
Sample records for adenine nucleotides

  1. Adenine nucleotide depletion from endothelial cells exposed to xanthine oxidase

    International Nuclear Information System (INIS)

    Aalto, T.K.; Raivio, K.O.


    Hypoxia causes breakdown of cellular nucleotides, accumulation of hypoxanthine (HX), and conversion of xanthine dehydrogenase into xanthine oxidase (XO). Upon reoxygenation, the HX-XO reaction generates free radicals, one potential mechanism of tissue damage. Because endothelial cells contain XO and are exposed to circulating HX, they are a likely target for damage. We studied the effect of XO and/or HX at physiologically relevant concentrations on nucleotide metabolism of cultured endothelial cells from human umbilical veins. Cells were labeled with [14C]adenine and incubated for up to 6 h with HX, XO, or both, in the absence or presence of serum. Adenine nucleotides from cell extracts and nucleotide breakdown products (HX, xanthine, and urate) from the medium were separated and counted. HX alone had no effect. XO (80 mU/ml) alone caused a 70% (no serum) or 40% (with serum) fall in adenine nucleotides and an equivalent increase of xanthine and urate. The combination of HX and XO caused a 90% (no serum) or 70% (with serum) decrease in nucleotides, decrease in energy charge, and detachment of cells from the culture plate. Nucleotide depletion was not accounted for by proteolytic activity in the XO preparation. Albumin was only half as effective as serum in preventing nucleotide loss. Thus exogenous XO, in the presence of endogenous HX, triggers adenine nucleotide catabolism, but endogenous XO activity is too low to influence nucleotide levels even at high exogenous HX concentrations. Serum limits the catabolic effect of XO and thus protects cells from free radical damage

  2. Adenine nucleotide translocator transports haem precursors into mitochondria.

    Directory of Open Access Journals (Sweden)

    Motoki Azuma


    Full Text Available Haem is a prosthetic group for haem proteins, which play an essential role in oxygen transport, respiration, signal transduction, and detoxification. In haem biosynthesis, the haem precursor protoporphyrin IX (PP IX must be accumulated into the mitochondrial matrix across the inner membrane, but its mechanism is largely unclear. Here we show that adenine nucleotide translocator (ANT, the inner membrane transporter, contributes to haem biosynthesis by facilitating mitochondrial accumulation of its precursors. We identified that haem and PP IX specifically bind to ANT. Mitochondrial uptake of PP IX was inhibited by ADP, a known substrate of ANT. Conversely, ADP uptake into mitochondria was competitively inhibited by haem and its precursors, suggesting that haem-related porphyrins are accumulated into mitochondria via ANT. Furthermore, disruption of the ANT genes in yeast resulted in a reduction of haem biosynthesis by blocking the translocation of haem precursors into the matrix. Our results represent a new model that ANT plays a crucial role in haem biosynthesis by facilitating accumulation of its precursors into the mitochondrial matrix.

  3. Purine nucleotide synthesis from exogenous adenine and guanine in rodent small intestine

    International Nuclear Information System (INIS)

    Gross, C.J.; Karlberg, P.K.; Savaiano, D.A.


    14 C-Adenine and 14 C-guanine uptake was studied in isolated guinea pig enterocytes. Cells were incubated in Hank's buffer and separated from the medium by centrifugation through silicone oil into 1M PCA. Uptake was temperature and concentration dependent. Both compounds were incorporated into nucleotides as measured by HPLC and HVE. Adenine was more extensively incorporated into nucleotides than was guanine. Adenine nucleotides accounted for about 70% of the intracellular label after 30 min with a majority being ADP and ATP (medium concentration = 10 μM). Guanine nucleotides accounted for only 30% of the intracellular label after 30 min. Labeled intracellular free adenine or guanine were not detected. Significantly more guanine vs. adenine was converted to uric acid. After 30 min, 11.5 +/- 3.9% (n=3) and 83.0 +/- 8.4% (n=4) of the label was present as uric acid in the medium when adenine and guanine, respectively, were the substrate. After 1 min, 34.8 +/- 3.4% (n=4) of the label in the medium was present as uric acid when guanine was the substrate. Decreasing the concentration of adenine resulted in an increase in the percent of uric acid in the medium. 14 C-adenine (75 nmol) was injected into 1 gm segments of rat jejunum. After 5 min., segments were quickly flushed and the tissue homogenized in 1M PCA. Only uric acid was present after 5 min (n=6). In contrast, in animals fasted 3 to 5 days, less conversion to uric acid was observed in the intestinal content (50-80% of the same dose was still present as adenine after 5 min) and nucleotide formation was observed in the tissue. The results indicate that uric acid and nucleotide synthesis from exogenous adenine and guanine are concentration dependent and affected by nutritional state

  4. Adenine and guanine nucleotide metabolism during platelet storage at 22 degree C

    International Nuclear Information System (INIS)

    Edenbrandt, C.M.; Murphy, S.


    Adenine and guanine nucleotide metabolism of platelet concentrates (PCs) was studied during storage for transfusion at 22 +/- 2 degrees C over a 7-day period using high-pressure liquid chromatography. There was a steady decrease in platelet adenosine triphosphate (ATP) and adenosine diphosphate (ADP), which was balanced quantitatively by an increase in plasma hypoxanthine. As expected, ammonia accumulated along with hypoxanthine but at a far greater rate. A fall in platelet guanosine triphosphate (GTP) and guanosine diphosphate (GDP) paralleled the fall in ATP + ADP. When adenine was present in the primary anticoagulant, it was carried over into the PC and metabolized. ATP, GTP, total adenine nucleotides, and total guanine nucleotides declined more slowly in the presence of adenine than in its absence. With adenine, the increase in hypoxanthine concentration was more rapid and quantitatively balanced the decrease in adenine and platelet ATP + ADP. Plasma xanthine rose during storage but at a rate that exceeded the decline in GTP + GDP. When platelet ATP + ADP was labeled with 14C-adenine at the initiation of storage, half of the radioactivity was transferred to hypoxanthine (45%) and GTP + GDP + xanthine (5%) by the time storage was completed. The isotopic data were consistent with the presence of a radioactive (metabolic) and a nonradioactive (storage) pool of ATP + ADP at the initiation of storage with each pool contributing approximately equally to the decline in ATP + ADP during storage. The results suggested a continuing synthesis of GTP + GDP from ATP + ADP, explaining the slower rate of fall of GTP + GDP relative to the rate of rise of plasma xanthine. Throughout storage, platelets were able to incorporate 14C-hypoxanthine into both adenine and guanine nucleotides but at a rate that was only one fourth the rate of hypoxanthine accumulation

  5. De novo synthesis of adenine nucleotides in different skeletal muscle fiber types

    International Nuclear Information System (INIS)

    Tullson, P.C.; John-Alder, H.B.; Hood, D.A.; Terjung, R.L.


    Management of adenine nucleotide catabolism differs among skeletal muscle fiber types. This study evaluated whether there are corresponding differences in the rates of de novo synthesis of adenine nucleotide among fiber type sections of skeletal muscle using an isolated perfused rat hindquarter preparation. Label incorporation into adenine nucleotides from the [1-14C]glycine precursor was determined and used to calculate synthesis rates based on the intracellular glycine specific radioactivity. Results show that intracellular glycine is closely related to the direct precursor pool. Rates of de novo synthesis were highest in fast-twitch red muscle (57.0 +/- 4.0, 58.2 +/- 4.4 nmol.h-1.g-1; deep red gastrocnemius and vastus lateralis), relatively high in slow-twitch red muscle (47.0 +/- 3.1; soleus), and low in fast-twitch white muscle (26.1 +/- 2.0 and 21.6 +/- 2.3; superficial white gastrocnemius and vastus lateralis). Rates for four mixed muscles were intermediate, ranging between 32.3 and 37.3. Specific de novo synthesis rates exhibited a strong correlation (r = 0.986) with muscle section citrate synthase activity. Turnover rates (de novo synthesis rate/adenine nucleotide pool size) were highest in high oxidative muscle (0.82-1.06%/h), lowest in low oxidative muscle (0.30-0.35%/h), and intermediate in mixed muscle (0.44-0.55%/h). Our results demonstrate that differences in adenine nucleotide management among fiber types extends to the process of de novo adenine nucleotide synthesis

  6. Ethanol-induced activation of adenine nucleotide turnover. Evidence for a role of acetate

    International Nuclear Information System (INIS)

    Puig, J.G.; Fox, I.H.


    Consumption of alcohol causes hyperuricemia by decreasing urate excretion and increasing its production. Our previous studies indicate that ethanol administration increases uric acid production by increasing ATP degradation to uric acid precursors. To test the hypothesis that ethanol-induced increased urate production results from acetate metabolism and enhanced adenosine triphosphate turnover, we gave intravenous sodium acetate, sodium chloride and ethanol (0.1 mmol/kg per min for 1 h) to five normal subjects. Acetate plasma levels increased from 0.04 +/- 0.01 mM (mean +/- SE) to peak values of 0.35 +/- 0.07 mM and to 0.08 +/- 0.01 mM during acetate and ethanol infusions, respectively. Urinary oxypurines increased to 223 +/- 13% and 316 +/- 44% of the base-line values during acetate and ethanol infusions, respectively. Urinary radioactivity from the adenine nucleotide pool labeled with [8-14C] adenine increased to 171 +/- 27% and to 128 +/- 8% of the base-line values after acetate and ethanol infusions. These data indicate that both ethanol and acetate increase purine nucleotide degradation by enhancing the turnover of the adenine nucleotide pool. They support the hypothesis that acetate metabolism contributes to the increased production of urate associated with ethanol intake

  7. Pulmonary preservation studies: effects on endothelial function and pulmonary adenine nucleotides. (United States)

    Paik, Hyo Chae; Hoffmann, Steven C; Egan, Thomas M


    Lung transplantation is an effective therapy plagued by a high incidence of early graft dysfunction, in part because of reperfusion injury. The optimal preservation solution for lung transplantation is unknown. We performed experiments using an isolated perfused rat lung model to test the effect of lung preservation with three solutions commonly used in clinical practice. Lungs were retrieved from Sprague-Dawley rats and flushed with one of three solutions: modified Euro-Collins (MEC), University of Wisconsin (UW), or low potassium dextran and glucose (LPDG), then stored cold for varying periods before reperfusion with Earle's balanced salt solution using the isolated perfused rat lung model. Outcome measures were capillary filtration coefficient (Kfc), wet-to-dry weight ratio, and lung tissue levels of adenine nucleotides and cyclic AMP. All lungs functioned well after 4 hr of storage. By 6 hr, UW-flushed lungs had a lower Kfc than LPDG-flushed lungs. After 8 hr of storage, only UW-flushed lungs had a measurable Kfc. Adenine nucleotide levels were higher in UW-flushed lungs after prolonged storage. Cyclic AMP levels correlated with Kfc in all groups. Early changes in endothelial permeability seemed to be better attenuated in lungs flushed with UW compared with LPDG or MEC; this was associated with higher amounts of adenine nucleotides. MEC-flushed lungs failed earlier than LPDG-flushed or UW-flushed lungs. The content of the solution may be more important for lung preservation than whether the ionic composition is intracellular or extracellular.

  8. NMR studies of the fate of adenine nucleotides in glucose-starved erythrocytes

    International Nuclear Information System (INIS)

    Bubb, W.A.; Mulquiney, P.J.; Kuchel, P.W.; Rohwer, J.; De Atauri, P.


    Full text: As a consequence of many refinements during the past 30 years, we now have a detailed understanding of the glycolytic pathway in human erythrocytes. By comparison, and notwithstanding their central importance to four key steps in erythrocyte glycolysis, our knowledge of the catabolism of adenine nucleotides remains relatively limited. In particular, the mechanism for the degradation of AMP, whose concentration rises under conditions of oxidative stress or glucose deprivation, remains poorly understood, AMP degradation may proceed via two possible pathways which converge in the production of inosine. Analysis of the key intermediates for the respective pathways, adenosine and AMP, as well as determination of end products is not straightforward. High-resolution NMR spectroscopy affords a potentially simple analytical solution to this problem but is complicated by spectral overlap and the sensitivity of key resonances to variations in pH and the concentrations of cations such as Mg 2+ . We describe a multinuclear NMR approach towards characterising the intermediates and end-products of adenine nucleotide metabolism in glucose-starved human erythrocytes. Assignments based on homo- and heteronuclear correlation experiments for both 13 C and 31 P are presented

  9. Divalent phosphate is a counterion for carboxyatractyloside-insensitive adenine nucleotide transport in rat liver mitochondria

    International Nuclear Information System (INIS)

    Nosek, M.T.; Aprille, J.R.


    Unidirectional, carboxyatractyloside(CAT)-insensitive adenine nucleotide (AdN) fluxes have been studied in isolated rat liver mitochondria (mito). Previous work has shown that ATP x Mg transport in one direction is coupled to ATP x Mg or P/sub i/ transport in the opposite direction. The purpose of this study was to determine whether divalent HPO 4 2- or monovalent H 2 PO 4 - is the transported phosphate species. The authors used the monofluorophosphate (PO 3 F 2- ) and difluorophosphate (PO 2 F 2 - ) analogues as potential counterions forAdN efflux. After a preincubation on ice with 14 C-ADP to label the matrix AdN, efflux was measured at 30 0 C, pH 7.4, in 225mM sucrose, 10mM KCl, 5mM MgCl 2 , 5mM glutamate, 5mM malate, 10mM Tris, 0.5mM P/sub i/, 1mM ATP, and 5μM CAT. With no other additions efflux was -0.62 +/- 0.20 nmole/minute/mg protein. The data supports the hypothesis that divalent but not monovalent phosphate can act as a counterion for ATPx Mg transport over this CAT-insensitive carrier

  10. Functional expression of human adenine nucleotide translocase 4 in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Takashi Hamazaki


    Full Text Available The adenine nucleotide translocase (ANT mediates the exchange of ADP and ATP across the inner mitochondrial membrane. The human genome encodes multiple ANT isoforms that are expressed in a tissue-specific manner. Recently a novel germ cell-specific member of the ANT family, ANT4 (SLC25A31 was identified. Although it is known that targeted depletion of ANT4 in mice resulted in male infertility, the functional biochemical differences between ANT4 and other somatic ANT isoforms remain undetermined. To gain insight into ANT4, we expressed human ANT4 (hANT4 in yeast mitochondria. Unlike the somatic ANT proteins, expression of hANT4 failed to complement an AAC-deficient yeast strain for growth on media requiring mitochondrial respiration. Moreover, overexpression of hANT4 from a multi-copy plasmid interfered with optimal yeast growth. However, mutation of specific amino acids of hANT4 improved yeast mitochondrial expression and supported growth of the AAC-deficient yeast on non-fermentable carbon sources. The mutations affected amino acids predicted to interact with phospholipids, suggesting the importance of lipid interactions for function of this protein. Each mutant hANT4 and the somatic hANTs exhibited similar ADP/ATP exchange kinetics. These data define common and distinct biochemical characteristics of ANT4 in comparison to ANT1, 2 and 3 providing a basis for study of its unique adaptation to germ cells.

  11. Ebselen induces mitochondrial permeability transition because of its interaction with adenine nucleotide translocase. (United States)

    Pavón, Natalia; Correa, Francisco; Buelna-Chontal, Mabel; Hernández-Esquivel, Luz; Chávez, Edmundo


    Mitochondrial permeability transition is a process established through massive Ca(2+) load in addition to an inducer reagent. Ebselen (Ebs), an antioxidant seleno compound, has been introduced as a reagent which inhibits mitochondrial dysfunction induced by permeability transition. Paradoxically enough, it has been shown that Ebs may also be able to induce the opening of the mitochondrial non-selective pores. This study was performed with the purpose of establishing the membrane system involved in Ebs-induced pore opening. Permeability transition was appraised by analyzing the following: i) matrix Ca(2+) release, and mitochondrial swelling, ii) efflux of cytochrome c, and iii) the inhibition of superoxide dismutase. All of these adverse reactions were inhibited by N-ethylmaleimide and cyclosporin A. At concentrations from 5 to 20 μM, we found that Ebs induces non-specific membrane permeability. Remarkably, Ebs blocks the binding of the fluorescent reagent eosin-5-maleimide to the thiol groups of the adenine nucleotide translocase. Based on the above, it is tempting to hypothesize that Ebs induces pore opening through its binding to the ADP/ATP carrier. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Transgenic overexpression of adenine nucleotide translocase 1 protects ischemic hearts against oxidative stress. (United States)

    Klumpe, Inga; Savvatis, Konstantinos; Westermann, Dirk; Tschöpe, Carsten; Rauch, Ursula; Landmesser, Ulf; Schultheiss, Heinz-Peter; Dörner, Andrea


    Ischemia impairs the adenine nucleotide translocase (ANT), which transports ADP and ATP across the inner mitochondrial membrane. We investigated whether ANT1 overexpression has protective effects on ischemic hearts. Myocardial infarction was induced in wild-type (WT) and heart-specific ANT1-transgenic (ANT1-TG) rats, and hypoxia was set in isolated cardiomyocytes. ANT1 overexpression reduced the myocardial infarct area and increased the survival rate of infarcted rats. Reduced ANT1 expression and increased 4-hydroxynonenal modification of ANT paralleled to impaired ANT function in infarcted WT hearts. ANT1 overexpression improved ANT expression and function. This was accompanied by reduced mitochondrial cytochrome C release and caspase-3 activation. ANT1-TG hearts suffered less from oxidative stress, as shown by lower protein carbonylation and 4-hydroxynonenal modification of ANT. ANT1 overexpression also increased cell survival of hypoxic cardiomyocytes and attenuated reactive oxygen species (ROS) production. This was linked to higher stability of mitochondrial membrane potential and lower activity of ROS detoxifying catalase. ANT1-TG cardiomyocytes also showed higher resistance against H2O2 treatment, which was independent of catalase activity. In conclusion, ANT1 overexpression compensates impaired ANT activity under oxygen-restricted conditions. It reduces ROS production and oxidative stress, stabilizes mitochondrial integrity, and increases survival, making ANT1 a component in ROS management and heart protection during ischemia. ANT1 overexpression reduces infarct size and increases survival after infarction. ANT1 overexpression compensates restricted ANT expression and function in infarcted hearts. Increased ANT1 expression enhances mitochondrial integrity. ANT1-overexpressing hearts reduce oxidative stress by decreasing ROS generation. ANT1 is a component in ROS management and heart protection.

  13. Two adenine nucleotide translocase paralogues involved in cell proliferation and spermatogenesis in the silkworm Bombyx mori.

    Directory of Open Access Journals (Sweden)

    Ryohei Sugahara

    Full Text Available Mitochondrial adenine nucleotide translocase (ANT specifically acts in ADP/ATP exchange through the mitochondrial inner membrane. This transporter protein thereby plays a significant role in energy metabolism in eukaryotic cells. Most mammals have four paralogous ANT genes (ANT1-4 and utilize these paralogues in different types of cells. The fourth paralogue of ANT (ANT4 is present only in mammals and reptiles and is exclusively expressed in testicular germ cells where it is required for meiotic progression in the spermatocytes. Here, we report that silkworms harbor two ANT paralogues, the homeostatic paralogue (BmANTI1 and the testis-specific paralogue (BmANTI2. The BmANTI2 protein has an N-terminal extension in which the positions of lysine residues in the amino acid sequence are distributed as in human ANT4. An expression analysis showed that BmANTI2 transcripts were restricted to the testis, suggesting the protein has a role in the progression of spermatogenesis. By contrast, BmANTI1 was expressed in all tissues tested, suggesting it has an important role in homeostasis. We also observed that cultured silkworm cells required BmANTI1 for proliferation. The ANTI1 protein of the lepidopteran Plutella xylostella (PxANTI1, but not those of other insect species (or PxANTI2, restored cell proliferation in BmANTI1-knockdown cells suggesting that ANTI1 has similar energy metabolism functions across the Lepidoptera. Our results suggest that BmANTI2 is evolutionarily divergent from BmANTI1 and has developed a specific role in spermatogenesis similar to that of mammalian ANT4.

  14. An alternative membrane transport pathway for phosphate and adenine nucleotides in mitochondria and its possible function (United States)

    Reynafarje, Baltazar; Lehninger, Albert L.


    This paper describes the properties and a possible biological role of a transport process across the inner membrane of rat liver mitochondria resulting in the exchange of ATP4- (out) for ADP3- (in) + 0.5 phosphate2- (in). This transmembrane exchange reaction, designated as the ATP-ADP-phosphate exchange, is specific for the ligands shown, electroneutral, insensitive to N-ethylmaleimide or mersalyl, inhibited by atractyloside, and appears to occur only in the direction as written. It is thus distinct from the well-known phosphate-hydroxide and phosphate-dicarboxylate exchange systems, which are inhibited by mersalyl, and from the ATP-ADP exchanger, which does not transport phosphate. During ATP hydrolysis by mitochondria, half of the phosphate formed from ATP passes from the matrix to the medium by the mersalyl-insensitive ATP-ADP-phosphate exchange and the other half by the well-known mersalyl-sensitive phosphate-hydroxide exchange. These and other considerations have led to a hypothesis for the pathway and stoichiometry of ATP-dependent reverse electron transport, characterized by a requirement of 1.33 molecules of ATP per pair of electrons reversed and by the utilization of a different membrane transport pathway for phosphate and adenine nucleotides than is taken in forward electron flow and oxidative phosphorylation. The possible occurrence of independent pathways for ATP-forming forward electron flow and ATP-consuming reverse electron flow is consonant with the fact that the opposing degradative and synthetic pathways in the central routes of cell metabolism generally have different pathways that are independently regulated. PMID:283393

  15. Evaluation of Porin Interaction with Adenine Nucleotide Translocase and Cyclophilin-D Proteins after Brain Ischemia and Reperfusion

    Directory of Open Access Journals (Sweden)

    Mohammad Ali Atlasi


    Full Text Available Objective (s Porin is a mitochondrial outer membrane channel, which usually functions as the pathway for the movement of various substances in and out of the mitochondria and is considered to be a component of the permeability transition (PT pore complex that plays a role in the PT. We addressed the hypothesis that porin interacts with other mitochondrial proteins after ischemic injury.Materials and MethodsFor this purpose, we used in vivo 4-vessel occlusion model of rat brain and porin purification method by hydroxyapatite column. After SDS gel electrophoresis and silver nitrate staining, Western blotting was done for porin, adenine nucleotide translocase and cyclophilin-D proteins.Results Porin was purified from mitochondrial mixture in ischemic brain and control groups. Investigation of interaction of adenine nucleotide transposes (ANT and cyclophilin-D with porin by Western blotting showed no proteins co-purified with porin from injured tissues.Conclusion The present study implies that there may not be interaction between porin, and ANT or cyclophilin-D, and if there is any, it is not maintained during the purification procedure.

  16. When does the lung die? Kfc, cell viability, and adenine nucleotide changes in the circulation-arrested rat lung. (United States)

    Jones, D R; Becker, R M; Hoffmann, S C; Lemasters, J J; Egan, T M


    Lungs harvested from cadaveric circulation-arrested donors may increase the donor pool for lung transplantation. To determine the degree and time course of ischemia-reperfusion injury, we evaluated the effect of O2 ventilation on capillary permeability [capillary filtration coefficient (Kfc)], cell viability, and total adenine nucleotide (TAN) levels in in situ circulation-arrested rat lungs. Kfc increased with increasing postmortem ischemic time (r = 0.88). Lungs ventilated with O2 1 h postmortem had similar Kfc and wet-to-dry ratios as controls. Nonventilated lungs had threefold (P Kfc at 30 and 60 min postmortem compared with controls. Cell viability decreased in all groups except for 30-min postmortem O2-ventilated lungs. TAN levels decreased with increasing ischemic time, particularly in nonventilated lungs. Loss of adenine nucleotides correlated with increasing Kfc values (r = 0.76). This study indicates that lungs retrieved 1 h postmortem may have normal Kfc with preharvest O2 ventilation. The relationship between Kfc and TAN suggests that vascular permeability may be related to lung TAN levels.

  17. Intramolecular stacking interactions in ternary copper(II) complexes formed by a heteroaromatic amine and 9-[2-(2-phosphonoethoxy)ethyl]adenine, a relative of the antiviral nucleotide analogue 9-[2-(phosphonomethoxy)ethyl]adenine

    Czech Academy of Sciences Publication Activity Database

    Fernández-Botello, A.; Holý, Antonín; Moreno, V.; Sigel, H.


    Roč. 98, - (2004), s. 2114-2124 ISSN 0162-0134 R&D Projects: GA MŠk OC D20.002 Institutional research plan: CEZ:AV0Z4055905 Keywords : adenine nucleotide analogues * intramolecular equilibria * isomeric complexes Subject RIV: CC - Organic Chemistry Impact factor: 2.225, year: 2004

  18. Effect of gamma radiation on levels of adenine nucleotides in erythrocytes of healthy individuals after submaximum physical exertion

    International Nuclear Information System (INIS)

    Zagorski, T.; Dudek, I.; Mazurek, M.; Berkan, L.; Chmielewski, H.; Kedziora, J.


    The authors studied the effect of gamma radiation and submaximum physical exercise on adenosine-5'-triphosphate (ATP), adenosine-5'-diphosphate (ADP) and adenosine-5'-monophosphate (AMP) contents in erythrocytes of healthy males. Twenty one men aged 20-22 years were examined. They underwent physical exercise at doses of 2 w/kg body weight for 15 min. Erythrocytes were exposed to gamma radiation (500 Gy doses) from 60 Co source. The concentration of adenine nucleotides in erythrocytes was measured by the Boehringer Mannheim tests. The submaximum physical exercise was found to decrease ATP content and to increase ADP and AMP in erythrocytes. Gamma radiation at 500 Gy dose was found to decrease ATP concentration in erythrocytes both at rest and after submaximum exercise and to increase AD content. It was revealed that AMP content increased at rest and decreased after submaximum exercise in irradiated erythrocytes. (author). 20 refs, 1 tab

  19. Persistent changes in the initial rate of pyruvate transport by isolated rat liver mitochondria after preincubation with adenine nucleotides and calcium ions

    NARCIS (Netherlands)

    Vaartjes, W.J.; Breejen, J.N. den; Geelen, M.J.H.; Bergh, S.G. van den


    1. Preincubation of isolated rat-liver mitochondria in the presence of adenine nucleotides or Ca2+ results in definite and persistent changes in the initial rate of pyruvate transport. 2. These changes in the rate of pyruvate transport are accompanied by equally persistent changes in the opposite

  20. Modular kinetic analysis of the adenine nucleotide translocator-mediated effects of palmitoyl-CoA on the oxidative phosphorylation in isolated rat liver mitochondria

    NARCIS (Netherlands)

    Ciapaite, J.; van Eikenhorst, G.; Bakker, S.J.L.; Diamant, M.; Heine, R.J.; Wagner, M.J.; Westerhoff, H.V.; Krab, K.


    To test whether long-chain fatty acyl-CoA esters link obesity with type 2 diabetes through inhibition of the mitochondrial adenine nucleotide translocator, we applied a system-biology approach, dual modular kinetic analysis, with mitochondrial membrane potential (Δψ) and the fraction of matrix ATP

  1. Modular kinetic analysis of the adenine nucleotide translocator-mediated effects of palmitoyl-CoA on the oxidative phosphorylation in isolated rat liver mitochondria

    NARCIS (Netherlands)

    Ciapaite, J; Van Eikenhorst, G; Bakker, SJL; Diamant, M; Heine, RJ; Wagner, MJ; Westerhoff, HV; Krab, K

    To test whether long-chain fatty acyl-CoA esters link obesity with type 2 diabetes through inhibition of the mitochondrial adenine nucleotide translocator, we applied a system-biology approach, dual modular kinetic analysis, with mitochondrial membrane potential (Delta psi) and the fraction of

  2. Caffeic acid treatment alters the extracellular adenine nucleotide hydrolysis in platelets and lymphocytes of adult rats. (United States)

    Anwar, Javed; Spanevello, Roselia Maria; Pimentel, Victor Camera; Gutierres, Jessié; Thomé, Gustavo; Cardoso, Andreia; Zanini, Daniela; Martins, Caroline; Palma, Heloisa Einloft; Bagatini, Margarete Dulce; Baldissarelli, Jucimara; Schmatz, Roberta; Leal, Cláudio Alberto Martins; da Costa, Pauline; Morsch, Vera Maria; Schetinger, Maria Rosa Chitolina


    This study evaluated the effects of caffeic acid on ectonucleotidase activities such as NTPDase (nucleoside triphosphate diphosphohydrolase), Ecto-NPP (nucleotide pyrophosphatase/phosphodiesterase), 5'-nucleotidase and adenosine deaminase (ADA) in platelets and lymphocytes of rats, as well as in the profile of platelet aggregation. Animals were divided into five groups: I (control); II (oil); III (caffeic acid 10 mg/kg); IV (caffeic acid 50 mg/kg); and V (caffeic acid 100 mg/kg). Animals were treated with caffeic acid diluted in oil for 30 days. In platelets, caffeic acid decreased the ATP hydrolysis and increased ADP hydrolysis in groups III, IV and V when compared to control (P<0.05). The 5'-nucleotidase activity was decreased, while E-NPP and ADA activities were increased in platelets of rats of groups III, IV and V (P<0.05). Caffeic acid reduced significantly the platelet aggregation in the animals of groups III, IV and V in relation to group I (P<0.05). In lymphocytes, the NTPDase and ADA activities were increased in all groups treated with caffeic acid when compared to control (P<0.05). These findings demonstrated that the enzymes were altered in tissues by caffeic acid and this compound decreased the platelet aggregation suggesting that caffeic acid should be considered a potentially therapeutic agent in disorders related to the purinergic system. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Adenine Nucleotide Analogues Locked in a Northern Methanocarba Conformation: Enhanced Stability and Potency as P2Y1 Receptor Agonists (United States)

    Ravi, R. Gnana; Kim, Hak Sung; Servos, Jörg; Zimmermann, Herbert; Lee, Kyeong; Maddileti, Savitri; Boyer, José L.; Harden, T. Kendall; Jacobson, Kenneth A.


    Preference for the Northern (N) ring conformation of the ribose moiety of nucleotide 5′-triphosphate agonists at P2Y1, P2Y2, P2Y4, and P2Y11 receptors, but not P2Y6 receptors, was established using a ring-constrained methanocarba (a 3.1.0-bicyclohexane) ring as a ribose substitute (Kim et al. J. Med. Chem. 2002, 45, 208–218.). We have now combined the ring-constrained (N)-methanocarba modification of adenine nucleotides with other functionalities known to enhance potency at P2 receptors. The potency of the newly synthesized analogues was determined in the stimulation of phospholipase C through activation of turkey erythrocyte P2Y1 or human P2Y1 and P2Y2 receptors stably expressed in astrocytoma cells. An (N)-methanocarba-2-methylthio-ADP analogue displayed an EC50 at the hP2Y1 receptor of 0.40 nM and was 55-fold more potent than the corresponding triphosphate and 16-fold more potent than the riboside 5′-diphosphate. 2-Cl–(N)-methanocarba-ATP and its N6-Me analogue were also highly selective, full agonists at P2Y1 receptors. The (N)-methanocarba-2-methylthio and 2-chloromonophosphate analogues were full agonists exhibiting micromolar potency at P2Y1 receptors, while the corresponding ribosides were inactive. Although β,γ-methylene-ATP was inactive at P2Y receptors, β,γ-methylene-(N)-methanocarba-ATP was a potent hP2Y1 receptor agonist with an EC50 of 160 nM and was selective versus hP2Y2 and hP2Y4 receptors. The rates of hydrolysis of Northern (N) and Southern (S) methanocarba analogues of AMP by rat 5′-ectonucleotidase were negligible. The rates of hydrolysis of the corresponding triphosphates by recombinant rat NTPDase1 and 2 were studied. Both isomers were hydrolyzed by NTPDase 1 at about half the rate of ATP hydrolysis. The (N) isomer was hardly hydrolyzed by NTPDase 2, while the (S) isomer was hydrolyzed at one-third of the rate of ATP hydrolysis. This suggests that new, more stable and selective nucleotide agonists may be designed on the basis of

  4. Simultaneous quantification of porcine myocardial adenine nucleotides and creatine phosphate by ion-pair reverse-phase high-performance liquid chromatography

    International Nuclear Information System (INIS)

    Cordis, G.A.; Das, D.K.


    In order to follow the energy metabolism and the levels of high-energy phosphate compounds in porcine myocardium subjected to ischemic insult, it was necessary to develop a high-performance liquid chromatography (HPLC) method where creatine phosphate (CP) and the adenine nucleotides could be measured simultaneously in a single run. Currently available ion-pair reverse-phase HPLC methods require a separate injection with a change in wavelength and mobile phase in order to measure the creatine phosphate, while baseline separation of AMP is lacking. The ion-exchange HPLC method includes a simultaneous determination, but the baseline drifts due to the gradient and baseline separation of AMP is not achieved. In the following ion-pair reverse-phase HPLC method, simultaneous measurements of porcine myocardial adenine nucleotides and creatine phosphate were achieved along with a stable baseline and homogeneous baseline separation of each measured compound, allowing accurate quantification

  5. Dependence of mitochondrial and cytosolic adenine nucleotides on oxygen partial pressure in isolated hepatocytes. Application of a new rapid high pressure filtration technique for fractionation.


    Hummerich, H; de Groot, H; Noll, T; Soboll, S


    By using a new rapid high pressure filtration technique, mitochondrial and cytosolic ATP and ADP contents were determined in isolated hepatocytes at different oxygen partial pressures. At 670 mmHg, subcellular adenine nucleotide contents and ATP/ADP ratios were comparable with values obtained with the digitonin fractionation technique. However at lower oxygen partial pressure ADP appears to be rephosphorylated during digitonin fractionation whereas with high pressure filtration fractionation ...

  6. Persistent changes in the initial rate of pyruvate transport by isolated rat liver mitochondria after preincubation with adenine nucleotides and calcium ions


    Vaartjes, W.J.; Breejen, J.N. den; Geelen, M.J.H.; Bergh, S.G. van den


    1. Preincubation of isolated rat-liver mitochondria in the presence of adenine nucleotides or Ca2+ results in definite and persistent changes in the initial rate of pyruvate transport. 2. These changes in the rate of pyruvate transport are accompanied by equally persistent changes in the opposite direction of the activity of pyruvate dehydrogenase (EC. 3. Changes of the transmembrane pH gradient and of the membrane potential, brought about by the pretreatments of the mitochondria, c...

  7. Levels of adenine nucleotides (ATP, ADP, AMP) and of inorganic phosphate in needles of Picea abies, representing different stages of development and of pollution dependence

    Energy Technology Data Exchange (ETDEWEB)

    Benz, T; Hampp, R; Horsch, F; Filby, G; Fund, N; Gross, S; Hanisch, B; Kilz, E; Seidel, A [comps.


    Levels of adenine nucleotides (ATP, ADP, AMP) and of inorganic phosphate in needles of Picea abies, representing different stages of development and of pollution dependence. Lyophilized needles of Picea abies (Kaelbelescheuer, southern Black Forest) were analyzed for their content of adenine nucleotides (ATP, ADP, AMP: AdN) and of inorganic phosphate (Psub(i)). The metabolite levels were related to needle age, vegetation period and degree of damage (chlorophyll content). The results were as follows: 1) With increasing needle age there is a general decrease in the total AdN-pool. This decrease is most pronounced in very young needles and occurs in both healthy and damaged tissue. 2) The ATP/ADP-ratio of damaged needle is significantly higher than that of healthy ones. 3) Both phosphorylation potential (ATP.(ADP.Psub(i))/sup -1/) and adenylate energy charge ((ATP + 0.5.ADP).(AdN)/sup -1/) are significantly reduced in damaged needles. This is due to relatively higher levels of Psub(i) and of AMP. The results, although incomplete and preliminary, indicate metabolic alterations which have been described for other tissues in response to pollution by photooxidants.

  8. Studies on the energy metabolism of opossum (Didelphis virginiana) erythrocytes: V. Utilization of hypoxanthine for the synthesis of adenine and guanine nucleotides in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Bethlenfalvay, N.C.; White, J.C.; Chadwick, E.; Lima, J.E. (Fitzsimons Army Medical Center, Aurora, CO (USA))


    High pressure liquid radiochromatography was used to test the ability of opossum erythrocytes to incorporate tracer amounts of (G-{sup 3}H) hypoxanthine (Hy) into ({sup 3}H) labelled triphosphates of adenine and guanine. In the presence of supraphysiologic (30 mM) phosphate which is optimal for PRPP synthesis, both ATP and GTP are extensively labelled. When physiologic (1 mM) medium phosphate is used, red cells incubated under an atmosphere of nitrogen accumulate ({sup 3}H) ATP in a linear fashion suggesting ongoing PRPP synthesis in red cells whose hemoglobin is deoxygenated. In contrast, a lesser increase of labelled ATP is observed in cells incubated under oxygen, suggesting that conditions for purine nucleotide formation from ambient Hy are more favorable in the venous circulation.

  9. Studies on the energy metabolism of opossum (Didelphis virginiana) erythrocytes: V. Utilization of hypoxanthine for the synthesis of adenine and guanine nucleotides in vitro

    International Nuclear Information System (INIS)

    Bethlenfalvay, N.C.; White, J.C.; Chadwick, E.; Lima, J.E.


    High pressure liquid radiochromatography was used to test the ability of opossum erythrocytes to incorporate tracer amounts of [G- 3 H] hypoxanthine (Hy) into [ 3 H] labelled triphosphates of adenine and guanine. In the presence of supraphysiologic (30 mM) phosphate which is optimal for PRPP synthesis, both ATP and GTP are extensively labelled. When physiologic (1 mM) medium phosphate is used, red cells incubated under an atmosphere of nitrogen accumulate [ 3 H] ATP in a linear fashion suggesting ongoing PRPP synthesis in red cells whose hemoglobin is deoxygenated. In contrast, a lesser increase of labelled ATP is observed in cells incubated under oxygen, suggesting that conditions for purine nucleotide formation from ambient Hy are more favorable in the venous circulation

  10. Pyridine nucleotide cycle of Salmonella typhimurium: isolation and characterization of pncA, pncB, and pncC mutants and utilization of exogenous nicotinamide adenine dinucleotide. (United States)

    Foster, J W; Kinney, D M; Moat, A G


    Mutants of Salmonella typhimurium LT-2 deficient in nicotinamidase activity (pncA) or nicotinic acid phosphoribosyltransferase activity (pncB) were isolated as resistant to analogs of nicotinic acid and nicotinamide. Information obtained from interrupted mating experiments placed the pncA gene at 27 units and the pncB gene at 25 units on the S. typhimurium LT-2 linkage map. A major difference in the location of the pncA gene was found between the S. typhimurium and Escherichia coli linkage maps. The pncA gene is located in a region in which there is a major inversion of the gene order in S. typhimurium as compared to that in E. coli. Growth experiments using double mutants blocked in the de novo pathway to nicotinamide adenine dinucleotide (NAD) (nad) and in the pyridine nucleotide cycle (pnc) at either the pncA or pncB locus, or both, have provided evidence for the existence of an alternate recycling pathway in this organism. Mutants lacking this alternate cycle, pncC, have been isolated and mapped via cotransduction at 0 units. Utilization of exogenous NAD was examined through the use of [14C]carbonyl-labeled NAD and [14C]adenine-labeled NAD. The results of these experiments suggest that NAD is degraded to nicotinamide mononucleotide at the cell surface. A portion of this extracellular nicotinamide mononucleotide is then transported across the cell membrane by nicotinamide mononucleotide glycohydrolase and degraded to nicotinamide in the process. The remaining nicotinamide mononucleotide accumulates extracellularly and will support the growth of nadA pncB mutants which cannot utilize the nicotinamide resulting from the major pathway of NAD degradation. A model is presented for the utilization of exogenous NAD by S. typhimurium LT-2.

  11. Damage to uracil- and adenine-containing bases, nucleosides, nucleotides and polynucleotides: quantum yields on irradiation at 193 and 254 nm

    International Nuclear Information System (INIS)

    Gurzadyan, G.G.; Goerner, H.


    Photoreactions, such as base release and decomposition of the base moeity, induced by either 20 ns laser pulses at 193 nm or continuous 254 nm irradiation, were studied for a series of uracil and adenine derivatives in neutral aqueous solution. The quantum yield of chromophore loss (Φ cl ) depends significantly on the nature of the nucleic acid constituent and the saturating gas (Ar, N 2 O or O 2 ). In the case of polynucleotides the destruction of nucleotides was measured by high-performance liquid chromatography after hydrolysis; the quantum yields (Φ dn ) are comparable to those of chromophore loss or larger. The Φ cl and Φ dn of 0.04-0.1 for poly(U) and poly(dU), obtained for both wavelengths of irradiation, are due to processes originating from the lowest excited singlet state, i.e. formation of photohydrates and photodimers, and a second part from photoionization using λ irr = 193 nm. Irradiation at 193 nm effectively splits pyrimidine dimers and thus reverts them into monomers. (author)

  12. Specificities and pH profiles of adenine and hypoxanthine-guanine-xanthine phosphoribosyltransferases (nucleotide synthases) of the thermoacidophile archaeon Sulfolobus solfataricus

    DEFF Research Database (Denmark)

    Hansen, Michael Riis; Jensen, Kristine Steen; Rasmussen, Mads Skytte


    Two open reading frames in the genome of Sulfolobus solfataricus (SSO2341 and SSO2424) were cloned and expressed in E. coli. The protein products were purified and their enzymatic activity characterized. Although SSO2341 was annotated as a gene (gpT-1) encoding a 6-oxopurine...... phosphoribosyltransferase (PRTase), the protein product turned out to be a PRTase highly specific for adenine and we suggest that the reading frame should be renamed apT. The other reading frame SSO2424 (gpT-2) proved to be a true 6-oxopurine PRTase active with hypoxanthine, xanthine and guanine as substrates, and we.......5, while maximal activity with xanthine was observed at pH 7.5. We discuss likely reasons why SSO2341 in S. solfataricus and similar open reading frames in other Crenarchaeota could not be identified as genes encoding APRTase....

  13. An adenine-to-guanine nucleotide change in the IRES SL-IV domain of picornavirus/hepatitis C chimeric viruses leads to a nonviable phenotype

    International Nuclear Information System (INIS)

    McKnight, Kevin L.; Sandefur, Stephanie; Phipps, Krista M.; Heinz, Beverly A.


    The inability for the internal ribosomal entry site (IRES) of hepatitis C virus (HCV) to be readily studied in the context of viral replication has been circumvented by constructing chimeras such as with poliovirus (PV), in which translation of the genome polyprotein is under control of the HCV IRES. During our attempts to configure the PV/HCV chimera for our drug discovery efforts, we discovered that an adenine- (A) to-guanine (G) change at nt 350 in domain IV of the HCV IRES resulted in a nonviable phenotype. Similarly, a mengovirus (MV)/HCV chimera using the same configuration with a G at nt 350 (G-350) was found to be nonviable. In contrast, a bovine viral diarrhea virus (BVDV)/HCV chimera remained viable with G-350 in the HCV IRES insert. Second-site, resuscitating mutations were identified from the G-350 PV/HCV and MV/HCV viruses after blind passaging. For both viruses, the resuscitating mutations involved destabilization of domain IV in the HCV IRES. The nonviability of G-350 in the picornavirus/HCV chimeric background might be linked to translation efficiency as indicated by analyses with dual reporter and PV/HCV replicon constructs

  14. Properties of the mitochondrial carrier of adenine-nucleotide after purification. Study of the transport protein under isolated form and reincorporated form in phospho-lipidic vesicles

    International Nuclear Information System (INIS)

    Brandolin, Gerard


    The first part of this research thesis addresses the reconstitution of the ADP/ATP transport by incorporation of the specific carrier, isolated in presence of detergent, in phospholipids vesicles. Fundamental properties of the reconstituted transport are identical to that of transport in mitochondria, notably as far as the exchange stoichiometry, the turn over and the transport Km are concerned, as well as the asymmetric orientation of the carrier in the membrane. The second part of this research addresses the study of interactions of specific ligands with the ADP/ATP transport protein in presence of detergent. The study of the variations of the intrinsic fluorescence of the isolated ADP/ATP carrier highlights conformational changes exclusively induced by the presence of transportable nucleotides which are modulated in a different manner by carboxy-atractyloside or bongkrekic acid. Moreover, by using the isolated protein, a detailed analysis of binding parameters of fluorescent analogues of ATP is reported [fr

  15. Extent of Intramolecular p-Stacks in Aqueous Solution in Mixed-Ligand Copper(II) Complexes Formed by Heteroaromatic Amines and Several 2-Aminopurine Derivatives of the Antivirally Active Nucleotide Analog 9-[2-(Phosphonomethoxy)ethyl]adenine (PMEA)

    Czech Academy of Sciences Publication Activity Database

    Gómez-Coca, R. B.; Blindauer, C. A.; Sigel, A.; Operschall, B. P.; Holý, Antonín; Sigel, H.


    Roč. 9, č. 9 (2012), s. 2008-2034 ISSN 1612-1872 R&D Projects: GA MŠk 1M0508 Institutional research plan: CEZ:AV0Z40550506 Keywords : copper complexes * nucleotides * acyclic nucleoside phosphonates * ANPs * antiviral activity Subject RIV: CE - Biochemistry Impact factor: 1.808, year: 2012

  16. Antinociceptive effect of purine nucleotides. (United States)

    Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R


    The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.

  17. A comparison of adenine and some derivatives on pig isolated tracheal muscle. (United States)

    Bach-Dieterle, Y.; Holden, W. E.; Junod, A. F.


    We studied the muscle relaxation induced by adenine and several adenine derivatives in strips of tracheal smooth muscle from pigs; in addition their metabolism by the tissue was examined. Adenine relaxed tissue which was contracted by carbachol, histamine, or KCl. Adenine's potency was similar to that of adenosine and ATP (threshold about 4 X 10(-5)M). In tissues with carbachol-induced tone, the adenine effect differed from adenosine and ATP by being slower in onset and in 'washout' time. Furthermore, neither dipyridamole nor theophylline modified the response to adenine. The relationship was examined between pharmacological effects and the metabolism of [3H]-adenosine and [3H]-adenine. Both substrates were taken up by the tissue and converted to nucleotides, but relaxation correlated with nucleotide accumulation only in the case of [3H]-adenine. We conclude that the site and mechanism of adenine-induced relaxation is different from that of adenosine and ATP in porcine tracheal muscle. PMID:6571222

  18. Adenine N6-methylation in diverse fungi

    NARCIS (Netherlands)

    Seidl, Michael F.


    A DNA modification - methylation of cytosines and adenines - has important roles in diverse processes such as regulation of gene expression and genome stability, yet until recently adenine methylation had been considered to be only a hallmark of prokaryotes. A new study identifies abundant

  19. Cleavage of nicotinamide adenine dinucleotide by the ribosome-inactivating protein from Momordica charantia. (United States)

    Vinkovic, M; Dunn, G; Wood, G E; Husain, J; Wood, S P; Gill, R


    The interaction of momordin, a type 1 ribosome-inactivating protein from Momordica charantia, with NADP(+) and NADPH has been investigated by X-ray diffraction analysis of complexes generated by co-crystallization and crystal soaking. It is known that the proteins of this family readily cleave the adenine-ribose bond of adenosine and related nucleotides in the crystal, leaving the product, adenine, bound to the enzyme active site. Surprisingly, the nicotinamide-ribose bond of oxidized NADP(+) is cleaved, leaving nicotinamide bound in the active site in the same position but in a slightly different orientation to that of the five-membered ring of adenine. No binding or cleavage of NADPH was observed at pH 7.4 in these experiments. These observations are in accord with current views of the enzyme mechanism and may contribute to ongoing searches for effective inhibitors.

  20. Adenine phosphoribosyltransferase-deficient Leishmania donovani

    International Nuclear Information System (INIS)

    Kaur, K.; Iovannisci, D.M.; Ullman, B.


    To elucidate the relative roles of two routes for adenine salvage, the authors use biochemical genetic approaches to isolate clonal strains of Leishmania donovani promasatigotes genetically deficient in APRTase activity. The studies suggest that the metabolic rate of adenine in these organisms is initiated by deamination. The radiolabel incorporation experiments and biochemical experiments are described in which the rate of uptake of radiolabelled purine nucleobases (C 14) was determined. Results are presented

  1. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens


    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  2. Dissociative Excitation of Adenine by Electron Impact (United States)

    McConkey, J. William; Trocchi, Joshuah; Dech, Jeffery; Kedzierski, Wladek


    Dissociative excitation of adenine (C6H5NH2) into excited atomic fragments has been studied in the electron impact energy range from threshold to 300 eV. A crossed beam system coupled to a vacuum ultraviolet (VUV) monochromator is used to study emissions in the wavelength range from 110 to 200 nm. The beam of adenine vapor from a stainless steel oven is crossed at right angles by the electron beam and the resultant UV radiation is detected in a mutually orthogonal direction. The strongest feature in the spectrum is H Lyman- α. Financial support from NSERC and CFI, Canada, is gratefully acknowledged.

  3. Synthesis and Characterization of Oligodeoxyribonucleotides Modified with 2'-Amino-α-l-LNA Adenine Monomers

    DEFF Research Database (Denmark)

    Andersen, Nicolai K; Anderson, Brooke A; Wengel, Jesper


    The development of conformationally restricted nucleotide building blocks continues to attract considerable interest because of their successful use within antisense, antigene, and other gene-targeting strategies. Locked nucleic acid (LNA) and its diastereomer α-l-LNA are two interesting examples...... (ONs) modified with 2'-amino-α-l-LNA adenine monomers W-Z. The synthesis of the target phosphoramidites 1-4 is initiated from pentafuranose 5, which upon Vorbrüggen glycosylation, O2'-deacylation, O2'-activation and C2'-azide introduction yields nucleoside 8. A one-pot tandem Staudinger....... ONs modified with pyrene-functionalized 2'-amino-α-l-LNA adenine monomers X-Z display greatly increased affinity toward DNA targets (ΔTm/modification up to +14 °C). Results from absorption and fluorescence spectroscopy suggest that the duplex stabilization is a result of pyrene intercalation...

  4. The catalase activity of diiron adenine deaminase

    Energy Technology Data Exchange (ETDEWEB)

    Kamat S. S.; Swaminathan S.; Holmes-Hampton, G. P.; Bagaria, A.; Kumaran, D.; Tichy, S. E.; Gheyi, T.; Zheng, X.; Bain, K.; Groshong, C.; Emtage, S.; Sauder, J. M.; Burley, S. K.; Lindahl, P. A.; Raushel, F. M.


    Adenine deaminase (ADE) from the amidohydrolase superfamily (AHS) of enzymes catalyzes the conversion of adenine to hypoxanthine and ammonia. Enzyme isolated from Escherichia coli was largely inactive toward the deamination of adenine. Molecular weight determinations by mass spectrometry provided evidence that multiple histidine and methionine residues were oxygenated. When iron was sequestered with a metal chelator and the growth medium supplemented with Mn{sup 2+} before induction, the post-translational modifications disappeared. Enzyme expressed and purified under these conditions was substantially more active for adenine deamination. Apo-enzyme was prepared and reconstituted with two equivalents of FeSO{sub 4}. Inductively coupled plasma mass spectrometry and Moessbauer spectroscopy demonstrated that this protein contained two high-spin ferrous ions per monomer of ADE. In addition to the adenine deaminase activity, [Fe{sup II}/Fe{sup II}]-ADE catalyzed the conversion of H{sub 2}O{sub 2} to O{sub 2} and H{sub 2}O. The values of k{sub cat} and k{sub cat}/K{sub m} for the catalase activity are 200 s{sup -1} and 2.4 x 10{sup 4} M{sup -1} s{sup -1}, respectively. [Fe{sup II}/Fe{sup II}]-ADE underwent more than 100 turnovers with H{sub 2}O{sub 2} before the enzyme was inactivated due to oxygenation of histidine residues critical for metal binding. The iron in the inactive enzyme was high-spin ferric with g{sub ave} = 4.3 EPR signal and no evidence of anti-ferromagnetic spin-coupling. A model is proposed for the disproportionation of H{sub 2}O{sub 2} by [Fe{sup II}/Fe{sup II}]-ADE that involves the cycling of the binuclear metal center between the di-ferric and di-ferrous oxidation states. Oxygenation of active site residues occurs via release of hydroxyl radicals. These findings represent the first report of redox reaction catalysis by any member of the AHS.

  5. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes. (United States)

    Kondo, Jiro; Westhof, Eric


    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  6. Hydrolytic cleavage of N-6-substituted adenine derivatives by eukaryotic adenine and adenosine deaminases

    Czech Academy of Sciences Publication Activity Database

    Pospíšilová, H.; Šebela, M.; Novák, Ondřej; Frébort, I.


    Roč. 28, č. 6 (2008), s. 335-347 ISSN 0144-8463 R&D Projects: GA ČR(CZ) GA522/06/0022 Institutional research plan: CEZ:AV0Z50380511 Keywords : adenine deaminase * adenosine deaminase (ADA) * aminohydrolase Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.525, year: 2008

  7. Influence of Magnetic Microparticles Isolation on Adenine Homonucleotides Structure

    Directory of Open Access Journals (Sweden)

    Monika Kremplova


    Full Text Available The electroactivity of purine and pyrimidine bases is the most important property of nucleic acids that is very useful for determining oligonucleotides using square wave voltammetry. This study was focused on the electrochemical behavior of adenine-containing oligonucleotides before and after their isolation using paramagnetic particles. Two peaks were detected—peak A related to the reduction of adenine base and another peak B involved in the interactions between individual adenine strands and contributes to the formation of various spatial structures. The influence of the number of adenine bases in the strand in the isolation process using paramagnetic particles was investigated too.


    Directory of Open Access Journals (Sweden)

    L.G. Mamonova


    Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.

  9. Effects of adenine nucleotide and sterol depletion on tight junction structure and function in MDCK cells

    International Nuclear Information System (INIS)

    Ladino, C.A.


    The antitumor agent Hadacidin (H), N-formyl-hydroxyamino-acetic acid, reversibly inhibited the multiplication of clone 4 Madin-Darby canine kidney (MDCK) cells at a 4 mM concentration within 24-48 hours. Treated cells were arrested in the S phase of the cell cycle. Accompanying this action was a 16-fold increase in the area occupied b the cells and a refractoriness to trypsin treatment. To test whether this effect was due to an increase in tight junction integrity, electrical resistance (TER) was measured across H-treated monolayers. Addition of H at the onset of junction formation reversibly prevented the development of TER. ATP and cAMP levels were decreased by H, as well as the rate of [ 3 H]-leucine incorporation into protein. When 1 mM dibutyryl-cAMP (d.cAMP) and theophylline were added, H had no effect on cell division or protein synthesis, and TER was partially restored. The addition of 1 mM d.cAMP and 1 mM theophylline to control cultures decreased TER, indicating a biphasic effect on TER development/maintenance. In a separate study, the effect of sterol depletion on tight junctions formation/maintenance in wild-type MDCK cells was investigated

  10. Raw coffee based dietary supplements contain carboxyatractyligenin derivatives inhibiting mitochondrial adenine-nucleotide-translocase. (United States)

    Lang, Roman; Fromme, Tobias; Beusch, Anja; Lang, Tatjana; Klingenspor, Martin; Hofmann, Thomas


    Capsules, powders and tablets containing raw coffee extract are advertised to the consumer as antioxidant rich dietary supplements as part of a healthy diet. We isolated carboxyatractyligenin (4), 2-O-β-d-glucopyranosyl carboxyatractyligenin (6) and 3'-O-β-d-glucopyranosyl-2'-O-isovaleryl-2β-(2-desoxy-carboxyatractyligenin)-β-d-glucopyranoside (8) from green coffee and found strong inhibitory effects on phosphorylating respiration in isolated mitochondria similar to the effects of the known phytotoxin carboxyatractyloside. LC-MS/MS analysis of commercial green coffee based dietary supplements revealed the occurrence of carboxyatractyligenin, 3'-O-β-d-glucopyranosyl-2'-O-isovaleryl-2β-(2-desoxy-carboxyatractyligenin)-β-d-glucopyranoside, and 2-O-β-d-glucopyranosyl carboxyatractyligenin in concentrations up to 4.0, 5.7, and 41.6μmol/g, respectively. These data might help to gain first insight into potential physiological side-effects of green coffee containing dietary supplement. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Effects of Mg2+ and adenine nucleotides on thymidylate synthetase from different mouse tumors. (United States)

    Rode, W; Jastreboff, M M


    Magnesium ions variably influenced activity of highly purified thymidylate synthetase preparations from different mouse tumors, activating the enzyme from Ehrlich ascites carcinoma (EAC) cells and inhibiting the enzyme from L1210 and L5178Y cells and from 5-fluorodeoxyuridine (FdUrd)-resistant EAC cells. In the presence of Mg2+ in a concentration resulting in either maximum activation or inhibition (25-30 mM) the enzymes from both the sensitive and FdUrd-resistant EAC lines and L5178Y cells were activated by ATP. Under the same conditions of Mg2+ concentration ADP and AMP inhibited the enzyme from the parental but not from the FdUrd-resistant EAC cells.

  12. Degradation of adenine in aqueous solution containing 3HHO

    International Nuclear Information System (INIS)

    Yamamoto, Osamu; Fuji, Izumi


    Aqueous adenine solutions of 5 x 10 -4 M (containing 14 C-adenine and buffered pH 7.0) were irradiated with 60 Co gamma-rays and 3 H beta-rays from tritiated water in the presence of N 2 , O 2 , N 2 O or t-BuOH-N 2 . Thin-layer chromatography (TLC) was carried out bidimensionally for separation of the radiolytically produced products and autoradiography was performed. Considerable differences were observed in the dose-yield curves for the decomposition of adenine and for the product formation between gamma- and beta-radiolyses. As for the degradation yield, oxygen enhancement ratios, 3.19 in gamma-irradiation and 1.08 in beta-irradiation, were obtained at a dose of 3.0 x 10 3 Gy. Similar products were produced both under N 2 and O 2 , but there were found a specific reaction of t-butanol radical with adenine, the high yield of hypoxanthine under N 2 O, and the higher degradation of the TLC origin-fixed products in beta-irradiation. The present results on adenine suggest, as reported previously for thymine, that a specific oxidative species is produced from water in beta-radiolysis but not in gamma-radiolysis. (author)

  13. pH dependent interaction of biofunctionalized CdS nanoparticles with nucleobases and nucleotides: A fluorimetric study

    International Nuclear Information System (INIS)

    Chatterjee, Anindita; Priyam, Amiya; Bhattacharya, Subhash C.; Saha, Abhijit


    The interaction of DNA bases and corresponding nucleotides with CdS nanoparticles (NPs), biofunctionalized by cysteine, has been investigated by absorption and fluorescence spectroscopy. Unique enhancement effect of adenine, in contrast to other nucleobases, on the luminescence of cysteine capped CdS (cys-CdS) NPs at both pH 7.5 and 10.5 was found, the extent of enhancement being much higher at pH 10.5. At the latter pH, the difference optical absorption spectra show development of new peak at 278 nm with corresponding decrease in the absorption of adenine at 260 nm, which is attributed to binding of adenine anion to the CdS surface through N7 of the purine ring. Appearance of a new band at 478 cm -1 and concomitant shift in the C 8 -N 7 vibrations to 1610 cm -1 in the FTIR spectra of cys-CdS NPs with adenine also suggest Cd-N7 binding on the particle surface. Amongst various nucleotides, ATP exhibited maximum luminescence enhancement on CdS NPs for a given change in concentration in the micro-molar range at physiological pH. A quantitative correlation between ATP concentration and PL enhancement of CdS NPs has been established, a step which in future might assist in developing new protocols for fluorescence sensing of adenine nucleotides under certain pathological conditions

  14. Synthesis of adenine-modified reduced graphene oxide nanosheets. (United States)

    Cao, Huaqiang; Wu, Xiaoming; Yin, Gui; Warner, Jamie H


    We report here a facile strategy to synthesize the nanocomposite of adenine-modified reduced graphene oxide (AMG) via reaction between adenine and GOCl which is generated from SOCl(2) reacted with graphite oxide (GO). The as-synthesized AMG was characterized by transmission electron microscopy (TEM), atomic force microscopy (AFM), UV-vis absorption spectroscopy, Fourier transform infrared (FT-IR) spectroscopy, Raman spectroscopy, thermogravimetric analysis (TGA), X-ray photoelectron spectroscopy (XPS), cyclic voltammetry (CV), and galvanostatic discharge analysis. The AMG owns about one adenine group per 53 carbon atoms on a graphene sheet, which improves electronic conductivity compared with reduced graphene oxide (RGO). The AMG displays enhanced supercapacitor performance compared with RGO accompanying good stability and good cycling behavior in the supercapacitor.

  15. Adenine and 2-aminopurine: paradigms of modern theoretical photochemistry. (United States)

    Serrano-Andrés, Luis; Merchán, Manuela; Borin, Antonio C


    Distinct photophysical behavior of nucleobase adenine and its constitutional isomer, 2-aminopurine, has been studied by using quantum chemical methods, in particular an accurate ab initio multiconfigurational second-order perturbation theory. After light irradiation, the efficient, ultrafast energy dissipation observed for nonfluorescent 9H-adenine is explained here by the nonradiative internal conversion process taking place along a barrierless reaction path from the initially populated 1(pipi* La) excited state toward a low-lying conical intersection (CI) connected with the ground state. In contrast, the strong fluorescence recorded for 2-aminopurine at 4.0 eV with large decay lifetime is interpreted by the presence of a minimum in the 1(pipi* La) hypersurface lying below the lowest CI and the subsequent potential energy barrier required to reach the funnel to the ground state. Secondary deactivation channels were found in the two systems related to additional CIs involving the 1(pipi* Lb) and 1(npi*) states. Although in 9H-adenine a population switch between both states is proposed, in 7H-adenine this may be perturbed by a relatively larger barrier to access the 1(npi*) state, and, therefore, the 1(pipi* Lb) state becomes responsible for the weak fluorescence measured in aqueous adenine at approximately 4.5 eV. In contrast to previous models that explained fluorescence quenching in adenine, unlike in 2-aminopurine, on the basis of the vibronic coupling of the nearby 1(pipi*) and 1(npi*) states, the present results indicate that the 1(npi*) state does not contribute to the leading photophysical event and establish the prevalence of a model based on the CI concept in modern photochemistry.

  16. Protection of Chinese herbs against Adenine-induced chronic renal ...

    African Journals Online (AJOL)

    The aim of the study is to evaluate the efficacy of Chinese herbs (Angelica sinensis, Ligusticum wallichii, Salvia miltiorrhiza, Rhizoma dioscoreae, Rhodiola crenilata, Astragalus membranaceus and Angelica sinensis) on adenine-induced chronic renal failure in rats. 30 age-matched male Wistar rats were divided into three ...

  17. Rapid field multiplication of plantains using benzyl adenine or ...

    African Journals Online (AJOL)

    Une technique appropriee et moins chere pour la multiplication rapide sur Ie terrain de deux varietes locales de plantain Apantu (une corne fausse) et Asamienu (une come veritable) a ete obtenue par injection de 6 ou 8 ml du jus de noix de coco mur sec apres L' ebullition et la filtration ou de 4 ml 10-2 M benzyle adenine ...

  18. Effect of Adenine Concentration on the Corrosion Inhibition of Aisi ...

    African Journals Online (AJOL)

    This gave a surface coverage of 0.8956 and corrosion penetration rate of 0.022132mm/yr. Hence, the best adenine concentration for the corrosion inhibition of alloys 304L in 1.0M sulphuric acid solution to obtain optimum inhibition efficiency is 0.011M. Keywords: Corrosion, AISI 304L Steel, Inhibition efficiency, Degree of ...

  19. Catalytic Mechanism and Three-Dimensional Structure of Adenine Deaminase

    Energy Technology Data Exchange (ETDEWEB)

    S Kamat; A Bagaria; D Kumaran; G Holmes-Hampton; H Fan; A Sali; J Sauder; S Burley; P Lindahl; et. al.


    Adenine deaminase (ADE) catalyzes the conversion of adenine to hypoxanthine and ammonia. The enzyme isolated from Escherichia coli using standard expression conditions was low for the deamination of adenine (k{sub cat} = 2.0 s{sup -1}; k{sub cat}/K{sub m} = 2.5 x 10{sup 3} M{sup -1} s{sup -1}). However, when iron was sequestered with a metal chelator and the growth medium was supplemented with Mn{sup 2+} prior to induction, the purified enzyme was substantially more active for the deamination of adenine with k{sub cat} and k{sub cat}/K{sub m} values of 200 s{sup -1} and 5 x 10{sup 5} M{sup -1} s{sup -1}, respectively. The apoenzyme was prepared and reconstituted with Fe{sup 2+}, Zn{sup 2+}, or Mn{sup 2+}. In each case, two enzyme equivalents of metal were necessary for reconstitution of the deaminase activity. This work provides the first example of any member of the deaminase subfamily of the amidohydrolase superfamily to utilize a binuclear metal center for the catalysis of a deamination reaction. [Fe{sup II}/Fe{sup II}]-ADE was oxidized to [Fe{sup III}/Fe{sup III}]-ADE with ferricyanide with inactivation of the deaminase activity. Reducing [Fe{sup III}/Fe{sup III}]-ADE with dithionite restored the deaminase activity, and thus, the diferrous form of the enzyme is essential for catalytic activity. No evidence of spin coupling between metal ions was evident by electron paramagnetic resonance or Moessbauer spectroscopy. The three-dimensional structure of adenine deaminase from Agrobacterium tumefaciens (Atu4426) was determined by X-ray crystallography at 2.2 {angstrom} resolution, and adenine was modeled into the active site on the basis of homology to other members of the amidohydrolase superfamily. On the basis of the model of the adenine-ADE complex and subsequent mutagenesis experiments, the roles for each of the highly conserved residues were proposed. Solvent isotope effects, pH-rate profiles, and solvent viscosity were utilized to propose a chemical reaction

  20. Catalytic Mechanism and Three-Dimensional Structure of Adenine Deaminase

    Energy Technology Data Exchange (ETDEWEB)

    Kamat, S.S.; Swaminathan, S.; Bagaria, A.; Kumaran, D.; Holmes-Hampton, G. P.; Fan, H.; Sali, A.; Sauder, J. M.; Burley, S. K.; Lindahl, P. A.; Raushel, F. M.


    Adenine deaminase (ADE) catalyzes the conversion of adenine to hypoxanthine and ammonia. The enzyme isolated from Escherichia coli using standard expression conditions was low for the deamination of adenine (k{sub cat} = 2.0 s{sup -1}; k{sub cat}/K{sub m} = 2.5 x 10{sup 3} M{sup -1} s{sup -1}). However, when iron was sequestered with a metal chelator and the growth medium was supplemented with Mn{sup 2+} prior to induction, the purified enzyme was substantially more active for the deamination of adenine with kcat and kcat/Km values of 200 s{sup -1} and 5 x 10{sup 5} M{sup -1} s{sup -1}, respectively. The apoenzyme was prepared and reconstituted with Fe{sup 2+}, Zn{sup 2+}, or Mn{sup 2+}. In each case, two enzyme equivalents of metal were necessary for reconstitution of the deaminase activity. This work provides the first example of any member of the deaminase subfamily of the amidohydrolase superfamily to utilize a binuclear metal center for the catalysis of a deamination reaction. [Fe{sup II}/Fe{sup II}]-ADE was oxidized to [Fe{sup III}/Fe{sup III}]-ADE with ferricyanide with inactivation of the deaminase activity. Reducing [Fe{sup III}/Fe{sup III}]-ADE with dithionite restored the deaminase activity, and thus, the diferrous form of the enzyme is essential for catalytic activity. No evidence of spin coupling between metal ions was evident by electron paramagnetic resonance or Moessbauer spectroscopy. The three-dimensional structure of adenine deaminase from Agrobacterium tumefaciens (Atu4426) was determined by X-ray crystallography at 2.2 {angstrom} resolution, and adenine was modeled into the active site on the basis of homology to other members of the amidohydrolase superfamily. On the basis of the model of the adenine-ADE complex and subsequent mutagenesis experiments, the roles for each of the highly conserved residues were proposed. Solvent isotope effects, pH-rate profiles, and solvent viscosity were utilized to propose a chemical reaction mechanism and the

  1. Crystallization and preliminary X-ray diffraction study of recombinant adenine phosphoribosyltransferase from the thermophilic bacterium Thermus thermophilus strain HB27 (United States)

    Sinitsyna, E. V.; Timofeev, V. I.; Tuzova, E. S.; Kostromina, M. A.; Murav'eva, T. I.; Esipov, R. S.; Kuranova, I. P.


    Adenine phosphoribosyltransferase (APRT) belongs to the type I phosphoribosyltransferase family and catalyzes the formation of adenosine monophosphate via transfer of the 5-phosphoribosyl group from phosphoribosyl pyrophosphate to the nitrogen atom N9 of the adenine base. Proteins of this family are involved in a salvage pathway of nucleotide synthesis, thus providing purine base utilization and maintaining the optimal level of purine bases in the body. Adenine phosphoribosyltransferase from the extremely thermophilic Thermus thermophilus strain HB27 was produced using a highly efficient E. coli producer strain and was then purified by affinity and gel-filtration chromatography. This enzyme was successfully employed as a catalyst for the cascade biosynthesis of biologically important nucleotides. The screening of crystallization conditions for recombinant APRT from T. thermophilus HB27 was performed in order to determine the enzyme structure by X-ray diffraction. The crystallization conditions, which were found by the vapor-diffusion technique, were then optimized to apply the counter-diffusion technique. The crystals of the enzyme were grown by the capillary counter-diffusion method. The crystals belong to sp. gr. P1211 and have the following unitcell parameters: a = 69.86 Å, b = 82.16 Å, c = 91.39 Å, α = γ = 90°, β = 102.58°. The X-ray diffraction data set suitable for the determination of the APRT structure at 2.6 Å resolution was collected from the crystals at the SPring-8 synchrotron facility (Japan).

  2. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels


    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  3. Adenine-N-oxide produced from adenine with gamma-rays and its binding to SH protein

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, O [Hiroshima Univ. (Japan). Research Inst. for Nuclear Medicine and Biology


    /sup 14/C-labeled adenine aqueous solution was irradiated with /sup 60/Co gamma-rays. The yield of adenine-7-N-oxide, a radiolytic product, was determined by Sephadex G-10 column chromatography and TLC autoradiography. The apparent productive yield was very low, but the true yield should be much higher because of the reversible reaction to adenine and the easy decomposition of the N-oxide itself. Using synthesized /sup 14/C-adenine-7-N-oxide, noncovalent binding of this N-oxide to urease, an SH protein, was confirmed in comparison between the presence and absence of SDS by Ultrogel AcA 22 column chromatography. The noncovalent binding of the gamma-irradiated /sup 35/S-cysteine was also observed. The yield reached a limit in O/sub 2/ easier than in N/sub 2/ as the atmosphere for DNA irradiation. These results support an interaction structure, chemical bonds N-O---H-S-, for noncovalent binding which may be applied to the biological system as a radiation-induced damage.

  4. {8-14C}-Adenine and {1-14C}-isopentenyl pyrophosphate - precursors for root-produced cytokinins in the tomato (Lycopersicon esculentum mill.)

    International Nuclear Information System (INIS)

    Dickinson, J.R.


    Following the detection of reasonable levels of biologically active cytokinin-like compounds in one-month-old tomato plants, the possible involvement of {8- 14 C}-adenine and {1- 14 C}-isopentenyl pyrophosphate in the biosynthetic pathway leading to an accumulation of free zeatin derivatives, was studied. Intact tomato plants were used for a time-course study involving the uptake of {8- 14 C}-adenine and the tentative identification of compounds into which the 14 C became incorporated. Using high performance liquid chromatography, radioactive trans-zeatin was identified as being present in the Dowex 50 root extract. The 12-hour time interval was used and the roots of the tomato plants were immersed in a more heavily radiolabelled medium. Modified separation techniques were used to achieve enhanced radioactivity recovery rates. This experiment demonstrated the presence of relatively high levels of tentatively identified radioactive zeatin in the Dowex 50 root and stem extracts. Radioactivity in the aqueous extracts was found not to be contributed by cytokinin nucleotides. A final experiment was carried out using decapitated root systems to determine if the root tissue alone could be implicated in the synthesis of cytokinins. Decapitated tomato root systems were supplied with either {8- 14 C}-adenine or {1- 14 C}-isopentenyl pyrophosphate. The ratio of incorporation of {1- 14 C}-isopentenyl pyrophosphate into identified cytokinins was higher than for {8- 14 C}-adenine. It was concluded that both adenine and isopentenyl pyrophosphate are involved in the biosynthetic pathway leading to an accumulation of free zeatin derivatives in tomato roots

  5. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result ...

  6. Studies on mixed ligand complexes of adenine and xanthine with some rare earth ions

    International Nuclear Information System (INIS)

    Rastogi, P.R.; Singh, Mamta; Nayan, Ram


    Interactions of 6-aminopurine (adenine, HA) and 2,6-dihydroxypurine (xanthine, HB) with trivalent rare earth ions Y, Tb, Dy, Ho, Er and Tm, have been studied by pH-titration methods in aqueous solution at 20 o (μ = 0.1 M KNO 3 ). The ligands in their mixtures with tripositive rare earth ions (M 3+ ) form a number of mixed ligand complexes, M 3+ -adenine-xanthine, M 3+ -(adenine) 2 -xanthine, M 3+ -adenine-(xanthine) 2 in addition to the binary complexes, M 3+ -(adenine), M 3+ -(adenine) 2 , M 3+ -(adenine) 3 , M 3+ -(xanthine), M 3+ -(xanthine) 2 and M 3+ -(xanthine) 3 . The stability constants of these complexes have been evaluated and the results discussed. (author). 13 refs., 1 fig., 1 tab

  7. Voltammetric study of adenine complex with copper on mercury electrode

    Czech Academy of Sciences Publication Activity Database

    Jelen, František; Kouřilová, Alena; Hasoň, Stanislav; Kizek, R.; Trnková, L.


    Roč. 21, 3-5 (2009), s. 439-444 ISSN 1040-0397 R&D Projects: GA AV ČR(CZ) IAA100040602; GA AV ČR(CZ) IAA400040804; GA AV ČR(CZ) KAN200040651 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cyclic voltammetry * elimination voltammetry * copper-adenine complex Subject RIV: BO - Biophysics Impact factor: 2.630, year: 2009

  8. A Cascade of Thermophilic Enzymes As an Approach to the Synthesis of Modified Nucleotides. (United States)

    Esipov, R S; Abramchik, Yu A; Fateev, I V; Konstantinova, I D; Kostromina, M A; Muravyova, T I; Artemova, K G; Miroshnikov, A I


    We propose a new approach for the synthesis of biologically important nucleotides which includes a multi-enzymatic cascade conversion of D -pentoses into purine nucleotides. The approach exploits nucleic acid exchange enzymes from thermophilic microorganisms: ribokinase, phosphoribosylpyrophosphate synthetase, and adenine phosphoribosyltransferase. We cloned the ribokinase gene from Thermus sp . 2.9, as well as two different genes of phosphoribosylpyrophosphate synthetase (PRPP-synthetase) and the adenine phosphoribosyltransferase (APR-transferase) gene from Thermus thermophilus HB27 into the expression vectors, generated high-yield E. coli producer strains, developed methods for the purification of the enzymes, and investigated enzyme substrate specificity. The enzymes were used for the conversion of D -pentoses into 5-phosphates that were further converted into 5-phospho-α- D -pentofuranose 1-pyrophosphates by means of ribokinase and PRPP-synthetases. Target nucleotides were obtained through the condensation of the pyrophosphates with adenine and its derivatives in a reaction catalyzed by APR-transferase. 2-Chloro- and 2-fluoroadenosine monophosphates were synthesized from D -ribose and appropriate heterobases in one pot using a system of thermophilic enzymes in the presence of ATP, ribokinase, PRPP-synthetase, and APR-transferase.

  9. Cyclic nucleotides and radioresistnace

    International Nuclear Information System (INIS)

    Kulinskij, V.I.; Mikheeva, G.A.; Zel'manovich, B.M.


    The addition of glucose to meat-peptone broth does not change the radiosensitizing effect (RSE) of cAMP at the logarithmic phase (LP) and the radioprotective effect (RPE) at the stationary phase (SP), but sensitization, characteristic of cGMP, disappears in SP and turns into RPE in LP. Introduction of glucose into the broth for 20 min eliminates all the effects of both cyclic nucleotides in the cya + strain while cya - mutant exhibits RSE. RSE of both cyclic nucleotides is only manifested on minimal media. These data brought confirmation of the dependence of the influence of cyclic media. These data brought confirmation of the dependence of the influence of cyclic nucleotides on radioresistance upon the metabolic status of the cell [ru

  10. Approach to the unfolding and folding dynamics of add A-riboswitch upon adenine dissociation using a coarse-grained elastic network model

    Energy Technology Data Exchange (ETDEWEB)

    Li, Chunhua [College of Life Science and Bioengineering, Beijing University of Technology, Beijing 100124 (China); Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan 45108 (United States); Lv, Dashuai; Zhang, Lei; Yang, Feng; Wang, Cunxin [College of Life Science and Bioengineering, Beijing University of Technology, Beijing 100124 (China); Su, Jiguo, E-mail:, E-mail: [College of Science, Yanshan University, Qinhuangdao 066004 (China); Zhang, Yang, E-mail:, E-mail: [Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan 45108 (United States)


    Riboswitches are noncoding mRNA segments that can regulate the gene expression via altering their structures in response to specific metabolite binding. We proposed a coarse-grained Gaussian network model (GNM) to examine the unfolding and folding dynamics of adenosine deaminase (add) A-riboswitch upon the adenine dissociation, in which the RNA is modeled by a nucleotide chain with interaction networks formed by connecting adjoining atomic contacts. It was shown that the adenine binding is critical to the folding of the add A-riboswitch while the removal of the ligand can result in drastic increase of the thermodynamic fluctuations especially in the junction regions between helix domains. Under the assumption that the native contacts with the highest thermodynamic fluctuations break first, the iterative GNM simulations showed that the unfolding process of the adenine-free add A-riboswitch starts with the denature of the terminal helix stem, followed by the loops and junctions involving ligand binding pocket, and then the central helix domains. Despite the simplified coarse-grained modeling, the unfolding dynamics and pathways are shown in close agreement with the results from atomic-level MD simulations and the NMR and single-molecule force spectroscopy experiments. Overall, the study demonstrates a new avenue to investigate the binding and folding dynamics of add A-riboswitch molecule which can be readily extended for other RNA molecules.

  11. Sensitive and selective detection of adenine using fluorescent ZnS nanoparticles

    International Nuclear Information System (INIS)

    Meerabai Devi, L; Negi, Devendra P S


    We have used fluorescent ZnS nanoparticles as a probe for the determination of adenine. A typical 2 x 10 -7 M concentration of adenine quenches 39.3% of the ZnS fluorescence. The decrease in ZnS fluorescence as a function of adenine concentration was found to be linear in the concentration range 5 x 10 -9 -2 x 10 -7 M. The limit of detection (LOD) of adenine by this method is 3 nM. Among the DNA bases, only adenine quenched the fluorescence of ZnS nanoparticles in the submicromolar concentration range, thus adding selectivity to the method. The amino group of adenine was important in determining the quenching efficiency. Steady-state fluorescence experiments suggest that one molecule of adenine is sufficient to quench the emission arising from a cluster of ZnS consisting of about 20 molecules. Time-resolved fluorescence measurements indicate that the adenine molecules block the sites on the surface of ZnS responsible for emission with the longest lifetime component. This method may be applied for the determination of adenine in biological samples since the measurements have been carried out at pH 7.

  12. Enzymatic synthesis of 13N-β-nicotinamide adenine dinucleotide

    International Nuclear Information System (INIS)

    Lambrecht, R.H.D.; Slegers, G.; Claeys, A.; Vandecasteele, C.


    Nitrogen-13-labelled β-nicotinamide adenine dinucleotide ( 13 N-NAD) is an interesting new compound for positron emission tomography. A semi-automatic production method is developed that yields a solution of 13 N-NAD of radiopharmaceutical quality, suitable for human intravenous administration. The 13 N-NAD is prepared enzymatically in one step from cyclotron-produced 13 NH 3 and nicotinic acid adenine dinucleotide (deamido-NAD). The enzyme NAD synthetase (E.C., catalysing this reaction, is extracted and purified from Escherichia coli. The purified enzyme is immobilized by glutaraldehyde coupling to γ-aminopropylsilane-coated porous glass beads. The enzyme-loaded glass beads are packed in a column. The kinetic properties of the column are optimized. For synthetizing 13 N-NAD, the mixture of co-factors and substrates, containing 13 NH 3 , is pumped over the enzyme column. The unreacted 13 NH 3 is separated from 13 N-NAD by on-line passage over a cation exchanger. After passing over a millipore filter, a sterile solution of radiochemically pure 13 N-NAD is obtained, containing 70 mCi in 10 mL. The total synthesis time is 10 minutes. The specific activity is about 120 mCi/μmol at EOB. Quality control includes sterility and pyrogen tests, HPLC and HPTLC analysis. (author)

  13. Nonselective enrichment for yeast adenine mutants by flow cytometry (United States)

    Bruschi, C. V.; Chuba, P. J.


    The expression of certain adenine biosynthetic mutations in the yeast Saccharomyces cerevisiae results in a red colony color. This phenomenon has historically provided an ideal genetic marker for the study of mutation, recombination, and aneuploidy in lower eukaryotes by classical genetic analysis. In this paper, it is reported that cells carrying ade1 and/or ade2 mutations exhibit primary fluorescence. Based on this observation, the nonselective enrichment of yeast cultures for viable adenine mutants by using the fluorescence-activated cell sorter has been achieved. The advantages of this approach over conventional genetic analysis of mutation, recombination, and mitotic chromosomal stability include speed and accuracy in acquiring data for large numbers of clones. By using appropriate strains, the cell sorter has been used for the isolation of both forward mutations and chromosomal loss events in S. cerevisiae. The resolving power of this system and its noninvasiveness can easily be extended to more complex organisms, including mammalian cells, in which analogous metabolic mutants are available.

  14. PA0148 from Pseudomonas aeruginosa Catalyzes the Deamination of Adenine

    Energy Technology Data Exchange (ETDEWEB)

    Goble, A.M.; Swaminathan, S.; Zhang, Z.; Sauder, J. M.; Burley, S. K.; Raushel, F. M.


    Four proteins from NCBI cog1816, previously annotated as adenosine deaminases, have been subjected to structural and functional characterization. Pa0148 (Pseudomonas aeruginosa PAO1), AAur1117 (Arthrobacter aurescens TC1), Sgx9403e, and Sgx9403g have been purified and their substrate profiles determined. Adenosine is not a substrate for any of these enzymes. All of these proteins will deaminate adenine to produce hypoxanthine with k{sub cat}/K{sub m} values that exceed 10{sup 5} M{sup -1} s{sup -1}. These enzymes will also accept 6-chloropurine, 6-methoxypurine, N-6-methyladenine, and 2,6-diaminopurine as alternate substrates. X-ray structures of Pa0148 and AAur1117 have been determined and reveal nearly identical distorted ({beta}/{alpha}){sub 8} barrels with a single zinc ion that is characteristic of members of the amidohydrolase superfamily. Structures of Pa0148 with adenine, 6-chloropurine, and hypoxanthine were also determined, thereby permitting identification of the residues responsible for coordinating the substrate and product.

  15. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg


    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

  16. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes (United States)

    Kondo, Jiro; Westhof, Eric


    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  17. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth; Meier, Stuart Kurt; Gehring, Christoph A


    Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms

  18. Silver-induced reconstruction of an adeninate-based metal-organic framework for encapsulation of luminescent adenine-stabilized silver clusters. (United States)

    Jonckheere, Dries; Coutino-Gonzalez, Eduardo; Baekelant, Wouter; Bueken, Bart; Reinsch, Helge; Stassen, Ivo; Fenwick, Oliver; Richard, Fanny; Samorì, Paolo; Ameloot, Rob; Hofkens, Johan; Roeffaers, Maarten B J; De Vos, Dirk E


    Bright luminescent silver-adenine species were successfully stabilized in the pores of the MOF-69A (zinc biphenyldicarboxylate) metal-organic framework, starting from the intrinsically blue luminescent bio-MOF-1 (zinc adeninate 4,4'-biphenyldicarboxylate). Bio-MOF-1 is transformed to the MOF-69A framework by selectively leaching structural adenine linkers from the original framework using silver nitrate solutions in aqueous ethanol. Simultaneously, bright blue-green luminescent silver-adenine clusters are formed inside the pores of the recrystallized MOF-69A matrix in high local concentrations. The structural transition and concurrent changes in optical properties were characterized using a range of structural, physicochemical and spectroscopic techniques (steady-state and time-resolved luminescence, quantum yield determination, fluorescence microscopy). The presented results open new avenues for exploring the use of MOFs containing luminescent silver clusters for solid-state lighting and sensor applications.

  19. Suppression of feline immunodeficiency virus infection in vivo by 9-(2-phosphonomethoxyethyl)adenine

    NARCIS (Netherlands)

    Horzinek, M.C.; Egberink, H.F.; Borst, M.; Niphuis, H.; Balzarini, J.; Neu, H.; Schellekens, H.; Clercq, H. de; Koolen, M.J.M.


    The acyclic purine nucleoside analogue 9-(2-phosphonomethoxyethyl)adenine [PMEA; formerly referred to as 9-(2-phosphonylmethoxyethyl)adenine] is a potent and selective inhibitor of human immunodeficiency virus replication in vitro and of Moloney murine sarcoma virus-induced tumor formation in mice.

  20. Measurement of binding of adenine nucleotides and phosphate to cytosolic proteins in permeabilized rat-liver cells

    NARCIS (Netherlands)

    Gankema, H. S.; Groen, A. K.; Wanders, R. J.; Tager, J. M.


    1. A method is described for measuring the binding of metabolites to cytosolic proteins in situ in isolated rat-liver cells treated with filipin to render the plasma membrane permeable to compounds of low molecular weight. 2. There is no binding of ATP or inorganic phosphate to cytosolic proteins,

  1. 31P NMR saturation-transfer study of the in situ kinetics of the mitochondrial adenine nucleotide translocase

    International Nuclear Information System (INIS)

    Masiakos, P.T.; Williams, G.D.; Berkich, D.A.; Smith, M.B.; LaNoue, K.F.


    The exchange of intramitochondrial ATP (ATP in ) for extramitochondrial ATP (ATP out ) was measured by using 31 P NMR spectroscopy over a range of temperatures in isolated rat liver mitochondria oxidizing glutamate and succinate in the presence of external ATP but no added ADP (state 4). The rate of this exchange is more than an order of magnitude faster than rates reported previously that were determined by using isotopic techniques in the presence of oligomycin, the potent ATPase inhibitor. Differences are ascribed in part to the low levels of matrix ATP present in oligomycin-treated mitochondrial. Intramitochondrial ATP content regulates the rate of the ATP in /ATP out exchange. At 18C, the concentration of internal ATP that produces half-maximal transport rate is 6.6±0.12 nmol/mg of mitochondrial protein. The relationship between substrate concentration and flux is sigmoidal and is 90% saturated at 11.3±0.18 nmol/mg of mitochondrial protein. Since the measured rates of exchange of ATP in for ATP out are almost 10 times faster than the ATP synthase (ATP/P i ) exchange rates, the translocase cannot limit net ATP/P i exchange in state 4. It may, nonetheless, limit net synthesis of ATP under other conditions when matrix ATP concentration is lower than in state 4 and when external ADP is present at higher concentrations than in these experiments

  2. De novo synthesis of purine nucleotides in different fiber types of rat skeletal muscle

    International Nuclear Information System (INIS)

    Tullson, P.C.; John-Alder, H.; Hood, D.A.; Terjung, R.L.


    The contribution of de novo purine nucleotide synthesis to nucleotide metabolism in skeletal muscles is not known. The authors have determined rates of de novo synthesis in soleus (slow-twitch red), red gastrocnemius (fast-twitch red), and white gastrocnemius (fast-twitch white) using the perfused rat hindquarter. 14 C glycine incorporation into ATP was linear after 1 and 2 hours of perfusion with 0.2 mM added glycine. The intracellular (I) and extracellular (E) specific activity of 14 C glycine was determined by HPLC of phenylisothiocyanate derivatives of neutralized PCA extracts. The rates of de novo synthesis when expressed relative to muscle ATP content show slow and fast-twitch red muscles to be similar and about twice as great as fast-twitch white muscles. This could represent a greater turnover of the adenine nucleotide pool in more oxidative red muscle types

  3. Complexes of Escherichia coli adenylate kinase and nucleotides: 1H NMR studies of the nucleotide sites in solution

    International Nuclear Information System (INIS)

    Vetter, I.R.; Reinstein, J.; Roesch, P.


    One- and two-dimensional nuclear magnetic resonance (NMR) studies, in particular substrate-protein nuclear Overhauser effect (NOESY) measurements, as well as nucleotide and P 1 ,P 5 -bis-(5'-adenosyl) pentaphosphate (AP 5 A) titrations and studies of the temperature-dependent unfolding of the tertiary structure of Escherichia coli adenylate kinase (AK EC ) were performed. These experiments and comparison with the same type of experiments performed with the porcine enzyme led them to the following conclusions: (1) at pH 8 and concentrations of approximately 2.5-3 mM, AK EC is partially unfolded at 318 K; (2) ATP·Mg 2+ binds to the ATP site with a dissociation constant of approximately 40 μM under the assumption that ATP binds to one nucleotide site only; (3) AP 5 A·Mg 2+ binds to both nucleotide sites and thus simulates the active complex; (4) the ATP·Mg 2+ adenine in the AK EC ·AP 5 A·Mg 2+ complex is located close to His 134 and Phe 19 ; (5) the AK EC G-loop with bound ATP·Mg 2+ is structurally highly homologous to the loop region in the oncogene product p21 with bound GTP·Mg 2+

  4. File list: Oth.Lar.20.Adenine_N6-methylation.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Lar.20.Adenine_N6-methylation.AllCell ce10 TFs and others Adenine N6-methylatio...n Larvae ...

  5. File list: Oth.Adl.20.Adenine_N6-methylation.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Adl.20.Adenine_N6-methylation.AllCell ce10 TFs and others Adenine N6-methylatio...n Adult ...

  6. File list: Oth.Unc.10.Adenine_N6-methylation.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Unc.10.Adenine_N6-methylation.AllCell ce10 TFs and others Adenine N6-methylatio...n Unclassified ...

  7. File list: Oth.ALL.20.Adenine_N6-methylation.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.20.Adenine_N6-methylation.AllCell ce10 TFs and others Adenine N6-methylatio...n All cell types ...

  8. File list: Oth.Unc.50.Adenine_N6-methylation.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Unc.50.Adenine_N6-methylation.AllCell ce10 TFs and others Adenine N6-methylatio...n Unclassified ...

  9. File list: Oth.Emb.50.Adenine_N6-methylation.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Emb.50.Adenine_N6-methylation.AllCell ce10 TFs and others Adenine N6-methylatio...n Embryo ...

  10. Electron transfer driven decomposition of adenine and selected analogs as probed by experimental and theoretical methods (United States)

    Cunha, T.; Mendes, M.; Ferreira da Silva, F.; Eden, S.; García, G.; Bacchus-Montabonel, M.-C.; Limão-Vieira, P.


    We report on a combined experimental and theoretical study of electron-transfer-induced decomposition of adenine (Ad) and a selection of analog molecules in collisions with potassium (K) atoms. Time-of-flight negative ion mass spectra have been obtained in a wide collision energy range (6-68 eV in the centre-of-mass frame), providing a comprehensive investigation of the fragmentation patterns of purine (Pu), adenine (Ad), 9-methyl adenine (9-mAd), 6-dimethyl adenine (6-dimAd), and 2-D adenine (2-DAd). Following our recent communication about selective hydrogen loss from the transient negative ions (TNIs) produced in these collisions [T. Cunha et al., J. Chem. Phys. 148, 021101 (2018)], this work focuses on the production of smaller fragment anions. In the low-energy part of the present range, several dissociation channels that are accessible in free electron attachment experiments are absent from the present mass spectra, notably NH2 loss from adenine and 9-methyl adenine. This can be understood in terms of a relatively long transit time of the K+ cation in the vicinity of the TNI tending to enhance the likelihood of intramolecular electron transfer. In this case, the excess energy can be redistributed through the available degrees of freedom inhibiting fragmentation pathways. Ab initio theoretical calculations were performed for 9-methyl adenine (9-mAd) and adenine (Ad) in the presence of a potassium atom and provided a strong basis for the assignment of the lowest unoccupied molecular orbitals accessed in the collision process.

  11. Endogenous adenosine produced during hypoxia attenuates neutrophil accumulation: coordination by extracellular nucleotide metabolism. (United States)

    Eltzschig, Holger K; Thompson, Linda F; Karhausen, Jorn; Cotta, Richard J; Ibla, Juan C; Robson, Simon C; Colgan, Sean P


    Hypoxia is a well-documented inflammatory stimulus and results in tissue polymorphonuclear leukocyte (PMN) accumulation. Likewise, increased tissue adenosine levels are commonly associated with hypoxia, and given the anti-inflammatory properties of adenosine, we hypothesized that adenosine production via adenine nucleotide metabolism at the vascular surface triggers an endogenous anti-inflammatory response during hypoxia. Initial in vitro studies indicated that endogenously generated adenosine, through activation of PMN adenosine A(2A) and A(2B) receptors, functions as an antiadhesive signal for PMN binding to microvascular endothelia. Intravascular nucleotides released by inflammatory cells undergo phosphohydrolysis via hypoxia-induced CD39 ectoapyrase (CD39 converts adenosine triphosphate/adenosine diphosphate [ATP/ADP] to adenosine monophosphate [AMP]) and CD73 ecto-5'-nucleotidase (CD73 converts AMP to adenosine). Extensions of our in vitro findings using cd39- and cd73-null animals revealed that extracellular adenosine produced through adenine nucleotide metabolism during hypoxia is a potent anti-inflammatory signal for PMNs in vivo. These findings identify CD39 and CD73 as critical control points for endogenous adenosine generation and implicate this pathway as an innate mechanism to attenuate excessive tissue PMN accumulation.

  12. Biochemistry of an olfactory purinergic system: dephosphorylation of excitatory nucleotides and uptake of adenosine

    Energy Technology Data Exchange (ETDEWEB)

    Trapido-Rosenthal, H G; Carr, W E; Gleeson, R A


    The olfactory organ of the spiny lobster, Panulirus argus, is composed of chemosensory sensilla containing the dendrites of primary chemosensory neurons. Receptors on these dendrites are activated by the nucleotides AMP, ADP, and ATP but not by the nucleoside adenosine. It is shown here that the lobster chemosensory sensilla contain enzymes that dephosphorylate excitatory nucleotides and an uptake system that internalizes the nonexcitatory dephosphorylated product adenosine. The uptake of (/sup 3/H)-adenosine is saturable with increasing concentration, linear with time for up to 3 h, sodium dependent, insensitive to moderate pH changes and has a Km of 7.1 microM and a Vmax of 5.2 fmol/sensillum/min (573 fmol/micrograms of protein/min). Double-label experiments show that sensilla dephosphorylate nucleotides extracellularly; /sup 3/H from adenine-labeled AMP or ATP is internalized, whereas 32P from phosphate-labeled nucleotides is not. The dephosphorylation of AMP is very rapid; /sup 3/H from AMP is internalized at the same rate as /sup 3/H from adenosine. Sensillar 5'-ectonucleotidase activity is inhibited by ADP and the ADP analog alpha, beta-methylene ADP. Collectively, these results indicate that the enzymes and the uptake system whereby chemosensory sensilla of the lobster inactivate excitatory nucleotides and clear adenosine from extracellular spaces are very similar to those present in the internal tissues of vertebrates, where nucleotides have many neuroactive effects.

  13. Statistical properties of nucleotides in human chromosomes 21 and 22

    International Nuclear Information System (INIS)

    Zhang Linxi; Sun Tingting


    In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence

  14. Distribution of 3H within purine nucleotides of Ehrlich mouse ascites tumour cells after intraabdominal injection of myo-[2-3H]inositol

    DEFF Research Database (Denmark)

    Christensen, Søren; Klenow, H.; Overgaard-Hansen, Kay


    /desorption the nucleotides were dephosphorylated, enriched with [U-14C]adenosine, and exposed to purine-nucleoside specific enzymes. Reverse phase HPLC and radioactivity measurement demonstrated that for adenosine about 82% of total stable 3H label was in ribose and thus about 18% in adenine. For guanosine about 89...

  15. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification. (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant


    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  16. Prevention of injury by resveratrol in a rat model of adenine-induced ...

    African Journals Online (AJOL)

    phosphorous, and fibroblast growth factor-23 (FGF-23) in rat urine samples after 2 months of adenine ... parathyroid hormone, phosphorous and FGF-23 levels (p < 0.002). In rats ... cartilage degradation in animal models of arthritis. [11].

  17. DNA adenine methylation modulates pathogenicity of Klebsiella pneumoniae genotype K1

    Directory of Open Access Journals (Sweden)

    Chi-Tai Fang


    Conclusion: Our results support the view that DNA adenine methylation plays an important role in modulating the pathogenicity of K. pneumoniae genotype K1. The incomplete attenuation indicates the existence of other regulatory factors.

  18. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth


    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  19. Heat-processed ginseng saponin ameliorates the adenine-induced renal failure in rats


    Kim, Eun Jin; Oh, Hyun-A; Choi, Hyuck Jai; Park, Jeong Hill; Kim, Dong-Hyun; Kim, Nam Jae


    To evaluate the effect of the saponin of heat-processed ginseng (Sun ginseng, SG), we investigated the protective effect of SG total saponin fraction against adenine-induced chronic renal failure in rats. SG saponin significantly decreased the levels of urea nitrogen and creatinine in the serum, but increased the urinary excretion of urea nitrogen and creatinine, indicating an improvement of renal function. SG saponin also inhibited adenine-induced kidney hypertrophy and edema. SG saponin red...

  20. Protonation mechanism and location of rate-determining steps for the Ascaris suum nicotinamide adenine dinucleotide-malic enzyme reaction from isotope effects and pH studies

    International Nuclear Information System (INIS)

    Kiick, D.M.; Harris, B.G.; Cook, P.F.


    The pH dependence of the kinetic parameters and the primary deuterium isotope effects with nicotinamide adenine dinucleotide (NAD) and also thionicotinamide adenine dinucleotide (thio-NAD) as the nucleotide substrates were determined in order to obtain information about the chemical mechanism and location of rate-determining steps for the Ascaris suum NAD-malic enzyme reaction. The maximum velocity with thio-NAD as the nucleotide is pH-independent from pH 4.2 to 9.6, while with NAD, V decreases below a pK of 4.8. V/K for both nucleotides decreases below a pK of 5.6 and above a pK of 8.9. Both the tartronate pKi and V/Kmalate decrease below a pK of 4.8 and above a pK of 8.9. Oxalate is competitive vs. malate above pH 7 and noncompetitive below pH 7 with NAD as the nucleotide. The oxalate Kis increases from a constant value above a pK of 4.9 to another constant value above a pK of 6.7. The oxalate Kii also increases above a pK of 4.9, and this inhibition is enhanced by NADH. In the presence of thio-NAD the inhibition by oxalate is competitive vs. malate below pH 7. For thio-NAD, both DV and D(V/K) are pH-independent and equal to 1.7. With NAD as the nucleotide, DV decreases to 1.0 below a pK of 4.9, while D(V/KNAD) and D(V/Kmalate) are pH-independent. Above pH 7 the isotope effects on V and the V/K values for NAD and malate are equal to 1.45, the pH-independent value of DV above pH 7. Results indicate that substrates bind to only the correctly protonated form of the enzyme. Two enzyme groups are necessary for binding of substrates and catalysis. Both NAD and malate are released from the Michaelis complex at equal rates which are equal to the rate of NADH release from E-NADH above pH 7. Below pH 7 NADH release becomes more rate-determining as the pH decreases until at pH 4.0 it completely limits the overall rate of the reaction

  1. A novel approach to adenine-induced chronic kidney disease associated anemia in rodents.

    Directory of Open Access Journals (Sweden)

    Asadur Rahman

    Full Text Available To date, good experimental animal models of renal anemia are not available. Therefore, the purpose of this study was to establish a novel approach to induce chronic kidney disease (CKD with severe anemia by oral administration of adenine in rodents. Adenine was administered to 6-week-old male C57BL/6 mice (25 and 50 mg/kg body weight by oral gavage daily for 28 days. Serum creatinine and BUN as well as hematocrit, hemoglobin (Hb and plasma erythropoietin (EPO levels were monitored to assess renal function and anemia, respectively. Adenine at 25 mg/kg for 28 days slightly increased plasma creatinine levels, but did not induce anemia. In contrast, 50 mg/kg of adenine daily for 28 days showed severe renal dysfunction (plasma creatinine 1.9 ± 0.10 mg/dL and anemia (hematocrit 36.5 ± 1.0% and EPO 28 ± 2.4 pg/mL as compared with vehicle-treated mice (0.4 ± 0.02 mg/dL, 49.6 ± 1.6% and 61 ± 4.0 pg/mL, respectively. At the end of experiment, level of Hb also significantly reduced in 50 mg/kg adenine administration group. Remarkable histological changes of kidney tissues characterized by interstitial fibrosis and cystic appearance in tubules were observed in 50 mg/kg of adenine treatment group. These results have demonstrated that oral dosing with adenine at 50 mg/kg for 28 days is suitable to induce a stable anemia associated with CKD in mice.

  2. Determination of adenine based on the fluorescence recovery of the L-Tryptophan-Cu(2+) complex. (United States)

    Duan, Ruilin; Li, Chunyan; Liu, Shaopu; Liu, Zhongfang; Li, Yuanfang; Yuan, Yusheng; Hu, Xiaoli


    A simple and sensitive method for determination of adenine was developed based on fluorescence quenching and recovery of L-Tryptophan (L-Trp). The fluorescence of L-Trp could efficiently quenched by copper ion compared with other common metal ions. Upon addition of adenine (Ade) in L-Trp-Cu(II) system, the fluorescence was reoccurred. Under the optimum conditions, the recovery fluorescence intensity was linearly correlated with the concentration of adenine in the range from 0.34 to 25.0μmolL(-1), with a correlation coefficient (R(2)) of 0.9994. The detection limit (3σ/k) was 0.046μmolL(-1), indicating that this method could applied to detect trace adenine. In this study, amino acids including L-Trp, D-Trp, L-Tyr, D-Tyr, L-Phe, D-Phe were investigated and only L-Trp could well chelated copper ion. Additionally, the mechanism of quench and recovery also were discussed and the method was successfully applied to detect the adenine in DNA with satisfactory results. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Quercetin Attenuates Vascular Calcification through Suppressed Oxidative Stress in Adenine-Induced Chronic Renal Failure Rats

    Directory of Open Access Journals (Sweden)

    Xue-ying Chang


    Full Text Available Background. This study investigated whether quercetin could alleviate vascular calcification in experimental chronic renal failure rats induced by adenine. Methods. 32 adult male Wistar rats were randomly divided into 4 groups fed normal diet, normal diet with quercetin supplementation (25 mg/kg·BW/d, 0.75% adenine diet, or adenine diet with quercetin supplementation. All rats were sacrificed after 6 weeks of intervention. Serum renal functions biomarkers and oxidative stress biomarkers were measured and status of vascular calcification in aorta was assessed. Furthermore, the induced nitric oxide synthase (iNOS/p38 mitogen activated protein kinase (p38MAPK pathway was determined to explore the potential mechanism. Results. Adenine successfully induced renal failure and vascular calcification in rat model. Quercetin supplementation reversed unfavorable changes of phosphorous, uric acid (UA and creatinine levels, malonaldehyde (MDA content, and superoxide dismutase (SOD activity in serum and the increases of calcium and alkaline phosphatase (ALP activity in the aorta (P<0.05 and attenuated calcification and calcium accumulation in the medial layer of vasculature in histopathology. Western blot analysis showed that iNOS/p38MAPK pathway was normalized by the quercetin supplementation. Conclusions. Quercetin exerted a protective effect on vascular calcification in adenine-induced chronic renal failure rats, possibly through the modulation of oxidative stress and iNOs/p38MAPK pathway.

  4. Dibenzotetraaza[14]annulene-adenine conjugate recognizes complementary poly dT among ss-DNA/ss-RNA sequences. (United States)

    Radić Stojković, Marijana; Škugor, Marko; Tomić, Sanja; Grabar, Marina; Smrečki, Vilko; Dudek, Łukasz; Grolik, Jarosław; Eilmes, Julita; Piantanida, Ivo


    Among three novel DBTAA derivatives only the DBTAA-propyl-adenine conjugate showed recognition of the consecutive oligo dT sequence by increased affinity and specific induced chirooptical response in comparison to other single stranded RNA and DNA; whereby of particular importance is the up until now unique efficient differentiation between dT and rU. At variance, its close analogue DBTAA-hexyl-adenine did not reveal any selectivity between ss-DNA/RNA pointing out the important role of steric factors (linker length); moreover non-selectivity of the reference compound (, lacking adenine) stressed the importance of adenine interactions in the selectivity.

  5. Lung Oxidative Stress, DNA Damage, Apoptosis, and Fibrosis in Adenine-Induced Chronic Kidney Disease in Mice

    Directory of Open Access Journals (Sweden)

    Abderrahim Nemmar


    Full Text Available It is well-established that there is a crosstalk between the lung and the kidney, and several studies have reported association between chronic kidney disease (CKD and pulmonary pathophysiological changes. Experimentally, CKD can be caused in mice by dietary intake of adenine. Nevertheless, the consequence of such intervention on the lung received only scant attention. Here, we assessed the pulmonary effects of adenine (0.2% w/w in feed for 4 weeks-induced CKD in mice by assessing various physiological histological and biochemical endpoints. Adenine treatment induced a significant increase in urine output, urea and creatinine concentrations, and it decreased the body weight and creatinine clearance. It also increased proteinuria and the urinary levels of kidney injury molecule-1 and neutrophil gelatinase-associated lipocalin. Compared with control group, the histopathological evaluation of lungs from adenine-treated mice showed polymorphonuclear leukocytes infiltration in alveolar and bronchial walls, injury, and fibrosis. Moreover, adenine caused a significant increase in lung lipid peroxidation and reactive oxygen species and decreased the antioxidant catalase. Adenine also induced DNA damage assessed by COMET assay. Similarly, adenine caused apoptosis in the lung characterized by a significant increase of cleaved caspase-3. Moreover, adenine induced a significant increase in the expression of nuclear factor erythroid 2–related factor 2 (Nrf2 in the lung. We conclude that administration of adenine in mice induced CKD is accompanied by lung oxidative stress, DNA damage, apoptosis, and Nrf2 expression and fibrosis.

  6. Hydrothermal stability of adenine under controlled fugacities of N2, CO2 and H2. (United States)

    Franiatte, Michael; Richard, Laurent; Elie, Marcel; Nguyen-Trung, Chinh; Perfetti, Erwan; LaRowe, Douglas E


    An experimental study has been carried out on the stability of adenine (one of the five nucleic acid bases) under hydrothermal conditions. The experiments were performed in sealed autoclaves at 300 degrees C under fugacities of CO(2), N(2) and H(2) supposedly representative of those in marine hydrothermal systems on the early Earth. The composition of the gas phase was obtained from the degradation of oxalic acid, sodium nitrite and ammonium chloride, and the oxidation of metallic iron. The results of the experiments indicate that after 200 h, adenine is still present in detectable concentration in the aqueous phase. In fact, the concentration of adenine does not seem to be decreasing after approximately 24 h, which suggests that an equilibrium state may have been established with the inorganic constituents of the hydrothermal fluid. Such a conclusion is corroborated by independent thermodynamic calculations.

  7. Nucleotide excision repair in yeast

    NARCIS (Netherlands)

    Eijk, Patrick van


    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  8. Different effects of guanine nucleotides (GDP and GTP) on protein-mediated mitochondrial proton leak. (United States)

    Woyda-Ploszczyca, Andrzej M; Jarmuszkiewicz, Wieslawa


    In this study, we compared the influence of GDP and GTP on isolated mitochondria respiring under conditions favoring oxidative phosphorylation (OXPHOS) and under conditions excluding this process, i.e., in the presence of carboxyatractyloside, an adenine nucleotide translocase inhibitor, and/or oligomycin, an FOF1-ATP synthase inhibitor. Using mitochondria isolated from rat kidney and human endothelial cells, we found that the action of GDP and GTP can differ diametrically depending on the conditions. Namely, under conditions favoring OXPHOS, both in the absence and presence of linoleic acid, an activator of uncoupling proteins (UCPs), the addition of 1 mM GDP resulted in the state 4 (non-phosphorylating respiration)-state 3 (phosphorylating respiration) transition, which is characteristic of ADP oxidative phosphorylation. In contrast, the addition of 1 mM GTP resulted in a decrease in the respiratory rate and an increase in the membrane potential, which is characteristic of UCP inhibition. The stimulatory effect of GDP, but not GTP, was also observed in inside-out submitochondrial particles prepared from rat kidney mitochondria. However, the effects of GDP and GTP were more similar in the presence of OXPHOS inhibitors. The importance of these observations in connection with the action of UCPs, adenine nucleotide translocase (or other carboxyatractyloside-sensitive carriers), carboxyatractyloside- and purine nucleotide-insensitive carriers, as well as nucleoside-diphosphate kinase (NDPK) are considered. Because the measurements favoring oxidative phosphorylation better reflect in vivo conditions, our study strongly supports the idea that GDP cannot be considered a significant physiological inhibitor of UCP. Moreover, it appears that, under native conditions, GTP functions as a more efficient UCP inhibitor than GDP and ATP.

  9. The effect of caffeine and adenine on radiation induced suppression of DNA synthesis, and cell survival

    International Nuclear Information System (INIS)

    Wilcoxson, L.T.; Griffiths, T.D.


    Exposure of cultured mammalian cells to ionizing radiation or UV light results in a transient decrease in the rate of DNA synthesis. This depression in synthetic rate may be attenuated or deferred via a post-irradiation treatment with caffeine or adenine. It has been suggested that this attenuation may increase the fixation of damage and, therefore, increase radiation sensitivity. However, it has been previously reported that, for V79 cells treated with caffeine or adenine, no correlation exists between the extent of depression and cell survival. The present investigation expands upon these findings by examining the effect of caffeine or adenine post-irradiation treatment on two cell lines with normal UV sensitivity, mouse 3T3 and CHO AA8 cells, and one UV sensitive cell line, CHO UV5 cells. Both caffeine and adenine have been found to reduce, or delay, the suppression in DNA synthesis in all three cell lines. Surprisingly, caffeine appeared to induced even the UV5 cells to recover DNA synthetic ability. The amount of reduction in suppression of DNA synthesis, however, varies between the different cell lines and no consistent relationship with cell survival has emerged

  10. Synthetic models related to DNA-intercalating molecules. Interactions between 8-alkoxypsoralen and adenine

    International Nuclear Information System (INIS)

    Decout, J.L.; Lhomme, J.


    To investigate the interactions and the photoreactions between furocoumarins and adenine, compounds in which a psoralen molecule is linked by different polymethylene bridges have been synthesised. Ring-ring intramolecular interactions are observed by UV spectroscopy. Thermodynamic parameters of these hydrophobic interactions are determined by the study of the variation of the hypochromic effect with temperature. (author)

  11. Absorption by DNA single strands of adenine isolated in vacuo: The role of multiple chromophores

    DEFF Research Database (Denmark)

    Nielsen, L.M.; Pedersen, S.O.; Kirketerp, M.-B.S.


    to that for the adenine molecule and the dAMP mononucleotide. Desolvation has little effect on the bandwidth, which implies that inhomogenous broadening of the absorption bands in aqueous solution is of minor importance compared to, e.g., conformational disorder. Finally, at high photon energies, internal conversion...

  12. Probing electronic coupling between adenine bases in RNA strands from synchrotron radiation circular dichroism experiments

    DEFF Research Database (Denmark)

    Nielsen, Lisbeth Munksgård; Hoffmann, Søren Vrønning; Nielsen, Steen Brøndsted


    Circular dichroism spectra (176–330 nm) of RNA adenine oligomers, (rA)n (n = 1–10, 12, 15, and 20), reveal electronic coupling between two bases in short strands. The number of interacting bases in long strands is more and larger than that reported previously for the corresponding DNA strands....

  13. SERS, XPS, and DFT Study of Adenine Adsorption on Silver and Gold Surfaces. (United States)

    Pagliai, Marco; Caporali, Stefano; Muniz-Miranda, Maurizio; Pratesi, Giovanni; Schettino, Vincenzo


    The adsorption of adenine on silver and gold surfaces has been investigated combining density functional theory calculations with surface-enhanced Raman scattering and angle-resolved X-ray photoelectron spectroscopy measurements, obtaining useful insight into the orientation and interaction of the nucleobase with the metal surfaces.

  14. Kinetic analysis of Yersinia pestis DNA adenine methyltransferase activity using a hemimethylated molecular break light oligonucleotide.

    Directory of Open Access Journals (Sweden)

    Robert J Wood

    Full Text Available BACKGROUND: DNA adenine methylation plays an important role in several critical bacterial processes including mismatch repair, the timing of DNA replication and the transcriptional control of gene expression. The dependence of bacterial virulence on DNA adenine methyltransferase (Dam has led to the proposal that selective Dam inhibitors might function as broad spectrum antibiotics. METHODOLOGY/PRINCIPAL FINDINGS: Herein we report the expression and purification of Yersinia pestis Dam and the development of a continuous fluorescence based assay for DNA adenine methyltransferase activity that is suitable for determining the kinetic parameters of the enzyme and for high throughput screening against potential Dam inhibitors. The assay utilised a hemimethylated break light oligonucleotide substrate containing a GATC methylation site. When this substrate was fully methylated by Dam, it became a substrate for the restriction enzyme DpnI, resulting in separation of fluorophore (fluorescein and quencher (dabcyl and therefore an increase in fluorescence. The assays were monitored in real time using a fluorescence microplate reader in 96 well format and were used for the kinetic characterisation of Yersinia pestis Dam, its substrates and the known Dam inhibitor, S-adenosylhomocysteine. The assay has been validated for high throughput screening, giving a Z-factor of 0.71+/-0.07 indicating that it is a sensitive assay for the identification of inhibitors. CONCLUSIONS/SIGNIFICANCE: The assay is therefore suitable for high throughput screening for inhibitors of DNA adenine methyltransferases and the kinetic characterisation of the inhibition.

  15. Circular dichroism spectroscopy of conformers of (guanine + adenine) repeat strands of DNA

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Kypr, Jaroslav; Vorlíčková, Michaela


    Roč. 15, č. 7 (2003), s. 584-592 ISSN 0899-0042 R&D Projects: GA AV ČR IAA4004201; GA ČR GA204/01/0561 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA conformation * (guanine + adenine) repeats * homoduplexes Subject RIV: BO - Biophysics Impact factor: 1.793, year: 2003

  16. Effect of AST-120 on Endothelial Dysfunction in Adenine-Induced Uremic Rats

    Directory of Open Access Journals (Sweden)

    Yuko Inami


    Full Text Available Aim. Chronic kidney disease (CKD represents endothelial dysfunction. Monocyte adhesion is recognized as the initial step of arteriosclerosis. Indoxyl sulfate (IS is considered to be a risk factor for arteriosclerosis in CKD. Oral adsorbent AST-120 retards deterioration of renal function, reducing accumulation of IS. In the present study, we determined the monocyte adhesion in the adenine-induced uremic rats in vivo and effects of AST-120 on the adhesion molecules. Methods. Twenty-four rats were divided into control, control+AST-120, adenine, and adenine+AST-120 groups. The number of monocytes adherent to the endothelium of thoracic aorta by imaging the entire endothelial surface and the mRNA expressions of adhesion and atherosclerosis-related molecules were examined on day 49. The mRNA expressions of ICAM-1 and VCAM-1 in human umbilical vein endothelial cells were also examined. Results. Adenine increased the number of adherent monocytes, and AST-120 suppressed the increase. The monocyte adhesion was related to serum creatinine and IS in sera. Overexpression of VCAM-1 and TGF-β1 mRNA in the arterial walls was observed in uremic rats. IS induced increase of the ICAM-1 and VCAM-1 mRNA expressions in vitro. Conclusion. It appears that uremic condition introduces the monocyte adhesion to arterial wall and AST-120 might inhibit increasing of the monocyte adherence with CKD progression.

  17. Effect of atracylodes rhizome polysaccharide in rats with adenine-induced chronic renal failure. (United States)

    Yang, C; Liu, C; Zhou, Q; Xie, Y C; Qiu, X M; Feng, X


    The aim of the study was to elucidate the therapeutic effects of Atracylodes rhizome polysaccharide on adenine-induced chronic renal failure in rats. Fifty male Sprague Dawley rats were selected and randomly divided in to 5 groups (n=10 rats per group): The normal control group, the chronic renal failure pathological control group, the dexamethasone treatment group and two Atracylodes rhizome polysaccharide treatment groups, treated with two different concentrations of the polysaccharide, the Atracylodes rhizome polysaccharide high group and the Atracylodes rhizome polysaccharide low group. All the rats, except those in the normal control group were fed adenine-enriched diets, containing 10 g adenine per kg food for 3 weeks. After being fed with adenine, the dexamethasone treatment group, Atracylodes rhizome polysaccharide high group and Atracylodes rhizome polysaccharide low group rats were administered the drug orally for 2 weeks. On day 35, the kidney coefficient of the rats and the serum levels of creatinine, blood urea nitrogen, total protein and hemalbumin were determined. Subsequent to experimentation on a model of chronic renal failure in rats, the preparation was proven to be able to reduce serum levels of creatinine, blood urea nitrogen and hemalbumin levels (Prenal function. Atracylodes rhizome polysaccharide had reversed the majority of the indices of chronic renal failure in rats.

  18. Quercetin Attenuates Vascular Calcification through Suppressed Oxidative Stress in Adenine-Induced Chronic Renal Failure Rats. (United States)

    Chang, Xue-Ying; Cui, Lei; Wang, Xing-Zhi; Zhang, Lei; Zhu, Dan; Zhou, Xiao-Rong; Hao, Li-Rong


    This study investigated whether quercetin could alleviate vascular calcification in experimental chronic renal failure rats induced by adenine. 32 adult male Wistar rats were randomly divided into 4 groups fed normal diet, normal diet with quercetin supplementation (25 mg/kg·BW/d), 0.75% adenine diet, or adenine diet with quercetin supplementation. All rats were sacrificed after 6 weeks of intervention. Serum renal functions biomarkers and oxidative stress biomarkers were measured and status of vascular calcification in aorta was assessed. Furthermore, the induced nitric oxide synthase (iNOS)/p38 mitogen activated protein kinase (p38MAPK) pathway was determined to explore the potential mechanism. Adenine successfully induced renal failure and vascular calcification in rat model. Quercetin supplementation reversed unfavorable changes of phosphorous, uric acid (UA) and creatinine levels, malonaldehyde (MDA) content, and superoxide dismutase (SOD) activity in serum and the increases of calcium and alkaline phosphatase (ALP) activity in the aorta ( P chronic renal failure rats, possibly through the modulation of oxidative stress and iNOs/p38MAPK pathway.

  19. Quercetin Attenuates Vascular Calcification through Suppressed Oxidative Stress in Adenine-Induced Chronic Renal Failure Rats (United States)

    Chang, Xue-ying; Cui, Lei; Wang, Xing-zhi; Zhang, Lei; Zhu, Dan


    Background This study investigated whether quercetin could alleviate vascular calcification in experimental chronic renal failure rats induced by adenine. Methods 32 adult male Wistar rats were randomly divided into 4 groups fed normal diet, normal diet with quercetin supplementation (25 mg/kg·BW/d), 0.75% adenine diet, or adenine diet with quercetin supplementation. All rats were sacrificed after 6 weeks of intervention. Serum renal functions biomarkers and oxidative stress biomarkers were measured and status of vascular calcification in aorta was assessed. Furthermore, the induced nitric oxide synthase (iNOS)/p38 mitogen activated protein kinase (p38MAPK) pathway was determined to explore the potential mechanism. Results Adenine successfully induced renal failure and vascular calcification in rat model. Quercetin supplementation reversed unfavorable changes of phosphorous, uric acid (UA) and creatinine levels, malonaldehyde (MDA) content, and superoxide dismutase (SOD) activity in serum and the increases of calcium and alkaline phosphatase (ALP) activity in the aorta (P chronic renal failure rats, possibly through the modulation of oxidative stress and iNOs/p38MAPK pathway. PMID:28691026

  20. Guanine nucleotide regulation of α1-adrenergic receptors of muscle and kidney eptihelial cells

    International Nuclear Information System (INIS)

    Terman, B.I.; Hughes, R.J.; Slivka, S.R.; Insel, P.A.


    The authors have examined the effect of guanine nucleotides on the interaction of adrenergic agents with α 1 -adrenergic receptors of two cell lines, the Madin-Darby Canine Kidney (MDCK) and BC3H-1 muscle cells. While gaunylylimidodiphosphoate (Gpp(NH)p) had no effect on the affinity or the total number of [ -3 H]prazosin binding sites in membranes prepared from these cells, the nucleotide decreased the apparent affinity of the agonist epinephrine in competing for [ 3 H]prazosin binding sites in both cell types. The EC 50 of Gpp(NH)p was ∼100 μM, and a maximal effect was seen at 500 μM. In contrast, 100 μM Gpp(NH)p yielding maximal shifts in binding of epinephrine to β-adrenergic receptors in BC3H-1 cell membranes. Guanine nucleotides were significantly more effective than adenine nucleotides in shifting agonist affinity for the α 1 -receptor and Mg ++ was required to observe a maximal effect. α 1 -receptor agonists activated phosphatidylinositol (PI) hydrolysis in both cell types, but have no direct effect on membrane adenylate cyclase activity. In intact BC3H-1 cells, α 1 -agonists inhibited β-adrenergic cAMP production, an effect which appears in preliminary studies not to result from enhanced phosphodieterase activity. These results show that agonist binding to α 1 -adrenergic receptors in mammalian kidney and muscle cells is regulated by guanine nucleotides. This regulation and inturn transmembrane signalling (PI hydrolysis) by these receptors appear to involve a guanine nucleotide binding (G) protein, which may be different than G/sub s/ and G/sub i/


    International Nuclear Information System (INIS)

    Evans, Nicholas L.; Ullrich, Susanne; Bennett, Chris J.; Kaiser, Ralf I.


    The molecular inventory available on the prebiotic Earth was likely derived from both terrestrial and extraterrestrial sources. A complete description of which extraterrestrial molecules may have seeded early Earth is therefore necessary to fully understand the prebiotic evolution which led to life. Galactic cosmic rays (GCRs) are expected to cause both the formation and destruction of important biomolecules-including nucleic acid bases such as adenine-in the interstellar medium within the ices condensed on interstellar grains. The interstellar ultraviolet (UV) component is expected to photochemically degrade gas-phase adenine on a short timescale of only several years. However, the destruction rate is expected to be significantly reduced when adenine is shielded in dense molecular clouds or even within the ices of interstellar grains. Here, biomolecule destruction by the energetic charged particle component of the GCR becomes important as it is not fully attenuated. Presented here are results on the destruction rate of the nucleobase adenine in the solid state at 10 K by energetic electrons, as generated in the track of cosmic ray particles as they penetrate ices. When both UV and energetic charged particle destructive processes are taken into account, the half-life of adenine within dense interstellar clouds is found to be ∼6 Myr, which is on the order of a star-forming molecular cloud. We also discuss chemical reaction pathways within the ices to explain the production of observed species, including the formation of nitriles (R-C≡N), epoxides (C-O-C), and carbonyl functions (R-C=O).

  2. DNA homoduplexes containing no pyrimidine nucleotide

    Czech Academy of Sciences Publication Activity Database

    Kypr, Jaroslav; Kejnovská, Iva; Vorlíčková, Michaela


    Roč. 32, č. 2 (2003), s. 154-158 ISSN 0175-7571 R&D Projects: GA ČR GA301/01/0590; GA AV ČR IAA4004201 Institutional research plan: CEZ:AV0Z5004920 Keywords : adenine * base pairing * circular dichroism spectroscopy Subject RIV: BO - Biophysics Impact factor: 1.769, year: 2003

  3. Erythro-9-(2-hydroxy-3-nonyl)adenine (EHNA) blocks differentiation and maintains the expression of pluripotency markers in human embryonic stem cells. (United States)

    Burton, Peter; Adams, David R; Abraham, Achamma; Allcock, Robert W; Jiang, Zhong; McCahill, Angela; Gilmour, Jane; McAbney, John; Kaupisch, Alexandra; Kane, Nicole M; Baillie, George S; Baker, Andrew H; Milligan, Graeme; Houslay, Miles D; Mountford, Joanne C


    hESCs (human embryonic stem cells) have enormous potential for use in pharmaceutical development and therapeutics; however, to realize this potential, there is a requirement for simple and reproducible cell culture methods that provide adequate numbers of cells of suitable quality. We have discovered a novel way of blocking the spontaneous differentiation of hESCs in the absence of exogenous cytokines by supplementing feeder-free conditions with EHNA [erythro-9-(2-hydroxy-3-nonyl)adenine], an established inhibitor of ADA (adenosine deaminase) and cyclic nucleotide PDE2 (phosphodiesterase 2). hESCs maintained in feeder-free conditions with EHNA for more than ten passages showed no reduction in hESC-associated markers including NANOG, POU5F1 (POU domain class 5 transcription factor 1, also known as Oct-4) and SSEA4 (stage-specific embryonic antigen 4) compared with cells maintained in feeder-free conditions containing bFGF (basic fibroblast growth factor). Spontaneous differentiation was reversibly suppressed by the addition of EHNA, but, upon removing EHNA, hESC populations underwent efficient spontaneous, multi-lineage and directed differentiation. EHNA also acts as a strong blocker of directed neuronal differentiation. Chemically distinct inhibitors of ADA and PDE2 lacked the capacity of EHNA to suppress hESC differentiation, suggesting that the effect is not driven by inhibition of either ADA or PDE2. Preliminary structure-activity relationship analysis found the differentiation-blocking properties of EHNA to reside in a pharmacophore comprising a close adenine mimetic with an extended hydrophobic substituent in the 8- or 9-position. We conclude that EHNA and simple 9-alkyladenines can block directed neuronal and spontaneous differentiation in the absence of exogenous cytokine addition, and may provide a useful replacement for bFGF in large-scale or cGMP-compliant processes.

  4. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit


    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  5. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan


    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  6. Ribose Supplementation Alone or with Elevated Creatine Does Not Preserve High Energy Nucleotides or Cardiac Function in the Failing Mouse Heart.

    Directory of Open Access Journals (Sweden)

    Kiterie M E Faller

    Full Text Available Reduced levels of creatine and total adenine nucleotides (sum of ATP, ADP and AMP are hallmarks of chronic heart failure and restoring these pools is predicted to be beneficial by maintaining the diseased heart in a more favourable energy state. Ribose supplementation is thought to support both salvage and re-synthesis of adenine nucleotides by bypassing the rate-limiting step. We therefore tested whether ribose would be beneficial in chronic heart failure in control mice and in mice with elevated myocardial creatine due to overexpression of the creatine transporter (CrT-OE.FOUR GROUPS WERE STUDIED: sham; myocardial infarction (MI; MI+ribose; MI+CrT-OE+ribose. In a pilot study, ribose given in drinking water was bioavailable, resulting in a two-fold increase in myocardial ribose-5-phosphate levels. However, 8 weeks post-surgery, total adenine nucleotide (TAN pool was decreased to a similar amount (8-14% in all infarcted groups irrespective of the treatment received. All infarcted groups also presented with a similar and substantial degree of left ventricular (LV dysfunction (3-fold reduction in ejection fraction and LV hypertrophy (32-47% increased mass. Ejection fraction closely correlated with infarct size independently of treatment (r(2 = 0.63, p<0.0001, but did not correlate with myocardial creatine or TAN levels.Elevating myocardial ribose and creatine levels failed to maintain TAN pool or improve post-infarction LV remodeling and function. This suggests that ribose is not rate-limiting for purine nucleotide biosynthesis in the chronically failing mouse heart and that alternative strategies to preserve TAN pool should be investigated.

  7. Influence of gamma irradiation and benzyl adenine on keeping quality of custard apple fruits during storage

    International Nuclear Information System (INIS)

    Chouksey, Swati; Singh, Alpana; Thakur, Rajendra Singh; Deshmukh, Reena


    The custard apple (Annona squamosa) fruits were procured from local market, irradiated with radiation doses 0, 0.25, 0.50, 0.75, 1.00, 1.25, 1.50, 1.75 kGy and then treated with benzyl adenine (50 and 100 part per million) and stored at ambient temperature (25±5 °C, Relative Humidity 90±2%) for 12 days. The treated fruits were evaluated for sensory (viz; flavour, texture, internal and external colour) and chemical constituents (viz; Total Soluble Solids, titrable acidity, ascorbic acid, free soluble sugar, reducing sugar, non reducing sugar, carbohydrate) during storage. The study concluded that radiation dose of 1.5 kilo Gray along with 50 ppm benzyl adenine enhanced in shelf-life of custard apple fruits by 6 days at ambient temperature with good pulp texture, flavour, colour and nutritional quality as compared to control. (author)

  8. Communication: Site-selective bond excision of adenine upon electron transfer (United States)

    Cunha, T.; Mendes, M.; Ferreira da Silva, F.; Eden, S.; García, G.; Limão-Vieira, P.


    This work demonstrates that selective excision of hydrogen atoms at a particular site of the DNA base adenine can be achieved in collisions with electronegative atoms by controlling the impact energy. The result is based on analysing the time-of-flight mass spectra yields of potassium collisions with a series of labeled adenine derivatives. The production of dehydrogenated parent anions is consistent with neutral H loss either from selective breaking of C-H or N-H bonds. These unprecedented results open up a new methodology in charge transfer collisions that can initiate selective reactivity as a key process in chemical reactions that are dominant in different areas of science and technology.

  9. The synthesis of nucleotide in the aqueous solution induced by low energy ions

    International Nuclear Information System (INIS)

    Shi Huaibin; Shao Chunlin; Wang Xiangqin; Yu Zengliang


    A new apparatus was designed to induce reactions in aqueous solution by introducing low energy ions into the aqueous solution, this apparatus overcome the defaults of the old ones which demanded vacuum and made it possible to study the action among solutions, it also expanded the ion implantation biology. The role of low energy ions was introduced into the study of the origin of life, primitive earth conditions were imitated to study prior-life synthesis of nucleotide by introducing low energy ions into aqueous solution, low energy N + was implanted into adenine supersaturation solution including D-ribose and NH 4 H 2 PO 4 , it was confirmed that 5'-AMP was gained by HPLC analysis of the products. In comparison with other methods in this field, this one is simpler and nearer to the primitive earth conditions, thus it provided a new try for the studying of the origin of life

  10. Fluorometric detection of adenine in target DNA by exciplex formation with fluorescent 8-arylethynylated deoxyguanosine. (United States)

    Saito, Yoshio; Kugenuma, Kenji; Tanaka, Makiko; Suzuki, Azusa; Saito, Isao


    We demonstrated an intriguing method to discriminate adenine by incident appearance of an intense new emission via exciplex formation in hybridization of target DNA with newly designed fluorescent 8-arylethynylated deoxyguanosine derivatives. We described the synthesis of such highly electron donating fluorescent guanosine derivatives and their incorporation into DNA oligomers which may be used for the structural study and the fluorometric analysis of nucleic acids. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Adenine ribbon stabilized by Watson–Crick and Hoogsteen hydrogen Bonds: WFT and DFT study

    Czech Academy of Sciences Publication Activity Database

    Zierkiewicz, W.; Michalska, D.; Hobza, Pavel


    Roč. 12, č. 12 (2010), s. 2888-2894 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:Wroclaw University of Technology(PL) 343974/Z0304 Institutional research plan: CEZ:AV0Z40550506 Keywords : adenine ribbon * ab initio correlated calculations * self- organization Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.454, year: 2010

  12. Quantification of DNA in Neonatal Dried Blood Spots by Adenine Tandem Mass Spectrometry. (United States)

    Durie, Danielle; Yeh, Ed; McIntosh, Nathan; Fisher, Lawrence; Bulman, Dennis E; Birnboim, H Chaim; Chakraborty, Pranesh; Al-Dirbashi, Osama Y


    Newborn screening programs have expanded to include molecular-based assays as first-tier tests and the success of these assays depends on the quality and yield of DNA extracted from neonatal dried blood spots (DBS). To meet high throughput and rapid turnaround time requirements, newborn screening laboratories adopted rapid DNA extraction methods that produce crude extracts. Quantification of DNA in neonatal DBS is not routinely performed due to technical challenges; however, this may enhance the performance of assays that are sensitive to amounts of input DNA. In this study, we developed a novel high throughput method to quantify total DNA in DBS. It is based on specific acid-catalyzed depurination of DNA followed by mass spectrometric quantification of adenine. The amount of adenine was used to calculate DNA quantity per 3.2 mm DBS. Reference intervals were established using archived, neonatal DBS (n = 501) and a median of 130.6 ng of DNA per DBS was obtained, which is in agreement with literature values. The intra- and interday variations were quantification were 12.5 and 37.8 nmol/L adenine, respectively. We demonstrated that DNA from neonatal DBS can be successfully quantified in high throughput settings using instruments currently deployed in NBS laboratories.

  13. Adenine radicals generated in alternating AT duplexes by direct absorption of low-energy UV radiation. (United States)

    Banyasz, Akos; Ketola, Tiia; Martínez-Fernández, Lara; Improta, Roberto; Markovitsi, Dimitra


    There is increasing evidence that the direct absorption of photons with energies that are lower than the ionization potential of nucleobases may result in oxidative damage to DNA. The present work, which combines nanosecond transient absorption spectroscopy and quantum mechanical calculations, studies this process in alternating adenine-thymine duplexes (AT)n. We show that the one-photon ionization quantum yield of (AT)10 at 266 nm (4.66 eV) is (1.5 ± 0.3) × 10-3. According to our PCM/TD-DFT calculations carried out on model duplexes composed of two base pairs, (AT)1 and (TA)1, simultaneous base pairing and stacking does not induce important changes in the absorption spectra of the adenine radical cation and deprotonated radical. The adenine radicals, thus identified in the time-resolved spectra, disappear with a lifetime of 2.5 ms, giving rise to a reaction product that absorbs at 350 nm. In parallel, the fingerprint of reaction intermediates other than radicals, formed directly from singlet excited states and assigned to AT/TA dimers, is detected at shorter wavelengths. PCM/TD-DFT calculations are carried out to map the pathways leading to such species and to characterize their absorption spectra; we find that, in addition to the path leading to the well-known TA* photoproduct, an AT photo-dimerization path may be operative in duplexes.

  14. Structure-wise discrimination of adenine and guanine by proteins on the basis of their nonbonded interactions. (United States)

    Usha, S; Selvaraj, S


    We have analyzed the nonbonded interactions of the structurally similar moieties, adenine and guanine forming complexes with proteins. The results comprise (a) the amino acid-ligand atom preferences, (b) solvent accessibility of ligand atoms before and after complex formation with proteins, and (c) preferred amino acid residue atoms involved in the interactions. We have observed that the amino acid preferences involved in the hydrogen bonding interactions vary for adenine and guanine. The structural variation between the purine atoms is clearly reflected by their burial tendency in the solvent environment. Correlation of the mean amino acid preference values show the variation that exists between adenine and guanine preferences of all the amino acid residues. All our observations provide evidence for the discriminating nature of the proteins in recognizing adenine and guanine.

  15. Distinctive Spectral Features of Exciton and Excimer States in the Ultrafast Electronic Deactivation of the Adenine Dinucleotide (United States)

    Stuhldreier, Mayra C.; Röttger, Katharina; Temps, Friedrich

    We report the observation by transient absorption spectroscopy of distinctive spectro-temporal signatures of delocalized exciton versus relaxed, weakly bound excimer states in the ultrafast electronic deactivation after UV photoexcitation of the adenine dinucleotide.

  16. Design, synthesis, and characterization of 0-D, 1-D, and 2-D Zinc–Adeninate coordination assemblies

    Energy Technology Data Exchange (ETDEWEB)

    An, Ji Hyun [Dept. of Chemistry Education, Seoul National University, Seoul (Korea, Republic of); Geib, Steven J. [Dept. of Chemistry, University of Pittsburgh, Pittsburgh (United States); Kim, Myung Gil [Dept. of Chemistry, Chungang University, Seoul (Korea, Republic of)


    In this study, we demonstrate the synthesis and characterization of zinc– adeninate coordination polymers with 0-D, 1-D, and 2-D structures. We describe methods for controlling the structure of these materials by applying different synthetic conditions and discuss their structural relationships. 0-D, 1-D, and 2-D zinc–adeninate coordination polymers with the same metal–adeninate coordination mode were synthesized and characterized. By controlling the temperature, a material with 0-D macrocycle or 1-D chain coordination polymer was prepared. A replacement of pyridine with bipyridine formed 2-D sheet structure by connecting 1-D chains with each other. They exhibited an interesting relationship between synthetic methods and structures. Further study of metal–adeninate coordination chemistry will render a precise control of the structure in synthesis and will open a new venue to new materials with fascinating properties.

  17. An experimental and theoretical vibrational study of interaction of adenine and thymine with artificial seawaters: A prebiotic chemistry experiment. (United States)

    Anizelli, Pedro R; Baú, João P T; Nabeshima, Henrique S; da Costa, Marcello F; de Santana, Henrique; Zaia, Dimas A M


    Nucleic acid bases play important roles in living beings. Thus, their interaction with salts the prebiotic Earth could be an important issue for the understanding of origin of life. In this study, the effect of pH and artificial seawaters on the structure of adenine and thymine was studied via parallel determinations using FT-IR, Raman spectroscopy and theoretical calculations. Thymine and adenine lyophilized in solutions at basic and acidic conditions showed characteristic bands of the enol-imino tautomer due to the deprotonation and the hydrochloride form due to protonation, respectively. The interaction of thymine and adenine with different seawaters representative of different geological periods on Earth was also studied. In the case of thymine a strong interaction with Sr(2+) promoted changes in the Raman and infrared spectra. For adenine changes in infrared and Raman spectra were observed in the presence of salts from all seawaters tested. The experimental results were compared to theoretical calculations, which showed structural changes due to the presence of ions Na(+), Mg(2+), Ca(2+) and Sr(2+) of artificial seawaters. For thymine the bands arising from C4=C5 and C6=O stretching were shifted to lower values, and for adenine, a new band at 1310cm(-1) was observed. The reactivity of adenine and thymine was studied by comparing changes in nucleophilicity and energy of the HOMO orbital. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Prolonged Pulmonary Exposure to Diesel Exhaust Particles Exacerbates Renal Oxidative Stress, Inflammation and DNA Damage in Mice with Adenine-Induced Chronic Renal Failure

    Directory of Open Access Journals (Sweden)

    Abderrahim Nemmar


    Full Text Available Background/Aims: Epidemiological evidence indicates that patients with chronic kidney diseases have increased susceptibility to adverse outcomes related to long-term exposure to particulate air pollution. However, mechanisms underlying these effects are not fully understood. Methods: Presently, we assessed the effect of prolonged exposure to diesel exhaust particles (DEP on chronic renal failure induced by adenine (0.25% w/w in feed for 4 weeks, which is known to involve inflammation and oxidative stress. DEP (0.5m/kg was intratracheally (i.t. instilled every 4th day for 4 weeks (7 i.t. instillation. Four days following the last exposure to either DEP or saline (control, various renal endpoints were measured. Results: While body weight was decreased, kidney weight increased in DEP+adenine versus saline+adenine or DEP. Water intake, urine volume, relative kidney weight were significantly increased in adenine+DEP versus DEP and adenine+saline versus saline. Plasma creatinine and urea increased and creatinine clearance decreased in adenine+DEP versus DEP and adenine+saline versus saline. Tumor necrosis factor α, lipid peroxidation and reactive oxygen species were significantly increased in adenine+DEP compared with either DEP or adenine+saline. The antioxidant calase was significantly decreased in adenine+DEP compared with either adenine+saline or DEP. Notably, renal DNA damage was significantly potentiated in adenine+DEP compared with either adenine+saline or DEP. Similarly, systolic blood pressure was increased in adenine+DEP versus adenine+saline or DEP, and in DEP versus saline. Histological evaluation revealed more collagen deposition, higher number of necrotic cell counts and dilated tubules, cast formation and collapsing glomeruli in adenine+DEP versus adenine+saline or DEP. Conclusion: Prolonged pulmonary exposure to diesel exhaust particles worsen renal oxidative stress, inflammation and DNA damage in mice with adenine-induced chronic

  19. Prolonged Pulmonary Exposure to Diesel Exhaust Particles Exacerbates Renal Oxidative Stress, Inflammation and DNA Damage in Mice with Adenine-Induced Chronic Renal Failure. (United States)

    Nemmar, Abderrahim; Karaca, Turan; Beegam, Sumaya; Yuvaraju, Priya; Yasin, Javed; Hamadi, Naserddine Kamel; Ali, Badreldin H


    Epidemiological evidence indicates that patients with chronic kidney diseases have increased susceptibility to adverse outcomes related to long-term exposure to particulate air pollution. However, mechanisms underlying these effects are not fully understood. Presently, we assessed the effect of prolonged exposure to diesel exhaust particles (DEP) on chronic renal failure induced by adenine (0.25% w/w in feed for 4 weeks), which is known to involve inflammation and oxidative stress. DEP (0.5m/kg) was intratracheally (i.t.) instilled every 4th day for 4 weeks (7 i.t. instillation). Four days following the last exposure to either DEP or saline (control), various renal endpoints were measured. While body weight was decreased, kidney weight increased in DEP+adenine versus saline+adenine or DEP. Water intake, urine volume, relative kidney weight were significantly increased in adenine+DEP versus DEP and adenine+saline versus saline. Plasma creatinine and urea increased and creatinine clearance decreased in adenine+DEP versus DEP and adenine+saline versus saline. Tumor necrosis factor α, lipid peroxidation and reactive oxygen species were significantly increased in adenine+DEP compared with either DEP or adenine+saline. The antioxidant calase was significantly decreased in adenine+DEP compared with either adenine+saline or DEP. Notably, renal DNA damage was significantly potentiated in adenine+DEP compared with either adenine+saline or DEP. Similarly, systolic blood pressure was increased in adenine+DEP versus adenine+saline or DEP, and in DEP versus saline. Histological evaluation revealed more collagen deposition, higher number of necrotic cell counts and dilated tubules, cast formation and collapsing glomeruli in adenine+DEP versus adenine+saline or DEP. Prolonged pulmonary exposure to diesel exhaust particles worsen renal oxidative stress, inflammation and DNA damage in mice with adenine-induced chronic renal failure. Our data provide biological plausibility that air

  20. Spectral studies of lanthanide-nucleic acid component interaction: complexes of adenine, adenosine, adenosine 5'-mono-, adenosine 5'-di- and adenosine 5' tri-phosphates with praseodymium(III)

    International Nuclear Information System (INIS)

    Joseph, George; Anjaiah, K.; Misra, S.N.


    The interactions of adenine, adenosine, adenosine 5'-mono-, adenosine 5'-di-and adenosine 5'-tri-phosphates with praseodymium(III) have been studied in different stoichiometries and at varying hydrogen ion concentrations by absorption spectral studies. The sharp bands in the spectra have been individually analysed by Gaussian curve analysis, and various spectral parameters have been computed using partial and multiple regression methods on an HP-1000/45 computer. The changes in and the magnitudes of these parameters have been correlated with the degrees of outer- and inner-sphere coordination around praseodymium(III). Crystalline complexes of the type: Pr(nucleotide) 2 (H 2 O) 2 (where nucleotide = AMP, ADP and ATP) have been characterized on the basis of analytical, IR and 1 H NMR spectral data. These studies indicate that the binding of the nucleotide is through phosphoric oxygen. These complexes in aqueous medium show significant ionization which supports the observed weak 4f-4f bands, lower values of nephelauxetic effect and the parameters derived from coulombic and spin-orbit interactions. (author). 3 t abs., 28 refs

  1. In vitro propagation of Calla lily: adenine sulphate and 6-benzilaminopurine

    Directory of Open Access Journals (Sweden)

    Márcia De Nazaré Oliveira Ribeiro


    Full Text Available Calla lily [Zantedeschia aethiopica (L. Spreng.] belonging to the Araceae family is appreciated as cut flower and in com­position of gardens. However, the conventional propagation of this plants shows a poor productive. Thus, tissue culture besides allowing fast clonal propagation also provides healthy and uniforms plants. The aim was study the influence of the differents concentrations of 6-benzilaminopurine (BAP and adenine sulphate (AS on in vitro multiplication of Calla lily. The explants were maintained in MS medium added with BAP (0.0, 8.9, 17.8 and 26.7 μM and adenine sulphate (0, 54, 108 and 162 μM. The plants were transferred to growth room and maintained at 25±1ºC and photoperiod of 16 hours for 60 days, under luminous intensity of 35 μmol m-2 s-1, for a period of 60 days. The experimental design was entirely randomized with four repetitions of three seedlings each, resulting in twelve plants per treatment, each tube with one plant. The statistics analysis showed interactive effects for quantify of BAP and AS for leaves number and fresh mass of the aerial parts. The highest number of leaves (4.8 and fresh mass of aerial parts (0.73 g was obtained with 26.7 μM of BAP combined with 108 μM of AS, highest number of shoots (2.6 was obtained with 22,19 μM of BAP and highest lengh of sprouts (5.0 cm was observed in the absence of BAP. The addition of BAP increased the number of shoots per explant. The use of adenine sulphate in combination with BAP had a positive effect for the accumulation of fresh weight and number of leaves in vitro culture.

  2. Gum acacia mitigates genetic damage in adenine-induced chronic renal failure in rats. (United States)

    Ali, B H; Al Balushi, K; Al-Husseini, I; Mandel, P; Nemmar, A; Schupp, N; Ribeiro, D A


    Subjects with chronic renal failure (CRF) exhibit oxidative genome damage, which may predispose to carcinogenesis, and Gum acacia (GumA) ameliorates this condition in humans and animals. We evaluated here renal DNA damage and urinary excretion of four nucleic acid oxidation adducts namely 8-oxoguanine (8-oxoGua), 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG), 8-oxoguanosine (8-oxoGuo) and 8-hydroxy-2-deoxyguanisone (8-OHdg) in rats with adenine (ADE)-induced CRF with and without GumA treatment. Twenty-four rats were divided into four equal groups and treated for 4 weeks. The first group was given normal food and water (control). The second group was given normal food and GumA (15% w/v) in drinking water. The third group was fed powder diet containing adenine (ADE) (0·75% w/w in feed). The fourth group was fed like in the third group, plus GumA in drinking water (15%, w/v). ADE feeding induced CRF (as measured by several physiological, biochemical and histological indices) and also caused a significant genetic damage and significant decreases in urinary 8-oxo Gua and 8-oxoGuo, but not in the other nucleic acids. However, concomitant GumA treatment reduced the level of genetic damage in kidney cells as detected by Comet assay and significantly reversed the effect of adenine on urinary 8-oxoGuo. Treatment with GumA is able to mitigate genetic damage in renal tissues of rats with ADE-induced CRF. © 2015 Stichting European Society for Clinical Investigation Journal Foundation.

  3. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions (United States)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.


    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  4. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions. (United States)

    Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B


    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  5. Regulation of bovine kidney alpha-ketoglutarate dehydrogenase complex by calcium ion and adenine nucleotides. Effects on S0.5 for alpha-ketoglutarate. (United States)

    Lawlis, V B; Roche, T E


    Regulation of bovine kidney alpha-ketoglutarate dehydrogenase complex by energy-linked metabolites was investigated. Ca2+, ADP, or inorganic phosphate markedly enhanced the activity of the complex, and ATP or, to a lesser extent, GTP decreased the activity of the complex. Initial velocity studies with alpha-ketoglutarate as the varied substrate demonstrated that these modulators induced large changes in S0.5 for alpha-ketoglutarate (based on analysis in Hill plots) with no change in the maximum velocity (as determined by double-reciprocal plots). For all conditions studied, the Hill coefficients were significantly less than 1.0 with slopes that were linear over wide ranges of alpha-ketoglutarate concentrations, indicating negative cooperativity that probably resulted from multiple site-site interactions. Ca2+ (maintained at 10 muM by a Ca2+ buffer) decreased the S0.5 for alpha-ketoglutarate 63-fold (from 25 to 0.40 mM); even in the presence of a positive effector, ADP or phosphate, Ca2+ decreased the S0.5 for alpha-ketoglutarate 7.8- or 28-fold, respectively. Consistent with a mechanism of action dependent of Ca2+, ADP (1.60 mM) or phosphate (20 mM) reduced the S0.5 for alpha-ketoglutarate in the presence of Ca2+ (i.e., 4.5- or 1.67-fold, respectively); however, these effectors elicited larger decreases in S0.5 in the absence of Ca2+ (i.e., 37- or 3.7-fold, respectively). ATP (1.6 mM) increased the S0.5 for alpha-ketoglutarate, and Ca2+ appreciably reduced the effect, lowering the S0.5 98-fold from 66 to 0.67 mM. Thus the activity of the kidney alpha-ketoglutarate dehydrogenase complex is poised to increase as the energy potential in mitochondria declines, and Ca2+ has a pronounced modulatory effect. Comparative studies on bovine heart alpha-ketoglutarate dehydrogenase complex and the effects of varying the ADP/ATP ratio in the presence or absence of Ca2+ or phosphate are also described.

  6. Role of thiol homeostasis and adenine nucleotide metabolism in the protective effects of fructose in quinone-induced cytotoxicity in rat hepatocytes

    NARCIS (Netherlands)

    Toxopeus, C.; van Holsteijn, I.; de Winther, M. P.; van den Dobbelsteen, D.; Horbach, G. J.; Blaauboer, B. J.; Noordhoek, J.


    Freshly-isolated rat hepatocytes were exposed in glucose (15 mM) or fructose (5 mM) medium to menadione (2-methyl-1,4-naphthoquinone) (85 microM) or 1,4-naphthoquinone (NQ) (50 microM). Menadione and NQ are closely related quinones and have an approximately equal potential to induce redox cycling.

  7. Nicotinamide nucleotide transhydrogenase from Rhodobacter capsulatus; the H+/H- ratio and the activation state of the enzyme during reduction of acetyl pyridine adenine dinucleotide. (United States)

    Palmer, T; Jackson, J B


    Chromatophores from Rhodobacter capsulatus were incubated in the dark with NADPH and acetylpyridineadenine dinucleotide (AcPdAD+) in the presence of different concentrations of myxothiazol. The transhydrogenase activity was monitored until an appropriate mass action ratio, [AcPdAD+][NADPH]/[AcPdADH][NADP+], was reached. The sample was then illuminated and the initial rate of either AcPdAD+ reduction by NADPH or AcPdADH oxidation by NADP+ was recorded. The ratio of H+ translocated per H- equivalent transferred by transhydrogenase was calculated from the value of the membrane potential (delta pH = 0) at which illumination caused no net reaction in either direction. The mean value for the H+/H- ratio was 0.55. At greater values of [AcPdAD+][NADPH]/[AcPdADH][NADP+] than were employed in the above experiments and over a wider range of concentrations of myxothiazol, it was found that incremental increases in the membrane potential always gave rise to a decrease, never an increase in the rate of AcPdAD+ reduction. In contrast to the H(+)-ATP synthase, there is no evidence of any activation/deactivation of H(+)-transhydrogenase by the protonmotive force.

  8. In vitro studies of immunoglobulin heavy-chain binding protein (BiP, GRP78). Interactions of BiP with newly synthesized proteins and adenine nucleotides

    International Nuclear Information System (INIS)

    Kassenbrock, C.K.


    Here we examine the interaction of BiP with newly synthesized polypeptides in an in vitro protein translations-translocation system. We find that BiP forms tight complexes with nonglycosylated yeast invertase and incorrectly disulfide-bonded prolactin but not with glycosylated invertase or correctly disulfide-bonded prolactin. Moreover, BiP associates detectably only with completed chains of prolactin, not with chains undergoing synthesis. We conclude that BiP recognizes and binds with high affinity to aberrantly folded or aberrantly glycosylated polypeptides in vitro, but not to all nascent chains as they are folding. BiP also binds APT and can be purified by APT affinity chromatography. We show that submicromolar levels of ATP or ADP decrease the rate of absorption of 125 I-BiP to nitrocellulose filters coated with protein or nonionic detergents. ATP and ADP also protect portions of BiP from proteolytic degradation. In contrast, micromolar levels of AMP increase the rate of adsorption and the rate of proteolytic degradation of BiP. We also show that an ATPase activity co-purifies with BiP, but its slow turnover number suggests a regulatory, rather than a functional role. The BiP-associated ATPase shares several properties with the related cytoplasmic protein, HSC70/clathrin uncoating ATPase

  9. The effect of solvation on the radiation damage rate constants for adenine

    DEFF Research Database (Denmark)

    Milhøj, Birgitte Olai; Sauer, Stephan P. A.


    in calculations of Gibbs free energies and reaction rates for the reaction between the OH radical and the DNA nucleobase adenine using Density Functional Theory at the ωB97X-D/6-311++G(2df,2pd) level with the Eckart tunneling correction. The solvent, water, has been included through either the implicit...... polarizable continuum model (PCM) or through explicit modelling of micro-solvation by a single water molecule at the site of reaction as well as the combination of both. Scrutiny of the thermodynamics and kinetics of the individual sub-reactions suggests that the qualitative differences introduced...

  10. Synthesis of coenzyme A and nicotineamide-adenine dinucleotide labelled with tritium

    International Nuclear Information System (INIS)

    Sidorov, G.V.; Zverkov, Yu.B.; Myasoedov, N.F.


    Isotopic exchange in solution with tritium water and with gaseous tritium and solid-phase reaction of isotopic exchange of NAD with tritium were investigated. For synthesis of labelled with tritium coenzyme A solid-phase reaction of isotopic exchange with gaseous tritium was used. It was determined that 98% of tritium was contained in nicotineamide part of molecule of NAD. In the case of coenzyme A studying of intramolecular distribution of tritium demonstrated that 90% of tritium were localized in adenine fragment [ru

  11. Trichomonas vaginalis NTPDase and ecto-5'-nucleotidase hydrolyze guanine nucleotides and increase extracellular guanosine levels under serum restriction. (United States)

    Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana


    Trichomonas vaginalis is the aethiologic agent of trichomoniasis, the most common non-viral sexually transmitted disease in the world. The purinergic signaling pathway is mediated by extracellular nucleotides and nucleosides that are involved in many biological effects as neurotransmission, immunomodulation and inflammation. Extracellular nucleotides can be hydrolyzed by a family of enzymes known as ectonucleotidases including the ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) family which hydrolyses nucleosides triphosphate and diphosphate as preferential substrates and ecto-5'-nucleotidase which catalyzes the conversion of monophosphates into nucleosides. In T. vaginalis the E-NTPDase and ecto-5'-nucleotidase activities upon adenine nucleotides have already been characterized in intact trophozoites but little is known concerning guanine nucleotides and nucleoside. These enzymes may exert a crucial role on nucleoside generation, providing the purine sources for the synthesis de novo of these essential nutrients, sustaining parasite growth and survival. In this study, we investigated the hydrolysis profile of guanine-related nucleotides and nucleoside in intact trophozoites from long-term-grown and fresh clinical isolates of T. vaginalis. Knowing that guanine nucleotides are also substrates for T. vaginalis ectoenzymes, we evaluated the profile of nucleotides consumption and guanosine uptake in trophozoites submitted to a serum limitation condition. Results show that guanine nucleotides (GTP, GDP, GMP) were substrates for T. vaginalis ectonucleotidases, with expected kinetic parameters for this enzyme family. Different T. vaginalis isolates (two from the ATCC and nine fresh clinical isolates) presented a heterogeneous hydrolysis profile. The serum culture condition increased E-NTPDase and ecto-5'-nucleotidase activities with high consumption of extracellular GTP generating enhanced GDP, GMP and guanosine levels as demonstrated by HPLC, with final

  12. CeO{sub 2} nanoparticles decorated multi-walled carbon nanotubes for electrochemical determination of guanine and adenine

    Energy Technology Data Exchange (ETDEWEB)

    Wei Yan [College of Chemistry and Materials Sciences, Anhui Normal University, Wuhu 241000 (China); Department of Chemistry, Wannan Medical College, Wuhu 241002 (China); Huang Qinan [Department of Chemistry, Wannan Medical College, Wuhu 241002 (China); Li Maoguo [College of Chemistry and Materials Sciences, Anhui Normal University, Wuhu 241000 (China); Huang Xingjiu [Institute of Intelligent Machines, Chinese Academy of Sciences, Hefei 230031 (China); Fang Bin, E-mail: [College of Chemistry and Materials Sciences, Anhui Normal University, Wuhu 241000 (China); Wang Lun, E-mail: [College of Chemistry and Materials Sciences, Anhui Normal University, Wuhu 241000 (China)


    Sub-10 nm CeO{sub 2} nanoparticles decorated multi-walled carbon nanotubes has been constructed for electrochemial determination of guanine and adenine. Transmission electron microscopy (TEM) and X-ray diffraction (XRD) were used to characterize the nanoparticles CeO{sub 2}/MWCNTs. Electrochemical impedance spectroscopy (EIS) was used to characterize the electrode modifying process. Cyclic voltammetry (CV) and differential pulse voltammetry (DPV) were used to study the electrocatalytic activity toward the electrochemical oxidation of guanine and adenine. The detection limit (S/N = 3) for adenine and guanine was found to be 20 and 10 nM, respectively. The obtained sensitivity toward guanine and adenine was 1.26 and 1.13 {mu}A/{mu}M in the linear concentration range 5-50 {mu}M and 5-35 {mu}M, respectively. These results demonstrate that the carbon nanotubes could provide huge locations and facilitate the adsorptive accumulation of the guanine and adenine, and the CeO{sub 2} nanoparticles are promising substrates for the development of high-performance electrocatalysts for biosensing.

  13. Synthesis, spectroscopic, structural and thermal characterizations of vanadyl(IV) adenine complex prospective as antidiabetic drug agent (United States)

    El-Megharbel, Samy M.; Hamza, Reham Z.; Refat, Moamen S.


    The vanadyl(IV) adenine complex; [VO(Adn)2]ṡSO4; was synthesized and characterized. The molar conductivity of this complex was measured in DMSO solution that showed an electrolyte nature. Spectroscopic investigation of the green solid complex studied here indicate that the adenine acts as a bidentate ligand, coordinated to vanadyl(IV) ions through the nitrogen atoms N7 and nitrogen atom of amino group. Thus, from the results presented the vanadyl(IV) complex has square pyramid geometry. Further characterizations using thermal analyses and scanning electron techniques was useful. The aim of this paper was to introduce a new drug model for the diabetic complications by synthesized a novel mononuclear vanadyl(IV) adenine complex to mimic insulin action and reducing blood sugar level. The antidiabetic ability of this complex was investigated in STZ-induced diabetic mice. The results suggested that VO(IV)/adenine complex has antidiabetic activity, it improved the lipid profile, it improved liver and kidney functions, also it ameliorated insulin hormone and blood glucose levels. The vanadyl(IV) complex possesses an antioxidant activity and this was clear through studying SOD, CAT, MDA, GSH and methionine synthase. The current results support the therapeutic potentiality of vanadyl(IV)/adenine complex for the management and treatment of diabetes.

  14. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.


    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  15. Synthesis of adenine mediated superparamagnetic colloidal β-FeOOH nanostructure(s): study of their morphological changes and magnetic behavior

    International Nuclear Information System (INIS)

    Kumar, Anil; Gupta, Sudhir Kumar


    This paper describes the synthesis of adenine-mediated superparamagnetic β-FeOOH nanostructures in aqueous medium. Capping by adenine provides a synthetic control to manipulate their size, morphology, optical and magnetization properties. β-FeOOH binds to adenine mainly through –NH 2 , N(3); N(9)H and N(7) of the pyridine and imidazole rings, respectively. At low [adenine], it produces nanorods, but at higher [adenine] (>1 × 10 −2 mol dm −3 ), increasing numbers of spherical nanoparticles encapsulating β-FeOOH with an average diameter of 2.5 nm in the core and adenine molecules in the shell are obtained, causing an increase in the specific surface area by about twofold. Dynamic light scattering technique also depicts a regular decrease in their hydrodynamic size with increasing [adenine] and exhibits the highest stability with a zeta potential of ∼67 mV for the sample containing 2 × 10 −2 mol dm −3 adenine (SP5). An increasing [adenine] from 1 × 10 −3 to 2 × 10 −2 mol dm −3 in these samples enhanced the value of saturation magnetization (M S ), due to β-FeOOH, gradually from 2.0 to 6.9 emu g −1 at 300 K, but at S at 300 K having potential for environmental and biological applications.

  16. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator. (United States)

    Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V


    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Nucleotide variability in the 5-enolpyruvylshikimate-3-phosphate synthase gene from Eleusine indica (L.) Gaertn. (United States)

    Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S


    This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.

  18. Influence of gamma irradiation and benzyl adenine on keeping quality of custard apple fruits during storage. (United States)

    Chouksey, Swati; Singh, Alpana; Thakur, Rajendra Singh; Deshmukh, Reena


    The custard apple (Annona squamosa) fruits were procured from local market, irradiated with radiation doses 0, 0.25, 0.50, 0.75, 1.00, 1.25, 1.50, 1.75 kGy and then treated with benzyl adenine (50 and 100 part per million) and stored at ambient temperature (25 ± 5 °C, Relative Humidity 90 ± 2%) for 12 days. The treated fruits were evaluated for sensory (viz; flavour, texture, internal and external colour) and chemical constituents (viz; Total Soluble Solids, titrable acidity, ascorbic acid, free soluble sugar, reducing sugar. non reducing sugar, carbohydrate) during storage. The study concluded that radiation dose of 1.5 kilo Gray along with 50 ppm benzyl adenine enhanced in shelf-life of custard apple fruits by 6 days at ambient temperature with good pulp texture, flavour, colour and nutritional quality as compared to control.

  19. Biofabrication of chitosan-silver composite SERS substrates enabling quantification of adenine by a spectroscopic shift

    International Nuclear Information System (INIS)

    Luo, X L; Bentley, W E; Buckhout-White, S; Rubloff, G W


    Surface-enhanced Raman scattering (SERS) has grown dramatically as an analytical tool for the sensitive and selective detection of molecules adsorbed on nano-roughened noble metal structures. Quantification with SERS based on signal intensity remains challenging due to the complicated fabrication process to obtain well-dispersed nanoparticles and well-ordered substrates. We report a new biofabrication strategy of SERS substrates that enable quantification through a newly discovered spectroscopic shift resulting from the chitosan-analyte interactions in solution. We demonstrate this phenomenon by the quantification of adenine, which is an essential part of the nucleic acid structure and a key component in pathways which generate signal molecules for bacterial communications. The SERS substrates were fabricated simply by sequential electrodeposition of chitosan on patterned gold electrodes and electroplating of a silver nitrate solution through the chitosan scaffold to form a chitosan-silver nanoparticle composite. Active SERS signals of adenine solutions were obtained in real time from the chitosan-silver composite substrates with a significant concentration-dependent spectroscopic shift. The Lorentzian curve fitting of the dominant peaks suggests the presence of two separate peaks with a concentration-dependent area percentage of the separated peaks. The chitosan-mediated composite SERS substrates can be easily biofabricated on predefined electrodes within microfluidic channels for real-time detection in microsystems.

  20. Control of box C/D snoRNP assembly by N6-methylation of adenine. (United States)

    Huang, Lin; Ashraf, Saira; Wang, Jia; Lilley, David Mj


    N 6 -methyladenine is the most widespread mRNA modification. A subset of human box C/D snoRNA species have target GAC sequences that lead to formation of N 6 -methyladenine at a key trans Hoogsteen-sugar A·G base pair, of which half are methylated in vivo The GAC target is conserved only in those that are methylated. Methylation prevents binding of the 15.5-kDa protein and the induced folding of the RNA Thus, the assembly of the box C/D snoRNP could in principle be regulated by RNA methylation at its critical first stage. Crystallography reveals that N 6 -methylation of adenine prevents the formation of trans Hoogsteen-sugar A·G base pairs, explaining why the box C/D RNA cannot adopt its kinked conformation. More generally, our data indicate that sheared A·G base pairs (but not Watson-Crick base pairs) are more susceptible to disruption by N 6 mA methylation and are therefore possible regulatory sites. The human signal recognition particle RNA and many related Alu retrotransposon RNA species are also methylated at N6 of an adenine that forms a sheared base pair with guanine and mediates a key tertiary interaction. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  1. High-NaCl diet impairs dynamic renal blood flow autoregulation in rats with adenine-induced chronic renal failure

    DEFF Research Database (Denmark)

    Saeed, Aso; DiBona, Gerald F; Grimberg, Elisabeth


    This study examined the effects of 2 wk of high-NaCl diet on kidney function and dynamic renal blood flow autoregulation (RBFA) in rats with adenine-induced chronic renal failure (ACRF). Male Sprague-Dawley rats received either chow containing adenine or were pair-fed an identical diet without...... arterial pressure variability (SAPV), and heart rate variability were assessed by spectral analytical techniques. Rats with ACRF showed marked reductions in glomerular filtration rate and renal blood flow (RBF), whereas mean arterial pressure and SAPV were significantly elevated. In addition, spontaneous...... adenine (controls). After 10 wk, rats were randomized to either remain on the same diet (0.6% NaCl) or to be switched to high 4% NaCl chow. Two weeks after randomization, renal clearance experiments were performed under isoflurane anesthesia and dynamic RBFA, baroreflex sensitivity (BRS), systolic...

  2. Modeling the high-energy electronic state manifold of adenine: Calibration for nonlinear electronic spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Nenov, Artur, E-mail:; Giussani, Angelo; Segarra-Martí, Javier; Jaiswal, Vishal K. [Dipartimento di Chimica “G. Ciamician,” Università di Bologna, Via Selmi 2, IT-40126 Bologna (Italy); Rivalta, Ivan [Université de Lyon, CNRS, Institut de Chimie de Lyon, École Normale Supérieure de Lyon, 46 Allée d’Italie, F-69364 Lyon Cedex 07 (France); Cerullo, Giulio [Dipartimento di Fisica, Politecnico di Milano, IFN-CNR, Piazza Leonardo Da Vinci 32, IT-20133 Milano (Italy); Mukamel, Shaul [Department of Chemistry, University of California, Irvine, California 92697-2025 (United States); Garavelli, Marco, E-mail:, E-mail: [Dipartimento di Chimica “G. Ciamician,” Università di Bologna, Via Selmi 2, IT-40126 Bologna (Italy); Université de Lyon, CNRS, Institut de Chimie de Lyon, École Normale Supérieure de Lyon, 46 Allée d’Italie, F-69364 Lyon Cedex 07 (France)


    Pump-probe electronic spectroscopy using femtosecond laser pulses has evolved into a standard tool for tracking ultrafast excited state dynamics. Its two-dimensional (2D) counterpart is becoming an increasingly available and promising technique for resolving many of the limitations of pump-probe caused by spectral congestion. The ability to simulate pump-probe and 2D spectra from ab initio computations would allow one to link mechanistic observables like molecular motions and the making/breaking of chemical bonds to experimental observables like excited state lifetimes and quantum yields. From a theoretical standpoint, the characterization of the electronic transitions in the visible (Vis)/ultraviolet (UV), which are excited via the interaction of a molecular system with the incoming pump/probe pulses, translates into the determination of a computationally challenging number of excited states (going over 100) even for small/medium sized systems. A protocol is therefore required to evaluate the fluctuations of spectral properties like transition energies and dipole moments as a function of the computational parameters and to estimate the effect of these fluctuations on the transient spectral appearance. In the present contribution such a protocol is presented within the framework of complete and restricted active space self-consistent field theory and its second-order perturbation theory extensions. The electronic excited states of adenine have been carefully characterized through a previously presented computational recipe [Nenov et al., Comput. Theor. Chem. 1040–1041, 295-303 (2014)]. A wise reduction of the level of theory has then been performed in order to obtain a computationally less demanding approach that is still able to reproduce the characteristic features of the reference data. Foreseeing the potentiality of 2D electronic spectroscopy to track polynucleotide ground and excited state dynamics, and in particular its expected ability to provide

  3. Few-layer graphene sheets with embedded gold nanoparticles for electrochemical analysis of adenine

    Directory of Open Access Journals (Sweden)

    Biris AR


    Full Text Available Alexandru R Biris,1 Stela Pruneanu,1 Florina Pogacean,1 Mihaela D Lazar,1 Gheorghe Borodi,1 Stefania Ardelean,1 Enkeleda Dervishi,2 Fumiya Watanabe,2 Alexandru S Biris2 1National Institute for Research and Development of Isotopic and Molecular Technologies, Cluj-Napoca, Romania; 2Center for Integrative Nanotechnology Sciences, University of Arkansas at Little Rock, Little Rock, AR, USA Abstract: This work describes the synthesis of few-layer graphene sheets embedded with various amounts of gold nanoparticles (Gr-Au-x over an Aux/MgO catalytic system (where x = 1, 2, or 3 wt%. The sheet-like morphology of the Gr-Au-x nanostructures was confirmed by transmission electron microscopy and high resolution transmission electron microscopy, which also demonstrated that the number of layers within the sheets varied from two to seven. The sample with the highest percentage of gold nanoparticles embedded within the graphitic layers (Gr-Au-3 showed the highest degree of crystallinity. This distinct feature, along with the large number of edge-planes seen in high resolution transmission electron microscopic images, has a crucial effect on the electrocatalytic properties of this material. The reaction yields (40%–50% and the final purity (96%–98% of the Gr-Au-x composites were obtained by thermogravimetric analysis. The Gr-Au-x composites were used to modify platinum substrates and subsequently to detect adenine, one of the DNA bases. For the bare electrode, no oxidation signal was recorded. In contrast, all of the modified electrodes showed a strong electrocatalytic effect, and a clear peak for adenine oxidation was recorded at approximately +1.05 V. The highest increase in the electrochemical signal was obtained using a platinum/Gr-Au-3-modified electrode. In addition, this modified electrode had an exchange current density (I0, obtained from the Tafel plot one order of magnitude higher than that of the bare platinum electrode, which also confirmed that

  4. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)


    Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

  5. Nucleotide excision repair in the test tube.

    NARCIS (Netherlands)

    N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)


    textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

  6. On the existence of the H3 tautomer of adenine in aqueous solution. Rationalizations based on hybrid quantum mechanics/molecular mechanics predictions

    DEFF Research Database (Denmark)

    Aidas, Kestutis; Mikkelsen, Kurt V; Kongsted, Jacob


    The (15)N NMR spectrum of adenine in aqueous solution has been modeled using high-level combined density functional theory/molecular mechanics techniques coupled to a dynamical averaging scheme. The explicit consideration of the three lowest-energy tautomers of adenine-H9, H7 and H3-allows...

  7. Metal-adeninate vertices for the construction of an exceptionally porous metal-organic framework. (United States)

    An, Jihyun; Farha, Omar K; Hupp, Joseph T; Pohl, Ehmke; Yeh, Joanne I; Rosi, Nathaniel L


    Metal-organic frameworks comprising metal-carboxylate cluster vertices and long, branched organic linkers are the most porous materials known, and therefore have attracted tremendous attention for many applications, including gas storage, separations, catalysis and drug delivery. To increase metal-organic framework porosity, the size and complexity of linkers has increased. Here we present a promising alternative strategy for constructing mesoporous metal-organic frameworks that addresses the size of the vertex rather than the length of the organic linker. This approach uses large metal-biomolecule clusters, in particular zinc-adeninate building units, as vertices to construct bio-MOF-100, an exclusively mesoporous metal-organic framework. Bio-MOF-100 exhibits a high surface area (4,300 m(2) g(-1)), one of the lowest crystal densities (0.302 g cm(-3)) and the largest metal-organic framework pore volume reported to date (4.3 cm(3) g(-1)).

  8. Structural study and investigation of NMR tensors in interaction of dopamine with Adenine and guanine

    Directory of Open Access Journals (Sweden)

    Lingjia Xu


    Full Text Available The interaction of dopamine with adenine and guanine were studied at the Hartree-Fock level theory. The structural and vibrational properties of dopamine-4-N7GUA and dopamine-4-N3ADE were studied at level of HF/6-31G*. Interaction energies (ΔE were calculated to be -11.49 and -11.92 kcal/mol, respectively. Some of bond lengths, angels and tortions are compared. NBO studies were performed to the second-order and perturbative estimates of donor-acceptor interaction have been done. The procedures of gauge-invariant atomic orbital (GIAO and continuous-set-of-gauge-transformation (CSGT were employed to calculate isotropic shielding, chemical shifts anisotropy and chemical shifts anisotropy asymmetry and effective anisotropy using 6-31G* basis set. These calculations yielded molecular geometries in good agreement with available experimental data.

  9. Animal models of pediatric chronic kidney disease. Is adenine intake an appropriate model?

    Directory of Open Access Journals (Sweden)

    Débora Claramunt


    Full Text Available Pediatric chronic kidney disease (CKD has peculiar features. In particular, growth impairment is a major clinical manifestation of CKD that debuts in pediatric age because it presents in a large proportion of infants and children with CKD and has a profound impact on the self-esteem and social integration of the stunted patients. Several factors associated with CKD may lead to growth retardation by interfering with the normal physiology of growth plate, the organ where longitudinal growth rate takes place. The study of growth plate is hardly possible in humans and justifies the use of animal models. Young rats made uremic by 5/6 nephrectomy have been widely used as a model to investigate growth retardation in CKD. This article examines the characteristics of this model and analyzes the utilization of CKD induced by high adenine diet as an alternative research protocol.

  10. Red blood cell aging markers during storage in citrate-phosphate-dextrose-saline-adenine-glucose-mannitol. (United States)

    Antonelou, Marianna H; Kriebardis, Anastasios G; Stamoulis, Konstantinos E; Economou-Petersen, Effrosini; Margaritis, Lukas H; Papassideri, Issidora S


    It has been suggested that red blood cell (RBC) senescence is accelerated under blood bank conditions, although neither protein profile of RBC aging nor the impact of additive solutions on it have been studied in detail. RBCs and vesicles derived from RBCs in both citrate-phosphate-dextrose (CPD)-saline-adenine-glucose-mannitol (SAGM) and citrate-phosphate-dextrose-adenine (CPDA) were evaluated for the expression of cell senescence markers (vesiculation, protein aggregation, degradation, activation, oxidation, and topology) through immunoblotting technique and immunofluorescence or immunoelectron microscopy study. A group of cellular stress proteins exhibited storage time- and storage medium-related changes in their membrane association and exocytosis. The extent, the rate, and the expression of protein oxidation, Fas oligomerization, caspase activation, and protein modifications in Band 3, hemoglobin, and immunoglobulin G were less conspicuous and/or exhibited significant time retardation under storage in CPD-SAGM, compared to the CPDA storage. There was evidence for the localization of activated caspases near to the membrane of both cells and vesicles. We provide circumstantial evidence for a lower protein oxidative damage in CPD-SAGM-stored RBCs compared to the CPDA-stored cells. The different expression patterns of the senescence markers in the RBCs seem to be accordingly related to the oxidative stress management of the cells. We suggest that the storage of RBCs in CPD-SAGM might be more alike the in vivo RBC aging process, compared to storage in CPDA, since it is characterized by a slower stimulation of the recognition signaling pathways that are already known to trigger the erythrophagocytosis of senescent RBCs.

  11. Quantum-chemical studies on the favored and rare tautomers of neutral and redox adenine. (United States)

    Raczyńska, Ewa D; Makowski, Mariusz; Zientara-Rytter, Katarzyna; Kolczyńska, Katarzyna; Stępniewski, Tomasz M; Hallmann, Małgorzata


    All possible twenty-three prototropic tautomers of neutral and redox adenine (nine amine and fourteen imine forms, including geometric isomerism of the exo ═NH group) were examined in vacuo {DFT(B3LYP)/6-311+G(d,p)}. The NH → NH conversions as well as those usually omitted, NH → CH and CH → CH, were considered. An interesting change of the tautomeric preference occurs when proceeding from neutral to reduced adenine. One-electron reduction favors the nonaromatic amine C8H-N10H tautomer. This tautomeric preference is similar to that (C2H) for reduced imidazole. Water molecules (PCM model) seem to not change this trend. They influence solely the relative energies. The DFT vertical detachment energy in the gas phase is positive for each tautomer, e.g., 0.03 eV for N9H-N10H and 1.84 eV for C8H-N10H. The DFT adiabatic electron affinity for the favored process, neutral N9H-N10H → reduced C8H-N10H (ground states), is equal to 0.18 eV at 0 K (ZPE included). One-electron oxidation does not change the tautomeric preference in the gas phase. The aromatic amine N9H-N10H tautomer is favored for the oxidized molecule similarly as for the neutral one. The DFT adiabatic ionization potential for the favored process, neutral N9H-N10H → oxidized N9H-N10H (ground states), is equal to 8.12 eV at 0 K (ZPE included). Water molecules (PCM model) seem to influence solely the composition of the tautomeric mixture and the relative energies. They change the energies of the oxidation and reduction processes by ca. 2 eV.

  12. Effect of adenine on bacterial translocation using technetium-99m labeled E. coli in an intestinal obstruction model in rats

    International Nuclear Information System (INIS)

    Ugur Oflaz; Fatma Yurt Lambrecht; Osman Yilmaz; Cetin Pekcetin


    This study aims to investigate effects of adenine on bacterial translocation (BT) using 99m Tc-labeled E. coli in an intestinal obstruction rat model. In the study twenty-one rats were used. The rats were divided into three groups according to different feeding patterns. The control group (CG) was fed with a standard chow diet for 7 days. Group A1 and group A2 were fed with adenine supplemented chow diet for 7 days. At the end of the feeding period, after all groups was submitted intestinal obstruction. 99m Tc-E. coli was injected into the rats' terminal ileum under anesthetic. The rats were sacrificed under aseptic conditions at 24th h after the surgery. The uptake of 99m Tc-E. coli was determined in organs such as the liver, mesenteric lymph nodes, spleen and ileum. Group A1 and group A2 results show that the uptake of 99m Tc-E. coli decreased in the blood and organs comparing to the CG. As a result, it was observed that adenine reduced the level of BT when compared with CG. The beneficial effect of adenine on BT in intestinal obstruction was observed. However, further studies are needed to more clearly assess how this benefit can be achieved. (author)

  13. Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.


    Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

  14. Kinetics and thermodynamics of the reaction between the •OH radical and adenine – a theoretical investigation

    DEFF Research Database (Denmark)

    Milhøj, Birgitte Olai; Sauer, Stephan P. A.


    the computational method is validated by considering the hydrogen abstraction from the heterocyclic N9 nitrogen in adenine as a test system. Geometries for all molecules in the reaction are optimised with four different DFT exchange-correlation functionals (B3LYP, BHandHLYP, M06-2X and wB97X-D), in combination...

  15. The incorporation of 14C-adenine into the oocytes of Asellus aquaticus as studied by autoradiography

    NARCIS (Netherlands)

    Broek, C.J.H. van den; Tates, A.D.

    Asellus aquaticus females were injected with 8-14C-adenine, fixed after 3 hours and sectioned. In coated autoradiographs, the number of β-tracks from 14C were counted over nucleolus, nucleus and cytoplasm of the oocytes at various stages of their development. Incorporation into nucleolar RNA, being

  16. Electrochemical behaviors and simultaneous determination of guanine and adenine based on graphene–ionic liquid–chitosan composite film modified glassy carbon electrode

    International Nuclear Information System (INIS)

    Niu Xiuli; Yang Wu; Ren Jie; Guo Hao; Long Shijia; Chen Jiaojiao; Gao Jinzhang


    Highlights: ► This work developed a novel electrochemical biosensors for guanine and adenine detection simultaneously. ► A disposable electrode based on graphene sheets, ionic liquid and chitosan was proposed. ► The presented method was also applied to simultaneous determination of guanine and adenine in denatured DNA samples with satisfying results. ► Easy fabrication, high sensitivity, excellent reproducibility and long-term stability. - Abstract: A graphene sheets (GS), ionic liquid (IL) and chitosan (CS) modified electrode was fabricated and the modified electrode displayed excellent electrochemical catalytic activities toward guanine and adenine. The transfer electron number (n) and the charge transfer coefficient (α) were calculated with the result as n = 2, α = 0.58 for guanine, and n = 2, α = 0.51 for adenine, which indicated the electrochemical oxidation of guanine and adenine on GS/IL/CS modified electrode was a two-electron and two-proton process. The oxidation overpotentials of guanine and adenine were decreased significantly compared with those obtained at the bare glassy carbon electrode and multi-walled carbon nanotubes modified electrode. The modified electrode exhibited good analytical performance and was successfully applied for individual and simultaneous determination of guanine and adenine. Low detection limits of 0.75 μM for guanine and 0.45 μM for adenine were obtained, with the linear calibration curves over the concentration range 2.5–150 μM and 1.5–350 μM, respectively. At the same time, the proposed method was successfully applied for the determination of guanine and adenine in denatured DNA samples with satisfying results. Moreover, the GS/IL/CS modified electrode exhibited good sensitivity, long-term stability and reproducibility for the determination of guanine and adenine.

  17. Pyridine nucleotide cycling and control of intracellular redox state in relation to poly (ADP-ribose) polymerase activity and nuclear localization of glutathione during exponential growth of Arabidopsis cells in culture. (United States)

    Pellny, Till K; Locato, Vittoria; Vivancos, Pedro Diaz; Markovic, Jelena; De Gara, Laura; Pallardó, Federico V; Foyer, Christine H


    Pyridine nucleotides, ascorbate and glutathione are major redox metabolites in plant cells, with specific roles in cellular redox homeostasis and the regulation of the cell cycle. However, the regulation of these metabolite pools during exponential growth and their precise functions in the cell cycle remain to be characterized. The present analysis of the abundance of ascorbate, glutathione, and pyridine nucleotides during exponential growth of Arabidopsis cells in culture provides evidence for the differential regulation of each of these redox pools. Ascorbate was most abundant early in the growth cycle, but glutathione was low at this point. The cellular ascorbate to dehydroascorbate and reduced glutathione (GSH) to glutathione disulphide ratios were high and constant but the pyridine nucleotide pools were largely oxidized over the period of exponential growth and only became more reduced once growth had ceased. The glutathione pool increased in parallel with poly (ADP-ribose) polymerase (PARP) activities and with increases in the abundance of PARP1 and PARP2 mRNAs at a time of high cell cycle activity as indicated by transcriptome information. Marked changes in the intracellular partitioning of GSH between the cytoplasm and nucleus were observed. Extension of the exponential growth phase by dilution or changing the media led to increases in the glutathione and nicotinamide adenine dinucleotide, oxidized form (NAD)-plus-nicotinamide adenine dinucleotide, reduced form (NADH) pools and to higher NAD/NADH ratios but the nicotinamide adenine dinucleotide phosphate, oxidized form (NADP)-plus-nicotinamide adenine dinucleotide phosphate, reduced form (NADPH) pool sizes, and NAPD/NADPH ratios were much less affected. The ascorbate, glutathione, and pyridine nucleotide pools and PARP activity decreased before the exponential growth phase ended. We conclude that there are marked changes in intracellular redox state during the growth cycle but that redox homeostasis is

  18. Polymerization of amino acids containing nucleotide bases (United States)

    Ben Cheikh, Azzouz; Orgel, Leslie E.


    The nucleoamino acids 1-(3'-amino,3'-carboxypropyl)uracil (3) and 9-(3'-amino,3'-carboxypropyl)adenine (4) have been prepared as (L)-en-antiomers and as racemic mixtures. When 3 or 4 is suspended in water and treated with N,N'-carbon-yldiimidazole, peptides are formed in good yield. The products formed from the (L)-enantiomers are hydrolyzed to the monomeric amino acids by pronase. Attempts to improve the efficiency of these oligomerizations by including a polyuridylate template in the reaction mixture were not successful. Similarly, oligomers derived from the (L)-enantiomer of 3 did not act as templates to facilitate the oligomerization of 4.

  19. A Nucleotide Phosphatase Activity in the Nucleotide Binding Domain of an Orphan Resistance Protein from Rice* (United States)

    Fenyk, Stepan; de San Eustaquio Campillo, Alba; Pohl, Ehmke; Hussey, Patrick J.; Cann, Martin J.


    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack. PMID:22157756

  20. A nucleotide phosphatase activity in the nucleotide binding domain of an orphan resistance protein from rice. (United States)

    Fenyk, Stepan; Campillo, Alba de San Eustaquio; Pohl, Ehmke; Hussey, Patrick J; Cann, Martin J


    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack.

  1. Actinides and rare earths complexation with adenosine phosphate nucleotides

    International Nuclear Information System (INIS)

    Mostapha, Sarah


    Organophosphorus compounds are important molecules in both nuclear industry and living systems fields. Indeed, several extractants of organophosphorus compounds (such as TBP, HDEHP) are used in the nuclear fuel cycle reprocessing and in the biological field. For instance, the nucleotides are organophosphates which play a very important role in various metabolic processes. Although the literature on the interactions of actinides with inorganic phosphate is abundant, published studies with organophosphate compounds are generally limited to macroscopic and / or physiological approaches. The objective of this thesis is to study the structure of several organophosphorus compounds with actinides to reach a better understanding and develop new specific buildings blocks. The family of the chosen molecules for this procedure consists of three adenine nucleotides mono, bi and triphosphate (AMP, adenosine monophosphate - ADP, adenosine diphosphate - ATP, adenosine triphosphate) and an amino-alkylphosphate (AEP O-phosphoryl-ethanolamine). Complexes synthesis was conducted in aqueous and weakly acidic medium (2.8-4) for several lanthanides (III) (Lu, Yb, Eu) and actinides (U (VI), Th (IV) and Am (III)). Several analytical and spectroscopic techniques have been used to describe the organization of the synthesized complexes: spectrometric analysis performed by FTIR and NMR were used to identify the functional groups involved in the complexation, analysis by ESI-MS and pH-metric titration were used to determine the solution speciation and EXAFS analyzes were performed on Mars beamline of the SOLEIL synchrotron, have described the local cation environment, for both solution and solid compounds. Some theoretical approaches of DFT were conducted to identify stable structures in purpose of completing the experimental studies. All solid complexes (AMP, ADP, ATP and AEP) have polynuclear structures, while soluble ATP complexes are mononuclear. For all synthesized complexes, it has been

  2. Preclinical evidence of mitochondrial nicotinamide adenine dinucleotide as an effective alarm parameter under hypoxia (United States)

    Shi, Hua; Sun, Nannan; Mayevsky, Avraham; Zhang, Zhihong; Luo, Qingming


    Early detection of tissue hypoxia in the intensive care unit is essential for effective treatment. Reduced nicotinamide adenine dinucleotide (NADH) has been suggested to be the most sensitive indicator of tissue oxygenation at the mitochondrial level. However, no experimental evidence comparing the kinetics of changes in NADH and other physiological parameters has been provided. The aim of this study is to obtain the missing data in a systematic and reliable manner. We constructed four acute hypoxia models, including hypoxic hypoxia, hypemic hypoxia, circulatory hypoxia, and histogenous hypoxia, and measured NADH fluorescence, tissue reflectance, cerebral blood flow, respiration, and electrocardiography simultaneously from the induction of hypoxia until death. We found that NADH was not always the first onset parameter responding to hypoxia. The order of responses was mainly affected by the cause of hypoxia. However, NADH reached its alarm level earlier than the other monitored parameters, ranging from several seconds to >10 min. As such, we suggest that the NADH can be used as a hypoxia indicator, although the exact level that should be used must be further investigated. When the NADH alarm is detected, the body still has a chance to recover if appropriate and timely treatment is provided.

  3. Studies of yeast cell oxygenation and energetics by laser fluorometry of reduced nicotinamide adenine dinucleotide (United States)

    Pan, Fu-shih; Chen, Stephen; Mintzer, Robert A.; Chen, Chin-Tu; Schumacker, Paul


    It is of fundamental importance for biological scientists to assess cellular energetics. Under aerobic conditions, the tricarboxylic acid cycle (TCA cycle) is coupled with the mitochondrial electron cascade pathway to provide the cell with energy. The nicotinamide adenine dinucleotide-conjugated pair (NAD and NADH) is the coenzyme in numerous important biomedical reactions which include several important dehydrogenase reactions in the TCA cycle. Based on Le Chatelier's principle, NADH will accumulate when this energy production mechanism is impaired. The relative amounts of NAD and NADH in a cell are defined as the redox state of the cell (Williamson 1967) which provides a valuable index of cellular energetics. The sum of the amounts of NAD and NADH in a cell may be assumed to be constant during a finite time; therefore, a reliable means of measuring the NADH concentration would provide us with a useful indicator of tissue viability. Traditionally, the quantities of NADH and NAD may be measured by chemical assay methods. We can avoid these tediois analyses by exploiting the significant difference between the ultraviolet absorption spectra of this redox pair. However, because of the opacity of biological samples and the interference of other biochemicals that also absorb ultraviolet radiation, measurement of NADH and NAD+ concentrations in vivo by absorption spectroscopy is not feasible.

  4. Magnitude of malate-aspartate reduced nicotinamide adenine dinucleotide shuttle activity in intact respiring tumor cells. (United States)

    Greenhouse, W V; Lehninger, A L


    Measurements of respiration, CO2 and lactate production, and changes in the levels of various key metabolites of the glycolytic sequence and tricarboxylic acid cycle were made on five lines of rodent ascites tumor cells (two strains of Ehrlich ascites tumor cells, Krebs II carcinoma, AS-30D carcinoma, and L1210 cells) incubated aerobically in the presence of uniformly labeled D-[14C]glucose. From these data, as well as earlier evidence demonstrating that the reduced nicotinamide adenine dinucleotide (NADH) shuttle in these cells requires a transaminase step and is thus identified as the malate-aspartate shuttle (W.V.V. Greenhouse and A.L. Lehninger, Cancer Res., 36: 1392-1396, 1976), metabolic flux diagrams were constructed for the five cell lines. These diagrams show the relative rates of glycolysis, the tricarboxylic acid cycle, electron transport, and the malate-aspartate shuttle in these tumors. Large amounts of cytosolic NADH were oxidized by the mitochondrial respiratory chain via the NADH shuttle, comprising anywhere from about 20 to 80% of the total flow of reducing equivalents to oxygen in these tumors. Calculations of the sources of energy for adenosine triphosphate synthesis indicated that on the average about one-third of the respiratory adenosine triphosphate is generated by electron flow originating from cytosolic NADH via the malate-aspartate shuttle.

  5. DNA adenine methylation is required to replicate both Vibrio cholerae chromosomes once per cell cycle. (United States)

    Demarre, Gaëlle; Chattoraj, Dhruba K


    DNA adenine methylation is widely used to control many DNA transactions, including replication. In Escherichia coli, methylation serves to silence newly synthesized (hemimethylated) sister origins. SeqA, a protein that binds to hemimethylated DNA, mediates the silencing, and this is necessary to restrict replication to once per cell cycle. The methylation, however, is not essential for replication initiation per se but appeared so when the origins (oriI and oriII) of the two Vibrio cholerae chromosomes were used to drive plasmid replication in E. coli. Here we show that, as in the case of E. coli, methylation is not essential for oriI when it drives chromosomal replication and is needed for once-per-cell-cycle replication in a SeqA-dependent fashion. We found that oriII also needs SeqA for once-per-cell-cycle replication and, additionally, full methylation for efficient initiator binding. The requirement for initiator binding might suffice to make methylation an essential function in V. cholerae. The structure of oriII suggests that it originated from a plasmid, but unlike plasmids, oriII makes use of methylation for once-per-cell-cycle replication, the norm for chromosomal but not plasmid replication.

  6. DNA adenine methylation is required to replicate both Vibrio cholerae chromosomes once per cell cycle.

    Directory of Open Access Journals (Sweden)

    Gaëlle Demarre


    Full Text Available DNA adenine methylation is widely used to control many DNA transactions, including replication. In Escherichia coli, methylation serves to silence newly synthesized (hemimethylated sister origins. SeqA, a protein that binds to hemimethylated DNA, mediates the silencing, and this is necessary to restrict replication to once per cell cycle. The methylation, however, is not essential for replication initiation per se but appeared so when the origins (oriI and oriII of the two Vibrio cholerae chromosomes were used to drive plasmid replication in E. coli. Here we show that, as in the case of E. coli, methylation is not essential for oriI when it drives chromosomal replication and is needed for once-per-cell-cycle replication in a SeqA-dependent fashion. We found that oriII also needs SeqA for once-per-cell-cycle replication and, additionally, full methylation for efficient initiator binding. The requirement for initiator binding might suffice to make methylation an essential function in V. cholerae. The structure of oriII suggests that it originated from a plasmid, but unlike plasmids, oriII makes use of methylation for once-per-cell-cycle replication, the norm for chromosomal but not plasmid replication.

  7. Chinese herbal medicine Shenqi Detoxification Granule inhibits fibrosis in adenine induced chronic renal failure rats. (United States)

    Peng, Min; Cai, Pingping; Ma, Hongbo; Meng, Hongyan; Xu, Yuan; Zhang, Xiaoyi; Si, Guomin


    Progressive fibrosis accompanies all chronic renal disease, connective tissue growth factor (CTGF,) and platelet-derived growth factor-B, (PDGF-B,) play important roles in extra-cellular matrix abnormal accumulation, while endothelin-1 (ET-1) nitric oxide (NO,) are related to endothelial dysfunction, which mediates the progression of renal fibrosis. Shenqi Detoxification Granule (SDG), a traditional Chinese herbal formula, has been used for treatment of chronic renal failure in clinic for many years. In order to evaluate the efficacy, and explore the mechanism of SDG to inhibit the progression of renal fibrosis, study was carried out using the adenine-induced Wister rats as the CRF model, and losartan as postive control drug. Levels of serum creatinine [Scr], and blood urea nitrogen (BUN), albumin (ALB), 24hrs, urine protein (24hUP), triacylglycerol (TG), and cholesterol (CHO), together with ET-1, and NO were detected. Pathological changes of renal tissues were observed by HE, staining. In addition, CTGF and PDGF-B expression were analyzed by immuno-histo-chemistry. The results indicated that SDG can effectively reduce Scr, BUN, 24hUP, TG, and CHO levels, increase ALB levels, inhibit renal tissue damage in CRF rats, and the mechanism maybe reduce PDGF-B, CTGF expression and ET-1/NO. Shenqi Detoxification Granule is a beneficial treatment for chronic renal failure.

  8. Gas-phase spectroscopy of protonated adenine, adenosine 5′-monophosphate and monohydrated ions

    DEFF Research Database (Denmark)

    Pedersen, S.O.; Støchkel, K.; Byskov, C.S.


    . The yields of these were measured as a function of the wavelength of the light from 210 nm to 300 nm, and they were combined to obtain the total photoinduced dissociation at each wavelength (i.e., action spectrum). A broad band between 230 nm and 290 nm and the tail of a band with maximum below 210 nm (high......-energy band) are seen. In the case of AdeH+(H2O), the dominant dissociation channel after photoexcitation in the low-energy band was simply loss of H2O while photodissociation of protonated AMP revealed two dominant dissociation channels associated with the formation of either AdeH+ or loss of H3PO4....... The action spectra of AdeH+, AdeH+(H2O), and AMPH+ are almost identical in the 230–290 nm region, and they resemble the absorption spectrum of protonated adenine in aqueous solution recorded at low pH. Hence from our work it is firmly established that the lowest-energy transitions are independent...

  9. Ultrafast deactivation processes in the 2-aminopyridine dimer and the adenine-thymine base pair: Similarities and differences

    International Nuclear Information System (INIS)

    Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi


    2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized 1 ππ* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.

  10. Synthesis of metal-adeninate frameworks with high separation capacity on C{sub 2}/C{sub 1} hydrocarbons

    Energy Technology Data Exchange (ETDEWEB)

    He, Yan-Ping, E-mail: [State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China); Zhou, Nan [State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China); Hunan GuangYi Experimental Middle School, Changsha, Hunan 410014 (China); Tan, Yan-Xi; Wang, Fei; Zhang, Jian [State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China)


    By introducing isophthalic acid or 2,5-thiophenedicarboxylic acid to assemble with adenine and cadmium salt, two isostructural and anionic porous metal-organic frameworks (1 and 2) possessing the novel (4,8)-connected sqc topology are presented here. 1 shows permanent porosity with Langmuir surface area of 770.1 m{sup 2}/g and exhibits high separation capacity on C{sub 2}/C{sub 1} hydrocarbons. - Graphical abstract: The assembly between isophthalic acid, adenine ligands and Cd{sup 2+} ions leads to an anionic porous metal-organic frameworks, which shows permanent porosity and exhibits high C{sub 2}/C{sub 1} hydrocarbons separation capacity. Display Omitted.

  11. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator

    International Nuclear Information System (INIS)

    Fenati, Renzo A.; Connolly, Ashley R.; Ellis, Amanda V.


    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded–DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP–Cytosine > TPP–Thymine > TPP–Adenine ≥ TPP–Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80–90% quenching), compared to 25–30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. - Highlights: • Fluorophores and DNA intercalators effect the rate of toehold-mediated strand displacement. • Ethidium bromide had a destabilizing effect on mismatches that contained cytosine. • A cationic fluorophore and Black Hole Quencher 1 strand displacement system was 2–3 times faster than a FRET system. • This enabled SNP detection using toehold-mediated strand displacement in 15 min.

  12. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator

    Energy Technology Data Exchange (ETDEWEB)

    Fenati, Renzo A.; Connolly, Ashley R. [Flinders Centre for Nanoscale Science and Technology, Flinders University, Sturt Road, Bedford Park, Adelaide, South Australia 5042 (Australia); Ellis, Amanda V., E-mail: [Flinders Centre for Nanoscale Science and Technology, Flinders University, Sturt Road, Bedford Park, Adelaide, South Australia 5042 (Australia); Chemical and Biomolecular Engineering, The University of Melbourne, Parkville, VIC 3010 (Australia)


    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded–DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP–Cytosine > TPP–Thymine > TPP–Adenine ≥ TPP–Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80–90% quenching), compared to 25–30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. - Highlights: • Fluorophores and DNA intercalators effect the rate of toehold-mediated strand displacement. • Ethidium bromide had a destabilizing effect on mismatches that contained cytosine. • A cationic fluorophore and Black Hole Quencher 1 strand displacement system was 2–3 times faster than a FRET system. • This enabled SNP detection using toehold-mediated strand displacement in 15 min.

  13. DNA Three-Way Junction for Differentiation of Single-Nucleotide Polymorphisms with Fluorescent Copper Nanoparticles. (United States)

    Sun, Feifei; You, Ying; Liu, Jie; Song, Quanwei; Shen, Xiaotong; Na, Na; Ouyang, Jin


    A label- and enzyme-free fluorescent sensor for the detection of single-nucleotide polymorphisms (SNPs) at room temperature is proposed, using new copper nanoparticles (CuNPs) as fluorescent reporters. The CuNPs were constructed by using a DNA three-way junction (3WJ) template. In this assay, two complementary adenine/thymine-rich probes can hybridize with the wild-type target simultaneously to construct a 3WJ structure, serving as an efficient scaffold for the generation of CuNPs. However, the CuNPs produce weak fluorescence when the probes bind with a mutant-type target. SNPs can be identified by the difference in fluorescence intensity of the CuNPs. This SNPs detection strategy is straightforward, cost-effective, and avoids the complicated procedures of labeling or enzymatic reactions. The fluorescent sensor is versatile and can be applied to all types of mutation because the probes are programmable. Moreover, the sensor exhibits good detection performance in biological samples. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Effect of adipose-derived mesenchymal stem cell transplantation on vascular calcification in rats with adenine-induced kidney disease


    Yokote, Shinya; Katsuoka, Yuichi; Yamada, Akifumi; Ohkido, Ichiro; Yokoo, Takashi


    Previous studies have investigated the use of mesenchymal stem cells (MSCs) to treat damaged kidneys. However, the effect of adipose-derived MSCs (ASCs) on vascular calcification in chronic kidney disease (CKD) is still poorly understood. In the present study, we explored the potential of ASCs for the treatment of CKD and vascular calcification. CKD was induced in male Sprague-Dawley rats by feeding them a diet containing 0.75% adenine for 4 weeks. ASCs transplantation significantly reduced s...

  15. Renal and Myocardial Histopathology and Morphometry in Rats with Adenine - Induced Chronic Renal Failure: Influence of Gum Acacia

    Directory of Open Access Journals (Sweden)

    Badreldin H. Ali


    Full Text Available Background/Aim: Chronic kidney disease (CKD is associated with increased occurrence of cardiovascular system dysfunction. Previous studies have revealed a number of alterations in the kidneys and heart during CKD. However, unbiased quantitative studies on these structures in this disease have so far not been addressed. Materials and Methods: We induced CKD in rats by feeding adenine (0.75% w/w, four weeks and using unbiased stereological methods, investigated the effect of the ensuing CKD on the kidneys and left ventricular structure. Since gum acacia (GA has previously been shown to ameliorate the severity of CKD in humans and rodents, we investigated the effect of giving GA (15% w/v in the drinking water concomitantly with adenine on the kidneys and left ventricular structure using the above model. Results: The CKD was confirmed by standard biochemical indices in plasma and urine and by accumulation of the uremic toxin indoxyl sulfate. Additionally, it increased blood pressure. In rats with CKD absolute volume of left ventricle was significantly increased, and the volume density and absolute volume of myocardial capillaries were decreased, whilst the same parameters of myocardium and interstitial tissue were increased. Renal morphometry demonstrated significant increase in kidney volume and interstitial tissue in adenine- treated rats. Similarly, glomerular Bowman's capsule was significantly thickened. The myocardial and renal changes were significantly mitigated by GA treatment. Conclusions: These results add to our existing knowledge of the pathophysiology of adenine - CKD and provides plausible histopathological and morphometric evidence for the usefulness of GA in CKD.

  16. High-NaCl diet impairs dynamic renal blood flow autoregulation in rats with adenine-induced chronic renal failure. (United States)

    Saeed, Aso; DiBona, Gerald F; Grimberg, Elisabeth; Nguy, Lisa; Mikkelsen, Minne Line Nedergaard; Marcussen, Niels; Guron, Gregor


    This study examined the effects of 2 wk of high-NaCl diet on kidney function and dynamic renal blood flow autoregulation (RBFA) in rats with adenine-induced chronic renal failure (ACRF). Male Sprague-Dawley rats received either chow containing adenine or were pair-fed an identical diet without adenine (controls). After 10 wk, rats were randomized to either remain on the same diet (0.6% NaCl) or to be switched to high 4% NaCl chow. Two weeks after randomization, renal clearance experiments were performed under isoflurane anesthesia and dynamic RBFA, baroreflex sensitivity (BRS), systolic arterial pressure variability (SAPV), and heart rate variability were assessed by spectral analytical techniques. Rats with ACRF showed marked reductions in glomerular filtration rate and renal blood flow (RBF), whereas mean arterial pressure and SAPV were significantly elevated. In addition, spontaneous BRS was reduced by ∼50% in ACRF animals. High-NaCl diet significantly increased transfer function fractional gain values between arterial pressure and RBF in the frequency range of the myogenic response (0.06-0.09 Hz) only in ACRF animals (0.3 ± 4.0 vs. -4.4 ± 3.8 dB; P renal failure by facilitating pressure transmission to the microvasculature.

  17. DNA synthesis and cell survival after X-irradiation of mammalian cells treated with caffeine or adenine

    International Nuclear Information System (INIS)

    Griffiths, T.D.; Carpenter, J.G.; Dahle, D.B.


    The expression of the transient depression in the rate of DNA synthesis normally observed after exposure of randomly-dividing Chinese hamster V-79 or Chinese hamster CHO cells to ionizing radiation could be postponed by a post-irradiation treatment with 1.0 to 2.0 mM adenine or 1.5 mM caffeine. Caffeine may exert its effect by creating additional sites for replication in irradiated cells. Cells treated with caffeine or adenine for 2 or 4 hours after exposure to 3000 rad of 300 kVp X-rays exhibited depressed synthesis only after the removal of caffeine or adenine. These alterations in the timing of the X-ray-induced depression of the rate of DNA synthesis had no effect on X-ray-induced cell killing. Although a 4 hour post-irradiation treatment of randomly-dividing Chinese hamster V-79 cells with 1.0 or 2.0 mM caffeine potentiated X-ray-induced cell killing, this reduction in survival was due primarily to effects on cells not in S-phase. (author)

  18. Molecular recognition of AT-DNA sequences by the induced CD pattern of dibenzotetraaza[14]annulene (DBTAA)-adenine derivatives. (United States)

    Stojković, Marijana Radić; Skugor, Marko; Dudek, Lukasz; Grolik, Jarosław; Eilmes, Julita; Piantanida, Ivo


    An investigation of the interactions of two novel and several known DBTAA-adenine conjugates with double-stranded DNA and RNA has revealed the DNA/RNA groove as the dominant binding site, which is in contrast to the majority of previously studied DBTAA analogues (DNA/RNA intercalators). Only DBTAA-propyladenine conjugates revealed the molecular recognition of AT-DNA by an ICD band pattern > 300 nm, whereas significant ICD bands did not appear for other ds-DNA/RNA. A structure-activity relation for the studied series of compounds showed that the essential structural features for the ICD recognition are a) the presence of DNA-binding appendages (adenine side chain and positively charged side chain) on both DBTAA side chains, and b) the presence of a short propyl linker, which does not support intramolecular aromatic stacking between DBTAA and adenine. The observed AT-DNA-ICD pattern differs from previously reported ss-DNA (poly dT) ICD recognition by a strong negative ICD band at 350 nm, which allows for the dynamic differentiation between ss-DNA (poly dT) and coupled ds-AT-DNA.

  19. Determination of the major tautomeric form of the covalently modified adenine in the (+)-CC-1065-DNA adduct by 1H and 15N NMR studies

    International Nuclear Information System (INIS)

    Lin, Chin Hsiung; Hurley, L.H.


    (+)-CC-1065 is an extremely potent antitumor antibiotic produced by Streptomyces zelensis. The potent cytotoxic effects of the drug are thought to be due to the formation of a covalent adduct with DNA through N3 of adenine. Although the covalent linkage sites between (+)-CC-1065 and DNA have been determined, the tautomeric form of the covalently modified adenine in the (+)-CC-1065-DNA duplex adduct was not defined. The [6- 15 N]deoxyadenosine-labeled 12-mer duplex adduct was then studied by 1 H and 15 N NMR. One-dimensional NOE difference and two-dimensional NOESY 1 H NMR experiments on the nonisotopically labeled 12-mer duplex adduct demonstrate that the 6-amino protons of the covalently modified adenine exhibit two signals at 9.19 and 9.08 ppm. Proton NMR experiments on the [6- 15 N]deoxyadenosine-labeled 12-mer duplex adduct show that the two resonance signals for adenine H6 observed on the nonisotopically labeled duplex adduct were split into doublets by the 15 N nucleus with coupling constants of 91.3 Hz for non-hydrogen-bonded and 86.8 Hz for hydrogen-bonded amino protons. The authors conclude that the covalently modified adenine N6 of the (+)-CC-1065-12-mer duplex adduct is predominantly in the doubly protonated form, in which calculations predict that the C6-N6 bond is shortened and the positive charge is delocalized over the entire adenine molecule

  20. The International Nucleotide Sequence Database Collaboration. (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu


    Under the International Nucleotide Sequence Database Collaboration (INSDC;, globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  1. Bacterial nucleotide-based second messengers. (United States)

    Pesavento, Christina; Hengge, Regine


    In all domains of life nucleotide-based second messengers transduce signals originating from changes in the environment or in intracellular conditions into appropriate cellular responses. In prokaryotes cyclic di-GMP has emerged as an important and ubiquitous second messenger regulating bacterial life-style transitions relevant for biofilm formation, virulence, and many other bacterial functions. This review describes similarities and differences in the architecture of the cAMP, (p)ppGpp, and c-di-GMP signaling systems and their underlying signaling principles. Moreover, recent advances in c-di-GMP-mediated signaling will be presented and the integration of c-di-GMP signaling with other nucleotide-based signaling systems will be discussed.

  2. Electrochemical oxidation of dihydronicotinamide adenine dinucleotide at nitrogen-doped carbon nanotube electrodes. (United States)

    Goran, Jacob M; Favela, Carlos A; Stevenson, Keith J


    Nitrogen-doped carbon nanotubes (N-CNTs) substantially lower the overpotential necessary for dihydronicotinamide adenine dinucleotide (NADH) oxidation compared to nondoped CNTs or traditional carbon electrodes such as glassy carbon (GC). We observe a 370 mV shift in the peak potential (Ep) from GC to CNTs and another 170 mV shift from CNTs to 7.4 atom % N-CNTs in a sodium phosphate buffer solution (pH 7.0) with 2.0 mM NADH (scan rate 10 mV/s). The sensitivity of 7.4 atom % N-CNTs to NADH was measured at 0.30 ± 0.04 A M(-1) cm(-2), with a limit of detection at 1.1 ± 0.3 μM and a linear range of 70 ± 10 μM poised at a low potential of -0.32 V (vs Hg/Hg2SO4). NADH fouling, known to occur to the electrode surface during NADH oxidation, was investigated by measuring both the change in Ep and the resulting loss of electrode sensitivity. NADH degradation, known to occur in phosphate buffer, was characterized by absorbance at 340 nm and correlated with the loss of NADH electroactivity. N-CNTs are further demonstrated to be an effective platform for dehydrogenase-based biosensing by allowing glucose dehydrogenase to spontaneously adsorb onto the N-CNT surface and measuring the resulting electrode's sensitivity to glucose. The glucose biosensor had a sensitivity of 0.032 ± 0.003 A M(-1) cm(-2), a limit of detection at 6 ± 1 μM, and a linear range of 440 ± 50 μM.

  3. Sodium thiosulfate protects brain in rat model of adenine induced vascular calcification. (United States)

    Subhash, N; Sriram, R; Kurian, Gino A


    Vascular bed calcification is a common feature of ends stage renal disease that may lead to a complication in cardiovascular and cerebrovascular beds, which is a promoting cause of myocardial infarction, stroke, dementia and aneurysms. Sodium thiosulfate (STS) due to its multiple properties such as antioxidant and calcium chelation has been reported to prevent vascular calcification in uremic rats, without mentioning its impact on cerebral function. Moreover, the previous studies have not explored the effect of STS on the mitochondrial dysfunction, one of the main pathophysiological features associated with the disease and the main site for STS metabolism. The present study addresses this limitation by using a rat model where 0.75% adenine was administered to induce vascular calcification and 400 mg/kg b wt. of STS was given as preventive and curative agent. The blood and urine chemistries along with histopathology of aorta confirms the renal protective effect of STS in two modes of administration. The brain oxidative stress assessment was made through TBARS level, catalase (CAT), superoxide dismutase (SOD) and glutathione peroxidase (GPx) activities, found to be in the near normal level. STS administration not only reduced the mitochondrial oxidative stress (measured by TBARS, SOD, GPx and CAT) but also preserved the mitochondrial respiratory enzyme activities (NADH dehydrogenase, Succinate dehydrogenase and Malate dehydrogenase) and its physiology (measured by P/O ratio and RCR). In fact, the protective effect of STS was prominent, when it was administered as a curative agent, where low H2S and high thiosulfate level was observed along with low cystathionine β synthase activity, confirms thiosulfate mediated renal protection. In conclusion, STS when given after induction of calcification is protective to the brain by preserving its mitochondria, compared to the treatment given concomitantly. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Nucleotide Manipulatives to Illustrate the Central Dogma


    Sonja B. Yung; Todd P. Primm


    The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  5. Nucleotide Manipulatives to Illustrate the Central Dogma

    Directory of Open Access Journals (Sweden)

    Sonja B. Yung


    Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  6. Histone displacement during nucleotide excision repair

    DEFF Research Database (Denmark)

    Dinant, C.; Bartek, J.; Bekker-Jensen, S.


    Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called...... of histone variants and histone displacement (including nucleosome sliding). Here we review current knowledge, and speculate about current unknowns, regarding those chromatin remodeling activities that physically displace histones before, during and after NER....

  7. Pyrrolidine nucleotide analogs with a tunable conformation

    Czech Academy of Sciences Publication Activity Database

    Poštová Slavětínská, Lenka; Rejman, Dominik; Pohl, Radek


    Roč. 10, Aug 22 (2014), s. 1967-1980 ISSN 1860-5397 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : conformation * NMR * nucleic acids * nucleotide analog * phosphonic acid * pseudorotation * pyrrolidine Subject RIV: CC - Organic Chemistry Impact factor: 2.762, year: 2014

  8. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Joong-Won, E-mail: [Division of Science, Governors State University, University Park, Illinois 60484-0975 (United States); Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States); Bernstein, Elliot R., E-mail: [Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States)


    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  9. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    International Nuclear Information System (INIS)

    Shin, Joong-Won; Bernstein, Elliot R.


    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5 ′ -monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results

  10. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.; Dawe, Adam Sean; Berkowitz, Gerald A.


    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin

  11. Effects of hypokinesia on cyclic nucleotides and hormonal regulation ...

    African Journals Online (AJOL)

    PTH), calcitonin (CT), cyclic nucleotides (cAMP, cGMP) and calcium in the blood of rats, while in urine - phosphate, calcium and cyclic nucleotides. Design: Laboratory based experiment. Setting: Laboratory in the Department of Biochemistry, ...

  12. A nucleotide-analogue-induced gain of function corrects the error-prone nature of human DNA polymerase iota. (United States)

    Ketkar, Amit; Zafar, Maroof K; Banerjee, Surajit; Marquez, Victor E; Egli, Martin; Eoff, Robert L


    Y-family DNA polymerases participate in replication stress and DNA damage tolerance mechanisms. The properties that allow these enzymes to copy past bulky adducts or distorted template DNA can result in a greater propensity for them to make mistakes. Of the four human Y-family members, human DNA polymerase iota (hpol ι) is the most error-prone. In the current study, we elucidate the molecular basis for improving the fidelity of hpol ι through use of the fixed-conformation nucleotide North-methanocarba-2'-deoxyadenosine triphosphate (N-MC-dATP). Three crystal structures were solved of hpol ι in complex with DNA containing a template 2'-deoxythymidine (dT) paired with an incoming dNTP or modified nucleotide triphosphate. The ternary complex of hpol ι inserting N-MC-dATP opposite dT reveals that the adenine ring is stabilized in the anti orientation about the pseudo-glycosyl torsion angle, which mimics precisely the mutagenic arrangement of dGTP:dT normally preferred by hpol ι. The stabilized anti conformation occurs without notable contacts from the protein but likely results from constraints imposed by the bicyclo[3.1.0]hexane scaffold of the modified nucleotide. Unmodified dATP and South-MC-dATP each adopt syn glycosyl orientations to form Hoogsteen base pairs with dT. The Hoogsteen orientation exhibits weaker base-stacking interactions and is less catalytically favorable than anti N-MC-dATP. Thus, N-MC-dATP corrects the error-prone nature of hpol ι by preventing the Hoogsteen base-pairing mode normally observed for hpol ι-catalyzed insertion of dATP opposite dT. These results provide a previously unrecognized means of altering the efficiency and the fidelity of a human translesion DNA polymerase.

  13. A nucleotide analogue induced gain of function corrects the error-prone nature of human DNA polymerase iota (United States)

    Ketkar, Amit; Zafar, Maroof K.; Banerjee, Surajit; Marquez, Victor E.; Egli, Martin; Eoff, Robert L


    Y-family DNA polymerases participate in replication stress and DNA damage tolerance mechanisms. The properties that allow these enzymes to copy past bulky adducts or distorted template DNA can result in a greater propensity for them to make mistakes. Of the four human Y-family members, human DNA polymerase iota (hpol ι) is the most error-prone. In the current study, we elucidate the molecular basis for improving the fidelity of hpol ι through use of the fixed-conformation nucleotide North-methanocarba-2′-deoxyadenosine triphosphate (N-MC-dATP). Three crystal structures were solved of hpol ι in complex with DNA containing a template 2′-deoxythymidine (dT) paired with an incoming dNTP or modified nucleotide triphosphate. The ternary complex of hpol ι inserting N-MC-dATP opposite dT reveals that the adenine ring is stabilized in the anti orientation about the pseudo-glycosyl torsion angle (χ), which mimics precisely the mutagenic arrangement of dGTP:dT normally preferred by hpol ι. The stabilized anti conformation occurs without notable contacts from the protein but likely results from constraints imposed by the bicyclo[3.1.0]hexane scaffold of the modified nucleotide. Unmodified dATP and South-MC-dATP each adopt syn glycosyl orientations to form Hoogsteen base pairs with dT. The Hoogsteen orientation exhibits weaker base stacking interactions and is less catalytically favorable than anti N-MC-dATP. Thus, N-MC-dATP corrects the error-prone nature of hpol ι by preventing the Hoogsteen base-pairing mode normally observed for hpol ι-catalyzed insertion of dATP opposite dT. These results provide a previously unrecognized means of altering the efficiency and the fidelity of a human translesion DNA polymerase. PMID:22632140

  14. Photochemical decoration of gold nanoparticles on polymer stabilized magnetic microspheres for determination of adenine by surface-enhanced Raman spectroscopy

    International Nuclear Information System (INIS)

    Alula, Melisew Tadele; Yang, Jyisy


    Magnetic microspheres decorated with gold nanoparticles (AuNPs) were prepared and used for the determination of adenine by surface-enhanced Raman scattering (SERS). Magnetic particles were first synthesized by coprecipitation of solutions containing iron(II) and iron(III) ions with ammonium hydroxide. Subsequently, the magnetic particles were suspended into a solution of poly(divinylbenzene-co-methyl methacrylate) to yield polymer-stabilized magnetic microspheres. These were further decorated with AuNPs via a new photochemical reduction method. The magnetic microspheres were characterized by XRD patterns and SEM images. They are shown to represent highly SERS-active substrates by giving an enhancement by almost 7 orders of magnitude compared to conventional Raman spectroscopy. Several factors that affect the photochemical reduction to form the AuNPs were examined. It is found that the concentration of gold ion, UV irradiation time, and citrate concentration have more impact on the reaction rate than on the morphologies of the AuNPs. The gold-decorated magnetic microspheres are highly stable in aqueous solution and capable of concentrating nucleobases. A linear response of the SERS signal to adenine in concentrations up to 10 μM is found, with a linear regression coefficient of 0.997. The detection limit is estimated to a few hundreds of nM (at an SNR of 3). Based on its specific Raman peak at 734 cm −1 , adenine can be selectively determined without interference by other nucleobases, and a recovery higher than 95 % could be obtained. (author)

  15. Erhuang Formula ameliorates renal damage in adenine-induced chronic renal failure rats via inhibiting inflammatory and fibrotic responses. (United States)

    Zhang, Chun-Yan; Zhu, Jian-Yong; Ye, Ying; Zhang, Miao; Zhang, Li-Jun; Wang, Su-Juan; Song, Ya-Nan; Zhang, Hong


    The present study aimed to evaluate the protective effects of Erhuang Formula (EHF) and explore its pharmacological mechanisms on adenine-induced chronic renal failure (CRF). The compounds in EHF were analyzed by HPLC/MS. Adenine-induced CRF rats were administrated by EHF. The effects were evaluated by renal function examination and histology staining. Immunostaining of some proteins related cell adhesion was performedin renal tissues, including E-cadherin, β-catenin, fibronectin and laminin. The qRT-PCR was carried out determination of gene expression related inflammation and fibrosis including NF-κB, TNF-α, TGF-β1, α-SMA and osteopontin (OPN). Ten compounds in EHF were identified including liquiritigenin, farnesene, vaccarin, pachymic acid, cycloastragenol, astilbin, 3,5,6,7,8,3',4'-heptemthoxyflavone, physcion, emodin and curzerene. Abnormal renal function and histology had significant improvements by EHF treatment. The protein expression of β-catenin, fibronectin and laminin were significantly increased and the protein expression of E-cadherin significantly decreased in CRF groups. However, these protein expressions were restored to normal levels in EHF group. Furthermore, low expression of PPARγ and high expression of NF-κB, TNF-α, TGF-β1, α-SMA and OPN were substantially restored by EHF treatment in a dose-dependent manner. EHF ameliorated renal damage in adenine-induced CRF rats, and the mechanisms might involve in the inhibition of inflammatory and fibrotic responses and the regulation of PPARγ, NF-κB and TGF-β signaling pathways. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  16. The GC-Rich Mitochondrial and Plastid Genomes of the Green Alga Coccomyxa Give Insight into the Evolution of Organelle DNA Nucleotide Landscape

    Energy Technology Data Exchange (ETDEWEB)

    Smith, David Roy; Burki, Fabien; Yamada, Takashi; Grimwood, Jane; Grigoriev, Igor V.; Van Etten, James L.; Keeling, Patrick J.


    Most of the available mitochondrial and plastid genome sequences are biased towards adenine and thymine (AT) over guanine and cytosine (GC). Examples of GC-rich organelle DNAs are limited to a small but eclectic list of species, including certain green algae. Here, to gain insight in the evolution of organelle nucleotide landscape, we present the GC-rich mitochondrial and plastid DNAs from the trebouxiophyte green alga Coccomyxa sp. C-169. We compare these sequences with other GC-rich organelle DNAs and argue that the forces biasing them towards G and C are nonadaptive and linked to the metabolic and/or life history features of this species. The Coccomyxa organelle genomes are also used for phylogenetic analyses, which highlight the complexities in trying to resolve the interrelationships among the core chlorophyte green algae, but ultimately favour a sister relationship between the Ulvophyceae and Chlorophyceae, with the Trebouxiophyceae branching at the base of the chlorophyte crown.

  17. Study on preventive effects of i.v. administration of flavin adenine dinucleotide (FAD) before irradiation on radiation stomatitis

    International Nuclear Information System (INIS)

    Nagai, Masao; Houzawa, Jiro; Hakamada, Masaru


    In order to compare the preventive effect on radiation stomatitis, flavin adenine dinucleotide (FAD) or vitamin C was administered intravenously until the blood level reached the maximum at the time of irradiation. Thirtyfive patients with cranial or cervical tumors were allocated into the group with FAD (15), the group with vitamin C (10), and the group with irradiation alone (10). The incidence of stomititis was significantly lower and the number of patients in whom the drug was withdrawn due to stomatitis was extremely smaller in the group with FAD than in the other groups. FAD administered before irradiation was considered very useful in preventing radiation stomatitis. (Namekawa, K.)

  18. Rationalizing the structural variability of the exocyclic amino groups in nucleobases and their metal complexes: cytosine and adenine. (United States)

    Fonseca Guerra, Célia; Sanz Miguel, Pablo J; Cebollada, Andrea; Bickelhaupt, F Matthias; Lippert, Bernhard


    The exocyclic amino groups of cytosine and adenine nucleobases are normally almost flat, with the N atoms essentially sp(2) hybridized and the lone pair largely delocalized into the heterocyclic rings. However, a change to marked pyramidality of the amino group (N then sp(3) hybridized, lone pair essentially localized at N) occurs during i) involvement of an amino proton in strong hydrogen bonding donor conditions or ii) with monofunctional metal coordination following removal of one of the two protons. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. A novel twist on molecular interactions between thioredoxin and nicotinamide adenine dinucleotide phosphate-dependent thioredoxin reductase

    DEFF Research Database (Denmark)

    Kirkensgaard, Kristine Groth; Hägglund, Per; Shahpiri, Azar


    The ubiquitous disulfide reductase thioredoxin (Trx) regulates several important biological processes such as seed germination in plants. Oxidized cytosolic Trx is regenerated by nicotinamide adenine dinucleotide phosphate (NADPH)-dependent thioredoxin reductase (NTR) in a multistep transfer...... dinucleotide (FAD)-binding domain of HvNTR2 to strongly affect the interaction with Trx. In particular, Trp42 and Met43 play key roles for recognition of the endogenous HvTrxh2. Trx from Arabidopsis thaliana is also efficiently recycled by HvNTR2 but turnover in this case appears to be less dependent...

  20. The Effects of Foliar Application of Benzyl Adenine, Ascorbic Acid and Thiamine on Some Morphological and Biochemical Characteristics of Petunia (Petunia hybrida

    Directory of Open Access Journals (Sweden)

    M. Salehi


    Full Text Available The improvement of growth and flowering of petunia as one of the most popular and cultivated bedding plants in Iran, is of significant importance. Thus, a CRD experiment with five replications was conducted at the Research Greenhouse of Shahid Bahonar University, Kerman, Iran.  From 48 days after sowing, when the seedlings had 5-6 true leaves, the seedlings were sprayed with  thiamine (0 and 100 mgL-1, ascorbic acid (0 and 100 mg L-1 and benzyl adenine (0 and 200 mg L-1 at 4 steps during  growth and development. The results indicated that the treatment of ascorbic acid with thiamine and benzyl adenine led to 2.5 and 3.5-fold increases in the number and length of lateral shoots compared to control treatment. The greatest fresh weight was obtained with ascorbic acid with thiamine and benzyl adenine treatment which led to a 2.5-fold increase in this trait, compared to the control. The highest dry weight was achieved in benzyl adenine treatment. The greatest vase-life and flower diameter were found with ascorbic acid (100 mg L-1, thiamine (100 mg L-1 and benzyl adenine (200 mg L-1 treatments in an extent that the flower longevity and diameter were increased by 83% and 72%, respectively, in comparison to control. Furthermore, chlorophyll a, chlorophyll b, total chlorophyll, carotenoids and reduced sugars concentrations were significantly increased by the foliar-applied compounds compared to control.

  1. The conserved baculovirus protein p33 (Ac92) is a flavin adenine dinucleotide-linked sulfhydryl oxidase

    International Nuclear Information System (INIS)

    Long, C.M.; Rohrmann, G.F.; Merrill, G.F.


    Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involved in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.

  2. Kinetic and thermodynamic study of the reaction catalyzed by glucose-6-phosphate dehydrogenase with nicotinamide adenine dinucleotide

    International Nuclear Information System (INIS)

    Martin del Campo, Julia S.; Patino, Rodrigo


    Research highlights: → The reaction catalyzed by one enzyme of the pentose phosphate pathway was studied. → A spectrophotometric method is proposed for kinetic and thermodynamic analysis. → The pH and the temperature influences are reported on physical chemical properties. → Relative concentrations of substrates are also important in the catalytic process. - Abstract: The enzyme glucose-6-phosphate dehydrogenase (G6PD, EC from Leuconostoc mesenteroides has a dual coenzyme specificity with oxidized nicotinamide adenine dinucleotide (NAD ox ) and oxidized nicotinamide adenine dinucleotide phosphate as electron acceptors. The G6PD coenzyme selection is determined by the metabolic cellular prevailing conditions. In this study a kinetic and thermodynamic analysis is presented for the reaction catalyzed by G6PD from L. mesenteroides with NAD ox as coenzyme in phosphate buffer. For this work, an in situ spectrophotometric technique was employed based on the detection of one product of the reaction. Substrate and coenzyme concentrations as well as temperature and pH effects were evaluated. The apparent equilibrium constant, the Michaelis constant, and the turnover number were determined as a function of each experimental condition. The standard transformed Gibbs energy of reaction was determined from equilibrium constants at different initial conditions. For the product 6-phospho-D-glucono-1,5-lactone, a value of the standard Gibbs energy of formation is proposed, Δ f G o = -1784 ± 5 kJ mol -1 .

  3. Kinetic and thermodynamic study of the reaction catalyzed by glucose-6-phosphate dehydrogenase with nicotinamide adenine dinucleotide

    Energy Technology Data Exchange (ETDEWEB)

    Martin del Campo, Julia S. [Departamento de Fisica Aplicada, Centro de Investigacion y de Estudios Avanzados - Unidad Merida, Carretera antigua a Progreso Km. 6, A.P. 73 Cordemex, 97310, Merida, Yucatan (Mexico); Patino, Rodrigo, E-mail: [Departamento de Fisica Aplicada, Centro de Investigacion y de Estudios Avanzados - Unidad Merida, Carretera antigua a Progreso Km. 6, A.P. 73 Cordemex, 97310, Merida, Yucatan (Mexico)


    Research highlights: {yields} The reaction catalyzed by one enzyme of the pentose phosphate pathway was studied. {yields} A spectrophotometric method is proposed for kinetic and thermodynamic analysis. {yields} The pH and the temperature influences are reported on physical chemical properties. {yields} Relative concentrations of substrates are also important in the catalytic process. - Abstract: The enzyme glucose-6-phosphate dehydrogenase (G6PD, EC from Leuconostoc mesenteroides has a dual coenzyme specificity with oxidized nicotinamide adenine dinucleotide (NAD{sub ox}) and oxidized nicotinamide adenine dinucleotide phosphate as electron acceptors. The G6PD coenzyme selection is determined by the metabolic cellular prevailing conditions. In this study a kinetic and thermodynamic analysis is presented for the reaction catalyzed by G6PD from L. mesenteroides with NAD{sub ox} as coenzyme in phosphate buffer. For this work, an in situ spectrophotometric technique was employed based on the detection of one product of the reaction. Substrate and coenzyme concentrations as well as temperature and pH effects were evaluated. The apparent equilibrium constant, the Michaelis constant, and the turnover number were determined as a function of each experimental condition. The standard transformed Gibbs energy of reaction was determined from equilibrium constants at different initial conditions. For the product 6-phospho-D-glucono-1,5-lactone, a value of the standard Gibbs energy of formation is proposed, {Delta}{sub f}G{sup o} = -1784 {+-} 5 kJ mol{sup -1}.

  4. High-NaCl Diet Aggravates Cardiac Injury in Rats with Adenine-Induced Chronic Renal Failure and Increases Serum Troponin T Levels

    DEFF Research Database (Denmark)

    Kashioulis, Pavlos; Hammarsten, Ola; Marcussen, Niels


    AIMS: To examine the effects of 2 weeks of high-NaCl diet on left ventricular (LV) morphology and serum levels of cardiac troponin T (cTnT) in rats with adenine-induced chronic renal failure (ACRF). METHODS: Male Sprague-Dawley rats either received chow containing adenine or were pair......-fed an identical diet without adenine [controls (C)]. Approximately 10 weeks after the beginning of the study, the rats were randomized to either remain on a normal NaCl diet (NNa; 0.6%) or to be switched to high-NaCl chow (HNa; 4%) for 2 weeks, after which acute experiments were performed. RESULTS: Rats with ACRF...... showed statistically significant increases (p rats (p

  5. Regulation of nucleotide excision repair through ubiquitination

    Institute of Scientific and Technical Information of China (English)

    Jia Li; Audesh Bhat; Wei Xiao


    Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.

  6. Formation of amino acids and nucleotide bases in a Titan atmosphere simulation experiment. (United States)

    Hörst, S M; Yelle, R V; Buch, A; Carrasco, N; Cernogora, G; Dutuit, O; Quirico, E; Sciamma-O'Brien, E; Smith, M A; Somogyi, A; Szopa, C; Thissen, R; Vuitton, V


    The discovery of large (>100 u) molecules in Titan's upper atmosphere has heightened astrobiological interest in this unique satellite. In particular, complex organic aerosols produced in atmospheres containing C, N, O, and H, like that of Titan, could be a source of prebiotic molecules. In this work, aerosols produced in a Titan atmosphere simulation experiment with enhanced CO (N(2)/CH(4)/CO gas mixtures of 96.2%/2.0%/1.8% and 93.2%/5.0%/1.8%) were found to contain 18 molecules with molecular formulae that correspond to biological amino acids and nucleotide bases. Very high-resolution mass spectrometry of isotopically labeled samples confirmed that C(4)H(5)N(3)O, C(4)H(4)N(2)O(2), C(5)H(6)N(2)O(2), C(5)H(5)N(5), and C(6)H(9)N(3)O(2) are produced by chemistry in the simulation chamber. Gas chromatography-mass spectrometry (GC-MS) analyses of the non-isotopic samples confirmed the presence of cytosine (C(4)H(5)N(3)O), uracil (C(5)H(4)N(2)O(2)), thymine (C(5)H(6)N(2)O(2)), guanine (C(5)H(5)N(5)O), glycine (C(2)H(5)NO(2)), and alanine (C(3)H(7)NO(2)). Adenine (C(5)H(5)N(5)) was detected by GC-MS in isotopically labeled samples. The remaining prebiotic molecules were detected in unlabeled samples only and may have been affected by contamination in the chamber. These results demonstrate that prebiotic molecules can be formed by the high-energy chemistry similar to that which occurs in planetary upper atmospheres and therefore identifies a new source of prebiotic material, potentially increasing the range of planets where life could begin.

  7. Probing adenine rings and backbone linkages using base specific isotope-edited Raman spectroscopy: application to group II intron ribozyme domain V. (United States)

    Chen, Yuanyuan; Eldho, Nadukkudy V; Dayie, T Kwaku; Carey, Paul R


    Raman difference spectroscopy is used to probe the properties of a 36-nt RNA molecule, "D5", which lies at the heart of the catalytic apparatus in group II introns. For D5 that has all of its adenine residues labeled with (13)C and (15)N and utilizing Raman difference spectroscopy, we identify the conformationally sensitive -C-O-P-O-C- stretching modes of the unlabeled bonds adjacent to adenine bases, as well as the adenine ring modes themselves. The phosphodiester modes can be assigned to individual adenine residues based on earlier NMR data. The effect of Mg(2+) binding was explored by analyzing the Raman difference spectra for [D5 + Mg(2+)] minus [D5 no Mg(2+)], for D5 unlabeled, or D5 labeled with (13)C/(15)N-enriched adenine. In both sets of data we assign differential features to G ring modes perturbed by Mg(2+) binding at the N7 position. In the A-labeled spectra we attribute a Raman differential near 1450 cm(-1) and changes of intensity at 1296 cm(-1) to Mg binding at the N7 position of adenine bases. The A and G bases involved in Mg(2+) binding again can be identified using earlier NMR results. For the unlabeled D5, a change in the C-O-P-O-C stretch profile at 811 cm(-1) upon magnesium binding is due to a "tightening up" (in the sense of a more rigid molecule with less dynamic interchange among competing ribose conformers) of the D5 structure. For adenine-labeled D5, small changes in the adenine backbone bond signatures in the 810-830 cm(-1) region suggest that small conformational changes occur in the tetraloop and bulge regions upon binding of Mg(2+). The PO(2)(-) stretching vibration, near 1100 cm(-1), from the nonbridging phosphate groups, probes the effect of Mg(2+)-hydrate inner-sphere interactions that cause an upshift. In turn, the upshift is modulated by the presence of monovalent cations since in the presence of Na(+) and Li(+) the upshift is 23 +/- 2 cm(-1) while in the presence of K(+) and Cs(+) it is 13 +/- 3 cm(-1), a finding that correlates

  8. Palindromic nucleotide analysis in human T cell receptor rearrangements.

    Directory of Open Access Journals (Sweden)

    Santosh K Srivastava

    Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

  9. The Human SLC25A33 and SLC25A36 Genes of Solute Carrier Family 25 Encode Two Mitochondrial Pyrimidine Nucleotide Transporters* (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando


    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081

  10. The human SLC25A33 and SLC25A36 genes of solute carrier family 25 encode two mitochondrial pyrimidine nucleotide transporters. (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando


    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H


    The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

  12. Cyclic nucleotide specific phosphodiesterases of Leishmania major

    Directory of Open Access Journals (Sweden)

    Linder Markus


    Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range

  13. Genetic Control of Biosynthesis and Transport of Riboflavin and Flavin Nucleotides and Construction of Robust Biotechnological Producers† (United States)

    Abbas, Charles A.; Sibirny, Andriy A.


    Summary: Riboflavin [7,8-dimethyl-10-(1′-d-ribityl)isoalloxazine, vitamin B2] is an obligatory component of human and animal diets, as it serves as the precursor of flavin coenzymes, flavin mononucleotide, and flavin adenine dinucleotide, which are involved in oxidative metabolism and other processes. Commercially produced riboflavin is used in agriculture, medicine, and the food industry. Riboflavin synthesis starts from GTP and ribulose-5-phosphate and proceeds through pyrimidine and pteridine intermediates. Flavin nucleotides are synthesized in two consecutive reactions from riboflavin. Some microorganisms and all animal cells are capable of riboflavin uptake, whereas many microorganisms have distinct systems for riboflavin excretion to the medium. Regulation of riboflavin synthesis in bacteria occurs by repression at the transcriptional level by flavin mononucleotide, which binds to nascent noncoding mRNA and blocks further transcription (named the riboswitch). In flavinogenic molds, riboflavin overproduction starts at the stationary phase and is accompanied by derepression of enzymes involved in riboflavin synthesis, sporulation, and mycelial lysis. In flavinogenic yeasts, transcriptional repression of riboflavin synthesis is exerted by iron ions and not by flavins. The putative transcription factor encoded by SEF1 is somehow involved in this regulation. Most commercial riboflavin is currently produced or was produced earlier by microbial synthesis using special selected strains of Bacillus subtilis, Ashbya gossypii, and Candida famata. Whereas earlier RF overproducers were isolated by classical selection, current producers of riboflavin and flavin nucleotides have been developed using modern approaches of metabolic engineering that involve overexpression of structural and regulatory genes of the RF biosynthetic pathway as well as genes involved in the overproduction of the purine precursor of riboflavin, GTP. PMID:21646432

  14. Genetic control of biosynthesis and transport of riboflavin and flavin nucleotides and construction of robust biotechnological producers. (United States)

    Abbas, Charles A; Sibirny, Andriy A


    Riboflavin [7,8-dimethyl-10-(1'-d-ribityl)isoalloxazine, vitamin B₂] is an obligatory component of human and animal diets, as it serves as the precursor of flavin coenzymes, flavin mononucleotide, and flavin adenine dinucleotide, which are involved in oxidative metabolism and other processes. Commercially produced riboflavin is used in agriculture, medicine, and the food industry. Riboflavin synthesis starts from GTP and ribulose-5-phosphate and proceeds through pyrimidine and pteridine intermediates. Flavin nucleotides are synthesized in two consecutive reactions from riboflavin. Some microorganisms and all animal cells are capable of riboflavin uptake, whereas many microorganisms have distinct systems for riboflavin excretion to the medium. Regulation of riboflavin synthesis in bacteria occurs by repression at the transcriptional level by flavin mononucleotide, which binds to nascent noncoding mRNA and blocks further transcription (named the riboswitch). In flavinogenic molds, riboflavin overproduction starts at the stationary phase and is accompanied by derepression of enzymes involved in riboflavin synthesis, sporulation, and mycelial lysis. In flavinogenic yeasts, transcriptional repression of riboflavin synthesis is exerted by iron ions and not by flavins. The putative transcription factor encoded by SEF1 is somehow involved in this regulation. Most commercial riboflavin is currently produced or was produced earlier by microbial synthesis using special selected strains of Bacillus subtilis, Ashbya gossypii, and Candida famata. Whereas earlier RF overproducers were isolated by classical selection, current producers of riboflavin and flavin nucleotides have been developed using modern approaches of metabolic engineering that involve overexpression of structural and regulatory genes of the RF biosynthetic pathway as well as genes involved in the overproduction of the purine precursor of riboflavin, GTP.

  15. Exploiting nucleotide composition to engineer promoters.

    Directory of Open Access Journals (Sweden)

    Manfred G Grabherr

    Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

  16. Supplementary Material for: The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara; Meier, Stuart; Gehring, Christoph A


    Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  17. In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

    African Journals Online (AJOL)

    Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

  18. Condensing the information in DNA with double-headed nucleotides

    DEFF Research Database (Denmark)

    Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte


    A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

  19. Effect of aqueous extract and anthocyanins of calyces of Hibiscus sabdariffa (Malvaceae) in rats with adenine-induced chronic kidney disease. (United States)

    Ali, Badreldin H; Cahliková, Lucie; Opletal, Lubomir; Karaca, Turan; Manoj, Priyadarsini; Ramkumar, Aishwarya; Al Suleimani, Yousuf M; Al Za'abi, Mohammed; Nemmar, Abderrahim; Chocholousova-Havlikova, Lucie; Locarek, Miroslav; Siatka, Tomas; Blunden, Gerald


    The aim of this work was to assess the possible beneficial effects of aqueous extracts of Hibiscus sabdariffa L. calyces and anthocyanins isolated therefrom in an adenine-induced chronic kidney disease (CKD) model. Rats were orally given, for 28 consecutive days, either adenine alone or together with either aqueous extract of H. sabdariffa calyces (5 and 10%) or anthocyanins (50, 100 and 200 mg/kg of anthocyanin concentrate). For comparative purposes, two groups of rats were given lisinopril (10 mg/kg). When either H. sabdariffa aqueous extract or the anthocyanins isolated from it was administered along with adenine, the adverse effects of adenine-induced CKD were significantly lessened, mostly in a dose-dependent manner. The positive effects were similar to those obtained by administration of lisinopril. The results obtained show that both H. sabdariffa and its anthocyanins could be considered as possible promising safe dietary agents that could be used to attenuate the progression of human CKD. This could have added significance as H. sabdariffa tea is widely consumed in many parts of Africa and Asia and is thus readily available. © 2017 Royal Pharmaceutical Society.

  20. Effects of low-molecular-weight-chitosan on the adenine-induced chronic renal failure rats in vitro and in vivo (United States)

    Zhi, Xuan; Han, Baoqin; Sui, Xianxian; Hu, Rui; Liu, Wanshun


    The effects of low-molecular-weight-chitosan (LMWC) on chronic renal failure (CRF) rats induced by adenine were investigated in vivo and in vitro. Chitosan were hydrolyzed using chitosanase at pH 6-7 and 37° for 24 h to obtain LMWC. In vitro, the effect of LMWC on the proliferation of renal tubular epithelial cells (RTEC) showed that it had no cytotoxic effect and could promote cell growth. For the in vivo experiment, chronic renal failure rats induced by adenine were randomly divided into control group, Niaoduqing group, and high-, medium- and low-dose LMWC groups. For each group, we detected serum creatinine (SCR), blood urea nitrogen (BUN), and total superoxide dismutase (T-SOD), glutathione oxidase (GSH-Px) activities of renal tissue, and obtained the ratio of kidney weight/body weight, pathological changes of kidney. The levels of serum SCR, BUN were higher in the adenine-induced rats than those in the control group, indicating that the rat chronic renal failure model worked successfully. The results after treatment showed that LMWC could reduce the SCR and BUN levels and enhance the activities/levels of T-SOD and GSH-PX in kidney compared to control group. Histopathological examination revealed that adenine-induced renal alterations were restored by LMWC at three tested dosages, especially at the low dosage of 100 mg kg-1 d-1.

  1. Removal of oxygen free-radical-induced 5′,8-purine cyclodeoxynucleosides from DNA by the nucleotide excision-repair pathway in human cells (United States)

    Kuraoka, Isao; Bender, Christina; Romieu, Anthony; Cadet, Jean; Wood, Richard D.; Lindahl, Tomas


    Exposure of cellular DNA to reactive oxygen species generates several classes of base lesions, many of which are removed by the base excision-repair pathway. However, the lesions include purine cyclodeoxynucleoside formation by intramolecular crosslinking between the C-8 position of adenine or guanine and the 5′ position of 2-deoxyribose. This distorting form of DNA damage, in which the purine is attached by two covalent bonds to the sugar-phosphate backbone, occurs as distinct diastereoisomers. It was observed here that both diastereoisomers block primer extension by mammalian and microbial replicative DNA polymerases, using DNA with a site-specific purine cyclodeoxynucleoside residue as template, and consequently appear to be cytotoxic lesions. Plasmid DNA containing either the 5′R or 5′S form of 5′,8-cyclo-2-deoxyadenosine was a substrate for the human nucleotide excision-repair enzyme complex. The R diastereoisomer was more efficiently repaired than the S isomer. No correction of the lesion by direct damage reversal or base excision repair was detected. Dual incision around the lesion depended on the core nucleotide excision-repair protein XPA. In contrast to several other types of oxidative DNA damage, purine cyclodeoxynucleosides are chemically stable and would be expected to accumulate at a slow rate over many years in the DNA of nonregenerating cells from xeroderma pigmentosum patients. High levels of this form of DNA damage might explain the progressive neurodegeneration seen in XPA individuals. PMID:10759556


    Anderson, Tom; Schein, Philip S.; McMenamin, Mary G.; Cooney, David A.


    The diabetogenic activity of streptozotocin has been correlated with a reduction in pyridine nucleotide synthesis in the mouse pancreatic islet. To determine the specificity of this reduction for diabetogenicity, a comparative study of streptozotocin, its cytotoxic moiety, 1-methyl-1-nitrosourea, and alloxan was performed. Streptozotocin administered intraperitoneally (i.p.) producd a dose-related reduction in islet NAD which was proportional to the degree of diabetogenicity. A diabetogenic dose, 200 mg/kg, attained a peak plasma N-nitroso intact streptozotocin concentration of 0.224 μmol/ml and reduced the mean islet NAD from a control of 0.78 to 0.15 pmol. At borderline, 150 mg/kg, and nondiabetogenic, 100 mg/kg, doses, plasma concentrations reached 0.161 and 0.136 μmol/ml, and NAD was 0.36 and 0.86 pmol/islet, respectively. 1-Methyl-1-nitrosourea, 100 mg/kg, attained a maximum N-nitroso intact 1-methyl-1-nitrosourea concentration of 0.162 μmol/ml and reduced the mean NAD to 0.58 pmol/islet, and was nondiabetogenic; 200 mg/kg attained a peak plasma concentration of 0.344 μmol/ml and depressed NAD to 0.38 pmol/islet, and was inconsistently diabetogenic. Islet NAD of 0.4 pmol/islet or greater is required for integrity of the beta cell. A diabetogenic dose of alloxan, 500 mg/kg, did not depress NAD, 0.85 pmol/islet, therefore confirming that its mechanism of diabetogenicity differs from that of streptozotocin. In vivo uptake of [methyl-14C]streptozotocin by islets was 3.8 times that of [methyl-14C]-1-methyl-1-nitrosourea, whereas uptake by the exocrine pancreas favored 1-methyl-1-nitrosourea over streptozotocin 2.4:1. The decreased islet uptake of 1-methyl-1-nitrosourea correlates with the 3.5 times increased molar dosage required to produce islet NAD depression comparable to that of streptozotocin, 150 mg/kg. These studies indicate that the glucose carrier of streptozotocin facilitates uptake of its cytotoxic group, 1-methyl-1-nitrosourea, into islets. PMID

  3. Nucleotide excision repair in differentiated cells

    Energy Technology Data Exchange (ETDEWEB)

    Wees, Caroline van der [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Jansen, Jacob [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Vrieling, Harry [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Laarse, Arnoud van der [Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Zeeland, Albert van [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Mullenders, Leon [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands)]. E-mail:


    Nucleotide excision repair (NER) is the principal pathway for the removal of a wide range of DNA helix-distorting lesions and operates via two NER subpathways, i.e. global genome repair (GGR) and transcription-coupled repair (TCR). Although detailed information is available on expression and efficiency of NER in established mammalian cell lines, little is known about the expression of NER pathways in (terminally) differentiated cells. The majority of studies in differentiated cells have focused on repair of UV-induced cyclobutane pyrimidine dimers (CPD) and 6-4-photoproducts (6-4PP) because of the high frequency of photolesions at low level of toxicity and availability of sensitive technologies to determine photolesions in defined regions of the genome. The picture that emerges from these studies is blurred and rather complex. Fibroblasts and terminally differentiated myocytes of the rat heart display equally efficient GGR of 6-4PP but poor repair of CPD due to the absence of p48 expression. This repair phenotype is clearly different from human terminal differentiated neurons. Furthermore, both cell types were found to carry out TCR of CPD, thus mimicking the repair phenotype of established rodent cell lines. In contrast, in intact rat spermatogenic cells repair was very inefficient at the genome overall level and in transcriptionally active genes indicating that GGR and TCR are non-functional. Also, non-differentiated mouse embryonic stem (ES) cells exhibit low levels of NER after UV irradiation. However, the mechanisms that lead to low NER activity are clearly different: in differentiated spermatogenic cells differences in chromatin compaction and sequestering of NER proteins may underlie the lack of NER activity in pre-meiotic cells, whereas in non-differentiated ES cells NER is impaired by a strong apoptotic response.

  4. Development of a simple and efficient method for assaying cytidine monophosphate sialic acid synthetase activity using an enzymatic reduced nicotinamide adenine dinucleotide/oxidized nicotinamide adenine dinucleotide converting system. (United States)

    Fujita, Akiko; Sato, Chihiro; Münster-Kühnel, Anja-K; Gerardy-Schahn, Rita; Kitajima, Ken


    A new reliable method to assay the activity of cytidine monophosphate sialic acid (CMP-Sia) synthetase (CSS) has been developed. The activation of sialic acids (Sia) to CMP-Sia is a prerequisite for the de novo synthesis of sialoglycoconjugates. In vertebrates, CSS has been cloned from human, mouse, and rainbow trout, and the crystal structure has been resolved for the mouse enzyme. The mouse and rainbow trout enzyme have been compared with respect to substrate specificity, demonstrating that the mouse enzyme exhibits a pronounced specificity for N-acetylneuraminic acid (Neu5Ac), while the rainbow trout CSS is equally active with either of three Sia species, Neu5Ac, N-glycolylneuraminic acid (Neu5Gc), and deaminoneuraminic acid (KDN). However, molecular details that explain the pronounced substrate specificities are unknown. Understanding the catalytic mechanisms of these enzymes is of major importance, since CSSs play crucial roles in cellular sialylation patterns and thus are potential drug targets in a number of pathophysiological situations. The availability of the cDNAs and the obtained structural data enable rational approaches; however, these efforts are limited by the lack of a reliable high-throughput assay system. Here we describe a new assay system that allows product quantification in a reduced nicotinamide adenine dinucleotide (NADH)-dependent color reaction. The activation reaction catalyzed by CSS, CTP+Sia-->CMP-Sia+pyrophosphate, was evaluated by a consumption of Sia, which corresponds to that of NADH on the following two successive reactions: (i) Sia-->pyruvate+ManNAc (or Man), catalyzed by a sialic acid lyase (SAL), and (ii) pyruvate+NADH-->lactate+oxidized nicotinamide adenine dinucleotide (NAD+), catalyzed by a lactate dehydrogenase (LDH). Consumption of NADH can be photometrically monitored on a microtiter plate reader for a number of test samples at the same time. Furthermore, based on the quantification of CSS used in the SAL/LDH assay

  5. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Directory of Open Access Journals (Sweden)

    Simon Reed


    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  6. The possible role of human milk nucleotides as sleep inducers. (United States)

    Sánchez, Cristina L; Cubero, Javier; Sánchez, Javier; Chanclón, Belén; Rivero, Montserrat; Rodríguez, Ana B; Barriga, Carmen


    Breast-milk contains a potent mixture of diverse components, such as the non-protein nitrogen fraction which includes nucleotides, whose variation in levels is evident throughout lactation. In addition, these substances play an important role in sleep homeostasis. In the present study, human milk samples were analyzed using a capillary electrophoresis system. The rhythmicity of each nucleotide was studied by cosinor analysis. It was found that the nucleotides 5'AMP, 5'GMP, 5'CMP, and 5'IMP have significant (P inducing the 'hypnotic' action of breast-milk at night in the infant.

  7. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.


    Le Gall, O; Candresse, T; Brault, V; Dunez, J


    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  8. Influence of nucleotide modifications at the C2' position on the Hoogsteen base-paired parallel-stranded duplex of poly(A) RNA. (United States)

    Copp, William; Denisov, Alexey Y; Xie, Jingwei; Noronha, Anne M; Liczner, Christopher; Safaee, Nozhat; Wilds, Christopher J; Gehring, Kalle


    Polyadenylate (poly(A)) has the ability to form a parallel duplex with Hoogsteen adenine:adenine base pairs at low pH or in the presence of ammonium ions. In order to evaluate the potential of this structural motif for nucleic acid-based nanodevices, we characterized the effects on duplex stability of substitutions of the ribose sugar with 2'-deoxyribose, 2'-O-methyl-ribose, 2'-deoxy-2'-fluoro-ribose, arabinose and 2'-deoxy-2'-fluoro-arabinose. Deoxyribose substitutions destabilized the poly(A) duplex both at low pH and in the presence of ammonium ions: no duplex formation could be detected with poly(A) DNA oligomers. Other sugar C2' modifications gave a variety of effects. Arabinose and 2'-deoxy-2'-fluoro-arabinose nucleotides strongly destabilized poly(A) duplex formation. In contrast, 2'-O-methyl and 2'-deoxy-2'-fluoro-ribo modifications were stabilizing either at pH 4 or in the presence of ammonium ions. The differential effect suggests they could be used to design molecules selectively responsive to pH or ammonium ions. To understand the destabilization by deoxyribose, we determined the structures of poly(A) duplexes with a single DNA residue by nuclear magnetic resonance spectroscopy and X-ray crystallography. The structures revealed minor structural perturbations suggesting that the combination of sugar pucker propensity, hydrogen bonding, pKa shifts and changes in hydration determine duplex stability. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. The electrochemical reduction of the purines guanine and adenine at platinum electrodes in several room temperature ionic liquids

    International Nuclear Information System (INIS)

    Zanoni, Maria Valnice Boldrin; Rogers, Emma I.; Hardacre, Christopher; Compton, Richard G.


    The reduction of guanine was studied by microelectrode voltammetry in the room temperature ionic liquids (RTILs) N-hexyltriethylammonium bis (trifluoromethanesulfonyl) imide [N 6,2,2,2 ][N(Tf) 2 ], 1-butyl-3-methylimidazolium hexafluorosphosphate [C 4 mim][PF 6 ], N-butyl-N-methyl-pyrrolidinium bis(trifluoromethanesulfonyl)imide [C 4 mpyrr][N(Tf) 2 ], 1-butyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imide [C 4 mim][N(Tf) 2 ], N-butyl-N-methyl-pyrrolidinium dicyanamide [C 4 mpyrr][N(NC) 2 ] and tris(P-hexyl)-tetradecylphosphonium trifluorotris(pentafluoroethyl)phosphate [P 14,6,6,6 ][FAP] on a platinum microelectrode. In [N 6,2,2,2 ][NTf 2 ] and [P 14,6,6,6 ][FAP], but not in the other ionic liquids studied, guanine reduction involves a one-electron, diffusion-controlled process at very negative potential to produce an unstable radical anion, which is thought to undergo a dimerization reaction, probably after proton abstraction from the cation of the ionic liquid. The rate of this subsequent reaction depends on the nature of the ionic liquid, and it is faster in the ionic liquid [P 14,6,6,6 ][FAP], in which the formation of the resulting dimer can be voltammetrically monitored at less negative potentials than required for the reduction of the parent molecule. Adenine showed similar behaviour to guanine but the pyrimidines thymine and cytosine did not; thymine was not reduced at potentials less negative than required for solvent (RTIL) decomposition while only a poorly defined wave was seen for cytosine. The possibility for proton abstraction from the cation in [N 6,2,2,2 ][NTf 2 ] and [P 14,6,6,6 ][FAP] is noted and this is thought to aid the electrochemical dimerization process. The resulting rapid reaction is thought to shift the reduction potentials for guanine and adenine to lower values than observed in RTILs where the scope for proton abstraction is not present. Such shifts are characteristic of so-called EC processes where reversible electron transfer

  10. Recognition and repair of the CC-1065-(N3-Adenine)-DNA adduct by the UVRABC nuclease

    International Nuclear Information System (INIS)

    Tang, M.; Lee, C.S.; Doisy, R.; Ross, L.; Needham-VanDevanter, D.R.; Hurley, L.H.


    The recognition and repair of the helix-stabilizing and relatively nondistortive CC-1065-(N3-adenine)-DNA adduct by UVRABC nuclease has been investigated both in vivo with phi X174RFI DNA by a transfection assay and in vitro by a site-directed adduct in a 117 base pair fragment from M13mp1. CC-1065 is a potent antitumor antibiotic produced by Streptomyces zelensis which binds within the minor groove of DNA through N3 of adenine. In contrast to the helix-destabilizing and distortive modifications of DNA caused by ultraviolet light or N-acetoxy-2-(acetylamino)fluorene, CC-1065 increases the melting point of DNA and decreases the S1 nuclease activity. Using a viral DNA-Escherichia coli transfection system, the authors have found that the uvrA, uvrB, and uvrC genes, which code for the major excision repair proteins for UV- and NAAAF-induced DNA damage, are also involved in the repair of CC-1065-DNA adducts. In contrast, the uvrD gene product, which has been found to be involved in the repair of UV damage, has no effect in repairing CC-1065-DNA adducts. Purified UVRA, UVRB, and UVRC proteins must work in concert to incise the drug-modified phi X174RFI DNA. Using a site-directed and multiple CC-1065 modified (MspI-BstNI) 117 base pair fragment from M13mp1, they have found that UVRABC nuclease incises at the eight phosphodiester bond on the 5' side of the CC-1065-DNA adduct on the drug-modified strand. The enzymes do not cut the noncovalently modified strand. The DNA sequence and/or helix-stabilizing effect of multiple adducts may determine the recognition and/or incision of the drug-DNA adduct by UVRABC nuclease. These results are discussed in relation to the structure of the CC-1065-DNA adduct and the effect of drug binding on local DNA structure

  11. Heteronuclear multidimensional NMR and homology modelling studies of the C-terminal nucleotide-binding domain of the human mitochondrial ABC transporter ABCB6

    Energy Technology Data Exchange (ETDEWEB)

    Kurashima-Ito, Kaori [RIKEN, Cellular and Molecular Biology Laboratory (Japan); Ikeya, Teppei [National Institute of Advanced Industrial Science and Technology (AIST), (Japan); Senbongi, Hiroshi [Mitochondrial Diseases Group, MRC Dunn Human NutritionUnit (United Kingdom); Tochio, Hidehito [International Graduate School of Arts and Sciences, Supramolecular Biology, Yokohama City University, Molecular Biophysics Laboratory (Japan); Mikawa, Tsutomu [RIKEN, Cellular and Molecular Biology Laboratory (Japan); Shibata, Takehiko [RIKEN, Shibata Distinguished Senior Scientist Laboratory (Japan); Ito, Yutaka [RIKEN, Cellular and Molecular Biology Laboratory (Japan)], E-mail:


    Human ATP-binding cassette, sub-family B, member 6 (ABCB6) is a mitochondrial ABC transporter, and presumably contributes to iron homeostasis. Aimed at understanding the structural basis for the conformational changes accompanying the substrate-transportation cycle, we have studied the C-terminal nucleotide-binding domain of ABCB6 (ABCB6-C) in both the nucleotide-free and ADP-bound states by heteronuclear multidimensional NMR and homology modelling. A non-linear sampling scheme was utilised for indirectly acquired {sup 13}C and {sup 15}N dimensions of all 3D triple-resonance NMR experiments, in order to overcome the instability and the low solubility of ABCB6-C. The backbone resonances for approximately 25% of non-proline residues, which are mostly distributed around the functionally important loops and in the Helical domain, were not observed for nucleotide-free form of ABCB6-C. From the pH, temperature and magnetic field strength dependencies of the resonance intensities, we concluded that this incompleteness in the assignments is mainly due to the exchange between multiple conformations at an intermediate rate on the NMR timescale. These localised conformational dynamics remained in ADP-bound ABCB6-C except for the loops responsible for adenine base and {alpha}/{beta}-phosphate binding. These results revealed that the localised dynamic cooperativity, which was recently proposed for a prokaryotic ABC MJ1267, also exists in a higher eukaryotic ABC, and is presumably shared by all members of the ABC family. Since the Helical domain is the putative interface to the transmembrane domain, this cooperativity may explain the coupled functions between domains in the substrate-transportation cycle.

  12. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze; Gehring, Christoph A


    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs

  13. A single nucleotide polymorphism (SNP) assay for population ...

    African Journals Online (AJOL)

    A single nucleotide polymorphism (SNP) assay for population stratification test ... phenotypes and unlinked candidate loci in case-control and cohort studies of ... Key words: Chinese, Japanese, population stratification, ancestry informative ...

  14. Mitochondrial DNA analysis reveals a low nucleotide diversity of ...

    African Journals Online (AJOL)



    Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.

  15. Extracellular nucleotide derivatives protect cardiomyctes against hypoxic stress

    DEFF Research Database (Denmark)

    Golan, O; Issan, Y; Isak, A


    assures cardioprotection. Treatment with extracellular nucleotides, or with tri/di-phosphate, administered under normoxic conditions or during hypoxic conditions, led to a decrease in reactive oxygen species production. CONCLUSIONS: Extracellular tri/di-phosphates are apparently the molecule responsible...

  16. Enzymatic Incorporation of Modified Purine Nucleotides in DNA. (United States)

    Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet


    A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Detection of DNA nucleotides on pretreated boron doped diamond electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko [UNESP, Araraquara, SP (Brazil). Inst. de Quimica


    The individual detection and equimolar mixture of DNA nucleotides guanosine monophosphate (GMP), adenosine monophosphate (AMP), thymidine (TMP) and cytidine (CMP) 5'-monophosphate using square wave voltammetry was performed on boron doped diamond (BDD) electrodes cathodically (Red-DDB) and anodically (Oxi-DDB) pretreated. The oxidation of individual DNA nucleotides was more sensitive on Oxi-BDD electrode. In a simultaneous detection of nucleotides, the responses of GMP, AMP, TMP and CMP were very adequate on both treated electrodes. Particularly, more sensitive and separate peaks for TMP and CMP on Oxi-BDD and Red-BDD electrodes, respectively, were observed after deconvolution procedure. The detection of nucleotides in aqueous solutions will certainly contribute for genotoxic evaluation of substances and hybridization reactions by immobilizing ss or ds-DNA on BDD surface. (author)

  18. Nucleotide Metabolism and its Control in Lactic Acid Bacteria

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal


    Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including...... the interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods...... for manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....

  19. Free amino acids and 5'-nucleotides in Finnish forest mushrooms. (United States)

    Manninen, Hanna; Rotola-Pukkila, Minna; Aisala, Heikki; Hopia, Anu; Laaksonen, Timo


    Edible mushrooms are valued because of their umami taste and good nutritional values. Free amino acids, 5'-nucleotides and nucleosides were analyzed from four Nordic forest mushroom species (Lactarius camphoratus, Boletus edulis, Cantharellus cibarius, Craterellus tubaeformis) using high precision liquid chromatography analysis. To our knowledge, these taste components were studied for the first time from Craterellus tubaeformis and Lactarius camphoratus. The focus was on the umami amino acids and 5'-nucleotides. The free amino acid and 5'-nucleotide/nucleoside contents of studied species differed from each other. In all studied samples, umami amino acids were among five major free amino acids. The highest concentration of umami amino acids was on L. camphoratus whereas B. edulis had the highest content of sweet amino acids and C. cibarius had the highest content of bitter amino acids. The content of umami enhancing 5'-nucleotides were low in all studied species. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Statistical properties and fractals of nucleotide clusters in DNA sequences

    International Nuclear Information System (INIS)

    Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting


    Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

  1. Blue light induced reactive oxygen species from flavin mononucleotide and flavin adenine dinucleotide on lethality of HeLa cells. (United States)

    Yang, Ming-Yeh; Chang, Chih-Jui; Chen, Liang-Yü


    Photodynamic therapy (PDT) is a safe and non-invasive treatment for cancers and microbial infections. Various photosensitizers and light sources have been developed for clinical cancer therapies. Flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD) are the cofactor of enzymes and are used as photosensitizers in this study. Targeting hypoxia and light-triggering reactive oxygen species (ROS) are experimental strategies for poisoning tumor cells in vitro. HeLa cells are committed to apoptosis when treated with FMN or FAD and exposed to visible blue light (the maximum emitted wavelength of blue light is 462nm). Under blue light irradiation at 3.744J/cm 2 (=0.52mW/cm 2 irradiated for 2h), the minimal lethal dose is 3.125μM and the median lethal doses (LD 50 ) for FMN and FAD are 6.5μM and 7.2μM, respectively. Individual exposure to visible blue light irradiation or riboflavin photosensitizers does not produce cytotoxicity and no side effects are observed in this study. The western blotting results also show that an intrinsic apoptosis pathway is activated by the ROS during photolysis of riboflavin analogues. Blue light triggers the cytotoxicity of riboflavins on HeLa cells in vitro. Based on these results, this is a feasible and efficient of PDT with an intrinsic photosensitizer for cancer research. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Kynureninase-type enzymes and the evolution of the aerobic tryptophan-to-nicotinamide adenine dinucleotide pathway

    Energy Technology Data Exchange (ETDEWEB)

    Gaertner, F.H.; Shetty, A.S.


    Kynureninase-type (L-kynurenine hydrolase, EC activity has been found to be present in the livers of fish, amphibia, reptiles, and birds. In addition to past information concerning this enzyme activity in mammalian liver, it is now clear that all the major classes of vertebrates carry a highly specialized kynureninase-type enzyme, which we have termed a hydroxykynureninase. To compare the reactivities of these enzymes with L-kynurenine and L-3-hydroxykynurenine, ratios of tau values (K/sub m//V) were used. Based on this comparison, the bacterium Pseudomonas fluorescens carries the most efficient kynureninase, whereas the amphibian Xenopus laevis has the most efficient hydroxykynurenase. In these two cases, the ratio of tau values differs by a factor of 38,000. It is hypothesized that the tryptophan-to-nicotinamide adenine dinucleotide biosynthetic pathway evolved from a catabolic system of enzymes, and that the differences observed in the kynureninase-type enzymes between lower and higher organisms reflect the specialization of the function of these enzymes from a strictly catabolic role to an anabolic one during the course of evolution.

  3. Mitochondrial nicotinamide adenine dinucleotide reduced (NADH) oxidation links the tricarboxylic acid (TCA) cycle with methionine metabolism and nuclear DNA methylation. (United States)

    Lozoya, Oswaldo A; Martinez-Reyes, Inmaculada; Wang, Tianyuan; Grenet, Dagoberto; Bushel, Pierre; Li, Jianying; Chandel, Navdeep; Woychik, Richard P; Santos, Janine H


    Mitochondrial function affects many aspects of cellular physiology, and, most recently, its role in epigenetics has been reported. Mechanistically, how mitochondrial function alters DNA methylation patterns in the nucleus remains ill defined. Using a cell culture model of induced mitochondrial DNA (mtDNA) depletion, in this study we show that progressive mitochondrial dysfunction leads to an early transcriptional and metabolic program centered on the metabolism of various amino acids, including those involved in the methionine cycle. We find that this program also increases DNA methylation, which occurs primarily in the genes that are differentially expressed. Maintenance of mitochondrial nicotinamide adenine dinucleotide reduced (NADH) oxidation in the context of mtDNA loss rescues methionine salvage and polyamine synthesis and prevents changes in DNA methylation and gene expression but does not affect serine/folate metabolism or transsulfuration. This work provides a novel mechanistic link between mitochondrial function and epigenetic regulation of gene expression that involves polyamine and methionine metabolism responding to changes in the tricarboxylic acid (TCA) cycle. Given the implications of these findings, future studies across different physiological contexts and in vivo are warranted.

  4. Fluorimetric study of the interaction between nicotinamide adenine dinucleotide phosphate and tetracycline-europium complex and its application

    International Nuclear Information System (INIS)

    Peng Qian; Hou Faju; Ge Xiaoxia; Jiang Chongqiu; Gong Shubo


    A new spectrofluorimetric method was developed for the determination of trace amount of nicotinamide adenine dinucleotide phosphate (NADP). Using europium (Eu 3+ )-tetracycline (TC) complex as a fluorescent probe, in the buffer solution of pH 7.60. NADP can remarkably enhance the fluorescence intensity of the Eu 3+ -TC complex at λ = 612 nm and the enhanced fluorescence intensity of Eu 3+ ion is in proportion to the concentration of NADP. Optimum conditions for the determination of NADP were also investigated. The dynamic range for the determination of NADP is 4.4 x 10 -7 to 2.2 x 10 -6 mol l -1 with detection limit of 6.9 x 10 -8 mol l -1 . This method is simple, practical and relatively free interference from coexisting substances and can be successfully applied to determination of NADP in synthetic water samples and in serum samples. Moreover, the enhancement mechanisms of the fluorescence intensity in the Eu 3+ -TC system and the Eu 3+ -TC-NADP system have been also discussed

  5. Electron-transfer studies with a new flavin adenine dinucleotide dependent glucose dehydrogenase and osmium polymers of different redox potentials. (United States)

    Zafar, Muhammad Nadeem; Wang, Xiaoju; Sygmund, Christoph; Ludwig, Roland; Leech, Dónal; Gorton, Lo


    A new extracellular flavin adenine dinucleotide (FAD)-dependent glucose dehydrogenase from Glomerella cingulata (GcGDH) was electrochemically studied as a recognition element in glucose biosensors. The redox enzyme was recombinantly produced in Pichia pastoris and homogeneously purified, and its glucose-oxidizing properties on spectrographic graphite electrodes were investigated. Six different Os polymers, the redox potentials of which ranged in a broad potential window between +15 and +489 mV versus the normal hydrogen electrode (NHE), were used to immobilize and "wire" GcGDH to the spectrographic graphite electrode's surface. The GcGDH/Os polymer modified electrodes were evaluated by chronoamperometry using flow injection analysis. The current response was investigated using a stepwisely increased applied potential. It was observed that the ratio of GcGDH/Os polymer and the overall loading of the enzyme electrode significantly affect the performance of the enzyme electrode for glucose oxidation. The best-suited Os polymer [Os(4,4'-dimethyl-2,2'-bipyridine)(2)(PVI)Cl](+) had a potential of +309 mV versus NHE, and the optimum GcGDH/Os polymer ratio was 1:2 yielding a maximum current density of 493 μA·cm(-2) at a 30 mM glucose concentration. © 2011 American Chemical Society

  6. The human amygdaloid complex: a cytologic and histochemical atlas using Nissl, myelin, acetylcholinesterase and nicotinamide adenine dinucleotide phosphate diaphorase staining. (United States)

    Sims, K S; Williams, R S


    We examined the distribution of acetylcholinesterase and nicotinamide adenine dinucleotide phosphate diaphorase enzyme activity in the human amygdala using histochemical techniques. Both methods revealed compartments of higher or lower enzyme activity, in cells or neuropil, which corresponded to the nuclear subdivisions of the amygdala as defined with classical Nissl and myelin methods. The boundaries between the histochemical compartments were usually so sharp that the identification of these nuclear subdivisions was enhanced. There was also variation of staining intensity within many of the nuclear subdivisions, such as the lateral and central nuclei, anterior amygdaloid area and the intercalated groups. This histochemical difference corresponded to more subtle differences in Nissl and myelin staining patterns, and suggests further structural subdivisions of potential functional significance. We present a revised scheme of anatomical parcellation of the human amygdala based upon serial analysis with all four techniques. Our expectation is that this will allow the delineation of a clearer homology between the cytoarchitectonic subdivisions of the human amygdala and those of experimental animals.

  7. Synthesis, conformational analysis, and biological activity of new analogues of thiazole-4-carboxamide adenine dinucleotide (TAD) as IMP dehydrogenase inhibitors. (United States)

    Franchetti, Palmarisa; Cappellacci, Loredana; Pasqualini, Michela; Petrelli, Riccardo; Jayaprakasan, Vetrichelvan; Jayaram, Hiremagalur N; Boyd, Donald B; Jain, Manojkumar D; Grifantini, Mario


    Thiazole-4-carboxamide adenine dinucleotide (TAD) analogues T-2'-MeAD (1) and T-3'-MeAD (2) containing, respectively, a methyl group at the ribose 2'-C-, and 3'-C-position of the adenosine moiety, were prepared as potential selective human inosine monophosphate dehydrogenase (IMPDH) type II inhibitors. The synthesis of heterodinucleotides was carried out by CDI-catalyzed coupling reaction of unprotected 2'-C-methyl- or 3'-C-methyl-adenosine 5'-monophosphate with 2',3'-O-isopropylidene-tiazofurin 5'-monophosphate, and then deisopropylidenation. Biological evaluation of dinucleotides 1 and 2 as inhibitors of recombinant human IMPDH type I and type II resulted in a good activity. Inhibition of both isoenzymes by T-2'-MeAD and T-3'-MeAD was noncompetitive with respect to NAD substrate. Binding of T-3'-MeAD was comparable to that of parent compound TAD, while T-2'-MeAD proved to be a weaker inhibitor. However, no significant difference was found in inhibition of the IMPDH isoenzymes. T-2'-MeAD and T-3'-MeAD were found to inhibit the growth of K562 cells (IC(50) 30.7 and 65.0muM, respectively).

  8. Immobilization of flavin adenine dinucleotide (FAD) onto carbon cloth and its application as working electrode in an electroenzymatic bioreactor. (United States)

    Jayabalan, R; Sathishkumar, M; Jeong, E S; Mun, S P; Yun, S E


    A high porosity carbon cloth with immobilized FAD was employed as working electrode in electrochemical NADH-regeneration procedure. Carbon cloth was oxidized with hot acids to create surface carboxyl group and then coupled by adenine amino group of FAD with carbodiimide in the presence of N-hydroxysulfosuccinimide. The bioelectrocatalytic NADH-regeneration was coupled to the conversion of achiral substrate pyruvate into chiral product l-lactate by l-lactate dehydrogenase (l-LDH) within the same reactor. The conversion was completed at 96h in bioreactor with FAD-modified carbon cloth, resulting in about 6mM of l-lactate from 10mM of pyruvate. While with bare carbon cloth, the yield at 120h was around 5mM. Immobilized FAD on the surface of carbon cloth electrode facilitated it to carry electrons from electrode to electron transfer enzymes; thereby NADH-regeneration was accelerated to drive the enzymatic reaction efficiently. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Amperometric cholesterol biosensor based on in situ reconstituted cholesterol oxidase on an immobilized monolayer of flavin adenine dinucleotide cofactor. (United States)

    Vidal, Juan-C; Espuelas, Javier; Castillo, Juan-R


    A new amperometric biosensor for determining cholesterol based on deflavination of the enzyme cholesterol oxidase (ChOx) and subsequent reconstitution of the apo-protein with a complexed flavin adenine dinucleotide (FAD) monolayer is described. The charge transfer mediator pyrroquinoline quinone (PQQ) was covalently bound to a cystamine self-assembled monolayer (SAM) on an Au electrode. Boronic acid (BA) was then bound to PQQ using the carbodiimide procedure, and the BA ligand was complexed to the FAD molecules on which the apo-ChOx was subsequently reconstituted. The effective release of the FAD from the enzyme and the successful reconstitution were verified using molecular fluorescence and cyclic voltammetry. The optimal orientation of FAD toward the PQQ mediator and the distances between FAD and PQQ and between PQQ and electrode enhance the charge transfer, very high sensitivity (about 2,500 nAmM(-1)cm(-2)) being obtained for cholesterol determination. The biosensor is selective toward electroactive interferents (ascorbic acid and uric acid) and was tested in reference serum samples, demonstrating excellent accuracy (relative errors below 3% in all cases). The biosensor activity can be successfully regenerated in a simple process by successive reconstitution with batches of recently prepared apo-ChOx on the same immobilized Au/SAM-PQQ-BA-FAD monolayer (it was tested five times); the lifetime of the biosensor is about 45-60 days.

  10. Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

    International Nuclear Information System (INIS)

    Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz


    The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

  11. Deficiency of the iron-sulfur clusters of mitochondrial reduced nicotinamide-adenine dinucleotide-ubiquinone oxidoreductase (complex I) in an infant with congenital lactic acidosis.


    Moreadith, R W; Batshaw, M L; Ohnishi, T; Kerr, D; Knox, B; Jackson, D; Hruban, R; Olson, J; Reynafarje, B; Lehninger, A L


    We report the case of an infant with hypoglycemia, progressive lactic acidosis, an increased serum lactate/pyruvate ratio, and elevated plasma alanine, who had a moderate to profound decrease in the ability of mitochondria from four organs to oxidize pyruvate, malate plus glutamate, citrate, and other NAD+-linked respiratory substrates. The capacity to oxidize the flavin adenine dinucleotide-linked substrate, succinate, was normal. The most pronounced deficiency was in skeletal muscle, the le...

  12. {sup 19}F-labeling of the adenine H2-site to study large RNAs by NMR spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Sochor, F. [Johann Wolfgang Goethe-University Frankfurt, Institut für Organische Chemie und Chemische Biologie, Center for Biomolecular Magnetic Resonance (BMRZ) (Germany); Silvers, R. [Massachusetts Institute of Technology, Department of Chemistry, Francis Bitter Magnet Laboratory (United States); Müller, D.; Richter, C.; Fürtig, B., E-mail:; Schwalbe, H., E-mail: [Johann Wolfgang Goethe-University Frankfurt, Institut für Organische Chemie und Chemische Biologie, Center for Biomolecular Magnetic Resonance (BMRZ) (Germany)


    In comparison to proteins and protein complexes, the size of RNA amenable to NMR studies is limited despite the development of new isotopic labeling strategies including deuteration and ligation of differentially labeled RNAs. Due to the restricted chemical shift dispersion in only four different nucleotides spectral resolution remains limited in larger RNAs. Labeling RNAs with the NMR-active nucleus {sup 19}F has previously been introduced for small RNAs up to 40 nucleotides (nt). In the presented work, we study the natural occurring RNA aptamer domain of the guanine-sensing riboswitch comprising 73 nucleotides from Bacillus subtilis. The work includes protocols for improved in vitro transcription of 2-fluoroadenosine-5′-triphosphat (2F-ATP) using the mutant P266L of the T7 RNA polymerase. Our NMR analysis shows that the secondary and tertiary structure of the riboswitch is fully maintained and that the specific binding of the cognate ligand hypoxanthine is not impaired by the introduction of the {sup 19}F isotope. The thermal stability of the {sup 19}F-labeled riboswitch is not altered compared to the unmodified sequence, but local base pair stabilities, as measured by hydrogen exchange experiments, are modulated. The characteristic change in the chemical shift of the imino resonances detected in a {sup 1}H,{sup 15}N-HSQC allow the identification of Watson–Crick base paired uridine signals and the {sup 19}F resonances can be used as reporters for tertiary and secondary structure transitions, confirming the potential of {sup 19}F-labeling even for sizeable RNAs in the range of 70 nucleotides.

  13. 19F-labeling of the adenine H2-site to study large RNAs by NMR spectroscopy

    International Nuclear Information System (INIS)

    Sochor, F.; Silvers, R.; Müller, D.; Richter, C.; Fürtig, B.; Schwalbe, H.


    In comparison to proteins and protein complexes, the size of RNA amenable to NMR studies is limited despite the development of new isotopic labeling strategies including deuteration and ligation of differentially labeled RNAs. Due to the restricted chemical shift dispersion in only four different nucleotides spectral resolution remains limited in larger RNAs. Labeling RNAs with the NMR-active nucleus 19 F has previously been introduced for small RNAs up to 40 nucleotides (nt). In the presented work, we study the natural occurring RNA aptamer domain of the guanine-sensing riboswitch comprising 73 nucleotides from Bacillus subtilis. The work includes protocols for improved in vitro transcription of 2-fluoroadenosine-5′-triphosphat (2F-ATP) using the mutant P266L of the T7 RNA polymerase. Our NMR analysis shows that the secondary and tertiary structure of the riboswitch is fully maintained and that the specific binding of the cognate ligand hypoxanthine is not impaired by the introduction of the 19 F isotope. The thermal stability of the 19 F-labeled riboswitch is not altered compared to the unmodified sequence, but local base pair stabilities, as measured by hydrogen exchange experiments, are modulated. The characteristic change in the chemical shift of the imino resonances detected in a 1 H, 15 N-HSQC allow the identification of Watson–Crick base paired uridine signals and the 19 F resonances can be used as reporters for tertiary and secondary structure transitions, confirming the potential of 19 F-labeling even for sizeable RNAs in the range of 70 nucleotides

  14. Binding of p-mercaptobenzoic acid and adenine to gold-coated electroless etched silicon nanowires studied by surface-enhanced Raman scattering. (United States)

    Mohaček-Grošev, Vlasta; Gebavi, Hrvoje; Bonifacio, Alois; Sergo, Valter; Daković, Marko; Bajuk-Bogdanović, Danica


    Modern diagnostic tools ever aim to reduce the amount of analyte and the time needed for obtaining the result. Surface-enhanced Raman spectroscopy is a method that could satisfy both of these requirements, provided that for each analyte an adequate substrate is found. Here we demonstrate the ability of gold-sputtered silicon nanowires (SiNW) to bind p-mercaptobenzoic acid in 10 -3 , 10 -4 and 10 -5 M and adenine in 30 and 100μM concentrations. Based on the normal mode analysis, presented here for the first time, the binding of p-mercaptobenzoic acid is deduced. The intensity enhancement of the 1106cm -1 band is explained by involvement of the CS stretching deformation, and the appearance of the broad 300cm -1 band attributed to SAu stretching mode. Adenine SERS spectra demonstrate the existence of the 7H tautomer since the strongest band observed is at 736cm -1 . The adenine binding is likely to occur in several ways, because the number of observed bands in the 1200-1600cm -1 interval exceeds the number of observed bands in the normal Raman spectrum of the free molecule. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Molecular recognition of AT-DNA sequences by the induced CD pattern of dibenzotetraaza[14]annulene (DBTAA)–adenine derivatives (United States)

    Stojković, Marijana Radić; Škugor, Marko; Dudek, Łukasz; Grolik, Jarosław; Eilmes, Julita


    Summary An investigation of the interactions of two novel and several known DBTAA–adenine conjugates with double-stranded DNA and RNA has revealed the DNA/RNA groove as the dominant binding site, which is in contrast to the majority of previously studied DBTAA analogues (DNA/RNA intercalators). Only DBTAA–propyladenine conjugates revealed the molecular recognition of AT-DNA by an ICD band pattern > 300 nm, whereas significant ICD bands did not appear for other ds-DNA/RNA. A structure–activity relation for the studied series of compounds showed that the essential structural features for the ICD recognition are a) the presence of DNA-binding appendages (adenine side chain and positively charged side chain) on both DBTAA side chains, and b) the presence of a short propyl linker, which does not support intramolecular aromatic stacking between DBTAA and adenine. The observed AT-DNA-ICD pattern differs from previously reported ss-DNA (poly dT) ICD recognition by a strong negative ICD band at 350 nm, which allows for the dynamic differentiation between ss-DNA (poly dT) and coupled ds-AT-DNA. PMID:25246976

  16. Receptor binding of somatostatin-14 and somatostatin-28 in rat brain: differential modulation by nucleotides and ions. (United States)

    Srikant, C B; Dahan, A; Craig, C


    The tissue-selective binding of the two principal bioactive forms of somatostatin, somatostatin-14 (SS-14) and somatostatin-28 (SS-28), their ability to modulate cAMP-dependent and -independent regulation of post-receptor events to different degrees and the documentation of specific labelling of SS receptor subtypes with SS-28 but not SS-14 in discrete regions of rat brain suggest the existence of distinct SS-14 and SS-28 binding sites. Receptor binding of SS-14 ligands has been shown to be modulated by nucleotides and ions, but the effect of these agents on SS-28 binding has not been studied. In the present study we investigated the effects of adenine and guanine nucleotides as well as monovalent and divalent cations on rat brain SS receptors quantitated with radioiodinated analogs of SS-14 ([125I-Tyr11]SS14, referred to in this paper as SS-14) and SS-28 ([Leu8, D-Trp22, 125I-Tyr25] SS-28, referred to as LTT* SS-28) in order to determine if distinct receptor sites for SS-14 and SS-28 could be distinguished on the basis of their modulation by nucleotides and ions. GTP as well as ATP exerted a dose-dependent inhibition (over a concentration range of 10(-7)-10(-3) M) of the binding of the two radioligands. The nucleotide inhibition of binding resulted in a decrease the Bmax of the SS receptors, the binding affinity remaining unaltered. GTP (10(-4) M) decreased the Bmax of LTT* SS-28 binding sites to a greater extent than ATP (145 +/- 10 and 228 +/- 16 respectively, compared to control value of 320 +/- 20 pmol mg-1). Under identical conditions GTP was less effective than ATP in reducing the number of T* SS-14 binding sites (Bmax = 227 +/- 8 and 182 +/- 15, respectively, compared to 340 +/- 15 pmol mg-1 in the absence of nucleotides). Monovalent cations inhibited the binding of both radioligands, Li+ and Na+ inhibited the binding of T* SS-14 to a greater extent than K+. The effect of divalent cations on the other hand was varied. At low concentration (2 mM) Mg2+, Ba2

  17. Signal-enhanced electrochemiluminescence immunosensor based on synergistic catalysis of nicotinamide adenine dinucleotide hydride and silver nanoparticles. (United States)

    Wang, Guangjie; Jin, Feng; Dai, Nan; Zhong, Zhaoyang; Qing, Yi; Li, Mengxia; Yuan, Ruo; Wang, Dong


    A new metal-organic nanocomposite with synergistic catalysis function was prepared and developed to construct an electrochemiluminescence (ECL) immunosensor for ultrasensitive detection of tumor biomarker CA125. Silver nanoparticles (AgNPs) and nicotinamide adenine dinucleotide hydride (NADH) that can participate and catalyze the ECL reaction of Ru(bpy)(3)(2+) were employed as the metal component and the organic component to synthesize the metal-organic nanocomposite of NADH-AgNPs (NA). The novel ECL immunosensor was assembled via Ru(bpy)(3)(2+)-doped silica nanoparticles (Ru-SiO(2)) modified electrode with the NA as immune labels. First, the chitosan-suspended Ru-SiO(2) nanoparticles were cast on the gold electrode surface to immobilize the ECL probes of Ru(bpy)(3)(2+) and link gold nanoparticles. Then, the primary antibodies were loaded onto the modified electrode via the gold sulfhydryl covalent binding. After immunobinding the analytes of antigen, NA-attached secondary antibodies could be captured as a sandwich type on the electrode. Finally, based on the circularly synergistic catalysis by the silver and NADH for the solid-phase ECL of Ru(bpy)(3)(2+), the proposed immunosensor sensed the concentration of antigen. The synergistic ECL catalysis of metal-organic nanocomposite amplified response signal and pushed the detection limit down to 0.03 U ml(-1), which initiated a new ECL labeling field and has great significance for ECL immunoassays. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Structural Probing of Off-Target G Protein-Coupled Receptor Activities within a Series of Adenosine/Adenine Congeners (United States)

    Paoletta, Silvia; Tosh, Dilip K.; Salvemini, Daniela; Jacobson, Kenneth A.


    We studied patterns of off-target receptor interactions, mostly at G protein-coupled receptors (GPCRs) in the µM range, of nucleoside derivatives that are highly engineered for nM interaction with adenosine receptors (ARs). Because of the considerable interest of using AR ligands for treating diseases of the CNS, we used the Psychoactive Drug Screening Program (PDSP) for probing promiscuity of these adenosine/adenine congeners at 41 diverse receptors, channels and a transporter. The step-wise truncation of rigidified, trisubstituted (at N6, C2, and 5′ positions) nucleosides revealed unanticipated interactions mainly with biogenic amine receptors, such as adrenergic receptors and serotonergic receptors, with affinities as high as 61 nM. The unmasking of consistent sets of structure activity relationship (SAR) at novel sites suggested similarities between receptor families in molecular recognition. Extensive molecular modeling of the GPCRs affected suggested binding modes of the ligands that supported the patterns of SAR at individual receptors. In some cases, the ligand docking mode closely resembled AR binding and in other cases the ligand assumed different orientations. The recognition patterns for different GPCRs were clustered according to which substituent groups were tolerated and explained in light of the complementarity with the receptor binding site. Thus, some likely off-target interactions, a concern for secondary drug effects, can be predicted for analogues of this set of substructures, aiding the design of additional structural analogues that either eliminate or accentuate certain off-target activities. Moreover, similar analyses could be performed for unrelated structural families for other GPCRs. PMID:24859150

  19. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1. (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J


    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  20. DNA Nucleotide Sequence Restricted by the RI Endonuclease (United States)

    Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.


    The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

  1. Development of a single nucleotide polymorphism (SNP) marker for ...

    African Journals Online (AJOL)

    The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...

  2. Four new single nucleotide polymorphisms (SNPs) of toll-like ...

    African Journals Online (AJOL)

    In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...

  3. Detection of new single nucleotide polymorphisms by means of real ...

    Indian Academy of Sciences (India)


    amplified millions to billions of times by means of a PCR before the PCR product ... Keywords. Single nucleotide polymorphism; real time PCR; DNA melting curve analysis. ... VAL158MET SNP and alcoholism and to test for interac- tions between the .... indicate a heterozygote sample (VAL/MET genotype). The curve with ...

  4. Involvement of cyclic nucleotides in locust flight muscle metabolism

    NARCIS (Netherlands)

    Worm, R.A.A.


    1. Flight had no significant effect on the levels of c-AMP of c-GMP in the flight muscles of Locusta migratoria. 2. Injections of 0.01 or 0.1 corpus cardiacum equivalents into the abdominal cavity did not elicit any effect on cyclic nucleotide levels either. 3. Injection of A23187 resulted in

  5. Analysis of single nucleotide polymorphisms in case-control studies. (United States)

    Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer


    Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

  6. Subpicosecond Dynamics in Nucleotides Measured by Spontaneous Raman Spectroscopy

    NARCIS (Netherlands)

    Terpstra, P.A.; Terpstra, P.A.; Otto, Cornelis; Greve, Jan


    The band widths in Raman spectra are sensitive to dynamics active on a time scale from 0.1 to 10 ps. The band widths of nucleotide vibrations and their dependence on temperature, concentration, and structure are reported. From the experimental band widths and second moments, it is derived that the

  7. Nucleotide excision repair II: From yeast to mammals

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)


    textabstractAn intricate network of repair systems safeguards the integrity of genetic material, by eliminating DNA lesions induced by numerous environmental and endogenous genotoxic agents. Nucleotide excision repair (NER) is one of the most versatile DNA repair systems. Deficiencies in this

  8. Nucleotide excision repair I: from E.coli to yeast.

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)


    textabstractGenetic information is constantly deteriorating, mainly as a consequence of the action of numerous genotoxic agents. In order to cope with this fundamental problem, all living organisms have acquired a complex network of DNA repair systems to safeguard their genetic integrity. Nucleotide

  9. Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)

    NARCIS (Netherlands)

    Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.

    We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database

  10. DNA Nucleotides Detection via capacitance properties of Graphene (United States)

    Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash


    In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

  11. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    Effects of dietary nucleotides on growth and disease resistance of crustaceans were evaluated using axenic Artemia culture tests. Higher Artemia growth in xenic culture (15.6 ± 2.9 mm) than in axenic culture (9.2 ± 1.9 mm) reaffirmed the need to eliminate microbial populations known to influence growth and disease ...

  12. Adiponectin Single Nucleotide Polymorphism (+276G/T) and Its ...

    African Journals Online (AJOL)

    The present study was investigating the association between the single nucleotide polymorphism +276 G/T of the adiponectin gene with serum adiponectin level in patients with coronary artery disease (CAD). In this study 100 healthy controls and 100 Egyptian patients with coronary artery disease of both genders ...

  13. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O


    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  14. Single nucleotide polymorphisms in the 5'-flanking region of the ...

    African Journals Online (AJOL)

    Prolactin (PRL), a polypeptide hormone synthesized and secreted by the animal's anterior pituitary gland, plays an important role in the regulation of mammalian lactation and avian reproduction. Considering the significant association between single nucleotide polymorphisms (SNPs) in the 5'-flanking region of PRL and ...

  15. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    Nucleotides are low molecular weight biological compounds, which are ... nutrition and disease aspects of crustaceans (Overton and Bland 1981 .... additives on growth and disease resistance. Effects of ... metabolically active cells during stressful conditions ... in humans supplemented with Uracyl, which resulted in optimal ...

  16. Hydration properties of natural and synthetic DNA sequences with methylated adenine or cytosine bases in the R.DpnI target and BDNF promoter studied by molecular dynamics simulations (United States)

    Shanak, Siba; Helms, Volkhard


    Adenine and cytosine methylation are two important epigenetic modifications of DNA sequences at the levels of the genome and transcriptome. To characterize the differential roles of methylating adenine or cytosine with respect to their hydration properties, we performed conventional MD simulations and free energy perturbation calculations for two particular DNA sequences, namely the brain-derived neurotrophic factor (BDNF) promoter and the R.DpnI-bound DNA that are known to undergo methylation of C5-methyl cytosine and N6-methyl adenine, respectively. We found that a single methylated cytosine has a clearly favorable hydration free energy over cytosine since the attached methyl group has a slightly polar character. In contrast, capping the strongly polar N6 of adenine with a methyl group gives a slightly unfavorable contribution to its free energy of solvation. Performing the same demethylation in the context of a DNA double-strand gave quite similar results for the more solvent-accessible cytosine but much more unfavorable results for the rather buried adenine. Interestingly, the same demethylation reactions are far more unfavorable when performed in the context of the opposite (BDNF or R.DpnI target) sequence. This suggests a natural preference for methylation in a specific sequence context. In addition, free energy calculations for demethylating adenine or cytosine in the context of B-DNA vs. Z-DNA suggest that the conformational B-Z transition of DNA transition is rather a property of cytosine methylated sequences but is not preferable for the adenine-methylated sequences investigated here.

  17. Experimental study on the fragmentation of Adenine and Porphyrin molecules induced by low energy multicharged ion impact

    International Nuclear Information System (INIS)

    Li, B.


    Since the dissociation of small molecules might play key roles in the understanding of radiation induced damages of living tissues at the primary steps and at the molecular levels, fragmentation dynamics of small biomolecules have drawn much attention. The knowledge of the internal energy is of fundamental importance for understanding its fragmentation dynamics following external excitation. For a long time however, it was difficult to measure this parameter in coincidence with the fragmentation patterns until the development of CIDEC (Collision Induced Dissociation under Energy Control) method in 2007. In this work, the CIDEC method was extended to study the fragmentation of gas-phase biomolecules adenine (Ade: H 5 C 5 N 5 ) and porphyrin chloride FeTPPCl (C 44 H 28 N 4 FeCl). The population distribution for each dissociation channel as a function of the excitation energy of the parent molecular ions at a well-determined initial charge state has been experimentally determined, which could shed some light on the fragmentation dynamics of these molecules. In collisions between Cl + and Ade at 3 keV, the fragmentation pattern of Ade 2+ is dominated by the loss of H 2 CN + and the successive emission of HCN. The energy distribution of the parent dication confirms the successive emission dynamics. A specific decay channel is observed, i.e. the emission of a charged H 2 CN + followed by the emission of HC 2 N 2 . The measured mean excitation energies of this channel and other competitive channels are compared. In Kr 8+ - FeTPPCl collisions at 80 keV, parent ions FeTPPCL 1+,2+,3+ are observed, along with the corresponding decay patterns. It is found that, in the first step the dominant low-energy-cost decay channel is the emission of Cl 0 independent of the initial charge state of FeTPPCl r+ . For the resulted dication FeTPP 2+ , the dominant fragmentation channel is the neutral evaporation; for the tri-cation however, the dominant fragmentation channel is the

  18. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis. (United States)

    Pisithkul, Tippapha; Jacobson, Tyler B; O'Brien, Thomas J; Stevenson, David M; Amador-Noguez, Daniel


    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using (13)C-labeled sugars and [(15)N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. Copyright © 2015, Pisithkul et al.

  19. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis (United States)

    Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.; Stevenson, David M.


    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. PMID:26070680

  20. Degradation of Adenine on the Martian Surface in the Presence of Perchlorates and Ionizing Radiation: A Reflectron Time-of-flight Mass Spectrometric Study

    Energy Technology Data Exchange (ETDEWEB)

    Góbi, Sándor; Bergantini, Alexandre; Kaiser, Ralf I., E-mail: [Department of Chemistry, University of Hawaii at Mānoa, Honolulu, HI 96822 (United States)


    The aim of the present work is to unravel the radiolytic decomposition of adenine (C{sub 5}H{sub 5}N{sub 5}) under conditions relevant to the Martian surface. Being the fundamental building block of (deoxy)ribonucleic acids, the possibility of survival of this biomolecule on the Martian surface is of primary importance to the astrobiology community. Here, neat adenine and adenine–magnesium perchlorate mixtures were prepared and irradiated with energetic electrons that simulate the secondary electrons originating from the interaction of the galactic cosmic rays with the Martian surface. Perchlorates were added to the samples since they are abundant—and therefore relevant oxidizers on the surface of Mars—and they have been previously shown to facilitate the radiolysis of organics such as glycine. The degradation of the samples were monitored in situ via Fourier transformation infrared spectroscopy and the electron ionization quadruple mass spectrometric method; temperature-programmed desorption profiles were then collected by means of the state-of-the-art single photon photoionization reflectron time-of-flight mass spectrometry (PI-ReTOF-MS), allowing for the detection of the species subliming from the sample. The results showed that perchlorates do increase the destruction rate of adenine by opening alternative reaction channels, including the concurrent radiolysis/oxidation of the sample. This new pathway provides a plethora of different radiolysis products that were identified for the first time. These are carbon dioxide (CO{sub 2}), isocyanic acid (HNCO), isocyanate (OCN{sup −}), carbon monoxide (CO), and nitrogen monoxide (NO); an oxidation product containing carbonyl groups (R{sub 1}R{sub 2}–C=O) with a constrained five-membered cyclic structure could also be observed. Cyanamide (H{sub 2}N–C≡N) was detected in both irradiated samples as well.

  1. Adenine phosphoribosyltransferase from Sulfolobus solfataricus is an enzyme with unusual kinetic properties and a crystal structure that suggests it evolved from a 6-oxopurine phosphoribosyltransferase. (United States)

    Jensen, Kaj Frank; Hansen, Michael Riis; Jensen, Kristine Steen; Christoffersen, Stig; Poulsen, Jens-Christian Navarro; Mølgaard, Anne; Kadziola, Anders


    The adenine phosphoribosyltransferase (APRTase) encoded by the open reading frame SSO2342 of Sulfolobus solfataricus P2 was subjected to crystallographic, kinetic, and ligand binding analyses. The enzyme forms dimers in solution and in the crystals, and binds one molecule of the reactants 5-phosphoribosyl-α-1-pyrophosphate (PRPP) and adenine or the product adenosine monophosphate (AMP) or the inhibitor adenosine diphosphate (ADP) in each active site. The individual subunit adopts an overall structure that resembles a 6-oxopurine phosphoribosyltransferase (PRTase) more than known APRTases implying that APRT functionality in Crenarchaeotae has its evolutionary origin in this family of PRTases. Only the N-terminal two-thirds of the polypeptide chain folds as a traditional type I PRTase with a five-stranded β-sheet surrounded by helices. The C-terminal third adopts an unusual three-helix bundle structure that together with the nucleobase-binding loop undergoes a conformational change upon binding of adenine and phosphate resulting in a slight contraction of the active site. The inhibitor ADP binds like the product AMP with both the α- and β-phosphates occupying the 5'-phosphoribosyl binding site. The enzyme shows activity over a wide pH range, and the kinetic and ligand binding properties depend on both pH and the presence/absence of phosphate in the buffers. A slow hydrolysis of PRPP to ribose 5-phosphate and pyrophosphate, catalyzed by the enzyme, may be facilitated by elements in the C-terminal three-helix bundle part of the protein.

  2. Degradation of Adenine on the Martian Surface in the Presence of Perchlorates and Ionizing Radiation: A Reflectron Time-of-flight Mass Spectrometric Study

    International Nuclear Information System (INIS)

    Góbi, Sándor; Bergantini, Alexandre; Kaiser, Ralf I.


    The aim of the present work is to unravel the radiolytic decomposition of adenine (C 5 H 5 N 5 ) under conditions relevant to the Martian surface. Being the fundamental building block of (deoxy)ribonucleic acids, the possibility of survival of this biomolecule on the Martian surface is of primary importance to the astrobiology community. Here, neat adenine and adenine–magnesium perchlorate mixtures were prepared and irradiated with energetic electrons that simulate the secondary electrons originating from the interaction of the galactic cosmic rays with the Martian surface. Perchlorates were added to the samples since they are abundant—and therefore relevant oxidizers on the surface of Mars—and they have been previously shown to facilitate the radiolysis of organics such as glycine. The degradation of the samples were monitored in situ via Fourier transformation infrared spectroscopy and the electron ionization quadruple mass spectrometric method; temperature-programmed desorption profiles were then collected by means of the state-of-the-art single photon photoionization reflectron time-of-flight mass spectrometry (PI-ReTOF-MS), allowing for the detection of the species subliming from the sample. The results showed that perchlorates do increase the destruction rate of adenine by opening alternative reaction channels, including the concurrent radiolysis/oxidation of the sample. This new pathway provides a plethora of different radiolysis products that were identified for the first time. These are carbon dioxide (CO 2 ), isocyanic acid (HNCO), isocyanate (OCN − ), carbon monoxide (CO), and nitrogen monoxide (NO); an oxidation product containing carbonyl groups (R 1 R 2 –C=O) with a constrained five-membered cyclic structure could also be observed. Cyanamide (H 2 N–C≡N) was detected in both irradiated samples as well.

  3. Comparative anatomy of the human APRT gene and enzyme: nucleotide sequence divergence and conservation of a nonrandom CpG dinucleotide arrangement

    International Nuclear Information System (INIS)

    Broderick, T.P.; Schaff, D.A.; Bertino, A.M.; Dush, M.K.; Tischfield, J.A.; Stambrook, P.J.


    The functional human adenine phosphoribosyltransferase (APRT) gene is <2.6 kilobases in length and contains five exons. The amino acid sequences of APRTs have been highly conserved throughout evolution. The human enzyme is 82%, 90%, and 40% identical to the mouse, hamster, and Escherichia coli enzymes, respectively. The promoter region of the human APRT gene, like that of several other housekeeping genes, lacks TATA and CCAAT boxes but contains five GC boxes that are potential binding sites for the Sp1 transcription factor. The distal three, however, are dispensable for gene expression. Comparison between human and mouse APRT gene nucleotide sequences reveals a high degree of homology within protein coding regions but an absence of significant homology in 5' flanking, 3' untranslated, and intron sequences, except for similarly positioned GC boxes in the promoter region and a 26-base-pair region in intron 3. This 26-base-pair sequence is 92% identical with a similarly positioned sequence in the mouse gene and is also found in intron 3 of the hamster gene, suggesting that its retention may be a consequence of stringent selection. The positions of all introns have been precisely retained in the human and both rodent genes. Retention of an elevated CpG dinucleotide content, despite loss of sequence homology, suggests that there may be selection for CpG dinucleotides in these regions and that their maintenance may be important for APRT gene function

  4. P2Y purinoceptor and nucleotide receptor-induced relaxation of precontracted bovine aortic collateral artery rings: differential sensitivity to suramin and indomethacin. (United States)

    Wilkinson, G F; McKechnie, K; Dainty, I A; Boarder, M R


    We have examined a series of adenine nucleotides and UTP for their ability to cause relaxation of precontracted bovine aortic collateral artery rings. The overall rank order of agonist potency for relaxation was 2-methylthioadenosine 5'-triphosphate (2MeSATP) > adenosine 5'-O-(3-thiotriphosphate) (ATP gamma S) > UTP > ADP > ATP. These responses were endothelium-dependent. Interaction studies showed that responses to the selective P2Y purinoceptor agonist 2MeSATP, and to ADP, were mediated by different receptors from those mediating responses to UTP. Suramin, a P2 purinoceptor antagonist that binds to diverse sites for ATP, produced a concentration-dependent shift in the agonist concentration-effect curve to 2MeSATP, with a pKB of 5.45 +/- 0.15 and a slope of 0.94 +/- 0.09. Suramin produced a small, nonsignificant shift in the UTP response curve and had little effect on responses to ATP. Indomethacin (2.8 x 10(-6) M) had no effect on concentration-effect curves to UTP but almost abolished the relaxations produced by 2MeSATP and ADP. The concentration-effect curves to ATP and ATP gamma S showed a significant (P effects of indomethacin show that these receptors differentially modulate the release of cyclooxygenase-derived mediators of relaxation.

  5. Crystal structure of an intermolecular 2:1 complex between adenine and thymine. Evidence for both Hoogsteen and 'quasi-Watson-Crick' interactions. (United States)

    Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru


    The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.

  6. Molecular recognition of AT-DNA sequences by the induced CD pattern of dibenzotetraaza[14]annulene (DBTAA)–adenine derivatives


    Stojković, Marijana Radić; Škugor, Marko; Dudek, Łukasz; Grolik, Jarosław; Eilmes, Julita; Piantanida, Ivo


    Summary An investigation of the interactions of two novel and several known DBTAA–adenine conjugates with double-stranded DNA and RNA has revealed the DNA/RNA groove as the dominant binding site, which is in contrast to the majority of previously studied DBTAA analogues (DNA/RNA intercalators). Only DBTAA–propyladenine conjugates revealed the molecular recognition of AT-DNA by an ICD band pattern > 300 nm, whereas significant ICD bands did not appear for other ds-DNA/RNA. A structure–activity...

  7. Preparation of protected nucleotides usable in oligonucleotide synthesis

    International Nuclear Information System (INIS)

    Debiard, Jean-Pascal


    After having presented the components of DNA, the author of this research thesis outlines that, when dealing the chemical synthesis, the respect of the sequence of these components is the main problem as each nucleotide possesses several functions which may react with each other. In order to solve this problem, functional protection is used to protect functions which may react in an undesirable way and to let free those which participate to the desired reaction. But a selective protector group must be used and this group must remain stable during the operations it is not involved in. Therefore, its elimination will be easy and without any risk of deterioration of the synthesised molecule. This research thesis first addresses the various available techniques to perform these steps, and then reports the study of possible applications of synthetic nucleotides in the field of genetic engineering [fr

  8. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.


    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.

  9. Pd-catalyzed versus uncatalyzed, PhI(OAc)2-mediated cyclization reactions of N6-([1,1'-biaryl]-2-yl)adenine nucleosides. (United States)

    Satishkumar, Sakilam; Poudapally, Suresh; Vuram, Prasanna K; Gurram, Venkateshwarlu; Pottabathini, Narender; Sebastian, Dellamol; Yang, Lijia; Pradhan, Padmanava; Lakshman, Mahesh K


    In this work we have assessed reactions of N 6 -([1,1'-biaryl]-2-yl)adenine nucleosides with Pd(OAc) 2 and PhI(OAc) 2 , via a Pd II /Pd IV redox cycle. The substrates are readily obtained by Pd/Xantphos-catalyzed reaction of adenine nucleosides with 2-bromo-1,1'-biaryls. In PhMe, the N 6 -biarylyl nucleosides gave C6-carbazolyl nucleoside analogues by C-N bond formation with the exocyclic N 6 nitrogen atom. In the solvent screening for the Pd-catalyzed reactions, an uncatalyzed process was found to be operational. It was observed that the carbazolyl products could also be obtained in the absence of a metal catalyst by reaction with PhI(OAc) 2 in 1,1,1,3,3,3-hexafluoroisopropanol (HFIP). Thus, under Pd catalysis and in HFIP, reactions proceed to provide carbazolyl nucleoside analogues, with some differences. If reactions of N 6 -biarylyl nucleoside substrates were conducted in MeCN, formation of aryl benzimidazopurinyl nucleoside derivatives was observed in many cases by C-N bond formation with the N 1 ring nitrogen atom of the purine (carbazole and benzimidazole isomers are readily separated by chromatography). Whereas Pd II /Pd IV redox is responsible for carbazole formation under the metal-catalyzed conditions, in HFIP and MeCN radical cations and/or nitrenium ions can be intermediates. An extensive set of radical inhibition experiments was conducted and the data are presented.

  10. Changes in phosphorylation of adenosine phosphate and redox state of nicotinamide-adenine dinucleotide (phosphate) in Geobacter sulfurreducens in response to electron acceptor and anode potential variation

    KAUST Repository

    Rose, Nicholas D.; Regan, John M.


    © 2015 Elsevier B.V. Geobacter sulfurreducens is one of the dominant bacterial species found in biofilms growing on anodes in bioelectrochemical systems. The intracellular concentrations of reduced and oxidized forms of nicotinamide-adenine dinucleotide (NADH and NAD+, respectively) and nicotinamide-adenine dinucleotide phosphate (NADPH and NADP+, respectively) as well as adenosine triphosphate (ATP), adenosine diphosphate (ADP), and adenosine monophosphate (AMP) were measured in G. sulfurreducens using fumarate, Fe(III)-citrate, or anodes poised at different potentials (110, 10, -90, and -190mV (vs. SHE)) as the electron acceptor. The ratios of CNADH/CNAD+ (0.088±0.022) and CNADPH/CNADP+ (0.268±0.098) were similar under all anode potentials tested and with Fe(III)-citrate (reduced extracellularly). Both ratios significantly increased with fumarate as the electron acceptor (0.331±0.094 for NAD and 1.96±0.37 for NADP). The adenylate energy charge (the fraction of phosphorylation in intracellular adenosine phosphates) was maintained near 0.47 under almost all conditions. Anode-growing biofilms demonstrated a significantly higher molar ratio of ATP/ADP relative to suspended cultures grown on fumarate or Fe(III)-citrate. These results provide evidence that the cellular location of reduction and not the redox potential of the electron acceptor controls the intracellular redox potential in G. sulfurreducens and that biofilm growth alters adenylate phosphorylation.

  11. Post-synthetic modification of mesoporous zinc-adeninate framework with tris(2,2′-biprydine) ruthenium(II) complex and its electrochemiluminescence

    Energy Technology Data Exchange (ETDEWEB)

    Park, Ji Eun; Shin, Ik Soo [Dept. of Chemistry, Soongsil University, Seoul (Korea, Republic of); Oh, Hye Jae; An, Ji Hyun [Dept. of Chemistry Education, Seoul National University, Seoul (Korea, Republic of)


    Herein we report a redox-active metal-organic framework (MOF) via post-synthetic cation exchange with tris(2,2′-biprydine) ruthenium(II) complex (Ru(bpy){sub 3}{sup 2+}). A porous anionic zinc-adeninate framework (bMOF-100) is spacious enough to easily entrap 2.43 of Ru(bpy){sub 3}{sup 2+} cations within the mesopore. The encapsulation supported the framework structure preventing any distortion from a rapid solvent evaporation under SEM observation. Ru(bpy){sub 3}{sup 2+}@bMOF-100 was then immobilized on the surface of glassy carbon electrode, and its electrocatalytic and electrochemiluminescent (ECL) properties were investigated in aqueous and organic solution. Especially, Ru(bpy){sub 3}{sup 2+}@bMOF-100 showed the excellent electrochemical properties of Ru(bpy){sub 3}{sup 2+}, but gradual decomposition of the MOF structure was observed under electrochemical measurements because of the sluggish oxidation of adeninate ligand.

  12. Changes in phosphorylation of adenosine phosphate and redox state of nicotinamide-adenine dinucleotide (phosphate) in Geobacter sulfurreducens in response to electron acceptor and anode potential variation

    KAUST Repository

    Rose, Nicholas D.


    © 2015 Elsevier B.V. Geobacter sulfurreducens is one of the dominant bacterial species found in biofilms growing on anodes in bioelectrochemical systems. The intracellular concentrations of reduced and oxidized forms of nicotinamide-adenine dinucleotide (NADH and NAD+, respectively) and nicotinamide-adenine dinucleotide phosphate (NADPH and NADP+, respectively) as well as adenosine triphosphate (ATP), adenosine diphosphate (ADP), and adenosine monophosphate (AMP) were measured in G. sulfurreducens using fumarate, Fe(III)-citrate, or anodes poised at different potentials (110, 10, -90, and -190mV (vs. SHE)) as the electron acceptor. The ratios of CNADH/CNAD+ (0.088±0.022) and CNADPH/CNADP+ (0.268±0.098) were similar under all anode potentials tested and with Fe(III)-citrate (reduced extracellularly). Both ratios significantly increased with fumarate as the electron acceptor (0.331±0.094 for NAD and 1.96±0.37 for NADP). The adenylate energy charge (the fraction of phosphorylation in intracellular adenosine phosphates) was maintained near 0.47 under almost all conditions. Anode-growing biofilms demonstrated a significantly higher molar ratio of ATP/ADP relative to suspended cultures grown on fumarate or Fe(III)-citrate. These results provide evidence that the cellular location of reduction and not the redox potential of the electron acceptor controls the intracellular redox potential in G. sulfurreducens and that biofilm growth alters adenylate phosphorylation.

  13. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Lo, A.; Yang, H.L.


    This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

  14. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.


    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  15. Mitochondria as determinant of nucleotide pools and chromosomal stability

    DEFF Research Database (Denmark)

    Madsen, Claus Desler; Munch-Petersen, Birgitte; Stevnsner, Tinna


    Mitochondrial function plays an important role in multiple human diseases and mutations in the mitochondrial genome have been detected in nearly every type of cancer investigated to date. However, the mechanism underlying the interrelation is unknown. We used human cell lines depleted of mitochon...... mitochondrial activity. Our results suggest that mitochondria are central players in maintaining genomic stability and in controlling essential nuclear processes such as upholding a balanced supply of nucleotides....

  16. Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices. (United States)

    Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro


    The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Nucleotide sequence of tomato ringspot virus RNA-2. (United States)

    Rott, M E; Tremaine, J H; Rochon, D M


    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  18. Scambio, a novel guanine nucleotide exchange factor for Rho

    Directory of Open Access Journals (Sweden)

    Groffen John


    Full Text Available Abstract Background Small GTPases of the Rho family are critical regulators of various cellular functions including actin cytoskeleton organization, activation of kinase cascades and mitogenesis. For this reason, a major objective has been to understand the mechanisms of Rho GTPase regulation. Here, we examine the function of a novel protein, Scambio, which shares homology with the DH-PH domains of several known guanine nucleotide exchange factors for Rho family members. Results Scambio is located on human chromosome 14q11.1, encodes a protein of around 181 kDa, and is highly expressed in both heart and skeletal muscle. In contrast to most DH-PH-domain containing proteins, it binds the activated, GTP-bound forms of Rac and Cdc42. However, it fails to associate with V14RhoA. Immunofluorescence studies indicate that Scambio and activated Rac3 colocalize in membrane ruffles at the cell periphery. In accordance with these findings, Scambio does not activate either Rac or Cdc42 but rather, stimulates guanine nucleotide exchange on RhoA and its close relative, RhoC. Conclusion Scambio associates with Rac in its activated conformation and functions as a guanine nucleotide exchange factor for Rho.

  19. Determination of the recognition site for adenine-specific methylase of Shigella sonnei 47 by hydazinolysis of DNA, followed by separation of the purine oligonucleotides by thin-layer chromatography on DEAE-cellulose

    International Nuclear Information System (INIS)

    Lopatina, N.G.; Kirnos, M.D.; Suchkov, S.V.; Vanyushin, B.F.; Nikol'skaya, I.I.; Debov, S.S.


    A method has been developed for the separation of oligopurine units according to length and composition by two-dimensional thin-layer chromatography on plates with DEAE-cellulose, permitting a comparative analysis of the content of various purine isopliths in DNA of different origin. In the case of the analysis of methylated DNA, the method permits a comparison of the substrate specificity of various enzymes of methylation of the adenine residues in DNA. In conjunction with enzymatic treatment of labeled methylated isopliths, the method permits determination of the methylatable sequence and in a number of cases an ascertainment of the recognition site for adenine-specific methylase as a whole. The proposed method was used to establish the fact that the methylase Ssol recognizes the sequence 5'...G-A-A-T-T-C...3' and methylates the adenine residue closest to its 5'-end

  20. The Role of Cyclic Nucleotide Signaling Pathways in Cancer: Targets for Prevention and Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Fajardo, Alexandra M.; Piazza, Gary A. [Drug Discovery Research Center, Mitchell Cancer Institute, University of South Alabama, 1660 Springhill Ave, Suite 3029, Mobile, AL 36604 (United States); Tinsley, Heather N., E-mail: [Department of Biology, Chemistry, and Mathematics, University of Montevallo, Station 6480, Montevallo, AL 35115 (United States)


    For more than four decades, the cyclic nucleotides cyclic AMP (cAMP) and cyclic GMP (cGMP) have been recognized as important signaling molecules within cells. Under normal physiological conditions, cyclic nucleotides regulate a myriad of biological processes such as cell growth and adhesion, energy homeostasis, neuronal signaling, and muscle relaxation. In addition, altered cyclic nucleotide signaling has been observed in a number of pathophysiological conditions, including cancer. While the distinct molecular alterations responsible for these effects vary depending on the specific cancer type, several studies have demonstrated that activation of cyclic nucleotide signaling through one of three mechanisms—induction of cyclic nucleotide synthesis, inhibition of cyclic nucleotide degradation, or activation of cyclic nucleotide receptors—is sufficient to inhibit proliferation and activate apoptosis in many types of cancer cells. These findings suggest that targeting cyclic nucleotide signaling can provide a strategy for the discovery of novel agents for the prevention and/or treatment of selected cancers.

  1. AVP-stimulated nucleotide secretion in perfused mouse medullary thick ascending limb and cortical collecting duct

    DEFF Research Database (Denmark)

    Odgaard, Elvin V. P.; Prætorius, Helle; Leipziger, Jens Georg


    is stimulated remain elusive. Here, we investigate the phenomenon of nucleotide secretion in intact, perfused mouse medullary thick ascending limb (mTAL) and cortical collecting duct (CCD). The nucleotide secretion was monitored by a biosensor adapted to register nucleotides in the tubular outflow...

  2. Evidence for the existence of a tyrosyl residue in the nicotinamide adenine dinucleotide binding site of chicken liver xanthine dehydrogenase

    International Nuclear Information System (INIS)

    Nishino, T.; Nishino, T.


    Xanthine-NAD and NADH-methylene blue oxidoreductase activities of chicken liver xanthine dehydrogenase were inactivated by incubation with 5'-[p-(fluorosulfonyl)benzoyl]adenosine (5'-FSBA), an active site directed reagent for nucleotide binding sites. The inactivation reaction displayed pseudo-first-order kinetics. A double-reciprocal plot of inactivation velocity vs. 5'-FSBA concentration showed that 5'-FSBA and enzyme formed a complex prior to inactivation. NAD protected the enzyme from inactivation by 5'-FSBA in a competitive fashion. The modified enzyme had the same xanthine-dichlorophenolindophenol and xanthine-O 2 oxidoreductase activities as the native enzyme, and on addition of xanthine to the modified enzyme, bleaching of the spectrum occurred in the visible region. The amount of radioactivity incorporated into the enzyme by incubation with [ 14 C]-5'-FSBA was parallel to the loss of xanthine-NAD oxidoreductase activity, and the stoichiometry was 1 mol/mol of enzyme-bound FAD for complete inactivation. These results indicated that 5'-FSBA modified specifically the binding site for NAD of chicken liver xanthine dehydrogenase. The incorporated radioactivity was released slowly from 14 C-labeled enzyme by incubation with dithiothreitol with concomitant restoration of catalytic activity. The modified residue responsible for inactivation was identified as a tyrosine

  3. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange* (United States)

    Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.


    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946

  4. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange. (United States)

    Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J


    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms


    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca


    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jka/Jkb, Fya/Fyb, S/s, K/k, Kpa/Kpb, Jsa/Jsb, Coa/Cob and Lua/Lub alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplif...

  6. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))


    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  7. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin


    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from...... the sensor bias current to magnetize magnetic beads in the vicinity of the sensor. The method allows for real-time measurements of the specific bead binding to the sensor surface during DNA hybridization and washing. Compared to other magnetic biosensing platforms, our approach eliminates the need...... for external electromagnets and thus allows for miniaturization of the sensor platform....

  8. Nucleotide Selectivity at a Preinsertion Checkpoint of T7 RNA Polymerase Transcription Elongation. (United States)

    E, Chao; Duan, Baogen; Yu, Jin


    Nucleotide selection is crucial for transcription fidelity control, in particular, for viral T7 RNA polymerase (RNAP) lack of proofreading activity. It has been recognized that multiple kinetic checkpoints exist prior to full nucleotide incorporation. In this work, we implemented intensive atomistic molecular dynamics (MD) simulations to quantify how strong the nucleotide selection is at the initial checkpoint of an elongation cycle of T7 RNAP. The incoming nucleotides bind into a preinsertion site where a critical tyrosine residue locates nearby to assist the nucleotide selection. We calculated the relative binding free energy between a noncognate nucleotide and a cognate one at a preinsertion configuration via alchemical simulations, showing that a small selection free energy or the binding free energy difference (∼3 k B T) exists between the two nucleotides. Indeed, another preinsertion configuration favored by the noncognate nucleotides was identified, which appears to be off path for further nucleotide insertion and additionally assists the nucleotide selection. By chemical master equation (CME) approach, we show that the small selection free energy at the preinsertion site along with the off-path noncognate nucleotide filtering can help substantially to reduce the error rate and to maintain the elongation rate high in the T7 RNAP transcription.

  9. Relative Stability of the La and Lb Excited States in Adenine and Guanine: Direct Evidence from TD-DFT Calculations of MCD Spectra. (United States)

    Santoro, Fabrizio; Improta, Roberto; Fahleson, Tobias; Kauczor, Joanna; Norman, Patrick; Coriani, Sonia


    The relative position of La and Lb ππ* electronic states in purine nucleobases is a much debated topic, since it can strongly affect our understanding of their photoexcited dynamics. To assess this point, we calculated the absorption and magnetic circular dichroism (MCD) spectra of adenine, guanine, and their nucleosides in gas-phase and aqueous solution, exploiting recent developments in MCD computational technology within time-dependent density functional theory. MCD spectroscopy allows us to resolve the intense S0→ La transition from the weak S0→ Lb transition. The spectra obtained in water solution, by using B3LYP and CAM-B3LYP functionals and describing solvent effect by cluster models and by the polarizable continuum model (PCM), are in very good agreement with the experimental counterparts, thus providing direct and unambiguous evidence that the energy ordering predicted by TD-DFT, La < Lb, is the correct one.

  10. Synthesis and characterization of zinc adeninate metal-organic frameworks (bioMOF1) as potential anti-inflammatory drug delivery material (United States)

    Usman, Ken Aldren S.; Buenviaje, Salvador C.; Razal, Joselito M.; Conato, Marlon T.; Payawan, Leon M.


    Zn8(ad)4(BPDC)6O•2Me2NH2 (bioMOF1), a porous metal-organic framework with zinc-adeninate secondary building units (SBUs), interconnected via biphenyldicarboxylate linkers, shows great potential for drug delivery applications due to its non-toxic and biocompatible components (zinc and adenine). In this study, bioMOF1 crystals synthesized solvothermally at 130°C for 24 hours, were characterized thoroughly and loaded with a known anti-inflammatory drug, nimesulide (NIM). The crystalline nature of the material was confirmed using powder x-ray diffraction crystallography (PXRD) along with morphology assessment using focused-ion beam/field emission scanning electron microscopy (FIB/FESEM). NIM was introduced to the crystals via solvent exchange accompanied with vigorous stirring and quantified using thermogravimetric analysis (TGA) with loading saturation of ˜30% attained during the 2nd to 3rd day of drug immersion. Drug release in phosphate buffer saline and in deionized water was done to monitor the kinetic of drug release in vitro. The drug release showed a controlled discharge profile which slowed down at the 24th and 48th hour of release. Drug release in buffer showed a faster release of drug from the material, which means that the presence of cations in the solution could further trigger the release of drug. Slow drug release was observed for all of the set-ups with maximum % drug release of 24.47%, and 16.14% for the bioMOF1 in buffer and bioMOF1 in water respectively for the span of 48 hours.

  11. An important role for adenine, cholera toxin, hydrocortisone and triiodothyronine in the proliferation, self-renewal and differentiation of limbal stem cells in vitro. (United States)

    Yu, Min; Bojic, Sanja; Figueiredo, Gustavo S; Rooney, Paul; de Havilland, Julian; Dickinson, Anne; Figueiredo, Francisco C; Lako, Majlinda


    The cornea is a self-renewing tissue located at the front of the eye. Its transparency is essential for allowing light to focus onto the retina for visual perception. The continuous renewal of corneal epithelium is supported by limbal stem cells (LSCs) which are located in the border region between conjunctiva and cornea known as the limbus. Ex vivo expansion of LSCs has been successfully applied in the last two decades to treat patients with limbal stem cell deficiency (LSCD). Various methods have been used for their expansion, yet the most widely used culture media contains a number of ingredients derived from animal sources which may compromise the safety profile of human LSC transplantation. In this study we sought to understand the role of these components namely adenine, cholera toxin, hydrocortisone and triiodothyronine with the aim of re-defining a safe and GMP compatible minimal media for the ex vivo expansion of LSCs on human amniotic membrane. Our data suggest that all four components play a critical role in maintaining LSC proliferation and promoting LSC self-renewal. However removal of adenine and triiodothyronine had a more profound impact and led to LSC differentiation and loss of viability respectively, suggesting their essential role for ex vivo expansion of LSCs. Replacement of each of the components with GMP-grade reagents resulted in equal growth to non-GMP grade media, however an enhanced differentiation of LSCs was observed, suggesting that additional combinations of GMP grade reagents need to be tested to achieve similar or better level of LSC maintenance in the same manner as the traditional LSC media. Crown Copyright © 2016. Published by Elsevier Ltd. All rights reserved.

  12. Adenine phosphoribosyltransferase from Sulfolobus solfataricus is an enzyme with unusual kinetic properties and a crystal structure that suggests it evolved from a 6-oxopurine phosphoribosyltransferase

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank; Hansen, Michael Riis; Jensen, Kristine Steen


    The adenine phosphoribosyltransferase (APRTase) encoded by the open reading frame SSO2342 of Sulfolobus solfataricus P2, was subjected to crystallographic, kinetic and ligand binding analyses. The enzyme forms dimers in solution and in the crystals, and binds one molecule of the reactants 5...

  13. Supra-molecular hydrogen-bonding patterns in the N(9)-H protonated and N(7)-H tautomeric form of an N(6) -benzoyl-adenine salt: N (6)-benzoyl-adeninium nitrate. (United States)

    Karthikeyan, Ammasai; Jeeva Jasmine, Nithianantham; Thomas Muthiah, Packianathan; Perdih, Franc


    In the title molecular salt, C12H10N5O(+)·NO3 (-), the adenine unit has an N (9)-protonated N(7)-H tautomeric form with non-protonated N(1) and N(3) atoms. The dihedral angle between the adenine ring system and the phenyl ring is 51.10 (10)°. The typical intra-molecular N(7)-H⋯O hydrogen bond with an S(7) graph-set motif is also present. The benzoyl-adeninium cations also form base pairs through N-H⋯O and C-H⋯N hydrogen bonds involving the Watson-Crick face of the adenine ring and the C and O atoms of the benzoyl ring of an adjacent cation, forming a supra-molecular ribbon with R 2 (2)(9) rings. Benzoyl-adeninum cations are also bridged by one of the oxygen atoms of the nitrate anion, which acts as a double acceptor, forming a pair of N-H⋯O hydrogen bonds to generate a second ribbon motif. These ribbons together with π-π stacking inter-actions between the phenyl ring and the five- and six-membered adenine rings of adjacent mol-ecules generate a three-dimensional supra-molecular architecture.

  14. Selective inhibitory effects of (S)-9-(3-hydroxy-2-phosphonyl-methoxypropyl)adenine and 1-(2'-deoxy-2'-fluoro-ß-D-arabinofuranosyl)-5-iodouracil on seal herpesvirus (Phocid herpesvirus 1) infection in vitro.

    NARCIS (Netherlands)

    A.D.M.E. Osterhaus (Albert); J. Groen (Jan); E. de Clercq


    textabstractFrom a selection of 25 antiviral compounds with specific anti-herpes activity or broad-spectrum antiviral properties, two compounds, namely (S)-9-(3-hydroxy-2-phosphonyl-methoxypropyl)adenine and 1-(2'-deoxy-2'-fluoro-beta-D-arabinofuranosyl)-5-iodouracil, appeared particularly effective

  15. Kinetic mechanism and nucleotide specificity of NADH peroxidase

    International Nuclear Information System (INIS)

    Stoll, V.S.; Blanchard, J.S.


    NADH peroxidase is a flavoprotein isolated from Streptococcus faecalis which catalyzes the pyridine nucleotide-dependent reduction of hydrogen peroxide to water. Initial velocity, product, and dead-end inhibition studies have been performed at pH 7.5 and support a ping-pong kinetic mechanism. In the absence of hydrogen peroxide, both transhydrogenation between NADH and thioNAD, and isotope exchange between [ 14 C]NADH and NAD, have been demonstrated, although in both these experiments, the maximal velocity of nucleotide exchange was less than 1.5% the maximal velocity of the peroxidatic reaction. We propose that NADH binds tightly to both oxidized and two-electron reduced enzyme. NADH oxidation proceeds stereospecifically with the transfer of the 4S hydrogen to enzyme, and then, via exchange, to water. No primary tritium kinetic isotope effect was observed, and no statistically significant primary deuterium kinetic isotope effects on V/K were determined, although primary deuterium kinetic isotope effects on V were observed in the presence and absence of sodium acetate. NADH peroxidase thus shares with other flavoprotein reductases striking kinetic, spectroscopic, and stereochemical similarities. On this basis, we propose a chemical mechanism for the peroxide cleaving reaction catalyzed by NADH peroxidase which involves the obligate formation of a flavinperoxide, and peroxo bond cleavage by nucleophilic attack by enzymatic dithiols

  16. Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men

    Directory of Open Access Journals (Sweden)

    Ahamad Salamian


    Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.

  17. Retinal Cyclic Nucleotide-Gated Channels: From Pathophysiology to Therapy

    Directory of Open Access Journals (Sweden)

    Stylianos Michalakis


    Full Text Available The first step in vision is the absorption of photons by the photopigments in cone and rod photoreceptors. After initial amplification within the phototransduction cascade the signal is translated into an electrical signal by the action of cyclic nucleotide-gated (CNG channels. CNG channels are ligand-gated ion channels that are activated by the binding of cyclic guanosine monophosphate (cGMP or cyclic adenosine monophosphate (cAMP. Retinal CNG channels transduce changes in intracellular concentrations of cGMP into changes of the membrane potential and the Ca2+ concentration. Structurally, the CNG channels belong to the superfamily of pore-loop cation channels and share a common gross structure with hyperpolarization-activated cyclic nucleotide-gated (HCN channels and voltage-gated potassium channels (KCN. In this review, we provide an overview on the molecular properties of CNG channels and describe their physiological role in the phototransduction pathways. We also discuss insights into the pathophysiological role of CNG channel proteins that have emerged from the analysis of CNG channel-deficient animal models and human CNG channelopathies. Finally, we summarize recent gene therapy activities and provide an outlook for future clinical application.

  18. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A.


    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  19. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A; Turek, Ilona S.


    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  20. Modification of synthesis nucleotides [γ-32P] ATP

    International Nuclear Information System (INIS)

    Wira Y Rahman; Endang Sarmini; Herlina; Triyanto; Hambali; Abdul Mutalib; Santi Nurbaiti


    In molecular biology, radionuclides in the form of radiolabeled compounds have been widely used as deoxyribonucleic acid (DNA) / ribonucleic acid (RNA) tracer in order to explore a wide range of physiological and pathological processes. One of such compounds is [γ- 32 P]-adenosine triphosphate {[γ- 32 P]-ATP} [γ- 32 P]-ATP which has been widely used in the biotechnology research. In order to support the biotechnology research in Indonesia in this project, [γ- 32 P]- ATP had been synthesized by enzymatic reactions with modifying the method of synthesis using the precursor DL-glyceraldehyde 3-phosphate, nucleotides Adenosine Diphosphate (ADP) and H 3 32 PO 4 and enzymes glyceraldehyde 3-phosphate dehydrogenase, 3-phosphoroglyceric phosphokinase and lactate dehydrogenase. The purification of the synthesized [γ- 32 P]-ATP, by using DEAE Sephadex column chromatography. The synthesis and purification process that had been performed were able in producing of [γ- 32 P]-ATP with radioactivity of 1,175 mCi and radiochemical purity of 99,49%.. Having successfully prepared the [γ- 32 P]-ATP and application, in the near future the Radioisotopes and Radiopharmaceuticals Centre is expected to be able in providing the above-mentioned radiolabeled nucleotide for biotechnology research in Indonesia. (author)

  1. Nucleobases, nucleosides, and nucleotides: versatile biomolecules for generating functional nanomaterials. (United States)

    Pu, Fang; Ren, Jinsong; Qu, Xiaogang


    The incorporation of biomolecules into nanomaterials generates functional nanosystems with novel and advanced properties, presenting great potential for applications in various fields. Nucleobases, nucleosides and nucleotides, as building blocks of nucleic acids and biological coenzymes, constitute necessary components of the foundation of life. In recent years, as versatile biomolecules for the construction or regulation of functional nanomaterials, they have stimulated interest in researchers, due to their unique properties such as structural diversity, multiplex binding sites, self-assembly ability, stability, biocompatibility, and chirality. In this review, strategies for the synthesis of nanomaterials and the regulation of their morphologies and functions using nucleobases, nucleosides, and nucleotides as building blocks, templates or modulators are summarized alongside selected applications. The diverse applications range from sensing, bioimaging, and drug delivery to mimicking light-harvesting antenna, the construction of logic gates, and beyond. Furthermore, some perspectives and challenges in this emerging field are proposed. This review is directed toward the broader scientific community interested in biomolecule-based functional nanomaterials.

  2. Assay of cyclic nucleotide phosphodiesterase using radiolabeled and fluorescent substrates

    International Nuclear Information System (INIS)

    Kincaid, R.L.; Manganiello, V.C.


    There are four major classes of phosphodiesterase with different specificities for cAMP and cGMP and different allosteric regulators. Type I phosphodiesterase is activated by calmodulin plus Ca/sup 2+/ and has a higher affinity for cGMP than cAMP. Type II phosphodiesterase likewise has a higher affinity for cGMP than cAMP, but the activity toward one substrate is markedly stimulated by low (micromolar) concentrations of the other nucleotide. Type III phosphodiesterase has a higher affinity for cAMP than cGMP; its activity is increased in responsive cells by certain hormones, e.g., insulin, isoproterenol. Type IV phosphodiesterase is the cGMP-specific enzyme, which also has an allosteric binding site for cGMP. An example of this class of enzyme is the one from retinal rod outer segments, which is activated by light via rhodopsin and the guanine nucleotide-binding protein transducin. There appears to be little structural relatedness among these enzymes based on immunologic analysis, consistent with the possibility that divergent forms evolved from an ancestral enzyme. Determination of the amount of a specific form of phosphodiesterase in crude material is often difficult. Modification of assay conditions by judicious choice of substrate and/or inhibitor concentrations may selectively favor (or reduce) the activity of a particular form; in many instances, however, some fractionation of enzymes may be necessary. This is discussed more fully in the final section of this chapter

  3. Complete nucleotide sequences of avian metapneumovirus subtype B genome. (United States)

    Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro


    Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

  4. Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB

    Directory of Open Access Journals (Sweden)

    Joon-Ho Lee


    Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB ( provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.

  5. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun; Li, Yue; Peng, Chengbin; Moses, Alan M.; Zhang, Zhaolei


    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  6. Radicals of DNA and DNA nucleotides generated by ionising radiation

    International Nuclear Information System (INIS)

    Przybytniak, G.


    A first stage of cell processes leading to DNA damage of initiated by radical reactions. In a model system such transformations were generated by ionising radiation which involves production of electron loss and electron gain centers of the substrate and radical formation. Using cryogenic ESR spectroscopy it was found that the DNA nucleotides, which convert to radical anions upon electron capture undergo the separation of unpaired spin and charge due to protonation. Circular and linear dichroism studies enabled to conclude that iron ions(III) induce strong changes in the DNA helical structure indicating their coordination with nitrogen bases. The repair of DNA radicals produced via radiolytic oxidation, i.e. the guanine radical cation and the allyl type radical of thymine, is possible at elevated temperatures due to the involvement of sulphydryl groups. The influence of the thiol charge is then limited

  7. Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles (United States)

    Berti, Lorenzo; Burley, Glenn A.


    Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.

  8. Environmental heat stress, hyperammonemia and nucleotide metabolism during intermittent exercise

    DEFF Research Database (Denmark)

    Mohr, Magni; Rasmussen, Peter; Drust, Barry


    ) followed by five 15 s all-out sprints. Control trials were conducted in a 20°C environment while heat stress trials were performed at an ambient temperature of 40°C. Muscle biopsies and venous blood samples were obtained at rest, after 40 min of exercise and following the maximal sprints. Following......Abstract  This study investigated the influence of environmental heat stress on ammonia (NH3) accumulation in relation to nucleotide metabolism and fatigue during intermittent exercise. Eight males performed 40 min of intermittent exercise (15 s at 306±22 W alternating with 15 s of unloaded cycling...... exercise with heat stress, the core and muscle temperatures peaked at 39.5±0.2 and 40.2±0.2°C to be ~ 1°C higher (Pheat stress trial (P

  9. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun


    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  10. Genome-wide patterns of nucleotide polymorphism in domesticated rice

    DEFF Research Database (Denmark)

    Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D


    Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... to explain contemporary patterns of polymorphisms in rice, including a (i) selectively neutral population bottleneck model, (ii) bottleneck plus migration model, (iii) multiple selective sweeps model, and (iv) bottleneck plus selective sweeps model. We find that a simple bottleneck model, which has been...

  11. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze


    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs are often part of complex multifunctional proteins with different domain organizations and biological functions that are not conserved in higher plants. For this reason, we have developed CNC search strategies based on functionally conserved amino acids in the catalytic center of annotated and/or experimentally confirmed CNCs. Here we detail this method which has led to the identification of >25 novel candidate CNCs in Arabidopsis thaliana, several of which have been experimentally confirmed in vitro and in vivo. We foresee that the application of this method can be used to identify many more members of the growing family of CNCs in higher plants. © Springer Science+Business Media New York 2013.

  12. High pressure {sup 31}P NMR spectroscopy on guanine nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Spoerner, Michael; Karl, Matthias; Lopes, Pedro; Hoering, Marcus; Loeffel, Karoline; Nuehs, Andrea; Adelsberger, Joseph; Kremer, Werner; Kalbitzer, Hans Robert, E-mail: [University of Regensburg, Centre of Magnetic Resonance in Chemistry and Biomedicine, Institute of Biophysics and Physical Biochemistry (Germany)


    The {sup 31}P NMR pressure response of guanine nucleotides bound to proteins has been studied in the past for characterizing the pressure perturbation of conformational equilibria. The pressure response of the {sup 31}P NMR chemical shifts of the phosphate groups of GMP, GDP, and GTP as well as the commonly used GTP analogs GppNHp, GppCH{sub 2}p and GTPγS was measured in the absence and presence of Mg{sup 2+}-ions within a pressure range up to 200 MPa. The pressure dependence of chemical shifts is clearly non-linear. For all nucleotides a negative first order pressure coefficient B{sub 1} was determined indicating an upfield shift of the resonances with pressure. With exception of the α-phosphate group of Mg{sup 2+}·GMP and Mg{sup 2+}·GppNHp the second order pressure coefficients are positive. To describe the data of Mg{sup 2+}·GppCH{sub 2}p and GTPγS a Taylor expansion of 3rd order is required. For distinguishing pH effects from pressure effects a complete pH titration set is presented for GMP, as well as GDP and GTP in absence and presence of Mg{sup 2+} ions using indirect referencing to DSS under identical experimental conditions. By a comparison between high pressure {sup 31}P NMR data on free Mg{sup 2+}-GDP and Mg{sup 2+}-GDP in complex with the proto-oncogene Ras we demonstrate that pressure induced changes in chemical shift are clearly different between both forms.

  13. Formate supplementation enhances folate-dependent nucleotide biosynthesis and prevents spina bifida in a mouse model of folic acid-resistant neural tube defects. (United States)

    Sudiwala, Sonia; De Castro, Sandra C P; Leung, Kit-Yi; Brosnan, John T; Brosnan, Margaret E; Mills, Kevin; Copp, Andrew J; Greene, Nicholas D E


    The curly tail mouse provides a model for neural tube defects (spina bifida and exencephaly) that are resistant to prevention by folic acid. The major ct gene, responsible for spina bifida, corresponds to a hypomorphic allele of grainyhead-like 3 (Grhl3) but the frequency of NTDs is strongly influenced by modifiers in the genetic background. Moreover, exencephaly in the curly tail strain is not prevented by reinstatement of Grhl3 expression. In the current study we found that expression of Mthfd1L, encoding a key component of mitochondrial folate one-carbon metabolism (FOCM), is significantly reduced in ct/ct embryos compared to a partially congenic wild-type strain. This expression change is not attributable to regulation by Grhl3 or the genetic background at the Mthfd1L locus. Mitochondrial FOCM provides one-carbon units as formate for FOCM reactions in the cytosol. We found that maternal supplementation with formate prevented NTDs in curly tail embryos and also resulted in increased litter size. Analysis of the folate profile of neurulation-stage embryos showed that formate supplementation resulted in an increased proportion of formyl-THF and THF but a reduction in proportion of 5-methyl THF. In contrast, THF decreased and 5-methyl THF was relatively more abundant in the liver of supplemented dams than in controls. In embryos cultured through the period of spinal neurulation, incorporation of labelled thymidine and adenine into genomic DNA was suppressed by supplemental formate, suggesting that de novo folate-dependent biosynthesis of nucleotides (thymidylate and purines) was enhanced. We hypothesise that reduced Mthfd1L expression may contribute to susceptibility to NTDs in the curly tail strain and that formate acts as a one-carbon donor to prevent NTDs. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  14. Electrical detection and quantification of single and mixed DNA nucleotides in suspension (United States)

    Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah


    High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

  15. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  16. The immediate nucleotide precursor, guanosine triphosphate, in the riboflavin biosynthetic pathway

    International Nuclear Information System (INIS)

    Mitsuda, Hisateru; Nakajima, Kenji; Nadamoto, Tomonori


    In the present paper, the nucleotide precursor of riboflavin was investigated by experiments with labeled purines using non-growing cells of Eremothecium ashbyii. The added purines, at 10 -4 M, were effectively incorporated into riboflavin at an early stage of riboflavin biosynthesis under the experimental conditions. In particular, both labeled xanthine and labeled guanine were specifically transported to guanosine nucleotides, GMP, GDP, GDP-Mannose and GTP, in the course of the riboflavin biosynthesis. A comparison of specific activities of labeled guanosine nucleotides and labeled riboflavin indicated that the nucleotide precursor of riboflavin is guanosine triphosphate. From the results obtained, a biosynthetic pathway of riboflavin is proposed. (auth.)

  17. Nucleos: a web server for the identification of nucleotide-binding sites in protein structures. (United States)

    Parca, Luca; Ferré, Fabrizio; Ausiello, Gabriele; Helmer-Citterich, Manuela


    Nucleos is a web server for the identification of nucleotide-binding sites in protein structures. Nucleos compares the structure of a query protein against a set of known template 3D binding sites representing nucleotide modules, namely the nucleobase, carbohydrate and phosphate. Structural features, clustering and conservation are used to filter and score the predictions. The predicted nucleotide modules are then joined to build whole nucleotide-binding sites, which are ranked by their score. The server takes as input either the PDB code of the query protein structure or a user-submitted structure in PDB format. The output of Nucleos is composed of ranked lists of predicted nucleotide-binding sites divided by nucleotide type (e.g. ATP-like). For each ranked prediction, Nucleos provides detailed information about the score, the template structure and the structural match for each nucleotide module composing the nucleotide-binding site. The predictions on the query structure and the template-binding sites can be viewed directly on the web through a graphical applet. In 98% of the cases, the modules composing correct predictions belong to proteins with no homology relationship between each other, meaning that the identification of brand-new nucleotide-binding sites is possible using information from non-homologous proteins. Nucleos is available at

  18. Rho-kinase inhibitor and nicotinamide adenine dinucleotide phosphate oxidase inhibitor prevent impairment of endothelium-dependent cerebral vasodilation by acute cigarette smoking in rats. (United States)

    Iida, Hiroki; Iida, Mami; Takenaka, Motoyasu; Fukuoka, Naokazu; Dohi, Shuji


    We previously reported that acute cigarette smoking can cause a dysfunction of endothelium-dependent vasodilation in cerebral vessels, and that blocking the angiotensin II (Ang II) type 1 (AT1) receptor with valsartan prevented this impairment. Our aim was to investigate the effects of a Rho-kinase inhibitor (fasudil) and a Nicotinamide Adenine Dinucleotide PHosphate (NADPH) oxidase inhibitor (apocynin) on smoking-induced endothelial dysfunction in cerebral arterioles. In Sprague-Dawley rats, we used a closed cranial window preparation to measure changes in pial vessel diameters following topical acetylcholine (ACh) before smoking. After one-minute smoking, we again examined the arteriolar responses to ACh. Finally, after intravenous fasudil or apocynin pre-treatment we re-examined the vasodilator responses to topical ACh (before and after cigarette smoking). Under control conditions, cerebral arterioles were dose-dependently dilated by topical ACh (10(-6) M and 10(-5) M). One hour after a one-minute smoking (1 mg-nicotine cigarette), 10(-5) M ACh constricted cerebral arterioles. However, one hour after a one-minute smoking, 10(-5) M ACh dilated cerebral pial arteries both in the fasudil pre-treatment and the apocynin pre-treatment groups, responses that were significantly different from those obtained without fasudil or apocynin pre-treatment. Thus, inhibition of Rho-kinase and NADPH oxidase activities may prevent the above smoking-induced impairment of endothelium-dependent vasodilation.

  19. Solvent effect on the intermolecular proton transfer of the Watson and Crick guanine-cytosine and adenine-thymine base pairs: a polarizable continuum model study. (United States)

    Romero, Eduardo E; Hernandez, Florencio E


    Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.

  20. Comparison of equine platelet function and survival in whole blood collected in acid-citrate-dextrose solution or citrate-phosphate-dextrose-adenine solution. (United States)

    Bozorgmanesh, Rana; Sutton-Burges, Julie W; Tablin, Fern


    Equine whole blood collection and storage methods have been evaluated to assess red blood cell viability; however, platelet (PLT) viability has not been comprehensively assessed. The purpose of the study was to compare viability of PLTs collected in whole blood into 2 different anticoagulants. Whole blood from 6 healthy adult Thoroughbred horses was collected into citrate-phosphate-dextrose-adenine (CPDA) or acid-citrate-dextrose (ACD). Platelet count, pH, and concentrations of glucose, lactate, carbon dioxide, oxygen, bicarbonate, sodium, potassium, and chloride were measured within 10 minutes of collection and then again one hour later at which time PLT aggregometry was performed to assess PLT function. Aggregometry mean amplitudes were significantly higher in CPDA compared to ACD. Blood glucose, pH, bicarbonate, sodium, and lactate concentrations were significantly higher in CPDA compared to ACD. Lactate concentration was higher following one hour in either anticoagulant. Potassium, oxygen, and carbon dioxide concentrations were significantly higher in ACD compared to CPDA at collection. Platelet aggregometry results suggest that CPDA is superior to ACD for maintaining PLT viability following whole blood collection. This may be associated with the higher, more neutral pH as well as an increase in glucose available for metabolism. Although lactate was increased in the CPDA samples it was not high enough to decrease pH and therefore may not have been high enough to cause morphologic lesions and loss of PLT viability. © 2017 American Society for Veterinary Clinical Pathology.

  1. The Importance of Electron Correlation on Stacking Interaction of Adenine-Thymine Base-Pair Step in B-DNA: A Quantum Monte Carlo Study. (United States)

    Hongo, Kenta; Cuong, Nguyen Thanh; Maezono, Ryo


    We report fixed-node diffusion Monte Carlo (DMC) calculations of stacking interaction energy between two adenine(A)-thymine(T) base pairs in B-DNA (AA:TT), for which reference data are available, obtained from a complete basis set estimate of CCSD(T) (coupled-cluster with singles, doubles, and perturbative triples). We consider four sets of nodal surfaces obtained from self-consistent field calculations and examine how the different nodal surfaces affect the DMC potential energy curves of the AA:TT molecule and the resulting stacking energies. We find that the DMC potential energy curves using the different nodes look similar to each other as a whole. We also benchmark the performance of various quantum chemistry methods, including Hartree-Fock (HF) theory, second-order Møller-Plesset perturbation theory (MP2), and density functional theory (DFT). The DMC and recently developed DFT results of the stacking energy reasonably agree with the reference, while the HF, MP2, and conventional DFT methods give unsatisfactory results.

  2. Protective effect of nicotinamide adenine dinucleotide (NAD+) against spinal cord ischemia-reperfusion injury via reducing oxidative stress-induced neuronal apoptosis. (United States)

    Xie, Lei; Wang, Zhenfei; Li, Changwei; Yang, Kai; Liang, Yu


    As previous studies demonstrate that oxidative stress and apoptosis play crucial roles in ischemic pathogenesis and nicotinamide adenine dinucleotide (NAD + ) treatment attenuates oxidative stress-induced cell death among primary neurons and astrocytes as well as significantly reduce cerebral ischemic injury in rats. We used a spinal cord ischemia injury (SCII) model in rats to verify our hypothesis that NAD + could ameliorate oxidative stress-induced neuronal apoptosis. Adult male rats were subjected to transient spinal cord ischemia for 60min, and different doses of NAD + were administered intraperitoneally immediately after the start of reperfusion. Neurological function was determined by Basso, Beattie, Bresnahan (BBB) scores. The oxidative stress level was assessed by superoxide dismutase (SOD) activity and malondialdehyde (MDA) content. The degree of apoptosis was analyzed by deoxyuridinetriphosphate nick-end labeling (TUNEL) staining and protein levels of cleaved caspase-3 and AIF (apoptosis inducing factor). The results showed that NAD + at 50 or 100mg/kg significantly decreased the oxidative stress level and neuronal apoptosis in the spinal cord of ischemia-reperfusion rats compared with saline, as accompanied with the decreased oxidative stress, NAD + administration significantly restrained the neuronal apoptosis after ischemia injury while improved the neurological and motor function. These findings suggested that NAD + might protect against spinal cord ischemia-reperfusion via reducing oxidative stress-induced neuronal apoptosis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Wear Particles Promote Reactive Oxygen Species-Mediated Inflammation via the Nicotinamide Adenine Dinucleotide Phosphate Oxidase Pathway in Macrophages Surrounding Loosened Implants

    Directory of Open Access Journals (Sweden)

    Weishen Chen


    Full Text Available Background/Aims: Prosthesis loosening is closely associated with chronic inflammatory cytokine secretion by macrophages, which are activated by wear particles or inflammatory stimulants such as lipopolysaccharide (LPS. Reactive oxygen species (ROS are critical regulators of inflammation, but their enzymatic sources in response to wear particles and their effects on peri-implant LPS-tolerance remain unclear. Methods: Three ROS-related enzymes—nicotinamide adenine dinucleotide phosphate oxidase (NOX-1 and -2 and catalase—were investigated in interface membrane tissues and in titanium (Ti particle-stimulated macrophages in vitro. The generation of ROS and downstream inflammatory effects were measured with or without pre-incubation with apocynin, an NOX inhibitor. Results: Pre-exposure to Ti particles attenuated NF-κB activation in LPS-stimulated macrophages, indicating that wear particles suppress immune response, which may lead to chronic inflammation. NOX-1 and -2 were highly expressed in aseptically loosened interface membranes and in macrophages stimulated with Ti particles; the particles induced a moderate amount of ROS generation, NF-κB activation, and TNF-a secretion in macrophages, and these effects were suppressed by apocynin. Conclusion: Wear particles induce ROS generation through the NOX signaling pathway, resulting in persistent inflammation and delayed loosening. Thus, the suppression of NOX activity may be a useful strategy for preventing prosthesis loosening.

  4. Deficiency of the iron-sulfur clusters of mitochondrial reduced nicotinamide-adenine dinucleotide-ubiquinone oxidoreductase (complex I) in an infant with congenital lactic acidosis. (United States)

    Moreadith, R W; Batshaw, M L; Ohnishi, T; Kerr, D; Knox, B; Jackson, D; Hruban, R; Olson, J; Reynafarje, B; Lehninger, A L


    We report the case of an infant with hypoglycemia, progressive lactic acidosis, an increased serum lactate/pyruvate ratio, and elevated plasma alanine, who had a moderate to profound decrease in the ability of mitochondria from four organs to oxidize pyruvate, malate plus glutamate, citrate, and other NAD+-linked respiratory substrates. The capacity to oxidize the flavin adenine dinucleotide-linked substrate, succinate, was normal. The most pronounced deficiency was in skeletal muscle, the least in kidney mitochondria. Enzymatic assays on isolated mitochondria ruled out defects in complexes II, III, and IV of the respiratory chain. Further studies showed that the defect was localized in the inner membrane mitochondrial NADH-ubiquinone oxidoreductase (complex I). When ferricyanide was used as an artificial electron acceptor, complex I activity was normal, indicating that electrons from NADH could reduce the flavin mononucleotide cofactor. However, electron paramagnetic resonance spectroscopy performed on liver submitochondrial particles showed an almost total loss of the iron-sulfur clusters characteristic of complex I, whereas normal signals were noted for other mitochondrial iron-sulfur clusters. This infant is presented as the first reported case of congenital lactic acidosis caused by a deficiency of the iron-sulfur clusters of complex I of the mitochondrial electron transport chain.

  5. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms. (United States)

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca


    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, K/k, Kp(a)/Kp(b), Js(a)/Js(b), Co(a)/Co(b) and Lu(a)/Lu(b) alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplifies the alleles tested routinely, namely Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, and K/k. PCR II amplifies those alleles that are typed less frequently. Biotinylated PCR products are hybridized in a single multiplex assay with the corresponding probe mixture. After incubation with R-phycoerythrin-conjugated streptavidin, the emitted fluorescence is analyzed with Luminex 100. So far, we have typed more than 2,000 subjects, 493 of whom with multiplex assay, and there have been no discrepancies with the serology results other than null and/or weak phenotypes. The cost of consumables and reagents for typing a single biallelic pair per sample is less than EUR 3.-, not including DNA extraction costs. The capability to perform multiplexed reactions makes the method markedly suitable for mass screening of red blood cell alleles. This genotyping approach represents an important tool in transfusion medicine.

  6. Implication of SUMO E3 ligases in nucleotide excision repair. (United States)

    Tsuge, Maasa; Kaneoka, Hidenori; Masuda, Yusuke; Ito, Hiroki; Miyake, Katsuhide; Iijima, Shinji


    Post-translational modifications alter protein function to mediate complex hierarchical regulatory processes that are crucial to eukaryotic cellular function. The small ubiquitin-like modifier (SUMO) is an important post-translational modification that affects transcriptional regulation, nuclear localization, and the maintenance of genome stability. Nucleotide excision repair (NER) is a very versatile DNA repair system that is essential for protection against ultraviolet (UV) irradiation. The deficiencies in NER function remarkably increase the risk of skin cancer. Recent studies have shown that several NER factors are SUMOylated, which influences repair efficiency. However, how SUMOylation modulates NER has not yet been elucidated. In the present study, we performed RNAi knockdown of SUMO E3 ligases and found that, in addition to PIASy, the polycomb protein Pc2 affected the repair of cyclobutane pyrimidine dimers. PIAS1 affected both the removal of 6-4 pyrimidine pyrimidone photoproducts and cyclobutane pyrimidine dimers, whereas other SUMO E3 ligases did not affect the removal of either UV lesion.

  7. Base Sequence Context Effects on Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Yuqin Cai


    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  8. Myristoylated α subunits of guanine nucleotide-binding regulatory proteins

    International Nuclear Information System (INIS)

    Buss, J.E.; Mumby, S.M.; Casey, P.J.; Gilman, A.G.; Sefton, B.M.


    Antisera directed against specific subunits of guanine nucleotide-binding regulatory proteins (G proteins) were used to immunoprecipitate these polypeptides from metabolically labeled cells. This technique detects, in extracts of a human astrocytoma cell line, the α subunits of G/sub s/ (stimulatory) (α 45 and α 52 ), a 41-kDa subunit of G/sub i/ (inhibitory) (α 41 ), a 40-kDa protein (α 40 ), and the 36-kDa β subunit. No protein that comigrated with the α subunit of G 0 (unknown function) (α 39 ) was detected. In cells grown in the presence of [ 3 H]myristic acid, α 41 and α 40 contained 3 H label, while the β subunit did not. Chemical analysis of lipids attached covalently to purified α 41 and α 39 from bovine brain also revealed myristic acid. Similar analysis of brain G protein β and γ subunits and of G/sub t/ (Transducin) subunits (α, β, and γ) failed to reveal fatty acids. The fatty acid associated with α 41 , α 40 , and α 39 was stable to treatment with base, suggesting that the lipid is linked to the polypeptide via an amide bond. These GTP binding proteins are thus identified as members of a select group of proteins that contains myristic acid covalently attached to the peptide backbone. Myristate may play an important role in stabilizing interactions of G proteins with phospholipid or with membrane-bound proteins

  9. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.


    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  10. Expression of Vesicular Nucleotide Transporter in Rat Odontoblasts

    International Nuclear Information System (INIS)

    Ikeda, Erina; Goto, Tetsuya; Gunjigake, Kaori; Kuroishi, Kayoko; Ueda, Masae; Kataoka, Shinji; Toyono, Takashi; Nakatomi, Mitsushiro; Seta, Yuji; Kitamura, Chiaki; Nishihara, Tatsuji; Kawamoto, Tatsuo


    Several theories have been proposed regarding pain transmission mechanisms in tooth. However, the exact signaling mechanism from odontoblasts to pulp nerves remains to be clarified. Recently, ATP-associated pain transmission has been reported, but it is unclear whether ATP is involved in tooth pain transmission. In the present study, we focused on the vesicular nucleotide transporter (VNUT), a transporter of ATP into vesicles, and examined whether VNUT was involved in ATP release from odontoblasts. We examined the expression of VNUT in rat pulp by RT-PCR and immunostaining. ATP release from cultured odontoblast-like cells with heat stimulation was evaluated using ATP luciferase methods. VNUT was expressed in pulp tissue, and the distribution of VNUT-immunopositive vesicles was confirmed in odontoblasts. In odontoblasts, some VNUT-immunopositive vesicles were colocalized with membrane fusion proteins. Additionally P2X 3 , an ATP receptor, immunopositive axons were distributed between odontoblasts. The ATP release by thermal stimulation from odontoblast-like cells was inhibited by the addition of siRNA for VNUT. These findings suggest that cytosolic ATP is transported by VNUT and that the ATP in the vesicles is then released from odontoblasts to ATP receptors on axons. ATP vesicle transport in odontoblasts seems to be a key mechanism for signal transduction from odontoblasts to axons in the pulp

  11. Implication of Posttranslational Histone Modifications in Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Shisheng Li


    Full Text Available Histones are highly alkaline proteins that package and order the DNA into chromatin in eukaryotic cells. Nucleotide excision repair (NER is a conserved multistep reaction that removes a wide range of generally bulky and/or helix-distorting DNA lesions. Although the core biochemical mechanism of NER is relatively well known, how cells detect and repair lesions in diverse chromatin environments is still under intensive research. As with all DNA-related processes, the NER machinery must deal with the presence of organized chromatin and the physical obstacles it presents. A huge catalogue of posttranslational histone modifications has been documented. Although a comprehensive understanding of most of these modifications is still lacking, they are believed to be important regulatory elements for many biological processes, including DNA replication and repair, transcription and cell cycle control. Some of these modifications, including acetylation, methylation, phosphorylation and ubiquitination on the four core histones (H2A, H2B, H3 and H4 or the histone H2A variant H2AX, have been found to be implicated in different stages of the NER process. This review will summarize our recent understanding in this area.

  12. Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.

    Directory of Open Access Journals (Sweden)

    B Josh Lane


    Full Text Available Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein. TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs, Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K, appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.

  13. Single Nucleotide Polymorphism Identification, Characterization, and Linkage Mapping in Quinoa

    Directory of Open Access Journals (Sweden)

    P. J. Maughan


    Full Text Available Quinoa ( Willd. is an important seed crop throughout the Andean region of South America. It is important as a regional food security crop for millions of impoverished rural inhabitants of the Andean Altiplano (high plains. Efforts to improve the crop have led to an increased focus on genetic research. We report the identification of 14,178 putative single nucleotide polymorphisms (SNPs using a genomic reduction protocol as well as the development of 511 functional SNP assays. The SNP assays are based on KASPar genotyping chemistry and were detected using the Fluidigm dynamic array platform. A diversity screen of 113 quinoa accessions showed that the minor allele frequency (MAF of the SNPs ranged from 0.02 to 0.50, with an average MAF of 0.28. Structure analysis of the quinoa diversity panel uncovered the two major subgroups corresponding to the Andean and coastal quinoa ecotypes. Linkage mapping of the SNPs in two recombinant inbred line populations produced an integrated linkage map consisting of 29 linkage groups with 20 large linkage groups, spanning 1404 cM with a marker density of 3.1 cM per SNP marker. The SNPs identified here represent important genomic tools needed in emerging plant breeding programs for advanced genetic analysis of agronomic traits in quinoa.

  14. Domestication rewired gene expression and nucleotide diversity patterns in tomato. (United States)

    Sauvage, Christopher; Rau, Andrea; Aichholz, Charlotte; Chadoeuf, Joël; Sarah, Gautier; Ruiz, Manuel; Santoni, Sylvain; Causse, Mathilde; David, Jacques; Glémin, Sylvain


    Plant domestication has led to considerable phenotypic modifications from wild species to modern varieties. However, although changes in key traits have been well documented, less is known about the underlying molecular mechanisms, such as the reduction of molecular diversity or global gene co-expression patterns. In this study, we used a combination of gene expression and population genetics in wild and crop tomato to decipher the footprints of domestication. We found a set of 1729 differentially expressed genes (DEG) between the two genetic groups, belonging to 17 clusters of co-expressed DEG, suggesting that domestication affected not only individual genes but also regulatory networks. Five co-expression clusters were enriched in functional terms involving carbohydrate metabolism or epigenetic regulation of gene expression. We detected differences in nucleotide diversity between the crop and wild groups specific to DEG. Our study provides an extensive profiling of the rewiring of gene co-expression induced by the domestication syndrome in one of the main crop species. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  15. Nucleotide diversity and linkage disequilibrium in five Lolium perenne genes with putative role in shoot branching

    DEFF Research Database (Denmark)

    Brazauskas, Gintaras; Pašakinskienė, Izolda; Asp, Torben


    Knowledge on nucleotide diversity and linkage disequilibrium (LD) patterns is prerequisite for association analyses. However, little is known about the nucleotide diversity in the evolutionary important ryegrass shoot morphology genes. Five candidate genes, LpIAA1, LpRUB1, LpBRI1, LpSHOOT1 and Lp...

  16. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey


    A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technolo...

  17. A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.

    NARCIS (Netherlands)

    Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.


    A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having

  18. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13. (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L


    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  19. Supra-molecular architecture in a co-crystal of the N(7)-H tautomeric form of N (6)-benzoyl-adenine with adipic acid (1/0.5). (United States)

    Swinton Darious, Robert; Thomas Muthiah, Packianathan; Perdih, Franc


    The asymmetric unit of the title co-crystal, C12H9N5O·0.5C6H10O4, consists of one mol-ecule of N (6)-benzoyl-adenine (BA) and one half-mol-ecule of adipic acid (AA), the other half being generated by inversion symmetry. The dihedral angle between the adenine and phenyl ring planes is 26.71 (7)°. The N (6)-benzoyl-adenine mol-ecule crystallizes in the N(7)-H tautomeric form with three non-protonated N atoms. This tautomeric form is stabilized by intra-molecular N-H⋯O hydrogen bonding between the carbonyl (C=O) group and the N(7)-H hydrogen atom on the Hoogsteen face of the purine ring, forming an S(7) ring motif. The two carboxyl groups of adipic acid inter-act with the Watson-Crick face of the BA mol-ecules through O-H⋯N and N-H⋯O hydrogen bonds, generating an R 2 (2)(8) ring motif. The latter units are linked by N-H⋯N hydrogen bonds, forming layers parallel to (10-5). A weak C-H⋯O hydrogen bond is also present, linking adipic acid mol-ecules in neighbouring layers, enclosing R (2) 2(10) ring motifs and forming a three-dimensional structure. C=O⋯π and C-H⋯π inter-actions are also present in the structure.

  20. R3D Align web server for global nucleotide to nucleotide alignments of RNA 3D structures. (United States)

    Rahrig, Ryan R; Petrov, Anton I; Leontis, Neocles B; Zirbel, Craig L


    The R3D Align web server provides online access to 'RNA 3D Align' (R3D Align), a method for producing accurate nucleotide-level structural alignments of RNA 3D structures. The web server provides a streamlined and intuitive interface, input data validation and output that is more extensive and easier to read and interpret than related servers. The R3D Align web server offers a unique Gallery of Featured Alignments, providing immediate access to pre-computed alignments of large RNA 3D structures, including all ribosomal RNAs, as well as guidance on effective use of the server and interpretation of the output. By accessing the non-redundant lists of RNA 3D structures provided by the Bowling Green State University RNA group, R3D Align connects users to structure files in the same equivalence class and the best-modeled representative structure from each group. The R3D Align web server is freely accessible at

  1. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi


    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  2. Association of single nucleotide polymorphisms with radiation-induced esophagitis

    International Nuclear Information System (INIS)

    Zhang Li; Wang Lvhua; Yang Ming; Ji Wei; Zhao Lujun; Yang Weizhi; Zhou Zongmei; Ou Guangfei; Lin Dongxin


    Objective: To evaluate the relationship between single nucleotide polymorphism(SNP) of candidate genes and radiation-induced esophagitis (RIE) in patients with lung cancer. Methods: Between Jan. 2004 and Aug. 2006, 170 patients with pathologically diagnosed lung cancer were enrolled in this study. The total target dose was 45-70 Gy (median 60 Gy). One hundred and thirty-two patients were treated with three-dimensional conformal radiotherapy(3DCRT) and 38 with two-dimensional radiotherapy(2DRT). Forty-one patients received radiotherapy alone, 78 received sequential chemoradiotherapy and 51 received concurrent chemoradiotherapy. Thirty-seven SNPs in 20 DNA repair genes were analyzed by using PCR- based restricted fragment length polymorphism (RFLP). These genes were apoptosis and inflammatory cytokine genes including ATM, ERCC1, XRCC3, XRCCI, XPD, XPC, XPG, NBS1, STK15, ZNF350, ADPRT, TP53, FAS, FASL, CYP2D6*4, CASPASE8, COX2,TGF-β, CD14 and ACE. The endpoint was grade ≥2 R I E. Results: Forty of the 170 patients developed grade ≥2 R I E, including 36 in grade 2 and 4 in grade 3. Univariate analysis revealed that radiation technique and concurrent chemoradiotherapy were statistically significant relatives to the incidence of R I E (P=0.032, 0.049), and both of them had the trend associating with the esophagitis (P=0.072, 0.094). An increased incidence of esophagitis was observed associating with the TGF-β 1 -509T and XPD 751Lys/Lys genotypes (χ 2 =5.65, P=0.017; χ 2 =3.84, P=0.048) in multivariate analysis. Conclusions: Genetic polymorphisms in TGF-β 1 gene and XPD gene have a significant association with radiation-induced esophagitis. (authors)

  3. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria. (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung


    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association.

  4. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung


    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association. PMID:28158221

  5. Deregulation of ocular nucleotide homeostasis in patients with diabetic retinopathy. (United States)

    Loukovaara, Sirpa; Sandholm, Jouko; Aalto, Kristiina; Liukkonen, Janne; Jalkanen, Sirpa; Yegutkin, Gennady G


    Clear signaling roles for ATP and adenosine have been established in all tissues, including the eye. The magnitude of signaling responses is governed by networks of enzymes; however, little is known about the regulatory mechanisms of purinergic signaling in the eye. By employing thin-layer chromatographic assays with 3 H-labeled substrates, this study aimed to evaluate the role of nucleotide homeostasis in the pathogenesis of vitreoretinal diseases in humans. We have identified soluble enzymes ecto-5'-nucleotidase/CD73, adenylate kinase-1, and nucleoside diphosphate kinase in the vitreous fluid that control active cycling between pro-inflammatory ATP and anti-inflammatory adenosine. Strikingly, patients with proliferative form of diabetic retinopathy (DR) had higher adenylate kinase activity and ATP concentration, when compared to non-proliferative DR eyes and non-diabetic controls operated for rhegmatogenous retinal detachment, macular hole, and pucker. The non-parametric correlation analysis revealed positive correlations between intravitreal adenylate kinase and concentrations of ATP, ADP, and other angiogenic (angiopoietins-1 and -2), profibrotic (transforming growth factor-β1), and proteolytic (matrix metalloproteinase-9) factors but not erythropoietin and VEGF. Immunohistochemical staining of postmortem human retina additionally revealed selective expression of ecto-5'-nucleotidase/CD73 on the rod-and-cone-containing photoreceptor cells. Collectively, these findings provide novel insights into the regulatory mechanisms that influence purinergic signaling in diseased eye and open up new possibilities in the development of enzyme-targeted therapeutic approaches for prevention and treatment of DR. Ecto-5'-nucleotidase/CD73 and adenylate kinase-1 circulate in human vitreous fluid. Adenylate kinase activity is high in diabetic eyes with proliferative retinopathy. Diabetic eyes display higher intravitreal ATP/ADP ratio than non-diabetic controls. Soluble adenylate

  6. Degradation of brown adipocyte purine nucleotides regulates uncoupling protein 1 activity

    Directory of Open Access Journals (Sweden)

    Tobias Fromme


    Full Text Available Objective: Non-shivering thermogenesis in mammalian brown adipose tissue depends on thermogenic uncoupling protein 1. Its activity is triggered by free fatty acids while purine nucleotides mediate inhibition. During activation, it is thought that free fatty acids overcome purine-mediated inhibition. We measured the cellular concentration and the release of purine nucleotide metabolites to uncover a possible role of purine nucleotide degradation in uncoupling protein 1 activation. Methods: With mass spectrometry, purine nucleotide metabolites were quantified in cellular homogenates and supernatants of cultured primary brown adipocytes. We also determined oxygen consumption in response to a β-adrenergic agonist. Results: Upon adrenergic activation, brown adipocytes decreased the intracellular concentration of inhibitory nucleotides (ATP, ADP, GTP and GDP and released the respective degradation products. At the same time, an increase in cellular calcium occurred. None of these phenomena occurred in white adipocytes or myotubes. The brown adipocyte expression of enzymes implicated in purine metabolic remodeling is altered upon cold exposure. Pharmacological and genetic interference of purine metabolism altered uncoupling protein 1 mediated uncoupled respiration. Conclusion: Adrenergic stimulation of brown adipocytes lowers the intracellular concentration of purine nucleotides, thereby contributing to uncoupling protein 1 activation. Keywords: Purine nucleotides, Uncoupling protein 1, Brown adipose tissue, Non-shivering thermogenesis, HILIC-MS/MS, Guanosine monophosphate reductase

  7. Effect of telmisartan on the expression of adiponectin receptors and nicotinamide adenine dinucleotide phosphate oxidase in the heart and aorta in type 2 diabetic rats

    Directory of Open Access Journals (Sweden)

    Guo Zhixin


    Full Text Available Abstract Background Diabetic cardiovascular disease is associated with decreased adiponectin and increased oxidative stress. This study investigated the effect of telmisartan on the expression of adiponectin receptor 2 (adipoR2 and nicotinamide adenine dinucleotide phosphate (NADPH oxidase subunits in the heart and the expression of adiponectin receptor 1 (adipoR1 in aorta in type 2 diabetic rats. Methods Type 2 diabetes was induced by high-fat and high-sugar diet and intraperitoneal injection of a low dose of streptozotocin (STZ. Heart function, adipoR2, p22phox, NOX4, glucose transporter 4(GLUT4, monocyte chemoattractant protein-1(MCP-1 and connective tissue growth factor (CTGFin the heart, and adipoR1, MCP-1 and nuclear factor kappa B (NF-κB in aorta were analyzed in controls and diabetic rats treated with or without telmisartan (5mg/kg/d by gavage for 12 weeks. Results Heart function, plasma and myocardial adiponectin levels, the expression of myocardial adipoR2 and GLUT4 were significantly decreased in diabetic rats (P Conclusions Our results suggest that telmisartan upregulates the expression of myocardial adiponectin, its receptor 2 and GLUT4. Simultaneously, it downregulates the expression of myocardial p22phox, NOX4, MCP-1, and CTGF, contributing so to the improvement of heart function in diabetic rats. Telmisartan also induces a protective role on the vascular system by upregulating the expression of adipoR1 and downregulating the expression of MCP-1 and NF-κB in the abdominal aorta in diabetic rats.

  8. Simultaneous determination of adenine guanine and thymine at multi-walled carbon nanotubes incorporated with poly(new fuchsin) composite film

    Energy Technology Data Exchange (ETDEWEB)

    Tang Ching; Yogeswaran, Umasankar [Department of Chemical Engineering and Biotechnology, National Taipei University of Technology, No.1, Section 3, Chung-Hsiao East Road, Taipei 106, Taiwan (China); Chen, S.-M. [Department of Chemical Engineering and Biotechnology, National Taipei University of Technology, No.1, Section 3, Chung-Hsiao East Road, Taipei 106, Taiwan (China)], E-mail:


    A composite film (MWCNTs-PNF) which contains multi-walled carbon nanotubes (MWCNTs) along with the incorporation of poly(new fuchsin) (PNF) has been synthesized on glassy carbon electrode (GCE), gold (Au) and indium tin oxide (ITO) by potentiostatic methods. The presence of MWCNTs in the composite film enhances surface coverage concentration ({gamma}) of PNF to {approx}176.5%, and increases the electron transfer rate constant (k{sub s}) to {approx}346%. The composite film also exhibits promising enhanced electrocatalytic activity towards the mixture of biochemical compounds such as adenine (AD), guanine (GU) and thymine (THY). The surface morphology of the composite film deposited on ITO has been studied using scanning electron microscopy and atomic force microscopy. These two techniques reveal that the PNF incorporated on MWCNTs. Electrochemical quartz crystal microbalance study reveals the enhancement in the functional properties of MWCNTs and PNF. The electrocatalytic responses of analytes at MWCNTs and MWCNTs-PNF films were measured using both cyclic voltammetry (CV) and differential pulse voltammetry (DPV). From electrocatalysis studies, well separated voltammetric peaks have been obtained at the composite film for AD, GU and THY, with the peak separation of 320.3 and 132.7 mV between GU-AD and AD-THY respectively. The sensitivity of the composite film towards AD, GU and THY in DPV technique is 218.18, 12.62 and 78.22 mA M{sup -1} cm{sup -2} respectively, which are higher than MWCNTs film. Further, electroanalytical studies of AD, GU and THY present in single-strand deoxyribonucleic acid (ssDNA) have been carried out using semi-derivative CV and DPV.

  9. Spectroscopy and Speciation Studies on the Interactions of Aluminum (III with Ciprofloxacin and β-Nicotinamide Adenine Dinucleotide Phosphate in Aqueous Solutions

    Directory of Open Access Journals (Sweden)

    Xiaodi Yang


    Full Text Available In this study, both experimental and theoretical approaches, including absorption spectra, fluorescence emission spectra, 1H- and 31P-NMR, electrospray ionization mass spectrometry (ESI-MS, pH-potentiometry and theoretical approaches using the BEST & SPE computer programs were applied to study the competitive complexation between ciprofloxacin (CIP and b-nicotinamide adenine dinucleotide phosphate (NADP with aluminum (III in aqueous solutions. Rank annihilation factor analysis (RAFA was used to analyze the absorption and fluorescence emission spectra of the ligands, the binary complexes and the ternary complexes. It is found, at the mM total concentration level and pH = 7.0, the bidentate mononuclear species [Al(CIP]2+ and [Al(NADP] predominate in the aqueous solutions of the Al(III-CIP and Al(III-NADP systems, and the two complexes have similar conditional stability constants. However, the pH-potentiometry results show at the mM total concentration level and pH = 7.0, the ternary species [Al(CIP(HNADP] predominates in the ternary complex system. Comparing predicted NMR spectra with the experimental NMR results, it can be concluded that for the ternary complex, CIP binds to aluminum ion between the 3-carboxylic and 4-carbonyl groups, while the binding site of oxidized coenzyme II is through the oxygen of phosphate, which is linked to adenosine ribose, instead of pyrophosphate. The results also suggested CIP has the potential to be a probe molecular for the detection of NADP and the Al(III-NADP complexes under physiological condition.

  10. Effect of transient warming of red blood cells for up to 24 h: in vitro characteristics in CPD/saline-adenine-glucose-mannitol environment. (United States)

    Gulliksson, H; Nordahl-Källman, A-S


    There are few studies on transient warming of red blood cells (RBCs). Occasional storage outside restricted temperature range often results in destroying of the RBC unit, even after a short period of time due to national guidelines. This study evaluates the in vitro effects associated with such accidental warming on RBCs stored in saline-adenine-glucose-mannitol (SAGM) and prepared within 8 h after blood collection. This study includes both repeated short-term exposure of RBCs to room temperature for 6 h as wells as warming for either 6, 12, 18 or 24 h after 1 week or after 3 weeks of storage in two separate studies. RBCs were stored for 42 days. We weekly measured pH, K(+) , glucose, lactate, haemolysis, red cell ATP and 2,3-diphosphoglycerate. The lowest individual ATP value observed in any of the groups of warmed units was 2·6 μmol/g haemoglobin. Increased haemolysis in warmed units was noted in two of the studies. None of the individual units exceeded the European maximum limit of 0·8% haemolysis. Our results suggest that quality of RBCs after transient warming will be maintained at acceptable levels specified in standards and in previous studies. However, increased haemolysis was observed when transient warming occurred during the second part of the storage period of 6 weeks suggesting that RBCs are more vulnerable to warming by the end of storage. © 2013 International Society of Blood Transfusion.

  11. Nicotinic Acid Adenine Dinucleotide Phosphate Plays a Critical Role in Naive and Effector Murine T Cells but Not Natural Regulatory T Cells. (United States)

    Ali, Ramadan A; Camick, Christina; Wiles, Katherine; Walseth, Timothy F; Slama, James T; Bhattacharya, Sumit; Giovannucci, David R; Wall, Katherine A


    Nicotinic acid adenine dinucleotide phosphate (NAADP), the most potent Ca(2+) mobilizing second messenger discovered to date, has been implicated in Ca(2+) signaling in some lymphomas and T cell clones. In contrast, the role of NAADP in Ca(2+) signaling or the identity of the Ca(2+) stores targeted by NAADP in conventional naive T cells is less clear. In the current study, we demonstrate the importance of NAADP in the generation of Ca(2+) signals in murine naive T cells. Combining live-cell imaging methods and a pharmacological approach using the NAADP antagonist Ned-19, we addressed the involvement of NAADP in the generation of Ca(2+) signals evoked by TCR stimulation and the role of this signal in downstream physiological end points such as proliferation, cytokine production, and other responses to stimulation. We demonstrated that acidic compartments in addition to the endoplasmic reticulum were the Ca(2+) stores that were sensitive to NAADP in naive T cells. NAADP was shown to evoke functionally relevant Ca(2+) signals in both naive CD4 and naive CD8 T cells. Furthermore, we examined the role of this signal in the activation, proliferation, and secretion of effector cytokines by Th1, Th2, Th17, and CD8 effector T cells. Overall, NAADP exhibited a similar profile in mediating Ca(2+) release in effector T cells as in their counterpart naive T cells and seemed to be equally important for the function of these different subsets of effector T cells. This profile was not observed for natural T regulatory cells. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. β-Nicotinamide adenine dinucleotide acts at prejunctional adenosine A1 receptors to suppress inhibitory musculomotor neurotransmission in guinea pig colon and human jejunum (United States)

    Wang, Guo-Du; Wang, Xi-Yu; Liu, Sumei; Xia, Yun; Zou, Fei; Qu, Meihua; Needleman, Bradley J.; Mikami, Dean J.


    Intracellular microelectrodes were used to record neurogenic inhibitory junction potentials in the intestinal circular muscle coat. Electrical field stimulation was used to stimulate intramural neurons and evoke contraction of the smooth musculature. Exposure to β-nicotinamide adenine dinucleotide (β-NAD) did not alter smooth muscle membrane potential in guinea pig colon or human jejunum. ATP, ADP, β-NAD, and adenosine, as well as the purinergic P2Y1 receptor antagonists MRS 2179 and MRS 2500 and the adenosine A1 receptor agonist 2-chloro-N6-cyclopentyladenosine, each suppressed inhibitory junction potentials in guinea pig and human preparations. β-NAD suppressed contractile force of twitch-like contractions evoked by electrical field stimulation in guinea pig and human preparations. P2Y1 receptor antagonists did not reverse this action. Stimulation of adenosine A1 receptors with 2-chloro-N6-cyclopentyladenosine suppressed the force of twitch contractions evoked by electrical field stimulation in like manner to the action of β-NAD. Blockade of adenosine A1 receptors with 8-cyclopentyl-1,3-dipropylxanthine suppressed the inhibitory action of β-NAD on the force of electrically evoked contractions. The results do not support an inhibitory neurotransmitter role for β-NAD at intestinal neuromuscular junctions. The data suggest that β-NAD is a ligand for the adenosine A1 receptor subtype expressed by neurons in the enteric nervous system. The influence of β-NAD on intestinal motility emerges from adenosine A1 receptor-mediated suppression of neurotransmitter release at inhibitory neuromuscular junctions. PMID:25813057

  13. The distribution of nicotinamide adenine dinucleotide phosphate-diaphorase (NADPH-d) in the medulla oblongata, spinal cord, cranial and spinal nerves of frog, Microhyla ornata. (United States)

    Jadhao, Arun G; Biswas, Saikat P; Bhoyar, Rahul C; Pinelli, Claudia


    Nicotinamide adenine dinucleotide phosphate-diaphorase (NADPH-d) enzymatic activity has been reported in few amphibian species. In this study, we report its unusual localization in the medulla oblongata, spinal cord, cranial nerves, spinal nerves, and ganglions of the frog, Microhyla ornata. In the rhombencephalon, at the level of facial and vagus nerves, the NADPH-d labeling was noted in the nucleus of the abducent and facial nerves, dorsal nucleus of the vestibulocochlear nerve, the nucleus of hypoglossus nerve, dorsal and lateral column nucleus, the nucleus of the solitary tract, the dorsal field of spinal grey, the lateral and medial motor fields of spinal grey and radix ventralis and dorsalis (2-10). Many ependymal cells around the lining of the fourth ventricle, both facial and vagus nerves and dorsal root ganglion, were intensely labeled with NADPH-d. Most strikingly the NADPH-d activity was seen in small and large sized motoneurons in both medial and lateral motor neuron columns on the right and left sides of the brain. This is the largest stained group observed from the caudal rhombencephalon up to the level of radix dorsalis 10 in the spinal cord. The neurons were either oval or elongated in shape with long processes and showed significant variation in the nuclear and cellular diameter. A massive NADPH-d activity in the medulla oblongata, spinal cord, and spinal nerves implied an important role of this enzyme in the neuronal signaling as well as in the modulation of motor functions in the peripheral nervous systems of the amphibians. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Nicotinic Acid Adenine Dinucleotide Phosphate Plays a Critical Role in Naive and Effector Murine T Cells but Not Natural Regulatory T Cells* (United States)

    Ali, Ramadan A.; Camick, Christina; Wiles, Katherine; Walseth, Timothy F.; Slama, James T.; Bhattacharya, Sumit; Giovannucci, David R.; Wall, Katherine A.


    Nicotinic acid adenine dinucleotide phosphate (NAADP), the most potent Ca2+ mobilizing second messenger discovered to date, has been implicated in Ca2+ signaling in some lymphomas and T cell clones. In contrast, the role of NAADP in Ca2+ signaling or the identity of the Ca2+ stores targeted by NAADP in conventional naive T cells is less clear. In the current study, we demonstrate the importance of NAADP in the generation of Ca2+ signals in murine naive T cells. Combining live-cell imaging methods and a pharmacological approach using the NAADP antagonist Ned-19, we addressed the involvement of NAADP in the generation of Ca2+ signals evoked by TCR stimulation and the role of this signal in downstream physiological end points such as proliferation, cytokine production, and other responses to stimulation. We demonstrated that acidic compartments in addition to the endoplasmic reticulum were the Ca2+ stores that were sensitive to NAADP in naive T cells. NAADP was shown to evoke functionally relevant Ca2+ signals in both naive CD4 and naive CD8 T cells. Furthermore, we examined the role of this signal in the activation, proliferation, and secretion of effector cytokines by Th1, Th2, Th17, and CD8 effector T cells. Overall, NAADP exhibited a similar profile in mediating Ca2+ release in effector T cells as in their counterpart naive T cells and seemed to be equally important for the function of these different subsets of effector T cells. This profile was not observed for natural T regulatory cells. PMID:26728458

  15. Molecular recognition of nucleotides in micelles and the development and expansion of a chemistry outreach program (United States)

    Schechinger, Linda Sue

    I. To investigate the delivery of nucleotide-based drugs, we are studying molecular recognition of nucleotide derivatives in environments that are similar to cell membranes. The Nowick group previously discovered that membrane-like surfactant micelles tetradecyltrimethylammonium bromide (TTAB) micelle facilitate molecular of adenosine monophosphate (AMP) recognition. The micelles bind nucleotides by means of electrostatic interactions and hydrogen bonding. We observed binding by following 1H NMR chemical shift changes of unique hexylthymine protons upon addition of AMP. Cationic micelles are required for binding. In surfactant-free or sodium dodecylsulfate solutions, no hydrogen bonding is observed. These observations suggest that the cationic surfactant headgroups bind the nucleotide phosphate group, while the intramicellar base binds the nucleotide base. The micellar system was optimized to enhance binding and selectivity for adenosine nucleotides. The selectivity for adenosine and the number of phosphate groups attached to the adenosine were both investigated. Addition of cytidine, guanidine, or uridine monophosphates, results in no significant downfield shifting of the NH resonance. Selectivity for the phosphate is limited, since adenosine mono-, di-, and triphosphates all have similar binding constants. We successfully achieved molecular recognition of adenosine nucleotides in micellar environments. There is significant difference in the binding interactions between the adenosine nucleotides and three other natural nucleotides. II. The UCI Chemistry Outreach Program (UCICOP) addresses the declining interest of the nations youth for science. UCICOP brings fun and exciting chemistry experiments to local high schools, to remind students that science is fun and has many practical uses. Volunteer students and alumni of UCI perform the demonstrations using scripts and material provided by UCICOP. The preparation of scripts and materials is done by two coordinators

  16. Subnanomole detection and quantitation of high specific activity 32P-nucleotides

    International Nuclear Information System (INIS)

    Coniglio, C.; Pappas, G.; Gill, W.J.; Kashdan, M.; Maniscalco, M.


    Microbore liquid chromatography utilizes conventional HPLC and ultraviolet detection principles to determine subnanomole mass quantities of biologically significant molecules. This system takes advantage of specifically designed microflow equipment to analyze ultraviolet absorbing species at the picomole range. 32P-labeled nucleotides are examples of compounds routinely used at picomole quantities that are extremely difficult to accurately quantify using standard mass measurement techniques. The procedure described in this paper has the capability of measuring nucleotides down to 10 pmol using commercially available microbore ultraviolet detection equipment. The technique can be used to accurately measure the specific activity of as little as 10 microCi of an aqueous 32P-nucleotide solution

  17. A novel genome signature based on inter-nucleotide distances profiles for visualization of metagenomic data (United States)

    Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo


    There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.

  18. Pro-inflammatory cytokine single nucleotide polymorphisms in Kawasaki disease. (United States)

    Assari, Raheleh; Aghighi, Yahya; Ziaee, Vahid; Sadr, Maryam; Rahmani, Farzaneh; Rezaei, Arezou; Sadr, Zeinab; Moradinejad, Mohammad Hassan; Raeeskarami, Seyed Reza; Rezaei, Nima


    Kawasaki disease (KD) is a systemic vasculitis of children associated with cardiovascular sequelae. Proinflammatory cytokines play a major role in KD pathogenesis. However, their role is both influenced and modified by regulatory T-cells. IL-1 gene cluster, IL-6 and TNF-α polymorphisms have shown significant associations with some vasculitides. Herein we investigated their role in KD. Fifty-five patients with KD who were randomly selected from referrals to the main pediatric hospital were enrolled in this case-control study. Single nucleotide polymorphisms (SNPs) of the following genes were assessed in patients and 140 healthy subjects as control group: IL-1α at -889 (rs1800587), IL-1β at -511 (rs16944), IL-1β at +3962 (rs1143634), IL-1R at Pst-I 1970 (rs2234650), IL-1RN/A at Mspa-I 11100 (rs315952), TNF-α at -308 (rs1800629), TNF-α at -238, IL-6 at -174 (rs1800795) and IL-6 at +565. Twenty-one percent of the control group had A allele at TNF-α -238 while only 8% of KD patients had A allele at this position (P = 0.003, OR [95%CI] = 0.32 [0.14-0.71]). Consistently, TNF-α genotype GG at -238 had significant association with KD (OR [95% CI] = 4.31 [1.79-10.73]). Most controls carried the CG genotype at IL-6 -174 (n = 93 [66.9%]) while GG genotype was the most common genotype (n = 27 [49%]) among patients. Carriers of the GG haplotype at TNF-α (-308, -238) were significantly more prevalent among the KD group. No association was found between IL-1 gene cluster, allelic or haplotypic variants and KD. TNF-α GG genotype at -238 and GG haplotype at positions -308 and -238 were associated with KD in an Iranian population. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  19. Unraveling the cellular context of cyclic nucleotide signaling proteins by chemical proteomics

    NARCIS (Netherlands)

    Corradini, E.


    Understanding the molecular mechanisms which regulate signal transduction is fundamental to the development of therapeutic molecules for the treatment of several diseases. In particular, signaling proteins, such as cyclic nucleotide dependent enzymes are the orchestrators of many tissue functions.

  20. WEB-server for search of a periodicity in amino acid and nucleotide sequences (United States)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.


    A new web server ( was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  1. Study on the change of cyclic nucleotide in mice with yang vacuity disease

    International Nuclear Information System (INIS)

    Zhu Xinhua; Shen Ling; Wang Shuguang


    To study the relation between Yang Vacuity disease happening, development and cyclic nucleotide response, and prove curative effects of some assisting Yang drug, the plasma cAMP, cGMP and cAMP/cGMP levels were detected by radioimmunoassay in the Yang Vacuity group and curing group. Results: showed: (1) Yang Vacuity group: the symptoms were clear, death rate was high, the plasma cAMP and cAMP/cGMP increased obviously, it suggests that cyclic nucleotide was imbalance. (2) Curing group: the symptoms of Yang Vacuity disease were improved obviously, death rate dropped, cAMP declined, cGMP increased, while cAMP/cGMP reached the normal level, it showed that cyclic nucleotide of the body had altered greatly. (3) It is a reference target for Yang Vacuity. (4) Assisting yang drug (Sini Decoction) had a close relation with correcting imbalance of cyclic nucleotide

  2. Efficient reverse transcription using locked nucleic acid nucleotides towards the evolution of nuclease resistant RNA aptamers

    DEFF Research Database (Denmark)

    Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L


    We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....

  3. The effect of exhaustive exercise on the concentration of purine nucleotides and their metabolites in erythrocytes


    E Skotnicka; I Baranowska-Bosiacka; W Dudzińska; M Suska; R Nowak; K Krupecki; AJ Hłyńczak


    In this study we tried to obtain a complete overview of purine nucleotide metabolism in erythrocytes before and during an incremental, intermittent exhaustive exercise bout protocol for sportsmen (high-performance rowers) and untrained, healthy, active volunteers. Erythrocyte levels of the main nucleotides (ATP, ADP, AMP, GTP, GDP, GMP, IMP, NAD and NADP ), nucleosides (Ado, Guo, Ino) and the base Hyp were measured using the HPLC method. The parameters that can be deducted from their concent...

  4. Guanine nucleotides stimulate hydrolysis of phosphatidyl inositol bis phosphate in human myelin membranes

    International Nuclear Information System (INIS)

    Boulias, C.; Moscarello, M.A.


    Phosphodiesterase activity was stimulated in myelin membranes in the presence of guanine nucleotide analogues. This activity was reduced in myelin membranes which had been adenosine diphosphate ribosylated in the presence of cholera toxin which ADP-ribosylated three proteins of Mr 46,000, 43,000 and 18,500. Aluminum fluoride treatment of myelin had the same stimulatory effects on phosphodiesterase activity as did the guanine nucleotides

  5. Critical role of DNA intercalation in enzyme-catalyzed nucleotide flipping (United States)

    Hendershot, Jenna M.; O'Brien, Patrick J.


    Nucleotide flipping is a common feature of DNA-modifying enzymes that allows access to target sites within duplex DNA. Structural studies have identified many intercalating amino acid side chains in a wide variety of enzymes, but the functional contribution of these intercalating residues is poorly understood. We used site-directed mutagenesis and transient kinetic approaches to dissect the energetic contribution of intercalation for human alkyladenine DNA glycosylase, an enzyme that initiates repair of alkylation damage. When AAG flips out a damaged nucleotide, the void in the duplex is filled by a conserved tyrosine (Y162). We find that tyrosine intercalation confers 140-fold stabilization of the extrahelical specific recognition complex, and that Y162 functions as a plug to slow the rate of unflipping by 6000-fold relative to the Y162A mutant. Surprisingly, mutation to the smaller alanine side chain increases the rate of nucleotide flipping by 50-fold relative to the wild-type enzyme. This provides evidence against the popular model that DNA intercalation accelerates nucleotide flipping. In the case of AAG, DNA intercalation contributes to the specific binding of a damaged nucleotide, but this enhanced specificity comes at the cost of reduced speed of nucleotide flipping. PMID:25324304

  6. Regulation of Ca2+ release from mitochondria by the oxidation-reduction state of pyridine nucleotides (United States)

    Lehninger, Albert L.; Vercesi, Anibal; Bababunmi, Enitan A.


    Mitochondria from normal rat liver and heart, and also Ehrlich tumor cells, respiring on succinate as energy source in the presence of rotenone (to prevent net electron flow to oxygen from the endogenous pyridine nucleotides), rapidly take up Ca2+ and retain it so long as the pyridine nucleotides are kept in the reduced state. When acetoacetate is added to bring the pyridine nucleotides into a more oxidized state, Ca2+ is released to the medium. A subsequent addition of a reductant of the pyridine nucleotides such as β-hydroxybutyrate, glutamate, or isocitrate causes reuptake of the released Ca2+. Successive cycles of Ca2+ release and uptake can be induced by shifting the redox state of the pyridine nucleotides to more oxidized and more reduced states, respectively. Similar observations were made when succinate oxidation was replaced as energy source by ascorbate oxidation or by the hydrolysis of ATP. These and other observations form the basis of a hypothesis for feedback regulation of Ca2+-dependent substrate- or energy-mobilizing enzymatic reactions by the uptake or release of mitochondrial Ca2+, mediated by the cytosolic phosphate potential and the ATP-dependent reduction of mitochondrial pyridine nucleotides by reversal of electron transport. Images PMID:25436

  7. GDP-bound and nucleotide-free intermediates of the guanine nucleotide exchange in the Rab5·Vps9 system. (United States)

    Uejima, Tamami; Ihara, Kentaro; Goh, Tatsuaki; Ito, Emi; Sunada, Mariko; Ueda, Takashi; Nakano, Akihiko; Wakatsuki, Soichi


    Many GTPases regulate intracellular transport and signaling in eukaryotes. Guanine nucleotide exchange factors (GEFs) activate GTPases by catalyzing the exchange of their GDP for GTP. Here we present crystallographic and biochemical studies of a GEF reaction with four crystal structures of Arabidopsis thaliana ARA7, a plant homolog of Rab5 GTPase, in complex with its GEF, VPS9a, in the nucleotide-free and GDP-bound forms, as well as a complex with aminophosphonic acid-guanylate ester and ARA7·VPS9a(D185N) with GDP. Upon complex formation with ARA7, VPS9 wedges into the interswitch region of ARA7, inhibiting the coordination of Mg(2+) and decreasing the stability of GDP binding. The aspartate finger of VPS9a recognizes GDP β-phosphate directly and pulls the P-loop lysine of ARA7 away from GDP β-phosphate toward switch II to further destabilize GDP for its release during the transition from the GDP-bound to nucleotide-free intermediates in the nucleotide exchange reaction.

  8. Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats

    Directory of Open Access Journals (Sweden)

    Desirée Villahermosa


    Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.

  9. Defects in Nicotinamide-adenine Dinucleotide Phosphate Oxidase Genes NOX1 and DUOX2 in Very Early Onset Inflammatory Bowel DiseaseSummary

    Directory of Open Access Journals (Sweden)

    Patti Hayes


    Full Text Available Background & Aims: Defects in intestinal innate defense systems predispose patients to inflammatory bowel disease (IBD. Reactive oxygen species (ROS generated by nicotinamide-adenine dinucleotide phosphate (NADPH oxidases in the mucosal barrier maintain gut homeostasis and defend against pathogenic attack. We hypothesized that molecular genetic defects in intestinal NADPH oxidases might be present in children with IBD. Methods: After targeted exome sequencing of epithelial NADPH oxidases NOX1 and DUOX2 on 59 children with very early onset inflammatory bowel disease (VEOIBD, the identified mutations were validated using Sanger Sequencing. A structural analysis of NOX1 and DUOX2 variants was performed by homology in silico modeling. The functional characterization included ROS generation in model cell lines and in in vivo transduced murine crypts, protein expression, intracellular localization, and cell-based infection studies with the enteric pathogens Campylobacter jejuni and enteropathogenic Escherichia coli. Results: We identified missense mutations in NOX1 (c.988G>A, p.Pro330Ser; c.967G>A, p.Asp360Asn and DUOX2 (c.4474G>A, p.Arg1211Cys; c.3631C>T, p.Arg1492Cys in 5 of 209 VEOIBD patients. The NOX1 p.Asp360Asn variant was replicated in a male Ashkenazi Jewish ulcerative colitis cohort. Patients with both NOX1 and DUOX2 variants showed abnormal Paneth cell metaplasia. All NOX1 and DUOX2 variants showed reduced ROS production compared with wild-type enzymes. Despite appropriate cellular localization and comparable pathogen-stimulated translocation of altered oxidases, cells harboring NOX1 or DUOX2 variants had defective host resistance to infection with C. jejuni. Conclusions: This study identifies the first inactivating missense variants in NOX1 and DUOX2 associated with VEOIBD. Defective ROS production from intestinal epithelial cells constitutes a risk factor for developing VEOIBD. Keywords: Inflammatory Bowel Disease, NADPH Oxidase

  10. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma. (United States)

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O


    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  11. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions. (United States)

    Hesketh, Andy; Vergnano, Marta; Wan, Chris; Oliver, Stephen G


    We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. IMPORTANCE During infections, pathogenic bacteria can release nucleotides into the cells of their eukaryotic hosts. These nucleotides are recognized as signals that contribute to the initiation of defensive immune responses that help the infected

  12. Multifactor dimensionality reduction analysis identifies specific nucleotide patterns promoting genetic polymorphisms

    Directory of Open Access Journals (Sweden)

    Arehart Eric


    Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in

  13. Vγ9Vδ2 T cell activation by strongly agonistic nucleotidic phosphoantigens. (United States)

    Moulin, Morgane; Alguacil, Javier; Gu, Siyi; Mehtougui, Asmaa; Adams, Erin J; Peyrottes, Suzanne; Champagne, Eric


    Human Vγ9Vδ2 T cells can sense through their TCR tumor cells producing the weak endogenous phosphorylated antigen isopentenyl pyrophosphate (IPP), or bacterially infected cells producing the strong agonist hydroxyl dimethylallyl pyrophosphate (HDMAPP). The recognition of the phosphoantigen is dependent on its binding to the intracellular B30.2 domain of butyrophilin BTN3A1. Most studies have focused on pyrophosphate phosphoantigens. As triphosphate nucleotide derivatives are naturally co-produced with IPP and HDMAPP, we analyzed their specific properties using synthetic nucleotides derived from HDMAPP. The adenylated, thymidylated and uridylated triphosphate derivatives were found to activate directly Vγ9Vδ2 cell lines as efficiently as HDMAPP in the absence of accessory cells. These antigens were inherently resistant to terminal phosphatases, but apyrase, when added during a direct stimulation of Vγ9Vδ2 cells, abrogated their stimulating activity, indicating that their activity required transformation into strong pyrophosphate agonists by a nucleotide pyrophosphatase activity which is present in serum. Tumor cells can be sensitized with nucleotide phosphoantigens in the presence of apyrase to become stimulatory, showing that this can occur before their hydrolysis into pyrophosphates. Whereas tumors sensitized with HDMAPP rapidly lost their stimulatory activity, sensitization with nucleotide derivatives, in particular with the thymidine derivative, induced long-lasting stimulating ability. Using isothermal titration calorimetry, binding of some nucleotide derivatives to BTN3A1 intracellular domain was found to occur with an affinity similar to that of IPP, but much lower than that of HDMAPP. Thus, nucleotide phosphoantigens are precursors of pyrophosphate antigens which can deliver strong agonists intracellularly resulting in prolonged and strengthened activity.

  14. Genetic Control of Biosynthesis and Transport of Riboflavin and Flavin Nucleotides and Construction of Robust Biotechnological Producers†


    Abbas, Charles A.; Sibirny, Andriy A.


    Summary: Riboflavin [7,8-dimethyl-10-(1′-d-ribityl)isoalloxazine, vitamin B2] is an obligatory component of human and animal diets, as it serves as the precursor of flavin coenzymes, flavin mononucleotide, and flavin adenine dinucleotide, which are involved in oxidative metabolism and other processes. Commercially produced riboflavin is used in agriculture, medicine, and the food industry. Riboflavin synthesis starts from GTP and ribulose-5-phosphate and proceeds through pyrimidine and pterid...

  15. Reversal of Proximal Renal Tubular Dysfunction after Nucleotide Analogue Withdrawal in Chronic Hepatitis B

    Directory of Open Access Journals (Sweden)

    Abhasnee Sobhonslidsuk


    Full Text Available Aims. Proximal renal tubular dysfunction (PRTD is an infrequent complication after nucleotide analogue therapy. We evaluated the outcomes of PRTD and nephrotoxicity after nucleotide analogue withdrawal in chronic hepatitis B (CHB. Methods. A longitudinal follow-up study was performed in patients with PRTD after nucleotide analogue discontinuation. Serum and urine were collected at baseline and every 3 months for one year. The fractional excretion of phosphate (PO4, uric acid (UA, and potassium and tubular maximal reabsorption rate of PO4 to glomerular filtration rate (TmPO4/GFR were calculated. Renal losses were defined based on the criteria of substance losses. Subclinical PRTD and overt PRTD were diagnosed when 2 and ≥3 criteria were identified. Results. Eight subclinical and eight overt PRTD patients were enrolled. After nucleotide analogue withdrawal, there were overall improvements in GFR, serum PO4, and UA. Renal loss of PO4, UA, protein, and β2-microglobulin reduced over time. At one year, complete reversal of PRTD was seen in 13 patients (81.2%. Improvements in PRTD were seen in all but one patient. Conclusion. One year after nucleotide analogue withdrawal, PRTD was resolved in most patients. Changes in TmPO4/GFR, urinary protein, and β2-microglobulin indicate that urinary biomarkers may represent an early sign of PRTD recovery.

  16. Enhanced NMR signal detection of imino protons in RNA molecules containing 3' dangling nucleotides

    International Nuclear Information System (INIS)

    Amborski, Andrew N.; Johnson, Philip E.


    We present a method for improving the quality of nuclear magnetic resonance (NMR) spectra involving exchangeable protons near the base of the stem of RNA hairpin molecules. NMR spectra of five different RNA hairpins were compared. These hairpins consisted of a native RNA structure and four molecules each having different unpaired, or dangling, nucleotides at the 3' end. NMR experiments were acquired in water for each construct and the quality of the imino proton spectral regions were examined. The imino resonances near the base of the stem of the wild type RNA structure were not observed due to breathing motions. However, a significant increase in spectral quality for molecules with dangling 3' adenosine or guanosine nucleotides was observed, with imino protons detected in these constructs that were not observed in the wild type construct. A modest improvement in spectral quality was seen for the construct with a 3' unpaired uridine, whereas no significant improvement was observed for a 3' unpaired cytidine. This improvement in NMR spectral quality mirrors the increased thermodynamic stability observed for 3' unpaired nucleotides which is dependant on the stacking interactions of these nucleotides against the base of the stem. The use of a dangling 3' adenosine nucleotide represents an easy method to significantly improve the quality of NMR spectra of RNA molecules

  17. Mixed adenine/guanine quartets with three trans-a2 Pt(II) (a=NH(3) or MeNH(2)) cross-links: linkage and rotational isomerism, base pairing, and loss of NH(3). (United States)

    Albertí, Francisca M; Rodríguez-Santiago, Luis; Sodupe, Mariona; Mirats, Andrea; Kaitsiotou, Helena; Sanz Miguel, Pablo J; Lippert, Bernhard


    Of the numerous ways in which two adenine and two guanines (N9 positions blocked in each) can be cross-linked by three linear metal moieties such as trans-a2 Pt(II) (with a=NH3 or MeNH2 ) to produce open metalated purine quartets with exclusive metal coordination through N1 and N7 sites, one linkage isomer was studied in detail. The isomer trans,trans,trans-[{Pt(NH3 )2 (N7-9-EtA-N1)2 }{Pt(MeNH2 )2 (N7-9-MeGH)}2 ][(ClO4 )6 ]⋅3H2 O (1) (with 9-EtA=9-ethyladenine and 9-MeGH=9-methylguanine) was crystallized from water and found to adopt a flat Z-shape in the solid state as far as the trinuclear cation is concerned. In the presence of excess 9-MeGH, a meander-like construct, trans,trans,trans-[{Pt(NH3 )2 (N7-9-EtA-N1)2 }{Pt(MeNH2 )2 (N7-9-MeGH)2 }][(ClO4 )6 ]⋅[(9-MeGH)2 ]⋅7 H2 O (2) is formed, in which the two extra 9-MeGH nucleobases are hydrogen bonded to the two terminal platinated guanine ligands of 1. Compound 1, and likewise the analogous complex 1 a (with NH3 ligands only), undergo loss of an ammonia ligand and formation of NH4 (+) when dissolved in [D6 ]DMSO. From the analogy between the behavior of 1 and 1 a it is concluded that a NH3 ligand from the central Pt atom is lost. Addition of 1-methylcytosine (1-MeC) to such a DMSO solution reveals coordination of 1-MeC to the central Pt. In an analogous manner, 9-MeGH can coordinate to the central Pt in [D6 ]DMSO. It is proposed that the proton responsible for formation of NH4 (+) is from one of the exocyclic amino groups of the two adenine bases, and furthermore, that this process is accompanied by a conformational change of the cation from Z-form to U-form. DFT calculations confirm the proposed mechanism and shed light on possible pathways of this process. Calculations show that rotational isomerism is not kinetically hindered and that it would preferably occur previous to the displacement of NH3 by DMSO. This displacement is the most energetically costly step, but it is compensated by the proton

  18. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases (United States)

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.


    Inosine-5'-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches.

  19. Optimization time synthesis of nucleotide labelled [γ-32P]-ATP

    International Nuclear Information System (INIS)

    Rahman, Wira Y; Sarmini, Endang; Herlina; Lubis, Hotman; Triyanto; Hambali


    Adenosine triphosphate-labelled with γ- 32 P([γ- 32 p]-ATP) has been widely used in the biotechnology research, usually as a tracer to study aspects of physiological and pathological processes. In order to support biotechnology research in Indonesia, a process for production of [γ- 32 P]-ATP with enzymatic reaction was used as precursors DL-glyceraldehydde 3-phosphate, Adenosine Diphosphate (ADP) and H 3 32 PO 4 , and enzyme glyceraldehid 3-phosphate dehydrogenase, 3-phosphoglyceryc phosphokinase and lactate dehydrogenase. Optimization of incubation time labeled nucleotide synthesis process is performed to find the optimum conditions, in terms of the most advantageous time in the synthesis process. With the success of the synthesis and optimization is done incubation time of synthesis labeled nucleotide, the result suggested can be used for producing [γ- 32 P] -ATP to support the provision of radiolabeled nucleotide for biotechnology research in Indonesia. (author)

  20. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay. (United States)

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M


    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  1. The Fanconi anaemia components UBE2T and FANCM are functionally linked to nucleotide excision repair.

    Directory of Open Access Journals (Sweden)

    Ian R Kelsall

    Full Text Available The many proteins that function in the Fanconi anaemia (FA monoubiquitylation pathway initiate replicative DNA crosslink repair. However, it is not clear whether individual FA genes participate in DNA repair pathways other than homologous recombination and translesion bypass. Here we show that avian DT40 cell knockouts of two integral FA genes--UBE2T and FANCM are unexpectedly sensitive to UV-induced DNA damage. Comprehensive genetic dissection experiments indicate that both of these FA genes collaborate to promote nucleotide excision repair rather than translesion bypass to protect cells form UV genotoxicity. Furthermore, UBE2T deficiency impacts on the efficient removal of the UV-induced photolesion cyclobutane pyrimidine dimer. Therefore, this work reveals that the FA pathway shares two components with nucleotide excision repair, intimating not only crosstalk between the two major repair pathways, but also potentially identifying a UBE2T-mediated ubiquitin-signalling response pathway that contributes to nucleotide excision repair.

  2. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

    Directory of Open Access Journals (Sweden)

    Shui-Lian He

    Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  3. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica). (United States)

    He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang


    Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  4. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2. (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J


    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  5. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2]. (United States)

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I


    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  6. Different characteristics and nucleotide binding properties of inosine monophosphate dehydrogenase (IMPDH isoforms.

    Directory of Open Access Journals (Sweden)

    Elaine C Thomas

    Full Text Available We recently reported that Inosine Monophosphate Dehydrogenase (IMPDH, a rate-limiting enzyme in de novo guanine nucleotide biosynthesis, clustered into macrostructures in response to decreased nucleotide levels and that there were differences between the IMPDH isoforms, IMPDH1 and IMPDH2. We hypothesised that the Bateman domains, which are present in both isoforms and serve as energy-sensing/allosteric modules in unrelated proteins, would contribute to isoform-specific differences and that mutations situated in and around this domain in IMPDH1 which give rise to retinitis pigmentosa (RP would compromise regulation. We employed immuno-electron microscopy to investigate the ultrastructure of IMPDH macrostructures and live-cell imaging to follow clustering of an IMPDH2-GFP chimera in real-time. Using a series of IMPDH1/IMPDH2 chimera we demonstrated that the propensity to cluster was conferred by the N-terminal 244 amino acids, which includes the Bateman domain. A protease protection assay suggested isoform-specific purine nucleotide binding characteristics, with ATP protecting IMPDH1 and AMP protecting IMPDH2, via a mechanism involving conformational changes upon nucleotide binding to the Bateman domain without affecting IMPDH catalytic activity. ATP binding to IMPDH1 was confirmed in a nucleotide binding assay. The RP-causing mutation, R224P, abolished ATP binding and nucleotide protection and this correlated with an altered propensity to cluster. Collectively these data demonstrate that (i the isoforms are differentially regulated by AMP and ATP by a mechanism involving the Bateman domain, (ii communication occurs between the Bateman and catalytic domains and (iii the RP-causing mutations compromise such regulation. These findings support the idea that the IMPDH isoforms are subject to distinct regulation and that regulatory defects contribute to human disease.

  7. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data. (United States)

    Dunn, Joshua G; Weissman, Jonathan S


    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

  8. Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina. (United States)

    Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián


    The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

  9. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions

    Directory of Open Access Journals (Sweden)

    Andy Hesketh


    Full Text Available We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP, cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection.

  10. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome. (United States)

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A


    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  11. Cytosolic nucleotides block and regulate the Arabidopsis vacuolar anion channel AtALMT9. (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis


    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al(3+) to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Cytosolic Nucleotides Block and Regulate the Arabidopsis Vacuolar Anion Channel AtALMT9* (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis


    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al3+ to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. PMID:25028514

  13. Adenylate Nucleotides and 2,3-Biphosphoglycerate Concentration in Erythrocytes of Growing Wielkopolska Stallions


    M. Suska; E. Skotnicka; W. Dudzińska; W. Orowicz; M. Brzezinska


    The aim of this study was to examine the relationships between the concentrations of adenylate nucleotides (ATP, ADP, AMP), total nucleotide pool (TAN), adenylate energy charge (AEC) and 2,3-biphosphoglycerate (2,3-BPG) in the erythrocytes of young horses in the period of their rapid growth and development. The studies were conducted on 10 young Wielkopolska breed stallions for two years; Group A: 1-month-old, Group B: 3-month-old, Group C: 6-month-old, Group D: 1-year-old, and Group E: 2-yea...


    Directory of Open Access Journals (Sweden)

    Lakshya Veer Singh


    Full Text Available The present study was undertaken to characterize exon 1 and exon 2 sequence of one of fecundity genes: GDF9 (Growth differentiation factor 9, in high altitude livestock animal (Yak and Gaddi goat. Six nucleotide differences were identified between sheep (AF078545 and goats (EF446168 in exon 1 and exon 2. Sequencing revealed nine novel single nucleotide mutations in exon 1 and exon 2 of Indian yak that compared with Bos taurus (GQ922451. These results preliminarily showed that the GDF9 gene might be a major gene that influences prolificacy of Gaddi goats and Indian yak.

  15. Hydrolytic and alcoholytic dephosphorylation of nucleotides by acid phosphatase in the presence of ethanol. (United States)

    Tomaszewski, M; Buchowicz, J


    The effect of ethanol on the activity of acid phosphatase from wheat germ was studied, by using ribonucleoside monophosphates as the enzyme substrates. The nucleotides were effectively degraded to the corresponding nucleosides in the presence of ethanol at all concentrations tested, including a 96% (v/v) solution. However, the nucleotide dephosphorylation was accompanied by the liberation of orthophosphate only when the concentration of ethanol in the assay mixture did not exceed 15%. No inorganic phosphate was liberated when ethanol was present at higher concentrations. Instead, monoethyl phosphate was formed in quantities expected for orthophosphate. The results are explained in terms of phosphatase-catalysed alcoholysis.

  16. Detecting Single-Nucleotides by Tunneling Current Measurements at Sub-MHz Temporal Resolution. (United States)

    Morikawa, Takanori; Yokota, Kazumichi; Tanimoto, Sachie; Tsutsui, Makusu; Taniguchi, Masateru


    Label-free detection of single-nucleotides was performed by fast tunneling current measurements in a polar solvent at 1 MHz sampling rate using SiO₂-protected Au nanoprobes. Short current spikes were observed, suggestive of trapping/detrapping of individual nucleotides between the nanoelectrodes. The fall and rise features of the electrical signatures indicated signal retardation by capacitance effects with a time constant of about 10 microseconds. The high temporal resolution revealed current fluctuations, reflecting the molecular conformation degrees of freedom in the electrode gap. The method presented in this work may enable direct characterizations of dynamic changes in single-molecule conformations in an electrode gap in liquid.

  17. Effect of the nucleotides surrounding the start codon on the translation of foot-and-mouth disease virus RNA. (United States)

    Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R


    As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.

  18. Nucleotide composition of the Zika virus RNA genome and its codon usage

    NARCIS (Netherlands)

    van Hemert, Formijn; Berkhout, Ben


    RNA viruses have genomes with a distinct nucleotide composition and codon usage. We present the global characteristics of the RNA genome of Zika virus (ZIKV), an emerging pathogen within the Flavivirus genus. ZIKV was first isolated in 1947 in Uganda, caused a widespread epidemic in South and

  19. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van


    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  20. Building the library of RNA 3D nucleotide conformations using the clustering approach

    Directory of Open Access Journals (Sweden)

    Zok Tomasz


    Full Text Available An increasing number of known RNA 3D structures contributes to the recognition of various RNA families and identification of their features. These tasks are based on an analysis of RNA conformations conducted at different levels of detail. On the other hand, the knowledge of native nucleotide conformations is crucial for structure prediction and understanding of RNA folding. However, this knowledge is stored in structural databases in a rather distributed form. Therefore, only automated methods for sampling the space of RNA structures can reveal plausible conformational representatives useful for further analysis. Here, we present a machine learning-based approach to inspect the dataset of RNA three-dimensional structures and to create a library of nucleotide conformers. A median neural gas algorithm is applied to cluster nucleotide structures upon their trigonometric description. The clustering procedure is two-stage: (i backbone- and (ii ribose-driven. We show the resulting library that contains RNA nucleotide representatives over the entire data, and we evaluate its quality by computing normal distribution measures and average RMSD between data points as well as the prototype within each cluster.

  1. Understanding specificity in metabolic pathways-Structural biology of human nucleotide metabolism

    International Nuclear Information System (INIS)

    Welin, Martin; Nordlund, Paer


    Interactions are the foundation of life at the molecular level. In the plethora of activities in the cell, the evolution of enzyme specificity requires the balancing of appropriate substrate affinity with a negative selection, in order to minimize interactions with other potential substrates in the cell. To understand the structural basis for enzyme specificity, the comparison of structural and biochemical data between enzymes within pathways using similar substrates and effectors is valuable. Nucleotide metabolism is one of the largest metabolic pathways in the human cell and is of outstanding therapeutic importance since it activates and catabolises nucleoside based anti-proliferative drugs and serves as a direct target for anti-proliferative drugs. In recent years the structural coverage of the enzymes involved in human nucleotide metabolism has been dramatically improved and is approaching completion. An important factor has been the contribution from the Structural Genomics Consortium (SGC) at Karolinska Institutet, which recently has solved 33 novel structures of enzymes and enzyme domains in human nucleotide metabolism pathways and homologs thereof. In this review we will discuss some of the principles for substrate specificity of enzymes in human nucleotide metabolism illustrated by a selected set of enzyme families where a detailed understanding of the structural determinants for specificity is now emerging.

  2. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus. (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H


    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  3. Sirtuin 1 gene rs2273773 C >T single nucleotide polymorphism and ...

    African Journals Online (AJOL)

    Background: Sirtuin-1 (SIRT-1), a protein has been found to protect the cells against oxidative stress due to its deacetylase activity. In this investigation, we aimed to study SIRT-1 gene rs2273773 C >T single nucleotide polymorphism and markers of serum protein oxidation (protein carbonyl and sulfhydryl groups) in ...

  4. Evolutionary and structural perspectives of plant cyclic nucleotide-gated cation channels

    KAUST Repository

    Zelman, Alice K.; Dawe, Adam; Gehring, Christoph A; Berkowitz, Gerald A.


    , including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide-binding domain and a

  5. 2′-O-methyl nucleotide modified DNA substrates influence the ...

    Indian Academy of Sciences (India)


    Jul 18, 2014 ... 1. Introduction. Due to the development of novel nucleotide derivatives, ..... which is located in a spiral ring made of 152-157 bases before α6. ..... 8 126–. 130. Majlessi M, Nelson NC and Becker MM 1998 Advantages of 2'-O-.

  6. Twelve single nucleotide polymorphisms on chromosome 19q13.2-13.3

    DEFF Research Database (Denmark)

    Yin, Jiaoyang; Vogel, Ulla; Gerdes, Lars Ulrik


    The genetic susceptibility to basal cell carcinoma (BCC) among Danish psoriatic patients was investigated in association studies with 12 single nucleotide polymorphisms on chromosome 19q13.2-3. The results show a significant association between BCC and the A-allele of a polymorphism in ERCCI exon4...

  7. Factor 11 single-nucleotide variants in women with heavy menstrual bleeding

    NARCIS (Netherlands)

    Wiewel-Verschueren, Sophie; Mulder, Andre B.; Meijer, Karina; Mulder, Rene


    In a previous study it was shown that lower factor XI (FXI) levels in women with heavy menstrual bleeding (HMB). Our aim was to determine the single-nucleotide variants (SNVs) in the F11 gene in women with HMB. In addition, an extensive literature search was performed to determine the clinical

  8. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

    DEFF Research Database (Denmark)

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr


    Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver...

  9. Infectious mononucleosis-linked HLA class I single nucleotide polymorphism is associated with multiple sclerosis. (United States)

    Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q


    Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.

  10. Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1

    NARCIS (Netherlands)

    Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef

    The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for

  11. Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.

    Directory of Open Access Journals (Sweden)

    Kouki Yonezawa

    Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.

  12. Pyridine nucleotides in regulation of cell death and survival by redox and non-redox reactions. (United States)

    Novak Kujundžić, Renata; Žarković, Neven; Gall Trošelj, Koraljka


    Changes of the level and ratios of pyridine nucleotides determine metabolism- dependent cellular redox status and the activity of poly(ADP-ribose) polymerases (PARPs) and sirtuins, thereby influencing several processes closely related to cell survival and death. Pyridine nucleotides participate in numerous metabolic reactions whereby their net cellular level remains constant, but the ratios of NAD+/NADP+ and NADH/NADPH oscillate according to metabolic changes in response to diverse stress signals. In non-redox reactions, NAD+ is degraded and quickly, afterward, resynthesized in the NAD+ salvage pathway, unless overwhelming activation of PARP-1 consumes NAD+ to the point of no return, when the cell can no longer generate enough ATP to accommodate NAD+ resynthesis. The activity of PARP-1 is mandatory for the onset of cytoprotective autophagy on sublethal stress signals. It has become increasingly clear that redox status, largely influenced by the metabolism-dependent composition of the pyridine nucleotides pool, plays an important role in the synthesis of pro-apoptotic and anti-apoptotic sphingolipids. Awareness of the involvement of the prosurvival sphingolipid, sphingosine-1-phosphate, in transition from inflammation to malignant transformation has recently emerged. Here, the participation of pyridine nucleotides in redox and non-redox reactions, sphingolipid metabolism, and their role in cell fate decisions is reviewed.

  13. SUMO and ubiquitin-dependent XPC exchange drives nucleotide excision repair

    DEFF Research Database (Denmark)

    Van Cuijk, Loes; Van Belle, Gijsbert J.; Turkyilmaz, Yasemin


    XPC recognizes UV-induced DNA lesions and initiates their removal by nucleotide excision repair (NER). Damage recognition in NER is tightly controlled by ubiquitin and SUMO modifications. Recent studies have shown that the SUMO-targeted ubiquitin ligase RNF111 promotes K63-linked ubiquitylation o...

  14. Grinding up Wheat: a Massive Loss of Nucleotide Diversity Since Domestication

    DEFF Research Database (Denmark)

    Haudry, Anabelle; Cenci, Alberto; Ravel, Catherine


    Several demographic and selective events occurred during the domestication of wheat from the allotetraploid wild emmer (Triticum turgidum ssp. dicoccoides). Cultivated wheat has since been affected by other historical events. We analyzed nucleotide diversity at 21 loci in a sample of 101 individu...

  15. A fluorimetric readout reporting the kinetics of nucleotide-induced human ribonucleotide reductase oligomerization. (United States)

    Fu, Yuan; Lin, Hongyu; Wisitpitthaya, Somsinee; Blessing, William A; Aye, Yimon


    Human ribonucleotide reductase (hRNR) is a target of nucleotide chemotherapeutics in clinical use. The nucleotide-induced oligomeric regulation of hRNR subunit α is increasingly being recognized as an innate and drug-relevant mechanism for enzyme activity modulation. In the presence of negative feedback inhibitor dATP and leukemia drug clofarabine nucleotides, hRNR-α assembles into catalytically inert hexameric complexes, whereas nucleotide effectors that govern substrate specificity typically trigger α-dimerization. Currently, both knowledge of and tools to interrogate the oligomeric assembly pathway of RNR in any species in real time are lacking. We therefore developed a fluorimetric assay that reliably reports on oligomeric state changes of α with high sensitivity. The oligomerization-directed fluorescence quenching of hRNR-α, covalently labeled with two fluorophores, allows for direct readout of hRNR dimeric and hexameric states. We applied the newly developed platform to reveal the timescales of α self-assembly, driven by the feedback regulator dATP. This information is currently unavailable, despite the pharmaceutical relevance of hRNR oligomeric regulation. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Solubilization and reconstitution of the formylmethionylleucylphenylalanine receptor coupled to guanine nucleotide regulatory protein

    International Nuclear Information System (INIS)

    Williamson, K.; Dickey, B.F.; Pyun, H.Y.; Navarro, J.


    The authors describe the solubilization, resolution, and reconstitution of the formylmethionylleucylphenylalanine (fMet-Leu-Phe) receptor and guanine nucleotide regulatory proteins (G-proteins). The receptor was solubilized with 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate. Guanine nucleotides decreased the number of high-affinity binding sites and accelerated the rate of dissociation of the receptor-ligand complex, suggesting that the solubilized receptor remained coupled to endogenous G-proteins. The solubilized receptor was resolved from endogenous G-proteins by fractionation on a wheat germ agglutinin (WGA)-Sepharose 4B column. High-affinity [ 3 H]fMet-Leu-Phe binding to the WGA-purified receptor was diminished and exhibited reduced guanine nucleotide sensitivity. High-affinity [ 3 H]fMET-Leu-Phe binding and guanine nucleotide sensitivity were reconstituted upon the addition of purified brain G-proteins. Similar results were obtained when the receptor was reconstituted with brain G-proteins into phospholipid vesicles by gel filtration chromatography. In addition, they also demonstrated fMET-Leu-Phe-dependent GTP hydrolysis in the reconstituted vesicles. The results of this work indicate that coupling of the fMet-Leu-Phe receptor to G-proteins converts the receptor to a high-affinity binding state and that agonist produces activation of G-proteins. The resolution and functional reconstitution of this receptor should provide an important step toward the elucidation of the molecular mechanism of the fMet-Leu-Phe transduction system in neutrophils

  17. Development and characterization of 35 single nucleotide polymorphism markers for the brown alga Fucus vesiculosus

    NARCIS (Netherlands)

    Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth


    We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP

  18. Targeted Metabolic Engineering Guided by Computational Analysis of Single-Nucleotide Polymorphisms (SNPs)

    DEFF Research Database (Denmark)

    Udatha, D B R K Gupta; Rasmussen, Simon; Sicheritz-Pontén, Thomas


    The non-synonymous SNPs, the so-called non-silent SNPs, which are single-nucleotide variations in the coding regions that give "birth" to amino acid mutations, are often involved in the modulation of protein function. Understanding the effect of individual amino acid mutations on a protein...

  19. Association between nucleotide mutation of eNOS gene and serum ...

    African Journals Online (AJOL)

    Various mutation on endothelial nitric oxide synthase (eNOs) gene cause reduced production of NO, the expansion factor (VEF) and may accelerate the process of atherosclerosis. The study was designed to investigate the frequency of T-786C polymorphism of the gene or nucleotide mutation of eNOS gene in patients ...

  20. A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction. (United States)

    Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen


    A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

  1. Slow spontaneous [Ca2+]i oscillations reflect nucleotide release from renal epithelia

    DEFF Research Database (Denmark)

    Geyti, Christine Stride; Odgaard, Elvin V. P.; Overgaard, Morten Thaarup


    Renal epithelia can be provoked mechanically to release nucleotides, which subsequently increases the intracellular Ca(2+) concentration [Ca(2+)](i) through activation of purinergic (P2) receptors. Cultured cells often show spontaneous [Ca(2+)](i) oscillations, a feature suggested to involve nucl...

  2. Interaction of organophosphorus pesticides with DNA nucleotides on a Boron-doped diamond electrode

    Energy Technology Data Exchange (ETDEWEB)

    Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko, E-mail: [Universidade Estadual Paulista Julio de Mesquita Filho (UNESP), Bauru, SP (Brazil). Dept. de Quimica Analitica


    Diamond electrode was used to evaluate the interaction of the nucleotides guanosine monophosphate (GMP) and adenosine monophosphate (AMP) with the pesticides chlorpyrifos, methamidophos and monocrotophos. Changes were observed in the currents and peak potentials of the nucleotide voltammograms in the presence of the pesticides, with dependence on the pesticide concentration (from 5.0 Multiplication-Sign 10{sup -7} to 5.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) and the interaction time (from 1 min to 4 h). This is probably due to binding of the pesticides to the nitrogenous bases present in the nucleotides, which could lead to problems in the DNA replication and biological functions of nucleotides. The pesticides showed stronger interaction with AMP than with GMP. Studies of the interaction of 50 Micro-Sign g mL{sup -1} DNA with the pesticides (from 30 min to 4 h and from 1.0 Multiplication-Sign 10{sup -6} to 6.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) did not reveal any peaks relating to double helix opening or DNA unwinding. (author)

  3. Analysis of multiple single nucleotide polymorphisms (SNP) on DNA traces from plasma and dried blood samples

    NARCIS (Netherlands)

    Catsburg, Arnold; van der Zwet, Wil C.; Morre, Servaas A.; Ouburg, Sander; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.


    Reliable analysis of single nucleotide polymorphisms (SNPs) in DNA derived from samples containing low numbers of cells or from suboptimal sources can be difficult. A new procedure to characterize multiple SNPs in traces of DNA from plasma and old dried blood samples was developed. Six SNPs in the

  4. Determination of the Nucleic Acid Adducts Structure at the Nucleoside/Nucleotide Level by NMR Spectroscopy

    Czech Academy of Sciences Publication Activity Database

    Dračínský, Martin; Pohl, Radek


    Roč. 28, č. 2 (2015), s. 155-165 ISSN 0893-228X R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : NMR spectroscopy * nucleic acids * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.025, year: 2015

  5. Lupus-related single nucleotide polymorphisms and risk of diffuse large B-cell lymphoma

    NARCIS (Netherlands)

    Bernatsky, Sasha; Velásquez García, Héctor A; Spinelli, John; Gaffney, Patrick; Smedby, Karin E; Ramsey-Goldman, Rosalind; Wang, Sophia S.; Adami, Hans-Olov; Albanes, Demetrius; Angelucci, Emanuele; Ansell, Stephen M.; Asmann, Yan W.; Becker, Nikolaus; Benavente, Yolanda; Berndt, Sonja I.; Bertrand, Kimberly A.; Birmann, Brenda M.; Boeing, Heiner; Boffetta, Paolo; Bracci, Paige M.; Brennan, Paul; Brooks-Wilson, Angela R.; Cerhan, James R.; Chanock, Stephen J.; Clavel, Jacqueline; Conde, Lucia; Cotenbader, Karen H; Cox, David G; Cozen, Wendy; Crouch, Simon; De Roos, Anneclaire J.; De Sanjose, Silvia; Di Lollo, Simonetta; Diver, W. Ryan; Dogan, Ahmet; Foretova, Lenka; Ghesquières, Hervé; Giles, Graham G.; Glimelius, Bengt; Habermann, Thomas M.; Haioun, Corinne; Hartge, Patricia; Hjalgrim, Henrik; Holford, Theodore R.; Holly, Elizabeth A.; Jackson, Rebecca D.; Kaaks, Rudolph; Kane, Eleanor; Kelly, Rachel S.; Klein, Robert J.; Kraft, Peter; Kricker, Anne; Lan, Qing; Lawrence, Charles; Liebow, Mark; Lightfoot, Tracy; Link, Brian K.; Maynadie, Marc; McKay, James; Melbye, Mads; Molina, Thierry Jo; Monnereau, Alain; Morton, Lindsay M.; Nieters, Alexandra; North, Kari E.; Novak, Anne J.; Offit, Kenneth; Purdue, Mark P.; Rais, Marco; Riby, Jacques; Roman, Eve; Rothman, Nathaniel; Salles, Gilles; Severi, Gianluca; Severson, Richard K.; Skibola, Christine F.; Slager, Susan L.; Smith, Alex; Smith, Martyn T.; Southey, Melissa C.; Staines, Anthony; Teras, Lauren R.; Thompson, Carrie A.; Tilly, Hervé; Tinker, Lesley F.; Tjonneland, Anne; Turner, Jenny; Vajdic, Claire M.; Vermeulen, Roel C H; Vijai, Joseph; Vineis, Paolo; Virtamo, Jarmo; Wang, Zhaoming; Weinstein, Stephanie; Witzig, Thomas E.; Zelenetz, Andrew; Zeleniuch-Jacquotte, Anne; Zhang, Yawei; Zheng, Tongzhang; Zucca, Mariagrazia; Clarke, Ann E


    Objective: Determinants of the increased risk of diffuse large B-cell lymphoma (DLBCL) in SLE are unclear. Using data from a recent lymphoma genome-wide association study (GWAS), we assessed whether certain lupus-related single nucleotide polymorphisms (SNPs) were also associated with DLBCL.

  6. Synthesis of Benzene and Pyridine 2-C-Methyl-C-ribonucleosides and -nucleotides

    Czech Academy of Sciences Publication Activity Database

    Tokarenko, Anna; Poštová Slavětínská, Lenka; Klepetářová, Blanka; Hocek, Michal


    Roč. 2015, č. 36 (2015), s. 7962-7983 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344 Institutional support: RVO:61388963 Keywords : nucleosides * nucleotides * glycosides * antiviral agents * cross - coupling Subject RIV: CC - Organic Chemistry Impact factor: 3.068, year: 2015

  7. Synthesis of Substituted Benzyl Homo-C-Ribonucleosides and -Nucleotides as Carba-Analogues of Phosphoribosylanthranilate

    Czech Academy of Sciences Publication Activity Database

    Kubelka, Tomáš; Slavětínská, Lenka; Hocek, Michal

    -, č. 26 (2012), s. 4969-4981 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344; GA AV ČR IAA400550902 Institutional support: RVO:61388963 Keywords : C-nucleosides * homonucleosides * cross - coupling * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.344, year: 2012

  8. Adsorption of nucleotides onto Fe-Mg-Al rich swelling clays (United States)

    Feuillie, Cécile; Daniel, Isabelle; Michot, Laurent J.; Pedreira-Segade, Ulysse


    Mineral surfaces may have played a role in the origin of the first biopolymers, by concentrating organic monomers from a dilute ocean. Swelling clays provide a high surface area for the concentration of prebiotic monomers, and have therefore been the subject of numerous investigations. In that context, montmorillonite, the most abundant swelling clay in modern environments, has been extensively studied with regard to adsorption and polymerization of nucleic acids. However, montmorillonite was probably rather marginal on the primitive ocean floor compared to iron-magnesium rich phyllosilicates such as nontronite that results from the hydrothermal alteration of a mafic or ultramafic oceanic crust. In the present paper, we study the adsorption of nucleotides on montmorillonite and nontronite, at various pH and ionic strength conditions plausible for Archean sea-water. A thorough characterization of the mineral surfaces shows that nucleotide adsorb mainly on the edge faces of the smectites by ligand exchange between the phosphate groups of the nucleotides and the -OH groups from the edge sites over a wide pH range (4-10). Nontronite is more reactive than montmorillonite. At low pH, additional ion exchange may play a role as the nucleotides become positively charged.

  9. Transmembrane Domain Single-Nucleotide Polymorphisms Impair Expression and Transport Activity of ABC Transporter ABCG2

    NARCIS (Netherlands)

    Sjostedt, N.; Heuvel, J.J.M.W. van den; Koenderink, J.B.; Kidron, H.


    PURPOSE: To study the function and expression of nine naturally occurring single-nucleotide polymorphisms (G406R, F431L, S441N, P480L, F489L, M515R, L525R, A528T and T542A) that are predicted to reside in the transmembrane regions of the ABC transporter ABCG2. METHODS: The transport activity of the

  10. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis. (United States)

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A


    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Oligodeoxynucleotides containing 2'-amino-LNA nucleotides as constrained morpholino phosphoramidate and phosphorodiamidate monomers

    DEFF Research Database (Denmark)

    Kristensen, Kim Vejlegaard; Paul, Sibasish; Kosbar, Tamer


    Incorporation in a 2'→5' direction of a phosphorodiamidite 2'-amino-LNA-T nucleotide as the morpholino phosphoramidate and N,N-dimethylamino phosphorodiamidate monomers into six oligonucleotides is reported. Thermal denaturation studies showed that the novel 2'-amino-LNA-based morpholino monomers...

  12. Dietary nucleotide supplementation raises erythrocyte 2, 3-diphosphoglycerate concentration in neonatal rats. (United States)

    Scopesi, F; Verkeste, C M; Paola, D; Gazzolo, D; Pronzato, M A; Bruschettini, P L; Marinari, U M


    The present study was designed to test if dietary intake of nucleotides increases erythrocyte 2,3-diphosphoglycerate (2,3-DPG) in neonatal rats. To this end, rat pups were fed a nucleotide-supplemented formula (S, n = 14) from d 9 until d 16 after birth. The results were compared with those obtained from a group of breast-fed pups (C, n = 14) and a group of pups artificially fed with nucleotide-free formula (NS, n = 14). Neonatal weight, 2,3-DPG concentration, hematocrit (Hct) and hemoglobin concentration (Hb) were determined before the experiment (d 9) and after 7 d of treatment (d 16). In all groups, 2,3-DPG concentration was greater at d 16 than d 9, and the increase was greater in the S group than in the NS group. Alterations in neonatal weight, Hct and Hb concentration did not differ among the groups. On d 16 the 2, 3-DPG/Hb ratio, reflecting the affinity of hemoglobin for oxygen, was significantly higher in the C and S groups than in the NS group. We conclude that in neonatal rats, dietary nucleotides increase erythrocyte 2,3-DPG concentration. Studies need to be conducted in humans to assess the effect of this increase on both neonatal peripheral hemodynamics and metabolism in this species.

  13. Synthesis of Hydrazone-Modified Nucleotides and Their Polymerase Incorporation onto DNA for Redox Labeling

    Czech Academy of Sciences Publication Activity Database

    Raindlová, Veronika; Pohl, Radek; Klepetářová, Blanka; Havran, Luděk; Šimková, Eva; Horáková Brázdilová, Petra; Pivoňková, Hana; Fojta, Miroslav; Hocek, Michal


    Roč. 77, č. 8 (2012), s. 652-662 ISSN 2192-6506 R&D Projects: GA AV ČR(CZ) IAA400040901; GA ČR GBP206/12/G151 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040702 Keywords : DNA * oligonucleotides * polymerase * hydrazones * nucleotides Subject RIV: CC - Organic Chemistry

  14. Single-nucleotide polymorphism of INS, INSR, IRS1, IRS2, PPAR-G ...

    Indian Academy of Sciences (India)


    Mar 2, 2017 ... Abstract. Polycystic ovary syndrome (PCOS) is the most common and a complex female endocrine disorder, and is one of the leading cause of female infertility. Here, we aimed to investigate the association of single-nucleotide polymorphism of INS, INSR,. IRS1, IRS2, PPAR-G and CAPN10 gene in the ...

  15. On the biased nucleotide composition of the human coronavirus RNA genome

    NARCIS (Netherlands)

    Berkhout, Ben; van Hemert, Formijn


    We investigated the nucleotide composition of the RNA genome of the six human coronaviruses. Some general coronavirus characteristics were apparent (e.g. high U, low C count), but we also detected species-specific signatures. Most strikingly, the high U and low C proportions are quite variable and

  16. Enhanced activity of the purine nucleotide cycle of the exercising muscle in patients with hyperthyroidism. (United States)

    Fukui, H; Taniguchi , S; Ueta, Y; Yoshida, A; Ohtahara, A; Hisatome, I; Shigemasa, C


    Myopathy frequently develops in patients with hyperthyroidism, but its precise mechanism is not clearly understood. In this study we focused on the purine nucleotide cycle, which contributes to ATP balance in skeletal muscles. To investigate purine metabolism in muscles, we measured metabolites related to the purine nucleotide cycle using the semiischemic forearm test. We examined the following four groups: patients with untreated thyrotoxic Graves' disease (untreated group), patients with Graves' disease treated with methimazole (treated group), patients in remission (remission group), and healthy volunteers (control group). To trace the glycolytic process, we measured glycolytic metabolites (lactate and pyruvate) as well as purine metabolites (ammonia and hypoxanthine). In the untreated group, the levels of lactate, pyruvate, and ammonia released were remarkably higher than those in the control group. Hypoxanthine release also increased in the untreated group, but the difference among the patient groups was not statistically significant. The accelerated purine catabolism did not improve after 3 months of treatment with methimazole, but it was completely normalized in the remission group. This indicated that long-term maintenance of thyroid function was necessary for purine catabolism to recover. We presume that an unbalanced ATP supply or conversion of muscle fiber type may account for the acceleration of the purine nucleotide cycle under thyrotoxicosis. Such acceleration of the purine nucleotide cycle is thought to be in part a protective mechanism against a rapid collapse of the ATP energy balance in exercising muscles of patients with hyperthyroidism.

  17. Coupling of guanine nucleotide inhibitory protein to somatostatin receptors on pancreatic acinar membranes

    International Nuclear Information System (INIS)

    Sakamoto, C.; Matozaki, T.; Nagao, M.; Baba, S.


    Guanine nucleotides and pertussis toxin were used to investigate whether somatostatin receptors interact with the guanine nucleotide inhibitory protein (NI) on pancreatic acinar membranes in the rat. Guanine nucleotides reduced 125 I-[Tyr 1 ]somatostatin binding to acinar membranes up to 80%, with rank order of potency being 5'-guanylyl imidodiphosphate [Gpp(NH)p]>GTP>TDP>GMP. Scatchard analysis revealed that the decrease in somatostatin binding caused by Gpp(NH)p was due to the decrease in the maximum binding capacity without a significant change in the binding affinity. The inhibitory effect of Gpp(NH)p was partially abolished in the absence of Mg 2+ . When pancreatic acini were treated with 1 μg/ml pertussis toxin for 4 h, subsequent 125 I-[Tyr 1 ]somatostatin binding to acinar membranes was reduced. Pertussis toxin treatment also abolished the inhibitory effect of somatostatin on vasoactive intestinal peptide-stimulated increase in cellular content of adenosine 3',5'-cyclic monophosphate (cAMP) in the acini. The present results suggest that 1) somatostatin probably functions in the pancreas to regulate adenylate cyclase enzyme system via Ni, 2) the extent of modification of Ni is correlated with the ability of somatostatin to inhibit cAMP accumulation in acini, and 3) guanine nucleotides also inhibit somatostatin binding to its receptor

  18. Dynamic interaction of TTDA with TFIIH is stabilized by nucleotide excision repair in living cells.

    NARCIS (Netherlands)

    G. Giglia-Mari (Giuseppina); C. Miquel (Catherine); A.F. Theil (Arjan); P.O. Mari (Pierre-Olivier); D. Hoogstraten (Deborah); J.M.Y. Ng (Jessica); C. Dinant (Christoffel); J.H.J. Hoeijmakers (Jan); W. Vermeulen (Wim)


    textabstractTranscription/repair factor IIH (TFIIH) is essential for RNA polymerase II transcription and nucleotide excision repair (NER). This multi-subunit complex consists of ten polypeptides, including the recently identified small 8-kDa trichothiodystrophy group A (TTDA)/ hTFB5 protein.

  19. Nucleotide variation in ATHK1 region of Arabidopsis thaliana and its ...

    African Journals Online (AJOL)

    The ATHK1 gene in Arabidopsis encodes a putative histidine kinase that is transcriptionally upregulated in response to changes in external osmolarity. In this work, we investigated the nucleotide variability of the ATHK1 gene in a sample of 32 core Arabidopsis accessions originating from different ecoclimatic regions and ...

  20. The binding of glucose and nucleotides to hexokinase from Saccharomyces cerevisiae. (United States)

    Woolfitt, A R; Kellett, G L; Hoggett, J G


    The binding of glucose, ADP and AdoPP[NH]P, to the native PII dimer and PII monomer and the proteolytically-modified SII monomer of hexokinase (ATP:D-hexose 6-phosphotransferase, EC from Saccharomyces cerevisiae was monitored at pH 6.7 by the concomitant quenching of protein fluorescence. The data were analysed in terms of Qmax, the maximal quenching of fluorescence at saturating concentrations of ligand, and [L]0.5, the concentration of ligand at half-maximal quenching. No changes in fluorescence were observed with free enzyme and nucleotide alone. In the presence of saturating levels of glucose, Qmax induced by nucleotide was between 2 and 7%, and [L]0.5 was between 0.12 and 0.56 mM, depending on the nucleotide and enzyme species. Qmax induced by glucose alone was between 22 and 25%, while [L]0.5 was approx. 0.4 mM for either of the monomeric hexokinase forms and 3.4 for PII dimer. In the presence of 6 mM ADP or 2 mM AdoPP[NH]P, Qmax for glucose was increased by up to 4% and [L]0.5 was diminished 3-fold for hexokinase PII monomer, 6-fold for SII monomer, and 15-fold for PII dimer. The results are interpreted in terms of nucleotide-induced conformational change of hexokinase in the presence of glucose and synergistic binding interactions between glucose and nucleotide.

  1. Ras conformational switching: simulating nucleotide-dependent conformational transitions with accelerated molecular dynamics.

    Directory of Open Access Journals (Sweden)

    Barry J Grant


    Full Text Available Ras mediates signaling pathways controlling cell proliferation and development by cycling between GTP- and GDP-bound active and inactive conformational states. Understanding the complete reaction path of this conformational change and its intermediary structures is critical to understanding Ras signaling. We characterize nucleotide-dependent conformational transition using multiple-barrier-crossing accelerated molecular dynamics (aMD simulations. These transitions, achieved for the first time for wild-type Ras, are impossible to observe with classical molecular dynamics (cMD simulations due to the large energetic barrier between end states. Mapping the reaction path onto a conformer plot describing the distribution of the crystallographic structures enabled identification of highly populated intermediate structures. These structures have unique switch orientations (residues 25-40 and 57-75 intermediate between GTP and GDP states, or distinct loop3 (46-49, loop7 (105-110, and alpha5 C-terminus (159-166 conformations distal from the nucleotide-binding site. In addition, these barrier-crossing trajectories predict novel nucleotide-dependent correlated motions, including correlations of alpha2 (residues 66-74 with alpha3-loop7 (93-110, loop2 (26-37 with loop10 (145-151, and loop3 (46-49 with alpha5 (152-167. The interconversion between newly identified Ras conformations revealed by this study advances our mechanistic understanding of Ras function. In addition, the pattern of correlated motions provides new evidence for a dynamic linkage between the nucleotide-binding site and the membrane interacting C-terminus critical for the signaling function of Ras. Furthermore, normal mode analysis indicates that the dominant collective motion that occurs during nucleotide-dependent conformational exchange, and captured in aMD (but absent in cMD simulations, is a low-frequency motion intrinsic to the structure.

  2. DNA incorporation of 6-thioguanine nucleotides during maintenance therapy of childhood acute lymphoblastic leukaemia and non-Hodgkin lymphoma

    DEFF Research Database (Denmark)

    Hedeland, Rikke L; Hvidt, Kristian; Nersting, Jacob


    To explore the DNA incorporation of 6-thioguanine nucleotide levels (DNA-6TGN) during 6-mercaptopurine (6MP) therapy of childhood acute lymphoblastic leukaemia (ALL) and non-Hodgkin lymphoma (NHL) and its relation to erythrocyte levels of their metabolites: 6-thioguanine-nucleotides (E-6TGN...

  3. Simulation of the coupling between nucleotide binding and transmembrane domains in the ABC transporter BtuCD

    DEFF Research Database (Denmark)

    Sonne, Jacob; Kandt, C.; Peters, Günther H.j.


    The nucleotide-induced structural rearrangements in ATP binding cassette (ABC) transporters, leading to substrate translocation, are largely unknown. We have modeled nucleotide binding and release in the vitamin B12 importer BtuCD using perturbed elastic network calculations and biased molecular...

  4. Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms (United States)

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

  5. New carbocyclic N(6)-substituted adenine and pyrimidine nucleoside analogues with a bicyclo[2.2.1]heptane fragment as sugar moiety; synthesis, antiviral, anticancer activity and X-ray crystallography. (United States)

    Tănase, Constantin I; Drăghici, Constantin; Cojocaru, Ana; Galochkina, Anastasia V; Orshanskaya, Jana R; Zarubaev, Vladimir V; Shova, Sergiu; Enache, Cristian; Maganu, Maria


    New nucleoside analogues with an optically active bicyclo[2.2.1]heptane skeleton as sugar moiety and 6-substituted adenine were synthesized by alkylation of 6-chloropurine intermediate. Thymine and uracil analogs were synthesized by building the pyrimidine ring on amine 1. X-ray crystallography confirmed an exo-coupling of the thymine to the ring and an L configuration of the nucleoside analogue. The library of compounds was tested for their inhibitory activity against influenza virus A∖California/07/09 (H1N1)pdm09 and coxsackievirus B4 in cell culture. Compounds 13a and 13d are the most promising for their antiviral activity against influenza, and compound 3c against coxsackievirus B4. Compounds 3b and 3g were tested for anticancer activity. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Nucleotide variability and linkage disequilibrium patterns in the porcine MUC4 gene

    Directory of Open Access Journals (Sweden)

    Yang Ming


    Full Text Available Abstract Background MUC4 is a type of membrane anchored glycoprotein and serves as the major constituent of mucus that covers epithelial surfaces of many tissues such as trachea, colon and cervix. MUC4 plays important roles in the lubrication and protection of the surface epithelium, cell proliferation and differentiation, immune response, cell adhesion and cancer development. To gain insights into the evolution of the porcine MUC4 gene, we surveyed the nucleotide variability and linkage disequilibrium (LD within this gene in Chinese indigenous breeds and Western commercial breeds. Results A total of 53 SNPs covering the MUC4 gene were genotyped on 5 wild boars and 307 domestic pigs representing 11 Chinese breeds and 3 Western breeds. The nucleotide variability, haplotype phylogeny and LD extent of MUC4 were analyzed in these breeds. Both Chinese and Western breeds had considerable nucleotide diversity at the MUC4 locus. Western pig breeds like Duroc and Large White have comparable nucleotide diversity as many of Chinese breeds, thus artificial selection for lean pork production have not reduced the genetic variability of MUC4 in Western commercial breeds. Haplotype phylogeny analyses indicated that MUC4 had evolved divergently in Chinese and Western pigs. The dendrogram of genetic differentiation between breeds generally reflected demographic history and geographical distribution of these breeds. LD patterns were unexpectedly similar between Chinese and Western breeds, in which LD usually extended less than 20 kb. This is different from the presumed high LD extent (more than 100 kb in Western commercial breeds. The significant positive Tajima’D, and Fu and Li’s D statistics in a few Chinese and Western breeds implied that MUC4 might undergo balancing selection in domestic breeds. Nevertheless, we cautioned that the significant statistics could be upward biased by SNP ascertainment process. Conclusions Chinese and Western breeds have

  7. Synthesis and spectroscopy of clay intercalated Cu(II) bio-monomer complexes: coordination of Cu(II) with purines and nucleotides

    NARCIS (Netherlands)

    Weckhuysen, B.M.; Leeman, H.; Schoonheydt, R.A.


    The spectroscopic properties of Cu(bio-monomer)nm+ complexes [BM=bio-monomer (purine, adenine, guanine, hypoxanthine, 5-ADP and 5-GMP)] in saponite clays have been investigated by diffuse reflectance spectroscopy (DRS) in the UV-Vis-NIR region and electron paramagnetic resonance (EPR) at X-band.

  8. Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

    International Nuclear Information System (INIS)

    Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.


    The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

  9. Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G


    Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.

  10. Effects of preservation methods on amino acids and 5'-nucleotides of Agaricus bisporus mushrooms. (United States)

    Liu, Ying; Huang, Fan; Yang, Hong; Ibrahim, S A; Wang, Yan-Feng; Huang, Wen


    In this study, the proximate composition, free amino acids content and 5'-nucleotides in frozen, canned and salted Agaricus bisporus (A. bisporus) were investigated. We found that the three kinds of A. bisporus products were good sources of protein, with amount varying in the ranges of 16.54-24.35g/100g (dry weight). Freezing, canning and salting process, followed by 6months of storage led to a significant reduction in free amino acids, especially tyrosine, alanine, glutamine and cysteine. There were medium levels of MSG-like amino acids in frozen A. bisporus and canned A. bisporus, and low levels of MSG-like amino acids in salted A. bisporus. The mount of flavor 5'-nucleotides in frozen A. bisporus was higher than that of canned and salted A. bisporus. The present study thus suggests that freezing is beneficial for the preservation of A. bisporus. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Prioritizing single-nucleotide polymorphisms and variants associated with clinical mastitis

    Directory of Open Access Journals (Sweden)

    Suravajhala P


    Full Text Available Prashanth Suravajhala,1 Alfredo Benso2 1Department of Molecular Biology and Genetics, Center for Quantitative Genetics and Genomics, Aarhus University, Aarhus, Denmark; 2Department of Control and Computer Engineering, Politecnico di Torino, Torino, Italy Abstract: Next-generation sequencing technology has provided resources to easily explore and identify candidate single-nucleotide polymorphisms (SNPs and variants. However, there remains a challenge in identifying and inferring the causal SNPs from sequence data. A problem with different methods that predict the effect of mutations is that they produce false positives. In this hypothesis, we provide an overview of methods known for identifying causal variants and discuss the challenges, fallacies, and prospects in discerning candidate SNPs. We then propose a three-point classification strategy, which could be an additional annotation method in identifying causalities. Keywords: clinical mastitis, single-nucleotide polymorphisms, variants, associations, diseases, linkage disequilibrium, GWAS

  12. Effect of ionizing radiation on calcium and cyclic nucleotides metabolism in rats of different age

    International Nuclear Information System (INIS)

    Efimova, N.I.; Libenson, S.V.


    Some features of mechanism of calcium homeostasis and cyclic nucleotide exchange breakage in case of acute radiation injury of rats of various age were studied. It is established that calcium level in blood in nonpuberal animals, calcium and cAMP excretion with urine are minimal and reach maximum at puberal age. cGMP excretion with urine and concentrational levels of cAMP and cGMP in blood do not change with age. It is shown that calcium excretion with urine decreases adaptively in conditions of acute radiation injury in rats of all age groups. Maximal shifts in cAMP/cGMP ratio were noted in nonpuberal animals, whereas maximal adaptive-compensatory abilities in the regulation system of calcium homeostasis and cyclic nucleotides are typical to adolescent puberal animals

  13. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA. (United States)

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V


    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

  14. Role of Metal Oxides in Chemical Evolution: Interaction of Ribose Nucleotides with Alumina (United States)

    Arora, Avnish Kumar; Kamaluddin


    Interaction of ribonucleotides—namely, 5‧-AMP, 5‧-GMP, 5‧-CMP, and 5‧-UMP—with acidic, neutral, and basic alumina has been studied. Purine nucleotides showed higher adsorption on alumina in comparison with pyrimidine nucleotides under acidic conditions. Adsorption data obtained followed Langmuir adsorption isotherm, and Xm and KL values were calculated. On the basis of infrared spectral studies of ribonucleotides, alumina, and ribonucleotide-alumina adducts, we propose that the nitrogen base and phosphate moiety of the ribonucleotides interact with the positive charge surface of alumina. Results of the present study may indicate the importance of alumina in concentrating organic molecules from dilute aqueous solutions in primeval seas in the course of chemical evolution on Earth.

  15. An algorithm and program for finding sequence specific oligo-nucleotide probes for species identification

    Directory of Open Access Journals (Sweden)

    Tautz Diethard


    Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.

  16. A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms. (United States)

    Zeng, Lingwen; Xiao, Zhuo


    A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

  17. Lack of nucleotide variability in a beetle pest with extreme inbreeding


    Andreev, D.; Breilid, H.; Kirkendall, L.; Brun, Luc-Olivier; French-Constant, R.H.


    The coffee berry borer beetle #Hypothenemus hampei$ (Ferrari) (#Curculionidae$ : #Scolytinae$) is the major insect pest of coffee and has spread to most of the coffee-growing countries of the world. This beetle also displays an usual life cycle, with regular sibling mating. This regular inbreeding and the population bottlenecks occuring on colonization of new regions should lead to low levels of genetic diversity. We were therefore interested in determining the level of nucleotide variation i...

  18. Non-nucleotide Agonists Triggering P2X7 Receptor Activation and Pore Formation

    Directory of Open Access Journals (Sweden)

    Francesco Di Virgilio


    Full Text Available The P2X7 receptor (P2X7R is a ligand-gated plasma membrane ion channel belonging to the P2X receptor subfamily activated by extracellular nucleotides. General consensus holds that the physiological (and maybe the only agonist is ATP. However, scattered evidence generated over the last several years suggests that ATP might not be the only agonist, especially at inflammatory sites. Solid data show that NAD+ covalently modifies the P2X7R of mouse T lymphocytes, thus lowering the ATP threshold for activation. Other structurally unrelated agents have been reported to activate the P2X7R via a poorly understood mechanism of action: (a the antibiotic polymyxin B, possibly a positive allosteric P2X7R modulator, (b the bactericidal peptide LL-37, (c the amyloidogenic β peptide, and (d serum amyloid A. Some agents, such as Alu-RNA, have been suggested to activate the P2X7R acting on the intracellular N- or C-terminal domains. Mode of P2X7R activation by these non-nucleotide ligands is as yet unknown; however, these observations raise the intriguing question of how these different non-nucleotide ligands may co-operate with ATP at inflammatory or tumor sites. New information obtained from the cloning and characterization of the P2X7R from exotic mammalian species (e.g., giant panda and data from recent patch-clamp studies are strongly accelerating our understanding of P2X7R mode of operation, and may provide hints to the mechanism of activation of P2X7R by non-nucleotide ligands.

  19. Non-thiolate ligation of nickel by nucleotide-free UreG of Klebsiella aerogenes

    Energy Technology Data Exchange (ETDEWEB)

    Martin-Diaconescu, Vlad; Joseph, Crisjoe A.; Boer, Jodi L.; Mulrooney, Scott B.; Hausinger, Robert P.; Maroney, Michael J.


    Nickel-dependent ureases are activated by a multiprotein complex that includes the GTPase UreG. Prior studies showed that nucleotide-free UreG from Klebsiella aerogenes is monomeric and binds one nickel or zinc ion with near-equivalent affinity using an undefined binding site, whereas nucleotide-free UreG from Helicobacter pylori selectively binds one zinc ion per dimer via a universally conserved Cys-Pro-His motif in each protomer. Iodoacetamide-treated K. aerogenes UreG was nearly unaffected in nickel binding compared to non-treated sample, suggesting the absence of thiolate ligands to the metal. X-ray absorption spectroscopy of nickel-bound UreG showed the metal possessed four-coordinate geometry with all O/N donor ligands including one imidazole, thus confirming the absence of thiolate ligation. The nickel site in Strep-tag II-modified protein possessed six-coordinate geometry, again with all O/N donor ligands, but now including two or three imidazoles. An identical site was noted for the Strep-tag II-modified H74A variant, substituted in the Cys-Pro-His motif, ruling out coordination by this His residue. These results are consistent with metal binding to both His6 and a His residue of the fusion peptide in Strep-tagged K. aerogenes UreG. We conclude that the nickel- and zinc-binding site in nucleotide-free K. aerogenes UreG is distinct from that of nucleotide-free H. pylori UreG and does not involve the Cys-Pro-His motif. Further, we show the Strep-tag II can perturb metal coordination of this protein.

  20. Calcium-dependent, cyclic nucleotide-independent steroidogenesis in the bovine placenta.


    Shemesh, M; Hansel, W; Strauss, J F


    Dispersed bovine placental cells (fetal cotyledon and maternal caruncle) were shown to synthesize progesterone. To determine if their steroidogenic activity could be modulated by a cyclic nucleotide-mediated process, we added luteinizing hormone, 8-bromoadenosine 3',5'-monophosphate, 8-bromoguanosine 3',5'-monophosphate, adenosine, or cholera toxin to dispersed cells from placentomes of 100-283 days gestational age and examined progesterone synthesis during 3-to 16-hr incubation periods. Net ...