WorldWideScience

Sample records for adaptation growth arrest

  1. Mycobacterium tuberculosis transcriptional adaptation, growth arrest and dormancy phenotype development is triggered by vitamin C.

    Science.gov (United States)

    Taneja, Neetu Kumra; Dhingra, Sakshi; Mittal, Aditya; Naresh, Mohit; Tyagi, Jaya Sivaswami

    2010-05-27

    Tubercle bacilli are thought to persist in a dormant state during latent tuberculosis (TB) infection. Although little is known about the host factors that induce and maintain Mycobacterium tuberculosis (M. tb) within latent lesions, O(2) depletion, nutrient limitation and acidification are some of the stresses implicated in bacterial dormancy development/growth arrest. Adaptation to hypoxia and exposure to NO/CO is implemented through the DevRS/DosT two-component system which induces the dormancy regulon. Here we show that vitamin C (ascorbic acid/AA) can serve as an additional signal to induce the DevR regulon. Physiological levels of AA scavenge O(2) and rapidly induce the DevR regulon at an estimated O(2) saturation of vitamin C induces the expression of selected genes previously shown to be responsive to low pH and oxidative stress, triggers bacterial growth arrest and promotes dormancy phenotype development in M. tb grown in axenic culture and intracellularly in THP-1 cells. Vitamin C mimics multiple intracellular stresses and has wide-ranging regulatory effects on gene expression and physiology of M. tb which leads to growth arrest and a 'dormant' drug-tolerant phenotype, but in a manner independent of the DevRS/DosT system. The 'AA-dormancy infection model' offers a potential alternative to other models of non-replicating persistence of M. tb and may be useful for investigating host-'dormant' M. tb interactions. Our findings offer a new perspective on the role of nutritional factors in TB and suggest a possible role for vitamin C in TB.

  2. MRI in the assessment of growth arrest

    Energy Technology Data Exchange (ETDEWEB)

    Lohman, Martina; Kivisaari, Arto; Kivisaari, Leena [Helsinki Univ. Central Hospital (Finland). Dept. of Radiology; Vehmas, Tapio [Finnish Institute of Occupational Health, Helsinki (Finland); Kallio, Pentti; Puntila, Juha [Department of Paediatric Surgery, Hospital for Children and Adolescents, University Central Hospital, Helsinki (Finland)

    2002-01-01

    Objective: To compare MRI with X-ray tomography in the assessment of bone bridges across the growth plate. Materials and methods: The investigation consisted of two parts. (1) Eleven children with 13 epiphyses suspected of physeal growth arrests were examined with conventional X-ray tomography and MRI. The bar was post-traumatic in eight children, postinfectious in two and due to a congenital, operated pes equinovarus in one. Three blinded radiologists separately evaluated the examinations retrospectively. (2) The images of four children with known physeal bars in the ankle were mixed with 36 normal examinations obtained 1-year after trauma and evaluated blindly by three radiologists. Results: In 5 of 13 epiphysis, the bony bridge was considered smaller on MRI than on X-ray tomography, in 7 of 13 it was considered equal, while it was larger only in one. The interobserver agreement (weighted kappa) was 0.8 (very good) for MRI, 0.76 (good) for X-ray tomography and 0.60 (moderate) for radiographs. The four bony bridges were easily detected on MRI. Conclusions: Compared to MRI, the size of bridges was estimated larger by tomography in about half of the patients. (orig.)

  3. Metazoan operons accelerate recovery from growth arrested states

    Science.gov (United States)

    Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.

    2011-01-01

    Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799

  4. Growth arrest lines and intra-epiphyseal silhouettes: a case series.

    Science.gov (United States)

    Kennedy, John W; Irwin, Greg J; Huntley, James S

    2014-01-10

    Growth arrest lines can develop within the skeleton after physiological stress or trauma. They are usually evident on radiographs as transverse lines in the metaphyses and have been used in fields from palaeontology to orthopaedics. This report consists of three cases, two of which describe growth arrest lines in an intra-epiphyseal site hitherto rarely documented, and a third demonstrating their clinical application. Case 1 describes a 9-year-old who suffered a knee hyperflexion injury requiring anterior cruciate ligament and posterior cruciate ligament reattachments. She subsequently developed a marked distal femoral intra-epiphyseal arrest silhouette, as well as metaphyseal arrest lines in the femur, tibia and fibula. Case 2 describes an 8-year-old who sustained a tibial spine fracture and underwent open reduction and internal fixation. Subsequent imaging shows a further example of femoral intra-epiphyseal arrest silhouette as well as tibia and fibula metaphyseal arrest lines. Case 3 describes a 10-year-old who sustained a distal tibia fracture which was managed with open reduction and internal fixation. Subsequently the metaphyseal growth arrest line was parallel to the physis, suggesting no growth arrest (a danger with such a fracture). This case series describes two examples of rarely described intra-epiphyseal growth arrest silhouettes and demonstrates the usefulness of arrest lines when assessing for growth plate damage.

  5. Total triterpenoids from Ganoderma Lucidum suppresses prostate cancer cell growth by inducing growth arrest and apoptosis.

    Science.gov (United States)

    Wang, Tao; Xie, Zi-ping; Huang, Zhan-sen; Li, Hao; Wei, An-yang; Di, Jin-ming; Xiao, Heng-jun; Zhang, Zhi-gang; Cai, Liu-hong; Tao, Xin; Qi, Tao; Chen, Di-ling; Chen, Jun

    2015-10-01

    In this study, one immortalized human normal prostatic epithelial cell line (BPH) and four human prostate cancer cell lines (LNCaP, 22Rv1, PC-3, and DU-145) were treated with Ganoderma Lucidum triterpenoids (GLT) at different doses and for different time periods. Cell viability, apoptosis, and cell cycle were analyzed using flow cytometry and chemical assays. Gene expression and binding to DNA were assessed using real-time PCR and Western blotting. It was found that GLT dose-dependently inhibited prostate cancer cell growth through induction of apoptosis and cell cycle arrest at G1 phase. GLT-induced apoptosis was due to activation of Caspases-9 and -3 and turning on the downstream apoptotic events. GLT-induced cell cycle arrest (mainly G1 arrest) was due to up-regulation of p21 expression at the early time and down-regulation of cyclin-dependent kinase 4 (CDK4) and E2F1 expression at the late time. These findings demonstrate that GLT suppresses prostate cancer cell growth by inducing growth arrest and apoptosis, which might suggest that GLT or Ganoderma Lucidum could be used as a potential therapeutic drug for prostate cancer.

  6. Measles virus C protein suppresses gamma-activated factor formation and virus-induced cell growth arrest

    International Nuclear Information System (INIS)

    Yokota, Shin-ichi; Okabayashi, Tamaki; Fujii, Nobuhiro

    2011-01-01

    Measles virus (MeV) produces two accessory proteins, V and C, from the P gene. These accessory proteins have been reported to contribute to efficient virus proliferation through the modulation of host cell events. Our previous paper described that Vero cell-adapted strains of MeV led host cells to growth arrest through the upregulation of interferon regulatory factor 1 (IRF-1), and wild strains did not. In the present study, we found that C protein expression levels varied among MeV strains in infected SiHa cells. C protein levels were inversely correlated with IRF-1 expression levels and with cell growth arrest. Forced expression of C protein released cells from growth arrest. C-deficient recombinant virus efficiently upregulated IRF-1 and caused growth arrest more efficiently than the wild-type virus. C protein preferentially bound to phosphorylated STAT1 and suppressed STAT1 dimer formation. We conclude that MeV C protein suppresses IFN-γ signaling pathway via inhibition of phosphorylated STAT1 dimerization.

  7. Growth Arrest on Inhibition of Nonsense-Mediated Decay Is Mediated by Noncoding RNA GAS5

    Directory of Open Access Journals (Sweden)

    Mirna Mourtada-Maarabouni

    2013-01-01

    Full Text Available Nonsense-mediated decay is a key RNA surveillance mechanism responsible for the rapid degradation of mRNAs containing premature termination codons and hence prevents the synthesis of truncated proteins. More recently, it has been shown that nonsense-mediated decay also has broader significance in controlling the expression of a significant proportion of the transcriptome. The importance of this mechanism to the mammalian cell is demonstrated by the observation that its inhibition causes growth arrest. The noncoding RNA growth arrest specific transcript 5 (GAS5 has recently been shown to play a key role in growth arrest induced by several mechanisms, including serum withdrawal and treatment with the mTOR inhibitor rapamycin. Here we show that inhibition of nonsense-mediated decay in several human lymphocyte cell lines causes growth arrest, and siRNA-mediated downregulation of GAS5 in these cells significantly alleviates the inhibitory effects observed. These observations hold true for inhibition of nonsense-mediated decay both through RNA interference and through pharmacological inhibition by aminoglycoside antibiotics gentamycin and G418. These studies have important implications for ototoxicity and nephrotoxicity caused by gentamycin and for the proposed use of NMD inhibition in treating genetic disease. This report further demonstrates the critical role played by GAS5 in the growth arrest of mammalian cells.

  8. Gene expression signature in organized and growth arrested mammaryacini predicts good outcome in breast cancer

    Energy Technology Data Exchange (ETDEWEB)

    Fournier, Marcia V.; Martin, Katherine J.; Kenny, Paraic A.; Xhaja, Kris; Bosch, Irene; Yaswen, Paul; Bissell, Mina J.

    2006-02-08

    To understand how non-malignant human mammary epithelial cells (HMEC) transit from a disorganized proliferating to an organized growth arrested state, and to relate this process to the changes that occur in breast cancer, we studied gene expression changes in non-malignant HMEC grown in three-dimensional cultures, and in a previously published panel of microarray data for 295 breast cancer samples. We hypothesized that the gene expression pattern of organized and growth arrested mammary acini would share similarities with breast tumors with good prognoses. Using Affymetrix HG-U133A microarrays, we analyzed the expression of 22,283 gene transcripts in two HMEC cell lines, 184 (finite life span) and HMT3522 S1 (immortal non-malignant), on successive days post-seeding in a laminin-rich extracellular matrix assay. Both HMECs underwent growth arrest in G0/G1 and differentiated into polarized acini between days 5 and 7. We identified gene expression changes with the same temporal pattern in both lines. We show that genes that are significantly lower in the organized, growth arrested HMEC than in their proliferating counterparts can be used to classify breast cancer patients into poor and good prognosis groups with high accuracy. This study represents a novel unsupervised approach to identifying breast cancer markers that may be of use clinically.

  9. Identification of Fitness Determinants during Energy-Limited Growth Arrest in Pseudomonas aeruginosa.

    Science.gov (United States)

    Basta, David W; Bergkessel, Megan; Newman, Dianne K

    2017-11-28

    Microbial growth arrest can be triggered by diverse factors, one of which is energy limitation due to scarcity of electron donors or acceptors. Genes that govern fitness during energy-limited growth arrest and the extent to which they overlap between different types of energy limitation are poorly defined. In this study, we exploited the fact that Pseudomonas aeruginosa can remain viable over several weeks when limited for organic carbon (pyruvate) as an electron donor or oxygen as an electron acceptor. ATP values were reduced under both types of limitation, yet more severely in the absence of oxygen. Using transposon-insertion sequencing (Tn-seq), we identified fitness determinants in these two energy-limited states. Multiple genes encoding general functions like transcriptional regulation and energy generation were required for fitness during carbon or oxygen limitation, yet many specific genes, and thus specific activities, differed in their relevance between these states. For instance, the global regulator RpoS was required during both types of energy limitation, while other global regulators such as DksA and LasR were required only during carbon or oxygen limitation, respectively. Similarly, certain ribosomal and tRNA modifications were specifically required during oxygen limitation. We validated fitness defects during energy limitation using independently generated mutants of genes detected in our screen. Mutants in distinct functional categories exhibited different fitness dynamics: regulatory genes generally manifested a phenotype early, whereas genes involved in cell wall metabolism were required later. Together, these results provide a new window into how P. aeruginosa survives growth arrest. IMPORTANCE Growth-arrested bacteria are ubiquitous in nature and disease yet understudied at the molecular level. For example, growth-arrested cells constitute a major subpopulation of mature biofilms, serving as an antibiotic-tolerant reservoir in chronic

  10. Prolyl oligopeptidase inhibition-induced growth arrest of human gastric cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Suzuki, Kanayo [Laboratory of Cell Biology, Osaka University of Pharmaceutical Sciences, 4-20-1 Nasahara, Takatsuki, Osaka 569-1094 (Japan); Sakaguchi, Minoru, E-mail: sakaguti@gly.oups.ac.jp [Laboratory of Cell Biology, Osaka University of Pharmaceutical Sciences, 4-20-1 Nasahara, Takatsuki, Osaka 569-1094 (Japan); Tanaka, Satoshi [Laboratory of Cell Biology, Osaka University of Pharmaceutical Sciences, 4-20-1 Nasahara, Takatsuki, Osaka 569-1094 (Japan); Yoshimoto, Tadashi [Department of Life Science, Setsunan University, 17-8 Ikeda-Nakamachi, Neyagawa, Osaka 572-8508 (Japan); Takaoka, Masanori [Laboratory of Cell Biology, Osaka University of Pharmaceutical Sciences, 4-20-1 Nasahara, Takatsuki, Osaka 569-1094 (Japan)

    2014-01-03

    Highlights: •We examined the effects of prolyl oligopeptidase (POP) inhibition on p53 null gastric cancer cell growth. •POP inhibition-induced cell growth suppression was associated with an increase in a quiescent G{sub 0} state. •POP might regulate the exit from and/or reentry into the cell cycle. -- Abstract: Prolyl oligopeptidase (POP) is a serine endopeptidase that hydrolyzes post-proline peptide bonds in peptides that are <30 amino acids in length. We recently reported that POP inhibition suppressed the growth of human neuroblastoma cells. The growth suppression was associated with pronounced G{sub 0}/G{sub 1} cell cycle arrest and increased levels of the CDK inhibitor p27{sup kip1} and the tumor suppressor p53. In this study, we investigated the mechanism of POP inhibition-induced cell growth arrest using a human gastric cancer cell line, KATO III cells, which had a p53 gene deletion. POP specific inhibitors, 3-((4-[2-(E)-styrylphenoxy]butanoyl)-L-4-hydroxyprolyl)-thiazolidine (SUAM-14746) and benzyloxycarbonyl-thioprolyl-thioprolinal, or RNAi-mediated POP knockdown inhibited the growth of KATO III cells irrespective of their p53 status. SUAM-14746-induced growth inhibition was associated with G{sub 0}/G{sub 1} cell cycle phase arrest and increased levels of p27{sup kip1} in the nuclei and the pRb2/p130 protein expression. Moreover, SUAM-14746-mediated cell cycle arrest of KATO III cells was associated with an increase in the quiescent G{sub 0} state, defined by low level staining for the proliferation marker, Ki-67. These results indicate that POP may be a positive regulator of cell cycle progression by regulating the exit from and/or reentry into the cell cycle by KATO III cells.

  11. Physeal growth arrest after tibial lengthening in achondroplasia

    Science.gov (United States)

    2012-01-01

    Background and purpose Bilateral tibial lengthening has become one of the standard treatments for upper segment-lower segment disproportion and to improve quality of life in achondroplasia. We determined the effect of tibial lengthening on the tibial physis and compared tibial growth that occurred at the physis with that in non-operated patients with acondroplasia. Methods We performed a retrospective analysis of serial radiographs until skeletal maturity in 23 achondroplasia patients who underwent bilateral tibial lengthening before skeletal maturity (lengthening group L) and 12 achondroplasia patients of similar height and age who did not undergo tibial lengthening (control group C). The mean amount of lengthening of tibia in group L was 9.2 cm (lengthening percentage: 60%) and the mean age at the time of lengthening was 8.2 years. The mean duration of follow-up was 9.8 years. Results Skeletal maturity (fusion of physis) occurred at 15.2 years in group L and at 16.0 years in group C. The actual length of tibia (without distraction) at skeletal maturity was 238 mm in group L and 277 mm in group C (p = 0.03). The mean growth rates showed a decrease in group L relative to group C from about 2 years after surgery. Physeal closure was most pronounced on the anterolateral proximal tibial physis, with relative preservation of the distal physis. Interpretation Our findings indicate that physeal growth rate can be disturbed after tibial lengthening in achondroplasia, and a close watch should be kept for such an occurrence—especially when lengthening of more than 50% is attempted. PMID:22489887

  12. Reversal of growth arrest in adolescents with Crohn's disease after parenteral alimentation.

    Science.gov (United States)

    Layden, T; Rosenberg, F; Nemchausky, G; Elson, C; Rosenberg, I

    1976-06-01

    Growth arrest and delayed onset of puberty often complicate childhood onset Crohn's disease of the small bowel (granulomatous enteritis). Nutritional deficits arising from inadequate dietary intake, malabsorption, and increased caloric needs may contribute to growth retardation. To assess whether a sustained high caloric and nitrogen intake could reestablish growth, 4 children with extensive Crohn's disease of the small bowel were studied before and after parenteral alimentation which was instituted for symtomatic disease control. Weight gain, positive nitrogen balance, and improved nutritional status were achieved during parenteral alimentation in each patient. In 2 patients weight gain was sustained using oral nutritional supplements, and a substantial increase in linear skeletal growth continued in the ensuing months. One patient entered puberty within 4 months of parenteral alimentation and another had the onset of menarche and the development of secondary sex characteristics 4 months after parenteral alimentation and resection of diseased bowel. Growth may be reestablished in some growth-arrested children if intake is sufficient to establish a sustained positive caloric and nitrogen balance. Nutritional requirements imposed by the demands of growth and active disease and often compounded by the catabolic effects of corticosteroids may be excessive; growth may occur only if these needs are met orally and/or parenterally.

  13. Growth-arrest-specific protein 2 inhibits cell division in Xenopus embryos.

    Directory of Open Access Journals (Sweden)

    Tong Zhang

    Full Text Available Growth-arrest-specific 2 gene was originally identified in murine fibroblasts under growth arrest conditions. Furthermore, serum stimulation of quiescent, non-dividing cells leads to the down-regulation of gas2 and results in re-entry into the cell cycle. Cytoskeleton rearrangements are critical for cell cycle progression and cell division and the Gas2 protein has been shown to co-localize with actin and microtubules in interphase mammalian cells. Despite these findings, direct evidence supporting a role for Gas2 in the mechanism of cell division has not been reported.To determine whether the Gas2 protein plays a role in cell division, we over-expressed the full-length Gas2 protein and Gas2 truncations containing either the actin-binding CH domain or the tubulin-binding Gas2 domain in Xenopus laevis embryos. We found that both the full-length Gas2 protein and the Gas2 domain, but not the CH domain, inhibited cell division and resulted in multinucleated cells. The observation that Gas2 domain alone can arrest cell division suggests that Gas2 function is mediated by microtubule binding. Gas2 co-localized with microtubules at the cell cortex of Gas2-injected Xenopus embryos using cryo-confocal microscopy and co-sedimented with microtubules in cytoskeleton co-sedimentation assays. To investigate the mechanism of Gas2-induced cell division arrest, we showed, using a wound-induced contractile array assay, that Gas2 stabilized microtubules. Finally, electron microscopy studies demonstrated that Gas2 bundled microtubules into higher-order structures.Our experiments show that Gas2 inhibits cell division in Xenopus embryos. We propose that Gas2 function is mediated by binding and bundling microtubules, leading to cell division arrest.

  14. Tempol inhibits growth of As4.1 juxtaglomerular cells via cell cycle arrest and apoptosis.

    Science.gov (United States)

    Han, Yong Hwan; Park, Woo Hyun

    2012-03-01

    A stable nitroxide 4-hydroxy-2,2,6,6-tetramethylpiperidine-N-osyl (Tempol) is widely used as an antioxidant in vitro and in vivo. In this study, we investigated the effects of Tempol on the growth of As4.1 juxtaglomerular cells in relation to cell cycle and cell death. Tempol dose-dependently decreased the growth of As4.1 cells with an IC50 of ~1 mM at 48 h. DNA flow cytometry analysis and BrdU staining indicated that Tempol induced S phase arrest, which is accompanied by a downregulation of cyclin A. Tempol also induced apoptotic cell death, which was accompanied by the loss of mitochondrial membrane potential (MMP; ∆Ψm), an activation of caspase-3 and cleavage of poly(ADP-ribose)polymerase-1 (PARP-1). Furthermore, Tempol increased reactive oxygen species (ROS) levels, and the phosphorylation of extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK). MEK and JNK inhibitors significantly attenuated a growth inhibition in Tempol-treated As4.1 cells. In conclusion, Tempol inhibited the growth of As4.1 cells via cell cycle arrest and apoptosis. Tempol also activated ERK and JNK signaling, which was responsible for cell growth inhibition. Our present data provide useful information for the toxicological effects of Tempol in juxtaglomerular cells in relation to cell growth inhibition and cell death.

  15. Zebularine inhibits the growth of A549 lung cancer cells via cell cycle arrest and apoptosis.

    Science.gov (United States)

    You, Bo Ra; Park, Woo Hyun

    2014-11-01

    Zebularine (Zeb) is a DNA methyltransferase (DNMT) inhibitor to that has an anti-tumor effect. Here, we evaluated the anti-growth effect of Zeb on A549 lung cancer cells in relation to reactive oxygen species (ROS) levels. Zeb inhibited the growth of A549 cells with an IC50 of approximately 70 µM at 72 h. Cell cycle analysis indicated that Zeb induced an S phase arrest in A549 cells. Zeb also induced A549 cell death, which was accompanied by the loss of mitochondrial membrane potential (MMP; ΔΨm ), Bcl-2 decrease, Bax increase, p53 increase and activation of caspase-3 and -8. In contrast, Zeb mildly inhibited the growth of human pulmonary fibroblast (HPF) normal cells and lead to a G1 phase arrest. Zeb did not induce apoptosis in HPF cells. In relation to ROS level, Zeb increased ROS level in A549 cells and induced glutathione (GSH) depletion. The well-known antioxidant, N-acetyl cysteine (NAC) prevented the death of Zeb-treated A549 cells. Moreover, Zeb increased the level of thioredoxin reductase 1 (TrxR1) in A549 cells. While the overexpression of TrxR1 attenuated death and ROS level in Zeb-treated A549 cells, the downregulation of TrxR1 intensified death and ROS level in these cells. In conclusion, Zeb inhibited the growth of A549 lung cancer cells via cell cycle arrest and apoptosis. The inhibition was influenced by ROS and TrxR1 levels. © 2013 Wiley Periodicals, Inc.

  16. Modulation of medium pH by Caulobacter crescentus facilitates recovery from uranium-induced growth arrest.

    Science.gov (United States)

    Park, Dan M; Jiao, Yongqin

    2014-09-01

    The oxidized form of uranium [U(VI)] predominates in oxic environments and poses a major threat to ecosystems. Due to its ability to mineralize U(VI), the oligotroph Caulobacter crescentus is an attractive candidate for U(VI) bioremediation. However, the physiological basis for U(VI) tolerance is unclear. Here we demonstrated that U(VI) caused a temporary growth arrest in C. crescentus and three other bacterial species, although the duration of growth arrest was significantly shorter for C. crescentus. During the majority of the growth arrest period, cell morphology was unaltered and DNA replication initiation was inhibited. However, during the transition from growth arrest to exponential phase, cells with shorter stalks were observed, suggesting a decoupling between stalk development and the cell cycle. Upon recovery from growth arrest, C. crescentus proliferated with a growth rate comparable to that of a control without U(VI), although a fraction of these cells appeared filamentous with multiple replication start sites. Normal cell morphology was restored by the end of exponential phase. Cells did not accumulate U(VI) resistance mutations during the prolonged growth arrest, but rather, a reduction in U(VI) toxicity occurred concomitantly with an increase in medium pH. Together, these data suggest that C. crescentus recovers from U(VI)-induced growth arrest by reducing U(VI) toxicity through pH modulation. Our finding represents a unique U(VI) detoxification strategy and provides insight into how microbes cope with U(VI) under nongrowing conditions, a metabolic state that is prevalent in natural environments. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  17. Placental Adaptations in Growth Restriction

    Directory of Open Access Journals (Sweden)

    Song Zhang

    2015-01-01

    Full Text Available The placenta is the primary interface between the fetus and mother and plays an important role in maintaining fetal development and growth by facilitating the transfer of substrates and participating in modulating the maternal immune response to prevent immunological rejection of the conceptus. The major substrates required for fetal growth include oxygen, glucose, amino acids and fatty acids, and their transport processes depend on morphological characteristics of the placenta, such as placental size, morphology, blood flow and vascularity. Other factors including insulin-like growth factors, apoptosis, autophagy and glucocorticoid exposure also affect placental growth and substrate transport capacity. Intrauterine growth restriction (IUGR is often a consequence of insufficiency, and is associated with a high incidence of perinatal morbidity and mortality, as well as increased risk of cardiovascular and metabolic diseases in later life. Several different experimental methods have been used to induce placental insufficiency and IUGR in animal models and a range of factors that regulate placental growth and substrate transport capacity have been demonstrated. While no model system completely recapitulates human IUGR, these animal models allow us to carefully dissect cellular and molecular mechanisms to improve our understanding and facilitate development of therapeutic interventions.

  18. Adapting RRT growth for heterogeneous environments

    KAUST Repository

    Denny, Jory

    2013-11-01

    Rapidly-exploring Random Trees (RRTs) are effective for a wide range of applications ranging from kinodynamic planning to motion planning under uncertainty. However, RRTs are not as efficient when exploring heterogeneous environments and do not adapt to the space. For example, in difficult areas an expensive RRT growth method might be appropriate, while in open areas inexpensive growth methods should be chosen. In this paper, we present a novel algorithm, Adaptive RRT, that adapts RRT growth to the current exploration area using a two level growth selection mechanism. At the first level, we select groups of expansion methods according to the visibility of the node being expanded. Second, we use a cost-sensitive learning approach to select a sampler from the group of expansion methods chosen. Also, we propose a novel definition of visibility for RRT nodes which can be computed in an online manner and used by Adaptive RRT to select an appropriate expansion method. We present the algorithm and experimental analysis on a broad range of problems showing not only its adaptability, but efficiency gains achieved by adapting exploration methods appropriately. © 2013 IEEE.

  19. The Role of Telomere Maintenance in the Spontaneous Growth Arrest of Pediatric Low-Grade Gliomas

    Directory of Open Access Journals (Sweden)

    Uri Tabori

    2006-02-01

    Full Text Available Spontaneous tumor regression is a unique feature of pediatric low-grade gliomas (PLGG. We speculated that lack of telomere maintenance is responsible for this behavior. We first looked for evidence of telomerase activity and alternative-lengthening telomeres (ALT in 56 PLGG. Telomerase activity was observed in 0 of 11 PLGG in contrast to 10 of 13 high-grade pediatric brain tumors. There was no ALT in 45 of 45 samples. We applied Q-FISH to eight patients whose indolent PLGG underwent two metachronous biopsies over a lag of several years. Telomere shortening was observed in the second biopsy in all tumors but not in a normal brain control (P 8.0 conferred a high likelihood of late recurrences in PLGG. Our findings provide a plausible biological mechanism to explain the tendency of PLGG to exhibit growth arrest and spontaneous regression. Telomere maintenance may therefore represent the first known biologic prognostic marker in PLGG.

  20. Investigation Analysis of Crack Growth Arresting with Fasteners in Hybrid Laminated Skin-Stiffener Joint

    Science.gov (United States)

    Jeevan Kumar, N.; Ramesh Babu, P.

    2018-02-01

    In recent years carbon fibre-reinforced polymers (CFRP) emerged its increasing demand in aerospace engineering. Due to their high specific strength to weight ratio, these composites offer more characteristics and considerable advantages compared to metals. Metals, unlike composites, offer plasticity effects to evade high stress concentrations during postbuckling. Under compressive load, composite structures show a wide range of damage mechanisms where a set of damage modes combined together might lead to the eventual structural collapse. Crack is one of the most critical damages in fiber composites, which are being employed in primary aircraft structures. A parametric study is conducted to investigate the arrest mechanism of the delamination or crack growth with installation of multiple fasteners when the delamination is embedded in between the skin and stiffener interface.

  1. The transcriptional network that controls growth arrest and differentiation in a human myeloid leukemia cell line

    DEFF Research Database (Denmark)

    Suzuki, Harukazu; Forrest, Alistair R R; van Nimwegen, Erik

    2009-01-01

    , we identified the key transcription regulators, their time-dependent activities and target genes. Systematic siRNA knockdown of 52 transcription factors confirmed the roles of individual factors in the regulatory network. Our results indicate that cellular states are constrained by complex networks......Using deep sequencing (deepCAGE), the FANTOM4 study measured the genome-wide dynamics of transcription-start-site usage in the human monocytic cell line THP-1 throughout a time course of growth arrest and differentiation. Modeling the expression dynamics in terms of predicted cis-regulatory sites...... involving both positive and negative regulatory interactions among substantial numbers of transcription factors and that no single transcription factor is both necessary and sufficient to drive the differentiation process....

  2. Analysis of Mode I and Mode II Crack Growth Arrest Mechanism with Z-Fibre Pins in Composite Laminated Joint

    Science.gov (United States)

    Jeevan Kumar, N.; Ramesh Babu, P.

    2018-04-01

    This paper presents the numerical study of the mode I and mode II interlaminar crack growth arrest in hybrid laminated curved composite stiffened joint with Z-fibre reinforcement. A FE model of hybrid laminated skin-stiffener joint reinforced with Z-pins is developed to investigate the effect of Z- fibre pins on mode I and mode II crack growth where the delamination is embedded inbetween the skin and stiffener interface. A finite element model was developed using S4R element of a 4-node doubly curved thick shell elements to model the composite laminates and non linear interface elements to simulate the reinforcements. The numerical analyses revealed that Z-fibre pinning were effective in suppressing the delamination growth when propagated due to applied loads. Therefore, the Z-fibre technique effectively improves the crack growth resistance and hence arrests or delays crack growth extension.

  3. Three-dimensional MR imaging in the assessment of physeal growth arrest

    International Nuclear Information System (INIS)

    Sailhan, Frederic; Chotel, Franck; Gollogly, Sohrab; Adam, Philippe; Berard, Jerome; Guibal, Anne-Laure; Guibaud, Laurent

    2004-01-01

    The purpose of this study is to describe an imaging method for identifying and characterising physeal growth arrest following physeal plate aggression. The authors describe the use of three-dimensional MRI performed with fat-suppressed three-dimensional spoiled gradient-recalled echo sequences followed by manual image reconstruction to create a 3D model of the physeal plate. This retrospective series reports the analysis of 33 bony physeal bridges in 28 children (mean age 10.5 years) with the use of fat-suppressed three-dimensional spoiled gradient-recalled echo imaging and 3D reconstructions from the source images. 3D reconstructions were obtained after the outlining was done manually on each source image. Files of all patients were reviewed for clinical data at the time of MRI, type of injury, age at MRI and bone bridge characteristics on reconstructions. Twenty-one (63%) of the 33 bridges were post-traumatic and were mostly situated in the lower extremities (19/21). The distal tibia was involved in 66% (14/21) of the cases. Bridges due to causes other than trauma were located in the lower extremities in 10/12 cases, and the distal femur represented 60% of these cases. Of the 28 patients, five presented with two bridges involving two different growth plates making a total of 33 physeal bone bars. The location and shape of each bridge was accurately identified in each patient, and in post-traumatic cases, 89% of bone bars were of Ogden type III (central) or I (peripheral). Reconstructions were obtained in 15 min and are easy to interpret. Volumes of the physeal bone bridge(s) and of the remaining normal physis were calculated. The bone bridging represented less than 1% to 47% of the total physeal plate volume. The precise shape and location of the bridge can be visualised on the 3D reconstructions. This information is useful in the surgical management of these deformities; as for the eight patients who underwent bone bar resection, an excellent correspondence was

  4. A network of transcriptional and signaling events is activated by FGF to induce chondrocyte growth arrest and differentiation

    OpenAIRE

    Dailey, Lisa; Laplantine, Emmanuel; Priore, Riccardo; Basilico, Claudio

    2003-01-01

    Activating mutations in FGF receptor 3 (FGFR3) cause several human dwarfism syndromes by affecting both chondrocyte proliferation and differentiation. Using microarray and biochemical analyses of FGF-treated rat chondrosarcoma chondrocytes, we show that FGF inhibits chondrocyte proliferation by initiating multiple pathways that result in the induction of antiproliferative functions and the down-regulation of growth-promoting molecules. The initiation of growth arrest is characterized by the r...

  5. A network of transcriptional and signaling events is activated by FGF to induce chondrocyte growth arrest and differentiation.

    Science.gov (United States)

    Dailey, Lisa; Laplantine, Emmanuel; Priore, Riccardo; Basilico, Claudio

    2003-06-23

    Activating mutations in FGF receptor 3 (FGFR3) cause several human dwarfism syndromes by affecting both chondrocyte proliferation and differentiation. Using microarray and biochemical analyses of FGF-treated rat chondrosarcoma chondrocytes, we show that FGF inhibits chondrocyte proliferation by initiating multiple pathways that result in the induction of antiproliferative functions and the down-regulation of growth-promoting molecules. The initiation of growth arrest is characterized by the rapid dephosphorylation of the retinoblastoma protein (pRb) p107 and repression of a subset of E2F target genes by a mechanism that is independent of cyclin E-Cdk inhibition. In contrast, hypophosphorylation of pRb and p130 occur after growth arrest is first detected, and may contribute to its maintenance. Importantly, we also find a number of gene expression changes indicating that FGF promotes many aspects of hypertrophic differentiation, a notion supported by in situ analysis of developing growth plates from mice expressing an activated form of FGFR3. Thus, FGF may coordinate the onset of differentiation with chondrocyte growth arrest in the developing growth plate.

  6. Fibroblasts from long-lived Snell dwarf mice are resistant to oxygen-induced in vitro growth arrest

    DEFF Research Database (Denmark)

    Maynard, Scott P; Miller, Richard A

    2006-01-01

    Snell dwarf mice live longer than controls, and show lower age-adjusted rates of lethal neoplastic diseases. Fibroblast cells from adult dwarf mice are resistant to the lethal effects of oxidative and nonoxidative stresses, including the carcinogen methyl methanesulfonate. We now report that dwarf......-derived fibroblasts are slow to enter the stage of growth arrest induced by culturing normal cells under standard culture conditions at 20% O(2). Dwarf cells cultured at 20% O(2) resemble control cells cultured at 3% O(2) not only in their delayed growth arrest, but also in their rapid growth rates and resistance...... to both oxidative and nonoxidative forms of cytotoxic stress. Levels of the heat-shock protein HSP-70 respond to serum withdrawal and stress only in control cells, showing that intracellular signals are blunted in dwarf-derived cells. These data suggest a model in which stable epigenetic changes induced...

  7. Transcriptional stimulation of the retina-specific QR1 gene upon growth arrest involves a Maf-related protein.

    Science.gov (United States)

    Pouponnot, C; Nishizawa, M; Calothy, G; Pierani, A

    1995-10-01

    The avian neural retina (NR) is derived from proliferating neuroectodermal precursors which differentiate after terminal mitosis and become organized in cell strata. Proliferation of postmitotic NR cells can be induced by infection with Rous sarcoma virus (RSV) and requires the expression of a functional v-Src protein. QR1 is a retina-specific gene expressed exclusively at the stage of growth arrest and differentiation during retinal development. In NR cells infected with tsPA101, an RSV mutant conditionally defective in pp60v-src mitogenic capacity, QR1 expression is downregulated in proliferating cells at 37 degrees C and is fully restored when the cells become quiescent as a result of pp60v-src inactivation at 41 degrees C. We were able to arrest proliferation of tsPA101-infected quail NR cells expressing an active v-Src protein by serum starvation at 37 degrees C. This allowed us to investigate the role of cell growth in regulating QR1 transcription. We report that QR1 transcription is stimulated in growth-arrested cells at 37 degrees C compared with that in proliferating cells maintained at the same temperature. Growth arrest-dependent stimulation of QR1 transcription requires the integrity of the A box, a previously characterized cis-acting element responsible for QR1 transcriptional stimulation upon v-Src inactivation and during retinal differentiation. We also show that formation of the C1 complex on the A box is increased upon growth arrest by serum starvation in the presence of an active v-Src oncoprotein. Thus, the C1 complex represents an important link between cell cycle and developmental control of QR1 gene transcription during NR differentiation and RSV infection. By using antibodies directed against different Maf proteins of the leucine zipper family and competition with Maf consensus site-containing oligonucleotides in a gel shift assay, we show that the C1 complex is likely to contain a Maf-related protein. We also show that a purified bacterially

  8. Antimicrobial Cream Formulated with Supercritical Carbon Dioxide Extract of Tuberose Flowers Arrests Growth of Staphylococcus aureus.

    Science.gov (United States)

    Ghosh, Probir Kumar; Bhattacharjee, Paramita; Das, Satadal

    2016-01-01

    Antimicrobial potency of herbal extracts is well known. The review of patents and research articles revealed that several herbal extracts have been employed in the formulation of topical products such as creams, exclusive of the cream reported in the present study. 0ur previous study has established antimicrobial potency of supercritical carbon dioxide extracts of tuberose flowers, better known for its sweet fragrance. The present work focuses on formulating a topical antimicrobial herbal cream with methyl eugenol (principal antimicrobial compound) rich - supercritical carbon dioxide extract of tuberose flowers, having good combination of phytochemical and antimicrobial potencies. Supercritical carbon dioxide parameters such as temperature, pressure and time were optimized using full factorial experimental design to obtain methyl eugenol-rich extracts. A cream was formulated using the extract having the best combination of phytochemical and antimicrobial potencies and was assayed further for in vitro antimicrobial potency; physiochemical and sensory properties. Two commercial antimicrobial cream samples were used as reference samples in the study. The extract obtained at 40°C, 10 MPa, 135 min at 1 L min-1 flow rate of gaseous C02 showed the best combination of phytochemical and antimicrobial potencies and was used for formulation of herbal creams. The cream formulated with 5% w/w of extract arrested growth of the common human skin pathogen Staphylococcus aureus and showed stable physiochemical properties and high sensory appeal for a year. The cream could be considered as a 'finished herbal product&' in compliance with the World Health 0rganization guidelines.

  9. The hydroxy-naphthoquinone lapachol arrests mycobacterial growth and immunomodulates host macrophages.

    Science.gov (United States)

    Oliveira, Renato A S; Azevedo-Ximenes, Eulalia; Luzzati, Roberto; Garcia, Rodolfo C

    2010-11-01

    The present study reports the anti-mycobacterial activity of 2-hydroxy-3-(3-methyl-2-butenyl)-1,4-naphthoquinone (lapachol) as well as its influence on macrophage functions. Lapachol (L) did not induce apoptosis/necrosis of THP-1 macrophages at ≤32 μg/mL. Mycobacterium avium liquid growth was arrested by ≥32 μg/mL and intra-macrophage proliferation by ≥16 μg/mL lapachol. The main immuno-modulatory effects of lapachol observed were an up-regulation of interferon-γ-receptor 1 (IFN-γR1) and major histocompatibility complex class II (MHCII) surface expression, and a marked inhibition of IL-10 secretion. Lapachol did not affect resting, IFN-γ- or toll-like receptor 2 (TLR2)-induced levels of oxygen and nitrogen metabolism key proteins nor the TLR2-mediated secretion of TNF-α, nor induced either oxidative or endoplasmic reticulum (ER) stress. Lapachol inhibited the surface expression of the co-stimulatory molecule CD86 but not that of CD80 and CD83. The results obtained indicate that the substituted naphthoquinone lapachol exhibits an anti-mycobacterial activity that is more efficient intra- than extra-cellularly, and exerts immuno-modulatory effects some of which may enhance the capacity of the host cell to control mycobacterial growth. The immune-modulatory action of lapachol could contribute to its more efficient intra-macrophage anti-mycobacterial activity. Copyright © 2010 Elsevier B.V. All rights reserved.

  10. A novel peptide sansalvamide analogue inhibits pancreatic cancer cell growth through G0/G1 cell-cycle arrest

    International Nuclear Information System (INIS)

    Ujiki, Michael B.; Milam, Ben; Ding Xianzhong; Roginsky, Alexandra B.; Salabat, M. Reza; Talamonti, Mark S.; Bell, Richard H.; Gu Wenxin; Silverman, Richard B.; Adrian, Thomas E.

    2006-01-01

    Patients with pancreatic cancer have little hope for cure because no effective therapies are available. Sansalvamide A is a cyclic depsipeptide produced by a marine fungus. We investigated the effect of a novel sansalvamide A analogue on growth, cell-cycle phases, and induction of apoptosis in human pancreatic cancer cells in vitro. The sansalvamide analogue caused marked time- and concentration-dependent inhibition of DNA synthesis and cell proliferation of two human pancreatic cancer cell lines (AsPC-1 and S2-013). The analogue induced G0/G1 phase cell-cycle arrest and morphological changes suggesting induction of apoptosis. Apoptosis was confirmed by annexin V binding. This novel sansalvamide analogue inhibits growth of pancreatic cancer cells through G0/G1 arrest and induces apoptosis. Sansalvamide analogues may be valuable for the treatment of pancreatic cancer

  11. Transcriptional stimulation of the retina-specific QR1 gene upon growth arrest involves a Maf-related protein.

    OpenAIRE

    Pouponnot, C; Nishizawa, M; Calothy, G; Pierani, A

    1995-01-01

    The avian neural retina (NR) is derived from proliferating neuroectodermal precursors which differentiate after terminal mitosis and become organized in cell strata. Proliferation of postmitotic NR cells can be induced by infection with Rous sarcoma virus (RSV) and requires the expression of a functional v-Src protein. QR1 is a retina-specific gene expressed exclusively at the stage of growth arrest and differentiation during retinal development. In NR cells infected with tsPA101, an RSV muta...

  12. Growth inhibition and cell cycle arrest effects of epigallocatechin gallate in the NBT-II bladder tumour cell line.

    Science.gov (United States)

    Chen, J J; Ye, Z-Q; Koo, M W L

    2004-05-01

    To examine the growth inhibition and cell cycle arrest effects of epigallocatechin gallate (EGCG), a major constituent of green tea polyphenols, on the NBT-II bladder tumour cell line. Growth inhibition and cell cycle arrest effects of EGCG were evaluated by the tetrazolium assay, flow cytometry and apoptotic DNA ladder tests. The cell cycle-related oncogene and protein expressions in NBT-II bladder tumour cells, when incubated with EGCG, were detected with reverse transcription-polymerase chain reaction (RT-PCR) and Western blot analysis. EGCG inhibited growth of the NBT-II bladder tumour cells in a dose- and time-dependent manner. Flow cytometry showed a G0/G1 arrest in cells when cultured with EGCG at doses of 10, 20 or 40 micro mol/L for 48 or 72 h. The apoptotic DNA ladder test showed that EGCG at 10 micro mol/L induced early apoptosis after 48 h of incubation. A down-regulation of cyclin D1 was detected by RT-PCR when the cells were incubated with EGCG (20 micro mol/L for 48 h. EGCG also down-regulated protein expression of cyclin D1, cyclin-dependent kinase 4/6 and phosphorylated retinoblastoma protein, in both a time- and dose-dependent manner, when detected by Western blot. EGCG had growth inhibition and cell-cycle arrest effects in NBT-II bladder tumour cells by down-regulating the cyclin D1, cyclin-dependent kinase 4/6 and retinoblastoma protein machinery for regulating cell-cycle progression.

  13. Mutation of Growth Arrest Specific 8 Reveals a Role in Motile Cilia Function and Human Disease.

    Science.gov (United States)

    Lewis, Wesley R; Malarkey, Erik B; Tritschler, Douglas; Bower, Raqual; Pasek, Raymond C; Porath, Jonathan D; Birket, Susan E; Saunier, Sophie; Antignac, Corinne; Knowles, Michael R; Leigh, Margaret W; Zariwala, Maimoona A; Challa, Anil K; Kesterson, Robert A; Rowe, Steven M; Drummond, Iain A; Parant, John M; Hildebrandt, Friedhelm; Porter, Mary E; Yoder, Bradley K; Berbari, Nicolas F

    2016-07-01

    Ciliopathies are genetic disorders arising from dysfunction of microtubule-based cellular appendages called cilia. Different cilia types possess distinct stereotypic microtubule doublet arrangements with non-motile or 'primary' cilia having a 9+0 and motile cilia have a 9+2 array of microtubule doublets. Primary cilia are critical sensory and signaling centers needed for normal mammalian development. Defects in their structure/function result in a spectrum of clinical and developmental pathologies including abnormal neural tube and limb patterning. Altered patterning phenotypes in the limb and neural tube are due to perturbations in the hedgehog (Hh) signaling pathway. Motile cilia are important in fluid movement and defects in motility result in chronic respiratory infections, altered left-right asymmetry, and infertility. These features are the hallmarks of Primary Ciliary Dyskinesia (PCD, OMIM 244400). While mutations in several genes are associated with PCD in patients and animal models, the genetic lesion in many cases is unknown. We assessed the in vivo functions of Growth Arrest Specific 8 (GAS8). GAS8 shares strong sequence similarity with the Chlamydomonas Nexin-Dynein Regulatory Complex (NDRC) protein 4 (DRC4) where it is needed for proper flagella motility. In mammalian cells, the GAS8 protein localizes not only to the microtubule axoneme of motile cilia, but also to the base of non-motile cilia. Gas8 was recently implicated in the Hh signaling pathway as a regulator of Smoothened trafficking into the cilium. Here, we generate the first mouse with a Gas8 mutation and show that it causes severe PCD phenotypes; however, there were no overt Hh pathway phenotypes. In addition, we identified two human patients with missense variants in Gas8. Rescue experiments in Chlamydomonas revealed a subtle defect in swim velocity compared to controls. Further experiments using CRISPR/Cas9 homology driven repair (HDR) to generate one of these human missense variants in

  14. Mutation of Growth Arrest Specific 8 Reveals a Role in Motile Cilia Function and Human Disease.

    Directory of Open Access Journals (Sweden)

    Wesley R Lewis

    2016-07-01

    Full Text Available Ciliopathies are genetic disorders arising from dysfunction of microtubule-based cellular appendages called cilia. Different cilia types possess distinct stereotypic microtubule doublet arrangements with non-motile or 'primary' cilia having a 9+0 and motile cilia have a 9+2 array of microtubule doublets. Primary cilia are critical sensory and signaling centers needed for normal mammalian development. Defects in their structure/function result in a spectrum of clinical and developmental pathologies including abnormal neural tube and limb patterning. Altered patterning phenotypes in the limb and neural tube are due to perturbations in the hedgehog (Hh signaling pathway. Motile cilia are important in fluid movement and defects in motility result in chronic respiratory infections, altered left-right asymmetry, and infertility. These features are the hallmarks of Primary Ciliary Dyskinesia (PCD, OMIM 244400. While mutations in several genes are associated with PCD in patients and animal models, the genetic lesion in many cases is unknown. We assessed the in vivo functions of Growth Arrest Specific 8 (GAS8. GAS8 shares strong sequence similarity with the Chlamydomonas Nexin-Dynein Regulatory Complex (NDRC protein 4 (DRC4 where it is needed for proper flagella motility. In mammalian cells, the GAS8 protein localizes not only to the microtubule axoneme of motile cilia, but also to the base of non-motile cilia. Gas8 was recently implicated in the Hh signaling pathway as a regulator of Smoothened trafficking into the cilium. Here, we generate the first mouse with a Gas8 mutation and show that it causes severe PCD phenotypes; however, there were no overt Hh pathway phenotypes. In addition, we identified two human patients with missense variants in Gas8. Rescue experiments in Chlamydomonas revealed a subtle defect in swim velocity compared to controls. Further experiments using CRISPR/Cas9 homology driven repair (HDR to generate one of these human missense

  15. The novel compound OSI-461 induces apoptosis and growth arrest in human acute myeloid leukemia cells.

    Science.gov (United States)

    Singh, Raminder; Fröbel, Julia; Cadeddu, Ron-Patrick; Bruns, Ingmar; Schroeder, Thomas; Brünnert, Daniela; Wilk, Christian Matthias; Zerbini, Luiz Fernando; Haas, Rainer; Czibere, Akos

    2012-02-01

    Acute myeloid leukemia (AML) is a heterogeneous hematological malignancy. Treatment of patients suffering from high-risk AML as defined by clinical parameters, cytogenetics, and/or molecular analyses is often unsuccessful. OSI-461 is a pro-apoptotic compound that has been proposed as a novel therapeutic option for patients suffering from solid tumors like prostate or colorectal carcinoma. But little is known about its anti-proliferative potential in AML. Hence, we treated bone marrow derived CD34(+) selected blast cells from 20 AML patients and the five AML cell lines KG-1a, THP-1, HL-60, U-937, and MV4-11 with the physiologically achievable concentration of 1 μM OSI-461 or equal amounts of DMSO as a control. Following incubation with OSI-461, we found a consistent induction of apoptosis and an accumulation of cells in the G2/M phase of the cell cycle. In addition, we demonstrate that the OSI-461 mediated anti-proliferative effects observed in AML are associated with the induction of the pro-apoptotic cytokine mda-7/IL-24 and activation of the growth arrest and DNA-damage inducible genes (GADD) 45α and 45γ. Furthermore, OSI-461 treated leukemia cells did not regain their proliferative potential for up to 8 days after cessation of treatment following the initial 48 h treatment period with 1 μM OSI-461. This indicates sufficient targeting of the leukemia-initiating cells in our in vitro experiments through OSI-461. The AML samples tested in this study included samples from patients who were resistant to conventional chemotherapy and/or had FLT3-ITD mutations demonstrating the high potential of OSI-461 in human AML.

  16. Acetate supplementation induces growth arrest of NG2/PDGFRα-positive oligodendroglioma-derived tumor-initiating cells.

    Directory of Open Access Journals (Sweden)

    Patrick M Long

    Full Text Available Cancer is associated with globally hypoacetylated chromatin and considerable attention has recently been focused on epigenetic therapies. N-acetyl-L-aspartate (NAA, the primary storage form of acetate in the brain, and aspartoacylase (ASPA, the enzyme responsible for NAA catalysis to generate acetate and ultimately acetyl-Coenzyme A for histone acetylation, are reduced in oligodendroglioma. The short chain triglyceride glyceryl triacetate (GTA, which increases histone acetylation and inhibits histone deacetylase expression, has been safely used for acetate supplementation in Canavan disease, a leukodystrophy due to ASPA mutation. We demonstrate that GTA induces cytostatic G0 growth arrest of oligodendroglioma-derived cells in vitro, without affecting normal cells. Sodium acetate, at doses comparable to that generated by complete GTA catalysis, but not glycerol also promoted growth arrest, whereas long chain triglycerides promoted cell growth. To begin to elucidate its mechanism of action, the effects of GTA on ASPA and acetyl-CoA synthetase protein levels and differentiation of established human oligodendroglioma cells (HOG and Hs683 and primary tumor-derived oligodendroglioma cells that exhibit some features of cancer stem cells (grade II OG33 and grade III OG35 relative to an oligodendrocyte progenitor line (Oli-Neu were examined. The nuclear localization of ASPA and acetyl-CoA synthetase-1 in untreated cells was regulated during the cell cycle. GTA-mediated growth arrest was not associated with apoptosis or differentiation, but increased expression of acetylated proteins. Thus, GTA-mediated acetate supplementation may provide a safe, novel epigenetic therapy to reduce the growth of oligodendroglioma cells without affecting normal neural stem or oligodendrocyte progenitor cell proliferation or differentiation.

  17. P53 but not p16INK4a induces growth arrest in retinoblastoma-deficient hepatocellular carcinoma cells.

    Science.gov (United States)

    Morel, A P; Unsal, K; Cagatay, T; Ponchel, F; Carr, B; Ozturk, M

    2000-08-01

    Both p16INK4a and p53 proteins are negative regulators of the cell cycle. In human hepatocellular carcinomas (HCC), the loss of function of p53, retinoblastoma (pRb) and pl6INK4a genes by different mechanisms has been largely documented, but their hepatocellular effects are poorly known. We compared the growth-inhibitory effects of p16INK4a and p53 proteins in Hep3B cell line-derived clones. Cells were transfected with inducible p16INK4a and p53 expression vectors, and stable clones were analyzed for transgene expression by Western blotting and immunoperoxidase staining. Effects on cell growth were analyzed by in vitro growth assay, thymidine incorporation and flow cytometry. Biochemical effects of p53 were tested by Northern blotting of p21Cip1 transcripts and by Western blotting of p21Cip1, mdm-2, bax, cyclin-dependent kinase 2 and cyclin E proteins. The pRb protein was studied by Western blotting and immunoprecipitation assays. The induction of p16INK4a protein expression did not affect in vitro growth of cells. In contrast, p53 protein in its wild-type conformation provoked a growth arrest accompanied by transactivation of p21Cip1 gene and accumulation of p21Cip1, bax and mdm-2 proteins. p53-induced growth arrest was due to a cell cycle arrest at the G1/S transition, probably mediated by p21Cip1 protein, which inhibits cyclin-dependent kinase 2/cyclin E complexes. The lack of detectable pRb protein and resistance of cells to p16TNK4a strongly suggest that p53 is able to arrest the growth of HCC cells by a mechanism independent of "p53-retinoblastoma pathway". These findings are applicable to HCC with abberrations of both p53 and pRb genes, and may not represent the universal effects of p53 in hepatic cells.

  18. Methyl Sartortuoate Inhibits Colon Cancer Cell Growth by Inducing Apoptosis and G2/M-Phase Arrest.

    Science.gov (United States)

    Lan, Qiusheng; Li, Shoufeng; Lai, Wei; Xu, Heyang; Zhang, Yang; Zeng, Yujie; Lan, Wenjian; Chu, Zhonghua

    2015-08-17

    The potential anti-neoplastic activity of terpenoids is of continued interest. In this study, we investigate whether methyl sartortuoate, a terpenoid isolated from soft coral, induced cell cycle arrest and apoptosis in a human colon cancer cell line. Culture studies found that methyl sartortuoate inhibited colon cancer cell (LoVo and RKO) growth and caused apoptotic death in a concentration- and time-dependent manner, by activation of caspase-8, caspase-9, caspase-3, p53 and Bax, and inactivation of B-cell lymphoma 2 (Bcl-2) apoptosis regulating proteins. Methyl sartortuoate treatment led to reduced expression of cdc2 and up-regulated p21 and p53, suggesting that Methyl sartortuoate induced G2-M arrest through modulation of p53/p21/cdc2 pathways. Methyl sartortuoate also up-regulated phospho-JNK and phospho-p38 expression levels. This resulted in cell cycle arrest at the G2-M phase and apoptosis in LoVo and RKO cells. Treatment with the JNK inhibitor SP600125 and the p38 MAPK inhibitor SB203580 prevented methyl sartortuoate-induced apoptosis in LoVo cells. Moreover, methyl sartortuoate also prevented neoplasm growth in NOD-SCID nude mice inoculated with LoVo cells. Taken together, these findings suggest that methyl sartortuoate is capable of leading to activation of caspase-8, -9, -3, increasing p53 and Bax/Bcl-2 ratio apoptosis through MAPK-dependent apoptosis and results in G2-M phase arrest in LoVo and RKO cells. Thus, methyl sartortuoate may be a promising anticancer candidate.

  19. Dynamic analysis of crack growth and arrest in a pressure vessel subjected to thermal and pressure loading

    International Nuclear Information System (INIS)

    Brickstad, B.

    1984-01-01

    Predictions of crack arrest behaviour are performed for a cracked reactor pressure vessel under both thermal and pressure loading. The object is to compare static and dynamic calculations. The dynamic calculations are made using an explicit finite element technique where crack growth is simulated by gradual nodal release. Three different load cases and the effect of different velocity dependence on the crack propagation toughness are studied. It is found that for the analysed cases the static analysis is slightly conservative, thus justifying its use for these problems. (orig.)

  20. Sequential signaling cascade of IL-6 and PGC-1α is involved in high glucose-induced podocyte loss and growth arrest

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong Il; Park, Soo Hyun, E-mail: parksh@chonnam.ac.kr

    2013-06-14

    Highlights: •The pathophysiological role of IL-6 in high glucose-induced podocyte loss. •The novel role of PGC-1α in the development of diabetic nephropathy. •Signaling of IL-6 and PGC-1α in high glucose-induced dysfunction of podocyte. -- Abstract: Podocyte loss, which is mediated by podocyte apoptosis, is implicated in the onset of diabetic nephropathy. In this study, we investigated the involvement of interleukin (IL)-6 in high glucose-induced apoptosis of rat podocytes. We also examined the pathophysiological role of peroxisome proliferator-activated receptor gamma coactivator-1 alpha (PGC-1α) in this system. High glucose treatment induced not only podocyte apoptosis but also podocyte growth arrest. High glucose treatment also increased IL-6 secretion and activated IL-6 signaling. The high glucose-induced podocyte apoptosis was blocked by IL-6 neutralizing antibody. IL-6 treatment or overexpression induced podocyte apoptosis and growth arrest, and IL-6 siRNA transfection blocked high glucose-induced podocyte apoptosis and growth arrest. Furthermore, high glucose or IL-6 treatment increased PGC-1α expression, and PGC-1α overexpression also induced podocyte apoptosis and growth arrest. PGC-1α siRNA transfection blocked high glucose-induced podocyte apoptosis and growth arrest. Collectively, these findings showed that high glucose promoted apoptosis and cell growth arrest in podocytes via IL-6 signaling. In addition, PGC-1α is involved in podocyte apoptosis and cell growth arrest. Therefore, blocking IL-6 and its downstream mediators such as IL6Rα, gp130 and PGC-1α may attenuate the progression of diabetic nephropathy.

  1. The effects of ethanol and strontium on growth and development of two-cell arrested mouse embryos.

    Science.gov (United States)

    Darabi, Mohammad Reza; Shiravi, Abdolhossein; Hojati, Vida

    2012-01-01

    Arresting at a certain stage of development like the two-cell stage could be one of the causes of infertility. The aim of this study is to evaluate the effects of ethanol and strontium on growth and development of mice embryos arrested at the two-cell stage. In this experimental study, female mice were coupled with a male following superovulation. Positive vaginal plug mice were sacrificed 48 hours after human chorionic gonadotropin (hCG) injection. Two-cell embryos were transferred to M16 medium and divided to four groups. The first control group was incubated without any exposure to low temperatures. Groups 2, 3 and 4 were exposed to 4°C for 24 hours. The second control group was incubated immediately, while the third and fourth groups were exposed to 10 mM strontium for five minutes and 0.1% ethanol for a further five minutes. Growth rate and developmental parameters of embryos were analyzed by one- way ANOVA. The significant difference between the groups was determined by Post Hoc. The data shows that developmental rate is decreased significantly by 4°C exposure. The mean percentage of degenerated embryo was significantly different between groups but the mean cleavage rate was not significantly different. The mean percent of morula, blastocyst and hatched blastocyst formation were significantly different between groups during a 120 hours study post hCG injection. The effect of strontium and ethanol on arrested two-cell embryos had no significant effect on the mean percentage of morula, but ethanol treatment significantly increased the percentage of blastocyst and hatched blastocyst formation compared to strontium.

  2. Interaction of E-cadherin and PTEN regulates morphogenesis and growth arrest in human mammary epithelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Fournier, Marcia V.; Fata, Jimmie E.; Martin, Katherine J.; Yaswen, Paul; Bissell, Mina J.

    2009-06-03

    PTEN is a dual function phosphatase with tumor suppressor function compromised in a wide spectrum of cancers. Because tissue polarity and architecture are crucial modulators of normal and malignant behavior, we postulated that PTEN may play a role in maintenance of tissue integrity. We used two non-malignant human mammary epithelial cell lines (HMECs) that form polarized, growth-arrested structures (acini) when cultured in 3-dimensional laminin-rich extracellular matrix gels (3D lrECM). As acini begin to form, PTEN accumulates in both the cytoplasm, and at cell-cell contacts where it colocalizes with E-cadherin/{beta}-catenin complex. Reduction of PTEN levels by shRNA in lrECM prevents formation of organized breast acini and disrupts growth arrest. Importantly, disruption of acinar polarity and cell-cell contact by E-cadherin function-blocking antibodies reduces endogenous PTEN protein levels and inhibits its accumulation at cell-cell contacts. Conversely, in SKBR3 breast cancer cells lacking endogenous E-cadherin expression, exogenous introduction of E-cadherin gene causes induction of PTEN expression and its accumulation at sites of cell interactions. These studies provide evidence that E-cadherin regulates both the PTEN protein levels and its recruitment to cell-cell junctions in 3D lrECM indicating a dynamic reciprocity between architectural integrity and the levels and localization of PTEN. This interaction thus appears to be a critical integrator of proliferative and morphogenetic signaling in breast epithelial cells.

  3. tRNAHis 5-methylcytidine levels increase in response to several growth arrest conditions in Saccharomyces cerevisiae.

    Science.gov (United States)

    Preston, Melanie A; D'Silva, Sonia; Kon, Yoshiko; Phizicky, Eric M

    2013-02-01

    tRNAs are highly modified, each with a unique set of modifications. Several reports suggest that tRNAs are hypomodified or, in some cases, hypermodified under different growth conditions and in certain cancers. We previously demonstrated that yeast strains depleted of tRNA(His) guanylyltransferase accumulate uncharged tRNA(His) lacking the G(-1) residue and subsequently accumulate additional 5-methylcytidine (m(5)C) at residues C(48) and C(50) of tRNA(His), due to the activity of the m(5)C-methyltransferase Trm4. We show here that the increase in tRNA(His) m(5)C levels does not require loss of Thg1, loss of G(-1) of tRNA(His), or cell death but is associated with growth arrest following different stress conditions. We find substantially increased tRNA(His) m(5)C levels after temperature-sensitive strains are grown at nonpermissive temperature, and after wild-type strains are grown to stationary phase, starved for required amino acids, or treated with rapamycin. We observe more modest accumulations of m(5)C in tRNA(His) after starvation for glucose and after starvation for uracil. In virtually all cases examined, the additional m(5)C on tRNA(His) occurs while cells are fully viable, and the increase is neither due to the GCN4 pathway, nor to increased Trm4 levels. Moreover, the increased m(5)C appears specific to tRNA(His), as tRNA(Val(AAC)) and tRNA(Gly(GCC)) have much reduced additional m(5)C during these growth arrest conditions, although they also have C(48) and C(50) and are capable of having increased m(5)C levels. Thus, tRNA(His) m(5)C levels are unusually responsive to yeast growth conditions, although the significance of this additional m(5)C remains unclear.

  4. The mitogen-activated protein kinase pathway mediates growth arrest or E1A-dependent apoptosis in SKBR3 human breast cancer cells.

    Science.gov (United States)

    Blagosklonny, M V

    1998-11-09

    Previously, we have shown that phorbol ester (PMA) induces p21(WAF1/CIP1)-dependent growth arrest in SKBr3 breast cancer and LNCaP prostate cancer cells. Here, I demonstrate that inhibition of Raf-1 kinase by dominant-negative Raf-1 or pharmacological depletion of Raf-1 prevented PMA-mediated induction of p21(WAF1/CIP1). Similarly, PD98059, a specific inhibitor of MEK, abolished p21(WAF1/CIP1) induction and PMA-induced growth arrest. Like PMA, the H-ras oncogene, another activator of the Raf-1/MEK/MAPK pathway, transactivated p21(WAF1/CIP1) in SKBr3 cells. I further investigated PMA-induced growth arrest following infection of SKBr3 cells with 12S E1A-expressing adenovirus. Although high levels of E1A oncoprotein prevented both PMA-induced p21(WAF1/CIP1) and growth arrest, smaller amounts of E1A abrogated growth arrest without down-regulation of p21(WAF1/CIP1). Therefore, E1A can stimulate proliferation downstream of p21(WAF1/CIP1). Albeit less effective than full activity, either Rb- or p300-binding activity of E1A was sufficient for the abrogation of PMA-mediated growth arrest. E1A-driven proliferation of PMA-treated SKBr3 cells was accompanied by apoptosis. New therapeutic approaches can be envisioned that would utilize stimulation of the Raf-1/MEK/MAPK pathway to inhibit growth of PMA-sensitive cancer cells.

  5. Isoalantolactone inhibits UM-SCC-10A cell growth via cell cycle arrest and apoptosis induction.

    Directory of Open Access Journals (Sweden)

    Minjun Wu

    Full Text Available Isoalantolactone is a sesquiterpene lactone compound isolated from the roots of Inula helenium L. Previous studies have demonstrated that isoalantolactone possesses antifungal, anti-bacterial, anti-helminthic and anti-proliferative properties in a variety of cells, but there are no studies concerning its effects on head and neck squamous cell carcinoma (HNSCC. In the present study, an MTT assay demonstrated that isoalantolactone has anti-proliferative activity against the HNSCC cell line (UM-SCC-10A. Immunostaining identified that this compound induced UM-SCC-10A cell apoptosis but not necrosis. To explain the molecular mechanisms underlying its effects, flow cytometry and western blot analysis showed that the apoptosis was associated with cell cycle arrest during the G1 phase, up-regulation of p53 and p21, and down-regulation of cyclin D. Furthermore, our results revealed that induction of apoptosis through a mitochondrial pathway led to up-regulation of pro-apoptotic protein expression (Bax, down-regulation of anti-apoptotic protein expression (Bcl-2, mitochondrial release of cytochrome c (Cyto c, reduction of mitochondrial membrane potential (MMP and activation of caspase-3 (Casp-3. Involvement of the caspase apoptosis pathway was confirmed using caspase inhibitor Z-VAD-FMK pretreatment. Together, our findings suggest that isoalantolactone induced caspase-dependent apoptosis via a mitochondrial pathway and was associated with cell cycle arrest in the G1 phase in UM-SCC-10A cells. Therefore, isoalantolactone may become a potential drug for treating HNSCC.

  6. Stilbene 5c, a microtubule poison with vascular disrupting properties that induces multiple modes of growth arrest and cell death.

    Science.gov (United States)

    Alotaibi, M R; Asnake, B; Di, Xu; Beckman, M J; Durrant, D; Simoni, D; Baruchello, R; Lee, R M; Schwartz, E L; Gewirtz, D A

    2013-12-15

    The stilbene derivative, cis-3,4',5-trimethoxy-3'-aminostilbene (stilbene 5c), is a potentially potent antitumor agent that acts via binding to the colchicine-binding site in tubulin. The current studies were designed to investigate the effectiveness of stilbene 5c against the HCT-116 human colon cancer cell line and B16/F10 melanoma cells as well as human endothelial cell tube formation and tumor perfusion. Stilbene 5c produced a time-dependent decrease in cell viability in both cell lines and the capacity of the cells to proliferate was not restored upon removal of the drug. Treatment with stilbene 5c also promoted both senescence and autophagy in both cell lines. TUNEL and annexin 5 staining indicated that apoptosis also occurs in stilbene 5c-treated HCT-116 cells, but not in B16/F10 melanoma cells. DAPI staining revealed morphological changes in the cell nuclei (binucleated and micronucleated cells) indicative of mitotic catastrophe in HCT-116 cells but not in the B16/F10 melanoma cells. p53-null HCT-116 cells demonstrated a similar growth arrest/cell death response to stilbene as p53-wild type HCT-116 cells. Stilbene 5c also completely inhibited human endothelial cell tube formation on Matrigel, consistent with potential anti-angiogenic actions. Using a new method developed for monitoring the pharmacodynamic effects of stilbene 5c in vivo, we found that a single injection of stilbene 5c reduced tumor perfusion by 65% at 4h, returning to baseline by 24h, while subsequent daily injections of stilbene 5c produced progressively larger reductions and smaller rebounds. This work indicates that stilbene 5c could potentially be effective against melanoma and colon cancer through the promotion of multiple modes of growth arrest and cell death coupled with anti-angiogenic and antivascular actions. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Inhibition of root growth by narciclasine is caused by DNA damage-induced cell cycle arrest in lettuce seedlings.

    Science.gov (United States)

    Hu, Yanfeng; Li, Jiaolong; Yang, Lijing; Nan, Wenbin; Cao, Xiaoping; Bi, Yurong

    2014-09-01

    Narciclasine (NCS) is an Amaryllidaceae alkaloid isolated from Narcissus tazetta bulbs. Its phytotoxic effects on plant growth were examined in lettuce (Lactuca sativa L.) seedlings. Results showed that high concentrations (0.5-5 μM) of NCS restricted the growth of lettuce roots in a dose-dependent manner. In NCS-treated lettuce seedlings, the following changes were detected: reduction of mitotic cells and cell elongation in the mature region, inhibition of proliferation of meristematic cells, and cell cycle. Moreover, comet assay and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay indicated that higher levels NCS (0.5-5 μM) induced DNA damage in root cells of lettuce. The decrease in meristematic cells and increase in DNA damage signals in lettuce roots in responses to NCS are in a dose-dependent manner. NCS-induced reactive oxygen species accumulation may explain an increase in DNA damage in lettuce roots. Thus, the restraint of root growth is due to cell cycle arrest which is caused by NCS-induced DNA damage. In addition, it was also found that NCS (0.5-5 μM) inhibited the root hair development of lettuce seedlings. Further investigations on the underlying mechanism revealed that both auxin and ethylene signaling pathways are involved in the response of root hairs to NCS.

  8. Novel protein kinase D inhibitors cause potent arrest in prostate cancer cell growth and motility

    Directory of Open Access Journals (Sweden)

    Lazo John S

    2010-05-01

    Full Text Available Abstract Background Protein kinase D (PKD has been implicated in a wide range of cellular processes and pathological conditions including cancer. However, targeting PKD therapeutically and dissecting PKD-mediated cellular responses remains difficult due to lack of a potent and selective inhibitor. Previously, we identified a novel pan-PKD inhibitor, CID755673, with potency in the upper nanomolar range and high selectivity for PKD. In an effort to further enhance its selectivity and potency for potential in vivo application, small molecule analogs of CID755673 were generated by modifying both the core structure and side-chains. Results After initial activity screening, five analogs with equal or greater potencies as CID755673 were chosen for further analysis: kb-NB142-70, kb-NB165-09, kb-NB165-31, kb-NB165-92, and kb-NB184-02. Our data showed that modifications to the aromatic core structure in particular significantly increased potency while retaining high specificity for PKD. When tested in prostate cancer cells, all compounds inhibited PMA-induced autophosphorylation of PKD1, with kb-NB142-70 being most active. Importantly, these analogs caused a dramatic arrest in cell proliferation accompanying elevated cytotoxicity when applied to prostate cancer cells. Cell migration and invasion were also inhibited by these analogs with varying potencies that correlated to their cellular activity. Conclusions Throughout the battery of experiments, the compounds kb-NB142-70 and kb-NB165-09 emerged as the most potent and specific analogs in vitro and in cells. These compounds are undergoing further testing for their effectiveness as pharmacological tools for dissecting PKD function and as potential anti-cancer agents in the treatment of prostate cancer.

  9. L-citrulline attenuates arrested alveolar growth and pulmonary hypertension in oxygen-induced lung injury in newborn rats.

    Science.gov (United States)

    Vadivel, Arul; Aschner, Judy L; Rey-Parra, Gloria J; Magarik, Jordan; Zeng, Heng; Summar, Marshall; Eaton, Farah; Thébaud, Bernard

    2010-12-01

    Bronchopulmonary dysplasia (BPD) is characterized by arrested alveolar development and complicated by pulmonary hypertension (PH). NO promotes alveolar growth. Inhaled NO (iNO) ameliorates the BPD phenotype in experimental models and in some premature infants. Arginosuccinate synthetase (ASS) and arginosuccinate lyase (ASL) convert L-citrulline to L-arginine; L-citrulline is regenerated during NO synthesis from L-arginine. Plasma levels of these NO precursors are low in PH. We hypothesized that L-citrulline prevents experimental O2-induced BPD in newborn rats. Rat pups were assigned from birth through postnatal day (P) 14 to room air (RA), RA + L-citrulline, 95% hyperoxia (BPD model), and 95%O2 + L-citrulline. Rat pups exposed to hyperoxia had fewer and enlarged air spaces and decreased capillary density, mimicking human BPD. This was associated with decreased plasma L-arginine and L-citrulline concentrations on P7. L-citrulline treatment significantly increased plasma L-arginine and L-citrulline concentrations and increased ASL protein expression in hyperoxia. L-citrulline preserved alveolar and vascular growth in O2-exposed pups and decreased pulmonary arterial medial wall thickness (MWT) and right ventricular hypertrophy (RVH). Increased lung arginase (ARG) activity in O2-exposed pups was reversed by L-citrulline treatment. L-citrulline supplementation prevents hyperoxia-induced lung injury and PH in newborn rats. L-citrulline may represent a novel therapeutic alternative to iNO for prevention of BPD.

  10. Higher order nuclear organization in growth arrest of humanmammary epithelial cells: A novel role for telomere-associated proteinTIN2

    Energy Technology Data Exchange (ETDEWEB)

    Kaminker, Patrick; Plachot, Cedric; Kim, Sahn-Ho; Chung, Peter; Crippen, Danielle; Petersen, Ole W.; Bissell, Mina J.; Campisi, Judith; Lelievre, Sophie A.

    2004-12-15

    Nuclear organization, such as the formation of specific nuclear subdomains, is generally thought to be involved in the control of cellular phenotype; however, there are relatively few specific examples of how mammalian nuclei organize during radical changes in phenotype, such as those which occur during differentiation and growth arrest. Using human mammary epithelial cells (HMECs) in which growth arrest is essential for morphological differentiation, we show that the arrest of cell proliferation is accompanied by a reorganization of the telomere-associated protein, TIN2, into one to three large nuclear subdomains. The large TIN2 domains do not contain telomeres and occur concomitant with the continued presence of TIN2 at telomeres. The TIN2 domains were sensitive to DNAse, but not RNAse, occurred frequently, but not exclusively near nucleoli, and overlapped often with dense domains containing heterochromatin protein l{gamma}. Expression of truncated forms of TIN2 simultaneously prevented the formation of TIN2 domains and relaxed the stringent morphogenesis-induced growth arrest in HMECs. Our findings reveal a novel extra-telomeric organization of TIN2 associated with the control of cell proliferation and identify TIN2 as an important regulator of mammary epithelial differentiation.

  11. Cardiovascular adaptation to extrauterine life after intrauterine growth restriction.

    Science.gov (United States)

    Rodriguez-Guerineau, Luciana; Perez-Cruz, Miriam; Gomez Roig, María D; Cambra, Francisco J; Carretero, Juan; Prada, Fredy; Gómez, Olga; Crispi, Fátima; Bartrons, Joaquim

    2018-02-01

    Introduction The adaptive changes of the foetal heart in intrauterine growth restriction can persist postnatally. Data regarding its consequences for early circulatory adaptation to extrauterine life are scarce. The aim of this study was to assess cardiac morphometry and function in newborns with late-onset intrauterine growth restriction to test the hypothesis that intrauterine growth restriction causes cardiac shape and functional changes at birth. A comprehensive echocardiographic study was performed in 25 neonates with intrauterine growth restriction and 25 adequate-for-gestational-age neonates. Compared with controls, neonates with intrauterine growth restriction had more globular ventricles, lower longitudinal tricuspid annular motion, and higher left stroke volume without differences in the heart rate. Neonates with intrauterine growth restriction also showed subclinical signs of diastolic dysfunction in the tissue Doppler imaging with lower values of early (e') diastolic annular peak velocities in the septal annulus. Finally, the Tei index in the tricuspid annulus was higher in the intrauterine growth restriction group. Neonates with history of intrauterine growth restriction showed cardiac remodelling and signs of systolic and diastolic dysfunction. Overall, there was a significant tendency to worse cardiac function results in the right heart. The adaptation to extrauterine life occurred with more globular hearts, higher stroke volumes but a similar heart rate compared to adequate-for-gestational-age neonates.

  12. Live-Cell Imaging Visualizes Frequent Mitotic Skipping During Senescence-Like Growth Arrest in Mammary Carcinoma Cells Exposed to Ionizing Radiation

    Energy Technology Data Exchange (ETDEWEB)

    Suzuki, Masatoshi, E-mail: msuzuki@nagasaki-u.ac.jp [Department of Radiation Medical Sciences, Atomic Bomb Disease Institute, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki (Japan); Yamauchi, Motohiro; Oka, Yasuyoshi; Suzuki, Keiji; Yamashita, Shunichi [Department of Radiation Medical Sciences, Atomic Bomb Disease Institute, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki (Japan)

    2012-06-01

    Purpose: Senescence-like growth arrest in human solid carcinomas is now recognized as the major outcome of radiotherapy. This study was designed to analyze cell cycle during the process of senescence-like growth arrest in mammary carcinoma cells exposed to X-rays. Methods and Materials: Fluorescent ubiquitination-based cell cycle indicators were introduced into the human mammary carcinoma cell line MCF-7. Cell cycle was sequentially monitored by live-cell imaging for up to 5 days after exposure to 10 Gy of X-rays. Results: Live-cell imaging revealed that cell cycle transition from G2 to G1 phase without mitosis, so-called mitotic skipping, was observed in 17.1% and 69.8% of G1- and G2-irradiated cells, respectively. Entry to G1 phase was confirmed by the nuclear accumulation of mKO{sub 2}-hCdt1 as well as cyclin E, which was inversely correlated to the accumulation of G2-specific markers such as mAG-hGeminin and CENP-F. More than 90% of cells skipping mitosis were persistently arrested in G1 phase and showed positive staining for the senescent biochemical marker, which is senescence-associated ss-galactosidase, indicating induction of senescence-like growth arrest accompanied by mitotic skipping. While G2 irradiation with higher doses of X-rays induced mitotic skipping in approximately 80% of cells, transduction of short hairpin RNA (shRNA) for p53 significantly suppressed mitotic skipping, suggesting that ionizing radiation-induced mitotic skipping is associated with p53 function. Conclusions: The present study found the pathway of senescence-like growth arrest in G1 phase without mitotic entry following G2-irradiation.

  13. Live-Cell Imaging Visualizes Frequent Mitotic Skipping During Senescence-Like Growth Arrest in Mammary Carcinoma Cells Exposed to Ionizing Radiation

    International Nuclear Information System (INIS)

    Suzuki, Masatoshi; Yamauchi, Motohiro; Oka, Yasuyoshi; Suzuki, Keiji; Yamashita, Shunichi

    2012-01-01

    Purpose: Senescence-like growth arrest in human solid carcinomas is now recognized as the major outcome of radiotherapy. This study was designed to analyze cell cycle during the process of senescence-like growth arrest in mammary carcinoma cells exposed to X-rays. Methods and Materials: Fluorescent ubiquitination-based cell cycle indicators were introduced into the human mammary carcinoma cell line MCF-7. Cell cycle was sequentially monitored by live-cell imaging for up to 5 days after exposure to 10 Gy of X-rays. Results: Live-cell imaging revealed that cell cycle transition from G2 to G1 phase without mitosis, so-called mitotic skipping, was observed in 17.1% and 69.8% of G1- and G2-irradiated cells, respectively. Entry to G1 phase was confirmed by the nuclear accumulation of mKO 2 -hCdt1 as well as cyclin E, which was inversely correlated to the accumulation of G2-specific markers such as mAG-hGeminin and CENP-F. More than 90% of cells skipping mitosis were persistently arrested in G1 phase and showed positive staining for the senescent biochemical marker, which is senescence-associated ß-galactosidase, indicating induction of senescence-like growth arrest accompanied by mitotic skipping. While G2 irradiation with higher doses of X-rays induced mitotic skipping in approximately 80% of cells, transduction of short hairpin RNA (shRNA) for p53 significantly suppressed mitotic skipping, suggesting that ionizing radiation-induced mitotic skipping is associated with p53 function. Conclusions: The present study found the pathway of senescence-like growth arrest in G1 phase without mitotic entry following G2-irradiation.

  14. Production of 4-Hydroxybenzoic Acid by an Aerobic Growth-Arrested Bioprocess Using Metabolically Engineered Corynebacterium glutamicum.

    Science.gov (United States)

    Kitade, Yukihiro; Hashimoto, Ryoma; Suda, Masako; Hiraga, Kazumi; Inui, Masayuki

    2018-03-15

    Corynebacterium glutamicum was metabolically engineered to produce 4-hydroxybenzoic acid (4-HBA), a valuable aromatic compound used as a raw material for the production of liquid crystal polymers and paraben. C. glutamicum was found to have a higher tolerance to 4-HBA toxicity than previously reported hosts used for the production of genetically engineered 4-HBA. To obtain higher titers of 4-HBA, we employed a stepwise overexpression of all seven target genes in the shikimate pathway in C. glutamicum Specifically, multiple chromosomal integrations of a mutated aroG gene from Escherichia coli , encoding a 3-deoxy-d-arabinoheptulosonic acid 7-phosphate (DAHP) synthase, and wild-type aroCKB from C. glutamicum , encoding chorismate synthase, shikimate kinase, and 3-dehydroquinate synthase, were effective in increasing product titers. The last step of the 4-HBA biosynthesis pathway was recreated in C. glutamicum by expressing a highly 4-HBA-resistant chorismate pyruvate-lyase (UbiC) from the intestinal bacterium Providencia rustigianii To enhance the yield of 4-HBA, we reduced the formation of by-products, such as 1,3-dihydroxyacetone and pyruvate, by deleting hdpA , a gene coding for a haloacid dehalogenase superfamily phosphatase, and pyk , a gene coding for a pyruvate kinase, from the bacterial chromosome. The maximum concentration of 4-HBA produced by the resultant strain was 36.6 g/liter, with a yield of 41% (mol/mol) glucose after incubation for 24 h in minimal medium in an aerobic growth-arrested bioprocess using a jar fermentor. To our knowledge, this is the highest concentration of 4-HBA produced by a metabolically engineered microorganism ever reported. IMPORTANCE Since aromatic compound 4-HBA has been chemically produced from petroleum-derived phenol for a long time, eco-friendly bioproduction of 4-HBA from biomass resources is desired in order to address environmental issues. In microbial chemical production, product toxicity often causes problems, but we

  15. Nanotechnology and mesenchymal stem cells with chondrocytes in prevention of partial growth plate arrest in pigs

    Czech Academy of Sciences Publication Activity Database

    Plánka, L.; Srnec, R.; Rauser, P.; Starý, D.; Filová, Eva; Jančář, J.; Juhásová, Jana; Křen, J.; Nečas, A.; Gál, P.

    2012-01-01

    Roč. 156, č. 2 (2012), s. 128-134 ISSN 1213-8118 R&D Projects: GA MZd(CZ) NS9896 Institutional research plan: CEZ:AV0Z50390512; CEZ:AV0Z50450515 Institutional support: RVO:68378041 ; RVO:67985904 Keywords : mesenchymal stem cells * growth plate defect * bone bridge Subject RIV: FI - Traumatology, Orthopedics Impact factor: 0.990, year: 2012

  16. Morphine Can Inhibit the Growth of Breast Cancer MCF-7 Cells by Arresting the Cell Cycle and Inducing Apoptosis.

    Science.gov (United States)

    Chen, Yanhua; Qin, Yi; Li, Li; Chen, Jing; Zhang, Xu; Xie, Yubo

    2017-10-01

    Morphine is widely used for relieving cancer pain in patients with advanced cancer. However, whether morphine can suppress or promote the progression of cancer in breast cancer patients receiving morphine analgesia remains unclear. Therefore, we used an in vitro model treated with morphine and naloxone to investigate the effects of morphine on breast cancer cell line MCF-7. MCF-7 cells were cultured with different concentrations (0.01 to 10 µM) of morphine at 12th, 24th, 36th, 48th, 60th and 72nd hours. Then, cell viability was measured through the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, and cell cycle and apoptosis assays were detected by flow cytometry (FCM). In addition, cell proliferation was conducted by colony formation assay. In this study, we have found that morphine (0.01 to 10 µM) could significantly reduce the cell vitality, growth and colony formation rate of MCF-7 cells, which has a certain relationship with cell cycle progression arrested at the G0/G1 and G2/M phase and MCF-7 cells apoptosis. Moreover, naloxone along with morphine could not reverse these effects, which indicates that the inhibition of MCF-7 breast cancer cell growth and proliferation by morphine could be its independent effect, not associated with opioid receptors. Morphine can inhibit cell growth by blocking the cell cycle and promote apoptosis in MCF-7 cells. Hence, morphine may be unable to promote the progression of cancer in breast cancer patients receiving morphine analgesia.

  17. Overexpression of 15-lipoxygenase-1 induces growth arrest through phosphorylation of p53 in human colorectal cancer cells.

    Science.gov (United States)

    Kim, Jong-Sik; Baek, Seung Joon; Bottone, Frank G; Sali, Tina; Eling, Thomas E

    2005-09-01

    To investigate the function of 15-lipoxygenase-1 (15-LOX-1) in human colorectal cancer, we overexpressed 15-LOX-1 in HCT-116 human colorectal cancer cells. Clones expressing the highest levels of 15-LOX-1 displayed reduced viability compared with the HCT-116-Vector control cells. Further, by cell cycle gene array analyses, the cyclin-dependent kinase inhibitor p21WAF1/CIP1 and MDM2 genes were up-regulated in 15-LOX-1-overexpressing cells. The induction of p21(WAF1/CIP1) and MDM2 were linked to activation of p53 by 15-LOX-1, as there was a dramatic induction of phosphorylated p53 (Ser15) in 15-LOX-1-overesxpressing cells. However, the 15-LOX-1 metabolites 13(S)-hydroxyoctadecadienoic acid and 15(S)-hydroxyeicosatetraenoic acid failed to induce phosphorylation of p53 at Ser15, and the 15-LOX-1 inhibitor PD146176 did not inhibit the phosphorylation of p53 at Ser15 in 15-LOX-1-overexpressing cells. Nonetheless, the growth-inhibitory effects of 15-LOX-1 were p53 dependent, as 15-LOX-1 overexpression had no effect on cell growth in p53 (-/-) HCT-116 cells. Finally, treatment of HCT-116-15-LOX-1 cells with different kinase inhibitors suggested that the effects of 15-LOX-1 on p53 phosphorylation and activation were due to effects on DNA-dependent protein kinase. Collectively, these findings suggest a new mechanism to explain the biological activity of 15-LOX-1, where 15-LOX plays a stoichiometric role in activating a DNA-dependent protein kinase-dependent pathway that leads to p53-dependent growth arrest.

  18. Physeal growth arrest after tibial lengthening in achondroplasia: 23 children followed to skeletal maturity.

    Science.gov (United States)

    Song, Sang-Heon; Agashe, Mandar Vikas; Huh, Young-Jae; Hwang, Soon-Young; Song, Hae-Ryong

    2012-06-01

    Bilateral tibial lengthening has become one of the standard treatments for upper segment-lower segment disproportion and to improve quality of life in achondroplasia. We determined the effect of tibial lengthening on the tibial physis and compared tibial growth that occurred at the physis with that in non-operated patients with achondroplasia. We performed a retrospective analysis of serial radiographs until skeletal maturity in 23 achondroplasia patients who underwent bilateral tibial lengthening before skeletal maturity (lengthening group L) and 12 achondroplasia patients of similar height and age who did not undergo tibial lengthening (control group C). The mean amount of lengthening of tibia in group L was 9.2 cm (lengthening percentage: 60%) and the mean age at the time of lengthening was 8.2 years. The mean duration of follow-up was 9.8 years. Skeletal maturity (fusion of physis) occurred at 15.2 years in group L and at 16.0 years in group C. The actual length of tibia (without distraction) at skeletal maturity was 238 mm in group L and 277 mm in group C (p = 0.03). The mean growth rates showed a decrease in group L relative to group C from about 2 years after surgery. Physeal closure was most pronounced on the anterolateral proximal tibial physis, with relative preservation of the distal physis. Our findings indicate that physeal growth rate can be disturbed after tibial lengthening in achondroplasia, and a close watch should be kept for such an occurrence-especially when lengthening of more than 50% is attempted.

  19. Linear growth arrest without weight gain due to overuse of topical clobetasol.

    Science.gov (United States)

    Razavi, Zahra; Sanginabadi, Milad

    2014-11-01

    Prolonged potent topical glucocorticoid therapy in infants can cause iatrogenic Cushing's syndrome. This case highlights the rarity of poor weight gain in iatrogenic Cushing's syndrome. A 17-month-old boy was referred to outpatients pediatric endocrine clinic for evaluation of growth failure. On presentation his weight was 9.7kg (5th percentile) and height was 72cm (-3.6 SD below mean for age and sex). Systemic examination revealed grossly moon-like face, hypertrichosis and thin skin in the genital area. His mother reported using local clobetasol for the previous seven months for his diaper dermatitis. Baseline plasma cortisol was low (0.3ng/ml, normal range: 60 to 280ng/ml). During standard dose of synthetic adrenocorticotropic hormone test, the peak cortisol level was 0.4ng/ml (N>180ng/ml) and was consistent with hypothalamic-pituitary-adrenal axis suppression. The patient's clinical presentation and laboratory investigations confirmed the diagnosis of secondary adrenal insufficiency and iatrogenic Cushing's syndrome. He was treated successfully by discontinuing use of clobetasol. His appearance and growth returned to normal within two months. Morning cortisol was 101.2ng/ml after stopping the oral physiologic dose of hydrocortisone. Our case differed from other reports of iatrogenic Cushing's syndrome by presenting in poor weight gain rather than obesity.

  20. Gallotannin imposes S phase arrest in breast cancer cells and suppresses the growth of triple-negative tumors in vivo.

    Science.gov (United States)

    Zhao, Tiejun; Sun, Qiang; del Rincon, Sonia V; Lovato, Amanda; Marques, Maud; Witcher, Michael

    2014-01-01

    Triple-negative breast cancers are associated with poor clinical outcomes and new therapeutic strategies are clearly needed. Gallotannin (Gltn) has been previously demonstrated to have potent anti-tumor properties against cholangiocarcinoma in mice, but little is known regarding its capacity to suppress tumor outgrowth in breast cancer models. We tested Gltn for potential growth inhibitory properties against a variety of breast cancer cell lines in vitro. In particular, triple-negative breast cancer cells display higher levels of sensitivity to Gltn. The loss of proliferative capacity in Gltn exposed cells is associated with slowed cell cycle progression and S phase arrest, dependent on Chk2 phosphorylation and further characterized by changes to proliferation related genes, such as cyclin D1 (CcnD1) as determined by Nanostring technology. Importantly, Gltn administered orally or via intraperitoneal (IP) injections greatly reduced tumor outgrowth of triple-negative breast cells from mammary fat pads without signs of toxicity. In conclusion, these data strongly suggest that Gltn represents a novel approach to treat triple-negative breast carcinomas.

  1. Gallotannin imposes S phase arrest in breast cancer cells and suppresses the growth of triple-negative tumors in vivo.

    Directory of Open Access Journals (Sweden)

    Tiejun Zhao

    Full Text Available Triple-negative breast cancers are associated with poor clinical outcomes and new therapeutic strategies are clearly needed. Gallotannin (Gltn has been previously demonstrated to have potent anti-tumor properties against cholangiocarcinoma in mice, but little is known regarding its capacity to suppress tumor outgrowth in breast cancer models. We tested Gltn for potential growth inhibitory properties against a variety of breast cancer cell lines in vitro. In particular, triple-negative breast cancer cells display higher levels of sensitivity to Gltn. The loss of proliferative capacity in Gltn exposed cells is associated with slowed cell cycle progression and S phase arrest, dependent on Chk2 phosphorylation and further characterized by changes to proliferation related genes, such as cyclin D1 (CcnD1 as determined by Nanostring technology. Importantly, Gltn administered orally or via intraperitoneal (IP injections greatly reduced tumor outgrowth of triple-negative breast cells from mammary fat pads without signs of toxicity. In conclusion, these data strongly suggest that Gltn represents a novel approach to treat triple-negative breast carcinomas.

  2. The Growth Suppressing Effects of Girinimbine on Hepg2 Involve Induction of Apoptosis and Cell Cycle Arrest

    Directory of Open Access Journals (Sweden)

    Tang Sook Wah

    2011-08-01

    Full Text Available Murraya koenigii is an edible herb widely used in folk medicine. Here we report that girinimbine, a carbazole alkaloid isolated from this plant, inhibited the growth and induced apoptosis in human hepatocellular carcinoma, HepG2 cells. The MTT and LDH assay results showed that girinimbine decreased cell viability and increased cytotoxicity in a dose-and time-dependent manner selectively. Girinimbine-treated HepG2 cells showed typical morphological features of apoptosis, as observed from normal inverted microscopy and Hoechst 33342 assay. Furthermore, girinimbine treatment resulted in DNA fragmentation and elevated levels of caspase-3 in HepG2 cells. Girinimbine treatment also displayed a time-dependent accumulation of the Sub-G0/G1 peak (hypodiploid and caused G0/G1-phase arrest. Together, these results demonstrated for the first time that girinimbine could effectively induce programmed cell death in HepG2 cells and suggests the importance of conducting further investigations in preclinical human hepatocellular carcinoma models, especially on in vivo efficacy, to promote girinimbine for use as an anticancer agent against hepatocellular carcinoma.

  3. Silica Nanoparticles Sensitize Human Multiple Myeloma Cells to Snake (Walterinnesia aegyptia Venom-Induced Apoptosis and Growth Arrest

    Directory of Open Access Journals (Sweden)

    Douaa Sayed

    2012-01-01

    Full Text Available Background. Multiple myeloma (MM, an almost incurable disease, is the second most common blood cancer. Initial chemotherapeutic treatment could be successful; however, resistance development urges the use of higher toxic doses accompanied by hematopoietic stem cell transplantation. The establishment of more effective treatments that can overcome or circumvent chemoresistance has become a priority. We recently demonstrated that venom extracted from Walterinnesia aegyptia (WEV either alone or in combination with silica nanoparticles (WEV+NPs mediated the growth arrest and apoptosis of prostate cancer cells. In the present study, we evaluated the impact of WEV alone and WEV+NP on proliferation and apoptosis of MM cells. Methods. The impacts of WEV alone and WEV+NP were monitored in MM cells from 70 diagnosed patients. The influences of WEV and WEV+NP were assessed with flow cytometry analysis. Results. WEV alone and WEV+NP decreased the viability of MM cells. Using a CFSE proliferation assay, we found that WEV+NP strongly inhibited MM cell proliferation. Furthermore, analysis of the cell cycle using the propidium iodide (PI staining method indicated that WEV+NP strongly altered the cell cycle of MM cells and enhanced the induction of apoptosis. Conclusions. Our data reveal the biological effects of WEV and WEV+NP on MM cells that enable these compounds to function as effective treatments for MM.

  4. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma [Retraction

    Directory of Open Access Journals (Sweden)

    Huang W

    2017-12-01

    Full Text Available Huang W, Huang H, Wang L, Hu J, Song W. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma. OncoTargets and Therapy. 2017;10:2825–2833.This article has been retracted at the request of the Editor-in-Chief of OncoTargets and Therapy. It was brought to the attention of the Editorial team by the authors that in Lentivirus package and transfection part of the Materials and Methods section, the authors noted “a nontargeting shRNA (5′-GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT-3′ was used as control”. Recently the authors were advised by the supplier of the lentivirus there was an error in the illustration concerning the control group sequence. The correct sequence should be TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT rather than GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT. The authors cannot confirm that the sequence carried by the control group lentivirus was TTCTCCGAACGTGTCACGTCTCGA GACGTGACACGTTCGGAGAATTTTT so they have decided to respectfully retract this original research paper and perform the experiments again to retest the data. This retraction relates to

  5. Growth arrest specific gene 2 in tilapia (Oreochromis niloticus): molecular characterization and functional analysis under low-temperature stress.

    Science.gov (United States)

    Yang, ChangGeng; Wu, Fan; Lu, Xing; Jiang, Ming; Liu, Wei; Yu, Lijuan; Tian, Juan; Wen, Hua

    2017-07-17

    Growth arrest specific 2 (gas2) gene is a component of the microfilament system that plays a major role in the cell cycle, regulation of microfilaments, and cell morphology during apoptotic processes. However, little information is available on fish gas2. In this study, the tilapia (Oreochromis niloticus) gas2 gene was cloned and characterized for the first time. The open reading frame was 1020 bp, encoding 340 amino acids; the 5'-untranslated region (UTR) was 140 bp and the 3'-UTR was 70 bp, with a poly (A) tail. The highest promoter activity occurred in the regulatory region (-3000 to -2400 bp). The Gas2-GFP fusion protein was distributed within the cytoplasm. Quantitative reverse transcription-polymerase chain reaction and western blot analyses revealed that gas2 gene expression levels in the liver, muscle, and brain were clearly affected by low temperature stress. The results of gas2 RNAi showed decreased expression of the gas2 and P53 genes. These results suggest that the tilapia gas2 gene may be involved in low temperature stress-induced apoptosis.

  6. Growth Arrest Line Mimicking Lymphoma Involvement: The Findings of (99m)Tc-MDP Bone SPECT/CT and Serial Bone Scan in a Child with Non-Hodgkin's Lymphoma.

    Science.gov (United States)

    Kim, Chanwoo; Kim, Ji Young; Choi, Yun Young; Lee, Seunghun; Lee, Young-Ho

    2016-06-01

    Growth arrest lines appear as dense sclerotic lines parallel to the growth plate of long bones on radiography. We describe the case of a 9-year-old female with growth arrest lines initially masquerading as lymphoma involvement on (99m)Tc-MDP bone scintigraphy who had been treated with chemotherapy for non-Hodgkin's lymphoma about 3 years previously. Subsequent regional bone SPECT/CT clearly diagnosed the growth arrest lines, and retrograde review of previous bone scintigraphy demonstrated line migration in this patient. Growth arrest lines should be considered a possible diagnosis on bone scintigraphy, especially in the surveillance of children who have experienced severe childhood infections, malnutrition, immobilization, or treatment with immunosuppressive or chemotherapeutic drugs that may inhibit bone growth.

  7. Growth arrest line mimicking lymphoma involvement: The findings of 99mTc-MDP bone SPECT/CT and serial bone scan in a child with non-Hodgkin's lymphoma

    International Nuclear Information System (INIS)

    Kim, Chan Woo; Kim, Ji Young; Choi, Yun Young; Lee, Seung Hun; Lee, Young Ho

    2016-01-01

    Growth arrest lines appear as dense sclerotic lines parallel to the growth plate of long bones on radiography. We describe the case of a 9-year-old female with growth arrest lines initially masquerading as lymphoma involvement on 99m Tc-MDP bone scintigraphy who had been treated with chemotherapy for non-Hodgkin's lymphoma about 3 years previously. Subsequent regional bone SPECT/CT clearly diagnosed the growth arrest lines, and retrograde review of previous bone scintigraphy demonstrated line migration in this patient. Growth arrest lines should be considered a possible diagnosis on bone scintigraphy, especially in the surveillance of children who have experienced severe childhood infections, malnutrition, immobilization, or treatment with immunosuppressive or chemotherapeutic drugs that may inhibit bone growth

  8. Growth arrest line mimicking lymphoma involvement: The findings of {sup 99m}Tc-MDP bone SPECT/CT and serial bone scan in a child with non-Hodgkin's lymphoma

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Chan Woo; Kim, Ji Young; Choi, Yun Young; Lee, Seung Hun; Lee, Young Ho [Hanyang University Medical Center, Seoul (Korea, Republic of)

    2016-06-15

    Growth arrest lines appear as dense sclerotic lines parallel to the growth plate of long bones on radiography. We describe the case of a 9-year-old female with growth arrest lines initially masquerading as lymphoma involvement on {sup 99m}Tc-MDP bone scintigraphy who had been treated with chemotherapy for non-Hodgkin's lymphoma about 3 years previously. Subsequent regional bone SPECT/CT clearly diagnosed the growth arrest lines, and retrograde review of previous bone scintigraphy demonstrated line migration in this patient. Growth arrest lines should be considered a possible diagnosis on bone scintigraphy, especially in the surveillance of children who have experienced severe childhood infections, malnutrition, immobilization, or treatment with immunosuppressive or chemotherapeutic drugs that may inhibit bone growth.

  9. NBPF1, a tumor suppressor candidate in neuroblastoma, exerts growth inhibitory effects by inducing a G1 cell cycle arrest

    International Nuclear Information System (INIS)

    Andries, Vanessa; Vandepoele, Karl; Staes, Katrien; Berx, Geert; Bogaert, Pieter; Van Isterdael, Gert; Ginneberge, Daisy; Parthoens, Eef; Vandenbussche, Jonathan; Gevaert, Kris; Roy, Frans van

    2015-01-01

    NBPF1 (Neuroblastoma Breakpoint Family, member 1) was originally identified in a neuroblastoma patient on the basis of its disruption by a chromosomal translocation t(1;17)(p36.2;q11.2). Considering this genetic defect and the frequent genomic alterations of the NBPF1 locus in several cancer types, we hypothesized that NBPF1 is a tumor suppressor. Decreased expression of NBPF1 in neuroblastoma cell lines with loss of 1p36 heterozygosity and the marked decrease of anchorage-independent clonal growth of DLD1 colorectal carcinoma cells with induced NBPF1 expression further suggest that NBPF1 functions as tumor suppressor. However, little is known about the mechanisms involved. Expression of NBPF was analyzed in human skin and human cervix by immunohistochemistry. The effects of NBPF1 on the cell cycle were evaluated by flow cytometry. We investigated by real-time quantitative RT-PCR the expression profile of a panel of genes important in cell cycle regulation. Protein levels of CDKN1A-encoded p21 CIP1/WAF1 were determined by western blotting and the importance of p53 was shown by immunofluorescence and by a loss-of-function approach. LC-MS/MS analysis was used to investigate the proteome of DLD1 colon cancer cells with induced NBPF1 expression. Possible biological interactions between the differentially regulated proteins were investigated with the Ingenuity Pathway Analysis tool. We show that NBPF is expressed in the non-proliferative suprabasal layers of squamous stratified epithelia of human skin and cervix. Forced expression of NBPF1 in HEK293T cells resulted in a G1 cell cycle arrest that was accompanied by upregulation of the cyclin-dependent kinase inhibitor p21 CIP1/WAF1 in a p53-dependent manner. Additionally, forced expression of NBPF1 in two p53-mutant neuroblastoma cell lines also resulted in a G1 cell cycle arrest and CDKN1A upregulation. However, CDKN1A upregulation by NBPF1 was not observed in the DLD1 cells, which demonstrates that NBPF1 exerts cell

  10. Notch1 signaling inhibits growth of human hepatocellular carcinoma through induction of cell cycle arrest and apoptosis.

    Science.gov (United States)

    Qi, Runzi; An, Huazhang; Yu, Yizhi; Zhang, Minghui; Liu, Shuxun; Xu, Hongmei; Guo, Zhenghong; Cheng, Tao; Cao, Xuetao

    2003-12-01

    Notch signaling plays a critical role in maintaining the balance between cell proliferation, differentiation, and apoptosis; hence, perturbed Notch signaling may contribute to tumorigenesis. Hepatocellular carcinoma (HCC) is one of the most common malignant tumors in Africa and Asia. The mechanisms that orchestrate the multiple oncogenic insults required for initiation and progression of HCC are not clear. We constitutively overexpressed active Notch1 in human HCC to explore the effects of Notch1 signaling on HCC cell growth and to investigate the underlying molecular mechanisms. We show here that overexpression of Notch1 was able to inhibit the growth of HCC cells in vitro and in vivo. Biochemical analysis revealed the involvement of cell cycle regulated proteins in Notch1-mediated G(0)/G(1) arrest of HCC cells. Compared with green fluorescent protein (GFP) control, transient transfection of Notch1 ICN decreased expression of cyclin A (3.5-fold), cyclin D1 (2-fold), cyclin E (4.5-fold), CDK2 (2.8-fold), and the phosphorylated form of retinoblastoma protein (3-fold). Up-regulation of p21(waf/cip1) protein expression was observed in SMMC7721-ICN cells stably expressing active Notch1 but not in SMMC7721-GFP cells, which only express GFP. Furthermore, a 12-fold increase in p53 expression and an increase (4.8-fold) in Jun-NH(2)-terminal kinase activation were induced in SMMC7721-ICN cells compared with SMMC7721-GFP cells. In contrast, expression of the antiapoptotic Bcl-2 protein could not be detected in SMMC7721-ICN cells. These findings suggest that Notch1 signaling may participate in the development of HCC cells, affecting multiple pathways that control both cell proliferation and apoptosis.

  11. Serum Growth Arrest Specific Protein 6 (Gas-6 Levels in Patients with Schizophrenia

    Directory of Open Access Journals (Sweden)

    Fethullah Gerin

    2016-03-01

    Full Text Available Objective: We have investigated serum growth ar­rest-specific protein 6 (GAS-6 levels from patients with schizophrenia divided into acute phase remission phases as well as control group. Methods: This study was conducted in Psychiatry De­partment of Istanbul University Cerrahpasa Medical Fac­ulty. The patients who were diagnosed with schizophrenia after regular psychiatric examination according to DSM-IV criteria (n=22 as well as control subjects were includ­ed in the study. Schizophrenia patients with acute phase and remission phase were evaluated by Positive and Negative Syndrome Scale (PANSS and Clinical global Impression Scale (CGI-S. The serum GAS-6 levels of schizophrenia patients during acute phase and remission phase were compared with the serum GAS-6 levels of healthy controls. Serum GAS-6 levels were measured by commercial ELISA kits. Results: No difference was found in serum GAS-6 levels among the three groups; schizophrenia with acute phase, schizophrenia with remission phase, and controls. There were no correlations between serum GAS-6 levels and PANSS and CGI scores. Conclusion: To reach a definitive data and better in­terpretation about the relationship between GAS-6 and schizophrenia, future studies with larger groups of pa­tients with schizophrenia subdivided by drug naïve and treated with antipsychotics/other treatment modalities and controls are needed.

  12. Resveratrol induces growth arrest and apoptosis through activation of FOXO transcription factors in prostate cancer cells.

    Directory of Open Access Journals (Sweden)

    Qinghe Chen

    2010-12-01

    Full Text Available Resveratrol, a naturally occurring phytopolyphenol compound, has attracted extensive interest in recent years because of its diverse pharmacological characteristics. Although resveratrol possesses chemopreventive properties against several cancers, the molecular mechanisms by which it inhibits cell growth and induces apoptosis have not been clearly understood. The present study was carried out to examine whether PI3K/AKT/FOXO pathway mediates the biological effects of resveratrol.Resveratrol inhibited the phosphorylation of PI3K, AKT and mTOR. Resveratrol, PI3K inhibitors (LY294002 and Wortmannin and AKT inhibitor alone slightly induced apoptosis in LNCaP cells. These inhibitors further enhanced the apoptosis-inducing potential of resveratrol. Overexpression of wild-type PTEN slightly induced apoptosis. Wild type PTEN and PTEN-G129E enhanced resveratrol-induced apoptosis, whereas PTEN-G129R had no effect on proapoptotic effects of resveratrol. Furthermore, apoptosis-inducing potential of resveratrol was enhanced by dominant negative AKT, and inhibited by wild-type AKT and constitutively active AKT. Resveratrol has no effect on the expression of FKHR, FKHRL1 and AFX genes. The inhibition of FOXO phosphorylation by resveratrol resulted in its nuclear translocation, DNA binding and transcriptional activity. The inhibition of PI3K/AKT pathway induced FOXO transcriptional activity resulting in induction of Bim, TRAIL, p27/KIP1, DR4 and DR5, and inhibition of cyclin D1. Similarly, resveratrol-induced FOXO transcriptional activity was further enhanced when activation of PI3K/AKT pathway was blocked. Over-expression of phosphorylation deficient mutants of FOXO proteins (FOXO1-TM, FOXO3A-TM and FOXO4-TM induced FOXO transcriptional activity, which was further enhanced by resveratrol. Inhibition of FOXO transcription factors by shRNA blocked resveratrol-induced upregulation of Bim, TRAIL, DR4, DR5, p27/KIP1 and apoptosis, and inhibition of cyclin D1 by

  13. Health, growth and psychosocial adaptation of immigrant children.

    Science.gov (United States)

    Gualdi-Russo, Emanuela; Toselli, Stefania; Masotti, Sabrina; Marzouk, Diaa; Sundquist, Kristina; Sundquist, Jan

    2014-08-01

    The increasing population diversity in Europe demands clarification of possible ethnic influences on the growth and health of immigrant children and their psychosocial adaptation to the host countries. This article assesses recent data on immigrant children in Europe in comparison to European natives by means of a systematic review of the literature on growth patterns and data on children's health and adaptation. There were wide variations across countries in growth patterns and development of immigrant children and natives, with different trends in Central and Northern Europe with respect to Southern Europe. In general, age at menarche was lower in immigrant girls, while male pubertal progression seemed faster in immigrants than in European natives, even when puberty began after. Owing to the significant differences in anthropometric traits (mainly stature and weight), new reference growth curves for immigrant children were constructed for the largest minority groups in Central Europe. Possible negative effects on growth, health and psychosocial adaptation were pointed out for immigrant children living in low income, disadvantaged communities with a high prevalence of poor lifestyle habits. In conclusion, this review provides a framework for the health and growth of immigrant children in Europe in comparison to native-born children: the differences among European countries in growth and development of migrants and non-migrants are closely related to the clear anthropological differences among the ethnic groups due to genetic influences. Higher morbidity and mortality was frequently associated with the minority status of these children and their low socio-economic status. The observed ethnic differences in health reveal the need for adequate health care in all groups. Therefore, we provide suggestions for the development of health care strategies in Europe. © The Author 2014. Published by Oxford University Press on behalf of the European Public Health Association

  14. p21WAF1 expression induced by MEK/ERK pathway activation or inhibition correlates with growth arrest, myogenic differentiation and onco-phenotype reversal in rhabdomyosarcoma cells

    Directory of Open Access Journals (Sweden)

    Giacinti Cristina

    2005-12-01

    Full Text Available Abstract Background p21WAF1, implicated in the cell cycle control of both normal and malignant cells, can be induced by p53-dependent and independent mechanisms. In some cells, MEKs/ERKs regulate p21WAF1 transcriptionally, while in others they also affect the post-transcriptional processes. In myogenic differentiation, p21WAF1 expression is also controlled by the myogenic transcription factor MyoD. We have previously demonstrated that the embryonal rhabdomyosarcoma cell line undergoes growth arrest and myogenic differentiation following treatments with TPA and the MEK inhibitor U0126, which respectively activate and inhibit the ERK pathway. In this paper we attempt to clarify the mechanism of ERK-mediated and ERK-independent growth arrest and myogenic differentiation of embryonal and alveolar rhabdomyosarcoma cell lines, particularly as regards the expression of the cell cycle inhibitor p21WAF1. Results p21WAF1 expression and growth arrest are induced in both embryonal (RD and alveolar (RH30 rhabdomyosarcoma cell lines following TPA or MEK/ERK inhibitor (U0126 treatments, whereas myogenic differentiation is induced in RD cells alone. Furthermore, the TPA-mediated post-transcriptional mechanism of p21WAF1-enhanced expression in RD cells is due to activation of the MEK/ERK pathway, as shown by transfections with constitutively active MEK1 or MEK2, which induces p21WAF1 expression, and with ERK1 and ERK2 siRNA, which prevents p21WAF1 expression. By contrast, U0126-mediated p21WAF1 expression is controlled transcriptionally by the p38 pathway. Similarly, myogenin and MyoD expression is induced both by U0126 and TPA and is prevented by p38 inhibition. Although MyoD and myogenin depletion by siRNA prevents U0126-mediated p21WAF1 expression, the over-expression of these two transcription factors is insufficient to induce p21WAF1. These data suggest that the transcriptional mechanism of p21WAF1 expression in RD cells is rescued when MEK/ERK inhibition

  15. Andrographis paniculata extracts and major constituent diterpenoids inhibit growth of intrahepatic cholangiocarcinoma cells by inducing cell cycle arrest and apoptosis.

    Science.gov (United States)

    Suriyo, Tawit; Pholphana, Nanthanit; Rangkadilok, Nuchanart; Thiantanawat, Apinya; Watcharasit, Piyajit; Satayavivad, Jutamaad

    2014-05-01

    Andrographis paniculata is an important herbal medicine widely used in several Asian countries for the treatment of various diseases due to its broad range of pharmacological activities. The present study reports that A. paniculata extracts potently inhibit the growth of liver (HepG2 and SK-Hep1) and bile duct (HuCCA-1 and RMCCA-1) cancer cells. A. paniculata extracts with different contents of major diterpenoids, including andrographolide, 14-deoxy-11,12-didehydroandrographolide, neoandrographolide, and 14-deoxyandrographolide, exhibited a different potency of growth inhibition. The ethanolic extract of A. paniculata at the first true leaf stage, which contained a high amount of 14-deoxyandrographolide but a low amount of andrographolide, showed a cytotoxic effect to cancer cells about 4 times higher than the water extract of A. paniculata at the mature leaf stage, which contained a high amount of andrographolide but a low amount of 14-deoxyandrographolide. Andrographolide, not 14-deoxy-11,12-didehydroandrographolide, neoandrographolide, or 14-deoxyandrographolide, possessed potent cytotoxic activity against the growth of liver and bile duct cancer cells. The cytotoxic effect of the water extract of A. paniculata at the mature leaf stage could be explained by the present amount of andrographolide, while the cytotoxic effect of the ethanolic extract of A. paniculata at the first true leaf stage could not. HuCCA-1 cells showed more sensitivity to A. paniculata extracts and andrographolide than RMCCA-1 cells. Furthermore, the ethanolic extract of A. paniculata at the first true leaf stage increased cell cycle arrest at the G0/G1 and G2/M phases, and induced apoptosis in both HuCCA-1 and RMCCA-1 cells. The expressions of cyclin-D1, Bcl-2, and the inactive proenzyme form of caspase-3 were reduced by the ethanolic extract of A. paniculata in the first true leaf stage treatment, while a proapoptotic protein Bax was increased. The cleavage of poly (ADP

  16. Serum sex hormone and growth arrest-specific protein 6 levels in male patients with coronary heart disease

    Directory of Open Access Journals (Sweden)

    Rui Zhao

    2016-01-01

    Full Text Available Epidemiological studies have shown a high prevalence of low serum testosterone levels in men with cardiovascular disease. Moreover, the tyrosine kinase receptor Axl, the ligand of which is growth arrest-specific protein 6 (GAS6, is expressed in the vasculature, and serum GAS6 levels are associated with endothelial dysfunction and cardiovascular events. Testosterone regulates GAS6 gene transcription directly, which inhibits calcification of vascular smooth muscle cells and provides a mechanistic insight into the cardioprotective action of androgens. This study was designed to determine the correlation between serum GAS6 and testosterone levels in male patients with coronary heart disease (CHD. We recruited 225 patients with CHD and 102 apparently healthy controls. Serum concentrations of GAS6 and soluble Axl were quantified by an enzyme-linked immunosorbent assay. Levels of high-sensitivity C-reactive protein, testosterone, estradiol, and other routine biochemical markers were also measured. Testosterone decreased from 432.69 ± 14.40 to 300.76 ± 6.23 ng dl−1 (P < 0.001 and GAS6 decreased from 16.20 ± 0.31 to 12.51 ± 0.19 ng ml−1 (P < 0.001 in patients with CHD, compared with control subjects. Multiple linear regression analysis showed that serum testosterone and GAS6 levels were positively associated in male patients with CHD. Alterations in GAS6 levels may influence the development of CHD. Downregulation of GAS6/Axl signaling in the presence of low sex hormone levels during disease progression is a potential mechanism by which GAS6 affects CHD. This study provides novel results regarding the influence of sex hormones on serum GAS6 levels in patients with CHD.

  17. Growth arrest DNA damage-inducible gene 45 gamma expression as a prognostic and predictive biomarker in hepatocellular carcinoma.

    Science.gov (United States)

    Ou, Da-Liang; Shyue, Song-Kun; Lin, Liang-In; Feng, Zi-Rui; Liou, Jun-Yang; Fan, Hsiang-Hsuan; Lee, Bin-Shyun; Hsu, Chiun; Cheng, Ann-Lii

    2015-09-29

    Growth arrest DNA damage-inducible gene 45 (GADD45) family proteins play a crucial role in regulating cellular stress responses and apoptosis. The present study explored the prognostic and predictive role of GADD45γ in hepatocellular carcinoma (HCC) treatment. GADD45γ expression in HCC cells was examined using quantitative reverse transcription-PCR (qRT-PCR) and Western blotting. The control of GADD45γ transcription was examined using a luciferase reporter assay and chromatin immunoprecipitation. The in vivo induction of GADD45γ was performed using adenoviral transfer. The expression of GADD45γ in HCC tumor tissues from patients who had undergone curative resection was measured using qRT-PCR. Sorafenib induced expression of GADD45γ mRNA and protein, independent of its RAF kinase inhibitor activity. GADD45γ induction was more prominent in sorafenib-sensitive HCC cells (Huh-7 and HepG2, IC50 6-7 μM) than in sorafenib-resistant HCC cells (Hep3B, Huh-7R, and HepG2R, IC50 12-15 μM). Overexpression of GADD45γ reversed sorafenib resistance in vitro and in vivo, whereas GADD45γ expression knockdown by using siRNA partially abrogated the proapoptotic effects of sorafenib on sorafenib-sensitive cells. Overexpression of survivin in HCC cells abolished the antitumor enhancement between GADD45γ overexpression and sorafenib treatment, suggesting that survivin is a crucial mediator of antitumor effects of GADD45γ. GADD45γ expression decreased in tumors from patients with HCC who had undergone curative surgery, and low GADD45γ expression was an independent prognostic factor for poor survival, in addition to old age and vascular invasion. The preceding data indicate that GADD45γ suppression is a poor prognostic factor in patients with HCC and may help predict sorafenib efficacy in HCC.

  18. Daily Arrests

    Data.gov (United States)

    Montgomery County of Maryland — This dataset provides the public with arrest information from the Montgomery County Central Processing Unit (CPU) systems. The data presented is derived from every...

  19. Hepatocyte proliferation/growth arrest balance in the liver of mice during E. multilocularis infection: a coordinated 3-stage course.

    Directory of Open Access Journals (Sweden)

    Chuanshan Zhang

    Full Text Available BACKGROUND: Alveolar echinococcosis (AE is characterized by the tumor-like growth of Echinococcus (E. multilocularis. Very little is known on the influence of helminth parasites which develop in the liver on the proliferation/growth arrest metabolic pathways in the hepatocytes of the infected liver over the various stages of infection. METHODOLOGY/PRINCIPAL FINDINGS: Using Western blot analysis, qPCR and immunohistochemistry, we measured the levels of MAPKs activation, Cyclins, PCNA, Gadd45β, Gadd45γ, p53 and p21 expression in the murine AE model, from day 2 to 360 post-infection. Within the early (day 2-60 and middle (day60-180 stages, CyclinB1 and CyclinD1 gene expression increased up to day30 and then returned to control level after day60; Gadd45β, CyclinA and PCNA increased all over the period; ERK1/2 was permanently activated. Meanwhile, p53, p21 and Gadd45γ gene expression, and caspase 3 activation, gradually increased in a time-dependent manner. In the late stage (day180-360, p53, p21 and Gadd45γ gene expression were significantly higher in infected mice; JNK and caspase 3 were activated. TUNEL analysis showed apoptosis of hepatocytes. No significant change in CyclinE, p53 mRNA and p-p38 expression were observed at any time. CONCLUSIONS: Our data support the concept of a sequential activation of metabolic pathways which 1 would first favor parasitic, liver and immune cell proliferation and survival, and thus promote metacestode fertility and tolerance by the host, and 2 would then favor liver damage/apoptosis, impairment in protein synthesis and xenobiotic metabolism, as well as promote immune deficiency, and thus contribute to the dissemination of the protoscoleces after metacestode fertility has been acquired. These findings give a rational explanation to the clinical observations of hepatomegaly and of unexpected survival of AE patients after major hepatic resections, and of chronic liver injury, necrosis and of hepatic failure at

  20. A class of DNA-binding peptides from wheat bud causes growth inhibition, G2 cell cycle arrest and apoptosis induction in HeLa cells

    Directory of Open Access Journals (Sweden)

    Elgjo Kjell

    2009-07-01

    Full Text Available Abstract Background Deproteinized DNA from eukaryotic and prokaryotic cells still contains a low-molecular weight peptidic fraction which can be dissociated by alkalinization of the medium. This fraction inhibits RNA transcription and tumor cell growth. Removal from DNA of normal cells causes amplification of DNA template activity. This effect is lower or absent in several cancer cell lines. Likewise, the amount of active peptides in cancer cell DNA extracts is lower than in DNA preparation of the corresponding normal cells. Such evidence, and their ubiquitous presence, suggests that they are a regulatory, conserved factor involved in the control of normal cell growth and gene expression. Results We report that peptides extracted from wheat bud chromatin induce growth inhibition, G2 arrest and caspase-dependent apoptosis in HeLa cells. The growth rate is decreased in cells treated during the S phase only and it is accompanied by DNA damage and DNA synthesis inhibition. In G2 cells, this treatment induces inactivation of the CDK1-cyclin B1 complex and an increase of active chk1 kinase expression. Conclusion The data indicate that the chromatin peptidic pool inhibits HeLa cell growth by causing defective DNA replication which, in turn, arrests cell cycle progression to mitosis via G2 checkpoint pathway activation.

  1. Regenerative Endodontic Treatment of an Immature Necrotic Molar with Arrested Root Development by Using Recombinant Human Platelet-derived Growth Factor: A Case Report.

    Science.gov (United States)

    Zhujiang, Annie; Kim, Sahng G

    2016-01-01

    Regenerative endodontic treatment has provided a treatment option that aims to allow root maturation. The present report describes the regenerative endodontic treatment of a necrotic, immature molar by using recombinant human platelet-derived growth factor (rhPDGF-BB) and shows the continued root maturation in the tooth with arrested root development. A regenerative endodontic procedure that used a growth factor was performed for a necrotic molar with arrested root formation in a 20-year-old patient. Thorough disinfection by using mechanical instrumentation and copious irrigation of antimicrobial agents as well as intracanal medication with calcium hydroxide was performed throughout the first 2 appointments. At the third appointment, the root canals were irrigated with an antimicrobial solution and 17% EDTA, and bleeding was evoked by passing sterile paper points beyond the apex in each canal. Small pieces of a collagen membrane saturated with rhPDGF-BB solution from GEM 21S were packed into each canal. Mineral trioxide aggregate was placed, and Cavit and composite resin were used to restore the tooth. Complete root maturation and resolution of a periapical radiolucency were observed at the 15-month follow-up. The present report presents a regenerative endodontic procedure that uses rhPDGF-BB for a necrotic molar with arrested root development. The finding of continued root development in the present case suggests that regenerative endodontic treatment may be able to resume the root maturation process in teeth with arrested root formation. Further clinical studies are required to investigate the efficacy of rhPDGF-BB in regenerative endodontic treatment. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  2. Effects of gamma-radiation on cell growth, cycle arrest, death, and superoxide dismutase expression by DU 145 human prostate cancer cells

    Directory of Open Access Journals (Sweden)

    Vucic V.

    2006-01-01

    Full Text Available Gamma-irradiation (gamma-IR is extensively used in the treatment of hormone-resistant prostate carcinoma. The objective of the present study was to investigate the effects of 60Co gamma-IR on the growth, cell cycle arrest and cell death of the human prostate cancer cell line DU 145. The viability of DU 145 cells was measured by the Trypan blue exclusion assay and the 3(4,5-dimethylthiazol-2-yl-2,5,diphenyltetrazolium bromide test. Bromodeoxyuridine incorporation was used for the determination of cell proliferation. Cell cycle arrest and cell death were analyzed by flow cytometry. Superoxide dismutase (SOD, specifically CuZnSOD and MnSOD protein expression, after 10 Gy gamma-IR, was determined by Western immunoblotting analysis. gamma-IR treatment had a significant (P < 0.001 antiproliferative and cytotoxic effect on DU 145 cells. Both effects were time and dose dependent. Also, the dose of gamma-IR which inhibited DNA synthesis and cell proliferation by 50% was 9.7 Gy. Furthermore, gamma-IR induced cell cycle arrest in the G2/M phase and the percentage of cells in the G2/M phase was increased from 15% (control to 49% (IR cells, with a nonsignificant induction of apoptosis. Treatment with 10 Gy gamma-IR for 24, 48, and 72 h stimulated CuZnSOD and MnSOD protein expression in a time-dependent manner, approximately by 3- to 3.5-fold. These data suggest that CuZnSOD and MnSOD enzymes may play an important role in the gamma-IR-induced changes in DU 145 cell growth, cell cycle arrest and cell death.

  3. Growth arrest specific 2-like protein 1 expression is upregulated in podocytes through advanced glycation end-products.

    Science.gov (United States)

    Liebisch, Marita; Bondeva, Tzvetanka; Franke, Sybille; Hause, Stephan; Wolf, Gunter

    2017-04-01

    Growth arrest specific 2-like protein 1 (GAS2L1) protein is a member of the GAS2 family of proteins, known to regulate apoptosis and cellular cytoskeleton reorganization in different cells. Recently we identified that Gas2l1 gene expression in podocytes is influenced by advanced glycation end product-bovine serum albumin(AGE-BSA). The study was performed employing cultured podocytes and diabetic ( db/db ) mice, a model of type 2 diabetes. Akbuminuria as wellas urinary neutrophil gelatinase-associated lipocalin (NGAL) excretion as measured with specific ELISAs. Gene expression was analysed via semiquantitative and real-time polymerase chain reaction. The protein levels were determined by western blotting and immunostaining. We found that the Gas2l1 α isoform is expressed in podocytes. Treatment with AGE-BSA induced Gas2l1 α and Gas2 mRNA levels compared with controls incubated with non-glycated control BSA (Co-BSA). Moreover, application of the recombinant soluble receptor of AGEs (sRAGE), a competitor of cellular RAGE, reversed the AGE-BSA effect. Interestingly, AGE-BSA also increased the protein levels of GAS2L1α in a RAGE-dependent manner, but did not affect the GAS2 expression. Periodic acid-Schiff staining and albuminuria as well as urinary NGAL excretion revealed that db/db mice progressively developed diabetic nephropathy with renal accumulation of N ε -carboxy-methyl-lysine (immunohistochemistry, western blots). Analyses of GAS2L1α and GAS2 proteins in diabetic mice revealed that both were significantly elevated relative to their non-diabetic littermates. In addition, GAS2L1α and GAS2 proteins positively correlated with the accumulation of AGEs in the blood plasma of diabetic mice and the administration of sRAGE in diabetic mice reduced the glomerular expression of both proteins. We show for the first time that the protein expression of GAS2L1α in vitro and in vivo is regulated by the AGE-RAGE axis. The suppression of AGE ligation with their RAGE in

  4. Curcumin induces growth-arrest and apoptosis in association with the inhibition of constitutively active JAK-STAT pathway in T cell leukemia

    International Nuclear Information System (INIS)

    Rajasingh, Johnson; Raikwar, Himanshu P.; Muthian, Gladson; Johnson, Caroline; Bright, John J.

    2006-01-01

    Adult T cell leukemia is an aggressive and frequently fatal malignancy that expressess constitutively activated growth-signaling pathways in association with deregulated growth and resistance to apoptosis. Curcumin (diferuloylmethane) is a naturally occurring yellow pigment, isolated from the rhizomes of the plant Curcuma longa that has traditionally been used in the treatment of injury and inflammation. But the effect and mechanism of action of curcumin on T cell leukemia is not known. To investigate the antitumor activity of curcumin in T cell leukemia, we examined its effect on constitutive phosphorylation of JAK and STAT proteins, proliferation, and apoptosis in HTLV-I-transformed T cell lines. HTLV-I-transformed T cell leukemia lines, MT-2, HuT-102, and SLB-1, express constitutively phosphorylated JAK3, TYK2, STAT3, and STAT5 signaling proteins. In vitro treatment with curcumin induced a dose-dependent decrease in JAK and STAT phosphorylation resulting in the induction of growth-arrest and apoptosis in T cell leukemia. The induction of growth-arrest and apoptosis in association with the blockade of constitutively active JAK-STAT pathway suggests this be a mechanism by which curcumin induces antitumor activity in T cell leukemia

  5. Adaptive diversification of growth allometry in the plant Arabidopsis thaliana.

    Science.gov (United States)

    Vasseur, François; Exposito-Alonso, Moises; Ayala-Garay, Oscar J; Wang, George; Enquist, Brian J; Vile, Denis; Violle, Cyrille; Weigel, Detlef

    2018-03-27

    Seed plants vary tremendously in size and morphology; however, variation and covariation in plant traits may be governed, at least in part, by universal biophysical laws and biological constants. Metabolic scaling theory (MST) posits that whole-organismal metabolism and growth rate are under stabilizing selection that minimizes the scaling of hydrodynamic resistance and maximizes the scaling of resource uptake. This constrains variation in physiological traits and in the rate of biomass accumulation, so that they can be expressed as mathematical functions of plant size with near-constant allometric scaling exponents across species. However, the observed variation in scaling exponents calls into question the evolutionary drivers and the universality of allometric equations. We have measured growth scaling and fitness traits of 451 Arabidopsis thaliana accessions with sequenced genomes. Variation among accessions around the scaling exponent predicted by MST was correlated with relative growth rate, seed production, and stress resistance. Genomic analyses indicate that growth allometry is affected by many genes associated with local climate and abiotic stress response. The gene with the strongest effect, PUB4 , has molecular signatures of balancing selection, suggesting that intraspecific variation in growth scaling is maintained by opposing selection on the trade-off between seed production and abiotic stress resistance. Our findings suggest that variation in allometry contributes to local adaptation to contrasting environments. Our results help reconcile past debates on the origin of allometric scaling in biology and begin to link adaptive variation in allometric scaling to specific genes. Copyright © 2018 the Author(s). Published by PNAS.

  6. Adapting to Population Growth: The Evolutionary Alternative to Malthus

    Directory of Open Access Journals (Sweden)

    Axel Kristinsson

    2016-06-01

    Full Text Available A long-standing debate on the dynamics of population growth in human history has become polarized between a Malthusian stance and a Boserupian one. The former tends to view population growth as limited by carrying capacity, dependent on environment and technology, whereas the latter sees population growth itself as a major inducement to social, economic and technological developments. In this paper the authors experiment with approaching this debate by using recent developments in evolutionary theory. According to these, evolutionary principles, as expounded by Charles Darwin and subsequent evolutionary scientists, apply not only to biological evolution but also to social or cultural evolution. Here, the role of genes is taken over by culture and, since culture is much more pliable than our DNA, evolution speeds up. As the only organisms on Earth whose evolution relies as heavily on culture as on genes, humans have become extremely adaptable. Their hyper-adaptability suggest that humans, through their cultural evolution, have managed increasingly to adapt to their own growing population, thus succeeding in accommodating ever-growing numbers. This hypothesis fits the Boserupian approach to population very well but less so the Malthusian one, perhaps indicating a gradual shift from a Malthusian regime to a Boserupian one in human history. The hypothesis is discussed and examined through four case studies: The beginning of farming around Göbekli Tepe in southeast Turkey, the productive farming systems of Tiwanaku in South America, the population crisis of late medieval and early modern Iceland, and the ‘collapse’ of Rapa Nui (Easter Island.

  7. Resistance to ursodeoxycholic acid-induced growth arrest can also result in resistance to deoxycholic acid-induced apoptosis and increased tumorgenicity

    International Nuclear Information System (INIS)

    Powell, Ashley A; Akare, Sandeep; Qi, Wenqing; Herzer, Pascal; Jean-Louis, Samira; Feldman, Rebecca A; Martinez, Jesse D

    2006-01-01

    There is a large body of evidence which suggests that bile acids increase the risk of colon cancer and act as tumor promoters, however, the mechanism(s) of bile acids mediated tumorigenesis is not clear. Previously we showed that deoxycholic acid (DCA), a tumorogenic bile acid, and ursodeoxycholic acid (UDCA), a putative chemopreventive agent, exhibited distinct biological effects, yet appeared to act on some of the same signaling molecules. The present study was carried out to determine whether there is overlap in signaling pathways activated by tumorogenic bile acid DCA and chemopreventive bile acid UDCA. To determine whether there was an overlap in activation of signaling pathways by DCA and UDCA, we mutagenized HCT116 cells and then isolated cell lines resistant to UDCA induced growth arrest. These lines were then tested for their response to DCA induced apoptosis. We found that a majority of the cell lines resistant to UDCA-induced growth arrest were also resistant to DCA-induced apoptosis, implying an overlap in DCA and UDCA mediated signaling. Moreover, the cell lines which were the most resistant to DCA-induced apoptosis also exhibited a greater capacity for anchorage independent growth. We conclude that UDCA and DCA have overlapping signaling activities and that disregulation of these pathways can lead to a more advanced neoplastic phenotype

  8. Casticin impairs cell growth and induces cell apoptosis via cell cycle arrest in human oral cancer SCC-4 cells.

    Science.gov (United States)

    Chou, Guan-Ling; Peng, Shu-Fen; Liao, Ching-Lung; Ho, Heng-Chien; Lu, Kung-Wen; Lien, Jin-Cherng; Fan, Ming-Jen; La, Kuang-Chi; Chung, Jing-Gung

    2018-02-01

    Casticin, a polymethoxyflavone, present in natural plants, has been shown to have biological activities including anti-cancer activities. Herein, we investigated the anti-oral cancer activity of casticin on SCC-4 cells in vitro. Viable cells, cell cycle distribution, apoptotic cell death, reactive oxygen species (ROS) production, and Ca 2+ production, levels of ΔΨ m and caspase activity were measured by flow cytometric assay. Cell apoptosis associated protein expressions were examined by Western blotting and confocal laser microscopy. Results indicated that casticin induced cell morphological changes, DNA condensation and damage, decreased the total viable cells, induced G 2 /M phase arrest in SCC-4 cells. Casticin promoted ROS and Ca 2+ productions, decreases the levels of ΔΨ m , promoted caspase-3, -8, and -9 activities in SCC-4 cells. Western blotting assay demonstrated that casticin affect protein level associated with G2/M phase arrest and apoptosis. Confocal laser microscopy also confirmed that casticin increased the translocation of AIF and cytochrome c in SCC-4 cells. In conclusion, casticin decreased cell number through G 2 /M phase arrest and the induction of cell apoptosis through caspase- and mitochondria-dependent pathways in SCC-4 cells. © 2017 Wiley Periodicals, Inc.

  9. Ethanol enhances neutrophil membrane tether growth and slows rolling on P-selectin but reduces capture from flow and firm arrest on IL-1-treated endothelium.

    Science.gov (United States)

    Oh, Hana; Diamond, Scott L

    2008-08-15

    The effects of ethanol at physiological concentrations on neutrophil membrane tether pulling, adhesion lifetime, rolling, and firm arrest behavior were studied in parallel-plate flow chamber assays with adherent 1-microm-diameter P-selectin-coated beads, P-selectin-coated surfaces, or IL-1-stimulated human endothelium. Ethanol (0.3% by volume) had no effect on P-selectin glycoprotein ligand-1 (PSGL-1), L-selectin, or CD11b levels but caused PSGL-1 redistribution. Also, ethanol prevented fMLP-induced CD11b up-regulation. During neutrophil collisions with P-selectin-coated beads at venous wall shear rates of 25-100 s(-1), ethanol increased membrane tether length and membrane growth rate by 2- to 3-fold but reduced the adhesion efficiency (detectable bonding per total collisions) by 2- to 3-fold, compared with untreated neutrophils. Without ethanol treatment, adhesion efficiency and adhesion lifetime declined as wall shear rate was increased, whereas ethanol caused the adhesion lifetime over all events to increase from 0.1 s to 0.5 s as wall shear rate was increased, an example of pharmacologically induced hydrodynamic thresholding. Consistent with this increased membrane fluidity and reduced capture, ethanol reduced rolling velocity by 37% and rolling flux by 55% on P-selectin surfaces at 100 s(-1), compared with untreated neutrophils. On IL-1-stimulated endothelium, rolling velocity was unchanged by ethanol treatment, but the fraction of cells converting to firm arrest was reduced from 35% to 24% with ethanol. Overall, ethanol caused competing biophysical and biochemical effects that: 1) reduced capture due to PSGL-1 redistribution, 2) reduced rolling velocity due to increased membrane tether growth, and 3) reduced conversion to firm arrest.

  10. Increased Susceptibility to Apoptosis and Growth Arrest of Human Breast Cancer Cells Treated by a Snake Venom-Loaded Silica Nanoparticles

    Directory of Open Access Journals (Sweden)

    Gamal Badr

    2014-11-01

    Full Text Available Background: The development of effective treatments against metastatic cancers, including breast cancer, is among the most important challenges in current experimental and clinical cancer research. We recently demonstrated that Walterinnesia aegyptia venom (WEV, either alone or in combination with silica nanoparticles (WEV+NP, resulted in the growth arrest and apoptosis of different cancer cell lines. Aims: In the present study, we evaluated the impact of WEV alone and WEV+NP on human breast cancer cells isolated from cancer biopsies. Methods: The potential effects of WEV alone and WEV+NP on the proliferation, induction of apoptosis and generation of free radicals in breast cancer cells isolated from 80 patients clinically diagnosed with breast cancer were evaluated by flow cytometry and ELISA. Results: WEV alone and WEV+NP inhibited the proliferation, altered the cell cycle and enhanced the induction of apoptosis of the breast cancer cells by increasing the activities of caspase-3, caspase-8 and caspase-9. In addition, the combination of WEV and NP robustly sensitized the breast cancer cells to growth arrest and apoptosis by increasing the generation of free radicals, including reactive oxygen species (ROS, hydroperoxide and nitric oxide. The combination of WEV with NP significantly enhanced the anti-tumor effect of WEV in breast cancer cells. Conclusion: Our data indicate the therapeutic potential of the nanoparticle-sustained delivery of snake venom for the treatment of breast cancer.

  11. Radiation adaptive response for the growth of cultured glial cells

    International Nuclear Information System (INIS)

    Suzuki, S.; Miura, Y.; Kano, M.; Toda, T.; Urano, S.

    2003-01-01

    Full text: To examine the molecular mechanism of radiation adaptive response (RAR) for the growth of cultured glial cells and to investigate the influence of aging on the response, glial cells were cultured from young and aged rats (1 month and 24 months old). RAR for the growth of glial cells conditioned with a low dose of X-rays and subsequently exposed to a high dose of X-rays was examined for cell number and BrdU incorporation. Involvement of the subcellular signaling pathway factors in RAR was investigated using their inhibitors, activators and mutated glial cells. RAR was observed in cells cultured from young rats, but was not in cells from aged rats. The inhibitors of protein kinase C (PKC) and DNA-dependent protein kinase (DNA-PK) or phosphatidylinositol 3-kinase (PI3K) suppressed RAR. The activators of PKC instead of low dose irradiation also caused RAR. Moreover, glial cells cultured from severe combined immunodeficiency (scid) mice (CB-17 scid) and ataxia-telangiectasia (AT) cells from AT patients showed no RAR. These results indicated that PKC, ATM, DNAPK and/or PI3K were involved in RAR for growth and BrdU incorporation of cultured glial cells and RAR decreased with aging. Proteomics data of glial cells exposed to severe stress of H 2 O 2 or X-rays also will be presented in the conference since little or no difference has not been observed with slight stress yet

  12. A Novel Function for the nm23-Hl Gene: Overexpression in Human Breast Carcinoma Cells Leads to the Formation of Basement Membrane and Growth Arrest

    Energy Technology Data Exchange (ETDEWEB)

    Howlett, Anthony R; Petersen, Ole W; Steeg, Patricia S; Bissell, Mina J

    1994-01-01

    We have developed a culture system using reconstituted basement membrane components in which normal human mammary epithelial cells exhibit several aspects of the development and differentiation process, including formation of acinar-like structures, production and basal deposition of basement membrane components, and production and apical secretion of sialomucins. Cell lines and cultures from human breast carcinomas failed to recapitulate this process. The data indicate the importance of cellular interactions with the basement membrane in the regulation of normal breast differentiation and, potentially, its loss in neoplasia. Our purpose was to use this assay to investigate the role of the putative metastasis suppressor gene nm23-H1 in mammary development and differentiation. The metastatic human breast carcinoma cell line MDA-MB-435, clones transfected with a control pCMVBamneo vector, and clones transfected with pCMVBamneo vector containing nm23-H1 complementary DNA (the latter of which exhibited a substantial reduction in spontaneous metastatic potential in vivo) were cultured within a reconstituted basement membrane. Clones were examined for formation of acinus-like spheres, deposition of basement membrane components, production of sialomucin, polarization, and growth arrest. In contrast to the parental cell line and control transfectants, MDA-MB-435 breast carcinoma cells overexpressing Nm23-H1 protein regained several aspects of the normal phenotype within reconstituted basement membrane. Nm23-H1 protein-positive cells formed organized acinus-like spheres, deposited the basement membrane components type IV collagen and, to some extent, laminin to the outside of the spheres, expressed sialomucin, and growth arrested. Growth arrest of Nm23-H1 protein-positive cells was preceded by and correlated with formation of a basement membrane, suggesting a causal relationship. The data indicate a previously unidentified cause-and-effect relationship between nm23-H1 gene

  13. Expression of the bacterial type III effector DspA/E in Saccharomyces cerevisiae down-regulates the sphingolipid biosynthetic pathway leading to growth arrest.

    Science.gov (United States)

    Siamer, Sabrina; Guillas, Isabelle; Shimobayashi, Mitsugu; Kunz, Caroline; Hall, Michael N; Barny, Marie-Anne

    2014-06-27

    Erwinia amylovora, the bacterium responsible for fire blight, relies on a type III secretion system and a single injected effector, DspA/E, to induce disease in host plants. DspA/E belongs to the widespread AvrE family of type III effectors that suppress plant defense responses and promote bacterial growth following infection. Ectopic expression of DspA/E in plant or in Saccharomyces cerevisiae is toxic, indicating that DspA/E likely targets a cellular process conserved between yeast and plant. To unravel the mode of action of DspA/E, we screened the Euroscarf S. cerevisiae library for mutants resistant to DspA/E-induced growth arrest. The most resistant mutants (Δsur4, Δfen1, Δipt1, Δskn1, Δcsg1, Δcsg2, Δorm1, and Δorm2) were impaired in the sphingolipid biosynthetic pathway. Exogenously supplied sphingolipid precursors such as the long chain bases (LCBs) phytosphingosine and dihydrosphingosine also suppressed the DspA/E-induced yeast growth defect. Expression of DspA/E in yeast down-regulated LCB biosynthesis and induced a rapid decrease in LCB levels, indicating that serine palmitoyltransferase (SPT), the first and rate-limiting enzyme of the sphingolipid biosynthetic pathway, was repressed. SPT down-regulation was mediated by dephosphorylation and activation of Orm proteins that negatively regulate SPT. A Δcdc55 mutation affecting Cdc55-PP2A protein phosphatase activity prevented Orm dephosphorylation and suppressed DspA/E-induced growth arrest. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. SRJ23, a new semisynthetic andrographolide derivative: in vitro growth inhibition and mechanisms of cell cycle arrest and apoptosis in prostate cancer cells.

    Science.gov (United States)

    Wong, Hui Chyn; Wong, Charng Choon; Sagineedu, Sreenivasa Rao; Loke, Seng Cheong; Lajis, Nordin Haji; Stanslas, Johnson

    2014-10-01

    3,19-(3-Chloro-4-fluorobenzylidene)andrographolide (SRJ23), a new semisynthetic derivative of andrographolide (AGP), exhibited selectivity against prostate cancer cells in the US National Cancer Institute (NCI) in vitro anti-cancer screen. Herein, we report the in vitro growth inhibition and mechanisms of cell cycle arrest and apoptosis induced by SRJ23. 3-(4,5-Dimethythiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay was used in assessing in vitro growth inhibition of compounds against prostate cancer (PC-3, DU-145 and LNCaP) and mouse macrophage (RAW 264.7) cell lines. Flow cytometry was utilised to analyse cell cycle distribution, whereas fluorescence microscopy was performed to determine morphological cell death. DNA fragmentation and annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) flow cytometry were done to confirm apoptosis induced by SRJ23. Quantitation of cell cycle and apoptotic regulatory proteins were determined by immunoblotting. AGP and SRJ23 selectively inhibited the growth of prostate cancer cells compared with RAW 264.7 cells at low micromolar concentrations; however, SRJ23 was more potent. Mechanistically, SRJ23-treated PC-3 cells displayed down-regulation of cyclin-dependent kinase (CDK) 1 without affecting levels of CDK4 and cyclin D1. However, SRJ23 induced down-regulation of CDK4 and cyclin D1 but without affecting CDK1 in DU145 and LNCaP cell lines. DNA histogram analysis revealed that the SRJ23 induced G2/M in PC-3 cells but G1 arrest in DU-145 and LNCaP cells. Morphologically, both compounds induced predominantly apoptosis, which was further confirmed by DNA fragmentation and annexin V-FITC staining. The DNA fragmentation was inhibited in the presence of caspase 8 inhibitor (Z-IETD-FMK). Apoptosis was associated with an increase in caspase 8 expression and activation. This thought to have induced cleavage of Bid into t-Bid. Additionally, increased expression and activation of caspase 9 and Bax proteins were

  15. kurkku, a Phenotype of Acetabularia acetabulum That Is Arrested in Vegetative Growth, Can Be Rescued with Wild-Type Cytoplasm.

    Science.gov (United States)

    Mandoli, D. F.; Hunt, B. E.

    1996-02-01

    We isolated several spontaneous phenotypes in the giant unicell Acetabularia acetabulum that have vegetative terminal morphologies. Because they arrest in vegetative development, these cell lines are effectively immortalized. However, they had to be rescued before they could be studied via classical genetics because no heterozygotes from the original self-crosses were found, that is, the wild-type siblings yielded only wild-type progeny. We attempted to rescue these phenotypes in three ways: by amputating the cell apex, by "piggybacking" the mutant nucleus through development in a binucleate heterokaryon, and by replacing the abnormal apex with a wild-type apex. We used one of our immortal cell lines, kurkku, which has a terminal phenotype consistent with arrest early in the juvenile phase of vegetative development, as a prototype for these rescue methods. The kurkku phenotype segregated 1:3 in the original self-cross in which it arose as if it were a single, recessive Mendelian trait. Although amputation failed to rescue kurkku, we succeeded in compensating for the defect both in binucleate heterokaryons and in apical grafts to wild-type cells. kurkku was always recovered in the progeny of the self-crosses of these grafts. These unique ways of analyzing vegetative mutants, combined with the ability to then perform classical genetics, may make A. acetabulum a powerful unicellular model system for the study of vegetative phase change in plants.

  16. Identification of MicroRNAs Involved in Growth Arrest and Apoptosis in Hydrogen Peroxide-Treated Human Hepatocellular Carcinoma Cell Line HepG2

    Directory of Open Access Journals (Sweden)

    Yuan Luo

    2016-01-01

    Full Text Available Although both oxidative stress and microRNAs (miRNAs play vital roles in physiological and pathological processes, little is known about the interactions between them. In this study, we first described the regulation of H2O2 in cell viability, proliferation, cycle, and apoptosis of human hepatocellular carcinoma cell line HepG2. Then, miRNAs expression was profiled after H2O2 treatment. The results showed that high concentration of H2O2 (600 μM could decrease cell viability, inhibit cell proliferation, induce cell cycle arrest, and finally promote cell apoptosis. Conversely, no significant effects could be found under treatment with low concentration (30 μM. miRNAs array analysis identified 131 differentially expressed miRNAs (125 were upregulated and 6 were downregulated and predicted 13504 putative target genes of the deregulated miRNAs. Gene ontology (GO analysis revealed that the putative target genes were associated with H2O2-induced cell growth arrest and apoptosis. The subsequent bioinformatics analysis indicated that H2O2-response pathways, including MAPK signaling pathway, apoptosis, and pathways in cancer and cell cycle, were significantly affected. Overall, these results provided comprehensive information on the biological function of H2O2 treatment in HepG2 cells. The identification of miRNAs and their putative targets may offer new diagnostic and therapeutic strategies for liver cancer.

  17. 6-Gingerol Inhibits Growth of Colon Cancer Cell LoVo via Induction of G2/M Arrest

    Directory of Open Access Journals (Sweden)

    Ching-Bin Lin

    2012-01-01

    Full Text Available 6-Gingerol, a natural component of ginger, has been widely reported to possess antiinflammatory and antitumorigenic activities. Despite its potential efficacy against cancer, the anti-tumor mechanisms of 6-gingerol are complicated and remain sketchy. In the present study, we aimed to investigate the anti-tumor effects of 6-gingerol on colon cancer cells. Our results revealed that 6-gingerol treatment significantly reduced the cell viability of human colon cancer cell, LoVo, in a dose-dependent manner. Further flow cytometric analysis showed that 6-gingerol induced significant G2/M phase arrest and had slight influence on sub-G1 phase in LoVo cells. Therefore, levels of cyclins, cyclin-dependent kinases (CDKs, and their regulatory proteins involved in S-G2/M transition were investigated. Our findings revealed that levels of cyclin A, cyclin B1, and CDK1 were diminished; in contrast, levels of the negative cell cycle regulators p27Kip1 and p21Cip1 were increased in response to 6-gingerol treatment. In addition, 6-gingerol treatment elevated intracellular reactive oxygen species (ROS and phosphorylation level of p53. These findings indicate that exposure of 6-gingerol may induce intracellular ROS and upregulate p53, p27Kip1, and p21Cip1 levels leading to consequent decrease of CDK1, cyclin A, and cyclin B1 as result of cell cycle arrest in LoVo cells. It would be suggested that 6-gingerol should be beneficial to treatment of colon cancer.

  18. A novel muscarinic antagonist R2HBJJ inhibits non-small cell lung cancer cell growth and arrests the cell cycle in G0/G1.

    Directory of Open Access Journals (Sweden)

    Nan Hua

    Full Text Available Lung cancers express the cholinergic autocrine loop, which facilitates the progression of cancer cells. The antagonists of mAChRs have been demonstrated to depress the growth of small cell lung cancers (SCLCs. In this study we intended to investigate the growth inhibitory effect of R2HBJJ, a novel muscarinic antagonist, on non-small cell lung cancer (NSCLC cells and the possible mechanisms. The competitive binding assay revealed that R2HBJJ had a high affinity to M3 and M1 AChRs. R2HBJJ presented a strong anticholinergic activity on carbachol-induced contraction of guinea-pig trachea. R2HBJJ markedly suppressed the growth of NSCLC cells, such as H1299, H460 and H157. In H1299 cells, both R2HBJJ and its leading compound R2-PHC displayed significant anti-proliferative activity as M3 receptor antagonist darifenacin. Exogenous replenish of ACh could attenuate R2HBJJ-induced growth inhibition. Silencing M3 receptor or ChAT by specific-siRNAs resulted in a growth inhibition of 55.5% and 37.9% on H1299 cells 96 h post transfection, respectively. Further studies revealed that treatment with R2HBJJ arrested the cell cycle in G0/G1 by down-regulation of cyclin D1-CDK4/6-Rb. Therefore, the current study reveals that NSCLC cells express an autocrine and paracrine cholinergic system which stimulates the growth of NSCLC cells. R2HBJJ, as a novel mAChRs antagonist, can block the local cholinergic loop by antagonizing predominantly M3 receptors and inhibit NSCLC cell growth, which suggest that M3 receptor antagonist might be a potential chemotherapeutic regimen for NSCLC.

  19. UV-B inhibition of hypocotyl growth in etiolated Arabidopsis thaliana seedlings is a consequence of cell cycle arrest initiated by photodimer accumulation

    Science.gov (United States)

    Biever, Jessica J.; Brinkman, Doug; Gardner, Gary

    2014-01-01

    Ultraviolet (UV) radiation is an important constituent of sunlight that determines plant morphology and growth. It induces photomorphogenic responses but also causes damage to DNA. Arabidopsis mutants of the endonucleases that function in nucleotide excision repair, xpf-3 and uvr1-1, showed hypersensitivity to UV-B (280–320nm) in terms of inhibition of hypocotyl growth. SOG1 is a transcription factor that functions in the DNA damage signalling response after γ-irradiation. xpf mutants that carry the sog1-1 mutation showed hypocotyl growth inhibition after UV-B irradiation similar to the wild type. A DNA replication inhibitor, hydroxyurea (HU), also inhibited hypocotyl growth in etiolated seedlings, but xpf-3 was not hypersensitive to HU. UV-B irradiation induced accumulation of the G2/M-specific cell cycle reporter construct CYCB1;1-GUS in wild-type Arabidopsis seedlings that was consistent with the expected accumulation of photodimers and coincided with the time course of hypocotyl growth inhibition after UV-B treatment. Etiolated mutants of UVR8, a recently described UV-B photoreceptor gene, irradiated with UV-B showed inhibition of hypocotyl growth that was not different from that of the wild type, but they lacked UV-B-specific expression of chalcone synthase (CHS), as expected from previous reports. CHS expression after UV-B irradiation was not different in xpf-3 compared with the wild type, nor was it altered after HU treatment. These results suggest that hypocotyl growth inhibition by UV-B light in etiolated Arabidopsis seedlings, a photomorphogenic response, is dictated by signals originating from UV-B absorption by DNA that lead to cell cycle arrest. This process occurs distinct from UVR8 and its signalling pathway responsible for CHS induction. PMID:24591052

  20. Benzylidene derivatives of andrographolide inhibit growth of breast and colon cancer cells in vitro by inducing G1 arrest and apoptosis

    Science.gov (United States)

    Jada, S R; Matthews, C; Saad, M S; Hamzah, A S; Lajis, N H; Stevens, M F G; Stanslas, J

    2008-01-01

    Background and purpose: Andrographolide, the major phytoconstituent of Andrographis paniculata, was previously shown by us to have activity against breast cancer. This led to synthesis of new andrographolide analogues to find compounds with better activity than the parent compound. Selected benzylidene derivatives were investigated for their mechanisms of action by studying their effects on the cell cycle progression and cell death. Experimental approach: Microculture tetrazolium, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) and sulphorhodamine B (SRB) assays were utilized in assessing the in vitro growth inhibition and cytotoxicity of compounds. Flow cytometry was used to analyse the cell cycle distribution of control and treated cells. CDK1 and CDK4 levels were determined by western blotting. Apoptotic cell death was assessed by fluorescence microscopy and flow cytometry. Key results: Compounds, in nanomolar to micromolar concentrations, exhibited growth inhibition and cytotoxicity in MCF-7 (breast) and HCT-116 (colon) cancer cells. In the NCI screen, 3,19-(2-bromobenzylidene) andrographolide (SRJ09) and 3,19-(3-chloro-4-fluorobenzylidene) andrographolide (SRJ23) showed greater cytotoxic potency and selectivity than andrographolide. SRJ09 and SRJ23 induced G1 arrest and apoptosis in MCF-7 and HCT-116 cells, respectively. SRJ09 downregulated CDK4 but not CDK1 level in MCF-7 cells. Apoptosis induced by SRJ09 and SRJ23 in HCT-116 cells was confirmed by annexin V-FITC/PI flow cytometry analysis. Conclusion and implications: The new benzylidene derivatives of andrographolide are potential anticancer agents. SRJ09 emerged as the lead compound in this study, exhibiting anticancer activity by downregulating CDK4 to promote a G1 phase cell cycle arrest, coupled with induction of apoptosis. PMID:18806812

  1. Benzylidene derivatives of andrographolide inhibit growth of breast and colon cancer cells in vitro by inducing G(1) arrest and apoptosis.

    Science.gov (United States)

    Jada, S R; Matthews, C; Saad, M S; Hamzah, A S; Lajis, N H; Stevens, M F G; Stanslas, J

    2008-11-01

    Andrographolide, the major phytoconstituent of Andrographis paniculata, was previously shown by us to have activity against breast cancer. This led to synthesis of new andrographolide analogues to find compounds with better activity than the parent compound. Selected benzylidene derivatives were investigated for their mechanisms of action by studying their effects on the cell cycle progression and cell death. Microculture tetrazolium, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) and sulphorhodamine B (SRB) assays were utilized in assessing the in vitro growth inhibition and cytotoxicity of compounds. Flow cytometry was used to analyse the cell cycle distribution of control and treated cells. CDK1 and CDK4 levels were determined by western blotting. Apoptotic cell death was assessed by fluorescence microscopy and flow cytometry. Compounds, in nanomolar to micromolar concentrations, exhibited growth inhibition and cytotoxicity in MCF-7 (breast) and HCT-116 (colon) cancer cells. In the NCI screen, 3,19-(2-bromobenzylidene) andrographolide (SRJ09) and 3,19-(3-chloro-4-fluorobenzylidene) andrographolide (SRJ23) showed greater cytotoxic potency and selectivity than andrographolide. SRJ09 and SRJ23 induced G(1) arrest and apoptosis in MCF-7 and HCT-116 cells, respectively. SRJ09 downregulated CDK4 but not CDK1 level in MCF-7 cells. Apoptosis induced by SRJ09 and SRJ23 in HCT-116 cells was confirmed by annexin V-FITC/PI flow cytometry analysis. The new benzylidene derivatives of andrographolide are potential anticancer agents. SRJ09 emerged as the lead compound in this study, exhibiting anticancer activity by downregulating CDK4 to promote a G(1) phase cell cycle arrest, coupled with induction of apoptosis.

  2. Arresting Evolution.

    Science.gov (United States)

    Bull, James J; Barrick, Jeffrey E

    2017-12-01

    Evolution in the form of selective breeding has long been harnessed as a useful tool by humans. However, rapid evolution can also be a danger to our health and a stumbling block for biotechnology. Unwanted evolution can underlie the emergence of drug and pesticide resistance, cancer, and weeds. It makes live vaccines and engineered cells inherently unreliable and unpredictable, and therefore potentially unsafe. Yet, there are strategies that have been and can possibly be used to stop or slow many types of evolution. We review and classify existing population genetics-inspired methods for arresting evolution. Then, we discuss how genome editing techniques enable a radically new set of approaches to limit evolution. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  3. Neonatal cardiovascular system adaptation in babies with intrauterine growth retardation

    Directory of Open Access Journals (Sweden)

    I. N. Petrova

    2016-01-01

    Full Text Available Objective: to reveal the adaptive features of the cardiovascular system in newborn infants with intrauterine growth retardation (IUGR on the basis of a clinical instrumental study.Subjects and methods. A study group included 100 newborn infants with IUGR; a control group consisted of 40 babies with normal anthropometric measurements at birth. Medical history and clinical data and electrocardiographic and echocardiographic findings were analyzed.Results. All the examinees with IUGR had manifestations of cardiovascular system dysadaptation. There was a high rate of electrocardiographic changes, such as cardiac arrhythmias; low voltage; systolic overload of the right heart and left ventricle; signs of ventricular hypertrophy; and transient myocardial ischemia. The specific features of cardiac hemodynamics were decreased sizes of the left ventricle, lower parameters of its systolic function, and longer functioning of fetal communications.Conclusion. IUGR is associated with the development of cardiovascular system dysadaptation syndrome, which is due to prior perinatal hypoxia. The findings necessitate a follow-up of children by involving a cardiologist.

  4. Using quantitative PCR to Identify Kinesin-3 Genes that are Upregulated During Growth Arrest in MouseNIH3T3 Cells

    DEFF Research Database (Denmark)

    Thorsteinsson, Rikke; Christensen, Søren Tvorup; Pedersen, Lotte Bang

    2009-01-01

    Most cells in our body form a single primary cilium when entering growth arrest. During the past decade, a number of studies have revealed a key role for primary cilia in coordinating a variety of signaling pathways that control important cellular and developmental processes. Consequently, signif...

  5. Koelreuteria Formosana Extract Induces Growth Inhibition and Cell Death in Human Colon Carcinoma Cells via G2/M Arrest and LC3-II Activation-Dependent Autophagy.

    Science.gov (United States)

    Horng, Chi-Ting; Wu, Yueh-Jung; Chen, Pei-Ni; Chu, Shu-Chen; Tsai, Chun-Miao; Hsieh, Yih-Shou

    2017-01-01

    Autophagy is a self-destructive process that degrades cytoplasmic constituents. In our previous study, Koelreuteria formosana ethanolic extract (KFEE), which is obtained from natural plants endemic to Taiwan, has inhibited cell metastasis in renal carcinoma cells. However, the anticancer effects of KFEE on colon cancer remain unclear. In this study, KFEE exerted a strong cytotoxic effect on DLD-1 and COLO 205 human colorectal cancer cell lines. KFEE effectively inhibited cancer cell proliferation, induced G2/M-phase arrest associated with downregulaton of cyclin E, cyclin B and cdc25C and upregulation of p21, and induced cell death by activating autophagy but did not cause apoptotic cell death. Exposed KFEE cells showed increased levels of acridine orange, autophagic vacuoles, and LC3-II proteins, which are specific autophagic markers. Bcl-2, p-Akt, and p-mTOR levels, which have been implicated in autophagic downregulation, were decreased after KFEE treatment. Autophagy inhibitor 3-methyladenosine and bafilomycin-A1 and genetic silencing of LC3 attenuated KFEE-induced growth inhibition. These findings suggested that KFEE causes cytostatic effect through autophagy. In xenograft studies, oral administration of KFEE had significantly inhibited the tumor growth in nude mice that had received subcutaneous injection of DLD-1 cells. KFEE is a promising candidate in phytochemical-based, mechanistic, and pathway-targeted cancer prevention strategies.

  6. Targeting DTL induces cell cycle arrest and senescence and suppresses cell growth and colony formation through TPX2 inhibition in human hepatocellular carcinoma cells.

    Science.gov (United States)

    Chen, Yu-Chia; Chen, I-Shu; Huang, Guan-Jin; Kang, Chi-Hsiang; Wang, Kuo-Chiang; Tsao, Min-Jen; Pan, Hung-Wei

    2018-01-01

    Hepatocellular carcinoma (HCC) has an increasing incidence and high mortality. Surgical operation is not a comprehensive strategy for liver cancer. Moreover, tolerating systemic chemotherapy is difficult for patients with HCC because hepatic function is often impaired due to underlying cirrhosis. Therefore, a comprehensive strategy for cancer treatment should be developed. DTL (Cdc10-dependent transcript 2) is a critical regulator of cell cycle progression and genomic stability. In our previous study, the upregulation of DTL expression in aggressive HCC correlated positively with tumor grade and poor patient survival. We hypothesize that targeting DTL may provide a novel therapeutic strategy for liver cancer. DTL small interference RNAs were used to knock down DTL protein expression. A clonogenic assay, immunostaining, double thymidine block, imaging flow cytometry analysis, and a tumor spheroid formation assay were used to analyze the role of DTL in tumor cell growth, cell cycle progression, micronucleation, ploidy, and tumorigenicity. Our results demonstrated that targeting DTL reduced cell cycle regulators and chromosome segregation genes, resulting in increased cell micronucleation. DTL depletion inhibited liver cancer cell growth, increased senescence, and reduced tumorigenesis. DTL depletion resulted in the disruption of the mitotic proteins cyclin B, CDK1, securin, seprase, Aurora A, and Aurora B as well as the upregulation of the cell cycle arrest gene p21 . A rescue assay indicated that DTL should be targeted through TPX2 downregulation for cancer cell growth inhibition. Moreover, DTL silencing inhibited the growth of patient-derived primary cultured HCC cells. Our study results indicate that DTL is a potential novel target gene for treating liver cancer through liver cancer cell senescence induction. Furthermore, our results provide insights into molecular mechanisms for targeting DTL in liver cancer cells. The results also indicate several other starting

  7. Adaptability, growth and reproductive success of the Nile tilapia ...

    African Journals Online (AJOL)

    Despite the high contribution of the introduced Oreochromis niloticus as source of food and additional income to the local community, little has been documented on the adaptability and reproductive success of stocked fish in Ethiopia. This study was therefore, conducted to examine the adaptability and reproductive success ...

  8. Growth inhibition of the intestinal parasite Giardia lamblia by a dietary lectin is associated with arrest of the cell cycle.

    OpenAIRE

    Ortega-Barria, E; Ward, H D; Keusch, G T; Pereira, M E

    1994-01-01

    Giardia lamblia, a cause of diarrheal disease throughout the world, is a protozoan parasite that thrives in the small intestine. It is shown here that wheat germ agglutinin (WGA), a naturally occurring lectin widely consumed in normal human diets, reversibly inhibits the growth of G. lamblia trophozoites in vitro, and reduces infection by G. muris in the adult mouse model of giardiasis. The inhibitory effect was dose related, not associated with cytotoxicity and reversed by N-acetyl-D-glucosa...

  9. Generation of growth arrested Leishmania amastigotes: a tool to develop live attenuated vaccine candidates against visceral leishmaniasis.

    Science.gov (United States)

    Selvapandiyan, Angamuthu; Dey, Ranadhir; Gannavaram, Sreenivas; Solanki, Sumit; Salotra, Poonam; Nakhasi, Hira L

    2014-06-30

    Visceral leishmaniasis (VL) is fatal if not treated and is prevalent widely in the tropical and sub-tropical regions of world. VL is caused by the protozoan parasite Leishmania donovani or Leishmania infantum. Although several second generation vaccines have been licensed to protect dogs against VL, there are no effective vaccines against human VL [1]. Since people cured of leishmaniasis develop lifelong protection, development of live attenuated Leishmania parasites as vaccines, which can have controlled infection, may be a close surrogate to leishmanization. This can be achieved by deletion of genes involved in the regulation of growth and/or virulence of the parasite. Such mutant parasites generally do not revert to virulence in animal models even under conditions of induced immune suppression due to complete deletion of the essential gene(s). In the Leishmania life cycle, the intracellular amastigote form is the virulent form and causes disease in the mammalian hosts. We developed centrin gene deleted L. donovani parasites that displayed attenuated growth only in the amastigote stage and were found safe and efficacious against virulent challenge in the experimental animal models. Thus, targeting genes differentially expressed in the amastigote stage would potentially attenuate only the amastigote stage and hence controlled infectivity may be effective in developing immunity. This review lays out the strategies for attenuation of the growth of the amastigote form of Leishmania for use as live vaccine against leishmaniasis, with a focus on visceral leishmaniasis. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Antitumor action of 3-bromopyruvate implicates reorganized tumor growth regulatory components of tumor milieu, cell cycle arrest and induction of mitochondria-dependent tumor cell death.

    Science.gov (United States)

    Yadav, Saveg; Kujur, Praveen Kumar; Pandey, Shrish Kumar; Goel, Yugal; Maurya, Babu Nandan; Verma, Ashish; Kumar, Ajay; Singh, Rana Pratap; Singh, Sukh Mahendra

    2018-01-15

    Evidences demonstrate that metabolic inhibitor 3-bromopyruvate (3-BP) exerts a potent antitumor action against a wide range of malignancies. However, the effect of 3-BP on progression of the tumors of thymic origin remains unexplored. Although, constituents of tumor microenvironment (TME) plays a pivotal role in regulation of tumor progression, it remains unclear if 3-BP can alter the composition of the crucial tumor growth regulatory components of the external surrounding of tumor cells. Thus, the present investigation attempts to understand the effect of 3-BP administration to a host bearing a progressively growing tumor of thymic origin on tumor growth regulatory soluble, cellular and biophysical components of tumor milieu vis-à-vis understanding its association with tumor progression, accompanying cell cycle events and mode of cell death. Further, the expression of cell survival regulatory molecules and hemodynamic characteristics of the tumor milieu were analysed to decipher mechanisms underlying the antitumor action of 3-BP. Administration of 3-BP to tumor-bearing hosts retarded tumor progression accompanied by induction of tumor cell death, cell cycle arrest, declined metabolism, inhibited mitochondrial membrane potential, elevated release of cytochrome c and altered hemodynamics. Moreover, 3-BP reconstituted the external milieu, in concurrence with deregulated glucose and pH homeostasis and increased tumor infiltration by NK cells, macrophages, and T lymphocytes. Further, 3-BP administration altered the expression of key regulatory molecules involved in glucose uptake, intracellular pH and tumor cell survival. The outcomes of this study will help in optimizing the therapeutic application of 3-BP by targeting crucial tumor growth regulatory components of tumor milieu. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Circulatory Arrest, Brain Arrest and Death Determination

    Directory of Open Access Journals (Sweden)

    Sam David Shemie

    2018-03-01

    Full Text Available Technological advances, particularly in the capacity to support, replace or transplant failing organs, continue to challenge and refine our understanding of human death. Given the ability to reanimate organs before and after death, both inside and outside of the body, through reinstitution of oxygenated circulation, concepts related to death of organs (e.g. cardiac death are no longer valid. This paper advances the rationale for a single conceptual determination of death related to permanent brain arrest, resulting from primary brain injury or secondary to circulatory arrest. The clinical characteristics of brain arrest are the permanent loss of capacity for consciousness and loss of all brainstem functions. In the setting of circulatory arrest, death occurs after the arrest of circulation to the brain rather than death of the heart. Correspondingly, any intervention that resumes oxygenated circulation to the brain after circulatory arrest would invalidate the determination of death.

  12. Comparison of growth and yield adaptability indicators of two maize ...

    African Journals Online (AJOL)

    . ) cultivars under planting basin technique in Zimbabwe. ... season maize cultivars (P2859W and PHB3253) should opt for PHB3253 for better productivity. Key words: Early maturing cultivars, PHB3253 and P2859W performance, adaptation.

  13. The small molecule SI113 synergizes with mitotic spindle poisons in arresting the growth of human glioblastoma multiforme

    Science.gov (United States)

    Abbruzzese, Claudia; Catalogna, Giada; Gallo, Enzo; di Martino, Simona; Mileo, Anna M.; Carosi, Mariantonia; Dattilo, Vincenzo; Schenone, Silvia; Musumeci, Francesca; Lavia, Patrizia; Perrotti, Nicola; Amato, Rosario; Paggi, Marco G.

    2017-01-01

    Glioblastoma multiforme (GBM) is the deadliest brain tumor. State-of-art GBM therapy often fails to ensure control of a disease characterized by high frequency of recurrences and progression. In search for novel therapeutic approaches, we assayed the effect of compounds from a cancer drug library on the ADF GBM cell line, establishing their elevated sensitivity to mitotic spindle poisons. Our previous work showed that the effectiveness of the spindle poison paclitaxel in inhibiting cancer cell growth was dependent on the expression of RANBP1, a regulatory target of the serine/threonine kinase SGK1. Recently, we developed the small molecule SI113 to inhibit SGK1 activity. Therefore, we explored the outcome of the association between SI113 and selected spindle poisons, finding that these drugs generated a synergistic cytotoxic effect in GBM cells, drastically reducing their viability and clonogenic capabilities in vitro, as well as inhibiting tumor growth in vivo. We also defined the molecular bases of such a synergistic effect. Because SI113 displays low systemic toxicity, yet strong activity in potentiating the effect of radiotherapy in GBM cells, we believe that this drug could be a strong candidate for clinical trials, with the aim to add it to the current GBM therapeutic approaches. PMID:29340013

  14. The small molecule SI113 synergizes with mitotic spindle poisons in arresting the growth of human glioblastoma multiforme.

    Science.gov (United States)

    Abbruzzese, Claudia; Catalogna, Giada; Gallo, Enzo; di Martino, Simona; Mileo, Anna M; Carosi, Mariantonia; Dattilo, Vincenzo; Schenone, Silvia; Musumeci, Francesca; Lavia, Patrizia; Perrotti, Nicola; Amato, Rosario; Paggi, Marco G

    2017-12-19

    Glioblastoma multiforme (GBM) is the deadliest brain tumor. State-of-art GBM therapy often fails to ensure control of a disease characterized by high frequency of recurrences and progression. In search for novel therapeutic approaches, we assayed the effect of compounds from a cancer drug library on the ADF GBM cell line, establishing their elevated sensitivity to mitotic spindle poisons. Our previous work showed that the effectiveness of the spindle poison paclitaxel in inhibiting cancer cell growth was dependent on the expression of RANBP1, a regulatory target of the serine/threonine kinase SGK1. Recently, we developed the small molecule SI113 to inhibit SGK1 activity. Therefore, we explored the outcome of the association between SI113 and selected spindle poisons, finding that these drugs generated a synergistic cytotoxic effect in GBM cells, drastically reducing their viability and clonogenic capabilities in vitro , as well as inhibiting tumor growth in vivo . We also defined the molecular bases of such a synergistic effect. Because SI113 displays low systemic toxicity, yet strong activity in potentiating the effect of radiotherapy in GBM cells, we believe that this drug could be a strong candidate for clinical trials, with the aim to add it to the current GBM therapeutic approaches.

  15. Plant Isoquinoline Alkaloid Berberine Exhibits Chromatin Remodeling by Modulation of Histone Deacetylase To Induce Growth Arrest and Apoptosis in the A549 Cell Line.

    Science.gov (United States)

    Kalaiarasi, Arunachalam; Anusha, Chidambaram; Sankar, Renu; Rajasekaran, Subbiah; John Marshal, Jayaraj; Muthusamy, Karthikeyan; Ravikumar, Vilwanathan

    2016-12-21

    Histone deacetylases (HDACs) are a group of epigenetic enzymes that control gene expression through their repressive influence on histone deacetylation transcription. HDACs are probable therapeutic targets for cancer treatment, spurring the progress of different types of HDAC inhibitors. Further, natural-source-based derived bioactive compounds possess HDAC inhibitor property. In this way, we hypothesized that plant isoquinoline alkaloid berberine (BBR) could be a HDAC inhibitor in the human lung cancer A549 cell line. BBR represses total HDAC and also class I, II, and IV HDAC activity through hyperacetylation of histones. Furthermore, BBR triggers positive regulation of the sub-G 0 /G 1 cell cycle progression phase in A549 cells. Moreover, BBR-induced A549 cell growth arrest and morphological changes were confirmed using different fluorescence-dye-based microscope techniques. Additionally, BBR downregulates oncogenes (TNF-α, COX-2, MMP-2, and MMP-9) and upregulates tumor suppressor genes (p21 and p53) mRNA and protein expressions. Besides, BBR actively regulates Bcl-2/Bax family proteins and also triggered the caspase cascade apoptotic pathway in A549 cells. Our finding suggests that BBR mediates epigenetic reprogramming by HDAC inhibition, which may be the key mechanism for its antineoplastic activity.

  16. Opposing roles of C/EBPbeta and AP-1 in the control of fibroblast proliferation and growth arrest-specific gene expression

    DEFF Research Database (Denmark)

    Gagliardi, Mark; Maynard, Scott; Miyake, Tetsuaki

    2003-01-01

    Chicken embryo fibroblasts (CEF) express several growth arrest-specific (GAS) gene products in G0. In contact-inhibited cells, the expression of the most abundant of these proteins, the p20K lipocalin, is activated at the transcriptional level by C/EBPbeta. In this report, we describe the role of C....../EBPbeta in CEF proliferation. We show that the expression of a dominant negative mutant of C/EBPbeta (designated Delta184-C/EBPbeta) completely inhibited p20K expression at confluence and stimulated the proliferation of CEF without inducing transformation. Mouse embryo fibroblasts nullizygous for C/EBPbeta had...... in the levels of AP-1 proteins. Therefore, C/EBPbeta is a negative regulator of AP-1 expression and activity in CEF. The expression of cyclin D1 and cell proliferation were stimulated by the dominant negative mutant of C/EBPbeta but not in the presence of TAM67, a dominant negative mutant of c-Jun and AP-1. CEF...

  17. Growth Arrest-Specific 6 Enhances the Suppressive Function of CD4+CD25+ Regulatory T Cells Mainly through Axl Receptor

    Directory of Open Access Journals (Sweden)

    Guang-ju Zhao

    2017-01-01

    Full Text Available Background. Growth arrest-specific (Gas 6 is one of the endogenous ligands of TAM receptors (Tyro3, Axl, and Mertk, and its role as an immune modulator has been recently emphasized. Naturally occurring CD4+CD25+ regulatory T cells (Tregs are essential for the active suppression of autoimmunity. The present study was designed to investigate whether Tregs express TAM receptors and the potential role of Gas6-TAM signal in regulating the suppressive function of Tregs. Methods. The protein and mRNA levels of TAM receptors were determined by using Western blot, immunofluorescence, flow cytometry, and RT-PCR. Then, TAM receptors were silenced using targeted siRNA or blocked with specific antibody. The suppressive function of Tregs was assessed by using a CFSE-based T cell proliferation assay. Flow cytometry was used to determine the expression of Foxp3 and CTLA4 whereas cytokines secretion levels were measured by ELISA assay. Results. Tregs express both Axl and Mertk receptors. Gas6 increases the suppressive function of Tregs in vitro and in mice. Both Foxp3 and CTLA-4 expression on Tregs are enhanced after Gas6 stimulation. Gas6 enhances the suppressive activity of Tregs mainly through Axl receptor. Conclusion. Gas6 has a direct effect on the functions of CD4+CD25+Tregs mainly through its interaction with Axl receptor.

  18. Ability of Group IVB metallocene polyethers containing dienestrol to arrest the growth of selected cancer cell lines

    Science.gov (United States)

    2009-01-01

    Background Monomeric Group IVB (Ti, Zr and Hf) metallocenes represent a new class of antitumor compounds. There is literature on the general biological activities of some organotin compounds. Unfortunately, there is little information with respect to the molecular level activity of these organotin compounds. We recently started focusing on the anti-cancer activity of organotin polymers that we had made for other purposes and as part of our platinum anti-cancer effort. Methods For this study, we synthesized a new series of metallocene-containing compounds coupling the metallocene unit with dienestrol, a synthetic, nonsteroidal estrogen. This is part of our effort to couple known moieties that offer antitumor activity with biologically active units hoping to increase the biological activity of the combination. The materials were confirmed to be polymeric using light scattering photometry and the structural repeat unit was verified employing matrix assisted laser desorption ionization mass spectrometry and infrared spectroscopy results. Results The polymers demonstrated the ability to suppress the growth of a series of tumor cell lines originating from breast, colon, prostrate, and lung cancers at concentrations generally lower than those required for inhibition of cell growth by the commonly used antitumor drug cisplatin. Conclusion These drugs show great promise in vitro against a number of cancer cell lines and due to their polymeric nature will most likely be less toxic than currently used metal-containing drugs such as cisplatin. These drugs also offer several addition positive aspects. First, the reactants are commercially available so that additional synthetic steps are not needed. Second, synthesis of the polymer is rapid, occurring within about 15 seconds. Third, the interfacial synthetic system is already industrially employed in the synthesis of aromatic nylons and polycarbonates. Thus, the ability to synthesize large amounts of the drugs is straight

  19. Ability of Group IVB metallocene polyethers containing dienestrol to arrest the growth of selected cancer cell lines

    Directory of Open Access Journals (Sweden)

    Ashida Yuki

    2009-10-01

    Full Text Available Abstract Background Monomeric Group IVB (Ti, Zr and Hf metallocenes represent a new class of antitumor compounds. There is literature on the general biological activities of some organotin compounds. Unfortunately, there is little information with respect to the molecular level activity of these organotin compounds. We recently started focusing on the anti-cancer activity of organotin polymers that we had made for other purposes and as part of our platinum anti-cancer effort. Methods For this study, we synthesized a new series of metallocene-containing compounds coupling the metallocene unit with dienestrol, a synthetic, nonsteroidal estrogen. This is part of our effort to couple known moieties that offer antitumor activity with biologically active units hoping to increase the biological activity of the combination. The materials were confirmed to be polymeric using light scattering photometry and the structural repeat unit was verified employing matrix assisted laser desorption ionization mass spectrometry and infrared spectroscopy results. Results The polymers demonstrated the ability to suppress the growth of a series of tumor cell lines originating from breast, colon, prostrate, and lung cancers at concentrations generally lower than those required for inhibition of cell growth by the commonly used antitumor drug cisplatin. Conclusion These drugs show great promise in vitro against a number of cancer cell lines and due to their polymeric nature will most likely be less toxic than currently used metal-containing drugs such as cisplatin. These drugs also offer several addition positive aspects. First, the reactants are commercially available so that additional synthetic steps are not needed. Second, synthesis of the polymer is rapid, occurring within about 15 seconds. Third, the interfacial synthetic system is already industrially employed in the synthesis of aromatic nylons and polycarbonates. Thus, the ability to synthesize large amounts of

  20. Ability of Group IVB metallocene polyethers containing dienestrol to arrest the growth of selected cancer cell lines

    International Nuclear Information System (INIS)

    Roner, Michael R; Carraher, Charles E Jr; Shahi, Kimberly; Ashida, Yuki; Barot, Girish

    2009-01-01

    Monomeric Group IVB (Ti, Zr and Hf) metallocenes represent a new class of antitumor compounds. There is literature on the general biological activities of some organotin compounds. Unfortunately, there is little information with respect to the molecular level activity of these organotin compounds. We recently started focusing on the anti-cancer activity of organotin polymers that we had made for other purposes and as part of our platinum anti-cancer effort. For this study, we synthesized a new series of metallocene-containing compounds coupling the metallocene unit with dienestrol, a synthetic, nonsteroidal estrogen. This is part of our effort to couple known moieties that offer antitumor activity with biologically active units hoping to increase the biological activity of the combination. The materials were confirmed to be polymeric using light scattering photometry and the structural repeat unit was verified employing matrix assisted laser desorption ionization mass spectrometry and infrared spectroscopy results. The polymers demonstrated the ability to suppress the growth of a series of tumor cell lines originating from breast, colon, prostrate, and lung cancers at concentrations generally lower than those required for inhibition of cell growth by the commonly used antitumor drug cisplatin. These drugs show great promise in vitro against a number of cancer cell lines and due to their polymeric nature will most likely be less toxic than currently used metal-containing drugs such as cisplatin. These drugs also offer several addition positive aspects. First, the reactants are commercially available so that additional synthetic steps are not needed. Second, synthesis of the polymer is rapid, occurring within about 15 seconds. Third, the interfacial synthetic system is already industrially employed in the synthesis of aromatic nylons and polycarbonates. Thus, the ability to synthesize large amounts of the drugs is straight forward

  1. Domain requirements for the Dock adapter protein in growth- cone signaling

    OpenAIRE

    Rao, Yong; Zipursky, S. Lawrence

    1998-01-01

    Tyrosine phosphorylation has been implicated in growth-cone guidance through genetic, biochemical, and pharmacological studies. Adapter proteins containing src homology 2 (SH2) domains and src homology 3 (SH3) domains provide a means of linking guidance signaling through phosphotyrosine to downstream effectors regulating growth-cone motility. The Drosophila adapter, Dreadlocks (Dock), the homolog of mammalian Nck containing three N-terminal SH3 domains and a single SH2 domain, is highly speci...

  2. Comparison of growth and yield adaptability indicators of two maize ...

    African Journals Online (AJOL)

    admin

    2017-01-04

    Jan 4, 2017 ... It is therefore recommended that farmers who use planting basins in semi-arid areas for growing short season maize cultivars (P2859W and PHB3253) should opt for PHB3253 for better productivity. Key words: Early maturing cultivars, PHB3253 and P2859W performance, adaptation. INTRODUCTION.

  3. Possible adaptive growth responses of Chromolaena odorata during ...

    African Journals Online (AJOL)

    The changes in morphological and crude protein content of Chromolaena odorata to heavy metal-induced stress were investigated. This was with a view to providing information on the test plant adaptation potential during remediation of contaminated with . Stems of C. odorata were planted in soils treated with Cd (as CdCl) ...

  4. Hedging Medical Spending Growth: An Adaptive Expectations Approach

    Science.gov (United States)

    Lieberthal, Robert D.

    2016-01-01

    Long-term health insurance provides consumers with protection against persistent, negative health shocks. While the stochastic rise in medical spending growth may make some health risks harder to insure, financial assets could act as a hedge for medical spending growth risk. The purpose of this research was to determine whether such hedges exist. The results of this study were two-fold. First, the asset classes with the strongest statistical evidence as hedges were bonds, not stocks. Second, any strategy to hedge medical spending growth involved shorting assets i.e. betting against the bond or stock market. Health insurers writing long-term contracts should combine the use of hedges in the bond market with of portfolio diversification, and may benefit from health policies to moderate the uncertainty of medical spending growth. PMID:27635415

  5. Hypertonic conditions trigger transient plasmolysis, growth arrest and blockage of transporter endocytosis in Aspergillus nidulans and Saccharomyces cerevisiae.

    Science.gov (United States)

    Bitsikas, Vassilis; Karachaliou, Mayia; Gournas, Christos; Diallinas, George

    2011-01-01

    By using Aspergillus nidulans strains expressing functional GFP-tagged transporters under hypertonic conditions, we noticed the rapid appearance of cortical, relatively static, fluorescent patches (0.5-2.3 μm). These patches do not correspond to transporter microdomains as they co-localize with other plasma membrane-associated molecules, such as the pleckstrin homology (PH) domain and the SsoA t-Snare, or the lipophilic markers FM4-64 and filipin. In addition, they do not show characteristics of lipid rafts, MCCs or other membrane microdomains. Deconvoluted microscopic images showed that fluorescent patches correspond to plasma membrane invaginations. Transporters remain fully active during this phenomenon of localized plasmolysis. Plasmolysis was however associated with reduced growth rate and a dramatic blockage in transporter and FM4-64 endocytosis. These phenomena are transient and rapidly reversible upon wash-out of hypertonic media. Based on the observation that block in endocytosis by hypertonic treatment altered dramatically the cellular localization of tropomyosin (GFP-TpmA), although it did not affect the cortical appearance of upstream (SlaB-GFP) or downstream (AbpA-mRFP) endocytic components, we conclude that hypertonicity modifies actin dynamics and thus acts indirectly on endocytosis. This was further supported by the effect of latrunculin B, an actin depolymerization agent, on endocytosis. We show that the phenomena observed in A. nidulans also occur in Saccharomyces cerevisiae, suggesting that they constitute basic homeostatic responses of ascomycetes to hypertonic shock. Finally, our work shows that hypertonic treatments can be used as physiological tools to study the endocytic down-regulation of transporters in A. nidulans, as non-conditional genetic blocks affecting endocytic internalization are lethal or severely debilitating.

  6. Modeling posttraumatic growth among cancer patients: The roles of social support, appraisals, and adaptive coping.

    Science.gov (United States)

    Cao, Weidan; Qi, Xiaona; Cai, Deborah A; Han, Xuanye

    2018-01-01

    The purpose of the study was to build a model to explain the relationships between social support, uncontrollability appraisal, adaptive coping, and posttraumatic growth (PTG) among cancer patients in China. The participants who were cancer patients in a cancer hospital in China filled out a survey. The final sample size was 201. Structural equation modeling was used to build a model explaining PTG. Structural equation modeling results indicated that higher levels of social support predicted higher levels of adaptive coping, higher levels of uncontrollability appraisal predicted lower levels of adaptive coping, and higher levels of adaptive coping predicted higher levels of PTG. Moreover, adaptive coping was a mediator between social support and growth, as well as a mediator between uncontrollability and growth. The direct effects of social support and uncontrollability on PTG were insignificant. The model demonstrated the relationships between social support, uncontrollability appraisal, adaptive coping, and PTG. It could be concluded that uncontrollability appraisal was a required but not sufficient condition for PTG. Neither social support nor uncontrollability appraisal had direct influence on PTG. However, social support and uncontrollability might indirectly influence PTG, through adaptive coping. It implies that both internal factors (eg, cognitive appraisal and coping) and external factors (eg, social support) are required in order for growth to happen. Copyright © 2017 John Wiley & Sons, Ltd.

  7. A metabolite of nobiletin, 4'-demethylnobiletin and atorvastatin synergistically inhibits human colon cancer cell growth by inducing G0/G1 cell cycle arrest and apoptosis.

    Science.gov (United States)

    Wu, Xian; Song, Mingyue; Qiu, Peiju; Li, Fang; Wang, Minqi; Zheng, Jinkai; Wang, Qi; Xu, Fei; Xiao, Hang

    2018-01-24

    Combining different chemopreventive agents is a promising strategy to reduce cancer incidence and mortality due to potential synergistic interactions between these agents. Previously, we demonstrated that oral administration of nobiletin (NBT, a citrus flavonoid) at 0.05% (w/w, in diet) together with atorvastatin (ATST, a lipid-lowering drug) at 0.02% (w/w, in diet) produced much stronger inhibition against colon carcinogenesis in rats in comparison with that produced by NBT (at 0.1% w/w in diet) or ATST (at 0.04% w/w in diet) alone at higher doses. To further elucidate the mechanism of this promising synergy between NBT and ATST, herein, we measured the levels of NBT, its major metabolites and ATST in the colonic tissue of rats fed NBT (0.05% w/w, in diet) + ATST (0.02% w/w, in diet), and determined the mode of interaction between the major NBT metabolite and ATST in inhibiting colon cancer cell growth. HPLC-MS analysis showed that 4'-demethylnobiletin (4DN) is the most abundant metabolite of NBT with a level about 5-fold as high as that of NBT in the colonic tissue, which indicated the potential significance of 4DN in mediating the biological effects of NBT in the colon. We found that co-treatments of 4DN/ATST at 2 : 1 concentration ratio produced much stronger growth inhibitory effects on human colon cancer HT-29 cells than 4DN or ATST alone, and isobologram analysis confirmed that this enhanced inhibitory effect by the 4DN/ATST combination was highly synergistic. The co-treatment of 4DN/ATST led to G0/G1 cell cycle arrest and induced extensive apoptosis in HT-29 cells. Furthermore, the 4DN/ATST co-treatment profoundly modulated key signaling proteins related to the regulation of the cell cycle and apoptosis. Our results demonstrated a strong synergy produced by the 4DN/ATST co-treatment in inhibiting colon cancer cell growth, which provided a novel mechanism by which NBT/ATST in combination synergistically inhibit colon carcinogenesis.

  8. Growth arrest-specific transcript 5 associated snoRNA levels are related to p53 expression and DNA damage in colorectal cancer.

    Directory of Open Access Journals (Sweden)

    Jonathan Krell

    Full Text Available The growth arrest-specific transcript 5 gene (GAS5 encodes a long noncoding RNA (lncRNA and hosts a number of small nucleolar RNAs (snoRNAs that have recently been implicated in multiple cellular processes and cancer. Here, we investigate the relationship between DNA damage, p53, and the GAS5 snoRNAs to gain further insight into the potential role of this locus in cell survival and oncogenesis both in vivo and in vitro.We used quantitative techniques to analyse the effect of DNA damage on GAS5 snoRNA expression and to assess the relationship between p53 and the GAS5 snoRNAs in cancer cell lines and in normal, pre-malignant, and malignant human colorectal tissue and used biological techniques to suggest potential roles for these snoRNAs in the DNA damage response.GAS5-derived snoRNA expression was induced by DNA damage in a p53-dependent manner in colorectal cancer cell lines and their levels were not affected by DICER. Furthermore, p53 levels strongly correlated with GAS5-derived snoRNA expression in colorectal tissue.In aggregate, these data suggest that the GAS5-derived snoRNAs are under control of p53 and that they have an important role in mediating the p53 response to DNA damage, which may not relate to their function in the ribosome. We suggest that these snoRNAs are not processed by DICER to form smaller snoRNA-derived RNAs with microRNA (miRNA-like functions, but their precise role requires further evaluation. Furthermore, since GAS5 host snoRNAs are often used as endogenous controls in qPCR quantifications we show that their use as housekeeping genes in DNA damage experiments can lead to inaccurate results.

  9. Growth Arrest-Specific 6 Protein in Patients with Sjögren Syndrome: Determination of the Plasma Level and Expression in the Labial Salivary Gland.

    Directory of Open Access Journals (Sweden)

    Chen-Hung Chen

    Full Text Available Growth arrest-specific protein 6 (Gas6 is a vitamin K-dependent protein expressed by endothelial cells and leukocytes that are involved in cell survival, migration, and proliferation in response to inflammatory processes. The aim of this study was to assess the implications of Gas6 in Sjögren syndrome (SS and its expression in the labial salivary gland.A total of 254 adults, including 159 with primary Sjögren syndrome (pSS, 34 with secondary Sjögren syndrome (sSS, and 61 normal controls, were recruited. Plasma Gas6 concentrations were determined, and Gas6 expressions in labial salivary gland (LSG tissues from controls and pSS and sSS patients were also evaluated. Plasma Gas6 concentrations were significantly lower among patients with pSS than normal controls (13.5 ± 8.6 vs. 19.9 ± 13.4 ng/ml, p < 0.001. There were, however, no significant differences in plasma Gas6 levels between pSS and sSS patients (13.5 ± 8.6 vs. 16.9 ± 11.2 ng/ml, p = 0.068. In multivariate logistic regression analysis, after adjustment for white blood cell count, hemoglobin level, platelet count, lymphocyte count, and C3 and C4 levels, lower plasma Gas6 concentrations were significantly associated with an increased risk of SS. Moreover, by using a semi-quantitative scale to evaluate Gas6 expression in LSG tissues, Gas6 expression was found to be markedly lower in LSG tissues from pSS patients than in tissues from normal controls.Decreased plasma Gas6 concentration and LSG expression were associated with pSS. As such, Gas6 may represent a novel independent risk factor for pSS, with a potential role in salivary gland inflammation and dysfunction.

  10. Hwanggeumchal sorghum induces cell cycle arrest, and suppresses tumor growth and metastasis through Jak2/STAT pathways in breast cancer xenografts.

    Directory of Open Access Journals (Sweden)

    Jin Hee Park

    Full Text Available BACKGROUND: Cancer is one of the highly virulent diseases known to humankind with a high mortality rate. Breast cancer is the most common cancer in women worldwide. Sorghum is a principal cereal food in many parts of the world, and is critical in folk medicine of Asia and Africa. In the present study, we analyzed the effects of HSE in metastatic breast cancer. METHODOLOGY/PRINCIPAL FINDINGS: Preliminary studies conducted on MDA-MB 231 and MCF-7 xenograft models showed tumor growth suppression by HSE. Western blotting studies conducted both in vivo and in vitro to check the effect of HSE in Jak/STAT pathways. Anti-metastatic effects of HSE were confirmed using both MDA-MB 231 and MCF-7 metastatic animal models. These studies showed that HSE can modulate Jak/STAT pathways, and it hindered the STAT5b/IGF-1R and STAT3/VEGF pathways not only by down-regulating the expression of these signal molecules and but also by preventing their phosphorylation. The expression of angiogenic factors like VEGF, VEGF-R2 and cell cycle regulators like cyclin D, cyclin E, and pRb were found down-regulated by HSE. In addition, it also targets Brk, p53, and HIF-1α for anti-cancer effects. HSE induced G1 phase arrest and migration inhibition in MDA-MB 231 cells. The metastasis of breast cancer to the lungs also found blocked by HSE in the metastatic animal model. CONCLUSIONS/SIGNIFICANCE: Usage of HS as a dietary supplement is an inexpensive natural cancer therapy, without any side effects. We strongly recommend the use of HS as an edible therapeutic agent as it possesses tumor suppression, migration inhibition, and anti-metastatic effects on breast cancer.

  11. N-Methyl-N'-nitro-N-nitrosoguanidine-induced senescence-like growth arrest in colon cancer cells is associated with loss of adenomatous polyposis coli protein, microtubule organization, and telomeric DNA

    Directory of Open Access Journals (Sweden)

    Narayan Satya

    2004-01-01

    Full Text Available Abstract Background Cellular senescence is a state in which mammalian cells enter into an irreversible growth arrest and altered biological functions. The senescence response in mammalian cells can be elicited by DNA-damaging agents. In the present study we report that the DNA-damaging agent N-methyl-N'-nitro-N-nitrosoguanidine (MNNG is able to induce senescence in the HCT-116 colon cancer cell line. Results Cells treated with lower concentrations of MNNG (0–25 microM for 50 h showed a dose-dependent increase in G2/M phase arrest and apoptosis; however, cells treated with higher concentrations of MNNG (50–100 microM showed a senescence-like G0/G1 phase arrest which was confirmed by increased expression of β-galactosidase, a senescence induced marker. The G2/M phase arrest and apoptosis were found to be associated with increased levels of p53 protein, but the senescence-like G0/G1 phase arrest was dissociated with p53 protein levels, since the p53 protein levels decreased in senescence-like arrested cells. We further, determined whether the decreased level of p53 was a transcriptional or a translational phenomenon. The results revealed that the decreased level of p53 protein in senescence-like arrested cells was a transcriptional phenomenon since p53 mRNA levels simultaneously decreased after treatment with higher concentrations of MNNG. We also examined the effect of MNNG treatment on other cell cycle-related proteins such as p21, p27, cyclin B1, Cdc2, c-Myc and max. The expression levels of these proteins were increased in cells treated with lower concentrations of MNNG, which supported the G2/M phase arrest. However, cells treated with higher concentrations of MNNG showed decreased levels of these proteins, and hence, may not play a role in cell cycle arrest. We then examined a possible association of the expression of APC protein and telomeric DNA signals with cellular senescence in MNNG-treated cells. We found that protein and m

  12. Genetic basis of growth adaptation of Escherichia coli after deletion of pgi, a major metabolic gene.

    Directory of Open Access Journals (Sweden)

    Pep Charusanti

    2010-11-01

    Full Text Available Bacterial survival requires adaptation to different environmental perturbations such as exposure to antibiotics, changes in temperature or oxygen levels, DNA damage, and alternative nutrient sources. During adaptation, bacteria often develop beneficial mutations that confer increased fitness in the new environment. Adaptation to the loss of a major non-essential gene product that cripples growth, however, has not been studied at the whole-genome level. We investigated the ability of Escherichia coli K-12 MG1655 to overcome the loss of phosphoglucose isomerase (pgi by adaptively evolving ten replicates of E. coli lacking pgi for 50 days in glucose M9 minimal medium and by characterizing endpoint clones through whole-genome re-sequencing and phenotype profiling. We found that 1 the growth rates for all ten endpoint clones increased approximately 3-fold over the 50-day period; 2 two to five mutations arose during adaptation, most frequently in the NADH/NADPH transhydrogenases udhA and pntAB and in the stress-associated sigma factor rpoS; and 3 despite similar growth rates, at least three distinct endpoint phenotypes developed as defined by different rates of acetate and formate secretion. These results demonstrate that E. coli can adapt to the loss of a major metabolic gene product with only a handful of mutations and that adaptation can result in multiple, alternative phenotypes.

  13. Adaptive temperature profile control of a multizone crystal growth furnace

    Science.gov (United States)

    Batur, C.; Sharpless, R. B.; Duval, W. M. B.; Rosenthal, B. N.

    1991-01-01

    An intelligent measurement system is described which is used to assess the shape of a crystal while it is growing inside a multizone transparent furnace. A color video imaging system observes the crystal in real time, and determines the position and the shape of the interface. This information is used to evaluate the crystal growth rate, and to analyze the effects of translational velocity and temperature profiles on the shape of the interface. Creation of this knowledge base is the first step to incorporate image processing into furnace control.

  14. High-density growth arrest in Ras-transformed cells: low Cdk kinase activities in spite of absence of p27Kip Cdk-complexes

    DEFF Research Database (Denmark)

    Groth, Anja; Willumsen, Berthe Marie

    2005-01-01

    The ras oncogene transforms immortalized, contact-inhibited non-malignant murine fibroblasts into cells that are focus forming, exhibit increased saturation density, and are malignant in suitable hosts. Here, we examined changes in cell cycle control complexes as normal and Ras-transformed cells...... and Cdk2 complexes, as these kinases were inactivated. Ras-transformed cells failed to arrest at normal saturation density and showed no significant alterations in cell control complexes at this point. Yet, at an elevated density the Ras-transformed cells ceased to proliferate and entered a quiescent...... response to contact inhibition, a separate back-up mechanism enforced cell cycle arrest at higher cell density....

  15. Adaptation, Growth, and Resilience in Biological Distribution Networks

    Science.gov (United States)

    Ronellenfitsch, Henrik; Katifori, Eleni

    Highly optimized complex transport networks serve crucial functions in many man-made and natural systems such as power grids and plant or animal vasculature. Often, the relevant optimization functional is nonconvex and characterized by many local extrema. In general, finding the global, or nearly global optimum is difficult. In biological systems, it is believed that such an optimal state is slowly achieved through natural selection. However, general coarse grained models for flow networks with local positive feedback rules for the vessel conductivity typically get trapped in low efficiency, local minima. We show how the growth of the underlying tissue, coupled to the dynamical equations for network development, can drive the system to a dramatically improved optimal state. This general model provides a surprisingly simple explanation for the appearance of highly optimized transport networks in biology such as plant and animal vasculature. In addition, we show how the incorporation of spatially collective fluctuating sources yields a minimal model of realistic reticulation in distribution networks and thus resilience against damage.

  16. Domain requirements for the Dock adapter protein in growth- cone signaling.

    Science.gov (United States)

    Rao, Y; Zipursky, S L

    1998-03-03

    Tyrosine phosphorylation has been implicated in growth-cone guidance through genetic, biochemical, and pharmacological studies. Adapter proteins containing src homology 2 (SH2) domains and src homology 3 (SH3) domains provide a means of linking guidance signaling through phosphotyrosine to downstream effectors regulating growth-cone motility. The Drosophila adapter, Dreadlocks (Dock), the homolog of mammalian Nck containing three N-terminal SH3 domains and a single SH2 domain, is highly specialized for growth-cone guidance. In this paper, we demonstrate that Dock can couple signals in either an SH2-dependent or an SH2-independent fashion in photoreceptor (R cell) growth cones, and that Dock displays different domain requirements in different neurons.

  17. Immunoneutralization of endogenous glucagon-like peptide-2 reduces adaptive intestinal growth in diabetic rats

    DEFF Research Database (Denmark)

    Hartmann, Bolette; Thulesen, Jesper; Hare, Kristine Juul

    2002-01-01

    in the proximal part of the small intestine (10.84+/-0.44 mm(2)). Antibody treatment had no effect on body weight, blood glucose concentrations and food intake. Thus, blocking of endogenous GLP-2 in a model of adaptive intestinal growth reduces the growth response, providing strong evidence for a physiological......Supraphysiological doses of glucagon-like peptide-2 (GLP-2) have been shown to induce intestinal growth by increasing villus height and crypt depth and by decreasing apoptosis, but a physiological effect of GLP-2 has not yet been demonstrated. Earlier, we found elevated levels of endogenous GLP-2...... in untreated streptozotocin diabetic rats associated with marked intestinal growth. In the present study, we investigated the role of endogenous GLP-2 for this adaptive response. We included four groups of six rats: (1) diabetic rats treated with saline, (2) diabetic rats treated with non-specific antibodies...

  18. Growth, uniformity, local responsiveness, and system-wide adaptation in multiunit franchising

    OpenAIRE

    Boulay, Jacques; Caemmerer, Barbara; Evanschitzky, Heiner; Duniach, Krista

    2016-01-01

    Using the resource-based view framework, we investigate the link between multiunit franchising (MUF) and performance on four key challenges in franchise chain management: growth, uniformity, local responsiveness, and system-wide adaptation. Our findings support the assertion that system growth is positively related to MUF rate within a system, in particular in relation to geographic expansion. Interestingly, while uniformity does not seem to be related to MUF rate, we find marginal support fo...

  19. Transforming growth factor-β1 induces cell cycle arrest by activating atypical cyclin-dependent kinase 5 through up-regulation of Smad3-dependent p35 expression in human MCF10A mammary epithelial cells.

    Science.gov (United States)

    Park, Seong Ji; Yang, Sun Woo; Kim, Byung-Chul

    2016-04-08

    Cyclin-dependent kinases (Cdks) play important roles in control of cell division. Cdk5 is an atypical member of Cdk family with non-cyclin-like regulatory subunit, p35, but its role in cell cycle progression is still unclear. In the present study, we investigated the role of Cdk5/p35 on transforming growth factor-β1 (TGF-β1)-induced cell cycle arrest. In human MCF10A mammary epithelial cells, TGF-β1 induced cell cycle arrest at G1 phase and increased p27KIP1 expression. Interestingly, pretreatment with roscovitine, an inhibitor of Cdk5, or transfection with small interfering (si) RNAs specific to Cdk5 and p35 significantly attenuated the TGF-β1-induced p27KIP1 expression and cell cycle arrest. TGF-β1 increased Cdk5 activity via up-regulation of p35 gene at transcriptional level, and these effects were abolished by transfection with Smad3 siRNA or infection of adenovirus carrying Smad3 mutant at the C-tail (3SA). Chromatin immunoprecipitation assay further revealed that wild type Smad3, but not mutant Smad3 (3SA), binds to the region of the p35 promoter region (-1000--755) in a TGF-β1-dependent manner. These results for the first time demonstrate a role of Cdk5/p35 in the regulation of cell cycle progression modulated by TGF-β1. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Cold adaptation generates mutations associated with the growth of influenza B vaccine viruses.

    Science.gov (United States)

    Kim, Hyunsuh; Velkov, Tony; Camuglia, Sarina; Rockman, Steven P; Tannock, Gregory A

    2015-10-26

    Seasonal inactivated influenza vaccines are usually trivalent or quadrivalent and are prepared from accredited seed viruses. Yields of influenza A seed viruses can be enhanced by gene reassortment with high-yielding donor strains, but similar approaches for influenza B seed viruses have been largely unsuccessful. For vaccine manufacture influenza B seed viruses are usually adapted for high-growth by serial passage. Influenza B antigen yields so obtained are often unpredictable and selection of influenza B seed viruses by this method can be a rate-limiting step in seasonal influenza vaccine manufacture. We recently have shown that selection of stable cold-adapted mutants from seasonal epidemic influenza B viruses is associated with improved growth. In this study, specific mutations were identified that were responsible for growth enhancement as a consequence of adaptation to growth at lower temperatures. Molecular analysis revealed that the following mutations in the HA, NP and NA genes are required for enhanced viral growth: G156/N160 in the HA, E253, G375 in the NP and T146 in the NA genes. These results demonstrate that the growth of seasonal influenza B viruses can be optimized or improved significantly by specific gene modifications. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Serum Removal from Culture Induces Growth Arrest, Ploidy Alteration, Decrease in Infectivity and Differential Expression of Crucial Genes in Leishmania infantum Promastigotes.

    Directory of Open Access Journals (Sweden)

    Pedro J Alcolea

    Full Text Available Leishmania infantum is one of the species responsible for visceral leishmaniasis. This species is distributed basically in the Mediterranean basin. A recent outbreak in humans has been reported in Spain. Axenic cultures are performed for most procedures with Leishmania spp. promastigotes. This model is stable and reproducible and mimics the conditions of the gut of the sand fly host, which is the natural environment of promastigote development. Culture media are undefined because they contain mammalian serum, which is a rich source of complex lipids and proteins. Serum deprivation slows down the growth kinetics and therefore, yield in biomass. In fact, we have confirmed that the growth rate decreases, as well as infectivity. Ploidy is also affected. Regarding the transcriptome, a high-throughput approach has revealed a low differential expression rate but important differentially regulated genes. The most remarkable profiles are: up-regulation of the GINS Psf3, the fatty acyl-CoA synthase (FAS1, the glyoxylase I (GLO1, the hydrophilic surface protein B (HASPB, the methylmalonyl-CoA epimerase (MMCE and an amastin gene; and down-regulation of the gPEPCK and the arginase. Implications for metabolic adaptations, differentiation and infectivity are discussed herein.

  2. Climate Change Adaptation. Challenges and Opportunities for a Smart Urban Growth

    Directory of Open Access Journals (Sweden)

    Adriana Galderisi

    2014-04-01

    Full Text Available Climate change is one of the main environmental issues challenging cities in the 21th century. At present, more than half of the world population lives in cities and the latter are responsible for 60% to 80% of global energy consumption and greenhouse gas (GHG emissions, which are the main causes of the change in climate conditions. In the meantime, they are seriously threatened by the heterogeneous climate-related phenomena, very often exacerbated by the features of the cities themselves. In the last decade, international and European efforts have been mainly focused on mitigation rather than on adaptation strategies. Europe is one of the world leaders in global mitigation policies, while the issue of adaptation has gained growing importance in the last years. As underlined by the EU Strategy on adaptation to climate change, even though climate change mitigation still remains a priority for the global community, large room has to be devoted to adaptation measures, in order to effectively face the unavoidable impacts and related economic, environmental and social costs of climate change (EC, 2013. Thus, measures for adaptation to climate change are receiving an increasing financial support and a growing number of European countries are implementing national and urban adaptation strategies to deal with the actual and potential climate change impacts. According to the above considerations, this paper explores strengths and weaknesses of current adaptation strategies in European cities. First the main suggestions of the European Community to improve urban adaptation to climate change are examined; then, some recent Adaptation Plans are analyzed, in order to highlight challenges and opportunities arising from the adaptation processes at urban level and to explore the potential of Adaptation Plans to promote a smart growth in the European cities.

  3. Identifying Students at Risk: An Examination of Computer-Adaptive Measures and Latent Class Growth Analysis

    Science.gov (United States)

    Keller-Margulis, Milena; McQuillin, Samuel D.; Castañeda, Juan Javier; Ochs, Sarah; Jones, John H.

    2018-01-01

    Multitiered systems of support depend on screening technology to identify students at risk. The purpose of this study was to examine the use of a computer-adaptive test and latent class growth analysis (LCGA) to identify students at risk in reading with focus on the use of this methodology to characterize student performance in screening.…

  4. Repair of U/G and U/A in DNA by UNG2-associated repair complexes takes place predominantly by short-patch repair both in proliferating and growth-arrested cells

    DEFF Research Database (Denmark)

    Akbari, Mansour; Otterlei, Marit; Pena Diaz, Javier

    2004-01-01

    Nuclear uracil-DNA glycosylase UNG2 has an established role in repair of U/A pairs resulting from misincorporation of dUMP during replication. In antigen-stimulated B-lymphocytes UNG2 removes uracil from U/G mispairs as part of somatic hypermutation and class switch recombination processes. Using......, PCNA and DNA ligase, the latter detected as activity. Short-patch repair was the predominant mechanism both in extracts and UNG2-ARC from proliferating and less BER-proficient growth-arrested cells. Repair of U/G mispairs and U/A pairs was completely inhibited by neutralizing UNG...

  5. A novel parameter estimation method for metal oxide surge arrester ...

    Indian Academy of Sciences (India)

    Accurate modelling and exact determination of Metal Oxide (MO) surge arrester parameters are very important for arrester allocation, insulation coordination studies and systems reliability calculations. In this paper, a new technique, which is the combination of Adaptive Particle Swarm Optimization (APSO) and Ant Colony ...

  6. Salinity fluctuation influencing biological adaptation: growth dynamics and Na+ /K+ -ATPase activity in a euryhaline bacterium.

    Science.gov (United States)

    Yang, Hao; Meng, Yang; Song, Youxin; Tan, Yalin; Warren, Alan; Li, Jiqiu; Lin, Xiaofeng

    2017-07-01

    Although salinity fluctuation is a prominent characteristic of many coastal ecosystems, its effects on biological adaptation have not yet been fully recognized. To test the salinity fluctuations on biological adaptation, population growth dynamics and Na + /K + -ATPase activity were investigated in the euryhaline bacterium Idiomarina sp. DYB, which was acclimated at different salinity exposure levels, exposure times, and shifts in direction of salinity. Results showed: (1) bacterial population growth dynamics and Na + /K + -ATPase activity changed significantly in response to salinity fluctuation; (2) patterns of variation in bacterial growth dynamics were related to exposure times, levels of salinity, and shifts in direction of salinity change; (3) significant tradeoffs were detected between growth rate (r) and carrying capacity (K) on the one hand, and Na + /K + -ATPase activity on the other; and (4) beneficial acclimation was confirmed in Idiomarina sp. DYB. In brief, this study demonstrated that salinity fluctuation can change the population growth dynamics, Na + /K + -ATPase activity, and tradeoffs between r, K, and Na + /K + -ATPase activity, thus facilitating bacterial adaption in a changing environment. These findings provide constructive information for determining biological response patterns to environmental change. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Irreversibility of a bad start: early exposure to osmotic stress limits growth and adaptive developmental plasticity.

    Science.gov (United States)

    Wu, Chi-Shiun; Gomez-Mestre, Ivan; Kam, Yeong-Choy

    2012-05-01

    Harsh environments experienced early in development have immediate effects and potentially long-lasting consequences throughout ontogeny. We examined how salinity fluctuations affected survival, growth and development of Fejervarya limnocharis tadpoles. Specifically, we tested whether initial salinity effects on growth and rates of development were reversible and whether they affected the tadpoles' ability to adaptively accelerate development in response to deteriorating conditions later in development. Tadpoles were initially assigned to either low or high salinity, and then some were switched between salinity levels upon reaching either Gosner stage 30 (early switch) or 38 (late switch). All tadpoles initially experiencing low salinity survived whereas those initially experiencing high salinity had poor survival, even if switched to low salinity. Growth and developmental rates of tadpoles initially assigned to high salinity did not increase after osmotic stress release. Initial low salinity conditions allowed tadpoles to attain a fast pace of development even if exposed to high salinity afterwards. Tadpoles experiencing high salinity only late in development metamorphosed faster and at a smaller size, indicating an adaptive acceleration of development to avoid osmotic stress. Nonetheless, early exposure to high salinity precluded adaptive acceleration of development, always causing delayed metamorphosis relative to those in initially low salinity. Our results thus show that stressful environments experienced early in development can critically impact life history traits, having long-lasting or irreversible effects, and restricting their ability to produce adaptive plastic responses.

  8. Defining Old Growth for Fire-adapted Forests of the Western United States

    Directory of Open Access Journals (Sweden)

    Merrill R. Kaufmann

    2007-12-01

    Full Text Available There are varying definitions of old-growth forests because of differences in environment and differing fire influence across the Intermountain West. Two general types of forests reflect the role of fire: 1 forests shaped by natural changes in structure and species makeup - plant succession - that are driven by competitive differences among species and individual trees and by small-scale disturbances, and 2 forests where plant succession processes are disrupted by major biological disturbances (fire, insects, wind, or drought extending across larger areas. Some case examples of old-growth forests where fire was historically frequent are used. The examples sketch out the typical biophysical settings, fire regime, natural disturbance factors, spatial features of patches, and the processes and conditions that produce spatial changes of the landscape over time. These examples confirm the complexity of describing or defining old growth in frequent-fire forests. We define fire-adapted forests at three spatial scales, whereas the standard definition of old growth refers to a patch or stand condition. Our definition is based on ecological principles rather than on the cultural aspects of old growth. It focuses on central tendencies, given all the possible combinations of conditions and processes, that move forests toward old growth in the fire-adapted forests of the Intermountain West.

  9. Genetic Adaptation to Growth Under Laboratory Conditions in Escherichia coli and Salmonella enterica

    Directory of Open Access Journals (Sweden)

    Anna Knöppel

    2018-04-01

    Full Text Available Experimental evolution under controlled laboratory conditions is becoming increasingly important to address various evolutionary questions, including, for example, the dynamics and mechanisms of genetic adaptation to different growth and stress conditions. In such experiments, mutations typically appear that increase the fitness under the conditions tested (medium adaptation, but that are not necessarily of interest for the specific research question. Here, we have identified mutations that appeared during serial passage of E. coli and S. enterica in four different and commonly used laboratory media and measured the relative competitive fitness and maximum growth rate of 111 genetically re-constituted strains, carrying different single and multiple mutations. Little overlap was found between the mutations that were selected in the two species and the different media, implying that adaptation occurs via different genetic pathways. Furthermore, we show that commonly occurring adaptive mutations can generate undesired genetic variation in a population and reduce the accuracy of competition experiments. However, by introducing media adaptation mutations with large effects into the parental strain that was used for the evolution experiment, the variation (standard deviation was decreased 10-fold, and it was possible to measure fitness differences between two competitors as small as |s| < 0.001.

  10. Placental adaptations to the maternal-fetal environment: implications for fetal growth and developmental programming.

    Science.gov (United States)

    Sandovici, Ionel; Hoelle, Katharina; Angiolini, Emily; Constância, Miguel

    2012-07-01

    The placenta is a transient organ found in eutherian mammals that evolved primarily to provide nutrients for the developing fetus. The placenta exchanges a wide array of nutrients, endocrine signals, cytokines and growth factors with the mother and the fetus, thereby regulating intrauterine development. Recent studies show that the placenta is not just a passive organ mediating maternal-fetal exchange. It can adapt its capacity to supply nutrients in response to intrinsic and extrinsic variations in the maternal-fetal environment. These dynamic adaptations are thought to occur to maximize fetal growth and viability at birth in the prevailing conditions in utero. However, some of these adaptations may also affect the development of individual fetal tissues, with patho-physiological consequences long after birth. Here, this review summarizes current knowledge on the causes, possible mechanisms and consequences of placental adaptive responses, with a focus on the regulation of transporter-mediated processes for nutrients. This review also highlights the emerging roles that imprinted genes and epigenetic mechanisms of gene regulation may play in placental adaptations to the maternal-fetal environment. Copyright © 2012 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

  11. Effect of a Previous Acid Adaptation of Zygosaccharomyces bailii on its Growth Kinetic in Acidic Media

    Directory of Open Access Journals (Sweden)

    Alex Tchuenchieu

    2014-11-01

    Full Text Available The growth response of Zygosaccharomyces bailii acid adapted cells was assessed in acidified media. Yeast cells were first pre-cultured in nutrient broth adjusted with hydrochloric, citric and malic acid to pH 4; 4.5; 5; 5.5; 6 and 6.5. Moreover, they were also grown in two controls consisting of nutrient broth and nutrient broth supplemented with 1% of glucose both adjusted at pH 7. The variation of pH before and after the growth along with yeast concentration was measured. The cells pre-cultured in controls conditions and in the three conditions at pH 5 were then each inoculated in six BHI medium consisting of BHI adjusted with hydrochloric, citric and malic acid at pH 5.5 and 3.5. The growth was monitored by spectrophotometry and the yeast concentration after incubation was obtained by microscopy using a Thoma cell chamber. DMFit 2.1 was used to plot the growth curves and to estimate the growth parameters. All the pre-cultures and cultures were made at 37°C during 24 hours. During the pre-cultures, an important decrease of pH was noted in nutrient broth supplemented with glucose, moving from 7 to 3.81. In all the other pre-cultures, just a little variation was observed ranging from -0.57 to 0.50. Growth was observed in all the conditions, except at pH4. By growing the cells coming from the selected pre-cultures conditions in the different acidic BHI media, it appears that acid adaptation enhance the growth at pH 5.5 no matter the acid contains in the medium and the acid to which the cells were adapted. However, this acid adaptation was not sufficient to initiate growth at pH 3.5 after 24 hours of incubation at 37°C. Growth rate was significantly affected by the pH of the pre-culture medium and the acid present in the culture medium. Pre-culture with glucose supplementation was the only parameter studied affecting the latency.

  12. Mortality affects adaptive allocation to growth and reproduction: field evidence from a guild of body snatchers.

    Science.gov (United States)

    Hechinger, Ryan F

    2010-05-07

    The probability of being killed by external factors (extrinsic mortality) should influence how individuals allocate limited resources to the competing processes of growth and reproduction. Increased extrinsic mortality should select for decreased allocation to growth and for increased reproductive effort. This study presents perhaps the first clear cross-species test of this hypothesis, capitalizing on the unique properties offered by a diverse guild of parasitic castrators (body snatchers). I quantify growth, reproductive effort, and expected extrinsic mortality for several species that, despite being different species, use the same species' phenotype for growth and survival. These are eight trematode parasitic castrators-the individuals of which infect and take over the bodies of the same host species-and their uninfected host, the California horn snail. As predicted, across species, growth decreased with increased extrinsic mortality, while reproductive effort increased with increased extrinsic mortality. The trematode parasitic castrator species (operating stolen host bodies) that were more likely to be killed by dominant species allocated less to growth and relatively more to current reproduction than did species with greater life expectancies. Both genders of uninfected snails fit into the patterns observed for the parasitic castrator species, allocating as much to growth and to current reproduction as expected given their probability of reproductive death (castration by trematode parasites). Additionally, species differences appeared to represent species-specific adaptations, not general plastic responses to local mortality risk. Broadly, this research illustrates that parasitic castrator guilds can allow unique comparative tests discerning the forces promoting adaptive evolution. The specific findings of this study support the hypothesis that extrinsic mortality influences species differences in growth and reproduction.

  13. Maternal pelvic dimensions and neonatal size: Implications for growth plasticity in early life as adaptation.

    Science.gov (United States)

    Wells, Jonathan C K; Figueiroa, José N; Alves, Joao G

    2017-01-01

    Patterns of fetal growth predict non-communicable disease risk in adult life, but fetal growth variability appears to have a relatively weak association with maternal nutritional dynamics during pregnancy. This challenges the interpretation of fetal growth variability as 'adaptation'. We hypothesized that associations of maternal size and nutritional status with neonatal size are mediated by the dimensions of the maternal pelvis. We analysed data on maternal height, body mass index (BMI) and pelvic dimensions (conjugate, inter-spinous and inter-cristal diameters) and neonatal gestational age, weight, length, thorax girth and head girth ( n = 224). Multiple regression analysis was used to identify independent maternal predictors of neonatal size, and the mediating role of neonatal head girth in these associations. Pelvic dimensions displaced maternal BMI as a predictor of birth weight, explaining 11.6% of the variance. Maternal conjugate and inter-spinous diameters predicted neonatal length, thorax girth and head girth, whereas inter-cristal diameter only predicted neonatal length. Associations of pelvic dimensions with birth length, but not birth weight, were mediated by neonatal head girth. Pelvic dimensions predicted neonatal size better than maternal BMI, and these associations were mostly independent of maternal height. Sensitivity of fetal growth to pelvic dimensions reduces the risk of cephalo-pelvic disproportion, potentially a strong selective pressure during secular trends in height. Selection on fetal adaptation to relatively inflexible components of maternal phenotype, rather than directly to external ecological conditions, may help explain high levels of growth plasticity during late fetal life and early infancy.

  14. Pittsburgh Police Arrest Data

    Data.gov (United States)

    Allegheny County / City of Pittsburgh / Western PA Regional Data Center — Arrest data contains information on people taken into custody by City of Pittsburgh police officers. More serious crimes such as felony offenses are more likely to...

  15. Adaptation, growth and survival of tilapia (Oreochromis niloticus) in Bafgh brackish water

    OpenAIRE

    Sarsangi, A.H.; Mohammadi, M.; Mashaii, N.; Rajabipou, F.; Bitaraf, A.; Askari, H.M.; Moazedi, J.; Nezamabadi, H.; Hosseinzadeh Sahafi, H.

    2012-01-01

    An experiment was conducted to evaluate the possibility of adaptation, growth and survival of Nile tilapia (Oreochromis niloticus) with 0.3g initial weight and red tilapia (Oreochromis sp.) with 0.7g initial weight in underground brackish water. Fry of Nile tilapia and red tilapia imported from Indonesia and after passing larviculture (25g) were examined separately in fiber glass tank by two replicate. Fish were fed at a restricted feeding program according to standard table during the light ...

  16. Effect of modeled microgravity on radiation-induced adaptive response of root growth in Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Deng, Chenguang; Wang, Ting; Wu, Jingjing; Xu, Wei; Li, Huasheng; Liu, Min

    2017-01-01

    Highlights: • The radio-adaptive response (RAR) of A. thaliana root growth is modulated in microgravity. • The DNA damage repairs in RAR are regulated by microgravity. • The phytohormone auxin plays a regulatory role in the modulation of microgravity on RAR of root growth. - Abstract: Space particles have an inevitable impact on organisms during space missions; radio-adaptive response (RAR) is a critical radiation effect due to both low-dose background and sudden high-dose radiation exposure during solar storms. Although it is relevant to consider RAR within the context of microgravity, another major space environmental factor, there is no existing evidence as to its effects on RAR. In the present study, we established an experimental method for detecting the effects of gamma-irradiation on the primary root growth of Arabidopsis thaliana, in which RAR of root growth was significantly induced by several dose combinations. Microgravity was simulated using a two-dimensional rotation clinostat. It was shown that RAR of root growth was significantly inhibited under the modeled microgravity condition, and was absent in pgm-1 plants that had impaired gravity sensing in root tips. These results suggest that RAR could be modulated in microgravity. Time course analysis showed that microgravity affected either the development of radio-resistance induced by priming irradiation, or the responses of plants to challenging irradiation. After treatment with the modeled microgravity, attenuation in priming irradiation-induced expressions of DNA repair genes (AtKu70 and AtRAD54), and reduced DNA repair efficiency in response to challenging irradiation were observed. In plant roots, the polar transportation of the phytohormone auxin is regulated by gravity, and treatment with an exogenous auxin (indole-3-acetic acid) prevented the induction of RAR of root growth, suggesting that auxin might play a regulatory role in the interaction between microgravity and RAR of root growth.

  17. Arrested larval development in cattle nematodes.

    Science.gov (United States)

    Armour, J; Duncan, M

    1987-06-01

    Most economically important cattle nematodes are able to arrest their larval development within the host - entering a period of dormancy or hypobiosis. Arrested larvae have a low death rate, and large numbers can accumulate in infected cattle during the grazing season. Because of this, outbreaks of disease caused by such nematodes can occur at times when recent infection with the parasites could not have occurred, for example during winter in temperature northern climates when cattle are normally housed. The capacity to arrest is a heritable trait. It is seen as an adaptation by the parasite to avoid further development to its free-living stages during times when the climate is unsuitable for free-living survival. But levels of arrestment can vary markedly in different regions, in different cattle, and under different management regimes. Climatic factors, previous conditioning, host immune status, and farm management all seem to affect arrestment levels. In this article, James Armour and Mary Duncan review the biological basis of the phenomenon, and discuss the apparently conflicting views on how it is controlled.

  18. Original research paper. Hydrazinyldiene-chroman-2,4-diones in inducing growth arrest and apoptosis in breast cancer cells: Synergism with doxorubicin and correlation with physicochemical properties.

    Science.gov (United States)

    Ballazhi, Lulzime; Imeri, Faik; Jashari, Ahmed; Popovski, Emil; Stojković, Goran; Dimovski, Aleksandar J; Mikhova, Bozhana; Mladenovska, Kristina

    2017-03-01

    This study evaluates the effects of previously synthesized hydrazinyldiene-chroman-2,4-diones on cell proliferation and apoptosis, cell cycle distribution and migration capacity of MCF-7 breast cancer cells in synergy with doxorubicin. Physicochemical properties of the synthesized compounds were correlated with their structure and activity. Significant cell viability decrease in comparison with the effect of doxorubicin alone and the reference 4-hydroxycoumarin was observed when combination treatment comprising doxorubicin and the title compounds was applied. Synergistic effect with doxorubicin was also observed in down-regulation of phospho-Thr308Akt levels, confirming reduced proliferation and increased apoptosis. Combined treatment increased the percentage of cells arrested at the G2/M stage. Additive inhibition of cell migration was also observed, pointing to the possibility of reducing the risk of metastases. With their solubility profile and log D7.4, all the synthesized compounds follow Lipinski's rule of five for good permeability (absorption) potential.

  19. Adaptation.

    Science.gov (United States)

    Broom, Donald M

    2006-01-01

    The term adaptation is used in biology in three different ways. It may refer to changes which occur at the cell and organ level, or at the individual level, or at the level of gene action and evolutionary processes. Adaptation by cells, especially nerve cells helps in: communication within the body, the distinguishing of stimuli, the avoidance of overload and the conservation of energy. The time course and complexity of these mechanisms varies. Adaptive characters of organisms, including adaptive behaviours, increase fitness so this adaptation is evolutionary. The major part of this paper concerns adaptation by individuals and its relationships to welfare. In complex animals, feed forward control is widely used. Individuals predict problems and adapt by acting before the environmental effect is substantial. Much of adaptation involves brain control and animals have a set of needs, located in the brain and acting largely via motivational mechanisms, to regulate life. Needs may be for resources but are also for actions and stimuli which are part of the mechanism which has evolved to obtain the resources. Hence pigs do not just need food but need to be able to carry out actions like rooting in earth or manipulating materials which are part of foraging behaviour. The welfare of an individual is its state as regards its attempts to cope with its environment. This state includes various adaptive mechanisms including feelings and those which cope with disease. The part of welfare which is concerned with coping with pathology is health. Disease, which implies some significant effect of pathology, always results in poor welfare. Welfare varies over a range from very good, when adaptation is effective and there are feelings of pleasure or contentment, to very poor. A key point concerning the concept of individual adaptation in relation to welfare is that welfare may be good or poor while adaptation is occurring. Some adaptation is very easy and energetically cheap and

  20. Pronounced metabolic changes in adaptation to biofilm growth by Streptococcus pneumoniae.

    Science.gov (United States)

    Allan, Raymond N; Skipp, Paul; Jefferies, Johanna; Clarke, Stuart C; Faust, Saul N; Hall-Stoodley, Luanne; Webb, Jeremy

    2014-01-01

    Streptococcus pneumoniae accounts for a significant global burden of morbidity and mortality and biofilm development is increasingly recognised as important for colonization and infection. Analysis of protein expression patterns during biofilm development may therefore provide valuable insights to the understanding of pneumococcal persistence strategies and to improve vaccines. iTRAQ (isobaric tagging for relative and absolute quantification), a high-throughput gel-free proteomic approach which allows high resolution quantitative comparisons of protein profiles between multiple phenotypes, was used to interrogate planktonic and biofilm growth in a clinical serotype 14 strain. Comparative analyses of protein expression between log-phase planktonic and 1-day and 7-day biofilm cultures representing nascent and late phase biofilm growth were carried out. Overall, 244 proteins were identified, of which >80% were differentially expressed during biofilm development. Quantitatively and qualitatively, metabolic regulation appeared to play a central role in the adaptation from the planktonic to biofilm phenotype. Pneumococci adapted to biofilm growth by decreasing enzymes involved in the glycolytic pathway, as well as proteins involved in translation, transcription, and virulence. In contrast, proteins with a role in pyruvate, carbohydrate, and arginine metabolism were significantly increased during biofilm development. Downregulation of glycolytic and translational proteins suggests that pneumococcus adopts a covert phenotype whilst adapting to an adherent lifestyle, while utilization of alternative metabolic pathways highlights the resourcefulness of pneumococcus to facilitate survival in diverse environmental conditions. These metabolic proteins, conserved across both the planktonic and biofilm phenotypes, may also represent target candidates for future vaccine development and treatment strategies. Data are available via ProteomeXchange with identifier PXD001182.

  1. Recovering from a bad start: rapid adaptation and tradeoffs to growth below a threshold density

    Directory of Open Access Journals (Sweden)

    Marx Christopher J

    2012-07-01

    Full Text Available Abstract Background Bacterial growth in well-mixed culture is often assumed to be an autonomous process only depending upon the external conditions under control of the investigator. However, increasingly there is awareness that interactions between cells in culture can lead to surprising phenomena such as density-dependence in the initiation of growth. Results Here I report the unexpected discovery of a density threshold for growth of a strain of Methylobacterium extorquens AM1 used to inoculate eight replicate populations that were evolved in methanol. Six of these populations failed to grow to the expected full density during the first couple transfers. Remarkably, the final cell number of six populations crashed to levels 60- to 400-fold smaller than their cohorts. Five of these populations recovered to full density soon after, but one population remained an order of magnitude smaller for over one hundred generations. These variable dynamics appeared to be due to a density threshold for growth that was specific to both this particular ancestral strain and to growth on methanol. When tested at full density, this population had become less fit than its ancestor. Simply increasing the initial dilution 16-fold reversed this result, revealing that this population had more than a 3-fold advantage when tested at this lower density. As this population evolved and ultimately recovered to the same final density range as the other populations this low-density advantage waned. Conclusions These results demonstrate surprisingly strong tradeoffs during adaptation to growth at low absolute densities that manifest over just a 16-fold change in density. Capturing laboratory examples of transitions to and from growth at low density may help us understand the physiological and evolutionary forces that have led to the unusual properties of natural bacteria that have specialized to low-density environments such as the open ocean.

  2. Recovering from a bad start: rapid adaptation and tradeoffs to growth below a threshold density.

    Science.gov (United States)

    Marx, Christopher J

    2012-07-04

    Bacterial growth in well-mixed culture is often assumed to be an autonomous process only depending upon the external conditions under control of the investigator. However, increasingly there is awareness that interactions between cells in culture can lead to surprising phenomena such as density-dependence in the initiation of growth. Here I report the unexpected discovery of a density threshold for growth of a strain of Methylobacterium extorquens AM1 used to inoculate eight replicate populations that were evolved in methanol. Six of these populations failed to grow to the expected full density during the first couple transfers. Remarkably, the final cell number of six populations crashed to levels 60- to 400-fold smaller than their cohorts. Five of these populations recovered to full density soon after, but one population remained an order of magnitude smaller for over one hundred generations. These variable dynamics appeared to be due to a density threshold for growth that was specific to both this particular ancestral strain and to growth on methanol. When tested at full density, this population had become less fit than its ancestor. Simply increasing the initial dilution 16-fold reversed this result, revealing that this population had more than a 3-fold advantage when tested at this lower density. As this population evolved and ultimately recovered to the same final density range as the other populations this low-density advantage waned. These results demonstrate surprisingly strong tradeoffs during adaptation to growth at low absolute densities that manifest over just a 16-fold change in density. Capturing laboratory examples of transitions to and from growth at low density may help us understand the physiological and evolutionary forces that have led to the unusual properties of natural bacteria that have specialized to low-density environments such as the open ocean.

  3. Resveratrol analogue 3,4,4′,5-tetramethoxystilbene inhibits growth, arrests cell cycle and induces apoptosis in ovarian SKOV‐3 and A-2780 cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Piotrowska, Hanna; Myszkowski, Krzysztof; Ziółkowska, Alicja [Department of Toxicology, Poznan University of Medical Sciences, Poznan (Poland); Kulcenty, Katarzyna [Chair of Medical Biotechnology, Poznan University of Medical Sciences, Poznan (Poland); Wierzchowski, Marcin [Department of Chemical Technology of Drugs, Poznan University of Medical Sciences, Poznan (Poland); Kaczmarek, Mariusz [Department of Clinical Immunology, Poznan University of Medical Sciences, Poznan (Poland); Murias, Marek [Department of Toxicology, Poznan University of Medical Sciences, Poznan (Poland); Kwiatkowska-Borowczyk, Eliza [Chair of Medical Biotechnology, Poznan University of Medical Sciences, Poznan (Poland); Department of Cancer Diagnostics and Immunology, Greater Poland Cancer Centre, Poznan (Poland); Jodynis-Liebert, Jadwiga, E-mail: liebert@ump.edu.pl [Department of Toxicology, Poznan University of Medical Sciences, Poznan (Poland)

    2012-08-15

    In the screening studies, cytotoxicity of 12 methylated resveratrol analogues on 11 human cancer cell lines was examined. The most active compound 3,4,4′5-tetramethoxystilbene (DMU-212) and two ovarian cancer cell lines A-2780 (IC{sub 50} = 0.71 μM) and SKOV-3 (IC{sub 50} = 11.51 μM) were selected for further investigation. To determine the mechanism of DMU-212 cytotoxicity, its ability to induce apoptosis was examined. DMU-212 arrested cell cycle in the G2/M or G0/G1 phase which resulted in apoptosis of both cell lines. The expression level of 84 apoptosis-related genes was investigated. In SKOV-3 cells DMU-212 caused up-regulation of pro-apoptotic Bax, Apaf-1 and p53 genes, specific to intrinsic pathway of apoptosis, and a decrease in Bcl-2 and Bcl 2110 mRNA expressions. Conversely, in A-2780 cells an increased expression of pro-apoptotic genes Fas, FasL, TNF, TNFRSF10A, TNFRSF21, TNFRSF16 specific to extracellular mechanism of apoptosis was observed. There are no data published so far regarding the receptor mediated apoptosis induced by DMU-212. The activation of caspase-3/7 was correlated with decreased TRAF-1 and BIRC-2 expression level in A-2780 cells exposed to DMU-212. DMU-212 caused a decrease in CYP1A1 and CYP1B1 mRNA levels in A-2780 by 50% and 75%, and in SKOV-3 cells by 15% and 45%, respectively. The protein expression was also reduced in both cell lines. It is noteworthy that the expression of CYP1B1 protein was entirely inhibited in A-2780 cells treated with DMU-212. It can be suggested that different CYP1B1 expression patterns in either ovarian cell line may affect their sensitivity to cytotoxic activity of DMU-212. -- Highlights: ► DMU-212 was the most cytotoxic among 12 O-methylated resveratrol analogues. ► DMU-212 arrested cell cycle at G2/M and G0/G1phase ► DMU-212 triggered mitochondria- and receptor‐mediated apoptosis. ► DMU-212 entirely inhibited CYP1B1 protein expression in A-2780 cells.

  4. Front tracking based modeling of the solid grain growth on the adaptive control volume grid

    Science.gov (United States)

    Seredyński, Mirosław; Łapka, Piotr

    2017-07-01

    The paper presents the micro-scale model of unconstrained solidification of the grain immersed in under-cooled liquid, based on the front tracking approach. For this length scale, the interface tracked through the domain is meant as the solid-liquid boundary. To prevent generation of huge meshes the energy transport equation is discretized on the adaptive control volume (c.v.) mesh. The coupling of dynamically changing mesh and moving front position is addressed. Preliminary results of simulation of a test case, the growth of single grain, are presented and discussed.

  5. Alpinia pricei Rhizome Extracts Induce Cell Cycle Arrest in Human Squamous Carcinoma KB Cells and Suppress Tumor Growth in Nude Mice

    Directory of Open Access Journals (Sweden)

    You-Cheng Hseu

    2011-01-01

    Full Text Available Alpinia pricei has been shown to induce apoptosis in human squamous carcinoma (KB cells. In this study, we report the effectiveness of the ethanol (70% extracts of A. pricei rhizome (AP extracts in terms of tumor regression as determined using both in vitro cell culture and in vivo athymic nude mice models of KB cells. We found that the AP extract (25–200 μg/mL treatment decreased the proliferation of KB cells by arresting progression through the G2/M phase of the cell cycle. This cell cycle blockade was associated with reductions in cyclin A and B1, Cdc2, and Cdc25C, and increased p21/WAF1, Wee1, p53 and phospho-p53 (p-p53 in a dose- and time-dependent manner. Moreover, we found that AP extract treatment decreased metalloproteinase-9 (MMP-9 and urokinase plasminogen activator (u-PA expression, while expression of their endogenous inhibitors, tissue inhibitor of MMP-1 (TIMP-1 and plasminogen activator inhibitor-1 (PAI-1, were increased in KB cells. Furthermore, AP extract treatment effectively delayed tumor incidence in nude mice inoculated with KB cells and reduced the tumor burden. AP extract treatment also induced apoptotic DNA fragmentation, as detected by in situ TUNEL staining. Thus, A. pricei may possess antitumor activity in human squamous carcinoma (KB cells.

  6. CARI III Inhibits Tumor Growth in a Melanoma-Bearing Mouse Model through Induction of G0/G1 Cell Cycle Arrest

    Directory of Open Access Journals (Sweden)

    Hye-Jin Park

    2014-09-01

    Full Text Available Mushroom-derived natural products have been used to prevent or treat cancer for millennia. In this study, we evaluated the anticancer effects of CARI (Cell Activation Research Institute III, which consists of a blend of mushroom mycelia from Phellinus linteus grown on germinated brown rice, Inonotus obliquus grown on germinated brown rice, Antrodia camphorata grown on germinated brown rice and Ganoderma lucidum. Here, we showed that CARI III exerted anti-cancer activity, which is comparable to Dox against melanoma in vivo. B16F10 cells were intraperitoneally injected into C57BL6 mice to develop solid intra-abdominal tumors. Three hundred milligrams of the CARI III/kg/day p.o. regimen reduced tumor weight, comparable to the doxorubicin (Dox-treated group. An increase in life span (ILS% = 50.88% was observed in the CARI III-administered group, compared to the tumor control group. CARI III demonstrates anti-proliferative activity against B16F10 melanoma cells through inducing G0/G1 cell cycle arrest. CARI III inhibits the expression of cyclin D1, CDK4 and CDK2 and induces p21. Therefore, CARI III could be a potential chemopreventive supplement to melanoma patients.

  7. Adaptation

    International Development Research Centre (IDRC) Digital Library (Canada)

    . Dar es Salaam. Durban. Bloemfontein. Antananarivo. Cape Town. Ifrane ... program strategy. A number of CCAA-supported projects have relevance to other important adaptation-related themes such as disaster preparedness and climate.

  8. TGF-β-Dependent Growth Arrest and Cell Migration in Benign and Malignant Breast Epithelial Cells Are Antagonistically Controlled by Rac1 and Rac1b.

    Science.gov (United States)

    Melzer, Catharina; von der Ohe, Juliane; Hass, Ralf; Ungefroren, Hendrik

    2017-07-20

    Despite improvements in diagnosis and treatment, breast cancer is still the most common cancer type among non-smoking females. TGF-β can inhibit breast cancer development by inducing cell cycle arrest in both, cancer cells and, as part of a senescence program in normal human mammary epithelial cells (HMEC). Moreover, TGF-β also drives cell migration and invasion, in part through the small GTPases Rac1 and Rac1b. Depletion of Rac1b or Rac1 and Rac1b in MDA-MB-231 or MDA-MB-435s breast cancer cells by RNA interference enhanced or suppressed, respectively, TGF-β1-induced migration/invasion. Rac1b depletion in MDA-MB-231 cells also increased TGF-β-induced p21 WAF1 expression and ERK1/2 phosphorylation. Senescent HMEC (P15/P16), when compared to their non-senescent counterparts (P11/P12), presented with dramatically increased migratory activity. These effects were paralleled by elevated expression of genes associated with TGF-β signaling and metastasis, downregulated Rac1b, and upregulated Rac1. Our data suggest that acquisition of a motile phenotype in HMEC resulted from enhanced autocrine TGF-β signaling, invasion/metastasis-associated gene expression, and a shift in the ratio of antimigratory Rac1b to promigratory Rac1. We conclude that although enhanced TGF-β signaling is considered antioncogenic in HMEC by suppressing oncogene-induced transformation, this occurs at the expense of a higher migration and invasion potential.

  9. TGF-β-Dependent Growth Arrest and Cell Migration in Benign and Malignant Breast Epithelial Cells Are Antagonistically Controlled by Rac1 and Rac1b

    Directory of Open Access Journals (Sweden)

    Catharina Melzer

    2017-07-01

    Full Text Available Despite improvements in diagnosis and treatment, breast cancer is still the most common cancer type among non-smoking females. TGF-β can inhibit breast cancer development by inducing cell cycle arrest in both, cancer cells and, as part of a senescence program in normal human mammary epithelial cells (HMEC. Moreover, TGF-β also drives cell migration and invasion, in part through the small GTPases Rac1 and Rac1b. Depletion of Rac1b or Rac1 and Rac1b in MDA-MB-231 or MDA-MB-435s breast cancer cells by RNA interference enhanced or suppressed, respectively, TGF-β1-induced migration/invasion. Rac1b depletion in MDA-MB-231 cells also increased TGF-β-induced p21WAF1 expression and ERK1/2 phosphorylation. Senescent HMEC (P15/P16, when compared to their non-senescent counterparts (P11/P12, presented with dramatically increased migratory activity. These effects were paralleled by elevated expression of genes associated with TGF-β signaling and metastasis, downregulated Rac1b, and upregulated Rac1. Our data suggest that acquisition of a motile phenotype in HMEC resulted from enhanced autocrine TGF-β signaling, invasion/metastasis-associated gene expression, and a shift in the ratio of antimigratory Rac1b to promigratory Rac1. We conclude that although enhanced TGF-β signaling is considered antioncogenic in HMEC by suppressing oncogene-induced transformation, this occurs at the expense of a higher migration and invasion potential.

  10. Aqueous extract of Tribulus terrestris Linn induces cell growth arrest and apoptosis by down-regulating NF-κB signaling in liver cancer cells.

    Science.gov (United States)

    Kim, Hye Jin; Kim, Jin Chul; Min, Jung Sun; Kim, Mi-Jee; Kim, Ji Ae; Kor, Myung Ho; Yoo, Hwa Seung; Ahn, Jeong Keun

    2011-06-14

    A medicinal herb Tribulus terrestris Linn has been used to treat various diseases including hepatocellular carcinoma. The aim of the present study was to investigate the anticancer activity of Tribulus terrestris Linn (TT) in liver cancer cells. The antitumor activity of aqueous TT extract was analyzed by testing the cytotoxicity and the effect on clonogenecity in HepG2 cells. Apoptosis and cell cycle arrest induced by TT were dissected by flow cytometry and its inhibitory effect on NF-κB activity was determined by analyzing the expression levels of NF-κB/IκB subunit proteins. The suppression of NF-κB-regulated gene expression by TT was assessed by RT-PCR. TT extract repressed clonogenecity and proliferation, induced apoptosis, and enhanced accumulation in the G0/G1 phase of liver cancer cells. It also turned out that TT extract inhibited NF-κB-dependent reporter gene expression and NF-κB subunit p50 expression, while it enhanced the cellular level of IκBα by inhibiting the phosphorylation and degradation of IκBα. In addition, IKK activity was inhibited in a dose-dependent manner. Furthermore, TT extract suppressed the transcription of genes associated with cell cycle regulation, anti-apoptosis, and invasion. These data showed that TT extract blocks proliferation and induces apoptosis in human liver cancer cells through the inhibition of NF-κB signaling. Aqueous TT extract can be used as an anticancer drug for hepatocellular carcinoma patients. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  11. Knockdown of eukaryotic translation initiation factor 4E suppresses cell growth and invasion, and induces apoptosis and cell cycle arrest in a human lung adenocarcinoma cell line.

    Science.gov (United States)

    Chen, Baofu; Zhang, Bo; Xia, Lilong; Zhang, Jian; Chen, Yu; Hu, Quanteng; Zhu, Chengchu

    2015-12-01

    Eukaryotic translation initiation factor 4E (eIF4E) was shown to be upregulated in malignant human tumors. To assess the effect of downregulation of eIF4E on the proliferation and invasiveness of a human lung adenocarcinoma cell line, a short hairpin (sh)RNA targeting eIF4E was constructed and transfected into A549 human lung adenocarcinoma cells. The expression of eIF4E was determined by reverse transcription‑quantitative polymerase chain reaction and western blotting. Cell viability was assessed using a Cell Counting kit‑8, and apoptosis levels and cell cycle distribution were assessed by flow cytometry. Invasiveness was assessed using Transwell chambers. Transfection of the A549 cells with eIF4E targeting shRNA reduced the mRNA and protein expression levels of eIF4E by >70% 48 and 72 h following transfection, and eIF4E targeting shRNA‑transfected cells were significantly less viable compared with the cells transfected with scrambled shRNA. The rate of apoptosis was also significantly increased, significantly more cells were in the G0/G1 phase and fewer were in the S phase, indicating cell cycle arrest. The fraction of transfected cells migrating across Transwell inserts were also reduced. In conclusion, inhibition of eIF4E suppressed cell growth and invasion, induced apoptosis and cell cycle arrest, suggesting that eIF4E may be a potential therapeutic target in lung adenocarcinoma.

  12. Adaptation of BAp crystal orientation to stress distribution in rat mandible during bone growth

    Energy Technology Data Exchange (ETDEWEB)

    Nakano, T; Fujitani, W; Ishimoto, T [Division of Materials and Manufacturing Science, Graduate School of Engineering, Osaka University, 2-1, Yamada-oka, Suita, Osaka 565-0871 (Japan); Umakoshi, Y [National Institute for Materials Science, 1-2-1, Sengen, Tsukuba, Ibaragi, 305-0471 (Japan)], E-mail: nakano@mat.eng.osaka-u.ac.jp

    2009-05-01

    Biological apatite (BAp) c-axis orientation strongly depends on stress distribution in vivo and tends to align along the principal stress direction in bones. Dentulous mandible is subjected to a complicated stress condition in vivo during chewing but few studies have been carried out on the BAp c-axis orientation; so the adaptation of BAp crystal orientation to stress distribution was examined in rat dentulous mandible during bone growth and mastication. Female SD rats 4 to 14 weeks old were prepared, and the bone mineral density (BMD) and BAp crystal orientation were analyzed in a cross-section of mandible across the first molar focusing on two positions: separated from and just under the tooth root on the same cross-section perpendicular to the mesiodistal axis. The degree of BAp orientation was analyzed by a microbeam X-ray diffractometer using Cu-K{alpha} radiation equipped with a detector of curved one-dimensional PSPC and two-dimensional PSPC in the reflection and transmission optics, respectively. BMD quickly increased during bone growth up to 14 weeks, although it was independent of the position from the tooth root. In contrast, BAp crystal orientation strongly depended on the age and the position from the tooth root, even in the same cross-section and direction, especially along the mesiodistal and the biting axes. With increased biting stress during bone growth, the degree of BAp orientation increased along the mesiodistal axis in a position separated from the tooth root more than that near the tooth root. In contrast, BAp preferential alignment clearly appeared along the biting axis near the tooth root. We conclude that BAp orientation rather than BMD sensitively adapts to local stress distribution, especially from the chewing stress in vivo in the mandible.

  13. Characterization of the adaptive response and growth upon hyperosmotic shock in Saccharomyces cerevisiae.

    Science.gov (United States)

    Parmar, Jignesh H; Bhartiya, Sharad; Venkatesh, K V

    2011-04-01

    Molecular and physiological details of osmoadaptation in yeast Saccharomyces cerevisiae are well characterized. It is well known that a cell, upon osmotic shock, delays its growth, produces a compatible solute like glycerol in yeast to maintain the osmotic equilibrium. Many genes are regulated by the hyperosmolarity glycerol (HOG) singling pathway, some of which in turn control the carbon flux in the glycolytic pathway for glycerol synthesis and reduced growth. The whole process of survival of cells under hyperosmotic stress is controlled at multiple levels in signaling and metabolic pathways. To better understand the multi-level regulations in yeast to osmotic shock, a mathematical model is formulated which integrates the growth and the osmoadaptation process. The model included the HOG pathway which consists of Sho1 and Sln1 signaling branches, gene regulation, metabolism and cell growth on glucose and ethanol. Experiments were performed to characterize the effect of various concentrations of salt on the wild-type and mutant strains. The model was able to successfully predict the experimental observations for both the wild-type and mutant strains. Further, the model was used to analyze the effects of various regulatory mechanisms prevalent in the signaling and metabolic pathways which are essential in achieving optimum growth in a saline medium. The analysis demonstrated the relevance of the combined effects of regulation at several points in the signaling and metabolic pathways including activation of GPD1 and GPD2, inhibition of PYK and PDC1, closure of the Fps1 channel, volume effect on the glucose uptake rate, downregulation of ethanol synthesis and upregulation of ALD6 for acetate synthesis. The analysis demonstrated that these combined effects orchestrated the phenomena of adaptation to osmotic stress in yeast.

  14. Transcriptome adaptation of group B Streptococcus to growth in human amniotic fluid.

    Directory of Open Access Journals (Sweden)

    Izabela Sitkiewicz

    Full Text Available BACKGROUND: Streptococcus agalactiae (group B Streptococcus is a bacterial pathogen that causes severe intrauterine infections leading to fetal morbidity and mortality. The pathogenesis of GBS infection in this environment is poorly understood, in part because we lack a detailed understanding of the adaptation of this pathogen to growth in amniotic fluid. To address this knowledge deficit, we characterized the transcriptome of GBS grown in human amniotic fluid (AF and compared it with the transcriptome in rich laboratory medium. METHODS: GBS was grown in Todd Hewitt-yeast extract medium and human AF. Bacteria were collected at mid-logarithmic, late-logarithmic and stationary growth phase. We performed global expression microarray analysis using a custom-made Affymetrix GeneChip. The normalized hybridization values derived from three biological replicates at each growth point were obtained. AF/THY transcript ratios representing greater than a 2-fold change and P-value exceeding 0.05 were considered to be statistically significant. PRINCIPAL FINDINGS: We have discovered that GBS significantly remodels its transcriptome in response to exposure to human amniotic fluid. GBS grew rapidly in human AF and did not exhibit a global stress response. The majority of changes in GBS transcripts in AF compared to THY medium were related to genes mediating metabolism of amino acids, carbohydrates, and nucleotides. The majority of the observed changes in transcripts affects genes involved in basic bacterial metabolism and is connected to AF composition and nutritional requirements of the bacterium. Importantly, the response to growth in human AF included significant changes in transcripts of multiple virulence genes such as adhesins, capsule, and hemolysin and IL-8 proteinase what might have consequences for the outcome of host-pathogen interactions. CONCLUSIONS/SIGNIFICANCE: Our work provides extensive new information about how the transcriptome of GBS responds

  15. Discontinuous growth modeling of adaptation to sleep setting changes: individual differences and age.

    Science.gov (United States)

    Bliese, Paul D; McGurk, Dennis; Thomas, Jeffrey L; Balkin, Thomas J; Wesensten, Nancy

    2007-05-01

    Biomedical devices allow investigators to collect long-term repeated measures data to study adaptation. We examined 26 d of actigraph sleep data and tested for individual differences in sleep patterns prior to, during, and after a transition of sleeping in garrison to sleeping in a field exercise setting. In addition, we examined whether the individual difference variable of participant age (a continuous variable ranging from 19-29 yr) was related to sleep patterns. Actigraph data was obtained from 77 cadets participating in a month-long military training program. At day 17, participants transitioned from sleeping in garrison to sleeping in a field exercise setting. A discontinuous growth model tested for individual differences in 1) overall sleep time, 2) garrison sleep slope, 3) the transition, and 4) the sleep slope during the field exercise setting. Individuals varied significantly in their overall sleep time, pattern of sleep in garrison, and the degree to which sleep decreased at the transition. The decline in sleep at the transition was related to participant age such that increases in age were associated with larger declines in sleep minutes. Individuals display significant variability in sleep patterns that can be detected using discontinuous growth models. The individual difference variable of participant age explains some of this variability. Much of the variability, however, remains unexplained. Future work will benefit from using discontinuous growth models to identify and model individual difference variables such as age when examining response patterns and transitions in data collected in applied field settings.

  16. Key physiological properties contributing to rhizosphere adaptation and plant growth promotion abilities of Azospirillum brasilense.

    Science.gov (United States)

    Fibach-Paldi, Sharon; Burdman, Saul; Okon, Yaacov

    2012-01-01

    Azospirillum brasilense is a plant growth promoting rhizobacterium (PGPR) that is being increasingly used in agriculture in a commercial scale. Recent research has elucidated key properties of A. brasilense that contribute to its ability to adapt to the rhizosphere habitat and to promote plant growth. They include synthesis of the auxin indole-3-acetic acid, nitric oxide, carotenoids, and a range of cell surface components as well as the ability to undergo phenotypic variation. Storage and utilization of polybetahydroxyalkanoate polymers are important for the shelf life of the bacteria in production of inoculants, products containing bacterial cells in a suitable carrier for agricultural use. Azospirillum brasilense is able to fix nitrogen, but despite some controversy, as judging from most systems evaluated so far, contribution of fixed nitrogen by this bacterium does not seem to play a major role in plant growth promotion. In this review, we focus on recent advances in the understanding of physiological properties of A. brasilense that are important for rhizosphere performance and successful interactions with plant roots. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  17. Adapt

    Science.gov (United States)

    Bargatze, L. F.

    2015-12-01

    Active Data Archive Product Tracking (ADAPT) is a collection of software routines that permits one to generate XML metadata files to describe and register data products in support of the NASA Heliophysics Virtual Observatory VxO effort. ADAPT is also a philosophy. The ADAPT concept is to use any and all available metadata associated with scientific data to produce XML metadata descriptions in a consistent, uniform, and organized fashion to provide blanket access to the full complement of data stored on a targeted data server. In this poster, we present an application of ADAPT to describe all of the data products that are stored by using the Common Data File (CDF) format served out by the CDAWEB and SPDF data servers hosted at the NASA Goddard Space Flight Center. These data servers are the primary repositories for NASA Heliophysics data. For this purpose, the ADAPT routines have been used to generate data resource descriptions by using an XML schema named Space Physics Archive, Search, and Extract (SPASE). SPASE is the designated standard for documenting Heliophysics data products, as adopted by the Heliophysics Data and Model Consortium. The set of SPASE XML resource descriptions produced by ADAPT includes high-level descriptions of numerical data products, display data products, or catalogs and also includes low-level "Granule" descriptions. A SPASE Granule is effectively a universal access metadata resource; a Granule associates an individual data file (e.g. a CDF file) with a "parent" high-level data resource description, assigns a resource identifier to the file, and lists the corresponding assess URL(s). The CDAWEB and SPDF file systems were queried to provide the input required by the ADAPT software to create an initial set of SPASE metadata resource descriptions. Then, the CDAWEB and SPDF data repositories were queried subsequently on a nightly basis and the CDF file lists were checked for any changes such as the occurrence of new, modified, or deleted

  18. Ethyl acetate extract of Chinese medicinal herb Sarcandra glabra induces growth inhibition on human leukemic HL-60 cells, associated with cell cycle arrest and up-regulation of pro-apoptotic Bax/Bcl-2 ratio.

    Science.gov (United States)

    Li, W Y; Chiu, Lawrence C M; Lam, W S; Wong, W Y; Chan, Y T; Ho, Y P; Wong, Elaine Y L; Wong, Y S; Ooi, Vincent E C

    2007-02-01

    Sarcandra glabra (Thunb.) Nakai, colloquially known as Caoshanhu, is a Chinese medicinal herb with reported anti-tumor, anti-inflammatory, anti-viral and non-specific immunoenhancing properties. Although the plant has been clinically used for treating a variety of diseases, its bioactive ingredients are largely unknown and its mode of action has never been investigated. In this study, the anti-tumor property of ethyl acetate (EA) extract of S. glabra was investigated by determining its in vitro growth-inhibitory effects on a panel of human cancer cell lines of different histotypes. Growth inhibition of the EA extract on the cancer cells seemed to be selective, and the leukemic HL-60 was found to be the most responsive after 48 h of treatment (IC50=58 microg/ml). Flow cytometric studies further illustrated that the extract might interfere with DNA replication and thus arrested the cell cycle at S phase in the leukemic cells, followed by DNA fragmentation and loss of phospholipid asymmetry in the plasma membrane after 72 h of treatment. Concurrently, the pro-apoptotic Bax/Bcl-2 ratio was also up-regulated by more than 178% of the control level. All these findings suggested that the extract had initiated apoptosis to kill the leukemic cells. Results from this pioneer study help to establish a scientific foundation for future research and development of the bioactive ingredients in EA extract of S. glabra as efficacious anti-cancer agents.

  19. Physiological and cell morphology adaptation of Bacillus subtilis at near-zero specific growth rates: a transcriptome analysis.

    Science.gov (United States)

    Overkamp, Wout; Ercan, Onur; Herber, Martijn; van Maris, Antonius J A; Kleerebezem, Michiel; Kuipers, Oscar P

    2015-02-01

    Nutrient scarcity is a common condition in nature, but the resulting extremely low growth rates (below 0.025 h(-1) ) are an unexplored research area in Bacillus subtilis. To understand microbial life in natural environments, studying the adaptation of B. subtilis to near-zero growth conditions is relevant. To this end, a chemostat modified for culturing an asporogenous B. subtilis sigF mutant strain at extremely low growth rates (also named a retentostat) was set up, and biomass accumulation, culture viability, metabolite production and cell morphology were analysed. During retentostat culturing, the specific growth rate decreased to a minimum of 0.00006 h(-1) , corresponding to a doubling time of 470 days. The energy distribution between growth and maintenance-related processes showed that a state of near-zero growth was reached. Remarkably, a filamentous cell morphology emerged, suggesting that cell separation is impaired under near-zero growth conditions. To evaluate the corresponding molecular adaptations to extremely low specific growth, transcriptome changes were analysed. These revealed that cellular responses to near-zero growth conditions share several similarities with those of cells during the stationary phase of batch growth. However, fundamental differences between these two non-growing states are apparent by their high viability and absence of stationary phase mutagenesis under near-zero growth conditions. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  20. Experimental investigation of interfacial crack arrest in sandwich beams subjected to fatigue loading using a novel crack arresting device

    DEFF Research Database (Denmark)

    Martakos, G.; Andreasen, J.H.; Berggreen, Christian

    2017-01-01

    A recently proposed face-sheet–core interface crack arresting device is implemented in sandwich beams and tested using the Sandwich Tear Test configuration. Fatigue loading conditions are applied to propagate the crack and determine the effect of the crack stopper on the fatigue growth rate...... the energy release rate, mode mixity and to simulate crack propagation and arrest of the crack. Finally, the effectiveness of the crack arresting device is demonstrated on composite sandwich beams subjected to fatigue loading conditions....... and arrest of the crack. Digital image correlation is used through the duration of the fatigue experiment to track the strain evolution as the crack tip advances. The measured strains are related to crack tip propagation, arrest, and re-initiation of the crack. A finite element model is used to calculate...

  1. Adaptation

    International Development Research Centre (IDRC) Digital Library (Canada)

    Nairobi, Kenya. 28 Adapting Fishing Policy to Climate Change with the Aid of Scientific and Endogenous Knowledge. Cap Verde, Gambia,. Guinea, Guinea Bissau,. Mauritania and Senegal. Environment and Development in the Third World. (ENDA-TM). Dakar, Senegal. 29 Integrating Indigenous Knowledge in Climate Risk ...

  2. Thyroid hormone is required for growth adaptation to pressure load in the ovine fetal heart.

    Science.gov (United States)

    Segar, Jeffrey L; Volk, Ken A; Lipman, Michael H B; Scholz, Thomas D

    2013-03-01

    Thyroid hormone exerts broad effects on the adult heart, but little is known regarding the role of thyroid hormone in the regulation of cardiac growth early in development and in response to pathophysiological conditions. To address this issue, we determined the effects of fetal thyroidectomy on cardiac growth and growth-related gene expression in control and pulmonary-artery-banded fetal sheep. Fetal thyroidectomy (THX) and/or placement of a restrictive pulmonary artery band (PAB) were performed at 126 ± 1 days of gestation (term, 145 days). Four groups of animals [n = 5-6 in each group; (i) control; (ii) fetal THX; (iii) fetal PAB; and (iv) fetal PAB + THX] were monitored for 1 week prior to being killed. Fetal heart rate was significantly lower in the two THX groups compared with the non-THX groups, while mean arterial blood pressure was similar among groups. Combined left and right ventricle free wall + septum weight, expressed per kilogram of fetal weight, was significantly increased in PAB (6.27 ± 0.85 g kg(-1)) compared with control animals (4.72 ± 0.12 g kg(-1)). Thyroidectomy significantly attenuated the increase in cardiac mass associated with PAB (4.94 ± 0.13 g kg(-1)), while THX alone had no detectable effect on heart mass (4.95 ± 0.27 g kg(-1)). The percentage of binucleated cardiomyocytes was significantly decreased in THX and PAB +THX groups (∼16%) compared with the non-THX groups (∼27%). No differences in levels of activated Akt, extracellular signal-regulated kinase or c-Jun N-terminal kinase were detected among the groups. Markers of cellular proliferation but not apoptosis or expression of growth-related genes were lower in the THX and THX+ PAB groups relative to thyroid-intact animals. These findings suggest that in the late-gestation fetal heart, thyroid hormone has important cellular growth functions in both physiological and pathophysiological states. Specifically, thyroid hormone is required for adaptive fetal cardiac growth in

  3. Force-induced bone growth and adaptation: A system theoretical approach to understanding bone mechanotransduction

    International Nuclear Information System (INIS)

    Maldonado, Solvey; Findeisen, Rolf

    2010-01-01

    The modeling, analysis, and design of treatment therapies for bone disorders based on the paradigm of force-induced bone growth and adaptation is a challenging task. Mathematical models provide, in comparison to clinical, medical and biological approaches an structured alternative framework to understand the concurrent effects of the multiple factors involved in bone remodeling. By now, there are few mathematical models describing the appearing complex interactions. However, the resulting models are complex and difficult to analyze, due to the strong nonlinearities appearing in the equations, the wide range of variability of the states, and the uncertainties in parameters. In this work, we focus on analyzing the effects of changes in model structure and parameters/inputs variations on the overall steady state behavior using systems theoretical methods. Based on an briefly reviewed existing model that describes force-induced bone adaptation, the main objective of this work is to analyze the stationary behavior and to identify plausible treatment targets for remodeling related bone disorders. Identifying plausible targets can help in the development of optimal treatments combining both physical activity and drug-medication. Such treatments help to improve/maintain/restore bone strength, which deteriorates under bone disorder conditions, such as estrogen deficiency.

  4. Towards optimisation of induced pluripotent cell culture: Extracellular acidification results in growth arrest of iPSC prior to nutrient exhaustion.

    Science.gov (United States)

    Wilmes, Anja; Rauch, Caroline; Carta, Giada; Kern, Georg; Meier, Florian; Posch, Wilfried; Wilflingseder, Doris; Armstrong, Lyle; Lako, Majlinda; Beilmann, Mario; Gstraunthaler, Gerhard; Jennings, Paul

    2017-12-01

    Human induced pluripotent stem cells (iPSC) have the potential to radically reduce the number of animals used in both toxicological science and disease elucidation. One initial obstacle culturing iPSC is that they require daily medium exchange. This study attempts to clarify why and propose some practical solutions. Two iPSC lineages were fed at different intervals in a full growth area (FGA) or a restricted growth area (RGA). The FGA consisted of a well coated with Matrigel™ and the RGA consisted of a coated coverslip placed in a well. Glucose, lactate, extracellular pH and cell cycle phases were quantified. Without daily feeding, FGA cultured iPSC had significantly reduced growth rates by day 2 and began to die by day 3. In contrast, RGA cultured cells grew to confluence over 3days. Surprisingly, glucose was not exhausted under any condition. However, extracellular pH reached 6.8 after 72h in FGA cultures. Artificially reducing medium pH to 6.8 also inhibited glycolysis and initiated an increase in G0/G1 phase of the cell cycle, while adding an additional 10mM bicarbonate to the medium increased glycolysis rates. This study demonstrates that iPSC are highly sensitive to extracellular acidification, a likely limiting factor in maintenance of proliferative and pluripotent status. Culturing iPSC in RGA prevents rapid extracellular acidification, while still maintaining pluripotency and allowing longer feeding cycles. Copyright © 2017. Published by Elsevier Ltd.

  5. Antisense expression of an Arabidopsis ran binding protein renders transgenic roots hypersensitive to auxin and alters auxin-induced root growth and development by arresting mitotic progress

    Science.gov (United States)

    Kim, S. H.; Arnold, D.; Lloyd, A.; Roux, S. J.

    2001-01-01

    We cloned a cDNA encoding an Arabidopsis Ran binding protein, AtRanBP1c, and generated transgenic Arabidopsis expressing the antisense strand of the AtRanBP1c gene to understand the in vivo functions of the Ran/RanBP signal pathway. The transgenic plants showed enhanced primary root growth but suppressed growth of lateral roots. Auxin significantly increased lateral root initiation and inhibited primary root growth in the transformants at 10 pM, several orders of magnitude lower than required to induce these responses in wild-type roots. This induction was followed by a blockage of mitosis in both newly emerged lateral roots and in the primary root, ultimately resulting in the selective death of cells in the tips of both lateral and primary roots. Given the established role of Ran binding proteins in the transport of proteins into the nucleus, these findings are consistent with a model in which AtRanBP1c plays a key role in the nuclear delivery of proteins that suppress auxin action and that regulate mitotic progress in root tips.

  6. ADAPTATION TO UNFAVORABLE CONDITIONS OF GROWTH: PATHOGENICITY OF ACHOLEPLASMA LAIDLAWII PG8

    Directory of Open Access Journals (Sweden)

    Maxim V. Trushin

    2006-11-01

    Full Text Available ABSTRACT:As a result of cultivation of A. laidlawii PG8 cells on the deficient medium during 480 days, the mycoplasma culture adapted in vitro to unfavorable growth conditions was obtained. The culture consisted of cells with sizes less than 0.2 µm and features of A. laidlawii PG8 ultramicroforms, nanocells. A. laidlawii PG8 culture adapted in vitro to unfavorable growth conditions shows more evident phytopathogenicity than the unadapted one. Infecting plants V. minor L. by A. laidlawii PG8 culture adapted in vitro to UGC resulted in the appearance of chloroses in 75%, necrosis – 50%, leaves marcescence – 50% and abnormalities of bine development in 30% of plants through 12 days, while infecting plants by A. laidlawii PG8 culture unadapted to UGC led to respective signs in 40%, 25%, 25% and 0% of samples, respectively, through 30 days. The ability of A. laidlawii PG8 to form UMF resistant to stress factors in UGC with high phytopathogenic potential seems to demand a new approach to investigate the precise mechanisms of interacting the mycoplasma with host organisms.RESUMENComo resultado del cultivo de células de A. laidlawii PG8 en medio deficiente durante 480 días, fue obtenido un cultivo de mycoplasma adaptado in vitro a las condiciones desfavorables del crecimiento. El cultivo consistió en células con tamaño menor de 0.2 µm y características PG8 ultramicroformas de A. laidlawii nanocélulas. El cultivo de A. laidlawii PG8 adaptado in vitro a condiciones desfavorables del crecimiento muestra más evidente fitopatogenicidad que el inadaptado. Plantas infectadas V. minor L. por el cultivo del A. laidlawii PG8 adaptado in vitro a UGC dio como resultado la aparición de clorosis en el 75%, necrosis en el 50%, marcescencia de las hojas en el 50% y anormalidades del desarrollo del bine en el 30% de plantas a los 12 días, mientras que las plantas infectadas por el cultivo del A. laidlawii PG8 inadaptado a UGC, condujo a dichos signos en

  7. An adaptive ARX model to estimate the RUL of aluminum plates based on its crack growth

    Science.gov (United States)

    Barraza-Barraza, Diana; Tercero-Gómez, Víctor G.; Beruvides, Mario G.; Limón-Robles, Jorge

    2017-01-01

    A wide variety of Condition-Based Maintenance (CBM) techniques deal with the problem of predicting the time for an asset fault. Most statistical approaches rely on historical failure data that might not be available in several practical situations. To address this issue, practitioners might require the use of self-starting approaches that consider only the available knowledge about the current degradation process and the asset operating context to update the prognostic model. Some authors use Autoregressive (AR) models for this purpose that are adequate when the asset operating context is constant, however, if it is variable, the accuracy of the models can be affected. In this paper, three autoregressive models with exogenous variables (ARX) were constructed, and their capability to estimate the remaining useful life (RUL) of a process was evaluated following the case of the aluminum crack growth problem. An existing stochastic model of aluminum crack growth was implemented and used to assess RUL estimation performance of the proposed ARX models through extensive Monte Carlo simulations. Point and interval estimations were made based only on individual history, behavior, operating conditions and failure thresholds. Both analytic and bootstrapping techniques were used in the estimation process. Finally, by including recursive parameter estimation and a forgetting factor, the ARX methodology adapts to changing operating conditions and maintain the focus on the current degradation level of an asset.

  8. Posttraumatic growth measures: translation and adaptation of three self-report instruments to Brazilian Portuguese

    Directory of Open Access Journals (Sweden)

    Thiago Loreto Garcia da Silva

    2016-06-01

    Full Text Available Abstract Background Posttraumatic growth is one of the most commonly used concepts to evaluate positive changes after trauma. The principal scales used internationally to evaluate this phenomenon have not yet a Brazilian Portuguese version. Objectives This study aimed to translate and adapt to the Brazilian context the Posttraumatic Growth Inventory (PTGI, the Core Beliefs Inventory (CBI, and the Event Related Rumination Inventory (ERRI. Methods The procedures included translation, back translation, expert committee’s evaluation, and pilot testing in the target population. Results All items of all three instruments had a good content validity index after evaluation by four experts and three reformulations. The back translation of the final version also demonstrated that all Brazilian Portuguese versions convey the same meaning as the original English version. The final version was pilot tested with 30 undergraduate students, and all the items were above the cut-off point. Discussion This study was able to produce Brazilian versions of the PTGI, CBI, and ERRI. Further studies are underway to determine the reliability, factorial validity, and convergent validity of the subscales of the instruments.

  9. Psychrobacter arcticus 273-4 uses resource efficiency and molecular motion adaptations for subzero temperature growth.

    Science.gov (United States)

    Bergholz, Peter W; Bakermans, Corien; Tiedje, James M

    2009-04-01

    Permafrost soils are extreme environments that exert low-temperature, desiccation, and starvation stress on bacteria over thousands to millions of years. To understand how Psychrobacter arcticus 273-4 survived for >20,000 years in permafrost, transcriptome analysis was performed during growth at 22 degrees C, 17 degrees C, 0 degrees C, and -6 degrees C using a mixed-effects analysis of variance model. Genes for transcription, translation, energy production, and most biosynthetic pathways were downregulated at low temperatures. Evidence of isozyme exchange was detected over temperature for D-alanyl-D-alanine carboxypeptidases (dac1 and dac2), DEAD-box RNA helicases (csdA and Psyc_0943), and energy-efficient substrate incorporation pathways for ammonium and acetate. Specific functions were compensated by upregulation of genes at low temperature, including genes for the biosynthesis of proline, tryptophan, and methionine. RNases and peptidases were generally upregulated at low temperatures. Changes in energy metabolism, amino acid metabolism, and RNase gene expression were consistent with induction of a resource efficiency response. In contrast to results observed for other psychrophiles and mesophiles, only clpB and hsp33 were upregulated at low temperature, and there was no upregulation of other chaperones and peptidyl-prolyl isomerases. relA, csdA, and dac2 knockout mutants grew more slowly at low temperature, but a dac1 mutant grew more slowly at 17 degrees C. The combined data suggest that the basal biological machinery, including translation, transcription, and energy metabolism, is well adapted to function across the growth range of P. arcticus from -6 degrees C to 22 degrees C, and temperature compensation by gene expression was employed to address specific challenges to low-temperature growth.

  10. Growth inhibition and cell cycle arrest in the G0/G1 by schizandrin, a dibenzocyclooctadiene lignan isolated from Schisandra chinensis, on T47D human breast cancer cells.

    Science.gov (United States)

    Kim, Sun-Jack; Min, Hye-Young; Lee, Eun Jin; Kim, Yeong Shik; Bae, KiHwan; Kang, Sam Sik; Lee, Sang Kook

    2010-02-01

    Schizandrin is one of the main dibenzocyclooctadiene lignans present in the fruit of Schisandra chinensis (Schisandraceae). Biological activities including hepatoprotective, antiviral and neuroprotective effects of schizandrin and other dibenzocyclooctadiene lignans have been reported previously. However, the antiproliferative effect of schizandrin against human cancer cells has been poorly determined to date. This study examined the antiproliferative effect of schizandrin in human breast cancer cells. Schizandrin exhibited growth inhibitory activities in cultured human breast cancer cells, and the effect was the more profound in estrogen receptor (ER)-positive T47D cells than in ER-negative MDA-MB-231 cells. When treated with the compound in T47D cells, schizandrin induced the accumulation of a cell population in the G0/G1 phase, which was further demonstrated by the induction of CDK inhibitors p21 and p27 and the inhibition of the expression of cell cycle checkpoint proteins including cyclin D1, cyclin A, CDK2 and CDK4. These results suggest that schizandrin inhibits cell proliferation through the induction of cell cycle arrest with modulating cell cycle-related proteins in human breast cancer cells. (c) 2009 John Wiley & Sons, Ltd.

  11. Tibial tunnel defect size as a risk factor in growth arrest following paediatric transphyseal anterior cruciate ligament reconstruction: an anatomical study.

    Science.gov (United States)

    Pananwala, Hasitha; Jabbar, Yaser; Mills, Leonora; Symes, Michael; Nandapalan, Haren; Sefton, Andrew; Delungahawatte, Lasitha; Dao, Quang

    2016-09-01

    There is ongoing controversy regarding growth disturbances in younger patients undergoing anterior cruciate ligament reconstructions. Animal models have shown that an injury of 7-9% of the physeal area is a risk factor for growth disturbances. A total of 39 magnetic resonance imaging studies of the knee were examined. The proximal tibial physeal area was determined using a calibrated 'region of interest' ligature encompassing the tibial physis in the axial plane. The potential defect left by commonly used drill sizes was calculated as a percentage of the physeal area. A 7-mm drill leaves a mean defect of 1.45% physeal area (range: 1.11-1.89%, SD: 0.28, 95% CI: ±0.09), 8-mm drill leaves a 1.84% mean defect (range: 1.43-2.49%, SD: 0.38, 95% CI: ±0.12) and a 9-mm drill leaves a 2.30% mean defect (range: 1.83-3.19%, SD: 0.58, 95% CI: ±0.17). At 55°, 7-mm drill leaves a mean defect of 1.96% (range: 1.32-2.28%, SD: 0.37, 95% CI: ±0.12), 8-mm drill leaves a mean defect of 2.19% (range: 1.71-2.95%, SD: 0.46, 95% CI: ±0.14) and a 9-mm drill leaves a mean defect of 2.76% (range: 2.16-3.73%, SD: 0.58, 95% CI: ±0.18). There was a statistically significant difference in the tunnel area with a change of drill angle (7-mm drill P = 0.005, 8-mm drill P = 0.001, 9-mm drill P = 0.001). On the basis of this study in the context of animal model and observational evidence, the area of physeal injury using drill tunnels for anterior cruciate ligament reconstruction would not appear to contribute to potential growth disturbances. © 2016 Royal Australasian College of Surgeons.

  12. Growth arrest and decrease of alpha-SMA and type I collagen expression by palmitic acid in the rat hepatic stellate cell line PAV-1.

    Science.gov (United States)

    Abergel, Armand; Sapin, Vincent; Dif, Nicolas; Chassard, Christophe; Darcha, Claude; Marcand-Sauvant, Julie; Gaillard-Martinie, Brigitte; Rock, Edmond; Dechelotte, Pierre; Sauvant, Patrick

    2006-05-01

    Liver fibrosis is characterized by an activation of hepatic stellate cells (HSC). During primary culture HSC evolve from a quiescent into an activated phenotype which is characterized by alpha-smooth muscle actin (alpha-SMA) up-regulation, increase in cell growth, and extracellular matrix secretion. HSC culture with trans-resveratrol can lead to deactivation of myofibroblast-like HSC. We used an HSC line, PAV-1, to check the role of retinol and palmitic acid in the deactivation process of HSC. Using mass and metabolic-based methods, Western blot and immunocytochemistry assays, we demonstrated that treatment with palmitic acid (75 muM) alone or in combination with retinol (2 muM) significantly decreased cell proliferation and alpha-SMA expression. We also established that the association of both compounds strongly decreased collagen type I expression. Our results suggest the potential use of palmitic acid alone or in combination with retinol to induce HSC deactivation.

  13. Proteasomal degradation of sphingosine kinase 1 and inhibition of dihydroceramide desaturase by the sphingosine kinase inhibitors, SKi or ABC294640, induces growth arrest in androgen-independent LNCaP-AI prostate cancer cells.

    Science.gov (United States)

    McNaughton, Melissa; Pitman, Melissa; Pitson, Stuart M; Pyne, Nigel J; Pyne, Susan

    2016-03-29

    Sphingosine kinases (two isoforms termed SK1 and SK2) catalyse the formation of the bioactive lipid sphingosine 1-phosphate. We demonstrate here that the SK2 inhibitor, ABC294640 (3-(4-chlorophenyl)-adamantane-1-carboxylic acid (pyridin-4-ylmethyl)amide) or the SK1/SK2 inhibitor, SKi (2-(p-hydroxyanilino)-4-(p-chlorophenyl)thiazole)) induce the proteasomal degradation of SK1a (Mr = 42 kDa) and inhibit DNA synthesis in androgen-independent LNCaP-AI prostate cancer cells. These effects are recapitulated by the dihydroceramide desaturase (Des1) inhibitor, fenretinide. Moreover, SKi or ABC294640 reduce Des1 activity in Jurkat cells and ABC294640 induces the proteasomal degradation of Des1 (Mr = 38 kDa) in LNCaP-AI prostate cancer cells. Furthermore, SKi or ABC294640 or fenretinide increase the expression of the senescence markers, p53 and p21 in LNCaP-AI prostate cancer cells. The siRNA knockdown of SK1 or SK2 failed to increase p53 and p21 expression, but the former did reduce DNA synthesis in LNCaP-AI prostate cancer cells. Moreover, N-acetylcysteine (reactive oxygen species scavenger) blocked the SK inhibitor-induced increase in p21 and p53 expression but had no effect on the proteasomal degradation of SK1a. In addition, siRNA knockdown of Des1 increased p53 expression while a combination of Des1/SK1 siRNA increased the expression of p21. Therefore, Des1 and SK1 participate in regulating LNCaP-AI prostate cancer cell growth and this involves p53/p21-dependent and -independent pathways. Therefore, we propose targeting androgen-independent prostate cancer cells with compounds that affect Des1/SK1 to modulate both de novo and sphingolipid rheostat pathways in order to induce growth arrest.

  14. Global analysis of gene expression changes during retinoic acid-induced growth arrest and differentiation of melanoma: comparison to differentially expressed genes in melanocytes vs melanoma

    Directory of Open Access Journals (Sweden)

    Primerano Donald A

    2008-10-01

    Full Text Available Abstract Background The incidence of malignant melanoma has significantly increased over the last decade. Some of these malignancies are susceptible to the growth inhibitory and pro-differentiating effects of all-trans-retinoic acid (RA. The molecular changes responsible for the biological activity of RA in melanoma are not well understood. Results In an analysis of sequential global gene expression changes during a 4–48 h RA treatment of B16 mouse melanoma cells, we found that RA increased the expression of 757 genes and decreased the expression of 737 genes. We also compared the gene expression profile (no RA treatment between non-malignant melan-a mouse melanocytes and B16 melanoma cells. Using the same statistical test, we found 1495 genes whose expression was significantly higher in melan-a than in B16 cells and 2054 genes whose expression was significantly lower in melan-a than in B16 cells. By intersecting these two gene sets, we discovered a common set of 233 genes whose RNA levels were significantly different between B16 and melan-a cells and whose expression was altered by RA treatment. Within this set, RA treatment altered the expression of 203 (87% genes toward the melan-a expression level. In addition, hierarchical clustering showed that after 48 h of RA treatment expression of the 203 genes was more closely related to the melan-a gene set than any other RA treatment time point. Functional analysis of the 203 gene set indicated that RA decreased expression of mRNAs that encode proteins involved in cell division/cell cycle, DNA replication, recombination and repair, and transcription regulation. Conversely, it stimulated genes involved in cell-cell signaling, cell adhesion and cell differentiation/embryonic development. Pathway analysis of the 203 gene set revealed four major hubs of connectivity: CDC2, CHEK1, CDC45L and MCM6. Conclusion Our analysis of common genes in the 48 h RA-treatment of B16 melanoma cells and untreated B16

  15. Association genetics of growth and adaptive traits in loblolly pine (Pinus taeda L.) using whole-exome-discovered polymorphisms

    Science.gov (United States)

    Mengmeng Lu; Konstantin V. Krutovsky; C. Dana Nelson; Jason B. West; Nathalie A. Reilly; Carol A. Loopstra

    2017-01-01

    In the USA, forest genetics research began over 100 years ago and loblolly pine breeding programs were established in the 1950s. However, the genetics underlying complex traits of loblolly pine remains to be discovered. To address this, adaptive and growth traits were measured and analyzed in a clonally tested loblolly pine (Pinus taeda L.) population. Over 2.8 million...

  16. Fast growth phenotype of E. coli K-12 from adaptive laboratory evolution does not require intracellular flux rewiring

    DEFF Research Database (Denmark)

    Long, Christopher P.; Gonzalez, Jacqueline E.; Feist, Adam M.

    2017-01-01

    Adaptive laboratory evolution (ALE) is a widely-used method for improving the fitness of microorganisms in selected environmental conditions. It has been applied previously to Escherichia coli K-12 MG1655 during aerobic exponential growth on glucose minimal media, a frequently used model organism...

  17. An adaptable model for growth and/or shrinkage of droplets in the respiratory tract during inhalation of aqueous particles

    NARCIS (Netherlands)

    Grasmeijer, Niels; Frijlink, Henderik W.; Hinrichs, Wouter L.J.

    2016-01-01

    The site of deposition of pulmonary delivered aerosols is dependent on the aerosol[U+05F3]s droplet size distribution, which may change during inhalation. The aim of this study was to develop a freely accessible and adaptable model that describes the growth (due to condensation) and shrinkage (due

  18. Metabolic adaptation and hormonal regulation in young rabbit does during long-term caloric restriction and subsequent compensatory growth

    NARCIS (Netherlands)

    Rommers, J.M.; Boiti, C.; Brecchia, G.; Meijerhof, R.; Noordhuizen, J.P.T.M.; Decuypere, M.P.; Kemp, B.

    2004-01-01

    An experiment was performed to assess the metabolic adaptation and hormonal regulation in young female rabbits during long-term food restriction and subsequent compensatory growth during rearing. Feeding level was either ad libitum (AL, no. = 52) or restricted (R, no. = 52). From 6 to 12 weeks of

  19. Cardiac arrest – cardiopulmonary resuscitation

    Directory of Open Access Journals (Sweden)

    Basri Lenjani

    2014-01-01

    Conclusions: All survivors from cardiac arrest have received appropriate medical assistance within 10 min from attack, which implies that if cardiac arrest occurs near an institution health care (with an opportunity to provide the emergent health care the rate of survival is higher.

  20. Berberine modulates AP-1 activity to suppress HPV transcription and downstream signaling to induce growth arrest and apoptosis in cervical cancer cells

    Directory of Open Access Journals (Sweden)

    Husain Syed A

    2011-04-01

    Full Text Available Abstract Background- Specific types of high risk Human papillomaviruses (HR-HPVs particularly, HPV types 16 and 18 cause cervical cancer and while the two recently developed vaccines against these HPV types are prophylactic in nature, therapeutic options for treatment and management of already existing HPV infection are not available as yet. Because transcription factor, Activator Protein-1 (AP-1 plays a central role in HPV-mediated cervical carcinogenesis, we explored the possibility of its therapeutic targeting by berberine, a natural alkaloid derived from a medicinal plant species, Berberis which has been shown to possess anti-inflammatory and anti-cancer properties with no known toxicity; however, the effect of berberine against HPV has not been elucidated. Results- We studied the effect of berberine on HPV16-positive cervical cancer cell line, SiHa and HPV18-positive cervical cancer cell line, HeLa using electrophoretic mobility gel shift assays, western and northern blotting which showed that berberine could selectively inhibit constitutively activated AP-1 in a dose- and time-dependent manner and downregulates HPV oncogenes expression. Inhibition of AP-1 was also accompanied by changes in the composition of their DNA-binding complex. Berberine specifically downregulated expression of oncogenic c-Fos which was also absent in the AP-1 binding complex. Treatment with berberine resulted in repression of E6 and E7 levels and concomitant increase in p53 and Rb expression in both cell types. Berberine also suppressed expression of telomerase protein, hTERT, which translated into growth inhibition of cervical cancer cells. Interestingly, a higher concentration of berberine was found to reduce the cell viability through mitochondria-mediated pathway and induce apoptosis by activating caspase-3. Conclusion- These results indicate that berberine can effectively target both the host and viral factors responsible for development of cervical cancer

  1. Adaptive mutations in sugar metabolism restore growth on glucose in a pyruvate decarboxylase negative yeast strain.

    Science.gov (United States)

    Zhang, Yiming; Liu, Guodong; Engqvist, Martin K M; Krivoruchko, Anastasia; Hallström, Björn M; Chen, Yun; Siewers, Verena; Nielsen, Jens

    2015-08-08

    A Saccharomyces cerevisiae strain carrying deletions in all three pyruvate decarboxylase (PDC) genes (also called Pdc negative yeast) represents a non-ethanol producing platform strain for the production of pyruvate derived biochemicals. However, it cannot grow on glucose as the sole carbon source, and requires supplementation of C2 compounds to the medium in order to meet the requirement for cytosolic acetyl-CoA for biosynthesis of fatty acids and ergosterol. In this study, a Pdc negative strain was adaptively evolved for improved growth in glucose medium via serial transfer, resulting in three independently evolved strains, which were able to grow in minimal medium containing glucose as the sole carbon source at the maximum specific rates of 0.138, 0.148, 0.141 h(-1), respectively. Several genetic changes were identified in the evolved Pdc negative strains by genomic DNA sequencing. Among these genetic changes, 4 genes were found to carry point mutations in at least two of the evolved strains: MTH1 encoding a negative regulator of the glucose-sensing signal transduction pathway, HXT2 encoding a hexose transporter, CIT1 encoding a mitochondrial citrate synthase, and RPD3 encoding a histone deacetylase. Reverse engineering of the non-evolved Pdc negative strain through introduction of the MTH1 (81D) allele restored its growth on glucose at a maximum specific rate of 0.053 h(-1) in minimal medium with 2% glucose, and the CIT1 deletion in the reverse engineered strain further increased the maximum specific growth rate to 0.069 h(-1). In this study, possible evolving mechanisms of Pdc negative strains on glucose were investigated by genome sequencing and reverse engineering. The non-synonymous mutations in MTH1 alleviated the glucose repression by repressing expression of several hexose transporter genes. The non-synonymous mutations in HXT2 and CIT1 may function in the presence of mutated MTH1 alleles and could be related to an altered central carbon metabolism in

  2. [Population: evolution of Rwandan attitudes or the adaptation of the Rwanda population to population growth].

    Science.gov (United States)

    Ngendakumana, M

    1988-04-01

    A consequence of the increasing pressure on Rwanda's ecosystem resulting from population growth has been that demographic factors have played a significant role in modifying attitudes and beliefs of the population. The history of Rwanda demonstrates a constant struggle for survival in the face of increasing population pressure. Migration, colonization of new agricultural lands, adoption of new crops and new forms of animal husbandry have been responses to population pressures. Recent unprecedented population growth has exceeded the capacity of older systems of cultivation and combinations of agricultural and animal husbandry to support the population. Smaller animals have largely replaced the cattle that once roamed freely in extensive pastures, and new techniques of stabling animals, use of organic or chemical fertilizers, and new tools adapted to the shrinking size of farm plots have represented responses to the new demographic realities. The concept of the family is likewise undergoing modification in the face of population growth and modernization. Children, who once were valued as a source of labor and constrained to conform to the wishes of the parents in return for the eventual inheritance of the goods and livelihood, now increasingly look beyond the household for education and employment. Family land holdings have become too small to support all the members with a claim on them. The greater distances between family members inevitably mean that relations between them lose closeness. The choice of a marriage partner is increasingly assumed by the young people themselves and not by their families. Old traditions of food sharing and hospitality have been curtailed because of the increasing scarcity of food. Despite the changes engendered by increasing population pressure, pronatalist sentiments are still widespread. But the desire to assure the future of each child rather than to await his services, a new conception of women less dependent on their reproductive

  3. [Association study between 834+7G/A and +1332C/T polymorphisms in the growth arrest specific 6 gene and risk of severe preeclampsia in Chinese population].

    Science.gov (United States)

    Ye, Liyan; Guan, Linbo; Fan, Ping; Liu, Xinghui; Liu, Rui; Chen, Jinxin; Zhu, Yue; Wei, Xin; Liu, Yu; Bai, Huai

    2017-02-10

    To investigate the relationship between polymorphisms of the growth arrest specific 6 (GAS6) gene and severe preeclampsia in a South West Han Chinese population. Blood samples from 167 patients with severe preeclampsia and 312 normal pregnant women as controls from Han Chinese in Chengdu area were analyzed by polymerase chain reaction-restriction fragment length polymorphisms. C and T allele frequencies for +1332C/T site were 85.63% and 14.37% in the patient group, respectively, and 78.04% and 21.96% in control group, respectively. The TT genotype and variant T allelic frequencies of the +1332C/T polymorphism were significantly lower in patients with severe preeclampsia than in the control group (both Ppreeclampsia was 0.602 (95%CI: 0.401-0.904) in carriers for the variant T allele (χ 2 =6.045, P=0.014). G and A allele frequencies for 834+7G/A site were 72.75% and 27.25% in case group, respectively, and 74.36% and 25.64% in control group, respectively. The genotype and allele frequencies of the 834+7G/A polymorphism in patients with severe preeclampsia and controls showed no significant differences (both P>0.05). In addition, there was no significant association between the polymorphisms and blood pressure levels in the patient or control groups. The variant GAS6+1332 T allele is associated with a decreased risk for severe preeclampsia in a South West Han Chinese population. On the other hand, the 834+7G/A polymorphism has no effect on the severe preeclampsia.

  4. Growth gains from selective breeding in a spruce hybrid zone do not compromise local adaptation to climate.

    Science.gov (United States)

    MacLachlan, Ian R; Yeaman, Sam; Aitken, Sally N

    2018-02-01

    Hybrid zones contain extensive standing genetic variation that facilitates rapid responses to selection. The Picea glauca  ×  Picea engelmannii hybrid zone in western Canada is the focus of tree breeding programs that annually produce ~90 million reforestation seedlings. Understanding the direct and indirect effects of selective breeding on adaptive variation is necessary to implement assisted gene flow (AGF) polices in Alberta and British Columbia that match these seedlings with future climates. We decomposed relationships among hybrid ancestry, adaptive traits, and climate to understand the implications of selective breeding for climate adaptations and AGF strategies. The effects of selection on associations among hybrid index estimated from ~6,500 SNPs, adaptive traits, and provenance climates were assessed for ~2,400 common garden seedlings. Hybrid index differences between natural and selected seedlings within breeding zones were small in Alberta (average +2%), but larger and more variable in BC (average -7%, range -24% to +1%), slightly favoring P. glauca ancestry. The average height growth gain of selected seedlings over natural seedlings within breeding zones was 36% (range 12%-86%). Clines in growth with temperature-related variables were strong, but differed little between selected and natural populations. Seedling hybrid index and growth trait associations with evapotranspiration-related climate variables were stronger in selected than in natural seedlings, indicating possible preadaptation to drier future climates. Associations among cold hardiness, hybrid ancestry, and cold-related climate variables dominated signals of local adaptation and were preserved in breeding populations. Strong hybrid ancestry-phenotype-climate associations suggest that AGF will be necessary to match interior spruce breeding populations with shifting future climates. The absence of antagonistic selection responses among traits and maintenance of cold adaptation in

  5. Metoclopramide-induced cardiac arrest

    Directory of Open Access Journals (Sweden)

    Martha M. Rumore

    2011-11-01

    Full Text Available The authors report a case of cardiac arrest in a patient receiving intravenous (IV metoclopramide and review the pertinent literature. A 62-year-old morbidly obese female admitted for a gastric sleeve procedure, developed cardiac arrest within one minute of receiving metoclopramide 10 mg via slow intravenous (IV injection. Bradycardia at 4 beats/min immediately appeared, progressing rapidly to asystole. Chest compressions restored vital function. Electrocardiogram (ECG revealed ST depression indicative of myocardial injury. Following intubation, the patient was transferred to the intensive care unit. Various cardiac dysrrhythmias including supraventricular tachycardia (SVT associated with hypertension and atrial fibrillation occurred. Following IV esmolol and metoprolol, the patient reverted to normal sinus rhythm. Repeat ECGs revealed ST depression resolution without pre-admission changes. Metoclopramide is a non-specific dopamine receptor antagonist. Seven cases of cardiac arrest and one of sinus arrest with metoclopramide were found in the literature. The metoclopramide prescribing information does not list precautions or adverse drug reactions (ADRs related to cardiac arrest. The reaction is not dose related but may relate to the IV administration route. Coronary artery disease was the sole risk factor identified. According to Naranjo, the association was possible. Other reports of cardiac arrest, severe bradycardia, and SVT were reviewed. In one case, five separate IV doses of 10 mg metoclopramide were immediately followed by asystole repeatedly. The mechanism(s underlying metoclopramide’s cardiac arrest-inducing effects is unknown. Structural similarities to procainamide may play a role. In view of eight previous cases of cardiac arrest from metoclopramide having been reported, further elucidation of this ADR and patient monitoring is needed. Our report should alert clinicians to monitor patients and remain diligent in surveillance and

  6. Metabolomic Profiling of 13 Diatom Cultures and Their Adaptation to Nitrate-Limited Growth Conditions.

    Directory of Open Access Journals (Sweden)

    Mariusz A Bromke

    Full Text Available Diatoms are very efficient in their use of available nutrients. Changes in nutrient availability influence the metabolism and the composition of the cell constituents. Since diatoms are valuable candidates to search for oil producing algae, measurements of diatom-produced compounds can be very useful for biotechnology. In order to explore the diversity of lipophilic compounds produced by diatoms, we describe the results from an analysis of 13 diatom strains. With the help of a lipidomics platform, which combines an UPLC separation with a high resolution/high mass accuracy mass spectrometer, we were able to measure and annotate 142 lipid species. Out of these, 32 were present in all 13 cultures. The annotated lipid features belong to six classes of glycerolipids. The data obtained from the measurements were used to create lipidomic profiles. The metabolomic overview of analysed cultures is amended by the measurement of 96 polar compounds. To further increase the lipid diversity and gain insight into metabolomic adaptation to nitrogen limitation, diatoms were cultured in media with high and low concentrations of nitrate. The growth in nitrogen-deplete or nitrogen-replete conditions affects metabolite accumulation but has no major influence on the species-specific metabolomic profile. Thus, the genetic component is stronger in determining metabolic patterns than nitrogen levels. Therefore, lipid profiling is powerful enough to be used as a molecular fingerprint for diatom cultures. Furthermore, an increase of triacylglycerol (TAG accumulation was observed in low nitrogen samples, although this trend was not consistent across all 13 diatom strains. Overall, our results expand the current understanding of metabolomics diversity in diatoms and confirm their potential value for producing lipids for either bioenergy or as feed stock.

  7. Metabolomic Profiling of 13 Diatom Cultures and Their Adaptation to Nitrate-Limited Growth Conditions

    Science.gov (United States)

    Bromke, Mariusz A.; Sabir, Jamal S.; Alfassi, Fahad A.; Hajarah, Nahid H.; Kabli, Saleh A.; Al-Malki, Abdulrahman L.; Ashworth, Matt P.; Méret, Michaël; Jansen, Robert K.; Willmitzer, Lothar

    2015-01-01

    Diatoms are very efficient in their use of available nutrients. Changes in nutrient availability influence the metabolism and the composition of the cell constituents. Since diatoms are valuable candidates to search for oil producing algae, measurements of diatom-produced compounds can be very useful for biotechnology. In order to explore the diversity of lipophilic compounds produced by diatoms, we describe the results from an analysis of 13 diatom strains. With the help of a lipidomics platform, which combines an UPLC separation with a high resolution/high mass accuracy mass spectrometer, we were able to measure and annotate 142 lipid species. Out of these, 32 were present in all 13 cultures. The annotated lipid features belong to six classes of glycerolipids. The data obtained from the measurements were used to create lipidomic profiles. The metabolomic overview of analysed cultures is amended by the measurement of 96 polar compounds. To further increase the lipid diversity and gain insight into metabolomic adaptation to nitrogen limitation, diatoms were cultured in media with high and low concentrations of nitrate. The growth in nitrogen-deplete or nitrogen-replete conditions affects metabolite accumulation but has no major influence on the species-specific metabolomic profile. Thus, the genetic component is stronger in determining metabolic patterns than nitrogen levels. Therefore, lipid profiling is powerful enough to be used as a molecular fingerprint for diatom cultures. Furthermore, an increase of triacylglycerol (TAG) accumulation was observed in low nitrogen samples, although this trend was not consistent across all 13 diatom strains. Overall, our results expand the current understanding of metabolomics diversity in diatoms and confirm their potential value for producing lipids for either bioenergy or as feed stock. PMID:26440112

  8. Application studies of line arresters

    Energy Technology Data Exchange (ETDEWEB)

    Zanetta Junior, Luiz Cera; Pereira, Carlos Eduardo de Morais [Sao Paulo Univ., SP (Brazil). Escola Politecnica. Dept. de Engenharia de Energia e Automacao Eletricas]. E-mail: lzanetta@pea.usp.br

    2001-07-01

    This paper presents the main calculations of the line arresters impact on outage rates, by focusing their effects on critical current curves, in presence of the power frequency voltage. The present critical results obtained will help in the understanding of some variables during the outrage calculations. Energy stresses on arresters due to first stroke are also evaluated in function of tower foot resistance. The transmission line studied, has a shielded 138 kV line configuration, single circuit typical of Brazilian SE region. The alternative with Zn O arresters consider their installation at every tower, in the two lower phases b and c. (author)

  9. Growth-arresting Activity of Acmella Essential Oil and its Isolated Component D-Limonene (1, 8 P-Mentha Diene) againstTrichophyton rubrum(Microbial Type Culture Collection 296).

    Science.gov (United States)

    Padhan, Diptikanta; Pattnaik, Smaranika; Behera, Ajaya Kumar

    2017-10-01

    Spilanthes acmella is used as a remedy in toothache complaints by the tribal people of Western part of Odisha, India. The objective of this study was to study the growth-arresting activity of an indigenous Acmella essential oil (EO) ( S. acmella Murr, Asteraceae ) and its isolated component, d-limonene against Trichophyton rubrum (microbial type culture collection 296). The EO was extracted from flowers of indigenous S. acmella using Clevenger's apparatus and analyzed by gas chromatography-mass spectrometry (GC-MS). High pressure liquid chromatography (HPLC) was carried out to isolate the major constituent. The isolated fraction was subjected to fourier transform infrared spectroscopy (FTIR) and nuclear magnetic resonance (NMR). The antidermatophytic activity was screened for using "disc diffusion" and "slant dilution" method followed by optical, scanning electron microscopy (SEM), and transmission electron microscopy (TEM) studies. The molecular dockings were made between d-limonene with cell wall synthesis-related key enzymes (14 methyl deaminase and monooxygenase). The GC-MS analysis EO had inferred the presence of 7 number of major (≥2%) components. The component with highest peak area (%) was found to be 41.02. The HPLC-isolated fraction was identified as d-limonene (1,8 p-Mentha-diene) by FTIR and NMR. Qualitative and quantitative assays had suggested the growth inhibitory activity of Acmella EO and its component. Shrinkage, evacuation, cell wall puncture, and leakage of cellular constituents by the activity of Acmella oil and d-limonene were evidenced from optical, SEM, and TEM studies. The computer simulation had predicted the binding strengths of d-limonene and fluconazole with dermatophyte cell wall enzymes. There could have been synergistic action of all or some of compounds present in indigenous Acmella EO. There was presence of seven number of (d-limonene, ocimene, β-myrcene, cyclohexene, 3-(1, 5-dimethyl-4-hexenyl)-6-methylene,

  10. Growth arrest specific protein (GAS) 6

    DEFF Research Database (Denmark)

    Haase, T N; Rasmussen, Morten; Jaksch, C A M

    2013-01-01

    aimed to identify differentially expressed genes in the pancreas and their potential role in the fetal programming. Methods Wistar rats were given either an LP diet or normal-chow (NC) diet during gestation and differentially expressed genes in the offspring around the time of birth were identified...

  11. Intestinal growth adaptation and glucagon-like peptide 2 in rats with ileal--jejunal transposition or small bowel resection

    DEFF Research Database (Denmark)

    Thulesen, J; Hartmann, B; Kissow, Hannelouise

    2001-01-01

    -jejunal transposition, resection of the proximal or distal half of the small intestine, and appropriate sham-operated controls. After two weeks, ileal-jejunal transposition led to pronounced growth of the transposed segment and also of the remaining intestinal segments. Plasma GLP-2 levels increased twofold, whereas...... GLP-2 levels in the intestinal segments were unchanged. In resected rats with reduced intestinal capacity, adaptive small bowel growth was more pronounced following proximal resection than distal small bowel resection. Circulating GLP-2 levels increased threefold in proximally resected animals...... with increased plasma levels of GLP-2, and GLP-2 seems to act in an endocrine as well as a paracrine manner....

  12. Diabetic intestinal growth adaptation and glucagon-like peptide 2 in the rat

    DEFF Research Database (Denmark)

    Thulesen, J; Hartmann, B; Nielsen, C

    1999-01-01

    Dietary fibre influence growth and function of the upper gastrointestinal tract. This study investigates the importance of dietary fibre in intestinal growth in experimental diabetes, and correlates intestinal growth with plasma levels of the intestinotrophic factor, glucagon-like peptide 2 (GLP-2)....

  13. Cognitive and Adaptive Advantages of Growth Hormone Treatment in Children with Prader-Willi Syndrome

    Science.gov (United States)

    Dykens, Elisabeth M.; Roof, Elizabeth; Hunt-Hawkins, Hailee

    2017-01-01

    Background: People with Prader-Willi syndrome (PWS) typically have mild to moderate intellectual deficits, compulsivity, hyperphagia, obesity, and growth hormone deficiencies. Growth hormone treatment (GHT) in PWS has well-established salutatory effects on linear growth and body composition, yet cognitive benefits of GHT, seen in other patient…

  14. Interfacial Crack Arrest in Sandwich Panels with Embedded Crack Stoppers Subjected to Fatigue Loading

    DEFF Research Database (Denmark)

    Martakos, G.; Andreasen, J. H.; Berggreen, Christian

    2017-01-01

    A novel crack arresting device has been implemented in sandwich panels and tested using a special rig to apply out-of-plane loading on the sandwich panel face-sheets. Fatigue crack propagation was induced in the face-core interface of the sandwich panels which met the crack arrester. The effect...... of the embedded crack arresters was evaluated in terms of the achieved enhancement of the damage tolerance of the tested sandwich panels. A finite element (FE) model of the experimental setup was used for predicting propagation rates and direction of the crack growth. The FE simulation was based on the adoption...... as the overall performance of the crack arresters....

  15. Land management on soil physical properties and maize (Zea mays L. var. BIMA) growth (An adaptation strategy of climate change)

    Science.gov (United States)

    Zaki, M. K.; Komariah; Pujiasmanto, B.; Noda, K.

    2018-03-01

    Water deficit is a problem on rainfed maize production but can be solved by proper land management. The objective of the study to determine the soil physical properties and maize yield affected by land management to adapt to drought. The experimental design was a randomized complete block using 5 treatments with 4 repetitions, including: (i) Control (KO), (ii) Rice Straw Mulched (MC), (iii) Compost Fertilizer (CF), (iv) In-Organic Fertilizer (AF), (v) Legume Cover crop (CC). Soil physical and maize growth properties namely soil moisture, soil texture, soil bulk density, plant height, biomass, and yield were investigated. The results showed that composting land increased soil water availability and provided nutrient to crops and thus increase soil physical properties, maize growth and yield. Although inorganic fertilizer also increased plant growth and yield, but it did not improve soil physical properties.

  16. Brain serotonergic activation in growth-stunted farmed salmon: adaption versus pathology

    DEFF Research Database (Denmark)

    Vindas, Marco A.; Johansen, Ida B.; Folkedal, Ole

    2016-01-01

    Signalling systems activated under stress are highly conserved, suggesting adaptive effects of their function. Pathologies arising from continued activation of such systems may represent a mismatch between evolutionary programming and current environments. Here, we use Atlantic salmon (Salmo salar...

  17. Growth of infants born to HIV-positive mothers fed a whey-adapted ...

    African Journals Online (AJOL)

    2009-03-04

    Mar 4, 2009 ... Keywords: milk formula; acidification; probiotics; nucleotides; infant growth. Growth of infants born to ... The infants were randomised to receive one of three milk formulas. The intervention comprised ..... Thibault H, Aubert-Jacquin C, Goulet O. Effects of long-term consumption of a fermented infant formula.

  18. Reversible cryo-arrest for imaging molecules in living cells at high spatial resolution

    Science.gov (United States)

    Sabet, Ola; Wehner, Frank; Konitsiotis, Antonios; Fuhr, Günther R.; Bastiaens, Philippe I. H.

    2016-01-01

    The dynamics of molecules in living cells hamper precise imaging of molecular patterns by functional and super resolution microscopy. Circumventing lethal chemical fixation, an on-stage cryo-arrest was developed for consecutive imaging of molecular patterns within the same living, but arrested cells. The reversibility of consecutive cryo-arrests was demonstrated by the high survival rate of different cell lines and intact growth factor signaling that was not perturbed by stress response. Reversible cryo-arrest was applied to study the evolution of ligand-induced receptor tyrosine kinase activation at different scales. The nanoscale clustering of epidermal growth factor receptor (EGFR) in the plasma membrane was assessed by single molecule localization microscopy and endosomal microscale activity patterns of ephrin receptor type-A (EphA2) by fluorescence lifetime imaging microscopy. We thereby demonstrate that reversible cryo-arrest allows the precise determination of molecular patterns while conserving the dynamic capabilities of living cells. PMID:27400419

  19. Different transcriptional responses from slow and fast growth rate strains of Listeria monocytogenes adapted to low temperature

    Directory of Open Access Journals (Sweden)

    Ninoska eCordero

    2016-03-01

    Full Text Available Listeria monocytogenes has become one of the principal foodborne pathogens worldwide. The capacity of this bacterium to grow at low temperatures has opened an interesting field of study in terms of the identification and classification of new strains of L. monocytogenes with different growth capacities at low temperatures. We determined the growth rate at 8 ºC of 110 strains of L. monocytogenes isolated from different food matrices. We identified a group of slow and fast strains according to their growth rate at 8 °C and performed a global transcriptomic assay in strains previously adapted to low temperature. We then identified shared and specific transcriptional mechanisms, metabolic and cellular processes of both groups; bacterial motility was the principal process capable of differentiating the adaptation capacity of L. monocytogenes strains with different ranges of tolerance to low temperatures. Strains belonging to the fast group were less motile, which may allow these strains to achieve a greater rate of proliferation at low temperature.

  20. Gait in ducks (Anas platyrhynchos and chickens (Gallus gallus – similarities in adaptation to high growth rate

    Directory of Open Access Journals (Sweden)

    B. M. Duggan

    2016-08-01

    Full Text Available Genetic selection for increased growth rate and muscle mass in broiler chickens has been accompanied by mobility issues and poor gait. There are concerns that the Pekin duck, which is on a similar selection trajectory (for production traits to the broiler chicken, may encounter gait problems in the future. In order to understand how gait has been altered by selection, the walking ability of divergent lines of high- and low-growth chickens and ducks was objectively measured using a pressure platform, which recorded various components of their gait. In both species, lines which had been selected for large breast muscle mass moved at a slower velocity and with a greater step width than their lighter conspecifics. These high-growth lines also spent more time supported by two feet in order to improve balance when compared with their lighter, low-growth conspecifics. We demonstrate that chicken and duck lines which have been subjected to intense selection for high growth rates and meat yields have adapted their gait in similar ways. A greater understanding of which components of gait have been altered in selected lines with impaired walking ability may lead to more effective breeding strategies to improve gait in poultry.

  1. Problems of house arrest application

    Directory of Open Access Journals (Sweden)

    Mikhail Vladimirovich Kolesnikov

    2015-06-01

    Full Text Available Objective to determine the position of house arrest in the system of preventive measures and to identify the main problems of criminal procedural regulation that prevent its broader use during the preliminary investigation and trial. Methods dialectical approach to the analysis of social phenomena allowing to view them in static and dynamic aspect evolutionarysynergetic paradigm providing the opportunity to explore the phenomenon under investigation with respect to the system subordinate and coordinating relationships within the system. Dialectical approach and the evolutionarysynergetic paradigm determined the choice of specific methods of research historical comparative law comparative formallegal statistical. Results the problems arising with application of house arrest are grouped by author depending on the structure of the provisions of Article 107 of the CriminalProcedural Code of the Russian Federation. The first group of problems includes the determination of the location of the accused suspect under house arrest and the scope of the legal restrictions imposed. The second group includes the establishment of terms of house arrest and their subsequent renewal or change of the preventive measure. The third group is the identification of persons to which the house arrest will be the best preventive measure. The results of the study allow to make proposals to change the current wording of Art. 107 of the CriminalProcedural Code of Russia. Scientific novelty a comprehensive study of current state of the normativelegal regulation of house arrest in the context of its practical application. Practical value the main provisions and conclusions of the article can be used in scientific and pedagogical activity when considering questions about the nature of preventive measures related to the restraint of personal liberty of the accused. nbsp

  2. Growth and collapse of a resource system: an adaptive cycle of change in public lands governance and forest management in Alaska

    Science.gov (United States)

    Colin M. Beier; Amy Lauren Lovecraft; F. Stuart Chapin

    2009-01-01

    Large-scale government efforts to develop resources for societal benefit have often experienced cycles of growth and decline that leave behind difficult social and ecological legacies. To understand the origins and outcomes of these failures of resource governance, scholars have applied the framework of the adaptive cycle. In this study, we used the adaptive cycle as a...

  3. The transcriptome of the nosocomial pathogen Enterococcus faecalis V583 reveals adaptive responses to growth in blood.

    Directory of Open Access Journals (Sweden)

    Heidi C Vebø

    Full Text Available BACKGROUND: Enterococcus faecalis plays a dual role in human ecology, predominantly existing as a commensal in the alimentary canal, but also as an opportunistic pathogen that frequently causes nosocomial infections like bacteremia. A number of virulence factors that contribute to the pathogenic potential of E. faecalis have been established. However, the process in which E. faecalis gains access to the bloodstream and establishes a persistent infection is not well understood. METHODOLOGY/PRINCIPAL FINDINGS: To enhance our understanding of how this commensal bacterium adapts during a bloodstream infection and to examine the interplay between genes we designed an in vitro experiment using genome-wide microarrays to investigate what effects the presence of and growth in blood have on the transcriptome of E. faecalis strain V583. We showed that growth in both 2xYT supplemented with 10% blood and in 100% blood had a great impact on the transcription of many genes in the V583 genome. We identified several immediate changes signifying cellular processes that might contribute to adaptation and growth in blood. These include modulation of membrane fatty acid composition, oxidative and lytic stress protection, acquisition of new available substrates, transport functions including heme/iron transporters and genes associated with virulence in E. faecalis. CONCLUSIONS/SIGNIFICANCE: The results presented here reveal that cultivation of E. faecalis in blood in vitro has a profound impact on its transcriptome, which includes a number of virulence traits. Observed regulation of genes and pathways revealed new insight into physiological features and metabolic capacities which enable E. faecalis to adapt and grow in blood. A number of the regulated genes might potentially be useful candidates for development of new therapeutic approaches for treatment of E. faecalis infections.

  4. Professional growth in adaptive teaching competence as a result of Lesson Study

    NARCIS (Netherlands)

    Schipper, Tijmen; Goei, Sui Lin; de Vries, Siebrich; van Veen, Klaas

    2017-01-01

    Since classrooms have become more diverse, professional development on adaptive teaching seems critically important, yet turns out to be complex. Lesson Study may address this issue due to its explicit focus on student learning. In total, 22 Lesson Study participants from" different school contexts

  5. Simulation and Evaluation of Urban Growth for Germany Including Climate Change Mitigation and Adaptation Measures

    Directory of Open Access Journals (Sweden)

    Jana Hoymann

    2016-06-01

    Full Text Available Decision-makers in the fields of urban and regional planning in Germany face new challenges. High rates of urban sprawl need to be reduced by increased inner-urban development while settlements have to adapt to climate change and contribute to the reduction of greenhouse gas emissions at the same time. In this study, we analyze conflicts in the management of urban areas and develop integrated sustainable land use strategies for Germany. The spatial explicit land use change model Land Use Scanner is used to simulate alternative scenarios of land use change for Germany for 2030. A multi-criteria analysis is set up based on these scenarios and based on a set of indicators. They are used to measure whether the mitigation and adaptation objectives can be achieved and to uncover conflicts between these aims. The results show that the built-up and transport area development can be influenced both in terms of magnitude and spatial distribution to contribute to climate change mitigation and adaptation. Strengthening the inner-urban development is particularly effective in terms of reducing built-up and transport area development. It is possible to reduce built-up and transport area development to approximately 30 ha per day in 2030, which matches the sustainability objective of the German Federal Government for the year 2020. In the case of adaptation to climate change, the inclusion of extreme flood events in the context of spatial planning requirements may contribute to a reduction of the damage potential.

  6. Mortality affects adaptive allocation to growth and reproduction: field evidence from a guild of body snatchers

    OpenAIRE

    Hechinger Ryan F

    2010-01-01

    Abstract Background The probability of being killed by external factors (extrinsic mortality) should influence how individuals allocate limited resources to the competing processes of growth and reproduction. Increased extrinsic mortality should select for decreased allocation to growth and for increased reproductive effort. This study presents perhaps the first clear cross-species test of this hypothesis, capitalizing on the unique properties offered by a diverse guild of parasitic castrator...

  7. Interfacial crack arrest in sandwich beams subjected to fatigue loading using a novel crack arresting device – Numerical modelling

    DEFF Research Database (Denmark)

    Martakos, G.; Andreasen, J.H.; Berggreen, Christian

    2017-01-01

    A novel crack arresting device is implemented in foam-cored composite sandwich beams and tested using the Sandwich Tear Test (STT) configuration. A finite element model of the setup is developed, and the predictions are correlated with observations and results from a recently conducted experimental...... fatigue test study. Based on a linear elastic fracture mechanics approach, the developed FE model is utilised to simulate crack propagation and arrest in foam-cored sandwich beam specimens subjected to fatigue loading conditions. The effect of the crack arresters on the fatigue life is analysed......, and the predictive results are subsequently compared with the observations from the previously conducted fatigue tests. The FE model predicts the energy release rate and the mode mixity based on the derived crack surface displacements, utilising algorithms for the prediction of accelerated fatigue crack growth...

  8. An airline cardiac arrest program.

    Science.gov (United States)

    O'Rourke, M F; Donaldson, E; Geddes, J S

    1997-11-04

    As many as 1000 lives are lost annually from cardiac arrest in commercial aircraft. Ventricular fibrillation (VF), the most common mechanism, can be treated effectively only with prompt defibrillation, whereas the current policy of most airlines is to continue cardiopulmonary resuscitation pending aircraft diversion. The objective of this study was to assess the impact of making semiautomatic external defibrillators (AEDs) available for use on airline passengers with cardiac arrest. AEDs were installed on international Qantas aircraft and at major terminals, selected crew were trained in their use, and all crew members were trained in cardiopulmonary resuscitation. Supervision was provided by medical volunteers or (remotely) by airline physicians. During a 64-month period, AEDs were used on 109 occasions: 63 times for monitoring an acutely ill passenger and 46 times for cardiac arrest. Twenty-seven episodes of cardiac arrest occurred in aircraft, often (11 of 27 [41%]) unwitnessed, and they were usually (21 of 27 [78%]) associated with asystole or pulseless idioventricular rhythm. All 19 arrests in terminals were witnessed; VF was present in 17 (89%). Overall, defibrillation was initially successful in 21 of 23 cases (91%). Long-term survival from VF was achieved in 26% (2 of 6 in aircraft and 4 of 17 in terminals). The ability to monitor cardiac rhythm aided decisions on diversion, which was avoided in most passengers with asystole or idioventricular rhythm. AEDs in aircraft and terminals, with appropriate crew training, are helpful in the management of cardiac emergencies. Survival from VF is practicable and is comparable with the most effective prehospital ambulance emergency services. Costly aircraft diversions can be avoided in clearly futile situations, enhancing the cost-effectiveness of the program.

  9. Adaptation of the QoL-AGHDA scale for adults with growth hormone deficiency in four Slavic languages

    Directory of Open Access Journals (Sweden)

    McKenna Stephen P

    2011-08-01

    Full Text Available Abstract Purpose The Quality of Life in Adult Growth Hormone Deficiency Assessment (QoL-AGHDA is a disease-specific quality of life measure specific to individuals who are growth hormone deficient. The present study describes the adaptation of the QoL-AGHDA for use in the following four Slavic languages; Czech, Polish, Serbian and Slovakian. Methods The study involved three stages in each language; translation, cognitive debriefing and validation. The validation stage assessed internal consistency (Cronbach's alpha, reproducibility (test-retest reliability using Spearman's rank correlations, convergent and divergent validity (Correlations with the NHP and known group validity. Results The QoL-AGHDA was successfully translated into the target languages with minimal problems. Cognitive debriefing interviewees (n = 15-18 found the measures easy to complete and identified few problems with the content. Internal consistency (Czech Republic = 0.91, Poland = 0.91, Serbia = 0.91 and Slovakia = 0.89 and reproducibility (Czech Republic = 0.91, Poland = 0.91, Serbia = 0.88 and Slovakia = 0.93 were good in all adaptations. Convergent and divergent validity and known group validity data were not available for Slovakia. The QoL-AGHDA correlated as expected with the NHP scales most relevant to GHD. The QoL-AGHDA was able to distinguish between participants based on a range of variables. Conclusions The QoL-AGHDA was successfully adapted for use in the Czech Republic, Poland, Serbia and Slovakia. Further validation of the Slovakian version would be beneficial. The addition of these new lanaguage versions will prove valuable to multinational clinical trials and to clinical practice in the respective countries.

  10. Long-term warming of a subarctic heath decreases soil bacterial community growth but has no effects on its temperature adaptation

    DEFF Research Database (Denmark)

    Rinnan, Riikka; Michelsen, Anders; Bååth, E

    2011-01-01

    We tested whether bacterial communities of subarctic heath soil are adapted to elevated temperature after experimental warming by open-top greenhouses for 7 or 17 years. The long-term warming by 1–2 °C significantly decreased bacterial community growth, by 28% and 73% after 7 and 17 years......, respectively. The decrease was most likely due to decreased availability of labile substrate under warming. However, we found no evidence for temperature adaptation of soil bacterial communities. The optimum temperature for bacterial growth was on average 25 °C, and the apparent minimum temperature for growth...

  11. Insertion-Sequence-Mediated Mutations Isolated During Adaptation to Growth and Starvation in Lactococcus lactis.

    NARCIS (Netherlands)

    Visser, de J.A.G.M.; Akkermans, A.D.L.; Hoekstra, R.F.; Vos, de W.M.

    2004-01-01

    We studied the activity of three multicopy insertion sequence (IS) elements in 12 populations of Lactococcus lactis IL1403 that evolved in the laboratory for 1000 generations under various environmental conditions (growth or starvation and shaken or stationary). Using RFLP analysis of single-clone

  12. Out-of-hospital Cardiac Arrest (OHCA) Biomarkers

    Science.gov (United States)

    2017-12-21

    Neurological Outcome; Cardiac Arrest; Out-Of-Hospital Cardiac Arrest; Brain Anoxia Ischemia; Hypoxia, Brain; Hypoxia-Ischemia, Brain; Cardiac Arrest With Successful Resuscitation; Cardiac Arrest, Out-Of-Hospital; Brain Injuries

  13. Cold adaptation improves the growth of seasonal influenza B vaccine viruses.

    Science.gov (United States)

    Kim, Hyunsuh; Schoofs, Peter; Anderson, David A; Tannock, Gregory A; Rockman, Steven P

    2014-05-01

    Gene reassortment has proved useful in improving yields of influenza A antigens of egg-based inactivated vaccines, but similar approaches have been difficult with influenza B antigens. Current regulations for influenza vaccine seed viruses limit the number of egg passages and as a result resultant yields from influenza B vaccine seed viruses are frequently inconsistent. Therefore, reliable approaches to enhance yields of influenza B vaccine seed viruses are required for efficient vaccine manufacture. In the present study three stable cold-adapted (ca) mutants, caF, caM and caB derived from seasonal epidemic strains, B/Florida/4/2006, B/Malaysia/2506/2004 and B/Brisbane/60/2008 were prepared, which produced high hemagglutinin antigen yields and also increased viral yields of reassortants possessing the desired 6:2 gene constellation. The results demonstrate that consistent improvements in yields of influenza B viruses can be obtained by cold adaptation following extended passage. Taken together, the three ca viruses were shown to have potential as donor viruses for the preparation of high-yielding influenza B vaccine viruses by reassortment. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Vegetative anatomical adaptations of Epidendrum radicans (Epidendroideae, Orchidaceae to epiphytic conditions of growth

    Directory of Open Access Journals (Sweden)

    Muthukumar Thangavelu

    2017-12-01

    Full Text Available The anatomical properties of leaf, stem, and root of Epidendrum radicans Pav. ex Lindl., belonging to the subfamily Epidendroideae (Orchidaceae were investigated for adaptations to stressed habitats. The anatomical investigation revealed that leaves of E. radicans have a thick cuticle (3–4 µm and paracytic type of stomata. Foliar epidermal cells are conical on the adaxial surface and rectangular in the abaxial surface, distinct hypodermis absent, and uniseriate fiber bundles are arranged in both sides of the leaves. The foliar mesophyll is homogenous and starch grains and raphides present. The leaf sheath covering the stem have cuticle restricted to the outer surface and air spaces are present. The stem has a cuticulerized uniseriate epidermis and a uniseriate hypodermis. The cortex and a parenchymatous ground tissue of the stem are separated by a layer of sclerenchymatous band. Vascular bundles are collateral and their size generally increases from the periphery towards the center. A sclerenchymatous patch covers the phloem pole, whereas the xylem is covered by thin-walled parenchymatous cells. The roots possess Epidendrum-type velamen. Cover cells present. Uniseriate dimorphic exodermis consists of U-thickened long cells and thin-walled passage cells. The endodermal cells O-thickened, pericycle sclerenchymatous, xylem 10–14 arched. The pith is sclerenchymatous, but parenchymatous at the center. The anatomical examination of E. radicans revealed adaptations to moisture stress conditions like thick cuticle covering the leaves and stem, water storage cells, multilayered velamen and dimorphic exodermis.

  15. Adaptation of root growth to increased ambient temperature requires auxin and ethylene coordination in Arabidopsis

    DEFF Research Database (Denmark)

    Fei, Qionghui; Wei, Shaodong; Zhou, Zhaoyang

    2017-01-01

    Key message: A fresh look at the roles of auxin, ethylene, and polar auxin transport during the plant root growth response to warmer ambient temperature (AT). Abstract: The ambient temperature (AT) affects plant growth and development. Plants can sense changes in the AT, but how this change......-naphthaleneacetic acid, but not indole-3-acetic acid (IAA). AUX1, PIN1, and PIN2 are involved in the ckrc1-1 root gravity response under increased AT. Furthermore, CKRC1-dependent auxin biosynthesis was critical for maintaining PIN1, PIN2, and AUX1 expression at elevated temperatures. Ethylene was also involved...... in this regulation through the ETR1 pathway. Higher AT can promote CKRC1-dependent auxin biosynthesis by enhancing ETR1-mediated ethylene signaling. Our research suggested that the interaction between auxin and ethylene and that the interaction-mediated polar auxin transport play important roles during the plant...

  16. Extra-gynoecial pollen-tube growth in apocarpous angiosperms is phylogenetically widespread and probably adaptive.

    Science.gov (United States)

    Wang, Xiao-Fan; Armbruster, W Scott; Huang, Shuang-Quan

    2012-01-01

    • Fusion of floral carpels (syncarpy) in angiosperms is thought to have allowed for significant improvements in offspring quantity and quality in syncarpous species over gymnosperms and apocarpous (free-carpelled) angiosperms. Given the disadvantages of apocarpy, it remains an evolutionary puzzle why many angiosperm lineages with free carpels (apocarpy) have been so successful and why some lineages show reversals to apocarpy. • To investigate whether some advantages of syncarpy may accrue in other ways to apocarpous species, we reviewed previous studies of pollen-tube growth in apocarpous species and also documented pollen-tube growth in nine additional apocarpous species in six families. • Anatomical studies of a scattering of apocarpous paleodicots, monocots, and eudicots show that, after transiting the style, 'extra' pollen tubes exit fully fertilized carpels and grow to other carpels with unfertilized ovules. In many species this occurs via openings in the simple carpels, as we report here for Sagittaria potamogetifolia, Sagittaria pygmaea, Sedum lineare, and Schisandra sphenanthera. • The finding that extra-gynoecial pollen-tube growth is widespread in apocarpous species eliminates the possibility of a major fitness cost of apocarpy relative to syncarpy and may help to explain the persistence of, and multiple reversals to, apocarpy in the evolutionary history of angiosperms. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

  17. Photosynthetic performance in Antarctic lichens with different growth forms reflect the diversity of lichenized algal adaptation to microhabitats

    Directory of Open Access Journals (Sweden)

    Cao Shunan

    2015-06-01

    Full Text Available Lichens, as typical obligate associations between lichenized fungi and their photosynthetic partners, are dominant in Antarctica. Three Antarctic lichens, Ochrolechia frigida, Umbilicaria antarctica, and Usnea aurantiacoatra with different growth forms, were sampled nearby the Great Wall Station, King George Island. Molecular data revealed that the photosynthetic algae in these three lichens were Trebouxia jamesii. The net photo− synthesis (Pn of three individuals from these species, together with environmental factors such as light and temperature, were recorded by CO2 gas exchange measurements using a CI−340 portable photosynthetic system in situ. Differences between T(leaf (the temperature of the thalli and T(air (the air temperature for these lichens were not consistent, which reflected that environment and the growth form of thalli could affect T(leaf significantly. Strong irradiation was expected to have adverse effects on Pn of Ochrolechia frigida and Umbilicaria antarctica whose thalli spread flat; but this photoinhibition had little effect on Usnea aurantiacoatra with exuberant tufted thallus. These results indicated that photosynthetic activity in lichens was affected by the growth forms of thalli besides microhabitat factors. One species of lichenized alga could exhibit diversified types of photosynthetic behavior when it was associated with various lichenized fungi in different microhabitats. It will be helpful for understanding how lichens are able to adapt to and colonize in extreme environments.

  18. Adaptation of high-growth influenza H5N1 vaccine virus in Vero cells: implications for pandemic preparedness.

    Directory of Open Access Journals (Sweden)

    Yu-Fen Tseng

    Full Text Available Current egg-based influenza vaccine production technology can't promptly meet the global demand during an influenza pandemic as shown in the 2009 H1N1 pandemic. Moreover, its manufacturing capacity would be vulnerable during pandemics caused by highly pathogenic avian influenza viruses. Therefore, vaccine production using mammalian cell technology is becoming attractive. Current influenza H5N1 vaccine strain (NIBRG-14, a reassortant virus between A/Vietnam/1194/2004 (H5N1 virus and egg-adapted high-growth A/PR/8/1934 virus, could grow efficiently in eggs and MDCK cells but not Vero cells which is the most popular cell line for manufacturing human vaccines. After serial passages and plaque purifications of the NIBRG-14 vaccine virus in Vero cells, one high-growth virus strain (Vero-15 was generated and can grow over 10(8 TCID(50/ml. In conclusion, one high-growth H5N1 vaccine virus was generated in Vero cells, which can be used to manufacture influenza H5N1 vaccines and prepare reassortant vaccine viruses for other influenza A subtypes.

  19. Leuconostoc mesenteroides growth in food products: prediction and sensitivity analysis by adaptive-network-based fuzzy inference systems.

    Directory of Open Access Journals (Sweden)

    Hue-Yu Wang

    Full Text Available BACKGROUND: An adaptive-network-based fuzzy inference system (ANFIS was compared with an artificial neural network (ANN in terms of accuracy in predicting the combined effects of temperature (10.5 to 24.5°C, pH level (5.5 to 7.5, sodium chloride level (0.25% to 6.25% and sodium nitrite level (0 to 200 ppm on the growth rate of Leuconostoc mesenteroides under aerobic and anaerobic conditions. METHODS: THE ANFIS AND ANN MODELS WERE COMPARED IN TERMS OF SIX STATISTICAL INDICES CALCULATED BY COMPARING THEIR PREDICTION RESULTS WITH ACTUAL DATA: mean absolute percentage error (MAPE, root mean square error (RMSE, standard error of prediction percentage (SEP, bias factor (Bf, accuracy factor (Af, and absolute fraction of variance (R (2. Graphical plots were also used for model comparison. CONCLUSIONS: The learning-based systems obtained encouraging prediction results. Sensitivity analyses of the four environmental factors showed that temperature and, to a lesser extent, NaCl had the most influence on accuracy in predicting the growth rate of Leuconostoc mesenteroides under aerobic and anaerobic conditions. The observed effectiveness of ANFIS for modeling microbial kinetic parameters confirms its potential use as a supplemental tool in predictive mycology. Comparisons between growth rates predicted by ANFIS and actual experimental data also confirmed the high accuracy of the Gaussian membership function in ANFIS. Comparisons of the six statistical indices under both aerobic and anaerobic conditions also showed that the ANFIS model was better than all ANN models in predicting the four kinetic parameters. Therefore, the ANFIS model is a valuable tool for quickly predicting the growth rate of Leuconostoc mesenteroides under aerobic and anaerobic conditions.

  20. Dual role of tree florigen activation complex component FD in photoperiodic growth control and adaptive response pathways.

    Science.gov (United States)

    Tylewicz, Szymon; Tsuji, Hiroyuki; Miskolczi, Pál; Petterle, Anna; Azeez, Abdul; Jonsson, Kristoffer; Shimamoto, Ko; Bhalerao, Rishikesh P

    2015-03-10

    A complex consisting of evolutionarily conserved FD, flowering locus T (FT) proteins is a regulator of floral transition. Intriguingly, FT orthologs are also implicated in developmental transitions distinct from flowering, such as photoperiodic control of bulbing in onions, potato tuberization, and growth cessation in trees. However, whether an FT-FD complex participates in these transitions and, if so, its mode of action, are unknown. We identified two closely related FD homologs, FD-like 1 (FDL1) and FD-like 2 (FDL2), in the model tree hybrid aspen. Using gain of function and RNAi-suppressed FDL1 and FDL2 transgenic plants, we show that FDL1 and FDL2 have distinct functions and a complex consisting of FT and FDL1 mediates in photoperiodic control of seasonal growth. The downstream target of the FT-FD complex in photoperiodic control of growth is Like AP1 (LAP1), a tree ortholog of the floral meristem identity gene APETALA1. Intriguingly, FDL1 also participates in the transcriptional control of adaptive response and bud maturation pathways, independent of its interaction with FT, presumably via interaction with abscisic acid insensitive 3 (ABI3) transcription factor, a component of abscisic acid (ABA) signaling. Our data reveal that in contrast to its primary role in flowering, FD has dual roles in the photoperiodic control of seasonal growth and stress tolerance in trees. Thus, the functions of FT and FD have diversified during evolution, and FD homologs have acquired roles that are independent of their interaction with FT.

  1. Leuconostoc mesenteroides growth in food products: prediction and sensitivity analysis by adaptive-network-based fuzzy inference systems.

    Science.gov (United States)

    Wang, Hue-Yu; Wen, Ching-Feng; Chiu, Yu-Hsien; Lee, I-Nong; Kao, Hao-Yun; Lee, I-Chen; Ho, Wen-Hsien

    2013-01-01

    An adaptive-network-based fuzzy inference system (ANFIS) was compared with an artificial neural network (ANN) in terms of accuracy in predicting the combined effects of temperature (10.5 to 24.5°C), pH level (5.5 to 7.5), sodium chloride level (0.25% to 6.25%) and sodium nitrite level (0 to 200 ppm) on the growth rate of Leuconostoc mesenteroides under aerobic and anaerobic conditions. THE ANFIS AND ANN MODELS WERE COMPARED IN TERMS OF SIX STATISTICAL INDICES CALCULATED BY COMPARING THEIR PREDICTION RESULTS WITH ACTUAL DATA: mean absolute percentage error (MAPE), root mean square error (RMSE), standard error of prediction percentage (SEP), bias factor (Bf), accuracy factor (Af), and absolute fraction of variance (R (2)). Graphical plots were also used for model comparison. The learning-based systems obtained encouraging prediction results. Sensitivity analyses of the four environmental factors showed that temperature and, to a lesser extent, NaCl had the most influence on accuracy in predicting the growth rate of Leuconostoc mesenteroides under aerobic and anaerobic conditions. The observed effectiveness of ANFIS for modeling microbial kinetic parameters confirms its potential use as a supplemental tool in predictive mycology. Comparisons between growth rates predicted by ANFIS and actual experimental data also confirmed the high accuracy of the Gaussian membership function in ANFIS. Comparisons of the six statistical indices under both aerobic and anaerobic conditions also showed that the ANFIS model was better than all ANN models in predicting the four kinetic parameters. Therefore, the ANFIS model is a valuable tool for quickly predicting the growth rate of Leuconostoc mesenteroides under aerobic and anaerobic conditions.

  2. Effects of submergence on growth and survival of saplings of three wetland trees differing in adaptive mechanisms for flood tolerance

    Directory of Open Access Journals (Sweden)

    Fumiko Iwanaga

    2015-04-01

    Full Text Available Aim of study: Withstanding total submergence and reaeration following submergence is essential for the survival and establishment of wetland species. We focused on “LOES–low oxygen escape syndrome” and “LOQS–low oxygen quiescence syndrome” and compared tolerances to total submergence among wetland woody species differing in morphological adaptation to soil flooding. Area of study, materials and methods: This study examined the survival of 2-year-old saplings of Taxodium distichum and Metasequioia glyptostroboides (LOQS species, and Alnus japonica (LOES species, during and after total submergence. Saplings were completely submerged, then de-submerged to determine trends in survival and growth Main results: The M. glyptostroboides and A. japonica saplings could not survive prolonged submergence for more than 8 weeks, whereas saplings of T. distichum survived for over 2 years. Submerged saplings of all species showed no significant growth or modifications in morphology and anatomy under water, such as shoot elongation, adventitious root formation, and/or aerenchyma development. All T. distichum saplings that were de-submerged in the second year had the same pattern of shoot growth regardless of differences in timing and seasonality of de-submergence. Wood formation in T. distichum saplings ceased during submergence and resumed after de-submergence in spring and summer, but not in autumn. Research highlights: T. distichum saplings, which survived longer submergence periods than A. japonica and M. glyptostroboides, had physiological characteristics, such as suspension of growth and metabolism, which allowed survival of protracted total submergence (at least 2 years when saplings were immersed during the dormant stage before leaf flushing.

  3. Effect of silver nanoparticles and silver ions on growth and adaptive response mechanisms of Pseudomonas putida mt-2.

    Science.gov (United States)

    Hachicho, Nancy; Hoffmann, Philipp; Ahlert, Kristin; Heipieper, Hermann J

    2014-06-01

    The distribution and use of nanoparticles increased rapidly during the last years, while the knowledge about mode of action, ecological tolerance and biodegradability of these chemicals is still insufficient. The effect of silver nanoparticles (AgNP) and free silver ions (Ag(+) , AgNO3 ) on Pseudomonas putida mt-2 as one of the best described bacterial strains for stress response were investigated. The effective concentration (EC50) causing 50% growth inhibition for AgNP was about 250 mg L(-1) , whereas this was only 0.175 mg L(-1) for AgNO3 . However, when calculating the amount of free silver ions released from AgNP both tested compounds showed very similar results. Therefore, the antibacterial activity of AgNP can be explained and reduced, respectively, to the amount of silver ions released from the nanoparticles. Both tested compounds showed a strong activation of the unique membrane adaptive response of Pseudomonas strains, the cis-trans isomerization of unsaturated fatty acids, whereas another important adaptive response of these bacteria, changes in cell surface hydrophobicity, measured as water contact angle, was not activated. These results are important informations for the estimation of environmental tolerance of newly developed, active ingredients like silver nanoparticles. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  4. Growth curve of locally adapted pantaneiro cows raised under natural conditions

    Directory of Open Access Journals (Sweden)

    Eleonora Araújo Barbosa

    2013-11-01

    Full Text Available The objective of this study was to use morphometric and ultrasound evaluations to estimate the growth curve of the Pantaneiro cattle breed, raised in its natural habitat, aiming at the re-insertion of this breed in production systems. One hundred and three females, aging from months to 11 years, and raised on native pastures, were evaluated. The animals belonged to the Conservation Nucleus of Embrapa Pantanal, located in the Pantanal of Mato Grosso do Sul (Brazil. Weight, thoracic perimeter (TP, body length (BL, rump height (RH, height at withers (HW, hip height (HH, depth (DP, distance between the ilia (DI (cm and rib-eye area (REA were measured. To relate the measurements with the age of the animals, the univariate regression model was used, assigning the variable response to gamma distribution. The Pearson correlation between variables was also estimated. The inflection point of the growth curve was 37 months for HH; between 38 and 39 months for TP and HW; between 40 and 41 months for DI, HH and DP; and 45 months for BL. The REA results could not fit in a statistical model. The majority of the variables presented a correlation above 60% among themselves, except for REA × Age, of 15.81%; REA × HW, of 34.44%; HH × Age, of 46.19; HH × DI, of 58.07%; REA × HH, of 24.57%; and REA × TP, of 39.9%. The cows showed maturity age at 40 months, which may have occurred because they were raised in natural farming conditions. In Pantaneiro cows reared in extensive systems only on natural pastures, the use of ultrasound is not effective to estimate the curve of muscular development, perhaps because this breed was not selected for weight gain.

  5. Carbamazepine induces mitotic arrest in mammalian Vero cells

    International Nuclear Information System (INIS)

    Perez Martin, J.M.; Fernandez Freire, P.; Labrador, V.; Hazen, M.J.

    2008-01-01

    We reported recently that the anticonvulsant drug carbamazepine, at supratherapeutic concentrations, exerts antiproliferative effects in mammalian Vero cells, but the underlying mechanism has not been elucidated. This motivates us to examine rigorously whether growth arrest was associated with structural changes in cellular organization during mitosis. In the present work, we found that exposure of the cells to carbamazepine led to an increase in mitotic index, mainly due to the sustained block at the metaphase/anaphase boundary, with the consequent inhibition of cell proliferation. Indirect immunofluorescence, using antibodies directed against spindle apparatus proteins, revealed that mitotic arrest was associated with formation of monopolar spindles, caused by impairment of centrosome separation. The final consequence of the spindle defects induced by carbamazepine, depended on the duration of cell cycle arrest. Following the time course of accumulation of metaphase and apoptotic cells during carbamazepine treatments, we observed a causative relationship between mitotic arrest and induction of cell death. Conversely, cells released from the block of metaphase by removal of the drug, continued to progress through mitosis and resume normal proliferation. Our results show that carbamazepine shares a common antiproliferative mechanism with spindle-targeted drugs and contribute to a better understanding of the cytostatic activity previously described in Vero cells. Additional studies are in progress to extend these initial findings that define a novel mode of action of carbamazepine in cultured mammalian cells

  6. Adaptation of Trichoderma Species to Pesticide Confidor and Evaluation of their Growth Ability in the Media Containing Confidor

    Directory of Open Access Journals (Sweden)

    Farnaz Ershadfath

    2015-12-01

    Full Text Available Introduction: Contamination caused by pesticides is considered as one of the environmental problems. Bioremediation is exploiting the ability of microorganisms to remove pollutants. Trichoderma species are free-living fungi that exist naturally in the environment. These fungi have the ability to uptake some contaminants biologically. The aim of this study is to evaluate the effect of Confidor, as an environmental contaminant, on the growth ability of Trichoderma sp. as a contaminant absorber. Materials and methods: Five species of Trichoderma fungi were cultured in PDA media. Then the fungi were adapted with 3 different concentrations of Confidor gradually (5, 10 and 20 mg/l. The diameter of the fungal colonies growing in different concentrations of the toxin, were measured after 24 hr and were compared with the control samples (medium without toxin. Results: Results showed that in all species of fungi the colony diameters increased significantly with increasing toxin concentrations. The largest colony diameter was related to T.tomentosum, T.asperellum and T.harzianum (88.88, 87.5 and 86.95%, respectively at the concentration of 20 mg of toxic. Also, in all studied fungal species, in the medium containing 20 (mg/ l of toxic, the aerial hyphae expanded much thicker and faster than other concentrations. Discussion and conclusion: The results indicate a significant increase in the growth ability of Trichoderma strains with increasing Confidor concentration. Therefore it could be concluded that Trichoderma fungi have a high potentiality for biodegradation of Confidor.

  7. Planting density and initial growth of two tree species adapted to the semi-arid region

    Directory of Open Access Journals (Sweden)

    Paulo Sérgio Lima e Silva

    2012-10-01

    Full Text Available Planting densities influence several aspects of forest formation, including management practices, timber yield, quality, and extraction, and consequently its production costs. The objective of this study was to evaluate Mimosa caesalpiinifolia and Gliricidia sepium growth as a function of planting density (400, 600, 800, 1000, and 1200 plants ha-1 and plant age. The species were evaluated every 90 days for plant height (PH, crown diameter (CD and root collar diameter (RCD (10 cm above the ground, with the first evaluation performed at 90 days and the last at 720 days. When plants were one year of age and beyond, evaluations were conducted also for stem diameter at breast height (DBH (1.30 m above the ground. A randomized block design with split-plots and three replicates was adopted. Species were assigned to plots, planting densities were assigned to subplots, and evaluation ages were assigned to subsubplots. The four traits in both species had their values decreased as planting density increased, but continually increased as plant age increased. For PH and RCD there was an alternation between species superiority, with gliricidia being superior to sabiá at some ages, while the opposite occurred at other ages. As to CD the species only differed in the last measurement, gliricidia being superior. With regard to DBH, gliricidia was superior starting from the second measurement. There was an effect of the species × ages interaction for the four traits and also an effect of the densities × ages interaction for CD and DBH.

  8. [Growth responses of six leguminous plants adaptable in Northern Shaanxi to petroleum contaminated soil].

    Science.gov (United States)

    Shan, Bao-Qin; Zhang, Yong-Tao; Cao, Qiao-Ling; Kang, Zhen-Yan; Li, Shu-Yuan

    2014-03-01

    To select appropriate native species in Northern Shaanxi for phytoremediation, the growth index of six kinds of leguminous plants planted in petroleum contaminated soils were investigated through pot culture. Petroleum concentrations were set at 0, 5 000, 10 000, 20 000, 40 000 mg x kg(-1) respectively with three replicates. Using different levels of seed germination rate, germination time, individual height, wilting rate, dry weight and chlorophyll content in leaves of tested plants as the ecological indicator. The results showed that tested plants have significantly different responses to petroleum pollution. Compared with those planted in clean soils, seed germination rate and individual height were promoted when petroleum concentration was lower than 5000 mg x kg(-1), but inhibition occurred when petroleum concentrations were higher than 10000 mg x kg(-1). Strong endurance of Medicago sativa was observed to petroleum polluted soil, especially at lower petroleum concentration. Leaf wilting of Robinia pseudoacacia was unobserved even when petroleum concentration was 40 000 mg x kg(-1), thus displaying the potential of remediating petroleum contaminated soils. The petroleum concentration was significantly and negatively correlated with seed germination rate, individual height and dry weight, but positively correlated with chlorophyll content in leaves.

  9. Adaptation and cultivation of permanent fish cell line CCO in serum-free medium and influence of protein hydrolysates on growth performance.

    Science.gov (United States)

    Radošević, Kristina; Dukić, Bogdanka; Andlar, Martina; Slivac, Igor; Gaurina Srček, Višnja

    2016-01-01

    In this work we describe the adaptation of channel catfish ovary (CCO) cell line to commercially available Ultra Culture serum-free medium by gradual reduction of serum concentration from 10 to 0 %. With this approach we obtained CCO cells fully adapted to serum-free conditions in 32 days. Growth, nutritional and morphological characteristics of these cells remained unchanged when compared to the control group kept in the presence of serum. Additionally, three commercially available protein hydrolysates were tested for the effects on growth performance of the newly serum-free adapted CCO cells. Supplementation with wheat gluten hydrolysate resulted in growth similar to serum free medium solely, while yeast and soy hydrolysates showed inhibitory effects on the cell growth. Taken together, the successful adaptation of CCO cells to serum-free conditions indicates their potential to be used in cytotoxicity assays when serum omission is demanded or for developing serum free bioprocesses using CCO cells. However, a more extended study on nutrient supplementation is still required to further boost the cell growth in a serum free culture.

  10. Stepwise metabolic adaption from pure metabolization to balanced anaerobic growth on xylose explored for recombinant Saccharomyces cerevisiae.

    Science.gov (United States)

    Klimacek, Mario; Kirl, Elisabeth; Krahulec, Stefan; Longus, Karin; Novy, Vera; Nidetzky, Bernd

    2014-03-08

    To effectively convert lignocellulosic feedstocks to bio-ethanol anaerobic growth on xylose constitutes an essential trait that Saccharomyces cerevisiae strains normally do not adopt through the selective integration of a xylose assimilation route as the rate of ATP-formation is below energy requirements for cell maintenance (mATP). To enable cell growth extensive evolutionary and/or elaborate rational engineering is required. However the number of available strains meeting demands for process integration are limited. In this work evolutionary engineering in just two stages coupled to strain selection under strict anaerobic conditions was carried out with BP10001 as progenitor. BP10001 is an efficient (Yethanol = 0.35 g/g) but slow (qethanol = 0.05 ± 0.01 g/gBM/h) xylose-metabolizing recombinant strain of Saccharomyces cerevisiae that expresses an optimized yeast-type xylose assimilation pathway. BP10001 was adapted in 5 generations to anaerobic growth on xylose by prolonged incubation for 91 days in sealed flasks. Resultant strain IBB10A02 displayed a specific growth rate μ of 0.025 ± 0.002 h-1 but produced large amounts of glycerol and xylitol. In addition growth was strongly impaired at pH below 6.0 and in the presence of weak acids. Using sequential batch selection and IBB10A02 as basis, IBB10B05 was evolved (56 generations). IBB10B05 was capable of fast (μ = 0.056 ± 0.003 h-1; qethanol = 0.28 ± 0.04 g/gBM/h), efficient (Yethanol = 0.35 ± 0.02 g/g), robust and balanced fermentation of xylose. Importantly, IBB10A02 and IBB10B05 displayed a stable phenotype. Unlike BP10001 both strains displayed an unprecedented biphasic formation of glycerol and xylitol along the fermentation time. Transition from a glycerol- to a xylitol-dominated growth phase, probably controlled by CO2/HCO3-, was accompanied by a 2.3-fold increase of mATP while YATP (= 87 ± 7 mmolATP/gBM) remained unaffected. As long as glycerol

  11. Prediction of cardiac arrest recurrence using ensemble classifiers

    Indian Academy of Sciences (India)

    Nachiket Tapas

    Abstract. Inability of a heart to contract effectually or its failure to contract prevents blood from circulating efficiently, causing circulatory arrest or cardiac arrest or cardiopulmonary arrest. The unexpected cardiac arrest is medically referred to as sudden cardiac arrest (SCA). Poor survival rate of patients with SCA is one of the.

  12. Cancer: brain-regulated biphasic stress response induces cell growth or cell death to adapt to psychological stressors.

    Science.gov (United States)

    Thomas, Charles; Bhatia, Shruti

    2014-01-01

    According to Indian Vedic philosophy, a human being contains 3 major bodies: (1) the matter body--brain, organs, and senses; (2) the mental body--mind, individual consciousness, intellect, and ego; and (3) the soul or causal body--universal consciousness. The third, which is located in the heart according to all spiritual traditions and recent scientific literature, can be seen as the information body that contains all memories. The mental body, which can interface with the matter and information bodies, can be seen as a field of immaterial energy that can carry, regulate, and strengthen all information (eg, thoughts or emotions) both positively and negatively. This body of information may store ancestral and/or autobiographical memories: unconscious memories from inner traumas--inner information (Ii) or samskaras in Vedic philosophy--and conscious memories from outer traumas--outer information (Io). These conscious and unconscious memories can be seen as potential psychological stressors. Resonance between Ii and Io may induce active conflicts if resistance occurs in the mental body; this conflict may cause specific metabolic activity in the brain and a stress response in the physical body, which permits adjustment to psychological stressors. The brainregulated stress response may be biphasic: cell death or growth induced by adrenergic molecular pathways during the conflict's unresolved phase and reversion to cell growth or death induced by cholinergic molecular pathways during the conflict's resolved phase. Case studies and data mining from PubMed suggest that this concept complies with the principles of holistic medicine and the scientific literature supporting its benefits. We suggest that the evolution of cancer can be seen as a biphasic stress response regulated by the brain to adapt to psychological stressors, which produce imbalance among the physical, mental, and information bodies.

  13. A Computational Approach to Model Vascular Adaptation During Chronic Hemodialysis: Shape Optimization as a Substitute for Growth Modeling

    Science.gov (United States)

    Mahmoudzadeh Akherat, S. M. Javid; Boghosian, Michael; Cassel, Kevin; Hammes, Mary

    2015-11-01

    End-stage-renal disease patients depend on successful long-term hemodialysis via vascular access, commonly facilitated via a Brachiocephalic Fistula (BCF). The primary cause of BCF failure is Cephalic Arch Stenosis (CAS). It is believed that low Wall Shear Stress (WSS) regions, which occur because of the high flow rates through the natural bend in the cephalic vein, create hemodynamic circumstances that trigger the onset and development of Intimal Hyperplasia (IH) and subsequent CAS. IH is hypothesized to be a natural effort to reshape the vessel, aiming to bring the WSS values back to a physiologically acceptable range. We seek to explore the correlation between regions of low WSS and subsequent IH and CAS in patient-specific geometries. By utilizing a shape optimization framework, a method is proposed to predict cardiovascular adaptation that could potentially be an alternative to vascular growth and remodeling. Based on an objective functional that seeks to alter the vessel shape in such a way as to readjust the WSS to be within the normal physiological range, CFD and shape optimization are then coupled to investigate whether the optimal shape evolution is correlated with actual patient-specific geometries thereafter. Supported by the National Institute of Diabetes and Digestive and Kidney Diseases of the National Institutes of Health (R01 DK90769).

  14. Adaptive control of interface by temperature and interface profile feedback in transparent multi-zone crystal growth furnace

    Science.gov (United States)

    Batur, Celal

    1991-01-01

    The objective of this research is to control the dynamics of multizone programmable crystal growth furnaces. Due to the inevitable heat exchange among different heating zones and the transient nature of the process, the dynamics of multizone furnaces is time varying, distributed, and therefore complex in nature. Electrical power to heating zones and the translational speed of the ampoule are employed as inputs to control the dynamics. Structural properties of the crystal is the ultimate aim of this adaptive control system. These properties can be monitored in different ways. Following an order of complexity, these may include: (1) on line measurement of the material optical properties such as the refractive index of crystal; (2) on line x-ray imaging of the interface topology; (3) on line optical quantification of the interface profile such as the determination of concavity or convexity of the interface shape; and (4) on line temperature measurement at points closest to the material such as measurements of the ampoule's outside and inside surface temperatures. The research performed makes use of the temperature and optical measurements, specified in (3) and (4) as the outputs of furnace dynamics. However, if the instrumentation is available, the proposed control methodology can be extended to the measurements listed in (1) and (2).

  15. Arrested segregative phase separation in capillary tubes

    NARCIS (Netherlands)

    Tromp, R. Hans; Lindhoud, Saskia

    2006-01-01

    Phase separation in a capillary tube with one of the phases fully wetting the capillary wall is arrested when the typical size of the phase domains reaches the value of the diameter of the tube. The arrested state consists of an alternating sequence of concave-capped and convex-capped cylindrical

  16. Cardiorespiratory arrest in children (out of hospital)

    OpenAIRE

    Writer, Hilary

    2007-01-01

    Cardiorespiratory arrest outside hospital occurs in approximately 1/10,000 children a year in resource-rich countries, with two thirds of arrests occurring in children under 18 months of age. Approximately 40% of cases have undetermined causes, including sudden infant death syndrome . Of the rest, 20% are caused by trauma, 10% by chronic disease, and 6% by pneumonia.

  17. Cardiorespiratory arrest in children (out of hospital)

    OpenAIRE

    Writer, Hilary

    2010-01-01

    Cardiorespiratory arrest outside hospital occurs in approximately 1/10,000 children a year in resource-rich countries, with two-thirds of arrests occurring in children under 18 months of age. Approximately 45% of cases have undetermined causes, including sudden infant death syndrome. Of the rest, 20% are caused by trauma, 10% by chronic disease, and 6% by pneumonia.

  18. Juvenile Arrests, 2000. Juvenile Justice Bulletin.

    Science.gov (United States)

    Snyder, Howard N.

    This bulletin examines the national and state juvenile arrest rate in 2000 using data reported annually by local law enforcement agencies nationwide to the FBI's Uniform Crime Reporting program. Results indicate that the murder rate in 2000 was the lowest since 1965; juvenile arrests for violence in 2000 were the lowest since 1988; few juveniles…

  19. Psychopathology in Women Arrested for Domestic Violence

    Science.gov (United States)

    Stuart, Gregory L.; Moore, Todd M.; Gordon, Kristina Coop; Ramsey, Susan E.; Kahler, Christopher W.

    2006-01-01

    This study examined the prevalence of psychopathology among women arrested for violence and whether the experience of intimate partner violence (IPV) was associated with Axis I psychopathology. Women who were arrested for domestic violence perpetration and court referred to violence intervention programs (N=103) completed measures of IPV…

  20. Determinate primary root growth as an adaptation to aridity in Cactaceae: towards an understanding of the evolution and genetic control of the trait

    Science.gov (United States)

    Shishkova, Svetlana; Las Peñas, María Laura; Napsucialy-Mendivil, Selene; Matvienko, Marta; Kozik, Alex; Montiel, Jesús; Patiño, Anallely; Dubrovsky, Joseph G.

    2013-01-01

    Background and Aims Species of Cactaceae are well adapted to arid habitats. Determinate growth of the primary root, which involves early and complete root apical meristem (RAM) exhaustion and differentiation of cells at the root tip, has been reported for some Cactoideae species as a root adaptation to aridity. In this study, the primary root growth patterns of Cactaceae taxa from diverse habitats are classified as being determinate or indeterminate, and the molecular mechanisms underlying RAM maintenance in Cactaceae are explored. Genes that were induced in the primary root of Stenocereus gummosus before RAM exhaustion are identified. Methods Primary root growth was analysed in Cactaceae seedlings cultivated in vertically oriented Petri dishes. Differentially expressed transcripts were identified after reverse northern blots of clones from a suppression subtractive hybridization cDNA library. Key Results All species analysed from six tribes of the Cactoideae subfamily that inhabit arid and semi-arid regions exhibited determinate primary root growth. However, species from the Hylocereeae tribe, which inhabit mesic regions, exhibited mostly indeterminate primary root growth. Preliminary results suggest that seedlings of members of the Opuntioideae subfamily have mostly determinate primary root growth, whereas those of the Maihuenioideae and Pereskioideae subfamilies have mostly indeterminate primary root growth. Seven selected transcripts encoding homologues of heat stress transcription factor B4, histone deacetylase, fibrillarin, phosphoethanolamine methyltransferase, cytochrome P450 and gibberellin-regulated protein were upregulated in S. gummosus root tips during the initial growth phase. Conclusions Primary root growth in Cactoideae species matches their environment. The data imply that determinate growth of the primary root became fixed after separation of the Cactiodeae/Opuntioideae and Maihuenioideae/Pereskioideae lineages, and that the genetic regulation of

  1. [Cardiorespiratory arrest in children with trauma].

    Science.gov (United States)

    López-Herce Cid, J; Domínguez Sampedro, P; Rodríguez Núñez, A; García Sanz, C; Carrillo Alvarez, A; Calvo Macías, C; Bellón Cano, J M

    2006-11-01

    To analyze the characteristics and outcome of cardiorespiratory arrest secondary to trauma in children. We performed a secondary analysis of data from a prospective, multicenter study of cardiorespiratory arrest in children. Data were recorded according to the Utstein style. Twenty-eight children (age range: 7 days to 16 years) with cardiorespiratory arrest secondary to trauma were evaluated. The outcome variables were return of spontaneous circulation, sustained (more than 20 minutes) return of spontaneous circulation (initial survival), and survival at hospital discharge (final survival) in relation to the characteristics of the cardiorespiratory arrest and cardiopulmonary resuscitation. Neurological and general performance outcome was assessed by means of the Pediatric Cerebral Performance Category scale and the Pediatric Overall Performance Category scale. Return of spontaneous circulation was obtained in 18 patients (64.2 %), initial survival was achieved in 14 (50 %) and final survival was achieved in three (10.7 %) (two without neurological sequelae and one with vegetative status). Final survival was significantly higher in patients with respiratory arrest (33.3 %) than in those with cardiac arrest (4.5 %), p = 0.04. Final survival was also higher in patients with a duration of cardiopulmonary resuscitation shorter than 20 minutes (27.2 %) than in the remaining patients (0 %), p =0.05. The two survivors without neurologic sequelae had respiratory arrest. Survival until hospital discharge in children with cardiorespiratory arrest secondary to trauma is lower than that in children with cardiorespiratory arrest. Patients with respiratory arrest when resuscitation is started and those with a duration of cardiopulmonary resuscitation of less than 20 minutes showed better survival than the remaining patients.

  2. Aqueous Extracts of the Edible Gracilaria tenuistipitata are Protective Against H2O2-Induced DNA Damage, Growth Inhibition, and Cell Cycle Arrest

    Directory of Open Access Journals (Sweden)

    Chi-Chen Yeh

    2012-06-01

    Full Text Available Potential antioxidant properties of an aqueous extract of the edible red seaweed Gracilaria tenuistipitata (AEGT against oxidative DNA damage were evaluated. The AEGT revealed several antioxidant molecules, including phenolics, flavonoids and ascorbic acid. In a cell-free assay, the extract exhibited 1,1-diphenyl-2-picrylhydrazyl (DPPH radical scavenging activity that significantly reduced H2O2-induced plasmid DNA breaks in a dose-response manner (P < 0.001. The AEGT also suppressed H2O2-induced oxidative DNA damage in H1299 cells by reducing the percentage of damaged DNA in a dose-response manner (P < 0.001 as measured by a modified alkaline comet-nuclear extract (comet-NE assay. The MTT assay results showed that AEGT confers significant protection against H2O2-induced cytotoxicity and that AEGT itself is not cytotoxic (P < 0.001. Moreover, H2O2-induced cell cycle G2/M arrest was significantly released when cells were co-treated with different concentrations of AEGT (P < 0.001. Taken together, these findings suggest that edible red algae Gracilaria water extract can prevent H2O2-induced oxidative DNA damage and its related cellular responses.

  3. Arrested embryonic development: a review of strategies to delay hatching in egg-laying reptiles

    Science.gov (United States)

    Rafferty, Anthony R.; Reina, Richard D.

    2012-01-01

    Arrested embryonic development involves the downregulation or cessation of active cell division and metabolic activity, and the capability of an animal to arrest embryonic development results in temporal plasticity of the duration of embryonic period. Arrested embryonic development is an important reproductive strategy for egg-laying animals that provide no parental care after oviposition. In this review, we discuss each type of embryonic developmental arrest used by oviparous reptiles. Environmental pressures that might have directed the evolution of arrest are addressed and we present previously undiscussed environmentally dependent physiological processes that may occur in the egg to bring about arrest. Areas for future research are proposed to clarify how ecology affects the phenotype of developing embryos. We hypothesize that oviparous reptilian mothers are capable of providing their embryos with a level of phenotypic adaptation to local environmental conditions by incorporating maternal factors into the internal environment of the egg that result in different levels of developmental sensitivity to environmental conditions after they are laid. PMID:22438503

  4. Development of a data dictionary for the Strategies for Post Arrest Resuscitation Care (SPARC) network for post cardiac arrest research.

    Science.gov (United States)

    Lin, Steve; Morrison, Laurie J; Brooks, Steven C

    2011-04-01

    The widely accepted Utstein style has standardized data collection and analysis in resuscitation and post resuscitation research. However, collection of many of these variables poses significant practical challenges. In addition, several important variables in post resuscitation research are missing. Our aim was to develop a comprehensive data dictionary and web-based data collection tool as part of the Strategies for Post Arrest Resuscitation Care (SPARC) Network project, which implemented a knowledge translation program for post cardiac arrest therapeutic hypothermia in 37 Ontario hospitals. A list of data variables was generated based on the current Utstein style, previous studies and expert opinion within our group of investigators. We developed a data dictionary by creating clear definitions and establishing abstraction instructions for each variable. The data dictionary was integrated into a web-based collection form allowing for interactive data entry. Two blinded investigators piloted the data collection tool, by performing a retrospective chart review. A total of 454 variables were included of which 400 were Utstein, 2 were adapted from existing studies and 52 were added to address missing elements. Kappa statistics for two outcome variables, survival to discharge and induction of therapeutic hypothermia were 0.86 and 0.64, respectively. This is the first attempt in the literature to develop a data dictionary as part of a standardized, pragmatic data collection tool for post cardiac arrest research patients. In addition, our dataset defined important variables that were previously missing. This data collection tool can serve as a reference for future trials in post cardiac arrest care. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  5. Vitamin B5 Reduces Bacterial Growth via Regulating Innate Immunity and Adaptive Immunity in Mice Infected with Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Wenting He

    2018-02-01

    Full Text Available The mechanisms by which vitamins regulate immunity and their effect as an adjuvant treatment for tuberculosis have gradually become very important research topics. Studies have found that vitamin B5 (VB5 can promote epithelial cells to express inflammatory cytokines. We aimed to examine the proinflammatory and antibacterial effect of VB5 in macrophages infected with Mycobacterium tuberculosis (MTB strain H37Rv and the therapeutic potential of VB5 in vivo with tuberculosis. We investigated the activation of inflammatory signal molecules (NF-κB, AKT, JNK, ERK, and p38, the expression of two primary inflammatory cytokines (tumor necrosis factor and interleukin-6 and the bacterial burdens in H37Rv-infected macrophages stimulated with VB5 to explore the effect of VB5 on the inflammatory and antibacterial responses of macrophages. We further treated the H37Rv-infected mice with VB5 to explore VB5’s promotion of the clearance of H37Rv in the lungs and the effect of VB5 on regulating the percentage of inflammatory cells. Our data showed that VB5 enhanced the phagocytosis and inflammatory response in macrophages infected with H37Rv. Oral administration of VB5 decreased the number of colony-forming units of H37Rv in lungs of mice at 1, 2, and 4 weeks after infection. In addition, VB5 regulated the percentage of macrophages and promoted CD4+ T cells to express interferon-γ and interleukin-17; however, it had no effect on the percentage of polymorphonuclear neutrophils, CD4+ and CD8+ T cells. In conclusion, VB5 significantly inhibits the growth of MTB by regulating innate immunity and adaptive immunity.

  6. Comparison of crack arrest methodologies

    International Nuclear Information System (INIS)

    Anon.

    1979-01-01

    The ASTM Cooperative Test Program Data were used to compare the static (K/sub Ia/) and dynamic (K/sud ID/, K/sub IDm/) approaches to crack arrest. K/sub Ia/ is not dependent on K/sub Q/. This is consistent with the requirements of the static approach, but not the dynamic one which requires that K/sub Ia/ decrease with K/sub Q/ if K/sub ID/ (= K/sub IDm/) is a constant. K/sub ID/ increases systematically with K/sub Q/ at a rate that is consistent with calculations based on the use of a constant value for K/sub Ia/ which is equal to its measured mean value. Only in the limiting case of very short crack jumps (associated with very low average crack speeds) can K/sub ID/ be identified as a minimum value at which K/sub ID/ = K/sub IDm/. In this case K/sub IDm/ approx. K/sub Ia/ approx. K/sub Im/. The latter is the idealized minimum value of K that will support the continued propagation of a running crack

  7. Spatiotemporal Stability of Public Cardiac Arrests

    NARCIS (Netherlands)

    Demirtas, Derya; Brooks, Steven C.; Morrison, Laurie J.; Chan, Timothy C.Y.

    2015-01-01

    Background: Public access automated external defibrillator (AED) deployment and community cardiopulmonary resuscitation (CPR) programs should target geographical areas with high risk of out-of-hospital cardiac arrest (OHCA). Although these long-term, location-based interventions implicitly assume

  8. Composite Pressure Vessel Including Crack Arresting Barrier

    Science.gov (United States)

    DeLay, Thomas K. (Inventor)

    2013-01-01

    A pressure vessel includes a ported fitting having an annular flange formed on an end thereof and a tank that envelopes the annular flange. A crack arresting barrier is bonded to and forming a lining of the tank within the outer surface thereof. The crack arresting barrier includes a cured resin having a post-curing ductility rating of at least approximately 60% through the cured resin, and further includes randomly-oriented fibers positioned in and throughout the cured resin.

  9. Sex Disparities in Arrest Outcomes for Domestic Violence

    Science.gov (United States)

    Hamilton, Melissa; Worthen, Meredith G. F.

    2011-01-01

    Domestic violence arrests have been historically focused on protecting women and children from abusive men. Arrest patterns continue to reflect this bias with more men arrested for domestic violence compared to women. Such potential gender variations in arrest patterns pave the way to the investigation of disparities by sex of the offender in…

  10. Chlorophyll a fluorescence, under half of the adaptive growth-irradiance, for high-throughput sensing of leaf-water deficit in Arabidopsis thaliana accessions

    Directory of Open Access Journals (Sweden)

    Kumud B. Mishra

    2016-11-01

    Full Text Available Abstract Background Non-invasive and high-throughput monitoring of drought in plants from its initiation to visible symptoms is essential to quest drought tolerant varieties. Among the existing methods, chlorophyll a fluorescence (ChlF imaging has the potential to probe systematic changes in photosynthetic reactions; however, prerequisite of dark-adaptation limits its use for high-throughput screening. Results To improve the throughput monitoring of plants, we have exploited their light-adaptive strategy, and investigated possibilities of measuring ChlF transients under low ambient irradiance. We found that the ChlF transients and associated parameters of two contrasting Arabidopsis thaliana accessions, Rsch and Co, give almost similar information, when measured either after ~20 min dark-adaptation or in the presence of half of the adaptive growth-irradiance. The fluorescence parameters, effective quantum yield of PSII photochemistry (ΦPSII and fluorescence decrease ratio (R FD resulting from this approach enabled us to differentiate accessions that is often not possible by well-established dark-adapted fluorescence parameter maximum quantum efficiency of PSII photochemistry (F V/F M. Further, we screened ChlF transients in rosettes of well-watered and drought-stressed six A. thaliana accessions, under half of the adaptive growth-irradiance, without any prior dark-adaptation. Relative water content (RWC in leaves was also assayed and compared to the ChlF parameters. As expected, the RWC was significantly different in drought-stressed from that in well-watered plants in all the six investigated accessions on day-10 of induced drought; the maximum reduction in the RWC was obtained for Rsch (16%, whereas the minimum reduction was for Co (~7%. Drought induced changes were reflected in several features of ChlF transients; combinatorial images obtained from pattern recognition algorithms, trained on pixels of image sequence, improved the contrast

  11. Burkholderia pseudomallei transcriptional adaptation in macrophages

    Directory of Open Access Journals (Sweden)

    Chieng Sylvia

    2012-07-01

    Full Text Available Abstract Background Burkholderia pseudomallei is a facultative intracellular pathogen of phagocytic and non-phagocytic cells. How the bacterium interacts with host macrophage cells is still not well understood and is critical to appreciate the strategies used by this bacterium to survive and how intracellular survival leads to disease manifestation. Results Here we report the expression profile of intracellular B. pseudomallei following infection of human macrophage-like U937 cells. During intracellular growth over the 6 h infection period, approximately 22 % of the B. pseudomallei genome showed significant transcriptional adaptation. B. pseudomallei adapted rapidly to the intracellular environment by down-regulating numerous genes involved in metabolism, cell envelope, motility, replication, amino acid and ion transport system and regulatory function pathways. Reduced expression in catabolic and housekeeping genes suggested lower energy requirement and growth arrest during macrophage infection, while expression of genes encoding anaerobic metabolism functions were up regulated. However, whilst the type VI secretion system was up regulated, expression of many known virulence factors was not significantly modulated over the 6hours of infection. Conclusions The transcriptome profile described here provides the first comprehensive view of how B. pseudomallei survives within host cells and will help identify potential virulence factors and proteins that are important for the survival and growth of B. pseudomallei within human cells.

  12. Microanatomical and histological features in the long bones of Mosasaurine mosasaurs (Reptilia, Squamata)--implications for aquatic adaptation and growth rates.

    Science.gov (United States)

    Houssaye, Alexandra; Lindgren, Johan; Pellegrini, Rodrigo; Lee, Andrew H; Germain, Damien; Polcyn, Michael J

    2013-01-01

    During their evolution in the Late Cretaceous, mosasauroids attained a worldwide distribution, accompanied by a marked increase in body size and open ocean adaptations. This transition from land-dwellers to highly marine-adapted forms is readily apparent not only at the gross anatomic level but also in their inner bone architecture, which underwent profound modifications. The present contribution describes, both qualitatively and quantitatively, the internal organization (microanatomy) and tissue types and characteristics (histology) of propodial and epipodial bones in one lineage of mosasauroids; i.e., the subfamily Mosasaurinae. By using microanatomical and histological data from limb bones in combination with recently acquired knowledge on the inner structure of ribs and vertebrae, and through comparisons with extant squamates and semi-aquatic to fully marine amniotes, we infer possible implications on mosasaurine evolution, aquatic adaptation, growth rates, and basal metabolic rates. Notably, we observe the occurrence of an unusual type of parallel-fibered bone, with large and randomly shaped osteocyte lacunae (otherwise typical of fibrous bone) and particular microanatomical features in Dallasaurus, which displays, rather than a spongious inner organization, bone mass increase in its humeri and a tubular organization in its femora and ribs. The dominance of an unusual type of parallel-fibered bone suggests growth rates and, by extension, basal metabolic rates intermediate between that of the extant leatherback turtle, Dermochelys, and those suggested for plesiosaur and ichthyosaur reptiles. Moreover, the microanatomical features of the relatively primitive genus Dallasaurus differ from those of more derived mosasaurines, indicating an intermediate stage of adaptation for a marine existence. The more complete image of the various microanatomical trends observed in mosasaurine skeletal elements supports the evolutionary convergence between this lineage of

  13. Microanatomical and histological features in the long bones of Mosasaurine mosasaurs (Reptilia, Squamata--implications for aquatic adaptation and growth rates.

    Directory of Open Access Journals (Sweden)

    Alexandra Houssaye

    Full Text Available BACKGROUND: During their evolution in the Late Cretaceous, mosasauroids attained a worldwide distribution, accompanied by a marked increase in body size and open ocean adaptations. This transition from land-dwellers to highly marine-adapted forms is readily apparent not only at the gross anatomic level but also in their inner bone architecture, which underwent profound modifications. METHODOLOGY/PRINCIPAL FINDINGS: The present contribution describes, both qualitatively and quantitatively, the internal organization (microanatomy and tissue types and characteristics (histology of propodial and epipodial bones in one lineage of mosasauroids; i.e., the subfamily Mosasaurinae. By using microanatomical and histological data from limb bones in combination with recently acquired knowledge on the inner structure of ribs and vertebrae, and through comparisons with extant squamates and semi-aquatic to fully marine amniotes, we infer possible implications on mosasaurine evolution, aquatic adaptation, growth rates, and basal metabolic rates. Notably, we observe the occurrence of an unusual type of parallel-fibered bone, with large and randomly shaped osteocyte lacunae (otherwise typical of fibrous bone and particular microanatomical features in Dallasaurus, which displays, rather than a spongious inner organization, bone mass increase in its humeri and a tubular organization in its femora and ribs. CONCLUSIONS/SIGNIFICANCE: The dominance of an unusual type of parallel-fibered bone suggests growth rates and, by extension, basal metabolic rates intermediate between that of the extant leatherback turtle, Dermochelys, and those suggested for plesiosaur and ichthyosaur reptiles. Moreover, the microanatomical features of the relatively primitive genus Dallasaurus differ from those of more derived mosasaurines, indicating an intermediate stage of adaptation for a marine existence. The more complete image of the various microanatomical trends observed in mosasaurine

  14. Cardiac arrest leadership: in need of resuscitation?

    Science.gov (United States)

    Robinson, Philip S; Shall, Emma; Rakhit, Roby

    2016-12-01

    Leadership skills directly correlate with the quality of technical performance of cardiopulmonary resuscitation (CPR) and clinical outcomes. Despite an improved focus on non-technical skills in CPR training, the leadership of cardiac arrests is often variable. To assess the perceptions of leadership and team working among members of a cardiac arrest team and to evaluate future training needs. Cross-sectional survey of 102 members of a cardiac arrest team at an Acute Hospital Trust in the UK with 892 inpatient beds. Responses sought from doctors, nurses and healthcare assistants to 12 rated statements and 4 dichotomous questions. Of 102 responses, 81 (79%) were from doctors and 21 (21%) from nurses. Among specialist registrars 90% agreed or strongly agreed that there was clear leadership at all arrests compared with between 28% and 49% of nurses and junior doctors respectively. Routine omission of key leadership tasks was reported by as many as 80% of junior doctors and 50% of nurses. Almost half of respondents reported non-adherence with Advanced Life Support (ALS) guidelines. Among junior members of the team, 36% felt confident to lead an arrest and 75% would welcome further dedicated cardiac arrest leadership training. Leadership training is integrated into the ALS (Resus Council, UK) qualification. However, this paper found that in spite of this training; standards of leadership are variable. The findings suggest a pressing need for further dedicated cardiac arrest leadership training with a focus on improving key leadership tasks such as role assignment, team briefing and debriefing. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  15. CANCER Escape from senescence boosts tumour growth

    NARCIS (Netherlands)

    Medema, Jan Paul

    2018-01-01

    Some chemotherapies block cancer growth by driving tumour cells into a state of cell-division arrest termed senescence. It emerges that such cells have a boosted capacity to drive tumour growth if they exit senescence

  16. Dynamical principles of cell-cycle arrest: Reversible, irreversible, and mixed strategies

    Science.gov (United States)

    Pfeuty, Benjamin

    2012-08-01

    Living cells often alternate between proliferating and nonproliferating states as part of individual or collective strategies to adapt to complex and changing environments. To this aim, they have evolved a biochemical regulatory network enabling them to switch between cell-division cycles (i.e., oscillatory state) and cell-cycle arrests (i.e., steady state) in response to extracellular cues. This can be achieved by means of a variety of bifurcation mechanisms that potentially give rise to qualitatively distinct cell-cycle arrest properties. In this paper, we study the dynamics of a minimal biochemical network model in which a cell-division oscillator and a differentiation switch mutually antagonize. We identify the existence of three biologically plausible bifurcation scenarios organized around a codimension-four swallowtail-homoclinic singularity. As a result, the model exhibits a broad repertoire of cell-cycle arrest properties in terms of reversibility of these arrests, tunability of interdivision time, and ability to track time-varying signals. This dynamic versatility would explain the diversity of cell-cycle arrest strategies developed in different living species and functional contexts.

  17. A cellular automaton - finite volume method for the simulation of dendritic and eutectic growth in binary alloys using an adaptive mesh refinement

    Science.gov (United States)

    Dobravec, Tadej; Mavrič, Boštjan; Šarler, Božidar

    2017-11-01

    A two-dimensional model to simulate the dendritic and eutectic growth in binary alloys is developed. A cellular automaton method is adopted to track the movement of the solid-liquid interface. The diffusion equation is solved in the solid and liquid phases by using an explicit finite volume method. The computational domain is divided into square cells that can be hierarchically refined or coarsened using an adaptive mesh based on the quadtree algorithm. Such a mesh refines the regions of the domain near the solid-liquid interface, where the highest concentration gradients are observed. In the regions where the lowest concentration gradients are observed the cells are coarsened. The originality of the work is in the novel, adaptive approach to the efficient and accurate solution of the posed multiscale problem. The model is verified and assessed by comparison with the analytical results of the Lipton-Glicksman-Kurz model for the steady growth of a dendrite tip and the Jackson-Hunt model for regular eutectic growth. Several examples of typical microstructures are simulated and the features of the method as well as further developments are discussed.

  18. Characteristics and outcome of cardiorespiratory arrest in children.

    Science.gov (United States)

    López-Herce, Jesús; García, Cristina; Domínguez, Pedro; Carrillo, Angel; Rodríguez-Núñez, Antonio; Calvo, Custodio; Delgado, Miguel Angel

    2004-12-01

    To analyse the present day characteristics and outcome of cardio-respiratory arrest in children in Spain. An 18-month prospective, multicentre study analysing out-of-hospital and in-hospital cardio-respiratory arrest in children. Two hundred and eighty-three children between 7 days and 17 years of age with cardio-respiratory arrest. Data were recorded according to the Utstein style. The outcome variables were the sustained return of spontaneous circulation (initial survival), and survival at 1 year (final survival). Three hundred and eleven cardio-respiratory arrest episodes, composed of 70 respiratory arrests and 241 cardiac arrests in 283 children were studied. Accidents were the most frequent cause of out-of-hospital arrest (40%), and cardiac disease was the leading cause (31%) of in-hospital arrest. Initial survival was 60.2% and 1 year survival was 33.2%. The final survival was higher in patients with respiratory arrest (70%) than in patients with cardiac arrest (21.1%) (P arrest in children remains high. Survival after respiratory arrest is significantly higher than after cardiac arrest. The duration of cardiopulmonary resuscitation attempt is the best indicator of mortality of cardio-respiratory arrest in children.

  19. Tumor-Targeting Salmonella typhimurium A1-R Promotes Tumoricidal CD8+ T Cell Tumor Infiltration and Arrests Growth and Metastasis in a Syngeneic Pancreatic-Cancer Orthotopic Mouse Model.

    Science.gov (United States)

    Murakami, Takashi; Hiroshima, Yukihiko; Zhang, Yong; Zhao, Ming; Kiyuna, Tasuku; Hwang, Ho Kyoung; Miyake, Kentaro; Homma, Yuki; Mori, Ryutaro; Matsuyama, Ryusei; Chishima, Takashi; Ichikawa, Yasushi; Tanaka, Kuniya; Bouvet, Michael; Endo, Itaru; Hoffman, Robert M

    2018-01-01

    The present study determined the effect of the tumor-targeting strain Salmonella typhimurium A1-R (S. typhimurium A1-R) on CD8 + tumor-infiltrating lymphocytes (TILs) in a syngeneic pancreatic-cancer orthotopic mouse model. The effect of tumor-targeting S. typhimurium A1-R on CD8 + TILs was determined on the Pan02 murine pancreatic-adenocarcinoma implanted orthotopically in the pancreatic tail of C57BL/6 immunocompromised mice. Three weeks after orthotopic implantation, mice were randomized as follows G1: untreated control group (n = 8); and G2: S. typhimurium A1-R-treatment group (n = 8, 1 × 10 7 colony forming units [CFU]/body, iv, weekly, 3 weeks). On the 22nd day from initial treatment, all mice were sacrificed and tumors were harvested. The tumor-volume ratio was defined as ratio of tumor volume on the 22nd day relative to the 1st day. The tumor volume ratio was significantly lower in the S. typhimurium A1-R-treated group (G2) (3.0 ± 2.8) than the untreated control (G1) (39.9 ± 30.7, P R-treated mice (G2). Six mice in G1 had peritoneal dissemination, whereas no mice showed peritoneal dissemination in G2 (P R promotes CD8 + T cell infiltration and inhibition of tumor growth and metastasis. J. Cell. Biochem. 119: 634-639, 2018. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  20. Miller Fisher syndrome with sinus arrest

    Directory of Open Access Journals (Sweden)

    Nobuko Shiraiwa

    2017-08-01

    Full Text Available Dysautonomia in Guillain-Barre syndrome (GBS rarely causes serious cardiovascular complications, such as sinus arrest. Miller Fisher syndrome (MFS is recognized as a variant of GBS. There have been few reports regarding the association between MFS and dysautonomia. We describe a case of a 68-year-old man with ophthalmoplegia, bulbar palsy, truncal ataxia, and areflexia. He was diagnosed with MFS because he exhibited the classical clinical triad and had elevated serum anti- GQ1b immunoglobulin G levels. A magnetic resonance imaging scan of his head was normal. His 24-hour Holter recording showed sinus arrest. He was treated with intravenous immunoglobulin, whereupon his symptoms gradually improved. This included the sinus arrest, which was considered a symptom of dysautonomia in MFS. Therefore, clinicians should be mindful of dysautonomia not only in GBS patients, but also in cases of MFS.

  1. Cell cycle arrest and cell survival induce reverse trends of cardiolipin remodeling.

    Directory of Open Access Journals (Sweden)

    Yu-Jen Chao

    Full Text Available Cell survival from the arrested state can be a cause of the cancer recurrence. Transition from the arrest state to the growth state is highly regulated by mitochondrial activity, which is related to the lipid compositions of the mitochondrial membrane. Cardiolipin is a critical phospholipid for the mitochondrial integrity and functions. We examined the changes of cardiolipin species by LC-MS in the transition between cell cycle arrest and cell reviving in HT1080 fibrosarcoma cells. We have identified 41 cardiolipin species by MS/MS and semi-quantitated them to analyze the detailed changes of cardiolipin species. The mass spectra of cardiolipin with the same carbon number form an envelope, and the C64, C66, C68, C70 C72 and C74 envelopes in HT1080 cells show a normal distribution in the full scan mass spectrum. The cardiolipin quantity in a cell decreases while entering the cell cycle arrest, but maintains at a similar level through cell survival. While cells awakening from the arrested state and preparing itself for replication, the groups with short acyl chains, such as C64, C66 and C68 show a decrease of cardiolipin percentage, but the groups with long acyl chains, such as C70 and C72 display an increase of cardiolipin percentage. Interestingly, the trends of the cardiolipin species changes during the arresting state are completely opposite to cell growing state. Our results indicate that the cardiolipin species shift from the short chain to long chain cardiolipin during the transition from cell cycle arrest to cell progression.

  2. Pseudolaric acid B induced cell cycle arrest, autophagy and senescence in murine fibrosarcoma l929 cell.

    Science.gov (United States)

    Yu, Jing hua; Liu, Chun yu; Zheng, Gui bin; Zhang, Li Ying; Yan, Ming hui; Zhang, Wen yan; Meng, Xian ying; Yu, Xiao fang

    2013-01-01

    PAB induced various cancer cell apoptosis, cell cycle arrest and senescence. But in cell line murine fibrosarcoma L929, PAB did not induce apoptosis, but autophagy, therefore it was thought by us as a good model to research the relationship of cell cycle arrest, autophagy and senescence bypass apoptosis. Inhibitory ratio was assessed by 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) analysis. Phase contrast microscopy visualized cell morphology. Hoechst 33258 staining for nuclear change, propidium iodode (PI) staining for cell cycle, monodansylcadaverine (MDC) staining for autophagy, and rodanmine 123 staining for mitochondrial membrane potential (MMP) were measured by fluorescence microscopy or flowcytometry. Apoptosis was determined by DNA ladder test. Protein kinase C (PKC) activity was detected by PKC assay kit. SA-β-galactosidase assay was used to detect senescence. Protein expression was examined by western blot. PAB inhibited L929 cell growth in time-and dose-dependent manner. At 12 h, 80 μmol/L PAB induced obvious mitotic arrest; at 24 h, PAB began to induce autophagy; at 36 h, cell-treated with PAB slip into G1 cell cycle; and 3 d PAB induced senescence. In time sequence PAB induced firstly cell cycle arrest, then autophagy, then slippage into G1 phase, lastly senescence. Senescent cells had high level of autophagy, inhibiting autophagy led to apoptosis, and no senescence. PAB activated PKC activity to induce cell cycle arrest, autophagy and senescence, inhibiting PKC activity suppressed cell cycle arrest, autophagy and senescence. PAB induced cell cycle arrest, autophagy and senescence in murine fibrosarcoma L929 cell through PKC.

  3. Comparison of Rooting Strategies to Explore Rock Fractures for Shallow Soil-Adapted Tree Species with Contrasting Aboveground Growth Rates: A Greenhouse Microcosm Experiment

    Directory of Open Access Journals (Sweden)

    Yunpeng Nie

    2017-09-01

    Full Text Available For tree species adapted to shallow soil environments, rooting strategies that efficiently explore rock fractures are important because soil water depletion occurs frequently. However, two questions: (a to what extent shallow soil-adapted species rely on exploring rock fractures and (b what outcomes result from drought stress, have rarely been tested. Therefore, based on the expectation that early development of roots into deep soil layers is at the cost of aboveground growth, seedlings of three tree species (Cyclobalanopsis glauca, Delavaya toxocarpa, and Acer cinnamomifolium with distinct aboveground growth rates were selected from a typical shallow soil region. In a greenhouse experiment that mimics the basic features of shallow soil environments, 1-year-old seedlings were transplanted into simulated microcosms of shallow soil overlaying fractured bedrock. Root biomass allocation and leaf physiological activities, as well as leaf δ13C values were investigated and compared for two treatments: regular irrigation and repeated cycles of drought stress. Our results show that the three species differed in their rooting strategies in the context of encountering rock fractures, however, these strategies were not closely related to the aboveground growth rate. For the slowest-growing seedling, C. glauca, percentages of root mass in the fractures, as well as in the soil layer between soil and bedrock increased significantly under both treatments, indicating a specialized rooting strategy that facilitated the exploration of rock fractures. Early investment in deep root growth was likely critical to the establishment of this drought-vulnerable species. For the intermediate-growing, A. cinnamomifolium, percentages of root mass in the bedrock and interface soil layers were relatively low and exhibited no obvious change under either treatment. This limited need to explore rock fractures was compensated by a conservative water use strategy. For the fast

  4. Next-generation transcriptome profiling reveals insights into genetic factors contributing to growth differences and temperature adaptation in Australian populations of barramundi (Lates calcarifer).

    Science.gov (United States)

    Newton, James R; Zenger, Kyall R; Jerry, Dean R

    2013-09-01

    Identification of genetically-regulated adaptation in fish is a precursor to understanding how populations will respond to future climate induced stressors like temperature. Australian populations of barramundi (Lates calcarifer) show strong evidence of local adaptation to temperature. However, the phenotypic consequences of this adaptation are unknown and the genetic mechanisms underlying this response are poorly understood. In the current study, two populations of barramundi from temperature extremes of the species Australian distribution were communally reared at cool (22°C), control (28°C) and hot (36°C) water temperatures for 3.5months. Southern populations of barramundi originating from a cooler environment grew significantly faster at 22°C than northern populations of warm adapted barramundi. However, no difference in population growth was present at either 28°C or 36°C. The underlying transcriptome profile of barramundi was examined via Illumina mRNA deep sequencing to determine the major contributing gene categories giving rise to phenotypic differences in barramundi population growth. Gene ontology (GO) analysis revealed enrichment in categories relating to the regulation of peptidase activity as well as microtubule, cytoplasmic and cellular metabolic based processes. Further analysis of the GO category "microtubule based process" with associated genes from the "response to stress" category revealed an apparent re-organization of cytoskeletal elements in response to an induced cold stress in northern barramundi reared at 22°C, when compared with northern barramundi reared at 36°C. Between southern barramundi and northern barramundi reared at 36°C, an analysis of the "endopeptidase inhibitor activity" GO category in conjunction with stress genes indicated a suppression of the complement system in southern barramundi along with an increase in the cellular stress response. The results of the present study show that southern populations of barramundi

  5. Cell cycle arrest by a gradient of Dpp signaling during Drosophila eye development

    Directory of Open Access Journals (Sweden)

    Bhattacharya Abhishek

    2010-03-01

    Full Text Available Abstract Background The secreted morphogen Dpp plays important roles in spatial regulation of gene expression and cell cycle progression in the developing Drosophila eye. Dpp signaling is required for timely cell cycle arrest ahead of the morphogenetic furrow as a prelude to differentiation, and is also important for eye disc growth. The dpp gene is expressed at multiple locations in the eye imaginal disc, including the morphogenetic furrow that sweeps across the eye disc as differentiation initiates. Results Studies of Brinker and Dad expression, and of Mad phosphorylation, establish that there is a gradient of Dpp signaling in the eye imaginal disc anterior to the morphogenetic furrow, predominantly in the anterior-posterior axis, and also Dpp signaling at the margins of the disc epithelium and in the dorsal peripodial membrane. Almost all signaling activity seems to spread through the plane of the epithelia, although peripodial epithelium cells can also respond to underlying disc cells. There is a graded requirement for Dpp signaling components for G1 arrest in the eye disc, with more stringent requirements further anteriorly where signaling is lower. The signaling level defines the cell cycle response, because elevated signaling through expression of an activated Thickveins receptor molecule arrested cells at more anterior locations. Very anterior regions of the eye disc were not arrested in response to activated receptor, however, and evidence is presented that expression of the Homothorax protein may contribute to this protection. By contrast to activated Thickveins, ectopic expression of processed Dpp leads to very high levels of Mad phosphorylation which appear to have non-physiological consequences. Conclusions G1 arrest occurs at a threshold level of Dpp signaling within a morphogen gradient in the anterior eye. G1 arrest is specific for one competent domain in the eye disc, allowing Dpp signaling to promote growth at earlier

  6. Expression of the citrus CsTIP2;1 gene improves tobacco plant growth, antioxidant capacity and physiological adaptation under stress conditions.

    Science.gov (United States)

    Martins, Cristina P S; Neves, Diana M; Cidade, Luciana C; Mendes, Amanda F S; Silva, Delmira C; Almeida, Alex-Alan F; Coelho-Filho, Mauricio A; Gesteira, Abelmon S; Soares-Filho, Walter S; Costa, Marcio G C

    2017-05-01

    Overexpression of the citrus CsTIP2;1 improves plant growth and tolerance to salt and drought stresses by enhancing cell expansion, H 2 O 2 detoxification and stomatal conductance. Tonoplast intrinsic proteins (TIPs) are a subfamily of aquaporins, belonging to the major intrinsic protein family. In a previous study, we have shown that a citrus TIP isoform, CsTIP2;1, is highly expressed in leaves and also transcriptionally regulated in leaves and roots by salt and drought stresses and infection by 'Candidatus Liberibacter asiaticus', the causal agent of the Huanglongbing disease, suggesting its involvement in the regulation of the flow of water and nutrients required during both normal growth and stress conditions. Here, we show that the overexpression of CsTIP2;1 in transgenic tobacco increases plant growth under optimal and water- and salt-stress conditions and also significantly improves the leaf water and oxidative status, photosynthetic capacity, transpiration rate and water use efficiency of plants subjected to a progressive soil drying. These results correlated with the enhanced mesophyll cell expansion, midrib aquiferous parenchyma abundance, H 2 O 2 detoxification and stomatal conductance observed in the transgenic plants. Taken together, our results indicate that CsTIP2;1 plays an active role in regulating the water and oxidative status required for plant growth and adaptation to stressful environmental conditions and may be potentially useful for engineering stress tolerance in citrus and other crop plants.

  7. Splenectomy inhibits non-small cell lung cancer growth by modulating anti-tumor adaptive and innate immune response

    Science.gov (United States)

    Levy, Liran; Mishalian, Inbal; Bayuch, Rachel; Zolotarov, Lida; Michaeli, Janna; Fridlender, Zvi G

    2015-01-01

    It has been shown that inhibitors of the immune system reside in the spleen and inhibit the endogenous antitumor effects of the immune system. We hypothesized that splenectomy would inhibit the growth of relatively large non-small lung cancer (NSCLC) tumors by modulating the systemic inhibition of the immune system, and in particular Myeloid Derived Suppressor Cells (MDSC). The effect of splenectomy was evaluated in several murine lung cancer models. We found that splenectomy reduces tumor growth and the development of lung metastases, but only in advanced tumors. In immune-deficient NOD-SCID mice the effect of splenectomy on tumor growth and metastatic spread disappeared. Splenectomy significantly reduced the presence of MDSC, and especially monocytic-MDSC in the circulation and inside the tumor. Specific reduction of the CCR2+ subset of monocytic MDSC was demonstrated, and the importance of the CCL2-CCR2 axis was further shown by a marked reduction in CCL2 following splenectomy. These changes were followed by changes in the macrophages contents of the tumors to become more antitumorigenic, and by increased activation of CD8+ Cytotoxic T-cells (CTL). By MDSC depletion, and adoptive transfer of MDSCs, we demonstrated that the effect of splenectomy on tumor growth was substantially mediated by MDSC cells. We conclude that the spleen is an important contributor to tumor growth and metastases, and that splenectomy can blunt this effect by depletion of MDSC, changing the amount and characteristics of myeloid cells and enhancing activation of CTL. PMID:26137413

  8. Method of propagation, stimulation of rhizomes growth in vitro culture and adaptation in the open ground for the genus Miscanthus representatives

    Directory of Open Access Journals (Sweden)

    С. М. Гонтаренко

    2017-09-01

    Full Text Available Purpose. To develop a method of propagation, stimulation of rhizomes growth in vitro culture for the genus Miscanthus representatives and their adaptation in the open field without the use of greenhouse complexes for acclimatization and completion of growing. Methods. Biotechnological procedures, mathematical and statistical analyses. Results. Prescription of nutrient medium was developed for explants inoculation, sprouts propagation, rhizomes growth stimulation in vitro. Such sterile explants as seeds, buds to be removed from rhizomes, parts of  stems with bud were placed on modified media with mineral portion by Murashige and Skoog (MS that contained 0,5–1 dose of macroelements and one dose of microelements,  vitamins (10 mg/l of thia­minum, 1,0 mg/l of pyridoxine, 1,0 mg/l of nicotinic acid and 1,0 mg/l of ascorbic acid supplemented with amino acids (250 mg/l of glutamic acid, 3 mg/l of tyrosine, 3 mg/l of arginine, 2 mg/l of hydroxyproline, plant growth regulators [0,5–1,0 mg/l of GA (gibberelline acid, 0,2 mg/l of 6-BAP (6-Benzylaminopurine, 0,1 mg/l of NAA (α-naphtylacetic acid] in different variations. After seed germination, buds emerging and sprouts formation 1–2 cm in height, for propagation purpose they were passivated on the medium of other composition that differed from previous one by the content and ratio of growth regulators, especially by a high concentration of cytokinins [6-BAP (0,4–0,5 mg/l, kinetin (0,5 mg/l, adenine (0,5 mg/k] in different variations in presence of GA (0,2 mg/l. In order to stimulate rhizomes growth, microclones were transferred on media with other composition and ratio growth regulators (6-BAP (0,2–0,3 mg/l + GA (0,5–1,0 mg/l or 6-BAP (0,2–0,3 mg/l + GA (0,5–1,0 mg/l + NAA (0,1 mg/l,  in other words,  with a high content of gibberellins. After the formation of rhizomes 10–15 cm in length, miscanthus plants were planted out in the open ground. Stimulation of

  9. Sulforaphane induces reactive oxygen species-mediated mitotic arrest and subsequent apoptosis in human bladder cancer 5637 cells.

    Science.gov (United States)

    Park, Hyun Soo; Han, Min Ho; Kim, Gi-Young; Moon, Sung-Kwon; Kim, Wun-Jae; Hwang, Hye Jin; Park, Kun Young; Choi, Yung Hyun

    2014-02-01

    The present study was undertaken to determine whether sulforaphane-derived reactive oxygen species (ROS) might cause growth arrest and apoptosis in human bladder cancer 5637 cells. Our results show that the reduced viability of 5637 cells by sulforaphane is due to mitotic arrest, but not the G2 phase. The sulforaphane-induced mitotic arrest correlated with an induction of cyclin B1 and phosphorylation of Cdk1, as well as a concomitant increased complex between cyclin B1 and Cdk1. Sulforaphane-induced apoptosis was associated with the activation of caspase-8 and -9, the initiators caspases of the extrinsic and intrinsic apoptotic pathways, respectively, and activation of effector caspase-3 and cleavage of poly (ADP-ribose) polymerase. However, blockage of caspase activation inhibited apoptosis and abrogated growth inhibition in sulforaphane-treated 5637 cells. This study further investigated the roles of ROS with respect to mitotic arrest and the apoptotic effect of sulforaphane, and the maximum level of ROS accumulation was observed 3h after sulforaphane treatment. However, a ROS scavenger, N-acetyl-L-cysteine, notably attenuated sulforaphane-mediated apoptosis as well as mitotic arrest. Overall, these results suggest that sulforaphane induces mitotic arrest and apoptosis of 5637 cells via a ROS-dependent pathway. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Growth phenotypes of Pseudomonas aeruginosa lasR mutants adapted to the airways of cystic fibrosis patients

    DEFF Research Database (Denmark)

    D'Argenio, D.A.; Wu, M.H.; Hoffman, L.R.

    2007-01-01

    The opportunistic pathogen Pseudomonas aeruginosa undergoes genetic change during chronic airway infection of cystic fibrosis (CF) patients. One common change is a mutation inactivating lasR, which encodes a transcriptional regulator that responds to a homoserine lactone signal to activate...... growth in the laboratory on a rich medium. The lasR loss-of-function mutations in these strains conferred a growth advantage with particular carbon and nitrogen sources, including amino acids, in part due to increased expression of the catabolic pathway regulator CbrB. This growth phenotype could......-lactam antibiotic. Loss of LasR function may represent a marker of an early stage in chronic infection of the CF airway with clinical implications for antibiotic resistance and disease progression....

  11. Root proteome response to growth on tannery waste in three different poplar species with various adaptation abilities

    Directory of Open Access Journals (Sweden)

    Zemleduch-Barylska A.

    2013-04-01

    Full Text Available In our study we compared growth of three poplar clones (Populus tremula ×alba, P. alba ‘Villafranca” and P. nigra on chromium-containing solid tannery waste. Tolerance index of saplings ranged from only 25% for P. nigra up to 80% for P. tremula x alba. Standard morphological, chemical and biochemical analyses also confirmed significant differences in reaction of all tested clones to such growth conditions. Preliminary proteomic study showed an unequal level of changes in protein profiles from roots in different poplars.

  12. Differential Involvement of the Five RNA Helicases in Adaptation of Bacillus cereus ATCC 14579 to Low Growth Temperatures ▿

    OpenAIRE

    Pandiani, Franck; Brillard, Julien; Bornard, Isabelle; Michaud, Caroline; Chamot, Stéphanie; Nguyen-the, Christophe; Broussolle, Véronique

    2010-01-01

    Bacillus cereus ATCC 14579 possesses five RNA helicase-encoding genes overexpressed under cold growth conditions. Out of the five corresponding mutants, only the {Delta}cshA, {Delta}cshB, and {Delta}cshC strains were cold sensitive. Growth of the {Delta}cshA strain was also reduced at 30°C but not at 37°C. The cold phenotype was restored with the cshA gene for the {Delta}cshA strain and partially for the {Delta}cshB strain but not for the {Delta}cshC strain, suggesting different functions at ...

  13. House Arrest: Florida's Community Control Program.

    Science.gov (United States)

    Chi, Keon S.

    This report highlights Florida's house arrest program, a new alternative to prison incarceration viewed as a significant criminal justice experiment. The implementation and operation of the community control program is decribed, specific goals and objectives of the community control program are listed, and a preliminary assessment is offered.…

  14. [Extracorporeal life support for treating cardiac arrest].

    Science.gov (United States)

    Lehot, Jean-Jacques; Long-Him-Nam, Nelly; Bastien, Olivier

    2011-12-01

    Percutaneous extracorporeal life support (ECLS) is now widespread for treating acute cardiac failure. ECLS has been used for treating in-hospital and out of hospital cardiac arrests. A systematic review of literature was performed in order to assess the results. Nine studies of in-hospital cardiac arrests were published between 2003 and January 31, 2011. They included 724 patients, 208 of which survived without significant neurological sequelae (28.7 %). In the other patients, the initial disease and the consequences of low flow brought multiorgan failure, or ECLS resulted in haemorrhage and ischaemia. Low flow lasted between 42 and 105 min (mean 54min). ECLS was used after out of hospital cardiac arrests in 3 studies published between 2008 and January 31, 2011. They included 110 patients of which only 6 survived (4.4 %) despite strict inclusion criteria. Low flow lasted between 60 and 120 min (mean 98 min.) According to these results the use of ECLS should be encouraged after in-hospital cardiac arrest and training in cardiorespiratory resuscitation should be improved in global population and health professionals.

  15. Cardiac Arrest After Submucosal Infiltration With Lignocaine

    African Journals Online (AJOL)

    Marinda

    excitation like perioral twitching or tinnitus, seizures in our case. The occurrence of cardiac arrest was within a ten minute period after submucosal infiltration of 6 ml lignocaine 2% (120 mg) and. 1:200,000 epinephrine (30 μg). Further, the rapid onset and offset of symptoms would likely correlate with epinephrine and not ...

  16. Juvenile Arrests, 2007. Juvenile Justice Bulletin

    Science.gov (United States)

    Puzzanchera, Charles

    2009-01-01

    This Bulletin summarizes 2007 juvenile crime and arrest data reported by local law enforcement agencies across the country and cited in the FBI report, "Crime in the United States 2007." The Bulletin describes the extent and nature of juvenile crime that comes to the attention of the justice system. It serves as a baseline for comparison for…

  17. The Organizational Determinants of Police Arrest Decisions

    Science.gov (United States)

    Chappell, Allison T.; MacDonald, John M.; Manz, Patrick W.

    2006-01-01

    A limited amount of research has examined the relationship between characteristics of police organizations and policing styles. In particular, few studies have examined the link between organizational structures and police officer arrest decisions. Wilson's (1968) pioneering case study of police organizations suggested that individual police…

  18. Heart Attack or Sudden Cardiac Arrest: How Are They Different?

    Science.gov (United States)

    ... Attack or Sudden Cardiac Arrest: How Are They Different? Updated:Mar 15,2018 People often use these ... The heart attack symptoms in women can be different than men. What is cardiac arrest? Sudden cardiac ...

  19. Mind your errors: evidence for a neural mechanism linking growth mind-set to adaptive posterror adjustments.

    Science.gov (United States)

    Moser, Jason S; Schroder, Hans S; Heeter, Carrie; Moran, Tim P; Lee, Yu-Hao

    2011-12-01

    How well people bounce back from mistakes depends on their beliefs about learning and intelligence. For individuals with a growth mind-set, who believe intelligence develops through effort, mistakes are seen as opportunities to learn and improve. For individuals with a fixed mind-set, who believe intelligence is a stable characteristic, mistakes indicate lack of ability. We examined performance-monitoring event-related potentials (ERPs) to probe the neural mechanisms underlying these different reactions to mistakes. Findings revealed that a growth mind-set was associated with enhancement of the error positivity component (Pe), which reflects awareness of and allocation of attention to mistakes. More growth-minded individuals also showed superior accuracy after mistakes compared with individuals endorsing a more fixed mind-set. It is critical to note that Pe amplitude mediated the relationship between mind-set and posterror accuracy. These results suggest that neural mechanisms indexing on-line awareness of and attention to mistakes are intimately involved in growth-minded individuals' ability to rebound from mistakes.

  20. Reproduction of Lightning Incidence Resulted in Line Surge Arrester Failure

    Science.gov (United States)

    Kawamura, Hironao; Kozuka, Masahiro; Itamoto, Naoki; Ishii, Masaru

    There is possibility that lightning strokes to transmission lines with large peaks and/or long duration of currents cause arrester failures. Hence it is important to evaluate reliability of transmission lines considering arrester failures caused by lightning strokes. Actually, arrester failures were caused by a winter lightning stroke to the tower top of one circuit transmission line. In this letter, the lightning stroke associated with the arrester failures is evaluated based on observation of electromagnetic field and analysis by EMTP simulation.

  1. Dynamic crack arrest in ceramics and ceramic composites

    Science.gov (United States)

    Kobayashi, A. S.; Yang, K. H.

    1989-01-01

    The results of past dynamic crack arrest experiments involving structural ceramics and ceramic composites are reviewed and analyzed. The lack of dynamic crack arrest in very brittle materials is discussed and contrasted with dynamic crack arrest in somewhat brittle metallic and polymeric materials. Numerical analyses show that the lack of crack arrest is due to reduced dynamic fracture resistance of the material and is not due to the kinetic energy.

  2. Adaptive step goals and rewards: a longitudinal growth model of daily steps for a smartphone-based walking intervention.

    Science.gov (United States)

    Korinek, Elizabeth V; Phatak, Sayali S; Martin, Cesar A; Freigoun, Mohammad T; Rivera, Daniel E; Adams, Marc A; Klasnja, Pedja; Buman, Matthew P; Hekler, Eric B

    2018-02-01

    Adaptive interventions are an emerging class of behavioral interventions that allow for individualized tailoring of intervention components over time to a person's evolving needs. The purpose of this study was to evaluate an adaptive step goal + reward intervention, grounded in Social Cognitive Theory delivered via a smartphone application (Just Walk), using a mixed modeling approach. Participants (N = 20) were overweight (mean BMI = 33.8 ± 6.82 kg/m 2 ), sedentary adults (90% female) interested in participating in a 14-week walking intervention. All participants received a Fitbit Zip that automatically synced with Just Walk to track daily steps. Step goals and expected points were delivered through the app every morning and were designed using a pseudo-random multisine algorithm that was a function of each participant's median baseline steps. Self-report measures were also collected each morning and evening via daily surveys administered through the app. The linear mixed effects model showed that, on average, participants significantly increased their daily steps by 2650 (t = 8.25, p model with a quadratic time variable indicated an inflection point for increasing steps near the midpoint of the intervention and this effect was significant (t 2  = -247, t = -5.01, p goal + rewards intervention using a smartphone app appears to be a feasible approach for increasing walking behavior in overweight adults. App satisfaction was high and participants enjoyed receiving variable goals each day. Future mHealth studies should consider the use of adaptive step goals + rewards in conjunction with other intervention components for increasing physical activity.

  3. Sequence adaptations during growth of rescued classical swine fever viruses in cell culture and within infected pigs.

    Science.gov (United States)

    Hadsbjerg, Johanne; Friis, Martin B; Fahnøe, Ulrik; Nielsen, Jens; Belsham, Graham J; Rasmussen, Thomas Bruun

    2016-08-30

    Classical swine fever virus (CSFV) causes an economically important disease of swine. Four different viruses were rescued from full-length cloned cDNAs derived from the Paderborn strain of CSFV. Three of these viruses had been modified by mutagenesis (with 7 or 8 nt changes) within stem 2 of the subdomain IIIf of the internal ribosome entry site (IRES) that directs the initiation of protein synthesis. Rescued viruses were inoculated into pigs. The rescued vPader10 virus, without modifications in the IRES, induced clinical disease in pigs that was very similar to that observed previously with the parental field strain and transmission to in-contact pigs occurred. Two sequence reversions, in the NS2 and NS5B coding regions, became dominant within the virus populations in these infected pigs. Rescued viruses, with mutant IRES elements, did not induce disease and only very limited circulation of viral RNA could be detected. However, the animals inoculated with these mutant viruses seroconverted against CSFV. Thus, these mutant viruses were highly attenuated in vivo. All 4 rescued viruses were also passaged up to 20 times in cell culture. Using full genome sequencing, the same two adaptations within each of four independent virus populations were observed that restored the coding sequence to that of the parental field strain. These adaptations occurred with different kinetics. The combination of reverse genetics and in depth, full genome sequencing provides a powerful approach to analyse virus adaptation and to identify key determinants of viral replication efficiency in cells and within host animals. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Growth and Collapse of a Resource System: an Adaptive Cycle of Change in Public Lands Governance and Forest Management in Alaska

    Directory of Open Access Journals (Sweden)

    Colin M. Beier

    2009-12-01

    Full Text Available Large-scale government efforts to develop resources for societal benefit have often experienced cycles of growth and decline that leave behind difficult social and ecological legacies. To understand the origins and outcomes of these failures of resource governance, scholars have applied the framework of the adaptive cycle. In this study, we used the adaptive cycle as a diagnostic approach to trace the drivers and dynamics of forest governance surrounding a boom-bust sequence of industrial forest management in one of the largest-scale resource systems in U.S. history: the Tongass National Forest in southeastern Alaska. Our application of the adaptive cycle combined a historical narrative tracing dynamics in political, institutional, and economic subsystems and a longitudinal analysis of an indicator of overall system behavior (timber harvests. We found that federal policies in concert with global market changes drove transformative change in both forest governance (policy making and forest management (practices, through creation and dissolution of subsidized long-term lease contracts. Evidence of the systemic resilience provided by these leases was found in the analysis of industry responses to market volatility before and after Tongass-specific federal reforms. Although the lease contracts stabilized the Tongass system for a period of time, they fostered a growing degree of rigidity that contributed to a severe industrial collapse and the subsequent emergence of complex social traps. Broader lessons from the Tongass suggest that large-scale changes occurred only when the nested economic and policy cycles were in coherence, and a systemic effort to minimize social and ecological variability ultimately resulted in catastrophic collapse of governance. This collapse resulted in a pervasive and challenging legacy that prevents Tongass reorganization and limits the adaptive capacity of the larger social-ecological system of southeastern Alaska

  5. Initial Characterization of the Growth Stimulation and Heat-Shock-Induced Adaptive Response in Developing Lake Whitefish Embryos after Ionizing Radiation Exposure.

    Science.gov (United States)

    Thome, Christopher; Mitz, Charles; Hulley, Emily N; Somers, Christopher M; Manzon, Richard G; Wilson, Joanna Y; Boreham, Douglas R

    2017-10-01

    Ionizing radiation is known to effect development during early life stages. Lake whitefish (Coregonus clupeaformis) represent a unique model organism for examining such effects. The purpose of this study was to examine how ionizing radiation affects development in lake whitefish embryos and to investigate the presence of an adaptive response induced by heat shock. Acute exposure to 137 Cs gamma rays was administered at five time points corresponding to major developmental stages, with doses ranging from 0.008 to 15.5 Gy. Chronic gamma-ray exposures were delivered throughout embryogenesis within a custom-built irradiator at dose rates between 0.06 and 4.4 mGy/day. Additionally, embryos were given a heat shock of 3, 6 or 9°C prior to a single acute exposure. Radiation effects were assessed based on survival, development rate, morphometric measurements and growth efficiency. Embryos showed high resistance to acute exposures with an LD 50/hatch of 5.0 ± 0.7 Gy immediately after fertilization, increasing to 14.2 ± 0.1 Gy later in development. Chronic irradiation at all dose rates stimulated growth, with treated embryos up to 60% larger in body mass during development compared to unirradiated controls. Chronic irradiation also accelerated the time-to-hatch. A heat shock administered 6 h prior to irradiation reduced mortality by up to 25%. Overall, low-dose chronic irradiation caused growth stimulation in developing lake whitefish embryos and acute radiation mortality was reduced by a heat-shock-induced adaptive response.

  6. An Audit Of Perioperative Cardiac Arrest At Lagos University ...

    African Journals Online (AJOL)

    Objective: Intraoperative cardiac arrests are not uncommon and are related to both surgical and anaesthetic factors. This study aimed to examine the factors which predispose to a periopeartive cardiac arrest, to assess the appropriateness of therapy and the outcome. Materials and Methods: All perioperative cardiac arrests ...

  7. Pattern of Perioperative Cardiac Arrests at University of Maiduguri ...

    African Journals Online (AJOL)

    only 4 out of the 14 cardiac arrests. Only 2(14%) out of 14 cardiac arrests recovered to home discharge, one of them with significant neurological deficit. Majority of arrests were due to hypoxia from airway problems that were not detected early. There is need to improve on patient monitoring, knowledge of CPR and intensive ...

  8. Transient Central Diabetes Insipidus and Marked Hypernatremia following Cardiorespiratory Arrest

    OpenAIRE

    Koubar, Sahar H.; Younes, Eliane

    2017-01-01

    Central Diabetes Insipidus is often an overlooked complication of cardiopulmonary arrest and anoxic brain injury. We report a case of transient Central Diabetes Insipidus (CDI) following cardiopulmonary arrest. It developed 4 days after the arrest resulting in polyuria and marked hypernatremia of 199?mM. The latter was exacerbated by replacing the hypotonic urine by isotonic saline.

  9. Transient Central Diabetes Insipidus and Marked Hypernatremia following Cardiorespiratory Arrest

    Directory of Open Access Journals (Sweden)

    Sahar H. Koubar

    2017-01-01

    Full Text Available Central Diabetes Insipidus is often an overlooked complication of cardiopulmonary arrest and anoxic brain injury. We report a case of transient Central Diabetes Insipidus (CDI following cardiopulmonary arrest. It developed 4 days after the arrest resulting in polyuria and marked hypernatremia of 199 mM. The latter was exacerbated by replacing the hypotonic urine by isotonic saline.

  10. 32 CFR 935.125 - Citation in place of arrest.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 6 2010-07-01 2010-07-01 false Citation in place of arrest. 935.125 Section 935... INSULAR REGULATIONS WAKE ISLAND CODE Peace Officers § 935.125 Citation in place of arrest. In any case in which a peace officer may make an arrest without a warrant, he may issue and serve a citation if he...

  11. Adaptability to climate change in forestry species: drought effects on growth and wood anatomy of ponderosa pines growing at different competition levels

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez, M. E.; Gyenge, J. E.; Urquiza, M. M.; Varela, S.

    2012-11-01

    More stressful conditions are expected due to climatic change in several regions, including Patagonia, South-America. In this region, there are no studies about the impact of severe drought events on growth and wood characteristics of the most planted forestry species, Pinus ponderosa (Doug. ex-Laws). The objective of this study was to quantify the effect of a severe drought event on annual stem growth and functional wood anatomy of pines growing at different plantation densities aiming to understand how management practices can help to increase their adaptability to climate change. Growth magnitude and period, specific hydraulic conductivity, and anatomical traits (early- and late wood proportion, lumen diameter, cell-wall thickness, tracheid length and bordered pit dimensions) were measured in the ring 2008-2009, which was formed during drought conditions. This drought event decreased annual stem growth by 30-38% and 58-65% respect to previous mean growth, in open vs. closed stand trees, respectively, indicating a higher sensitivity of the latter, which is opposite to reports from the same species growing in managed native forests in USA. Some wood anatomical variables did differ in more water stressed trees (lower cell wall thickness of early wood cells and higher proportion of small-lumen cells in late wood), which in turn did not affect wood function (hydraulic conductivity and resistance to implosion). Other anatomical variables (tracheid length, pit dimensions, early- and late wood proportion, lumen diameter of early wood cells) did not differ between tree sizes and plantation density. The results suggest that severe drought affects differentially the amount but not the function and quality of formed wood in ponderosa pine growing at different competition levels. (Author) 41 refs.

  12. Effect of carbon dioxide and bicarbonate as inorganic carbon sources on growth and adaptation of autohydrogenotrophic denitrifying bacteria

    International Nuclear Information System (INIS)

    Ghafari, Shahin; Hasan, Masitah; Aroua, Mohamed Kheireddine

    2009-01-01

    Acclimation of autohydrogenotrophic denitrifying bacteria using inorganic carbon source (CO 2 and bicarbonate) and hydrogen gas as electron donor was performed in this study. In this regard, activated sludge was used as the seed source and sequencing batch reactor (SBR) technique was applied for accomplishing the acclimatization. Three distinct strategies in feeding of carbon sources were applied: (I) continuous sparging of CO 2 , (II) bicarbonate plus continuous sparging of CO 2 , and (III) only bicarbonate. The pH-reducing nature of CO 2 showed an unfavorable impact on denitrification rate; however bicarbonate resulted in a buffered environment in the mixed liquor and provided a suitable mean to maintain the pH in the desirable range of 7-8.2. As a result, bicarbonate as the only carbon source showed a faster adaptation, while carbon dioxide as the only carbon source as well as a complementary carbon source added to bicarbonate resulted in longer acclimation period. Adapted hydrogenotrophic denitrifying bacteria, using bicarbonate and hydrogen gas in the aforementioned pH range, caused denitrification at a rate of 13.33 mg NO 3 - -N/g MLVSS/h for degrading 20 and 30 mg NO 3 - -N/L and 9.09 mg NO 3 - -N/g MLVSS/h for degrading 50 mg NO 3 - -N/L

  13. Effect of carbon dioxide and bicarbonate as inorganic carbon sources on growth and adaptation of autohydrogenotrophic denitrifying bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Ghafari, Shahin; Hasan, Masitah [Department of Chemical Engineering, Faculty of Engineering, University of Malaya, 50603 Kuala Lumpur (Malaysia); Aroua, Mohamed Kheireddine [Department of Chemical Engineering, Faculty of Engineering, University of Malaya, 50603 Kuala Lumpur (Malaysia)], E-mail: mk_aroua@um.edu.my

    2009-03-15

    Acclimation of autohydrogenotrophic denitrifying bacteria using inorganic carbon source (CO{sub 2} and bicarbonate) and hydrogen gas as electron donor was performed in this study. In this regard, activated sludge was used as the seed source and sequencing batch reactor (SBR) technique was applied for accomplishing the acclimatization. Three distinct strategies in feeding of carbon sources were applied: (I) continuous sparging of CO{sub 2}, (II) bicarbonate plus continuous sparging of CO{sub 2}, and (III) only bicarbonate. The pH-reducing nature of CO{sub 2} showed an unfavorable impact on denitrification rate; however bicarbonate resulted in a buffered environment in the mixed liquor and provided a suitable mean to maintain the pH in the desirable range of 7-8.2. As a result, bicarbonate as the only carbon source showed a faster adaptation, while carbon dioxide as the only carbon source as well as a complementary carbon source added to bicarbonate resulted in longer acclimation period. Adapted hydrogenotrophic denitrifying bacteria, using bicarbonate and hydrogen gas in the aforementioned pH range, caused denitrification at a rate of 13.33 mg NO{sub 3}{sup -}-N/g MLVSS/h for degrading 20 and 30 mg NO{sub 3}{sup -}-N/L and 9.09 mg NO{sub 3}{sup -}-N/g MLVSS/h for degrading 50 mg NO{sub 3}{sup -}-N/L.

  14. Metabolic and proteomic adaptation of Lactobacillus rhamnosus strains during growth under cheese-like environmental conditions compared to de Man, Rogosa, and Sharpe medium.

    Science.gov (United States)

    Bove, Claudio Giorgio; De Angelis, Maria; Gatti, Monica; Calasso, Maria; Neviani, Erasmo; Gobbetti, Marco

    2012-11-01

    The aim of this study was to demonstrate the metabolic and proteomic adaptation of Lactobacillus rhamnosus strains, which were isolated at different stages of Parmigiano Reggiano cheese ripening. Compared to de Man, Rogosa, and Sharpe (MRS) broth, cultivation under cheese-like conditions (cheese broth, CB) increased the number of free amino acids used as carbon sources. Compared with growth on MRS or pasteurized and microfiltrated milk, all strains cultivated in CB showed a low synthesis of d,l-lactic acid and elevated levels of acetic acid. The proteomic maps of the five representative strains, showing different metabolic traits, were comparatively determined after growth on MRS and CB media. The amount of intracellular and cell-associated proteins was affected by culture conditions and diversity between strains, depending on their time of isolation. Protein spots showing decreased (62 spots) or increased (59 spot) amounts during growth on CB were identified using MALDI-TOF-MS/MS or LC-nano-ESI-MS/MS. Compared with cultivation on MRS broth, the L. rhamnosus strains cultivated under cheese-like conditions had modified amounts of some proteins responsible for protein biosynthesis, nucleotide, and carbohydrate metabolisms, the glycolysis pathway, proteolytic activity, cell wall, and exopolysaccharide biosynthesis, cell regulation, amino acid, and citrate metabolism, oxidation/reduction processes, and stress responses. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Adaptation of mycobacteria to growth conditions: a theoretical analysis of changes in gene expression revealed by microarrays.

    Directory of Open Access Journals (Sweden)

    Robert Ashley Cox

    Full Text Available BACKGROUND: Microarray analysis is a powerful technique for investigating changes in gene expression. Currently, results (r-values are interpreted empirically as either unchanged or up- or down-regulated. We now present a mathematical framework, which relates r-values to the macromolecular properties of population-average cells. The theory is illustrated by the analysis of published data for two species; namely, Mycobacterium bovis BCG Pasteur and Mycobacterium smegmatis mc(2 155. Each species was grown in a chemostat at two different growth rates. Application of the theory reveals the growth rate dependent changes in the mycobacterial proteomes. PRINCIPAL FINDINGS: The r-value r (i of any ORF (ORF(i encoding protein p (i was shown to be equal to the ratio of the concentrations of p (i and so directly proportional to the ratio of the numbers of copies of p (i per population-average cells of the two cultures. The proportionality constant can be obtained from the ratios DNA: RNA: protein. Several subgroups of ORFs were identified because they shared a particular r-value. Histograms of the number of ORFs versus the expression ratio were simulated by combining the particular r-values of several subgroups of ORFs. The largest subgroup was ORF(j (r (j  = 1.00± SD which was estimated to comprise respectively 59% and 49% of ORFs of M. bovis BCG Pasteur and M. smegmatis mc(2 155. The standard deviations reflect the properties of the cDNA preparations investigated. SIGNIFICANCE: The analysis provided a quantitative view of growth rate dependent changes in the proteomes of the mycobacteria studied. The majority of the ORFs were found to be constitutively expressed. In contrast, the protein compositions of the outer permeability barriers and cytoplasmic membranes were found to be dependent on growth rate; thus illustrating the response of bacteria to their environment. The theoretical approach applies to any cultivatable bacterium under a wide range of

  16. First permanent molar root development arrest associated with compound odontoma.

    Science.gov (United States)

    Gunda, Sachin A; Patil, Anil; Varekar, Aniruddha

    2013-07-04

    Trauma or infection to the primary tooth may have deleterious effects on the underlying developing tooth buds. Anatomically the root apices of primary teeth are in close proximity to the developing permanent tooth buds; hence spread of infection originating from pulp necrosis of primary tooth may not only affect the underlying tooth bud but may also affect the adjacent tooth buds. The extent of malformation depends on the developmental stage of tooth or the age of patient. Presented here is a rare case of complete arrest of maxillary first permanent molar root growth due to spread of periapical infection originating from second primary molar leading to failure of its eruption and finally extraction. Histopathlogical analysis revealed compound odontoma associated with maxillary first permanent molar.

  17. Adaptation of seedling growth to the altitude: a case of the Norway spruce from the polish Sudety mountains

    Directory of Open Access Journals (Sweden)

    Robakowski, Piotr

    1997-12-01

    Full Text Available Seedlings of five Norway spruce [Picea abies (L. Karst.] populations originating from different altitudes in the massif of Snieznik Klodzki in the Sudety Mountains (Poland were grown in the greenhouse. Height, root length, and weight of root, shoot, needles and bud, as well as biomass allocation were studied. A good correlation of seedling traits and the altitude of mother stands was found. This indicates a rather good ecological adaptation of these, probably introduced populations. Some ecological and silvicultural aspects of the results are discussed.

    [fr] Les plantes de cinq populations de l'épicéa commun [Picea abies (L. Karst.] provenant des différentes altitudes du massif de Snieznik Klodzki dans les Sudètes (une chaîne des montagnes en Pologne ont été cultivées dans la serre. Leurs paramètres suivants ont été analysés: la hauteur, la longueur des racines, le poids frais et le poids sec des racines, des tiges, des aiguilles, des bourgeons et l'allocation de la biomasse. La haute corrélation a été notée entre les paramètres des plantes et l'altitude des stations des arbres ayant été les semenciers des graines. Ce résultat montre une plutôt bonne adaptation écologique de ces populations, probablement introduites dans le massif de Snieznik Klodzki. Les aspects écologiques et les conséquences de l'adaptation de l'épicéa commun aux conditions montagneuses pour la sylviculture sont discutés.
    [es] Plántulas de cinco poblaciones de abeto rojo [Picea abies (L. Karst.] procedentes de diferente altitud en el macizo de Snieznik Klodzki, en los Montes Sudetes, (Polonia se cultivaron en invernadero. Se han analizado los parámetros siguientes: altura y longitud de las raíces, pesos fresco y seco de raíces, tallos, hojas y yemas, así como la distribución de la biomasa. Como resultado se obtuvo una correlación alta entre los parámetros de las plántidas y la altitud de las estaciones donde se colectaron las

  18. Piperine causes G1 phase cell cycle arrest and apoptosis in melanoma cells through checkpoint kinase-1 activation.

    Directory of Open Access Journals (Sweden)

    Neel M Fofaria

    Full Text Available In this study, we determined the cytotoxic effects of piperine, a major constituent of black and long pepper in melanoma cells. Piperine treatment inhibited the growth of SK MEL 28 and B16 F0 cells in a dose and time-dependent manner. The growth inhibitory effects of piperine were mediated by cell cycle arrest of both the cell lines in G1 phase. The G1 arrest by piperine correlated with the down-regulation of cyclin D1 and induction of p21. Furthermore, this growth arrest by piperine treatment was associated with DNA damage as indicated by phosphorylation of H2AX at Ser139, activation of ataxia telangiectasia and rad3-related protein (ATR and checkpoint kinase 1 (Chk1. Pretreatment with AZD 7762, a Chk1 inhibitor not only abrogated the activation of Chk1 but also piperine mediated G1 arrest. Similarly, transfection of cells with Chk1 siRNA completely protected the cells from G1 arrest induced by piperine. Piperine treatment caused down-regulation of E2F1 and phosphorylation of retinoblastoma protein (Rb. Apoptosis induced by piperine was associated with down-regulation of XIAP, Bid (full length and cleavage of Caspase-3 and PARP. Furthermore, our results showed that piperine treatment generated ROS in melanoma cells. Blocking ROS by tiron protected the cells from piperine mediated cell cycle arrest and apoptosis. These results suggest that piperine mediated ROS played a critical role in inducing DNA damage and activation of Chk1 leading to G1 cell cycle arrest and apoptosis.

  19. Spanish Adaptation and Validation of the Transplant Effects Questionnaire (TxEQ-Spanish in Liver Transplant Recipients and Its Relationship to Posttraumatic Growth and Quality of Life

    Directory of Open Access Journals (Sweden)

    María Á. Pérez-San-Gregorio

    2018-04-01

    Full Text Available The valid assessment of the impact of transplantation on psychological well-being is highly relevant to optimize treatment. However, to date there is no standardized instrument available in Spain. The Transplant Effects Questionnaire (TxEQ evaluates the specific problems associated with organ transplantation, such as worry about transplant, guilt regarding the donor, disclosure of having undergone transplantation, adherence to medical treatment and responsibility toward the donor, family, friends, or medical staff. Against this backdrop the English original version of the TxEQ was translated into Spanish and validated in a sample of 240 liver transplant recipients. Participants also filled in the Posttraumatic Growth Inventory (PTGI, and the 12-Item Short Form Health Survey (SF-12v.2. Confirmatory factor analysis of the TxEQ-Spanish revealed a five-factor structure equivalent to the English original version, and satisfactory internal consistency (Cronbach's alpha: worry α = 0.82, guilt α = 0.77, disclosure α = 0.91, adherence α = 0.82, responsibility α = 0.83. Results showed that better mental quality of life was associated with higher adherence and disclosure, as well as less worry and guilt. Higher posttraumatic growth was significantly associated with worry, guilt, and responsibility. Interestingly, the most powerful predictor of posttraumatic growth was worry. Analysis of variance showed an interaction effect of PTG and mental quality of life on adherence, with medium PTG being associated with significantly stronger adherence in participants with better mental quality of life. In conclusion our study could successfully adapt and validate the Spanish version of the TxEQ in a large sample of liver transplant recipients. Our findings show a complex relationship between emotional reactions to transplantation, mental quality of life, and posttraumatic growth, which give further insight into inner processes supporting psychological well

  20. Antepartal insulin-like growth factor concentrations indicating differences in the metabolic adaptive capacity of dairy cows

    Science.gov (United States)

    Holzhausen, Lars; Araujo, Marcelo Gil; Heppelmann, Maike; Sipka, Anja; Pfarrer, Chistiane; Schuberth, Hans-Joachim; Bollwein, Heinrich

    2014-01-01

    Cows with different Insulin-like Growth Factor-I (IGF-I) concentrations showed comparable expression levels of hepatic growth hormone receptor (GHR). Suppressor of cytokine signaling 2 (SOCS2), could be responsible for additional inhibition of the GHR signal cascade. The aims were to monitor cows with high or low antepartal IGF-I concentrations (IGF-Ihigh or IGF-Ilow), evaluate the interrelationships of endocrine endpoints, and measure hepatic SOCS2 expression. Dairy cows (n = 20) were selected (240 to 254 days after artificial insemination (AI)). Blood samples were drawn daily (day -17 until calving) and IGF-I, GH, insulin, thyroid hormones, estradiol, and progesterone concentrations were measured. Liver biopsies were taken (day 264 ± 1 after AI and postpartum) to measure mRNA expression (IGF-I, IGFBP-2, IGFBP-3, IGFBP-4, acid labile subunit (ALS), SOCS2, deiodinase1, GHR1A). IGF-I concentrations in the two groups were different (p 0.05). Thyroxine levels and ALS expression were higher in the IGF-Ihigh cows compared to IGF-Ilow cows. Estradiol concentration tended to be greater in the IGF-Ilow group (p = 0.06). It was hypothesized that low IGF-I levels are associated with enhanced SOCS2 expression although this could not be decisively confirmed by the present study. PMID:24962413

  1. Adaptive Significance of Quorum Sensing-Dependent Regulation of Rhamnolipids by Integration of Growth Rate in Burkholderia glumae: A Trade-Off between Survival and Efficiency.

    Science.gov (United States)

    Nickzad, Arvin; Déziel, Eric

    2016-01-01

    Quorum sensing (QS) is a cell density-dependent mechanism which enables a population of bacteria to coordinate cooperative behaviors in response to the accumulation of self-produced autoinducer signals in their local environment. An emerging framework is that the adaptive significance of QS in the regulation of production of costly extracellular metabolites ("public goods") is to maintain the homeostasis of cooperation. We investigated this model using the phytopathogenic bacterium Burkholderia glumae, which we have previously demonstrated uses QS to regulate the production of rhamnolipids, extracellular surface-active glycolipids promoting the social behavior called "swarming motility." Using mass spectrometric quantification and chromosomal lux-based gene expression, we made the unexpected finding that when unrestricted nutrient resources are provided, production of rhamnolipids is carried out completely independently of QS regulation. This is a unique observation among known QS-controlled factors in bacteria. On the other hand, under nutrient-limited conditions, QS then becomes the main regulating mechanism, significantly enhancing the specific rhamnolipids yield. Accordingly, decreasing nutrient concentrations amplifies rhamnolipid biosynthesis gene expression, revealing a system where QS-dependent regulation is specifically triggered by the growth rate of the population, rather than by its cell density. Furthermore, a gradual increase in QS signal specific concentration upon decrease of specific growth rate suggests a reduction in quorum threshold, which reflects an increase in cellular demand for production of QS-dependent target gene product at low density populations. Integration of growth rate with QS as a decision-making mechanism for biosynthesis of costly metabolites, such as rhamnolipids, could serve to assess the demand and timing for expanding the carrying capacity of a population through spatial expansion mechanisms, such as swarming motility, thus

  2. Genetic changes during a laboratory adaptive evolution process that allowed fast growth in glucose to an Escherichia coli strain lacking the major glucose transport system

    Directory of Open Access Journals (Sweden)

    Aguilar César

    2012-08-01

    Full Text Available Abstract Background Escherichia coli strains lacking the phosphoenolpyruvate: carbohydrate phosphotransferase system (PTS, which is the major bacterial component involved in glucose transport and its phosphorylation, accumulate high amounts of phosphoenolpyruvate that can be diverted to the synthesis of commercially relevant products. However, these strains grow slowly in glucose as sole carbon source due to its inefficient transport and metabolism. Strain PB12, with 400% increased growth rate, was isolated after a 120 hours adaptive laboratory evolution process for the selection of faster growing derivatives in glucose. Analysis of the genetic changes that occurred in the PB12 strain that lacks PTS will allow a better understanding of the basis of its growth adaptation and, therefore, in the design of improved metabolic engineering strategies for enhancing carbon diversion into the aromatic pathways. Results Whole genome analyses using two different sequencing methodologies: the Roche NimbleGen Inc. comparative genome sequencing technique, and high throughput sequencing with Illumina Inc. GAIIx, allowed the identification of the genetic changes that occurred in the PB12 strain. Both methods detected 23 non-synonymous and 22 synonymous point mutations. Several non-synonymous mutations mapped in regulatory genes (arcB, barA, rpoD, rna and in other putative regulatory loci (yjjU, rssA and ypdA. In addition, a chromosomal deletion of 10,328 bp was detected that removed 12 genes, among them, the rppH, mutH and galR genes. Characterization of some of these mutated and deleted genes with their functions and possible functions, are presented. Conclusions The deletion of the contiguous rppH, mutH and galR genes that occurred simultaneously, is apparently the main reason for the faster growth of the evolved PB12 strain. In support of this interpretation is the fact that inactivation of the rppH gene in the parental PB11 strain substantially increased

  3. [Cardiorespiratory arrest at the age of 30].

    Science.gov (United States)

    Porlier, Magali; Porlier, Ludovic; Lefort, Hugues

    The cardiovascular risk of women is specific and polymorphous. Delays in treatment in women are evident and caused by multiple social and anthropological factors as well as changes to lifestyle habits which are becoming similar to those of men. Young women thereby have a higher risk of sudden death than the rest of the female and general population. A nurse who experienced cardiorespiratory arrest at the age of 30 shares her story. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  4. Dental Calculus Arrest of Dental Caries.

    Science.gov (United States)

    Keyes, Paul H; Rams, Thomas E

    An inverse relationship between dental calculus mineralization and dental caries demineralization on teeth has been noted in some studies. Dental calculus may even form superficial layers over existing dental caries and arrest their progression, but this phenomenon has been only rarely documented and infrequently considered in the field of Cariology. To further assess the occurrence of dental calculus arrest of dental caries, this study evaluated a large number of extracted human teeth for the presence and location of dental caries, dental calculus, and dental plaque biofilms. A total of 1,200 teeth were preserved in 10% buffered formal saline, and viewed while moist by a single experienced examiner using a research stereomicroscope at 15-25× magnification. Representative teeth were sectioned and photographed, and their dental plaque biofilms subjected to gram-stain examination with light microscopy at 100× magnification. Dental calculus was observed on 1,140 (95%) of the extracted human teeth, and no dental carious lesions were found underlying dental calculus-covered surfaces on 1,139 of these teeth. However, dental calculus arrest of dental caries was found on one (0.54%) of 187 evaluated teeth that presented with unrestored proximal enamel caries. On the distal surface of a maxillary premolar tooth, dental calculus mineralization filled the outer surface cavitation of an incipient dental caries lesion. The dental calculus-covered carious lesion extended only slightly into enamel, and exhibited a brown pigmentation characteristic of inactive or arrested dental caries. In contrast, the tooth's mesial surface, without a superficial layer of dental calculus, had a large carious lesion going through enamel and deep into dentin. These observations further document the potential protective effects of dental calculus mineralization against dental caries.

  5. Dental Calculus Arrest of Dental Caries

    Science.gov (United States)

    Keyes, Paul H.; Rams, Thomas E.

    2016-01-01

    Background An inverse relationship between dental calculus mineralization and dental caries demineralization on teeth has been noted in some studies. Dental calculus may even form superficial layers over existing dental caries and arrest their progression, but this phenomenon has been only rarely documented and infrequently considered in the field of Cariology. To further assess the occurrence of dental calculus arrest of dental caries, this study evaluated a large number of extracted human teeth for the presence and location of dental caries, dental calculus, and dental plaque biofilms. Materials and methods A total of 1,200 teeth were preserved in 10% buffered formal saline, and viewed while moist by a single experienced examiner using a research stereomicroscope at 15-25× magnification. Representative teeth were sectioned and photographed, and their dental plaque biofilms subjected to gram-stain examination with light microscopy at 100× magnification. Results Dental calculus was observed on 1,140 (95%) of the extracted human teeth, and no dental carious lesions were found underlying dental calculus-covered surfaces on 1,139 of these teeth. However, dental calculus arrest of dental caries was found on one (0.54%) of 187 evaluated teeth that presented with unrestored proximal enamel caries. On the distal surface of a maxillary premolar tooth, dental calculus mineralization filled the outer surface cavitation of an incipient dental caries lesion. The dental calculus-covered carious lesion extended only slightly into enamel, and exhibited a brown pigmentation characteristic of inactive or arrested dental caries. In contrast, the tooth's mesial surface, without a superficial layer of dental calculus, had a large carious lesion going through enamel and deep into dentin. Conclusions These observations further document the potential protective effects of dental calculus mineralization against dental caries. PMID:27446993

  6. Sulfur dioxide converter and pollution arrester system

    International Nuclear Information System (INIS)

    Montalvo, V.H.

    1983-01-01

    A sulphur dioxide converter and pollution arrester system are disclosed which involves the treatment of smoke and/or contaminated air emanating from a combustion area by passage through a zone achieving turbulence into a water spray contained first treating chamber. The turbulence zone, into which an atomized catalyst is introduced, serves to create a longer path for cooling as well as increased centrifugal motion to the solid particles in the contaminated air and also the formation of sulphur trioxide. In other words, the arrangement is such that pollution arresting action is provided in the form of ''slinging'' resulting from tangential directional movement and, when combining with the water spray in the first treating chamber, the ultimate formation of sulphuric acid. Subsequently, the contaminated air, containing amounts of sulphurous and sulphuric acids, passes through a second treating chamber, where airflow throughout the system is occasioned by action at the outlet end, such as the vacuum created by a flue and not by independent mechanical means. The arrangement serves to a twofold purpose, i.e. to minimize or arrest pollution and to convert sulphur dioxide, a component of high sulphur coal, into commercially valuable sulphuric acid

  7. Cardiorespiratory arrest in children (out of hospital).

    Science.gov (United States)

    Writer, Hilary

    2010-11-25

    Cardiorespiratory arrest outside hospital occurs in approximately 1/10,000 children a year in resource-rich countries, with two-thirds of arrests occurring in children under 18 months of age. Approximately 45% of cases have undetermined causes, including sudden infant death syndrome. Of the rest, 20% are caused by trauma, 10% by chronic disease, and 6% by pneumonia. We conducted a systematic review aiming to answer the following clinical question: What are the effects of treatments for non-submersion out-of-hospital cardiorespiratory arrest in children? We searched: Medline, Embase, The Cochrane Library, and other important databases up to December 2009 (Clinical Evidence reviews are updated periodically, please check our website for the most up-to-date version of this review). We included harms alerts from relevant organisations such as the US Food and Drug Administration (FDA) and the UK Medicines and Healthcare products Regulatory Agency (MHRA). We found 15 systematic reviews, RCTs, or observational studies that met our inclusion criteria. We performed a GRADE evaluation of the quality of evidence for interventions. In this systematic review we present information relating to the effectiveness and safety of the following interventions: airway management and ventilation (bag-mask ventilation and intubation), bystander cardiopulmonary resuscitation, direct-current cardiac shock, hypothermia, intravenous sodium bicarbonate, standard dose of intravenous adrenaline (epinephrine), and training parents to perform resuscitation.

  8. Variations in Cardiac Arrest Regionalization in California

    Directory of Open Access Journals (Sweden)

    Mary P. Mercer

    2018-02-01

    Full Text Available Introduction: The development of cardiac arrest centers and regionalization of systems of care may improve survival of patients with out-of-hospital cardiac arrest (OHCA. This survey of the local EMS agencies (LEMSA in California was intended to determine current practices regarding the treatment and routing of OHCA patients and the extent to which EMS systems have regionalized OHCA care across California. Methods: We surveyed all of the 33 LEMSA in California regarding the treatment and routing of OHCA patients according to the current recommendations for OHCA management. Results: Two counties, representing 29% of the California population, have formally regionalized cardiac arrest care. Twenty of the remaining LEMSA have specific regionalization protocols to direct all OHCA patients with return of spontaneous circulation to designated percutaneous coronary intervention (PCI-capable hospitals, representing another 36% of the population. There is large variation in LEMSA ability to influence inhospital care. Only 14 agencies (36%, representing 44% of the population, have access to hospital outcome data, including survival to hospital discharge and cerebral performance category scores. Conclusion: Regionalized care of OHCA is established in two of 33 California LEMSA, providing access to approximately one-third of California residents. Many other LEMSA direct OHCA patients to PCI-capable hospitals for primary PCI and targeted temperature management, but there is limited regional coordination and system quality improvement. Only one-third of LEMSA have access to hospital data for patient outcomes.

  9. Developing European operational oceanography for Blue Growth, climate change adaptation and mitigation, and ecosystem-based management

    Science.gov (United States)

    She, Jun; Allen, Icarus; Buch, Erik; Crise, Alessandro; Johannessen, Johnny A.; Le Traon, Pierre-Yves; Lips, Urmas; Nolan, Glenn; Pinardi, Nadia; Reißmann, Jan H.; Siddorn, John; Stanev, Emil; Wehde, Henning

    2016-07-01

    Operational approaches have been more and more widely developed and used for providing marine data and information services for different socio-economic sectors of the Blue Growth and to advance knowledge about the marine environment. The objective of operational oceanographic research is to develop and improve the efficiency, timeliness, robustness and product quality of this approach. This white paper aims to address key scientific challenges and research priorities for the development of operational oceanography in Europe for the next 5-10 years. Knowledge gaps and deficiencies are identified in relation to common scientific challenges in four EuroGOOS knowledge areas: European Ocean Observations, Modelling and Forecasting Technology, Coastal Operational Oceanography and Operational Ecology. The areas "European Ocean Observations" and "Modelling and Forecasting Technology" focus on the further advancement of the basic instruments and capacities for European operational oceanography, while "Coastal Operational Oceanography" and "Operational Ecology" aim at developing new operational approaches for the corresponding knowledge areas.

  10. Upregulation of eIF5B controls cell-cycle arrest and specific developmental stages

    OpenAIRE

    Lee, Sooncheol; Truesdell, Samuel S.; Bukhari, Syed I. A.; Lee, Ju Huck; LeTonqueze, Olivier; Vasudevan, Shobha

    2014-01-01

    This study uncovers a critical role for a general translation factor in specific developmental stages, including immature oocytes and ES cells, and during growth-factor deprivation of mammalian cells, which induces the transition to cell-cycle arrest. These conditions alter and decrease general translation yet maintain ongoing translation. We reveal upregulation of the eukaryotic translation factor 5B (eIF5B), which becomes essential for general translation, specifically in these conditions. ...

  11. Differentiated dynamics of bud dormancy and growth in temperate fruit trees relating to bud phenology adaptation, the case of apple and almond trees.

    Science.gov (United States)

    El Yaacoubi, Adnane; Malagi, Gustavo; Oukabli, Ahmed; Citadin, Idemir; Hafidi, Majida; Bonhomme, Marc; Legave, Jean-Michel

    2016-11-01

    Few studies have focused on the characterization of bud dormancy and growth dynamics for temperate fruit species in temperate and mild cropping areas, although this is an appropriate framework to anticipate phenology adaptation facing future warming contexts which would potentially combine chill declines and heat increases. To examine this issue, two experimental approaches and field observations were used for high- and low-chill apple cultivars in temperate climate of southern France and in mild climates of northern Morocco and southern Brazil. Low-chill almond cultivars offered an additional relevant plant material for comparison with apple in northern Morocco. Divergent patterns of dormancy and growth dynamics were clearly found in apple tree between southern France and southern Brazil. Divergences were less pronounced between France and Morocco. A global view outlined main differences in the dormancy chronology and intensity, the transition between endordormancy and ecodormancy and the duration of ecodormancy. A key role of bud rehydration in the transition period was shown. High-chill cultivars would be submitted in mild conditions to heterogeneous rehydration capacities linked to insufficient chill fulfillment and excessive forcing linked to high temperatures. This would favor bud competitions and consequently excessive flowering durations and weak flowering. Low chilling requirements in apple and almond would conversely confer biological capacities to tolerate superficial dormancy and abrupt transition from endordormancy to ecodormancy without important heterogeneous rehydration states within buds. It may also assume that low-chill cultivars can also tolerate high temperatures during ecodormancy as well as extended flowering durations.

  12. Kinetic analysis of a Saccharomyces cerevisiae strain adapted for improved growth on glycerol: Implications for the development of yeast bioprocesses on glycerol.

    Science.gov (United States)

    Ochoa-Estopier, A; Lesage, J; Gorret, N; Guillouet, S E

    2011-01-01

    Glycerol is an agro-industrial residue generated in high amounts during the biodiesel production. The growing production of biodiesel is creating a worldwide glycerol surplus. Therefore, replacing sugar-based feedstock in bioprocesses by glycerol could be potentially attractive. Saccharomyces cerevisiae is one of the most commonly used microorganisms in the agri-food industry and therefore currently produced in large quantities from sugar-based feedstock. Unfortunately, growth of S. cerevisiae strains on glycerol is very low with reported μmax around 0.01 h(-1). This study demonstrates that successive growth of the S. cerevisiae CBS 8066, CEN.PK 113-7 D and Ethanol Red on glycerol as sole carbon source considerably improved the μmax from 0.01 up to 0.2 h(-1). The "adapted strain" CBS 8066-FL20 was kinetically characterized during aerobic and oxygen-limited cultivation in bioreactor and the results discussed in terms of their implication for developing glycerol-based S. cerevisiae bioprocesses. Copyright © 2010 Elsevier Ltd. All rights reserved.

  13. Food Legumes and Rising Temperatures: Effects, Adaptive Functional Mechanisms Specific to Reproductive Growth Stage and Strategies to Improve Heat Tolerance

    Directory of Open Access Journals (Sweden)

    Kumari Sita

    2017-10-01

    Full Text Available Ambient temperatures are predicted to rise in the future owing to several reasons associated with global climate changes. These temperature increases can result in heat stress- a severe threat to crop production in most countries. Legumes are well-known for their impact on agricultural sustainability as well as their nutritional and health benefits. Heat stress imposes challenges for legume crops and has deleterious effects on the morphology, physiology, and reproductive growth of plants. High-temperature stress at the time of the reproductive stage is becoming a severe limitation for production of grain legumes as their cultivation expands to warmer environments and temperature variability increases due to climate change. The reproductive period is vital in the life cycle of all plants and is susceptible to high-temperature stress as various metabolic processes are adversely impacted during this phase, which reduces crop yield. Food legumes exposed to high-temperature stress during reproduction show flower abortion, pollen and ovule infertility, impaired fertilization, and reduced seed filling, leading to smaller seeds and poor yields. Through various breeding techniques, heat tolerance in major legumes can be enhanced to improve performance in the field. Omics approaches unravel different mechanisms underlying thermotolerance, which is imperative to understand the processes of molecular responses toward high-temperature stress.

  14. Green growth and improving preparedness to adapt to pollinator decline in Nigeria - Communicating results for policy and action

    Directory of Open Access Journals (Sweden)

    Thomas Aneni

    2017-06-01

    Full Text Available Insect pollinators contribute to agricultural crop yield and beekeeping provides a major source of livelihoods for farmers in Nigeria. This study developed two survey questionnaires and collected data from beekeepers, researchers and government officials to generate quantitative indicators for the purpose of description as a guide to action. Evaluation and characterization of colony bee loses by beekeepers were assessed and surveys conducted in Osun State, Southern Nigeria, consisting of questions related to: the importance of pollinators, including managed honeybees (Apis mellifera, in agriculture and observations on factors associated with pollinator declines; and management of bee mortality. A majority of beekeepers were ignorant of the cause of the death of their colonies. Information from policy makers indicate that population abundance trends in honey bee and other pollinator populations have largely not been documented in Nigeria. This study emphasizes pollination and insect pollinators as drivers of agricultural crop production with a view to providing guidance for sustainable management of pollinators and achievement of green growth objectives.

  15. A case of thyroid storm with cardiac arrest

    Directory of Open Access Journals (Sweden)

    Nakashima Y

    2014-05-01

    Full Text Available Yutaka Nakashima,1 Tsuneaki Kenzaka,2 Masanobu Okayama,3 Eiji Kajii31Department for Support of Rural Medicine, Yamaguchi Grand Medical Center, 2Division of General Medicine, Center for Community Medicine, Jichi Medical University School of Medicine, Shimotsuke, Japan; 3Division of Community and Family Medicine, Center for Community Medicine, Jichi Medical University School of Medicine, Shimotsuke, JapanAbstract: A 23-year-old man became unconscious while jogging. He immediately received basic life support from a bystander and was transported to our hospital. On arrival, his spontaneous circulation had returned from a state of ventricular fibrillation and pulseless electrical activity. Following admission, hyperthyroidism led to a suspicion of thyroid storm, which was then diagnosed as a possible cause of the cardiac arrest. Although hyperthyroidism-induced cardiac arrest including ventricular fibrillation is rare, it should be considered when diagnosing the cause of treatable cardiac arrest.Keywords: hyperthyroidism, ventricular fibrillation, treatable cardiac arrest, cardiac arrest, cardiopulmonary arrest

  16. [Identifying children at risk for cardiorespiratory arrest].

    Science.gov (United States)

    Carrillo Alvarez, A; Martínez Gutiérrez, A; Salvat Germán, F

    2004-08-01

    Cardiorespiratory arrest in children with severe disease does not usually present suddenly or unexpectedly but is often the result of a progressive deterioration of respiratory and/or circulatory function. Before failure of these functions occurs, there is a series of clinical signs that serve as a warning. Health professionals should not only evaluate clinical signs of respiratory and/or circulatory insufficiency but should also be able to identify these warning signs as early as possible, preferably in the compensation phase, given that the possibility that this process can be reversed by therapeutic measures decreases as the process progresses.

  17. [Lethal portal venous gas after cardiopulmonary arrest].

    Science.gov (United States)

    Thomachot, L; Arnal, J M; Vialet, R; Albanèse, J; Martin, C

    1998-01-01

    We report the case of a 51-year-old patient admitted after a transient cardiorespiratory arrest. The abdominal CT scan revealed the presence of hepatic portal venous gas. At laparotomy, a diffuse mesenteric ischaemia was diagnosed. The patient died from multiple organ failure in the subsequent hours. Necrotic bowel is associated with hepatic portal venous gas in 50% of the cases and the current mortality rate is 85%. Gas originates either through intestinal transmucosal passage, either by intraportal bacterial gas production, or through both mechanisms.

  18. SPARC expression induces cell cycle arrest via STAT3 signaling pathway in medulloblastoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Chetty, Chandramu [Department of Cancer Biology and Pharmacology, University of Illinois College of Medicine at Peoria, One Illini Drive, Peoria, IL-61605 (United States); Dontula, Ranadheer [Section of Hematology/Oncology, Department of Medicine, University of Illinois College of Medicine at Chicago, 840 South Wood Street, Suite 820-E, Chicago, IL-60612 (United States); Ganji, Purnachandra Nagaraju [Department of Cancer Biology and Pharmacology, University of Illinois College of Medicine at Peoria, One Illini Drive, Peoria, IL-61605 (United States); Gujrati, Meena [Department of Pathology, University of Illinois College of Medicine at Peoria, One Illini Drive, Peoria, IL-61605 (United States); Lakka, Sajani S., E-mail: slakka@uic.edu [Section of Hematology/Oncology, Department of Medicine, University of Illinois College of Medicine at Chicago, 840 South Wood Street, Suite 820-E, Chicago, IL-60612 (United States)

    2012-01-13

    Highlights: Black-Right-Pointing-Pointer Ectopic expression of SPARC impaired cell proliferation in medulloblastoma cells. Black-Right-Pointing-Pointer SPARC expression induces STAT3 mediated cell cycle arrest in medulloblastoma cells. Black-Right-Pointing-Pointer SPARC expression significantly inhibited pre-established tumor growth in nude-mice. -- Abstract: Dynamic cell interaction with ECM components has profound influence in cancer progression. SPARC is a component of the ECM, impairs the proliferation of different cell types and modulates tumor cell aggressive features. We previously reported that SPARC expression significantly impairs medulloblastoma tumor growth in vivo. In this study, we demonstrate that expression of SPARC inhibits medulloblastoma cell proliferation. MTT assay indicated a dose-dependent reduction in tumor cell proliferation in adenoviral mediated expression of SPARC full length cDNA (Ad-DsRed-SP) in D425 and UW228 cells. Flow cytometric analysis showed that Ad-DsRed-SP-infected cells accumulate in the G2/M phase of cell cycle. Further, immunoblot and immunoprecipitation analyses revealed that SPARC induced G2/M cell cycle arrest was mediated through inhibition of the Cyclin-B-regulated signaling pathway involving p21 and Cdc2 expression. Additionally, expression of SPARC decreased STAT3 phosphorylation at Tyr-705; constitutively active STAT3 expression reversed SPARC induced G2/M arrest. Ad-DsRed-SP significantly inhibited the pre-established orthotopic tumor growth and tumor volume in nude-mice. Immunohistochemical analysis of tumor sections from mice treated with Ad-DsRed-SP showed decreased immunoreactivity for pSTAT3 and increased immunoreactivity for p21 compared to tumor section from mice treated with mock and Ad-DsRed. Taken together our studies further reveal that STAT3 plays a key role in SPARC induced G2/M arrest in medulloblastoma cells. These new findings provide a molecular basis for the mechanistic understanding of the

  19. Arrested recovery of Diadema antillarum population: Survival or recruitment limitation?

    Science.gov (United States)

    Rodríguez-Barreras, Ruber; Pérez, María E.; Mercado-Molina, Alex E.; Sabat, Alberto M.

    2015-09-01

    Densities of the long-spined sea urchin Diadema antillarum remain significantly below pre mass-mortality levels at most Caribbean localities. The arrested recovery of this formerly abundant herbivore has been attributed to low supply of recruits and high post settlement mortality. There is, however, some debate as to which of these factors is determinant of the local dynamics of this echinoid. In this study, we use demographic modeling to analyze the contribution of recruitment and post settlement survival on the dynamics of D. antillarum in four localities of Puerto Rico Archipelago. Our results indicate relatively high adult survival, and low stasis but high growth transition in the small individuals. Recruitment rates were low and exhibited high spatial and temporal variability. The four populations exhibited asymptotic growth rates (λ) below 1.0, with λ varying from 0.918 to 0.964. The elasticity analysis showed that the survival of large-sized Diadema can potentially contribute most to the changes in λ for all sites. Numerical projections of the populations indicate that no site would exhibit an increase in density under current recruitment rates, but doubling recruitment would produce an increase in sea urchin density in three of the four sites. Recovery of D. antillarum populations would require the spatial and temporal co-occurrence of high recruitment and survival rates.

  20. Sublingual Microcirculation is Impaired in Post-cardiac Arrest Patients

    DEFF Research Database (Denmark)

    G. Omar, Yasser; Massey, Michael; Wiuff Andersen, Lars

    2013-01-01

    the microcirculation flow index (MFI) at 6 and 24h in the cardiac arrest patients, and within 6h of emergency department admission in the sepsis and control patients. RESULTS: We evaluated 30 post-cardiac arrest patients, 16 severe sepsis/septic shock patients, and 9 healthy control patients. Sublingual...... markers in the post-cardiac arrest state. METHODS: We prospectively evaluated the sublingual microcirculation in post-cardiac arrest patients, severe sepsis/septic shock patients, and healthy control patients using Sidestream Darkfield microscopy. Microcirculatory flow was assessed using...

  1. The ethics of cardiac arrest research.

    Science.gov (United States)

    Miller, B L

    1993-01-01

    In cardiac arrest research, prior informed consent is not available to resolve the conflict between the rights and well-being of subjects and the possible benefit to future patients. The right to autonomy is the fundamental right that is protected by the legal doctrine of informed consent. As a fundamental right, it cannot be balanced against other goods. Rather, it is a constraint, or trump, on the balancing of goods and can be overridden only for a narrow range of reasons: its recognition in a given case conflicts with another basic right, infringing the right will prevent great harm to others, and excluding a particular case from its scope will recognize and advance the right in the long run. Proxy consent, deferred consent, and presumed consent to cardiac arrest research are examined to determine if they qualify as justified infringements of the right to autonomy. The conclusion is that only presumed consent can be used, provided that the researcher can honestly say that outside of the randomized clinical trial of two or more treatments, a physician would have no basis for choosing one over the others.

  2. Cardiac arrest caused by nafamostat mesilate

    Directory of Open Access Journals (Sweden)

    Hyo Shik Kim

    2016-09-01

    Full Text Available A 65-year-old man was transferred from the Department of Vascular Surgery to Nephrology because of cardiac arrest during hemodialysis. He underwent incision and drainage for treatment of a buttock abscess. Nafamostat mesilate was used as an anticoagulant for hemodialysis to address bleeding from the incision and drainage site. Sudden cardiac arrest occurred after 15 minutes of dialysis. The patient was treated in the intensive care unit for 5 days. Continuous veno-venous hemodiafiltration was started without any anticoagulant in the intensive care unit. Conventional hemodialysis was reinitiated, and nafamostat mesilate was used again because of a small amount of continued bleeding. Ten minutes after hemodialysis, the patient complained of anaphylactic signs and symptoms such as dyspnea, hypotension, and facial swelling. Epinephrine, dexamethasone, and pheniramin were injected under the suspicion of anaphylactic shock, and the patient recovered. Total immunoglobulin E titer was high, and skin prick test revealed weak positivity for nafamostat mesilate. We first report a case of anaphylactic shock caused by nafamostat mesilate in Korea.

  3. L-Arginine supplementation inhibits the growth of breast cancer by enhancing innate and adaptive immune responses mediated by suppression of MDSCs in vivo.

    Science.gov (United States)

    Cao, Yu; Feng, Yonghui; Zhang, Yanjun; Zhu, Xiaotong; Jin, Feng

    2016-06-01

    L-Arg is involved in many biological activities, including the activation of T cells. In breast cancer patients, L-Arg is depleted by nitric oxide synthase 2 (NOS2) and arginase 1 (ARG-1) produced by myeloid-derived suppressor cells (MDSCs). Our aim was to test whether L-Arg supplementation could enhance antitumor immune response and improve survivorship in a rodent model of mammary tumor. Tumor volumes in control and L-Arg treated 4 T1 tumor bearing (TB) BALB/c mice were measured and survival rates were recorded. The percentages of MDSCs, dendritic cells (DCs), regulatory T cells (Tregs), macrophages, CD4(+) T cells, and CD8(+) T cells were examined by flow cytometry. Additionally, levels of IL-10, TNF-α, and IFN-γ were measured by enzyme-linked immunosorbent assay (ELISA) and nitric oxide (NO) levels were measured by the Griess reaction. IFN-γ, T-bet, Granzyme B, ARG-1 and iNOS mRNA levels were examined by real-time RT-PCR. L-Arg treatment inhibited tumor growth and prolonged the survival time of 4 T1 TB mice. The frequency of MDSCs was significantly suppressed in L-Arg treated TB mice. In contrast, the numbers and function of macrophages, CD4(+) T cells, and CD8(+) T cells were significantly enhanced. The IFN-γ, TNF-α, NO levels in splenocytes supernatant, as well as iNOS, IFN-γ, Granzyme B mRNA levels in splenocytes and tumor blocks were significantly increased. The ARG-1 mRNA level in tumor blocks, the frequency of Tregs, and IL-10 level were not affected. L-Arg supplementation significantly inhibited tumor growth and prolonged the survival time of 4 T1 TB mice, which was associated with the reduction of MDSCs, and enhanced innate and adaptive immune responses.

  4. An energy analysis of crack-initiation and arrest in epoxy

    Science.gov (United States)

    Chudnovsky, A.; Kim, A.; Bosnyak, C. P.

    1992-01-01

    The objective of this work is to study fracture processes such as crack initiation and arrest in epoxy. A compact tension specimen with displacement-controlled loading is employed to observe multiple crack initiations and arrests. The energy release rate at crack initiation is significantly higher than that at crack arrest, as has been observed elsewhere. In this study, the difference between these energy release rates is found to depend on specimen size (scale effect), and is quantitatively related to the fracture surface morphology. The scale effect, similar to that in strength theory, is conventionally attributed to the statistics of defects which control the fracture process. Triangular shaped ripples, deltoids, are formed on the fracture surface of the epoxy during the slow sub-critical crack growth, prior to the smooth mirrorlike surface characteristic of fast cracks. The deltoids are complimentary on the two crack faces which excludes any inelastic deformation from consideration. The deltoids are analogous to the ripples created on a river surface downstream from a small obstacle. However, in spite of the expectation based on this analogy and the observed scale effect, there are no 'defects' at the apex of the deltoids detectable down to the 0.1 micron level. This suggests that the formation of deltoids during the slow process of subcritical crack growth is an intrinsic feature of the fracture process itself, triggered by inhomogeneity of material on a submicron scale. This inhomogeneity may be related to a fluctuation in the cross-link density of the epoxy.

  5. Comparative Study on the Adaptation and Growth Dynamics of the Helix pomatia and Helix aspersa Muller Terrestrial Snails Under Different Feeding Regimes

    Directory of Open Access Journals (Sweden)

    Adrian Toader-Williams

    2010-05-01

    Full Text Available We used Helix pomatia and Helix aspersa species and measure their growth as the snails were approaching the hibernation season. Helix pomatia 2yo shown a decrease in weight while being raised in enclosed parcels of 4sqm the younger Helix pomatia 1yo as well as Helix aspersa Muller demonstrated the ability to adapt relatively fast to the same conditions. We established 5 experimental lots in a Helix pomatia farm, GPS coordinates N46.606040 E23.599950. Control lot contained Taraxacum officinales, Sonchus oleraceus, Equisetum arvense and Atriplex hortensis, wild flora found within the farm. The other lots contained the same plants as the control lot plus different combinations of imported plants from other areals. The H. pomatia 2yo weight decreased in the control lot by a mean of -3.86% while H. aspersa 1yo marked an increase of +16.89% in the same lot during the same period. The lot containing lupinus polyphyllus delivered snails with weight gain of +24.66% for H. pomatia 2yo and an increase of only +1.98% for H. aspersa 1yo. As a contrast, H. pomatia 2yo gained only +7.72% while H. aspersa 1yo gained +28.89%, in the lot containing Lavanda officinalis, Foeniculum vulgare and Hyssopus officinalis among the other plants.

  6. A Benzothiazole Derivative (5g) Induces DNA Damage And Potent G2/M Arrest In Cancer Cells.

    Science.gov (United States)

    Hegde, Mahesh; Vartak, Supriya V; Kavitha, Chandagirikoppal V; Ananda, Hanumappa; Prasanna, Doddakunche S; Gopalakrishnan, Vidya; Choudhary, Bibha; Rangappa, Kanchugarakoppal S; Raghavan, Sathees C

    2017-05-31

    Chemically synthesized small molecules play important role in anticancer therapy. Several chemical compounds have been reported to damage the DNA, either directly or indirectly slowing down the cancer cell progression by causing a cell cycle arrest. Direct or indirect reactive oxygen species formation causes DNA damage leading to cell cycle arrest and subsequent cell death. Therefore, identification of chemically synthesized compounds with anticancer potential is important. Here we investigate the effect of benzothiazole derivative (5g) for its ability to inhibit cell proliferation in different cancer models. Interestingly, 5g interfered with cell proliferation in both, cell lines and tumor cells leading to significant G2/M arrest. 5g treatment resulted in elevated levels of ROS and subsequently, DNA double-strand breaks (DSBs) explaining observed G2/M arrest. Consistently, we observed deregulation of many cell cycle associated proteins such as CDK1, BCL2 and their phosphorylated form, CyclinB1, CDC25c etc. Besides, 5g treatment led to decreased levels of mitochondrial membrane potential and activation of apoptosis. Interestingly, 5g administration inhibited tumor growth in mice without significant side effects. Thus, our study identifies 5g as a potent biochemical inhibitor to induce G2/M phase arrest of the cell cycle, and demonstrates its anticancer properties both ex vivo and in vivo.

  7. Out-of-Hospital Cardiac Arrest in Denmark

    DEFF Research Database (Denmark)

    Wissenberg Jørgensen, Mads

    challenges, due to the victim’s physical location, which brings an inherent risk of delay (or altogether absence) of recognition and treatment of cardiac arrest. A low frequency of bystander cardiopulmonary resuscitation and low 30-day survival after out-of-hospital cardiac arrest were identified nearly ten...

  8. Cardiac arrest during anesthesia at a University Hospital in Nigeria

    African Journals Online (AJOL)

    2013-03-07

    Mar 7, 2013 ... Background: We assessed the incidence and outcomes of cardiac arrest during anesthesia in the operating room at our university hospital. A previous study on intraoperative cardiac arrests covered a period from 1994-1998 and since then; anesthetic personnel, equipment, and workload have increased ...

  9. Cardiac arrest during anesthesia at a University Hospital in Nigeria ...

    African Journals Online (AJOL)

    Background: We assessed the incidence and outcomes of cardiac arrest during anesthesia in the operating room at our university hospital. A previous study on intraoperative cardiac arrests covered a period from 1994-1998 and since then; anesthetic personnel, equipment, and workload have increased remarkably.

  10. Efficacy of silver diamine fluoride for Arresting Caries Treatment.

    NARCIS (Netherlands)

    Yee, R.T.F.; Holmgren, C.J.; Mulder, J.; Lama, D.; Walker, D.; Palenstein Helderman, W.H. van

    2009-01-01

    Arresting Caries Treatment (ACT) has been proposed to manage untreated dental caries in children. This prospective randomized clinical trial investigated the caries-arresting effectiveness of a single spot application of: (1) 38% silver diamine fluoride (SDF) with tannic acid as a reducing agent;

  11. A novel parameter estimation method for metal oxide surge arrester ...

    Indian Academy of Sciences (India)

    45 and 60μs, is 2–4% lower than that of a 8μs current impulse (Martinez & Durbak 2005). In order to reproduce the MO surge arrester dynamic characteristics mentioned previously, a lot of researches have been done on modelling and simulation of MO surge arresters (Martinez. & Durbak 2005). A dynamic model has been ...

  12. A novel parameter estimation method for metal oxide surge arrester ...

    Indian Academy of Sciences (India)

    with experimental results. Keywords. Metal oxide surge arrester models; PSO; ACO; parameter estimation;. EMTP. 1. Introduction. Metal oxide (MO) surge arresters are widely used as protective devices against switching and lightning over-voltages in power systems. The proper nonlinear voltage-current characteristics,. ∗.

  13. The Influence of Mandatory Arrest Policies, Police Organizational Characteristics, and Situational Variables on the Probability of Arrest in Domestic Violence Cases

    Science.gov (United States)

    Eitle, David

    2005-01-01

    Prior research into factors predicting arrest in domestic violence cases is limited in three regards: (a) no examination of whether mandatory arrest policies are associated with increased risk of arrest across multiple jurisdictions; (b) little consideration of whether police organizational characteristics influence arrest in such cases; and (c)…

  14. Location of cardiac arrest and impact of pre-arrest chronic disease and medication use on survival.

    Science.gov (United States)

    Granfeldt, Asger; Wissenberg, Mads; Hansen, Steen Møller; Lippert, Freddy K; Torp-Pedersen, Christian; Christensen, Erika Frischknecht; Christiansen, Christian Fynbo

    2017-05-01

    Cardiac arrest in a private location is associated with a higher mortality when compared to public location. Past studies have not accounted for pre-arrest factors such as chronic disease and medication. To investigate whether the association between cardiac arrest in a private location and a higher mortality can be explained by differences in chronic diseases and medication. We identified 27,771 out-of-hospital cardiac arrest patients ≥18 years old from the Danish Cardiac Arrest Registry (2001-2012). Using National Registries, we identified pre-arrest chronic disease and medication. To investigate the importance of cardiac arrest related factors and chronic disease and medication use we performed adjusted Cox regression analyses during day 0-7 and day 8-365 following cardiac arrest to calculate hazard ratios (HR) for death. Day 0-7: Un-adjusted HR for death day 0-7 was 1.21 (95%CI:1.18-1.25) in private compared to public location. When including cardiac arrest related factors HR for death was 1.09 (95%CI:1.06-1.12). Adding chronic disease and medication to the analysis changed HR for death to 1.08 (95%CI:1.05-1.12). 8-365 day: The un-adjusted HR for death day 8-365 was 1.70 (95% CI: 1.43-2.02) in private compared to public location. When including cardiac arrest related factors the HR decreased to 1.39 (95% CI: 1.14-1.68). Adding chronic disease and medication to the analysis changed HR for death to 1.27 (95% CI:1.04-1.54). The higher mortality following cardiac arrest in a private location is partly explained by a higher prevalence of chronic disease and medication use in patients surviving until day 8. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Lung anatomy and histology of the extant coelacanth shed light on the loss of air-breathing during deep-water adaptation in actinistians.

    Science.gov (United States)

    Cupello, Camila; Meunier, François J; Herbin, Marc; Clément, Gaël; Brito, Paulo M

    2017-03-01

    Lungs are specialized organs originated from the posterior pharyngeal cavity and considered as plesiomorphic for osteichthyans, as they are found in extant basal actinopterygians (i.e. Polypterus ) and in all major groups of extant sarcopterygians. The presence of a vestigial lung in adult stages of the extant coelacanth Latimeria chalumnae is the result of allometric growth during ontogeny, in relation with long-time adaptation to deep water. Here, we present the first detailed histological and anatomical description of the lung of Latimeria chalumnae , providing new insights into its arrested differentiation in an air-breathing complex, mainly represented by the absence of pneumocytes and of compartmentalization in the latest ontogenetic stages.

  16. Structural arrest in an ideal gas.

    Science.gov (United States)

    van Ketel, Willem; Das, Chinmay; Frenkel, Daan

    2005-04-08

    We report a molecular dynamics study of a simple model system that has the static properties of an ideal gas, yet exhibits nontrivial "glassy" dynamics behavior at high densities. The constituent molecules of this system are constructs of three infinitely thin hard rods of length L, rigidly joined at their midpoints. The crosses have random but fixed orientation. The static properties of this system are those of an ideal gas, and its collision frequency can be computed analytically. For number densities NL(3)/V>1, the single-particle diffusivity goes to zero. As the system is completely structureless, standard mode-coupling theory cannot describe the observed structural arrest. Nevertheless, the system exhibits many dynamical features that appear to be mode-coupling-like. All high-density incoherent intermediate scattering functions collapse onto master curves that depend only on the wave vector.

  17. Crack arrest tests for a new ASTM-standard

    International Nuclear Information System (INIS)

    Gillot, R.; Kalthoff, J.

    1980-01-01

    In order to quantitatively describe the procedures in crack arrest, the following two parameters must be known which can be determined either experimentally or analytically: 1. The crack arrest toughness which represents a measure of the capability of the material to stop running cracks and 2. the stress intensity factor at the peak of the crack of the running or stopping crack as a measure of the danger of the crack. As cracks propagate as long as the K factor is greater than the crack arrest toughness, there are principally two possibilities of influencing the arrest: either one makes sure that the crack is led into an increasingly tougher region, i.e. by material-specific measures, or by leading the crack into an area of reduced stress by constructive measures. Both possibilities for crack arrest are described by the same fracture mechanical formula. (orig./RW) [de

  18. Maturation arrest of human oocytes at germinal vesicle stage

    Science.gov (United States)

    Chen, Zhi Qin; Ming, Teng Xiao; Nielsen, Hans Ingolf

    2010-01-01

    Maturation arrest of human oocytes may occur at various stages of the cell cycle. A total failure of human oocytes to complete meiosis is rarely observed during assisted conception cycles. We describe here a case of infertile couples for whom all oocytes repeatedly failed to mature at germinal vesicle (GV) stage during in vitro fertilization/Intra cytoplasmic sperm injection (IVF/ICSI). The patient underwent controlled ovarian stimulation followed by oocyte retrieval and IVF/ICSI. The oocytes were stripped off cumulus cells prior to the ICSI procedure and their maturity status was defined. The oocyte maturation was repeatedly arrested at the GV. Oocyte maturation arrest may be the cause of infertility in this couple. The recognition of oocyte maturation arrest as a specific medical condition may contribute to the characterization of the currently known as “oocyte factor.” The cellular and genetic mechanisms causing oocyte maturation arrest should be the subject for further investigation. PMID:21234179

  19. ERC initiatives to reduce the burden of cardiac arrest: the European Cardiac Arrest Awareness Day.

    Science.gov (United States)

    Georgiou, Marios; Lockey, Andrew S

    2013-09-01

    The rate of survival from out-of-hospital cardiac arrest in Europe remains unacceptably low and could be increased by better bystander cardiopulmonary resuscitation (CPR) rates. The European Resuscitation Council has announced that there will be a European Cardiac Arrest Awareness Day every year on the 16th of October. This is to coincide with the goals of the Written Declaration passed by the European Parliament in June 2012 that emphasised the importance of equal access to CPR and automated external defibrillator (AED) training. The topic of this year's Awareness Day is 'Children Saving Lives' and it is hoped that all national resuscitation councils will promote awareness of the benefits of training all children in CPR and AED use and lobby for legislative change to ensure that all children receive this training. Children are not just the adults of tomorrow - they are the lifesavers of today and tomorrow. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Mitochondrial ribosomal protein L41 mediates serum starvation-induced cell-cycle arrest through an increase of p21WAF1/CIP1

    International Nuclear Information System (INIS)

    Kim, Mi Jin; Yoo, Young A.; Kim, Hyung Jung; Kang, Seongman; Kim, Yong Geon; Kim, Jun Suk; Yoo, Young Do

    2005-01-01

    Ribosomal proteins not only act as components of the translation apparatus but also regulate cell proliferation and apoptosis. A previous study reported that MRPL41 plays an important role in p53-dependent apoptosis. It also showed that MRPL41 arrests the cell cycle by stabilizing p27 Kip1 in the absence of p53. This study found that MRPL41 mediates the p21 WAF1/CIP1 -mediated G1 arrest in response to serum starvation. The cells were released from serum starvation-induced G1 arrest via the siRNA-mediated blocking of MRPL41 expression. Overall, these results suggest that MRPL41 arrests the cell cycle by increasing the p21 WAF1/CIP1 and p27 Kip1 levels under the growth inhibitory conditions

  1. Multicenter Cohort Study of In-Hospital Pediatric Cardiac Arrest

    Science.gov (United States)

    Meert, Kathleen L.; Donaldson, Amy; Nadkarni, Vinay; Tieves, Kelly S.; Schleien, Charles L.; Brilli, Richard J.; Clark, Robert S. B.; Shaffner, D. H.; Levy, Fiona; Statler, Kimberly; Dalton, H.J.; van der Jagt, Elise W.; Hackbarth, Richard; Pretzlaff, Robert; Hernan, Lynn; Dean, J. Michael; Moler, Frank W.

    2009-01-01

    Objectives (1) Describe the clinical characteristics, hospital courses and outcomes of a cohort of children cared for within the Pediatric Emergency Care Applied Research Network (PECARN) who experienced in-hospital cardiac arrest with sustained return of circulation between July 1, 2003 and December 31, 2004, and (2) identify factors associated with hospital mortality in this population. These data are required to prepare a randomized trial of therapeutic hypothermia on neurobehavioral outcomes in children after in-hospital cardiac arrest. Design Retrospective cohort study. Setting Fifteen children’s hospitals associated with PECARN. Patients Patients between one day and 18 years of age who had cardiopulmonary resuscitation (CPR) and received chest compressions for >1 minute, and had a return of circulation for >20 minutes. Interventions None. Measurements and Main Results A total of 353 patients met entry criteria; 172 (48.7%) survived to hospital discharge. Among survivors, 132 (76.7%) had good neurological outcome documented by Pediatric Cerebral Performance Category scores. After adjustment for age, gender and first documented cardiac arrest rhythm, variables available prior to and during the arrest that were independently associated with increased mortality included pre-existing hematologic, oncologic, or immunologic disorders, genetic or metabolic disorders, presence of an endotracheal tube prior to the arrest, and the use of sodium bicarbonate during the arrest. Variables associated with decreased mortality included post-operative CPR. Extending the time frame to include variables available prior to, during, and within 12 hours following arrest, variables independently associated with increased mortality included the use of calcium during the arrest. Variables associated with decreased mortality included higher minimum blood pH and pupillary responsiveness. Conclusions Many factors are associated with hospital mortality among children after in

  2. Curcumin arrests endometriosis by downregulation of matrix metalloproteinase-9 activity.

    Science.gov (United States)

    Swarnakar, Snehasikta; Paul, Sumit

    2009-02-01

    Curcumin, a polyphenol derived from turmeric (Curcuma longa) possesses diverse pharmacological properties including antioxidant, anti-inflammatory and antiproliferative activities. Endometriosis is a gyneocological disorder characterized by growth of endometrial tissues outside uterus that involves aberrant matrix remodeling. In this study the effect of curcumin was studied on surgically developed endometriosis in mice. Endometriosis with varying severity was developed in mice by peritoneal implantation of uterine fragments. The changes in matrix metalloproteinase (MMP)-9 and tissue inhibitor of metalloprotease (TIMP)-1 were investigated in endometriotic tissues following curcumin pre- and posttreatment. Results showed that MMP-9 activity increased gradually in endometriotic tissues with severity and curcumin treatment reversed the MMP-9 activity near to control value. Curcumin administered either post- or pre-endometriosis arrested endometriosis in a dose-dependent manner. It inhibited both MMP-9 activity and its expression at the level of secretion, during regression of endometriotic lesion. In addition, the attenuated activity of MMP-9 was associated with decreased expression of tumor necrosis factor-alpha (TNF-alpha) during healing, suggesting the anti-inflammatory property of curcumin. Moreover, curcumin pretreatment prevented lipid peroxidation and protein oxidation in endometriotic tissues. We reported here for the first time the anti-endometriotic property of curcumin via MMP-9 dependent pathway that may lead to new therapeutic intervention.

  3. Sudden Cardiac Arrest during Participation in Competitive Sports.

    Science.gov (United States)

    Landry, Cameron H; Allan, Katherine S; Connelly, Kim A; Cunningham, Kris; Morrison, Laurie J; Dorian, Paul

    2017-11-16

    The incidence of sudden cardiac arrest during participation in sports activities remains unknown. Preparticipation screening programs aimed at preventing sudden cardiac arrest during sports activities are thought to be able to identify at-risk athletes; however, the efficacy of these programs remains controversial. We sought to identify all sudden cardiac arrests that occurred during participation in sports activities within a specific region of Canada and to determine their causes. In this retrospective study, we used the Rescu Epistry cardiac arrest database (which contains records of every cardiac arrest attended by paramedics in the network region) to identify all out-of-hospital cardiac arrests that occurred from 2009 through 2014 in persons 12 to 45 years of age during participation in a sport. Cases were adjudicated as sudden cardiac arrest (i.e., having a cardiac cause) or as an event resulting from a noncardiac cause, on the basis of records from multiple sources, including ambulance call reports, autopsy reports, in-hospital data, and records of direct interviews with patients or family members. Over the course of 18.5 million person-years of observation, 74 sudden cardiac arrests occurred during participation in a sport; of these, 16 occurred during competitive sports and 58 occurred during noncompetitive sports. The incidence of sudden cardiac arrest during competitive sports was 0.76 cases per 100,000 athlete-years, with 43.8% of the athletes surviving until they were discharged from the hospital. Among the competitive athletes, two deaths were attributed to hypertrophic cardiomyopathy and none to arrhythmogenic right ventricular cardiomyopathy. Three cases of sudden cardiac arrest that occurred during participation in competitive sports were determined to have been potentially identifiable if the athletes had undergone preparticipation screening. In our study involving persons who had out-of-hospital cardiac arrest, the incidence of sudden cardiac

  4. Integrated omics analyses reveal the details of metabolic adaptation of Clostridium thermocellum to lignocellulose-derived growth inhibitors released during the deconstruction of switchgrass

    Energy Technology Data Exchange (ETDEWEB)

    Poudel, Suresh [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Univ. of Tennessee, Knoxville, TN (United States); Giannone, Richard J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Rodriguez, Jr., Miguel [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Raman, Babu [Dow Chemical Company, Midland, MI (United States); Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Martin, Madhavi Z. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Engle, Nancy L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Mielenz, Jonathan R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Nookaew, Intawat [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Univ. of Arkansas, Fayetteville, AR (United States); Brown, Steven D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Univ. of Tennessee, Knoxville, TN (United States); Tschaplinski, Timothy J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Ussery, David W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Univ. of Arkansas, Fayetteville, AR (United States); Hettich, Robert L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Univ. of Tennessee, Knoxville, TN (United States)

    2017-01-10

    Clostridium thermocellum is capable of solubilizing and converting lignocellulosic biomass into ethanol. Though much of the work-to-date has centered on characterizing the organism s metabolism during growth on model cellulosic substrates, such as cellobiose, Avicel, or filter paper, it is vitally important to understand it metabolizes more complex, lignocellulosic substrates to identify relevant industrial bottlenecks that could undermine efficient biofuel production. To this end, we have examined a time course progression of C. thermocellum grown on switchgrass to assess the metabolic and protein changes that occur during the conversion of plant biomass to ethanol. The most striking feature of the metabolome was the observed accumulation of long-chain, branched fatty acids over time, implying an adaptive restructuring of C. thermocellum s cellular membrane as the culture progresses. This is likely a response to the gradual build-up of lignocellulose-derived inhibitory compounds detected as the organism deconstructs the switchgrass to access the embedded cellulose and includes 4-hydroxybenzoic acid, vanillic acid, ferulic acid, p-coumaric acid and vanillin. Corroborating the metabolomics data, proteomic analysis revealed a corresponding time-dependent increase in enzymes involved in the interconversion of branched amino acids valine, leucine and isoleucine to iso- and anteiso-fatty acid precursors. Furthermore, the metabolic accumulation of hemicellulose-derived sugars and sugar-alcohols concomitant with increased abundance of enzymes involved in C5 sugar metabolism / the pentose phosphate pathway, indicate that C. thermocellum either shifts glycolytic intermediates to alternate pathways to modulate overall carbon flux or is simply a response to C5 sugar metabolite pools that build during lignocellulose deconstruction.

  5. Sulforaphane induces cell cycle arrest by protecting RB-E2F-1 complex in epithelial ovarian cancer cells

    Directory of Open Access Journals (Sweden)

    Morris Robert

    2010-03-01

    Full Text Available Abstract Background Sulforaphane (SFN, an isothiocyanate phytochemical present predominantly in cruciferous vegetables such as brussels sprout and broccoli, is considered a promising chemo-preventive agent against cancer. In-vitro exposure to SFN appears to result in the induction of apoptosis and cell-cycle arrest in a variety of tumor types. However, the molecular mechanisms leading to the inhibition of cell cycle progression by SFN are poorly understood in epithelial ovarian cancer cells (EOC. The aim of this study is to understand the signaling mechanisms through which SFN influences the cell growth and proliferation in EOC. Results SFN at concentrations of 5 - 20 μM induced a dose-dependent suppression of growth in cell lines MDAH 2774 and SkOV-3 with an IC50 of ~8 μM after a 3 day exposure. Combination treatment with chemotherapeutic agent, paclitaxel, resulted in additive growth suppression. SFN at ~8 μM decreased growth by 40% and 20% on day 1 in MDAH 2774 and SkOV-3, respectively. Cells treated with cytotoxic concentrations of SFN have reduced cell migration and increased apoptotic cell death via an increase in Bak/Bcl-2 ratio and cleavage of procaspase-9 and poly (ADP-ribose-polymerase (PARP. Gene expression profile analysis of cell cycle regulated proteins demonstrated increased levels of tumor suppressor retinoblastoma protein (RB and decreased levels of E2F-1 transcription factor. SFN treatment resulted in G1 cell cycle arrest through down modulation of RB phosphorylation and by protecting the RB-E2F-1 complex. Conclusions SFN induces growth arrest and apoptosis in EOC cells. Inhibition of retinoblastoma (RB phosphorylation and reduction in levels of free E2F-1 appear to play an important role in EOC growth arrest.

  6. Outcomes following military traumatic cardiorespiratory arrest: A prospective observational study.

    Science.gov (United States)

    Tarmey, Nicholas T; Park, Claire L; Bartels, Oliver J; Konig, Thomas C; Mahoney, Peter F; Mellor, Adrian J

    2011-09-01

    To determine the characteristics of military traumatic cardiorespiratory arrest (TCRA), and to identify factors associated with successful resuscitation. Data was collected prospectively for adult casualties suffering TCRA presenting to a military field hospital in Helmand Province, Afghanistan between 29 November 2009 and 13 June 2010. Data was available for 52 patients meeting the inclusion criteria. The mean age (range) was 25 (18-36) years. The principal mechanism of injury was improvised explosive device (IED) explosion, the lower limbs were the most common sites of injury and exsanguination was the most common cause of arrest. Fourteen (27%) patients exhibited ROSC and four (8%) survived to discharge. All survivors achieved a good neurological recovery by Glasgow Outcome Scale. Three survivors had arrested due to exsanguination and one had arrested due to pericardial tamponade. All survivors had arrested after commencing transport to hospital and the longest duration of arrest associated with survival was 24 min. All survivors demonstrated PEA rhythms on ECG during arrest. When performed, 6/24 patients had ultrasound evidence of cardiac activity during arrest; all six with cardiac activity subsequently exhibited ROSC and two survived to hospital discharge. Overall rates of survival from military TCRA were similar to published civilian data, despite military TCRA victims presenting with high Injury Severity Scores and exsanguination due to blast and fragmentation injuries. Factors associated with successful resuscitation included arrest beginning after transport to hospital, the presence of electrical activity on ECG, and the presence of cardiac movement on ultrasound examination. Crown Copyright © 2011. Published by Elsevier Ireland Ltd. All rights reserved.

  7. Epidemiology and management of cardiac arrest: what registries are revealing.

    Science.gov (United States)

    Gräsner, Jan-Thorsten; Bossaert, Leo

    2013-09-01

    Major European institutions report cardiovascular disease (CVD) as the first cause of death in adults, with cardiac arrest and sudden death due to coronary ischaemia as the primary single cause. Global incidence of CVD is decreasing in most European countries, due to prevention, lifestyle and treatment. Mortality of acute coronary events inside the hospital decreases more rapidly than outside the hospital. To improve the mortality of cardiac arrest outside the hospital, reliable epidemiological and process figures are essential: "we can only manage what we can measure". Europe is a patchwork of 47 countries (total population of 830 million), with a 10-fold difference in incidence of coronary heart disease between North and South, East and West, and a 5-fold difference in number of EMS-treated cardiac arrest (range 17-53/1000,000/year). Epidemiology of cardiac arrest should not be calculated as a European average, but it is appropriate to describe the incidence of cardiac arrest, the resuscitation process, and the outcome in each of the European regions, for benchmarking and quality management. Epidemiological reports of cardiac arrest should specify definitions, nominator (number of cases) and denominator (study population). Recently some regional registries in North America, Japan and Europe fulfilled these conditions. The European Registry of Cardiac Arrest (EuReCa) has the potential to achieve these objectives on a pan-European scale. For operational applications, the Utstein definition of "Cardiac arrest" is used which includes the potential of survival. For application in community health, the WHO definition of "sudden death" is frequently used, describing the mode of death. There is considerable overlap between both definitions. But this explains that no single method can provide all information. Integrating data from multiple sources (local, national, multinational registries and surveys, death certificates, post-mortem reports, community statistics, medical

  8. Xanthones induce cell-cycle arrest and apoptosis in human colon cancer DLD-1 cells.

    Science.gov (United States)

    Matsumoto, Kenji; Akao, Yukihiro; Ohguchi, Kenji; Ito, Tetsuro; Tanaka, Toshiyuki; Iinuma, Munekazu; Nozawa, Yoshinori

    2005-11-01

    We investigated the antiproliferative effects of four structurally similar prenylated xanthones, alpha-mangostin, beta-mangostin, gamma-mangostin, and methoxy-beta-mangostin, in human colon cancer DLD-1 cells. These xanthones differ in the number of hydroxyl and methoxy groups. Except for methoxy-beta-mangostin, the other three xanthones strongly inhibited cell growth at 20 microM and their antitumor efficacy was correlated with the number of hydroxyl groups. Hoechst 33342 nuclear staining and nucleosomal DNA-gel electrophoresis revealed that the antiproliferative effects of alpha- and gamma-mangostin, but not that of beta-mangostin, were associated with apoptosis. It was also shown that their antiproliferative effects were associated with cell-cycle arrest by affecting the expression of cyclins, cdc2, and p27; G1 arrest was by alpha-mangostin and beta-mangostin, and S arrest by gamma-mangostin. These findings provide a relevant basis for the development of xanthones as an agent for cancer prevention and combination therapy with anti-cancer drugs.

  9. Crack-arrest behavior in SEN wide plates of low-upper-shelf base metal tested under nonisothermal conditions: WP-2 series

    International Nuclear Information System (INIS)

    Naus, D.J.; Keeney-Walker, J.; Bass, B.R.; Robinson, G.C. Jr.; Iskander, S.K.; Alexander, D.J.; Fields, R.J.; deWit, R.; Low, S.R.; Schwartz, C.W.

    1990-08-01

    The Heavy-Section Steel Technology (HSST) Program at the Oak Ridge National Laboratory under the sponsorship of the Nuclear Regulatory Commission is conducting analytical and experimental studies aimed at understanding the circumstances that would initiate the growth of an existing crack in a reactor pressure vessel (RPV) and the conditions leading to arrest of a propagating crack. Objectives of these studies are to determine (1) if the material will exhibit crack-arrest behavior when the driving force on a crack exceeds the ASME limit, (2) the relationship between K Ia and temperature, and (3) the interaction of fracture modes (arrest, stable crack growth, unstable crack growth, and tensile instability) when arrest occurs at high temperatures. In meeting these objectives, crack-arrest data are being developed over an expanded temperature range through tests involving large thermally shocked cylinders, pressurized thermally shocked vessels, and wide-plate specimens. The wide-plate specimens provide the opportunity for a significant number of data points to be obtained at relatively affordable costs. These tests are designed to provide fracture-toughness measurements approaching or above the onset of the Charpy upper-shelf regime in a rising toughness region and with an increasing driving force. This document discusses test methodology and results. 23 refs., 92 figs., 25 tabs

  10. Post-resuscitation care for survivors of cardiac arrest

    Directory of Open Access Journals (Sweden)

    Ashvarya Mangla

    2014-01-01

    Full Text Available Cardiac arrest can occur following a myriad of clinical conditions. With advancement of medical science and improvements in Emergency Medical Services systems, the rate of return of spontaneous circulation for patients who suffer an out-of-hospital cardiac arrest (OHCA continues to increase. Managing these patients is challenging and requires a structured approach including stabilization of cardiopulmonary status, early consideration of neuroprotective strategies, identifying and managing the etiology of arrest and initiating treatment to prevent recurrence. This requires a closely coordinated multidisciplinary team effort. In this article, we will review the initial management of survivors of OHCA, highlighting advances and ongoing controversies.

  11. Human papillomavirus 16E6 and NFX1-123 potentiate notch signaling and differentiation without activating cellular arrest

    Energy Technology Data Exchange (ETDEWEB)

    Vliet-Gregg, Portia A.; Hamilton, Jennifer R. [Center for Global Infectious Disease Research, Seattle Children' s Research Institute, 1900 Ninth Ave., Seattle, WA 98101 (United States); Katzenellenbogen, Rachel A., E-mail: rkatzen@uw.edu [Center for Global Infectious Disease Research, Seattle Children' s Research Institute, 1900 Ninth Ave., Seattle, WA 98101 (United States); Department of Pediatrics, Division of Adolescent Medicine, University of Washington, Seattle WA (United States)

    2015-04-15

    High-risk human papillomavirus (HR HPV) oncoproteins bind host cell proteins to dysregulate and uncouple apoptosis, senescence, differentiation, and growth. These pathways are important for both the viral life cycle and cancer development. HR HPV16 E6 (16E6) interacts with the cellular protein NFX1-123, and they collaboratively increase the growth and differentiation master regulator, Notch1. In 16E6 expressing keratinocytes (16E6 HFKs), the Notch canonical pathway genes Hes1 and Hes5 were increased with overexpression of NFX1-123, and their expression was directly linked to the activation or blockade of the Notch1 receptor. Keratinocyte differentiation genes Keratin 1 and Keratin 10 were also increased, but in contrast their upregulation was only indirectly associated with Notch1 receptor stimulation and was fully unlinked to growth arrest, increased p21{sup Waf1/CIP1}, or decreased proliferative factor Ki67. This leads to a model of 16E6, NFX1-123, and Notch1 differently regulating canonical and differentiation pathways and entirely uncoupling cellular arrest from increased differentiation. - Highlights: • 16E6 and NFX1-123 increased the Notch canonical pathway through Notch1. • 16E6 and NFX1-123 increased the differentiation pathway indirectly through Notch1. • 16E6 and NFX1-123 increased differentiation gene expression without growth arrest. • Increased NFX1-123 with 16E6 may create an ideal cellular phenotype for HPV.

  12. Arresting dissolution by interfacial rheology design

    Science.gov (United States)

    Beltramo, Peter J.; Gupta, Manish; Alicke, Alexandra; Liascukiene, Irma; Gunes, Deniz Z.; Baroud, Charles N.

    2017-01-01

    A strategy to halt dissolution of particle-coated air bubbles in water based on interfacial rheology design is presented. Whereas previously a dense monolayer was believed to be required for such an “armored bubble” to resist dissolution, in fact engineering a 2D yield stress interface suffices to achieve such performance at submonolayer particle coverages. We use a suite of interfacial rheology techniques to characterize spherical and ellipsoidal particles at an air–water interface as a function of surface coverage. Bubbles with varying particle coverages are made and their resistance to dissolution evaluated using a microfluidic technique. Whereas a bare bubble only has a single pressure at which a given radius is stable, we find a range of pressures over which bubble dissolution is arrested for armored bubbles. The link between interfacial rheology and macroscopic dissolution of ∼ 100 μm bubbles coated with ∼ 1 μm particles is presented and discussed. The generic design rationale is confirmed by using nonspherical particles, which develop significant yield stress at even lower surface coverages. Hence, it can be applied to successfully inhibit Ostwald ripening in a multitude of foam and emulsion applications. PMID:28893993

  13. Cardiac Arrest in Pediatric Patients Receiving Azithromycin.

    Science.gov (United States)

    Valdés, Santiago O; Kim, Jeffrey J; Niu, Mary C; de la Uz, Caridad M; Miyake, Christina Y; Moffett, Brady S

    2017-03-01

    To compare outcomes of pediatric patients treated with azithromycin compared with penicillin or cephalosporin. We hypothesized that azithromycin use would not be associated with increased cardiac mortality in the pediatric population. Retrospective cohort study from the Pediatric Health Information System database between 2008 and 2012. Patients Azithromycin was used in 5039 (6.1%); penicillin or cephalosporin was used in 77 943 (93.9%). Overall prevalence of antibiotic-associated CPR was 0.14%. Patients receiving a macrolide antibiotic had a lower prevalence of CPR compared with patients receiving a penicillin or cephalosporin (0.04% vs 0.14%, P = .04), and there was no difference in mortality. Multivariable analysis did not find an association between macrolide use and CPR. In contrast to recent adult studies, among children hospitalized for community-acquired pneumonia, azithromycin use was not associated with a greater prevalence of cardiac arrest compared with penicillin or cephalosporin use. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Effects of viscosity on cerebral blood flow after cardiac arrest

    NARCIS (Netherlands)

    Bisschops, L.L.A.; Pop, G.A.M.; Teerenstra, S.; Struijk, P.C.; Hoeven, J.G. van der; Hoedemaekers, C.W.E.

    2014-01-01

    OBJECTIVES: To determine blood viscosity in adult comatose patients treated with mild therapeutic hypothermia after cardiac arrest and to assess the relation between blood viscosity, cerebral blood flow, and cerebral oxygen extraction. DESIGN: Observational study. SETTING: Tertiary care university

  15. Therapeutic hypothermia in the treatment of cardiorespiratory arrest.

    Science.gov (United States)

    Fenwick, Rob

    2010-02-01

    Prompt treatment of patients with cardiorespiratory arrest can mean the difference between life and death. This article analyses the use of therapeutic hypothermia and aims to educate practitioners about its advantages and disadvantages as an immediate treatment.

  16. Endothelial Dysfunction in Resuscitated Cardiac Arrest (ENDO-RCA)

    DEFF Research Database (Denmark)

    Meyer, Anna Sina P; Ostrowski, Sisse Rye; Kjærgaard, Jesper

    2016-01-01

    BACKGROUND: Morbidity and mortality following initial survival of cardiac arrest remain high despite great efforts to improve resuscitation techniques and post-resuscitation care, in part due to the ischemia-reperfusion injury secondary to the restoration of the blood circulation. Patients...... resuscitated from cardiac arrest display evidence of endothelial injury and coagulopathy (hypocoagulability, hyperfibrinolysis), which in associated with poor outcome. Recent randomized controlled trials have revealed that treatment with infusion of prostacyclin reduces endothelial damage after major surgery...... and AMI. Thus, a study is pertinent to investigate if prostacyclin infusion as a therapeutic intervention reduces endothelial damage without compromising, or even improving, the hemostatic competence in resuscitated cardiac arrest patients. Post-cardiac arrest patients frequently have a need...

  17. Arrest of cytoplasmic streaming induces algal proliferation in green paramecia.

    Directory of Open Access Journals (Sweden)

    Toshiyuki Takahashi

    Full Text Available A green ciliate Paramecium bursaria, bearing several hundreds of endosymbiotic algae, demonstrates rotational microtubule-based cytoplasmic streaming, in which cytoplasmic granules and endosymbiotic algae flow in a constant direction. However, its physiological significance is still unknown. We investigated physiological roles of cytoplasmic streaming in P. bursaria through host cell cycle using video-microscopy. Here, we found that cytoplasmic streaming was arrested in dividing green paramecia and the endosymbiotic algae proliferated only during the arrest of cytoplasmic streaming. Interestingly, arrest of cytoplasmic streaming with pressure or a microtubule drug also induced proliferation of endosymbiotic algae independently of host cell cycle. Thus, cytoplasmic streaming may control the algal proliferation in P. bursaria. Furthermore, confocal microscopic observation revealed that a division septum was formed in the constricted area of a dividing paramecium, producing arrest of cytoplasmic streaming. This is a first report to suggest that cytoplasmic streaming controls proliferation of eukaryotic cells.

  18. Early myoclonic status and outcome after cardiorespiratory arrest

    OpenAIRE

    Morris, H; Howard, R; Brown, P

    1998-01-01

    It has been suggested that early myoclonic status after cardiorespiratory arrest is an agonal event.1 Here we describe three cases who developed early myoclonic status during a coma after cardiorespiratory arrest due to acute asthma. As consciousness improved, each patient developed Lance-Adams type multifocal myoclonus, but the eventual outcome was satisfactory. Only one patient needed assistance to walk, and all three were self caring. One patient had persistent dyscalc...

  19. Dynamic propagation and cleavage crack arrest in bainitic steel

    International Nuclear Information System (INIS)

    Hajjaj, M.

    2006-06-01

    In complement of the studies of harmfulness of defects, generally realized in term of initiation, the concept of crack arrest could be used as complementary analyses to the studies of safety. The stop occurs when the stress intensity factor becomes lower than crack arrest toughness (KIa) calculated in elasto-statics (KI ≤ KIa). The aim of this thesis is to understand and predict the stop of a crack propagating at high speed in a 18MND5 steel used in the pressure water reactor (PWR). The test chosen to study crack arrest is the disc thermal shock test. The observations under the scanning electron microscope of the fracture surface showed that the crack arrest always occurs in cleavage mode and that the critical microstructural entity with respect to the propagation and crack arrest corresponds to at least the size of the prior austenitic grain. The numerical analyses in elasto-statics confirm the conservatism of the codified curve of the RCC-M with respect to the values of KIa. The dynamic numerical analyses show that the deceleration of the crack measured at the end of the propagation is related to the global dynamic of the structure (vibrations). The transferability to components of crack arrest toughness obtained from tests analysed in static is thus not assured. The disc thermal shock tests were also modelled by considering a criterion of propagation and arrest of the type 'RKR' characterized by a critical stress sc which depends on the temperature. The results obtained account well for the crack jump measured in experiments as well as the shape of the crack arrest front. (author)

  20. Al-Qaeda arrest casts shadow over the LHC

    CERN Document Server

    Dacey, James

    2010-01-01

    "Cern remains on course for the imminent switch-on of the Large Hadron Collider (LHC) despite the media frenzy following the recent arrest of a physicist who had been working at the facility. The researcher in question is a 32-year-old man of Algerian descent who is expected to face trail in France - the country in which he was arrested" (0.5 page)

  1. Structural basis of RNA polymerase II backtracking, arrest and reactivation.

    Science.gov (United States)

    Cheung, Alan C M; Cramer, Patrick

    2011-03-10

    During gene transcription, RNA polymerase (Pol) II moves forwards along DNA and synthesizes messenger RNA. However, at certain DNA sequences, Pol II moves backwards, and such backtracking can arrest transcription. Arrested Pol II is reactivated by transcription factor IIS (TFIIS), which induces RNA cleavage that is required for cell viability. Pol II arrest and reactivation are involved in transcription through nucleosomes and in promoter-proximal gene regulation. Here we present X-ray structures at 3.3 Å resolution of an arrested Saccharomyces cerevisiae Pol II complex with DNA and RNA, and of a reactivation intermediate that additionally contains TFIIS. In the arrested complex, eight nucleotides of backtracked RNA bind a conserved 'backtrack site' in the Pol II pore and funnel, trapping the active centre trigger loop and inhibiting mRNA elongation. In the reactivation intermediate, TFIIS locks the trigger loop away from backtracked RNA, displaces RNA from the backtrack site, and complements the polymerase active site with a basic and two acidic residues that may catalyse proton transfers during RNA cleavage. The active site is demarcated from the backtrack site by a 'gating tyrosine' residue that probably delimits backtracking. These results establish the structural basis of Pol II backtracking, arrest and reactivation, and provide a framework for analysing gene regulation during transcription elongation.

  2. Outcome of out-of-hospital cardiorespiratory arrest in children.

    Science.gov (United States)

    López-Herce, Jesús; García, Cristina; Domínguez, Pedro; Rodríguez-Núñez, Antonio; Carrillo, Angel; Calvo, Custodio; Delgado, Miguel Angel

    2005-12-01

    To analyze the characteristics and outcome of out-of-hospital cardiorespiratory arrest in children in Spain. Secondary analysis of data from a prospective, multicenter study analyzing cardiorespiratory arrest in children. Ninety-five children between 7 days and 16 years with cardiorespiratory arrest. Data were recorded according to the Utstein style. The outcome variables were the sustained return of spontaneous circulation (initial survival), and survival at 1 year (final survival). Neurologic and general performance outcome was assessed by the Pediatric Cerebral Performance Category (PCPC) scale and the Pediatric Overall Performance Category (POPC) scale. Initial survival was 47.3% and 1-year survival was 26.4%. Mortality was higher in children younger than 1 year. Survival of patients with respiratory arrest (82.1%) was significantly higher than survival of cardiac arrest victims (14.4%). Patients who were initially resuscitated by laypersons or paramedics had higher survival (53.6%) than those who were initially resuscitated by doctors and/or nurses (15.2%) (P cardiorespiratory arrest in children is high. When resuscitation is started soon by layperson or paramedics, survival is increased. Duration of resuscitation efforts is the best indicator of mortality. Most of survivors had good long-term neurologic outcome.

  3. Respiratory Arrest in an Obese Pregnant Woman with Hyperemesis Gravidarum

    Directory of Open Access Journals (Sweden)

    Ayumi Iwashita

    2015-01-01

    Full Text Available A pregnant, non-Japanese-speaking Peruvian, and, thus, with communication difficulty, suffered hyperemesis gravidarum and had respiratory arrest, requiring cardiopulmonary resuscitation. The obese pregnant woman (prepregnancy weight: 107 kg had vomited and lost 15 kg in bodyweight over appropriately 2 weeks prior to the arrest but had not complained due to communication difficulty, which, together with her obesity, prevented a Japanese obstetrician from noticing her severe condition. 1,000 mL of low potassium fluid plus thiamine was administered. She became unable to stand, suggesting lower-extremity-proximal-muscle weakness, and then respiratory arrest occurred. Hypopotassemia (2.3 mEq/L, pulseless electrical activity, and muscle weakness suggested the presence of severe potassium deficiency, which may have caused respiratory muscle paralysis, leading to the respiratory arrest. Hypercapnea was severer than expected for compensatory hypoventilation, indicating the presence of concomitant severe hypoventilation, which may also have contributed to respiratory arrest. She recovered with electrolyte and volume replacement. Respiratory arrest can occur with hyperemesis gravidarum, and obesity and communication difficulties can prevent the early detection of severe conditions.

  4. Cardiac arrest due to lymphocytic colitis: a case report

    Directory of Open Access Journals (Sweden)

    Groth Kristian A

    2012-03-01

    Full Text Available Abstract Introduction We present a case of cardiac arrest due to hypokalemia caused by lymphocytic colitis. Case presentation A 69-year-old Caucasian man presented four months prior to a cardiac arrest with watery diarrhea and was diagnosed with lymphocytic colitis. Our patient experienced a witnessed cardiac arrest at his general practitioner's surgery. Two physicians and the emergency medical services resuscitated our patient for one hour and four minutes before arriving at our university hospital. Our patient was defibrillated 16 times due to the recurrence of ventricular tachyarrhythmias. An arterial blood sample revealed a potassium level of 2.0 mmol/L (reference range: 3.5 to 4.6 mmol/L and pH 6.86 (reference range: pH 7.37 to 7.45. As the potassium level was corrected, the propensity for ventricular tachyarrhythmias ceased. Our patient recovered from his cardiac arrest without any neurological deficit. Further tests and examinations revealed no other reason for the cardiac arrest. Conclusion Diarrhea can cause life-threatening situations due to the excretion of potassium, ultimately causing cardiac arrest due to hypokalemia. Physicians treating patients with severe diarrhea should consider monitoring their electrolyte levels.

  5. Use of Adaptive Laboratory Evolution To Discover Key Mutations Enabling Rapid Growth of Escherichia coli K-12 MG1655 on Glucose Minimal Medium

    DEFF Research Database (Denmark)

    LaCroix, Ryan A.; Sandberg, Troy E.; O'Brien, Edward J.

    2015-01-01

    Adaptive laboratory evolution (ALE) has emerged as an effective tool for scientific discovery and addressing biotechnological needs. Much of ALE's utility is derived from reproducibly obtained fitness increases. Identifying causal genetic changes and their combinatorial effects is challenging and...

  6. Role of the retinoblastoma protein in cell cycle arrest mediated by a novel cell surface proliferation inhibitor

    Science.gov (United States)

    Enebo, D. J.; Fattaey, H. K.; Moos, P. J.; Johnson, T. C.; Spooner, B. S. (Principal Investigator)

    1994-01-01

    A novel cell regulatory sialoglycopeptide (CeReS-18), purified from the cell surface of bovine cerebral cortex cells has been shown to be a potent and reversible inhibitor of proliferation of a wide array of fibroblasts as well as epithelial-like cells and nontransformed and transformed cells. To investigate the possible mechanisms by which CeReS-18 exerts its inhibitory action, the effect of the inhibitor on the posttranslational regulation of the retinoblastoma susceptibility gene product (RB), a tumor suppressor gene, has been examined. It is shown that CeReS-18 mediated cell cycle arrest of both human diploid fibroblasts (HSBP) and mouse fibroblasts (Swiss 3T3) results in the maintenance of the RB protein in the hypophosphorylated state, consistent with a late G1 arrest site. Although their normal nontransformed counterparts are sensitive to cell cycle arrest mediated by CeReS-18, cell lines lacking a functional RB protein, through either genetic mutation or DNA tumor virus oncoprotein interaction, are less sensitive. The refractory nature of these cells is shown to be independent of specific surface receptors for the inhibitor, and another tumor suppressor gene (p53) does not appear to be involved in the CeReS-18 inhibition of cell proliferation. The requirement for a functional RB protein product, in order for CeReS-18 to mediate cell cycle arrest, is discussed in light of regulatory events associated with density-dependent growth inhibition.

  7. Galiellalactone induces cell cycle arrest and apoptosis through the ATM/ATR pathway in prostate cancer cells.

    Science.gov (United States)

    García, Víctor; Lara-Chica, Maribel; Cantarero, Irene; Sterner, Olov; Calzado, Marco A; Muñoz, Eduardo

    2016-01-26

    Galiellalactone (GL) is a fungal metabolite that presents antitumor activities on prostate cancer in vitro and in vivo. In this study we show that GL induced cell cycle arrest in G2/M phase, caspase-dependent apoptosis and also affected the microtubule organization and migration ability in DU145 cells. GL did not induce double strand DNA break but activated the ATR and ATM-mediated DNA damage response (DDR) inducing CHK1, H2AX phosphorylation (fH2AX) and CDC25C downregulation. Inhibition of the ATM/ATR activation with caffeine reverted GL-induced G2/M cell cycle arrest, apoptosis and DNA damage measured by fH2AX. In contrast, UCN-01, a CHK1 inhibitor, prevented GL-induced cell cycle arrest but enhanced apoptosis in DU145 cells. Furthermore, we found that GL did not increase the levels of intracellular ROS, but the antioxidant N-acetylcysteine (NAC) completely prevented the effects of GL on fH2AX, G2/M cell cycle arrest and apoptosis. In contrast to NAC, other antioxidants such as ambroxol and EGCG did not interfere with the activity of GL on cell cycle. GL significantly suppressed DU145 xenograft growth in vivo and induced the expression of fH2AX in the tumors. These findings identify for the first time that GL activates DDR in prostate cancer.

  8. Premature Growth Plate Closure in a Ballet Dancer en Pointe.

    Science.gov (United States)

    Shah, Selina

    2017-09-01

    A 13-year-old ballet dancer who had been dancing en pointe (on the tips of the toes) since 10 years presented to the clinic with a shortened right second toe. She had no previous history of pain or trauma. She was diagnosed with premature growth arrest of the second metatarsal head physes resulting in a shortened metatarsal. This is the first reported case of premature growth arrest in a ballet dancer as a result of dancing en pointe.

  9. The Lightning Performance of Overhead Distribution Line Installed Mov and Clah Surge Arresters

    Science.gov (United States)

    Thanasaksiri, T.

    2008-10-01

    This paper compares the lightning performance of overhead distribution line which installed two arrester types, metal oxide varistor (MOV) and current limiting arcing horn (CLAH). The performance of line which related to the insulator flashover, with and without arresters installed, has been modeled and analyzed using EMTP. The MOV arrester type gives better line lightning performance. The relatively wide arrester spacings will reduce the lightning performance. The arrester leads should be kept as short as possible.

  10. Effect of early experience and adaptation period on voluntary intake, digestion, and growth in Barbarine lambs given tannin-containing (Acacia cyanophylla Lindl. foliage) or tannin-free (oaten hay) diets

    Energy Technology Data Exchange (ETDEWEB)

    Ben Salem, H. [Institut National de la Recherche Agronomique de Tunisie, Laboratoire des Productions Animales et Fourrageres, Ariana (Tunisia)]. E-mail: bensalem.hichem@iresa.agrinet.tn; Nefzaouia, A.; Ben Salem, I. [Institut National de la Recherche Agronomique de Tunisie, Laboratoire des Productions Animales et Fourrageres, Ariana (Tunisia); Makkar, H.P.S. [Animal Production and Health Section, Joint FAO/IAEA Division, International Atomic Energy Agency, Vienna (Austria); Hochlef, H. [Institut National de la Recherche Agronomique de Tunisie, Laboratoire des Productions Animales et Fourrageres, Ariana (Tunisia); Ecole Superieure d' Agriculture de Mateur, Mateur (Tunisia); Ben Salem, L. [Office de l' Elevage et des Paturages, Tunis (Tunisia)

    2005-08-19

    Our objective was to determine whether experience early in life and adaptation time (up to 72 days) to tannin-rich diets affect feed intake, digestion, nitrogen balance, and growth in Barbarine lambs given tannin-containing (Acacia cyanophylla Lindl., acacia) or tannin-free (oaten hay) diets later in life. Twelve experienced lambs (live-weight, LW: 13.2 {+-} 2.0 kg) were divided into two equal groups. Each group received air-dried acacia (tannin-containing diet) or oaten hay (hay, tannin free-diet) ad libitum. Twelve other inexperienced lambs (LW 12.3 {+-} 2.5 kg) were also divided into two equal groups. Each group received one of the above two diets. All animals were 4 months old at the start of this experiment and were supplemented with 300 g concentrate. To investigate the carry-over effect of tannins, the acacia-diet was removed on day 73, thus all lambs received thereafter the hay-diet for a further 24 days before starting a 6-day faecal collection period. Irrespective to early experience and adaptation time, the nutritive value of hay-diet was higher than that of acacia-diet and consequently lambs given hay performed better than those receiving acacia (P = 0.0001). Animals exposed to tannins early in life exhibited higher digestible crude protein intake (P = 0.0389), retained more N (P = 0.0963) and excreted more allantoin in urine (P = 0.0248) than the inexperienced lambs. Except plasma urea (P = 0.2923), the adaptation period to experimental diets affected significantly all measured parameters (P 0.0001). Animals adapted to diets for only 6 days exhibited the lowest acacia or hay intake and the highest diet digestibility compared to those adapted to these diets for 24, 48 or 72 days. Weight losses of inexperienced lambs adapted to acacia-diet for 6 days were associated with negative nitrogen balance. Sheep which received the acacia-diet, followed by the hay diet, had similar hay intake, diet digestibility, N balance and growth rate as compared to those

  11. Effect of early experience and adaptation period on voluntary intake, digestion, and growth in Barbarine lambs given tannin-containing (Acacia cyanophylla Lindl. foliage) or tannin-free (oaten hay) diets

    International Nuclear Information System (INIS)

    Ben Salem, H.; Nefzaouia, A.; Ben Salem, I.; Makkar, H.P.S.; Hochlef, H.; Ben Salem, L.

    2005-01-01

    Our objective was to determine whether experience early in life and adaptation time (up to 72 days) to tannin-rich diets affect feed intake, digestion, nitrogen balance, and growth in Barbarine lambs given tannin-containing (Acacia cyanophylla Lindl., acacia) or tannin-free (oaten hay) diets later in life. Twelve experienced lambs (live-weight, LW: 13.2 ± 2.0 kg) were divided into two equal groups. Each group received air-dried acacia (tannin-containing diet) or oaten hay (hay, tannin free-diet) ad libitum. Twelve other inexperienced lambs (LW 12.3 ± 2.5 kg) were also divided into two equal groups. Each group received one of the above two diets. All animals were 4 months old at the start of this experiment and were supplemented with 300 g concentrate. To investigate the carry-over effect of tannins, the acacia-diet was removed on day 73, thus all lambs received thereafter the hay-diet for a further 24 days before starting a 6-day faecal collection period. Irrespective to early experience and adaptation time, the nutritive value of hay-diet was higher than that of acacia-diet and consequently lambs given hay performed better than those receiving acacia (P = 0.0001). Animals exposed to tannins early in life exhibited higher digestible crude protein intake (P = 0.0389), retained more N (P = 0.0963) and excreted more allantoin in urine (P = 0.0248) than the inexperienced lambs. Except plasma urea (P = 0.2923), the adaptation period to experimental diets affected significantly all measured parameters (P 0.0001). Animals adapted to diets for only 6 days exhibited the lowest acacia or hay intake and the highest diet digestibility compared to those adapted to these diets for 24, 48 or 72 days. Weight losses of inexperienced lambs adapted to acacia-diet for 6 days were associated with negative nitrogen balance. Sheep which received the acacia-diet, followed by the hay diet, had similar hay intake, diet digestibility, N balance and growth rate as compared to those offered

  12. Does infill outperform climate-adaptive growth policies in meeting sustainable urbanization goals? : A scenario-based study in California, USA

    NARCIS (Netherlands)

    Thorne, James; Ferreira Dos Santos, M.J.; Bjorkman, Jacquelyn H.; Soong, O; Ikegami, M; Seo, C; Hannah, Lee

    Land allocation for urban growth is central to sustainable development strategy because urban growth can impact space available for food production, ecosystem services and biodiversity conservation. Urbanization is a growing stressor due the 2.5 billion additional people projected to live in urban

  13. Salidroside induces cell-cycle arrest and apoptosis in human breast cancer cells

    International Nuclear Information System (INIS)

    Hu, Xiaolan; Zhang, Xianqi; Qiu, Shuifeng; Yu, Daihua; Lin, Shuxin

    2010-01-01

    Research highlights: → Salidroside inhibits the growth of human breast cancer cells. → Salidroside induces cell-cycle arrest of human breast cancer cells. → Salidroside induces apoptosis of human breast cancer cell lines. -- Abstract: Recently, salidroside (p-hydroxyphenethyl-β-D-glucoside) has been identified as one of the most potent compounds isolated from plants of the Rhodiola genus used widely in traditional Chinese medicine, but pharmacokinetic data on the compound are unavailable. We were the first to report the cytotoxic effects of salidroside on cancer cell lines derived from different tissues, and we found that human breast cancer MDA-MB-231 cells (estrogen receptor negative) were sensitive to the inhibitory action of low-concentration salidroside. To further investigate the cytotoxic effects of salidroside on breast cancer cells and reveal possible ER-related differences in response to salidroside, we used MDA-MB-231 cells and MCF-7 cells (estrogen receptor-positive) as models to study possible molecular mechanisms; we evaluated the effects of salidroside on cell growth characteristics, such as proliferation, cell cycle duration, and apoptosis, and on the expression of apoptosis-related molecules. Our results demonstrated for the first time that salidroside induces cell-cycle arrest and apoptosis in human breast cancer cells and may be a promising candidate for breast cancer treatment.

  14. Salidroside induces cell-cycle arrest and apoptosis in human breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Xiaolan, E-mail: huxiaolan1998@yahoo.com.cn [Department of Pathology and Pathophysiology, Zhejiang University School of Medicine, Hangzhou (China); Zhang, Xianqi [The 2nd Affiliated Hospital of Zhejiang University School of Medicine, Hangzhou (China); Qiu, Shuifeng [Department of Pathology and Pathophysiology, Zhejiang University School of Medicine, Hangzhou (China); Yu, Daihua; Lin, Shuxin [Fourth Military Medical University, Xi' an (China)

    2010-07-16

    Research highlights: {yields} Salidroside inhibits the growth of human breast cancer cells. {yields} Salidroside induces cell-cycle arrest of human breast cancer cells. {yields} Salidroside induces apoptosis of human breast cancer cell lines. -- Abstract: Recently, salidroside (p-hydroxyphenethyl-{beta}-D-glucoside) has been identified as one of the most potent compounds isolated from plants of the Rhodiola genus used widely in traditional Chinese medicine, but pharmacokinetic data on the compound are unavailable. We were the first to report the cytotoxic effects of salidroside on cancer cell lines derived from different tissues, and we found that human breast cancer MDA-MB-231 cells (estrogen receptor negative) were sensitive to the inhibitory action of low-concentration salidroside. To further investigate the cytotoxic effects of salidroside on breast cancer cells and reveal possible ER-related differences in response to salidroside, we used MDA-MB-231 cells and MCF-7 cells (estrogen receptor-positive) as models to study possible molecular mechanisms; we evaluated the effects of salidroside on cell growth characteristics, such as proliferation, cell cycle duration, and apoptosis, and on the expression of apoptosis-related molecules. Our results demonstrated for the first time that salidroside induces cell-cycle arrest and apoptosis in human breast cancer cells and may be a promising candidate for breast cancer treatment.

  15. Climate Degradation and Extreme Icing Events Constrain Life in Cold-Adapted Mammals.

    Science.gov (United States)

    Berger, J; Hartway, C; Gruzdev, A; Johnson, M

    2018-01-18

    Despite the growth in knowledge about the effects of a warming Arctic on its cold-adapted species, the mechanisms by which these changes affect animal populations remain poorly understood. Increasing temperatures, declining sea ice and altered wind and precipitation patterns all may affect the fitness and abundance of species through multiple direct and indirect pathways. Here we demonstrate previously unknown effects of rain-on-snow (ROS) events, winter precipitation, and ice tidal surges on the Arctic's largest land mammal. Using novel field data across seven years and three Alaskan and Russian sites, we show arrested skeletal growth in juvenile muskoxen resulting from unusually dry winter conditions and gestational ROS events, with the inhibitory effects on growth from ROS events lasting up to three years post-partum. Further, we describe the simultaneous entombment of 52 muskoxen in ice during a Chukchi Sea winter tsunami (ivuniq in Iñupiat), and link rapid freezing to entrapment of Arctic whales and otters. Our results illustrate how once unusual, but increasingly frequent Arctic weather events affect some cold-adapted mammals, and suggest that an understanding of species responses to a changing Arctic can be enhanced by coalescing groundwork, rare events, and insights from local people.

  16. Relationship between growth and standard metabolic rate: measurement artefacts and implications for habitat use and life-history adaptation in salmonids.

    Science.gov (United States)

    Rosenfeld, Jordan; Van Leeuwen, Travis; Richards, Jeffrey; Allen, David

    2015-01-01

    Mass-specific standard metabolic rate (SMR, or maintenance metabolism) varies greatly among individuals. Metabolism is particularly sensitive to variation in food consumption and growth creating the potential for significant bias in measured SMR for animals that are growing (e.g. juveniles) or of uncertain nutritional status. Consequently, interpreting individual variation in metabolism requires a sound understanding of the potentially confounding role of growth and the relative importance of fixed (genetic) vs. environmental drivers of SMR variation. We review the role of growth in measured SMR variation in juvenile salmonids, with the goals of (i) understanding the contribution of growth (and food consumption) to SMR variation through ontogeny, (ii) understanding the relative contributions of tissue maintenance and biosynthesis (overhead costs of growth) to apparent SMR variation, and (iii) using intrinsic growth effects on SMR to model how alternate life-history strategies may influence growth and measured SMR in juvenile salmonids. SMR measures on juveniles, even when post-absorptive, may be inflated by delayed growth-associated overhead costs, unless juveniles are on a maintenance ration (i.e. not growing). Empirical measurements of apparent SMR in food restricted vs. satiated 2-5 g juvenile salmon demonstrate that estimates may be inflated by as much as 67% due to delayed overhead costs of growth, even when SMR measurements are taken 35 h post-feeding. These results indicate that a substantial component of variation in apparent SMR among juvenile salmonids may be associated with (i) environmentally driven variation in ration (where elevated SMR measurements are an artefact of delayed growth overhead costs), (ii) intrinsic (genetic) or plastic organ-system trade-offs related to increasing investment in metabolically expensive digestive tissue responsible for processing food and (iii) intrinsic (genetic) variation in maximum body size and growth among

  17. Cranial computed tomography in the resuscitated patient with cardiac arrest.

    Science.gov (United States)

    Naples, Robin; Ellison, Elizabeth; Brady, William J

    2009-01-01

    The incidence of out-of-hospital and in-hospital cardiorespiratory arrest from all causes in the United States occurs not infrequently. Postresuscitation care should include the identification of the inciting arrest event as well as therapy tailored to support the patient and treat the primary cause of the decompensation. The application of one particular testing modality, cranial computed tomography (CT) of the head, has not yet been determined. We undertook an evaluation of the use of head CT in patients who were resuscitated from cardiac arrest. Prehospital (emergency medical services), ED, and hospital records were reviewed for patients of all ages with cardiorespiratory arrest over a 4-year period (July 1996-June 2000). Information regarding diagnosis, management, and outcome was recorded. The results of cranial CT, if performed, and any apparent resulting therapeutic changes were recorded. Patients with a known traumatic mechanism for the cardiorespiratory arrest were excluded. A total of 454 patients (mean age 58.3 years with 60% male) with cardiorespiratory arrest were entered in the study with 98 (22%) individuals (mean age 58.5 years with 53% male) undergoing cranial CT. Arrest location was as follows: emergency medical services, 41 (42%); ED, 11 (11%); and hospital, 46 (47%). Seventy-eight (79%) patients demonstrated 111 CT abnormalities: edema, 35 (32%); atrophy, 24 (22%); extra-axial hemorrhage, 14 (13%); old infarct, 12 (11%); new infarct, 11 (10%); intraparenchymal hemorrhage, 6 (5%); skull fracture, 5 (4%); mass, 3 (2%); and foreign body, 1 (1%). Therapeutic and diagnostic alterations in care were made in 38 (39%) patients-35 abnormal and 3 normal CTs. The following alterations occurred: medication administration, 26; withdrawal of life support, 7; additional diagnostic study, 6; neurologic consultation, 6; and intracranial pressure monitoring. 4. No patient survived to discharge. In this subset of resuscitated patients with cardiac arrest

  18. Visualizing Vpr-induced G2 arrest and apoptosis.

    Directory of Open Access Journals (Sweden)

    Tomoyuki Murakami

    Full Text Available Vpr is an accessory protein of human immunodeficiency virus type 1 (HIV-1 with multiple functions. The induction of G2 arrest by Vpr plays a particularly important role in efficient viral replication because the transcriptional activity of the HIV-1 long terminal repeat is most active in G2 phase. The regulation of apoptosis by Vpr is also important for immune suppression and pathogenesis during HIV infection. However, it is not known whether Vpr-induced apoptosis depends on the ability of Vpr to induce G2 arrest, and the dynamics of Vpr-induced G2 arrest and apoptosis have not been visualized. We performed time-lapse imaging to examine the temporal relationship between Vpr-induced G2 arrest and apoptosis using HeLa cells containing the fluorescent ubiquitination-based cell cycle indicator2 (Fucci2. The dynamics of G2 arrest and subsequent long-term mitotic cell rounding in cells transfected with the Vpr-expression vector were visualized. These cells underwent nuclear mis-segregation after prolonged mitotic processes and then entered G1 phase. Some cells subsequently displayed evidence of apoptosis after prolonged mitotic processes and nuclear mis-segregation. Interestingly, Vpr-induced apoptosis was seldom observed in S or G2 phase. Likewise, visualization of synchronized HeLa/Fucci2 cells infected with an adenoviral vector expressing Vpr clearly showed that Vpr arrests the cell cycle at G2 phase, but does not induce apoptosis at S or G2 phase. Furthermore, time-lapse imaging of HeLa/Fucci2 cells expressing SCAT3.1, a caspase-3-sensitive fusion protein, clearly demonstrated that Vpr induces caspase-3-dependent apoptosis. Finally, to examine whether the effects of Vpr on G2 arrest and apoptosis were reversible, we performed live-cell imaging of a destabilizing domain fusion Vpr, which enabled rapid stabilization and destabilization by Shield1. The effects of Vpr on G2 arrest and subsequent apoptosis were reversible. This study is the first to

  19. [Definitions and prevention of cardiorespiratory arrest in children].

    Science.gov (United States)

    Carrillo Alvarez, A; López-Herce Cid, J

    2006-08-01

    In cardiopulmonary resuscitation ages are divided in neonates (in the inmediate period after the birth), infant (from birth to 12 months) and child (from 12 months to puberty). Respiratory arrest is defined by the absence of spontaneous respiration (apnea) or a severe respiratory insufficiency (agonal gasping) that require respiratory assistance. Cardiac arrest is defined as the absence of central arterial pulse or signs of circulation (movement, cough or normal breathing) or the presence of a central pulse less than 60 lpm in a child who does not respond, not breath and with poor perfusion. After resuscitation the return of spontaneous circulation is defined as the recuperation of central arterial pulse or signs of circulation in a child with previous cardiorespiratory arrest. It is maintained when the duration is longer than 20 minutes. Injuries, sudden infant death syndrome, and respiratory diseases are the most frequent etiologies of cardiorrespiratory arrest in children. The prevention and the formation of citizens in basic cardiopulmonary resuscitation are the most effective measures to reduce the mortality of cardiorespiratory arrest in children.

  20. Serum tau and neurological outcome in cardiac arrest

    DEFF Research Database (Denmark)

    Mattsson, Niklas; Zetterberg, Henrik; Nielsen, Niklas

    2017-01-01

    OBJECTIVE: To test serum tau as a predictor of neurological outcome after cardiac arrest. METHODS: We measured the neuronal protein tau in serum at 24, 48, and 72 hours after cardiac arrest in 689 patients in the prospective international Target Temperature Management trial. The main outcome...... was poor neurological outcome, defined as Cerebral Performance Categories 3-5 at 6 months. RESULTS: Increased tau was associated with poor outcome at 6 months after cardiac arrest (median = 38.5, interquartile range [IQR] = 5.7-245ng/l in poor vs median = 1.5, IQR = 0.7-2.4ng/l in good outcome, for tau....... The accuracy in predicting outcome by serum tau was equally high for patients randomized to 33 °C and 36 °C targeted temperature after cardiac arrest. INTERPRETATION: Serum tau is a promising novel biomarker for prediction of neurological outcome in patients with cardiac arrest. It may be significantly better...

  1. Cardiac arrest following ventilator fire: A rare cause

    Directory of Open Access Journals (Sweden)

    K Nazeer Ahmed

    2012-01-01

    Full Text Available Operating room fires are rare events, but when occur they result in serious and sometimes fatal consequences. Anaesthesia ventilator fire leading to cardiac arrest is a rare incident and has not been reported. We report a near catastrophic ventilator fire leading to cardiac arrest in a patient undergoing subtotal thyroidectomy. In the present case sparks due to friction or electrical short circuit within the ventilator might have acted as source of ignition leading to fire and explosion in the oxygen rich environment. The patient was successfully resuscitated and revived with uneventful recovery and no adverse sequelae. The cardiac arrest was possibly due to severe hypoxia resulting from inhalation of smoke containing high concentrations of carbon monoxide and other noxious gases.

  2. The role of vasopressin in cardiorespiratory arrest and pulmonary hypertension.

    Science.gov (United States)

    Smith, A M; Elliot, C M; Kiely, D G; Channer, K S

    2006-03-01

    Vasopressin is a peptide synthesized in the hypothalamus whose primary role is in fluid homeostasis. It has recently gained interest as a potential agent in the treatment of cardiorespiratory arrest. Initial human studies have shown benefits with vasopressin in patients with out of hospital ventricular fibrillation and asystolic cardiac arrest. One subgroup of patients not included in these trials is patients with pulmonary hypertension, who have a five-year mortality rate of 50%. Animal studies have shown vasopressin to be a vasodilator in the pulmonary vascular system of rats, under normoxic and hypoxic conditions, with conflicting results in canines. Human studies have shown conflicting results with increases, decreases and no changes seen in pulmonary artery pressures of patients with a variety of clinical conditions. Research needs to be done in patients with pulmonary hypertension regarding the potential role of vasopressin during cardiac arrest in this subgroup.

  3. [Cardiorespiratory arrest in full term newborn infants: six case reports].

    Science.gov (United States)

    Gatti, H; Castel, C; Andrini, P; Durand, P; Carlus, C; Chabernaud, J L; Vial, M; Dehan, M; Boithias, C

    2004-05-01

    Cardiorespiratory arrest occurring within the first two hours of life of a perfectly normal newborn is a very seldom event hitherto unreported. Six infants born after an uneventful pregnancy by normal vaginal delivery, with a normal Apgar score and physical examination, were found with unexpected cardiorespiratory arrest requiring cardiac and respiratory resuscitation early after birth. All were lying in the prone position, their face covered up while facing mother's abdomen, breast or neck. All mothers were primipara. All newborns but one died. Biological and bacteriological samples were normal and early onset neonatal sepsis was ruled out. Autopsy, performed in five infants, was not contributive. We hypothesize that the sudden and unexpected cardiorespiratory arrest occurring in these normal newborns was secondary to acute upper airway obstruction. To prevent this life threatening post-natal asphyxic episode, it is essential to ensure that the face of a newborn lying down upon mother's breast and abdomen is properly and continuously cleared.

  4. The optimal hemodynamics management of post-cardiac arrest shock.

    Science.gov (United States)

    Pellis, Tommaso; Sanfilippo, Filippo; Ristagno, Giuseppe

    2015-12-01

    Patients resuscitated from cardiac arrest develop a pathophysiological state named "post-cardiac arrest syndrome." Post-resuscitation myocardial dysfunction is a common feature of this syndrome, and many patients eventually die from cardiovascular failure. Cardiogenic shock accounts for most deaths in the first 3 days, when post-resuscitation myocardial dysfunction peaks. Thus, identification and treatment of cardiovascular failure is one of the key therapeutic goals during hospitalization of post-cardiac arrest patients. Patients with hemodynamic instability may require advanced cardiac output monitoring. Inotropes and vasopressors should be considered if hemodynamic goals are not achieved despite optimized preload. If these measures fail to restore adequate organ perfusion, a mechanical circulatory assistance device may be considered. Adequate organ perfusion should be ensured in the absence of definitive data on the optimal target pressure goals. Hemodynamic goals should also take into account targeted temperature management and its effect on the cardiovascular function. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Macrolide antibiotics allosterically predispose the ribosome for translation arrest.

    Science.gov (United States)

    Sothiselvam, Shanmugapriya; Liu, Bo; Han, Wei; Ramu, Haripriya; Klepacki, Dorota; Atkinson, Gemma Catherine; Brauer, Age; Remm, Maido; Tenson, Tanel; Schulten, Klaus; Vázquez-Laslop, Nora; Mankin, Alexander S

    2014-07-08

    Translation arrest directed by nascent peptides and small cofactors controls expression of important bacterial and eukaryotic genes, including antibiotic resistance genes, activated by binding of macrolide drugs to the ribosome. Previous studies suggested that specific interactions between the nascent peptide and the antibiotic in the ribosomal exit tunnel play a central role in triggering ribosome stalling. However, here we show that macrolides arrest translation of the truncated ErmDL regulatory peptide when the nascent chain is only three amino acids and therefore is too short to be juxtaposed with the antibiotic. Biochemical probing and molecular dynamics simulations of erythromycin-bound ribosomes showed that the antibiotic in the tunnel allosterically alters the properties of the catalytic center, thereby predisposing the ribosome for halting translation of specific sequences. Our findings offer a new view on the role of small cofactors in the mechanism of translation arrest and reveal an allosteric link between the tunnel and the catalytic center of the ribosome.

  6. Arrester Resistive Current Measuring System Based on Heterogeneous Network

    Science.gov (United States)

    Zhang, Yun Hua; Li, Zai Lin; Yuan, Feng; Hou Pan, Feng; Guo, Zhan Nan; Han, Yue

    2018-03-01

    Metal Oxide Arrester (MOA) suffers from aging and poor insulation due to long-term impulse voltage and environmental impact, and the value and variation tendency of resistive current can reflect the health conditions of MOA. The common wired MOA detection need to use long cables, which is complicated to operate, and that wireless measurement methods are facing the problems of poor data synchronization and instability. Therefore a novel synchronous measurement system of arrester current resistive based on heterogeneous network is proposed, which simplifies the calculation process and improves synchronization, accuracy and stability and of the measuring system. This system combines LoRa wireless network, high speed wireless personal area network and the process layer communication, and realizes the detection of arrester working condition. Field test data shows that the system has the characteristics of high accuracy, strong anti-interference ability and good synchronization, which plays an important role in ensuring the stable operation of the power grid.

  7. The Evolving Paradigm of Individualized Postresuscitation Care After Cardiac Arrest.

    Science.gov (United States)

    Seder, David B; Lord, Christine; Gagnon, David J

    2016-11-01

    The postresuscitation period after a cardiac arrest is characterized by a wide range of physiological derangements. Variations between patients include preexisting medical problems, the underlying cause of the cardiac arrest, presence or absence of hemodynamic and circulatory instability, severity of the ischemia-reperfusion injury, and resuscitation-related injuries such as pulmonary aspiration and rib or sternal fractures. Although protocols can be applied to many elements of postresuscitation care, the widely disparate clinical condition of cardiac arrest survivors requires an individualized approach that stratifies patients according to their clinical profile and targets specific treatments to patients most likely to benefit. This article describes such an individualized approach, provides a practical framework for evaluation and triage at the bedside, and reviews concerns specific to all members of the interprofessional postresuscitation care team. ©2016 American Association of Critical-Care Nurses.

  8. Numerical study of fracture arrest on snow cover

    Directory of Open Access Journals (Sweden)

    B. Frigo

    2010-10-01

    Full Text Available Under the hypothesis of a perfectly brittle phenomenon, avalanche triggering can be investigated numerically by means of Linear Elastic Fracture Mechanics (LEFM. Since, however, the real phenomenon is intrinsically dynamical, another aspect to investigate is represented by dynamic fracture propagation. In this paper, we model dynamic crack propagation into a dry snow slab and we investigate the possibility to arrest the crack propagation through the presence of weak zones distributed along the extension of the snow slope. Assuming that the weak layer is almost collapsed, we simulate the efficiency of artificial voids in the slab to arrest fracture propagation, into the framework of Dynamical Fracture Mechanics. We put forward here a new philosophy for the use of artificial discontinuities (void into the snowpack able to perform as crack arresters distributed along the snow slope area: the target is to split a large avalanche slab into smaller slabs, causing small avalanches to propagate with less catastrophic effects.

  9. Crack arrest toughness measurements with A533B steel

    International Nuclear Information System (INIS)

    Salonen, Seppo.

    1979-11-01

    This work covers crack arrest toughness measurements on A533B steel done at the Technical Research Centre of Finland. These measurements are one part of a multinational effort, involving 30 laboratories. The aim of the cooperative test program is to examine two test procedures for measuring the crack arrest toughness, to give information about their reproducibility, and to identify the factors affecting the interpretation. The principles given for the testing were easy to apply in general and the results were satisfactory. Some factors in the test runs and in the specimen's behaviour are indicated which can cause error in the results or make implementation of the test more difficult. By comparing the results from our laboratory with average values from the test program a good agreement can be seen. Crack arrest toughness values derived from the compared procedures with a static analysis agree closely, but values calculated using a dynamic analysis differ considerably. (author)

  10. Allyl isothiocyanate arrests cancer cells in mitosis, and mitotic arrest in turn leads to apoptosis via Bcl-2 protein phosphorylation.

    Science.gov (United States)

    Geng, Feng; Tang, Li; Li, Yun; Yang, Lu; Choi, Kyoung-Soo; Kazim, A Latif; Zhang, Yuesheng

    2011-09-16

    Allyl isothiocyanate (AITC) occurs in many commonly consumed cruciferous vegetables and exhibits significant anti-cancer activities. Available data suggest that it is particularly promising for bladder cancer prevention and/or treatment. Here, we show that AITC arrests human bladder cancer cells in mitosis and also induces apoptosis. Mitotic arrest by AITC was associated with increased ubiquitination and degradation of α- and β-tubulin. AITC directly binds to multiple cysteine residues of the tubulins. AITC induced mitochondrion-mediated apoptosis, as shown by cytochrome c release from mitochondria to cytoplasm, activation of caspase-9 and caspase-3, and formation of TUNEL-positive cells. Inhibition of caspase-9 blocked AITC-induced apoptosis. Moreover, we found that apoptosis induction by AITC depended entirely on mitotic arrest and was mediated via Bcl-2 phosphorylation at Ser-70. Pre-arresting cells in G(1) phase by hydroxyurea abrogated both AITC-induced mitotic arrest and Bcl-2 phosphorylation. Overexpression of a Bcl-2 mutant prevented AITC from inducing apoptosis. We further showed that AITC-induced Bcl-2 phosphorylation was caused by c-Jun N-terminal kinase (JNK), and AITC activates JNK. Taken together, this study has revealed a novel anticancer mechanism of a phytochemical that is commonly present in human diet.

  11. Swedish ambulance nurses' experiences of nursing patients suffering cardiac arrest.

    Science.gov (United States)

    Larsson, Ricard; Engström, Åsa

    2013-04-01

    Effective pre-hospital treatment of a person suffering cardiac arrest is a challenging task for the ambulance nurses. The aim of this study was to describe ambulance nurses' experiences of nursing patients suffering cardiac arrest. Qualitative personal interviews were conducted during 2011 in Sweden with seven ambulance nurses with experience of nursing patients suffering cardiac arrests. The interview texts were analyzed using qualitative thematic content analysis, which resulted in the formulation of one theme with six categories. Mutual preparation, regular training and education were important factors in the nursing of patients suffering cardiac arrest. Ambulance nurses are placed in ethically demanding situations regarding if and for how long they should continue cardio-pulmonary resuscitation (CPR) to accord with pre-hospital cardiac guidelines and patients' wishes. When a cardiac arrest patient is nursed their relatives also need the attention of ambulance nurses. Reflection is one way for ambulance nurses to learn from, and talk about, their experiences. This study provides knowledge of ambulance nurses' experiences in the care of people with cardiac arrest. Better feedback about the care given by the ambulance nurses, and about the diagnosis and nursing care the patients received after they were admitted to the hospital are suggested as improvements that would allow ambulance nurses to learn more from their experience. Further development and research concerning the technical equipment might improve the situation for both the ambulance nurses and the patients. Ambulance nurses need regularly training and education to be prepared for saving people's lives and also to be able to make the right decisions. © 2013 Wiley Publishing Asia Pty Ltd.

  12. The evolutionary origin of the turtle shell and its dependence on the axial arrest of the embryonic rib cage.

    Science.gov (United States)

    Hirasawa, Tatsuya; Pascual-Anaya, Juan; Kamezaki, Naoki; Taniguchi, Mari; Mine, Kanako; Kuratani, Shigeru

    2015-05-01

    Turtles are characterized by their possession of a shell with dorsal and ventral moieties: the carapace and the plastron, respectively. In this review, we try to provide answers to the question of the evolutionary origin of the carapace, by revising morphological, developmental, and paleontological comparative analyses. The turtle carapace is formed through modification of the thoracic ribs and vertebrae, which undergo extensive ossification to form a solid bony structure. Except for peripheral dermal elements, there are no signs of exoskeletal components ontogenetically added to the costal and neural bones, and thus the carapace is predominantly of endoskeletal nature. Due to the axial arrest of turtle rib growth, the axial part of the embryo expands laterally and the shoulder girdle becomes encapsulated in the rib cage, together with the inward folding of the lateral body wall in the late phase of embryogenesis. Along the line of this folding develops a ridge called the carapacial ridge (CR), a turtle-specific embryonic structure. The CR functions in the marginal growth of the carapacial primordium, in which Wnt signaling pathway might play a crucial role. Both paleontological and genomic evidence suggest that the axial arrest is the first step toward acquisition of the turtle body plan, which is estimated to have taken place after the divergence of a clade including turtles from archosaurs. The developmental relationship between the CR and the axial arrest remains a central issue to be solved in future. © 2014 Wiley Periodicals, Inc.

  13. Complete maternal and fetal recovery after prolonged cardiac arrest.

    Science.gov (United States)

    Selden, B S; Burke, T J

    1988-04-01

    A case of complete maternal and fetal recovery after prolonged cardiac arrest from massive lidocaine overdose is presented. A 27-year-old woman at 15 weeks gestation had a complete neurologic recovery after 22 minutes of CPR, including 19 minutes of electromechanical dissociation and asystole, with normal fetal heart function and fetal motion confirmed by ultrasound immediately after resuscitation. The patient delivered a healthy and neurologically normal infant at 40 weeks gestation. This is the longest cardiac arrest in early pregnancy reported in the medical literature with normal maternal and fetal outcome.

  14. Oxidative phosphorylation as a target to arrest malignant neoplasias.

    Science.gov (United States)

    Rodríguez-Enríquez, Sara; Gallardo-Pérez, Juan Carlos; Marín-Hernández, Alvaro; Aguilar-Ponce, José Luis; Mandujano-Tinoco, Edna Ayerim; Meneses, Abelardo; Moreno-Sánchez, Rafael

    2011-01-01

    Since Warburg proposed in 1956 that cancer cells exhibit increased glycolysis due to mitochondrial damage, numerous researchers have assumed that glycolysis is the predominant ATP supplier for cancer cell energy-dependent processes. However, chemotherapeutic strategies using glycolytic inhibitors have been unsuccessful in arresting tumor proliferation indicating that the Warburg hypothesis may not be applicable to all existing neoplasias. This review analyzes recent information on mitochondrial metabolism in several malignant neoplasias emphasizing that, although tumor cells maintain a high glycolytic rate, the principal ATP production may derive from active oxidative phosphorylation. Thus, anti-mitochondrial drug therapy may be an adequate adjuvant strategy to arrest proliferation of oxidative phosphorylation-dependent neoplasias.

  15. Interrater variability of EEG interpretation in comatose cardiac arrest patients

    DEFF Research Database (Denmark)

    Westhall, Erik; Rosén, Ingmar; Rossetti, Andrea O

    2015-01-01

    OBJECTIVE: EEG is widely used to predict outcome in comatose cardiac arrest patients, but its value has been limited by lack of a uniform classification. We used the EEG terminology proposed by the American Clinical Neurophysiology Society (ACNS) to assess interrater variability in a cohort.......42) for malignant patterns. Substantial agreement was found for malignant periodic or rhythmic patterns (κ 0.72) while agreement for identifying an unreactive EEG was fair (κ 0.26). CONCLUSIONS: The ACNS EEG terminology can be used to identify highly malignant EEG-patterns in post cardiac arrest patients...

  16. Lysophosphatidate induces chemo-resistance by releasing breast cancer cells from taxol-induced mitotic arrest.

    Directory of Open Access Journals (Sweden)

    Nasser Samadi

    Full Text Available Taxol is a microtubule stabilizing agent that arrests cells in mitosis leading to cell death. Taxol is widely used to treat breast cancer, but resistance occurs in 25-69% of patients and it is vital to understand how Taxol resistance develops to improve chemotherapy. The effects of chemotherapeutic agents are overcome by survival signals that cancer cells receive. We focused our studies on autotaxin, which is a secreted protein that increases tumor growth, aggressiveness, angiogenesis and metastasis. We discovered that autotaxin strongly antagonizes the Taxol-induced killing of breast cancer and melanoma cells by converting the abundant extra-cellular lipid, lysophosphatidylcholine, into lysophosphatidate. This lipid stimulates specific G-protein coupled receptors that activate survival signals.In this study we determined the basis of these antagonistic actions of lysophosphatidate towards Taxol-induced G2/M arrest and cell death using cultured breast cancer cells. Lysophosphatidate does not antagonize Taxol action in MCF-7 cells by increasing Taxol metabolism or its expulsion through multi-drug resistance transporters. Lysophosphatidate does not lower the percentage of cells accumulating in G2/M by decreasing exit from S-phase or selective stimulation of cell death in G2/M. Instead, LPA had an unexpected and remarkable action in enabling MCF-7 and MDA-MB-468 cells, which had been arrested in G2/M by Taxol, to normalize spindle structure and divide, thus avoiding cell death. This action involves displacement of Taxol from the tubulin polymer fraction, which based on inhibitor studies, depends on activation of LPA receptors and phosphatidylinositol 3-kinase.This work demonstrates a previously unknown consequence of lysophosphatidate action that explains why autotaxin and lysophosphatidate protect against Taxol-induced cell death and promote resistance to the action of this important therapeutic agent.

  17. Radioprotection and Cell Cycle Arrest of Intestinal Epithelial Cells by Darinaparsin, a Tumor Radiosensitizer

    Energy Technology Data Exchange (ETDEWEB)

    Tian, Junqiang; Doi, Hiroshi [Department of Radiation Oncology, School of Medicine, Stanford University, Stanford, California (United States); Saar, Matthias; Santos, Jennifer [Department of Urology, School of Medicine, Stanford University, Stanford, California (United States); Li, Xuejun; Peehl, Donna M. [Department of Radiation Oncology, School of Medicine, Stanford University, Stanford, California (United States); Knox, Susan J., E-mail: sknox@stanford.edu [Department of Radiation Oncology, School of Medicine, Stanford University, Stanford, California (United States)

    2013-12-01

    Purpose: It was recently reported that the organic arsenic compound darinaparsin (DPS) is a cytotoxin and radiosensitizer of tumor cells in vitro and in subcutaneous xenograft tumors. Surprisingly, it was also found that DPS protects normal intestinal crypt epithelial cells (CECs) from clonogenic death after ionizing radiation (IR). Here we tested the DPS radiosensitizing effect in a clinically relevant model of prostate cancer and explored the radioprotective effect and mechanism of DPS on CECs. Methods and Materials: The radiation modification effect of DPS was tested in a mouse model of orthotopic xenograft prostate cancer and of IR-induced acute gastrointestinal syndrome. The effect of DPS on CEC DNA damage and DNA damage responses was determined by immunohistochemistry. Results: In the mouse model of IR-induced gastrointestinal syndrome, DPS treatment before IR accelerated recovery from body weight loss and increased animal survival. DPS decreased post-IR DNA damage and cell death, suggesting that the radioprotective effect was mediated by enhanced DNA damage repair. Shortly after DPS injection, significant cell cycle arrest was observed in CECs at both G1/S and G2/M checkpoints, which was accompanied by the activation of cell cycle inhibitors p21 and growth arrest and DNA-damage-inducible protein 45 alpha (GADD45A). Further investigation revealed that DPS activated ataxia telangiectasia mutated (ATM), an important inducer of DNA damage repair and cell cycle arrest. Conclusions: DPS selectively radioprotected normal intestinal CECs and sensitized prostate cancer cells in a clinically relevant model. This effect may be, at least in part, mediated by DNA damage response activation and has the potential to significantly increase the therapeutic index of radiation therapy.

  18. Radioprotection and Cell Cycle Arrest of Intestinal Epithelial Cells by Darinaparsin, a Tumor Radiosensitizer

    International Nuclear Information System (INIS)

    Tian, Junqiang; Doi, Hiroshi; Saar, Matthias; Santos, Jennifer; Li, Xuejun; Peehl, Donna M.; Knox, Susan J.

    2013-01-01

    Purpose: It was recently reported that the organic arsenic compound darinaparsin (DPS) is a cytotoxin and radiosensitizer of tumor cells in vitro and in subcutaneous xenograft tumors. Surprisingly, it was also found that DPS protects normal intestinal crypt epithelial cells (CECs) from clonogenic death after ionizing radiation (IR). Here we tested the DPS radiosensitizing effect in a clinically relevant model of prostate cancer and explored the radioprotective effect and mechanism of DPS on CECs. Methods and Materials: The radiation modification effect of DPS was tested in a mouse model of orthotopic xenograft prostate cancer and of IR-induced acute gastrointestinal syndrome. The effect of DPS on CEC DNA damage and DNA damage responses was determined by immunohistochemistry. Results: In the mouse model of IR-induced gastrointestinal syndrome, DPS treatment before IR accelerated recovery from body weight loss and increased animal survival. DPS decreased post-IR DNA damage and cell death, suggesting that the radioprotective effect was mediated by enhanced DNA damage repair. Shortly after DPS injection, significant cell cycle arrest was observed in CECs at both G1/S and G2/M checkpoints, which was accompanied by the activation of cell cycle inhibitors p21 and growth arrest and DNA-damage-inducible protein 45 alpha (GADD45A). Further investigation revealed that DPS activated ataxia telangiectasia mutated (ATM), an important inducer of DNA damage repair and cell cycle arrest. Conclusions: DPS selectively radioprotected normal intestinal CECs and sensitized prostate cancer cells in a clinically relevant model. This effect may be, at least in part, mediated by DNA damage response activation and has the potential to significantly increase the therapeutic index of radiation therapy

  19. Multisensor integration and image recognition using Fuzzy Adaptive Resonance Theory

    Science.gov (United States)

    Singer, Steven M.

    1997-04-01

    The main objective of this work was to investigate the use of 'sensor based real time decision and control technology' applied to actively control the arrestment of aircraft (manned or unmanned). The proposed method is to develop an adaptively controlled system that would locate the aircraft's extended tailhook, predict its position and speed at the time of arrestment, adjust an arresting end effector to actively mate with the arresting hook and remove the aircraft's kinetic energy, thus minimizing the arresting distance and impact stresses. The focus of the work presented in this paper was to explore the use of fuzzy adaptive resonance theorem (fuzzy art) neural network to form a MSI scheme which reduces image data to recognize incoming aircraft and extended tailhook. Using inputs from several image sources a single fused image was generated to give details about range and tailhook characteristics for an F18 naval aircraft. The idea is to partition an image into cells and evaluate each using fuzzy art. Once the incoming aircraft is located in a cell that subimage is again divided into smaller cells. This image is evaluated to locate various parts of the aircraft (i.e., wings, tail, tailhook, etc.). the cell that contains the tailhook provides resolved position information. Multiple images from separate sensors provides opportunity to generate range details overtime.

  20. Arrests for child pornography production: data at two time points from a national sample of U.S. law enforcement agencies.

    Science.gov (United States)

    Wolak, Janis; Finkelhor, David; Mitchell, Kimberly J; Jones, Lisa M

    2011-08-01

    This study collected information on arrests for child pornography (CP) production at two points (2000-2001 and 2006) from a national sample of more than 2,500 law enforcement agencies. In addition to providing descriptive data about an understudied crime, the authors examined whether trends in arrests suggested increasing CP production, shifts in victim populations, and challenges to law enforcement. Arrests for CP production more than doubled from an estimated 402 in 2000-2001 to an estimated 859 in 2006. Findings suggest the increase was related to increased law enforcement activity rather than to growth in the population of CP producers. Adolescent victims increased, but there was no increase in the proportion of arrest cases involving very young victims or violent images. Producers distributed images in 23% of arrest cases, a proportion that did not change over time. This suggests that much CP production may be primarily for private use. Proactive law enforcement operations increased, as did other features consistent with a robust law enforcement response.

  1. Plant growth promotion properties of bacterial strains isolated from the rhizosphere of the Jerusalem artichoke (Helianthus tuberosus L.) adapted to saline-alkaline soils and their effect on wheat growth.

    Science.gov (United States)

    Liu, Xiaolin; Li, Xiangyue; Li, Yan; Li, Runzhi; Xie, Zhihong

    2017-03-01

    The Jerusalem artichoke (JA; Helianthus tuberosus), known to be tolerant to saline-alkaline soil conditions, has been cultivated for many years in the Yellow River delta, Shandong Province coastal zone, in China. The aim of our study was to isolate nitrogen-fixing bacteria colonizing the rhizosphere of JA and to characterize other plant growth promotion properties. The ultimate goal was to identify isolates that could be used as inoculants benefiting an economic crop, in particular for improving wheat growth production in the Yellow River delta. Bacterial strains were isolated from the rhizosphere soil of JA on the basis of growth on nitrogen-free Ashby medium. Identification and phylogenetic analysis was performed after nucleotide sequencing of 16S rRNA gene. Plant-growth-promoting traits, such as nitrogen fixation activity, phosphate solubilization activity, indole-3-acetic acid production, were determined using conventional methods. Eleven strains were isolated and 6 of them were further examined for their level of salt tolerance and their effect on plant growth promotion. Inoculation of Enterobacter sp. strain N10 on JA and wheat led to significant increases in both root and shoot dry mass and shoot height. Enterobacter sp. strain N10 appeared to be the best plant-growth-promoting rhizobacteria to increase wheat productivity in future field applications.

  2. Proteome Analysis of Cold Response in Spring and Winter Wheat (Triticum aestivum) Crowns Reveals Similarities in Stress Adaptation and Differences in Regulatory Processes between the Growth Habits

    Czech Academy of Sciences Publication Activity Database

    Kosová, K.; Vítámvás, P.; Planchon, S.; Renaut, J.; Vaňková, Radomíra; Prášil, I.T.

    2013-01-01

    Roč. 12, č. 11 (2013), s. 4830-4845 ISSN 1535-3893 R&D Projects: GA ČR GA522/09/2058 Institutional research plan: CEZ:AV0Z50380511 Keywords : 2D-DIGE analysis * cold stress * spring and winter growth habit Subject RIV: ED - Physiology Impact factor: 5.001, year: 2013

  3. Cardiac Arrest after Local Anaesthetic Toxicity in a Paediatric Patient

    Directory of Open Access Journals (Sweden)

    Liana Maria Torres de Araújo Azi

    2016-01-01

    Full Text Available We report a case of a paediatric patient undergoing urological procedure in which a possible inadvertent intravascular or intraosseous injection of bupivacaine with adrenaline in usual doses caused subsequent cardiac arrest, completely reversed after administration of 20% intravenous lipid emulsion. Early diagnosis of local anaesthetics toxicity and adequate cardiovascular resuscitation manoeuvres contribute to the favourable outcome.

  4. Offenders' Perceptions of House Arrest and Electronic Monitoring

    Science.gov (United States)

    Martin, Jamie S.; Hanrahan, Kate; Bowers, James H., Jr.

    2009-01-01

    This article reports on a study designed to examine the perceptions of house arrest (HA) and electronic monitoring (EM) among offenders who have recently experienced this criminal sentence. Data were gathered via a self-administered questionnaire and follow-up interviews with a sample of offenders. Our primary areas of interest were to assess (a)…

  5. Sudden cardiac arrest risk in young athletes | Gradidge | South ...

    African Journals Online (AJOL)

    Underlying cardiac abnormalities are the main cause of unexpected death in athletes on field. These abnormalities have been associated with a previous history of syncope, a family history of sudden cardiac arrest (SCA), cardiac murmur, a history of over-exhaustion post exercise and ventricular tachyarrhythmia during ...

  6. Early hypercementosis and arrested dental eruption: heritable multiple ankylodontia.

    Science.gov (United States)

    Israel, H

    1984-01-01

    This study describes arrested posterior permanent tooth eruption in association with hypercementosis, reduction of the periodontal ligamental space, and bony ankylosis. The severe dental malocclusion occurred in four members of the same family and it appears to have an autosomal dominant mode of inheritance.

  7. 19 CFR 162.63 - Arrests and seizures.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Arrests and seizures. 162.63 Section 162.63 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) INSPECTION, SEARCH, AND SEIZURE Controlled Substances, Narcotics, and Marihuana § 162...

  8. Trichostrongylus colubriformis rDNA polymorphism associated with arrested development

    Czech Academy of Sciences Publication Activity Database

    Langrová, I.; Zouhar, M.; Vadlejch, J.; Borovský, M.; Jankovská, I.; Lytvynets, Andrej

    2008-01-01

    Roč. 103, č. 2 (2008), s. 401-403 ISSN 0932-0113 Institutional research plan: CEZ:AV0Z50110509 Keywords : arrested development * polymorphism * rDNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.473, year: 2008

  9. Prediction of cardiac arrest recurrence using ensemble classifiers

    Indian Academy of Sciences (India)

    Home; Journals; Sadhana; Volume 42; Issue 7. Prediction of cardiac arrest recurrence using ensemble classifiers. NACHIKET TAPAS ... Poor survival rate of patients with SCA is one of themost ubiquitous health care problems today. Recent studies show that heart-rate-derived features can act as early predictors of SCA.

  10. Anaphylactic shock and cardiac arrest caused by thiamine infusion

    DEFF Research Database (Denmark)

    Juel, Jacob; Pareek, Manan; Langfrits, Christian Sigvald

    2013-01-01

    intoxication and developed cardiac arrest due to anaphylactic shock following intravenous thiamine infusion. The patient was successfully resuscitated after 15 min and repeated epinephrine administrations. He was discharged in good health after 14 days. This case report emphasises both the importance...

  11. [Refractory cardiac arrest patients in prehospital care, potential organ donors].

    Science.gov (United States)

    Le Jan, Arnaud; Dupin, Aurélie; Garrigue, Bruno; Sapir, David

    2016-09-01

    Under the authority of the French Biomedicine Agency, a new care pathway integrates refractory cardiac arrest patients into a process of organ donation. It is a medical, logistical and ethical challenge for the staff of the mobile emergency services. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  12. Cdc20 control of cell fate during prolonged mitotic arrest

    DEFF Research Database (Denmark)

    Nilsson, Jakob

    2011-01-01

    The fate of cells arrested in mitosis by antimitotic compounds is complex but is influenced by competition between pathways promoting cell death and pathways promoting mitotic exit. As components of both of these pathways are regulated by Cdc20-dependent degradation, I hypothesize that variations...

  13. Lupeol induces S-phase arrest and mitochondria-mediated ...

    Indian Academy of Sciences (India)

    48

    Lupeol induces S-phase arrest and mitochondria-mediated apoptosis in cervical cancer cells. Nupoor Prasad1, Akash Sabarwal2, Umesh C. S. Yadav1, Rana P. Singh2,*. 1School of Life Sciences, Central University of Gujarat, Gandhinagar, Gujarat, India. 2Cancer Biology Laboratory, School of Life Sciences, Jawaharlal ...

  14. Curcumin Induces Autophagy, Apoptosis, and Cell Cycle Arrest in Human Pancreatic Cancer Cells

    Directory of Open Access Journals (Sweden)

    Yaping Zhu

    2017-01-01

    Full Text Available Objective. Curcumin is an active extract from turmeric. The aim of this study was to identify the underlying mechanism of curcumin on PCa cells and the role of autophagy in this process. Methods. The inhibitory effect of curcumin on the growth of PANC1 and BxPC3 cell lines was detected by CCK-8 assay. Cell cycle distribution and apoptosis were tested by flow cytometry. Autophagosomes were tested by cell immunofluorescence assay. The protein expression was detected by Western blot. The correlation between LC3II/Bax and cell viability was analyzed. Results. Curcumin inhibited the cell proliferation in a dose- and time-dependent manner. Curcumin could induce cell cycle arrest at G2/M phase and apoptosis of PCa cells. The autophagosomes were detected in the dosing groups. Protein expression of Bax and LC3II was upregulated, while Bcl2 was downregulated in the high dosing groups of curcumin. There was a significant negative correlation between LC3II/Bax and cell viability. Conclusions. Autophagy could be triggered by curcumin in the treatment of PCa. Apoptosis and cell cycle arrest also participated in this process. These findings imply that curcumin is a multitargeted agent for PCa cells. In addition, autophagic cell death may predominate in the high concentration groups of curcumin.

  15. Is Ward Experience in Resuscitation Effort Related to the Prognosis of Unexpected Cardiac Arrest?

    Directory of Open Access Journals (Sweden)

    Sen-Kuang Hou

    2007-09-01

    Conclusion: Hospital wards with more than 5 cardiac arrests per year have a better patient survival rate than those with fewer arrests. This is despite all ward staff receiving the same level of training.

  16. The arresting phase determines the total healing time of

    Directory of Open Access Journals (Sweden)

    LI Ping

    2012-04-01

    Full Text Available 【Abstract】Objective: Radiation is an important cause of delayed wound healing, and there still exist many questions regarding the patterns and mechanisms of wound healing. This study investigated the characteristics of wound healing after varying doses of local radiation and explored possible causes of the delay in healing caused by radiation. Methods: A full-thickness dorsal longitudinal skin tissue, 2 cm in diameter, was excised after local irradiation on one side of the back of swine, and the other side was wounded as a control. The size of the wound area was re-corded every two days after injury. Pathological changes, proliferating cell nuclear antigen (PCNA, immunohisto-chemistry and apoptosis levels (TUNEL assay were mea-sured at different time points after wounding. Results: The course of wound healing can be divided into four phases, namely: the arresting phase, the healing priming phase, the fast healing phase, and the healed phase. Although the total wound healing time was closely corre-lated to the dose of irradiation (R 2 = 0.9758, it was more dependent on the length of the arresting phase (R 2 =0.9903 because once the arresting phase ended, the wound healed at a similar speed regardless of radiation doses. Pathologi-cal analysis showed that compared with the control side there were more necrotic tissues, slower epithelial crawling, as well as fewer blood vessels and cellular components in the irradiated side at the arresting phase, while other phases revealed no significant difference concerning these measurements. Immunohistochemistry showed that the ir-radiated wounds had significantly less PCNA-positive and more TUNEL-positive labeling of cells in the arresting phase than in other phases. Moreover, the changes were posi-tively related to the radiation doses, but there was no obvi-ous difference in cell proliferation or apoptosis among the healing priming phase, fast healing phase or healed phase, whether on the control side

  17. Effect of walking stress on growth, physiological adaptability and endocrine responses in Malpura ewes in a semi-arid tropical environment

    Science.gov (United States)

    Sejian, Veerasamy; Maurya, Vijai P.; Naqvi, Syed M. K.

    2012-03-01

    Sheep in hot semi-arid environments are mostly reared using extensive systems. In addition to thermal stress and feed scarcity, the animals need to walk long distances for grazing in this ecological zone. A study was conducted to assess the effect of long-distance walking on adaptive capability in terms of physiological, biochemical and endocrine responses in Malpura ewes. Fourteen adult Malpura non-pregnant ewes weighing between 33 and 35 kg were used in the study. The ewes were randomly allocated into two groups of seven animals each: GI ( n = 7; Control), and GII ( n = 7; walking stress). The animals were stall-fed with a diet consisting of 70% roughage and 30% concentrate. Both GI and GII ewes had uniform access to feed and water. The walking stress group (GII) ewes were made to walk 14 km in two spans between 0900 and 1500 hours with 1 h 30 min for each span (7 km) of walking. The ewes subjected to walking stress (GII) were prevented from grazing by applying a face mask made of cotton thread. The study was conducted for a period of two estrous cycles (35 days) during the autumn season (October-November). Physiological responses were recorded twice daily at 0800 and 1400 hours at weekly intervals. Blood samples were collected from the jugular vein at weekly intervals to study the effects of walking stress on blood biochemical and endocrine parameters. The results indicate that walking stress had significant ( P reproductive hormone levels. The significant changes in RR, RT, plasma cortisol, T3 and T4 show that Malpura ewes have the capability to adapt to long-distance walking, and that adrenal and thyroid gland hormones play a significant role in such adaptation.

  18. Adaptive Lighting

    DEFF Research Database (Denmark)

    Petersen, Kjell Yngve; Søndergaard, Karin; Kongshaug, Jesper

    2015-01-01

    Adaptive Lighting Adaptive lighting is based on a partial automation of the possibilities to adjust the colour tone and brightness levels of light in order to adapt to people’s needs and desires. IT support is key to the technical developments that afford adaptive control systems. The possibilities...... offered by adaptive lighting control are created by the ways that the system components, the network and data flow can be coordinated through software so that the dynamic variations are controlled in ways that meaningfully adapt according to people’s situations and design intentions. This book discusses...... differently into an architectural body. We also examine what might occur when light is dynamic and able to change colour, intensity and direction, and when it is adaptive and can be brought into interaction with its surroundings. In short, what happens to an architectural space when artificial lighting ceases...

  19. Long-term outcome of paediatric cardiorespiratory arrest in Spain.

    Science.gov (United States)

    López-Herce, Jesús; García, Cristina; Rodríguez-Núñez, Antonio; Domínguez, Pedro; Carrillo, Angel; Calvo, Custodio; Delgado, Miguel Angel

    2005-01-01

    To analyse the final outcome of cardiorespiratory arrest (CRA) in children and the neurological and functional state of survivors at 1 year. An 18-month prospective, multicentre study analysing out-of-hospital and in-hospital CRA in children was carried out; 283 children between 7 days and 17 years of age were included. CRA and resuscitation data were registered according to Utstein style. The outcome variables were: sustained return of spontaneous circulation (initial survival), and survival at 1 year (final survival). The status of survivors was evaluated by means of the paediatric cerebral performance category (PCPC) scale and the paediatric overall performance category (POPC) scale at Paediatric Intensive Care Unit discharge, at hospital discharge, and at 1 year follow-up. In 283 children, 311 CRA episodes, 73 respiratory arrests (23.5%) and 238 cardiac arrests (76.5%) were analysed. Seventeen children suffered more than one CRA episode (range: 2-6). The initial survival was 60.2% and 1-year survival was 33.2%. The final survival was significantly higher in respiratory arrest than in cardiac arrest patients (70.0% versus 21.1%) (P < 0.0001). After 1 year follow-up, 87.3% of patients had scores 1 or 2 on the PCPC scale and 84.0% had scores 1 or 2 in the POPC scale; these results indicate that 1 year after CRA, the majority of survivors had normal neurological and functional status or showed only mild disability. Prognosis of CRA in children continues to be poor in terms of survival but quite good in terms of neurological and functional status among survivors. Additional strategies and efforts are needed to improve the short-term prognosis of paediatric CRA. However, the long-term outcome of survivors is reassuring.

  20. Effects of Feeding Milk Replacer Ad Libitum or in Restricted Amounts for the First Five Weeks of Life on the Growth, Metabolic Adaptation, and Immune Status of Newborn Calves

    Science.gov (United States)

    Schäff, Christine T.; Gruse, Jeannine; Maciej, Josefine; Mielenz, Manfred; Wirthgen, Elisa; Hoeflich, Andreas; Schmicke, Marion; Pfuhl, Ralf; Jawor, Paulina; Stefaniak, Tadeusz

    2016-01-01

    The pre-weaning period is critical for calf health and growth, and intensive milk feeding programs may assist postnatal development by improving body growth and organ maturation. The aim of the present work was to study the effects of ad libitum milk replacer (MR) feeding on the growth, metabolic adaptation, health, and immune status of newborn calves. Twenty-eight newborn Holstein and Holstein x Charolais crossbred calves were fed ad libitum (ADLIB) or in restricted amounts (6 liters per day; RES) during the first five weeks of life. The MR intake in the ADLIB treatment was gradually reduced at weeks 6 and 7, and all calves then received 6 liters of MR per day until day 60. Blood samples were collected to measure the plasma concentrations of metabolites, insulin, insulin-like growth factor (IGF)-I and IGF binding proteins (IGFBP), immunoglobulins, and acute phase proteins. The expression of mRNA associated with both the somatotropic axis and gluconeogenic enzymes was measured in the liver on day 60. Intensive feeding improved MR intake and growth in ADLIB without influencing concentrate intake. Carcass weight, perirenal fat, and muscle mass were greater in ADLIB. Plasma concentrations of glucose, triglycerides, insulin, and IGF-I were greater, whereas plasma concentrations of β-hydroxybutyrate, total protein, albumin, urea, IGFBP-2 and -4, and fibrinogen were lower at distinct time points in ADLIB. The hepatic mRNA expression of cytosolic phosphoenolpyruvate carboxykinase was greater in ADLIB. Most metabolic and endocrine differences occurred during the MR feeding period, but a slightly greater concentrate intake was associated with increased plasma IGF-I and insulin at the end of the study. The immune and health status of the calves were not affected by MR feeding. However, increased plasma fibrinogen in the RES group suggested differences in the acute phase response. PMID:28036351

  1. Explaining Discrepancies in Arrest Rates Between Black and White Male Juveniles

    OpenAIRE

    Fite, Paula J.; Wynn, Porche’; Pardini, Dustin A.

    2009-01-01

    The authors investigated discrepancies in arrest rates between Black and White male juveniles by examining the role of early risk factors for arrest. Two hypotheses were evaluated: (a) Disproportionate minority arrest is due to increased exposure to early risk factors, and (b) a differential sensitivity to early risk factors contributes to disproportionate minority arrest. The study included 481 Black and White boys who were followed from childhood to early adulthood. A higher incidence of ea...

  2. Role of CrRLK1L Cell Wall Sensors HERCULES1 and 2, THESEUS1, and FERONIA in Growth Adaptation Triggered by Heavy Metals and Trace Elements

    Directory of Open Access Journals (Sweden)

    Julia Richter

    2017-09-01

    Full Text Available Cell walls are not only a protective barrier surrounding protoplasts but serve as signaling platform between the extracellular environment and the intracellular physiology. Ions of heavy metals and trace elements, summarized to metal ions, bind to cell wall components, trigger their modification and provoke growth responses. To examine if metal ions trigger cell wall sensing receptor like kinases (RLKs of the Catharanthus roseus RLK1-like (CrRLK1L family we employed a molecular genetic approach. Quantitative transcription analyses show that HERCULES1 (HERK1, THESEUS1 (THE1, and FERONIA (FER were differently regulated by cadmium (Cd, nickel (Ni, and lead (Pb. Growth responses were quantified for roots and etiolated hypocotyls of related mutants and overexpressors on Cd, copper (Cu, Ni, Pb, and zinc (Zn and revealed a complex pattern of gene specific, overlapping and antagonistic responses. Root growth was often inversely affected to hypocotyl elongation. For example, both HERK genes seem to negatively regulate hypocotyl elongation upon Cd, Ni, Zn, and Pb while they support root growth on Cd, Cu, and Ni. The different THE1 alleles exhibited a similar effect between roots and hypocotyls on Ni, where the loss-of-function mutant was more tolerant while the gain of function mutants were hypersensitive indicating that THE1 is mediating Ni specific inhibition of hypocotyl elongation in the dark. In contrast hypocotyl elongation of the knock-out mutant, fer-4, was hypersensitive to Ni but exhibited a higher tolerance to Cd, Cu, Pb, and Zn. These data indicate an antagonistic action between THE1 and FER in relation to hypocotyl elongation upon excess of Ni. FERs function as receptor for rapid alkalinization factors (RALFs was tested with the indicator bromocresol purple. While fer-4 roots strongly acidified control and metal ion containing media, the etiolated hypocotyls alkalized the media which is consistent with the already shorter hypocotyl of fer-4

  3. Gender and Relational-Distance Effects in Arrests for Domestic Violence

    Science.gov (United States)

    Lally, William; DeMaris, Alfred

    2012-01-01

    This study tests two hypotheses regarding factors affecting arrest of the perpetrator in domestic violence incidents. Black's relational-distance thesis is that the probability of arrest increases with increasing relational distance between perpetrator and victim. Klinger's leniency principle suggests that the probability of arrest is lower for…

  4. U.S. Juvenile Arrests: Gang Membership, Social Class, and Labeling Effects

    Science.gov (United States)

    Tapia, Mike

    2011-01-01

    This study addresses the link between gang membership and arrest frequency, exploring the Gang x Socioeconomic status interaction on those arrests. Notoriously poor, delinquent, and often well-known to police, America's gang youth should have very high odds of arrest. Yet it is unclear whether mere membership in a gang increases the risk of arrest…

  5. 30 CFR 75.521 - Lightning arresters; ungrounded and exposed power conductors and telephone wires.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Lightning arresters; ungrounded and exposed... Electrical Equipment-General § 75.521 Lightning arresters; ungrounded and exposed power conductors and... leads underground shall be equipped with suitable lightning arresters of approved type within 100 feet...

  6. Local Immigration Enforcement and Arrests of the Hispanic Population

    Directory of Open Access Journals (Sweden)

    Michael Coon

    2017-08-01

    Full Text Available Section 287(g of the Immigration and Nationality Act (INA, which was added to the INA by the Illegal Immigration Reform and Immigrant Responsibility Act of 1996 (IIRIRA, allows the federal government to enter into voluntary partnerships with state and local law enforcement agencies to enforce immigration law. Upon entering these agreements, law enforcement officers are trained by Immigration and Customs Enforcement (ICE and receive delegated authority to enquire about an individual’s immigration status and, if found to be removable, to detain the individual while ICE makes a determination of whether to initiate deportation proceedings. In some instances, this inquiry about immigration status takes place as part of the intake process when a criminal defendant is arrested and placed into a criminal jail. In other instances, task force officers are trained to inquire in the field about immigration status and enforce immigration law against people who have not committed any criminal offense.  The key difference between the two models is that task force agents can arrest for immigration violations undocumented individuals who have not committed any criminal offense, whereas in the jail model individuals must be arrested on some other criminal charge before immigration status can be determined. The 287(g program has raised several concerns regarding its implementation and results. First, the program could lead to racial and ethnic profiling. In particular, given that the majority of undocumented immigrants hail from Latin American countries, it is highly plausible that Hispanics, regardless of immigrant status, might be disproportionally affected by this program. That is, in a jurisdiction that participates in the jail model, an officer might arrest a Hispanic individual for a very minor offence in order to process them through the jail and determine their immigration status, when perhaps without the program they may have only issued a citation

  7. Adaptive Lighting

    DEFF Research Database (Denmark)

    Petersen, Kjell Yngve; Søndergaard, Karin; Kongshaug, Jesper

    2015-01-01

    Adaptive Lighting Adaptive lighting is based on a partial automation of the possibilities to adjust the colour tone and brightness levels of light in order to adapt to people’s needs and desires. IT support is key to the technical developments that afford adaptive control systems. The possibilities...... offered by adaptive lighting control are created by the ways that the system components, the network and data flow can be coordinated through software so that the dynamic variations are controlled in ways that meaningfully adapt according to people’s situations and design intentions. This book discusses...... the investigations of lighting scenarios carried out in two test installations: White Cube and White Box. The test installations are discussed as large-scale experiential instruments. In these test installations we examine what could potentially occur when light using LED technology is integrated and distributed...

  8. Tributyltin induces G2/M cell cycle arrest via NAD(+)-dependent isocitrate dehydrogenase in human embryonic carcinoma cells.

    Science.gov (United States)

    Asanagi, Miki; Yamada, Shigeru; Hirata, Naoya; Itagaki, Hiroshi; Kotake, Yaichiro; Sekino, Yuko; Kanda, Yasunari

    2016-04-01

    Organotin compounds, such as tributyltin (TBT), are well-known endocrine-disrupting chemicals (EDCs). We have recently reported that TBT induces growth arrest in the human embryonic carcinoma cell line NT2/D1 at nanomolar levels by inhibiting NAD(+)-dependent isocitrate dehydrogenase (NAD-IDH), which catalyzes the irreversible conversion of isocitrate to α-ketoglutarate. However, the molecular mechanisms by which NAD-IDH mediates TBT toxicity remain unclear. In the present study, we examined whether TBT at nanomolar levels affects cell cycle progression in NT2/D1 cells. Propidium iodide staining revealed that TBT reduced the ratio of cells in the G1 phase and increased the ratio of cells in the G2/M phase. TBT also reduced cell division cycle 25C (cdc25C) and cyclin B1, which are key regulators of G2/M progression. Furthermore, apigenin, an inhibitor of NAD-IDH, mimicked the effects of TBT. The G2/M arrest induced by TBT was abolished by NAD-IDHα knockdown. Treatment with a cell-permeable α-ketoglutarate analogue recovered the effect of TBT, suggesting the involvement of NAD-IDH. Taken together, our data suggest that TBT at nanomolar levels induced G2/M cell cycle arrest via NAD-IDH in NT2/D1 cells. Thus, cell cycle analysis in embryonic cells could be used to assess cytotoxicity associated with nanomolar level exposure of EDCs.

  9. PLK1 blockade enhances therapeutic effects of radiation by inducing cell cycle arrest at the mitotic phase.

    Science.gov (United States)

    Inoue, Minoru; Yoshimura, Michio; Kobayashi, Minoru; Morinibu, Akiyo; Itasaka, Satoshi; Hiraoka, Masahiro; Harada, Hiroshi

    2015-10-27

    The cytotoxicity of ionizing radiation depends on the cell cycle phase; therefore, its pharmacological manipulation, especially the induction of cell cycle arrest at the radiosensitive mitotic-phase (M-phase), has been attempted for effective radiation therapy. Polo-like kinase 1 (PLK1) is a serine/threonine kinase that functions in mitotic progression, and is now recognized as a potential target for radiosensitization. We herein investigated whether PLK1 blockade enhanced the cytotoxic effects of radiation by modulating cell cycle phases of cancer cells using the novel small molecule inhibitor of PLK1, TAK-960. The TAK-960 treatment exhibited radiosensitizing effects in vitro, especially when it increased the proportion of M-phase cells. TAK-960 did not sensitize cancer cells to radiation when an insufficient amount of time was provided to induce mitotic arrest. The overexpression of a PLK1 mutant, PLK1-R136G&T210D, which was confirmed to cancel the TAK-960-mediated increase in the proportion of mitotic cells, abrogated the radiosensitizing effects of TAK-960. A tumor growth delay assay also demonstrated that the radiosensitizing effects of TAK-960 depended on an increase in the proportion of M-phase cells. These results provide a rational basis for targeting PLK1 for radiosensitization when considering the therapeutic time window for M-phase arrest as the best timing for radiation treatments.

  10. Induction of Apoptosis and Cell Cycle Arrest in Human Colorectal Carcinoma by Litchi Seed Extract

    Directory of Open Access Journals (Sweden)

    Chih-Ping Hsu

    2012-01-01

    Full Text Available The Litchi (Litchi chinensis fruit products possess rich amounts of flavanoids and proanthocyanidins. Its pericarp has been shown to inhibit breast and liver cancer cell growth. However, the anticolorectal cancer effect of Litchi seed extract has not yet been reported. In this study, the effects of polyphenol-rich Litchi seed ethanol extract (LCSP on the proliferation, cell cycle, and apoptosis of two colorectal cancer cell lines Colo320DM and SW480 were examined. The results demonstrated that LCSP significantly induced apoptotic cell death in a dose-dependent manner and arrested cell cycle in G2/M in colorectal carcinoma cells. LCSP also suppressed cyclins and elevated the Bax : Bcl-2 ratio and caspase 3 activity. This study provides in vitro evidence that LCSP serves as a potential chemopreventive agent for colorectal cancer.

  11. Adaptation, allometry, and hypertension.

    Science.gov (United States)

    Weder, A B; Schork, N J

    1994-08-01

    Essential hypertension is a "disease of civilization" but has a clear genetic component. From an evolutionary perspective, persistence in the human genome of elements capable of raising blood pressure presupposes their adaptive significance. Recently, two hypotheses that explicitly appeal to selectionist arguments, the "slavery" and "thrifty gene" theories, have been forwarded. We find neither completely successful, and we advance an alternative explanation of the adaptive importance of genes responsible for hypertension. We propose that blood pressure rises during childhood and adolescence to subserve homeostatic needs of the organism. Specifically, we contend that blood pressure is a flexible element in the repertoire of renal homeostatic mechanisms serving to match renal function to growth. The effect of modern diet and lifestyle on human growth stimulates earlier and more vigorous development, straining biologically necessary relationships between renal and general somatic growth and requiring compensation via homeostatic mechanisms preserved during evolution. Prime among such mechanisms is blood pressure, which rises as a compensation to maintain renal function in the face of greater growth. Since virtually all members of acculturated societies share in the modern lifestyle, the demands imposed by accelerated growth and development result in a populational shift to higher blood pressures, with a consequent increase in the prevalence of hypertension. We propose that hypertension is the product of maladaptation of highly genetically conserved mechanisms subserving important biological homeostatic needs. Elucidation of the mechanisms underlying hypertension will require approaches that examine the developmental processes linking growth to blood pressure.

  12. ADAPT Dataset

    Data.gov (United States)

    National Aeronautics and Space Administration — Advanced Diagnostics and Prognostics Testbed (ADAPT) Project Lead: Scott Poll Subject Fault diagnosis in electrical power systems Description The Advanced...

  13. GADD45a Regulates Olaquindox-Induced DNA Damage and S-Phase Arrest in Human Hepatoma G2 Cells via JNK/p38 Pathways

    Directory of Open Access Journals (Sweden)

    Daowen Li

    2017-01-01

    Full Text Available Olaquindox, a quinoxaline 1,4-dioxide derivative, is widely used as a feed additive in many countries. The potential genotoxicity of olaquindox, hence, is of concern. However, the proper mechanism of toxicity was unclear. The aim of the present study was to investigate the effect of growth arrest and DNA damage 45 alpha (GADD45a on olaquindox-induced DNA damage and cell cycle arrest in HepG2 cells. The results showed that olaquindox could induce reactive oxygen species (ROS-mediated DNA damage and S-phase arrest, where increases of GADD45a, cyclin A, Cdk 2, p21 and p53 protein expression, decrease of cyclin D1 and the activation of phosphorylation-c-Jun N-terminal kinases (p-JNK, phosphorylation-p38 (p-p38 and phosphorylation-extracellular signal-regulated kinases (p-ERK were involved. However, GADD45a knockdown cells treated with olaquindox could significantly decrease cell viability, exacerbate DNA damage and increase S-phase arrest, associated with the marked activation of p-JNK, p-p38, but not p-ERK. Furthermore, SP600125 and SB203580 aggravated olaquindox-induced DNA damage and S-phase arrest, suppressed the expression of GADD45a. Taken together, these findings revealed that GADD45a played a protective role in olaquindox treatment and JNK/p38 pathways may partly contribute to GADD45a regulated olaquindox-induced DNA damage and S-phase arrest. Our findings increase the understanding on the molecular mechanisms of olaquindox.

  14. Suppression of c-Myc enhances p21WAF1/CIP1 -mediated G1 cell cycle arrest through the modulation of ERK phosphorylation by ascochlorin.

    Science.gov (United States)

    Jeong, Yun-Jeong; Hoe, Hyang-Sook; Cho, Hyun-Ji; Park, Kwan-Kyu; Kim, Dae-Dong; Kim, Cheorl-Ho; Magae, Junji; Kang, Dong Wook; Lee, Sang-Rae; Chang, Young-Chae

    2018-02-01

    Numerous anti-cancer agents inhibit cell cycle progression via a p53-dependent mechanism; however, other genes such as the proto-oncogene c-Myc are promising targets for anticancer therapy. In the present study, we provide evidence that ascochlorin, an isoprenoid antibiotic, is a non-toxic anti-cancer agent that induces G1 cell cycle arrest and p21 WAF1/CIP1 expression by downregulating of c-Myc protein expression. Ascochlorin promoted the G1 arrest, upregulated p53 and p21 WAF1/CIP1 , and downregulated c-Myc in HCT116 cells. In p53-deficient cells, ascochlorin enhanced the expression of G1 arrest-related genes except p53. Small interfering RNA (siRNA) mediated c-Myc silencing indicated that the transcriptional repression of c-Myc was related to ascochlorin-mediated modulation of p21 WAF1/CIP1 expression. Ascochlorin suppressed the stabilization of the c-Myc protein by inhibiting ERK and P70S6K/4EBP1 phosphorylation, whereas it had no effect on c-Myc degradation mediated by PI3K/Akt/GSK3β. The ERK inhibitor PD98059 and siRNA-mediated ERK silencing induced G1 arrest and p21 WAF1/CIP1 expression by downregulating c-Myc in p53-deficient cells. These results indicated that ascochlorin-induced G1 arrest is associated with the repression of ERK phosphorylation and c-Myc expression. Thus, we reveal a role for ascochlorin in inhibiting tumor growth via G1 arrest, and identify a novel regulatory mechanism for ERK/c-Myc. © 2017 Wiley Periodicals, Inc.

  15. HERG K+ channel-dependent apoptosis and cell cycle arrest in human glioblastoma cells.

    Directory of Open Access Journals (Sweden)

    Ingo Staudacher

    Full Text Available Glioblastoma (GB is associated with poor patient survival owing to uncontrolled tumor proliferation and resistance to apoptosis. Human ether-a-go-go-related gene K(+ channels (hERG; Kv11.1, KCNH2 are expressed in multiple cancer cells including GB and control cell proliferation and death. We hypothesized that pharmacological targeting of hERG protein would inhibit tumor growth by inducing apoptosis of GB cells. The small molecule hERG ligand doxazosin induced concentration-dependent apoptosis of human LNT-229 (EC50 = 35 µM and U87MG (EC50 = 29 µM GB cells, accompanied by cell cycle arrest in the G0/G1 phase. Apoptosis was associated with 64% reduction of hERG protein. HERG suppression via siRNA-mediated knock down mimicked pro-apoptotic effects of doxazosin. Antagonism of doxazosin binding by the non-apoptotic hERG ligand terazosin resulted in rescue of protein expression and in increased survival of GB cells. At the molecular level doxazosin-dependent apoptosis was characterized by activation of pro-apoptotic factors (phospho-erythropoietin-producing human hepatocellular carcinoma receptor tyrosine kinase A2, phospho-p38 mitogen-activated protein kinase, growth arrest and DNA damage inducible gene 153, cleaved caspases 9, 7, and 3, and by inactivation of anti-apoptotic poly-ADP-ribose-polymerase, respectively. In summary, this work identifies doxazosin as small molecule compound that promotes apoptosis and exerts anti-proliferative effects in human GB cells. Suppression of hERG protein is a crucial molecular event in GB cell apoptosis. Doxazosin and future derivatives are proposed as novel options for more effective GB treatment.

  16. Growth performance, innate immune responses and disease resistance of fingerling blunt snout bream, Megalobrama amblycephala adapted to different berberine-dietary feeding modes.

    Science.gov (United States)

    Xu, Wei-Na; Chen, Dan-Hong; Chen, Qing-Qing; Liu, Wen-Bin

    2017-09-01

    A 8-week feeding trial was conducted to evaluate the effect of different berberine-dietary feeding modes on growth, non-specific immune responses and disease resistance of blunt snout bream, Megalobrama amblycephala. Fish (average initial weight 4.70 ± 0.02 g) were fed two fat levels (5% and 10%) diets in three berberine-feeding modes (supplementing 50 mg/kg berberine continuously, two-week or four-week intervals) with four replicates, respectively. Then, fish were challenged by Aeromonas hydrophila and mortality was recorded for the next 96 h after feeding trial. The results showed that different feeding modes of berberine significantly influenced growth, innate immunity and antioxidant capability of fish. Fish fed normal diet with 50 mg/kg berberine at two-week interval mode reflected remarkably (P complement component 3 (C3) and complement component 4 (C4) concentrations were significantly (P feeding modes. Based on fish healthy improvement and feeding cost saving, blunt snout bream fed normal diet with 50 mg/kg berberine at two-week interval or fed high-fat diet with berberine at two-week or four-week intervals were optimal feeding mode, respectively. Copyright © 2017. Published by Elsevier Ltd.

  17. The effect of the siliceous composites of rice husk and green tea on growth and development of Fragaria × ananassa Duch. regenerants during the adaptation to ex vitro conditions

    Directory of Open Access Journals (Sweden)

    E. V. Ambros

    2015-10-01

    Full Text Available The effect of the composites of rice husk and green tea derived by mechanochemical method on growth and development of 6 cultivars of F. × ananassa Duch. during the adaptation to ex vitro conditions has been studied for the first time. The stimulating action of composite on both increment of the above-ground mass, and formation of the root system was revealed. The height of the rosette relative to the control was reliably increased by 1.3–4.1 times, the length of the root system – 1.1–2.0 times, the number of roots – 1.3–1.8 depending on the genotype.DOI: 10.14258/turczaninowia.18.3.5

  18. A Case of Morgagni Hernia Resulting with Respiratory Arrest

    Directory of Open Access Journals (Sweden)

    Cavit Çöl

    2011-05-01

    Full Text Available Morgagni’s hernia is seen at a rate of 3-4% among all diaphragmatic hernias. It develops from a defect in the pleuroperitoneal membrane. Herniation of the omentum is seen most commonly, that of the colon frequently, and herniation of small bowel and stomach is seen rarely. When being examined due to anemia and dyspnea, a 53-year-old male patient suffered from a respiratory arrest and was hence intubated and placed under treatment at the intensive care unit. On radiological examination, a giant diaphragmatic hernia was observed bilaterally, more marked on the right side. On laparotomy, especially on the right side, the caecum, the ascending colon, the transverse colon, the appendix, the omentum and part of the small bowel was seen to be herniated. Primary diaphragmatic repair + right hemicolectomy + end-to-end ileo-transversostomy was performed. We have reported this case because it was a giant hernia which caused respiratory arrest.

  19. [Hypothermia after cardiac arrest--underused method that saves lives].

    Science.gov (United States)

    Gornik, Ivan; Peklić, Marina; Gasparović, Vladimir

    2010-01-01

    Cardiorespiratory arrest causes ischemia and lesion of all organ systems, but the central nervous system is the most vulnerable. It is known that only few minutes of hypoperfusion and ischemia can cause irreversible damage to the brain which is the major frustration of reanimatology. Results of clinical trials suggest positive effects of hypothermia on survival and neurological recovery which led to including this method to Guidelines for resuscitation as a recommended standard method in post-resuscitation period for patients who have not regained consciousness. Methods for induction and maintenance of hypothermia are numerous and various, basically divided into invasive and non-invasive, each with its own advantages and disadvantages which are described in this paper. Despite recognised positive effects of mild therapeutic hypothermia after resuscitation from cardiac arrest, the method is not fully implemented as a standard method in post-resuscitation period.

  20. Cardiac arrest related to anaesthesia in Williams-Beuren syndrome.

    Science.gov (United States)

    Lucena Delgado, J; Sanabria Carretero, P; Durán la Fuente, P; Gónzalez Rocafort, A; Castro Parga, L; Reinoso Barbero, F

    2017-12-12

    Williams-Beuren syndrome is the clinical manifestation of a congenital genetic disorder in the elastin gene, among others. There is a history of cardiac arrest refractory to resuscitation manoeuvres in anaesthesia. The incidence of myocardial ischaemia is high during anaesthetic induction, but there are patients who do not have this condition yet also have had very serious cardiac events, and issues that are still to be resolved. Case descriptions will enable the common pathophysiological factors to be defined, and decrease morbidity and mortality. We report the case of a 3-year-old boy with cardiac arrest at induction, rescued with circulatory assistance with extracorporeal membrane oxygenation and hypothermia induced for cerebral protection. Copyright © 2017 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Publicado por Elsevier España, S.L.U. All rights reserved.

  1. Arrested of coalescence of emulsion droplets of arbitrary size

    Science.gov (United States)

    Mbanga, Badel L.; Burke, Christopher; Blair, Donald W.; Atherton, Timothy J.

    2013-03-01

    With applications ranging from food products to cosmetics via targeted drug delivery systems, structured anisotropic colloids provide an efficient way to control the structure, properties and functions of emulsions. When two fluid emulsion droplets are brought in contact, a reduction of the interfacial tension drives their coalescence into a larger droplet of the same total volume and reduced exposed area. This coalescence can be partially or totally hindered by the presence of nano or micron-size particles that coat the interface as in Pickering emulsions. We investigate numerically the dependance of the mechanical stability of these arrested shapes on the particles size, their shape anisotropy, their polydispersity, their interaction with the solvent, and the particle-particle interactions. We discuss structural shape changes that can be induced by tuning the particles interactions after arrest occurs, and provide design parameters for the relevant experiments.

  2. [Effect of thyroidectomy on the growth of the adult rat and on weight recovery after fasting].

    Science.gov (United States)

    Canguilhem, B; Lachambre, A

    1975-01-01

    After thyroidectomy, the growth of adult male rats is almost completely arrested. Body weight regulation is still present, but its decreased: actually, after fasting, thyroidectomized animals do not increase their daily food intake.

  3. Relationship between chest compression rates and outcomes from cardiac arrest.

    Science.gov (United States)

    Idris, Ahamed H; Guffey, Danielle; Aufderheide, Tom P; Brown, Siobhan; Morrison, Laurie J; Nichols, Patrick; Powell, Judy; Daya, Mohamud; Bigham, Blair L; Atkins, Dianne L; Berg, Robert; Davis, Dan; Stiell, Ian; Sopko, George; Nichol, Graham

    2012-06-19

    Guidelines for cardiopulmonary resuscitation recommend a chest compression rate of at least 100 compressions per minute. Animal and human studies have reported that blood flow is greatest with chest compression rates near 120/min, but few have reported rates used during out-of-hospital (OOH) cardiopulmonary resuscitation or the relationship between rate and outcome. The purpose of this study was to describe chest compression rates used by emergency medical services providers to resuscitate patients with OOH cardiac arrest and to determine the relationship between chest compression rate and outcome. Included were patients aged ≥ 20 years with OOH cardiac arrest treated by emergency medical services providers participating in the Resuscitation Outcomes Consortium. Data were abstracted from monitor-defibrillator recordings during cardiopulmonary resuscitation. Multiple logistic regression analysis assessed the association between chest compression rate and outcome. From December 2005 to May 2007, 3098 patients with OOH cardiac arrest were included in this study. Mean age was 67 ± 16 years, and 8.6% survived to hospital discharge. Mean compression rate was 112 ± 19/min. A curvilinear association between chest compression rate and return of spontaneous circulation was found in cubic spline models after multivariable adjustment (P=0.012). Return of spontaneous circulation rates peaked at a compression rate of ≈ 125/min and then declined. Chest compression rate was not significantly associated with survival to hospital discharge in multivariable categorical or cubic spline models. Chest compression rate was associated with return of spontaneous circulation but not with survival to hospital discharge in OOH cardiac arrest.

  4. Cerebral vasoconstriction in comatose patients resuscitated from a cardiac arrest?

    Science.gov (United States)

    Buunk, G; van der Hoeven, J G; Frölich, M; Meinders, A E

    1996-11-01

    To determine the role of cerebral vasoconstriction in the delayed hypoperfusion phase in comatose patients after cardiac arrest. Prospective study. Medical intensive care unit in a university hospital. 10 comatose patients (Glasgow Coma Score +/- 6)successfully resuscitated from a cardiac arrest occurring outside the hospital. We measured the pulsatility index (PI) and mean blood flow velocity (MFV) of the middle cerebral artery, the cerebral oxygen extraction ratio and jugular bulb levels of endothelin, nitrate, and cGMP during the first 24 h after cardiac arrest. The PI decreased significantly from 1.86 +/- 1.02 to 1.05 +/- 0.22 (p = 0.03). The MFV increased significantly from 29 +/- 10 to 62 +/- 25 cm/s (p = 0.003). Cerebral oxygen extraction ratio decreased also from 0.39 +/- 0.13 to 0.24 +/- 0.11 (p = 0.015). Endothelin levels were high but did not change during the study period. Nitrate levels varied widely and showed a slight but significant decrease from 37.1 mumol/l (median; 25th-75th percentiles: 26.8-61.6) to 31.3 mumol/l (22.1-39.6) (p = 0.04). Cyclic guanosine monophosphate levels increased significantly from 2.95 mumol/l (median; 25th-75th percentiles: 2.48-5.43) to 7.5 mumol/l (6.20-14.0) (p = 0.02). We found evidence of increased cerebrovascular resistance during the first 24 h after cardiac arrest with persistent high endothelin levels, gradually decreasing nitrate levels, and gradually increasing cGMP levels, This suggests that active cerebral vasoconstriction due to an imbalance between local vasodilators and vasoconstrictors plays a role in the delayed hypoperfusion phase.

  5. High voltage measurements on metal-oxide surge arresters

    Energy Technology Data Exchange (ETDEWEB)

    Yli-Aeyhoe, S. [Tampere University of Technology (Finland). High Voltage Laboratory

    2000-07-01

    Metal-oxide surge arresters (MOA) are used to prevent damages caused by overvoltages and currents. Because of the function of MOAs they have to be tested with high voltage and with high current. The aim of this seminar paper is to give some information how MOAs can be tested in laboratory circumstances and on- site. Few new test methods are introduced as well. (orig.)

  6. Outcome from paediatric cardiac arrest associated with trauma.

    Science.gov (United States)

    Crewdson, K; Lockey, D; Davies, G

    2007-10-01

    To examine survival rates for paediatric trauma patients requiring cardiopulmonary resuscitation (CPR) in the pre-hospital setting, and to identify characteristics that may be associated with survival. Ten-year retrospective trauma database review. An urban physician-led pre-hospital trauma service serving a population of approximately 7.5 million, in the United Kingdom. Eighty paediatric trauma patients (15 years or less) who received pre-hospital resuscitation following cardiorespiratory arrest between July 1994 and June 2004. Pre-hospital cardiopulmonary resuscitation. Survival to hospital discharge. Eighty children met inclusion criteria for the study. Nineteen (23.8%) were discharged alive from the emergency department and seven children (8.75%) survived to hospital discharge. Of the seven survivors, one had spinal cord injury. Two suffered asphyxial injury associated with blunt trauma and three sustained hypoxic insults following drowning or burns/smoke inhalation. In one patient with known congenital cardiac disease the cause of cardiac arrest was likely to have been medical. This study confirms the poor outcome for children requiring pre-hospital CPR following trauma. However, the results are better in this physician-attended group than in other studies where physicians were not present. They also suggest that cardiac arrest associated with trauma in children has a better outcome than in adults. In common with adults treated in this system, those patients with hypovolaemic cardiac arrest did not survive (Ann Emerg Med 2006;48:240-4). A large proportion of the survivors suffered hypoxic or asphyxial injuries. Targeted aggressive out-of-hospital resuscitation in certain patient groups can produce good outcomes.

  7. [Assessment of professional practices in treating cardiac arrest].

    Science.gov (United States)

    Mazon, Clara; Kerrou, Yamina

    2017-12-01

    An assessment of professional practices was carried out in 2013-2014 with the aim of improving the treatment of cardiac arrest in hospitals. Two methods were used: an assessment by questionnaire to evaluate theoretical knowledge and a practical assessment of external cardiac massage. The results highlight the need for greater knowledge. The use of cardiac massage must be included in continuing professional development. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  8. Adverse drug reactions in therapeutic hypothermia after cardiac arrest.

    Science.gov (United States)

    Witcher, Robert; Dzierba, Amy L; Kim, Catherine; Smithburger, Pamela L; Kane-Gill, Sandra L

    2017-03-01

    Therapeutic hypothermia (TH) improves survival and neurologic function in comatose survivors of cardiac arrest. Many medications used to support TH have altered pharmacokinetics and pharmacodynamics during this treatment. It is unknown if or at what frequency the medications used during TH cause adverse drug reactions (ADRs). A retrospective chart review was conducted for patients admitted to an intensive care unit (ICU) after cardiac arrest and treated with TH from January 2009 to June 2012 at two urban, university-affiliated, tertiary-care medical centres. Medications commonly used during TH were screened for association with significant ADRs (grade 3 or greater per Common Terminology Criteria for Adverse Events) using three published ADR detection instruments. A total of 229 patients were included, the majority being males with median age of 62 presenting with an out-of-hospital cardiac arrest in pulseless electrical activity or asystole. The most common comorbidities were hypertension, coronary artery disease, and diabetes mellitus. There were 670 possible ADRs and 69 probable ADRs identified. Of the 670 possible ADRs, propofol, fentanyl, and acetaminophen were the most common drugs associated with ADRs. Whereas fentanyl, insulin, and propofol were the most common drugs associated with a probable ADR. Patients were managed with TH for a median of 22 hours, with 38% of patients surviving to hospital discharge. Patients undergoing TH after cardiac arrest frequently experience possible adverse reactions associated with medications and the corresponding laboratory abnormalities are significant. There is a need for judicious use and close monitoring of drugs in the setting of TH until recommendations for dose adjustments are available to help prevent ADRs.

  9. Arresting Strategy Based on Dynamic Criminal Networks Changing over Time

    Directory of Open Access Journals (Sweden)

    Junqing Yuan

    2013-01-01

    Full Text Available We investigate a sequence of dynamic criminal networks on a time series based on the dynamic network analysis (DNA. According to the change of networks’ structure, networks’ variation trend is analyzed to forecast its future structure. Finally, an optimal arresting time and priority list are designed based on our analysis. Better results can be expected than that based on social network analysis (SNA.

  10. Distended Youth: Arrested Development in the Victorian Novel

    OpenAIRE

    Dean, Tyler Michael

    2014-01-01

    Distended Youth: Arrested Development in the Victorian Novel examines the figure of the eternal child, the childlike adult and other aberrant permutations of the figure who has neither fully exited childhood nor entered adulthood, and the ways in which such figures are made Gothic as an expression of a peculiarly Victorian anxiety surrounding the oft elided or adumbrated transition from innocent and generative childhood to corrupt and destructive adult. It uses Dickens's Bleak House, Brontë's...

  11. Brain Gray Matter MRI Morphometry for Neuroprognostication After Cardiac Arrest.

    Science.gov (United States)

    Silva, Stein; Peran, Patrice; Kerhuel, Lionel; Malagurski, Briguita; Chauveau, Nicolas; Bataille, Benoit; Lotterie, Jean Albert; Celsis, Pierre; Aubry, Florent; Citerio, Giuseppe; Jean, Betty; Chabanne, Russel; Perlbarg, Vincent; Velly, Lionel; Galanaud, Damien; Vanhaudenhuyse, Audrey; Fourcade, Olivier; Laureys, Steven; Puybasset, Louis

    2017-08-01

    We hypothesize that the combined use of MRI cortical thickness measurement and subcortical gray matter volumetry could provide an early and accurate in vivo assessment of the structural impact of cardiac arrest and therefore could be used for long-term neuroprognostication in this setting. Prospective cohort study. Five Intensive Critical Care Units affiliated to the University in Toulouse (France), Paris (France), Clermont-Ferrand (France), Liège (Belgium), and Monza (Italy). High-resolution anatomical T1-weighted images were acquired in 126 anoxic coma patients ("learning" sample) 16 ± 8 days after cardiac arrest and 70 matched controls. An additional sample of 18 anoxic coma patients, recruited in Toulouse, was used to test predictive model generalization ("test" sample). All patients were followed up 1 year after cardiac arrest. None. Cortical thickness was computed on the whole cortical ribbon, and deep gray matter volumetry was performed after automatic segmentation. Brain morphometric data were employed to create multivariate predictive models using learning machine techniques. Patients displayed significantly extensive cortical and subcortical brain volumes atrophy compared with controls. The accuracy of a predictive classifier, encompassing cortical and subcortical components, has a significant discriminative power (learning area under the curve = 0.87; test area under the curve = 0.96). The anatomical regions which volume changes were significantly related to patient's outcome were frontal cortex, posterior cingulate cortex, thalamus, putamen, pallidum, caudate, hippocampus, and brain stem. These findings are consistent with the hypothesis of pathologic disruption of a striatopallidal-thalamo-cortical mesocircuit induced by cardiac arrest and pave the way for the use of combined brain quantitative morphometry in this setting.

  12. Anaphylaxis with Latrodectus Antivenin Resulting in Cardiac Arrest

    OpenAIRE

    Murphy, Christine M.; Hong, Jeannie J.; Beuhler, Michael C.

    2011-01-01

    Latrodectus mactans antivenin is a safe and effective therapy for severe black widow spider envenomations when given to most patients. We report a case of a 37-year-old male with a history of asthma that was given L. mactans antivenin for symptoms related to a black widow envenomation and developed a severe anaphylactic reaction resulting in cardiac arrest. When traditional therapies failed, the patient was given methylene blue for anaphylactic shock resulting in a 30-h period of hemodynamic ...

  13. Adaptation Stories

    International Development Research Centre (IDRC) Digital Library (Canada)

    By Reg'

    formed a real foundation for endogenous, and, therefore, sustainable, strategies for adaptation to climate change. The stories reinforce what we already knew: that successful adaptation must come from the people who are living on the front lines, facing the many problems caused by climate change and climate variation.

  14. The Novel Human Influenza A(H7N9) Virus Is Naturally Adapted to Efficient Growth in Human Lung Tissue

    Science.gov (United States)

    Knepper, Jessica; Schierhorn, Kristina L.; Becher, Anne; Budt, Matthias; Tönnies, Mario; Bauer, Torsten T.; Schneider, Paul; Neudecker, Jens; Rückert, Jens C.; Gruber, Achim D.; Suttorp, Norbert; Schweiger, Brunhilde; Hippenstiel, Stefan; Hocke, Andreas C.; Wolff, Thorsten

    2013-01-01

    ABSTRACT A novel influenza A virus (IAV) of the H7N9 subtype has been isolated from severely diseased patients with pneumonia and acute respiratory distress syndrome and, apparently, from healthy poultry in March 2013 in Eastern China. We evaluated replication, tropism, and cytokine induction of the A/Anhui/1/2013 (H7N9) virus isolated from a fatal human infection and two low-pathogenic avian H7 subtype viruses in a human lung organ culture system mimicking infection of the lower respiratory tract. The A(H7N9) patient isolate replicated similarly well as a seasonal IAV in explanted human lung tissue, whereas avian H7 subtype viruses propagated poorly. Interestingly, the avian H7 strains provoked a strong antiviral type I interferon (IFN-I) response, whereas the A(H7N9) virus induced only low IFN levels. Nevertheless, all viruses analyzed were detected predominantly in type II pneumocytes, indicating that the A(H7N9) virus does not differ in its cellular tropism from other avian or human influenza viruses. Tissue culture-based studies suggested that the low induction of the IFN-β promoter correlated with an efficient suppression by the viral NS1 protein. These findings demonstrate that the zoonotic A(H7N9) virus is unusually well adapted to efficient propagation in human alveolar tissue, which most likely contributes to the severity of lower respiratory tract disease seen in many patients. PMID:24105764

  15. Advances in crack-arrest technology for reactor pressure vessels

    International Nuclear Information System (INIS)

    Bass, B.R.; Pugh, C.E.

    1988-01-01

    The Heavy-Section Steel Technology (HSST) Program at the Oak Ridge National Laboratory (ORNL) under the sponsorship of the US Nuclear Regulatory Commission is continuing to improve the understanding of conditions that govern the initiation, rapid propagation, arrest, and ductile tearing of cracks in reactor pressure vessel (RPV) steels. This paper describes recent advances in a coordinated effort being conducted under the HSST Program by ORNL and several subcontracting groups to develop the crack-arrest data base and the analytical tools required to construct inelastic dynamic fracture models for RPV steels. Large-scale tests are being carried out to generate crack-arrest toughness data at temperatures approaching and above the onset of Charpy upper-shelf behavior. Small- and intermediate-size specimens subjected to static and dynamic loading are being developed and tested to provide additional fracture data for RPV steels. Viscoplastic effects are being included in dynamic fracture models and computer programs and their utility validated through analyses of data from carefully controlled experiments. Recent studies are described that examine convergence problems associated with energy-based fracture parameters in viscoplastic-dynamic fracture applications. Alternative techniques that have potential for achieving convergent solutions for fracture parameters in the context of viscoplastic-dynamic models are discussed. 46 refs., 15 figs., 3 tabs

  16. Initiation and arrest - two approaches to pressure vessel safety

    International Nuclear Information System (INIS)

    Brumovsky, M.; Filip, R.; Stepanek, S.

    1976-01-01

    The safety analysis is described of the reactor pressure vessel related to brittle fracture based on the fracture mechanics theory using two different approximations, i.e., the Crack Arrest Temperature (CAT) or Nil Ductility Temperature (NDT), and fracture toughness. The variation of CAT with stress was determined for different steel specimens of 120 to 200 mm in thickness. A diagram is shown of CAT variation with stress allowing the determination of crack arrest temperature for all types of commonly used steels independently of the NDT initial value. The diagram also shows that the difference between fracture transition elastic (FTE) and NDT depends on the type of material and determines the value of the ΔTsub(sigma) factor typical of the safety coefficient. The so-called fracture toughness reference value Ksub(IR) is recommended for the computation of pressure vessel criticality. Also shown is a defect analysis diagram which may be used for the calculation of pressure vessel safety prior to and during operation and which may also be used in making the decision on what crack sizes are critical, what cracks may be arrested and what cracks are likely to expand. The diagram is also important for the fact that it is material-independent and may be employed for the estimates of pre-operational and operational inspections and for pressure vessel life prediction. It is generally applicable to materials of greater thickness in the region where the validity of linear elastic fracture mechanics is guaranteed. (J.P.)

  17. Predicting survival causes after out of hospital cardiac arrest using data mining method.

    Science.gov (United States)

    Le Duff, Franck; Muntean, Cristian; Cuggia, Marc; Mabo, Philippe

    2004-01-01

    The prognosis of life for patients with heart failure remains poor. By using data mining methods, the purpose of this study was to evaluate the most important criteria for predicting patient survival and to profile patients to estimate their survival chances together with the most appropriate technique for health care. Five hundred and thirty three patients who had suffered from cardiac arrest were included in the analysis. We performed classical statistical analysis and data mining analysis using mainly Bayesian networks. The mean age of the 533 patients was 63 (+/- 17) and the sample was composed of 390 (73 %) men and 143 (27 %) women. Cardiac arrest was observed at home for 411 (77 %) patients, in a public place for 62 (12 %) patients and on a public highway for 60 (11 %) patients. The belief network of the variables showed that the probability of remaining alive after heart failure is directly associated to five variables: age, sex, the initial cardiac rhythm, the origin of the heart failure and specialized resuscitation techniques employed. Data mining methods could help clinicians to predict the survival of patients and then adapt their practices accordingly. This work could be carried out for each medical procedure or medical problem and it would become possible to build a decision tree rapidly with the data of a service or a physician. The comparison between classic analysis and data mining analysis showed us the contribution of the data mining method for sorting variables and quickly conclude on the importance or the impact of the data and variables on the criterion of the study. The main limit of the method is knowledge acquisition and the necessity to gather sufficient data to produce a relevant model.

  18. Copepods in ice-covered seas—Distribution, adaptations to seasonally limited food, metabolism, growth patterns and life cycle strategies in polar seas

    Science.gov (United States)

    Conover, R. J.; Huntley, M.

    1991-07-01

    While a seasonal ice cover limits light penetration into both polar seas for up to ten months a year, its presence is not entirely negative. The mixed layer under sea ice will generally be shallower than in open water at the same latitude and season. Ice forms a substrate on which primary production can be concentrated, a condition which contrasts with the generally dilute nutritional conditions which prevail in the remaining ocean. The combination of a shallow, generally stable mixed layer with a close proximity to abundant food make the under-ice zone a suitable nursery for both pelagic and benthic species, an upside-down benthos for opportunistic substrate browsers, and a rich feeding environment for species often considered to be neritic in temperate environments. Where the ice cover is not continuous there may be a retreating ice edge that facilitates the seasonal production of phytoplankton primarily through increased stability from the melt water. Ice edge blooms similarly encourage secondary production by pelagic animals. Pseudocalanus acuspes, which may be the most abundant and productive copepod in north polar latitudes, initiates growth at the start of the "spring bloom" of epontic algae, reaching sexual maturity at breakup or slightly before. In the Southern Hemisphere, the small neritic copepod Paralabidocera antarctica and adult krill have been observed to utilize ice algae. Calanus hyperboreus breeds in the dark season at depth and its buoyant eggs, slowly developing on the ascent, reach the under-ice layer in April as nauplii ready to benefit from the primary production there. On the other hand, C. glacialis may initiate ontogenetic migrations and reproduction in response to increased erosion of ice algae due to solar warming and melting at the ice-water interface. While the same species in a phytoplankton bloom near the ice edge reproduces actively, those under still-consolidated ice nearby can have immature gonads. Diel migration and diel feeding

  19. Carbon adaptation influence the antagonistic ability of ...

    African Journals Online (AJOL)

    Jane

    2011-10-24

    Oct 24, 2011 ... adaptation to carbon-limited conditions did not alter the diameter of bacterial colony on MM agar. However, the growth of the adapted strain V4-C was superior to the parental strain V4 in MM broth, but was unaffected in. 1/20th strength NB broth and in 1/20th strength KMB broth. The growth of the adapted ...

  20. Explaining discrepancies in arrest rates between Black and White male juveniles.

    Science.gov (United States)

    Fite, Paula J; Wynn, Porche'; Pardini, Dustin A

    2009-10-01

    The authors investigated discrepancies in arrest rates between Black and White male juveniles by examining the role of early risk factors for arrest. Two hypotheses were evaluated: (a) Disproportionate minority arrest is due to increased exposure to early risk factors, and (b) a differential sensitivity to early risk factors contributes to disproportionate minority arrest. The study included 481 Black and White boys who were followed from childhood to early adulthood. A higher incidence of early risk factors accounted for racial differences related to any juvenile arrest, as well as differences in violence- and theft-related arrests. However, increased exposure to early risk factors did not explain race differences in drug-related arrests. Minimal support was found for the hypothesis that a differential sensitivity to risk factors accounts for disproportionate rate of minority male arrests. In sum, most racial discrepancies in juvenile male arrests were accounted for by an increased exposure to childhood risk factors. Specifically, Black boys were more likely to display early conduct problems and low academic achievement and experience poor parent-child communication, peer delinquency, and neighborhood problems, which increased their risk for juvenile arrest. (c) 2009 APA, all rights reserved.

  1. An La-related protein controls cell cycle arrest by nuclear retrograde transport of tRNAs during diapause formation in Artemia.

    Science.gov (United States)

    Chen, Dian-Fu; Lin, Cheng; Wang, Hong-Liang; Zhang, Li; Dai, Li; Jia, Sheng-Nan; Zhou, Rong; Li, Ran; Yang, Jin-Shu; Yang, Fan; Clegg, James S; Nagasawa, Hiromichi; Yang, Wei-Jun

    2016-03-03

    In eukaryotes, tRNA trafficking between the nucleus and cytoplasm is a complex process connected with cell cycle regulation. Such trafficking is therefore of fundamental importance in cell biology, and disruption of this process has grave consequences for cell viability and survival. To cope with harsh habitats, Artemia has evolved a special reproductive mode to release encysted embryos in which cell division can be maintained in a dormancy state for a long period. Using Artemia as a peculiar model of the cell cycle, an La-related protein from Artemia, named Ar-Larp, was found to bind to tRNA and accumulate in the nucleus, leading to cell cycle arrest and controlling the onset of diapause formation in Artemia. Furthermore, exogenous gene expression of Ar-Larp could induce cell cycle arrest in cancer cells and suppress tumor growth in a xenograft mouse model, similar to the results obtained in diapause embryos of Artemia. Our study of tRNA trafficking indicated that Ar-Larp controls cell cycle arrest by binding to tRNAs and influencing their retrograde movement from the cytoplasm to the nucleus, which is connected to pathways involved in cell cycle checkpoints. These findings in Artemia offer new insights into the mechanism underlying cell cycle arrest regulation, as well as providing a potentially novel approach to study tRNA retrograde movement from the cytoplasm to the nucleus.

  2. Sulforaphane, a Dietary Isothiocyanate, Induces G2/M Arrest in Cervical Cancer Cells through CyclinB1 Downregulation and GADD45β/CDC2 Association

    Directory of Open Access Journals (Sweden)

    Ya-Min Cheng

    2016-09-01

    Full Text Available Globally, cervical cancer is the most common malignancy affecting women. The main treatment methods for this type of cancer include conization or hysterectomy procedures. Sulforaphane (SFN is a natural, compound-based drug derived from dietary isothiocyanates which has previously been shown to possess potent anti-tumor and chemopreventive effects against several types of cancer. The present study investigated the effects of SFN on anti-proliferation and G2/M phase cell cycle arrest in cervical cancer cell lines (Cx, CxWJ, and HeLa. We found that cytotoxicity is associated with an accumulation of cells in the G2/M phases of the cell-cycle. Treatment with SFN led to cell cycle arrest as well as the down-regulation of Cyclin B1 expression, but not of CDC2 expression. In addition, the effects of GADD45β gene activation in cell cycle arrest increase proportionally with the dose of SFN; however, mitotic delay and the inhibition of proliferation both depend on the dosage of SFN used to treat cancer cells. These results indicate that SFN may delay the development of cancer by arresting cell growth in the G2/M phase via down-regulation of Cyclin B1 gene expression, dissociation of the cyclin B1/CDC2 complex, and up-regulation of GADD45β proteins.

  3. Toothbrush Adaptations.

    Science.gov (United States)

    Exceptional Parent, 1987

    1987-01-01

    Suggestions are presented for helping disabled individuals learn to use or adapt toothbrushes for proper dental care. A directory lists dental health instructional materials available from various organizations. (CB)

  4. Ambiguous Adaptation

    DEFF Research Database (Denmark)

    Møller Larsen, Marcus; Lyngsie, Jacob

    2017-01-01

    intense relational mechanisms provide an effective means for contingency adaptation and therefore reduce the probability of premature termination. However, in situations where relationships are already governed by longer duration contracts, we argue that investments in relational mechanism create...

  5. C.A.U.S.E.: Cardiac arrest ultra-sound exam--a better approach to managing patients in primary non-arrhythmogenic cardiac arrest.

    Science.gov (United States)

    Hernandez, Caleb; Shuler, Klaus; Hannan, Hashibul; Sonyika, Chionesu; Likourezos, Antonios; Marshall, John

    2008-02-01

    Cardiac arrest is a condition frequently encountered by physicians in the hospital setting including the Emergency Department, Intensive Care Unit and medical/surgical wards. This paper reviews the current literature involving the use of ultrasound in resuscitation and proposes an algorithmic approach for the use of ultrasound during cardiac arrest. At present there is the need for a means of differentiating between various causes of cardiac arrest, which are not a direct result of a primary ventricular arrhythmia. Identifying the cause of pulseless electrical activity or asystole is important as the underlying cause is what guides management in such cases. This approach, incorporating ultrasound to manage cardiac arrest aids in the diagnosis of the most common and easily reversible causes of cardiac arrest not caused by primary ventricular arrhythmia, namely; severe hypovolemia, tension pneumothorax, cardiac tamponade, and massive pulmonary embolus. These four conditions are addressed in this paper using four accepted emergency ultrasound applications to be performed during resuscitation of a cardiac arrest patient with the aim of determining the underlying cause of a cardiac arrest. Identifying the underlying cause of cardiac arrest represents the one of the greatest challenges of managing patients with asystole or PEA and accurate determination has the potential to improve management by guiding therapeutic decisions. We include several clinical images demonstrating examples of cardiac tamponade, massive pulmonary embolus, and severe hypovolemia secondary to abdominal aortic aneurysm. In conclusion, this protocol has the potential to reduce the time required to determine the etiology of a cardiac arrest and thus decrease the time between arrest and appropriate therapy.

  6. Ambiguous Adaptation

    DEFF Research Database (Denmark)

    Møller Larsen, Marcus; Lyngsie, Jacob

    We investigate why some exchange relationships terminate prematurely. We argue that investments in informal governance structures induce premature termination in relationships already governed by formal contracts. The formalized adaptive behavior of formal governance structures and the flexible...... and reciprocal adaptation of informal governance structure create ambiguity in situations of contingencies, which, subsequently, increases the likelihood of premature relationship termination. Using a large sample of exchange relationships in the global service provider industry, we find support for a hypothesis...

  7. Strategic Adaptation

    DEFF Research Database (Denmark)

    Andersen, Torben Juul

    2015-01-01

    This article provides an overview of theoretical contributions that have influenced the discourse around strategic adaptation including contingency perspectives, strategic fit reasoning, decision structure, information processing, corporate entrepreneurship, and strategy process. The related...... concepts of strategic renewal, dynamic managerial capabilities, dynamic capabilities, and strategic response capabilities are discussed and contextualized against strategic responsiveness. The insights derived from this article are used to outline the contours of a dynamic process of strategic adaptation...

  8. Adaptive ethnography

    DEFF Research Database (Denmark)

    Berth, Mette

    2005-01-01

    This paper focuses on the use of an adaptive ethnography when studying such phenomena as young people's use of mobile media in a learning pers