA adduct by UVRABC nuclease has been investigated both in vivo with phi X174RFI DNA by a transfection assay and in vitro by a site-directed adduct in a 117 base pair fragment from M13mp1. CC-1065 is a potent antitumor antibiotic produced by Streptomyces zelensis which binds within the minor groove of DNA through N3 of adenine. In contrast to the helix-destabilizing and distortive modifications of DNA caused by ultraviolet light or N-acetoxy-2-(acetylamino)fluorene, CC-1065 increases the melting point of DNA and decreases the S1 nuclease activity. Using a viral DNA-Escherichia coli transfection system, the authors have found that the uvrA, uvrB, and uvrC genes, which code for the major excision repair proteins for UV- and NAAAF-induced DNA damage, are also involved in the repair of CC-1065-DNA adducts. In contrast, the uvrD gene product, which has been found to be involved in the repair of UV damage, has no effect in repairing CC-1065-DNA adducts. Purified UVRA, UVRB, and UVRC proteins must work in concert to incise the drug-modified phi X174RFI DNA. Using a site-directed and multiple CC-1065 modified (MspI-BstNI) 117 base pair fragment from M13mp1, they have found that UVRABC nuclease incises at the eight phosphodiester bond on the 5' side of the CC-1065-DNA adduct on the drug-modified strand. The enzymes do not cut the noncovalently modified strand. The DNA sequence and/or helix-stabilizing effect of multiple adducts may determine the recognition and/or incision of the drug-DNA adduct by UVRABC nuclease. These results are discussed in relation to the structure of the CC-1065-DNA adduct and the effect of drug binding on local DNA structure

  6. The Tomato Nucleotide-binding Leucine-rich Repeat (NLR) Immune Receptor I-2 Couples DNA-Binding to Nucleotide-Binding Domain Nucleotide Exchange

    NARCIS (Netherlands)

    Fenyk, S.; Dixon, C.H.; Gittens, W.H.; Townsend, P.D.; Sharples, G.J.; Pålsson, L.O.; Takken, F.L.W.; Cann, M.J.

    2016-01-01

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognise and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception.

  7. Effects of nucleotides and nucleotide analogue inhibitors of HIV-1 reverse transcriptase in a ratchet model of polymerase translocation.

    Science.gov (United States)

    Götte, Matthias

    2006-01-01

    A single cycle of nucleotide incorporation by the reverse transcriptase of the human immunodeficiency virus type 1 (HIV-1 RT) involves the initial binding of an incoming nucleotide, a conformational change that traps the substrate, the formation of a new phosphodiester bond, the release of pyrophosphate (PPi), and ultimately polymerase translocation, which clears the nucleotide binding site. This article reviews different mechanistic models for polymerase translocation with emphasis placed on HIV-1 RT. Structure-function analyses of stalled complexes of HIV-1 RT provide strong evidence to suggest that the enzyme can oscillate between pre- and post-translocational states. Nucleotide hydrolysis is not required for the movement of the polymerase in a stalled configuration; thermal energy is sufficient to allow random bidirectional sliding. The next complementary nucleotide, following the incorporated chain-terminator, acts like a pawl of a ratchet that traps the enzyme in the post-translocation state and prevents the reverse movement. Quantitative footprinting experiments have shown that the concentration of the templated nucleotide required to shift the translocational equilibrium forward depends crucially on the structure of the 3'end of the primer. Changes in the relative population of pre- and post-translocation complexes can influence rates of excision of incorporated NRTIs, which, in turn, affects drug susceptibility. The concept of a ratchet model of HIV-1 RT translocation and its implications for drug action and resistance, and the discovery and development of novel antiviral compounds is discussed.

  8. Pharmacokinetic and antiretroviral activity in mice of oral [P(1),P(2)-bis[2-(adenin-9-yl)ethoxymethyl]phosphonate], a prodrug of 9-(2-phosphonylmethoxyethyl)adenine.

    Science.gov (United States)

    Rossi, Luigia; Dominici, Sabrina; Serafini, Sonja; Casabianca, Anna; Cerasi, Aurora; Chiarantini, Laura; Celeste, Angela Gabriela; Cappellacci, Loredana; Franchetti, Palmarisa; Grifantini, Mario; Magnani, Mauro

    2002-09-01

    9-(2-Phosphonylmethoxyethyl)adenine (PMEA) is an antiviral drug with activity against herpes viruses, Epstein-Barr virus and retroviruses, including the human immunodeficiency virus. Unfortunately, oral PMEA administration, as required for long-term therapy, is hindered by its low bioavailability. In the present study, the synthesis, oral bioavailability and antiretroviral activity of a new prodrug of PMEA, consisting of two molecules of PMEA bound together by a P-O-P bond (Bis-PMEA), are reported. Pharmacokinetic experiments in mice showed that the oral bioavailabilities of PMEA following oral gavage of Bis-PMEA or PMEA (at a dose equivalent to 28 mg of PMEA/kg) were 50.8 and 13.5%, respectively. These results correlate with the antiviral efficacy of Bis-PMEA administered orally at a dose equivalent to 50 mg/kg of PMEA in C57 BL/6 mice infected with the retroviral complex LP-BM5. Oral treatment with Bis-PMEA proved to be more effective than oral treatment with PMEA given at equimolar doses. Moreover, oral Bis-PMEA was more effective than intraperitoneal PMEA (50 mg/kg) in reducing lymphoadenopathy, hypergammaglobulinaemia and lymph node proviral DNA content, overall in the first weeks post virus inoculation. Bis-PMEA thus appears to be an efficient oral prodrug of PMEA without significant toxicity, at least in this mouse model.

  9. Phosphate-Modified Nucleotides for Monitoring Enzyme Activity.

    Science.gov (United States)

    Ermert, Susanne; Marx, Andreas; Hacker, Stephan M

    2017-04-01

    Nucleotides modified at the terminal phosphate position have been proven to be interesting entities to study the activity of a variety of different protein classes. In this chapter, we present various types of modifications that were attached as reporter molecules to the phosphate chain of nucleotides and briefly describe the chemical reactions that are frequently used to synthesize them. Furthermore, we discuss a variety of applications of these molecules. Kinase activity, for instance, was studied by transfer of a phosphate modified with a reporter group to the target proteins. This allows not only studying the activity of kinases, but also identifying their target proteins. Moreover, kinases can also be directly labeled with a reporter at a conserved lysine using acyl-phosphate probes. Another important application for phosphate-modified nucleotides is the study of RNA and DNA polymerases. In this context, single-molecule sequencing is made possible using detection in zero-mode waveguides, nanopores or by a Förster resonance energy transfer (FRET)-based mechanism between the polymerase and a fluorophore-labeled nucleotide. Additionally, fluorogenic nucleotides that utilize an intramolecular interaction between a fluorophore and the nucleobase or an intramolecular FRET effect have been successfully developed to study a variety of different enzymes. Finally, also some novel techniques applying electron paramagnetic resonance (EPR)-based detection of nucleotide cleavage or the detection of the cleavage of fluorophosphates are discussed. Taken together, nucleotides modified at the terminal phosphate position have been applied to study the activity of a large diversity of proteins and are valuable tools to enhance the knowledge of biological systems.

  10. Uncaria tomentosa extract alters the catabolism of adenine nucleotides and expression of ecto-5'-nucleotidase/CD73 and P2X7 and A1 receptors in the MDA-MB-231 cell line.

    Science.gov (United States)

    Santos, Karen Freitas; Gutierres, Jessié Martins; Pillat, Micheli Mainardi; Rissi, Vitor Braga; Santos Araújo, Maria do Carmo Dos; Bertol, Gustavo; Gonçalves, Paulo Bayard Dias; Schetinger, Maria Rosa Chitolina; Morsch, Vera Maria

    2016-12-24

    Uncaria tomentosa (Willd.) DC. (Rubiaceae) (Ut), also known as cat's claw, is a woody liana widely spread throughout the Amazon rainforest of Central and South America, containing many chemical constituents such as oxindole alkaloids, which are responsible for various biological activities. Since ancient times, the indigenous people of Peru have used it as a bark infusion for the treatment of a wide range of health problems gastric ulcers, arthritis and rheumatism. Recently, Ut is distributed worldwide and used as an immunomodulatory and anti-inflammatory herbal remedy. Additionally, U. tomentosa also has antitumural activity. However, little is known about the action of U. tomentosa on the purinergic system mechanisms, which is involved in tumor progression. Considering the pharmacological properties of U. tomentosa, we sought to evaluate the hydroalcoholic extract U tomentosa is able to influence the purinergic system in breast cancer cells, MDA-MB-231. Through the activity and expression of ectonucleotidases (NTPDase - CD39; Ecto-5'-nucleotidase - CD73) and purinergic repceptores (P2X7 and A1). A hydroalcoholic extract was prepared in two concentrations, 250 and 500μg/mL. (Ut250; Ut500). The effect of these concentrations on the activity and expression of ectonucleotidases, as well as on the density of purinergic receptors were investigated in MDA-MB-231 breast cancer cells. Cells were treated with the hydroalcoholic extract of Uncaria tomentosa and/or doxorubicin (Doxo 1μM; Ut250+Doxo; Ut500+Doxo) for 24h. Although the results were not significant for the hydrolysis of the ATP, they presented an increase in the ADP hydrolysis in the Ut500+Doxo group when compared to the control group. Additionally, the activity of 5'-nucleotidase was inhibited in all groups when compared with the untreated group of cells. Inhibition of the enzyme was more evident in groups with U. tomentosa per se. The expression of CD39 was increased in the Ut250 and Ut250+Doxo groups when compared to the control group. No changes were found in the CD73 expression. Furthermore, a reduction in the density of the P2X7 receptor in all treated groups was detected. On the other hand, the density of the A1 receptor increased in all groups compared to the control group, with the exception of the Ut500+Doxo group. Therefore, we conclude that hydroalcoholic extract of U. tomentosa may be responsible for the reduction of adenosine levels in the extracellular medium, which accelerates tumor progression. Interestingly, the dysregulation of A1 and P2X7 receptors in the MDA-MB-231 cells exacerbate the proliferation of this cells and U. tomentosa treatment may be stimulate the antitumor activity of adenosine A1 receptor and control the P2X7 effects. Our study demonstrates the significant participation of purinergic pathway in the regulation of MDA-MB-231 progression; additionally, U. tomentosa treatment alone or combined with chemotherapy may favor the action of doxorubicin. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  11. In vivo study of the effect of antiviral acyclic nucleotide phosphonate (R)-9-[2 -(phosphonomethoxy)propyl]adenine (PMPA, tenofovir) and its prodrug tenofovir disoproxil fumarate on rat microsomal cytochrome P450

    Czech Academy of Sciences Publication Activity Database

    Anzenbacherová, E.; Anzenbacher, P.; Zídek, Zdeněk; Buchar, Evžen; Kmoníčková, Eva; Potměšil, Petr; Nekvindová, J.; Veinlichová, A.; Holý, Antonín

    2008-01-01

    Roč. 57, č. 5 (2008), s. 761-767 ISSN 0862-8408 R&D Projects: GA MŠk 1M0508 Institutional research plan: CEZ:AV0Z50390512; CEZ:AV0Z40550506 Keywords : Tenofovir * PMPA * Cytochrome P450 Subject RIV: CE - Biochemistry Impact factor: 1.653, year: 2008

  12. New Method for Double-Resonance Spectroscopy in a Cold Quadrupole Ion Trap and Its Application to UV-UV Hole-Burning Spectroscopy of Protonated Adenine Dimer.

    Science.gov (United States)

    Kang, Hyuk; Féraud, Géraldine; Dedonder-Lardeux, Claude; Jouvet, Christophe

    2014-08-07

    A novel method for double-resonance spectroscopy in a cold quadrupole ion trap is presented, which utilizes dipolar resonant excitation of fragment ions in the quadrupole ion trap. Photofragments by a burn laser are removed by applying an auxiliary RF to the trap, and a probe laser detects the depletion of photofragments by the burn laser. By scanning the wavelength of the burn laser, conformation-specific UV spectrum of a cold ion is obtained. This simple and powerful method is applicable to any type of double-resonance spectroscopy in a cold quadrupole ion trap and was applied to UV-UV hole-burning spectroscopy of protonated adenine dimer. It was found that protonated adenine dimer has multiple conformers/tautomers, each with multiple excited states with drastically different excited state dynamics.

  13. Electron-transfer studies with a new flavin adenine dinucleotide dependent glucose dehydrogenase and osmium polymers of different redox potentials.

    Science.gov (United States)

    Zafar, Muhammad Nadeem; Wang, Xiaoju; Sygmund, Christoph; Ludwig, Roland; Leech, Dónal; Gorton, Lo

    2012-01-03

    A new extracellular flavin adenine dinucleotide (FAD)-dependent glucose dehydrogenase from Glomerella cingulata (GcGDH) was electrochemically studied as a recognition element in glucose biosensors. The redox enzyme was recombinantly produced in Pichia pastoris and homogeneously purified, and its glucose-oxidizing properties on spectrographic graphite electrodes were investigated. Six different Os polymers, the redox potentials of which ranged in a broad potential window between +15 and +489 mV versus the normal hydrogen electrode (NHE), were used to immobilize and "wire" GcGDH to the spectrographic graphite electrode's surface. The GcGDH/Os polymer modified electrodes were evaluated by chronoamperometry using flow injection analysis. The current response was investigated using a stepwisely increased applied potential. It was observed that the ratio of GcGDH/Os polymer and the overall loading of the enzyme electrode significantly affect the performance of the enzyme electrode for glucose oxidation. The best-suited Os polymer [Os(4,4'-dimethyl-2,2'-bipyridine)(2)(PVI)Cl](+) had a potential of +309 mV versus NHE, and the optimum GcGDH/Os polymer ratio was 1:2 yielding a maximum current density of 493 μA·cm(-2) at a 30 mM glucose concentration. © 2011 American Chemical Society

  14. Purification and characterization of the enzymes involved in nicotinamide adenine dinucleotide degradation by Penicillium brevicompactum NRC 829.

    Science.gov (United States)

    Ali, Thanaa Hamed; El-Ghonemy, Dina Helmy

    2016-06-01

    The present study was conducted to investigate a new pathway for the degradation of nicotinamide adenine dinucleotide (NAD) by Penicillium brevicompactum NRC 829 extracts. Enzymes involved in the hydrolysis of NAD, i.e. alkaline phosphatase, aminohydrolase and glycohydrolase were determined. Alkaline phosphatase was found to catalyse the sequential hydrolysis of two phosphate moieties of NAD molecule to nicotinamide riboside plus adenosine. Adenosine was then deaminated by aminohydrolase to inosine and ammonia. While glycohydrolase catalyzed the hydrolysis of the nicotinamide-ribosidic bond of NAD+ to produce nicotinamide and ADP-ribose in equimolar amounts, enzyme purification through a 3-step purification procedure revealed the existence of two peaks of alkaline phosphatases, and one peak contained deaminase and glycohydrolase activities. NAD deaminase was purified to homogeneity as estimated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis with an apparent molecular mass of 91 kDa. Characterization and determination of some of NAD aminohydrolase kinetic properties were conducted due to its biological role in the regulation of cellular NAD level. The results also revealed that NAD did not exert its feedback control on nicotinamide amidase produced by P. brevicompactum.

  15. Photosensitized oxidation of nicotinamide adenine dinucleotide by diethoxyphosphorus(V)tetraphenylporphyrin and its fluorinated derivative: Possibility of chain reaction

    Science.gov (United States)

    Hirakawa, Kazutaka; Murata, Atsushi

    2018-01-01

    Water-soluble porphyrins, diethoxyphosphorus(V)tetraphenylporphyrin (EtP(V)TPP) and its fluorinated analogue (FEtP(V)TPP), decreased the typical absorption around 340 nm of nicotinamide adenine dinucleotide (NADH) under visible light irradiation, indicating oxidative decomposition. A singlet oxygen quencher, sodium azide, and a triplet quencher, potassium iodide, slightly inhibited photosensitized NADH oxidation. However, these inhibitory effects were very small. Furthermore, the fluorescence lifetime of these P(V)porphyrins was decreased by NADH, suggesting the contribution of electron transfer to the singlet excited (S1) state of P(V)porphyrin. The redox potential measurement supports the electron transfer-mediated oxidation of NADH. The quantum yields of NADH photodecomposition by P(V)porphyrins could be estimated from the kinetic data and the effect of these quenchers on NADH oxidation. The obtained values suggest that the electron accepting by the S1 states of P(V)porphyrins triggers a chain reaction of NADH oxidation. This photosensitized reaction may play an important role in the photocytotoxicity of P(V)porphyrins. The axial ligand fluorination of P(V)porphyrins improved electron accepting ability. However, fluorination slightly suppressed static interaction with NADH, resulting in decreased oxidation quantum yield.

  16. Mitochondrial nicotinamide adenine dinucleotide reduced (NADH) oxidation links the tricarboxylic acid (TCA) cycle with methionine metabolism and nuclear DNA methylation.

    Science.gov (United States)

    Lozoya, Oswaldo A; Martinez-Reyes, Inmaculada; Wang, Tianyuan; Grenet, Dagoberto; Bushel, Pierre; Li, Jianying; Chandel, Navdeep; Woychik, Richard P; Santos, Janine H

    2018-04-18

    Mitochondrial function affects many aspects of cellular physiology, and, most recently, its role in epigenetics has been reported. Mechanistically, how mitochondrial function alters DNA methylation patterns in the nucleus remains ill defined. Using a cell culture model of induced mitochondrial DNA (mtDNA) depletion, in this study we show that progressive mitochondrial dysfunction leads to an early transcriptional and metabolic program centered on the metabolism of various amino acids, including those involved in the methionine cycle. We find that this program also increases DNA methylation, which occurs primarily in the genes that are differentially expressed. Maintenance of mitochondrial nicotinamide adenine dinucleotide reduced (NADH) oxidation in the context of mtDNA loss rescues methionine salvage and polyamine synthesis and prevents changes in DNA methylation and gene expression but does not affect serine/folate metabolism or transsulfuration. This work provides a novel mechanistic link between mitochondrial function and epigenetic regulation of gene expression that involves polyamine and methionine metabolism responding to changes in the tricarboxylic acid (TCA) cycle. Given the implications of these findings, future studies across different physiological contexts and in vivo are warranted.

  17. Molecular simulation of flavin adenine dinucleotide immobilized on charged single-walled carbon nanotubes for biosensor applications.

    Science.gov (United States)

    Yang, Guang; Kang, Zhengzhong; Ye, Xuesong; Wu, Tao; Zhu, Qin

    2012-12-01

    The reconstitution of apo-glucose oxidase (apo-GOx) on single-walled carbon nanotubes (SWNTs) functionalized with the cofactor, flavin adenine dinucleotide (FAD), greatly improved electron transfer turnover rate of the redox reactions in glucose sensing with glucose sensors. The research reported here is aimed to better understand molecular details of affection of the charging SWNT to the conformational changes of FAD, in order to find a rational design and selection scheme of SWNT which is suitable for the FAD and apo-GOx to perform their reconstitution. In this report, molecular simulations of FAD functionalized differently charged SWNTs were carried outin an aqueous environment, with counterions to maintain total charge neutrality. The conformation and orientation changes were observed by both trajectory and quantitative analyses. The simulation results showed that in both uncharged and positively charged SWNT situations, FAD adsorbed onto SWNT at the end of the simulations, which increased the steric resistance of molecules and hindered the reconstitution of apo-GOx and FAD to some degree. By contrast, FAD functionalized negatively charged SWNT maintained its original conformation largely. In addition, negatively charged SWNT may be the best choice for electron transfer mediator for the reconstitution of apo-GOx on relay-cofactor units associated with electrodes. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Regulation of the Salmonella enterica std fimbrial operon by DNA adenine methylation, SeqA, and HdfR.

    Science.gov (United States)

    Jakomin, Marcello; Chessa, Daniela; Bäumler, Andreas J; Casadesús, Josep

    2008-11-01

    DNA adenine methylase (dam) mutants of Salmonella enterica serovar Typhimurium grown under laboratory conditions express the std fimbrial operon, which is tightly repressed in the wild type. Here, we show that uncontrolled production of Std fimbriae in S. enterica serovar Typhimurium dam mutants contributes to attenuation in mice, as indicated by the observation that an stdA dam strain is more competitive than a dam strain upon oral infection. Dam methylation appears to regulate std transcription, rather than std mRNA stability or turnover. A genetic screen for std regulators showed that the GATC-binding protein SeqA directly or indirectly represses std expression, while the poorly characterized yifA gene product serves as an std activator. YifA encodes a putative LysR-like protein and has been renamed HdfR, like its Escherichia coli homolog. Activation of std expression by HdfR is observed only in dam and seqA backgrounds. These data suggest that HdfR directly or indirectly activates std transcription. Since SeqA is unable to bind nonmethylated DNA, it is possible that std operon derepression in dam and seqA mutants may result from unconstrained HdfR-mediated activation of std transcription. Derepression of std in dam and seqA mutants of S. enterica occurs in only a fraction of the bacterial population, suggesting the occurrence of either bistable expression or phase variation.

  19. Synthesis, conformational analysis, and biological activity of new analogues of thiazole-4-carboxamide adenine dinucleotide (TAD) as IMP dehydrogenase inhibitors.

    Science.gov (United States)

    Franchetti, Palmarisa; Cappellacci, Loredana; Pasqualini, Michela; Petrelli, Riccardo; Jayaprakasan, Vetrichelvan; Jayaram, Hiremagalur N; Boyd, Donald B; Jain, Manojkumar D; Grifantini, Mario

    2005-03-15

    Thiazole-4-carboxamide adenine dinucleotide (TAD) analogues T-2'-MeAD (1) and T-3'-MeAD (2) containing, respectively, a methyl group at the ribose 2'-C-, and 3'-C-position of the adenosine moiety, were prepared as potential selective human inosine monophosphate dehydrogenase (IMPDH) type II inhibitors. The synthesis of heterodinucleotides was carried out by CDI-catalyzed coupling reaction of unprotected 2'-C-methyl- or 3'-C-methyl-adenosine 5'-monophosphate with 2',3'-O-isopropylidene-tiazofurin 5'-monophosphate, and then deisopropylidenation. Biological evaluation of dinucleotides 1 and 2 as inhibitors of recombinant human IMPDH type I and type II resulted in a good activity. Inhibition of both isoenzymes by T-2'-MeAD and T-3'-MeAD was noncompetitive with respect to NAD substrate. Binding of T-3'-MeAD was comparable to that of parent compound TAD, while T-2'-MeAD proved to be a weaker inhibitor. However, no significant difference was found in inhibition of the IMPDH isoenzymes. T-2'-MeAD and T-3'-MeAD were found to inhibit the growth of K562 cells (IC(50) 30.7 and 65.0muM, respectively).

  20. Blue light induced reactive oxygen species from flavin mononucleotide and flavin adenine dinucleotide on lethality of HeLa cells.

    Science.gov (United States)

    Yang, Ming-Yeh; Chang, Chih-Jui; Chen, Liang-Yü

    2017-08-01

    Photodynamic therapy (PDT) is a safe and non-invasive treatment for cancers and microbial infections. Various photosensitizers and light sources have been developed for clinical cancer therapies. Flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD) are the cofactor of enzymes and are used as photosensitizers in this study. Targeting hypoxia and light-triggering reactive oxygen species (ROS) are experimental strategies for poisoning tumor cells in vitro. HeLa cells are committed to apoptosis when treated with FMN or FAD and exposed to visible blue light (the maximum emitted wavelength of blue light is 462nm). Under blue light irradiation at 3.744J/cm 2 (=0.52mW/cm 2 irradiated for 2h), the minimal lethal dose is 3.125μM and the median lethal doses (LD 50 ) for FMN and FAD are 6.5μM and 7.2μM, respectively. Individual exposure to visible blue light irradiation or riboflavin photosensitizers does not produce cytotoxicity and no side effects are observed in this study. The western blotting results also show that an intrinsic apoptosis pathway is activated by the ROS during photolysis of riboflavin analogues. Blue light triggers the cytotoxicity of riboflavins on HeLa cells in vitro. Based on these results, this is a feasible and efficient of PDT with an intrinsic photosensitizer for cancer research. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Structure of a eukaryotic cyclic nucleotide-gated channel

    Science.gov (United States)

    Li, Minghui; Zhou, Xiaoyuan; Wang, Shu; Michailidis, Ioannis; Gong, Ye; Su, Deyuan; Li, Huan; Li, Xueming; Yang, Jian

    2018-01-01

    Summary Cyclic nucleotide-gated (CNG) channels are essential for vision and olfaction. They belong to the voltage-gated ion channel superfamily but their activities are controlled by intracellular cyclic nucleotides instead of transmembrane voltage. Here we report a 3.5 Å-resolution single-particle electron cryomicroscopy structure of a CNG channel from C. elegans in the cGMP-bound open state. The channel has an unusual voltage-sensor-like domain (VSLD), accounting for its deficient voltage dependence. A C-terminal linker connecting S6 and the cyclic nucleotide-binding domain interacts directly with both the VSLD and pore domain, forming a gating ring that couples conformational changes triggered by cyclic nucleotide binding to the gate. The selectivity filter is lined by the carboxylate side chains of a functionally important glutamate and three rings of backbone carbonyls. This structure provides a new framework for understanding mechanisms of ion permeation, gating and channelopathy of CNG channels and cyclic nucleotide modulation of related channels. PMID:28099415

  2. Deficiency of the iron-sulfur clusters of mitochondrial reduced nicotinamide-adenine dinucleotide-ubiquinone oxidoreductase (complex I) in an infant with congenital lactic acidosis.

    OpenAIRE

    Moreadith, R W; Batshaw, M L; Ohnishi, T; Kerr, D; Knox, B; Jackson, D; Hruban, R; Olson, J; Reynafarje, B; Lehninger, A L

    1984-01-01

    We report the case of an infant with hypoglycemia, progressive lactic acidosis, an increased serum lactate/pyruvate ratio, and elevated plasma alanine, who had a moderate to profound decrease in the ability of mitochondria from four organs to oxidize pyruvate, malate plus glutamate, citrate, and other NAD+-linked respiratory substrates. The capacity to oxidize the flavin adenine dinucleotide-linked substrate, succinate, was normal. The most pronounced deficiency was in skeletal muscle, the le...

  3. High-NaCl Diet Aggravates Cardiac Injury in Rats with Adenine-Induced Chronic Renal Failure and Increases Serum Troponin T Levels

    DEFF Research Database (Denmark)

    Kashioulis, Pavlos; Hammarsten, Ola; Marcussen, Niels

    2016-01-01

    correlation between the degree of LV fibrosis and serum cTnT levels in ACRF rats (r = 0.81, p diet in rats with ACRF produces LV injury and aggravates increases in serum cTnT levels, presumably by causing hypertension-induced small artery lesions leading......AIMS: To examine the effects of 2 weeks of high-NaCl diet on left ventricular (LV) morphology and serum levels of cardiac troponin T (cTnT) in rats with adenine-induced chronic renal failure (ACRF). METHODS: Male Sprague-Dawley rats either received chow containing adenine or were pair......-fed an identical diet without adenine [controls (C)]. Approximately 10 weeks after the beginning of the study, the rats were randomized to either remain on a normal NaCl diet (NNa; 0.6%) or to be switched to high-NaCl chow (HNa; 4%) for 2 weeks, after which acute experiments were performed. RESULTS: Rats with ACRF...

  4. Binding of p-mercaptobenzoic acid and adenine to gold-coated electroless etched silicon nanowires studied by surface-enhanced Raman scattering.

    Science.gov (United States)

    Mohaček-Grošev, Vlasta; Gebavi, Hrvoje; Bonifacio, Alois; Sergo, Valter; Daković, Marko; Bajuk-Bogdanović, Danica

    2018-04-10

    Modern diagnostic tools ever aim to reduce the amount of analyte and the time needed for obtaining the result. Surface-enhanced Raman spectroscopy is a method that could satisfy both of these requirements, provided that for each analyte an adequate substrate is found. Here we demonstrate the ability of gold-sputtered silicon nanowires (SiNW) to bind p-mercaptobenzoic acid in 10 -3 , 10 -4 and 10 -5 M and adenine in 30 and 100μM concentrations. Based on the normal mode analysis, presented here for the first time, the binding of p-mercaptobenzoic acid is deduced. The intensity enhancement of the 1106cm -1 band is explained by involvement of the CS stretching deformation, and the appearance of the broad 300cm -1 band attributed to SAu stretching mode. Adenine SERS spectra demonstrate the existence of the 7H tautomer since the strongest band observed is at 736cm -1 . The adenine binding is likely to occur in several ways, because the number of observed bands in the 1200-1600cm -1 interval exceeds the number of observed bands in the normal Raman spectrum of the free molecule. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Molecular recognition of AT-DNA sequences by the induced CD pattern of dibenzotetraaza[14]annulene (DBTAA)–adenine derivatives

    Science.gov (United States)

    Stojković, Marijana Radić; Škugor, Marko; Dudek, Łukasz; Grolik, Jarosław; Eilmes, Julita

    2014-01-01

    Summary An investigation of the interactions of two novel and several known DBTAA–adenine conjugates with double-stranded DNA and RNA has revealed the DNA/RNA groove as the dominant binding site, which is in contrast to the majority of previously studied DBTAA analogues (DNA/RNA intercalators). Only DBTAA–propyladenine conjugates revealed the molecular recognition of AT-DNA by an ICD band pattern > 300 nm, whereas significant ICD bands did not appear for other ds-DNA/RNA. A structure–activity relation for the studied series of compounds showed that the essential structural features for the ICD recognition are a) the presence of DNA-binding appendages (adenine side chain and positively charged side chain) on both DBTAA side chains, and b) the presence of a short propyl linker, which does not support intramolecular aromatic stacking between DBTAA and adenine. The observed AT-DNA-ICD pattern differs from previously reported ss-DNA (poly dT) ICD recognition by a strong negative ICD band at 350 nm, which allows for the dynamic differentiation between ss-DNA (poly dT) and coupled ds-AT-DNA. PMID:25246976

  6. 19F-labeling of the adenine H2-site to study large RNAs by NMR spectroscopy

    International Nuclear Information System (INIS)

    Sochor, F.; Silvers, R.; Müller, D.; Richter, C.; Fürtig, B.; Schwalbe, H.

    2016-01-01

    In comparison to proteins and protein complexes, the size of RNA amenable to NMR studies is limited despite the development of new isotopic labeling strategies including deuteration and ligation of differentially labeled RNAs. Due to the restricted chemical shift dispersion in only four different nucleotides spectral resolution remains limited in larger RNAs. Labeling RNAs with the NMR-active nucleus 19 F has previously been introduced for small RNAs up to 40 nucleotides (nt). In the presented work, we study the natural occurring RNA aptamer domain of the guanine-sensing riboswitch comprising 73 nucleotides from Bacillus subtilis. The work includes protocols for improved in vitro transcription of 2-fluoroadenosine-5′-triphosphat (2F-ATP) using the mutant P266L of the T7 RNA polymerase. Our NMR analysis shows that the secondary and tertiary structure of the riboswitch is fully maintained and that the specific binding of the cognate ligand hypoxanthine is not impaired by the introduction of the 19 F isotope. The thermal stability of the 19 F-labeled riboswitch is not altered compared to the unmodified sequence, but local base pair stabilities, as measured by hydrogen exchange experiments, are modulated. The characteristic change in the chemical shift of the imino resonances detected in a 1 H, 15 N-HSQC allow the identification of Watson–Crick base paired uridine signals and the 19 F resonances can be used as reporters for tertiary and secondary structure transitions, confirming the potential of 19 F-labeling even for sizeable RNAs in the range of 70 nucleotides

  7. {sup 19}F-labeling of the adenine H2-site to study large RNAs by NMR spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Sochor, F. [Johann Wolfgang Goethe-University Frankfurt, Institut für Organische Chemie und Chemische Biologie, Center for Biomolecular Magnetic Resonance (BMRZ) (Germany); Silvers, R. [Massachusetts Institute of Technology, Department of Chemistry, Francis Bitter Magnet Laboratory (United States); Müller, D.; Richter, C.; Fürtig, B., E-mail: fuertig@nmr.uni-frankfurt.de; Schwalbe, H., E-mail: schwalbe@nmr.uni-frankfurt.de [Johann Wolfgang Goethe-University Frankfurt, Institut für Organische Chemie und Chemische Biologie, Center for Biomolecular Magnetic Resonance (BMRZ) (Germany)

    2016-01-15

    In comparison to proteins and protein complexes, the size of RNA amenable to NMR studies is limited despite the development of new isotopic labeling strategies including deuteration and ligation of differentially labeled RNAs. Due to the restricted chemical shift dispersion in only four different nucleotides spectral resolution remains limited in larger RNAs. Labeling RNAs with the NMR-active nucleus {sup 19}F has previously been introduced for small RNAs up to 40 nucleotides (nt). In the presented work, we study the natural occurring RNA aptamer domain of the guanine-sensing riboswitch comprising 73 nucleotides from Bacillus subtilis. The work includes protocols for improved in vitro transcription of 2-fluoroadenosine-5′-triphosphat (2F-ATP) using the mutant P266L of the T7 RNA polymerase. Our NMR analysis shows that the secondary and tertiary structure of the riboswitch is fully maintained and that the specific binding of the cognate ligand hypoxanthine is not impaired by the introduction of the {sup 19}F isotope. The thermal stability of the {sup 19}F-labeled riboswitch is not altered compared to the unmodified sequence, but local base pair stabilities, as measured by hydrogen exchange experiments, are modulated. The characteristic change in the chemical shift of the imino resonances detected in a {sup 1}H,{sup 15}N-HSQC allow the identification of Watson–Crick base paired uridine signals and the {sup 19}F resonances can be used as reporters for tertiary and secondary structure transitions, confirming the potential of {sup 19}F-labeling even for sizeable RNAs in the range of 70 nucleotides.

  8. Compositions and methods for detecting single nucleotide polymorphisms

    Energy Technology Data Exchange (ETDEWEB)

    Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.

    2016-11-22

    Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.

  9. Effect of nucleotides on broiler performance and carcass yield

    Directory of Open Access Journals (Sweden)

    VC Pelícia

    2010-03-01

    Full Text Available This study aimed at evaluating the effect of nucleotides on the performance and carcass yield of broilers fed diets with no antibiotic growth promoters (AGP, anticoccidials, or animal feedstuffs. In the trial, 600 Ross 308 male broilers were distributed in a completely randomized experimental design into six treatments with four replicates of 25 birds each. Treatments consisted of a control diet (CD, CD + AGP, CD + 0.04%, CD + 0.05%, CD + 0.06%, and CD + 0.07% nucleotides. The experimental diets did not contain anticoccidials, and birds were vaccinated against coccidiosis at three days of age. No significant differences were detected among broilers submitted to the different treatments in none of the studied parameters. Under the conditions of this experiment, diets supplemented with nucleotides did not influence broiler performance or carcass yield at 42 days of age, and were not different from the feeds not containing any additive or with AGP.

  10. Correlation between single nucleotide polymorphisms of NADPH oxidase p22phox gene and ischemic stroke in Shanghai Han population

    Directory of Open Access Journals (Sweden)

    Wei XU

    2015-09-01

    Full Text Available Objective This paper aims to investigate the distribution of genotypes and alleles of nicotinamide adenine dinucleotide phosphate (NADPH oxidase p22phox -930A/G, 242C/T and -675A/T, so as to evaluate the association between three single-nucleotide polymorphisms (SNPs and risk of atherosclerotic ischemic stroke in permanent resident population of Han nationality living in Shanghai area. Methods The genotypes and allele frequencies of NADPH oxidase p22phox subunit -930A/G, 242C/T and -675A/T were detected by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP analysis in 205 patients with ischemic stroke and 136 healthy controls. Results In patients with ischemic stroke, the results of PCR-RFLP in variant genetic loci were different. For -930A/G, one band appeared at 268 bp of genotype AA; 2 bands appeared at 197 and 71 bp of genotype GG; 3 bands appeared at 268, 197 and 71 bp of genotype AG. For 242C/T, one band appeared at 348 bp of genotype CC; 2 bands appeared at 188 and 160 bp of genotype TT; 3 bands appeared at 348, 188 and 160 bp of genotype CT. For -675A/T, 2 bands appeared at 158 and 54 bp of genotype TT; 3 bands appeared at 212, 158 and 54 bp of genotype AT. The genotypes and allele frequency of all three SNPs of NADPH oxidase p22phox gene had no significant difference between ischemic stroke patients and healthy controls (P > 0.05. Conclusions The genetic polymorphism of NADPH oxidase p22phox gene -930A/G, 242C/T and -675A/T might have no association with ischemic stroke. DOI: 10.3969/j.issn.1672-6731.2015.09.011

  11. Eliciting the mitochondrial unfolded protein response by nicotinamide adenine dinucleotide repletion reverses fatty liver disease in mice.

    Science.gov (United States)

    Gariani, Karim; Menzies, Keir J; Ryu, Dongryeol; Wegner, Casey J; Wang, Xu; Ropelle, Eduardo R; Moullan, Norman; Zhang, Hongbo; Perino, Alessia; Lemos, Vera; Kim, Bohkyung; Park, Young-Ki; Piersigilli, Alessandra; Pham, Tho X; Yang, Yue; Ku, Chai Siah; Koo, Sung I; Fomitchova, Anna; Cantó, Carlos; Schoonjans, Kristina; Sauve, Anthony A; Lee, Ji-Young; Auwerx, Johan

    2016-04-01

    With no approved pharmacological treatment, nonalcoholic fatty liver disease (NAFLD) is now the most common cause of chronic liver disease in Western countries and its worldwide prevalence continues to increase along with the growing obesity epidemic. Here, we show that a high-fat high-sucrose (HFHS) diet, eliciting chronic hepatosteatosis resembling human fatty liver, lowers hepatic nicotinamide adenine dinucleotide (NAD(+) ) levels driving reductions in hepatic mitochondrial content, function, and adenosine triphosphate (ATP) levels, in conjunction with robust increases in hepatic weight, lipid content, and peroxidation in C57BL/6J mice. To assess the effect of NAD(+) repletion on the development of steatosis in mice, nicotinamide riboside, a precursor of NAD(+) biosynthesis, was added to the HFHS diet, either as a preventive strategy or as a therapeutic intervention. We demonstrate that NR prevents and reverts NAFLD by inducing a sirtuin (SIRT)1- and SIRT3-dependent mitochondrial unfolded protein response, triggering an adaptive mitohormetic pathway to increase hepatic β-oxidation and mitochondrial complex content and activity. The cell-autonomous beneficial component of NR treatment was revealed in liver-specific Sirt1 knockout mice (Sirt1(hep-/-) ), whereas apolipoprotein E-deficient mice (Apoe(-/-) ) challenged with a high-fat high-cholesterol diet affirmed the use of NR in other independent models of NAFLD. Our data warrant the future evaluation of NAD(+) boosting strategies to manage the development or progression of NAFLD. © 2015 The Authors. Hepatology published by Wiley Periodicals, Inc., on behalf of the American Association for the Study of Liver Diseases.

  12. Auxotrophic Actinobacillus pleurpneumoniae grows in multispecies biofilms without the need for nicotinamide-adenine dinucleotide (NAD) supplementation.

    Science.gov (United States)

    Loera-Muro, Abraham; Jacques, Mario; Avelar-González, Francisco J; Labrie, Josée; Tremblay, Yannick D N; Oropeza-Navarro, Ricardo; Guerrero-Barrera, Alma L

    2016-06-27

    Actinobacillus pleuropneumoniae is the etiologic agent of porcine contagious pleuropneumonia, which causes important worldwide economic losses in the swine industry. Several respiratory tract infections are associated with biofilm formation, and A. pleuropneumoniae has the ability to form biofilms in vitro. Biofilms are structured communities of bacterial cells enclosed in a self-produced polymer matrix that are attached to an abiotic or biotic surface. Virtually all bacteria can grow as a biofilm, and multi-species biofilms are the most common form of microbial growth in nature. The goal of this study was to determine the ability of A. pleuropneumoniae to form multi-species biofilms with other bacteria frequently founded in pig farms, in the absence of pyridine compounds (nicotinamide mononucleotide [NMN], nicotinamide riboside [NR] or nicotinamide adenine dinucleotide [NAD]) that are essential for the growth of A. pleuropneumoniae. For the biofilm assay, strain 719, a field isolate of A. pleuropneumoniae serovar 1, was mixed with swine isolates of Streptococcus suis, Bordetella bronchiseptica, Pasteurella multocida, Staphylococcus aureus or Escherichia coli, and deposited in 96-well microtiter plates. Based on the CFU results, A. pleuropneumoniae was able to grow with every species tested in the absence of pyridine compounds in the culture media. Interestingly, A. pleuropneumoniae was also able to form strong biofilms when mixed with S. suis, B. bronchiseptica or S. aureus. In the presence of E. coli, A. pleuropneumoniae only formed a weak biofilm. The live and dead populations, and the matrix composition of multi-species biofilms were also characterized using fluorescent markers and enzyme treatments. The results indicated that poly-N-acetyl-glucosamine remains the primary component responsible for the biofilm structure. In conclusion, A. pleuropneumoniae apparently is able to satisfy the requirement of pyridine compounds through of other swine pathogens by

  13. Signal-enhanced electrochemiluminescence immunosensor based on synergistic catalysis of nicotinamide adenine dinucleotide hydride and silver nanoparticles.

    Science.gov (United States)

    Wang, Guangjie; Jin, Feng; Dai, Nan; Zhong, Zhaoyang; Qing, Yi; Li, Mengxia; Yuan, Ruo; Wang, Dong

    2012-03-01

    A new metal-organic nanocomposite with synergistic catalysis function was prepared and developed to construct an electrochemiluminescence (ECL) immunosensor for ultrasensitive detection of tumor biomarker CA125. Silver nanoparticles (AgNPs) and nicotinamide adenine dinucleotide hydride (NADH) that can participate and catalyze the ECL reaction of Ru(bpy)(3)(2+) were employed as the metal component and the organic component to synthesize the metal-organic nanocomposite of NADH-AgNPs (NA). The novel ECL immunosensor was assembled via Ru(bpy)(3)(2+)-doped silica nanoparticles (Ru-SiO(2)) modified electrode with the NA as immune labels. First, the chitosan-suspended Ru-SiO(2) nanoparticles were cast on the gold electrode surface to immobilize the ECL probes of Ru(bpy)(3)(2+) and link gold nanoparticles. Then, the primary antibodies were loaded onto the modified electrode via the gold sulfhydryl covalent binding. After immunobinding the analytes of antigen, NA-attached secondary antibodies could be captured as a sandwich type on the electrode. Finally, based on the circularly synergistic catalysis by the silver and NADH for the solid-phase ECL of Ru(bpy)(3)(2+), the proposed immunosensor sensed the concentration of antigen. The synergistic ECL catalysis of metal-organic nanocomposite amplified response signal and pushed the detection limit down to 0.03 U ml(-1), which initiated a new ECL labeling field and has great significance for ECL immunoassays. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. Relative abundances of primary ion radicals in γ-irradiated DNA: Cytosine vs thymine anions and guanine vs adenine cations

    International Nuclear Information System (INIS)

    Sevilla, M.D.; Becker, D.; Yan, Mengyao; Summerfield, S.R.

    1991-01-01

    An ESR study of the relative distribution of ion radicals formed in DNA equilibrated with D 2 O and γ-irradiated at 77 K is presented. The ESR spectra of irradiated DNA and polynucleotides (poly[dG]·poly[dC] and poly[dAdT]·poly[dAdT]) were obtained and employed in a computer-assisted analysis for the individual ion-radical distribution. Analysis of spectra as a function of power allowed the separation of the spectra of the pyrimidine anions (T sm-bullet- , C sm-bullet- ) from the spectra of the purine cations (G sm-bullet+ , A sm-bullet+ ). The spectra of the mononucleotide ion radicals, dCMP sm-bullet- , dTMP sm-bullet- , dGMP sm-bullet+ , and dAMP sm-bullet+ , were produced in 8 M LiCl glasses. In addition, the spectra of the ion radicals of all of the mononucleotide ion radicals except dAMP + were simulated by using hyperfine and g tensors from the literature. Basis spectra derived from (1) power saturation experiments, (2) polynucleotide and mononucleotide spectra, (3) spectra of mononucleotides alone, and (4) anisotropic simulations were used to fit the spectra of DNA by use of a linear least-squares analysis. Each of the four separate analyses confirms that the cytosine anion dominates the spectra of DNA at 100 K. Three analyses included the cationic composition, and they strongly favor the guanine cation over the adenine cation. An average of the authors results gives the DNA ion radicals' relative to abundances as ca. 77% C sm-bullet- , 23% T sm-bullet- for the anions and >90% G sm-bullet+ for the cations about equal amounts of anions and cations are present. No difference in results is found for DNA irradiated in frozen D 2 O solutions or simply exchanged at 100% D 2 O humidity

  15. Morphological features, distribution and compartmental organization of the nicotinamide adenine dinucleotide phosphate reduced-diaphorase interneurons in the human striatum.

    Science.gov (United States)

    Bernácer, Javier; Prensa, Lucía; Giménez-Amaya, José Manuel

    2005-08-29

    Striatal nicotinamide adenine dinucleotide phosphate reduced-diaphorase (NADPH-d)-positive (+) cells are one of the major classes of striatal interneurons. The present study analyzes their somatodendritic morphology, distribution pattern, and compartmental organization in the caudate nucleus (CN) and putamen (Put) of nine normal human brains. The following striatal territories are examined: 1) the precommissural head of the CN; 2) the postcommissural head of the CN; 3) the body of the CN; 4) the gyrus of the CN; 5) the tail of the CN; 6) the precommissural Put; and 7) the postcommissural Put. Three morphologically distinct types of NADPH-d+ neurons were found in each of these territories. The two most common NADPH-d+ neurons displayed an ovoid or triangular perikaryon from which several thick primary dendrites emerged, although much less numerous, bipolar-shaped NADPH-d+ cells were also observed. The highest density of NADPH-d+ neurons was found in the gyrus of the CN, followed by the body of the CN, tail of the CN, postcommissural head of the CN, postcommissural Put, precommissural head of the CN, and precommissural Put. The matrix was the striatal compartment with the densest NADPH-d+ neuronal population. Some of these cells also occurred in the center and peripheral regions of the striosomes located in the head of the CN and in the Put. In the body and gyrus of the CN, the striosomes were largely devoid of these striatal interneurons. Knowledge of the density and distribution of these interneurons should advance our understanding of the organization of the normal human striatum and help to evaluate the effects of neurodegenerative processes on cell density. (c) 2005 Wiley-Liss, Inc.

  16. Cellular properties of human erythrocytes preserved in saline-adenine-glucose-mannitol in the presence of L-carnitine.

    Science.gov (United States)

    Arduini, Arduino; Minetti, Giampaolo; Ciana, Annarita; Seppi, Claudio; Brovelli, Augusta; Profumo, Antonella; Vercellati, Cristina; Zappa, Manuela; Zanella, Alberto; Dottori, Secondo; Bonomini, Mario

    2007-01-01

    L-Carnitine (LC) in the preservation medium during storage of red blood cells (RBC) can improve the mean 24-hr percent recovery in vivo and increase RBC life-span after reinfusion. The purpose of the study was to investigate the differences in the biochemical properties of RBCs stored in the presence or absence of LC, and the cell-age related responses to storage conditions and to LC. RBC concentrates in saline-adenine-glucose-mannitol (SAG-M) were stored in the presence or absence of 5 mM LC at 4 degrees C for up to 8 weeks. RBC subpopulations of different densities were prepared by centrifugation on Stractan density gradient. Cells were sampled at 0, 3, 6, and 8 weeks, and hematological and cellular properties analyzed (MCV, MCHC, 4.1a/4.1b ratio as a cell age parameter, intracellular Na(+) and K(+)). After 6 weeks, MCV of RBC stored in the presence of LC was lower than that of controls (6 weeks MCV: controls 95.4 +/- 1.8 fl; LC 91.5 +/- 2.0 fl; n = 6; P < 0.005). This was due to swelling of control cells, and affected mainly older RBCs. LC appeared to reduce or retard cell swelling. Among the osmotically active substances whose changes during storage could contribute to cell swelling, only intracellular Na(+) and K(+) differed between stored control RBCs and LC-treated cells. LC reduces the swelling of older cells during storage at 4 degrees C in SAG-M, possibly by acting on the permeability of cell membrane to monovalent cations.

  17. Nucleotide composition bias and codon usage trends of gene ...

    Indian Academy of Sciences (India)

    2015-06-10

    Jun 10, 2015 ... Figure 1. Variations of the nucleotide composition of genes of the two mycoplasma species. (a) M. capricolum subsp. capricolum;. (b) M. agalactiae. Journal of Genetics, Vol. 94, No. 2, June 2015 ..... 2010 Codon usage bias and the evolution of influenza A viruses. Codon usage biases of influenza virus.

  18. Single nucleotide polymorphism genotyping and its application on ...

    African Journals Online (AJOL)

    The nucleotide diversity across a genome is the source of most phenotypic variation. Such DNA polymorphism is the basis for the development of molecular markers, an indispensable tool in genetic mapping studies. In general, the high resolution fine mapping of genes is often limited by lack of sufficient number of ...

  19. Spatiotemporal regulation of Rap guanine nucleotide exchange factors

    NARCIS (Netherlands)

    Consonni, S.V.

    2014-01-01

    Guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) orchestrate the activity of small G-proteins. In response to extracellular stimuli, GEFs and GAPs activate signaling cascades regulated by G-proteins by controlling their regulation in time and in space. Generally, GEFs

  20. Review Single nucleotide polymorphism in genome-wide ...

    African Journals Online (AJOL)

    Genome-wide patterns of variation across individuals provide most powerful source of data for uncovering the history of migration, expansion, and adaptation of the human population. The arrival of new technologies that type more than millions of the single nucleotide polymorphisms (SNPs) in a single experiment has ...

  1. Nucleotide variation at the dopa decarboxylase (Ddc) gene in ...

    Indian Academy of Sciences (India)

    We studied nucleotide sequence variation at the gene coding for dopa decarboxylase (Ddc) in seven populations of Drosophila melanogaster. Strength and pattern of linkage disequilibrium are somewhat distinct in the extensively sampled Spanish and Raleigh populations. In the Spanish population, a few sites are in ...

  2. Exogenous Nucleotides Antagonize the Developmental Toxicity of Ethanol In Vitro

    Directory of Open Access Journals (Sweden)

    Jie Zhao

    2013-01-01

    Full Text Available The objective of this study was to assess whether nucleotides supplementation in vitro could suppress ethanol-induced developmental toxicity in mouse. The models of whole embryo culture (WEC and midbrain (MB cell micromass culture were used in this study. In WEC system, exposure to 4.0 mg/mL ethanol for 48 h yielded various developmental malformations of the mice embryos. Nucleotides supplementation (0.16, 0.80, 4.00, 20.00, and 100.00 mg/L improved the growth parameters to some extent, and the protective effects peaked at 4.00 mg/L. In MB cell micromass culture system, exposure to 4.0 mg/mL ethanol for 5 days resulted in suppression of proliferation and differentiation. Supplementation of nucleotides (0.16, 0.80, 4.00, 20.00, and 100.00 mg/L showed some protective effects, which peaked at 4.00 mg/L, too. The present research indicated that nucleotides supplementation might be of some benefit in the prevention of ethanol-induced birth defects; however, appropriate dosage requires attention.

  3. Energy Conversion by Molecular Motors Coupled to Nucleotide Hydrolysis

    Science.gov (United States)

    Lipowsky, Reinhard; Liepelt, Steffen; Valleriani, Angelo

    2009-06-01

    Recent theoretical work on the energy conversion by molecular motors coupled to nucleotide hydrolysis is reviewed. The most abundant nucleotide is provided by adenosine triphosphate (ATP) which is cleaved into adenosine diphosphate (ADP) and inorganic phosphate. The motors have several catalytic domains (or active sites), each of which can be empty or occupied by ATP or ADP. The chemical composition of all catalytic domains defines distinct nucleotide states of the motor which form a discrete state space. Each of these motor states is connected to several other states via chemical transitions. For stepping motors such as kinesin, which walk along cytoskeletal filaments, some motor states are also connected by mechanical transitions, during which the motor is displaced along the filament and able to perform mechanical work. The different motor states together with the possible chemical and mechanical transitions provide a network representation for the chemomechanical coupling of the motor molecule. The stochastic motor dynamics on these networks exhibits several distinct motor cycles, which represent the dominant pathways for different regimes of nucleotide concentrations and load force. For the kinesin motor, the competition of two such cycles determines the stall force, at which the motor velocity vanishes and the motor reverses its direction of motion. In general, kinesin is found to be governed by the competition of three distinct chemomechanical cycles. The corresponding network representation provides a unified description for all motor properties that have been determined by single molecule experiments.

  4. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    Effects of dietary nucleotides on growth and disease resistance of crustaceans were evaluated using axenic Artemia culture tests. Higher Artemia growth in xenic culture (15.6 ± 2.9 mm) than in axenic culture (9.2 ± 1.9 mm) reaffirmed the need to eliminate microbial populations known to influence growth and disease ...

  5. Adiponectin Single Nucleotide Polymorphism (+276G/T) and Its ...

    African Journals Online (AJOL)

    The present study was investigating the association between the single nucleotide polymorphism +276 G/T of the adiponectin gene with serum adiponectin level in patients with coronary artery disease (CAD). In this study 100 healthy controls and 100 Egyptian patients with coronary artery disease of both genders ...

  6. Prospects for inferring pairwise relationships with single nucleotide polymorphisms

    Science.gov (United States)

    Jeffery C. Glaubitz; O. Eugene, Jr. Rhodes; J. Andrew DeWoody

    2003-01-01

    An extraordinarily large number of single nucleotide polymorphisms (SNPs) are now available in humans as well as in other model organisms. Technological advancements may soon make it feasible to assay hundreds of SNPs in virtually any organism of interest. One potential application of SNPs is the determination of pairwise genetic relationships in populations without...

  7. Single nucleotide polymorphism in genome-wide association of ...

    African Journals Online (AJOL)

    Mohd Fareed

    2012-09-25

    Sep 25, 2012 ... The arrival of new technologies that type more than millions of the single nucleotide polymor- phisms (SNPs) in .... Rapid advances in technology ...... carriers. Neuron. 2007;54:713–20. [97] Baum AE, Akula N, Cabanero M, et al. A genome-wide association study implicates diacylglycerol kinase eta (DGKH).

  8. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    cultured in 800 ml conical cylinders with sufficient aeration as described by Sorgeloos et al., (1986). The cylinders were put in a water bath so as to maintain the temperature at 25oC. The Artemia nauplii were fed with a non-sterile .... demand for nucleotides. At the same time, juveniles have a high rate of growth, which again ...

  9. Nucleotide excision repair I: from E.coli to yeast.

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractGenetic information is constantly deteriorating, mainly as a consequence of the action of numerous genotoxic agents. In order to cope with this fundamental problem, all living organisms have acquired a complex network of DNA repair systems to safeguard their genetic integrity. Nucleotide

  10. Detection of new single nucleotide polymorphisms by means of real ...

    Indian Academy of Sciences (India)

    Unknown

    Real time polymerase chain reaction (RT-PCR) is a new technique in molecular genetics which allows quantifica- tion of polymorphic DNA regions and genotyping of sin- gle nucleotide polymorphisms (SNPs) in one run. A by- product of real time PCR is the opportunity to identify new SNPs in the proximity of gene loci of ...

  11. Exact correspondence between walk in nucleotide and protein sequence spaces.

    Directory of Open Access Journals (Sweden)

    Dmitry N Ivankov

    Full Text Available In the course of evolution, genes traverse the nucleotide sequence space, which translates to a trajectory of changes in the protein sequence in protein sequence space. The correspondence between regions of the nucleotide and protein sequence spaces is understood in general but not in detail. One of the unexplored questions is how many sequences a protein can reach with a certain number of nucleotide substitutions in its gene sequence. Here I propose an algorithm to calculate the volume of protein sequence space accessible to a given protein sequence as a function of the number of nucleotide substitutions made in the protein-coding sequence. The algorithm utilizes the power of the dynamic programming approach, and makes all calculations within a couple of seconds on a desktop computer. I apply the algorithm to green fluorescence protein, and get the number of sequences four times higher than estimated before. However, taking into account the astronomically huge size of the protein sequence space, the previous estimate can be considered as acceptable as an order of magnitude estimation. The proposed algorithm has practical applications in the study of evolutionary trajectories in sequence space.

  12. Regulatory single nucleotide polymorphisms at the beginning of ...

    Indian Academy of Sciences (India)

    2015-11-28

    Nov 28, 2015 ... SNPs (rs12228277: T>A, rs12226937: G>A, and rs61761074: T>G) located in the same region of human KRAS. We ... and Merkulova TI 2015 Regulatory single nucleotide polymorphisms at the beginning of intron 2 of the human KRAS gene. J. Biosci. .... Membranes were blocked with 5% nonfat dried milk,.

  13. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  14. Nucleotide composition bias and codon usage trends of gene ...

    Indian Academy of Sciences (India)

    Table 2. Comparative synonymous codon usage patterns of the two mycoplasmas and ovine genomes. Codon (amino acid). Ovine*. M. capricolum .... Supplementary data, J. Genet. 94, 251–260. Table 4. Nucleotide composition statistics for a gene population in the two mycoplasma species. f ′. 1 = 6.75%# f ′. 2 = 5.82% ...

  15. Identification of sixteen single-nucleotide polymorphism markers in ...

    Indian Academy of Sciences (India)

    [Huang X., Wu S., Guan Y., Li Y. and He M. 2014 Development of sixteen single nucleotide polymorphism markers in the pearl oyster,. Pinctada fucata for .... P value. (. ◦. C) product allele and size (bp) frequency. PM5. As1: GCGGGCAGGGCGGCTGTGACTGCAGTGCATTAGGGT. 60. T 207. T. 0.3846 0.4212 0.5843.

  16. Unique nucleotide polymorphism of ankyrin gene cluster in ...

    Indian Academy of Sciences (India)

    Genomics 19, 478–493. Krumlauf R. 1992 Evolution of the vertebrate Hox homeobox genes. BioEssays 14, 245–252. Kuittinen H. and Aguadé M. 2000 Nucleotide variation at the. CHALCONE ISOMERASE locus in Arabidopsis thaliana. Ge- netics 155, 863–872. Lercher M. J., Urrutia A. O. and Hurst L. D. 2002 Clustering of.

  17. Combined LC/radiometric method of free nucleotide determination

    International Nuclear Information System (INIS)

    Mego, V.

    1980-01-01

    The combined chromatographic/radiometric method of determining free nucleotides allows their separation on ion exchanger DOWEX within one shift (i.e., 8 hours). A subsequent or parallel determination of activity of individual fractions increases the accuracy of results and gives a dynamic insight into the utilization of inorganic phosphorus by plants. (author)

  18. Detection of MspI polymorphism and the single nucleotide ...

    African Journals Online (AJOL)

    The aim of this study was to detect the genetic polymorphism of GH gene in five camel breeds reared in Egypt which are Sudany, Somali, Mowaled, Maghrabi and Falahy, using polymerase chain reaction- restriction fragment length polymorphism (PCR-RFLP) technique. Also, this work aimed to identify the single nucleotide ...

  19. Diversity and evolutionary relationship of nucleotide binding site ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    Most plant disease-resistance genes (R-genes) isolated so far encode proteins with a nucleotide binding site (NBS) domain and belong to a superfamily. NBS domains related to R-genes show a highly conserved backbone of an amino acid motif, which makes it possible to isolate resistance gene analogues (RGAs) by ...

  20. Single nucleotide polymorphisms in ghrelin gene and the resulting ...

    African Journals Online (AJOL)

    Ghrelin is a growth hormone releasing peptide which also affects feed intake in chickens. Ghrelin is encoded by chicken ghrelin gene (cGHRL) found in chromosome 7. Single nucleotide polymorphisms (SNPs) have been reported in cGHRL in Chinese native chickens, but such studies have not been carried out in chickens ...

  1. Development of a single nucleotide polymorphism (SNP) marker for ...

    African Journals Online (AJOL)

    The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...

  2. Four new single nucleotide polymorphisms (SNPs) of toll-like ...

    African Journals Online (AJOL)

    In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...

  3. Regulatory single nucleotide polymorphisms at the beginning of ...

    Indian Academy of Sciences (India)

    There are two regulatory single nucleotide polymorphisms (rSNPs) at the beginning of the second intron of the mouse - gene that are strongly associated with lung cancer susceptibility. We performed functional analysis of three SNPs (rs12228277: T>A, rs12226937: G>A, and rs61761074: T>G) located in the same ...

  4. The association of single nucleotide polymorphism of interleukin-21 ...

    African Journals Online (AJOL)

    Yasmin Mohamed Ahmed

    2016-05-08

    May 8, 2016 ... duced by activated CD4+ T cells, natural killer T cells and T helper (Th) cells. There is increasing evidence that IL-21 contributes to the pathogenesis of SLE due to its biological activity. Aim of the study: To investigate the association between single nucleotide polymorphism (SNP) of IL-21 rs2221903 gene ...

  5. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin

    2013-01-01

    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from the se...

  6. Complete nucleotide sequence and gene rearrangement of the ...

    Indian Academy of Sciences (India)

    ... Journals; Journal of Genetics; Volume 93; Issue 3. Complete nucleotide sequence and gene rearrangement of the mitochondrial genome of Occidozyga martensii. En Li Xiaoqiang Li Xiaobing Wu Ge Feng Man Zhang Haitao Shi Lijun Wang Jianping Jiang. Research Article Volume 93 Issue 3 December 2014 pp 631-641 ...

  7. Single nucleotide polymorphisms in the 5'-flanking region of the ...

    African Journals Online (AJOL)

    Prolactin (PRL), a polypeptide hormone synthesized and secreted by the animal's anterior pituitary gland, plays an important role in the regulation of mammalian lactation and avian reproduction. Considering the significant association between single nucleotide polymorphisms (SNPs) in the 5'-flanking region of PRL and ...

  8. Nucleotide variation at the methionine synthase locus in an ...

    African Journals Online (AJOL)

    Nucleotide variation at the methionine synthase (MetE) locus within and among populations of an endangered forest tree Fokienia hodginsii in Vietnam was investigated in the present study. A total of 12 populations were sampled across Vietnam. The length of the sequenced locus varied from 1567 to 1559 bp. A total of 42 ...

  9. Synthesis, bioanalysis and pharmacology of nucleoside and nucleotide analogs

    NARCIS (Netherlands)

    Jansen, R.S.

    2009-01-01

    Nucleoside analogs are an important class of drugs in anticancer and antiviral therapy. The compounds are, however, only active after intracellular conversion to their mono-, di- and triphosphate nucleotide form. In this thesis the development of sensitive liquid chromatography coupled to tandem

  10. [Tabular excel editor for analysis of aligned nucleotide sequences].

    Science.gov (United States)

    Demkin, V V

    2010-01-01

    Excel platform was used for transition of results of multiple aligned nucleotide sequences obtained using the BLAST network service to the form appropriate for visual analysis and editing. Two macros operators for MS Excel 2007 were constructed. The array of aligned sequences transformed into Excel table and processed using macros operators is more appropriate for analysis than initial html data.

  11. Influences of energization and nucleotide binding on the reaction of Lucifer Yellow vinyl sulfone with the alpha subunits of the chloroplast ATP synthase.

    Science.gov (United States)

    Cunningham, K M; McCarty, R E

    2000-04-18

    The catalytic portion of the chloroplast ATP synthase (CF(1)) consists of five different polypeptides in the stoichiometry alpha(3)beta(3)gammadeltaepsilon and is structurally asymmetric. Asymmetry is readily apparent in the properties of the six nucleotide binding sites and the single-copy, smaller subunits. Asymmetry is also detected in the alpha subunits by the rapid and covalent binding of Lucifer Yellow vinyl sulfone (LY) to one of the three chemically identical alpha subunits. The binding of LY to a single alpha subunit has allowed the investigation of whether asymmetry in the alpha subunits is a permanent feature of CF(1). The development of an electrochemical proton gradient across illuminated thylakoid membranes and the preincubation of CF(1) in solution with Mg(2+)-ATP were found to alter the LY distribution such that multiple alpha subunits were labeled with LY. Illumination of thylakoid membranes doubled the extent of LY labeling, and fluorescence resonance energy transfer measurements indicated that LY was bound to more than one alpha subunit. Since the change in LY distribution was inhibited by proton ionophores (uncouplers), alteration of alpha conformation by illumination is a result of the generation of a proton gradient. Preincubation of CF(1) in solution with Mg(2+)-ATP had no effect on the extent of LY labeling but resulted in multiple alpha subunits binding LY as determined by fluorescence resonance energy transfer measurements. Adenine nucleotides at substrate level concentrations inhibit the reaction of LY with the alpha subunits. No increase in LY labeling was observed when thylakoids were illuminated under conditions in which CF(1) was catalytically active.

  12. Global regulation of nucleotide biosynthetic genes by c-Myc.

    Directory of Open Access Journals (Sweden)

    Yen-Chun Liu

    2008-07-01

    Full Text Available The c-Myc transcription factor is a master regulator and integrates cell proliferation, cell growth and metabolism through activating thousands of target genes. Our identification of direct c-Myc target genes by chromatin immunoprecipitation (ChIP coupled with pair-end ditag sequencing analysis (ChIP-PET revealed that nucleotide metabolic genes are enriched among c-Myc targets, but the role of Myc in regulating nucleotide metabolic genes has not been comprehensively delineated.Here, we report that the majority of genes in human purine and pyrimidine biosynthesis pathway were induced and directly bound by c-Myc in the P493-6 human Burkitt's lymphoma model cell line. The majority of these genes were also responsive to the ligand-activated Myc-estrogen receptor fusion protein, Myc-ER, in a Myc null rat fibroblast cell line, HO.15 MYC-ER. Furthermore, these targets are also responsive to Myc activation in transgenic mouse livers in vivo. To determine the functional significance of c-Myc regulation of nucleotide metabolism, we sought to determine the effect of loss of function of direct Myc targets inosine monophosphate dehydrogenases (IMPDH1 and IMPDH2 on c-Myc-induced cell growth and proliferation. In this regard, we used a specific IMPDH inhibitor mycophenolic acid (MPA and found that MPA dramatically inhibits c-Myc-induced P493-6 cell proliferation through S-phase arrest and apoptosis.Taken together, these results demonstrate the direct induction of nucleotide metabolic genes by c-Myc in multiple systems. Our finding of an S-phase arrest in cells with diminished IMPDH activity suggests that nucleotide pool balance is essential for c-Myc's orchestration of DNA replication, such that uncoupling of these two processes create DNA replication stress and apoptosis.

  13. Interactions of fluoride and guanine nucleotides with thyroid adenylate cyclase.

    Science.gov (United States)

    Goldhammer, A; Wolff, J

    1982-02-18

    The activation of bovine thyroid adenylate cyclase (ATP pyrophosphate-lyase (cyclizing), EC 4.6.1.1) by Gpp(NH)p has been studied using steady-state kinetic methods. This activation is complex and may be characterized by two Gpp(NH)p binding sites of different affinities with measured constants: Ka1 = 0.1 micro M and Ka2 = 2.9 micro M. GDP beta S does not completely inhibit the Gpp(NH)p activation: analysis of the data is consistent with a single GDP beta S inhibitory site which is competitive with the weaker Gpp(NH)p site. Guanine nucleotide effects upon F- activation of adenylate cyclase have been studied. When App(NH)p is the substrate, 10 micro M GTP along with 10 mM NaF gives higher activity than NaF alone, while GDP together with NaF inhibits the activity by 50% relative to NaF. These features are not observed when the complex is assayed with ATP in the presence of a nucleotide regenerating system or when analogs Gpp)NH)p or GDP beta S are used along with NaF. These effects were studied in three other membrane systems using App(NH)p as substrate: rat liver, rat ovary and turkey erythrocyte. No consistent pattern of guanine nucleotide effects upon fluoride activation could be observed in the different membrane preparations. Previous experiments showed that the size of soluble thyroid adenylate cyclase changed whether membranes were preincubated with Gpp(NH)p or NaF. This size change roughly corresponded to the molecular weight of the nucleotide regulatory protein. This finding, coupled with the present data, suggests that two guanine nucleotide binding sites may be involved in regulating thyroid cyclase and that these sites may be on different protein chains.

  14. P2Y purinoceptor and nucleotide receptor-induced relaxation of precontracted bovine aortic collateral artery rings: differential sensitivity to suramin and indomethacin.

    Science.gov (United States)

    Wilkinson, G F; McKechnie, K; Dainty, I A; Boarder, M R

    1994-02-01

    We have examined a series of adenine nucleotides and UTP for their ability to cause relaxation of precontracted bovine aortic collateral artery rings. The overall rank order of agonist potency for relaxation was 2-methylthioadenosine 5'-triphosphate (2MeSATP) > adenosine 5'-O-(3-thiotriphosphate) (ATP gamma S) > UTP > ADP > ATP. These responses were endothelium-dependent. Interaction studies showed that responses to the selective P2Y purinoceptor agonist 2MeSATP, and to ADP, were mediated by different receptors from those mediating responses to UTP. Suramin, a P2 purinoceptor antagonist that binds to diverse sites for ATP, produced a concentration-dependent shift in the agonist concentration-effect curve to 2MeSATP, with a pKB of 5.45 +/- 0.15 and a slope of 0.94 +/- 0.09. Suramin produced a small, nonsignificant shift in the UTP response curve and had little effect on responses to ATP. Indomethacin (2.8 x 10(-6) M) had no effect on concentration-effect curves to UTP but almost abolished the relaxations produced by 2MeSATP and ADP. The concentration-effect curves to ATP and ATP gamma S showed a significant (P effects of indomethacin show that these receptors differentially modulate the release of cyclooxygenase-derived mediators of relaxation.

  15. Degradation of Adenine on the Martian Surface in the Presence of Perchlorates and Ionizing Radiation: A Reflectron Time-of-flight Mass Spectrometric Study

    Energy Technology Data Exchange (ETDEWEB)

    Góbi, Sándor; Bergantini, Alexandre; Kaiser, Ralf I., E-mail: ralfk@hawaii.edu [Department of Chemistry, University of Hawaii at Mānoa, Honolulu, HI 96822 (United States)

    2017-04-01

    The aim of the present work is to unravel the radiolytic decomposition of adenine (C{sub 5}H{sub 5}N{sub 5}) under conditions relevant to the Martian surface. Being the fundamental building block of (deoxy)ribonucleic acids, the possibility of survival of this biomolecule on the Martian surface is of primary importance to the astrobiology community. Here, neat adenine and adenine–magnesium perchlorate mixtures were prepared and irradiated with energetic electrons that simulate the secondary electrons originating from the interaction of the galactic cosmic rays with the Martian surface. Perchlorates were added to the samples since they are abundant—and therefore relevant oxidizers on the surface of Mars—and they have been previously shown to facilitate the radiolysis of organics such as glycine. The degradation of the samples were monitored in situ via Fourier transformation infrared spectroscopy and the electron ionization quadruple mass spectrometric method; temperature-programmed desorption profiles were then collected by means of the state-of-the-art single photon photoionization reflectron time-of-flight mass spectrometry (PI-ReTOF-MS), allowing for the detection of the species subliming from the sample. The results showed that perchlorates do increase the destruction rate of adenine by opening alternative reaction channels, including the concurrent radiolysis/oxidation of the sample. This new pathway provides a plethora of different radiolysis products that were identified for the first time. These are carbon dioxide (CO{sub 2}), isocyanic acid (HNCO), isocyanate (OCN{sup −}), carbon monoxide (CO), and nitrogen monoxide (NO); an oxidation product containing carbonyl groups (R{sub 1}R{sub 2}–C=O) with a constrained five-membered cyclic structure could also be observed. Cyanamide (H{sub 2}N–C≡N) was detected in both irradiated samples as well.

  16. Nicotinamide Adenine Dinucleotide Phosphate Oxidase 2 Regulates LPS-Induced Inflammation and Alveolar Remodeling in the Developing Lung

    Science.gov (United States)

    Menden, Heather L.; Xia, Sheng; Mabry, Sherry M.; Navarro, Angels; Nyp, Michael F.

    2016-01-01

    In premature infants, sepsis is associated with alveolar simplification manifesting as bronchopulmonary dysplasia. The redox-dependent mechanisms underlying sepsis-induced inflammation and alveolar remodeling in the immature lung remain unclear. We developed a neonatal mouse model of sepsis-induced lung injury to investigate whether nicotinamide adenine dinucleotide phosphate oxidase 2 (NOX2) regulates Toll-like receptor (TLR)–mediated inflammation and alveolar remodeling. Six-day-old NOX2+/+ and NOX2−/− mice were injected with intraperitoneal LPS to induce sepsis. Lung inflammation and canonical TLR signaling were assessed 24 hours after LPS. Alveolar development was examined in 15-day-old mice after LPS on Day 6. The in vivo efficacy of a NOX2 inhibitor (NOX2-I) on NOX2 complex assembly and sepsis-induced lung inflammation were examined. Lung cytokine expression and neutrophil influx induced with sepsis in NOX2+/+ mice was decreased by >50% in NOX2−/− mice. LPS-induced TLR4 signaling evident by inhibitor of NF-κB kinase-β and mitogen-activated protein kinase phosphorylation, and nuclear factor-κB/AP-1 translocation were attenuated in NOX2−/− mice. LPS increased matrix metalloproteinase 9 while decreasing elastin and keratinocyte growth factor levels in NOX2+/+ mice. An LPS-induced increase in matrix metalloproteinase 9 and decrease in fibroblast growth factor 7 and elastin were not evident in NOX2−/− mice. An LPS-induced reduction in radial alveolar counts and increased mean linear intercepts were attenuated in NOX2−/− mice. LPS-induced NOX2 assembly evident by p67phox/gp91phox coimmunoprecipitation was disrupted with NOX2-I. NOX2-I also mitigated LPS-induced cytokine expression, TLR pathway signaling, and alveolar simplification. In a mouse model of neonatal sepsis, NOX2 regulates proinflammatory TLR signaling and alveolar remodeling induced by a single dose of LPS. Our results provide mechanistic insight into the regulation of sepsis

  17. Experimental study on the fragmentation of Adenine and Porphyrin molecules induced by low energy multicharged ion impact

    International Nuclear Information System (INIS)

    Li, B.

    2010-01-01

    Since the dissociation of small molecules might play key roles in the understanding of radiation induced damages of living tissues at the primary steps and at the molecular levels, fragmentation dynamics of small biomolecules have drawn much attention. The knowledge of the internal energy is of fundamental importance for understanding its fragmentation dynamics following external excitation. For a long time however, it was difficult to measure this parameter in coincidence with the fragmentation patterns until the development of CIDEC (Collision Induced Dissociation under Energy Control) method in 2007. In this work, the CIDEC method was extended to study the fragmentation of gas-phase biomolecules adenine (Ade: H 5 C 5 N 5 ) and porphyrin chloride FeTPPCl (C 44 H 28 N 4 FeCl). The population distribution for each dissociation channel as a function of the excitation energy of the parent molecular ions at a well-determined initial charge state has been experimentally determined, which could shed some light on the fragmentation dynamics of these molecules. In collisions between Cl + and Ade at 3 keV, the fragmentation pattern of Ade 2+ is dominated by the loss of H 2 CN + and the successive emission of HCN. The energy distribution of the parent dication confirms the successive emission dynamics. A specific decay channel is observed, i.e. the emission of a charged H 2 CN + followed by the emission of HC 2 N 2 . The measured mean excitation energies of this channel and other competitive channels are compared. In Kr 8+ - FeTPPCl collisions at 80 keV, parent ions FeTPPCL 1+,2+,3+ are observed, along with the corresponding decay patterns. It is found that, in the first step the dominant low-energy-cost decay channel is the emission of Cl 0 independent of the initial charge state of FeTPPCl r+ . For the resulted dication FeTPP 2+ , the dominant fragmentation channel is the neutral evaporation; for the tri-cation however, the dominant fragmentation channel is the

  18. Molecular recognition of AT-DNA sequences by the induced CD pattern of dibenzotetraaza[14]annulene (DBTAA)–adenine derivatives

    OpenAIRE

    Stojković, Marijana Radić; Škugor, Marko; Dudek, Łukasz; Grolik, Jarosław; Eilmes, Julita; Piantanida, Ivo

    2014-01-01

    Summary An investigation of the interactions of two novel and several known DBTAA–adenine conjugates with double-stranded DNA and RNA has revealed the DNA/RNA groove as the dominant binding site, which is in contrast to the majority of previously studied DBTAA analogues (DNA/RNA intercalators). Only DBTAA–propyladenine conjugates revealed the molecular recognition of AT-DNA by an ICD band pattern > 300 nm, whereas significant ICD bands did not appear for other ds-DNA/RNA. A structure–activity...

  19. Content discovery and retrieval services at the European Nucleotide Archive.

    Science.gov (United States)

    Silvester, Nicole; Alako, Blaise; Amid, Clara; Cerdeño-Tárraga, Ana; Cleland, Iain; Gibson, Richard; Goodgame, Neil; Ten Hoopen, Petra; Kay, Simon; Leinonen, Rasko; Li, Weizhong; Liu, Xin; Lopez, Rodrigo; Pakseresht, Nima; Pallreddy, Swapna; Plaister, Sheila; Radhakrishnan, Rajesh; Rossello, Marc; Senf, Alexander; Smirnov, Dmitriy; Toribio, Ana Luisa; Vaughan, Daniel; Zalunin, Vadim; Cochrane, Guy

    2015-01-01

    The European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena) is Europe's primary resource for nucleotide sequence information. With the growing volume and diversity of public sequencing data comes the need for increased sophistication in data organisation, presentation and search services so as to maximise its discoverability and usability. In response to this, ENA has been introducing and improving checklists for use during submission and expanding its search facilities to provide targeted search results. Here, we give a brief update on ENA content and some major developments undertaken in data submission services during 2014. We then describe in more detail the services we offer for data discovery and retrieval. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Genome-wide patterns of nucleotide polymorphism in domesticated rice

    DEFF Research Database (Denmark)

    Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D

    2007-01-01

    Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... the dominant demographic model for domesticated species, cannot explain the derived nucleotide polymorphism site frequency spectrum in rice. Instead, a bottleneck model that incorporates selective sweeps, or a more complex demographic model that includes subdivision and gene flow, are more plausible...

  1. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.

    2013-09-03

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.

  2. Mitochondria as determinant of nucleotide pools and chromosomal stability

    DEFF Research Database (Denmark)

    Madsen, Claus Desler; Munch-Petersen, Birgitte; Stevnsner, Tinna

    2007-01-01

    Mitochondrial function plays an important role in multiple human diseases and mutations in the mitochondrial genome have been detected in nearly every type of cancer investigated to date. However, the mechanism underlying the interrelation is unknown. We used human cell lines depleted of mitochon...... mitochondrial activity. Our results suggest that mitochondria are central players in maintaining genomic stability and in controlling essential nuclear processes such as upholding a balanced supply of nucleotides....

  3. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  4. Nucleotide effects on the structure and dynamics of actin.

    Science.gov (United States)

    Zheng, Xiange; Diraviyam, Karthikeyan; Sept, David

    2007-08-15

    Adenosine 5'-triphosphate or ATP is the primary energy source within the cell, releasing its energy via hydrolysis into adenosine 5'-diphosphate or ADP. Actin is an important ATPase involved in many aspects of cellular function, and the binding and hydrolysis of ATP regulates its polymerization into actin filaments as well as its interaction with a host of actin-associated proteins. Here we study the dynamics of monomeric actin in ATP, ADP-Pi, and ADP states via molecular dynamics simulations. As observed in some crystal structures we see that the DNase-I loop is an alpha-helix in the ADP state but forms an unstructured coil domain in the ADP-Pi and ATP states. We also find that this secondary structure change is reversible, and by mimicking nucleotide exchange we can observe the transition between the helical and coil states. Apart from the DNase-I loop, we also see several key structural differences in the nucleotide binding cleft as well as in the hydrophobic cleft between subdomains 1 and 3 where WH2-containing proteins have been shown to interact. These differences provide a structural basis for understanding the observed differences between the various nucleotide states of actin and provide some insight into how ATP regulates the interaction of actin with itself and other proteins.

  5. Nucleotide Sequencing and Identification of Some Wild Mushrooms

    Directory of Open Access Journals (Sweden)

    Sudip Kumar Das

    2013-01-01

    Full Text Available The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India was amplified using ITS1 (Internal Transcribed Spacers 1 and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base of Amanita hemibapha [CN (Chota Nagpur 1, % identity 99 (JX844716.1], Amanita sp. [CN 2, % identity 98 (JX844763.1], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1], Termitomyces sp. [CN 4, % identity 90 (JF746992.1], Termitomyces sp. [CN 5, % identity 99 (GU001667.1], T. microcarpus [CN 6, % identity 82 (EF421077.1], Termitomyces sp. [CN 7, % identity 76 (JF746993.1], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

  6. Nucleotide sequencing and identification of some wild mushrooms.

    Science.gov (United States)

    Das, Sudip Kumar; Mandal, Aninda; Datta, Animesh K; Gupta, Sudha; Paul, Rita; Saha, Aditi; Sengupta, Sonali; Dubey, Priyanka Kumari

    2013-01-01

    The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India) was amplified using ITS1 (Internal Transcribed Spacers 1) and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base) of Amanita hemibapha [CN (Chota Nagpur) 1, % identity 99 (JX844716.1)], Amanita sp. [CN 2, % identity 98 (JX844763.1)], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1)], Termitomyces sp. [CN 4, % identity 90 (JF746992.1)], Termitomyces sp. [CN 5, % identity 99 (GU001667.1)], T. microcarpus [CN 6, % identity 82 (EF421077.1)], Termitomyces sp. [CN 7, % identity 76 (JF746993.1)], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1)]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

  7. Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.

    Science.gov (United States)

    Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro

    2015-11-01

    The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Electronic properties of carbon nanotubes complexed with a DNA nucleotide.

    Science.gov (United States)

    Chehelamirani, Morteza; da Silva, Maurício C; Salahub, Dennis R

    2017-03-08

    Electronic properties of carbon nanotubes (CNTs) play an important role in their interactions with nano-structured materials. In this work, interactions of adenosine monophosphate (AMP), a DNA nucleotide, with metallic and semi-conducting CNTs are studied using the density functional tight binding (DFTB) method. The electronic structure of semi-conducting CNTs was found to be changed as they turned to metallic CNTs in a vacuum upon interaction with the nucleotide while metallic CNTs remain metallic. Specifically, the band gap of semi-conducting CNTs was decreased by 0.79 eV on average while nearly no change was found in the metallic tubes. However, our investigations showed that the presence of explicit water molecules prevents the metallicity change and only small changes in the CNT band gap occur. According to our charge analysis, the average negative charge accumulated on CNTs upon interaction with the AMP was determined to be 0.77 e in a vacuum while it was 0.03 e in solution. Therefore, it is essential to include explicit water molecules in simulating complexes formed by DNA nucleotides and CNTs which were ignored in several past studies performed using quantum mechanical approaches.

  9. The Role of Cyclic Nucleotide Signaling Pathways in Cancer: Targets for Prevention and Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Fajardo, Alexandra M.; Piazza, Gary A. [Drug Discovery Research Center, Mitchell Cancer Institute, University of South Alabama, 1660 Springhill Ave, Suite 3029, Mobile, AL 36604 (United States); Tinsley, Heather N., E-mail: htinsley@montevallo.edu [Department of Biology, Chemistry, and Mathematics, University of Montevallo, Station 6480, Montevallo, AL 35115 (United States)

    2014-02-26

    For more than four decades, the cyclic nucleotides cyclic AMP (cAMP) and cyclic GMP (cGMP) have been recognized as important signaling molecules within cells. Under normal physiological conditions, cyclic nucleotides regulate a myriad of biological processes such as cell growth and adhesion, energy homeostasis, neuronal signaling, and muscle relaxation. In addition, altered cyclic nucleotide signaling has been observed in a number of pathophysiological conditions, including cancer. While the distinct molecular alterations responsible for these effects vary depending on the specific cancer type, several studies have demonstrated that activation of cyclic nucleotide signaling through one of three mechanisms—induction of cyclic nucleotide synthesis, inhibition of cyclic nucleotide degradation, or activation of cyclic nucleotide receptors—is sufficient to inhibit proliferation and activate apoptosis in many types of cancer cells. These findings suggest that targeting cyclic nucleotide signaling can provide a strategy for the discovery of novel agents for the prevention and/or treatment of selected cancers.

  10. n-Nucleotide circular codes in graph theory.

    Science.gov (United States)

    Fimmel, Elena; Michel, Christian J; Strüngmann, Lutz

    2016-03-13

    The circular code theory proposes that genes are constituted of two trinucleotide codes: the classical genetic code with 61 trinucleotides for coding the 20 amino acids (except the three stop codons {TAA,TAG,TGA}) and a circular code based on 20 trinucleotides for retrieving, maintaining and synchronizing the reading frame. It relies on two main results: the identification of a maximal C(3) self-complementary trinucleotide circular code X in genes of bacteria, eukaryotes, plasmids and viruses (Michel 2015 J. Theor. Biol. 380, 156-177. (doi:10.1016/j.jtbi.2015.04.009); Arquès & Michel 1996 J. Theor. Biol. 182, 45-58. (doi:10.1006/jtbi.1996.0142)) and the finding of X circular code motifs in tRNAs and rRNAs, in particular in the ribosome decoding centre (Michel 2012 Comput. Biol. Chem. 37, 24-37. (doi:10.1016/j.compbiolchem.2011.10.002); El Soufi & Michel 2014 Comput. Biol. Chem. 52, 9-17. (doi:10.1016/j.compbiolchem.2014.08.001)). The univerally conserved nucleotides A1492 and A1493 and the conserved nucleotide G530 are included in X circular code motifs. Recently, dinucleotide circular codes were also investigated (Michel & Pirillo 2013 ISRN Biomath. 2013, 538631. (doi:10.1155/2013/538631); Fimmel et al. 2015 J. Theor. Biol. 386, 159-165. (doi:10.1016/j.jtbi.2015.08.034)). As the genetic motifs of different lengths are ubiquitous in genes and genomes, we introduce a new approach based on graph theory to study in full generality n-nucleotide circular codes X, i.e. of length 2 (dinucleotide), 3 (trinucleotide), 4 (tetranucleotide), etc. Indeed, we prove that an n-nucleotide code X is circular if and only if the corresponding graph [Formula: see text] is acyclic. Moreover, the maximal length of a path in [Formula: see text] corresponds to the window of nucleotides in a sequence for detecting the correct reading frame. Finally, the graph theory of tournaments is applied to the study of dinucleotide circular codes. It has full equivalence between the combinatorics

  11. Isosteric analogues of nicotinamide adenine dinucleotide derived from furanfurin, thiophenfurin, and selenophenfurin as mammalian inosine monophosphate dehydrogenase (type I and II) inhibitors.

    Science.gov (United States)

    Franchetti, P; Cappellacci, L; Perlini, P; Jayaram, H N; Butler, A; Schneider, B P; Collart, F R; Huberman, E; Grifantini, M

    1998-05-07

    Dinucleotides TFAD (6), FFAD (7), and SFAD (8), isosteric NAD analogues derived, respectively, from C-nucleosides 5-beta-d-ribofuranosylthiophene-3-carboxamide (thiophenfurin, 1), 5-beta-d-ribofuranosylfuran-3-carboxamide (furanfurin, 2), and 5-beta-d-ribofuranosylselenophene-3-carboxamide (selenophenfurin, 5), were synthesized as human inosine monophosphate dehydrogenase (IMPDH) type I and II inhibitors. The synthesis was carried out by imidazole-catalyzed coupling of the 5'-monophosphate of 1, 2, and 5 with AMP. These dinucleotides, which are also analogues of thiazole-4-carboxamide adenine dinucleotide (TAD) and selenazole-4-carboxamide adenine dinucleotide (SAD), the active metabolites of the oncolytic C-nucleosides 2-beta-D-ribofuranosylthiazole-4-carboxamide (tiazofurin) and 2-beta-D-ribofuranosylselenazole-4-carboxamide (selenazofurin), were evaluated for their inhibitory potency against recombinant human IMPDH type I and II. The order of inhibitory potency found was SAD > SFAD = TFAD = TAD > FFAD for both enzyme isoforms. No significant difference was found in inhibition of IMPDH type I and II.

  12. Changes in phosphorylation of adenosine phosphate and redox state of nicotinamide-adenine dinucleotide (phosphate) in Geobacter sulfurreducens in response to electron acceptor and anode potential variation

    KAUST Repository

    Rose, Nicholas D.

    2015-12-01

    © 2015 Elsevier B.V. Geobacter sulfurreducens is one of the dominant bacterial species found in biofilms growing on anodes in bioelectrochemical systems. The intracellular concentrations of reduced and oxidized forms of nicotinamide-adenine dinucleotide (NADH and NAD+, respectively) and nicotinamide-adenine dinucleotide phosphate (NADPH and NADP+, respectively) as well as adenosine triphosphate (ATP), adenosine diphosphate (ADP), and adenosine monophosphate (AMP) were measured in G. sulfurreducens using fumarate, Fe(III)-citrate, or anodes poised at different potentials (110, 10, -90, and -190mV (vs. SHE)) as the electron acceptor. The ratios of CNADH/CNAD+ (0.088±0.022) and CNADPH/CNADP+ (0.268±0.098) were similar under all anode potentials tested and with Fe(III)-citrate (reduced extracellularly). Both ratios significantly increased with fumarate as the electron acceptor (0.331±0.094 for NAD and 1.96±0.37 for NADP). The adenylate energy charge (the fraction of phosphorylation in intracellular adenosine phosphates) was maintained near 0.47 under almost all conditions. Anode-growing biofilms demonstrated a significantly higher molar ratio of ATP/ADP relative to suspended cultures grown on fumarate or Fe(III)-citrate. These results provide evidence that the cellular location of reduction and not the redox potential of the electron acceptor controls the intracellular redox potential in G. sulfurreducens and that biofilm growth alters adenylate phosphorylation.

  13. Synthesis and antiviral properties of novel 7-heterocyclic substituted 7-deaza-adenine nucleoside inhibitors of Hepatitis C NS5B polymerase.

    Science.gov (United States)

    Di Francesco, M Emilia; Avolio, Salvatore; Pompei, Marco; Pesci, Silvia; Monteagudo, Edith; Pucci, Vincenzo; Giuliano, Claudio; Fiore, Fabrizio; Rowley, Michael; Summa, Vincenzo

    2012-08-01

    Previous investigations in our laboratories resulted in the discovery of a novel series of potent nucleoside inhibitors of Hepatitis C virus (HCV) NS5B polymerase bearing tetracyclic 7-substituted 7-deaza-adenine nucleobases. The planarity of such modified systems was suggested to play a role in the high inhibitory potency observed. This paper describes how we envisaged to maintain the desired planarity of the modified nucleobase by means of an intra-molecular H-bond, engaging a H-bond donor atom on an appropriately substituted 7-heterocyclic residue with the adjacent amino group of the nucleobase. The success of this strategy is reflected by the identification of several novel potent nucleoside inhibitors of HCV NS5B bearing a 7-heterocyclic substituted 7-deaza-adenine nucleobase. Amongst these, the 1,2,4-oxadiazole analog 11 showed high antiviral potency against HCV replication in replicon cells and efficient conversion to the corresponding NTP in vivo, with high and sustained levels of NTP measured in rat liver following intravenous and oral administration. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. Post-synthetic modification of mesoporous zinc-adeninate framework with tris(2,2′-biprydine) ruthenium(II) complex and its electrochemiluminescence

    Energy Technology Data Exchange (ETDEWEB)

    Park, Ji Eun; Shin, Ik Soo [Dept. of Chemistry, Soongsil University, Seoul (Korea, Republic of); Oh, Hye Jae; An, Ji Hyun [Dept. of Chemistry Education, Seoul National University, Seoul (Korea, Republic of)

    2017-04-15

    Herein we report a redox-active metal-organic framework (MOF) via post-synthetic cation exchange with tris(2,2′-biprydine) ruthenium(II) complex (Ru(bpy){sub 3}{sup 2+}). A porous anionic zinc-adeninate framework (bMOF-100) is spacious enough to easily entrap 2.43 of Ru(bpy){sub 3}{sup 2+} cations within the mesopore. The encapsulation supported the framework structure preventing any distortion from a rapid solvent evaporation under SEM observation. Ru(bpy){sub 3}{sup 2+}@bMOF-100 was then immobilized on the surface of glassy carbon electrode, and its electrocatalytic and electrochemiluminescent (ECL) properties were investigated in aqueous and organic solution. Especially, Ru(bpy){sub 3}{sup 2+}@bMOF-100 showed the excellent electrochemical properties of Ru(bpy){sub 3}{sup 2+}, but gradual decomposition of the MOF structure was observed under electrochemical measurements because of the sluggish oxidation of adeninate ligand.

  15. Nucleotide sequences specific to Brucella and methods for the detection of Brucella

    Energy Technology Data Exchange (ETDEWEB)

    McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA

    2009-02-24

    Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  16. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange*

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.

    2016-01-01

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946

  17. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange.

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J

    2016-01-15

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  19. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms

    OpenAIRE

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jka/Jkb, Fya/Fyb, S/s, K/k, Kpa/Kpb, Jsa/Jsb, Coa/Cob and Lua/Lub alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplif...

  20. Assay of covalent intermediate of 5'-nucleotide phosphodiesterase

    International Nuclear Information System (INIS)

    Blytt, H.J.; Brotherton, J.E.; Butler, L.

    1985-01-01

    A new procedure is reported for isolating a covalent phosphoryl enzyme (diester) intermediate of bovine intestinal 5'-nucleotide phosphodiesterase. The convenience of the procedure makes it possible to determine effects of reaction conditions on the yield of covalent intermediate. Under optimum conditions, using [methyl- 3 H]deoxythymidine 5'-triphosphate as substrate, more than 50% of the enzyme is recovered as thymidylyl enzyme, a 10-fold increase in yield over the previous procedure. Yields of thymidylyl enzyme were maximal at pH 4, whereas optimum catalytic activity is observed at pH greater than 9

  1. Purine nucleotide synthesis in cultured rat embryos undergoing organogenesis

    International Nuclear Information System (INIS)

    Rowe, P.B.; Kalaizis, A.; McEwen, S.E.

    1986-01-01

    The authors show that de n ovo synthesis is the sole source of the purine nucleotides required for in vitro rat embryonic growth during organogenesis. The presence of high levels of activity of purine catabolic enzymes in the homologous serum essential for culture prohibits the salvage of purine. While the 3-carbon atom of serine is the major source of one carbon units for purine ring synthesis there is a significant contribution from the 2-ring carbon atom of tryptophan. The paper describes in detail the incorporation of (1-14C)glycine into the acid soluble phase and other processes connected with de novo purine synthesis

  2. Nucleotide Selectivity at a Preinsertion Checkpoint of T7 RNA Polymerase Transcription Elongation.

    Science.gov (United States)

    E, Chao; Duan, Baogen; Yu, Jin

    2017-04-20

    Nucleotide selection is crucial for transcription fidelity control, in particular, for viral T7 RNA polymerase (RNAP) lack of proofreading activity. It has been recognized that multiple kinetic checkpoints exist prior to full nucleotide incorporation. In this work, we implemented intensive atomistic molecular dynamics (MD) simulations to quantify how strong the nucleotide selection is at the initial checkpoint of an elongation cycle of T7 RNAP. The incoming nucleotides bind into a preinsertion site where a critical tyrosine residue locates nearby to assist the nucleotide selection. We calculated the relative binding free energy between a noncognate nucleotide and a cognate one at a preinsertion configuration via alchemical simulations, showing that a small selection free energy or the binding free energy difference (∼3 k B T) exists between the two nucleotides. Indeed, another preinsertion configuration favored by the noncognate nucleotides was identified, which appears to be off path for further nucleotide insertion and additionally assists the nucleotide selection. By chemical master equation (CME) approach, we show that the small selection free energy at the preinsertion site along with the off-path noncognate nucleotide filtering can help substantially to reduce the error rate and to maintain the elongation rate high in the T7 RNAP transcription.

  3. Multi-nucleotide de novo Mutations in Humans.

    Directory of Open Access Journals (Sweden)

    Søren Besenbacher

    2016-11-01

    Full Text Available Mutation of the DNA molecule is one of the most fundamental processes in biology. In this study, we use 283 parent-offspring trios to estimate the rate of mutation for both single nucleotide variants (SNVs and short length variants (indels in humans and examine the mutation process. We found 17812 SNVs, corresponding to a mutation rate of 1.29 × 10-8 per position per generation (PPPG and 1282 indels corresponding to a rate of 9.29 × 10-10 PPPG. We estimate that around 3% of human de novo SNVs are part of a multi-nucleotide mutation (MNM, with 558 (3.1% of mutations positioned less than 20kb from another mutation in the same individual (median distance of 525bp. The rate of de novo mutations is greater in late replicating regions (p = 8.29 × 10-19 and nearer recombination events (p = 0.0038 than elsewhere in the genome.

  4. Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men

    Directory of Open Access Journals (Sweden)

    Ahamad Salamian

    2008-01-01

    Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.

  5. Retinal Cyclic Nucleotide-Gated Channels: From Pathophysiology to Therapy

    Directory of Open Access Journals (Sweden)

    Stylianos Michalakis

    2018-03-01

    Full Text Available The first step in vision is the absorption of photons by the photopigments in cone and rod photoreceptors. After initial amplification within the phototransduction cascade the signal is translated into an electrical signal by the action of cyclic nucleotide-gated (CNG channels. CNG channels are ligand-gated ion channels that are activated by the binding of cyclic guanosine monophosphate (cGMP or cyclic adenosine monophosphate (cAMP. Retinal CNG channels transduce changes in intracellular concentrations of cGMP into changes of the membrane potential and the Ca2+ concentration. Structurally, the CNG channels belong to the superfamily of pore-loop cation channels and share a common gross structure with hyperpolarization-activated cyclic nucleotide-gated (HCN channels and voltage-gated potassium channels (KCN. In this review, we provide an overview on the molecular properties of CNG channels and describe their physiological role in the phototransduction pathways. We also discuss insights into the pathophysiological role of CNG channel proteins that have emerged from the analysis of CNG channel-deficient animal models and human CNG channelopathies. Finally, we summarize recent gene therapy activities and provide an outlook for future clinical application.

  6. Nucleotide patterns aiding in prediction of eukaryotic promoters

    Science.gov (United States)

    Triska, Martin; Solovyev, Victor; Baranova, Ancha; Kel, Alexander

    2017-01-01

    Computational analysis of promoters is hindered by the complexity of their architecture. In less studied genomes with complex organization, false positive promoter predictions are common. Accurate identification of transcription start sites and core promoter regions remains an unsolved problem. In this paper, we present a comprehensive analysis of genomic features associated with promoters and show that probabilistic integrative algorithms-driven models allow accurate classification of DNA sequence into “promoters” and “non-promoters” even in absence of the full-length cDNA sequences. These models may be built upon the maps of the distributions of sequence polymorphisms, RNA sequencing reads on genomic DNA, methylated nucleotides, transcription factor binding sites, as well as relative frequencies of nucleotides and their combinations. Positional clustering of binding sites shows that the cells of Oryza sativa utilize three distinct classes of transcription factors: those that bind preferentially to the [-500,0] region (188 “promoter-specific” transcription factors), those that bind preferentially to the [0,500] region (282 “5′ UTR-specific” TFs), and 207 of the “promiscuous” transcription factors with little or no location preference with respect to TSS. For the most informative motifs, their positional preferences are conserved between dicots and monocots. PMID:29141011

  7. Kinetic mechanism and nucleotide specificity of NADH peroxidase

    Energy Technology Data Exchange (ETDEWEB)

    Stoll, V.S.; Blanchard, J.S.

    1988-02-01

    NADH peroxidase is a flavoprotein isolated from Streptococcus faecalis which catalyzes the pyridine nucleotide-dependent reduction of hydrogen peroxide to water. Initial velocity, product, and dead-end inhibition studies have been performed at pH 7.5 and support a ping-pong kinetic mechanism. In the absence of hydrogen peroxide, both transhydrogenation between NADH and thioNAD, and isotope exchange between (/sup 14/C)NADH and NAD, have been demonstrated, although in both these experiments, the maximal velocity of nucleotide exchange was less than 1.5% the maximal velocity of the peroxidatic reaction. We propose that NADH binds tightly to both oxidized and two-electron reduced enzyme. NADH oxidation proceeds stereospecifically with the transfer of the 4S hydrogen to enzyme, and then, via exchange, to water. No primary tritium kinetic isotope effect was observed, and no statistically significant primary deuterium kinetic isotope effects on V/K were determined, although primary deuterium kinetic isotope effects on V were observed in the presence and absence of sodium acetate. NADH peroxidase thus shares with other flavoprotein reductases striking kinetic, spectroscopic, and stereochemical similarities. On this basis, we propose a chemical mechanism for the peroxide cleaving reaction catalyzed by NADH peroxidase which involves the obligate formation of a flavinperoxide, and peroxo bond cleavage by nucleophilic attack by enzymatic dithiols.

  8. Kinetic mechanism and nucleotide specificity of NADH peroxidase

    International Nuclear Information System (INIS)

    Stoll, V.S.; Blanchard, J.S.

    1988-01-01

    NADH peroxidase is a flavoprotein isolated from Streptococcus faecalis which catalyzes the pyridine nucleotide-dependent reduction of hydrogen peroxide to water. Initial velocity, product, and dead-end inhibition studies have been performed at pH 7.5 and support a ping-pong kinetic mechanism. In the absence of hydrogen peroxide, both transhydrogenation between NADH and thioNAD, and isotope exchange between [ 14 C]NADH and NAD, have been demonstrated, although in both these experiments, the maximal velocity of nucleotide exchange was less than 1.5% the maximal velocity of the peroxidatic reaction. We propose that NADH binds tightly to both oxidized and two-electron reduced enzyme. NADH oxidation proceeds stereospecifically with the transfer of the 4S hydrogen to enzyme, and then, via exchange, to water. No primary tritium kinetic isotope effect was observed, and no statistically significant primary deuterium kinetic isotope effects on V/K were determined, although primary deuterium kinetic isotope effects on V were observed in the presence and absence of sodium acetate. NADH peroxidase thus shares with other flavoprotein reductases striking kinetic, spectroscopic, and stereochemical similarities. On this basis, we propose a chemical mechanism for the peroxide cleaving reaction catalyzed by NADH peroxidase which involves the obligate formation of a flavinperoxide, and peroxo bond cleavage by nucleophilic attack by enzymatic dithiols

  9. Complete nucleotide sequences of avian metapneumovirus subtype B genome.

    Science.gov (United States)

    Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

    2010-12-01

    Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

  10. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A.

    2017-10-04

    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  11. Assay of cyclic nucleotide phosphodiesterase using radiolabeled and fluorescent substrates

    International Nuclear Information System (INIS)

    Kincaid, R.L.; Manganiello, V.C.

    1988-01-01

    There are four major classes of phosphodiesterase with different specificities for cAMP and cGMP and different allosteric regulators. Type I phosphodiesterase is activated by calmodulin plus Ca/sup 2+/ and has a higher affinity for cGMP than cAMP. Type II phosphodiesterase likewise has a higher affinity for cGMP than cAMP, but the activity toward one substrate is markedly stimulated by low (micromolar) concentrations of the other nucleotide. Type III phosphodiesterase has a higher affinity for cAMP than cGMP; its activity is increased in responsive cells by certain hormones, e.g., insulin, isoproterenol. Type IV phosphodiesterase is the cGMP-specific enzyme, which also has an allosteric binding site for cGMP. An example of this class of enzyme is the one from retinal rod outer segments, which is activated by light via rhodopsin and the guanine nucleotide-binding protein transducin. There appears to be little structural relatedness among these enzymes based on immunologic analysis, consistent with the possibility that divergent forms evolved from an ancestral enzyme. Determination of the amount of a specific form of phosphodiesterase in crude material is often difficult. Modification of assay conditions by judicious choice of substrate and/or inhibitor concentrations may selectively favor (or reduce) the activity of a particular form; in many instances, however, some fractionation of enzymes may be necessary. This is discussed more fully in the final section of this chapter

  12. Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB

    Directory of Open Access Journals (Sweden)

    Joon-Ho Lee

    2014-09-01

    Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB (http://snugenome2.snu.ac.kr/HSDB provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.

  13. Relative Stability of the La and Lb Excited States in Adenine and Guanine: Direct Evidence from TD-DFT Calculations of MCD Spectra.

    Science.gov (United States)

    Santoro, Fabrizio; Improta, Roberto; Fahleson, Tobias; Kauczor, Joanna; Norman, Patrick; Coriani, Sonia

    2014-06-05

    The relative position of La and Lb ππ* electronic states in purine nucleobases is a much debated topic, since it can strongly affect our understanding of their photoexcited dynamics. To assess this point, we calculated the absorption and magnetic circular dichroism (MCD) spectra of adenine, guanine, and their nucleosides in gas-phase and aqueous solution, exploiting recent developments in MCD computational technology within time-dependent density functional theory. MCD spectroscopy allows us to resolve the intense S0→ La transition from the weak S0→ Lb transition. The spectra obtained in water solution, by using B3LYP and CAM-B3LYP functionals and describing solvent effect by cluster models and by the polarizable continuum model (PCM), are in very good agreement with the experimental counterparts, thus providing direct and unambiguous evidence that the energy ordering predicted by TD-DFT, La Lb, is the correct one.

  14. Supra-molecular hydrogen-bonding patterns in the N(9)-H protonated and N(7)-H tautomeric form of an N(6) -benzoyl-adenine salt: N (6)-benzoyl-adeninium nitrate.

    Science.gov (United States)

    Karthikeyan, Ammasai; Jeeva Jasmine, Nithianantham; Thomas Muthiah, Packianathan; Perdih, Franc

    2016-02-01

    In the title molecular salt, C12H10N5O(+)·NO3 (-), the adenine unit has an N (9)-protonated N(7)-H tautomeric form with non-protonated N(1) and N(3) atoms. The dihedral angle between the adenine ring system and the phenyl ring is 51.10 (10)°. The typical intra-molecular N(7)-H⋯O hydrogen bond with an S(7) graph-set motif is also present. The benzoyl-adeninium cations also form base pairs through N-H⋯O and C-H⋯N hydrogen bonds involving the Watson-Crick face of the adenine ring and the C and O atoms of the benzoyl ring of an adjacent cation, forming a supra-molecular ribbon with R 2 (2)(9) rings. Benzoyl-adeninum cations are also bridged by one of the oxygen atoms of the nitrate anion, which acts as a double acceptor, forming a pair of N-H⋯O hydrogen bonds to generate a second ribbon motif. These ribbons together with π-π stacking inter-actions between the phenyl ring and the five- and six-membered adenine rings of adjacent mol-ecules generate a three-dimensional supra-molecular architecture.

  15. Selective inhibitory effects of (S)-9-(3-hydroxy-2-phosphonyl-methoxypropyl)adenine and 1-(2'-deoxy-2'-fluoro-ß-D-arabinofuranosyl)-5-iodouracil on seal herpesvirus (Phocid herpesvirus 1) infection in vitro.

    NARCIS (Netherlands)

    A.D.M.E. Osterhaus (Albert); J. Groen (Jan); E. de Clercq

    1987-01-01

    textabstractFrom a selection of 25 antiviral compounds with specific anti-herpes activity or broad-spectrum antiviral properties, two compounds, namely (S)-9-(3-hydroxy-2-phosphonyl-methoxypropyl)adenine and 1-(2'-deoxy-2'-fluoro-beta-D-arabinofuranosyl)-5-iodouracil, appeared particularly effective

  16. Supra­molecular hydrogen-bonding patterns in the N(9)—H protonated and N(7)—H tautomeric form of an N6-benzoyl­adenine salt: N 6-benzoyl­adeninium nitrate

    Science.gov (United States)

    Karthikeyan, Ammasai; Jeeva Jasmine, Nithianantham; Thomas Muthiah, Packianathan; Perdih, Franc

    2016-01-01

    In the title molecular salt, C12H10N5O+·NO3 −, the adenine unit has an N 9-protonated N(7)—H tautomeric form with non-protonated N1 and N3 atoms. The dihedral angle between the adenine ring system and the phenyl ring is 51.10 (10)°. The typical intra­molecular N7—H⋯O hydrogen bond with an S(7) graph-set motif is also present. The benzoyl­adeninium cations also form base pairs through N—H⋯O and C—H⋯N hydrogen bonds involving the Watson–Crick face of the adenine ring and the C and O atoms of the benzoyl ring of an adjacent cation, forming a supra­molecular ribbon with R 2 2(9) rings. Benzoyl­adeninum cations are also bridged by one of the oxygen atoms of the nitrate anion, which acts as a double acceptor, forming a pair of N—H⋯O hydrogen bonds to generate a second ribbon motif. These ribbons together with π–π stacking inter­actions between the phenyl ring and the five- and six-membered adenine rings of adjacent mol­ecules generate a three-dimensional supra­molecular architecture. PMID:26958373

  17. Quantifying single nucleotide variant detection sensitivity in exome sequencing.

    Science.gov (United States)

    Meynert, Alison M; Bicknell, Louise S; Hurles, Matthew E; Jackson, Andrew P; Taylor, Martin S

    2013-06-18

    The targeted capture and sequencing of genomic regions has rapidly demonstrated its utility in genetic studies. Inherent in this technology is considerable heterogeneity of target coverage and this is expected to systematically impact our sensitivity to detect genuine polymorphisms. To fully interpret the polymorphisms identified in a genetic study it is often essential to both detect polymorphisms and to understand where and with what probability real polymorphisms may have been missed. Using down-sampling of 30 deeply sequenced exomes and a set of gold-standard single nucleotide variant (SNV) genotype calls for each sample, we developed an empirical model relating the read depth at a polymorphic site to the probability of calling the correct genotype at that site. We find that measured sensitivity in SNV detection is substantially worse than that predicted from the naive expectation of sampling from a binomial. This calibrated model allows us to produce single nucleotide resolution SNV sensitivity estimates which can be merged to give summary sensitivity measures for any arbitrary partition of the target sequences (nucleotide, exon, gene, pathway, exome). These metrics are directly comparable between platforms and can be combined between samples to give "power estimates" for an entire study. We estimate a local read depth of 13X is required to detect the alleles and genotype of a heterozygous SNV 95% of the time, but only 3X for a homozygous SNV. At a mean on-target read depth of 20X, commonly used for rare disease exome sequencing studies, we predict 5-15% of heterozygous and 1-4% of homozygous SNVs in the targeted regions will be missed. Non-reference alleles in the heterozygote state have a high chance of being missed when commonly applied read coverage thresholds are used despite the widely held assumption that there is good polymorphism detection at these coverage levels. Such alleles are likely to be of functional importance in population based studies of

  18. Chromatin Dynamics during Nucleotide Excision Repair: Histones on the Move

    Science.gov (United States)

    Adam, Salomé; Polo, Sophie E.

    2012-01-01

    It has been a long-standing question how DNA damage repair proceeds in a nuclear environment where DNA is packaged into chromatin. Several decades of analysis combining in vitro and in vivo studies in various model organisms ranging from yeast to human have markedly increased our understanding of the mechanisms underlying chromatin disorganization upon damage detection and re-assembly after repair. Here, we review the methods that have been developed over the years to delineate chromatin alterations in response to DNA damage by focusing on the well-characterized Nucleotide Excision Repair (NER) pathway. We also highlight how these methods have provided key mechanistic insight into histone dynamics coupled to repair in mammals, raising new issues about the maintenance of chromatin integrity. In particular, we discuss how NER factors and central players in chromatin dynamics such as histone modifiers, nucleosome remodeling factors, and histone chaperones function to mobilize histones during repair. PMID:23109890

  19. Environmental heat stress, hyperammonemia and nucleotide metabolism during intermittent exercise

    DEFF Research Database (Denmark)

    Mohr, Magni; Rasmussen, Peter; Drust, Barry

    2006-01-01

    Abstract  This study investigated the influence of environmental heat stress on ammonia (NH3) accumulation in relation to nucleotide metabolism and fatigue during intermittent exercise. Eight males performed 40 min of intermittent exercise (15 s at 306±22 W alternating with 15 s of unloaded cycling......) followed by five 15 s all-out sprints. Control trials were conducted in a 20°C environment while heat stress trials were performed at an ambient temperature of 40°C. Muscle biopsies and venous blood samples were obtained at rest, after 40 min of exercise and following the maximal sprints. Following...... exercise with heat stress, the core and muscle temperatures peaked at 39.5±0.2 and 40.2±0.2°C to be ~ 1°C higher (Pstress trial (P

  20. Pinched flow fractionation devices for detection of single nucleotide polymorphisms

    DEFF Research Database (Denmark)

    Larsen, A.V.; Poulsen, L.; Birgens, H.

    2008-01-01

    We demonstrate a new and flexible micro fluidic based method for genotyping single nucleotide polymorphisms ( SNPs). The method relies on size separation of selectively hybridized polystyrene microspheres in a micro fluidic pinched flow fractionation (PFF) device. The micro fluidic PFF devices...... and 5.6 mu m were functionalized with biotin-labeled oligonucleotides for the detection of a mutant (Mt) or wild-type (Wt) DNA sequence in the HBB gene, respectively. Hybridization to functionalized beads was performed with fluorescent targets comprising synthetic DNA oligonucleotides or amplified RNA......, synthesized using human DNA samples from individuals with point mutations in the HBB gene. Following a stringent wash, the beads were separated in a PFF device and the fluorescent signal from the beads was analyzed. Patients being wildtypes, heterozygotes or mutated respectively for the investigated mutation...

  1. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun

    2015-11-02

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  2. A single natural nucleotide mutation alters bacterial pathogen host tropism.

    Science.gov (United States)

    Viana, David; Comos, María; McAdam, Paul R; Ward, Melissa J; Selva, Laura; Guinane, Caitriona M; González-Muñoz, Beatriz M; Tristan, Anne; Foster, Simon J; Fitzgerald, J Ross; Penadés, José R

    2015-04-01

    The capacity of microbial pathogens to alter their host tropism leading to epidemics in distinct host species populations is a global public and veterinary health concern. To investigate the molecular basis of a bacterial host-switching event in a tractable host species, we traced the evolutionary trajectory of the common rabbit clone of Staphylococcus aureus. We report that it evolved through a likely human-to-rabbit host jump over 40 years ago and that only a single naturally occurring nucleotide mutation was required and sufficient to convert a human-specific S. aureus strain into one that could infect rabbits. Related mutations were identified at the same locus in other rabbit strains of distinct clonal origin, consistent with convergent evolution. This first report of a single mutation that was sufficient to alter the host tropism of a microorganism during its evolution highlights the capacity of some pathogens to readily expand into new host species populations.

  3. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze

    2013-09-03

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs are often part of complex multifunctional proteins with different domain organizations and biological functions that are not conserved in higher plants. For this reason, we have developed CNC search strategies based on functionally conserved amino acids in the catalytic center of annotated and/or experimentally confirmed CNCs. Here we detail this method which has led to the identification of >25 novel candidate CNCs in Arabidopsis thaliana, several of which have been experimentally confirmed in vitro and in vivo. We foresee that the application of this method can be used to identify many more members of the growing family of CNCs in higher plants. © Springer Science+Business Media New York 2013.

  4. Myocarditis in CD8-depleted SIV-infected rhesus macaques after short-term dual therapy with nucleoside and nucleotide reverse transcriptase inhibitors.

    Directory of Open Access Journals (Sweden)

    Lakshmanan Annamalai

    2010-12-01

    Full Text Available Although highly active antiretroviral therapy (HAART has dramatically reduced the morbidity and mortality associated with HIV infection, a number of antiretroviral toxicities have been described, including myocardial toxicity resulting from the use of nucleotide and nucleoside reverse transcriptase inhibitors (NRTIs. Current treatment guidelines recommend the use of HAART regimens containing two NRTIs for initial therapy of HIV-1 positive individuals; however, potential cardiotoxicity resulting from treatment with multiple NRTIs has not been addressed.We examined myocardial tissue from twelve CD8 lymphocyte-depleted adult rhesus macaques, including eight animals infected with simian immunodeficiency virus, four of which received combined antiretroviral therapy (CART consisting of two NRTIs [(9-R-2-Phosphonomethoxypropyl Adenine (PMPA and (+/--beta-2',3'-dideoxy-5-fluoro-3'-thiacytidine (RCV] for 28 days. Multifocal infiltrates of mononuclear inflammatory cells were present in the myocardium of all macaques that received CART, but not untreated SIV-positive animals or SIV-negative controls. Macrophages were the predominant inflammatory cells within lesions, as shown by immunoreactivity for the macrophage markers Iba1 and CD68. Heart specimens from monkeys that received CART had significantly lower virus burdens than untreated animals (p<0.05, but significantly greater quantities of TNF-α mRNA than either SIV-positive untreated animals or uninfected controls (p<0.05. Interferon-γ (IFN-γ, IL-1β and CXCL11 mRNA were upregulated in heart tissue from SIV-positive monkeys, independent of antiretroviral treatment, but CXCL9 mRNA was only upregulated in heart tissue from macaques that received CART.These results suggest that short-term treatment with multiple NRTIs may be associated with myocarditis, and demonstrate that the CD8-depleted SIV-positive rhesus monkey is a useful model for studying the cardiotoxic effects of combined antiretroviral

  5. A functional single nucleotide polymorphism at the promoter region of cyclin A2 is associated with increased risk of colon, liver, and lung cancers.

    Science.gov (United States)

    Kim, Duk-Hwan; Park, Seong-Eun; Kim, Minseung; Ji, Yong Ick; Kang, Mi Yeon; Jung, Eun Hyun; Ko, Eunkyung; Kim, Yujin; Kim, Sung; Shim, Young Mog; Park, Joobae

    2011-09-01

    The objective of this was to identify functional single nucleotide polymorphisms (SNPs) in cyclin-dependent kinases (CDKs) and cyclins that are associated with risk of human cancer. First, 45 SNPs in CDKs and cyclins were analyzed in 106 lung cancers and 108 controls for a pilot study. One SNP (reference SNP [rs] 769236, +1 guanine to adenine [G→A]) at the promoter region of cyclin A2 (CCNA2) also was analyzed in 1989 cancers (300 breast cancers, 450 colorectal cancers, 450 gastric cancers, 367 hepatocellular carcinomas, and 422 lung cancers) and in 1096 controls. Genotyping was performed using matrix-assisted laser desorption-ionization/time-of-flight mass spectrometry. Transcriptional activity of the SNP according to the cell cycle was analyzed by using a luciferase reporter assay and fluorescence-activated cell sorting analysis in NIH3T3 cells. In the pilot study, the SNP (rs769236) was associated significantly with the risk of lung cancer. In the expanded study, multivariate logistic regression indicated that the AA homozygous variant of the SNP was associated significantly with the development of lung cancer (P hepatocellular carcinoma (P = .02) but not with breast cancer or gastric cancer. The luciferase activity of a 300-base pair construct that contained the A allele was 1.5-fold greater than the activity of a construct with the G allele in NIH3T3 cells. The high luciferase activity of constructs that contained the A allele did not change with cell cycle progression. The current results suggested that an SNP (rs769236) at the promoter of CCNA2 may be associated significantly with increased risk of colon, liver, and lung cancers. Cancer 2011 © 2011 American Cancer Society.

  6. G-BLASTN: accelerating nucleotide alignment by graphics processors.

    Science.gov (United States)

    Zhao, Kaiyong; Chu, Xiaowen

    2014-05-15

    Since 1990, the basic local alignment search tool (BLAST) has become one of the most popular and fundamental bioinformatics tools for sequence similarity searching, receiving extensive attention from the research community. The two pioneering papers on BLAST have received over 96 000 citations. Given the huge population of BLAST users and the increasing size of sequence databases, an urgent topic of study is how to improve the speed. Recently, graphics processing units (GPUs) have been widely used as low-cost, high-performance computing platforms. The existing GPU-BLAST is a promising software tool that uses a GPU to accelerate protein sequence alignment. Unfortunately, there is still no GPU-accelerated software tool for BLAST-based nucleotide sequence alignment. We developed G-BLASTN, a GPU-accelerated nucleotide alignment tool based on the widely used NCBI-BLAST. G-BLASTN can produce exactly the same results as NCBI-BLAST, and it has very similar user commands. Compared with the sequential NCBI-BLAST, G-BLASTN can achieve an overall speedup of 14.80X under 'megablast' mode. More impressively, it achieves an overall speedup of 7.15X over the multithreaded NCBI-BLAST running on 4 CPU cores. When running under 'blastn' mode, the overall speedups are 4.32X (against 1-core) and 1.56X (against 4-core). G-BLASTN also supports a pipeline mode that further improves the overall performance by up to 44% when handling a batch of queries as a whole. Currently G-BLASTN is best optimized for databases with long sequences. We plan to optimize its performance on short database sequences in our future work. http://www.comp.hkbu.edu.hk/∼chxw/software/G-BLASTN.html chxw@comp.hkbu.edu.hk Supplementary data are available at Bioinformatics online.

  7. A model for the evolution of nucleotide polymerase directionality.

    Directory of Open Access Journals (Sweden)

    Joshua Ballanco

    Full Text Available BACKGROUND: In all known living organisms, every enzyme that synthesizes nucleic acid polymers does so by adding nucleotide 5′-triphosphates to the 3′-hydroxyl group of the growing chain. This results in the well known 5'→3' directionality of all DNA and RNA Polymerases. The lack of any alternative mechanism, e.g. addition in a 3'→5' direction, may indicate a very early founder effect in the evolution of life, or it may be the result of a selective pressure against such an alternative. METHODOLOGY/PRINCIPAL FINDINGS: In an attempt to determine whether the lack of an alternative polymerase directionality is the result of a founder effect or evolutionary selection, we have constructed a basic model of early polymerase evolution. This model is informed by the essential chemical properties of the nucleotide polymerization reaction. With this model, we are able to simulate the growth of organisms with polymerases that synthesize either 5'→3' or 3'→5' in isolation or in competition with each other. CONCLUSIONS/SIGNIFICANCE: We have found that a competition between organisms with 5'→3' polymerases and 3'→5' polymerases only results in a evolutionarily stable strategy under certain conditions. Furthermore, we have found that mutations lead to a much clearer delineation between conditions that lead to a stable coexistence of these populations and conditions which ultimately lead to success for the 5'→3' form. In addition to presenting a plausible explanation for the uniqueness of enzymatic polymerization reactions, we hope these results also provide an example of how whole organism evolution can be understood based on molecular details.

  8. Electrical detection and quantification of single and mixed DNA nucleotides in suspension

    Science.gov (United States)

    Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

    2016-09-01

    High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

  9. Nucleotide-mediated conformational changes of monomeric actin and Arp3 studied by molecular dynamics simulations.

    Science.gov (United States)

    Dalhaimer, Paul; Pollard, Thomas D; Nolen, Brad J

    2008-02-08

    Members of the actin family of proteins exhibit different biochemical properties when ATP, ADP-P(i), ADP, or no nucleotide is bound. We used molecular dynamics simulations to study the effect of nucleotides on the behavior of actin and actin-related protein 3 (Arp3). In all of the actin simulations, the nucleotide cleft stayed closed, as in most crystal structures. ADP was much more mobile within the cleft than ATP, despite the fact that both nucleotides adopt identical conformations in actin crystal structures. The nucleotide cleft of Arp3 opened in most simulations with ATP, ADP, and no bound nucleotide. Deletion of a C-terminal region of Arp3 that extends beyond the conserved actin sequence reduced the tendency of the Arp3 cleft to open. When the Arp3 cleft opened, we observed multiple instances of partial release of the nucleotide. Cleft opening in Arp3 also allowed us to observe correlated movements of the phosphate clamp, cleft mouth, and barbed-end groove, providing a way for changes in the nucleotide state to be relayed to other parts of Arp3. The DNase binding loop of actin was highly flexible regardless of the nucleotide state. The conformation of Ser14/Thr14 in the P1 loop was sensitive to the presence of the gamma-phosphate, but other changes observed in crystal structures were not correlated with the nucleotide state on nanosecond timescales. The divalent cation occupied three positions in the nucleotide cleft, one of which was not previously observed in actin or Arp2/3 complex structures. In sum, these simulations show that subtle differences in structures of actin family proteins have profound effects on their nucleotide-driven behavior.

  10. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  11. Comparative genomic analysis for nucleotide, codon, and amino acid usage patterns of mycoplasmas.

    Science.gov (United States)

    Ma, Xiao-Xia; Cao, Xin; Ma, Peng; Chang, Qiu-Yan; Li, Lin-Jie; Zhou, Xiao-Kai; Zhang, De-Rong; Li, Ming-Sheng; Ma, Zhong-Ren

    2018-03-14

    The evolutionary factors in influencing the genetic characteristics of nucleotide, synonymous codon, and amino acid usage of 18 mycoplasma species were analyzed. The nucleotide usage at the 1st and 2nd codon position which determines amino acid composition of proteins has a significant correlation with the total nucleotide composition of gene population of these mycoplasma species, however, the nucleotide usage at the 3rd codon position which affects synonymous codon usage patterns has a slight correlation with either the total nucleotide composition or the nucleotide usage at the 1st and 2nd codon position. Other evolutionary factors join in the evolutionary process of mycoplasma apart from mutation pressure caused by nucleotide usage constraint based on the relationships between effective number of codons/codon adaptation index and nucleotide usage at the 3rd codon position. Although nucleotide usage of gene population in mycoplasma dominates in forming the overall codon usage trends, the relative abundance of codon with nucleotide context and amino acid usage pattern show that translation selection involved in translation accuracy and efficiency play an important role in synonymous codon usage patterns. In addition, synonymous codon usage patterns of gene population have a bigger power to represent genetic diversity among different species than amino acid usage. These results suggest that although the mycoplasmas reduce its genome size during the evolutionary process and shape the form, which is opposite to their hosts, of AT usages at high levels, this kind organism still depends on nucleotide usage at the 1st and 2nd codon positions to control syntheses of the requested proteins for surviving in their hosts and nucleotide usage at the 3rd codon position to develop genetic diversity of different mycoplasma species. This systemic analysis with 18 mycoplasma species may provide useful clues for further in vivo genetic studies on the related species. © 2018 WILEY

  12. Nucleos: a web server for the identification of nucleotide-binding sites in protein structures.

    Science.gov (United States)

    Parca, Luca; Ferré, Fabrizio; Ausiello, Gabriele; Helmer-Citterich, Manuela

    2013-07-01

    Nucleos is a web server for the identification of nucleotide-binding sites in protein structures. Nucleos compares the structure of a query protein against a set of known template 3D binding sites representing nucleotide modules, namely the nucleobase, carbohydrate and phosphate. Structural features, clustering and conservation are used to filter and score the predictions. The predicted nucleotide modules are then joined to build whole nucleotide-binding sites, which are ranked by their score. The server takes as input either the PDB code of the query protein structure or a user-submitted structure in PDB format. The output of Nucleos is composed of ranked lists of predicted nucleotide-binding sites divided by nucleotide type (e.g. ATP-like). For each ranked prediction, Nucleos provides detailed information about the score, the template structure and the structural match for each nucleotide module composing the nucleotide-binding site. The predictions on the query structure and the template-binding sites can be viewed directly on the web through a graphical applet. In 98% of the cases, the modules composing correct predictions belong to proteins with no homology relationship between each other, meaning that the identification of brand-new nucleotide-binding sites is possible using information from non-homologous proteins. Nucleos is available at http://nucleos.bio.uniroma2.it/nucleos/.

  13. The immediate nucleotide precursor, guanosine triphosphate, in the riboflavin biosynthetic pathway

    International Nuclear Information System (INIS)

    Mitsuda, Hisateru; Nakajima, Kenji; Nadamoto, Tomonori

    1977-01-01

    In the present paper, the nucleotide precursor of riboflavin was investigated by experiments with labeled purines using non-growing cells of Eremothecium ashbyii. The added purines, at 10 -4 M, were effectively incorporated into riboflavin at an early stage of riboflavin biosynthesis under the experimental conditions. In particular, both labeled xanthine and labeled guanine were specifically transported to guanosine nucleotides, GMP, GDP, GDP-Mannose and GTP, in the course of the riboflavin biosynthesis. A comparison of specific activities of labeled guanosine nucleotides and labeled riboflavin indicated that the nucleotide precursor of riboflavin is guanosine triphosphate. From the results obtained, a biosynthetic pathway of riboflavin is proposed. (auth.)

  14. Regulation of Salmonella typhimurium pyr Gene Expression: Effect of Changing Both Purine and Pyrimidine Nucleotide Pools

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank

    1989-01-01

    The synthesis of the pyrimidine biosynthetic enzymes is repressed by the pyrimidine nucleotide end-products of the pathway. However, purine nucleotides also play a role. In this study, I have measured expression of the pyr genes (pyrA-E) in Salmonella typhimurium strains harbouring mutations...... that permit manipulation of the intracellular pools of both pyrimidine and purine nucleotides. The results identify the effectory purine compound as being a guanine nucleotide; it is probably GTP, but it may be GDP or GMP. The synthesis of carbamoylphosphate synthase, encoded by pyrA, and particularly...

  15. Transformation of 8-[(2-hydroxyalkyl)sulfanyl]adenines to 6-amino-7.I.H./I.-purin-8(9.I.H./I.)-one derivatives

    Czech Academy of Sciences Publication Activity Database

    Janeba, Zlatko; Holý, Antonín; Masojídková, Milena

    2001-01-01

    Roč. 66, č. 9 (2001), s. 1393-1406 ISSN 0010-0765 R&D Projects: GA ČR GV203/96/K001 Institutional research plan: CEZ:AV0Z4055905 Keywords : purin es * nucleotide analogs Subject RIV: CC - Organic Chemistry Impact factor: 0.778, year: 2001

  16. Association of PTPN22 Single Nucleotide Polymorphisms with Celiac Disease.

    Science.gov (United States)

    Aflatounian, Majid; Rezaei, Arezou; Sadr, Maryam; Saghazadeh, Amene; Elhamian, Nazanin; Sadeghi, Hengameh; Motevasselian, Fatemeh; Farahmand, Fatemeh; Fallahi, Gholamhossein; Motamed, Farzaneh; Najafi, Mehri; Rezaei, Nima

    2017-06-01

    Celiac disease is a chronic autoimmune disease in which gene-environment interactions cause the immune system to unfavorably react to naturally gluten-containing foods. PTPN22 plays a crucial role in regulating the function of various cells of the immune system, particularly T cells. Polymorphisms of the PTPN22 gene have been associated with many autoimmune diseases. The present genetic association study was conducted to investigate the possible associations between PTPNTT single nucleotide polymorphisms (SNPs) and celiac disease in an Iranian population. The study population consisted of 45 patients with celiac disease and 93 healthy controls. The study genotyped five SNPs of the PTPN22 gene: rs12760457, rs1310182, rs1217414, rs33996649, and rs2476601. Control and patient groups did not differ on the genotype distribution of four of five investigated SNPs in the PTPN22 gene, for example, rs12760457, rs2476601, rs1217414, and rs33996649. The only investigated PTPN22 variant, which could be associated with CD, was rs1310182. A significant increase in the carriage of the T allele of rs1310182 in CD patients was observed (OR (95% CI) = 11.42 (5.41, 24.1), p value celiac disease. Our study suggests that the rs1310182 SNP of PTPN22 gene may be a predisposing factor of celiac disease in the Iranian population. Further studies are required to investigate the issue in other racial and ethnic subgroups.

  17. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms

    Science.gov (United States)

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    Summary We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jka/Jkb, Fya/Fyb, S/s, K/k, Kpa/Kpb, Jsa/Jsb, Coa/Cob and Lua/Lub alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplifies the alleles tested routinely, namely Jka/Jkb, Fya/Fyb, S/s, and K/k. PCR II amplifies those alleles that are typed less frequently. Biotinylated PCR products are hybridized in a single multiplex assay with the corresponding probe mixture. After incubation with R-phycoerythrin-conjugated streptavidin, the emitted fluorescence is analyzed with Luminex 100. So far, we have typed more than 2,000 subjects, 493 of whom with multiplex assay, and there have been no discrepancies with the serology results other than null and/or weak phenotypes. The cost of consumables and reagents for typing a single biallelic pair per sample is less than EUR 3.–, not including DNA extraction costs. The capability to perform multiplexed reactions makes the method markedly suitable for mass screening of red blood cell alleles. This genotyping approach represents an important tool in transfusion medicine. PMID:21113257

  18. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, K/k, Kp(a)/Kp(b), Js(a)/Js(b), Co(a)/Co(b) and Lu(a)/Lu(b) alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplifies the alleles tested routinely, namely Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, and K/k. PCR II amplifies those alleles that are typed less frequently. Biotinylated PCR products are hybridized in a single multiplex assay with the corresponding probe mixture. After incubation with R-phycoerythrin-conjugated streptavidin, the emitted fluorescence is analyzed with Luminex 100. So far, we have typed more than 2,000 subjects, 493 of whom with multiplex assay, and there have been no discrepancies with the serology results other than null and/or weak phenotypes. The cost of consumables and reagents for typing a single biallelic pair per sample is less than EUR 3.-, not including DNA extraction costs. The capability to perform multiplexed reactions makes the method markedly suitable for mass screening of red blood cell alleles. This genotyping approach represents an important tool in transfusion medicine.

  19. Evaluating melanocytic lesions with single nucleotide polymorphism (SNP) chromosomal microarray.

    Science.gov (United States)

    Hedayat, Amin A; Linos, Konstantinos; Jung, Hou-Sung; Tafe, Laura J; Yan, Shaofeng; LeBlanc, Robert E; Lefferts, Joel A

    2017-12-01

    Histopathology is the gold standard for diagnosing melanocytic lesions; however, distinguishing benign versus malignant is not always clear histologically. Single nucleotide polymorphism (SNP) microarray analysis may help in making a definitive diagnosis. Here, we share our experience with the Oncoscan FFPE Assay and demonstrate its diagnostic utility in the context of ambiguous melanocytic lesions. Eleven archival melanocytic lesions, including three benign nevi, four melanomas, three BAP1-deficient Spitzoid nevi and one nevoid melanoma were selected for validation. SNP-array was performed according to the manufacturer's protocol, using the recommended 80ng of DNA; however, as little as 15ng was used if the extraction yield was lower. Concordance was assessed with H&E and various combinations of BAP1 and p16 immunohistochemical stains (IHC) and external reference laboratory chromosomal microarray results. After validation, the SNP array was utilized to make definitive diagnoses in four challenging cases. Oncoscan SNP array findings were in concordance with H&E, IHC, and reference laboratory chromosomal microarray testing. The SNP-based microarray can accurately detect copy number changes and aid in making a more definitive diagnosis of challenging melanocytic lesions. This can be accomplished using significantly less DNA than is required by other microarray technologies. Copyright © 2017. Published by Elsevier Inc.

  20. An overview on single nucleotide polymorphism studies in mastitis research

    Directory of Open Access Journals (Sweden)

    V. N. Muhasin Asaf

    2014-06-01

    Full Text Available Mastitis is an inflammatory condition of the mammary gland caused by microorganisms as diverse as bacteria, viruses, mycoplasma, yeasts and algae. Mastitis is an economically devastating disease mainly affecting the crossbred cattle in India. Control strategies against mastitis includes antibiotic therapy, vaccination, improvements in dairy cattle husbandry, farm and feeding management etc. but has met with little success.. Mastitis tolerance/susceptibility is difficult to measure directly and hence milk somatic cell count (SCC or milk somatic cell score (SCS is used as an indicator trait for mastitis as both traits are highly positively correlated. Single nucleotide polymorphism (SNP marker is a single base change in a DNA sequence at a given position. SNP markers are the most preferred genetic markers nowadays. Currently most researches worldwide have been targeting molecular high density SNP markers that are linked to mastitis tolerance in an attempt to incorporate to understand the genetics of host resistance to mastitis and this knowledge will be helpful in formulating breeding programmes in an attempt to control mastitis. This article reviews various SNPs which are reported to be significantly associated with mastitis tolerance/susceptibility.

  1. Expression of Vesicular Nucleotide Transporter in Rat Odontoblasts

    International Nuclear Information System (INIS)

    Ikeda, Erina; Goto, Tetsuya; Gunjigake, Kaori; Kuroishi, Kayoko; Ueda, Masae; Kataoka, Shinji; Toyono, Takashi; Nakatomi, Mitsushiro; Seta, Yuji; Kitamura, Chiaki; Nishihara, Tatsuji; Kawamoto, Tatsuo

    2016-01-01

    Several theories have been proposed regarding pain transmission mechanisms in tooth. However, the exact signaling mechanism from odontoblasts to pulp nerves remains to be clarified. Recently, ATP-associated pain transmission has been reported, but it is unclear whether ATP is involved in tooth pain transmission. In the present study, we focused on the vesicular nucleotide transporter (VNUT), a transporter of ATP into vesicles, and examined whether VNUT was involved in ATP release from odontoblasts. We examined the expression of VNUT in rat pulp by RT-PCR and immunostaining. ATP release from cultured odontoblast-like cells with heat stimulation was evaluated using ATP luciferase methods. VNUT was expressed in pulp tissue, and the distribution of VNUT-immunopositive vesicles was confirmed in odontoblasts. In odontoblasts, some VNUT-immunopositive vesicles were colocalized with membrane fusion proteins. Additionally P2X 3 , an ATP receptor, immunopositive axons were distributed between odontoblasts. The ATP release by thermal stimulation from odontoblast-like cells was inhibited by the addition of siRNA for VNUT. These findings suggest that cytosolic ATP is transported by VNUT and that the ATP in the vesicles is then released from odontoblasts to ATP receptors on axons. ATP vesicle transport in odontoblasts seems to be a key mechanism for signal transduction from odontoblasts to axons in the pulp

  2. Implication of Posttranslational Histone Modifications in Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Shisheng Li

    2012-09-01

    Full Text Available Histones are highly alkaline proteins that package and order the DNA into chromatin in eukaryotic cells. Nucleotide excision repair (NER is a conserved multistep reaction that removes a wide range of generally bulky and/or helix-distorting DNA lesions. Although the core biochemical mechanism of NER is relatively well known, how cells detect and repair lesions in diverse chromatin environments is still under intensive research. As with all DNA-related processes, the NER machinery must deal with the presence of organized chromatin and the physical obstacles it presents. A huge catalogue of posttranslational histone modifications has been documented. Although a comprehensive understanding of most of these modifications is still lacking, they are believed to be important regulatory elements for many biological processes, including DNA replication and repair, transcription and cell cycle control. Some of these modifications, including acetylation, methylation, phosphorylation and ubiquitination on the four core histones (H2A, H2B, H3 and H4 or the histone H2A variant H2AX, have been found to be implicated in different stages of the NER process. This review will summarize our recent understanding in this area.

  3. Evolutionary algorithms for the selection of single nucleotide polymorphisms.

    Science.gov (United States)

    Hubley, Robert M; Zitzler, Eckart; Roach, Jared C

    2003-07-23

    Large databases of single nucleotide polymorphisms (SNPs) are available for use in genomics studies. Typically, investigators must choose a subset of SNPs from these databases to employ in their studies. The choice of subset is influenced by many factors, including estimated or known reliability of the SNP, biochemical factors, intellectual property, cost, and effectiveness of the subset for mapping genes or identifying disease loci. We present an evolutionary algorithm for multiobjective SNP selection. We implemented a modified version of the Strength-Pareto Evolutionary Algorithm (SPEA2) in Java. Our implementation, Multiobjective Analyzer for Genetic Marker Acquisition (MAGMA), approximates the set of optimal trade-off solutions for large problems in minutes. This set is very useful for the design of large studies, including those oriented towards disease identification, genetic mapping, population studies, and haplotype-block elucidation. Evolutionary algorithms are particularly suited for optimization problems that involve multiple objectives and a complex search space on which exact methods such as exhaustive enumeration cannot be applied. They provide flexibility with respect to the problem formulation if a problem description evolves or changes. Results are produced as a trade-off front, allowing the user to make informed decisions when prioritizing factors. MAGMA is open source and available at http://snp-magma.sourceforge.net. Evolutionary algorithms are well suited for many other applications in genomics.

  4. Evolutionary algorithms for the selection of single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zitzler Eckart

    2003-07-01

    Full Text Available Abstract Background Large databases of single nucleotide polymorphisms (SNPs are available for use in genomics studies. Typically, investigators must choose a subset of SNPs from these databases to employ in their studies. The choice of subset is influenced by many factors, including estimated or known reliability of the SNP, biochemical factors, intellectual property, cost, and effectiveness of the subset for mapping genes or identifying disease loci. We present an evolutionary algorithm for multiobjective SNP selection. Results We implemented a modified version of the Strength-Pareto Evolutionary Algorithm (SPEA2 in Java. Our implementation, Multiobjective Analyzer for Genetic Marker Acquisition (MAGMA, approximates the set of optimal trade-off solutions for large problems in minutes. This set is very useful for the design of large studies, including those oriented towards disease identification, genetic mapping, population studies, and haplotype-block elucidation. Conclusion Evolutionary algorithms are particularly suited for optimization problems that involve multiple objectives and a complex search space on which exact methods such as exhaustive enumeration cannot be applied. They provide flexibility with respect to the problem formulation if a problem description evolves or changes. Results are produced as a trade-off front, allowing the user to make informed decisions when prioritizing factors. MAGMA is open source and available at http://snp-magma.sourceforge.net. Evolutionary algorithms are well suited for many other applications in genomics.

  5. Single Nucleotide Polymorphism Identification, Characterization, and Linkage Mapping in Quinoa

    Directory of Open Access Journals (Sweden)

    P. J. Maughan

    2012-11-01

    Full Text Available Quinoa ( Willd. is an important seed crop throughout the Andean region of South America. It is important as a regional food security crop for millions of impoverished rural inhabitants of the Andean Altiplano (high plains. Efforts to improve the crop have led to an increased focus on genetic research. We report the identification of 14,178 putative single nucleotide polymorphisms (SNPs using a genomic reduction protocol as well as the development of 511 functional SNP assays. The SNP assays are based on KASPar genotyping chemistry and were detected using the Fluidigm dynamic array platform. A diversity screen of 113 quinoa accessions showed that the minor allele frequency (MAF of the SNPs ranged from 0.02 to 0.50, with an average MAF of 0.28. Structure analysis of the quinoa diversity panel uncovered the two major subgroups corresponding to the Andean and coastal quinoa ecotypes. Linkage mapping of the SNPs in two recombinant inbred line populations produced an integrated linkage map consisting of 29 linkage groups with 20 large linkage groups, spanning 1404 cM with a marker density of 3.1 cM per SNP marker. The SNPs identified here represent important genomic tools needed in emerging plant breeding programs for advanced genetic analysis of agronomic traits in quinoa.

  6. Domestication rewired gene expression and nucleotide diversity patterns in tomato.

    Science.gov (United States)

    Sauvage, Christopher; Rau, Andrea; Aichholz, Charlotte; Chadoeuf, Joël; Sarah, Gautier; Ruiz, Manuel; Santoni, Sylvain; Causse, Mathilde; David, Jacques; Glémin, Sylvain

    2017-08-01

    Plant domestication has led to considerable phenotypic modifications from wild species to modern varieties. However, although changes in key traits have been well documented, less is known about the underlying molecular mechanisms, such as the reduction of molecular diversity or global gene co-expression patterns. In this study, we used a combination of gene expression and population genetics in wild and crop tomato to decipher the footprints of domestication. We found a set of 1729 differentially expressed genes (DEG) between the two genetic groups, belonging to 17 clusters of co-expressed DEG, suggesting that domestication affected not only individual genes but also regulatory networks. Five co-expression clusters were enriched in functional terms involving carbohydrate metabolism or epigenetic regulation of gene expression. We detected differences in nucleotide diversity between the crop and wild groups specific to DEG. Our study provides an extensive profiling of the rewiring of gene co-expression induced by the domestication syndrome in one of the main crop species. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  7. Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.

    Directory of Open Access Journals (Sweden)

    B Josh Lane

    2008-03-01

    Full Text Available Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein. TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs, Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K, appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.

  8. Nucleotide composition and codon usage bias of SRY gene.

    Science.gov (United States)

    Choudhury, M N; Uddin, A; Chakraborty, S

    2018-02-01

    The SRY gene is present within the sex-determining region of the Y chromosome which is responsible for maleness in mammals. The nonuniform usage of synonymous codons in the mRNA transcript for encoding a particular amino acid is the codon usage bias (CUB). Analysis of codon usage pattern is important to understand the genetic and molecular organisation of a gene. It also helps in heterologous gene expression, design of primer and synthetic gene. However, the analysis of codon usage bias of SRY gene was not yet studied. We have used bioinformatic tools to analyse codon usage bias of SRY gene across mammals. Codon bias index (CBI) indicated that the overall extent of codon usage bias was weak. The relative synonymous codon usage (RSCU) analysis suggested that most frequently used codons had an A or C at the third codon position. Compositional constraint played an important role in codon usage pattern as evident from correspondence analysis (CA). Significant correlation among nucleotides constraints indicated that both mutation pressure and natural selection affect the codon usage pattern. Neutrality plot suggested that natural selection might play a major role, while mutation pressure might play a minor role in codon usage pattern in SRY gene in different species of mammals. © 2017 Blackwell Verlag GmbH.

  9. Fluorogenic Labeling of 5-Formylpyrimidine Nucleotides in DNA and RNA.

    Science.gov (United States)

    Samanta, Biswajit; Seikowski, Jan; Höbartner, Claudia

    2016-01-26

    5-Formylcytosine (5fC) and 5-formyluracil (5fU) are natural nucleobase modifications that are generated by oxidative modification of 5-methylcytosine and thymine (or 5-methyluracil). Herein, we describe chemoselective labeling of 5-formylpyrimidine nucleotides in DNA and RNA by fluorogenic aldol-type condensation reactions with 2,3,3-trimethylindole derivatives. Mild and specific reaction conditions were developed for 5fU and 5fC to produce hemicyanine-like chromophores with distinct photophysical properties. Residue-specific detection was established by fluorescence readout as well as primer-extension assays. The reactions were optimized on DNA oligonucleotides and were equally suitable for the modification of 5fU- and 5fC-modified RNA. This direct labeling approach of 5-formylpyrimidines is expected to help in elucidating the occurrence, enzymatic transformations, and functional roles of these epigenetic/epitranscriptomic nucleobase modifications in DNA and RNA. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. MGMT expression: insights into its regulation. 2. Single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Iatsyshyna A. P.

    2013-09-01

    Full Text Available High intra- and interindividual variations in the expression levels of the human O6-methylguanine-DNA methyltransferase (MGMT gene have been observed. This DNA repair enzyme can be a cause of resistance of cancer cells to alkylating chemotherapy. It has been studied the association of single nucleotide polymorphisms (SNPs of MGMT with the risk for different types of cancer, progression-free survival in patients with cancer treated with alkylating chemotherapy, as well as an effect of SNPs on the MGMT gene expression and activity of the enzyme. SNPs have been suggested to be the factors which influence the levels of interindividual variability of the MGMT expression. Therefore, the aim of this paper was to review the experimental data on SNPs of the human MGMT gene, which are associated with cancer, as well as on location of MGMT-SNPs in regulatory and protein-coding regions of the gene in relation to its regulation. Lots of MGMT SNPs, which could affect the gene expression and result in interindividual MGMT variability or the enzyme resistance to pseudosubstrate inhibitors, have been re- vealed within the promoter and enhancer regions, the 5'- and 3'-UTRs and introns of the MGMT gene, as well as within the protein-coding region. Many of them may have regulatory effect.

  11. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  12. Bulk segregant analysis using single nucleotide polymorphism microarrays.

    Directory of Open Access Journals (Sweden)

    Anthony Becker

    2011-01-01

    Full Text Available Bulk segregant analysis (BSA using microarrays, and extreme array mapping (XAM have recently been used to rapidly identify genomic regions associated with phenotypes in multiple species. These experiments, however, require the identification of single feature polymorphisms (SFP between the cross parents for each new combination of genotypes, which raises the cost of experiments. The availability of the genomic polymorphism data in Arabidopsis thaliana, coupled with the efficient designs of Single Nucleotide Polymorphism (SNP genotyping arrays removes the requirement for SFP detection and lowers the per array cost, thereby lowering the overall cost per experiment. To demonstrate that these approaches would be functional on SNP arrays and determine confidence intervals, we analyzed hybridizations of natural accessions to the Arabidopsis ATSNPTILE array and simulated BSA or XAM given a variety of gene models, populations, and bulk selection parameters. Our results show a striking degree of correlation between the genotyping output of both methods, which suggests that the benefit of SFP genotyping in context of BSA can be had with the cheaper, more efficient SNP arrays. As a final proof of concept, we hybridized the DNA from bulks of an F2 mapping population of a Sulfur and Selenium ionomics mutant to both the Arabidopsis ATTILE1R and ATSNPTILE arrays, which produced almost identical results. We have produced R scripts that prompt the user for the required parameters and perform the BSA analysis using the ATSNPTILE1 array and have provided them as supplemental data files.

  13. Effects of Alkaline Phosphatase Activity on Nucleotide Measurements in Aquatic Microbial Communities †

    OpenAIRE

    Karl, D. M.; Craven, D. B.

    1980-01-01

    Alkaline phosphatase (APase) activity was detected in aquatic microbial assemblages from the subtropics to Antarctica. The occurrence of APase in environmental nucleotide extracts was shown to significantly affect the measured concentrations of cellular nucleotides (adenosine triphosphate, adenosine diphosphate, adenosine monophosphate, guanosine triphosphate, uridine triphosphate, and cytidine triphosphate), adenylate energy charge, and guanosine triphosphate/adenosine triphosphate ratios, w...

  14. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey

    2011-01-01

    A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technology...

  15. Complete nucleotide sequence and genome organization of a novel allexivirus from alfalfa (Medicago sativa)

    Science.gov (United States)

    A new species of the family Alphaflexiviridae provisionally named Alfalfa virus S (AVS) was diagnosed in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by Illumina NGS technology ...

  16. Complete nucleotide sequence of a monopartite Begomovirus and associated satellites infecting Carica papaya in Nepal.

    Science.gov (United States)

    Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

    2013-06-01

    Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.

  17. The nucleotide-binding site of the Escherichia coli DnaC protein: molecular topography of DnaC protein-nucleotide cofactor complexes.

    Science.gov (United States)

    Galletto, Roberto; Jezewska, Maria J; Maillard, Rodrigo; Bujalowski, Wlodzimierz

    2005-01-01

    The structure of the nucleotide-binding site of the Escherichia coli replication factor DnaC protein and the effect of the nucleotide cofactor on the protein structure have been examined using ultraviolet, steady-state, and time-dependent fluorescence spectroscopy. Emission spectra and quenching studies of the fluorescent nucleotide analogs, 3'-O-(N-methylantraniloyl)-5'-triphosphate (MANT-ATP) and 3'-O-(N-methylantraniloyl)-5'-diphosphate (MANT-ADP), bound to the DnaC protein indicate that the nucleotide-binding site forms a hydrophobic cleft on the surface of the protein. Fluorescence decays of free and bound MANT-ATP and MANT-ADP indicate that cofactors exist in two different conformations both, free and bound to the protein. However, the two conformations of the bound nucleotides differ in their solvent accessibilities. Moreover, there are significant differences in the solvent accessibility between ATP and ADP complexes. Specific binding of magnesium to the protein controls the structure of the binding site, particularly, in the case of the ATP complex, leading to additional opening of the binding site cleft. Both tyrosine and tryptophan residues are located on the surface of the protein. The tryptophans are clustered at a large distance from the nucleotide-binding site. However, in spite of a large spatial separation, binding of both cofactors induces significant and different changes in the structure of the environment of tryptophans, indicating long-range structural effects through the DnaC molecule. Moreover, only ATP induces changes in the distribution of the tyrosine residues on the surface of the protein. The data reveal that the nucleotide-DnaC protein complex is a sophisticated allosteric system, responding differently to the ATP and ADP binding.

  18. Single nucleotide polymorphism mining and nucleotide sequence analysis of Mx1 gene in exonic regions of Japanese quail.

    Science.gov (United States)

    Niraj, Diwesh Kumar; Kumar, Pushpendra; Mishra, Chinmoy; Narayan, Raj; Bhattacharya, Tarun Kumar; Shrivastava, Kush; Bhushan, Bharat; Tiwari, Ashok Kumar; Saxena, Vishesh; Sahoo, Nihar Ranjan; Sharma, Deepak

    2015-12-01

    An attempt has been made to study the Myxovirus resistant (Mx1) gene polymorphism in Japanese quail. In the present, investigation four fragments viz. Fragment I of 185 bp (Exon 3 region), Fragment II of 148 bp (Exon 5 region), Fragment III of 161 bp (Exon 7 region), and Fragment IV of 176 bp (Exon 13 region) of Mx1 gene were amplified and screened for polymorphism by polymerase chain reaction-single-strand conformation polymorphism technique in 170 Japanese quail birds. Out of the four fragments, one fragment (Fragment II) was found to be polymorphic. Remaining three fragments (Fragment I, III, and IV) were found to be monomorphic which was confirmed by custom sequencing. Overall nucleotide sequence analysis of Mx1 gene of Japanese quail showed 100% homology with common quail and more than 80% homology with reported sequence of chicken breeds. The Mx1 gene is mostly conserved in Japanese quail. There is an urgent need of comprehensive analysis of other regions of Mx1 gene along with its possible association with the traits of economic importance in Japanese quail.

  19. Single nucleotide polymorphism mining and nucleotide sequence analysis of Mx1 gene in exonic regions of Japanese quail

    Directory of Open Access Journals (Sweden)

    Diwesh Kumar Niraj

    2015-12-01

    Full Text Available Aim: An attempt has been made to study the Myxovirus resistant (Mx1 gene polymorphism in Japanese quail. Materials and Methods: In the present, investigation four fragments viz. Fragment I of 185 bp (Exon 3 region, Fragment II of 148 bp (Exon 5 region, Fragment III of 161 bp (Exon 7 region, and Fragment IV of 176 bp (Exon 13 region of Mx1 gene were amplified and screened for polymorphism by polymerase chain reaction-single-strand conformation polymorphism technique in 170 Japanese quail birds. Results: Out of the four fragments, one fragment (Fragment II was found to be polymorphic. Remaining three fragments (Fragment I, III, and IV were found to be monomorphic which was confirmed by custom sequencing. Overall nucleotide sequence analysis of Mx1 gene of Japanese quail showed 100% homology with common quail and more than 80% homology with reported sequence of chicken breeds. Conclusion: The Mx1 gene is mostly conserved in Japanese quail. There is an urgent need of comprehensive analysis of other regions of Mx1 gene along with its possible association with the traits of economic importance in Japanese quail.

  20. R3D Align web server for global nucleotide to nucleotide alignments of RNA 3D structures.

    Science.gov (United States)

    Rahrig, Ryan R; Petrov, Anton I; Leontis, Neocles B; Zirbel, Craig L

    2013-07-01

    The R3D Align web server provides online access to 'RNA 3D Align' (R3D Align), a method for producing accurate nucleotide-level structural alignments of RNA 3D structures. The web server provides a streamlined and intuitive interface, input data validation and output that is more extensive and easier to read and interpret than related servers. The R3D Align web server offers a unique Gallery of Featured Alignments, providing immediate access to pre-computed alignments of large RNA 3D structures, including all ribosomal RNAs, as well as guidance on effective use of the server and interpretation of the output. By accessing the non-redundant lists of RNA 3D structures provided by the Bowling Green State University RNA group, R3D Align connects users to structure files in the same equivalence class and the best-modeled representative structure from each group. The R3D Align web server is freely accessible at http://rna.bgsu.edu/r3dalign/.

  1. Activity of nicotinic acid substituted nicotinic acid adenine dinucleotide phosphate (NAADP) analogs in a human cell line: difference in specificity between human and sea urchin NAADP receptors.

    Science.gov (United States)

    Ali, Ramadan A; Zhelay, Tetyana; Trabbic, Christopher J; Walseth, Timothy F; Slama, James T; Giovannucci, David R; Wall, Katherine A

    2014-02-01

    Nicotinic acid adenine dinucleotide phosphate (NAADP) is the most potent Ca2+ mobilizing second messenger that has been identified. We have previously shown that NAADP analogs substituted at the 5-position of nicotinic acid were recognized by the sea urchin receptor at low concentration, whereas the 4- substituted analogs were not as potent. However, to date the structure-activity relationship (SAR) of these analogs has not been addressed in mammalian systems. Thus, we asked whether these structurally modified analogs behave similarly in an NAADP-responsive mammalian cell line (SKBR3) using microinjection and single cell fluorescent imaging methods. Novel "caged" 4- and 5-substituted NAADP analogs that were activated inside the cell by flash photolysis resulted in Ca2+ mobilizing activity in SKBR3 cells in a concentration dependent manner, but with reduced effectiveness compared to unmodified NAADP. The SAR in mammalian SKBR3 cells was quite different from that of sea urchin and may suggest that there are differences between NAADP receptors in different species or tissues. Importantly, these data indicate that modifications at the 4- and 5-position of the nicotinic acid ring may lead to the development of functional photoaffinity labels that could be used for receptor localization and isolation in mammalian systems. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Tissue-specific regulation of sirtuin and nicotinamide adenine dinucleotide biosynthetic pathways identified in C57Bl/6 mice in response to high-fat feeding.

    Science.gov (United States)

    Drew, Janice E; Farquharson, Andrew J; Horgan, Graham W; Williams, Lynda M

    2016-11-01

    The sirtuin (SIRT)/nicotinamide adenine dinucleotide (NAD) system is implicated in development of type 2 diabetes (T2D) and diet-induced obesity, a major risk factor for T2D. Mechanistic links have not yet been defined. SIRT/NAD system gene expression and NAD/NADH levels were measured in liver, white adipose tissue (WAT) and skeletal muscle from mice fed either a low-fat diet or high-fat diet (HFD) for 3 days up to 16 weeks. An in-house custom-designed multiplex gene expression assay assessed all 7 mouse SIRTs (SIRT1-7) and 16 enzymes involved in conversion of tryptophan, niacin, nicotinamide riboside and metabolic precursors to NAD. Significantly altered transcription was correlated with body weight, fat mass, plasma lipids and hormones. Regulation of the SIRT/NAD system was associated with early (SIRT4, SIRT7, NAPRT1 and NMNAT2) and late phases (NMNAT3, NMRK2, ABCA1 and CD38) of glucose intolerance. TDO2 and NNMT were identified as markers of HFD consumption. Altered regulation of the SIRT/NAD system in response to HFD was prominent in liver compared with WAT or muscle. Multiple components of the SIRTs and NAD biosynthetic enzymes network respond to consumption of dietary fat. Novel molecular targets identified above could direct strategies for dietary/therapeutic interventions to limit metabolic dysfunction and development of T2D. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Wear Particles Promote Reactive Oxygen Species-Mediated Inflammation via the Nicotinamide Adenine Dinucleotide Phosphate Oxidase Pathway in Macrophages Surrounding Loosened Implants

    Directory of Open Access Journals (Sweden)

    Weishen Chen

    2015-03-01

    Full Text Available Background/Aims: Prosthesis loosening is closely associated with chronic inflammatory cytokine secretion by macrophages, which are activated by wear particles or inflammatory stimulants such as lipopolysaccharide (LPS. Reactive oxygen species (ROS are critical regulators of inflammation, but their enzymatic sources in response to wear particles and their effects on peri-implant LPS-tolerance remain unclear. Methods: Three ROS-related enzymes—nicotinamide adenine dinucleotide phosphate oxidase (NOX-1 and -2 and catalase—were investigated in interface membrane tissues and in titanium (Ti particle-stimulated macrophages in vitro. The generation of ROS and downstream inflammatory effects were measured with or without pre-incubation with apocynin, an NOX inhibitor. Results: Pre-exposure to Ti particles attenuated NF-κB activation in LPS-stimulated macrophages, indicating that wear particles suppress immune response, which may lead to chronic inflammation. NOX-1 and -2 were highly expressed in aseptically loosened interface membranes and in macrophages stimulated with Ti particles; the particles induced a moderate amount of ROS generation, NF-κB activation, and TNF-a secretion in macrophages, and these effects were suppressed by apocynin. Conclusion: Wear particles induce ROS generation through the NOX signaling pathway, resulting in persistent inflammation and delayed loosening. Thus, the suppression of NOX activity may be a useful strategy for preventing prosthesis loosening.

  4. Discovery of Nicotinamide Adenine Dinucleotide Binding Proteins in the Escherichia coli Proteome Using a Combined Energetic- and Structural-Bioinformatics-Based Approach.

    Science.gov (United States)

    Zeng, Lingfei; Shin, Woong-Hee; Zhu, Xiaolei; Park, Sung Hoon; Park, Chiwook; Tao, W Andy; Kihara, Daisuke

    2017-02-03

    Protein-ligand interaction plays a critical role in regulating the biochemical functions of proteins. Discovering protein targets for ligands is vital to new drug development. Here, we present a strategy that combines experimental and computational approaches to identify ligand-binding proteins in a proteomic scale. For the experimental part, we coupled pulse proteolysis with filter-assisted sample preparation (FASP) and quantitative mass spectrometry. Under denaturing conditions, ligand binding affected protein stability, which resulted in altered protein abundance after pulse proteolysis. For the computational part, we used the software Patch-Surfer2.0. We applied the integrated approach to identify nicotinamide adenine dinucleotide (NAD)-binding proteins in the Escherichia coli proteome, which has over 4200 proteins. Pulse proteolysis and Patch-Surfer2.0 identified 78 and 36 potential NAD-binding proteins, respectively, including 12 proteins that were consistently detected by the two approaches. Interestingly, the 12 proteins included 8 that are not previously known as NAD binders. Further validation of these eight proteins showed that their binding affinities to NAD computed by AutoDock Vina are higher than their cognate ligands and also that their protein ratios in the pulse proteolysis are consistent with known NAD-binding proteins. These results strongly suggest that these eight proteins are indeed newly identified NAD binders.

  5. Deficiency of the iron-sulfur clusters of mitochondrial reduced nicotinamide-adenine dinucleotide-ubiquinone oxidoreductase (complex I) in an infant with congenital lactic acidosis.

    Science.gov (United States)

    Moreadith, R W; Batshaw, M L; Ohnishi, T; Kerr, D; Knox, B; Jackson, D; Hruban, R; Olson, J; Reynafarje, B; Lehninger, A L

    1984-09-01

    We report the case of an infant with hypoglycemia, progressive lactic acidosis, an increased serum lactate/pyruvate ratio, and elevated plasma alanine, who had a moderate to profound decrease in the ability of mitochondria from four organs to oxidize pyruvate, malate plus glutamate, citrate, and other NAD+-linked respiratory substrates. The capacity to oxidize the flavin adenine dinucleotide-linked substrate, succinate, was normal. The most pronounced deficiency was in skeletal muscle, the least in kidney mitochondria. Enzymatic assays on isolated mitochondria ruled out defects in complexes II, III, and IV of the respiratory chain. Further studies showed that the defect was localized in the inner membrane mitochondrial NADH-ubiquinone oxidoreductase (complex I). When ferricyanide was used as an artificial electron acceptor, complex I activity was normal, indicating that electrons from NADH could reduce the flavin mononucleotide cofactor. However, electron paramagnetic resonance spectroscopy performed on liver submitochondrial particles showed an almost total loss of the iron-sulfur clusters characteristic of complex I, whereas normal signals were noted for other mitochondrial iron-sulfur clusters. This infant is presented as the first reported case of congenital lactic acidosis caused by a deficiency of the iron-sulfur clusters of complex I of the mitochondrial electron transport chain.

  6. Enhancement of anaerobic degradation of azo dye with riboflavin and nicotinamide adenine dinucleotide harvested by osmotic lysis of wasted fermentation yeasts.

    Science.gov (United States)

    Victral, Davi M; Dias, Heitor R A; Silva, Silvana Q; Baeta, Bruno E L; Aquino, Sérgio F

    2017-02-01

    The study presented here aims at identifying the source of redox mediators (riboflavin), electron carriers nicotinamide adenine dinucleotide (NAD) and carbon to perform decolorization of azo dye under anaerobic conditions after osmotic shock pretreatment of residual yeast from industrial fermentation. Pretreatment conditions were optimized by Doehlert experiment, varying NaCl concentration, temperature, yeast density and time. After the optimization, the riboflavin concentration in the residual yeast lysate (RYL) was 46% higher than the one present in commercial yeast extract. Moreover, similar NAD concentration was observed in both extracts. Subsequently, two decolorization experiments were performed, that is, a batch experiment (48 h) and a kinetic experiment (102 h). The results of the batch experiment showed that the use of the RYL produced by the optimized method increased decolorization rates and led to color removal efficiencies similar to those found when using the commercial extract (∼80%) and from 23% to 50% higher when compared to the control (without redox mediators). Kinetics analysis showed that methane production was also higher in the presence of yeast extract and RYL, and biogas was mostly generated after stabilization of color removal. In all kinetics experiments the azo dye degradation followed the pseudo-second-order model, which suggested that there was a concomitant adsorption/degradation of the dye on the biomass cell surface. Therefore, results showed the possibility of applying the pretreated residual yeast to improve color removal under anaerobic conditions, which is a sustainable process.

  7. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  8. Determining Candidate Single Nucleotide Polymorphisms in Acquired Laryngotracheal Stenosis.

    Science.gov (United States)

    Anis, Mursalin M; Krynetskaia, Natalia; Zhao, Zhigen; Krynetskiy, Evgeny; Soliman, Ahmed M S

    2018-03-01

    Despite wide adoption of strategies to prevent injury from prolonged intubation and tracheotomy, acquired laryngotracheal stenosis (ALTS) has not disappeared. ALTS' persistence may be due to patient factors that confer unique susceptibility for some. We sought to identify genetic markers in genes associated with wound healing that could be associated with ALTS. Case-control study. One hundred thirty-eight patients were recruited, 53 patients with ALTS and 85 control patients who underwent intubation or tracheotomy without evidence of ALTS. The patients' DNA was isolated from whole blood. Custom primers were designed, and the TaqMan assay employing allele-specific polymerase chain reaction was used to interrogate single nucleotide polymorphisms (SNPs) rs1799750, rs522616, rs2276109, rs2569190, rs1800469, and rs1024611 of candidate wound healing genes MMP1, MMP3, MMP12, CD14, TGFβ1, and MCP1, respectively. A logistic regression model was used to examine the association of candidate gene polymorphisms with the presence or absence of ALTS. All 138 patients were successfully genotyped. No significant association was found between candidate SNPs and development of ALTS in the overall group. However, subgroup analysis within each ethnicity identified SNPs that are associated with ALTS depending upon the ethnic background. Patient factors such as variations in wound healing due to functional SNPs may shed light on the development of ALTS. There may be a difference in susceptibility to developing ALTS in different ethnic backgrounds. These preliminary findings need to be corroborated in larger population studies. 3b. Laryngoscope, 128:E111-E116, 2018. © 2017 The American Laryngological, Rhinological and Otological Society, Inc.

  9. Inferring clonal evolution of tumors from single nucleotide somatic mutations.

    Science.gov (United States)

    Jiao, Wei; Vembu, Shankar; Deshwar, Amit G; Stein, Lincoln; Morris, Quaid

    2014-02-01

    High-throughput sequencing allows the detection and quantification of frequencies of somatic single nucleotide variants (SNV) in heterogeneous tumor cell populations. In some cases, the evolutionary history and population frequency of the subclonal lineages of tumor cells present in the sample can be reconstructed from these SNV frequency measurements. But automated methods to do this reconstruction are not available and the conditions under which reconstruction is possible have not been described. We describe the conditions under which the evolutionary history can be uniquely reconstructed from SNV frequencies from single or multiple samples from the tumor population and we introduce a new statistical model, PhyloSub, that infers the phylogeny and genotype of the major subclonal lineages represented in the population of cancer cells. It uses a Bayesian nonparametric prior over trees that groups SNVs into major subclonal lineages and automatically estimates the number of lineages and their ancestry. We sample from the joint posterior distribution over trees to identify evolutionary histories and cell population frequencies that have the highest probability of generating the observed SNV frequency data. When multiple phylogenies are consistent with a given set of SNV frequencies, PhyloSub represents the uncertainty in the tumor phylogeny using a "partial order plot". Experiments on a simulated dataset and two real datasets comprising tumor samples from acute myeloid leukemia and chronic lymphocytic leukemia patients demonstrate that PhyloSub can infer both linear (or chain) and branching lineages and its inferences are in good agreement with ground truth, where it is available. PhyloSub can be applied to frequencies of any "binary" somatic mutation, including SNVs as well as small insertions and deletions. The PhyloSub and partial order plot software is available from https://github.com/morrislab/phylosub/.

  10. Analysis of codon usage and nucleotide composition bias in polioviruses

    Directory of Open Access Journals (Sweden)

    Gu Yuan-xing

    2011-03-01

    Full Text Available Abstract Background Poliovirus, the causative agent of poliomyelitis, is a human enterovirus and a member of the family of Picornaviridae and among the most rapidly evolving viruses known. Analysis of codon usage can reveal much about the molecular evolution of the viruses. However, little information about synonymous codon usage pattern of polioviruses genome has been acquired to date. Methods The relative synonymous codon usage (RSCU values, effective number of codon (ENC values, nucleotide contents and dinucleotides were investigated and a comparative analysis of codon usage pattern for open reading frames (ORFs among 48 polioviruses isolates including 31 of genotype 1, 13 of genotype 2 and 4 of genotype 3. Results The result shows that the overall extent of codon usage bias in poliovirus samples is low (mean ENC = 53.754 > 40. The general correlation between base composition and codon usage bias suggests that mutational pressure rather than natural selection is the main factor that determines the codon usage bias in those polioviruses. Depending on the RSCU data, it was found that there was a significant variation in bias of codon usage among three genotypes. Geographic factor also has some effect on the codon usage pattern (exists in the genotype-1 of polioviruses. No significant effect in gene length or vaccine derived polioviruses (DVPVs, wild viruses and live attenuated virus was observed on the variations of synonymous codon usage in the virus genes. The relative abundance of dinucleotide (CpG in the ORFs of polioviruses are far below expected values especially in DVPVs and attenuated virus of polioviruses genotype 1. Conclusion The information from this study may not only have theoretical value in understanding poliovirus evolution, especially for DVPVs genotype 1, but also have potential value for the development of poliovirus vaccines.

  11. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers*

    Science.gov (United States)

    Zoghbi, Maria E.; Altenberg, Guillermo A.

    2013-01-01

    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we used luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation. PMID:24129575

  12. Formation of ternary complexes by coordination of (diethylenetriamine)-Platinum(II) to N1 or N7 of the adenine moiety of the antiviral nucleotide analogue 9-[2-(phosphonomethoxy)ethyl]adenine (PMEA): Comparison of the acid-base and Metal-ion-binding properties of PMEA, (Dien)Pt(PMEA-.I.N./I.1), and (Dien)Pt(PMEA-.I.N./I.7)

    Czech Academy of Sciences Publication Activity Database

    Kampf, G.; Lüth, M. S.; Kapinos, L. E.; Müller, J.; Holý, Antonín; Lippert, B.; Sigel, H.

    2001-01-01

    Roč. 7, č. 9 (2001), s. 1899-1908 ISSN 0947-6539 R&D Projects: GA ČR GV203/96/K001; GA MŠk OC D8.30 Institutional research plan: CEZ:AV0Z4055905 Keywords : acidity constants Subject RIV: CC - Organic Chemistry Impact factor: 4.614, year: 2001

  13. Supra-molecular architecture in a co-crystal of the N(7)-H tautomeric form of N (6)-benzoyl-adenine with adipic acid (1/0.5).

    Science.gov (United States)

    Swinton Darious, Robert; Thomas Muthiah, Packianathan; Perdih, Franc

    2016-06-01

    The asymmetric unit of the title co-crystal, C12H9N5O·0.5C6H10O4, consists of one mol-ecule of N (6)-benzoyl-adenine (BA) and one half-mol-ecule of adipic acid (AA), the other half being generated by inversion symmetry. The dihedral angle between the adenine and phenyl ring planes is 26.71 (7)°. The N (6)-benzoyl-adenine mol-ecule crystallizes in the N(7)-H tautomeric form with three non-protonated N atoms. This tautomeric form is stabilized by intra-molecular N-H⋯O hydrogen bonding between the carbonyl (C=O) group and the N(7)-H hydrogen atom on the Hoogsteen face of the purine ring, forming an S(7) ring motif. The two carboxyl groups of adipic acid inter-act with the Watson-Crick face of the BA mol-ecules through O-H⋯N and N-H⋯O hydrogen bonds, generating an R 2 (2)(8) ring motif. The latter units are linked by N-H⋯N hydrogen bonds, forming layers parallel to (10-5). A weak C-H⋯O hydrogen bond is also present, linking adipic acid mol-ecules in neighbouring layers, enclosing R (2) 2(10) ring motifs and forming a three-dimensional structure. C=O⋯π and C-H⋯π inter-actions are also present in the structure.

  14. Unsaturated fluoro-ketopyranosyl nucleosides: synthesis and biological evaluation of 3-fluoro-4-keto-beta-d-glucopyranosyl derivatives of N(4)-benzoyl cytosine and N(6)-benzoyl adenine.

    Science.gov (United States)

    Manta, Stella; Agelis, George; Botić, Tanja; Cencic, Avrelija; Komiotis, Dimitri

    2008-02-01

    The protected beta-nucleosides 1-(2,4,6-tri-O-acetyl-3-deoxy-3-fluoro-beta-d-glucopyranosyl)-N(4)-benzoyl cytosine (2a) and 9-(2,4,6-tri-O-acetyl-3-deoxy-3-fluoro-beta-d-glucopyranosyl)-N(6)-benzoyl adenine (2b), were synthesized by the coupling of peracetylated 3-deoxy-3-fluoro-d-glucopyranose (1) with silylated N(4)-benzoyl cytosine and N(6)-benzoyl adenine, respectively. The nucleosides were deacetylated and several subsequent protection and deprotection steps afforded the partially acetylated nucleosides of cytosine 7a and adenine 7b, respectively. Finally, direct oxidation of the free hydroxyl group at 4'-position of 7a and 7b, and simultaneous elimination reaction of the beta-acetoxyl group, afforded the desired unsaturated 3-fluoro-4-keto-beta-d-glucopyranosyl derivatives. These newly synthesized compounds were evaluated for their potential antitumor and antiviral activities. Compared to 5FU, the newly synthesized derivatives showed to be more efficient as antitumor growth inhibitors and they exhibited direct antiviral effect toward rotavirus.

  15. .I.Ribo./I.-, .I.Xylo./I.-, and .I.Arabino./I.-configured adenine-based nucleoside phosphonates: synthesis of monomers for solid-phase oligonucleotide assembly

    Czech Academy of Sciences Publication Activity Database

    Páv, Ondřej; Buděšínský, Miloš; Rosenberg, Ivan

    2003-01-01

    Roč. 22, 5/8 (2003), s. 1053-1056 ISSN 1525-7770. [International Roundtable Nucleosides, Nucleotides and Nucleic Acids /15./. Leuven, 10.09.2002-14.09.2002] R&D Projects: GA ČR GA203/01/1166; GA AV ČR IAA4055101 Institutional research plan: CEZ:AV0Z4055905 Keywords : nucleoside phosphonic acids * adenosine * phosphonylation Subject RIV: CC - Organic Chemistry Impact factor: 0.813, year: 2003

  16. Molecular recognition of nucleotides in micelles and the development and expansion of a chemistry outreach program

    Science.gov (United States)

    Schechinger, Linda Sue

    I. To investigate the delivery of nucleotide-based drugs, we are studying molecular recognition of nucleotide derivatives in environments that are similar to cell membranes. The Nowick group previously discovered that membrane-like surfactant micelles tetradecyltrimethylammonium bromide (TTAB) micelle facilitate molecular of adenosine monophosphate (AMP) recognition. The micelles bind nucleotides by means of electrostatic interactions and hydrogen bonding. We observed binding by following 1H NMR chemical shift changes of unique hexylthymine protons upon addition of AMP. Cationic micelles are required for binding. In surfactant-free or sodium dodecylsulfate solutions, no hydrogen bonding is observed. These observations suggest that the cationic surfactant headgroups bind the nucleotide phosphate group, while the intramicellar base binds the nucleotide base. The micellar system was optimized to enhance binding and selectivity for adenosine nucleotides. The selectivity for adenosine and the number of phosphate groups attached to the adenosine were both investigated. Addition of cytidine, guanidine, or uridine monophosphates, results in no significant downfield shifting of the NH resonance. Selectivity for the phosphate is limited, since adenosine mono-, di-, and triphosphates all have similar binding constants. We successfully achieved molecular recognition of adenosine nucleotides in micellar environments. There is significant difference in the binding interactions between the adenosine nucleotides and three other natural nucleotides. II. The UCI Chemistry Outreach Program (UCICOP) addresses the declining interest of the nations youth for science. UCICOP brings fun and exciting chemistry experiments to local high schools, to remind students that science is fun and has many practical uses. Volunteer students and alumni of UCI perform the demonstrations using scripts and material provided by UCICOP. The preparation of scripts and materials is done by two coordinators

  17. Choleragen-stimulated release of guanyl nucleotides from turkey erythrocyte membranes.

    Science.gov (United States)

    Burns, D L; Moss, J; Vaughan, M

    1982-01-10

    Choleragen stimulates adenylate cyclase by ADP ribosylating a guanyl nucleotide-binding regulatory protein (G/F). beta-Adrenergic hormones also activate the adenylate cyclase of turkey erythrocytes, and it is currently believed that they do so in part by decreasing the affinity of G/F factor for GDP, an effect which is manifested by a hormone-stimulated release of guanyl nucleotides from the membranes. Since choleragen might also activate adenylate cyclase by a similar mechanism, the effect of toxin treatment on the release of guanyl nucleotides from turkey erythrocyte membranes was examined. In the presence of NAD, choleragen was found to stimulate release of guanyl nucleotides from membranes which had been preloaded with radiolabeled GTP. No stimulation of release was observed with cAMP or when NAD was replaced by NADP, which does not serve as a substrate for choleragen-catalyzed ADP ribosylation. While either isoproterenol or choleragen can stimulate release of guanyl nucleotides from the membranes, the amount of guanyl nucleotide released in the presence of both isoproterenol and choleragen was no greater than that released by isoproterenol alone. Furthermore, when membranes were first treated with choleragen and NAD, the subsequent release of guanyl nucleotides induced by isoproterenol was reduced to approximately 15% of that observed with membranes not treated with the toxin. Therefore, choleragen may enhance release of guanine nucleotides from sites on the membranes that are also affected by beta-adrenergic agonists, sites which are thought to correspond to G/F. These data are consistent with the hypothesis that choleragen may stimulate adenylate cyclase, in part, by enhancing release of guanyl nucleotides, a mechanism similar to that of beta-adrenergic agonists.

  18. Investigating structural changes induced by nucleotide binding to RecA using difference FTIR.

    OpenAIRE

    Butler, Blaine C; Hanchett, Ross H; Rafailov, Helena; MacDonald, Gina

    2002-01-01

    Nucleotide binding to RecA results in either the high-DNA affinity form (Adenosine 5'-triphosphate (ATP)-bound) or the more inactive protein conformation associated with a lower affinity for DNA (Adenosine 5'-diphosphate (ADP)-bound). Many of the key structural differences between the RecA-ATP and RecA-ADP bound forms have yet to be elucidated. We have used caged-nucleotides and difference FTIR in efforts to obtain a comprehensive understanding of the molecular changes induced by nucleotide b...

  19. Pro-inflammatory cytokine single nucleotide polymorphisms in Kawasaki disease.

    Science.gov (United States)

    Assari, Raheleh; Aghighi, Yahya; Ziaee, Vahid; Sadr, Maryam; Rahmani, Farzaneh; Rezaei, Arezou; Sadr, Zeinab; Moradinejad, Mohammad Hassan; Raeeskarami, Seyed Reza; Rezaei, Nima

    2016-07-25

    Kawasaki disease (KD) is a systemic vasculitis of children associated with cardiovascular sequelae. Proinflammatory cytokines play a major role in KD pathogenesis. However, their role is both influenced and modified by regulatory T-cells. IL-1 gene cluster, IL-6 and TNF-α polymorphisms have shown significant associations with some vasculitides. Herein we investigated their role in KD. Fifty-five patients with KD who were randomly selected from referrals to the main pediatric hospital were enrolled in this case-control study. Single nucleotide polymorphisms (SNPs) of the following genes were assessed in patients and 140 healthy subjects as control group: IL-1α at -889 (rs1800587), IL-1β at -511 (rs16944), IL-1β at +3962 (rs1143634), IL-1R at Pst-I 1970 (rs2234650), IL-1RN/A at Mspa-I 11100 (rs315952), TNF-α at -308 (rs1800629), TNF-α at -238, IL-6 at -174 (rs1800795) and IL-6 at +565. Twenty-one percent of the control group had A allele at TNF-α -238 while only 8% of KD patients had A allele at this position (P = 0.003, OR [95%CI] = 0.32 [0.14-0.71]). Consistently, TNF-α genotype GG at -238 had significant association with KD (OR [95% CI] = 4.31 [1.79-10.73]). Most controls carried the CG genotype at IL-6 -174 (n = 93 [66.9%]) while GG genotype was the most common genotype (n = 27 [49%]) among patients. Carriers of the GG haplotype at TNF-α (-308, -238) were significantly more prevalent among the KD group. No association was found between IL-1 gene cluster, allelic or haplotypic variants and KD. TNF-α GG genotype at -238 and GG haplotype at positions -308 and -238 were associated with KD in an Iranian population. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  20. Single nucleotide polymorphism discovery in elite north american potato germplasm

    Directory of Open Access Journals (Sweden)

    De Jong Walter S

    2011-06-01

    Full Text Available Abstract Background Current breeding approaches in potato rely almost entirely on phenotypic evaluations; molecular markers, with the exception of a few linked to disease resistance traits, are not widely used. Large-scale sequence datasets generated primarily through Sanger Expressed Sequence Tag projects are available from a limited number of potato cultivars and access to next generation sequencing technologies permits rapid generation of sequence data for additional cultivars. When coupled with the advent of high throughput genotyping methods, an opportunity now exists for potato breeders to incorporate considerably more genotypic data into their decision-making. Results To identify a large number of Single Nucleotide Polymorphisms (SNPs in elite potato germplasm, we sequenced normalized cDNA prepared from three commercial potato cultivars: 'Atlantic', 'Premier Russet' and 'Snowden'. For each cultivar, we generated 2 Gb of sequence which was assembled into a representative transcriptome of ~28-29 Mb for each cultivar. Using the Maq SNP filter that filters read depth, density, and quality, 575,340 SNPs were identified within these three cultivars. In parallel, 2,358 SNPs were identified within existing Sanger sequences for three additional cultivars, 'Bintje', 'Kennebec', and 'Shepody'. Using a stringent set of filters in conjunction with the potato reference genome, we identified 69,011 high confidence SNPs from these six cultivars for use in genotyping with the Infinium platform. Ninety-six of these SNPs were used with a BeadXpress assay to assess allelic diversity in a germplasm panel of 248 lines; 82 of the SNPs proved sufficiently informative for subsequent analyses. Within diverse North American germplasm, the chip processing market class was most distinct, clearly separated from all other market classes. The round white and russet market classes both include fresh market and processing cultivars. Nevertheless, the russet and round

  1. Myosin individualized: single nucleotide polymorphisms in energy transduction

    Directory of Open Access Journals (Sweden)

    Wieben Eric D

    2010-03-01

    Full Text Available Abstract Background Myosin performs ATP free energy transduction into mechanical work in the motor domain of the myosin heavy chain (MHC. Energy transduction is the definitive systemic feature of the myosin motor performed by coordinating in a time ordered sequence: ATP hydrolysis at the active site, actin affinity modulation at the actin binding site, and the lever-arm rotation of the power stroke. These functions are carried out by several conserved sub-domains within the motor domain. Single nucleotide polymorphisms (SNPs affect the MHC sequence of many isoforms expressed in striated muscle, smooth muscle, and non-muscle tissue. The purpose of this work is to provide a rationale for using SNPs as a functional genomics tool to investigate structurefunction relationships in myosin. In particular, to discover SNP distribution over the conserved sub-domains and surmise what it implies about sub-domain stability and criticality in the energy transduction mechanism. Results An automated routine identifying human nonsynonymous SNP amino acid missense substitutions for any MHC gene mined the NCBI SNP data base. The routine tested 22 MHC genes coding muscle and non-muscle isoforms and identified 89 missense mutation positions in the motor domain with 10 already implicated in heart disease and another 8 lacking sequence homology with a skeletal MHC isoform for which a crystallographic model is available. The remaining 71 SNP substitutions were found to be distributed over MHC with 22 falling outside identified functional sub-domains and 49 in or very near to myosin sub-domains assigned specific crucial functions in energy transduction. The latter includes the active site, the actin binding site, the rigid lever-arm, and regions facilitating their communication. Most MHC isoforms contained SNPs somewhere in the motor domain. Conclusions Several functional-crucial sub-domains are infiltrated by a large number of SNP substitution sites suggesting these

  2. Structural studies on MtRecA-nucleotide complexes: insights into DNA and nucleotide binding and the structural signature of NTP recognition.

    Science.gov (United States)

    Datta, S; Ganesh, N; Chandra, Nagasuma R; Muniyappa, K; Vijayan, M

    2003-02-15

    RecA protein plays a crucial role in homologous recombination and repair of DNA. Central to all activities of RecA is its binding to Mg(+2)-ATP. The active form of the protein is a helical nucleoprotein filament containing the nucleotide cofactor and single-stranded DNA. The stability and structure of the helical nucleoprotein filament formed by RecA are modulated by nucleotide cofactors. Here we report crystal structures of a MtRecA-ADP complex, complexes with ATPgammaS in the presence and absence of magnesium as well as a complex with dATP and Mg+2. Comparison with the recently solved crystal structures of the apo form as well as a complex with ADP-AlF4 confirms an expansion of the P-loop region in MtRecA, compared to its homologue in Escherichia coli, correlating with the reduced affinity of MtRecA for ATP. The ligand bound structures reveal subtle variations in nucleotide conformations among different nucleotides that serve in maintaining the network of interactions crucial for nucleotide binding. The nucleotide binding site itself, however, remains relatively unchanged. The analysis also reveals that ATPgammaS rather than ADP-AlF4 is structurally a better mimic of ATP. From among the complexed structures, a definition for the two DNA-binding loops L1 and L2 has clearly emerged for the first time and provides a basis to understand DNA binding by RecA. The structural information obtained from these complexes correlates well with the extensive biochemical data on mutants available in the literature, contributing to an understanding of the role of individual residues in the nucleotide binding pocket, at the molecular level. Modeling studies on the mutants again point to the relative rigidity of the nucleotide binding site. Comparison with other NTP binding proteins reveals many commonalties in modes of binding by diverse members in the structural family, contributing to our understanding of the structural signature of NTP recognition. Copyright 2003 Wiley

  3. The nucleotide exchange factor Ric-8A is a chaperone for the conformationally dynamic nucleotide-free state of Gαi1.

    Directory of Open Access Journals (Sweden)

    Celestine J Thomas

    Full Text Available Heterotrimeric G protein α subunits are activated upon exchange of GDP for GTP at the nucleotide binding site of Gα, catalyzed by guanine nucleotide exchange factors (GEFs. In addition to transmembrane G protein-coupled receptors (GPCRs, which act on G protein heterotrimers, members of the family cytosolic proteins typified by mammalian Ric-8A are GEFs for Gi/q/12/13-class Gα subunits. Ric-8A binds to Gα•GDP, resulting in the release of GDP. The Ric-8A complex with nucleotide-free Gαi1 is stable, but dissociates upon binding of GTP to Gαi1. To gain insight into the mechanism of Ric-8A-catalyzed GDP release from Gαi1, experiments were conducted to characterize the physical state of nucleotide-free Gαi1 (hereafter referred to as Gαi1[ ] in solution, both as a monomeric species, and in the complex with Ric-8A. We found that Ric-8A-bound, nucleotide-free Gαi1 is more accessible to trypsinolysis than Gαi1•GDP, but less so than Gαi1[ ] alone. The TROSY-HSQC spectrum of [(15N]Gαi1[ ] bound to Ric-8A shows considerable loss of peak intensity relative to that of [(15N]Gαi1•GDP. Hydrogen-deuterium exchange in Gαi1[ ] bound to Ric-8A is 1.5-fold more extensive than in Gαi1•GDP. Differential scanning calorimetry shows that both Ric-8A and Gαi1•GDP undergo cooperative, irreversible unfolding transitions at 47° and 52°, respectively, while nucleotide-free Gαi1 shows a broad, weak transition near 35°. The unfolding transition for Ric-8A:Gαi1[ ] is complex, with a broad transition that peaks at 50°, suggesting that both Ric-8A and Gαi1[ ] are stabilized within the complex, relative to their respective free states. The C-terminus of Gαi1 is shown to be a critical binding element for Ric-8A, as is also the case for GPCRs, suggesting that the two types of GEF might promote nucleotide exchange by similar mechanisms, by acting as chaperones for the unstable and dynamic nucleotide-free state of Gα.

  4. The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

    OpenAIRE

    Takaiwa, F; Kusuda, M; Saga, N; Sugiura, M

    1982-01-01

    The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

  5. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    Science.gov (United States)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  6. The nucleotide sequence of threonine transfer RNA coded by bacteriophage T4

    International Nuclear Information System (INIS)

    Guthrie, C.; Scholla, C.A.; Yesian, H.; Abelson, J.

    1978-01-01

    The nucleotide sequence of a low molecular weight RNA coded by bacteriophage T4 (and previously identified as species α) has been determined. The molecule is of particular biological interest for its associated biosynthetic properties. This RNA is 76 nucleotides in length, contains eight modified bases, and can be arranged in a cloverleaf configuration common to tRNAs. The anticodon sequence is UGU, which corresponds to the threonine-specific codons ACsub(G)sup(A). The nucleotide sequence was determined primarily by nearest-neighbour analysis of RNA synthesized in vitro using [α- 32 P] nucleoside triphosphates. Using the single-strand specific nuclease S1, two in vivo labelled half-molecules were generated and analysed. This information together with restrictions imposed by nearest-neighbour data, provided a unique linear sequence of nucleotides with the features of secondary structure common to tRNA molecules. (author)

  7. Unraveling the cellular context of cyclic nucleotide signaling proteins by chemical proteomics

    NARCIS (Netherlands)

    Corradini, E.

    2015-01-01

    Understanding the molecular mechanisms which regulate signal transduction is fundamental to the development of therapeutic molecules for the treatment of several diseases. In particular, signaling proteins, such as cyclic nucleotide dependent enzymes are the orchestrators of many tissue functions.

  8. Study on the change of cyclic nucleotide in mice with yang vacuity disease

    International Nuclear Information System (INIS)

    Zhu Xinhua; Shen Ling; Wang Shuguang

    2002-01-01

    To study the relation between Yang Vacuity disease happening, development and cyclic nucleotide response, and prove curative effects of some assisting Yang drug, the plasma cAMP, cGMP and cAMP/cGMP levels were detected by radioimmunoassay in the Yang Vacuity group and curing group. Results: showed: (1) Yang Vacuity group: the symptoms were clear, death rate was high, the plasma cAMP and cAMP/cGMP increased obviously, it suggests that cyclic nucleotide was imbalance. (2) Curing group: the symptoms of Yang Vacuity disease were improved obviously, death rate dropped, cAMP declined, cGMP increased, while cAMP/cGMP reached the normal level, it showed that cyclic nucleotide of the body had altered greatly. (3) It is a reference target for Yang Vacuity. (4) Assisting yang drug (Sini Decoction) had a close relation with correcting imbalance of cyclic nucleotide

  9. Cross talk between nucleotide synthesis pathways with cellular immunity in constraining hepatitis e virus replication

    NARCIS (Netherlands)

    Y. Wang (Yijin); W. Wang (Wenshi); L. Xu (Lei); X. Zhou (Xinying); E. Shokrollahi (Ehsan); K. Felczak (K.); L.J.W. van der Laan (Luc); K.W. Pankiewicz (Krzysztof W.); D. Sprengers (Dave); N.J.H. Raat (Nicolaas); H.J. Metselaar (Herold); M.P. Peppelenbosch (Maikel); Q. Pan (Qiuwei)

    2016-01-01

    textabstractiruses are solely dependent on host cells to propagate; therefore, understanding virus-host interaction is important for antiviral drug development. Since de novo nucleotide biosynthesis is essentially required for both host cell metabolism and viral replication, specific catalytic

  10. A Novel Nicotinamide Adenine Dinucleotide Correction Method for Mitochondrial Ca(2+) Measurement with FURA-2-FF in Single Permeabilized Ventricular Myocytes of Rat.

    Science.gov (United States)

    Lee, Jeong Hoon; Ha, Jeong Mi; Leem, Chae Hun

    2015-07-01

    Fura-2 analogs are ratiometric fluoroprobes that are widely used for the quantitative measurement of [Ca(2+)]. However, the dye usage is intrinsically limited, as the dyes require ultraviolet (UV) excitation, which can also generate great interference, mainly from nicotinamide adenine dinucleotide (NADH) autofluorescence. Specifically, this limitation causes serious problems for the quantitative measurement of mitochondrial [Ca(2+)], as no available ratiometric dyes are excited in the visible range. Thus, NADH interference cannot be avoided during quantitative measurement of [Ca(2+)] because the majority of NADH is located in the mitochondria. The emission intensity ratio of two different excitation wavelengths must be constant when the fluorescent dye concentration is the same. In accordance with this principle, we developed a novel online method that corrected NADH and Fura-2-FF interference. We simultaneously measured multiple parameters, including NADH, [Ca(2+)], and pH/mitochondrial membrane potential; Fura-2-FF for mitochondrial [Ca(2+)] and TMRE for Ψm or carboxy-SNARF-1 for pH were used. With this novel method, we found that the resting mitochondrial [Ca(2+)] concentration was 1.03 µM. This 1 µM cytosolic Ca(2+) could theoretically increase to more than 100 mM in mitochondria. However, the mitochondrial [Ca(2+)] increase was limited to ~30 µM in the presence of 1 µM cytosolic Ca(2+). Our method solved the problem of NADH signal contamination during the use of Fura-2 analogs, and therefore the method may be useful when NADH interference is expected.

  11. Effect of telmisartan on the expression of adiponectin receptors and nicotinamide adenine dinucleotide phosphate oxidase in the heart and aorta in type 2 diabetic rats

    Directory of Open Access Journals (Sweden)

    Guo Zhixin

    2012-08-01

    Full Text Available Abstract Background Diabetic cardiovascular disease is associated with decreased adiponectin and increased oxidative stress. This study investigated the effect of telmisartan on the expression of adiponectin receptor 2 (adipoR2 and nicotinamide adenine dinucleotide phosphate (NADPH oxidase subunits in the heart and the expression of adiponectin receptor 1 (adipoR1 in aorta in type 2 diabetic rats. Methods Type 2 diabetes was induced by high-fat and high-sugar diet and intraperitoneal injection of a low dose of streptozotocin (STZ. Heart function, adipoR2, p22phox, NOX4, glucose transporter 4(GLUT4, monocyte chemoattractant protein-1(MCP-1 and connective tissue growth factor (CTGFin the heart, and adipoR1, MCP-1 and nuclear factor kappa B (NF-κB in aorta were analyzed in controls and diabetic rats treated with or without telmisartan (5mg/kg/d by gavage for 12 weeks. Results Heart function, plasma and myocardial adiponectin levels, the expression of myocardial adipoR2 and GLUT4 were significantly decreased in diabetic rats (P Conclusions Our results suggest that telmisartan upregulates the expression of myocardial adiponectin, its receptor 2 and GLUT4. Simultaneously, it downregulates the expression of myocardial p22phox, NOX4, MCP-1, and CTGF, contributing so to the improvement of heart function in diabetic rats. Telmisartan also induces a protective role on the vascular system by upregulating the expression of adipoR1 and downregulating the expression of MCP-1 and NF-κB in the abdominal aorta in diabetic rats.

  12. Methotrexate and erythro-9-(2-hydroxynon-3-yl) adenine therapy for rat adjuvant arthritis and the effect of methotrexate on in vivo purine metabolism.

    Science.gov (United States)

    Baggott, Joseph E; Morgan, Sarah L

    2007-06-01

    The objectives were: (1) to test the association of methotrexate (MTX) efficacy in rat adjuvant arthritis (rat AA) with interference of purine biosynthesis and adenosine metabolism and (2) to test the efficacy of erythro-9-(2-hydroxynon-3-yl) adenine (EHNA), an inhibitor of adenosine deaminase, and the efficacy of aminoimidazolecarboxamide (AICA) riboside plus MTX in rat AA. Radiographic and histologic examinations of the hind limbs were measures of efficacy. Urinary excretions of AICA and adenosine were markers of AICA ribotide transformylase inhibition (i.e., blockage of purine biosynthesis) and interference with adenosine metabolism, respectively. AICA and adenosine excretions increased during the day of MTX dosing (treatment day) compared to the previous baseline day in animals responding well to MTX (i.e., low radiographic and histologic scores). Based on radiographic and histologic scores, adjuvant injected rats were separated into two disease categories (i.e., no/mild and moderate/severe). Only AICA excretion was significantly elevated on the treatment day in rat AA with no/mild disease (i.e., those responding well to MTX therapy). AICA (not adenosine) excretion was significantly correlated with the above scores. EHNA was not efficacious, even at toxic levels, while AICA riboside potentiated the efficacy of MTX. The data suggests that efficacious MTX therapy in rat AA (1) blocks purine biosynthesis; (2) increases in in vivo AICA levels. Also adenosine accumulation and blockage of adenosine deaminase (i.e., by EHNA) appear to be less critical to MTX efficacy. Increased levels of AICA metabolites may suppress the immune response in rat AA.

  13. The role of nucleotides in the neuron--glia communication responsible for the brain functions.

    Science.gov (United States)

    Inoue, Kazuhide; Koizumi, Schuichi; Tsuda, Makoto

    2007-09-01

    Accumulating findings indicate that nucleotides play an important role in cell-to-cell communication through P2 purinoceptors, even though ATP is recognized primarily to be a source of free energy and nucleotides are key molecules in cells. P2 purinoceptors are divided into two families, ionotropic receptors (P2X) and metabotropic receptors (P2Y). P2X receptors (7 types; P2X(1)-P2X(7)) contain intrinsic pores that open by binding with ATP. P2Y (8 types; P2Y(1, 2, 4, 6, 11, 12, 13,) and (14)) are activated by nucleotides and couple to intracellular second-messenger systems through heteromeric G-proteins. Nucleotides are released or leaked from non-excitable cells as well as neurons in physiological and pathophysiological conditions. One of the most exciting cells in non-excitable cells is the glia cells, which are classified into astrocytes, oligodendrocytes, and microglia. Astrocytes express many types of P2 purinoceptors and release the 'gliotransmitter' ATP to communicate with neurons, microglia and the vascular walls of capillaries. Microglia also express many types of P2 purinoceptors and are known as resident macrophages in the CNS. ATP and other nucleotides work as 'warning molecules' especially through activating microglia in pathophysiological conditions. Microglia play a key role in neuropathic pain and show phagocytosis through nucleotide-evoked activation of P2X(4) and P2Y(6) receptors, respectively. Such strong molecular, cellular and system-level evidence for extracellular nucleotide signaling places nucleotides in the central stage of cell communications in glia/CNS.

  14. Multifactor dimensionality reduction analysis identifies specific nucleotide patterns promoting genetic polymorphisms

    OpenAIRE

    Arehart, Eric; Gleim, Scott; White, Bill; Hwa, John; Moore, Jason H

    2009-01-01

    Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs) constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize ...

  15. Efficient reverse transcription using locked nucleic acid nucleotides towards the evolution of nuclease resistant RNA aptamers

    DEFF Research Database (Denmark)

    Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L

    2012-01-01

    We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers.......We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....

  16. Nucleotide diversity and linkage disequilibrium in 11 expressed resistance candidate genes in Lolium perenne

    Directory of Open Access Journals (Sweden)

    Asp Torben

    2007-08-01

    Full Text Available Abstract Background Association analysis is an alternative way for QTL mapping in ryegrass. So far, knowledge on nucleotide diversity and linkage disequilibrium in ryegrass is lacking, which is essential for the efficiency of association analyses. Results 11 expressed disease resistance candidate (R genes including 6 nucleotide binding site and leucine rich repeat (NBS-LRR like genes and 5 non-NBS-LRR genes were analyzed for nucleotide diversity. For each of the genes about 1 kb genomic fragments were isolated from 20 heterozygous genotypes in ryegrass. The number of haplotypes per gene ranged from 9 to 27. On average, one single nucleotide polymorphism (SNP was present per 33 bp between two randomly sampled sequences for the 11 genes. NBS-LRR like gene fragments showed a high degree of nucleotide diversity, with one SNP every 22 bp between two randomly sampled sequences. NBS-LRR like gene fragments showed very high non-synonymous mutation rates, leading to altered amino acid sequences. Particularly LRR regions showed very high diversity with on average one SNP every 10 bp between two sequences. In contrast, non-NBS LRR resistance candidate genes showed a lower degree of nucleotide diversity, with one SNP every 112 bp. 78% of haplotypes occurred at low frequency ( Conclusion Substantial LD decay was found within a distance of 500 bp for most resistance candidate genes in this study. Hence, LD based association analysis is feasible and promising for QTL fine mapping of resistance traits in ryegrass.

  17. Regulation of Ca2+ release from mitochondria by the oxidation-reduction state of pyridine nucleotides

    Science.gov (United States)

    Lehninger, Albert L.; Vercesi, Anibal; Bababunmi, Enitan A.

    1978-01-01

    Mitochondria from normal rat liver and heart, and also Ehrlich tumor cells, respiring on succinate as energy source in the presence of rotenone (to prevent net electron flow to oxygen from the endogenous pyridine nucleotides), rapidly take up Ca2+ and retain it so long as the pyridine nucleotides are kept in the reduced state. When acetoacetate is added to bring the pyridine nucleotides into a more oxidized state, Ca2+ is released to the medium. A subsequent addition of a reductant of the pyridine nucleotides such as β-hydroxybutyrate, glutamate, or isocitrate causes reuptake of the released Ca2+. Successive cycles of Ca2+ release and uptake can be induced by shifting the redox state of the pyridine nucleotides to more oxidized and more reduced states, respectively. Similar observations were made when succinate oxidation was replaced as energy source by ascorbate oxidation or by the hydrolysis of ATP. These and other observations form the basis of a hypothesis for feedback regulation of Ca2+-dependent substrate- or energy-mobilizing enzymatic reactions by the uptake or release of mitochondrial Ca2+, mediated by the cytosolic phosphate potential and the ATP-dependent reduction of mitochondrial pyridine nucleotides by reversal of electron transport. Images PMID:25436

  18. Critical role of DNA intercalation in enzyme-catalyzed nucleotide flipping

    Science.gov (United States)

    Hendershot, Jenna M.; O'Brien, Patrick J.

    2014-01-01

    Nucleotide flipping is a common feature of DNA-modifying enzymes that allows access to target sites within duplex DNA. Structural studies have identified many intercalating amino acid side chains in a wide variety of enzymes, but the functional contribution of these intercalating residues is poorly understood. We used site-directed mutagenesis and transient kinetic approaches to dissect the energetic contribution of intercalation for human alkyladenine DNA glycosylase, an enzyme that initiates repair of alkylation damage. When AAG flips out a damaged nucleotide, the void in the duplex is filled by a conserved tyrosine (Y162). We find that tyrosine intercalation confers 140-fold stabilization of the extrahelical specific recognition complex, and that Y162 functions as a plug to slow the rate of unflipping by 6000-fold relative to the Y162A mutant. Surprisingly, mutation to the smaller alanine side chain increases the rate of nucleotide flipping by 50-fold relative to the wild-type enzyme. This provides evidence against the popular model that DNA intercalation accelerates nucleotide flipping. In the case of AAG, DNA intercalation contributes to the specific binding of a damaged nucleotide, but this enhanced specificity comes at the cost of reduced speed of nucleotide flipping. PMID:25324304

  19. Isolation and analysis of sugar nucleotides using solid phase extraction and fluorophore assisted carbohydrate electrophoresis.

    Science.gov (United States)

    Barnes, Jarrod; Tian, Liping; Loftis, Jacqueline; Hiznay, James; Comhair, Suzy; Lauer, Mark; Dweik, Raed

    2016-01-01

    The building blocks of simple and complex oligosaccharides, termed sugar nucleotides, are often overlooked for their role in metabolic diseases and may hold the key to the underlying disease pathogenesis. Multiple reasons may account for the lack of analysis and quantitation of these sugar nucleotides, including the difficulty in isolation and purification as well as the required expensive instrumentation such as a high performance liquid chromatography (HPLC), mass spectrometer, or capillary electrophoresis. We have established a simple yet effective way to purify and quantitate sugar nucleotides using solid phase extraction (SPE) chromatography combined with fluorophore assisted carbohydrate electrophoresis (FACE). The simplicity of use, combined with the ability to run multiple samples at one time, give this technique a distinct advantage over the established methods for isolation and analysis of sugar nucleotides from cell culture models. •Sugar nucleotides can be easily purified with solid phase extraction chromatography.•FACE can be used to analyze multiple nucleotide sugar extracts with a single run.•The proposed method is simple, affordable, and uses common everyday research labware.

  20. Design and synthesis of a photocleavable biotinylated nucleotide for DNA analysis by mass spectrometry

    Science.gov (United States)

    Bai, Xiaopeng; Kim, Sobin; Li, Zengmin; Turro, Nicholas J.; Ju, Jingyue

    2004-01-01

    We report here the design, synthesis and evaluation of a novel photocleavable (PC) biotinylated nucleotide analog, dUTP-PC-Biotin, for DNA polymerase extension reaction to isolate DNA products for mass spectrometry (MS) analysis. This nucleotide analog has a biotin moiety attached to the 5-position of 2′-deoxyribouridine 5′-triphosphate via a photocleavable 2-nitrobenzyl linker. We have demonstrated that dUTP-PC-Biotin can be faithfully incorporated by the DNA polymerase Thermo Sequenase into the growing DNA strand in a DNA polymerase extension reaction and that its incorporation does not hinder the addition of the subsequent nucleotide. Therefore, the DNA extension fragments generated by using the dUTP-PC-Biotin can be efficiently isolated by a streptavidin-coated surface and recovered by near-UV light irradiation at room temperature in mild condition for further analysis without using any chemicals or heat. Single and multiple primer extension reactions were performed using the dUTP-PC-Biotin to generate DNA products for MALDI-TOF MS analysis. Such nucleotide analogs that carry a biotin and a photocleavable linker will allow the isolation and purification of DNA products under mild conditions for MS-based genetic analysis by DNA sequencing or multiplex single nucleotide polymorphism (SNP) detection. Furthermore, these nucleotide analogs should also be useful in isolating DNA–protein complexes under non-denaturing conditions. PMID:14744978

  1. Extracellular modulation of the silkmoth sex pheromone receptor activity by cyclic nucleotides.

    Directory of Open Access Journals (Sweden)

    Tatsuro Nakagawa

    Full Text Available Odorants and pheromones are essential to insects as chemical cues for finding food or an appropriate mating partner. These volatile compounds bind to olfactory receptors (Ors expressed by olfactory sensory neurons. Each insect Or functions as a ligand-gated ion channel and is a heteromeric complex that comprises one type of canonical Or and a highly conserved Orco subunit. Because there are many Or types, insect Ors can recognize with high specificity a myriad of chemical cues. Cyclic nucleotides can modulate the activity of insect Or-Orco complexes; however, the mechanism of action of these nucleotides is under debate. Here, we show that cyclic nucleotides, including cAMP and cGMP, interact with the silkmoth sex pheromone receptor complex, BmOr-1-BmOrco, from the outside of the cell and that these nucleotides act as antagonists at low concentrations and weak agonists at high concentrations. These cyclic nucleotides do not compete with the sex pheromone, bombykol, for binding to the BmOr-1 subunit. ATP and GTP also weakly inhibited BmOr-1-BmOrco activity, but D-ribose had no effect; these findings indicated that the purine moiety was crucial for the inhibition. Only the bombykol receptors have been so far shown to be subject to modulation by nucleotide-related compounds, indicating that this responsiveness to these compounds is not common for all insect Or-Orco complexes.

  2. Deuterated nucleotides as chemical probes of RNA structure: a detailed protocol for the enzymatic synthesis of a complete set of nucleotides specifically deuterated at ribose carbons

    Directory of Open Access Journals (Sweden)

    Robert N. Azad

    2015-05-01

    Full Text Available We describe here a detailed protocol for the synthesis of ribonucleotides specifically deuterated at each ribose carbon atom. We synthesized 20 specifically deuterated ribonucleotides: ATP, CTP, GTP, and UTP, each of which contained one of five deuterated riboses (either 1′-D, 2″-D, 3′-D, 4′-D, or 5′,5″-D2. Our synthetic approach is inspired by the pioneering work of Tolbert and Williamson, who developed a method for the convenient one-pot enzymatic synthesis of nucleotides (Tolbert, T. J. and Williamson, J. R. (1996 J. Am. Chem. Soc. 118, 7929–7940. Our protocol consists of a comprehensive list of required chemical and enzymatic reagents and equipment, detailed procedures for enzymatic assays and nucleotide synthesis, and chromatographic procedures for purification of deuterated nucleotides. As an example of the utility of specifically deuterated nucleotides, we used them to synthesize specifically deuterated sarcin/ricin loop (SRL RNA and measured the deuterium kinetic isotope effect on hydroxyl radical cleavage of the SRL.

  3. Nucleotide sequence of the 18S-26S rRNA intergene region of the sea urchin.

    OpenAIRE

    Hindenach, B R; Stafford, D W

    1984-01-01

    The DNA sequence which spans the internal transcribed spacers of a cloned ribosomal transcription unit from the sea urchin, Lytechinus variegatus, has been determined. The region extends from the conserved Eco RI site near the 3' end of the 18S rDNA to a Bam HI site in the 26S rDNA and includes 232 nucleotides coding for 18S rRNA, 367 nucleotides of internal transcribed spacer, 159 nucleotides coding for 5.8S rRNA, 338 nucleotides of internal transcribed spacer, and 505 nucleotides coding for...

  4. Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats

    Directory of Open Access Journals (Sweden)

    Desirée Villahermosa

    2017-05-01

    Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.

  5. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions.

    Science.gov (United States)

    Hesketh, Andy; Vergnano, Marta; Wan, Chris; Oliver, Stephen G

    2017-07-25

    We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. IMPORTANCE During infections, pathogenic bacteria can release nucleotides into the cells of their eukaryotic hosts. These nucleotides are recognized as signals that contribute to the initiation of defensive immune responses that help the infected

  6. Effects of dietary nucleotides supplementation on rainbow trout (Oncorhynchus mykiss) performance and acute stress response.

    Science.gov (United States)

    Tahmasebi-Kohyani, Ahmad; Keyvanshokooh, Saeed; Nematollahi, Amin; Mahmoudi, Nemat; Pasha-Zanoosi, Hossein

    2012-04-01

    This experiment was conducted to examine the effect of dietary nucleotides (NT) on fish performance and acute stress response on fingerling rainbow trout (23 g ± 0.01, mean weight ± SEM). Five experimental diets according to different levels of supplemented nucleotides (0, 0.05, 0.1, 0.15, and 0.2%) were assayed on experimental fish for 8 weeks. Growth, hematological parameters (hematocrit, hemoglobin, erythrocyte, lymphocyte, and neutrophil count), serum proteins (globulin, albumin), and plasma enzymatic activity (alkaline phosphatase, ALP; aspartate transaminase, AST; lactate dehydrogenase, LDH; alanine transaminase, ALT) were assayed. At the end of feeding trial, fish fed the control and 0.2% diets were subjected to handling and crowding stress. Modulatory effects of nucleotides on acute stress response (cortisol and glucose) and plasma electrolytes (Na(+), Cl(-), K(+), and Ca(2+)) were studied. The percentage of body weight gain (WG) and feed efficiency (FE) of fish were better when the fish were fed 0.15-0.2% diets. Fish fed the nucleotide-supplemented diets tended to have lower levels of serum enzymes including ALP, AST, LDH, and ALT. Plasma cortisol levels of fish fed on 0.2% diet under handling and crowding stress were significantly lower than fish fed the control diet at all post-stress time intervals. In our study, fish fed nucleotide-supplemented diet had significantly lower concentrations of glucose compared to those fed the basal diet. The concentrations of sodium, chloride, calcium, and potassium of fish fed the control diet were significantly lower than in fish fed nucleotide-supplemented diet. Dietary nucleotides administration seems to promote growth and to enhance resistance against handling and crowding stress in fingerling rainbow trout.

  7. Effect of dietary nucleotides on small intestinal repair after diarrhoea. Histological and ultrastructural changes.

    Science.gov (United States)

    Bueno, J; Torres, M; Almendros, A; Carmona, R; Nuñez, M C; Rios, A; Gil, A

    1994-01-01

    The effects of specific nutrients on intestinal maturation and repair after injury are practically unknown. The purpose of this work was to study the effects of dietary nucleotides on the repair of the intestinal mucosa after chronic diarrhoea induced by a lactose enriched diet in the weanling rat. One group of weanling rats was fed with a standard semipurified diet (control group), and another group was fed with the same diet containing lactose as the only soluble carbohydrate (lactose group). After 14 days the lactose group was allowed to recover for four weeks with the control diet (lactose-control group) or with the control diet supplemented with AMP, GMP, IMP, CMP, and UMP 50 mg/100 g each (lactose-nucleotide group). The control group was divided into two subgroups, which were fed with the control diet and the nucleotide supplemented diet for the same period (control-control group and control-nucleotide group). The lactose diet induced diarrhoea after 24 hours of feeding. Two weeks later there were changes in intestinal structure with loss of enterocyte microvillar surface, significant lymphocyte infiltration, supranuclear cytoplasmic vesiculation, decreased number of goblet cells, and enlarged mitochondria with low density and few cristae. After recovery from diarrhoea, animals fed the nucleotide enriched diet showed an intestinal histology and ultrastructure closer to that of the normal control group. Mitochondrial ultrastructure was closer to normal in comparison with the lactose-control diet group. In this second group the number of goblet cells as well as the villous height/crypt depth ratio was reduced and the number of intraepithelial lymphocytes increased compared with the nucleotide supplemented group. These results suggest that dietary nucleotides may be important nutrients for intestinal repair. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:8063220

  8. Multifactor dimensionality reduction analysis identifies specific nucleotide patterns promoting genetic polymorphisms

    Directory of Open Access Journals (Sweden)

    Arehart Eric

    2009-03-01

    Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in

  9. Unique features of nucleotide and codon usage patterns in mycoplasmas revealed by information entropy.

    Science.gov (United States)

    Wang, Yi-Ning; Ji, Wen-Heng; Li, Xue-Rui; Liu, Yong-Sheng; Zhou, Jian-Hua

    2018-03-01

    Currently, the comparison between GC usage pattern at the 3rd codon position and codon usage index is commonly used to estimate the roles of evolutionary forces in shaping synonymous codon usages, however, this kind of analysis often losses the information about the role of A/T usage bias in shaping synonymous codon usage bias. To overcome this limitation and better understand the interplay between nucleotide and codon usages for the evolution of bacteria at gene levels, in this study, we employed the information entropy method with some modification to estimate roles of nucleotide compositions in the overall codon usage bias for 18 mycoplasma species in combination with Davies-Bouldin index. At gene levels, the overall nucleotide usage bias represents A content as the highest, followed by T, G and C for mycoplasmas, resulting in a low GC content. This feature is universal across these species derived from different hosts, suggesting that the hosts have the limited impact on nucleotide usage bias of mycoplasmas. Information entropy and Davies-Bouldin index can better reveal that the nucleotide usage bias at the 3rd codon position is essential in shaping the overall nucleotide bias for all given mycoplasmas except M. pneumoniae M129. Davies-Bouldin index revealed that the 1st and 2nd codon position play more important role in synonymous codon usage bias than that of the 3rd position at gene levels. To our knowledge, this is the first comprehensive investigation into cooperation between nucleotide and codon usages for mycoplasma and extends our knowledge of the mechanisms that contribute to codon usage and evolution of this microorganism. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Supra­molecular architecture in a co-crystal of the N(7)—H tautomeric form of N 6-benzoyl­adenine with adipic acid (1/0.5)

    Science.gov (United States)

    Swinton Darious, Robert; Thomas Muthiah, Packianathan; Perdih, Franc

    2016-01-01

    The asymmetric unit of the title co-crystal, C12H9N5O·0.5C6H10O4, consists of one mol­ecule of N 6-benzoyl­adenine (BA) and one half-mol­ecule of adipic acid (AA), the other half being generated by inversion symmetry. The dihedral angle between the adenine and phenyl ring planes is 26.71 (7)°. The N 6-benzoyl­adenine mol­ecule crystallizes in the N(7)—H tautomeric form with three non-protonated N atoms. This tautomeric form is stabilized by intra­molecular N—H⋯O hydrogen bonding between the carbonyl (C=O) group and the N(7)—H hydrogen atom on the Hoogsteen face of the purine ring, forming an S(7) ring motif. The two carboxyl groups of adipic acid inter­act with the Watson–Crick face of the BA mol­ecules through O—H⋯N and N—H⋯O hydrogen bonds, generating an R 2 2(8) ring motif. The latter units are linked by N—H⋯N hydrogen bonds, forming layers parallel to (10-5). A weak C—H⋯O hydrogen bond is also present, linking adipic acid mol­ecules in neighbouring layers, enclosing R 2 2(10) ring motifs and forming a three-dimensional structure. C=O⋯π and C—H⋯π inter­actions are also present in the structure. PMID:27308047

  11. On the participation of photoinduced N-H bond fission in aqueous adenine at 266 and 220 nm: a combined ultrafast transient electronic and vibrational absorption spectroscopy study.

    Science.gov (United States)

    Roberts, Gareth M; Marroux, Hugo J B; Grubb, Michael P; Ashfold, Michael N R; Orr-Ewing, Andrew J

    2014-11-26

    A combination of ultrafast transient electronic absorption spectroscopy (TEAS) and transient vibrational absorption spectroscopy (TVAS) is used to investigate whether photoinduced N–H bond fission, mediated by a dissociative 1πσ(*) state, is active in aqueous adenine (Ade) at 266 and 220 nm. In order to isolate UV/visible and IR spectral signatures of the adeninyl radical (Ade[-H]), formed as a result of N–H bond fission, TEAS and TVAS are performed on Ade in D2O under basic conditions (pD = 12.5), which forms Ade[-H](-) anions via deprotonation at the N7 or N9 sites of Ade's 7H and 9H tautomers. At 220 nm we observe one-photon detachment of an electron from Ade[-H](-), which generates solvated electrons (eaq(-)) together with Ade[-H] radicals, with clear signatures in both TEAS and TVAS. Additional wavelength dependent TEAS measurements between 240–260 nm identify a threshold of 4.9 ± 0.1 eV (∼250 nm) for this photodetachment process in D2O. Analogous TEAS experiments on aqueous Ade at pD = 7.4 generate a similar photoproduct signal together with eaq(-) after excitation at 266 and 220 nm. These eaq(-) are born from ionization of Ade, together with Ade(+) cations, which are indistinguishable from Ade[-H] radicals in TEAS. Ade(+) and Ade[-H] are found to have different signatures in TVAS and we verify that the pD = 7.4 photoproduct signal observed in TEAS following 220 nm excitation is solely due to Ade(+) cations. Based on these observations, we conclude that: (i) N–H bond fission in aqueous Ade is inactive at wavelengths ≥220 nm; and (ii) if such a channel exists in aqueous solution, its threshold is strongly blue-shifted relative to the onset of the same process in gas phase 9H-Ade (≤233 nm). In addition, we extract excited state lifetimes and vibrational cooling dynamics for 9H-Ade and Ade[-H](-). In both cases, excited state lifetimes of <500 fs are identified, while vibrational cooling occurs within a time frame of 4–5 ps. In contrast, 7H

  12. 1,3-Butadiene-Induced Adenine DNA Adducts Are Genotoxic but Only Weakly Mutagenic When Replicated in Escherichia coli of Various Repair and Replication Backgrounds.

    Science.gov (United States)

    Chang, Shiou-Chi; Seneviratne, Uthpala I; Wu, Jie; Tretyakova, Natalia; Essigmann, John M

    2017-05-15

    The adverse effects of the human carcinogen 1,3-butadiene (BD) are believed to be mediated by its DNA-reactive metabolites such as 3,4-epoxybut-1-ene (EB) and 1,2,3,4-diepoxybutane (DEB). The specific DNA adducts responsible for toxic and mutagenic effects of BD, however, have yet to be identified. Recent in vitro polymerase bypass studies of BD-induced adenine (BD-dA) adducts show that DEB-induced N 6 ,N 6 -DHB-dA (DHB = 2,3-dihydroxybutan-1,4-diyl) and 1,N 6 -γ-HMHP-dA (HMHP = 2-hydroxy-3-hydroxymethylpropan-1,3-diyl) adducts block replicative DNA polymerases but are bypassed by human polymerases η and κ, leading to point mutations and deletions. In contrast, EB-induced N 6 -HB-dA (HB = 2-hydroxy-3-buten-1-yl) does not block DNA synthesis and is nonmutagenic. In the present study, we employed a newly established in vivo lesion-induced mutagenesis/genotoxicity assay via next-generation sequencing to evaluate the in vivo biological consequences of S-N 6 -HB-dA, R,R-N 6 ,N 6 -DHB-dA, S,S-N 6 ,N 6 -DHB-dA, and R,S-1,N 6 -γ-HMHP-dA. In addition, the effects of AlkB-mediated direct reversal repair, MutM and MutY catalyzed base excision repair, and DinB translesion synthesis on the BD-dA adducts in bacterial cells were investigated. BD-dA adducts showed the expected inhibition of DNA replication in vivo but were not substantively mutagenic in any of the genetic environments investigated. This result is in contrast with previous in vitro observations and opens the possibility that E. coli repair and bypass systems other than the ones studied here are able to minimize the mutagenic properties of BD-dA adducts.

  13. Defects in Nicotinamide-adenine Dinucleotide Phosphate Oxidase Genes NOX1 and DUOX2 in Very Early Onset Inflammatory Bowel DiseaseSummary

    Directory of Open Access Journals (Sweden)

    Patti Hayes

    2015-09-01

    Full Text Available Background & Aims: Defects in intestinal innate defense systems predispose patients to inflammatory bowel disease (IBD. Reactive oxygen species (ROS generated by nicotinamide-adenine dinucleotide phosphate (NADPH oxidases in the mucosal barrier maintain gut homeostasis and defend against pathogenic attack. We hypothesized that molecular genetic defects in intestinal NADPH oxidases might be present in children with IBD. Methods: After targeted exome sequencing of epithelial NADPH oxidases NOX1 and DUOX2 on 59 children with very early onset inflammatory bowel disease (VEOIBD, the identified mutations were validated using Sanger Sequencing. A structural analysis of NOX1 and DUOX2 variants was performed by homology in silico modeling. The functional characterization included ROS generation in model cell lines and in in vivo transduced murine crypts, protein expression, intracellular localization, and cell-based infection studies with the enteric pathogens Campylobacter jejuni and enteropathogenic Escherichia coli. Results: We identified missense mutations in NOX1 (c.988G>A, p.Pro330Ser; c.967G>A, p.Asp360Asn and DUOX2 (c.4474G>A, p.Arg1211Cys; c.3631C>T, p.Arg1492Cys in 5 of 209 VEOIBD patients. The NOX1 p.Asp360Asn variant was replicated in a male Ashkenazi Jewish ulcerative colitis cohort. Patients with both NOX1 and DUOX2 variants showed abnormal Paneth cell metaplasia. All NOX1 and DUOX2 variants showed reduced ROS production compared with wild-type enzymes. Despite appropriate cellular localization and comparable pathogen-stimulated translocation of altered oxidases, cells harboring NOX1 or DUOX2 variants had defective host resistance to infection with C. jejuni. Conclusions: This study identifies the first inactivating missense variants in NOX1 and DUOX2 associated with VEOIBD. Defective ROS production from intestinal epithelial cells constitutes a risk factor for developing VEOIBD. Keywords: Inflammatory Bowel Disease, NADPH Oxidase

  14. Multifactor dimensionality reduction analysis identifies specific nucleotide patterns promoting genetic polymorphisms

    Science.gov (United States)

    Arehart, Eric; Gleim, Scott; White, Bill; Hwa, John; Moore, Jason H

    2009-01-01

    Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs) constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR) approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194). We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI) database (n = 29967) and a control set of sequences (coding region) not associated with SNP sites randomly selected from the NCBI database (n = 29967). We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p << 0.001) were detected for each SNP type examined in the larger NCBI dataset. Importantly, the flanking region models were elongated or truncated depending on the nucleotide change. Additionally, nucleotide distributions differed significantly at motif sites relative to the type of variation observed. The MDR approach effectively discerned specific sites within the flanking regions of observed SNPs and their respective identities, supporting the collective

  15. Multifactor dimensionality reduction analysis identifies specific nucleotide patterns promoting genetic polymorphisms.

    Science.gov (United States)

    Arehart, Eric; Gleim, Scott; White, Bill; Hwa, John; Moore, Jason H

    2009-03-30

    The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs) constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR) approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194). We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI) database (n = 29967) and a control set of sequences (coding region) not associated with SNP sites randomly selected from the NCBI database (n = 29967). We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p nucleotide change. Additionally, nucleotide distributions differed significantly at motif sites relative to the type of variation observed. The MDR approach effectively discerned specific sites within the flanking regions of observed SNPs and their respective identities, supporting the collective contribution of these

  16. Genetic Control of Biosynthesis and Transport of Riboflavin and Flavin Nucleotides and Construction of Robust Biotechnological Producers†

    OpenAIRE

    Abbas, Charles A.; Sibirny, Andriy A.

    2011-01-01

    Summary: Riboflavin [7,8-dimethyl-10-(1′-d-ribityl)isoalloxazine, vitamin B2] is an obligatory component of human and animal diets, as it serves as the precursor of flavin coenzymes, flavin mononucleotide, and flavin adenine dinucleotide, which are involved in oxidative metabolism and other processes. Commercially produced riboflavin is used in agriculture, medicine, and the food industry. Riboflavin synthesis starts from GTP and ribulose-5-phosphate and proceeds through pyrimidine and pterid...

  17. Adenine phosphoribosyltransferase from Sulfolobus solfataricus is an enzyme with unusual kinetic properties and a crystal structure that suggests it evolved from a 6-oxopurine phosphoribosyltransferase

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank; Hansen, Michael Riis; Jensen, Kristine Steen

    2015-01-01

    undergoes a conformational change upon binding of adenine and phosphate resulting in a slight contraction of the active site. The inhibitor, ADP binds like the product AMP with both the α- and β-phosphates occupying the 5’-phosphoribosyl binding site. The enzyme shows activity over a wide p......H-range and the kinetic and ligand binding properties depend on both pH and the presence/absence of phosphate in the buffers. A slow hydrolysis of PRPP to ribose 5-phosphate and pyrophosphate, catalyzed by the enzyme may be facilitated by elements in the C-terminal three-helix bundle part of the protein....

  18. Enhanced NMR signal detection of imino protons in RNA molecules containing 3' dangling nucleotides

    International Nuclear Information System (INIS)

    Amborski, Andrew N.; Johnson, Philip E.

    2008-01-01

    We present a method for improving the quality of nuclear magnetic resonance (NMR) spectra involving exchangeable protons near the base of the stem of RNA hairpin molecules. NMR spectra of five different RNA hairpins were compared. These hairpins consisted of a native RNA structure and four molecules each having different unpaired, or dangling, nucleotides at the 3' end. NMR experiments were acquired in water for each construct and the quality of the imino proton spectral regions were examined. The imino resonances near the base of the stem of the wild type RNA structure were not observed due to breathing motions. However, a significant increase in spectral quality for molecules with dangling 3' adenosine or guanosine nucleotides was observed, with imino protons detected in these constructs that were not observed in the wild type construct. A modest improvement in spectral quality was seen for the construct with a 3' unpaired uridine, whereas no significant improvement was observed for a 3' unpaired cytidine. This improvement in NMR spectral quality mirrors the increased thermodynamic stability observed for 3' unpaired nucleotides which is dependant on the stacking interactions of these nucleotides against the base of the stem. The use of a dangling 3' adenosine nucleotide represents an easy method to significantly improve the quality of NMR spectra of RNA molecules

  19. Nucleotides increase the internal flexibility of filaments of dephosphorylated Acanthamoeba myosin II.

    Science.gov (United States)

    Redowicz, M J; Korn, E D; Rau, D C

    1996-05-24

    The actin-activated Mg(2+)-ATPase activity of Acanthamoeba myosin II minifilaments is dependent both on Mg2+ concentration and on the state of phosphorylation of three serine sites at the C-terminal end of the heavy chains. Previous electric birefringence experiments on minifilaments showed a large dependence of signal amplitude on the phosphorylation state and Mg2+ concentration, consistent with large changes in filament flexibility. These observations suggested that minifilament stiffness was important for function. We now report that the binding of nucleotides to dephosphorylated minifilaments at Mg2+ concentrations needed for optimal activity increases the flexibility by about 10-fold, as inferred from the birefringence signal amplitude increase. An increase in flexibility with nucleotide binding is not observed for dephosphorylated minifilaments at lower Mg2+ concentrations or for phosphorylated minifilaments at any Mg2+ concentrations examined. The relaxation times for minifilament rotations that are sensitive to the conformation myosin heads are also observed to depend on phosphorylation, Mg2+ concentration, and nucleotide binding. These latter experiments indicate that the actin-activated Mg2+ concentration, and nucleotide binding. These latter experiments indicate that the actin-activated Mg(2+)-ATPase activity of Acanthamoeba myosin II correlates with both changes in myosin head conformation and the ability of minifilaments to cycle between stiff and flexible conformations coupled to nucleotide binding and release.

  20. Nucleotide composition of CO1 sequences in Chelicerata (Arthropoda): detecting new mitogenomic rearrangements.

    Science.gov (United States)

    Arabi, Juliette; Judson, Mark L I; Deharveng, Louis; Lourenço, Wilson R; Cruaud, Corinne; Hassanin, Alexandre

    2012-02-01

    Here we study the evolution of nucleotide composition in third codon-positions of CO1 sequences of Chelicerata, using a phylogenetic framework, based on 180 taxa and three markers (CO1, 18S, and 28S rRNA; 5,218 nt). The analyses of nucleotide composition were also extended to all CO1 sequences of Chelicerata found in GenBank (1,701 taxa). The results show that most species of Chelicerata have a positive strand bias in CO1, i.e., in favor of C nucleotides, including all Amblypygi, Palpigradi, Ricinulei, Solifugae, Uropygi, and Xiphosura. However, several taxa show a negative strand bias, i.e., in favor of G nucleotides: all Scorpiones, Opisthothelae spiders and several taxa within Acari, Opiliones, Pseudoscorpiones, and Pycnogonida. Several reversals of strand-specific bias can be attributed to either a rearrangement of the control region or an inversion of a fragment containing the CO1 gene. Key taxa for which sequencing of complete mitochondrial genomes will be necessary to determine the origin and nature of mtDNA rearrangements involved in the reversals are identified. Acari, Opiliones, Pseudoscorpiones, and Pycnogonida were found to show a strong variability in nucleotide composition. In addition, both mitochondrial and nuclear genomes have been affected by higher substitution rates in Acari and Pseudoscorpiones. The results therefore indicate that these two orders are more liable to fix mutations of all types, including base substitutions, indels, and genomic rearrangements.