
Sample records for acyrthosiphon pisum hemiptera

  1. Respiratory metabolism of the pea aphid, Acyrthosiphon pisum (Hemipetra: Aphididae)

    Czech Academy of Sciences Publication Activity Database

    Sláma, Karel; Jedlička, Pavel


    Roč. 109, č. 4 (2012), s. 491-502. ISSN 1210-5759 R&D Projects: GA ČR GP522/09/P382 Institutional support: RVO:60077344 Keywords : Hemiptera * Aphididae * Acyrthosiphon pisum Subject RIV: ED - Physiology Impact factor: 0.918, year: 2012

  2. Evaluation of the susceptibility of the pea aphid, Acyrthosiphon pisum, to a selection of novel biorational insecticides using an artificial diet


    Sadeghi, Amin; Van Damme, Els; Smagghe, Guy


    An improved technique was developed to assay the toxicity of insecticides against aphids using an artificial diet. The susceptibility of the pea aphid Acyrthosiphon pisum (Harris) (Hemiptera: Aphidoidea) was determined for a selection of novel biorational insecticides, each representing a novel mode of action. Flonicamid, a novel systemic insecticide with selective activity as feeding blocker against sucking insects, showed high toxicity against first-instar A. pisum nymphs with an LC50 of 20...

  3. Genome sequence of the pea aphid Acyrthosiphon pisum

    DEFF Research Database (Denmark)

    Richards, S.; Gibbs, R. A.; Gerardo, N. M.;


    Aphids are important agricultural pests and also biological models for studies of insect-plant interactions, symbiosis, virus vectoring, and the developmental causes of extreme phenotypic plasticity. Here we present the 464 Mb draft genome assembly of the pea aphid Acyrthosiphon pisum. This first...... published whole genome sequence of a basal hemimetabolous insect provides an outgroup to the multiple published genomes of holometabolous insects. Pea aphids are host-plant specialists, they can reproduce both sexually and asexually, and they have coevolved with an obligate bacterial symbiont. Here we...

  4. Neonicotinoid Binding, Toxicity and Expression of Nicotinic Acetylcholine Receptor Subunits in the Aphid Acyrthosiphon pisum


    Taillebois, Emiliane; Beloula, Abdelhamid; Quinchard, Sophie; Jaubert-Possamai, Stéphanie; Daguin, Antoine; Servent, Denis; Tagu, Denis; Thany, Steeve H.; Tricoire-Leignel, Helene


    Neonicotinoid insecticides act on nicotinic acetylcholine receptor and are particularly effective against sucking pests. They are widely used in crops protection to fight against aphids, which cause severe damage. In the present study we evaluated the susceptibility of the pea aphid Acyrthosiphon pisum to the commonly used neonicotinoid insecticides imidacloprid (IMI), thiamethoxam (TMX) and clothianidin (CLT). Binding studies on aphid membrane preparations revealed the existence of high and ...

  5. Glutathione S-transferases of Aulacorthum solani and Acyrthosiphon pisum: partial purification and characterization.


    Francis, Frédéric; Haubruge, Eric; Gaspar, Charles; Dierickx, P. J.


    Glutathione S-transferases (GST) play an important role in the detoxification of many substances including allelochemicals from plants. Brassicaceae plants contain glucosinolates and emit volatile isothiocyanates which affect the GST system. A comparison of the GST of two aphid species, the generalist Aulacorthum solani found on Brassicaceae and the Fabaceae specialist Acyrthosiphon pisum, was made to try to explain their respective feeding behaviour. Differences of GST were determined among ...

  6. Functional characterization of the adipokinetic hormone in the pea aphid, Acyrthosiphon pisum

    Czech Academy of Sciences Publication Activity Database

    Jedlička, Pavel; Steinbauerová, V.; Šimek, Petr; Zahradníčková, Helena


    Roč. 162, č. 1 (2012), s. 51-58. ISSN 1095-6433 R&D Projects: GA ČR GP522/09/P382 Grant ostatní: European Union FP7(CZ) MOBITAG, GA 229518 Institutional research plan: CEZ:AV0Z50070508 Keywords : adipokinetic hormone * Acyrthosiphon pisum * neuropeptide Subject RIV: ED - Physiology Impact factor: 2.167, year: 2012

  7. Nicotinic Acetylcholine Receptor Gene Family of the Pea Aphid, Acyrthosiphon pisum

    Institute of Scientific and Technical Information of China (English)

    LIU Yi-peng; LIN Ke-jian; LIU Yang; GUI Fu-rong; WANG Gui-rong


    The nicotinic acetylcholine receptors (nAchRs) are cholinergic receptors that form ligand-gated ion channels by ifve subunits in insect and vertebrate nervous systems. The insect nAChR is the molecular target of a class of insecticides, neonicotinoids. Here, we identiifed and cloned 11 candidate nAChR subunit genes in Acyrthosiphon pisum using genome-based bioinformatics combined modern molecular techniques. Most A. pisum nAChRs including α1, α2, α3, α4, α6, α8, and β1 show highly sequence identities with the counterparts of other insects examined. Expression proifles analysis showed that all subunit genes were expressed in adult head. At least two subunits have alternative splicing that obviously increase A. pisum nicotinic receptor diversity. This study will be invaluable for exploring the molecular mechanisms of neonicotinoid-like insecticides in sucking pests, and for ultimately establishing the screening platform of novel insecticides.

  8. Modification of Cry4Aa toward Improved Toxin Processing in the Gut of the Pea Aphid, Acyrthosiphon pisum.

    Directory of Open Access Journals (Sweden)

    Michael A Rausch

    Full Text Available Aphids are sap-sucking insects (order: Hemiptera that cause extensive damage to a wide range of agricultural crops. Our goal was to optimize a naturally occurring insecticidal crystalline (Cry toxins produced by the soil-dwelling bacterium Bacillus thuringiensis for use against the pea aphid, Acyrthosiphon pisum. On the basis that activation of the Cry4Aa toxin is a rate-limiting factor contributing to the relatively low aphicidal activity of this toxin, we introduced cathepsin L and cathepsin B cleavage sites into Cry4Aa for rapid activation in the aphid gut environment. Incubation of modified Cry4Aa and aphid proteases in vitro demonstrated enhanced processing of the toxin into the active form for some of the modified constructs relative to non-modified Cry4Aa. Aphids fed artificial diet with toxin at a final concentration of 125 μg/ml showed enhanced mortality after two days for one of the four modified constructs. Although only modest toxin improvement was achieved by use of this strategy, such specific toxin modifications designed to overcome factors that limit aphid toxicity could be applied toward managing aphid populations via transgenic plant resistance.

  9. Glutathione S-transferases of Aulacorthum solani and Acyrthosiphon pisum: partial purification and characterization. (United States)

    Francis, F; Haubruge, E; Gaspar, C; Dierickx, P J


    Glutathione S-transferases (GST) play an important role in the detoxification of many substances including allelochemicals from plants. Brassicaceae plants contain glucosinolates and emit volatile isothiocyanates which affect the GST system. A comparison of the GST of two aphid species, the generalist Aulacorthum solani found on Brassicaceae and the Fabaceae specialist Acyrthosiphon pisum, was made to try to explain their respective feeding behaviour. Differences of GST were determined among the two aphid species based on purification by affinity chromatography, SDS-PAGE and on kinetic studies. Purification yields using an epoxy-activated Sepharose 6B column were highly different for the two aphid species (18% and 34% for A. solani and A. pisum, respectively). These variations were confirmed by SDS-PAGE. While only a 27-kDa band was observed for A. pisum, two bands of approximately 25-kDa were visualized for the generalist aphid, A. solani. Considering the kinetic results, differences of Km and Vmax were observed following the aphid species when a range of substrates (CDNB and DCNB) and GSH concentrations were tested. Studies on the detoxification enzymes of generalist and specialist herbivores would be undertaken to determine accurately the effect of the host plant on the organisms eating them, particularly in terms of biochemical and ecological advantages. PMID:11337260

  10. Diapause in the pea aphid (Acyrthosiphon pisum is a slowing but not a cessation of development

    Directory of Open Access Journals (Sweden)

    Sisk Geoffroy C


    Full Text Available Abstract Background Many insects undergo a period of arrested development, called diapause, to avoid seasonally recurring adverse conditions. Whilst the phenology and endocrinology of insect diapause have been well studied, there has been comparatively little research into the developmental details of diapause. We investigated developmental aspects of diapause in sexually-produced embryos of the pea aphid, Acyrthosiphon pisum. Results We found that early stages of embryogenesis progressed at a temperature-independent rate, characteristic of diapause, whereas later stages of embryogenesis progressed at a temperature-dependent rate. However, embryos maintained at very high temperatures during the temperature-independent stage showed severe developmental abnormalities. Under no temperature regime did embryos display a distinct resting stage. Rather, morphological development progressed slowly but continuously throughout embryogenesis. Conclusion Diapause in the pea aphid, and perhaps in many other insects, is a temperature-independent slowing but not a cessation of morphological development. This suggests that the mechanisms limiting developmental rate during diapause may be the same as those controlling developmental rate at other stages of growth.

  11. Neonicotinoid binding, toxicity and expression of nicotinic acetylcholine receptor subunits in the aphid Acyrthosiphon pisum.

    Directory of Open Access Journals (Sweden)

    Emiliane Taillebois

    Full Text Available Neonicotinoid insecticides act on nicotinic acetylcholine receptor and are particularly effective against sucking pests. They are widely used in crops protection to fight against aphids, which cause severe damage. In the present study we evaluated the susceptibility of the pea aphid Acyrthosiphon pisum to the commonly used neonicotinoid insecticides imidacloprid (IMI, thiamethoxam (TMX and clothianidin (CLT. Binding studies on aphid membrane preparations revealed the existence of high and low-affinity binding sites for [3H]-IMI (Kd of 0.16 ± 0.04 nM and 41.7 ± 5.9 nM and for the nicotinic antagonist [125I]-α-bungarotoxin (Kd of 0.008 ± 0.002 nM and 1.135 ± 0.213 nM. Competitive binding experiments demonstrated that TMX displayed a higher affinity than IMI for [125I]-α-bungarotoxin binding sites while CLT affinity was similar for both [125I]-α-bungarotoxin and [3H]-IMI binding sites. Interestingly, toxicological studies revealed that at 48 h, IMI (LC50 = 0.038 µg/ml and TMX (LC50 = 0.034 µg/ml were more toxic than CLT (LC50 = 0.118 µg/ml. The effect of TMX could be associated to its metabolite CLT as demonstrated by HPLC/MS analysis. In addition, we found that aphid larvae treated either with IMI, TMX or CLT showed a strong variation of nAChR subunit expression. Using semi-quantitative PCR experiments, we detected for all insecticides an increase of Apisumα10 and Apisumβ1 expressions levels, whereas Apisumβ2 expression decreased. Moreover, some other receptor subunits seemed to be differently regulated according to the insecticide used. Finally, we also demonstrated that nAChR subunit expression differed during pea aphid development. Altogether these results highlight species specificity that should be taken into account in pest management strategies.

  12. Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum

    Directory of Open Access Journals (Sweden)

    Leterme Nathalie


    Full Text Available Abstract Background Post-transcriptional regulation in eukaryotes can be operated through microRNA (miRNAs mediated gene silencing. MiRNAs are small (18-25 nucleotides non-coding RNAs that play crucial role in regulation of gene expression in eukaryotes. In insects, miRNAs have been shown to be involved in multiple mechanisms such as embryonic development, tissue differentiation, metamorphosis or circadian rhythm. Insect miRNAs have been identified in different species belonging to five orders: Coleoptera, Diptera, Hymenoptera, Lepidoptera and Orthoptera. Results We developed high throughput Solexa sequencing and bioinformatic analyses of the genome of the pea aphid Acyrthosiphon pisum in order to identify the first miRNAs from a hemipteran insect. By combining these methods we identified 149 miRNAs including 55 conserved and 94 new miRNAs. Moreover, we investigated the regulation of these miRNAs in different alternative morphs of the pea aphid by analysing the expression of miRNAs across the switch of reproduction mode. Pea aphid microRNA sequences have been posted to miRBase: Conclusions Our study has identified candidates as putative regulators involved in reproductive polyphenism in aphids and opens new avenues for further functional analyses.

  13. Stable isotope studies reveal pathways for the incorporation of non-essential amino acids in Acyrthosiphon pisum (pea aphids). (United States)

    Haribal, Meena; Jander, Georg


    Plant roots incorporate inorganic nitrogen into the amino acids glutamine, glutamic acid, asparagine and aspartic acid, which together serve as the primary metabolites of nitrogen transport to other tissues. Given the preponderance of these four amino acids, phloem sap is a nutritionally unbalanced diet for phloem-feeding insects. Therefore, aphids and other phloem feeders typically rely on microbial symbionts for the synthesis of essential amino acids. To investigate the metabolism of the four main transport amino acids by the pea aphid (Acyrthosiphon pisum), and its Buchnera aphidicola endosymbionts, aphids were fed defined diets with stable isotope-labeled glutamine, glutamic acid, asparagine or aspartic acid (U-(13)C, U-(15)N; U-(15)N; α-(15)N; or γ-(15)N). The metabolic fate of the dietary (15)N and (13)C was traced using gas chromatography-mass spectrometry (GC-MS). Nitrogen was the major contributor to the observed amino acid isotopomers with one additional unit mass (M+1). However, there was differential incorporation, with the amine nitrogen of asparagine being incorporated into other amino acids more efficiently than the amide nitrogen. Higher isotopomers (M+2, M+3 and M+4) indicated the incorporation of varying numbers of (13)C atoms into essential amino acids. GC-MS assays also showed that, even with an excess of dietary labeled glutamine, glutamic acid, asparagine or aspartic acid, the overall content of these amino acids in aphid bodies was mostly the product of catabolism of dietary amino acids and subsequent re-synthesis within the aphids. Thus, these predominant dietary amino acids are not passed directly to Buchnera endosymbionts for synthesis of essential amino acids, but are rather are produced de novo, most likely by endogenous aphid enzymes. PMID:26632455

  14. Solenopsis invicta virus 3: mapping of structural proteins, ribosomal frameshifting, and similarities to Acyrthosiphon pisum virus and Kelp fly virus.

    Directory of Open Access Journals (Sweden)

    Steven M Valles

    Full Text Available Solenopsis invicta virus 3 (SINV-3 is a positive-sense single-stranded RNA virus that infects the red imported fire ant, Solenopsis invicta. We show that the second open reading frame (ORF of the dicistronic genome is expressed via a frameshifting mechanism and that the sequences encoding the structural proteins map to both ORF2 and the 3' end of ORF1, downstream of the sequence that encodes the RNA-dependent RNA polymerase. The genome organization and structural protein expression strategy resemble those of Acyrthosiphon pisum virus (APV, an aphid virus. The capsid protein that is encoded by the 3' end of ORF1 in SINV-3 and APV is predicted to have a jelly-roll fold similar to the capsid proteins of picornaviruses and caliciviruses. The capsid-extension protein that is produced by frameshifting, includes the jelly-roll fold domain encoded by ORF1 as its N-terminus, while the C-terminus encoded by the 5' half of ORF2 has no clear homology with other viral structural proteins. A third protein, encoded by the 3' half of ORF2, is associated with purified virions at sub-stoichiometric ratios. Although the structural proteins can be translated from the genomic RNA, we show that SINV-3 also produces a subgenomic RNA encoding the structural proteins. Circumstantial evidence suggests that APV may also produce such a subgenomic RNA. Both SINV-3 and APV are unclassified picorna-like viruses distantly related to members of the order Picornavirales and the family Caliciviridae. Within this grouping, features of the genome organization and capsid domain structure of SINV-3 and APV appear more similar to caliciviruses, perhaps suggesting the basis for a "Calicivirales" order.

  15. Identification of distinct quantitative trait loci associated with defence against the closely related aphids Acyrthosiphon pisum and A. kondoi in Medicago truncatula

    KAUST Repository

    Guo, Su-Min


    Aphids are a major family of plant insect pests. Medicago truncatula and Acyrthosiphon pisum (pea aphid, PA) are model species with a suite of resources available to help dissect the mechanism underlying plant-aphid interactions. A previous study focused on monogenic and relatively strong resistance in M. truncatula to PA and other aphid species. In this study a moderate resistance to PA was characterized in detail in the M. truncatula line A17 and compared with the highly susceptible line A20 and the more resistant line Jester. The results show that PA resistance in A17 involves both antibiosis and tolerance, and that resistance is phloem based. Quantitative trait locus (QTL) analysis using a recombinant inbred line (RIL) population (n=114) from a cross between A17 and A20 revealed that one locus, which co-segregated with AIN (Acyrthosiphon-induced necrosis) on chromosome 3, is responsible for the reduction of aphid biomass (indicator of antibiosis) for both PA and bluegreen aphid (BGA, A. kondoi), albeit to a lesser degree for PA than BGA. Interestingly, two independent loci on chromosomes 5 and 3 were identified for the plant biomass reduction (indicator of plant tolerance) by PA and BGA, respectively, demonstrating that the plant\\'s tolerance response to these two closely related aphid species is distinct. Together with previously identified major resistant (R) genes, the QTLs identified in this study are powerful tools to understand fully the spectrum of plant defence against sap-sucking insects and provide opportunities for breeders to generate effective and sustainable strategies for aphid control. 2012 The Author.

  16. Acyrthosiphon pisum AQP2: a multifunctional insect aquaglyceroporin

    Czech Academy of Sciences Publication Activity Database

    Wallace, I. S.; Shakesby, A. J.; Hwang, J. H.; Choi, W. G.; Martínková, Natália; Douglas, A. E.; Roberts, D. M.


    Roč. 1818, č. 3 (2012), s. 627-635. ISSN 0005-2736 Institutional research plan: CEZ:AV0Z60930519 Keywords : aphid * Buchnera aphidicola * channel proteins * osmoregulation * phylogeny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.389, year: 2012

  17. Efficacy of different chemicals for the control of aphid (acyrthosiphon pisum) on guar (cymopisis tetragonolobus) crop

    International Nuclear Information System (INIS)

    An experiment was carried out to evaluate the efficacy of different chemicals far the control of aphid on guar crop at Adaptive Research Farm Karor during the three successive kharif seasons i.e. 2006-07 and 2008. The experiments were laid out in Randomized Complete Block Design with three replications and five treatments viz T1=control, T2 Bifenthrin at the rate 375 ml ha/sup -1/, T3=Primore 50PP at the rate 850 ml ha/sup -1/ T4=Furathiocrab at the rate 750 ml ha/sup -1/ and T5=Carbosulfan at the rate 1250 ml ha/sup -1/. All the treatments (T4) caused significant decrease in the Pest population as compared to the control. Treatment (T4) where Furathiocrab was applied at the rate. 750 ml ha/sup -1/ during the years 2006, 2007 and 2008 respectively. (author)

  18. Isolation and identification of culturable bacteria from honeydew of whitefly, Bemisia tabaci (G.) (Hemiptera: Aleyrodidae)


    Roopa H.K.; Rebijith K.B.; Asokan R.; Riaz Mahmood; Krishna Kumar N.K.


    Bemisia tabaci (G.) is an important pest and a vector of Gemini viruses infecting plants. During the process of feeding B. tabaci excretes honeydew which is rich in nutrients, and an excellent medium for microbial growth. Recent report proved that volatile emitted by the honeydew associated bacteria of aphid, Acyrthosiphon pisum Harris was involved in natural enemy calling. Thus understanding the honeydew associated bacteria is of paramount importance from the non-chemical method of insect pe...

  19. Taxonomy Icon Data: pea aphid [Taxonomy Icon

    Lifescience Database Archive (English)

    Full Text Available pea aphid Acyrthosiphon pisum Arthropoda Acyrthosiphon_pisum_L.png Acyrthosiphon_pisum_NL.png Acyrthosip...hon_pisum_S.png Acyrthosiphon_pisum_NS.png http:...// ...

  20. Genetic Mapping of a Major Resistance Gene to Pea Aphid (Acyrthosipon pisum) in the Model Legume Medicago truncatula. (United States)

    Kamphuis, Lars G; Guo, Su-Min; Gao, Ling-Ling; Singh, Karam B


    Resistance to the Australian pea aphid (PA; Acyrthosiphon pisum) biotype in cultivar Jester of the model legume Medicago truncatula is mediated by a single dominant gene and is phloem-mediated. The genetic map position for this resistance gene, APR (Acyrthosiphon pisum resistance), is provided and shows that APR maps 39 centiMorgans (cM) distal of the A. kondoi resistance (AKR) locus, which mediates resistance to a closely related species of the same genus bluegreen aphid (A. kondoi). The APR region on chromosome 3 is dense in classical nucleotide binding site leucine-rich repeats (NLRs) and overlaps with the region harbouring the RAP1 gene which confers resistance to a European PA biotype in the accession Jemalong A17. Further screening of a core collection of M. truncatula accessions identified seven lines with strong resistance to PA. Allelism experiments showed that the single dominant resistance to PA in M. truncatula accessions SA10481 and SA1516 are allelic to SA10733, the donor of the APR locus in cultivar Jester. While it remains unclear whether there are multiple PA resistance genes in an R-gene cluster or the resistance loci identified in the other M. truncatula accessions are allelic to APR, the introgression of APR into current M. truncatula cultivars will provide more durable resistance to PA. PMID:27483247

  1. Optimization of Agroinfiltration in Pisum sativum Provides a New Tool for Studying the Salivary Protein Functions in the Pea Aphid Complex. (United States)

    Guy, Endrick; Boulain, Hélène; Aigu, Yoann; Le Pennec, Charlotte; Chawki, Khaoula; Morlière, Stéphanie; Schädel, Kristina; Kunert, Grit; Simon, Jean-Christophe; Sugio, Akiko


    Aphids are piercing-sucking insect pests and feed on phloem sap. During feeding, aphids inject a battery of salivary proteins into host plant. Some of these proteins function like effectors of microbial pathogens and influence the outcome of plant-aphid interactions. The pea aphid (Acyrthosiphon pisum) is the model aphid and encompasses multiple biotypes each specialized to one or a few legume species, providing an opportunity to investigate the underlying mechanisms of the compatibility between plants and aphid biotypes. We aim to identify the aphid factors that determine the compatibility with host plants, hence involved in the host plant specialization process, and hypothesize that salivary proteins are one of those factors. Agrobacterium-mediated transient gene expression is a powerful tool to perform functional analyses of effector (salivary) proteins in plants. However, the tool was not established for the legume species that A. pisum feeds on. Thus, we decided to optimize the method for legume plants to facilitate the functional analyses of A. pisum salivary proteins. We screened a range of cultivars of pea (Pisum sativum) and alfalfa (Medicago sativa). None of the M. sativa cultivars was suitable for agroinfiltration under the tested conditions; however, we established a protocol for efficient transient gene expression in two cultivars of P. sativum, ZP1109 and ZP1130, using A. tumefaciens AGL-1 strain and the pEAQ-HT-DEST1 vector. We confirmed that the genes are expressed from 3 to 10 days post-infiltration and that aphid lines of the pea adapted biotype fed and reproduced on these two cultivars while lines of alfalfa and clover biotypes did not. Thus, the pea biotype recognizes these two cultivars as typical pea plants. By using a combination of ZP1109 and an A. pisum line, we defined an agroinfiltration procedure to examine the effect of in planta expression of selected salivary proteins on A. pisum fitness and demonstrated that transient expression of

  2. Taux de reproduction du puceron du pois (Acyrthosiphon pisum Harris) et teneur en acide médicagénique de la luzerne (Medicago sativa L)


    Bournoville, R


    Medicagenic acid, a major component of the saponin content of lucerne, has been reported by some authors as one of the possible mechanisms of resistance of lucerne to the pea aphid. We have measured the net reproductive rate of the pea aphid on 12 clones or hybrids of lucerne, derived from cultivars or lines of American (La, Res, Te) and French (12, 58, Eur) origins. The pea aphid performances were tested on plants growing under controlled conditions (temperature 20 °C, photophasis 16 h). Bef...

  3. Glucolipids of Zea mays and Pisum sativum

    Energy Technology Data Exchange (ETDEWEB)

    Morohashi, Y.; Bandurski, R.S.


    The glucolipids formed upon feeding (U--/sup 14/C)glucose to embryos of Zea mays were partially characterized with respect to: (a) metabolic turnover, (b) acid lability, (c) phosphorus content, (d) chromatographic properties, and (e) hydrolysis products. The chloroform--methanol-soluble-assimilated radioactivity was examined specifically for occurrence of a glycosylated prenol phosphate. With the extraction conditions used, no evidence was found for formation of a glucosylated prenol phosphate. Several, as yet unidentified, acid-labile glucolipids undergoing metabolic turnover were observed. Four diglycerides were characterized as hydrolysis products of a fraction that contained /sup 14/C-glucose and phosphorus, and was subject to metabolic turnover. Examination of the 1-butanol-soluble glucolipids from pea (Pisum sativum) seedlings also demonstrated anionic glucolipids, evidencing metabolic turnover but none with the properties of glucosylated prenol phosphate.

  4. Biosynthesis of the phytoalexin pisatin. [Pisum sativum

    Energy Technology Data Exchange (ETDEWEB)

    Preisig, C.L.; Bell, J.N.; Matthews, D.E.; VanEtten, H.D. (Cornell Univ., Ithaca, NY (USA)); Sun, Yuejin; Hrazdina, G. (Cornell Univ., Geneva, NY (USA))


    NADPH-dependent reduction of 2{prime},7-dihydroxy-4{prime},5{prime}-methylenedioxyisoflavone to the isoflavanone sophorol, a proposed intermediate step in pisatin biosynthesis, was detected in extracts of Pisum sativum. This isoflavone reductase activity was inducible by treatment of pea seedlings with CuCl{sub 2}. The timing of induction coincided with that of the 6a-hydroxymaackiain 3-O-methyltransferase, which catalyzes the terminal biosynthetic step. Neither enzyme was light inducible. Further NADPH-dependent metabolism of sophorol by extracts of CuCl{sub 2}-treated seedlings was also observed; three products were radiolabeled when ({sup 3}H)sophorol was the substrate, one of which is tentatively identified as maackiain.

  5. Pea (Pisum sp.) genetic resources, its analysis and exploration (United States)

    Pea is important temperate region pulse, with feed, fodder and vegetable uses. Originated and domesticated in Middle East and Mediterranean, it formed important dietary components of early civilizations. Although Pisum is a small genus with two or three species, it is very diverse and structured, r...

  6. Gender- and species-specific characteristics of bacteriomes from three psyllid species (Hemiptera: Psylloidae) (United States)

    Psyllids (Hemiptera: Pyslloidea) harbor bacterial symbionts in specialized organs called bacteriomes. Bacteriomes may be subject to manipulation to control psyllid pests including Bactericera cockerelli (Sulc) (Hemiptera: Triozidae) and Cacopsylla pyricola (Forster) (Hemiptera: Psyllidae) if the bi...

  7. Abundancia y riqueza específica de pulgones (Hemiptera: Aphididae y sus parasitoides en diferentes genotipos y estados fenologicos del garbanzo Species richness and abundance of aphids (Hemiptera: Aphididae and their parasitoids in different genotypes and at different growth stages of chickpea

    Directory of Open Access Journals (Sweden)

    V. E. Mazzuferi


    Full Text Available Los áfidos son insectos perjudiciales tanto por la succión de savia como por la transmisión de enfermedades. Los objetivos de este trabajo fueron conocer las especies de áfidos y sus parasitoides presentes en diferentes genotipos de garbanzo, calcular la incidencia del parasitismo e informar sobre las fluctuaciones poblacionales de pulgones y parasitoides en relación a los estados fenológicos del cultivo. El estudio se realizó durante 2006 y 2007 en San Marcos Sierras (Córdoba. Se evaluaron siete líneas y dos cultivares sembrados en un diseño en bloques completamente aleatorizados con tres repeticiones. Cada 15 días se colectaron manualmente áfidos y "momias" presentes en 10 plantas seleccionadas al azar, de cada genotipo y bloque. Se determinaron 13 especies de áfidos. En 2006 se observó mayor abundancia y riqueza de especies que en 2007. Las especies numéricamente dominantes fueron: Acyrthosiphon pisum y A. kondoi. Solamente cinco especies colonizaron el cultivo. El cultivar Chañaritos presentó la mayor abundancia de insectos en los dos años agrícolas, y los genotipos M60 y M75 mostraron la mayor riqueza de especies. En ambos años, los pulgones estuvieron presentes durante la etapa reproductiva del cultivo. Se registraron tres especies de parasitoides y se estimó un 35% de parasitismo total.Aphids may damage plants by sucking plant juices or by transmitting diseases. The aim of this study was to obtain further information about aphid species and their parasitoids in different genotypes of chickpea, calculate the incidence of parasitism and report on fluctuating populations (from aphids and parasitoid in relation to plant phenology. The study was undertaken during 2006 and 2007 in San Marcos Sierras (Cordoba. Seven lines and two cultivars of chickpea were evaluated. Crop plots were planted following a completely randomized design block with 3 replicates. Every two weeks different developmental stages of aphids and "mummies

  8. Role of Myzus persicae (Hemiptera: Aphididae) and its secondary hosts in plum pox virus propagation. (United States)

    Manachini, B; Casati, P; Cinanni, L; Bianco, P


    Plum pox virus (family Potyviridae, genus Potyvirus, PPV) is one of the most important viral pathogens of plants in the genus Prunus, particularly Prunus persica L. The role of the Myzus persicae (Sulzer) (Hemiptera: Aphididae) as a vector of PPV-M, and its role in spreading PPV-M, was investigated. PPV-M-infected peach trees were used as inoculum sources, and transmission to 15 herbaceous species commonly present in and around peach orchards was evaluated. The presence of PPV-M in secondary hosts after aphid transmission was verified by reverse transcription-polymerase chain reaction tests. The results indicate that Saponaria ocymoides L., Pisum sativum L., Trifolium repens L., Trifolium pratense L., Lepidium sativum L., Matricaria chamomilla L., Centaurea cyanus L., Bellis perennis L., Papaver rhoeas L., and Zinnia elegans L. became infected. Although Lupinus polyphyllus Lindley, Taraxacum officinale L., Achillea millefolium L., Amaranthus retroflexus L., and Linum rubrum L. did not become infected, they are hosts of M. persicae. Among the 10 positive species that were infected, the species most common in peach orchards, T. pratense, T. repens, B. perennis, and M. chamomilla, were used as source plants for the transmission studies to the peach tree. Our study reveals the ability of M. persicae to transmit PPV-M from herbaceous hosts to peach trees, describes PPV-M symptoms in herbaceous species, and discusses the role of M. persicae and its hosts as a source of PPV-M in peach orchards. PMID:17849850

  9. Gibberellin metabolism in chloroplasts of Pisum sativum L. var. Alaska

    International Nuclear Information System (INIS)

    Little is known about the metabolic control of gibberellin (GA) biosynthesis in higher plants. Recent studies have implicated chloroplasts in the metabolic control of GA metabolism in leaves. Thus chloroplasts from several higher plants have been shown to possess high levels of GA-like activity and appear to be able to localize certain GAs selectivity whilst allowing others to migrate into the cytoplasm. This paper evaluates the ability of chloroplasts to synthesize and interconvert GAs, in an in vitro system developed from plastids of Pisum sativum. The results of detailed analysis of the products are reported

  10. Inheritance of enlarged leaf mutations in pea (Pisum sativum L.)

    International Nuclear Information System (INIS)

    In the present study, two pea (Pisum sativum L.) mutants experimentally obtained after gamma irradiation of dry seeds are described. Both mutants were characterized by enlarged leaf size. The mutant 2/462 was shown to have semi-dominant inheritance pattern; 2/927 was sterile and inherited monogenic recessive. The induced mutations have pleiotropic effect, affecting morphological and reproductive traits. New mutants had similar phenotypes to previously named mutants latifolium (lat) and cabbage leaf (calf), but no allelism tests were made between the new and the previously reported mutants. Both mutant lines may be useful plant material for research on leaf development

  11. Genetic study of necrotic leaf pea (Pisum sativum L.) mutants

    International Nuclear Information System (INIS)

    Four pea (Pisum sativum L.) mutants characterized by necrotic leaves were isolated following mutagenesis. The mutants were shown to have single-gene recessive inheritance, characterized morphologically and for seed production. New mutants 1/704, 1/711M, XV/915 and 2/352 had similar phenotypes, respectively, to previously named mutants dgl (degenerating leaves), nec (necrosis), bls (brown leaf spots) and bls (brown leaf), but no allelism tests were made between the new and the previously reported mutants. Mutants 1/704 and 1/711M were shown to be non-allelic. The mutation in line 2/352 may be useful as a genetic marker

  12. Preacondicionamiento de la Semilla de Arveja (Pisum sativum L.)


    Henao Omar A; Marciales Bertha N; Medina Clara I; Lobo A. Mario


    En el Centro de Investigación "La selva ", de la Corporación Colombiana de Investigación Agropecuaria. CORPOICA, ubicado en Rionegro, Antioquia. a 2120 msnm, con una temperatura promedio de 17 °C y perteneciente a la formación ecológica Bosque Húmedo Montano Bajo, se llevó a cabo un estudio con la especie arveja (Pisum sativum L.), con el fin de evaluar el efecto del tratamiento de preacondicionamiento de las semillas, conocido como humedecimiento-secado, sobre la germinación, la emergencia y...

  13. Preacondicionamiento de la semilla de arveja (pisum sativum l.)


    Henao, Omar A; Marciales, Bertha N; Medina, Clara I; Lobo A., Mario


    En el Centro de Investigación "La selva ", de la Corporación Colombiana de Investigación Agropecuaria. CORPOICA, ubicado en Rionegro, Antioquia. a 2120 msnm, con una temperatura promedio de 17 °C y perteneciente a la formación ecológica Bosque Húmedo Montano Bajo, se llevó a cabo un estudio con la especie arveja (Pisum sativum L.), con el fin de evaluar el efecto del tratamiento de preacondicionamiento de las semillas, conocido como humedecimiento-secado, sobre la germinación, la emergencia y...

  14. Predation of Thaumastocoris peregrinus (Hemiptera: Thaumastocoridae by Atopozelus opsimus (Hemiptera: Reduviidae in Brazil

    Directory of Open Access Journals (Sweden)

    TKR Dias


    Full Text Available The bronze bug Thaumastocoris peregrinus (Hemiptera: Thaumastocoridae is an important pest of eucalyptus in several countries and the strategies for the integrated management of this insect in commercial plantations needs to be investigated. The predatory behavior of Atopozelus opsimus (Hemiptera: Reduviidae on T. peregrinus is described. Adults of A. opsimus feed on nymphs and adults of the bronze bug and also present phytophagy. A. opsimus has potential as a natural enemy for the biological control of T. peregrinus.

  15. Sex Attraction in Bactericera cockerelli (Hemiptera: Triozidae) (United States)

    The potato psyllid, Bactericera (= Paratrioza) cockerelli (Šulc) (Hemiptera: Triozidae), is a major pest of potato. We examined the role of chemical signals in sex attraction, assessing male and female response to male- and female-produced volatile chemicals. In laboratory olfactometer assays, pot...

  16. Presencia de Diaphorina citri (Hemiptera: Psyllidae en el Noroeste Argentino (NOA Record of Diaphorina citri (Hemiptera: Psyllidae in North West Argentina

    Directory of Open Access Journals (Sweden)

    Lucrecia Augier


    Full Text Available Se amplía la distribución de Diaphorina citri Kuwayama (Hemiptera: Psyllidae para el Noroeste Argentino.The distribution of Diaphorina citri Kuwayama (Hemiptera: Psyllidae is expanded to North West Argentina.

  17. Fertility improvement in pea (Pisum sativum L.) autotetraploids -mutation breeding

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, H.; Mercykuty, V.C.; Srivastava, C.P. [Banaras Hindu Univ., Varanasi (India). Dept. of Genetics and Plant Breeding


    C{sub 2} seeds of autotetraploids (colchicine-induced) of two diverse genotypes, T 163 and 5064-S, of pea (Pisum sativum L.) and their corresponding diploids were irradiated with 10 kR gamma-ray. Autotetraploids showed a high seed-sterility as compared to diploids. Seed fertility increased in M{sub 2} as compared to M{sub 1}. Both quadrivalent and bivalent frequencies decreased in the M{sub 1} generation of autotetraploids in relation to their respective controls. However, a positive shift in the mean bivalent formation was noted at the cost of other configurations in C{sub 3}-M{sub 2} with respect to C{sub 2}-M{sub 1} and varied with the genotype. In the M{sub 2} generation of autotetraploids, the variability was relatively higher for the number of pods per plant and seed yield per plant. Although the mean values for pods per plant, number of seeds per pod and seed yield per plant remained more or less parallel in autotetraploids in M{sub 1} and M{sub 2} generations, there was an increase in the upper range limit probably due to micromutation for these characters in M{sub 2}. (author). 15 refs, 2 tabs.

  18. Processing Pisum sativum seed storage protein precursors in vitro

    Institute of Scientific and Technical Information of China (English)



    The profile of polypeptides separated by SDS-PAGE from seed of major crop species such as pea(Pisum sativum) is complex,resulting from cleavage (processing) of precursors expressed from multiple copies of genes encoding vicilin and legumin,the major storage globulins.Translation in vitro of mRNAs hybridselected from mid-maturation pea seed RNAs by defined vicilin and legumin cDNA clones provided precursor molecules that were cleaved in vitro by a cell-free protease extract obtained from similar stage seed;the derived polypeptides were of comparable sizes to those observed in vivo.The feasibility of transcribing mRNA in vitro from a cDNA clone and cleavage in vitro of the derived translation products was established for a legumin clone,providing a method for determining polypeptide products of an expressed sequence.This approach will also be useful for characterising cleavage site requirements since modifications an readily be introduced at the DNA level.

  19. Transient protein expression in three Pisum sativum (green pea) varieties. (United States)

    Green, Brian J; Fujiki, Masaaki; Mett, Valentina; Kaczmarczyk, Jon; Shamloul, Moneim; Musiychuk, Konstantin; Underkoffler, Susan; Yusibov, Vidadi; Mett, Vadim


    The expression of proteins in plants both transiently and via permanently transformed lines has been demonstrated by a number of groups. Transient plant expression systems, due to high expression levels and speed of production, show greater promise for the manufacturing of biopharmaceuticals when compared to permanent transformants. Expression vectors based on a tobacco mosaic virus (TMV) are the most commonly utilized and the primary plant used, Nicotiana benthamiana, has demonstrated the ability to express a wide range of proteins at levels amenable to purification. N. benthamiana has two limitations for its use; one is its relatively slow growth, and the other is its low biomass. To address these limitations we screened a number of legumes for transient protein expression. Using the alfalfa mosaic virus (AMV) and the cucumber mosaic virus (CMV) vectors, delivered via Agrobacterium, we were able to identify three Pisum sativum varieties that demonstrated protein expression transiently. Expression levels of 420 +/- 26.24 mg GFP/kgFW in the green pea variety speckled pea were achieved. We were also able to express three therapeutic proteins indicating promise for this system in the production of biopharmaceuticals. PMID:19156736

  20. Burdock fructooligosaccharide induces stomatal closure in Pisum sativum. (United States)

    Guo, Yanling; Guo, Moran; Zhao, Wenlu; Chen, Kaoshan; Zhang, Pengying


    Burdock fructooligosaccharide (BFO) isolated from the root tissue of Arctium lappa is a reserve carbohydrate that can induce resistance against a number of plant diseases. Stomatal closure is a part of plant innate immune response to restrict bacterial invasion. In this study, the effects of BFO on stomata movement in Pisum sativum and the possible mechanisms were studied with abscisic acid (ABA) as a positive control. The results showed that BFO could induce stomatal closure accompanied by ROS and NO production, as is the case with ABA. BFO-induced stomatal closure was inhibited by pre-treatment with L-NAME (N(G)-nitro-L-arginine methyl ester, hydrochloride; nitric oxide synthase inhibitor) and catalase (hydrogen peroxide scavenger). Exogenous catalase completely restricted BFO-induced production of ROS and NO in guard cells. In contrast, L-NAME prevented the rise in NO levels but only partially restricted the ROS production. These results indicate that BFO-induced stomatal closure is mediated by ROS and ROS-dependent NO production. PMID:23911508

  1. Review of the health benefits of peas (Pisum sativum L.). (United States)

    Dahl, Wendy J; Foster, Lauren M; Tyler, Robert T


    Pulses, including peas, have long been important components of the human diet due to their content of starch, protein and other nutrients. More recently, the health benefits other than nutrition associated with pulse consumption have attracted much interest. The focus of the present review paper is the demonstrated and potential health benefits associated with the consumption of peas, Pisum sativum L., specifically green and yellow cotyledon dry peas, also known as smooth peas or field peas. These health benefits derive mainly from the concentration and properties of starch, protein, fibre, vitamins, minerals and phytochemicals in peas. Fibre from the seed coat and the cell walls of the cotyledon contributes to gastrointestinal function and health, and reduces the digestibility of starch in peas. The intermediate amylose content of pea starch also contributes to its lower glycaemic index and reduced starch digestibility. Pea protein, when hydrolysed, may yield peptides with bioactivities, including angiotensin I-converting enzyme inhibitor activity and antioxidant activity. The vitamin and mineral contents of peas may play important roles in the prevention of deficiency-related diseases, specifically those related to deficiencies of Se or folate. Peas contain a variety of phytochemicals once thought of only as antinutritive factors. These include polyphenolics, in coloured seed coat types in particular, which may have antioxidant and anticarcinogenic activity, saponins which may exhibit hypocholesterolaemic and anticarcinogenic activity, and galactose oligosaccharides which may exert beneficial prebiotic effects in the large intestine. PMID:22916813

  2. Metagenomics of Glassy-Winged Sharpshooter, Homalodisca vitripennis (Hemiptera: Cicadellidae) (United States)

    A Metagenomics approach was used to identify unknown organisms which live in association with the glassy-winged sharpshooter, Homalodisca vitripennis (Hemiptera: Cicadellidae). Metagenomics combines molecular biology and genetics to identify, and characterize genetic material from unique biological ...

  3. Metagenomics of Glassy-winged Sharpshooter, Homalodisca vitripennis (Hemiptera: Cicadellidae) (United States)

    Three new insect-infecting viruses, three endosymbiotic bacteria, a fungus, and a bacterial phage were discovered using a metagenomics approach to identify unknown organisms that live in association with the sharpshooter, Homalodisca vitripennis (Hemiptera: Cicadellidae). The genetic composition of ...

  4. The intracellular location of nitrogen metabolism enzymes in Pisum arvense L. roots

    Directory of Open Access Journals (Sweden)

    Grażyna Kłobus


    Full Text Available The time course changes of nitrate assimilation enzymes and their distribution has been studied in Pisum arvense roots. The results indicate that nitrate reductase (EC and glutamine synthetase (EC are present in the soluble fraction, and nitrite reductase (EC and glutamate synthase (EC are localised in the plastids. The results show that the glutamine synthetase/glutamate synthase system is the major pathway of ammonium incorporation in NO3-supplied Pisum arvense roots and glutamate dehydrogenase plays a lesser role.

  5. The role of malate in the synthesis of glutamate in Pisum arvense roots

    Directory of Open Access Journals (Sweden)

    Genowefa Kubik-Dorosz


    Full Text Available The in vivo and in vitro activities of NADH-dependent glutamate synthase in excised Pisum arvense roots increased several-fold under the influence of malate while pyruvate oxaloacctate. citrate and succinate inhibited this entyme. The plastids isolated from Pisum arvense root,. ahen incubated with glutamine and α-ketoglutarate, released glutamate into the medium Malate clearly stimulated this process. Albizziin (25 mM completely reduced the presence of glutamate in the incubation mixture. These results indicate that reduced pyridine nucleotides arising in P. arvense root plastids during oxidation of malic acid may constitute the indispensable source of electrons for glutamic acid synthesis.

  6. Megasporocyte formation in Pisum sativum L. against the back ground of bud development

    Directory of Open Access Journals (Sweden)

    Wanda Wojciechowska


    Full Text Available Megasporocyte formation in Pisum sativum L. takes place at the stages of bud development, when the vexillum surpasses the lower androecium whorl slightly at the beginning, and markedly in further stages. Under the epidermis of an ovule, a multicellular archesporium is formed. Mitotic division of these cells gives rise to a two-layered parietal tissue and to a group of megaspore mother cells (MMCs. The tetrad is formed from one megasporocyte. In the bud development of Pisum sativum the carpel walls accrete to each other relatively early.

  7. Pea (Pisum sativum L. in the Genomic Era

    Directory of Open Access Journals (Sweden)

    Robert J. Redden


    Full Text Available Pea (Pisum sativum L. was the original model organism used in Mendel’s discovery (1866 of the laws of inheritance, making it the foundation of modern plant genetics. However, subsequent progress in pea genomics has lagged behind many other plant species. Although the size and repetitive nature of the pea genome has so far restricted its sequencing, comprehensive genomic and post genomic resources already exist. These include BAC libraries, several types of molecular marker sets, both transcriptome and proteome datasets and mutant populations for reverse genetics. The availability of the full genome sequences of three legume species has offered significant opportunities for genome wide comparison revealing synteny and co-linearity to pea. A combination of a candidate gene and colinearity approach has successfully led to the identification of genes underlying agronomically important traits including virus resistances and plant architecture. Some of this knowledge has already been applied to marker assisted selection (MAS programs, increasing precision and shortening the breeding cycle. Yet, complete translation of marker discovery to pea breeding is still to be achieved. Molecular analysis of pea collections has shown that although substantial variation is present within the cultivated genepool, wild material offers the possibility to incorporate novel traits that may have been inadvertently eliminated. Association mapping analysis of diverse pea germplasm promises to identify genetic variation related to desirable agronomic traits, which are historically difficult to breed for in a traditional manner. The availability of high throughput ‘omics’ methodologies offers great promise for the development of novel, highly accurate selective breeding tools for improved pea genotypes that are sustainable under current and future climates and farming systems.

  8. Dicty_cDB: Contig-U03538-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available pisum cDNA c... 34 1.00 2 ( CN750096 ) ApDT-V-B10 ApDT Acyrthosiphon pisum cDNA clone...n pisum cDNA c... 34 1.4 2 ( CN750378 ) ApDT-XIII-F3 ApDT Acyrthosiphon pisum cDNA clone...FF8CE06CM1 ID0AFF Acyrthosiphon pisum cDNA cl... 34 1.5 2 ( AC021590 ) Homo sapiens chromosome 8, clone RP11...5235 ) Oryza officinalis clone OO__Ba0021O07, *** SEQUEN... 38 9.5 4 ( DV746373 ) ID0AAG5DD01CM1 ID0AAG Acyrthosiphon...V743597 ) ID0AAG10CA10CM1 ID0AAG Acyrthosiphon pisum cDNA c... 34 9.8 2 >( BJ398173 ) Dictyostelium discoideum cDNA clone

  9. Physiological responses of pisum sativum plant to exogenous aba application under drought conditions

    International Nuclear Information System (INIS)

    This study was carried out to investigate the possibility of using foliar ABA application with different concentrations (50,100 and 150 meu g/L-1) in order to decrease the adverse effect of water-deficit stress. The main parameters of interest were; growth parameters; endogenous phytohormones, proline; pigments contents; number and shape of stomata; minerals concentrations; isozymes; and SDS -PAGE protein profile in Pisum sativum plant at 36 days under drought and ABA treatments. The results showed that ABA reduces the reduction in both fresh and dry weights shoot and root of Pisum induced by drought stress. Proline content was increased in response to drought and ABA treatments. Water-stress caused significant reduction in Chl. a, b, whereas application of ABA significantly increased in total chlorohpyll. Water stress significantly decreased IAA, GA concentrations and increased ABA level in leaves than these of the control. ABA treatment partially overcame the decrease in IAA and GA contents. Water stress and ABA increased the activity of (POD) and (ACP) enzymes in Pisum plants. Proteins profile of Pisum sativum in shoot revealed qualitative and quantitative changes, also appearance or disappearance of some bands. After 54 days the yield harvested and total carbohydrates and SDS -PAGE protein profile in seed were investigated. The data showed that total carbohydrates contents were significantly decreased in plant under drought and ABA partially alleviate the adverse effect of water-deficit stress. (author)

  10. Geographic pattern of genetic diversity in the genus Pisum, with inferences about pea domestication (United States)

    We have analysed genetic diversity of common pea (Pisum sativum L.) focusing on wild pea and exploiting biogeographic information. Phylogenetic markers (trnSG and ITS) along with 35,647 genome-wide DARTseq generated single nucleotide polymorphisms (SNPs) and PeaGene 13.2k SNP Illumina assays reveale...

  11. The intracellular localization of malate dehydrogenase isoenzymes in Pisum arvense roots

    Directory of Open Access Journals (Sweden)

    Genowefa Kubik-Dorosz


    Full Text Available Mitochondria and plastids were isolated from Pisum arvense root cells by sucrose density gradient centrifugation. The individual subcellular fractions so obtained were subjected to isoelectric focusing on cellulose acetate strips. Mitochondria and plastids each contained one NAD -malate dehydrogenase, while three isoenzymes were associated with the supernatant.

  12. Chromosome aberration assays in Pisum for the study of environmental mutagens. (United States)

    Grant, W F; Owens, E T


    From a literature survey, 117 chemicals are tabulated that have been assayed in 179 assays for their clastogenic effects in Pisum. Of the 117 chemicals that have been assayed, 65 are reported at giving a positive reaction (i.e. causing chromosome aberrations), 30 positive with a dose response, five borderline positive. Seventeen chemicals gave a negative response. Eighty-one percent of the chemicals gave a definite positive response. A c-mitotic effect was detected from treatment with 17 chemicals. In addition to the above tabulation of chemicals, 39 chemicals have been reported with an antimitotic effect. Thirteen assays have been recorded for five types of radiation, which with the exception of ultrasound reacted positively. The results of assays with 38 chemicals and/or radiations in combined treatments, as well as 15 chemicals and three types of radiations that induce somatic mutations are tabulated. The Pisum sativum (2n=14) bioassay has been shown to be a very good plant bioassay for assessing chromosome damage both in mitosis and meiosis for somatic mutations induced by chemicals, radiations, and environmental pollutants. For some chemicals, the Pisum assay is not as sensitive in assessing clastogenicity as the Allium assay, although this should be considered in relative terms. Pisum fulvum (2n=14) has been used in clastogenic studies also, but to a much lesser extent. PMID:11344039

  13. Effect of TDZ on plant regeneration from mature seeds in pea (Pisum sativum)

    NARCIS (Netherlands)

    Shan, Zhihui; Tzitzikas, E.; Raemakers, C.J.J.M.; Zhengqiang, M.; Visser, R.G.F.


    Pea (Pisum sativum L. cv. Espace) seeds directly cultured on thidiazuron (TDZ)-containing medium formed high numbers of shoots. The number of shoots per seedling depended on the concentration and duration of the TDZ treatment. The best treatment was 12-wk incubation on MS medium supplemented with 4

  14. Effect of exogenous flavonoids on nodulation of pea (Pisum sativum L.)

    Czech Academy of Sciences Publication Activity Database

    Novák, Karel; Chovanec, Pavel; Škrdleta, Vladimír; Kropáčová, M.; Lisá, Ludmila; Němcová, M.


    Roč. 53, č. 375 (2002), s. 1735-1745. ISSN 0022-0957 R&D Projects: GA ČR GA521/00/0937 Institutional research plan: CEZ:AV0Z5020903 Keywords : flavonoids * nod gene * pisum Subject RIV: EE - Microbiology, Virology Impact factor: 2.852, year: 2002

  15. Cultivar and Rhizobium Strain Effects on the Symbiotic Performance of Pea (Pisum sativum)

    DEFF Research Database (Denmark)

    Skøt, Leif


    The symbiotic performance of four pea (Pisum sativum L.) cultivars in combination with each of four strains of Rhizobium leguminosarum was studied in growth chamber experiments in order to estimate the effects of cultivars, strains and cultivar × strain interaction on the variation in dry weight, N...

  16. Towards crystallization of the photosystem II reaction center from Pisum sativum

    Czech Academy of Sciences Publication Activity Database

    Kutá-Smatanová, Ivana; Šáchová, Marie; Vácha, František

    Heraklion : FESPP, 2002. s. 449. [13th Congress of the Federation of European Societies of Plant Physiology. 02.09.2002-06.09.2002, Hersonissos] R&D Projects: GA MŠk LN00A141; GA ČR GA206/00/D007 Keywords : photosystem II * Pisum sativum Subject RIV: ED - Physiology

  17. Pisum sativum L., 1753 - hrách setý

    Czech Academy of Sciences Publication Activity Database

    Kořínková, Dana

    Praha : ČSOP, 2006 - (Mlíkovský, J.; Stýblo, P.), s. 145-145 ISBN 80-86770-17-6 Grant ostatní: GA MŽP(CZ) SM/6/37/04 Institutional research plan: CEZ:AV0Z60050516 Keywords : Pisum sativum * distribution * invasibility Subject RIV: EF - Botanics

  18. Age-dependent variation in membrane lipid synthesis in leaves of garden pea (Pisum sativum L.)

    DEFF Research Database (Denmark)

    Hellgren, Lars; Sandelius, A.S.


    To study membrane lipid synthesis during the lifespan of a dicotyledon leaf, the second oldest leaf of 10-40-d-old plants of garden pea (Pisum sativum L.) was labelled with [1-C- 14]acetate and the distribution of radioactivity between the major membrane lipids was followed for 3 d. In the...

  19. Danish Rhizobium leguminosarum strains nodulating ‘Afghanistan’ pea (Pisum sativum)

    DEFF Research Database (Denmark)

    Jensen, Erik Steen; Sørensen, Lasse Holst; Engvild, Kjeld Christensen


    A wild pea (Pisum sativum L.) native to Afghanistan normally known to be resisant to nodulation with European strains of Rhizobium leguminosarum was nodulated early and effectively in field soil in Denmark. Isolates from nodules formed effective nodules abundantly on 'Afghanistan' on reinfection...

  20. Characterization of Stowaway MITEs in pea (Pisum sativum L.) and identification of their potential master elements

    Czech Academy of Sciences Publication Activity Database

    Macas, Jiří; Koblížková, Andrea; Neumann, Pavel


    Roč. 48, - (2005), s. 831-839. ISSN 0831-2796 R&D Projects: GA ČR(CZ) GA521/03/0595; GA ČR(CZ) GA521/00/0655 Institutional research plan: CEZ:AV0Z50510513 Keywords : genome * Pisum sativum L. Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.070, year: 2005

  1. Danish Rhizobium leguminosarum strains nodulating ‘Afghanistan’ pea (Pisum sativum)

    DEFF Research Database (Denmark)

    Jensen, Erik Steen; Sørensen, Lasse Holst; Engvild, Kjeld Christensen


    A wild pea (Pisum sativum L.) native to Afghanistan normally known to be resisant to nodulation with European strains of Rhizobium leguminosarum was nodulated early and effectively in field soil in Denmark. Isolates from nodules formed effective nodules abundantly on 'Afghanistan' on reinfection...... pattern with Rhizobium leguminosarum strains isolated from a modern pea variety cultivated in the same field....

  2. Preacondicionamiento de la Semilla de Arveja (Pisum sativum L.

    Directory of Open Access Journals (Sweden)

    Henao Omar A


    Full Text Available En el Centro de Investigación "La selva ", de la Corporación Colombiana de Investigación Agropecuaria. CORPOICA, ubicado en Rionegro, Antioquia. a 2120 msnm, con una temperatura promedio de 17 °C y perteneciente a la formación ecológica Bosque Húmedo Montano Bajo, se llevó a cabo un estudio con la especie arveja (Pisum sativum L., con el fin de evaluar el efecto del tratamiento de preacondicionamiento de las semillas, conocido como humedecimiento-secado, sobre la germinación, la emergencia y el establecimiento de plantas. Adicionalmente se evaluó el procedimiento con diferentes concentraciones del fungicida sistémico benomyl, en comparación con agua destilada, buscándose reducir la pérdida de plantas durante el período de establecimiento del cultivo, y se midió el efecto de los tratamientos con y sin fungicida sobre el rendimiento, en comparación con plantas provenientes de semilla no preacondicionada. A nivel de laboratorio se encontró que el tratamiento que produjo mayor velocidad de germinación fué la imbibición hasta el 75% de peso de la semilla, con secado posterior hasta recobrar el peso inicial. Utilizando el tratamiento anterior, se halló que la adición de benomyl, en diferentes concentraciones, no afectó la velocidad de germinación ni la germinación total, incrementándose el porcentaje de plantas sanas obtenidas en comparación con el preacondicionamiento sin fungicida, con valores máximos al imbibir con una solución de benomyl al 0.1%. En el campo no se observó efecto de los tratamientos de preacondicionamiento con y sin fungicida sobre la velocidad de emergencia y la emergencia total, reduciendo los tratamientos con fungicida la incidencia de plantas muertas en forma sensible con una respuesta diferencial en rendimiento, por parte de las dos variedades estudiadas, al aplicar los diversos procedimientos de preacondicionamiento. Así, mientras que con el cultivar 'Small Sieve All Sweet ', no hubo efecto

  3. NCBI nr-aa BLAST: CBRC-VPAC-01-0194 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available yltransferase [Candidatus Hamiltonella defensa 5AT (Acyrthosiphon pisum)] gb|ACQ67332.1| UDP-3-O-(3-hydroxymyristoyl)-glucosamine... N-acyltransferase [Candidatus Hamiltonella defensa 5AT (Acyrthosiphon pisum)] YP_002923480.1 0.58 29% ... ...CBRC-VPAC-01-0194 ref|YP_002923480.1| UDP-3-O-(3-hydroxymyristoyl)-glucosamine N-ac

  4. UniProt search blastx result: AK288506 [KOME

    Lifescience Database Archive (English)

    Full Text Available .99.5) (NADH dehydrogenase I subunit G) (NDH-1 subunit G) - Buchnera aphidicola subsp. Acyrthosiphon pisum (Acyrthosiphon pisum symbiotic bacterium) 0 ... ...AK288506 J090042C01 P57257|NUOG_BUCAI NADH-quinone oxidoreductase subunit G (EC 1.6

  5. NCBI nr-aa BLAST: CBRC-VPAC-01-0381 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available yltransferase [Candidatus Hamiltonella defensa 5AT (Acyrthosiphon pisum)] gb|ACQ67332.1| UDP-3-O-(3-hydroxymyristoyl)-glucosamine... N-acyltransferase [Candidatus Hamiltonella defensa 5AT (Acyrthosiphon pisum)] YP_002923480.1 0.76 28% ... ...CBRC-VPAC-01-0381 ref|YP_002923480.1| UDP-3-O-(3-hydroxymyristoyl)-glucosamine N-ac

  6. NCBI nr-aa BLAST: CBRC-TTRU-01-1371 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndent protein export [Candidatus Hamiltonella defensa 5AT (Acyrthosiphon pisum)] gb|ACQ68339.1| twin-arginine... translocase subunit, sec-independent protein export [Candidatus Hamiltonella defensa 5AT (Acyrthosiphon pisum)] YP_002924487.1 0.89 24% ... ...CBRC-TTRU-01-1371 ref|YP_002924487.1| twin-arginine translocase subunit, sec-indepe

  7. UniProt search blastx result: AK288641 [KOME

    Lifescience Database Archive (English)

    Full Text Available .99.5) (NADH dehydrogenase I subunit L) (NDH-1 subunit L) - Buchnera aphidicola subsp. Acyrthosiphon pisum (Acyrthosiphon pisum symbiotic bacterium) 2.00E-51 ... ...AK288641 J090056C13 P57262|NUOL_BUCAI NADH-quinone oxidoreductase subunit L (EC 1.6

  8. NCBI nr-aa BLAST: CBRC-MDOM-11-0019 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available (LIV-II) (LIVCS family) [Candidatus Hamiltonella defensa 5AT (Acyrthosiphon pisum)] gb|ACQ67379.1| branched...-chain amino acid transport system II (LIV-II) (LIVCS family) [Candidatus Hamiltonella defensa 5AT (Acyrthosiphon pisum)] YP_002923527.1 4.1 29% ...

  9. The genetic diversity and evolution of field pea (Pisum studied by high throughput retrotransposon based insertion polymorphism (RBIP marker analysis

    Directory of Open Access Journals (Sweden)

    Smýkal Petr


    Full Text Available Abstract Background The genetic diversity of crop species is the result of natural selection on the wild progenitor and human intervention by ancient and modern farmers and breeders. The genomes of modern cultivars, old cultivated landraces, ecotypes and wild relatives reflect the effects of these forces and provide insights into germplasm structural diversity, the geographical dimension to species diversity and the process of domestication of wild organisms. This issue is also of great practical importance for crop improvement because wild germplasm represents a rich potential source of useful under-exploited alleles or allele combinations. The aim of the present study was to analyse a major Pisum germplasm collection to gain a broad understanding of the diversity and evolution of Pisum and provide a new rational framework for designing germplasm core collections of the genus. Results 3020 Pisum germplasm samples from the John Innes Pisum germplasm collection were genotyped for 45 retrotransposon based insertion polymorphism (RBIP markers by the Tagged Array Marker (TAM method. The data set was stored in a purpose-built Germinate relational database and analysed by both principal coordinate analysis and a nested application of the Structure program which yielded substantially similar but complementary views of the diversity of the genus Pisum. Structure revealed three Groups (1-3 corresponding approximately to landrace, cultivar and wild Pisum respectively, which were resolved by nested Structure analysis into 14 Sub-Groups, many of which correlate with taxonomic sub-divisions of Pisum, domestication related phenotypic traits and/or restricted geographical locations. Genetic distances calculated between these Sub-Groups are broadly supported by principal coordinate analysis and these, together with the trait and geographical data, were used to infer a detailed model for the domestication of Pisum. Conclusions These data provide a clear picture


    Directory of Open Access Journals (Sweden)

    Maltsev Ye. I.


    Full Text Available We investigated the positive impact of cultures cyanobacteria genus Nostoc Vaucher ex Bornet et Flahault on growth and development of higher plants as an example Pisum sativum L. All the Nostoc species have a positive effect on the viability, germination energy, and biometric characteristics of Pisum sativum. The greatest positive influence was registered for N. entophytum Born. et. Flah. and N. linckia (Roth Bornetet Flahault f. linckia.

  11. Impact of dyeing industry effluent on germination and growth of pea (Pisum sativum). (United States)

    Malaviya, Piyush; Hali, Rajesh; Sharma, Neeru


    Dye industry effluent was analyzed for physico-chemical characteristics and its impact on germination and growth behaviour of Pea (Pisum sativum). The 100% effluent showed high pH (10.3) and TDS (1088 mg l(-1)). The germination parameters included percent germination, delay index, speed of germination, peak value and germination period while growth parameters comprised of root and shoot length, root and shootweight, root-shoot ratio and number of stipules. The study showed the maximum values of positive germination parameters viz. speed of germination (7.85), peak value (3.28), germination index (123.87) and all growth parameters at 20% effluent concentration while the values of negative germination parameters viz. delay index (-0.14) and percent inhibition (-8.34) were found to be minimum at 20% effluent concentration. The study demonstrated that at lower concentrations the dyeing industry effluent caused a positive impact on germination and growth of Pisum sativum. PMID:23741804

  12. Linkages in Pisum L. Pt. 7. Locus for the sterile gene calf (cabbage leaf)

    International Nuclear Information System (INIS)

    The recessive, pleiotropic gene calf, artificially induced was described by Sharma in 1975. An identical mutant gene at the same locus was isolated in this research. Two lines were included in the Pisum gene bank - the type line for the gene calf - Wt 15873 and the representative line - Wt 16024. In linkage studies the representative line was crossed with tester lines bearing gene markers. Analyses of dihybrid segregation in F2 generations revealed linkages of the gene calf with chromosome 2 markers. Two isozymic markers helped to reveal the calf locus on chromosome 2 with the following order: Orp - Calf - K Pgm-p Fum. This is agriment with the current Pisum linkage map

  13. Epigenetic Histone Marks of Extended Meta-Polycentric Centromeres of Lathyrus and Pisum Chromosomes


    Neumann, Pavel; Schubert, Veit; FUKOVÁ, Iva; Manning, Jasper E.; Houben, Andreas; Macas, Jiří


    Species of the legume genera Lathyrus and Pisum possess chromosomes that exhibit a unique structure of their centromeric regions, which is clearly apparent during metaphase by the formation of extended primary constrictions which span up to a third of the length of the chromosome. In addition, these species express two different variants of the CenH3 protein which are co-localized in multiple domains along the poleward surface of the primary constrictions. Here, we show that the constrictions...

  14. Long-Term Fungal Inhibition by Pisum sativum Flour Hydrolysate during Storage of Wheat Flour Bread


    Rizzello, Carlo Giuseppe; Lavecchia, Anna; Gramaglia, Valerio; Gobbetti, Marco


    In order to identify antifungal compounds from natural sources to be used as ingredients in the bakery industry, water/salt-soluble extracts (WSE) from different legume flour hydrolysates obtained by the use of a fungal protease were assayed against Penicillium roqueforti DPPMAF1. The agar diffusion assays allowed the selection of the pea (Pisum sativum) hydrolysate as the most active. As shown by the hyphal radial growth rate, the WSE had inhibitory activity towards several fungi isolated fr...

  15. Comportement agronomique d'une collection de pois (Pisum sativum L)


    M. BOUSLAMA; Rezgui, S.; Hannachi, C.; Mani, F.


    Agronomical Behaviour of a Pea Collection (Pisum sativum L.). This experience was achieved under greenhouse conditions. Twelve genotypes of pea were used (Asgrow, Jumbo, Lincoln, Merveille de Kelvedon, Purser, Rajai Torpe, Snajor Kosep, Korai,Wando, Rondo, local genotype, Major Kosep Korai and Surgevil). They were cultivated on peat during 5.5 months (from October to April). Some agronomical parameters were studied: resistance to diseases, (Powdery-mildew, mildew, top yellow virus, anthracnos...

  16. Sources of reducing equivalents for nitrite reductase in Pisum arvense roots


    Grażyna Kłobus


    Glucose-6-phosphate and NADP+ as well as malic acid and NADP+ present in the incubation mixture enhanced nitrite reductase (EC activity in Pisum arvense roots. This was manifested by a depression of the nitrite level in the tissues and an increased reduction of nitrites by plastids isolated from P. arvense roots. A marked stimulation of plastid malate dehydrogenase was also observed under the influence of nitrates present in the medium. These results suggest that pyridin nucleotides ...

  17. Megamelus bellicus (Hemiptera: Delphacidae): immature stages and biology (United States)

    The immature stages of Megamelus bellicus Remes Lenicov & Sosa (Hemiptera:Delphacidae) are described, keyed and illustrated. The descritpion of each stage was based on 24-h hatched nymphs from the laboratory colony. The main characters that distinguish the various stages are body size, color, number...

  18. Vibrational communication between the sexes in Diaphorina citri (Hemiptera: Psyllidae) (United States)

    We examined the substrate-borne vibrational signals used in communication between the sexes in Diaphorina citri Kuwayama (Hemiptera: Psyllidae), a vector of huanglongbing (an economically devastating disease of citrus), in an anechoic chamber and an olfactometer. Males and females both primarily pro...

  19. Relations between protein production, protein quality and environmental factors in Pisum mutants

    International Nuclear Information System (INIS)

    The seed protein content of 138 radiation-induced Pisum mutants was determined. The variability of this genetically well-defined material agrees approximately with that of the world collection of Pisum sativum. Some environmental factors to a great extent influence the protein production of the mutants and the initial line. Therefore, it is necessary to consider the relations between the genetically controlled protein production and its dependence upon the environmental factors. This is especially evident if the protein situation of the same genotypes cultivated under the moderate climatic conditions of middle Europe is compared with the subtropical conditions of India. A generally firm correlation between seed size and protein content could not be found in material regarding 148 different mutants of our assortment. Therefore, the selection of small-grained mutants does not result in a selection of protein-rich genotypes in Pisum sativum. Considering all the criteria positively and negatively influencing the protein production, a positive situation could be found in some mutants, especially in the fasciated ones. Furthermore, an improvement of the protein quality could be reached by a genetically conditioned alteration of the globulin-albumin ratio leading to an increase of some essential amino acids such as methionine and lysine. The combined action of mutant genes results in unexpected changes of the protein quantity as well as the quality of the recombinants in relation to their parental mutants. The comparison of some essential amino acids of our useful mutants with those of the varieties of other genera of the Leguminosae shows certain trends of biochemical alterations realized during evolutionary development of the family. (author)

  20. Growth, seed development and genetic analysis in wild type and Def mutant of Pisum sativum L


    Ayeh Kwadwo; Lee YeonKyeong; Ambrose Mike J; Hvoslef-Eide Anne


    Abstract Background The def mutant pea (Pisum sativum L) showed non-abscission of seeds from the funicule. Here we present data on seed development and growth pattern and their relationship in predicting this particular trait in wild type and mutant lines as well as the inheritance pattern of the def allele in F2 and F3 populations. Findings Pod length and seed fresh weight increase with fruit maturity and this may affect the abscission event in pea seeds. However, the seed position in either...

  1. Effect of sodium fluoride on phytase activity during germination of Pisum sativum L. seeds

    Energy Technology Data Exchange (ETDEWEB)

    Hauskrecht, I.


    The effects of fluoride ion, in concentrations varying from 0 to 4 mM F/sup -/, on phytase activity in the course of germination of Pisum sativum L. seeds and in the course of incubation in vitro are reported. The fluoride ion in 1 mM concentration cause a significant 80% decrease of the phytase activity in the incubation medium and a 24% decrease in the course of germination. The inhibition of phytase, as well as its synthesis, by fluoride ion during germination may influence the metabolism of phosphorus at the initial stage of ontogenesis.

  2. Nitrogen and phosphorus compounds in the aleurone grains of Iris pseudoacorus endosperm and Pisum sativum cotyledons

    Directory of Open Access Journals (Sweden)

    Ligia Konopska


    Full Text Available Aleurone grains from Iris pseudoacorus endosperm and Pisum sativum cotyledons were isolated partly according to Tombs's method (1967. Nitrogen compounds content was determined in them by Kjeldahl's micromethod, and in the particular fractions after Thiman and Laloraya (1960. Mainly protein N was detected in the aleurone grains, constituting 14.8 and 15.2 per cent of the dry mass of pea and Iris seeds, respectively. Moreover, phosphorus compounds were fractionated according to Holden and Pirie (1955. Analyses demonstrated the presence in aleurone grains of inorganic P, acid-soluble organophosphorus compounds, phospholipids and RNA.

  3. Phosphatidylinositol(4,5)bisphosphate and phosphatidylinositol(4)phosphate in plant tissues. [Pisum sativum

    Energy Technology Data Exchange (ETDEWEB)

    Irvine, R.F.; Letcher, A.J.; Lander, D.J. (Institute of Animal Physiology and Genetics Research, Cambridge (England)); Dawson, A.P. (Univ. of East Anglia, Norwich (England)); Musgrave, A. (Univ. of Amsterdam (Netherlands)); Drobak, B.K. (John Innes Institute, Norwich (England))


    Pea (Pisum sativum) leaf discs or swimming suspensions of Chlamydomonas eugametos were radiolabeled with ({sup 3}H)myo-inositol or ({sup 32}P)Pi and the lipids were extracted, deacylated, and their glycerol moieties removed. The resulting inositol trisphosphate and bisphosphate fractions were examined by periodate degradation, reduction and dephosphorylation, or by incubation with human red cell membranes. Their likely structures were identified as D-myo-inositol(1,4,5)trisphosphate and D-myo-inositol(1,4,)-bisphosphate. It is concluded that plants contain phosphatidylinositol(4)phosphate and phosphatidylinositol(4,5)bisphosphate; no other polyphosphoinositides were detected.

  4. Genetic study of pea (Pisum sativum L.) mutants with altered shape of the pod (moniliform pod)

    International Nuclear Information System (INIS)

    Mutants 1/39 and 2/179 were induced in pea cultivars Auralia and Borek after gamma-ray irradiation and temperature treatment of the seeds. The mutants were isolated in M2 generation and were characterized by altered shape of the pod. It was established that the mutants were allelic and resulted from mutation of a single recessive gene. The designation moniliform pod was proposed for the mutation type and the symbol mfp for the gene. Mutants are useful plant material for studying the genetics of the mutated trait, i.e. the shape of pod in peas (Pisum sativum L.)

  5. Age-dependent variation in membrane lipid synthesis in leaves of garden pea (Pisum sativum L.)

    DEFF Research Database (Denmark)

    Hellgren, Lars; Sandelius, A.S.


    To study membrane lipid synthesis during the lifespan of a dicotyledon leaf, the second oldest leaf of 10-40-d-old plants of garden pea (Pisum sativum L.) was labelled with [1-C- 14]acetate and the distribution of radioactivity between the major membrane lipids was followed for 3 d. In the...... of 18-26-d-old plants and in the youngest leaves, respectively. Thus, these results demonstrate that the distribution of newly synthesized fatty acids between acyl lipid synthesis in the chloroplast and extraplastidial membranes strongly varies with leaf age, as do the proportion utilized for sterol...

  6. Isolation and Characterization of Novel EST-Derived Genic Markers in Pisum sativum (Fabaceae

    Directory of Open Access Journals (Sweden)

    Shalu Jain


    Full Text Available Premise of the study: Novel markers were developed for pea (Pisum sativum from pea expressed sequence tags (ESTs having significant homology to Medicago truncatula gene sequences to investigate genetic diversity, linkage mapping, and cross-species transferability. Methods and Results: Seventy-seven EST-derived genic markers were developed through comparative mapping between M. truncatula and P. sativum in which 75 markers produced PCR products and 33 were polymorphic among 16 pea genotypes. Conclusions: The novel markers described here will be useful for future genetic studies of P. sativum; their amplification in lentil (Lens culinaris demonstrates their potential for use in closely related species.

  7. Analysis of nucleotide sequence of Pisum sativum chromosome-5-specific library

    Czech Academy of Sciences Publication Activity Database

    Wolko, L.; Vrána, Jan; Doležel, Jaroslav; Slomski, R.

    Poznan : Institute of Plant Genetics PAS, 2004 - (Sadowski, J.), s. 79-88 [International Workshop 'Understanding the Plant Genomeö. Poznan (PL), 02.06.2003-03.06.2003] R&D Projects: GA ČR GA521/03/0595 Grant ostatní: State Committee for Scientific Research (KBN)(PL) 5 P06A 015 19 Institutional research plan: CEZ:AV0Z5038910 Keywords : Pisum sativum * flow-sorted chromosomes * chromosome-5-specific DNA library Subject RIV: EB - Genetics ; Molecular Biology


    Directory of Open Access Journals (Sweden)

    Balaji Hajare and Avinash Ade1


    Full Text Available To confirm the location of the nitrogen fixing genes whether on the plasmids or on the genomic DNA the Rhizobial isolates isolated from pea (Pisum sativum were treated with acridine orange with various concentrations and fixed nitrogen was estimated from the media in which these rhizobia were grown. There was no significant difference in between the cured and non cured strains of the Rhizobium which proved that the nitrogen fixing genes are not plasmid borne but these are located on the genomic DNA.

  9. Endemism analysis of Neotropical Pentatomidae (Hemiptera, Heteroptera

    Directory of Open Access Journals (Sweden)

    Augusto Ferrari


    Full Text Available The definition of areas of endemism is central to studies of historical biogeography, and their interrelationships are fundamental questions. Consistent hypotheses for the evolution of Pentatomidae in the Neotropical region depend on the accuracy of the units employed in the analyses, which in the case of studies of historical biogeography, may be areas of endemism. In this study, the distribution patterns of 222 species, belonging to 14 Pentatomidae (Hemiptera genera, predominantly neotropical, were studied with the Analysis of Endemicity (NDM to identify possible areas of endemism and to correlate them to previously delimited areas. The search by areas of endemism was carried out using grid-cell units of 2.5° and 5° latitude-longitude. The analysis based on groupings of grid-cells of 2.5° of latitude-longitude allowed the identification of 51 areas of endemism, the consensus of these areas resulted in four clusters of grid-cells. The second analysis, with grid-cells units of 5° latitude-longitude, resulted in 109 areas of endemism. The flexible consensus employed resulted in 17 areas of endemism. The analyses were sensitive to the identification of areas of endemism in different scales in the Atlantic Forest. The Amazonian region was identified as a single area in the area of consensus, and its southeastern portion shares elements with the Chacoan and Paraná subregions. The distribution data of the taxa studied, with different units of analysis, did not allow the identification of individual areas of endemism for the Cerrado and Caatinga. The areas of endemism identified here should be seen as primary biogeographic hypotheses.

  10. Relative Abundance of Carsonella ruddii (Gamma Proteobacterium) in Females and Males of Cacopsylla pyricola (Hemiptera: Psyllidae) and Bactericera cockerelli (Hemiptera: Triozidae)


    Cooper, W. Rodney; Garczynski, Stephen F.; Horton, David R.


    Carsonella ruddii (Gamma Proteobacterium) is an obligate bacterial endosymbiont of psyllids that produces essential amino acids that are lacking in the insect’s diet. Accurate estimations of Carsonella populations are important to studies of Carsonella-psyllid interactions and to developing ways to target Carsonella for control of psyllid pests including pear psylla, Cacopsylla pyricola (Förster) (Hemiptera: Psyllidae) and potato psyllid, Bactericera cockerelli (Šulc) (Hemiptera: Triozidae). ...

  11. Diaspididae (Hemiptera: Coccoidea) of Espírito Santo, Brazil


    Culik, Mark P.; David S Martins; José A. Ventura; Wolff, Vera S.


    Twenty-seven species of armored scale insects (Hemiptera: Diaspididae) are newly recorded from Espírito Santo, Brazil, and information on the host plants and geographic distribution of the 31 species of Diaspididae that have been identified in the State is provided. New plant host records are reported for 11 of the diaspidid species studied and results are discussed with respect to development of agriculture in this and similar areas with objectives of modernization and diversification.

  12. Calcium-calmodulin signalling is involved in light-induced acidification by epidermal leaf cells of pea, Pisum sativum L.

    NARCIS (Netherlands)

    Elzenga, JTM; Staal, M; Prins, HBA


    Pathways of signal transduction of red and blue light-dependent acidification by leaf epidermal cells were studied using epidermal strips of the Argenteum mutant of Pisum sativum. In these preparations the contribution of guard cells to the acidification is minimal. The hydroxypyridine nifedipine, a

  13. Boron, cobalt and molybdenum in the knottiness and production on pea (Pisum sativum L.) cv Bolero culture

    International Nuclear Information System (INIS)

    The test carried out to study the effect of Boron, Cobalt and Molybdenum on the knottiness and production of the pea (Pisum sativum L.)cv Bolero culture, in controlled conditions. The results showed that Boron didn't affect the knottiness and it increased the production, while, Cobalt and Molybdenum promoted significant increase in the knottiness and productivity. (author)

  14. Development of transgenic pea (Pisum sativum L.) lines for improved tolerance to insect pests and fungal pathogens

    Czech Academy of Sciences Publication Activity Database

    Griga, M.; Švábová, L.; Sehnal, František; Hanáček, P.; Reinöhl, V.; Horáček, J.

    České Budějovice : Biology Centre of Academy of Sciences of the Czech Republic, 2009 - (Sehnal, F.; Drobník, J.), s. 38-38 ISBN 978-80-86668-05-3 Institutional research plan: CEZ:AV0Z50070508 Keywords : Pisum sativum L. Subject RIV: GF - Plant Pathology, Vermin, Weed, Plant Protection

  15. Chromosome localization of novel satellite repeats identified in pea (Pisum sativum) by computer analysis of 454-sequencing data

    Czech Academy of Sciences Publication Activity Database

    Navrátilová, Alice; Macas, Jiří


    Roč. 15, Suppl. 2 (2007), s. 45. ISSN 0967-3849. [International Chromosome Conference /16./. 25.08.2007-29.08.2007, Amsterdam] Institutional research plan: CEZ:AV0Z50510513 Keywords : pea ( Pisum sativum ) * Chromosome localization Subject RIV: EB - Genetics ; Molecular Biology

  16. Jumping performance of planthoppers (Hemiptera, Issidae). (United States)

    Burrows, Malcolm


    The structure of the hind limbs and the kinematics of their movements that propel jumping in planthopper insects (Hemiptera, Auchenorrhyncha, Fulgoroidea, Issidae) were analysed. The propulsion for a jump was delivered by rapid movements of the hind legs that both move in the same plane beneath the body and parallel to its longitudinal axis, as revealed in high-speed sequences of images captured at rates up to 7500 images s(-1). The first and key movement was the depression of both trochantera about their coxae, powered by large depressor muscles in the thorax, accompanied by rapid extension of the tibiae about their femora. The initial movements of the two trochantera of the hind legs were synchronised to within 0.03 ms. The hind legs are only 20% longer than the front and middle legs, represent 65% of the body length, and have a ratio of 1.8 relative to the cube root of the body mass. The two hind coxae have a different structure to those in frog- and leafhoppers. They are fused at the mid-line, covered ventrally by transparent cuticle, and each is fixed laterally to a part of the internal skeleton called the pleural arch that extends to the articulation of a hind wing. A small and pointed, ventral coxal protrusion covered in microtrichia engages with a raised, smooth, white patch on a dorsal femur when a hind leg is levated (cocked) in preparation for a jump. In the best jumps by a male Issus, the body was accelerated in 0.8 ms to a take-off velocity of 5.5 m s(-1), was subjected to a force of 719 g and was displaced a horizontal distance of 1.1 m. This performance required an energy output of 303 microJ, a power output of 388 mW and exerted a force of 141 mN, or more than 700 times its body mass. This performance implies that a catapult mechanism must be used, and that Issus ranks alongside the froghopper Philaenus as one of the best insect jumpers. PMID:19684220

  17. Dicty_cDB: Contig-U06802-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 2 map 4229098... 96 3e-16 1 ( CN760766 ) ID0AAA29BG03RM1 ApMS Acyrthosiphon pisum cDNA clo... 46 0.26 1 ( AC...1 ( CV844576 ) ID0ADD9DF11RM1 ID0ADD Acyrthosiphon pisum cDNA cl... 42 4.1 1 ( CV844350 ) ID0ADD9BA03RM1 ID0ADD Acyrthosiphon... pisum cDNA cl... 42 4.1 1 ( CV844286 ) ID0ADD9AC08RM1 ID0ADD Acyrthosiphon pisum cDNA cl...... 42 4.1 1 ( CV844220 ) ID0ADD8DE12RM1 ID0ADD Acyrthosiphon pisum cDNA cl... 42 4....1 1 ( CV844169 ) ID0ADD8DA08RM1 ID0ADD Acyrthosiphon pisum cDNA cl... 42 4.1 1 ( CV844153 ) ID0ADD8CH04RM1 ID0ADD Acyrthosiphon

  18. Photosynthesis and growth responses of pea Pisum sativum L. under heavy metals stress

    Institute of Scientific and Technical Information of China (English)

    Sabrine Hattab; Boutheina Dridi; Lassad Chouba; Mohamed Ben Kheder; Hamadi Bousetta


    The present work aims to study the physiological effects of cadmium (Cd) and copper (Cu) in pea (Pisum sativum).Pea plants were exposed to increasing doses of cadmium chloride (CdCl_2) and copper chloride (CuCl_2) for 20 d.The examined parameters,namely root and shoot lengths,the concentration of photosynthetic pigments and the rate of photosynthesis were affected by the treatments especially with high metals concentrations.The analysis of heavy metals accumulation shows that leaves significantly accumulate cadmium for all the tested concentrations.However,copper was significantly accumulated only with the highest tested dose.This may explain the higher inhibitory effects of cadmium on photosynthesis and growth in pea plants.These results are valuable for understanding the biological consequences of heavy metals contamination particularly in soils devoted to organic agriculture.

  19. Removal of chromium (III) and zinc(II) by using pods of pisum sativum (garden peas)

    International Nuclear Information System (INIS)

    The adsorption of Chromium(III) and Zinc(II) on ground pods of Pisum sativum (Garden peas) have been studied. The effects of adsorbent dose, pH, contact time and agitation speed on adsorption were studied. The study has revealed that pea pods have high metal removal efficiency. Cr(III) has been removed up to 80.92% and Zn(II) up to 75.11%. Adsorption equilibriums for both metals were developed, which were well described by the Langmuir and Freundlich isotherms. The maximum amounts of Cr(III) and Zn(II) adsorbed (Qmax), as evaluated by Langmuir isotherms were 1.88 mg and 1.45 mg per gram of pea pod's powder, respectively. It is anticipated that waste materials like pea pods can be used for removal of toxic metals like Cr(III) and Zn(II) from industrial effluents/waste waters. (author)

  20. Essential elements and cadmium and lead in fresh and canned peas (Pisum sativum L. )

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, A.; Williams, H.L.; Cooler, F.W.

    Sixteen essential elements along with cadmium and lead were determined in fresh and canned peas (Pisum sativum L.). Samples were taken during the canning process to determine where changes in element content occurred. The concentration of each sample was compared statistically to other samples taken at different stages of the process. Canned peas contained significantly lower concentrations of calcium, copper, iron, magnesium, manganese, phosphorus, potassium, silicon, and zinc than fresh peas. As sodium chloride was added during the canning process, higher concentrations of chloride and sodium were found in the canned product. A 100g serving of drained canned peas supplied less than 11% of the RDAs or of the estimated safe and adequate daily dietary intakes except chloride and sodium, ranged from 24-86%.

  1. Identification of the 64 kilodalton chloroplast stromal phosphoprotein as phosphoglucomutase. [Pisum sativum

    Energy Technology Data Exchange (ETDEWEB)

    Salvucci, M.E.; Drake, R.R.; Broadbent, K.P.; Haley, B.E. (Univ. of Kentucky, Lexington (USA)); Hanson, K.R.; McHale, N.A. (Connecticut Agricultural Experiment Station, New Haven, CT (USA))


    Phosphorylation of the 64 kilodalton stromal phosphoprotein by incubation of pea (Pisum sativum) chloroplast extracts with ({gamma}-{sup 32}P)ATP decreased in the presence of Glc-6-P and Glc-1,6-P{sub 2}, but was stimulated by glucose. Two-dimensional gel electrophoresis following incubation of intact chloroplasts and stromal extracts with ({gamma}-{sup 32}P)ATP, or incubation of stromal extracts and partially purified phosphoglucomutase (EC with ({sup 32}P)Glc-1-P showed that the identical 64 kilodalton polypeptide was labeled. A 62 kilodalton polypeptide was phosphorylated by incubation of tobacco (Nicotiana sylvestris) stromal extracts with either ({gamma}-{sup 32}P)ATP or ({sup 32}P)Glc-1-P. In contrast, an analogous polypeptide was not phosphorylated in extracts from a tobacco mutant deficient in plastid phosphoglucomutase activity. The results indicate that the 64 (or 62) kilodalton chloroplast stromal phosphoprotein is phosphoglucomutase.

  2. Crystallization and preliminary X-ray analysis of eukaryotic initiation factor 4E from Pisum sativum

    International Nuclear Information System (INIS)

    Crystals of N-terminally truncated eIF4E from pea were obtained and X-ray data were recorded in-house to a resolution of 2.2 Å. Crystals of an N-terminally truncated 20 kDa fragment of Pisum sativum eIF4E (ΔN-eIF4E) were grown by vapour diffusion. X-ray data were recorded to a resolution of 2.2 Å from a single crystal in-house. Indexing was consistent with primitive monoclinic symmetry and solvent-content estimations suggested that between four and nine copies of the eIF4E fragment were possible per crystallographic asymmetric unit. eIF4E is an essential component of the eukaryotic translation machinery and recent studies have shown that point mutations of plant eIF4Es can confer resistance to potyvirus infection

  3. Cultivar and Rhizobium Strain Effects on the Symbiotic Performance of Pea (Pisum sativum)

    DEFF Research Database (Denmark)

    Skøt, Leif


    The symbiotic performance of four pea (Pisum sativum L.) cultivars in combination with each of four strains of Rhizobium leguminosarum was studied in growth chamber experiments in order to estimate the effects of cultivars, strains and cultivar × strain interaction on the variation in dry weight, N...... content and dry weight/N ratio. At harvest 63 days after planting, cultivars accounted for 75% of the variation in dry weight, while the Rhizobium strains accounted for 63% of the variation in N-content and 70% of the variation in dry weight/N ratio. Cultivar × strain interactions were statistically...... significant, but of minor quantitative importance, accounting for 5–15% of the total variation. Rhizobium strains also influenced the partitioning of N between reproductive and vegetative plant parts and between root and shoot biomass....

  4. Sources of reducing equivalents for nitrite reductase in Pisum arvense roots

    Directory of Open Access Journals (Sweden)

    Grażyna Kłobus


    Full Text Available Glucose-6-phosphate and NADP+ as well as malic acid and NADP+ present in the incubation mixture enhanced nitrite reductase (EC activity in Pisum arvense roots. This was manifested by a depression of the nitrite level in the tissues and an increased reduction of nitrites by plastids isolated from P. arvense roots. A marked stimulation of plastid malate dehydrogenase was also observed under the influence of nitrates present in the medium. These results suggest that pyridin nucleotides utilised by NiR during nitrite reduction may be formed not only in processes of glucose-6-phosphate oxidation in the pentosephosphate cycle, but also of malic acid by NADP+-dependent malate dehydrogenase.

  5. Epigenetic Histone Marks of Extended Meta-Polycentric Centromeres of Lathyrus and Pisum Chromosomes. (United States)

    Neumann, Pavel; Schubert, Veit; Fuková, Iva; Manning, Jasper E; Houben, Andreas; Macas, Jiří


    Species of the legume genera Lathyrus and Pisum possess chromosomes that exhibit a unique structure of their centromeric regions, which is clearly apparent during metaphase by the formation of extended primary constrictions which span up to a third of the length of the chromosome. In addition, these species express two different variants of the CenH3 protein which are co-localized in multiple domains along the poleward surface of the primary constrictions. Here, we show that the constrictions represent a distinct type of chromatin differing from the chromosome arms. In metaphase, histone phosphorylation patterns including H3S10ph, H3S28ph, and H3T3ph were observed along the entire constriction, in a way similar to holocentric chromosomes. On the other hand, distribution of phosphorylated H2AT120 was different from that previously reported from either, holocentric and monocentric chromosomes, occurring at chromatin surrounding but not overlapping CenH3 domains. Since some of these phosphorylations play a role in chromatid cohesion, it can be assumed that they facilitate correct chromosome segregation by ensuring that multiple separate CenH3 domains present on the same chromatid are oriented toward the same pole. The constrictions also displayed distinct patterns of histone methylation marks, being enriched in H3K9me2 and depleted in H3K4me3 and H3K27me2 compared to the chromosome arms. Super-resolution fluorescence microscopy revealed that although both CenH3 protein variants are present in all CenH3 domains detected on metaphase chromosomes, they are only partially co-localized while there are chromatin subdomains which are mostly made of only one CenH3 variant. Taken together, these data revealed specific features of extended primary constrictions of Lathyrus and Pisum and support the idea that they may represent an intermediate stage between monocentric and holocentric chromosomes. PMID:26973677

  6. Epigenetic histone marks of extended meta-polycentric centromeres of Lathyrus and Pisum chromosomes

    Directory of Open Access Journals (Sweden)

    Pavel eNeumann


    Full Text Available Species of the legume genera Lathyrus and Pisum possess chromosomes that exhibit a unique structure of their centromeric regions, which is clearly apparent during metaphase by the formation of extended primary constrictions which span up to a third of the length of the chromosome. In addition, these species express two different variants of the CenH3 protein which are co-localized in multiple domains along the poleward surface of the primary constrictions. Here we show that the constrictions represent a distinct type of chromatin differing from the chromosome arms. In metaphase, histone phosphorylation patterns including H3S10ph, H3S28ph and H3T3ph were observed along the entire constriction, in a way similar to holocentric chromosomes. On the other hand, distribution of phosphorylated H2AT120 was different from that previously reported from either, holocentric and monocentric chromosomes, occurring at chromatin surrounding but not overlapping CenH3 domains. Since some of these phosphorylations play a role in chromatid cohesion, it can be assumed that they facilitate correct chromosome segregation by ensuring that multiple separate CenH3 domains present on the same chromatid are oriented towards the same pole. The constrictions also displayed distinct patterns of histone methylation marks, being enriched in H3K9me2 and depleted in H3K4me3 and H3K27me2 compared to the chromosome arms. High resolution fluorescence microscopy revealed that although both CenH3 protein variants are present in all CenH3 domains detected on metaphase chromosomes, they are only partially co-localized while there are chromatin subdomains which are mostly made of only one CenH3 variant. Taken together, these data revealed specific features of extended primary constrictions of Lathyrus and Pisum and support the idea that they may represent an intermediate stage between monocentric and holocentric chromosomes.

  7. Comprehensive transcriptome analysis of the highly complex Pisum sativum genome using next generation sequencing

    Directory of Open Access Journals (Sweden)

    Bräutigam Andrea


    Full Text Available Abstract Background The garden pea, Pisum sativum, is among the best-investigated legume plants and of significant agro-commercial relevance. Pisum sativum has a large and complex genome and accordingly few comprehensive genomic resources exist. Results We analyzed the pea transcriptome at the highest possible amount of accuracy by current technology. We used next generation sequencing with the Roche/454 platform and evaluated and compared a variety of approaches, including diverse tissue libraries, normalization, alternative sequencing technologies, saturation estimation and diverse assembly strategies. We generated libraries from flowers, leaves, cotyledons, epi- and hypocotyl, and etiolated and light treated etiolated seedlings, comprising a total of 450 megabases. Libraries were assembled into 324,428 unigenes in a first pass assembly. A second pass assembly reduced the amount to 81,449 unigenes but caused a significant number of chimeras. Analyses of the assemblies identified the assembly step as a major possibility for improvement. By recording frequencies of Arabidopsis orthologs hit by randomly drawn reads and fitting parameters of the saturation curve we concluded that sequencing was exhaustive. For leaf libraries we found normalization allows partial recovery of expression strength aside the desired effect of increased coverage. Based on theoretical and biological considerations we concluded that the sequence reads in the database tagged the vast majority of transcripts in the aerial tissues. A pathway representation analysis showed the merits of sampling multiple aerial tissues to increase the number of tagged genes. All results have been made available as a fully annotated database in fasta format. Conclusions We conclude that the approach taken resulted in a high quality - dataset which serves well as a first comprehensive reference set for the model legume pea. We suggest future deep sequencing transcriptome projects of species

  8. Young citrus leaves decrease dispersal distance of Diaphorina citri Kuwayama (Hemiptera: Liviidae) (United States)

    To manage citrus Huanglongbing, understanding factors that affect dispersal behavior of Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is required to answer questions related to disease epidemiology and to improve management tactics. Currently, little is known about cues medi...

  9. Platycorypha nigrivirga Burckhardt (Hemiptera: Sternorrhyncha: Psylloidea), tipu psyllid, new to North America


    Rung,Alessandra; Arakelian, Gevork; Gill, Ray; Nisson, Nick


    The tipu psyllid, Platycorypha nigrivirga Burckhardt (Hemiptera: Sternorrhyncha: Psylloidea), is reported for the first time in North America (USA: California). Diagnostic characters for identification of adults and nymphs, host and damage data, and known distribution are given.

  10. Phylogenetic divergences of the true bugs (Insecta: Hemiptera: Heteroptera), with emphasis on the aquatic lineages

    DEFF Research Database (Denmark)

    Wang, Yan-hui; Cui, Ying; Rédei, Dávid;


    Heteroptera are among the most diverse hemimetabolous insects. Seven infraorders have been recognized within this suborder of Hemiptera. Apart from the well-established sister-group relationship between Cimicomorpha and Pentatomomorpha (= Terheteroptera), the two terminal lineages, the relationsh...

  11. Variation in male and female genitalia among ten species of North American Anthocoris (Hemiptera: Heteroptera: Anthocoridae) (United States)

    We compared morphology of internal reproductive anatomy and genitalia among 10 species of North American Anthocoris (Hemiptera: Heteroptera: Anthocoridae). Reproductive structures of males, including internal reproductive organs (testes, seminal vesicles, ejaculatory bulb, phallus), the left parame...

  12. The Asian Citrus Psyllid Genome (Diaphorina citri, Hemiptera)


    Hunter, Wayne B.; Reese, Justin; International Psyllid Genome Consortium, The


    The Asian citrus psyllid, Diaphorina citri (Hemiptera), is an important pest of citrus because it vectors bacteria responsible for huanglongbing, which is one of the most serious diseases of citrus worldwide.  The first genome draft of D. citri (DIACI_1.0) was completed in 2011 (ARS, Ft. Pierce, FL), however, gaps in the assembly prompted additional sequencing using the long run PacBio system at the Los Alamos National Lab, NM.  The revised draft genome (DIACI_1.1) was assembled using the new...

  13. Diaspididae (Hemiptera, Coccoidea in sori of two fern species

    Directory of Open Access Journals (Sweden)

    Marcelo Santos


    Duas Espécies de Cochonilhas (Hemiptera: Diaspididae Associadas com Soros de Samambaias Resumo. A presente comunicação relata a presença de duas espécies de cochonilhas Hemiberlesia palmae (Cockerell e Pinnaspis strachani (Cooley (Coccoidea, Diaspididae, associadas respectivamente com Asplenium serratum L. (Aspleniaceae e Niphidium crassifolium (L. Lellinger (Polypodiaceae. É o primeiro registro de uma samambaia como planta hospedeira de Hemiberlesia palmae.  Nas duas espécies de samambaias, os diaspidídeos encontravam-se concentrados principalmente ao redor dos soros.

  14. New Midwestern state records of aquatic Hemiptera (Corixidae: Notonectidae) (United States)

    Chordas, Stephen W., III; Chapman, Eric G.; Hudson, Patrick L.; Chriscinske, Margret A.; Stewart, Richard L., Jr.


    Recent aquatic Hemiptera collections have yielded 15 new state records distributed among four midwestern States. These records include two species of water boatmen (Palmacorixa gillettei and Sigara mathesoni) new for Indiana, four water boatmen species (Cenocorixa utahensis, Corisella inscripta, Hesperocorixa laevigata, S. decorata), including one genus (Cenocorixa) new for Michigan, four water boatmen species (Corisella edulis, Trichocorixa macroceps, S. decoratella, S. mathesoni) and one backswimmer species (Notonecta indica) new for Ohio, and four water boatmen species (H. kennicotti, H. semilucida, S. compressoidea, S. variabilis) new for Pennsylvania.

  15. The effect of inhibitors of plasma membrane H+ - ATPase and oxidoreductases on NH4+ uptake by Pisum arvense roots


    Genowefa Kubik-Dobosz; Aleksandra Turska; Halina Lekacz; Waldemar Karcz; Józef Buczek


    The effect of inhibitors of plasma membrane oxidoreductases (quinacrine and dicumarol) and H+-ATPase (dicyclohexylcarbodiimide and orthovanadate) on ammonium uptake by Pisum arvense seedlings and the activities of H+-ATPase and NADH-ferricyanide oxidoreductase was investigated. The uptake solution contained 50 µM NH4+. In I h experiments, quinacrine and dicumarol depressed strongly and irreversibly the rate of NH4+ uptake and markedly inhibited the activity of NADH-ferri-cyanide oxidoreductas...

  16. ClEST cluster :Cl_singleton1657 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1657 pumilio ... 2 Cimex lectularius nuclear gene 590 TGATGATGAAAGATCAGTACGCCAATTATGTCGT ... ATATGATACATCAAATAAATTATTTGAGA fw20025 1 PREDICTED: pumilio ... homolog 2-like isoform 1 [Acyrthosiphon pisum] XP_ ...

  17. ClEST cluster :Cl_singleton2448 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2448 probable gdp-fucose ... transporter-like Cimex lectularius nuclear gene 314 ACGAATT ... AAAGTTTTCCCTGTCA mb31096 1 PREDICTED: probable GDP-fucose ... transporter-like [Acyrthosiphon pisum] XP_00194993 ...

  18. ClEST cluster :Cl_singleton0942 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0942 tbc1 domain family ... member 4-like Cimex lectularius nuclear gene 488 GCATTCGTATT ... CCACCATAAAGGAGCAA fs16074 1 PREDICTED: TBC1 domain family ... member 4-like [Acyrthosiphon pisum] XP_001947975 6 ...

  19. ClEST cluster :Cl_singleton0904 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0904 male -specific lethal 3 homolog Cimex lectularius nuclear gene 394 CTCGCAGGTTGAG ... GAATTCGACTTGGGATAGATTCGTTACCG fs15038 1 PREDICTED: male -specific lethal 3 homolog [Acyrthosiphon pisum] XP ...

  20. ClEST cluster :Cl_singleton1313 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1313 27 kda hemolymph ... Cimex lectularius nuclear gene 441 CCATTACGGCCGGGGAGAGTGGAATGA ... GAGGTGTTGATGAAAGAAATAA fw05075 1 PREDICTED: 27 kDa hemolymph ... protein-like [Acyrthosiphon pisum] XP_001947666 2. ...

  1. ClEST cluster :Cl_singleton1124 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1124 glyceraldehyde-3-phosphate ... dehydrogenase Cimex lectularius nuclear gene 609 CTC ... TTTGAATTGTTA fs25045 1 PREDICTED: glyceraldehyde-3-phosphate ... dehydrogenase-like [Acyrthosiphon pisum] XP_001943 ...

  2. ClEST cluster :Cl_singleton1771 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1771 inorganic phosphate ... cotransporter Cimex lectularius nuclear gene 540 GGTTTTAAAA ... AGGTCCGATT fw23080 1 PREDICTED: putative inorganic phosphate ... cotransporter-like isoform 2 [Acyrthosiphon pisum] ...

  3. ClEST cluster :Cl_singleton1772 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1772 myosin heavy chain Cimex lectularius nuclear gene 539 GAGTCAGACTCGCTCCAGCTCCCTC ... AACAAAGAAA fw23081 1 PREDICTED: myosin heavy chain muscle ... isoform 1 [Acyrthosiphon pisum] XP_001952092 5.076 ...

  4. ClEST cluster :Cl_singleton1298 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1298 nadh dehydrogenase Cimex lectularius nuclear gene 236 GAGTTCTAAGTCGTCTGGTCCTGAA ... TTTGAAAA fw05041 1 NADH dehydrogenase [ubiquinone] iron -sulfur protein 5 [Acyrthosiphon pisum] NP_00115530 ...

  5. Effect of exogenous supply of boron on nodule development in pea (pisum sativum L.)

    International Nuclear Information System (INIS)

    Exogenous supply of boron was evaluated on the seeds of Pisum sativum L. inoculated with Rhizobium leguminosarum and grown in aqua-culture. The liquid nutrition medium contained six boron concentrations (control, 1, 1.86, 2.86, 3.86, and 4.86 mg L/sup -1/ ). The results obtained from the present work showed that number of nodules, size of nodules and weight of boron treatment. Toxic effect of high concentration of boron (4.86 mg L/sup -1/ ) nodules exhibit great improvement in 2.86 mg L /sup-1/ was also recorded. There was significant reduction as compare to control in nodule weight, size and numbers. This fact becomes clear while observing the nodules growing in the boron free culture, which did not develop extensively. The comparison of the transverse sections of root-nodule area, from nutrient solutions with various boron concentrations showed that in the absence of boron, there was a considerable hypertrophy in cambial cells and a frequent disintegration of phloem and ground tissue along with xylem. The disintegration of the tissue seems to be linked with nodule bacteria. The nodular bacteria are considered to assume a parasitic habit in the absence of boron. (author)

  6. Profile and Functional Properties of Seed Proteins from Six Pea (Pisum sativum Genotypes

    Directory of Open Access Journals (Sweden)

    Nikola Ristic


    Full Text Available Extractability, extractable protein compositions, technological-functional properties of pea (Pisum sativum proteins from six genotypes grown in Serbia were investigated. Also, the relationship between these characteristics was presented. Investigated genotypes showed significant differences in storage protein content, composition and extractability. The ratio of vicilin:legumin concentrations, as well as the ratio of vicilin + convicilin: Legumin concentrations were positively correlated with extractability. Our data suggest that the higher level of vicilin and/or a lower level of legumin have a positive influence on protein extractability. The emulsion activity index (EAI was strongly and positively correlated with the solubility, while no significant correlation was found between emulsion stability (ESI and solubility, nor between foaming properties and solubility. No association was evident between ESI and EAI. A moderate positive correlation between emulsion stability and foam capacity was observed. Proteins from the investigated genotypes expressed significantly different emulsifying properties and foam capacity at different pH values, whereas low foam stability was detected. It appears that genotype has considerable influence on content, composition and technological-functional properties of pea bean proteins. This fact can be very useful for food scientists in efforts to improve the quality of peas and pea protein products.

  7. De Novo Assembly of the Pea (Pisum sativum L. Nodule Transcriptome

    Directory of Open Access Journals (Sweden)

    Vladimir A. Zhukov


    Full Text Available The large size and complexity of the garden pea (Pisum sativum L. genome hamper its sequencing and the discovery of pea gene resources. Although transcriptome sequencing provides extensive information about expressed genes, some tissue-specific transcripts can only be identified from particular organs under appropriate conditions. In this study, we performed RNA sequencing of polyadenylated transcripts from young pea nodules and root tips on an Illumina GAIIx system, followed by de novo transcriptome assembly using the Trinity program. We obtained more than 58,000 and 37,000 contigs from “Nodules” and “Root Tips” assemblies, respectively. The quality of the assemblies was assessed by comparison with pea expressed sequence tags and transcriptome sequencing project data available from NCBI website. The “Nodules” assembly was compared with the “Root Tips” assembly and with pea transcriptome sequencing data from projects indicating tissue specificity. As a result, approximately 13,000 nodule-specific contigs were found and annotated by alignment to known plant protein-coding sequences and by Gene Ontology searching. Of these, 581 sequences were found to possess full CDSs and could thus be considered as novel nodule-specific transcripts of pea. The information about pea nodule-specific gene sequences can be applied for gene-based markers creation, polymorphism studies, and real-time PCR.

  8. Nutritional assessment in vitro and in vivo of raw and extruded peas (Pisum sativum L.). (United States)

    Alonso, R; Grant, G; Dewey, P; Marzo, F


    The effects of extrusion cooking on the nutritional properties of Pisum sativum L. have been evaluated in vitro and in vivo. The treatment greatly elevated protein and starch digestibility in vitro. Also, the amounts of intact starch diminished while total free sugars increased. In addition, the levels of antinutritional factors, such as protease inhibitors and lectins, were greatly decreased. Concentrations of methionine and cystine were low in raw peas and were further reduced by extrusion treatment. The nutritional performance of rats fed extruded pea diets for 15 days was no better than that of rats given raw pea diet. This was due to the overriding effects of amino acid deficiencies in the diets. Weight gains by rats fed extruded pea diets supplemented with amino acids were, however, much higher than those achieved by rats fed supplemented raw pea diets. Food transformation index and protein efficiency ratio values were also greatly improved. Extrusion treatment did therefore significantly improve the nutritional quality of peas. PMID:10888538

  9. Gamma-ray induced mutations in Pisum arvense (L.s.s.)

    International Nuclear Information System (INIS)

    The subject of the studies was the progeny of seven lines of field pea, treated with gamma rays (at the doses of 1, 6, 12, 15, 50 kR) in the generations M2- M4. Of the total number of analysed 15630 plants 249 mutants have been isolated which constituted 1.59% of the total population. The mutation frequency was significantly different depending on the line under study and on the radiation dose. In the mutation spectrum lethal and semilethal mutations were prevalent. The cause of these phenomena were either chlorophyll aberrations or disturbances in the development, growth and morphology of plants. These mutations died in different periods of vegetation or did not come to flowering and died. A number of morphologic-developmental mutations have been isolated; their genotypes have been established, cytologically examined and characterized. Some of the isolated fertile mutations are similar to those obtained at other research centres (e.g., cirrhifolialis, viciaefolialis, fasciata), others seem to be original (eg. pumilio, celeriter crescens, gynaecei, multiplicis). It is necessary, however, to perform identification tests to introduce these mutations into the Pisum Genebank, the more so, as most of papers on mutations concerned edible and garden peas (P. sativum L.), and in our work we considered field forms (P. arvense L.s.s.). (author)

  10. Genotype-dependent patterns of accumulation of seed storage proteins in Pisum

    International Nuclear Information System (INIS)

    The storage proteins deposited in the protein bodies of mature cotyledons in Pisum sativum L. have been shown by crossed immunoelectrophoresis to comprise a series of four antigenically-distinct proteins or protein families related to vicilin, together with legumin and an additional, quantitatively minor, protein of distinctive polypeptide composition (designated Peak 6). These holoproteins appear during development in a similar sequence in three genotypes examined, but the quantitative representation of the legumins and Peak 6 relative to other components in mature seed differ between genotypes. The sequential appearance of immunologically specific storage proteins during development is reflected in the three distinctive phases of polypeptide accumulation evident between Day 10 after flower opening and seed maturity. Heterogeneity amongst the holoproteins of both the legumin and vicilin series was detected in mature seeds by cellulose acetate gel electrophoresis of protein body extracts. Multiple, electrophoretically distinct legumin and vicilin bands seen on such gels are inherited additively in F1 cotyledons from crosses between contrasting storage-protein phenotypes, without formation of new interaction products, and regardless of the direction of the cross. Differences between genotypes in the proportion of legumin contained in the total extractable cotyledonary protein are sufficient to indicate the importance of specific monitoring of legumin (or its homologues in other species) during breeding programmes aimed at increasing the sulphur-amino acid content of legume seed protein to improve its value for monogastric nutrition. (author)

  11. Cloning, overexpression, purification and preliminary crystallographic studies of a mitochondrial type II peroxiredoxin from Pisum sativum

    International Nuclear Information System (INIS)

    The isolation, purification, crystallization and molecular-replacement solution of mitochondrial type II peroxiredoxin from P. sativum is reported. A cDNA encoding an open reading frame of 199 amino acids corresponding to a type II peroxiredoxin from Pisum sativum with its transit peptide was isolated by RT-PCR. The 171-amino-acid mature protein (estimated molecular weight 18.6 kDa) was cloned into the pET3d vector and overexpressed in Escherichia coli. The recombinant protein was purified and crystallized by the hanging-drop vapour-diffusion technique. A full data set (98.2% completeness) was collected using a rotating-anode generator to a resolution of 2.8 Å from a single crystal flash-cooled at 100 K. X-ray data revealed that the protein crystallizes in space group P1, with unit-cell parameters a = 61.88, b = 66.40, c = 77.23 Å, α = 102.90, β = 104.40, γ = 99.07°, and molecular replacement using a theoretical model predicted from the primary structure as a search model confirmed the presence of six molecules in the unit cell as expected from the Matthews coefficient. Refinement of the structure is in progress

  12. Genetic interaction and mapping studies on the leaflet development (lld) mutant in Pisum sativum

    Indian Academy of Sciences (India)

    Sushil Kumar; Raghvendra Kumar Mishra; Arvind Kumar; Swati Chaudhary; Vishakha Sharma; Renu Kumari


    In Pisum sativum, the completely penetrant leaflet development (lld) mutation is known to sporadically abort pinnae suborgans in the unipinnate compound leaf. Here, the frequency and morphology of abortion was studied in each of the leaf suborgans in 36 genotypes and in presence of auxin and gibberellin, and their antagonists. Various lld genotypes were constructed by multifariously recombining lld with a coch homeotic stipule mutation and with af, ins, mare, mfp, tl and uni-tac leaf morphology mutations. It was observed that the suborgans at all levels of pinna subdivisions underwent lld-led abortion events at different stages of development. As in leafblades, lld aborted the pinnae in leaf-like compound coch stipules. The lld mutation interacted with mfp synergistically and with other leaf mutations additively. The rod-shaped and trumpet-shaped aborted pea leaf suborgans mimicked the phenotype of aborted leaves in HD-ZIP-III-deficient Arabidopsis thaliana mutants. Suborganwise aborted morphologies in lld gnotypes were in agreement with basipetal differentiation of leaflets and acropetal differentiation in tendrils. Altogether, the observations suggested that LLD was the master regulator of pinna development. On the basis of molecular markers found linked to lld, its locus was positioned on the linkage group III of the P. sativum genetic map.

  13. Role of LLD, a new locus for leaflet/pinna morphogenesis in Pisum sativum

    Indian Academy of Sciences (India)

    Seema Prajapati; Sushil Kumar


    Properties of a mutant at the LLD (LEAF-LET DEVELOPMENT) locus in pea Pisum sativum L. are reported in this paper. Plants homozygous for the Mendelian recessive mutation lld bear leaves in which a few to many leaflets are incompletely developed. Opposite pinnae of rachis nodes often formed fused incompletely developed leaflets. The lld mutation was observed to abort pinna development at almost all morphogenetic stages. The lld mutation demonstrated high penetrance and low expressivity. The phenotypes of lld plants in tl, tac, tl tac, tl af and tl af tac backgrounds suggested that LLD function is involved in the separation of lateral adjacent blastozones differentiated on primary, secondary and tertiary rachides and lamina development in leaflets. The aborted development of tendrils and leaflets in lld mutants was related to deficiency in vascular tissue growth. The morphological and anatomical features of the leaflets formed on a tl lld double mutant permitted a model of basipetal leaflet development. The key steps of leaflet morphogenesis include origin of the lamina by splitting of a radially symmetrical growing pinna having abaxial outer surface, opposite to the vascular cylinder, through an invaginational groove, differentiation of adaxial surface along the outer boundary of split tissue in the groove and expansion of the lamina ridges so formed into lamina spans.

  14. Purification and properties of asparaginase from the testa of immature seeds of pea (Pisum sativum L.

    Directory of Open Access Journals (Sweden)

    Chagas Eliana P.


    Full Text Available A K+-dependent asparaginase (E.C. was purified 1328-fold from the testas of immature pea seeds (Pisum sativum L., var. Bolero and characterized. Antibodies raised against purified asparaginase cross-reacted with the putative asparaginase band in Western blot analyses of semi-purified extracts. However, for crude extracts of pea testas, a cross-reaction was obtained with at least four protein bands, one of which was asparaginase protein. Affinity-purified antibodies to the four strongest bands of crude extracts were fairly specific for the bands from which they were purified, suggesting a mixture of specific antibodies. The Mr of asparaginase was 69,000 by Sephacryl S200 chromatography and also by mobility on native PAGE relative to BSA. There was no evidence for dissociation into subunits on SDS-PAGE, suggesting a monomeric protein of Mr 69,000. Other properties include an apparent Km of 2.4 mM, pI between 4.5 and 5, and competitive inhibition by aspartate and glycine.

  15. Effect of Pisum sativum as protein supplement on buffalo milk production

    Directory of Open Access Journals (Sweden)

    C. Grassi


    Full Text Available A study was carried out at an organic buffalo dairy farm in order to investigate the effect of feeding protein peas (Pisum sativum L. as an alternative protein source for buffalo cow diets. Two concentrates were formulated to contain (as fed basis either 350 g/kg of soybean cake (SC or 450 g/kg of peas (PC as the main protein sources. The two concentrates were formulated to be almost isonitrogenous (on average crude protein 240 g/kg DM. Two groups of 10 buffalo cows were used in a 100-day lactation study (from 10 days in milk onwards. Cows were blocked into two groups according to lactation number and previous milk yield and were assigned to one of two dietary treatments: control group was offered in the milking parlour 3 kg of SC, while treatment group was offered the same quantity of PC. All cows were fed a total mixed ration containing 3 kg of SC. Daily milk yield was not affected by treatment, as well as, milk fat and protein percentages, somatic cell count, urea content and fatty acid composition.

  16. Phytochrome regulation of gibberellin metabolism in shoots of dwarf Pisum sativum L

    Energy Technology Data Exchange (ETDEWEB)

    Campell, B.R.


    To study the effect of light on the recessive dwarfing allele, le, of Pisum sativum L., etiolated, paclobutrazol treated LeLe (cv. Alaska) and lele (cv. Progress) pea seedlings were transferred to different light regimes. The growth response of both genotypes to applications of GA/sub 1/, GA/sub 20/, and steviol was measured over 48 hours using position transducers. Both genotypes responded to GA/sub 1/ under red irradiation and in darkness. The LeLe plants grew in response to steviol and GA/sub 20/ under red irradiation and in darkness. The lele plants responded to steviol and GA/sub 20/ in darkness, but showed a much smaller response when red irradiated. The red effect on lele plants was reversible by far-red irradiation. (/sup 3/H)GA/sub 20/ was applied to nana pea seedlings, homozygous for le, grown under different light regimes. Radioactive metabolites were later extracted from the shoots of the treated plants. Both the free acid and conjugate pools were analyzed by reversed phase HPLC, and some radioactive metabolites were tentatively identified by comparing their retention times to those of authentic (/sup 3/H)GAs.

  17. Evidence that the mature leaves contribute auxin to the immature tissues of pea (Pisum sativum L.). (United States)

    Jager, Corinne E; Symons, Gregory M; Glancy, Naomi E; Reid, James B; Ross, John J


    In plants such as the garden pea (Pisum sativum L.), it is widely thought that the auxin indole-3-acetic acid (IAA) is synthesised mainly in the immature tissues of the apical bud and then transported basipetally to other parts of the plant. Consistent with this belief are results showing that removal of the apical bud markedly reduces the IAA content in the stem. However, it has also been suggested that the mature leaves may synthesise substantial amounts of IAA, which enters the basipetal transport stream after being transported to the shoot apex in the phloem (Cambridge and Morris in Planta 99:583-588, 1996). To examine this theory, we defoliated pea plants and measured the effect on IAA content in the remaining shoot tissues. IAA levels were reduced in the internodes, and to a lesser extent in the apical bud, after defoliation, suggesting that mature leaves are indeed an important source of auxin for the shoot. Consistent with this idea, we have demonstrated that mature, fully expanded leaves are capable of de novo IAA synthesis. Furthermore, we report evidence for the presence of IAA in the phloem sap of pea. Together these results support those of Cambridge and Morris, suggesting that mature leaves are a source of the IAA in the basipetal transport stream. PMID:17308928

  18. Auxin effects on in vitro and in vivo protein phosphorylation in pea. [Pisum sativum

    Energy Technology Data Exchange (ETDEWEB)

    Gallagher, S.R.; Ray, P.M.


    Terminal 8mm sections from the third internode of dark grown 7 day old Pisum sativum cv Alaska seedlings were separated into membrane and soluble fractions. SDS gradient PAGE identified approximately 50 in vivo phosphorylated proteins and proved superior to 2-D SDS PAGE in terms of resolution and repeatability. Addition of indoleacetic acid (IAA), fusicoccin, or 2,4 dichlorophenoxyacetic acid to membranes resulted in no detectable change in the number or phosphorylation level of the labeled proteins during in vitro phosphorylation in the presence of submicromolar concentrations of calcium. Similar results were obtained with soluble proteins. In the absence of calcium, the level of in vitro protein phosphorylation was much less, but not auxin effects could be identified. Furthermore, treatment of the sections with IAA in vivo followed by cell fractionation and in vitro phosphorylation failed to identify auxin responsive proteins. Lastly, when sections were labeled with /sup 32/P inorganic phosphate in the presence of 17 uM IAA, no auxin specific changes were found in the level of phosphorylation or in the number of phosphorylated proteins. Auxin effects on phosphorylation are thus slight or below their detection limit.

  19. Genetic interaction and mapping studies on the leaflet development (lld) mutant in Pisum sativum. (United States)

    Kumar, Sushil; Mishra, Raghvendra Kumar; Kumar, Arvind; Chaudhary, Swati; Sharma, Vishakha; Kumari, Renu


    In Pisum sativum, the completely penetrant leaflet development (lld) mutation is known to sporadically abort pinnae suborgans in the unipinnate compound leaf. Here, the frequency and morphology of abortion was studied in each of the leaf suborgans in 36 genotypes and in presence of auxin and gibberellin, and their antagonists. Various lld genotypes were constructed by multifariously recombining lld with a coch homeotic stipule mutation and with af, ins, mare, mfp, tl and uni-tac leaf morphology mutations. It was observed that the suborgans at all levels of pinna subdivisions underwent lld-led abortion events at different stages of development. As in leafblades, lld aborted the pinnae in leaf-like compound coch stipules. The lld mutation interacted with mfp synergistically and with other leaf mutations additively. The rod-shaped and trumpet-shaped aborted pea leaf suborgans mimicked the phenotype of aborted leaves in HD-ZIP-III-deficient Arabidopsis thaliana mutants. Suborganwise aborted morphologies in lld gnotypes were in agreement with basipetal differentiation of leaflets and acropetal differentiation in tendrils. Altogether, the observations suggested that LLD was the master regulator of pinna development. On the basis of molecular markers found linked to lld, its locus was positioned on the linkage group III of the P. sativum genetic map. PMID:23271018

  20. Comportement agronomique d'une collection de pois (Pisum sativum L

    Directory of Open Access Journals (Sweden)

    Bouslama, M.


    Full Text Available Agronomical Behaviour of a Pea Collection (Pisum sativum L.. This experience was achieved under greenhouse conditions. Twelve genotypes of pea were used (Asgrow, Jumbo, Lincoln, Merveille de Kelvedon, Purser, Rajai Torpe, Snajor Kosep, Korai,Wando, Rondo, local genotype, Major Kosep Korai and Surgevil. They were cultivated on peat during 5.5 months (from October to April. Some agronomical parameters were studied: resistance to diseases, (Powdery-mildew, mildew, top yellow virus, anthracnose, browning, fresh matter, number of branches/plant, number of flowers/plant, number of pods/ plant and the yield of grains /plant. Results showed that only the genotype Purser is resistant to all diseases and Surgevil is sensitive only to the Top Yellow virus. The local genotype is sensitive to three frequent diseases (Powdery-mildew, mildew and Anthracnose. With regard to vegetative growth, the highest yield of fresh matter do not contribute towards a high fertility rate. In fact, only the genotypes having a weak yield of fresh matter (Snajor Kosep Korai, Asgrow, Major Kosep Korai, Rajai Torpe and Purser have the most important rate of fertility (> 30%. Within this group, the most important yield (> 9 g/plant is a result of high: number of pods/plant (7.5 to 21.6 and of grains/pod (2.8 to 4.92. Finally, genotype Purser should be retained for farmers and programs of genetic amelioration for its resistance to diseases and agronomical performances.

  1. Study of effect of AC and DC magnetic fields on growth of Pisum sativum seeds (United States)

    Bahar, Mahmood; Yasaie Mehrjardi, Yasaman; Sojoodi, Jaleh; Bayani, Hosien; Kazem Salem, Mohammad


    This paper concentrates on the effect of the AC and DC magnetic fields on plant growth. The effect of AC magnetic field with intensities of 2.25, 1.66 and 1.49 mT and DC magnetic field with intensities of 3.6, 2.41 and 2.05 mT in exposure durations of 2, 4, 6, 8, 10 and 12 min on two groups of dry and wet Pisum sativum seedlings was studied. In each experiment 10 seeds were used; the experiments were repeated three times for each group and there was a sham exposed group for comparison purposes. The light cycle was 12 h light/12 h darkness and the temperature was 25 ± 1° C. The index of growth is considered to be the root and stem elongation on the sixth day. It was observed that AC magnetic field has a positive effect on the growth in all durations and intensities. Moreover, it is highlighted that during the experiments, the mean growth of dry seedlings significantly increased by a factor of 11 in AC magnetic field with the lowest intensity of 1.49 mT (p effect on the growth of plants in comparison to DC magnetic fields.

  2. Development and Characterization of 37 Novel EST-SSR Markers in Pisum sativum (Fabaceae

    Directory of Open Access Journals (Sweden)

    Xiaofeng Zhuang


    Full Text Available Premise of the study: Simple sequence repeat markers were developed based on expressed sequence tags (EST-SSR and screened for polymorphism among 23 Pisum sativum individuals to assist development and refinement of pea linkage maps. In particular, the SSR markers were developed to assist in mapping of white mold disease resistance quantitative trait loci. Methods and Results: Primer pairs were designed for 46 SSRs identified in EST contiguous sequences assembled from a 454 pyrosequenced transcriptome of the pea cultivar, ‘LIFTER’. Thirty-seven SSR markers amplified PCR products, of which 11 (30% SSR markers produced polymorphism in 23 individuals, including parents of recombinant inbred lines, with two to four alleles. The observed and expected heterozygosities ranged from 0 to 0.43 and from 0.31 to 0.83, respectively. Conclusions: These EST-SSR markers for pea will be useful for refinement of pea linkage maps, and will likely be useful for comparative mapping of pea and as tools for marker-based pea breeding.

  3. Cloning, overexpression, purification and preliminary crystallographic studies of a mitochondrial type II peroxiredoxin from Pisum sativum

    Energy Technology Data Exchange (ETDEWEB)

    Barranco-Medina, Sergio [Departamento de Bioquímica, Biología Molecular y Celular de Plantas, Estación Experimental del Zaidín, Consejo Superior de Investigaciones Científicas, E-18008 Granada (Spain); López-Jaramillo, Francisco Javier, E-mail: [Instituto de Biotecnología, Campus Fuentenueva, Universidad de Granada, E-18071 Granada (Spain); Bernier-Villamor, Laura [Departamento de Bioquímica, Biología Molecular y Celular de Plantas, Estación Experimental del Zaidín, Consejo Superior de Investigaciones Científicas, E-18008 Granada (Spain); Sevilla, Francisca [Departamento de Biología del Estrés y Patología Vegetal, Centro de Edafología y Biología Aplicada del Segura, Consejo Superior de Investigaciones Científicas, E-30080 Murcia (Spain); Lázaro, Juan-José [Departamento de Bioquímica, Biología Molecular y Celular de Plantas, Estación Experimental del Zaidín, Consejo Superior de Investigaciones Científicas, E-18008 Granada (Spain)


    The isolation, purification, crystallization and molecular-replacement solution of mitochondrial type II peroxiredoxin from P. sativum is reported. A cDNA encoding an open reading frame of 199 amino acids corresponding to a type II peroxiredoxin from Pisum sativum with its transit peptide was isolated by RT-PCR. The 171-amino-acid mature protein (estimated molecular weight 18.6 kDa) was cloned into the pET3d vector and overexpressed in Escherichia coli. The recombinant protein was purified and crystallized by the hanging-drop vapour-diffusion technique. A full data set (98.2% completeness) was collected using a rotating-anode generator to a resolution of 2.8 Å from a single crystal flash-cooled at 100 K. X-ray data revealed that the protein crystallizes in space group P1, with unit-cell parameters a = 61.88, b = 66.40, c = 77.23 Å, α = 102.90, β = 104.40, γ = 99.07°, and molecular replacement using a theoretical model predicted from the primary structure as a search model confirmed the presence of six molecules in the unit cell as expected from the Matthews coefficient. Refinement of the structure is in progress.

  4. Determination of the genotoxic effects of Trigonella foenum graecum L. extracts in stored Pisum sativum seeds

    Directory of Open Access Journals (Sweden)

    Fawzia, I. Mohamed


    Full Text Available This study was carried out to study the effect of Trigonella foenum graecum L extracts on mitotic, meiotic and cell cycle parameters in stored Pisum sativum seeds. The Trigonella foenum extracts induced a marked decrease in the mitotic index accompanied with considerable percentage of chromosomal aberrations. These abnormalities include stickiness, disturbed chromosomes, bridges and lagging chromosome. Cytophotometric measurements showed inhibition of cells in the Go/G1 phase at the expense of other phases of cell cycle (S-phase, G2-phase. The percentage of cells having 2C DNA content decreased gradually with increasing the concentrations, while those having 4C DNA increased. Trigonella foenum extracts not affected on PMCs. Of P. sativum plant after the seeds treated with 0.5-1% and storage for three months but, significant percentage of chromosome abnormalities observed in the PMCs of the plants treated with 2% Trigonella foenum extracts and storage for three months. Also, after storage for six months all treatments have significant effect on abnormalities of PMCs. In all the treatment, various abnormal cells were observed in mitotic and meiotic division. Aberrant cells observed according to concentration and time of storage of Trigonella foenum extracts.

  5. Phytochrome regulation of gibberellin metabolism in shoots of dwarf Pisum sativum L

    International Nuclear Information System (INIS)

    To study the effect of light on the recessive dwarfing allele, le, of Pisum sativum L., etiolated, paclobutrazol treated LeLe (cv. Alaska) and lele (cv. Progress) pea seedlings were transferred to different light regimes. The growth response of both genotypes to applications of GA1, GA20, and steviol was measured over 48 hours using position transducers. Both genotypes responded to GA1 under red irradiation and in darkness. The LeLe plants grew in response to steviol and GA20 under red irradiation and in darkness. The lele plants responded to steviol and GA20 in darkness, but showed a much smaller response when red irradiated. The red effect on lele plants was reversible by far-red irradiation. [3H]GA20 was applied to nana pea seedlings, homozygous for le, grown under different light regimes. Radioactive metabolites were later extracted from the shoots of the treated plants. Both the free acid and conjugate pools were analyzed by reversed phase HPLC, and some radioactive metabolites were tentatively identified by comparing their retention times to those of authentic [3H]GAs

  6. Complete mitochondrial genome of Drabescoides nuchalis (Hemiptera: Cicadellidae). (United States)

    Wu, Yunfei; Dai, Renhuai; Zhan, Hongping; Qu, Ling


    The complete mitochondrial genome (mitogenome) of Drabescoides nuchalis (Hemiptera: Cicadellidae) was sequenced. It is 15 309 bp in length with 75.62% (A + T) content and comprises 13 protein-coding genes, 22 transfer RNAs, two ribosomal RNA genes, and a non-coding region (GenBank accession no. KR349344). Gene order is identical to that of the inferred ancestral insect genome. All PCGs start with an ATN codon and terminate with TAA except ND4, which has an incomplete stop codon (T). The anticodons are identical to those of Drosophila yakuba. The phylogenetic tree confirms D. nuchalis and two Cicadellidae species are clustered into a clade, and Cicadellidae is a monophyletic group and provides support for the sister relationship of leafhopper and treehopper. PMID:26436567

  7. Observations on the Biology and Anatomy of Myerslopiidae (Hemiptera, Membracoidea

    Directory of Open Access Journals (Sweden)

    Roman Rakitov


    Full Text Available Adults and nymphs of Mapuchea chilensis (Nielson, from the poorly known family Myerslopiidae, were collected from the litter horizon of temperate forests and shrub bogs in southern Chile. The species apparently feeds on roots and creeping stems of angiosperms. Salivary sheaths of captive specimens terminated in vascular bundles. Indirect evidence suggests feeding on phloem sap. Both nymphs and adults are strong jumpers and both actively disperse, as evidenced by their capture in pan traps. The Malpighian tubules of this species produce no brochosomes and, unlike in most previously studied Membracoidea, comprise no specialized secretory segment. Each tubule comprises secretory cells scattered among excretory ones, a condition not previously known among Hemiptera.

  8. Determination of 4-Chloroindole-3-Acetic Acid Methyl Ester in Lathyrus Vicia and Pisum by Gas Chromatography - Mass Spectrometry

    DEFF Research Database (Denmark)

    Engvild, Kjeld Christensen; Egsgaard, Helge; Larsen, Elfinn


    4-Chloroindole-3-acetic acid methyl ester was identified unequivocally in Lathyrus latifolius L., Vicia faba L. and Pisum sativum L. by thin layer chromatography, gas chromatography and mass spectrometry. The gas chromatographic system was able to separate underivatized chloroindole-3-acetic acid...... methyl ester isomers. The quantitative determination of 4-chloroindole-3-acetic acid methyl ester in immature seeds of these three species was performed by gas chromatography – mass spectrometry using deuterium labelled 4-chloro-indole-3-acetic acid methyl ester as an internal standard. P. sativum...

  9. Convergence Caused Confusion: On the Systematics Of the Freshwater Gastropod Sulcospira pisum (Brot, 1868) (Cerithioidea, Pachychilidae)

    DEFF Research Database (Denmark)

    Koehler, Frank; Brinkmann, Nora; Glaubrecht, Matthias

    the family. It is tentatively placed within the genus Sulcospira, which is endemic to Java. We assume that a similar shell shape has evolved in both species of not closely related gastropods through convergence, which once more reveals that purely shell-based classifications are particularly...... present evidence that "Melania" pisum is not a thiarid species closely related to Balanocochlis glans (Busch, 1842), as has been supposed with respect to the very similar shells of both species. The species is transferred to the family Pachychilidae, because it shows various typical character states for...

  10. Effects of long-term reduced tillage on weed infestation of pea (Pisum sativum L.

    Directory of Open Access Journals (Sweden)

    Andrzej Woźniak


    Full Text Available The study evaluated weed infestation of pea (Pisum sativum L. cultivated under conditions of conventional (CT, reduced (RT and herbicide tillage (HT. It demonstrated the highest weed density per m2 in plots with the herbicide (HT and reduced (RT systems and significantly lower weed infestation in plots cultivated in the conventional system (CT. In addition, more weeds occurred at the third leaf stage (13/14 in BBCH scale than at the pod development stage (73/74 BBCH of pea. The highest biomass was produced by weeds in the herbicide system (HT, a lower one – in the reduced system (RT, and the lowest one – in the conventional system (CT. The air-dry weight of weeds depended also on pea development stage. At the pod development stage (73/74 BBCH, the air-dry weight of weeds was significantly higher than at the third leaf stage (13/14 BBCH. The tillage system was also observed to influence the species composition of weeds. This trait was also affected by the period of weed infestation assessment. At the third leaf stage of pea (13/14 BBCH, there occurred 26 weed species, including 24 annual ones. The most abundant species included: Chenopodium album L., Stellaria media (L. Vill., Capsella bursa-pastoris (L. Med., Matricaria inodora L., Thlaspi arvense L., and Fallopia convolvulus (L. A. Löve. At the pod development stage (73/74 BBCH, the pea crop was colonized by 24 weed species, including 3 perennial ones. At this stage the predominant species included: Avena fatua L., Amaranthus retroflexus L., Papaver rhoeas L., Echinochloa crus-galli (L. P.B., Matricaria inodora L., and Galeopsis tetrahit L.

  11. Biochemical and physiological detection of sulfur dioxide injury to pea plants (Pisum sativum)

    Energy Technology Data Exchange (ETDEWEB)

    Jaeger, H.J.; Klein, H.


    Biochemical and physlological experiments were conducted on pea plants (Pisum sativum) continuously exposed in growth chambers to SO/sub 2/ gas for 18 days. SO/sub 2/ gas concentrations were 0.1, 0.15, and 0.25 ppM. In plants exposed to 0.1 and 0.15 ppM it was clearly demonstrated that there was a greater accumulation of inorganic sulfur, a reduced buffer capacity of the cells relative to H-ions, and a stimulation of glutamate dehydrogenase activity. The only macroscopic symptom seen was slight chlorosis of the older leaves. There was only a slight decrease in fresh and dry weights of these plants compared to the control plants whereas in the group of plants exposed to 0.25 ppM SO/sub 2/ foliage necrosis was considerable. In addition, there was a marked reduction in the fresh and dry weights of the latter plants. However, the relationship among accumulated inorganic sulfur, reduced buffer capacity, and increased glutamate dehydrogenase activity as seen for the lower SO/sub 2/ concentrations was close. Accordingly, it might be possible to use these three parameters to diagnose SO/sub 2/ injury before any significant symptoms appear. In the case of severe SO/sub 2/ injury there was a marked increase in glutamine and ammonia concentrations suggesting that these factors in addition to the above could be used in diagnosing severe SO/sub 2/ injury. There was no significant difference between plants treated with 0.1 or 0.15 ppM SO/sub 2/ and control plants in the contents of K, Ca, P, and N fractions. Therefore, these factors would not be useful in the early detection of SO/sub 2/ injury.

  12. Effect of Rhizobium inoculation of seeds and foliar fertilization on productivity of Pisum sativum L.

    Directory of Open Access Journals (Sweden)

    Tadeusz Zając


    Full Text Available Pea (Pisum sativum L. is the second most important grain legume crop in the world which has a wide array of uses for human food and fodder. One of the major factors that determines the use of field pea is the yield potential of cultivars. Presently, pre-sowing inoculation of pea seeds and foliar application of microelement fertilizers are prospective solutions and may be reasonable agrotechnical options. This research was undertaken because of the potentially high productivity of the 'afila' morphotype in good wheat complex soils. The aim of the study was to determine the effect of vaccination with Rhizobium and foliar micronutrient fertilization on yield of the afila pea variety. The research was based on a two-year (2009–2010 controlled field experiment, conducted in four replicates and carried out on the experimental field of the Bayer company located in Modzurów, Silesian region. experimental field soil was Umbrisol – slightly degraded chernozem, formed from loess. Nitragina inoculant, as a source of symbiotic bacteria, was applied before sowing seeds. Green area index (GAI of the canopy, photosynthetically active radiation (PAR, and normalized difference vegetation index (NDVI were determined at characteristic growth stages. The presented results of this study on symbiotic nitrogen fixation by leguminous plants show that the combined application of Nitragina and Photrel was the best combination for productivity. Remote measurements of the pea canopy indexes indicated the formation of the optimum leaf area which effectively used photosynthetically active radiation. The use of Nitragina as a donor of effective Rhizobium for pea plants resulted in slightly higher GAI values and the optimization of PAR and NDVI. It is not recommended to use foliar fertilizers or Nitragina separately due to the slowing of pea productivity.

  13. Growth, seed development and genetic analysis in wild type and Def mutant of Pisum sativum L

    Directory of Open Access Journals (Sweden)

    Ayeh Kwadwo


    Full Text Available Abstract Background The def mutant pea (Pisum sativum L showed non-abscission of seeds from the funicule. Here we present data on seed development and growth pattern and their relationship in predicting this particular trait in wild type and mutant lines as well as the inheritance pattern of the def allele in F2 and F3 populations. Findings Pod length and seed fresh weight increase with fruit maturity and this may affect the abscission event in pea seeds. However, the seed position in either the distal and proximal ends of the pod did not show any difference. The growth factors of seed fresh weight (FW, width of funicles (WFN, seed width (SW and seed height (SH were highly correlated and their relationships were determined in both wild type and def mutant peas. The coefficient of determination R2 values for the relationship between WFN and FW, SW and SH and their various interactions were higher for the def dwarf type. Stepwise multiple regression analysis showed that variation of WFN was associated with SH and SW. Pearson's chi square analysis revealed that the inheritance and segregation of the Def locus in 3:1 ratio was significant in two F2 populations. Structural analysis of the F3 population was used to confirm the inheritance status of the Def locus in F2 heterozygote plants. Conclusions This study investigated the inheritance of the presence or absence of the Def allele, controlling the presence of an abscission zone (AZ or an abscission-less zone (ALZ forming in wild type and mutant lines respectively. The single major gene (Def controlling this phenotype was monogenic and def mutants were characterized and controlled by the homozygous recessive def allele that showed no palisade layers in the hilum region of the seed coat.

  14. Bean pod mottle virus: a new powerful tool for functional genomics studies in Pisum sativum. (United States)

    Meziadi, Chouaib; Blanchet, Sophie; Richard, Manon M S; Pilet-Nayel, Marie-Laure; Geffroy, Valérie; Pflieger, Stéphanie


    Pea (Pisum sativum L.) is an important legume worldwide. The importance of pea in arable rotations and nutritional value for both human and animal consumption have fostered sustained production and different studies to improve agronomic traits of interest. Moreover, complete sequencing of the pea genome is currently underway and will lead to the identification of a large number of genes potentially associated with important agronomic traits. Because stable genetic transformation is laborious for pea, virus-induced gene silencing (VIGS) appears as a powerful alternative technology for determining the function of unknown genes. In this work, we present a rapid and efficient viral inoculation method using DNA infectious plasmids of Bean pod mottle virus (BPMV)-derived VIGS vector. Six pea genotypes with important genes controlling biotic and/or abiotic stresses were found susceptible to BPMV carrying a GFP reporter gene and showed fluorescence in both shoots and roots. In a second step, we investigated 37 additional pea genotypes and found that 30 were susceptible to BPMV and only 7 were resistant. The capacity of BPMV to induce silencing of endogenes was investigated in the most susceptible genotype using two visual reporter genes: PsPDS and PsKORRIGAN1 (PsKOR1) encoding PHYTOENE DESATURASE and a 1,4-β-D-glucanase, respectively. The features of the 'one-step' BPMV-derived VIGS vector include (i) the ease of rub-inoculation, without any need for biolistic or agro-inoculation procedures, (ii) simple cost-effective procedure and (iii) noninterference of viral symptoms with silencing. These features make BPMV the most adapted VIGS vector in pea to make low- to high-throughput VIGS studies. PMID:26896301

  15. Roles for auxin during morphogenesis of the compound leaves of pea ( Pisum sativum). (United States)

    DeMason, Darleen A; Chawla, Rekha


    The goal of this study was to explore the impact of the plant growth regulator auxin on the development of compound leaves in pea. Wildtype ( WT) plantlets, as well as those of two leaf mutants, acacia ( tl) and tendrilled acacia ( uni-tac) of pea ( Pisum sativum L.), were grown on media containing the auxin-transport inhibitors 2,3,5-triiodobenzoic acid (TIBA), N-(1-naphthyl)phthalamic acid (NPA), or the auxin antagonist, p-chlorophenoxyisobutyric acid (PCIB). The resulting plantlets were carefully analyzed morphologically, by scanning electron microscopy and for Uni gene expression using quantitative reverse transcription-polymerase chain reaction. Auxin transport was measured in WT leaf parts using [(14)C]indole-3-acetic acid. Relative Uni gene expression was determined in shoot tips of a range of leaf-form mutants. Morphological abnormalities were observed for all genotypes examined. The terminal tendrils on WT plants were converted to leaflets, stubs or were aborted. The number of pinna pairs produced on leaves was reduced, with the distal forms being eliminated before the proximal ones. Some leaves were converted to simple, including tri-and bilobed, forms. These treatments phenocopy the uni-tac and unifoliata ( uni) mutants of pea. In the most extreme situations, leaf blades were completely lost leaving only a pair of stipules or scale leaves. Polar auxin transport was basipetal for all leaf parts. Uni gene expression in shoot tips was significantly reduced in 60 microM NPA and TIBA. Uni mRNA was more abundant in tl, af and af tl and reduced in the uni mutants compared to WT. These results indicate that an auxin gradient plays fundamental roles in controlling morphogenesis in the compound leaves of pea and specifically it: (i). is the driving force for leaf growth and pinna determination; (ii). is necessary for pinna initiation; and (iii). controls subsequent pinna development. PMID:12942326

  16. Cell wall yield properties of growing tissue: evaluation by in vivo stress relaxation. [Pisum sativus L

    Energy Technology Data Exchange (ETDEWEB)

    Cosgrove, D.J.


    Growing pea stem tissue, when isolated from an external supply of water, undergoes stress relaxation because of continued loosening of the cell wall. A theoretical analysis is presented to show that such stress relaxation should result in an exponential decrease in turgor pressure down to the yield threshold (Y), with a rate constant given by phi epsilon where phi is the metabolically maintained irreversible extensibility of the cell wall and epsilon is the volumetric elastic modulus of the cell. Stress relaxation was measured in pea (Pisum sativus L.) stem segments using the pressure microprobe technique. From the rate of stress relaxation, phi of segments pretreated with water was calculated to be 0.08 per megapascal per hour while that of auxin-pretreated tissue was 0.24 per megapascal per hour. These values agreed closely with estimates of phi made by a steady-state technique. The yield threshold (0.29 megapascal) was not affected by auxin. A theoretical analysis is also presented to show that the tissue hydraulic conductance may be estimated from the T/sub 1/2/ of tissue swelling. Experimentally, pea stems had a swelling T/sub 1/2/ of 2.0 minutes, corresponding to a relative hydraulic conductance of about 2.0 per megapascal per hour. This value is at least 8 times larger than phi. From these data and from computer modeling, it appears that the radial gradient in water potential which sustains water uptake in growing pea segments is small (0.04 megapascal). This means that hydraulic conductance does not substantially restrict growth. The results also demonstrate that the stimulation of growth by auxin can be entirely accounted for by the change in phi.

  17. Palladium uptake by Pisum sativum: partitioning and effects on growth and reproduction. (United States)

    Ronchini, Matteo; Cherchi, Laura; Cantamessa, Simone; Lanfranchi, Marco; Vianelli, Alberto; Gerola, Paolo; Berta, Graziella; Fumagalli, Alessandro


    Environmental palladium levels are increasing because of anthropogenic activities. The considerable mobility of the metal, due to solubilisation phenomena, and its known bioavailability may indicate interactions with higher organisms. The aim of the study was to determine the Pd uptake and distribution in the various organs of the higher plant Pisum sativum and the metal-induced effects on its growth and reproduction. P. sativum was grown in vermiculite with a modified Hoagland's solution of nutrients in the presence of Pd at concentrations ranging 0.10-25 mg/L. After 8-10 weeks in a controlled environment room, plants were harvested and dissected to isolate the roots, stems, leaves, pods and peas. The samples were analysed for Pd content using AAS and SEM-EDX. P. sativum absorbed Pd, supplied as K₂PdCl₄, beginning at seed germination and continuing throughout its life. Minimal doses (0.10-1.0 mg Pd/L) severely inhibited pea reproductive processes while showing a peculiar hormetic effect on root development. Pd concentrations ≥1 mg/L induced developmental delay, with late growth resumption, increased leaf biomass (up to 25%) and a 15-20% reduction of root mass. Unsuccessful repeated blossoming efforts led to misshapen pods and no seed production. Photosynthesis was also disrupted. The absorbed Pd (ca. 0.5 % of the supplied metal) was primarily fixed in the root, specifically in the cortex, reaching concentrations up to 200 μg/g. The metal moved through the stem (up to 1 μg/g) to the leaves (2 μg/g) and pods (0.3 μg/g). The presence of Pd in the pea fruits, together with established evidence of environmental Pd accumulation and bioavailability, suggests possible contamination of food plants and propagation in the food chain and must be the cause for concern. PMID:25639246

  18. Long-Term Fungal Inhibition by Pisum sativum Flour Hydrolysate during Storage of Wheat Flour Bread. (United States)

    Rizzello, Carlo Giuseppe; Lavecchia, Anna; Gramaglia, Valerio; Gobbetti, Marco


    In order to identify antifungal compounds from natural sources to be used as ingredients in the bakery industry, water/salt-soluble extracts (WSE) from different legume flour hydrolysates obtained by the use of a fungal protease were assayed against Penicillium roqueforti DPPMAF1. The agar diffusion assays allowed the selection of the pea (Pisum sativum) hydrolysate as the most active. As shown by the hyphal radial growth rate, the WSE had inhibitory activity towards several fungi isolated from bakeries. The MIC of the WSE was 9.0 mg/ml. Fungal inhibition was slightly affected by heating and variations in pH. The antifungal activity was attributed to three native proteins (pea defensins 1 and 2 and a nonspecific lipid transfer protein [nsLTP]) and a mixture of peptides released during hydrolysis. The three proteins have been reported previously as components of the defense system of the plant. Five peptides were purified from WSE and were identified as sequences encrypted in leginsulin A, vicilin, provicilin, and the nsLTP. To confirm antifungal activity, the peptides were chemically synthesized and tested. Freeze-dried WSE were used as ingredients in leavened baked goods. In particular, breads made by the addition of 1.6% (wt/wt) of the extract and fermented by baker's yeast or sourdough were characterized for their main chemical, structural, and sensory features, packed in polyethylene bags, stored at room temperature, and compared to controls prepared without pea hydrolysate. Artificially inoculated slices of a bread containing the WSE did not show contamination by fungi until at least 21 days of storage and behaved like the bread prepared with calcium propionate (0.3%, wt/wt). PMID:25862230

  19. Antioxidant enzymes regulate reactive oxygen species during pod elongation in Pisum sativum and Brassica chinensis. (United States)

    Liu, Nan; Lin, Zhifang; Guan, Lanlan; Gaughan, Gerald; Lin, Guizhu


    Previous research has focused on the involvement of reactive oxygen species (ROS) in cell wall loosening and cell extension in plant vegetative growth, but few studies have investigated ROS functions specifically in plant reproductive organs. In this study, ROS levels and antioxidant enzyme activities were assessed in Pisum sativum and Brassica chinensis pods at five developmental stages. In juvenile pods, the high levels of O2.- and .OH indicates that they had functions in cell wall loosening and cell elongation. In later developmental stages, high levels of .OH were also related to increases in cell wall thickness in lignified tissues. Throughout pod development, most of the O2.- was detected on plasma membranes of parenchyma cells and outer epidermis cells of the mesocarp, while most of the H2O2 was detected on plasma membranes of most cells throughout the mesocarp. This suggests that these sites are presumably the locations of ROS generation. The antioxidant enzymes superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) apparently contributed to ROS accumulation in pod wall tissues. Furthermore, specifically SOD and POD were found to be associated with pod growth through the regulation of ROS generation and transformation. Throughout pod development, O2.- decreases were associated with increased SOD activity, while changes in H2O2 accumulation were associated with changes in CAT and POD activities. Additionally, high POD activity may contribute to the generation of(.)OH in the early development of pods. It is concluded that the ROS are produced in different sites of plasma membranes with the regulation of antioxidant enzymes, and that substantial ROS generation and accumulation are evident in cell elongation and cell wall loosening in pod wall cells. PMID:24503564

  20. Effect of heavy metals on growth and heavy metal content of Allium porrum L. and Pisum sativum L

    Energy Technology Data Exchange (ETDEWEB)

    Gruenhage, L.; Jaeger, H.J.


    The effects of cadmium, lead, zinc and copper, singly and in combination, on yield, heavy metal content and the mineral composition of Allium porrum L. and Pisum sativum L. have been investigated. The Cd, Pb, Zn and Cu concentrations of shoots and roots of Allium porrum increased with increasing heavy metal contamination of soil. However, no visible symptoms of heavy metal toxicity were recognized. The dry matter production was reduced as a function of heavy metal concentration and combination. The mechanisms of combinations were mostly synergistic. The correlation between pollutant contents (nmol/shoot) and yield was higher than the correlation between heavy metal concentrations of soil or shoots (ppm) and yield. Results of regression analyses showed that the inhibition of copper translocation caused by Cd, Pb and Zn was responsible for the yield depressions. The antagonism between Cd and N-deficiency showed that the level of N-supply was without negative effects on yield depressions of Pisum sativum caused by Cd. In contrast to this, the N-form played an important role in Cd-toxicity as the synergism between Cd and NH4 illustrated. K-deficiency as well as acidic nutrient solution (pH=4) diminished the root/shoot-barrier for Cd and therefore Cd-translocation from roots to shoots increased. Concerning calcium, magnesium and iron the decrease of ion uptake caused by Cd was statistically significant higher than yield depression.

  1. Genetic diversity and population structure of Pisum sativum accessions for marker-trait association of lipid content

    Institute of Scientific and Technical Information of China (English)

    Sajjad; Ahmad; Simerjeet; Kaur; Neil; Dylan; Lamb-Palmer; Mark; Lefsrud; Jaswinder; Singh


    Field pea(Pisum sativum L.) is an important protein-rich pulse crop produced globally. Increasing the lipid content of Pisum seeds through conventional and contemporary molecular breeding tools may bring added value to the crop. However, knowledge about genetic diversity and lipid content in field pea is limited. An understanding of genetic diversity and population structure in diverse germplasm is important and a prerequisite for genetic dissection of complex characteristics and marker-trait associations. Fifty polymorphic microsatellite markers detecting a total of 207 alleles were used to obtain information on genetic diversity, population structure and marker-trait associations. Cluster analysis was performed using UPGMA to construct a dendrogram from a pairwise similarity matrix. Pea genotypes were divided into five major clusters. A model-based population structure analysis divided the pea accessions into four groups. Percentage lipid content in 35 diverse pea accessions was used to find potential associations with the SSR markers. Markers AD73, D21, and AA5 were significantly associated with lipid content using a mixed linear model(MLM) taking population structure(Q) and relative kinship(K) into account. The results of this preliminary study suggested that the population could be used for marker-trait association mapping studies.

  2. Genetic diversity and population structure of Pisum sativum accessions for marker-trait association of lipid content

    Directory of Open Access Journals (Sweden)

    Sajjad Ahmad


    Full Text Available Field pea (Pisum sativum L. is an important protein-rich pulse crop produced globally. Increasing the lipid content of Pisum seeds through conventional and contemporary molecular breeding tools may bring added value to the crop. However, knowledge about genetic diversity and lipid content in field pea is limited. An understanding of genetic diversity and population structure in diverse germplasm is important and a prerequisite for genetic dissection of complex characteristics and marker-trait associations. Fifty polymorphic microsatellite markers detecting a total of 207 alleles were used to obtain information on genetic diversity, population structure and marker-trait associations. Cluster analysis was performed using UPGMA to construct a dendrogram from a pairwise similarity matrix. Pea genotypes were divided into five major clusters. A model-based population structure analysis divided the pea accessions into four groups. Percentage lipid content in 35 diverse pea accessions was used to find potential associations with the SSR markers. Markers AD73, D21, and AA5 were significantly associated with lipid content using a mixed linear model (MLM taking population structure (Q and relative kinship (K into account. The results of this preliminary study suggested that the population could be used for marker-trait association mapping studies.

  3. Isoenzymes of superoxide dismutase in nodules of Phaseolus vulgaris L. , Pisum sativum L. , and Vigna unguiculata (L. ) Walp

    Energy Technology Data Exchange (ETDEWEB)

    Becana, M.; Paris, F.J.; Sandalio, L.M.; Del Rio, L.A. (IRNA, Salamanca (Spain) Unidad de Bioquimica Vegetal, Granada (Spain))


    The activity and isozymic composition of superoxide dismutase were determined in nodules of Phaseolus vulgaris L., Pisum sativum L., and Vigna unguiculata (L.) Walp. A Mn-SOD was present in Rhizobium and two in Bradyrhizobium and bacteroids. Nodule mitochondria from all three legume species had a single Mn-SOD with similar relative mobility, whereas the cytosol contained several CuZn-SODs: two in Phaseolus and Pisum, and four in Vigna. In the cytoplasm of V. unguiculata nodules, a Fe-containing SOD was also present, with an electrophoretic mobility between those of CuZn- and Mn-SODs, and an estimated molecular weight of 57,000. Total SOD activity of the soluble fraction of host cells, expressed on a nodule fresh weight basis, exceeded markedly that of bacteroids. Likewise, specific SOD activities of free-living bacteria were superior or equal to those of their symbiotic forms. Soluble extracts of bacteria and bacteroids did not show peroxidase activity, but the nodule cell cytoplasm contained diverse peroxidase isozymes which were readily distinguishable from leghemoglobin components by electrophoresis. Data indicated that peroxidases and leghemoglobins did not significantly interfere with SOD localization on gels. Treatment with chloroform-ethanol scarcely affected the isozymic pattern of SODs and peroxidases, and had limited success in the removal of leghemoglobin.

  4. Winged Pea Aphids Can Modify Phototaxis in Different Development Stages to Assist Their Host Distribution. (United States)

    Zhang, Yi; Wang, Xing-Xing; Jing, Xiangfeng; Tian, Hong-Gang; Liu, Tong-Xian


    The pea aphid, Acyrthosiphon pisum (Harris) (Hemiptera: Aphididae), shows wing polyphenism (winged and wingless morphs) in its life cycle. The winged morph is adapted for dispersal; its two developmental adult stages (for dispersal and reproduction) are based on its breeding periods. The two morphs show different phototactic behavior and the winged can change its preference to light according to the developmental stages. To determine the mechanism and ecological functions of phototaxis for A. pisum, we first investigated the phototaxis of the two aphid morphs at different stages and analyzed the phototactic response to lights of different wavelengths; the correlation between alate fecundity and their phototactic behaviors were then studied. Finally, we focused on the possible functions of phototaxis in aphid host location and distribution in combination with gravitaxis behaviors. Negative phototaxis was found for breeding winged adults but all the other stages of both winged and wingless morphs showed positive phototaxis. The reactions of the aphids to different wavelengths were also different. Nymph production in winged adults showed negative correlation to phototaxis. The dopamine pathway was possibly involved in these behavior modifications. We speculated that winged adults can use light for dispersal in the early dispersal stage and for position holding in the breeding stage. Based on our results, we assume that light signals are important for aphid dispersal and distribution, and are also essential for the pea aphids to cope with environmental changes. PMID:27531980

  5. The X Chromosome of Hemipteran Insects: Conservation, Dosage Compensation and Sex-Biased Expression. (United States)

    Pal, Arka; Vicoso, Beatriz


    Insects of the order Hemiptera (true bugs) use a wide range of mechanisms of sex determination, including genetic sex determination, paternal genome elimination, and haplodiploidy. Genetic sex determination, the prevalent mode, is generally controlled by a pair of XY sex chromosomes or by an XX/X0 system, but different configurations that include additional sex chromosomes are also present. Although this diversity of sex determining systems has been extensively studied at the cytogenetic level, only the X chromosome of the model pea aphid Acyrthosiphon pisum has been analyzed at the genomic level, and little is known about X chromosome biology in the rest of the order.In this study, we take advantage of published DNA- and RNA-seq data from three additional Hemiptera species to perform a comparative analysis of the gene content and expression of the X chromosome throughout this clade. We find that, despite showing evidence of dosage compensation, the X chromosomes of these species show female-biased expression, and a deficit of male-biased genes, in direct contrast to the pea aphid X. We further detect an excess of shared gene content between these very distant species, suggesting that despite the diversity of sex determining systems, the same chromosomal element is used as the X throughout a large portion of the order. PMID:26556591

  6. Evaluation of expression stability of candidate references genes among green and yellow pea cultivars (Pisum sativum L.) subjected to abiotic and biotic stress (United States)

    Dry pea (Pisum sativum) is grown as human and animal feed throughout the world. Large yield losses in pea due to biotic and abiotic stresses compel an improved understanding of mechanisms of stress tolerance and genetic determinants conditioning these tolerances. The availability of stably expressed...

  7. Repetitive DNA in the pea (Pisum sativum L.) genome: comprehensive characterization using 454 sequencing and comparison to soybean and Medicago truncatula

    Czech Academy of Sciences Publication Activity Database

    Macas, Jiří; Neumann, Pavel; Navrátilová, Alice


    Roč. 8, č. 1 (2007), s. 427. ISSN 1471-2164 R&D Projects: GA AV ČR IAA500960702; GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z50510513 Keywords : DNA * Pisum sativum L. Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.180, year: 2007

  8. Batch Scale Removal of an Organic Pollutant Amaranth Dye from Aqueous Solution using Pisum sativum Peels and Arachis hypogaea Shells as Adsorbents

    International Nuclear Information System (INIS)

    The goal of this study was to utilize low cost and environmentally friendly adsorbents for batch scale removal of Amaranth dye from aqueous medium. Peels of Pisum sativum (Pea) and Arachis hypogaea (Peanut) were utilized to investigate their dye removing capacity. The optimized adsorption conditions for Pisum sativum (P.S.P) and Arachis hypogaea (A.H.S) were: adsorbent dose; 0.6 and 0.4 g, contact time; 45 and 10 minutes, pH; 2.0 for both, agitation speed; 150 and 100 rpm and temperature; 60 and 50 degree C for P.S.P and A.H.S respectively. The adsorption data well suited to Langmuir isotherm. Maximum adsorption capacities were found to be 144.93 and 10.53 mg/g for P.S.P and A.H.S respectively. Feasibility of the process was indicated by negative values of thermodynamic parameters delta G/sup 0/ for both adsorbents. Kinetic studies indicated that adsorption of Amaranth dye from aqueous medium by Pisum sativum peels and Arachis hypogaea shells followed pseudo-seconder order kinetics. It was concluded that Pisum sativum peels are more effective adsorbent for removal of Amaranth from aqueous solution as compared to Arachis hypogaea shells. (author)

  9. Novel delivery of the fungi Paecilomyces formosoroseus (Deuteromycotina: Hyphomycetes) for managing the Asian citrus psyllid (Psyllidae: Hemiptera) (United States)

    A method was developed to increase efficacy and reduce grower costs when using the biological control fungal agent Paecilomyces fumosoroseus blastospores (Deuteromycotina: Hyphomycetes) to infect adult Asian citrus psyllids, Diaphorina citri (Psyllidae: Hemiptera). We analyzed the efficacy of this ‘...

  10. Efficacy of insecticide residues on adult Halyomorpha halys (Stal) (Hemiptera: Pentatomidae) mortality and injury in apple and peach orchards (United States)

    The primary threat from Halyomorpha halys (Stal) (Hemiptera: Pentatomidae) originates from populations continuously dispersing from and among wild and cultivated hosts. Many individuals may not come in contact with freshly applied insecticides, but only dried, aged residues. Limited information e...

  11. Dicty_cDB: FC-BI13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available pisum, Pea Aphid Acyrthosiphon pisum cDNA clone WHAP-002_A12 5', mRNA sequence. 50 3e-04 2 CD036313 |CD036313.1 mgmt...015xA07f.b Mated culture Magnaporthe grisea cDNA clone mgmt015xA07 5', mR

  12. Life table analysis and development of Singhiella simplex (Hemiptera:Aleyrodidae) under different constant temperatures (United States)

    The ficus whitefly, Singhiella simplex (Singh) (Hemiptera: Aleyrodidae), is a newly-invasive pest of ficus plants in the United States. Very little is known about its biology and life history. Here, we studied development and reproduction at 15, 20, 25, 27, 30 and 35°C. No immatures survived the 35°...

  13. Biology, ecology, and control of the Ficus whitefly, Singhiella simplex (Hemiptera: Aleyrodidae) (United States)

    The Ficus whitefly, Singhiella simplex (Singh) (Hemiptera: Aleyrodidae), is an economic pest of Ficus plant species in India, Burma and China. Severe infestations result in leaf dropping or shedding and defoliation. Since its initial US report in south Florida in 2007, the whitefly has expanded its ...

  14. Phylogeographic analysis of Harrisia cactus mealybug, Hypogeococcus pungens (Hemiptera: Pseudoccidae) populations: work in progress (United States)

    Harrisia cactus mealybug (HCM), Hypogeococcus pungens (Hemiptera: Pseudoccidae) Granara de Willink (1981) is infesting and killing cacti in the southern coast of Puerto Rico, covering an area of about 1,400 km2. The 13 species of cacti occurring in Puerto Rico are threatened by this new pest; three...

  15. FK506-binding protein from adult Asian citrus psyllid, Diaphorina citri (Hemiptera: Psyllidae) (United States)

    We successfully identified a new member of the FK-binding proteins from the Asian citrus psyllid, Diaphorina citri (Hemiptera: Psyllidae). FK-binding proteins (FKBP) function in many critical pathways needed for psyllid survival. The full length mRNA transcript provides us a new genetic target for ...

  16. Movement of Diaphorina citri Kuwayama (Hemiptera: Liviidae) adults between huanglongbing-affected and healthy citrus (United States)

    Asian citrus psyllid (ACP), Diaphorina citri Kuwayama (Hemiptera: Liviidae), is a vector transmitting the pathogen of citrus huanglongbing (HLB, also called yellow shoot disease or citrus greening disease). A typical symptom of citrus HLB is leaf yellowing. ACP adults behaved differently on HLB-affe...

  17. Contributions to the knowledge of Banasa Stål (Hemiptera, Heteroptera, Pentatomidae: Banasa chaca Thomas

    Directory of Open Access Journals (Sweden)

    Thereza de Almeida Garbelotto


    Full Text Available Contributions to the knowledge of Banasa Stål (Hemiptera, Heteroptera, Pentatomidae: Banasa chaca Thomas. The male of Banasa chaca Thomas is described with emphasis on external and internal genitalia and the female internal genitalia is described. Banasa chaca is newly recorded from Buenos Aires Province (Argentina.

  18. A new species of Taosa (Hemiptera:Dictyopharide) from South America associated with Water Hyacinth (United States)

    A new species of Taosa (Hemiptera: Dictyopharidae) is described. All the stages were collected on the aquatic weed Eichhornia crassipes (Martius) Solms-Laubach (Pontederiaceae) at several localities on the Paraguay River in Argentina, and the upper Amazon River in Perú. Taosa impictifrons Remes Leni...

  19. Variation in susceptibility to potato psyllid, Bactericera cockerelli (Hemiptera: Triozidae),among Solanum verrucosum germplasm accessions (United States)

    Potato psyllid, Bactericera cockerelli (Šulc) (Hemiptera: Triozidae) is a key pest of potato and the vector of "Candidatus Liberibacter solanacearum," the pathogen associated with zebra chip disease. Development of potato cultivars with genetic resistance to potato psyllid would enable cost-effecti...

  20. Effect of papaya trunk angle on infestation by white peach scale, Pseudaulacaspis pentagona (Hemiptera: Diaspididae) (United States)

    Two papaya (Carica papaya L.) seedlings growing in one planting hole often results in angular or non-vertical growth of the trees. Data on trunk angularity, or leaning, (deviation from the vertical line of reference) and white peach scale, Pseudaulacaspis pentagona Targioni-Tozzetti (Hemiptera: Dias...

  1. Description of a new coccid (Hemiptera, Coccidae on avocado (Persea americana Mill. from Colombia, South America

    Directory of Open Access Journals (Sweden)

    Takumasa Kondo


    Full Text Available A new soft scale insect, Bombacoccus aguacatae Kondo, gen. n. and sp. n. (Hemiptera: Coccidae collected on the branches and twigs of avocado, Persea americana Mill. (Lauraceae in Colombia, is described and illustrated based on the adult female. An updated taxonomic key to closely related genera of the Toumeyella-group is provided.

  2. Phylogenetic relationships among superfamilies of Cicadomorpha (Hemiptera: Auchenorrhyncha) inferred from the wing base structure


    Yoshizawa, Kazunori; Wagatsuma, Mutsumi


    The infraorder Cicadomorpha is a monophyletic group of the order Hemiptera, suborder Auchenorrhyncha, and is composed of three superfamilies: Cercopoidea (spittle bugs), Cicadoidea (cicadas) and Membracoidea (leafhoppers and treehoppers). Phylogenetic relationships among the superfamilies have been highly controversial morphologically and molecularly, but recent molecular phylogenetic analyses provided support for Cercopoidea + Cicadoidea. In this study, we examined morphology of the wing bas...

  3. Description of a new coccid (Hemiptera, Coccidae) on avocado (Persea americana Mill.) from Colombia, South America


    Takumasa Kondo


    A new soft scale insect, Bombacoccus aguacatae Kondo, gen. n. and sp. n. (Hemiptera: Coccidae) collected on the branches and twigs of avocado, Persea americana Mill. (Lauraceae) in Colombia, is described and illustrated based on the adult female. An updated taxonomic key to closely related genera of the Toumeyella-group is provided.

  4. Preliminary Observations on Zelus obscuridorsis (Stål (Hemiptera: Reduviidae as Predator of the Corn Leafhopper (Hemiptera: Cicadellidae in Argentina

    Directory of Open Access Journals (Sweden)

    Eduardo G. Virla


    Full Text Available The corn leafhopper Dalbulus maidis (Hemiptera: Cicadellidae, is an important corn pest in most of tropical and subtropical America. This leafhopper has a rich natural enemy complex of which parasitoids and pathogens are the most studied; knowledge on its predators is limited. We noted the presence of the native assassin bug Zelus obscuridorsis (Hemiptera: Reduviidae predating diverse motile insects, including the corn leafhopper, on corn plants cultivated in household vegetable gardens in San Miguel de Tucumán (Argentina; in order to verify its predatory actions, we exposed lab-bred individuals of D. maidis to adults of Z. obscuridorsis. The predators were starved for 24 h before trials in which the corn leafhopper in different developmental stages were exposed. Zelus obscuridorsis is highly skilled in catching specimens in motion, but it was not able to prey on eggs. The predator was capable to catch and prey on nymphs and adults.

  5. Megamelus bellicus (Hemiptera: Delphacidae: immature stages and biology Megamelus bellicus (Hemiptera: Delphacidae: estados inmaduros y biología

    Directory of Open Access Journals (Sweden)

    Roxana Mariani


    Full Text Available The immature stages of Megamelus bellicus Remes Lenicov & Sosa (Hemiptera: Delphacidae are described, keyed and illustrated. The description of each stage was based on 24-h hatched nymphs from the laboratory colony. The main characters that distinguish the various stages are: body size, color, number of tarsomeres, espinulation of the metatibia and number of teeth on the spur; presence of sensoria on antennal pedicel. This insect was reared on pieces of water hyacinth, Eichhornia crassipes (Martius Solms Laubach. Biological data based on lab and field observations show that M. bellicus carries out its biological cycle successfully on Pontederiaceae. One to nine eggs per scar are laid deeply into the aerenquima of the petiole, being most frequent 3-4, less frequent 5, 2 and 6 and rarely 1, 7 and 9. Eulophid wasps Aprostocetus (Ootetrastichus sp, known as eggs parasitoid, was registered and quantified. As M. bellicus occupies the same ecological habitat that M. scutellaris Berg, we highlighted some morphological and biological aspects that allow their differentiation.Se describen e ilustran los estados inmaduros de Megamelus bellicus Remes Lenicov & Sosa (Hemiptera: Delphacidae y se presenta una clave para identificarlos. La descripción de cada estadio se realizó sobre la base de ninfas extraidas 24 horas posteriores a la eclosión, de colonias de laboratorio y criadas sobre trozos de hojas de camalote Eichhornia crassipes (Martius Solms Laubach. Los principales caracteres para distinguir los distintos estadios son: tamaño del cuerpo, color, número de tarsómeros, espinulación de la metatibia y número de dientes del calcar y presencia de sensorios en el pedicelo antenal. Datos biológicos basados en observaciones en el laboratorio y en el campo, muestran que M. bellicus realiza su ciclo biológico exitosamente sobre Pontederiaceae. Los huevos, dispuestos de 1 a 9 por postura, son colocados profundamente en el aerénquima del pecíolo; son m

  6. Exploration for facultative endosymbionts of glassy-wingedsharpshooter (Hemiptera: Cicadellidae)

    Energy Technology Data Exchange (ETDEWEB)

    Montllor-Curley, C.; Brodie, E.L.; Lechner, M.G.; Purcell, A.H.


    Homalodisca vitripennis (Germar) (Hemiptera: Cicadellidae),glassy-winged sharpshooter, was collected in California and severalstates in the southeastern United States in 2002 and 2003 and analyzedfor endosymbiotic bacteria. Hemolymph, eggs, and bacteriomes wereexamined for the presence of bacteria by polymerase chain reaction. Asubset of hemolymph and egg samples had their 16S rRNA gene ampliconscloned and sequenced or analyzed by restriction digest patterns ofsamples compared with known bacterial DNA. Baumannia cicadellinicola, oneof the primary symbionts of glassy-winged sharpshooter, was found in themajority of hemolymph samples, although it has been considered until nowto reside primarily inside the specialized host bacteriocytes. Wolbachiasp., a common secondary symbiont in many insect taxa investigated todate, was the second most frequently detected bacterium in hemolymphsamples. In addition, we detected bacteria that were most closely related(by 16S rRNA gene sequence) to Pseudomonas, Stenotrophomonas, andAcinetobacter in hemolymph samples of one and/or two glassy-wingedsharpshooters, but their origin is uncertain.

  7. Accuracy of Trained Canines for Detecting Bed Bugs (Hemiptera: Cimicidae). (United States)

    Cooper, Richard; Wang, Changlu; Singh, Narinderpal


    Detection of low-level bed bug, Cimex lectularius L. (Hemiptera: Cimicidae), infestations is essential for early intervention, confirming eradication of infestations, and reducing the spread of bed bugs. Despite the importance of detection, few effective tools and methods exist for detecting low numbers of bed bugs. Scent dogs were developed as a tool for detecting bed bugs in recent years. However, there are no data demonstrating the reliability of trained canines under natural field conditions. We evaluated the accuracy of 11 canine detection teams in naturally infested apartments. All handlers believed their dogs could detect infestations at a very high rate (≥95%). In three separate experiments, the mean (min, max) detection rate was 44 (10-100)% and mean false-positive rate was 15 (0-57)%. The false-positive rate was positively correlated with the detection rate. The probability of a bed bug infestation being detected by trained canines was not associated with the level of bed bug infestations. Four canine detection teams evaluated on multiple days were inconsistent in their ability to detect bed bugs and exhibited significant variance in accuracy of detection between inspections on different days. There was no significant relationship between the team's experience or certification status of teams and the detection rates. These data suggest that more research is needed to understand factors affecting the accuracy of canine teams for bed bug detection in naturally infested apartments. PMID:26470083

  8. Soybean Aphid (Hemiptera: Aphididae) Affects Soybean Spectral Reflectance. (United States)

    Alves, Tavvs M; Macrae, Ian V; Koch, Robert L


    Soybean aphid, Aphis glycines Matsumura (Hemiptera: Aphididae), is the most economically important insect pest of soybean in the north central United States. Scouting-based integrated pest management (IPM) programs could become more efficient and more widely adopted by using plant spectral reflectance to estimate soybean aphid injury. Our objective was to determine whether plant spectral reflectance is affected by soybean aphid feeding. Field trials were conducted in 2013 and 2014 using caged plots. Early-, late-, and noninfested treatments were established to create a gradient of soybean aphid pressure. Whole-plant soybean aphid densities were recorded weekly. Measurements of plant spectral reflectance occurred on two sample dates per year. Simple linear regression models were used to test the effect of cumulative aphid-days (CAD) on plant spectral reflectance at 680 nm (RED) and 800 nm (NIR), normalized difference vegetation index (NDVI), and relative chlorophyll content. Data indicated that CAD had no effect on canopy-level RED reflectance, but CAD decreased canopy-level NIR reflectance and NDVI. Canopy- and leaf-level measurements typically indicated similar plant spectral response to increasing CAD. CAD generally had no effect on relative chlorophyll content. The present study provides the first documentation that remote sensing holds potential for detecting changes in plant spectral reflectance induced by soybean aphid. The use of plant spectral reflectance in soybean aphid management may assist future IPM programs to reduce sampling costs and prevent prophylactic insecticide sprays. PMID:26470392

  9. Climbing Ability of the Common Bed Bug (Hemiptera: Cimicidae). (United States)

    Hottel, B A; Pereira, R M; Gezan, S A; Qing, R; Sigmund, W M; Koehler, P G


    Little is known about what factors influence the climbing ability of bed bugs, Cimex lectularius L. (Hemiptera: Cimicidae), in relation to the various surfaces they encounter. We examined how sex, time since last fed, and what surfaces the bed bugs were in contact with affected their climbing performance. The effects of sex and time since fed were tested by counting the number of bed bugs able to climb a 45° slope. The pulling force was recorded using an analytical balance technique that captured the sequential vertical pulling force output of bed bugs attached to various surfaces. Recently fed female bed bugs were found to have the most difficulty in climbing smooth surfaces in comparison with males. This difference can be explained by the larger weight gained from bloodmeals by female bed bugs. A variety of vertical pulling forces were observed on surfaces ranging from sandpaper to talc powder-covered glass. For surfaces not treated with talc powder, bed bugs generated the least amount of vertical pulling force from synthetically created 0.6-µm plastron surfaces. This vast range in the ability of bed bugs to grip onto various surfaces may have implications on limiting bed bugs dispersal and hitchhiking behaviors. PMID:26334801

  10. Effect of pre-sowing magnetic field treatment to garden pea (pisum sativum l.) seed on germination and seedling growth

    International Nuclear Information System (INIS)

    The seeds of garden pea ( Pisum sativum L. cv. climax) were exposed to full-wave rectified sumusoidal non-uniform magnetic fields of strength 60 mT, 120 mT and 180 mT for 5, 10 and 15 min prior to sowing. The magnetically treated seeds were sown according to the protocol of International Seed Testing Association (ISTA). Magnetically treated seed showed significant increase in germination. The emergence index, final emergence index and vigor index increased by 86.43%, 13.21% and 204.60%, respectively. It was found that exposure of 5 min for magnetic field strengths of 60 mT and 180 mT significantly enhanced the germination parameters of the pea and these treatments can be used practically to accelerate the germination in garden pea. (author)

  11. The influence of rate and time of nitrate supply on nitrogen fixation and yield in pea (Pisum sativum L.)

    DEFF Research Database (Denmark)

    Jensen, Erik Steen


    The influence of nitrate N supply on dry matter production, N content and symbiotic nitrogen fixation in soil-grown pea (Pisum sativum L.) was studied in a pot experiment by means of15N fertilizer dilution. In pea receiving no fertilizer N symbiotic nitrogen fixation, soil and seed-borne N...... contributed with 82, 13 and 5% of total plant N, respectively. The supply of low rates of nitrate fertilizer at sowing (“starter N”) increased the vegetative dry matter production, but not the seed yield significantly. Nitrogen fixation was not significantly decreased by the lower rates of nitrate but higher...... rates supplied at sowing reduced the nitrogen fixation considerably. Applying nitrate N at the flat pod growth stage increased the yield of seed dry matter and N about 30% compared to pea receiving no nitrate fertilizer. Symbiotic nitrogen fixation was reduced only about 11%, compared with unfertilized...

  12. Genotype-environmental interaction and stability analysis of some yield components in field peas (Pisum Sativum L.)

    International Nuclear Information System (INIS)

    Genotype-environment interaction and assessment of the adaptation of the genotypes to a range of environments is presented. Some of the yield components (number of pods/plant, number of seeds/plant and seed weight/plant) were analysed by means of statistical techniques in three cultivars Auralia, Borek and Virtus and six mutant lines of field peas (Pisum sativurn L.). Differences in response to the environment were found among genotypes for the characters studied; a large proportion of these interactions was accounted for by linear regression. Using two stability parameters, regression coefficient (bi) and stability variance (erf), only one genotype cv Auralia could be considered widely adapted to seed weight/plant. Other stable genotypes were identified as suitable for poor/or favourable environmental conditions. The importance of genotype-environment interactions in breeding strategies is discussed

  13. Response of root fungi in Pisum sativum to plant and soil environmental factors

    DEFF Research Database (Denmark)

    Yu, Lingling

    , Pisum sativum was used as a model crop to study fungal community structure associated with roots under different environmental conditions. Three individual experiments were conducted in order to study root-associated fungal community structure in relation to root-internal factors in terms of plant...... analysis, analysis of variance (ANOVA) was used in the measurement of plant growth parameters and relative abundance of root-associated fungi, and principle component analysis (PCA) was used to examine the response of communities of root fungi to the plant and soil environmental factors. vi The three...... studies showed that root-associated fungal communities were highly diverse and significantly influenced by plant and soil environmental factors, and results supported the hypotheses that the relative abundance of dominant fungal groups differed between healthy and diseased plants, altered according to...

  14. Organic fertilization alters the community composition of root associated fungi in Pisum sativum

    DEFF Research Database (Denmark)

    Yu, L.; Nicolaisen, M.; Ravnskov, S.;


    Organic fertilization is well known to affect individual functional groups of root associated fungi such as arbuscular mycorrhizal (AM) fungi and root pathogens, but limited information is available on the effect of organic fertilization at the fungal community composition level. The main objective...... of the present study was to examine the response of communities of root associated fungi in Pisum sativum to Protamylasse, an organic fertilizer used in pea production. Plants were grown in pots with field soil amended with four different levels of Protamylasse. 454 pyrosequencing was employed to...... examine diversity of root associated fungi and revealed in total 164 non-singleton operational taxonomic units (OTUs). Principle component analysis (PCA) showed response of fungal community structure of the 15 most abundant OTUs to the four fertilization levels. Obligate biotrophic fungi such as the AM...

  15. Differential changes in size distribution of xyloglucan in the cell walls of gravitropically responding Pisum sativum epicotyls (United States)

    Talbott, L. D.; Pickard, B. G.


    Growth-related change in the size distribution of hemicellulosic wall polymers during the gravitropic curvature response of intact pea (Pisum sativum L. cv Alaska) epicotyls was examined by gel-filtration chromatography. The gravitropic response was characterized by the appearance of curvature 20 to 30 min after horizontal placement, with 35 degrees of curvature attained by 80 min. Correlated with the onset of curvature, on the upper side of the epicotyl, there was a conspicuous transient increase in the abundance of relatively large hemicellulosic xyloglucan polymers, similar to increases previously found under conditions where diminished wall extensibility was expected. On the lower side there was a moderate, slower, and longer-term increase in abundance of small xyloglucan, similar to changes previously found in connection with auxin-stimulated growth responses. Both shifts occurred primarily in the epidermis. They appear to represent two coordinated physiological mechanisms contributing to differential growth.

  16. The effect of inhibitors of plasma membrane H+ - ATPase and oxidoreductases on NH4+ uptake by Pisum arvense roots

    Directory of Open Access Journals (Sweden)

    Genowefa Kubik-Dobosz


    Full Text Available The effect of inhibitors of plasma membrane oxidoreductases (quinacrine and dicumarol and H+-ATPase (dicyclohexylcarbodiimide and orthovanadate on ammonium uptake by Pisum arvense seedlings and the activities of H+-ATPase and NADH-ferricyanide oxidoreductase was investigated. The uptake solution contained 50 µM NH4+. In I h experiments, quinacrine and dicumarol depressed strongly and irreversibly the rate of NH4+ uptake and markedly inhibited the activity of NADH-ferri-cyanide oxidoreductase in the plasma membrane vesicles prepared from root cells. Simultaneously, sodium orthovanadate inhibited the activity of plasma membrane H+-ATPase increased the rate of NH4+ uptake. Dicyclohexylcarbodiimide inhibited H+-ATPase activity and increased efflux of NH4+ from roots to ambient solution. The results indicate on the lack of direct connection between uptake rate of 50 µM NH4+ and H+-ATPase activity, and suggest that membrane redox systems play a predominant role in this process.

  17. Callose deposition during gravitropism of Zea mays and Pisum sativum and its inhibition by 2-deoxy-D-glucose (United States)

    Jaffe, M. J.; Leopold, A. C.


    In etiolated corn (Zea mays L.) and etiolated pea (Pisum sativum L.) seedlings, a gravitropic stimulation induces the deposition of callose. In the corn coleoptiles this occurs within 5 min of gravity stimulation, and prior to the beginning of curvature. Both gravitropic curvature and callose deposition reach their maxima by 12 h. Within the first 2 h more callose is deposited on the upper (concave) side, but after 2-3 h, this deposition pattern is reversed. An inhibitor of protein glycosylation, 2-deoxy-D-glucose (DDG), inhibits callose production and considerably retards gravitropic bending in both species of plants. Mannose can relieve the inhibition of gravitropic bending by DDG. The pea mutant "Ageotropum", which does not respond to gravity when etiolated, also fails to produce callose in response to a gravitic stimulus. These correlations indicate that callose deposition may be a biochemical component of gravitropism in plant shoots.

  18. The conformational stability and biophysical properties of the eukaryotic thioredoxins of Pisum sativum are not family-conserved.

    Directory of Open Access Journals (Sweden)

    David Aguado-Llera

    Full Text Available Thioredoxins (TRXs are ubiquitous proteins involved in redox processes. About forty genes encode TRX or TRX-related proteins in plants, grouped in different families according to their subcellular localization. For instance, the h-type TRXs are located in cytoplasm or mitochondria, whereas f-type TRXs have a plastidial origin, although both types of proteins have an eukaryotic origin as opposed to other TRXs. Herein, we study the conformational and the biophysical features of TRXh1, TRXh2 and TRXf from Pisum sativum. The modelled structures of the three proteins show the well-known TRX fold. While sharing similar pH-denaturations features, the chemical and thermal stabilities are different, being PsTRXh1 (Pisum sativum thioredoxin h1 the most stable isoform; moreover, the three proteins follow a three-state denaturation model, during the chemical-denaturations. These differences in the thermal- and chemical-denaturations result from changes, in a broad sense, of the several ASAs (accessible surface areas of the proteins. Thus, although a strong relationship can be found between the primary amino acid sequence and the structure among TRXs, that between the residue sequence and the conformational stability and biophysical properties is not. We discuss how these differences in the biophysical properties of TRXs determine their unique functions in pea, and we show how residues involved in the biophysical features described (pH-titrations, dimerizations and chemical-denaturations belong to regions involved in interaction with other proteins. Our results suggest that the sequence demands of protein-protein function are relatively rigid, with different protein-binding pockets (some in common for each of the three proteins, but the demands of structure and conformational stability per se (as long as there is a maintained core, are less so.

  19. Inventaire et mise en collection d’espèces de pucerons et de parasitoïdes collectés en grandes cultures, et premier enregistrement de Metopolophium frisicum (Hille Ris Lambers 1947) et Acyrthosiphon primulae (Theobald 1913) (Hemiptera: Aphididae) en Belgique


    Chevalier Mendes Lopes, Thomas; Hatt, Séverin; Starý, Petr; Francis, Frédéric


    L’objet de cette étude consistait à identifier et à mettre en collection des espèces de pucerons et de parasitoïdes collectées dans des cultures de froment et de pois, situées à Gembloux (Belgique). Pour ce faire, des pièges jaunes de von Moericke ont été utilisés pendant les saisons culturales de 2012, 2013 et 2014. Cinquante-deux espèces de pucerons ont été identifiées et conservées au Conservatoire entomologique de Gembloux. Parmi celles-ci, Metopolophium frisicum (Hille Ris Lambers 1947) ...

  20. New records of stink bugs (Hemiptera: Pentatomidae) from Colombia. (United States)

    Castro-Huertas, Valentina; Schwertner, Cristiano F; Fernández, Fernando


    New records of genera and species of stink bugs (Hemiptera: Pentatomidae) from Colombia are provided. Two genera are new records for South America: Alathetus and Schraderiellus. Fifteen genera are new record for Colombia: Agaclitus, Boea, Ceratozygum, Euthyrhynchus, Eritrachys, Doesburguedessa, Lopadusa, Marmessulus, Paralincus, Patanius, Peromatus, Phalaecus, Phoeacia, Rio, and Tyrannocoris. Forty-nine species from five subfamiles are recorded for the first time in Colombia. Asopinae: Coryzorhaphis carneolus Erichson, Coryzorhaphis superba Breddin, Euthyrhynchus floridanus (Linnaeus), Podisus sagitta Fabricius, Stiretrus anchorago (Fabricius), Stiretrus cinctellus Germar, Tylospilus peruvianus Horvath, Tyrannocoris nigriceps Thomas. Cyrtocorinae: Ceratozygum horridum (Germar). Discocephalinae: Agaclitus dromedarius Stål, Antiteuchus melanoleucus (Westwood), Antiteuchus sepulcralis (Fabricius), Dinocoris gibbosus (Fallou), Dinocoris variolosus (Linnaeus), Discocephalessa terminalis (Walker), Dryptocephala crenata Ruckes, Dryptocephala dentifrons (Latreille), Eurystethus ovalis Ruckes, Paralcippus dimidiatus (Ruckes), Alathetus rufitarsus Dallas, Eritrachys bituberculata Ruckes, Paralincus bimaculatus (Ruckes), Schraderiellus cinctus (Ruckes), Xynocoris recavus (Garbelotto & Campos). Edessinae: Brachystethus cribus (Fabricius), Brachystethus tricolor Bolívar, Doesburguedessa elongatispina Fernandes and Lopadusa fuscopunctata (Distant). Pentatominae: Banasa fulgida Thomas, Banasa paraexpallescens Thomas, Dichelops divisus (Walker), Dichelops nigrum Bergroth, Euschistus carbonerus Rolston, Mormidea bovilla (Distant), Mormidea triangularis (Walker), Murgantia bifasciata Herrich-Schaeffer, Murgantia violascens (Westwood), Oebalus pugnax (Fabricius), Oebalus ypsilon-griseus (DeGeer), Odmalea concolor (Walker), Patanius vittatus Rolston, Proxys albopunctulatus (Palisot), Proxys punctulatus (Palisot), Rhyncholepta grandicallosa Bergroth, Rio insularis Ruckes, Roferta

  1. Phenology of pea crop (Pisum sativum L. var. Santa Isabel) in the Bogotá plateau at open field and under plastic cover

    International Nuclear Information System (INIS)

    The assessment of environment effects on plant development is important to identify suitable zones and schedule crop production. In this research, plant development of pea (Pisum sativum L. var. Santa Isabel) was evaluated under Bogotá flat highland, Colombia, environmental conditions (2640 m over sea level, 14°C, 80% R.H., rainfall of 800 mm/year). Two experiments were done under plastic cover

  2. A novel lipid transfer protein from the pea Pisum sativum: isolation, recombinant expression, solution structure, antifungal activity, lipid binding, and allergenic properties


    Bogdanov, Ivan V.; Shenkarev, Zakhar O.; Finkina, Ekaterina I.; Melnikova, Daria N.; Rumynskiy, Eugene I.; Arseniev, Alexander S.; Ovchinnikova, Tatiana V.


    Background Plant lipid transfer proteins (LTPs) assemble a family of small (7–9 kDa) ubiquitous cationic proteins with an ability to bind and transport lipids as well as participate in various physiological processes including defense against phytopathogens. They also form one of the most clinically relevant classes of plant allergens. Nothing is known to date about correlation between lipid-binding and IgE-binding properties of LTPs. The garden pea Pisum sativum is widely consumed crop and i...

  3. Effect of Low-Temperature Plasma on the Structure of Seeds, Growth and Metabolism of Endogenous Phytohormones in Pea (Pisum sativum L.)


    Stolárik, T.; Henselová, M.; Martinka, M; Novák, O.; Záhoranová, A.; Černák, M.


    The objective of this study was to determine the influence of low-temperature plasma (LTP) on seed surface modification, water uptake by seeds, seed germination and vigor of seedlings, as well as changes in the content of endogenous hormones in pea, (Pisum sativum L. var. Prophet). The study's authors used diffuse coplanar surface barrier discharge as the source of LTP in various duration times of treatment (from 60 to 600 s). The SEM analysis showed that LTP induced significant changes on th...

  4. Analysis of genetic effects of major genes on yield traits of a pea (pisum sativum l.) cross between the santa isabel x wsu 31 varieties


    Ligarreto Moreno, Gustavo Adolfo; Gomez, Gustavo Ernesto


    Análisis de efectos de genes mayores sobre rasgos de rendimiento en arveja (Pisum Generation means and heritability analyses were conducted to estimate dominance, additive, maternal and gene interaction effects controlling eleven agronomic characteristics related with production in the pea. Ten generations (P1, P2, F1, F2, RC1, RC2 and each reciprocal generation) from a cross between the Santa Isabel and WSU 31 varieties were sown in two different environments for the present study. Eleven ch...

  5. Studies on the Control of Ascochyta Blight in Field Peas (Pisum sativum L.) Caused by Ascochyta pinodes in Zhejiang Province, China


    Liu, Na; Xu, Shengchun; Yao, Xiefeng; Zhang, Guwen; Mao, Weihua; Hu, Qizan; Feng, Zhijuan; Gong, Yaming


    Ascochyta blight, an infection caused by a complex of Ascochyta pinodes, Ascochyta pinodella, Ascochyta pisi, and/or Phoma koolunga, is a destructive disease in many field peas (Pisum sativum L.)-growing regions, and it causes significant losses in grain yield. To understand the composition of fungi associated with this disease in Zhejiang Province, China, a total of 65 single-pycnidiospore fungal isolates were obtained from diseased pea samples collected from 5 locations in this region. Thes...

  6. Molecular and morphological identification of mealybug species (Hemiptera: Pseudococcidae) in brazilian vineyards


    Pacheco da Silva, Vitor Cezar; Bertin, Aline; Blin, Aurélie; Germain, Jean-Francois; Bernardi, Daniel; Rignol, Guylène; Botton, Marcos


    Mealybugs (Hemiptera: Pseudococcidae) are pests constraining the international trade of Brazilian table grapes. They damage grapes by transmitting viruses and toxins, causing defoliation, chlorosis, and vigor losses and favoring the development of sooty mold. Difficulties in mealybug identification remain an obstacle to the adequate management of these pests. In this study, our primary aim was to identify the principal mealybug species infesting the major table grape-producing regions in Braz...

  7. Laboratory Rearing of Laricobius nigrinus (Coleoptera: Derodontidae): A Predator of the Hemlock Woolly Adelgid (Hemiptera: Adelgidae)


    Salom, S. M.; L. T. Kok; Lamb, A B; Jubb, C


    Coleopteran species are biological control agents of numerous invasive pests. Laricobius nigrinus (Coleoptera: Derodontidae), a predaceous, univoltine species, spends the summer aestivating but is active for the rest of the year. Laricobius nigrinus possesses many essential attributes for effective biological control of the hemlock woolly adelgid (Hemiptera: Adelgidae). The predator must be reared in large numbers for field releases. We describe some of the studies that led to the successful ...

  8. Primer Registro para el Perú de Brachycaudus schwartzi (Bórner (Hemiptera: Aphididae

    Directory of Open Access Journals (Sweden)

    Walter Díaz


    Full Text Available Se registra por primera vez para el Perú la especie Brachycaudus schwartzi (Bórner (Hemiptera: Aphididae, “pulgón pardo del duraznero”. La especie ha sido colectada en el departamento de Tacna. Material de referencia se encuentra depositado en la Colección Referencial de Insectos de la Unidad del Centro de Diagnóstico de Sanidad Vegetal del SENASA, Lima, Perú.

  9. Plant Essential Oils Synergize and Antagonize Toxicity of Different Conventional Insecticides against Myzus persicae (Hemiptera: Aphididae)


    Nicoletta Faraone; N Kirk Hillier; G Christopher Cutler


    Plant-derived products can play an important role in pest management programs. Essential oils from Lavandula angustifolia (lavender) and Thymus vulgaris (thyme) and their main constituents, linalool and thymol, respectively, were evaluated for insecticidal activity and synergistic action in combination with insecticides against green peach aphid, Myzus persicae (Sulzer) (Hemiptera: Aphididae). The essential oils and their main constituents exerted similar insecticidal activity when aphids wer...

  10. BIOLOGY OF Trissolcus latisulcus Crawford (Hymenoptera: Scelionidae), AN EGG PARASITOID OF Chrysocoris javanus Westw (Hemiptera: Scutelleridae)


    D. Adidharma; Y.D. Ciptadi


    The biology of Trissolcus latisulcus Crawford was studied on eggs of Chrysocoris javanus Westw (Hemiptera: Scutelleridae) which is a serious pest of Jatropha curcas L.. The aim of this study was to investigate the biology of Trissolcus latisulcus as a basic knowledge for developing a more suitable biological control programme in controlling the pest C. javanus. The current laboratory study was designed to evaluate developmental duration from egg to adult of C. javanus under room conditi...

  11. Ooencyrtus (Hymenoptera: Encyrtidae), egg parasitoids of the pistachio green stink bugs (Hemiptera: Pentatomidae) in Iran. (United States)

    Hayat, Mohammad; Mehrnejad, M Reza


    This paper deals with three species of Ooencyrtus Ashmead (Hymenoptera: Encyrtidae) obtained from eggs of the green stink bug, Brachynema germarii (Kolenati) (Hemiptera: Pentatomidae) infesting pistachio plants in Iran. Two new species, Ooencyrtus iranicus Hayat & Mehrnejad, sp. nov. and O. pistaciae Hayat & Mehrnejad, sp. nov., are described, and O. telenomicida (Vassiliev) is newly recorded from Iran, redescribed and illustrated. A key to some species considered similar to the species treated here is also given. PMID:27395169

  12. Responses of Neomegalotomus parvus (Hemiptera: Alydidae) to color and male-lured traps


    Maurício Ursi Ventura; Antônio Ricardo Panizzi


    In 1998, the relative responses of Neomegalotomus parvus (Westwood) (Hemiptera: Alydidae) to colors in traps were assessed in the field. Colors were printed in white alkaline paper and covered with transparent plastic. Printed colors were black, green, yellow, red and blue. Treatments also included white paper and aluminum foil. Green traps captured more bugs than the other traps (except yellow). Yellow traps caught significantly more N. parvus males than blue, black and aluminum traps. White...

  13. Characterization of a Newly Discovered Symbiont of the Whitefly Bemisia tabaci (Hemiptera: Aleyrodidae)


    Bing, Xiao-Li; Yang, Jiao; Zchori-Fein, Einat; Wang, Xiao-Wei; Liu, Shu-Sheng


    Bemisia tabaci (Hemiptera: Aleyrodidae) is a species complex containing >28 cryptic species, some of which are important crop pests worldwide. Like many other sap-sucking insects, whiteflies harbor an obligatory symbiont, “Candidatus Portiera aleyrodidarum,” and a number of secondary symbionts. So far, six genera of secondary symbionts have been identified in B. tabaci. In this study, we report and describe the finding of an additional bacterium in the indigenous B. tabaci cryptic species Chi...

  14. Wing base morphology of Aetalionidae (Hemiptera: Cicadomorpha) and its phylogenetic implications


    Ogawa, Naoki; Maruyama, Munetoshi; Yoshizawa, Kazunori


    The Aetalionidae is a small family belonging to the treehopper superfamily Membracoidea (Hemiptera: Cicadomorpha). Although the wing-base morphology of Cicadomorpha was examined in detail recently, the wing base of this family has not been investigated to date. We examined morphology of the wing-base structure of Aetalionidae. Using the characters selected from the wing base, we inferred the phylogenetic placement of this family and confirmed that it belongs to the superfamily Membracoidea an...

  15. Jumping mechanisms of treehopper insects (Hemiptera, Auchenorrhyncha, Membracidae). (United States)

    Burrows, M


    The kinematics and jumping performance of treehoppers (Hemiptera, Auchenorrhyncha, Membracidae) were analysed from high speed images. The eight species analysed had an 11-fold range of body mass (3.8-41 mg) and a 2-fold range of body length (4.1-8.4 mm). Body shape was dominated by a prothoracic helmet that projected dorsally and posteriorly over the body, and in some species forwards to form a protruding horn. Jumping was propelled by rapid depression of the trochantera of the hindlegs. The hindlegs were only 30-60% longer than the front and middle legs, and 47-94% the length of the body in different species. They were slung beneath the body and moved together in the same plane. In preparation for a jump, the hindlegs were initially levated and rotated forwards so that the femora were pressed into indentations of the coxae. The tibiae were flexed about the femora and the tarsi were placed on the ground directly beneath the lateral edges of the abdomen. Movements of the front and middle legs adjusted the angle of the body relative to the ground, but for most treehoppers this angle was small, so that the body was almost parallel to the ground. The rapid depression of the hindlegs accelerated the body to take-off in 1.2 ms in the lighter treehoppers and 3.7 ms in the heavier ones. Take-off velocities of 2.1-2.7 m s(-1) were achieved and were not correlated with body mass. In the best jumps, these performances involved accelerations of 560-2450 m s(-2) (g forces of 47-250), an energy expenditure of 13.5-101 μJ, a power output of 12-32 mW and exerted a force of 9.5-29 mN. The power output per mass of muscle far exceeds the maximum active contractile limit of normal muscle. Such requirements indicate that treehoppers must be using a power amplification mechanism in a catapult-like action. Some jumps were preceded by flapping movements of the wings, but the propulsive movements of the hindlegs were crucial in achieving take-off. PMID:23155084

  16. Bioefficacy of gamma radiation on Phenacoccus solenopsis (Hemiptera: pseudococcidae)

    International Nuclear Information System (INIS)

    Ionizing radiation can be considered as a possible alternative for treating agricultural products to overcome quarantine barriers against the Solenopsis mealy bug, Phenacoccus solenopsis (Hemiptera: Pseudococcidae). Exposure of ionizing radiation is one of the quarantine treatments which penetrate commodities quickly and most commodities can tolerate irradiation at doses that kill the pest. Evaluation of various bio-characteristics (survival, metamorphosis and reproductive potential) of Phenacoccus solenopsis irradiated in various life stages was attempted to ascertain the lethal doses and sublethal doses having sterilizing potential. A dose of 40Gy administered to the first instar nymph (N1) inhibited formation of adult male, whereas 100Gy checked the transformation of N1 up to adult female. Males exhibited short life span and appeared to have no or limited role in progeny formation. Males were more radio-sensitive than the female mealy bugs. Further, in case of N2 treatment, a dose of 100Gy completely inhibited adult male formation, and 150 Gy could completely inhibit male adult formation. The sexes were discernible only after N2. A dose of 500Gy given to female-N3 totally inhibited adult formation. The developmental period of female N3 was protracted with increase in radiation dosage. The efficacy of radiation at dose range, 5-300Gy, was evaluated on N3 and N4 male nymphs. Irradiation affected metamorphosis and reduced adult formation. For instance, a dose of 300Gy caused 0% male adult development from N4. 400Gy was almost sterilizing dose for 11-12 day old female mealy bug, and this sterilizing dose reduced oviposition by 28.1%; whereas 200Gy was found to induce sterility in 5-6 day old female mealy bug, with about 50% reduction in oviposition. The freshly emerged female adults (0-1 day old) was the most sensitive stage than the adult mealy bugs in their older phase, and it was completely sterilized by 40Gy. The data suggests a definite role of ionizing

  17. Revision of the Neotropical treehopper genus Tolania (Hemiptera, Membracidae

    Directory of Open Access Journals (Sweden)

    Jesse L. Albertson


    Full Text Available The treehopper genus Tolania Stål (Hemiptera: Membracidae: Nicomiinae: Nicomiini and 69 valid species (59 new are described and illustrated based on adult morphology. Ten informal species groups are recognized based on a previously published phylogenetic analysis: (1 the dira species group comprising T. calista sp. nov., T. dira sp. nov., T. inca sp. nov., T. macaria sp. nov., T. secoya sp. nov., and T. zaparo sp. nov.; (2 the fasciata species group comprising T. fasciata (Walker, T. gracilis sp. nov., and T. laticlava sp. nov.; (3 the femoralis species group comprising T. femoralis Stål, T. fraterna Stål, and T. roberti sp. nov.; (4 the furcata species group comprising T. furcata sp. nov., T. tryphena sp. nov., and T. venezuelensis sp. nov.; (5 the hispida species group comprising T. alida sp. nov., T. hispida sp. nov., and T. periculosa sp. nov.; (6 the malefica species group comprising T. cactina sp. nov., T. curvata sp. nov., T. grallator sp. nov., T. jocosa sp. nov., T. mackameyi sp. nov., T. malefica sp. nov., T. obliqua (Walker, and T. terencia sp. nov.; (7 the obtusa species group comprising T. obtusa Fowler, T. obunca sp. nov., and T. torosa sp. nov.; (8 the opponens species group comprising T. alvira sp. nov., T. arcuata sp. nov., T. damia sp. nov., T. insolita sp. nov., T. lunata sp. nov., T. lurida sp. nov., T. opponens (Walker, T. oriana sp. nov., T. reflexa sp. nov., T. risa sp. nov., T. sinuata sp. nov., T. trilobata sp. nov., T. tumida sp. nov., T. umbella sp. nov., T. vitocensis sp. nov., T. woodi sp. nov., and T. xantha sp. nov.; (9 the peltacauda species group comprising T. brasiliensis sp. nov., T. iratafelis sp. nov., T. modesta sp. nov., T. peltacauda sp. nov., T. picta sp. nov., and T. thyrea sp. nov.; and (10 the semipellucida species group comprising T. atrata sp. nov., T. fimbriata sp. nov., T. nicia sp. nov., and T. semipellucida Stål. The following new species are not placed in species groups: T. anomala sp. nov

  18. Preliminary study on biological effects of pea seeds (Pisum sativum L.) induced by 252Cf neutron source

    International Nuclear Information System (INIS)

    Background: The doses and biological effects of irradiated plants have been studied and reported widely. In the research, Co-60 gamma-ray source was more often used than the neutron source. However, fast neutron source is promising in such irradiation studies as it has many advantages, such as strong biological effect, high mutation rate, wide variation spectrum and stable mutant. Purpose: We aim to explore the method of dose calculation in pea samples. The biological effects of pea seeds (Pisum sativum L.) induced by different radioactive doses are to be investigated. Methods: The Needle Leaf Pea seeds were irradiated using 252Cf fission neutron source. The Monte Carlo simulation MCNP4C code was used to calculate the neutron absorbed doses and γ-rays (photons) absorbed doses in the samples. The biological effects of pea seeds induced by different radioactive doses were investigated. Results: The results showed that the flowering time of Ml generation peas was delayed with lower neutron absorbed doses (0.239-4.330 Gy), and the germination rate was promoted with micro-absorbed doses. The seedling branch rate of Ml generation peas was elevated by neutron radiation. The harvest of Ml generation was increased with appropriate neutron doses (0.619 Gy) irradiating peas. Conclusion: After being irradiated by low neutron doses (0.239-4.330 Gy), M1 generation peas show obvious biological effects. The research results have positive significance for the agricultural production and breeding. (authors)

  19. Extrusion of Peas (Pisum sativum L.: Effects on the Apparent Metabolisable Energy and Ileal Nutrient Digestibility of Broilers

    Directory of Open Access Journals (Sweden)

    C. L. Nalle


    Full Text Available Problem statement: The potential feeding values of grain legumes, such as peas (Pisum sativum, are limited because of the presence of anti-nutritional factors. In particular, protease inhibitors are of interest, but these can be readily destroyed by thermal treatments. In the present study, the influence of extrusion on the chemical composition and nutritive value of peas was evaluated. Approach: Two extrudates were produced by extruding the peas at two moisture levels (19 and 22% and one temperature (140°C. Four treatment diets consisting of a corn-soy basal diet and three test diets containing raw and the two extruded pea meals were formulated and assayed in digestibility and balance trials using broiler chickens. The test diets were formulated by substituting the raw and extruded pea meals for 25% (w/w of the basal diet. Ileal nutrient digestibility was calculated using titanium oxide as an indigestible indicator and the apparent metabolisable energy was determined using the classical total excreta collection method. Results: Extrusion had no effect (P>0.05 on the contents of crude protein and starch. Soluble non-starch polysaccharide contents were increased (P 0.05 on the apparent ileal protein digestibility and the apparent metabolisable energy of peas. Conclusion: Under the extrusion conditions employed in the present study, extrusion was not beneficial to improving the nutritive value of peas for broilers.

  20. Functional properties of purified vicilins from cowpea (Vigna unguiculata) and pea (Pisum sativum) and cowpea protein isolate. (United States)

    Rangel, Alessandra; Domont, Gilberto B; Pedrosa, Cristiana; Ferreira, Sérgio T


    The major storage globulins (vicilins) of cowpea (Vigna unguiculata) and pea (Pisum sativum) seeds were purified by ammonium sulfate precipitation, and a semipurified cowpea protein isolate (CPI) was prepared by isoelectric precipitation. Some of the functional properties of these proteins, including solubility, foaming, and emulsifying capacities, were investigated and compared. The solubility of purified cowpea vicilin was reduced at pH 5.0, increasing markedly below and above this value. Pea vicilin exhibited poor solubility between pH 5.0 and pH 6.0, and CPI was little soluble in the pH range from 4.0 to 6.0. At neutral pH, the emulsifying activity indexes (EAI) of purified pea vicilin and CPI were 194 and 291 m(2)/g, respectively, which compare quite favorably to EAIs of 110 and 133 m(2)/g for casein and albumin, respectively. Remarkably, purified cowpea vicilin exhibited an EAI of 490 m(2)/g, indicating a very high emulsifying activity. Purified cowpea and pea vicilins exhibited lower foaming capacities and foam stablity indexes (FSI) than CPI. FSI values of 80 and 260 min were obtained for purified pea and cowpea vicilin, respectively, whereas a FSI value of 380 min was obtained for CPI. These results are discussed in terms of the possible utilization of purified vicilins or protein isolates from pea and cowpea in the food processing industry. PMID:12952435

  1. Faba bean (Vicia faba minor and pea seeds (Pisum sativum as protein sources in lactating ewes’ diets.

    Directory of Open Access Journals (Sweden)

    D. Gatta


    Full Text Available 18 Massese lactating ewes, divided into 3 homogeneous groups for parity and milk yield, were used to evaluate the replacement effects of soybean meal by Faba bean (Vicia faba minor and Pea (Pisum sativum seeds. During a 70 days trial (beginning after weaning: 30±1.5 days after lambing animals were fed three isonitrogenous and isocaloric diets. Each diet was characterised by the presence of only one protein feed. The diets consisted of alfalfa hay (1.1 kg/head/d and a decreasing amount of mixed feed (from 1.1 to 0.7 kg/head/d to fit animals’ requirements. Milk yield, milk chemical composition, animals live weight and BCS, health state and hematochemical parameters were regularly monitored. No diets palatability problems were detected. No significant differences resulted for live weight, BCS, milk yield and milk chemical composition, except for milk protein: higher for faba bean (6.54% and soybean (6.39% respect pea (5.66% diets, P<0.05. No differences resulted for blood parameters too and no clinical signs of illness were observed. Therefore faba bean and pea seeds seem to be able to replace the soybean well.

  2. Determination of cadmium and lead species and phytochelatins in pea (Pisum sativum) by HPLC-ICPMS and HPLC-ESIMSn

    International Nuclear Information System (INIS)

    Full text: Trace elements play an important role in the functioning of life on our planet. Some of them can be highly toxic, whereas others can be essential. These effects are very often related to particular form in which the element is present. Often these different chemical forms of a particular element or its compounds are referred to as 'species'. Cadmium and lead are widespread heavy metal pollutants released into the environment by human activities. The presence of Pb2+ and Cd2+ in the environment leads to a numerous disturbances in many metabolic processes in plants. Inhibition of growth is a major symptom. Hyphenated techniques, such as HPLC-ICPMS and HPLC-ESIMSn seem to be the best analytical instruments to study metal speciation in plants. In our study, we used hyphenated techniques to identify compounds engaged in Cd and Pb metabolism and to perform analysis of metal complexes induced in Pisum sativum exposed to cadmium and lead. These identified compounds might be valuable source of information to study metal accumulation mechanism for bioremediation processes. (author)

  3. Electron microscope autoradiography of 14C photosynthate distribution at the haustorium-host interface in powdery mildew of pisum sativum

    International Nuclear Information System (INIS)

    Haustorial complexes were isolated from leaves of Pisum sativum with Erysiphe pisi and exposed to 14CO2 for 2 hours. The constituents of the isolated fraction were quantified and ultrastructurally described and the distribution of 14C studied by electron microscope autoradiography and statistical treatment. Most (86%) of the isotope in the fraction was associated with haustorial complexes. Three classes of haustorial complexes were distinguished by degree of labelling and ultrastructure. Most of the haustorial complexes were termed healthy (i.e., they showed a normal ultrastructure) and were heavily labelled; necrotic complexes were unlabelled; and a class with intermediate labelling, modified extrahaustorial membrane and usually a normal haustorial cytoplasm was termed pre-necrotic. In healthy haustorial complexes the haustorial lobes and extrahaustorial membrane showed the highest grain densities and the body and extrahaustorial matrix were also significantly labelled. Comparison of the results suggest that ultrastructural modifications leading to necrosis were caused by dehydration which in turn determined reduction in photosynthate transfer. Other factors influencing transport into haustoria and the status of the extrahaustorial matrix are also discussed. U.V. fluorescence microscopy with acetamido-isothiocyanatostilbene salt was used to distinguish healthy and pre-necrotic haustorial complexes. It is recommended as a simple technique to monitor the functional quality of isolated haustorial complexes. (author)

  4. Auxin-cytokinin and auxin-gibberellin interactions during morphogenesis of the compound leaves of pea (Pisum sativum). (United States)

    DeMason, Darleen A


    A number of mutations that alter the form of the compound leaf in pea (Pisum sativum) has proven useful in elucidating the role that auxin might play in pea leaf development. The goals of this study were to determine if auxin application can rescue any of the pea leaf mutants and if gibberellic acid (GA) plays a role in leaf morphogenesis in pea. A tissue culture system was used to determine the effects of various auxins, GA or a GA biosynethesis inhibitor (paclobutrazol) on leaf development. The GA mutant, nana1 (na1) was analyzed. The uni-tac mutant was rescued by auxin and GA and rescue involved both a conversion of the terminal leaflet into a tendril and an addition of a pair of lateral tendrils. This rescue required the presence of cytokinin. The auxins tested varied in their effectiveness, although methyl-IAA worked best. The terminal tendrils of wildtype plantlets grown on paclobutrazol were converted into leaflets, stubs or were aborted. The number of lateral pinna pairs produced was reduced and leaf initiation was impaired. These abnormalities resembled those caused by auxin transport inhibitors and phenocopy the uni mutants. The na1 mutant shared some morphological features with the uni mutants; including, flowering late and producing leaves with fewer lateral pinna pairs. These results show that both auxin and GA play similar and significant roles in pea leaf development. Pea leaf morphogenesis might involve auxin regulation of GA biosynthesis and GA regulation of Uni expression. PMID:15809864

  5. Remote sensing study of the influence of herbicides on the spectral reflectance of pea plant leaves (Pisum sativum L.) (United States)

    Krezhova, D.; Alexieva, V.; Yanev, T.; Ivanov, S.

    Results from a remote sensing study of spectral reflectance of leaves of pea plants Pisum sativum L treated by the herbicides atrazine 2 4-D glyphosate fluridone and chlorsulfuron are reported According to the classification of the Herbicide Action Committee reflecting their mode of action they belong to different groups photosystem II bloker - C1 atrazine synthetic auxins - O 2 4-D inhibition of EPSP synthase - G glyphosate photobleaching - F1 fluridone and inhibition of acetoctate synthase - B chlorsulfuron The plants studied were grown hydroponically in a growth chamber in a nutritious medium to which every herbicide was added at three low concentrations 1 mu M 0 1 mu M and 0 01 mu M with respect to the field dose applied in the agricultural practice The spectral measurements of the leaf spectral reflectance were carried out in laboratory using a multichannel spectrometer in the visible and near infrared regions of the spectrum 480 div 810 nm Data was registered in 128 channels at a high spectral resolution of 2 6 nm halfwidth and a spatial resolution of 2 mm 2 The reflectance spectra were obtained from the leaf-reflected radiation referenced against a standard white screen To assess the changes arising in the leaf spectral reflectance under the herbicide action the developed by us approach based on discriminant analysis and other statistical methods was applied The spectral reflectance characteristics SRC were investigated in three spectral intervals 520 div 580 nm region of maximal

  6. Phenotypic characterization and inheritance of two foliar mutants in pea (Pisum Sativum L.): 'Reduced leaf size' and 'Orange leaf'

    International Nuclear Information System (INIS)

    Two foliar pea (Pisum sativum L.) mutants characterized by reduced leaf size (2/978) and orange leaf (2/1409 M) were established. Both mutants were described morphologically and their productivity potential , pollen viability and inheritance of the mutant traits were evaluated. The mutant 2/978 was identified after irradiation of dry seeds from cv Borek with 15 Gy fast neutrons and was related to the leaf mutation 'rogue'. Reciprocal crosses between mutant 2/978 and cv Borel were executed, and F1 and F2 generations were analyzed. The altered leaf trait was presented in all F1 plants suggesting a dominant character. F2 segregation data indicated that the trait was controlled by a single dominant gene. The mutant 2/1409M originated from the mutant 2/978 after irradiation with 50 Gy γ-rays. The main mutant's phenotypic characteristic was the orange-yellow coloration of leaves and plants. After of series of crosses it was established that induced chlorophyll mutation is monogenic, recessive and both mutant traits are independently inherited. Two mutants could be used as appropriate plant material for genetic and biological investigations

  7. Genetic control and identification of QTLs associated with visual quality traits of field pea (Pisum sativum L.). (United States)

    Ubayasena, Lasantha; Bett, Kirstin; Tar'an, Bunyamin; Warkentin, Thomas


    Visual quality of field pea (Pisum sativum L.) is one of the most important determinants of the market value of the harvested crop. Seed coat color, seed shape, and seed dimpling are the major components of visual seed quality of field pea and are considered as important breeding objectives. The objectives of this research were to study the genetics and to identify quantitative trait loci (QTLs) associated with seed coat color, seed shape, and seed dimpling of green and yellow field peas. Two recombinant inbred line populations (RILs) consisting of 120 and 90 lines of F(5)-derived F(7) (F(5:7)) yellow pea (P. sativum 'Alfetta' × P. sativum 'CDC Bronco') and green pea (P. sativum 'Orb' × P. sativum 'CDC Striker'), respectively, were evaluated over two years at two locations in Saskatchewan, Canada. Quantitative inheritance with polygenic control and transgressive segregation were observed for all visual quality traits studied. All 90 RILs of the green pea population and 92 selected RILs from the yellow pea population were screened using AFLP and SSR markers and two linkage maps were developed. Nine QTLs controlling yellow seed lightness, 3 for yellow seed greenness, 15 for seed shape, and 9 for seed dimpling were detected. Among them, five QTLs located on LG II, LG IV, and LG VII were consistent in at least two environments. The QTLs and their associated markers will be useful tools to assist pea breeding programs attempting to pyramid positive alleles for the traits. PMID:21491970

  8. The same allele of translation initiation factor 4E mediates resistance against two Potyvirus spp. in Pisum sativum. (United States)

    Bruun-Rasmussen, M; Møller, I S; Tulinius, G; Hansen, J K R; Lund, O S; Johansen, I E


    Pathogenicity of two sequenced isolates of Bean yellow mosaic virus (BYMV) was established on genotypes of Pisum sativum L. reported to carry resistance genes to BYMV and other potyviruses. Resistance to the white lupin strain of BYMV (BYMV-W) is inherited as a recessive gene named wlv that maps to linkage group VI together with other Potyvirus resistances. One of these, sbm1, confers resistance to strains of Pea seedborne mosaic virus and previously has been identified as a mutant allele of the eukaryotic translation initiation factor 4E gene (eIF4E). Sequence comparison of eIF4E from BYMV-W-susceptible and -resistant P. sativum genotypes revealed a polymorphism correlating with the resistance profile. Expression of eIF4E from susceptible plants in resistant plants facilitated BYMV-W infection in inoculated leaves. When cDNA of BYMV-W was agroinoculated, resistance mediated by the wlv gene frequently was overcome, and virus from these plants had a codon change causing an Arg to His change at position 116 of the predicted viral genome-linked protein (VPg). Accordingly, plants carrying the wlv resistance gene were infected upon inoculation with BYMV-W derived from cDNA with a His codon at position 116 of the VPg coding region. These results suggested that VPg determined pathogenicity on plants carrying the wlv resistance gene and that wlv corresponded to the sbm1 allele of eIF4E. PMID:17849710

  9. Evidence for Phytochrome Regulation of Gibberellin A(20) 3beta-Hydroxylation in Shoots of Dwarf (lele) Pisum sativum L. (United States)

    Campell, B R; Bonner, B A


    The effect of light on the dwarfing allele, le, in Pisum sativum L. was tested as the growth response to gibberellins prior to or beyond the presumed block in the gibberellin biosynthetic pathway. The response to the substrate (GA(20)), the product (GA(1)), and a nonendogenous early precursor (steviol) was compared in plants bearing the normal Le and the deficient lele genotypes in plants made low in gibberellin content genetically (nana lines) or by paclobutrazol treatment to tall (cv Alaska) and dwarf (cv Progress) peas. Both genotypes responded to GA(1) under red irradiation and in darkness. The lele plants grew in response to GA(20) and steviol in darkness but showed a much smaller response when red irradiated. The Le plants responded to GA(20) and steviol in both light and darkness. The red effects on lele plants were largely reversible by far-red irradiation. It is concluded that the deficiency in 3beta-hydroxylation of GA(20) to GA(1) in genotype lele is due to a Pfr-induced blockage in the expression of that activity. PMID:16665165

  10. A Leafhopper Pest of Plants in the Mint Family, Eupteryx decemnotata Rey (Hemiptera: Auchenorrhyncha: Cicadellidae), Ligurian Leafhopper, New to North America


    Rung, Alessandra; Halbert, Susan E.; Ziesk, David C.; Gill, Raymond J.


    The Ligurian leafhoppter, Eupteryx decemnotata Rey (Hemiptera: Auchenorrhyncha: Cicadellidae), is reported for the first time in North America (USA: Florida and California). Diagnostic characters for species identification, summary of hosts and damage, and U.S. known distribution are given.

  11. Effects of moderately enhanced levels of ozone on the acyl lipid composition and dynamical properties of plasma membranes isolated from garden pea (Pisum sativum)

    DEFF Research Database (Denmark)

    Hellgren, Lars; Sellden, G.; Sandelius, A.S.


    Plasma membranes were isolated from leaves of 16-day-old garden pea, Pisum sativum L., that had been grown in the absence or presence of 65 nl l(-1) ozone for 4 days prior to membrane isolation, Plasma membranes from ozone-fumigated plants contained significantly more acyl lipids per protein than...... water penetration and mobility at the hydrophilic-hydrophobic interface of the membrane, At 0 degreesC, the molecular mobility was slightly lower in plasma membranes from ozone-fumigated plants than in plasma membranes from control plants, possibly reflecting the increased PE/PC, campesterol...

  12. Estudio de la adaptabilidad de cuatro genotipos de guisante (pisum setivum l. var. macrocarpon) bajo dos densidades y en dos localidades


    Aguilar, Miguel; Brusco, Patricia; Martínez, Ricardo


    Se evaluó y comparó el comportamiento agronómico de cuatro variedades de guisante Pisum satim L. var. macrocarpon bajo dos densidades y en dos localidadesmediante cultivos a libre exposición durante dos semestres. Se midieron variables de tipo morfofisiológico y reproductivo. Las cuatro variedades se adaptaron bien al medio ambiente ya que sus rendimientos fueron bastante aceptables. La variedad Super Mel Sugar logró los mejores puntajesen rendimiento y calidad además de la mayor capacidad de...

  13. [Regulatory genes of garden pea (Pisum sativum L.) controlling the development of nitrogen-fixing nodules and arbuscular mycorrhiza: a review of basic and applied aspects

    DEFF Research Database (Denmark)

    Borisov, A Iu; Vasil'chikov, A G; Voroshilova, V A; Danilova, T N; Zhernakov, A I; Zhukov, V A; Koroleva, T A; Kuznetsova, E V; Madsen, Lene Heegaard; Mofett, M; Naumkina, T S; Nemankin, T A; Ovchinnikova, E S; Pavlova, Z B; Petrova, N E; Pinaev, A G; Radutoiu, S; Rozov, S M; Rychagova, T S; Solovov, I I; Stougaard, J; Topunov, A F; Weeden, N F; Tsyganov, V E; Shtark, O Iu; Tikhonovich, I A


    The review sums up the long experience of the authors and other researchers in studying the genetic system of garden pea (Pisum sativum L.), which controls sthe development of nitrogen-fixing symbiosis and arbuscular mycorrhiza. A justified phenotypic classification of pea mutants is presented....... Progress in identifying and cloning symbiotic genes is adequately reflected. The feasibility of using double inoculation as a means of increasing the plant productivity is demonstrated, in which the potential of a tripartite symbiotic system (pea plants-root nodule bacteria-arbuscular mycorrhiza) is...

  14. The LSD1-Type Zinc Finger Motifs of Pisum sativa LSD1 Are a Novel Nuclear Localization Signal and Interact with Importin Alpha


    He, Shanping; Huang, Kuowei; Zhang, Xu; Yu, Xiangchun; Huang, Ping; An, Chengcai


    Background Genetic studies of the Arabidopsis mutant lsd1 highlight the important role of LSD1 in the negative regulation of plant programmed cell death (PCD). Arabidopsis thaliana LSD1 (AtLSD1) contains three LSD1-type zinc finger motifs, which are involved in the protein–protein interaction. Methodology/Principal Findings To further understand the function of LSD1, we have analyzed cellular localization and functional localization domains of Pisum sativa LSD1 (PsLSD1), which is a homolog of...

  15. Raw and extruded pea (Pisum sativum) and lupin (Lupinus albusvar. Multitalia) seeds as protein sources in weaned piglets’ diets: effect on growth rate and blood parameters


    Gianfranco Piva; Francesco Masoero; Giorgio Fusconi; Maurizio Moschini; Mauro Morlacchini; Aldo Prandini


    The 42 days trial was carried out using 140 piglets weaned at 28 days of age. The piglets were allocated according to  weight and sex to the 5 dietary treatments with 7 replicates for each treatments (4 pens x 4 castrated males and 3 pens  x 4 females). The piglets were fed according to the following experimental design: 1) control diet (CTR) with soybean  meal (SBM) 44% c.p. as protein source; 2) CRT diets with 200 g/kg of raw pea (Pisum sativum) (RP); 3) CTR diet with  2...

  16. The same allele of translation initiation factor 4E mediates resistance against two Potyvirus spp. in Pisum sativum

    DEFF Research Database (Denmark)

    Bruun-Rasmussen, M.; Møller, I.S.; Tulinius, G.;


    Pathogenicity of two sequenced isolates of Bean yellow mosaic virus (BYMV) was established on genotypes of Pisum sativum L. reported to carry resistance genes to BYMV and other potyviruses. Resistance to the white lupin strain of BYMV (BYMV-W) is inherited as a recessive gene named wlv that maps to...... linkage group VI together with other Potyvirus resistances. One of these, sbm1, confers resistance to strains of Pea seedborne mosaic virus and previously has been identified as a mutant allele of the eukaryotic translation initiation factor 4E gene (eIF4E). Sequence comparison of eIF4E from BYMV...

  17. Avances en la sistemática del género Micromonospora: estudio de cepas aisladas de la Rizosfera y Nódulos de Pisum sativum


    Carro Garcia, Lorena


    [ES] En este trabajo se ha llevado a cabo el aislamiento de 272 cepas, 239 obtenidas a partir de nódulos fijadores de nitrógeno de plantas de Pisum sativum esterilizados en superficie y recogidos en siete localidades diferentes de Castilla y León y 33 a partir de la rizosfera de esas mismas plantas. De estas cepas se seleccionaron las 106 obtenidas en Cañizal y en Salamanca, 27 y 46 obtenidas de nódulos, y 21 y 12 obtenidas de rizosfera respectivamente, para realizar un análisis de la diversi...

  18. Molecular profiling of proteolytic and lectin transcripts in Homalodisca vitripennis (Hemiptera: Auchenorrhyncha: Cicadellidae) feeding on sunflower and cowpea (United States)

    Homalodisca vitripennis Germar 1821 (Hemiptera: Cicadellidae) (Takiya et al. 2006, syn. H. coagulata (Say)) gut and salivary gland EST libraries were used to isolate cDNA fragments of the genes encoding for cathepsin L, asparaginyl endopeptidase, cathepsin B, metalloendopeptidase, cathepsin D, multi...

  19. Parasitism of Megacopta cribraria (Hemiptera: Plataspidae)by Paratelenomus saccharalis (Hymenoptera: Platygastridae) in organic soybean plots in Georgia, USA (United States)

    The kudzu bug, Megacopta cribraria (F.) (Hemiptera: Plataspidae), is a newly-invasive exotic pest of soybean in the southeastern US. In 2013, the exotic egg parasitoid Paratelenomus saccharalis (Hymenoptera: Platygastridae) (Dodd) was discovered parasitizing eggs of this pest in kudzu and soybean in...

  20. Newly recorded genus Pantilius Curtis (Hemiptera: Heteroptera: Miridae from the Korean Peninsula, with a key to the world Pantilius species

    Directory of Open Access Journals (Sweden)

    Junggon Kim


    Full Text Available A genus, Pantilius Curtis (Hemiptera: Heteroptera: Miridae: Mirinae, is reported for the first time from the Korean Peninsula, based on finding a species of Pantilius hayashii Miyamoto and Yasunaga, 1989, which was hitherto known only from Honshu, Japan. The morphological information, such as description and diagnosis, is presented with photographs and illustrations of adult habitus and male genitalia.

  1. New corological and biological data of the Red Gum Lerp Psyllid, Glycaspis brimblecombei Moore, 1964 in Italy (Hemiptera, Psyllidae)


    Ricardo Jiménez-Peydró; Francisco Javier Peris-Felipo


    Glycaspis brimblecombei Moore, 1964 is a psyllid (Hemiptera: Psyllidae) pest of Eucalyptus, native toAustralia and first recorded in Europe: Spain in 2008 and more recently (2010) in Italy. The present paper dealswith recent research, carried out in central Italy, with new data on the distribution and biology of this species.



    Caleca, V.; LO VERDE, G; Maltese, M.


    Psyllaephagus bliteus Riek (Hymenoptera Encyrtidae), parasitoid of the red gum lerp psyllid Glycaspis brimblecombei Moore (Hemiptera Psyllidae), has been recorded for the first time in Italy in September 2011. The arrival of P. bliteus in Sicily is due to an accidental introduction, probably together with its host, as already happened in New Zealand, Brazil, Spain and Morocco.

  3. Evaluation of a method to quantify glassy-winged sharpshooter (Hemiptera: Cicadellidae) egg maturation during a feeding assay (United States)

    Methods to improve an assay relating adult feeding to egg maturation by the glassy-winged sharpshooter (Hemiptera: Cicadellidae) were evaluated. The assay consisted of confining adult females to cowpea stems in parafilm enclosures and quantifying adult feeding and egg maturation. Adult feeding was...

  4. A new species of Tamarixia Mercet (Hymenoptera, Eulophidae, parasitoid of Trioza aguacate Hollis & Martin (Hemiptera, Triozidae in Mexico

    Directory of Open Access Journals (Sweden)

    Zoya Yefremova


    Full Text Available Tamarixia aguacatensis Yefremova, sp. n. (Hymenoptera: Eulophidae: Tetrastichinae is described from Mexico as a parasitoid of the avocado psyllid, Trioza aguacate Hollis & Martin (Hemiptera: Triozidae. Trioza aguacate is a serious pest of avocado, Persea americana Miller. A key to the species of Tamarixia Mercet in Mexico is given.

  5. OCORRÊNCIA DE Glycaspis brimblecombei (Moore, 1964 (Hemiptera: Psyllidae EM Eucalyptus spp. NO RIO GRANDE DO SUL, BRASIL

    Directory of Open Access Journals (Sweden)

    Leonardo da Silva Oliveira


    Full Text Available Em janeiro de 2005, pela primeira vez, foi constatada a ocorrência de Glycaspis brimblecombei (Moore, 1964 (Hemiptera: Psyllidae em espécies de Eucalyptus spp. no estado do Rio Grande do Sul, Brasil. A observação ocorreu nos municípios de Butiá, Caçapava do Sul e Santa Maria.

  6. New corological and biological data of the Red Gum Lerp Psyllid, Glycaspis brimblecombei Moore, 1964 in Italy (Hemiptera, Psyllidae

    Directory of Open Access Journals (Sweden)

    Ricardo Jiménez-Peydró


    Full Text Available Glycaspis brimblecombei Moore, 1964 is a psyllid (Hemiptera: Psyllidae pest of Eucalyptus, native toAustralia and first recorded in Europe: Spain in 2008 and more recently (2010 in Italy. The present paper dealswith recent research, carried out in central Italy, with new data on the distribution and biology of this species.

  7. Pheromone of the banana-spotting bug, amblypelta lutescens lutescens Distant (Hemiptera: Coreidae): identification, synthesis and field bioassay (United States)

    The banana spotting bug Amblypelta lutescens lutescens Distant (Hemiptera: Coreidae) is one of the principal pests of tree fruits and nuts across northern and eastern Australia. Apart from damage assessments in orchards, there are currently no other methods for monitoring bug activity to aid manage...

  8. Phalacrococcus howertoni Hodges & Hodgson (Hemiptera: Coccoidea: Coccidae), a new soft scale record for the island of Guadeloupe


    Étienne, Jean; Matile-Ferrero, Danièle; Kondo, Takumasa


    The croton scale, Phalacrococcus howertoni Hodges & Hodgson (Hemiptera: Coccoidea: Coccidae) is newly reported from the island of Guadeloupe, French West Indies, on several host-plants, including some new host records, i.e., on Spondias cytherea Sonnerat; (Euphorbiaceae), Ocotea membranacea (Sw.) R.A. Howard (Lauraceae), Miconia furfuracea (Vahl) Griseb (Melastomataceae), Ficus citrifolia Mill. (Moraceae) and Piper dilatatum Rich. (Piperaceae).

  9. Survey of 'Candidatus Liberibacter solanacearum' in carrot crops affected by the psyllid Trioza apicalis (Hemiptera: Triozidae) in Norway (United States)

    The carrot psyllid Trioza apicalis Förster (Hemiptera: Triozidae) is a serious insect pest of carrot (Daucus carota L.) in northern Europe, where it can cause up to 100% crop loss. Although it was long believed that T. apicalis causes damage to carrot by injection of toxins into the plant, it was re...

  10. Biology and host preference of the planthopper Taosa longula (Hemiptera: Dictyopharidae) a candidate for biological control of water hyacinth (United States)

    Taosa longula Remes Lenicov (Hemiptera: Dictyopharidae) is a planthopper from the South American tropics that feeds on water hyacinth, Eichhornia crassipes (Mart.) Solms-Laubach (Pontederiaceae). The biology of T. longula was studied in the laboratory and field to evaluate it as a potential biologic...

  11. Review of the biology, ecology, and management of Halyomorpha halys (Stal) (Hemiptera: Pentatomidae) in China, Japan and Korea (United States)

    Native to China, Japan, Korea, and Taiwan, the brown marmorated stink bug, Halyomorpha halys (Stal) (Hemiptera: Pentatomidae), was accidently introduced into the United States in the mid-1990s. Since establishing in the United States, this invasive species has caused significant economic losses in...

  12. A new species of Tamarixia Mercet (Hymenoptera, Eulophidae), parasitoid of Trioza aguacate Hollis & Martin (Hemiptera, Triozidae) in Mexico. (United States)

    Yefremova, Zoya; González-Santarosa, Graciela; Lomeli-Flores, J Refugio; Bautista-Martínez, Néstor


    Tamarixia aguacatensis Yefremova, sp. n. (Hymenoptera: Eulophidae: Tetrastichinae) is described from Mexico as a parasitoid of the avocado psyllid, Trioza aguacate Hollis & Martin (Hemiptera: Triozidae). Trioza aguacate is a serious pest of avocado, Persea americana Miller. A key to the species of Tamarixia Mercet in Mexico is given. PMID:24478580

  13. Introduction and Recovery of Delphastus catalinae (Coleoptera: Coccinellidae) as a predator of Bemisia tabaci (Hemiptera: Aleyrodidae) in Egypt (United States)

    Bemisia tabaci (Gennadius) (Hemiptera: Alyerodidae) is an important pest of many crops on a global scale. The use of biological control organisms such as coccinelid predators can help manage this pest. Delphastus catalinae (Horn) (Coleoptera: Coccinelidae) is an obligate predator of whiteflies, in...

  14. Metabolism of inositol(1,4,5)trisphosphate by a soluble enzyme fraction from pea (Pisum sativum) roots

    Energy Technology Data Exchange (ETDEWEB)

    Drobak, B.K.; Watkins, P.A.C.; Roberts, K. (John Innes Inst., Norwich (England)); Chattaway, J.A. (John Innes Inst., Norwich (England) Univ. of East Anglia, Norwich (England)); Dawson, A.P. (Univ. of East Anglia, Norwich (England))


    Metabolism of the putative messenger molecule D-myo-inositol(1,4,5)trisphosphate (Ins(1,4,5)P{sub 3}) in plant cells has been studied using a soluble fraction from pea (pisum sativum) roots as enzyme source and (5-{sup 32}P)Ins(1,4,5)P{sub 3} and (2-{sup 3}H)Ins(1,4,5)P{sub 3} as tracers. Ins(1,4,5)P{sub 3} was rapidly converted into both lower and higher inositol phosphates. The major dephosphorylation product was inositol (4,5) bisphosphate (Ins(4,5)P{sub 2}) whereas inositol(1,4)bisphosphate (Ins(1,4)P{sub 2}) was only present in very small quantities throughout a 15 minute incubation period. In addition to these compounds, small amounts of nine other metabolites were produced including inositol and inositol(1,4,5,X)P{sub 4}. Dephosphorylation of Ins(1,4,5)P{sub 3} to Ins(4,5)P{sub 2} was dependent on Ins(1,4,5)P{sub 3} concentration and was partially inhibited by the phosphohydrolase inhibitors 2,3-diphosphoglycerate, glucose 6-phosphate, and p-nitrophenylphosphate. Conversion of Ins(1,4,5)P{sub 3} to Ins(4,5)P{sub 2} and Ins(1,4,5,X)P{sub 4} was inhibited by 55 micromolar Ca{sup 2+}. This study demonstrates that enzymes are present in plant tissues which are capable of rapidly converting Ins(1,4,5)P{sub 3} and that pathways of inositol phosphate metabolism exist which may prove to be unique to the plant kingdom.

  15. Recessive resistance in Pisum sativum and potyvirus pathotype resolved in a gene-for-cistron correspondence between host and virus. (United States)

    Johansen, I E; Lund, O S; Hjulsager, C K; Laursen, J


    Pea seed-borne mosaic potyvirus (PSbMV) isolates are divided into pathotypes P-1, P-2, and P-4 according to their infection profile on a panel of Pisum sativum lines. P. sativum PI 269818 is resistant to P-1 and P-2 isolates and is susceptible to P-4 isolates. Resistance to P-1 is inherited as a single recessive gene, denoted sbm-1, and the pathogenicity determinant has previously been mapped to the virus-coded protein VPg. In the cultivar Bonneville, a second recessive gene, sbm-2, confers specific resistance to P-2. By exchanging cistrons between a P-2 and a P-4 isolate, the P3-6k1 cistron was identified as the PSbMV host-specific pathogenicity determinant on Bonneville. Exchange of P3-6k1 did not affect infection on PI 269818, and infection of Bonneville was not altered by substitution of the VPg cistron, indicating that P3-6k1 and VPg are independent determinants of pathotype-specific infectivity. On PI 269818 the pathogenicity determinant of both P-1 and P-2 mapped to the N terminus of VPg. This suggests that VPg from the P-1 and P-2 isolates are functionally similar on this host and that resistance to P-1 and P-2 in PI 269818 may operate by the same mechanism. Identification of VPg-sbm-1 and P3-6k1-sbm-2 as independent pairs of genetic interactors between PSbMV and P. sativum provides a simple explanation of the three known pathotypes of PSbMV. Furthermore, analysis of beta-glucuronidase-tagged P-2 virus indicated that sbm-2 resistance affected an early step in infection, implying that the P3-6k1 region plays a critical role in potyvirus replication or cell-to-cell movement. PMID:11413328

  16. The cadmium-tolerant pea (Pisum sativum L.) mutant SGECdt is more sensitive to mercury: assessing plant water relations. (United States)

    Belimov, Andrey A; Dodd, Ian C; Safronova, Vera I; Malkov, Nikita V; Davies, William J; Tikhonovich, Igor A


    Heavy metals have multiple effects on plant growth and physiology, including perturbation of plant water status. These effects were assessed by exposing the unique Cd-tolerant and Cd-accumulating pea (Pisum sativum L.) mutant SGECd(t) and its wild-type (WT) line SGE to either cadmium (1, 4 μM CdCl2) or mercury (0.5, 1, 2 μM HgCl2) in hydroponic culture for 12 days. When exposed to Cd, SGECd(t) accumulated more Cd in roots, xylem sap, and shoot, and had considerably more biomass than WT plants. WT plants lost circa 0.2 MPa turgor when grown in 4 μM CdCl2, despite massive decreases in whole-plant transpiration rate and stomatal conductance. In contrast, root Hg accumulation was similar in both genotypes, but WT plants accumulated more Hg in leaves and had a higher stomatal conductance, and root and shoot biomass compared with SGECd(t). Shoot excision resulted in greater root-pressure induced xylem exudation of SGECd(t) in the absence of Cd or Hg and following Cd exposure, whereas the opposite response or no genotypic differences occurred following Hg exposure. Exposing plants that had not been treated with metal to 50 μM CdCl2 for 1h increased root xylem exudation of WT, whereas 50 μM HgCl2 inhibited and eliminated genotypic differences in root xylem exudation, suggesting differences between WT and SGECd(t) plants in aquaporin function. Thus, root water transport might be involved in mechanisms of increased tolerance and accumulation of Cd in the SGECd(t) mutant. However, the lack of cross-tolerance to Cd and Hg stress in the mutant indicates metal-specific mechanisms related to plant adaptation. PMID:25694548

  17. Primary and Secondary Abscission in Pisum sativum and Euphorbia pulcherrima-How Do They Compare and How Do They Differ? (United States)

    Hvoslef-Eide, Anne K; Munster, Cristel M; Mathiesen, Cecilie A; Ayeh, Kwadwo O; Melby, Tone I; Rasolomanana, Paoly; Lee, YeonKyeong


    Abscission is a highly regulated and coordinated developmental process in plants. It is important to understand the processes leading up to the event, in order to better control abscission in crop plants. This has the potential to reduce yield losses in the field and increase the ornamental value of flowers and potted plants. A reliable method of abscission induction in poinsettia (Euphorbia pulcherrima) flowers has been established to study the process in a comprehensive manner. By correctly decapitating buds of the third order, abscission can be induced in 1 week. AFLP differential display (DD) was used to search for genes regulating abscission. Through validation using qRT-PCR, more information of the genes involved during induced secondary abscission have been obtained. A study using two pea (Pisum sativum) mutants in the def (Developmental funiculus) gene, which was compared with wild type peas (tall and dwarf in both cases) was performed. The def mutant results in a deformed, abscission-less zone instead of normal primary abscission at the funiculus. RNA in situ hybridization studies using gene sequences from the poinsettia differential display, resulted in six genes differentially expressed for abscission specific genes in both poinsettia and pea. Two of these genes are associated with gene up- or down-regulation during the first 2 days after decapitation in poinsettia. Present and previous results in poinsettia (biochemically and gene expressions), enables a more detailed division of the secondary abscission phases in poinsettia than what has previously been described from primary abscission in Arabidopsis. This study compares the inducible secondary abscission in poinsettia and the non-abscising mutants/wild types in pea demonstrating primary abscission zones. The results may have wide implications on the understanding of abscission, since pea and poinsettia have been separated for 94-98 million years in evolution, hence any genes or processes in common

  18. Primary and Secondary Abscission in Pisum sativum and Euphorbia pulcherrima—How Do They Compare and How Do They Differ? (United States)

    Hvoslef-Eide, Anne K.; Munster, Cristel M.; Mathiesen, Cecilie A.; Ayeh, Kwadwo O.; Melby, Tone I.; Rasolomanana, Paoly; Lee, YeonKyeong


    Abscission is a highly regulated and coordinated developmental process in plants. It is important to understand the processes leading up to the event, in order to better control abscission in crop plants. This has the potential to reduce yield losses in the field and increase the ornamental value of flowers and potted plants. A reliable method of abscission induction in poinsettia (Euphorbia pulcherrima) flowers has been established to study the process in a comprehensive manner. By correctly decapitating buds of the third order, abscission can be induced in 1 week. AFLP differential display (DD) was used to search for genes regulating abscission. Through validation using qRT-PCR, more information of the genes involved during induced secondary abscission have been obtained. A study using two pea (Pisum sativum) mutants in the def (Developmental funiculus) gene, which was compared with wild type peas (tall and dwarf in both cases) was performed. The def mutant results in a deformed, abscission-less zone instead of normal primary abscission at the funiculus. RNA in situ hybridization studies using gene sequences from the poinsettia differential display, resulted in six genes differentially expressed for abscission specific genes in both poinsettia and pea. Two of these genes are associated with gene up- or down-regulation during the first 2 days after decapitation in poinsettia. Present and previous results in poinsettia (biochemically and gene expressions), enables a more detailed division of the secondary abscission phases in poinsettia than what has previously been described from primary abscission in Arabidopsis. This study compares the inducible secondary abscission in poinsettia and the non-abscising mutants/wild types in pea demonstrating primary abscission zones. The results may have wide implications on the understanding of abscission, since pea and poinsettia have been separated for 94–98 million years in evolution, hence any genes or processes in common

  19. Xyloglucan oligosaccharides promote growth and activate cellulase: Evidence for a role of cellulase in cell expansion. [Pisum sativum L

    Energy Technology Data Exchange (ETDEWEB)

    McDougall, G.J.; Fry, S.C. (Univ. of Edinburgh (England))


    Oligosaccharides produced by the action of fungal cellulase on xyloglucans promoted the elongation of etiolated pea (Pisum sativum L.) stem segments in a straight-growth bioassay designed for the determination of auxins. The oligosaccharides were most active at about 1 micromolar. We tested the relative growth-promoting activities of four HPLC-purified oligosaccharides which shared a common glucose{sub 4} {center dot} xylose{sub 3} (XG7) core. The substituted oligosaccharides XG8 (glucose{sub 4} {center dot} xylose{sub 3} {center dot} galactose) and XG9n (glucose{sub 4} {center dot} xylose{sub 3} {center dot} galactose{sub 2}) were more effective than XG7 itself and XG9 (glucose{sub 4} {center dot} xylose{sub 3} {center dot} galactose {center dot} fucose). The same oligosaccharides also promoted the degradation, assayed viscometrically, of xyloglucan by an acidic cellulase from bean (Phaseolus vulgaris L.) leaves. The oligosaccharides were highly active at 10{sup {minus}4} molar, causing up to a fourfold increase in activity, but the effect was still detectable at 1 micromolar. Those oligosaccharides (XG8 and XG9n) which best promoted growth, stimulated cellulase activity to the greatest extent. The oligosaccharides did not stimulate the action of the cellulase in an assay based on the conversion of ({sup 3}H)xyloglucan to ethanol-soluble fragments. This suggests that the oligosaccharides enhanced the midchain hydrolysis of xyloglucan molecules (which would rapidly reduce the viscosity of the solution), at the expense of cleavage near the termini (which would yield ethanol-soluble products).

  20. First report of Idiopterus nephrelepidis Davis, 1909 (Hemiptera: Aphididae from Bulgaria

    Directory of Open Access Journals (Sweden)

    Elena Tasheva-Terzieva


    Full Text Available Idiopterus nephrelepidis (Hemiptera: Aphididae is reported for the first time in Bulgaria on ornamental ferns in four greenhouses in Sofia and Varna. Dense colonies of apterous viviparous females and larvae were observed. The established host plants are Nephrolepis exaltata, Asplenium nidus and Pteris cretica. Infested ferns exhibit leaf deformation. The aphids were reared in laboratory conditions for four months. A morphometric study of apterae was carried out. Taking into account the presence of host plants of I. nephrelepidis in Bulgaria which are native to the local flora and the reports of the aphid from the Balkan area, it may spread in the country outdoors.

  1. Dopluise (Hemiptera: Coccoidea geassosieer met die wipstertmier, Crematogaster peringueyi Emery (Hymenoptera: Formicidae

    Directory of Open Access Journals (Sweden)

    Johannes H. Giliomee


    Full Text Available Neste van die wipstertmier, Crematogaster peringueyi (Hymenoptera: Formicidae, is op verskeie plekke langs die kus van die Wes-Kaap versamel. Die doel was om vas te stel watter dopluisagtiges (Hemiptera: Coccoidea in die neste in assosiasie met hierdie miere leef. Dopluise van drie families, naamlik die Pseudococcidae (witluise, Coccidae (sagtedopluise en Kerriidae (lakdopluise is in die neste gevind, almal bekend daarvoor dat hulle heuningdou afskei. Hierdie mutualistiese verhouding tussen die miere en dopluise, bekend as mirmekofilie, is fakultatief van aard. Die wipstertmier blyk ook nie spesifiek te wees wat betref die plant waarop hulle nes maak nie.

  2. Integrated Pest Management of Aphis spiraecola (Hemiptera: Aphididae) in clementines: enhancing its biological control




    Aphis spiraecola Patch. (Hemiptera: Aphididae) es una de las plagas claves en el cultivo de clementinos de la cuenca Mediterránea. En primavera, este pulgón coloniza las brotaciones tiernas de los clementinos y causa importantes pérdidas económicas todos los años. Actualmente la gestión integrada de A. spiraecola en clementinos está basada en el control químico ya que se desconoce bastante sobre el control biológico de A. spiraecola en cítricos. Los esfuerzos realizados hasta la fecha se han ...

  3. The Complete Mitochondrial Genome of Mindarus keteleerifoliae (Insecta: Hemiptera: Aphididae) and Comparison with Other Aphididae Insects


    Yuan Wang; Jing Chen; Li-Yun Jiang; Ge-Xia Qiao


    The mitogenome of Mindarus keteleerifoliae Zhang (Hemiptera: Aphididae) is a 15,199 bp circular molecule. The gene order and orientation of M. keteleerifoliae is similarly arranged to that of the ancestral insect of other aphid mitogenomes, and, a tRNA isomerism event maybe identified in the mitogenome of M. keteleerifoliae. The tRNA-Trp gene is coded in the J-strand and the same sequence in the N-strand codes for the tRNA-Ser gene. A similar phenomenon was also found in the mitogenome of Eri...

  4. Relative Abundance of Carsonella ruddii (Gamma Proteobacterium) in Females and Males of Cacopsylla pyricola (Hemiptera: Psyllidae) and Bactericera cockerelli (Hemiptera: Triozidae). (United States)

    Cooper, W Rodney; Garczynski, Stephen F; Horton, David R


    Carsonella ruddii (Gamma Proteobacterium) is an obligate bacterial endosymbiont of psyllids that produces essential amino acids that are lacking in the insect's diet. Accurate estimations of Carsonella populations are important to studies of Carsonella-psyllid interactions and to developing ways to target Carsonella for control of psyllid pests including pear psylla, Cacopsylla pyricola (Förster) (Hemiptera: Psyllidae) and potato psyllid, Bactericera cockerelli (Šulc) (Hemiptera: Triozidae). We used two methods, namely fluorescence in situ hybridization and quantitative polymerase chain reaction (qPCR), to estimate relative abundance of Carsonella in bacteriocytes and whole bodies of psyllids, respectively. Using these two methods, we compared Carsonella populations between female and male insects. Estimations using fluorescence in situ hybridization indicated that Carsonella was more abundant in bacteriocytes of female C. pyricola than in those of males, but Carsonella abundance in bacteriocytes did not differ between sexes of B. cockerelli. Analyses by qPCR using whole-body specimens indicated Carsonella was more abundant in females than in males of both psyllids. Neither fluorescence in situ hybridization nor qPCR indicated that Carsonella populations differed in abundance among adults of different ages (0-3 wk after adult eclosion). Using fluorescence in situ hybridization, Carsonella was observed in ovarioles of newly emerged females and formed an aggregation in the posterior end of mature oocytes. Results of our study indicate that female psyllids harbor greater populations of Carsonella than do males and that sex should be controlled for in studies which require estimations of Carsonella populations. PMID:26056318

  5. High-Throughput Development of SSR Markers from Pea (Pisum sativum L. Based on Next Generation Sequencing of a Purified Chinese Commercial Variety.

    Directory of Open Access Journals (Sweden)

    Tao Yang

    Full Text Available Pea (Pisum sativum L. is an important food legume globally, and is the plant species that J.G. Mendel used to lay the foundation of modern genetics. However, genomics resources of pea are limited comparing to other crop species. Application of marker assisted selection (MAS in pea breeding has lagged behind many other crops. Development of a large number of novel and reliable SSR (simple sequence repeat or microsatellite markers will help both basic and applied genomics research of this crop. The Illumina HiSeq 2500 System was used to uncover 8,899 putative SSR containing sequences, and 3,275 non-redundant primers were designed to amplify these SSRs. Among the 1,644 SSRs that were randomly selected for primer validation, 841 yielded reliable amplifications of detectable polymorphisms among 24 genotypes of cultivated pea (Pisum sativum L. and wild relatives (P. fulvum Sm. originated from diverse geographical locations. The dataset indicated that the allele number per locus ranged from 2 to 10, and that the polymorphism information content (PIC ranged from 0.08 to 0.82 with an average of 0.38. These 1,644 novel SSR markers were also tested for polymorphism between genotypes G0003973 and G0005527. Finally, 33 polymorphic SSR markers were anchored on the genetic linkage map of G0003973 × G0005527 F2 population.

  6. Preparation of Mealybugs (Hemiptera: Pseudococcidae) for Genetic Characterization and Morphological Examination. (United States)

    Bahder, B W; Bollinger, M L; Sudarshana, M R; Zalom, F G


    Mealybugs (Hemiptera: Pseudococcidae) are economically significant agricultural pests on many different crops. Because of their small size and lack of easily visible characters for identification, determination of their taxonomic status is difficult and requires technical competency to prepare a slide-mounted specimen. The standard mounting technique does not allow for analysis of the genome of the specimen. Conversely, preparatory techniques for genetic analysis of mealybugs cause either loss of the entire individual or physical damage that can make morphology-based identification difficult. This study describes a simple protocol that does not impact physical integrity of the specimen for fixation and microscopic examination yet enables simultaneous DNA extraction for DNA-based identification of four mealybug species. All species prepared yielded high quality slide mounts, identified as Planococcus citri Risso, Pseudococcus viburni Signoret, Rhizoecus kondonis Kuwana, or Rhizoecus californicus Ferris. DNA extracted in this manner had higher purity and yield in the final eluate than in samples extracted using standard methods. DNA extracted was successfully amplified by polymerase chain reaction using primers for the cytochrome oxidase I gene and subsequently sequenced for all specimens. This protocol is likely to be applicable to other Hemiptera taxa that are preserved by slide mounting, allowing for both the preparation of a high-quality voucher specimen for morphological identification and simultaneous analysis of DNA for the same specimen. The methods used are technically less challenging than current standard procedures. PMID:26198869

  7. Complete DNA sequence of the mitochondrial genome of the treehopper Leptobelus gazella (Membracoidea: Hemiptera). (United States)

    Zhao, Xing; Liang, Ai-Ping


    The first complete DNA sequence of the mitochondrial genome (mitogenome) of Leptobelus gazelle (Membracoidea: Hemiptera) is determined in this study. The circular molecule is 16,007 bp in its full length, which encodes a set of 37 genes, including 13 proteins, 2 ribosomal RNAs, 22 transfer RNAs, and contains an A + T-rich region (CR). The gene numbers, content, and organization of L. gazelle are similar to other typical metazoan mitogenomes. Twelve of the 13 PCGs are initiated with ATR methionine or ATT isoleucine codons, except the atp8 gene that uses the ATC isoleucine as start signal. Ten of the 13 PCGs have complete termination codons, either TAA (nine genes) or TAG (cytb). The remaining 3 PCGs (cox1, cox2 and nad5) have incomplete termination codons T (AA). All of the 22 tRNAs can be folded in the form of a typical clover-leaf structure. The complete mitogenome sequence data of L. gazelle is useful for the phylogenetic and biogeographic studies of the Membracoidea and Hemiptera. PMID:25714149

  8. Feeding and oviposition preferences of Ctenarytaina spatulata Taylor (Hemiptera, Psyllidae) for Eucalyptus spp. and other Myrtaceae in Brazil Preferência de alimentação e oviposição de Ctenarytaina spatulata Taylor (Hemiptera, Psyllidae) por Eucalyptus spp. e outras Myrtaceae


    Dalva Luiz de Queiroz; Keti M. R. Zanol; Edílson B. Oliveira; Norivaldo dos Anjos; Jonathan Majer


    Feeding and oviposition preferences of Ctenarytaina spatulata Taylor (Hemiptera, Psyllidae) for Eucalyptus spp. and other Myrtaceae in Brazil. The Australian psyllid, Ctenarytaina spatulata Taylor (Hemiptera, Psyllidae), was first detected in Brazil in 1994, where it was found on drought-affected shoots of Eucalyptus grandis in a plantation located in the northern part of Paraná State. The oviposition and feeding preferences of this psyllid were examined on 19 Eucalyptus species, one Eucalypt...

  9. Das Lektin aus der Erbse Pisum sativum : Bindungsstudien, Monomer-Dimer-Gleichgewicht und Rückfaltung aus Fragmenten (United States)

    Küster, Frank


    Das Lektin aus Pisum sativum, der Gartenerbse, ist Teil der Familie der Leguminosenlektine. Diese Proteine haben untereinander eine hohe Sequenzhomologie, und die Struktur ihrer Monomere, ein all-ß-Motiv, ist hoch konserviert. Dagegen gibt es innerhalb der Familie eine große Vielfalt an unterschiedlichen Quartärstrukturen, die Gegenstand kristallographischer und theoretischer Arbeiten waren. Das Erbsenlektin ist ein dimeres Leguminosenlektin mit einer Besonderheit in seiner Struktur: Nach der Faltung in der Zelle wird aus einem Loop eine kurze Aminosäuresequenz herausgeschnitten, so dass sich in jeder Untereinheit zwei unabhängige Polypeptidketten befinden. Beide Ketten sind aber stark miteinander verschränkt und bilden eine gemeinsame strukturelle Domäne. Wie alle Lektine bindet Erbsenlektin komplexe Oligosaccharide, doch sind seine physiologische Rolle und der natürliche Ligand unbekannt. In dieser Arbeit wurden Versuche zur Entwicklung eines Funktionstests für Erbsenlektin durchgeführt und seine Faltung, Stabilität und Monomer-Dimer-Gleichgewicht charakterisiert. Um die spezifische Rolle der Prozessierung für Stabilität und Faltung zu untersuchen, wurde ein unprozessiertes Konstrukt in E. coli exprimiert und mit der prozessierten Form verglichen. Beide Proteine zeigen die gleiche kinetische Stabilität gegenüber chemischer Denaturierung. Sie denaturieren extrem langsam, weil nur die isolierten Untereinheiten entfalten können und das Monomer-Dimer-Gleichgewicht bei mittleren Konzentrationen an Denaturierungsmittel auf der Seite der Dimere liegt. Durch die extrem langsame Entfaltung zeigen beide Proteine eine apparente Hysterese im Gleichgewichtsübergang, und es ist nicht möglich, die thermodynamische Stabilität zu bestimmen. Die Stabilität und die Geschwindigkeit der Assoziation und Dissoziation in die prozessierten bzw. nichtprozessierten Untereinheiten sind für beide Proteine gleich. Darüber hinaus konnte gezeigt werden, dass auch unter

  10. Predation of Apiomerus pilipes (Fabricius (Hemiptera, Reduviidae, Harpactorinae, Apiomerini over Meliponinae bees (Hymenoptera, Apidae, in the State of Amazonas, Brazil

    Directory of Open Access Journals (Sweden)

    Alexandre Coletto da Silva


    Full Text Available The present work shows the occurrence of an intense predatory activity on adults working Meliponinae bees (Hymenoptera, Apidae, by Apiomerus pilipes (Fabricius, 1787 (Hemiptera, Reduviidae, Harpactorinae, Apiomerini at a meliponary in the Instituto Nacional de Pesquisas da Amazônia (INPA, Manaus, Amazonas State, Brazil.O presente trabalho registra a ocorrência de intensa atividade predatória de Apiomerus pilipes (Fabricius, 1787 (Hemiptera, Reduviidae, Harpactorini, Apiomerini sobre operárias adultas de meliponíneos (Hymenoptera, Apidae, no meliponário experimental do Instituto Nacional de Pesquisas da Amazônia (INPA, Manaus, Estado do Amazonas, Brasil. O meliponário se encontra num fragmento de vegetação secundária no próprio INPA.

  11. Desenvolvimento de Dysmicoccus brevipes (Cockerell (Hemiptera:Pseudococcidae em duas cultivares de abacaxi Development of the pineapple mealybug Dysmicoccus brevipes (Cockerell (Hemiptera: Pseudococcidae on two pineapple cultivars

    Directory of Open Access Journals (Sweden)

    Lenira Viana Costa Santa-Cecília


    Full Text Available A cochonilha Dysmicoccus brevipes (Cockerell (Hemiptera: Pseudococcidae é uma das principais pragas em cultivos de abacaxi e os estudos biológicos desse inseto em diferentes cultivares são uma necessidade. Objetivou-se com este trabalho avaliar o desenvolvimento dessa cochonilha em duas cultivares de abacaxi, Pérola e Cayenne. O experimento foi conduzido em câmara climatizada a 25 ± 1ºC, 70 ± 10% UR e fotofase de 12 horas. As plantas de abacaxi foram reproduzidas in vitro, transplantadas para vasos (250 mL e aclimatadas em casa-de-vegetação. Ninfas com até um dia de vida foram confinadas em gaiolas de PVC (1 cm de diâmetro, e fixadas em folhas de ambas as cultivares. Não foram detectadas diferenças no desenvolvimento de D. brevipes nos dois substratos alimentares utilizados. O desenvolvimento ninfal de fêmeas e machos de D. brevipes foi 39,9 e 32,0 dias na cv. Pérola e 38,5 e 32,4 dias na cv. Cayenne, respectivamente. A sobrevivência da fase ninfal foi 32,3 e 40,5%; a razão sexual, 0,39 e 0,33; e a longevidade de fêmeas, 20,3 e 26,1 dias nas cvs. Pérola e Cayenne, respectivamente.The pineapple mealybug Dysmicoccus brevipes (Cockerell (Hemiptera: Pseudococcidae is the main pest on pineapple crops and biological studies of this insect are necessary on different cultivars. The objective of this work was to evaluate the development time of this mealybug on the pineapple cultivars Pérola and Cayenne. The experiment was performed in climated chambers at 25 ± 1ºC, 70 ± 10% RH and 12 h photophase. Pinneapple plants were reproduced in vitro, transplanted to pots (250 mL and kept in greenhouse. One-day-old nymphs were kept inside a clipcage (1 cm diameter fixed on the plants. No differences in development of D. brevipes among the cultivars were found. Development times of females and males, respectively, were 39.9 and 32 days on cv. Pérola and 38.5 and 32.4 days on cv. Cayenne. Nymphs survivals were 32.3 and 40.5%, sexual rates

  12. Performances of survival, feeding behavior, and gene expression in aphids reveal their different fitness to host alteration


    Hong Lu; Pengcheng Yang; Yongyu Xu; Lan Luo; Junjie Zhu; Na Cui; Le Kang; Feng Cui


    Insect populations feeding on different plant species are under selection pressure to adapt to these differences. A study integrating elements of the ecology, behavior, and gene expression of aphids on different host plants has not yet been well-explored. The present study explores the relationship between host fitness and survival, feeding behavior, and salivary gland gene expression of a pea (Pisum sativum) host race of Acyrthosiphon pisum feeding on a common host Vicia faba and on three ge...

  13. Characterization of microsatellite DNA libraries from three mealybug species and development of microsatellite markers for Pseudococcus viburni (Hemiptera: Pseudococcidae).


    Correa, M. C. G.; Zaviezo, T.; Le Maguet, Jean; HERRBACH, Etienne; Malausa, Thibaut


    Mealybugs (Hemiptera: Pseudococcidae) are important pests for crops worldwide. Different species, cryptic taxa under the same species name or even populations within a species can differ in biological characteristics, such as phenology, resistance to insecticides, virus transmission and susceptibility to natural enemies. Therefore, their management efficacy depends on their accurate identification. Microsatellite genetic markers are efficient in revealing the fine-scale taxonomic status of in...

  14. Portanus Ball: descrição de uma espécie nova (Hemiptera, Cicadellidae, Xestocephalinae

    Directory of Open Access Journals (Sweden)

    Adenomar Neves de Carvalho


    Full Text Available Portanus dubius sp. nov. é descrita e ilustrada a partir de espécimens que foram coletados com armadilha Malaise durante um levantamento entomológico no Estado do Paraná, Brasil (PROFAUPAR.Portanus Ball: description of a new species (Hemiptera, Cicadellidae, Xestocephalinae. Portanus dubius sp. nov. is described and illustrated. The specimens were collected with Malaise trap during an entomological inventory in Paraná State, Brazil (PROFAUPAR.

  15. Fumigant Toxicity of Petroselinum Crispum L. (Apiaceae) Essential Oil on Trialeurodes Vaporariorum (Westwood) (Hemiptera: Aleyrodidae) Adults Under Greenhouse Conditions


    Mahmoodi Leila; Valizadegan Oroj; Mahdavi Vahid


    Trialeurodes vaporariorum (Westwood) (Hemiptera: Aleyrodidae) is one of the most harmful, world-wide known pests of greenhouse crops and ornamental plants. This insect feeds on plant sap, produces honeydew, and transmits plant viruses, while causing quantitative and qualitative damage to plants. For controlling this pest in greenhouses, plant essential oils are used as an alternative to chemical insecticidal. So in this study, fumigant toxicity of Petroselinum crispum L. (Apiaceae) plant oil ...

  16. Taxonomic Status of the Bemisia tabaci Complex (Hemiptera: Aleyrodidae) and Reassessment of the Number of Its Constituent Species


    Lee, Wonhoon; Park, Jongsun; Lee, Gwan-Seok; Lee, Seunghwan; Akimoto, Shin-ichi


    Bemisia tabaci (Hemiptera: Aleyrodidae) is one of the most important insect pests in the world. In the present study, the taxonomic status of B. tabaci and the number of species composing the B. tabaci complex were determined based on 1059 COI sequences of B. tabaci and 509 COI sequences of 153 hemipteran species. The genetic divergence within B. tabaci was conspicuously higher (on average, 11.1%) than interspecific genetic divergence within the respective genera of the 153 species (on averag...

  17. Phylogeography of a semi-aquatic bug, Microvelia horvathi (Hemiptera: Veliidae): an evaluation of historical, geographical and ecological factors


    Zhen Ye; Gengping Zhu; Jakob Damgaard; Xin Chen; Pingping Chen; Wenjun Bu


    Subtropical China is a centre of speciation and well known for its high biological diversity and endemism. To understand the impact of historical, geographical and ecological factors on the intraspecific lineage divergence of invertebrates, we examined these processes in a semiaquatic bug, Microvelia horvathi (Hemiptera: Veliidae). Three hypotheses were developed using ecological niche models (ENM). We tested these hypotheses using mitochondrial (COI + COII) and nuclear data (ITS1 + 5.8S + IT...

  18. Microgeographic Spatial Structuring of Triatoma infestans (Hemiptera: Reduviidae) Populations Using Wing Geometric Morphometry in the Argentine Chaco


    GASPE, M. S.; Schachter-Broide, J.; Gurevitz, J. M.; KITRON, U.; Gürtler, R. E.; Dujardin, J.P.


    We investigated the occurrence of spatial structuring in Triatoma infestans (Klug) (Hemiptera: Reduviidae) populations 12 yr after the last community-wide insecticide spraying campaign in rural Pampa del Indio, in the Gran Chaco of northeastern Argentina. In total, 172 male and 149 female right wings collected at 16 georeferenced sites with at least 10 individuals of the same sex were analyzed using geometric morphometry. Mean female body length and wing centroid size (CS) were significantly ...

  19. Variabilidad de la tolerancia a insecticidas en distintas poblaciones mediterráneas de Orius laevigatus (Fieber) (Hemiptera: Anthocoridae)


    Balanza Martínez, Virginia; Mendoza Rivas, José Enrique; Bielza Lino, Pablo


    Orius laevigatus (Fieber) (Hemiptera: Anthocoridae) es un enemigo natural usado ampliamente en el control biológico de plagas, principalmente del trips Frankliniella occidentalis (Pergande) (Thysanoptera: Thripidae). La instalación y establecimiento de O. laevigatus en los cultivos resulta de vital importancia, pero en ocasiones existen problemas de compatibilidad con algunos tratamientos fitosanitarios. Este problema siempre se ha abordado desde el punto de vista del plaguicid...

  20. The cotton mealybug Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae as a new insect pest on tomato plants in Egypt

    Directory of Open Access Journals (Sweden)

    Ibrahim Samah Sayed


    Full Text Available Recently, the mealybug Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae was recorded as a new pest on tomato plants (Lycopersicon esculentum Mill growing in Egypt. The mealybugs specimens were collected from tomato plants in the Qalyoubia governorate during summer season of 2014. The mealybug was identified as P. solenopsis based on the morphological characters and taxonomic key of this species. This study represents the first record of P. solenopsis as a new insect pest attacking tomato plants in Egypt

  1. The cotton mealybug Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae) as a new insect pest on tomato plants in Egypt


    Ibrahim Samah Sayed; Moharum Fatma Abdelhalim; Abd El-Ghany Nesreen Mohamed


    Recently, the mealybug Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae) was recorded as a new pest on tomato plants (Lycopersicon esculentum Mill) growing in Egypt. The mealybugs specimens were collected from tomato plants in the Qalyoubia governorate during summer season of 2014. The mealybug was identified as P. solenopsis based on the morphological characters and taxonomic key of this species. This study represents the first record of P. solenopsis as a new insect pest attacking ...

  2. Rhythmical changes of a level nitric oxide (NO in roots etiolated seedlings of pea (Pisum sativum L. and influence of exogenous calcium

    Directory of Open Access Journals (Sweden)

    A.K. Glyan’ko


    Full Text Available Studied time dynamics (during 60 mines a level oxide nitric (NO in cross cuts of roots 2 – day etiolated seedlings of pea sowing (Pisum sativum L. by use of fluorescent probe DAF-2DA and a fluorescent microscope depending on action exogenous calcium (Ca2+. During an exposition of seedlings on water, solution CaCl2 are shown fluctuation in level NO in roots – his increase and decrease that testifies to the certain rhythm in generation NO. Exogenous factors (Ca2+ change time dynamics of level NO in comparison with variant “water”. Ca2+chelate EGTA removes action exogenous calcium on rhythmical change of a level NO in roots. Results are discussed in aspect of close interference of signaling systems and molecules (Ca2+, NO, Н2О2.

  3. Expression of Pisum sativum defensin 1 (Psd1 in shaking flasks and bioreactor cultivations of recombinant Pichia pastoris at different pHs

    Directory of Open Access Journals (Sweden)

    A. L. Larentis


    Full Text Available The methylotrophic yeast Pichia pastoris was used to produce the recombinant Pisum sativum defensin (rPsd1, a small peptide from pea seeds that has a high level of antifungal activity. The plasmid rPsd1/pPIC9 was integrated into the yeast genome and methanol was used to induce expression and secretion of the recombinant Psd1, at 30º C in a fed-batch mode. The effects of different pH conditions and process scale-up were evaluated using a Monod-type model where dissolved oxygen was considered the limiting substrate. Parameter estimation showed that the process could be improved by expressing rPsd1 in a 1000 mL bioreactor at pH 4. Structural and functional analyses revealed that the recombinant Psd1 is very similar to the native one.

  4. El manganeso como factor positivo en la producción de papa (solanum tuberosum l.) y arveja (pisum sativum l.) en suelos del altiplano cundiboyacense


    Gómez, Manuel Iván; López, Miguel Ángel; Cifuentes, Yenny Carolina


    En dos suelos contrastantes, Andic Eutrudepts (Funza, Cundinamarca) y Typic Hapludands (Saboyá, Boyacá), se evaluó la respuesta agronómica a la aplicación de manganeso de Solanum tuberosum L. y Pisum sativum L. En S. tuberosum se realizó la investigación en dos localidades, Funza y Saboyá, evaluando dosis de Mn de 0,0; 3,0; 4,0; 6,0 kg· ha-1, respectivamente, aplicado en mezcla con el fertilizante NPK en siembra; en Saboyá se contó con un testigo sin aplicación de fertilizante. Las variedades...

  5. Characteristics of 36C103- influx into nitrate reductase deficient mutant E1 pisum sativum seedlings: evidence for restricted ''induction'' by nitrate compared with wild type

    International Nuclear Information System (INIS)

    The characteristics of nitrate uptake into seedlings of Pisum sativum L. cv. Rondo mutant E1 defective for nitrate reductase (NR) and of its parent variety Rondo have been investigated using 36C103- as an analogue for nitrate. The apparent Michaelis Menten constants (Km) for 36ClO3- influx measured over 10 min were similar for mutant E1 and the wild type (Wt). There was a 28% increase in 36C103- into Wt seedlings following nitrate pretreatment but this was not found when mutant seedlings were used. N starvation increased 36C103- influx into both mutant and Wt seedlings, and the rate of cycling E/I was also enhanced to a similar extent. The results are discussed in terms of current ideas on the regulation of nitrate uptake and assimilation. (author)

  6. Aphid populations (Hemiptera: Aphidoidea depend of mulching in watermelon production in the Mediterranean region of Croatia

    Directory of Open Access Journals (Sweden)

    K. Zanic


    Full Text Available Winged morphs of aphids were investigated under field conditions during 2008, 2010 and 2011 in the Mediterranean region of Croatia. Field experiments were conducted to record aphid diversity and compare polyethylene black mulch to straw mulch and bare soil in terms of their attractiveness to aphid species in a watermelon crop. Aphids were collected weekly using yellow water metal traps from May to July. During the study, 44 species in 31 genera were detected; 36 species in 24 genera were identified in 2008, 18 species in 15 genera were identified in 2010, and 34 species in 25 genera were identified in 2011. The overall seasonal percentage composition showed that Aphis fabae Scopoli and Myzus persicae (Sulzer were consistently eudominant species, whereas Acyrtosiphon pisum (Harris was consistently dominant. Cabbage aphid Brevicoryne brassicae (L. was determined as the dominant species in 2008 and as eudominant species in 2011. Additionally, Macrosiphum rosae (L. was twice recorded as the dominant species, whereas Aphis gossipii Glover was dominant once, and Phorodon humuli (Schrank was eudominant once. Our study also demonstrated that mulching sporadically affected the abundance of individual species. The attractiveness of mulching for aphid species differed between the treatments. It was found that bare soil was attractive to A. pisum and M. rosae, black mulch was attractive to B. helichrysi and P. humuli, and straw mulch was attractive to four aphid species, of which two were eudominant, A. fabae and M. persicae. The presented species are mostly polyphagous, and their preference for certain mulches can be used in crop protection management.

  7. Advances in the use of the RNA interference technique in Hemiptera

    Institute of Scientific and Technical Information of China (English)

    Jie Li; Xiao-Ping Wang; Man-Qun Wang; Wei-Hua Ma; Hong-Xia Hua


    RNA interference(RNAi)suppresses the expression of target genes by posttranscriptional regulation.Because double-stranded RNA(dsRNA)mediated gene silencing is a conserved mechanism in many eukaryotes,RNAi has become a valuable tool for unveiling gene function in many model insects.Recent research has also shown that RNAi can also be effective in the downregulation of target genes in Hemiptera.In this review,we discuss the use of the RNAi technique in gene functional analysis in hemipterans,highlighting the methods of dsRNA uptake by these insects and discuss the knock-down efficiency of these techniques.Although the RNAi technique has disadvantages,our primary goal here is to determine whether it can be exploited further in the discovery of new gene functions,and as a pest control strategy,in some important Hemipteran pests.

  8. A survey of scale insects in soil samples from Europe (Hemiptera, Coccomorpha). (United States)

    Kaydan, Mehmet Bora; Benedicty, Zsuzsanna Konczné; Kiss, Balázs; Szita, Éva


    In the last decades, several expeditions were organized in Europe by the researchers of the Hungarian Natural History Museum to collect snails, aquatic insects and soil animals (mites, springtails, nematodes, and earthworms). In this study, scale insect (Hemiptera: Coccomorpha) specimens extracted from Hungarian Natural History Museum soil samples (2970 samples in total), all of which were collected using soil and litter sampling devices, and extracted by Berlese funnel, were examined. From these samples, 43 scale insect species (Acanthococcidae 4, Coccidae 2, Micrococcidae 1, Ortheziidae 7, Pseudococcidae 21, Putoidae 1 and Rhizoecidae 7) were found in 16 European countries. In addition, a new species belonging to the family Pseudococcidae, Brevennia larvalis Kaydan, sp. n. and a new species of Ortheziidae, Ortheziola editae Szita & Konczné Benedicty, sp. n. are described and illustrated based on the adult female stage. Revised keys to the adult females of Brevennia and Ortheziola are presented. PMID:27081335

  9. VOLATILE COMPONENTS FROM GALLS INDUCED BY Baccharopelma dracunculifoliae (Hemiptera: Psyllidae ON LEAVES OF Baccharis dracunculifolia (Asteraceae

    Directory of Open Access Journals (Sweden)

    Michele Aparecida Besten


    Full Text Available The volatile components of the galls induced by the insect Baccharopelma dracunculifoliae (Hemiptera: Psyllidae on leaves of Baccharis dracunculifolia (Asteraceae were analyzed by gas chromatography-mass spectrometry (GC-MS and gas chromatographyflame- ionisation detection (GC-FID, and then comparison with volatile oil samples from healthy leaves collected in the vicinity. The galls produced around 3.5% of the total organic volatiles whereas healthy leaves rendered an average yield of 0.6%. The observed higher proportions of germacrene D, bicyclogermacrene, limonene, and β-pinene in the galls suggest that all these compounds are important targets in the search for natural enemies of this Psyllid. Moreover, higher relative percentages of (E-nerolidol and spathulenol were found in healthy leaves.

  10. On dorsal prothoracic appendages in treehoppers (Hemiptera: Membracidae) and the nature of morphological evidence. (United States)

    Mikó, István; Friedrich, Frank; Yoder, Matthew J; Hines, Heather M; Deitz, Lewis L; Bertone, Matthew A; Seltmann, Katja C; Wallace, Matthew S; Deans, Andrew R


    A spectacular hypothesis was published recently, which suggested that the "helmet" (a dorsal thoracic sclerite that obscures most of the body) of treehoppers (Insecta: Hemiptera: Membracidae) is connected to the 1st thoracic segment (T1; prothorax) via a jointed articulation and therefore was a true appendage. Furthermore, the "helmet" was interpreted to share multiple characteristics with wings, which in extant pterygote insects are present only on the 2nd (T2) and 3rd (T3) thoracic segments. In this context, the "helmet" could be considered an evolutionary novelty. Although multiple lines of morphological evidence putatively supported the "helmet"-wing homology, the relationship of the "helmet" to other thoracic sclerites and muscles remained unclear. Our observations of exemplar thoraces of 10 hemipteran families reveal multiple misinterpretations relevant to the "helmet"-wing homology hypothesis as originally conceived: 1) the "helmet" actually represents T1 (excluding the fore legs); 2) the "T1 tergum" is actually the anterior dorsal area of T2; 3) the putative articulation between the "helmet" and T1 is actually the articulation between T1 and T2. We conclude that there is no dorsal, articulated appendage on the membracid T1. Although the posterior, flattened, cuticular evagination (PFE) of the membracid T1 does share structural and genetic attributes with wings, the PFE is actually widely distributed across Hemiptera. Hence, the presence of this structure in Membracidae is not an evolutionary novelty for this clade. We discuss this new interpretation of the membracid T1 and the challenges of interpreting and representing morphological data more broadly. We acknowledge that the lack of data standards for morphology is a contributing factor to misinterpreted results and offer an example for how one can reduce ambiguity in morphology by referencing anatomical concepts in published ontologies. PMID:22272287

  11. Responses of Neomegalotomus parvus (Hemiptera: Alydidae to color and male-lured traps

    Directory of Open Access Journals (Sweden)

    Maurício Ursi Ventura


    Full Text Available In 1998, the relative responses of Neomegalotomus parvus (Westwood (Hemiptera: Alydidae to colors in traps were assessed in the field. Colors were printed in white alkaline paper and covered with transparent plastic. Printed colors were black, green, yellow, red and blue. Treatments also included white paper and aluminum foil. Green traps captured more bugs than the other traps (except yellow. Yellow traps caught significantly more N. parvus males than blue, black and aluminum traps. White, red and blue traps captured significantly more N. parvus males than black traps. In 1999, the same treatments were used and additionally included the factor presence (X absence of males in cages in the traps. Four males were confined in the cages together with pigeon pea seeds and water. Control traps received only pigeon pea seeds and water. No responses were found for color comparisons. Male-lured traps captured significantly more males than control traps.Em 1998, as respostas relativas de Neomegalotomus parvus (Westwood (Hemiptera: Alydidae a cores em armadilhas foram avaliadas no campo. As cores foram impressas (preto, verde, amarelo, vermelho e azul, em papel alcalino branco e coberto com plástico transparente. Também se incluiu papel branco e folha de alumínio, como tratamentos. Armadilhas verdes capturaram mais insetos que outras armadilhas (exceto amarelo. Armadilhas amarelas capturaram significativamente mais machos de N. parvus do que armadilhas azuis, pretas e alumínio. Armadilhas brancas, vermelhas e azuis capturaram significativamente mais machos de N. parvus do que armadilhas pretas. Em 1999, os mesmos tratamentos foram usados e também se incluiu fator presença (X ausência de machos em gaiolas nas armadilhas. Quatro machos foram confinados nas gaiolas junto com sementes de guandu e água. Testemunhas receberam somente sementes de guandu e água. Não foram obtidas respostas significativas à cores. Armadilhas com machos capturaram

  12. Primera cita de Blastopsylla occidentalis y Glycaspis brimblecombei (Hemiptera: Psyllidae para la República Argentina First record of Blastopsylla occidentalis and Glycaspis brimblecombei (Hemiptera: Psyllidae from Argentina

    Directory of Open Access Journals (Sweden)

    Juan P. R. Bouvet


    Full Text Available Se registran por primera vez para la República Argentina dos especies de "psílidos" (Hemiptera: Psyllidae, plagas provenientes de Australia que atacan a especies del género Eucalyptus L´Hér. Una de ellas, Glycaspis brimblecombei Moore es de gran importancia económica en países vecinos, debido a los daños que produce. De la otra, Blastopsylla occidentalis Taylor, es escasa la información referente a su biología y daños que ocasiona.Two psyllid species are recorded for the first time from Argentina. They are pests originating from Australia that attack species of the genus Eucalyptus L´Hér. One of them, Glycaspis brimblecombei Moore is of great economic importance in neighboring countries for the damage which it is causing on its hosts. Little information on the biology and damage caused is available for the second species, viz Blastopsylla occidentalis Taylor.

  13. First report and morphological redescription of Teleonemia morio (Stål (Hemiptera, Tingidae in Annona squamosa L. (Annonaceae in Brazil

    Directory of Open Access Journals (Sweden)

    Sônia M. F. Broglio


    Full Text Available First report and morphological redescription of Teleonemia morio (Stål (Hemiptera, Tingidae in Annona squamosa L. (Annonaceae in Brazil. This is the first report of a severe attack of Teleonemia morio (Stål, 1855 (Hemiptera, Heteroptera, Tingidae on Annona squamosa L. (custard apple, causing up to 80% of losses of infested trees. In order to facilitate the identification of this insect pest, the adult female of T. morio is redescribed based on specimens collected in Palmeira dos Índios, Alagoas, Brazil.

  14. First report and morphological redescription of Teleonemia morio (Stål) (Hemiptera, Tingidae) in Annona squamosa L. (Annonaceae) in Brazil



    First report and morphological redescription of Teleonemia morio (Stål) (Hemiptera, Tingidae) in Annona squamosa L. (Annonaceae) in Brazil. This is the first report of a severe attack of Teleonemia morio (Stål, 1855) (Hemiptera, Heteroptera, Tingidae) on Annona squamosa L. (custard apple), causing up to 80% of losses of infested trees. In order to facilitate the identification of this insect pest, the adult female of T. morio is redescribed based on specimens collected in Palmeira dos Índios,...

  15. Evaluación de nueve variedades de arveja (pisum sativum l.) para uso industrial, en la región de suba, santafé de bogotá


    Patiño O., William J.; Valderrama G., John A.; Ñustez L., Carlos E.


    En la localidad de Suba, Santafé de Bogotá, (Cundinamarca), se sembraron nueve variedades arbustivas de arveja (Pisum sativum L.): Aim, Alsweet, Flair, Kriter, Marifon, Payload, Pronto, Rondifon y Trend, a las cuales se les evaluaron algunas variables fenológicas y variables relacionadas con los componentes de rendimiento. Los materiales de mejor comportamiento fueron aquéllos de mayor precocidad y menor altura de planta (Payload, Marifon, Pronto y Rondifon), tendiendo a presentar mayor rendi...

  16. Dicty_cDB: SFJ609 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 2 CD036313 |CD036313.1 mgmt015xA07f.b Mated culture Magnaporthe grisea cDNA clone mgmt015xA07 5', mRNA seque...ea Aphid Acyrthosiphon pisum cDNA clone WHAP-002_A12 5', mRNA sequence. 50 3e-04

  17. Dicty_cDB: Contig-U06362-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available .52 1 ( CV846672 ) ID0AEE15CH04RM1 ID0AEE Acyrthosiphon pisum cDNA c... 48 0.52 1 ( CN920332 ) 000510AEAA003217HT (AEAA) Aotea leaf Ma... 48 0.52 1 ( CN910511 ) 030128ABLC005496HT (ABLC) Braeburn cell cultu

  18. Dicty_cDB: Contig-U01439-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 8 1.4 3 ( FG289417 ) 1108793302147 New World Screwworm Egg 9261 ESTs C... 38 1.4 2 ( CP001161 ) Buchnera aph...idicola str. 5A (Acyrthosiphon pisum)... 36 1.4 13 ( FG295674 ) 1108770739838 New World

  19. EST Table: FY037504 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FY037504 rbmte15h19 11/11/04 76 %/206 aa ref|NP_001153808.1| parvin [Acyrthosiphon pisum] dbj|BA ... 52 %/206 aa T21D12.4#CE18268#WBGene00003932#locus:pat - 6#status:Confirmed#UniProt:O16785#protein_id:AAC4 ...

  20. EST Table: FY037895 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FY037895 rbmte16j01 11/11/04 75 %/236 aa ref|NP_001153808.1| parvin [Acyrthosiphon pisum] dbj|BA ... 54 %/234 aa T21D12.4#CE18268#WBGene00003932#locus:pat - 6#status:Confirmed#UniProt:O16785#protein_id:AAC4 ...

  1. EST Table: FY016820 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FY016820 rbmov17o02 11/11/04 75 %/236 aa ref|NP_001153808.1| parvin [Acyrthosiphon pisum] dbj|BA ... 54 %/234 aa T21D12.4#CE18268#WBGene00003932#locus:pat - 6#status:Confirmed#UniProt:O16785#protein_id:AAC4 ...

  2. Efeito de extratos de plantas do Cerrado em Dipetalogaster maxima (Uhler (Hemiptera, Reduviidae Effect of Cerrado plant extracts on Dipetalogaster maxima (Uhler (Hemiptera, Reduviidae

    Directory of Open Access Journals (Sweden)

    André A. M. Coelho


    Full Text Available A transmissão da doença de Chagas ocorre, principalmente, por meio de fezes de hemípteros hematófagos (Triatominae, os quais ingerem o Trypanosoma cruzi ao se alimentarem do sangue de pessoas ou outros mamíferos infectados. Para o controle dos triatomíneos, os piretróides são os principais inseticidas utilizados. Entretanto, algumas populações de insetos demonstraram resistência a determinados piretróides, indicando a necessidade do desenvolvimento de novos inseticidas eficazes no controle desses vetores. Assim, foi avaliada a atividade inseticida de 83 extratos vegetais, pertencentes a 35 espécies diferentes, em ninfas do primeiro estádio de Dipetalogaster maxima (Uhler, 1894 (Hemiptera: Reduviidae, triatomíneo encontrado no México. Para o teste tópico, foram aplicados 50 ìg de cada extrato nos tergitos abdominais de dez ninfas, em duplicata. Como controles, foram utilizados insetos tratados com etanol, acetona ou sem nenhum tipo de tratamento. Os triatomíneos foram observados durante 28 dias. Nenhum extrato apresentou atividade inseticida significativa, entretanto, o extrato hexânico do fruto e o etanólico da casca do caule de Simarouba versicolor (Simaroubaceae inibiram a taxa de ecdise em D. maxima (40% e 25%, respectivamente. Sugere-se que estes extratos sejam quimicamente investigados e monitorados por ensaios biológicos a fim de determinar os componentes, para que estes possam ser utilizados como modelos moleculares ou como compostos biorracionais nos programas de controle de insetos.Chagas disease, also known as American Trypanosomiasis, is chiefly transmitted by faeces of haematophagous bugs (Triatominae that ingested Trypanosoma cruzi from blood of infected people or other mammals. Pyrethroids have been the main insecticides used against these insects. However, some populations of insects have shown significant levels of resistance to several pyrethroids, indicating the need of new insecticides for the control of

  3. Efeitos da temperatura e do alimento no desenvolvimento de Dysdercus maurus Distant (Hemiptera, Pyrrhocoridae Effects of temperature and food on the development of Dysdercus maurus Distant (Hemiptera, Pyrrhocoridae

    Directory of Open Access Journals (Sweden)

    Fábio Souto Almeida


    Full Text Available Dysdercus maurus Distant, 1901 (Hemiptera, Pyrrhocoridae é uma importante praga de Gossypium spp. (algodoeiro, Citrus Sinensis Osbeck (Rutaceae (laranjeira e Citrus reticulata (Rutaceae (tangerineira, além de sementes de Chorisia speciosa St. Hil. (paineira. Este trabalho objetivou avaliar os efeitos da temperatura e do alimento no desenvolvimento de D. maurus. Foram realizados oito tratamentos, seis em que os percevejos foram alimentados com sementes de paineira e mantidos a 15, 18, 20, 25 e 30 ± 1ºC, UR 80 ± 3% e fotofase de 12 h ou em condições ambientais de laboratório (23,5 ± 2,6ºC, UR 73,3 ± 9,9 %, e dois em que foram alimentados com sementes de algodão variedade IAC-22 e mantidos a 25 e 30ºC. Em todos os tratamentos foram observados cinco estágios imaturos. O aumento da temperatura proporcionou diminuição do tempo de desenvolvimento. A temperatura de 15ºC foi letal para ovos e ninfas de D. maurus. A menor mortalidade de ninfas ocorreu quando os percevejos foram alimentados com sementes de algodão a 25ºC (24,07%. A menor temperatura base (Tb foi obtida para o 1º ínstar (11,54ºC e a maior para o 2º ínstar (15,33ºC. As fêmeas de D. maurus necessitam de maior quantidade de graus-dias (329,93 graus-dias que os machos (300,49 graus-dias para atingir o estádio adulto.Dysdercus maurus Distant, 1901 (Hemiptera, Pyrrhocoridae is an important pest on Gossypium spp. (cotton tree, Citrus sinensis Osbeck (Rutaceae and Citrus reticulata Blanco (Rutaceae crops. This insect also feeds on seeds of Chorisia speciosa St. Hil. (Bombacaceae. This work aimed to evaluate the effects of temperature and food on the development of D. maurus. Eight treatments were carried out, in six of them bugs were fed with seeds of C. speciosa and kept at 15, 18, 20, 25 and 30 ± 1ºC, 80 ± 3% RH and 12h photophase or in laboratory conditions (23.5 ± 2.6ºC, 73.3 ± 9.9 % RH, and in the other two treatments bugs were fed with seeds of cotton variety

  4. Efeito da cobertura vegetal sobre a pérola-da-terra (Hemiptera: Margarodidae) na cultura da videira = Effect of cover crops on brazilian ground pearl (Hemiptera: Margarodidae) in vineyards


    Marcos Botton; George Wellington Bastos de Melo; Odoni Loris Pereira de Oliveira; Ismael Onzi


    O uso da cobertura vegetal em vinhedos é uma prática empregada paraminimizar a erosão e melhorar as qualidades químicas e físicas do solo. Neste trabalho, foi avaliado o efeito de coberturas vegetais sobre a população da pérola-da-terra Eurhizococcus brasiliensis (Hemiptera: Margarodidae) na cultura da videira. No primeiro experimento, o vinhedo foi mantido sem cobertura vegetal por meio da aplicação trimestral do herbicida glifosato comparado com o uso de vegetação espontânea, durante o ano,...

  5. Biologia do psilídeo-de-concha Glycaspis brimblecombei Moore (Hemiptera, Psyllidae) em Eucalyptus spp. Red gum lerp psyllid Glycaspis brimblecombei Moore (Hemiptera, Psylidae) biology in Eucalyptus spp.


    Daniela Cristina Firmino-Winckler; Carlos Frederico Wilcken; Nádia Cristina de Oliveira; Carlos Alberto Oliveira de Matos


    Biologia do psilídeo-de-concha Glycaspis brimblecombei Moore (Hemiptera, Psyllidae) em Eucalyptus spp.. Glycaspis brimblecombei Moore também conhecido por psilídeo-de-concha, se caracteriza por ser uma espécie específica ao gênero Eucalyptus L'Her. Este trabalho teve por objetivo determinar o ciclo biológico de G. brimblecombei em Eucalyptus spp. O trabalho foi conduzido em câmara climatizada (BOD), sob a temperatura de 26 °C e fotofase de 12 horas. As espécies de Eucalyptus utilizadas para o...

  6. NUEVO REGISTRO DE Greenidea ficicola Takahashi (Hemiptera: Sternorrhyncha: Aphididae) EN GUAYABO Psidium guajava (Myrtaceae) EN ANTIOQUIA, COLOMBIA NEW REGISTRATION OF Greenidea ficicola Takahashi (Hemiptera: Sternorrhyncha: Aphididae) IN GUAVA Psidium guajava (Myrtaceae) IN ANTIOQUIA, COLOMBIA


    Rubén Darío David Giraldo; Jhon Albeiro Quiroz Gamboa; Francisco Yepes Rodríguez; Allan Henry Smith Pardo


    Se encuentra por primera vez en el departamento de Antioquia (Colombia) y asociado al guayabo (Psidium guajava L.), la especie Greenidea ficicola Takahashi ( Hemiptera: Sternorrhyncha: Aphididae) colectada durante muestreos intensivos realizados durante el primer semestre de 2008 en el Valle de Aburrá y municipios aledaños. Dicha especie de áfido también fue colectada en falso laurel (Ficus benjamina). Dada la importancia que tienen los frutos de guayabo en la alimentación humana y de los ani...

  7. First occurrence of Alcaeorrhynchus grandis (Dallas) (Hemiptera: Pentatomidae) preying on defoliating caterpillars of oil palm in the state of Para, Brazil; Primeira ocorrencia de Alcaeorrhynchus grandis (Dallas) (Hemiptera: Pentatomidae) predando lagartas desfolhadoras do dendezeiro no estado do Para, Brasil

    Energy Technology Data Exchange (ETDEWEB)

    Ribeiro, Rafael C.; Lemos, Walkymario P.; Muller, Antonio A. [EMBRAPA Amazonia Oriental, Belem, PA (Brazil). Lab. de Entomologia], e-mail:, e-mail:; Muller, Antonio A. [Embrapa Amazonia Oriental, Belem, PA (Brazil). Lab. de Entomologia; Bernardino, Aline S.; Buecke, Joel [Grupo Agropalma S/A., Tailandia, PA (Brazil)


    The oil palm Elaeis guineensis is usually attacked by pests, particularly, defoliating caterpillars. Between 2004 and 2006 a stinkbug predator (Asopinae) was registered preying on caterpillars of Brassolis sophorae L., Opsiphanes invirae Hubner (Lepidoptera: Nymphalidae) and Sibine spp. (Lepidoptera: Limacodidae), reducing their populations in commercial oil palm plantations in the State of Para, Brazil. Specimens of the natural enemy were collected, mounted, and identified as Alcaeorrhynchus grandis (Dallas) (Hemiptera: Pentatomidae), corresponding to the first report of the occurrence of this stinkbug attacking defoliating caterpillars of oil palm in Brazil. (author)

  8. Controle químico da forma galícola da filoxera Daktulosphaira vitifoliae (Fitch, 1856) (Hemiptera: Phylloxeridae) na cultura da videira Chemical control of grape phylloxera Daktulosphaira vitifoliae (Fitch, 1856) leaf form (Hemiptera: Phylloxeridae) on vineyards


    Marcos Botton; Rudiney Ringenberg; Odimar Zanuzo Zanardi


    A filoxera Daktulosphaira vitifoliae (Fitch, 1856) (Hemiptera: Phylloxeridae) é considerada a principal praga da videira. O inseto se alimenta da parte aérea e raízes sendo que os maiores prejuízos são observados em raízes de Vitis vinifera cultivada como pé-franco. O dano nas folhas é importante em viveiros, quando o ataque ocorre nos ramos utilizados como porta-enxertos, resistentes à forma radícola. Este trabalho foi realizado com o objetivo de selecionar inseticidas que possam ser emprega...

  9. Otroacizzia soriae sp. nov., a new Miocene psyllid (Insecta, Hemiptera, Psyllidae from Dominican amber

    Directory of Open Access Journals (Sweden)

    García-Gimeno, V.


    Full Text Available new species of the fossil genus Otroacizzia Klimaszewski, 1996 (Hemiptera, Psyllidae is described as Otroacizzia soriae sp. nov. on the basis of a female specimen. This species is preserved in mid-Miocene amber from La Toca mines, Dominican Republic. The genus Otroacizzia is the most diverse psylloid genus in Dominican amber, with four known species. The new species differs from the three previously known species by the presence of a subapical dark band in the fore wing from the anterior part of the end of vein Rs to the end of vein Cu1b, which has a gap in the middle of the cell c1. Other differences in the fore wing are the presence of a strongly curved vein Cu1b and a cell c1 clearly longer than cell m1. Finally, the antennal segment 3 of the new species is one and a half times longer than segment 4.Se describe una nueva especie del género fósil Otroacizzia Klimaszewski, 1996 (Hemiptera, Psyllidae a partir de un ejemplar hembra: Otroacizzia soriae sp. nov. Esta especie está conservada en ámbar del Mioceno medio de las minas de La Toca en República Dominicana. Con cuatro especies conocidas, el género Otroacizzia es el género de psiloideo con mayor diversidad en el ámbar dominicano. La nueva especie difiere de las tres especies ya conocidas por la presencia de una banda oscura subapical en el ala anterior desde la parte anterior del final de la vena Rs hasta el final de la vena Cu1b, la cual presenta una discontinuidad en el medio de la celda c1. Otras diferencias en el ala anterior son la presencia de una vena Cu1b fuertemente curvada y una celda c1 claramente más larga que la celda m1. Finalmente, el tercer segmento antenal de la nueva especie es una vez y media más largo que el cuarto segmento.

  10. Organization of the mitochondrial genomes of whiteflies, aphids, and psyllids (Hemiptera, Sternorrhyncha

    Directory of Open Access Journals (Sweden)

    Baumann Paul


    Full Text Available Abstract Background With some exceptions, mitochondria within the class Insecta have the same gene content, and generally, a similar gene order allowing the proposal of an ancestral gene order. The principal exceptions are several orders within the Hemipteroid assemblage including the order Thysanoptera, a sister group of the order Hemiptera. Within the Hemiptera, there are available a number of completely sequenced mitochondrial genomes that have a gene order similar to that of the proposed ancestor. None, however, are available from the suborder Sternorryncha that includes whiteflies, psyllids and aphids. Results We have determined the complete nucleotide sequence of the mitochondrial genomes of six species of whiteflies, one psyllid and one aphid. Two species of whiteflies, one psyllid and one aphid have mitochondrial genomes with a gene order very similar to that of the proposed insect ancestor. The remaining four species of whiteflies had variations in the gene order. In all cases, there was the excision of a DNA fragment encoding for cytochrome oxidase subunit III(COIII-tRNAgly-NADH dehydrogenase subunit 3(ND3-tRNAala-tRNAarg-tRNAasn from the ancestral position between genes for ATP synthase subunit 6 and NADH dehydrogenase subunit 5. Based on the position in which all or part of this fragment was inserted, the mitochondria could be subdivided into four different gene arrangement types. PCR amplification spanning from COIII to genes outside the inserted region and sequence determination of the resulting fragments, indicated that different whitefly species could be placed into one of these arrangement types. A phylogenetic analysis of 19 whitefly species based on genes for mitochondrial cytochrome b, NADH dehydrogenase subunit 1, and 16S ribosomal DNA as well as cospeciating endosymbiont 16S and 23S ribosomal DNA indicated a clustering of species that corresponded to the gene arrangement types. Conclusions In whiteflies, the region of the

  11. Potential of the bean alpha-amylase inhibitor alpha-AI-1 to inhibit alpha-amylase activity in true bugs(Hemiptera) (United States)

    True bugs (Hemiptera) are an important pest complex not controlled by Bt crops. An alternative source of resistance includes inhibitors of digestive enzymes. aAI-1, an a-amylase inhibitor from the common bean, has been shown to inhibit a-amylases of bruchid pests of grain legumes. Here we quantify t...

  12. Preliminary evaluation of Delphastus catalinae (Coleoptera:Coccinellidae)as a predator of the ficus whitefly, Singhiella simplex (Singh) (Hemiptera:Aleyrodidae) (United States)

    The predatory lady beetle Delphastus catalinae (Horn) (Coleoptera: Coccinellidae) was evaluated as a potential biological control agent against the ficus whitefly, Singhiella simplex (Singh) (Hemiptera: Aleyrodidae), a newly-invasive pest of ficus plants. Adult D. catalinae females were starved for ...

  13. Characterization of a recombinant Cathepsin B-Like cysteine peptidase from Diaphorina citri Kuwayama (Hemiptera: Liviidae): A putative target control of citrus huanglongbing (United States)

    Huanglongbing (HLB) is one of the most destructive disease affecting citrus plants. The causal agent is associated with the phloem-limited bacterium Candidatus Liberibacter asiaticus (CLas) spread by the Asian citrus psyllid, Diaphorina citri (Hemiptera: Liviidae). Among the control strategies for H...

  14. Pre shipping dip treatments using soap, natural oils, and Isaria fumosorosea: potential biopesticides for mitigating the spread of whitefly Bemisia tabaci (Hemiptera: Aleyrodidae) invasive insects on ornamental plants (United States)

    The whitefly Bemisia tabaci (Hemiptera: Aleyodidae) is an invasive insect pest affecting different crops including vegetables, fruits, cereals, and ornamentals. The efficacy of some products such as commercial soap, natural oils and Preferal® (based on the entomopathogenic fungus Isaria fumosorosea ...

  15. Use of the entomopathogenic fungi Metarhizium anisopliae, Cordyceps bassiana and Isaria fumosorosea to control Diaphorina citri (Hemiptera: Psylidae) in Persian lime under field conditions (United States)

    The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Psyllidae), is a destructive insect pest in the citriculture, because it is an efficient vector of the proteobacteria, ‘Candidatus Liberibacter asiaticus’ (Las), ‘Ca. L. Africanus’ (Laf), and ‘Ca. L. Americanus’ (Lam). These bacteria c...

  16. Identification of Bloodmeal Sources and Trypanosoma cruzi Infection in Triatomine Bugs (Hemiptera: Reduviidae) From Residential Settings in Texas, the United States


    Kjos, Sonia A.; Marcet, Paula L.; Yabsley, Michael J.; KITRON, URIEL; Snowden, Karen F.; LOGAN, KATHLEEN S.; Barnes, John C.; Dotson, Ellen M.


    The host–vector–parasite interactions in Chagas disease peridomestic transmission cycles in the United States are not yet well understood. Trypanosoma cruzi (Kinetoplastida: Trypanosomatidae) infection prevalence and bloodmeal sources were determined for adult and immature triatomine (Hemiptera: Reduviidae) specimens collected from residential settings in central Texas. Sequenced cytochrome b DNA segments obtained from triatomine digestive tract identified nine vertebrate hosts and one invert...

  17. A review of the Oriental genus Eudeferunda Chen, Yang & Wilson (Hemiptera, Fulgoromorpha, Achilidae with description of one new species from Hainan, China

    Directory of Open Access Journals (Sweden)

    Jian-Kun Long


    Full Text Available A new species of Eudeferunda Chen, Yang & Wilson, 1989 (Hemiptera: Fulgoromorpha: Achilidae: Plectoderini, E. alatea Long & Chen sp. n. from Hainan, China, is described and illustrated. The generic characters are modified, including the addition of male genitalia characters. A key to the species of the genus is provided.

  18. A review of the Oriental genus Eudeferunda Chen, Yang & Wilson (Hemiptera, Fulgoromorpha, Achilidae) with description of one new species from Hainan, China


    Jian-Kun Long; Lin Yang; Xiangsheng Chen


    Abstract A new species of Eudeferunda Chen, Yang & Wilson, 1989 (Hemiptera: Fulgoromorpha: Achilidae: Plectoderini), Eudeferunda alatea Long & Chen sp. n. from Hainan, China, is described and illustrated. The generic characters are modified, including the addition of male genitalia characters. A key to the species of the genus is provided.

  19. Assessment of Impact of Insecticides on Anagrus nilaparvatae (Pang et Wang) (Hymenoptera: Mymanidae), an Egg Parasitoid of the Rice Planthopper, Nilaparvata lugens (Hemiptera: Delphacidae) (United States)

    The parasitoid Anagrus Nilaparvatae (Pang et Wang) (Hymenoptera: Mymanidae) is a major natural enemy of the rice planthopper Nilaparvata lugens (Hemiptera: Delphacidae). It plays an important role in the IPM of the rice planthopper. Contact and oral toxicity and residual effect of fourteen pesticide...

  20. Impact of the Arundo scale Rhizaspidiotus donacis (Hemiptera: Diaspididae) on the weight of Arundo donax (Poaceae: Arundinoideae) rhizomes in Languedoc southern France and Mediterranean Spain (United States)

    Arundo donax L. (Poaceae) is native to Mediterranean Europe and invasive in the Rio Grande Basin of North America. Rhizomes from nine sites in France and Spain infested with a candidate control agent, the armoured scale Rhizaspidiotus donacis (Hemiptera: Diaspididae) weighed 50% less than those fro...

  1. Taxonomic revision of the genus Megoura Buckton (Hemiptera : Aphididae) from the Korean Peninsula with the description of a new species and a key to the world species

    Czech Academy of Sciences Publication Activity Database

    Lee, S.; Holman, Jaroslav; Havelka, Jan


    Roč. 104, č. 2 (2002), s. 447-457. ISSN 0013-8797 R&D Projects: GA AV ČR IBS5007102 Institutional research plan: CEZ:AV0Z5007907 Keywords : Hemiptera * Aphididae * Megoura Subject RIV: EG - Zoology Impact factor: 0.392, year: 2002

  2. A revision of the genus Macrosiphoniella del Guercio (Hemiptera: Sternorrhyncha: Aphididae) from the Korean peninsula, part I: Subgenera Asterobium, Chosoniella, Papillomyzus, Phalangomyzus, Sinosiphoniella

    Czech Academy of Sciences Publication Activity Database

    Holman, Jaroslav; Lee, S.; Havelka, Jan


    Roč. 108, č. 1 (2006), s. 174-197. ISSN 0013-8797 R&D Projects: GA AV ČR(CZ) IBS5007102 Institutional research plan: CEZ:AV0Z5007907 Keywords : Hemiptera * Aphididae * Macrosiphoniella Subject RIV: EG - Zoology Impact factor: 0.394, year: 2006

  3. Characterization of EPG waveforms for the tea green leafhopper, Empoasca vitis Göthe (Hemiptera: Cicadellidae), on tea plants and their correlation with stylet activities (United States)

    Stylet probing activities of the tea green leafhopper, Empoasca vitis Göthe (Hemiptera: Cicadellidae), were studied using the DC electrical penetration graph (EPG) technique. Seven different EPG waveforms (i.e., Np, E1, E2, E3, E4, E5 and E6) were identified and characterized on susceptible tea leav...

  4. Mirideos neotropicais, CCLXXII: descrições de sete espécies novas da tribo Resthenini Reuter (Hemiptera)


    José C.M. Carvalho; Diego L. Carpintero


    Os autores descrevem sete espécies novas da tribo Resthenini Reuter (Hemiptera, Miridae, coligidos nas repúblicas da Argentina e do Chile, como segue: Nanniresthenia penai, sp. n, Chile; N. cordobensis, sp. it, Argentina, Platytylus saltensis, sp. n., Argentina; Prepops correntinoides, sp. n., Argentina; P. entrerianus, sp. n., Argentina; P. iguazuensis, sp. n., Argentina; P. oranensis, sp. n., Argentina. Ilustrações de corpo inteiro e genitália do macho acham-se incluídas.The authors describ...

  5. Nuevo registro de greenidea ficicola takahashi (hemiptera: sternorrhyncha:aphididae) en guayabo psidium guajava (myrtaceae) en antioquia, colombia.


    David Giraldo, Rubén Darío; Quiroz Gamboa, Jhon Albeiro; Yepes Rodríguez, Francisco; SmithPardo, Allan Henry


    Se encuentra por primera vez en el departamento de Antioquia (Colombia) y asociado al guayabo (Psidium guajava L.), la especie Greenidea ficicola Takahashi ( Hemiptera: Sternorrhyncha: Aphididae) colectada durante muestreos intensivos realizados durante el primer semestre de 2008 en el Valle de Aburrá y municipios aledaños. Dicha especie de áfido también fue colectada en falso laurel (Ficus benjamina). Dada la importancia que tienen los frutos de guayabo en la alimentación humana y de los ...

  6. Identification of defensive compounds in metathoracic glands of adults of the stink bug Dichelops melacanthus (Hemiptera: Pentatomidae)

    Energy Technology Data Exchange (ETDEWEB)

    Marques, Francisco A.; Wendler, Edison P.; Maia, Beatriz Helena L.N. Sales [Universidade Federal do Parana (UFPR), Curitiba, PR (Brazil). Dept. de Quimica]. E-mail:; Ventura, Mauricio U.; Arruda-Gatti, Iara Cintra [Universidade Estadual de Londrina (UEL), PR (Brazil). Centro de Ciencias Agrarias. Dept. de Agronomia


    The contents of metathoracic glands of adults of the stink bug Dichelops melacanthus (Hemiptera: Pentatomidae) were analyzed. Compounds were identified by gas chromatography (GC), coupled GC-mass spectrometry and matching retention indices and mass spectra with those of authentic samples. Tridecane was the major component followed by lesser and approximately equal amounts of (E)-4-oxo-2-hexenal and (E)-2-octenal. Other compounds identified include (E)-2-hexenal, decane, (E)-2-hexenyl acetate, undecane, (E)-4-oxo-2-octenal, dodecane, (E)-2-octenyl acetate, 1-tridecene, tetradecane and pentadecane. (author)

  7. Effect of Mineral Oil on Host Selection and Control of Diaphorina citri Kuwayama (Hemiptera: Psillidae) on Citrus


    M.P. Miranda; Micelli, M. L.; Felippe, M. R.; Caldeira, R. E.; Yamamoto, P. T.


    This research was carried out to study the influence of mineral oil on landing and permanence; oviposition; and mortality of Diaphorina citri Kuwayama (Hemiptera: Psyllidae) on citrus plants. For all experiments, mineral oil (Argenfrut®) was sprayed on sweet orange plants at 1% concentration. Landing-permanence and oviposition were assessed using choice and non-choice tests. For the first parameter, 50 adult psyllids were released in the center of the screen house (5mx2.5mx2m) (n = 10) and th...

  8. A two-in-one superhydrophobic and anti-reflective nanodevice in the grey cicada Cicada orni (Hemiptera)

    Energy Technology Data Exchange (ETDEWEB)

    Dellieu, Louis, E-mail:; Sarrazin, Michaël, E-mail:; Simonis, Priscilla; Deparis, Olivier; Vigneron, Jean Pol [Research Center in Physics of Matter and Radiation (PMR), Department of Physics, University of Namur (FUNDP), 61 rue de Bruxelles, B-5000 Namur (Belgium)


    Two separated levels of functionality are identified in the nanostructure which covers the wings of the grey cicada Cicada orni (Hemiptera). The upper level is responsible for superhydrophobic character of the wing, while the lower level enhances its anti-reflective behavior. Extensive wetting experiments with various chemical species and optical measurements were performed in order to assess the bi-functionality. Scanning electron microscopy imaging was used to identify the nanostructure morphology. Numerical optical simulations and analytical wetting models were used to prove the roles of both levels of the nanostructure. In addition, the complex refractive index of the chitinous material of the wing was determined from measurements.

  9. A two-in-one superhydrophobic and anti-reflective nanodevice in the grey cicada $\\textit{Cicada orni}$ (Hemiptera)

    CERN Document Server

    Dellieu, Louis; Simonis, Priscilla; Deparis, Olivier; Vigneron, Jean Pol


    Two separated levels of functionality are identified in the nanostructure which covers the wings of the grey cicada $\\textit{Cicada orni}$ (Hemiptera). The upper level is responsible for superhydrophobic character of the wing while the lower level enhances its anti-reflective behavior. Extensive wetting experiments with various chemical species and optical measurements were performed in order to assess the bi-functionality. Scanning electron microscopy imaging was used to identify the nanostructure morphology. Numerical optical simulations and analytical wetting models were used to prove the roles of both levels of the nanostructure. In addition, the complex refractive index of the chitinous material of the wing was determined from measurements.

  10. Study on species composition of Bemisia tabaci (Gennadius, 1889) (Hemiptera: Aleyrodidae) on cotton in Çukurova plain, Turkey


    KARUT, Kamil; Kaydan,M. Bora; CASTLE, Steven J.; KAZAK, Cengiz; ULUSOY, M. Rifat


    The whitefly Bemisia tabaci (Gennadius, 1889) (Hemiptera: Aleyrodidae) is one of the most important pest species on cotton in the Çukurova Plain as well as in all cotton growing areas of Turkey. Although numerous studies on population dynamics, population development and parasitism were conducted on B. tabaci in the Çukurova Plain, there has been a few studies on the species complex of B. tabaci for this region. The aims of this study were to present genetic polymorphism and species compositi...

  11. Characterization of a rapid, blue light-mediated change in detectable phosphorylation of a plasma membrane protein from etiolated pea (Pisum sativum L. ) seedlings

    Energy Technology Data Exchange (ETDEWEB)

    Short, T.W.; Briggs, W.R. (Stanford Univ., CA (USA))


    When crude microsomal membranes from apical stem segments of etiolated Pisum sativum L. cv Alaska are mixed in vitro with {gamma}-({sup 32}P)ATP, a phosphorylated band of apparent molecular mass 120 kilodaltons can be detected on autoradiographs of sodium dodecyl sulfate electrophoresis gels. If the stem sections are exposed to blue light immediately prior to membrane isolation, this band is not evident. Comparisons of the kinetics, tissue distribution, and dark recovery of the phosphorylation response with those published for blue light mediated phototropism or rapid growth inhibition indicate that the phosphorylation could be linked to one or both of the reactions described. However, the fluence-response relationships for the change in detectable phosphorylation match quite closely those reported for phototropism but not those for growth inhibition. Blue light has also been found to regulate the capacity for in vitro phosphorylation of a second protein. It has an apparent molecular mass of 84 kilodaltons and is localized primarily in basal stem sections.

  12. Electrophysiological and behavioral responses of pea weevil Bruchus pisorum L. (Coleóptera: Bruchidae to volatiles collected from its host Pisum sativum L

    Directory of Open Access Journals (Sweden)

    Ricardo Ceballos


    Full Text Available The pea weevil (Bruchus pisorum L. (Coleóptera: Bruchidae is one of the most damaging pests of pea (Pisum sativum L. We investigated the role of pea volatiles on the electrophysiological and behavioral response of B. pisorum using electroantennography (EAG and olfactometry bioassays. Plant volatiles emitted at different phenological stages were collected in situ by headspace on Porapak Q traps and analyzed through gas chromatography coupled to mass spectrometry (GC-MS. Most abundant volatiles identified in all phenological stages were terpenes and green leaf volatiles. All tested volatile extracts elicited significant EAG responses in both male and female B. pisorum, with females exhibiting a greater response (1.35 mV than males (1.02 mV to pea-pod volatiles. Volatiles from each phenological stage stimulated an attractant behavioral response of both males and females B. pisorum in olfactometer bioassay. A larger attraction of B. pisorum females was observed to volatiles from pods over other phenological stages (P < 0.001. These results suggest the relative importance of volatiles cues from plant mediating host location by B. pisorum. This work showed that plant volatiles elicited electrophysiological and behavioral responses and that B. pisorum female can discern between phenological stages of P. sativum based on those chemical cues.

  13. Characterization of a rapid, blue light-mediated change in detectable phosphorylation of a plasma membrane protein from etiolated pea (Pisum sativum L.) seedlings

    International Nuclear Information System (INIS)

    When crude microsomal membranes from apical stem segments of etiolated Pisum sativum L. cv Alaska are mixed in vitro with γ-[32P]ATP, a phosphorylated band of apparent molecular mass 120 kilodaltons can be detected on autoradiographs of sodium dodecyl sulfate electrophoresis gels. If the stem sections are exposed to blue light immediately prior to membrane isolation, this band is not evident. Comparisons of the kinetics, tissue distribution, and dark recovery of the phosphorylation response with those published for blue light mediated phototropism or rapid growth inhibition indicate that the phosphorylation could be linked to one or both of the reactions described. However, the fluence-response relationships for the change in detectable phosphorylation match quite closely those reported for phototropism but not those for growth inhibition. Blue light has also been found to regulate the capacity for in vitro phosphorylation of a second protein. It has an apparent molecular mass of 84 kilodaltons and is localized primarily in basal stem sections

  14. Iron absorption from experimental infant formulas based on pea (Pisum sativum)-protein isolate: the effect of phytic acid and ascorbic acid. (United States)

    Davidsson, L; Dimitriou, T; Walczyk, T; Hurrell, R F


    Infant formula based on pea (Pisum sativum)-protein isolate has been suggested as an alternative to soybean formula in countries where soybean is not a native crop, or when soybean protein cannot be used due to allergic reactions or intolerances. In the present study, Fe absorption from experimental infant formulas based on pea-protein isolate was measured in healthy non-anaemic young women. The influence of phytic acid and ascorbic acid on Fe absorption was evaluated, using a stable-isotope technique based on incorporation of Fe stable-isotope labels into erythrocytes 14 d after administration. Geometric mean Fe absorption increased from 20.7 (+1 SD 41.6, -1 SD 10.3) % to 33.1 (+1 SD 58.6, -1 SD 18.7) %; (P pea-protein-based formulas. After adjusting for differences in Fe status, our data indicate that Fe absorption from dephytinised pea protein might be less inhibitory than dephytinised soybean protein as measured in a previous study (Hurrell et al. 1998). PMID:11227034

  15. The major nucleoside triphosphatase in pea (Pisum sativum L.) nuclei and in rat liver nuclei share common epitopes also present in nuclear lamins (United States)

    Tong, C. G.; Dauwalder, M.; Clawson, G. A.; Hatem, C. L.; Roux, S. J.


    The major nucleoside triphosphatase (NTPase) activities in mammalian and pea (Pisum sativum L.) nuclei are associated with enzymes that are very similar both biochemically and immunochemically. The major NTPase from rat liver nuclei appears to be a 46-kD enzyme that represents the N-terminal portion of lamins A and C, two lamina proteins that apparently arise from the same gene by alternate splicing. Monoclonal antibody (MAb) G2, raised to human lamin C, both immunoprecipitates the major (47 kD) NTPase in pea nuclei and recognizes it in western blot analyses. A polyclonal antibody preparation raised to the 47-kD pea NTPase (pc480) reacts with the same lamin bands that are recognized by MAb G2 in mammalian nuclei. The pc480 antibodies also bind to the same lamin-like bands in pea nuclear envelope-matrix preparations that are recognized by G2 and three other MAbs known to bind to mammalian lamins. In immunofluorescence assays, pc480 and anti-lamin antibodies stain both cytoplasmic and nuclear antigens in plant cells, with slightly enhanced staining along the periphery of the nuclei. These results indicate that the pea and rat liver NTPases are structurally similar and that, in pea nuclei as in rat liver nuclei, the major NTPase is probably derived from a lamin precursor by proteolysis.

  16. Identification of Phenolic Compounds from Seed Coats of Differently Colored European Varieties of Pea (Pisum sativum L.) and Characterization of Their Antioxidant and In Vitro Anticancer Activities. (United States)

    Stanisavljević, Nemanja S; Ilić, Marija D; Matić, Ivana Z; Jovanović, Živko S; Čupić, Tihomir; Dabić, Dragana Č; Natić, Maja M; Tešić, Živoslav Lj


    To date little has been done on identification of major phenolic compounds responsible for anticancer and antioxidant properties of pea (Pisum sativum L.) seed coat extracts. In the present study, phenolic profile of the seed coat extracts from 10 differently colored European varieties has been determined using ultrahigh-performance liquid chromatography-linear trap quadrupole orbitrap mass spectrometer technique. Extracts of dark colored varieties with high total phenolic content (up to 46.56 mg GAE/g) exhibited strong antioxidant activities (measured by 2,2-diphenyl-1-picrylhydrazyl or DPPH assay, and ferric ion reducing and ferrous ion chelating capacity assays) which could be attributed to presence of gallic acid, epigallocatechin, naringenin, and apigenin. The aqueous extracts of dark colored varieties exert concentration-dependent cytotoxic effects on all tested malignant cell lines (human colon adenocarcinoma LS174, human breast carcinoma MDA-MB-453, human lung carcinoma A594, and myelogenous leukemia K562). Correlation analysis revealed that intensities of cytotoxic activity of the extracts strongly correlated with contents of epigallocatechin and luteolin. Cell cycle analysis on LS174 cells in the presence of caspase-3 inhibitor points out that extracts may activate other cell death modalities besides caspase-3-dependent apoptosis. The study provides evidence that seed coat extracts of dark colored pea varieties might be used as potential cancer-chemopreventive and complementary agents in cancer therapy. PMID:27348025

  17. COCHLEATA controls leaf size and secondary inflorescence architecture via negative regulation of UNIFOLIATA (LEAFY ortholog) gene in garden pea Pisum sativum

    Indian Academy of Sciences (India)

    Vishakha Sharma; Swati Chaudhary; Arvind Kumar; Sushil Kumar


    UNIFOLIATA [(UNI) or UNIFOLIATA-TENDRILLED ACACIA (UNI-TAC)] expression is known to be negatively regulated by COCHLEATA (COCH) in the differentiating stipules and flowers of Pisum sativum. In this study, additional roles of UNI and COCH in P. sativum were investigated. Comparative phenotyping revealed pleiotropic differences between COCH (UNI-TAC and uni-tac) and coch (UNI-TAC and uni-tac) genotypes of common genetic background. Secondary inflorescences were bracteole-less and bracteolated in COCH and coch genotypes, respectively. In comparison to the leaves and corresponding sub-organs and tissues produced on COCH plants, coch plants produced leaves of 1.5-fold higher biomass, 1.5-fold broader petioles and leaflets that were 1.8-fold larger in span and 1.2-fold dorso-ventrally thicker. coch leaflets possessed epidermal cells 1.3-fold larger in number and size, 1.4-fold larger spongy parenchyma cells and primary vascular bundles with 1.2-fold larger diameter . The transcript levels of UNI were at least 2-fold higher in coch leaves and secondary inflorescences than the corresponding COCH organs. It was concluded that COCH negatively regulated UNI in the differentiating leaves and secondary inflorescences and thereby controlled their sizes and/or structures. It was also surmised that COCH and UNI (LFY homolog) occur together widely in stipulate flowering plants.

  18. Discriminant Analysis of Defective and Non-Defective Field Pea (Pisum sativum L.) into Broad Market Grades Based on Digital Image Features (United States)

    McDonald, Linda S.; Panozzo, Joseph F.; Salisbury, Phillip A.; Ford, Rebecca


    Field peas (Pisum sativum L.) are generally traded based on seed appearance, which subjectively defines broad market-grades. In this study, we developed an objective Linear Discriminant Analysis (LDA) model to classify market grades of field peas based on seed colour, shape and size traits extracted from digital images. Seeds were imaged in a high-throughput system consisting of a camera and laser positioned over a conveyor belt. Six colour intensity digital images were captured (under 405, 470, 530, 590, 660 and 850nm light) for each seed, and surface height was measured at each pixel by laser. Colour, shape and size traits were compiled across all seed in each sample to determine the median trait values. Defective and non-defective seed samples were used to calibrate and validate the model. Colour components were sufficient to correctly classify all non-defective seed samples into correct market grades. Defective samples required a combination of colour, shape and size traits to achieve 87% and 77% accuracy in market grade classification of calibration and validation sample-sets respectively. Following these results, we used the same colour, shape and size traits to develop an LDA model which correctly classified over 97% of all validation samples as defective or non-defective. PMID:27176469

  19. Molecular cloning of isoflavone reductase from pea (Pisum sativum L.): evidence for a 3R-isoflavanone intermediate in (+)-pisatin biosynthesis. (United States)

    Paiva, N L; Sun, Y; Dixon, R A; VanEtten, H D; Hrazdina, G


    Isoflavone reductase (IFR) reduces achiral isoflavones to chiral isoflavanones during the biosynthesis of chiral pterocarpan phytoalexins. A cDNA clone for IFR from pea (Pisum sativum) was isolated using the polymerase chain reaction and expressed in Escherichia coli. Analysis of circular dichroism (CD) spectra of the reduction product sophorol obtained using the recombinant enzyme indicated that the isoflavanone possessed the 3R stereochemistry, in contrast to previous reports indicating a 3S-isoflavanone as the product of the pea IFR. Analysis of CD spectra of sophorol produced using enzyme extracts of CuCl2-treated pea seedlings confirmed the 3R stereochemistry. Thus, the stereochemistry of the isoflavanone intermediate in (+)-pisatin biosynthesis in pea is the same as that in (-)-medicarpin biosynthesis in alfalfa, although the final pterocarpans have the opposite stereochemistry. At the amino acid level the pea IFR cDNA was 91.8 and 85.2% identical to the IFRs from alfalfa and chickpea, respectively. IFR appears to be encoded by a single gene in pea. Its transcripts are highly induced in CuCl2-treated seedlings, consistent with the appearance of IFR enzyme activity and pisatin accumulation. PMID:8037464

  20. The involvement of indole-3-acetic acid in the control of stem elongation in dark- and light-grown pea (Pisum sativum) seedlings. (United States)

    Sorce, Carlo; Picciarelli, Piero; Calistri, Gianni; Lercari, Bartolomeo; Ceccarelli, Nello


    We investigated the role of auxin on stem elongation in pea (Pisum sativum L.) grown for 10d in continuous darkness or under low-irradiance blue, red, far red and white light. The third internode of treated seedlings was peeled and the tissues (epidermis and cortex+central cylinder) were separately analyzed for the concentration of free and conjugated indole-3-acetic acid (IAA). Under red, far red and white light internode elongation was linearly related with the free IAA content of all internode tissues, suggesting that phytochrome-dependent inhibition of stem growth may be mediated by a decrease of free IAA levels in pea seedlings. The correlation between IAA and internode elongation, however, did not hold for blue light-grown seedlings. The hypothesis that the growth response under low-irradiance blue light might be correlated with the lack of phytochrome B signalling and changes in gibberellin metabolism is discussed in view of current knowledge on hormonal control of stem growth. PMID:17706834

  1. Molecular basis of processing-induced changes in protein structure in relation to intestinal digestion in yellow and green type pea (Pisum sativum L.): A molecular spectroscopic analysis. (United States)

    Yu, Gloria Qingyu; Warkentin, Tom; Niu, Zhiyuan; Khan, Nazir A; Yu, Peiqiang


    The objectives of this study were (1) to quantify the protein inherent molecular structural features of green cotyledon (CDC Striker) and yellow cotyledon (CDC Meadow) pea (Pisum sativum L.) seeds using molecular spectroscopic technique (FT/IR-ATR); (2) measure the denaturation of protein molecular makeup in the two types of pea during dry roasting (120°C for 60 min), autoclaving (120°C for 60 min) or microwaving (for 5 min); and (3) correlate the heat-induced changes in protein molecular makeup to the corresponding changes in protein digestibility determined using modified three-step in vitro procedure. Compared with yellow-type, the green-type peas had higher (Pyellow-type, the green-type peas had lower (Pyellow (r=0.81) pea-types. However, across the pea types the correlation was not significant. Principal component and hierarchical cluster analyses on the entire spectral data from the amide region (ca. 1727-1480 cm(-1)) were able to visualize and discriminate the structural difference between pea varieties and processing treatments. This study shows that the molecular spectroscopy can be used as a rapid tool to screen the protein value of raw and heat-treated peas. PMID:26188704

  2. Alteration of gene expression in Pisum sativum tissue cultures caused by the free radical-generating agent 2,2`-azobis (2-amidinipropane) dihydrochloride

    Energy Technology Data Exchange (ETDEWEB)

    Henkow, L. [Sveriges Lantbruksuniv., Inst. foer Vaextfoeraedling, Uppsala (Sweden); Strid, Aa.; Rydstroem, J. [Goeteborgs Univ. och Chalmers Tekniska Hoegskola, Inst. foer Biokemi och Biofysik, Goeteborg (Sweden); Berglund, T.; Ohlsson, A.B. [Kungliga Tekniska Hoegskolan, Inst. foer Biokemi och biokemisk Teknologi, Stockholm (Sweden)


    Root-differentiated tissue cultures (PS-R) from Pisum sativum (cv. Greenfeast) were exposed to a 5 mM solution of the free radical-generating compound 2,2`-azobis (2-amidinopropane) dihydrochloride (AAPH). The levels of mRNA transcripts for two genes were examined: chs2, encoding a chalcone synthase isozyme, and cab, encoding the chlorophyll a/b-binding protein of the light-harvesting antenna complex. In light-grown PS-R, cab mRNA transcript levels decreased to 14% of controls after 6 h of exposure, whereas chs2 mRNA levels increased 50-fold. In dark-grown PS-R, chs2 mRNA transcripts increased by 40-fold compared with the controls. Glutathione determination inlight-grown PS-R showed no substantial difference in total glutathione (GSH{sub tot}), whereas oxidized glutathione (GSSG) increased by 66% after 12 h of exposure. However, in dark-grown PS-R a decrease in both GSH{sub tot} and GSSG after 6 h was followed by an increase of about 70%, as compared with the controls, after 12 h of exposure. In conclusion AAPH generated oxidative stress, reflected in changed glutathione levels and induced expression of the chs2 gene of the flavonoid biosynthetic pathway and also caused a decreased level of mRNA for the photosynthetic cab gene. (au) 39 refs.

  3. Energy storage and synchronisation of hind leg movements during jumping in planthopper insects (Hemiptera, Issidae). (United States)

    Burrows, M


    The hind legs of Issus (Hemiptera, Issidae) move in the same plane underneath the body, an arrangement that means they must also move synchronously to power jumping. Moreover, they move so quickly that energy must be stored before a jump and then released suddenly. High speed imaging and analysis of the mechanics of the proximal joints of the hind legs show that mechanical mechanisms ensure both synchrony of movements and energy storage. The hind trochantera move first in jumping and are synchronised to within 30 micros. Synchrony is achieved by mechanical interactions between small protrusions from each trochantera which fluoresce bright blue under specific wavelengths of ultra-violet light and which touch at the midline when the legs are cocked before a jump. In dead Issus, a depression force applied to a cocked hind leg, or to the tendon of its trochanteral depressor muscle causes a simultaneous depression of both hind legs. The protrusion of the hind leg that moves first nudges the other hind leg so that both move synchronously. Contractions of the trochanteral depressor muscles that precede a jump bend the metathoracic pleural arches of the internal skeleton. Large areas of these bow-shaped structures fluoresce bright blue in ultraviolet light, and the intensity of this fluorescence depends on the pH of the bathing saline. These are key signatures of the rubber-like protein resilin. The remainder of a pleural arch consists of stiff cuticle. Bending these composite structures stores energy and their recoil powers jumping. PMID:20086132

  4. Trap Cropping Systems and a Physical Barrier for Suppression of Stink Bugs (Hemiptera: Pentatomidae) in Cotton. (United States)

    Tillman, P G; Khrimian, A; Cottrell, T E; Lou, X; Mizell, R F; Johnson, C J


    Euschistus servus (Say), Nezara viridula (L.), and Chinavia hilaris (Say) (Hemiptera: Pentatomidae) are economic pests of cotton in the coastal plain of the southeastern United States. The objective of this 2-yr study was to determine the ability of trap cropping systems, pheromone-baited stink bug traps, and a synthetic physical barrier at the peanut-to-cotton interface to manage stink bugs in cotton. The physical barrier was the most effective management tactic. Stink bug density in cotton was lowest for this treatment. In 2010, boll injury was lower for the physical barrier compared to the other treatments except for soybean with stink bug traps. In 2011, boll injury was lower for this treatment compared to the control. Soybean was an effective trap crop, reducing both stink bug density in cotton and boll injury regardless if used alone or in combination with either stink bug traps or buckwheat. Incorporation of buckwheat in soybean enhanced parasitism of E. servus egg masses by Telenomus podisi Ashmead in cotton. The insertion of eyelets in the lid of the insect-collecting device of a stink bug trap allowed adult stink bug parasitoids, but not E. servus, to escape. Stand-alone stink bug traps were not very effective in deterring colonization of cotton by stink bugs or reducing boll injury. The paucity of effective alternative control measures available for stink bug management justifies further full-scale evaluations into these management tactics for control of these pests in crops. PMID:26453721

  5. Morphometric comparisons of Diaphorina citri (Hemiptera: Liviidae) populations from Iran, USA and Pakistan. (United States)

    Lashkari, Mohammadreza; Hentz, Matthew G; Boykin, Laura M


    The Asian citrus psyllid (ACP), Diaphorina citri Kuwayama (Hemiptera: Liviidae), vector of citrus greening disease pathogen, Huanglongbing (HLB), is considered the most serious pest of citrus in the world. Prior molecular based studies have hypothesized a link between the D. citri in Iran and the USA (Florida). The purpose of this study was to collect morphometric data from D. citri populations from Iran (mtCOI haplotype-1), Florida (mtCOI haplotype-1), and Pakistan (mtCOI haplotype-6), to determine whether different mtCOI haplotypes have a relationship to a specific morphometric variation. 240 samples from 6 ACP populations (Iran-Jiroft, Chabahar; Florida-Ft. Pierce, Palm Beach Gardens, Port St. Lucie; and Pakistan-Punjab) were collected for comparison. Measurements of 20 morphological characters were selected, measured and analysed using ANOVA and MANOVA. The results indicate differences among the 6 ACP populations (Wilks' lambda = 0.0376, F = 7.29, P < 0.0001). The body length (BL), circumanal ring length (CL), antenna length (AL), forewing length (WL) and Rs vein length of forewing (RL) were the most important characters separating the populations. The cluster analysis showed that the Iran and Florida populations are distinct from each other but separate from the Pakistan population. Thus, three subgroups can be morphologically discriminated within D. citri species in this study, (1) Iran, (2) USA (Florida) and (3) Pakistan population. Morphometric comparisons provided further resolution to the mtCOI haplotypes and distinguished the Florida and Iranian populations. PMID:26038715

  6. Species clarification of Isaria isolates used as biocontrol agents against Diaphorina citri (Hemiptera: Liviidae) in Mexico. (United States)

    Gallou, Adrien; Serna-Domínguez, María G; Berlanga-Padilla, Angélica M; Ayala-Zermeño, Miguel A; Mellín-Rosas, Marco A; Montesinos-Matías, Roberto; Arredondo-Bernal, Hugo C


    Entomopathogenic fungi belonging to the genus Isaria (Hypocreales: Cordycipitaceae) are promising candidates for microbial control of insect pests. Currently, the Mexican government is developing a biological control program based on extensive application of Isaria isolates against Diaphorina citri (Hemiptera: Liviidae), a vector of citrus huanglongbing disease. Previous research identified three promising Isaria isolates (CHE-CNRCB 303, 305, and 307; tentatively identified as Isaria fumosorosea) from Mexico. The goal of this work was to obtain a complete morphological and molecular characterization of these isolates. Comparative analysis of morphology established that the isolates showed similar characteristics to Isaria javanica. Multi-gene analysis confirmed the morphological identification by including the three isolates within the I. javanica clade. Additionally, this work demonstrated the misidentifications of three other Isaria isolates (CHE-CNRCB 310 and 324: I. javanica, formerly I. fumosorosea; CHE-CNRCB 393: I. fumosorosea, formerly Isaria farinosa), underlying the need for a full and correct characterization of an isolate before developing a biological control program. Finally, the inter-simple sequence repeat (ISSR) genotyping method revealed that the CHE-CNRCB 303, 305, and 307 isolates belong to three different genotypes. This result indicates that ISSR markers could be used as a tool to monitor their presence in field conditions. PMID:26895870

  7. Exposure to Guava Affects Citrus Olfactory Cues and Attractiveness to Diaphorina citri (Hemiptera: Psyllidae). (United States)

    Barman, Jagadish Chandra; Campbell, Stuart A; Zeng, Xinnian


    Intercropping can reduce agricultural pest incidence, and represents an important sustainable alternative to conventional pest control methods. Understanding the ecological mechanisms for intercropping could help optimize its use, particularly in tropical systems which present a large number of intercropping possibilities. Citrus is threatened worldwide by greening disease (huanglongbing, HLB) vectored by the Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Psyllidae). Control of HLB and citrus psyllid can be partially achieved through intercropping with guava, Psidium guajava L., but the mechanisms remain unclear. We tested the hypothesis that guava olfactory cues affect psyllid behavior by altering the attractiveness of citrus through plant-plant interactions. In choice and no-choice cage experiments, psyllid settlement was reduced on citrus shoots that had been exposed to guava shoot odors for at least 2 h. In Y-tube olfactometer experiments, psyllids oriented to odors of unexposed, compared with guava-exposed, citrus shoots. These behavioral results indicate that a mechanism for the success of guava intercropping for sustainable, ecological disease management may be the indirect effect of guava on citrus attractiveness. PMID:27247354

  8. The genus Lycoderides Sakakibara, stat. nov., its composition and descriptions of new species (Hemiptera, Membracidae, Stegaspidinae

    Directory of Open Access Journals (Sweden)

    Albino M. Sakakibara


    Full Text Available The genus Lycoderides Sakakibara, stat. nov. , its composition and descriptions of new species (Hemiptera, Membracidae, Stegaspidinae.The subgenus Lycoderes (Lycoderides Sakakibara, 1972 is raised to the genus category - Lycoderides stat. nov.. - : and it now includes: Lycoderides amazonicus (Sakakibara, 1991, comb. nov. , Lycoderides brevilobus (Sakakibara, 1972, comb. nov. , Lycoderides burmeisteri (Fairmaire, 1846, comb. nov. , Lycoderides cultratus (Sakakibara, 1991, comb. nov. , Lycoderides fernandezi (Strümpel, 1988, comb. nov. , Lycoderides fuscus (Amyot & Serville, 1843, comb. nov. , Lycoderides gradatus (Sakakibara, 1972, comb. nov. , Lycoderides hippocampus (Fabricius, 1803, comb. nov. , Lycoderides luteus (Funkhouser, 1940, comb. nov. , Lycoderides marginalis (Walker, 1851, comb. nov. , Lycoderides nathanieli (Cryan, 1999, comb. nov. , Lycoderides obtusus (Sakakibara, 1991, comb. nov. , Lycoderides pennyi (Sakakibara, 1991, comb. nov. , Lycoderides phasianus (Fowler, 1896, comb. nov. (= Enchenopa minamen Buckton, 1901,SYN. NOV: , Lycoderides protensus (Sakakibara, 1991, comb. nov. , Lycoderides serraticornis (Fowler, 1896, comb. nov. , and Lycoderides strumpeli (Sakakibara, 1991, comb. nov. The following new species are described: Lycoderides abditus, sp. nov. , Lycoderides brulei,SP. NOV. (: both from French Guiana, Lycoderides capixaba, sp. nov. (from Brazil, Espírito Santo, Lycoderides cavichiolii, sp. nov. (from Brazil, Rio de Janeiro, Lycoderides meloi, sp. nov. (from Brazil, Bahia, and Lycoderides oliviae, sp. nov. (from Brazil, Minas Gerais. Other nomenclatural change: Stegaspis bracteata (Fabricius, 1787 = Lycoderes capitata Buckton, 1903, syn. nov. New records of geographical distribution and a key to the species are provided.

  9. Molecular and morphological identification of mealybug species (Hemiptera: Pseudococcidae in Brazilian vineyards.

    Directory of Open Access Journals (Sweden)

    Vitor C Pacheco da Silva

    Full Text Available Mealybugs (Hemiptera: Pseudococcidae are pests constraining the international trade of Brazilian table grapes. They damage grapes by transmitting viruses and toxins, causing defoliation, chlorosis, and vigor losses and favoring the development of sooty mold. Difficulties in mealybug identification remain an obstacle to the adequate management of these pests. In this study, our primary aim was to identify the principal mealybug species infesting the major table grape-producing regions in Brazil, by morphological and molecular characterization. Our secondary aim was to develop a rapid identification kit based on species-specific Polymerase Chain Reactions, to facilitate the routine identification of the most common pest species. We surveyed 40 sites infested with mealybugs and identified 17 species: Dysmicoccus brevipes (Cockerell, Dysmicoccus sylvarum Williams and Granara de Willink, Dysmicoccus texensis (Tinsley, Ferrisia cristinae Kaydan and Gullan, Ferrisia meridionalis Williams, Ferrisia terani Williams and Granara de Willink, Phenacoccus baccharidis Williams, Phenacoccus parvus Morrison, Phenacoccus solenopsis Tinsley, Planococcus citri (Risso, Pseudococcus viburni (Signoret, Pseudococcus cryptus Hempel, four taxa closely related each of to Pseudococcus viburni, Pseudococcus sociabilis Hambleton, Pseudococcus maritimus (Ehrhorn and Pseudococcus meridionalis Prado, and one specimen from the genus Pseudococcus Westwood. The PCR method developed effectively identified five mealybug species of economic interest on grape in Brazil: D. brevipes, Pl. citri, Ps. viburni, Ph. solenopsis and Planococcus ficus (Signoret. Nevertheless, it is not possible to assure that this procedure is reliable for taxa that have not been sampled already and might be very closely related to the target species.

  10. Molecular and morphological identification of mealybug species (Hemiptera: Pseudococcidae) in Brazilian vineyards. (United States)

    Pacheco da Silva, Vitor C; Bertin, Aline; Blin, Aurélie; Germain, Jean-François; Bernardi, Daniel; Rignol, Guylène; Botton, Marcos; Malausa, Thibaut


    Mealybugs (Hemiptera: Pseudococcidae) are pests constraining the international trade of Brazilian table grapes. They damage grapes by transmitting viruses and toxins, causing defoliation, chlorosis, and vigor losses and favoring the development of sooty mold. Difficulties in mealybug identification remain an obstacle to the adequate management of these pests. In this study, our primary aim was to identify the principal mealybug species infesting the major table grape-producing regions in Brazil, by morphological and molecular characterization. Our secondary aim was to develop a rapid identification kit based on species-specific Polymerase Chain Reactions, to facilitate the routine identification of the most common pest species. We surveyed 40 sites infested with mealybugs and identified 17 species: Dysmicoccus brevipes (Cockerell), Dysmicoccus sylvarum Williams and Granara de Willink, Dysmicoccus texensis (Tinsley), Ferrisia cristinae Kaydan and Gullan, Ferrisia meridionalis Williams, Ferrisia terani Williams and Granara de Willink, Phenacoccus baccharidis Williams, Phenacoccus parvus Morrison, Phenacoccus solenopsis Tinsley, Planococcus citri (Risso), Pseudococcus viburni (Signoret), Pseudococcus cryptus Hempel, four taxa closely related each of to Pseudococcus viburni, Pseudococcus sociabilis Hambleton, Pseudococcus maritimus (Ehrhorn) and Pseudococcus meridionalis Prado, and one specimen from the genus Pseudococcus Westwood. The PCR method developed effectively identified five mealybug species of economic interest on grape in Brazil: D. brevipes, Pl. citri, Ps. viburni, Ph. solenopsis and Planococcus ficus (Signoret). Nevertheless, it is not possible to assure that this procedure is reliable for taxa that have not been sampled already and might be very closely related to the target species. PMID:25062012

  11. The foraging behavior of Diaeretiella rapae (Hymenoptera: Braconidae on Diuraphis noxia (Hemiptera: Aphididae

    Directory of Open Access Journals (Sweden)

    Tazerouni Zahra


    Full Text Available Host stage preference, functional response and mutual interference of Diaeretiella rapae (McIntosh (Hymenoptera: Braconidae: Aphidiinae on Diuraphis noxia (Mordvilko (Hemiptera: Aphididae were investigated under defined laboratory conditions (20±1°C; 60±5% relative humidity; 16 h light/8 h dark photoperiod. Nicholson’s model and linear regression were used to determine per capita search-efficiency and the interference coefficient, respectively. There was a significant difference between the rates of parasitism on different stages of D. noxia. The highest parasitism percentage was observed on the third instar nymphs of D. noxia in both choice and no-choice preference tests. Results of logistic regression revealed a type II functional response. The estimated values of search-efficiency (a and handling time (Th were 0.072 h-1 and 0.723 h, respectively. The maximum attack rate was calculated to be 33.22. The per capita search-efficiency decreased from 0.011 to 0.004 (h-1 as parasitoid densities increased from 1 to 8. Therefore, different host-parasitoid ratios can affect the efficacy of D. rapae.

  12. Effects of gamma irradiation on different stages of mealybug Dysmicoccus neobrevipes (Hemiptera: Pseudococcidae)

    Energy Technology Data Exchange (ETDEWEB)

    The, Doan Thi, E-mail: [Research and Development Center for Radiation Technology, Vietnam Atomic Energy Institute, 202A Street 11, Linh Xuan Ward, Thu Duc District, Ho Chi Minh City (Viet Nam); Khanh, Nguyen Thuy; Lang, Vo Thi Kim; Van Chung, Cao [Research and Development Center for Radiation Technology, Vietnam Atomic Energy Institute, 202A Street 11, Linh Xuan Ward, Thu Duc District, Ho Chi Minh City (Viet Nam); An, Tran Thi Thien; Thi, Nguyen Hoang Hanh [Agriculture and Forestry University, Linh Trung Ward, Thu Duc District, Ho Chi Minh City (Viet Nam)


    Utilization of phytosanitary irradiation as a potential treatment to disinfest agricultural commodities in trade has expanded rapidly in the recent years. Cobalt-60 gamma ray target doses of 100, 150, 200 and 250 Gy were used to irradiate immatures and adults of Dysmicoccus neobrevipes (Beardsley) (Hemiptera: Pseudococcidae) infesting dragon fruits to find the most tolerant stage and the most optimal dose range for quarantine treatment. In general, irradiation affected significantly all life stages of D. neobrevipes mortality and adult reproduction. The pattern of tolerance to irradiation in D. neobrevipes was 1st instars<2nd instars<3rd instars Gamma Co-60 irradiation as a potential phytosanitary for quarantine treatments. > Reproduction ability of D. neobrevipes has been efficiently inhibited at low dose. > Pattern of tolerance to irradiation was 1st<2nd<3rd instars Doses from 200 to 250 Gy could be efficient to prevent the reproduction of mealybug.

  13. The cuticular hydrocarbons of the Triatoma sordida species subcomplex (Hemiptera: Reduviidae

    Directory of Open Access Journals (Sweden)

    Gustavo Mario Calderon-Fernandez


    Full Text Available The cuticular hydrocarbons of the Triatoma sordida subcomplex (Hemiptera: Reduviidae: Triatominae were ana-lysed by gas chromatography and their structures identified by mass spectrometry. They comprised mostly n-alkanes and methyl-branched alkanes with one-four methyl substitutions. n-alkanes consisted of a homologous series from C21-C33 and represented 33-45% of the hydrocarbon fraction; n-C29 was the major component. Methyl-branched alkanes showed alkyl chains from C24-C43. High molecular weight dimethyl and trimethylalkanes (from C35-C39 represented most of the methyl-branched fraction. A few tetramethylalkanes were also detected, comprising mostly even-numbered chains. Several components such as odd-numbered 3-methylalkanes, dimethylalkanes and trimethylalkanes of C37 and C39 showed patterns of variation that allowed the differentiation of the species and populations studied. Triatoma guasayana and Triatoma patagonica showed the most distinct hydrocarbon patterns within the subcomplex. The T. sordida populations from Brazil and Argentina showed significantly different hydrocarbon profiles that posed concerns regarding the homogeneity of the species. Triatoma garciabesi had a more complex hydrocarbon pattern, but it shared some similarity with T. sordida. The quantitative and qualitative variations in the cuticular hydrocarbons may help to elucidate the relationships between species and populations of this insect group.

  14. The Complete Mitochondrial Genome of Mindarus keteleerifoliae (Insecta: Hemiptera: Aphididae and Comparison with Other Aphididae Insects

    Directory of Open Access Journals (Sweden)

    Yuan Wang


    Full Text Available The mitogenome of Mindarus keteleerifoliae Zhang (Hemiptera: Aphididae is a 15,199 bp circular molecule. The gene order and orientation of M. keteleerifoliae is similarly arranged to that of the ancestral insect of other aphid mitogenomes, and, a tRNA isomerism event maybe identified in the mitogenome of M. keteleerifoliae. The tRNA-Trp gene is coded in the J-strand and the same sequence in the N-strand codes for the tRNA-Ser gene. A similar phenomenon was also found in the mitogenome of Eriosoma lanigerum. However, whether tRNA isomers in aphids exist requires further study. Phylogenetic analyses, using all available protein-coding genes, support Mindarinae as the basal position of Aphididae. Two tribes of Aphidinae were recovered with high statistical significance. Characteristics of the M. keteleerifoliae mitogenome revealed distinct mitogenome structures and provided abundant phylogenetic signals, thus advancing our understanding of insect mitogenomic architecture and evolution. But, because only eight complete aphid mitogenomes, including M. keteleerifoliae, were published, future studies with larger taxon sampling sizes are necessary.

  15. Spatial Distribution of Adults of Triozoida limbata (Enderlein) (Hemiptera: Triozidae) in Guava Plants. (United States)

    Marcelino, M C S; Barbosa, J C


    The psyllid Triozoida limbata (Enderlein) (Hemiptera: Triozidae) is a major pest in guava, feeding primarily on new shoots. Despite its importance, there are no studies on the spatial distribution of T. limbata on guava. Such studies are needed to establish sequential sampling plans for decision making in pest control. Thus, an experiment was carried out in a 9-year-old commercial guava orchard divided into 100 sampling units or plots. Double-sided yellow sticky traps were placed on one plant per plot (sample unit) to capture and monitor T. limbata adults from April 2011 to May 2012. To determine the insect distribution in the area, we calculated the variance-to-mean ratio index (I), the Morisita index (I δ ), Green's coefficient (Cx), and the k exponent of the negative binomial distribution. Most of the samples showed that the adults had a moderate to highly aggregated distribution. Statistical models were also used to study the pest spatial distribution by fitting the number of adults captured to the Poisson and negative binomial distributions. The negative binomial distribution model best fitted the data of the number of adult psyllids captured by the traps, which is consistent with an aggregated distribution. PMID:26597967

  16. Vineyard Colonization by Hyalesthes obsoletus (Hemiptera: Cixiidae) Induced by Stinging Nettle Cut Along Surrounding Ditches. (United States)

    Mori, N; Pozzebon, A; Duso, C; Reggiani, N; Pavan, F


    Stinging nettle (Urtica dioica L.) is the most important host plant for both phytoplasma associated with Bois noir disease of the grapevine and its vector Hyalesthes obsoletus Signoret (Hemiptera: Cixiidae). Vector abundance in vineyards is favored by stinging nettle growing in surrounding areas. Nettle control by herbicides or cutting can reduce vector population in vineyards. However, chemical weeding can cause environmental problems. Many authors suggest that stinging nettle control applied during H. obsoletus flight could force adults to migrate into vineyards. We evaluate if cutting of nettle growing along ditches during adult flight favors vineyard colonization by H. obsoletus. Three different weed management regimes ("no cuts," "one cut" just before the beginning of adult flight, and "frequent cuts" over the whole vegetative season) were applied to the herbaceous vegetation in ditches bordering two vineyards. The flight dynamics of H. obsoletus were recorded by placing yellow sticky traps on the vegetation along the ditches and at different positions in the vineyards. Frequent stinging nettle cuts (compared with a single cut) in surrounding areas favored the dispersion of vectors inside the vineyards. Stinging nettle control should be based on an integration of a single herbicide application before H. obsoletus emergence followed by frequent cuts to minimize negative side effects of chemical weeding. In organic viticulture, a frequent-cuts strategy should avoid cuts during H. obsoletus flight period, at least in the first year of adoption. PMID:26352752

  17. Effects of selected fertilizers on the life history of Bemisia tabaci (Hemiptera: Aleyrodidae) biotype B. (United States)

    England, K M; Sadof, C S; Cañnas, L A; Kuniyoshi, C H; Lopez, R G


    We tested the effects among a purportedly sustainable water-soluble fertilizer, a conventional water-soluble fertilizer, an alternation of these, a controlled-release fertilizer, and a clear water control on the life-history traits of sweetpotato whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae; =Bemisia argentifolii Bellows & Perring) biotype B reared on poinsettia (Euphorbia pulcherrima Willdenow ex Klotzch). Free amino acids in petioles were measured to estimate plant nutrient assimilation and phloem nutritional quality for B. tabaci biotype B. The sustainable fertilizer produced plants with the highest concentration of amino acids. In contrast, fecundity of whiteflies was lowest in plants treated with the sustainable fertilizer and the water control. The relationship between total amino acids in phloem and survival was significantly quadratic, with the highest survival at intermediate levels. Fecundity, however, was negatively correlated with total amino acid content of the maternal host plant. Variation in total amino acid concentration in petioles of plants treated within fertilizer treatments makes it difficult to predict whether a particular fertilizer will produce plants with enough amino acids to deleteriously affect both survivorship and fecundity and yet yield a plant of good quality. Despite this limitation, we can conclude that the use of this sustainable fertilizer will not cause increases in whitefly populations relative to plants fertilized with water-soluble and slow-release fertilizers that deliver the same level of nitrogen to the plant. PMID:21510203

  18. Gammaproteobacteria as essential primary symbionts in the striped shield bug, Graphosoma Lineatum (Hemiptera: Pentatomidae). (United States)

    Karamipour, Naeime; Mehrabadi, Mohammad; Fathipour, Yaghoub


    Many members of suborder Heteroptra harbor heritable symbiotic bacteria. Here we characterize the gut symbiotic bacterium in Graphosoma lineatum (Hemiptera: Pentatomidae) by using molecular phylogeny, real-time PCR analysis as well as light and electron microscopy observations. The microscopy observations revealed the presence of a large number of rod-shaped bacterial cells in the crypts. A very high prevalence (98 to 100%) of the symbiont infection was found in the insect populations that strongly supports an intimate association between these two organisms. Real-time PCR analysis also showed that the Gammaproteobacteria dominated the crypts. The sequences of 16sr RNA and groEL genes of symbiont showed high levels of similarity (93 to 95%) to Pantoea agglomeranse and Erwinia herbicola Gammaproteobacteria. Phylogenetic analyses placed G. lineatum symbiont in a well-defined branch, divergent from other stink bug bacterial symbionts. Co-evolutionary analysis showed lack of host-symbiont phylogenetic congruence. Surface sterilization of eggs resulted in increased pre-adult stage in the offspring (aposymbionts) in comparison to the normal. Also, fecundity, longevity, and adult stage were significantly decreased in the aposymbionts. Therefore, it seems that the symbiont might play a vital function in the host biology, in which host optimal development depends on the symbiont. PMID:27609055

  19. Plant Essential Oils Synergize and Antagonize Toxicity of Different Conventional Insecticides against Myzus persicae (Hemiptera: Aphididae.

    Directory of Open Access Journals (Sweden)

    Nicoletta Faraone

    Full Text Available Plant-derived products can play an important role in pest management programs. Essential oils from Lavandula angustifolia (lavender and Thymus vulgaris (thyme and their main constituents, linalool and thymol, respectively, were evaluated for insecticidal activity and synergistic action in combination with insecticides against green peach aphid, Myzus persicae (Sulzer (Hemiptera: Aphididae. The essential oils and their main constituents exerted similar insecticidal activity when aphids were exposed by direct sprays, but were non-toxic by exposure to treated leaf discs. In synergism experiments, the toxicity of imidacloprid was synergized 16- to 20-fold by L. angustifolia and T. vulgaris essential oils, but far less synergism occurred with linalool and thymol, indicating that secondary constituents of the oils were probably responsible for the observed synergism. In contrast to results with imidacloprid, the insecticidal activity of spirotetramat was antagonized by L. angustifolia and T. vulgaris essential oils, and linalool and thymol. Our results demonstrate the potential of plant essential oils as synergists of insecticides, but show that antagonistic action against certain insecticides may occur.

  20. Gut Content Analysis of a Phloem-Feeding Insect, Bactericera cockerelli (Hemiptera: Triozidae). (United States)

    Cooper, W Rodney; Horton, David R; Unruh, Thomas R; Garczynski, Stephen F


    Potato psyllid, Bactericera cockerelli (Šulc) (Hemiptera: Triozidae), is a key pest of potato (Solanum tuberosum L., Solanales: Solanaceae) and a vector of "Candidatus Liberibacter solanacearum," the pathogen associated with zebra chip disease. In addition to its presence on cultivated crops, the psyllid regularly occurs on numerous uncultivated annual and perennial species within the Solanaceae. A better understanding of landscape-level ecology of B. cockerelli would substantially improve our ability to predict which potato fields are most likely to be colonized by infected psyllids. We developed three PCR-based methods of gut content analysis to identify what plant species B. cockerelli had previously fed upon. These methods included-1) sequencing PCR amplicons of regions of plant-derived internal transcribed spacer (ITS) or the chloroplast trnL gene from psyllids, 2) high-resolution melting analysis of ITS or trnL real-time PCR products, and 3) restriction enzyme digestion of trnL PCR product. Each method was used to test whether we could identify psyllids that had been reared continuously on potato versus psyllids reared continuously on the perennial nightshade, Solanum dulcamara. All three methods of gut content analysis correctly identified psyllids from potato and psyllids from S. dulcamara Our study is the first to demonstrate that plant DNA can be detected in a phloem-feeding insect. Gut content analysis, in combination with other landscape ecology approaches, could help elucidate patterns in landscape-level movements and host plant associations of B. cockerelli. PMID:27271944

  1. Morphometric comparisons of Diaphorina citri (Hemiptera: Liviidae populations from Iran, USA and Pakistan

    Directory of Open Access Journals (Sweden)

    Mohammadreza Lashkari


    Full Text Available The Asian citrus psyllid (ACP, Diaphorina citri Kuwayama (Hemiptera: Liviidae, vector of citrus greening disease pathogen, Huanglongbing (HLB, is considered the most serious pest of citrus in the world. Prior molecular based studies have hypothesized a link between the D. citri in Iran and the USA (Florida. The purpose of this study was to collect morphometric data from D. citri populations from Iran (mtCOI haplotype-1, Florida (mtCOI haplotype-1, and Pakistan (mtCOI haplotype-6, to determine whether different mtCOI haplotypes have a relationship to a specific morphometric variation. 240 samples from 6 ACP populations (Iran—Jiroft, Chabahar; Florida—Ft. Pierce, Palm Beach Gardens, Port St. Lucie; and Pakistan—Punjab were collected for comparison. Measurements of 20 morphological characters were selected, measured and analysed using ANOVA and MANOVA. The results indicate differences among the 6 ACP populations (Wilks’ lambda = 0.0376, F = 7.29, P < 0.0001. The body length (BL, circumanal ring length (CL, antenna length (AL, forewing length (WL and Rs vein length of forewing (RL were the most important characters separating the populations. The cluster analysis showed that the Iran and Florida populations are distinct from each other but separate from the Pakistan population. Thus, three subgroups can be morphologically discriminated within D. citri species in this study, (1 Iran, (2 USA (Florida and (3 Pakistan population. Morphometric comparisons provided further resolution to the mtCOI haplotypes and distinguished the Florida and Iranian populations.

  2. Probing behaviors of Sitobion avenae (Hemiptera: Aphididae on enhanced UV-B irradiated plants

    Directory of Open Access Journals (Sweden)

    Hu Zu-Qing


    Full Text Available UV-B induced changes in plants can influence sap-feeding insects through mechanisms that have not been studied. Herein the grain aphid, Sitobion avenae (Fabricius (Hemiptera: Aphididae, was monitored on barley plants under the treatments of control [0 kJ/ (m2.d], ambient UV-B [60 kJ/ (m2.d], and enhanced UV-B [120 kJ/ (m2.d] irradiation. Electrical penetration graph (EPG techniques were used to record aphid probing behaviors. Enhanced UV-B irradiated plants negatively affected probing behaviors of S. avenae compared with control plants. In particular, phloem factors that could diminish sieve element acceptance appeared to be involved, as reflected by smaller number of phloem phase, shorter phloem ingestion, and fewer aphids reaching the sustained phloem ingestion phase (E2>10min. On the other hand, factors from leaf surface, epidermis, and mesophyll cannot be excluded, as reflected by higher number of non-probing, longer non-probing and pathway phase, and later the time to first probe.

  3. Rapid molecular identification of armored scale insects (Hemiptera: Diaspididae) on Mexican 'Hass' avocado. (United States)

    Rugman-Jones, Paul F; Morse, Joseph G; Stouthamer, Richard


    'Hass' avocado, Persea americana Mill., fruit imported into California from Mexico are infested with high levels of armored scale insects (Hemiptera: Diaspididae), constituting several species. The paucity and delicate nature of morphological characters traditionally used to diagnose armored scales often require careful preparation of slide-mounted specimens and expert knowledge of the group, for their accurate identification. Here, we present a simple, quick, and accurate means to identify armored scales on Mexican avocados, based on amplification of the internal transcribed spacer two of ribosomal DNA, by using the polymerase chain reaction (PCR). This region seems to show a high level of intraspecific conformity among scale specimens originating from different localities. A suite of species-specific reverse PCR primers are combined in a single reaction, with a universal forward primer, and produce a PCR product of a unique size, that after standard gel electrophoresis, allows the direct diagnosis of six diaspidid species: Abgrallaspis aguacatae Evans, Watson & Miller; Hemiberlesia lataniae (Signoret); Hemiberlesia sp. near latania; Hemiberlesia rapax (Comstock); Acutaspis albopicta (Cockerell); and Pinnaspis strachani (Cooley). Two additional species, Diaspis miranda (Cockerell) and Diaspis sp. near miranda, also are separated from the others by using this method and are subsequently diagnosed by secondary digestion of the PCR product with the restriction endonuclease smaI. PMID:19886461

  4. Anagrus turpanicus sp. n. (Hymenoptera: Mymaridae) from China, an egg parasitoid of Arboridia kakogowana (Hemiptera: Cicadellidae). (United States)

    Hu, Hong-Ying; Triapitsyn, Serguei V


    A new Palaearctic species of Anagrus Haliday (Hymenoptera: Mymaridae), A. turpanicus Triapitsyn & Hu sp. n., is described and illustrated from Xinjiang Uyghur Autonomous Region of China. It was reared from parasitized eggs of the leafhopper Arboridia kakogowana (Matsumura) (Hemiptera: Cicadellidae) (Fig. 10) on cultivated table grapes from Turpan, which had been previously misidentified there as Erythroneura apicalis (Nawa) (e.g., Wang et al. 2004, 2011; Luan et al. 2006). This leafhopper has been an important economic pest in Turpan area since 1998, causing serious damage to the cultivated grapevines (Wang et al. 2004; Luan et al. 2006). Wang et al. (2011) reported that the mite Leptus sp. (Erythraeidae) and several unidentified spider species were the main natural enemies of Erythroneura apicalis in and around Turpan. This is the first record of A. kakogowana from China; it was not included in the key to the Chinese species of the genus Arboridia Zachvatkin by Song & Li (2015). Arboridia kakogowana is native to the eastern Palaearctic region (Japan, Korea, and Far East of Russia), and has been recently recorded as an invasive pest of cultivated grapes in southern Russia (Gnezdilov et al. 2008). PMID:27615953

  5. Infectivity and transmission of Xylellua fastidiosa by Philaenus spumarius (Hemiptera: Aphrophoridae) in Apulia, Italy. (United States)

    Saponari, Maria; Loconsole, Giuliana; Cornara, Daniele; Yokomi, Raymond K; De Stradis, Angelo; Boscia, Donato; Bosco, Domenico; Martelli, Giovanni P; Krugner, Rodrigo; Porcelli, Francesco


    Discovery of Xylella fastidiosa from olive trees with "Olive quick decline syndrome" in October 2013 on the west coast of the Salento Peninsula prompted an immediate search for insect vectors of the bacterium. The dominant xylem-fluid feeding hemipteran collected in olive orchards during a 3-mo survey was the meadow spittlebug, Philaenus spumarius (L.) (Hemiptera: Aphrophoridae). Adult P. spumarius, collected in November 2013 from ground vegetation in X. fastidiosa-infected olive orchards, were 67% (40 out of 60) positive for X. fastidiosa by polymerase chain reaction (PCR) assays. Euscelis lineolatus Brullé were also collected but tested negative for the pathogen. Transmission tests with P. spumarius collected from the Salento area were, therefore, conducted. After a 96-h inoculation access period with 8 to 10 insects per plant and a 30-d incubation period, PCR results showed P. spumarius transmitted X. fastidiosa to two of five periwinkle plants but not to the seven olive plants. Sequences of PCR products from infected periwinkle were identical with those from X. fastidiosa-infected field trees. These data showed P. spumarius as a vector of X. fastidiosa strain infecting olives trees in the Salento Peninsula, Italy. PMID:25195417

  6. Harmonic radar tagging for tracking movement of Nezara viridula (Hemiptera: Pentatomidae). (United States)

    Pilkay, Grant L; Reay-Jones, Francis P F; Greene, Jeremy K


    Harmonic radar tagging was investigated as a method for monitoring the movement of the southern green stink bug, Nezara viridula (L.) (Hemiptera: Pentatomidae). Because adhesive toxicity and tag weight limit the use of this technology, initial efforts focused on selection of the optimal adhesive and design of harmonic radar tags to reduce impact on the movement of stink bugs. A design consisting of a 6-cm-long 0.10-mm-thick silver-plated copper monopole on the anode terminal of a three-contact Schottky barrier diode attached with Gorilla super glue provided a compromise between unimpaired movement and tracking range, adding an additional 8% to the weight of the stink bug while not significantly (P > 0.05) reducing walking or flying mobility in the laboratory. Recovery of tagged stink bugs in cotton, Gossypium hirsutum (L.), and fallow fields ranged from 10 to 75% after 24 h, whereas marked stink bugs were recovered at rates of 0-35% by using sweep net or drop cloth sampling. The distance dispersed in the field was not impacted (P > 0.05) by crop, tagged status, or gender of the insect. Future research should examine possible improvements to the harmonic radar transceiver and the wire antenna to decrease encumbrance. PMID:24331611

  7. Laboratory Evaluation of Different Insecticides against Hibiscus Mealybug, Maconellicoccus hirsutus (Hemiptera: Pseudococcidae) (United States)

    Fatima, Samman; Hussain, Mubashar; Shafqat, Shama; Faheem Malik, Muhammad; Abbas, Zaheer; Noureen, Nadia; ul Ane, Noor


    Hibiscus mealybug, Maconellicoccus hirsutus (Hemiptera: Pseudococcidae), is the major pest of many vegetables, fruits, crops, and ornamental plants causing losses to the farmers and its control has been an issue of significance in the pest management. This study was aimed at evaluating different concentrations (0.06%, 0.1%, and 0.14%) of Telsta, Advantage, Talstar, Imidacloprid, and their mixtures against hibiscus mealybug in the Laboratory of Systematics and Pest Management at University of Gujrat, Pakistan. The toxic effect was evaluated in the laboratory bioassay after 24 and 48 h of the application of insecticides. The highest mortality (95.83%) was shown by Talstar and Talstar + Imidacloprid at the concentration of 0.14% after 48 h followed by Advantage + Talstar with 87.50% mortality at 0.14% concentration after 48 h of application. The study also showed that the least effective treatment observed was Advantage + Telsta with no mortality after 24 h and 25% mortality after 48 h at 0.14% concentration. The study revealed that the concentration 0.14% was highly effective in lowering the mealybug population and insecticide mixtures were effective in reducing mealybug density. The study emphasizes the use of such insecticide mixtures to develop better management strategy for mealybug populations attacking ornamental plants. However effects of such insecticide mixtures on other organisms and biological control agents should be checked under field conditions. PMID:27313962

  8. Species Composition and Abundance of Stink Bugs (Hemiptera: Heteroptera: Pentatomidae) in Minnesota Field Corn. (United States)

    Koch, Robert L; Pahs, Tiffany


    In response to concerns of increasing significance of stink bugs (Hemiptera: Heteroptera: Pentatomidae) in northern states, a survey was conducted over 2 yr in Minnesota to characterize the Pentatomidae associated with field corn, Zea mays L. Halyomorpha halys (Stål), an exotic species, was not detected in this survey, despite continued detection of this species as an invader of human-made structures in Minnesota. Five species of Pentatomidae (four herbivorous; one predatory) were collected from corn. Across years, Euschistus variolarius (Palisot de Beauvois) and Euschistus servus euschistoides (Vollenhoven) had the greatest relative abundances and frequencies of detection. In 2012, the abundance of herbivorous species exceeded 25 nymphs and adults per 100 plants (i.e., an economic threshold) in 0.48% of fields. However, the abundance of herbivorous species did not reach economic levels in any fields sampled in 2013. The frequency of detection of herbivorous species and ratio of nymphs to adults was highest during reproductive growth stages of corn. The predator species, Podisus maculiventris (Say), was detected in 0 to 0.32% of fields. These results provide baseline information on the species composition and abundance of Pentatomidae in Minnesota field corn, which will be necessary for documentation of changes to this fauna as a result of the invasion of H. halys and to determine if some native species continue to increase in abundance in field crops. PMID:26313176

  9. Factors affecting water strider (Hemiptera: Gerridae) mercury concentrations in lotic systems

    Energy Technology Data Exchange (ETDEWEB)

    Jardine, T.D.; Kidd, K.A.; Cunjak, R.A.; Arp, P.A. [University of New Brunswick, St John, NB (Canada). Canadian Rivers Institute


    Water striders (Hemiptera: Gerridae) have been considered as a potential sentinel for mercury (Hg) contamination of freshwater ecosystems, yet little is known about factors that control Hg concentrations in this invertebrate. Striders were collected from 80 streams and rivers in New Brunswick, Canada, in August and September of 2004 through 2007 to assess the influence of factors such as diet, water chemistry, and proximity to point sources on Hg concentrations in this organism. Higher than average Hg concentrations were observed in the southwest and Grand Lake regions of the province, the latter being the location of a coal-fired power plant that is a source of Hg (similar to 100 kg annually), with elevated Hg concentrations in the lichen Old Man's Beard (Usnea spp.) in its immediate vicinity. Across all streams, pH and total organic carbon of water were relatively weak predictors of strider Hg concentrations. Female striders that were larger in body size than males had significantly lower Hg concentrations within sites, suggestive of growth dilution. There was no relationship between percent aquatic carbon in the diet and Hg concentrations in striders. For those striders feeding solely on terrestrial carbon, Hg concentrations were higher in animals occupying a higher trophic level. Mercury concentrations were highly variable in striders collected monthly over two growing seasons, suggesting short-term changes in Hg availability. These measurements highlight the importance of considering both deposition and postdepositional processes in assessing Hg bioaccumulation in this species.

  10. First record of Triatoma maculata (Erichson, 1848 (Hemiptera: Reduviidae: Triatomini in Riohacha, La Guajira – Colombia

    Directory of Open Access Journals (Sweden)

    Edith Natalia Gómez-Melendro


    Full Text Available Introduction. Knowledge of vector insect species, their habitat and geographical distribution is crucial for determining the risk of transmission of the etiologic agents that cause disease in humans, which allows defining strategies for prevention, surveillance and control in line with the characteristics of each area. Objective. To determine the presence and public health importance of vectors of Chagas disease in the indigenous settlements of Marbacella and El Horno of the Wayúu ethnic group in the municipality of Riohacha, La Guajira, Colombia. Materials and methods. From active search, installation and inspection of biosensors and occasional catches, Hemiptera: Reduviidae: Triatomini were collected intra and in the peridomicile housing of the indigenous settlements of El Horno and Marbacella of the the Wayúu ethnic group. Indices of intra and peridomestic infestation, colonization, density, dispersion and natural infection with Trypanosoma cruzi Chagas, 1909 were calculated. Results. 79.6% (n = 90 of the specimens were collected around the homes and 20.3% (n = 23 inside the homes, all corresponding to Triatoma maculata (Erichson, 1848. The natural infection indices with T. cruzi accounted for 43.5% for Marbacella and 36% for El Horno. Conclusion. This is the first reported capture of individuals of T. maculata, considered a secondary vector of Chagas disease in Colombia, naturally infected with T. cruzi in the municipality of Riohacha expanding the geographical distribution of the species in the department of La Guajira.

  11. Relative Infestation Level and Sensitivity of Grapevine Cultivars to the Leafhopper Empoasca vitis (Hemiptera: Cicadellidae). (United States)

    Fornasiero, D; Pavan, F; Pozzebon, A; Picotti, P; Duso, C


    The leafhopper Empoasca vitis (Göthe) (Hemiptera: Cicadellidae) feeds on veins of grapevine leaves, mainly on the phloem, causing physiological injury, color change and drying of leaf margins, yield and sugar content reduction. The relative infestation level (i.e., the probability that a plant is attacked by herbivores) of E. vitis on different grapevine cultivars and their sensitivity (i.e., the incidence of symptoms expression in response to herbivore feeding or other stimuli) to this pest were studied over four years in two vineyards located in northeastern Italy. Some cultivars (e.g., Carménère and Sauvignon Blanc) were usually more infested than others (e.g., Cabernet Sauvignon and Pinot Gris), although some differences were observed among years and sites. The sensitivity varied among cultivars, i.e., some of them showed more symptoms than expected on the basis of infestation levels (e.g., Carménère and Merlot), in contrast with others (e.g., Rhine Riesling and Chardonnay). Information obtained can be used within the framework of integrated pest management in vineyards. Action thresholds should differ on the basis of sensitivity. Sampling must first be carried out on the most susceptible cultivar and, if the action threshold is exceeded, it should be extended to the remaining cultivars based on their decreasing relative infestation level. PMID:26503344

  12. Hemiptera acuáticos asociados a los estuarios de la costa pacífica colombiana Aquatic Hemiptera associated to estuaries of the colombian pacific coast

    Directory of Open Access Journals (Sweden)



    Full Text Available la mayoría de los hemípteros acuáticos son insectos predadores que habitan en agua dulce, estuarios y mar. Las familias que incluyen especies de hábitat salobres y estuarios son Gerridae y Veliidae. Con el fin de contribuir al conocimiento faunístico y ecológico de los hemípteros acuáticos asociados a los estuarios de la Costa Pacífica de Colombia y de la región del Chocó biogeográfico, se estudiaron seis estuarios del municipio de Tumaco: El Bajito, El Morro, Villa del Sol, Agua clara, Chilvi, e Inguapi, donde se realizaron recolecciones y se caracterizó el hábitat a través de la medición de algunos parámetros fisicoquímicos del agua. En total se colectaron diez especies, pertenecientes a tres familias: Gerridae con cuatro géneros Limnogonus, Rheumatobates, Telmatometroides y Trepobates; Veliidae, con dos géneros Microvelia y Rhagovelia; y un Mesoveliidae, con Mesovelia. Se caracteriza el hábitat y se señalan las especies más abundantes por sitio de muestreo. Se registra por primera vez en Colombia la especie Microvelia inquilina y se adicionan nuevos datos para las especies en la costa Pacífica del departamento de Nariño.Most of the aquatic hemipterans are predatory insects that inhabit fresh waters, estuaries and a few live in the open ocean. Ocean-dwelling and estuarine-inhabiting families include Gerridae and Veliidae. With the purpose of contributing to the biodiversity and ecology of aquatic hemipterans associated with estuaries of the Pacific coast of Colombia and the Chocó biogeographical region, six estuaries were studied from the municipality of Tumaco: El Bajito, El Morro, Villa del Sol, Agua clara, Chilvi, and Inguapi. Aquatic hemiptera were collected and each habitat was characterized measuring physical-chemical parameters of the water. In total, ten species were collected belonging to four genera Limnogonus, Rheumatobates, Telmatometroides, and Trepobates (Family: Gerridae; and two genera Microvelia and

  13. Nuevos registros de Hesperolabops nigriceps Reuter (Hemiptera: Miridae en el oriente del Estado de México New records of Hesperolabops nigriceps Reuter (Hemiptera: Miridae in the east of Mexico State

    Directory of Open Access Journals (Sweden)

    Marina Ruiz-Machuca

    Full Text Available El nopal tunero (Opuntia spp. se cultiva en todo el país, pero sólo en el Estado de México se concentra cerca de 35% de la producción nacional de tuna. Opuntia ficus-indica L. (Miller, es la especie predominante en la obtención de tunas, pero se carece de información que identifiquen taxonómicamente algunas plagas del cultivo; tal es el caso de la chinche roja (Hemiptera: Miridae. se realizaron colectas sistemáticas de este insecto sobre nopales (Opuntia spp., en diferentes municipios del Estado de México en 2008 y se encontraron 20 nuevos registros de Hesperolabops nigriceps Reuter.The prickly pear nopal (Opuntia spp. is cultivated throughout entire country, but 35% of the national production is found only within State of Mexico. Opuntia ficus-indica L. (Miller is the predominant species for obtaining prickly pears, but there is not any information available that would taxonomically identify some plagues particular to this crop; such is the case of red bug (Hemiptera: Miridae. Some of these insects were gathered from prickly pear nopal (Opuntia spp. in different municipalities of State of Mexico in 2008 and 20 new cases of Hesperolabops nigriceps Reuter were found.

  14. Population growth and within-plant distribution of the striped mealybug Ferrisia virgata (Cockerell (Hemiptera, Pseudococcidae on cotton

    Directory of Open Access Journals (Sweden)

    Martin D. Oliveira


    Full Text Available Population growth and within-plant distribution of the striped mealybug Ferrisia virgata (Cockerell (Hemiptera, Pseudococcidae on cotton. The striped mealybug, Ferrisia virgata (Cockerell (Hemiptera, Pseudococcidae, is a widely distributed and polyphagous pest species, which naturally occurs on cotton plants in Brazil. This study evaluated the establishment and population growth as well as the within-plant distribution of F. virgata on four cotton cultivars: CNPA 7H (white fibers, BRS Verde, BRS Safira, and BRS Rubi (colored fibers. The experiment was conducted in a complete randomized design with four treatments (cultivars and 18 replications of each. Thus, cotton plants of each cultivar were infested with 100 newly hatched nymphs of F. virgata. The number of adult female mealybugs and the total number of mealybugs per plant were quantified, respectively, at 25 and 50 days after infestation. The developmental and pre-reproductive periods were also determined. Furthermore, we verified the distribution of F. virgata on the plant parts at 25 and 50 days after infestation. Ferrisia virgata showed similar growth of 412-fold in the four cotton cultivars studied. Also, the nymphs were spread on infested leaves; the secondgeneration nymphs were spread and established in all plant parts. Our results characterize F. virgata as having much potential as an important cotton pest in Brazil.

  15. Performance of nymphs and adults of Piezodorus guildinii (Westwood (Hemiptera: Pentatomidae on soybean pods at different developmental stages

    Directory of Open Access Journals (Sweden)

    Émerson D. M. Oliveira


    Full Text Available A study was conducted in the laboratory to test the suitability of soybean [Glycine max (L. Merrill] pods at different phenological stages of development (R3-R8 on the performance of nymphs and adults of the small green stink bug Piezodorus guildinii (Westwood (Hemiptera: Pentatomidae. Nymphs and adults showed better performance when fed on soybean pods during the pod-filling stage (R5-R6, compared to those fed on soybean pods at the remaining stages of development. When fed on soybean pods without seeds (R3-R4 no nymphs survived and no adults reproduced.Estudos foram conduzidos em laboratório para testar a adequabilidade de vagens de soja [Glycine max (L. Merrill] em diferentes fases fenológicas (R3-R8 na performance de ninfas e adultos do percevejo verde pequeno Piezodorus guildinii (Westwood (Hemiptera: Pentatomidae. Tanto ninfas como adultos mostraram uma melhor performance quando se alimentaram das vagens de soja na fase de enchimento de grãos (R5-R6, comparado com aqueles que se alimentaram de vagens de soja nas demais fases de desenvolvimento. Em vagens sem grãos (R3-R4 nenhuma ninfa sobreviveu e não houve reprodução.

  16. Sobre o condicionamento alimentar na cochonilha-branca, Planococcus citri (Risso (Hemiptera: pseudococcidae Regarding to host conditioning in citrus mealybug Planococcus citri (Risso (Hemiptera: pseudococcidae

    Directory of Open Access Journals (Sweden)

    Lenira Viana Costa Santa-Cecília


    Full Text Available Estudos do comportamento alimentar mediante a técnica de "Electrical Penetration Graphs" (EPG das cochonilhas-farinhentas (Pseudococcidae provenientes de um hospedeiro de criação alternativo têm mostrado que esses insetos não atingem ou demoram cerca de 9 horas para alcançar a fase floemática. Por outro lado, aqueles provenientes do hospedeiro-fonte atingem a fase floemática mais rapidamente e apresentam maior frequência de alimentação nos vasos crivados. Esses resultados indicam a presença do fenômeno de condicionamento alimentar, ainda não demonstrado em cochonilhas. Assim, o presente trabalho teve como objetivo determinar a existência desse fenômeno em Planococcus citri (Risso (Hemiptera: Pseudococcidae. Foram realizados testes de livre escolha, monitoramento eletrônico (EPG e estudos de alguns parâmetros biológicos. Em todos os experimentos, o cafeeiro (Coffea arabica L., os citros (Citrus sinensis L. e abóbora (Cucurbita maxima L. foram utilizados como substratos de criação (fonte da cochonilha, sendo os tratamentos constituídos pela combinação entre os hospedeiros-fonte e os hospedeiros receptores (café e citros. O teste de escolha entre cafeeiro e citros nas primeiras 72 horas mostrou que as cochonilhas criadas em cafeeiro apresentaram preferência pelo cafeeiro; aquelas originadas dos citros mostraram uma tendência, embora não significativa, em selecionar os citros em relação ao cafeeiro e aquelas criadas em abóbora não mostraram preferência por nenhum dos hospedeiros. Os estudos do comportamento alimentar mediante o monitoramento eletrônico (EPG mostraram que a fase floemática, considerada como a fase de aceitação do hospedeiro, foi mais frequente em cafeeiro, seja com cochonilhas oriundas deste substrato, seja de citros. Aqueles insetos mantidos em abóbora e transferidos para o cafeeiro ou citros apresentaram excepcionalmente ou não apresentaram nenhuma fase floemática, respectivamente. A

  17. Identificação de marcadores moleculares ligados a um gene mutado de resistência ao oídio (Erysiphe pisi Syd.) em ervilha (Pisum sativum L.)


    Pereira, Maria da Graça Mendonça


    Este estudo teve como objectivos a obtenção de mutantes de ervilha (Pisum sativum L.) com interesse agronómico e o mapeamento genético de algumas mutações de maior relevância. Duas mutações conferindo resistência ao oídio (Erysiphe pisi Syd.) foram induzidas por tratamento das variedades Frilene e Solara com o agente mutagénico químico etilnitrosoureia. Os estudos realizados sobre o mecanismo genético da resistência apresentada pelos dois novos mutantes permitiram confirmar tra...

  18. Inoculation with Pseudomonas spp.containing ACC-deaminase partially eliminates the effects of drought stress on growth,yield,and ripening of pea (Pisum sativum L.)

    Institute of Scientific and Technical Information of China (English)



    Two preselected plant growth promoting rhizobacteria (PGPR) containing 1-aminocyelopropane-1-carboxylate (ACC)deaminase (EC were used to investigate their potential to ameliorate the effects of drought stress on growth,yield,and ripening of pea (Pisum sativum L.).Inoculated and uninoculated (control) seeds of pea cultivar 2000 were sown in pots (four seeds pot-1) and placed in a wire house.The plants were exposed to drought stress at different stages of growth (vegetative,flowering,and pod formation) by skipping the respective irrigation.Results revealed that inoculation of peas with PGPR containing ACC-deaminase significantly decreased the "drought stress imposed effects" on the growth and yield of peas.Exposure of plants to drought stress at vegetative growth stage significantly decreased shoot growth by 41% in the ease of uninoculated plants,whereas,by only 18% in the case of inoculated plants compared to nonstressed unlnoculated controlGrain yield was decreased when plants were exposed to drought stress at the flowering and pod formation stage,but inoculation resulted in better grain yield (up to 62% and 40% higher,respectively) than the respective uninoculated nonstressed control.Ripening of pods was also delayed in plants inoculated with PGPR,which may imply decreased endogenous ethylene production in inoculated plants.This premise is further supported by the observation that inoculation with PGPR reduced the intensity of classical "triple" response in etiolated pea seedlings,caused by externally applied ACC.It is very probable that the drought stress induced inhibitory effects of ethylene could be partially or completely eliminated by inoculation with PGPR containing ACC-deaminase.

  19. Effects of phosphorus fertilizer rate and Pseudomonas fluorescens strain on field pea (Pisum sativum subsp. arvense (L. Asch. growth and yield

    Directory of Open Access Journals (Sweden)

    Bahram SALEHI


    Full Text Available A field experiment was conducted at Rezvanshahr, Guilan province, Iran, to evaluate the effects of phosphorus fertilizer rate and Pseudomonas fluorescens strains on growth and yield of field pea (Pisum sativum L.. The experimental design was a randomized complete block in a factorial arrangement with three replicates. Factors were phosphorus fertilizer rates (0, 25, 50, 75, and 100 kg P2O5 ha-1 as triple superphosphate, and seed inoculation with P. florescens strains [control (non-inoculated, inoculated with strain R41, and strain R187. Analysis of variance showed that plant height, seed yield, pod number per m2, 100-seed weight, biological yield, harvest index, and leaf P concentration were significantly influenced by phosphorus fertilizer rate and P. florescens strain. At the same time, phosphorus fertilizer rate × P. fluorescens strain interaction was significant only for 100-seed weight. On the other hand, seed number per pod was significantly affected neither by phosphorus fertilizer rate nor by pseudomonas strains. Result showed that seed yield was significantly increased from 1099 ± 67 to 1898 ± 118 kg ha-1 as P2O5 application rate increased from 0 to 75 kg ha-1, and thereafter relatively remained constant. There was no significant difference in seed yield between plants raised from inoculated seeds with P. fluorescens, strain R187 (1664 ± 97 kg ha-1 and those raised from inoculated seeds with P. fluorescens, strain R41 (1669 ± 104 kg ha-1. At the same time, plants raised from inoculated seeds with P. fluorescens (both strains produced greater grain yield compared to those raised from uninoculated seeds (1370 ± 80 kg ha-1. Based on the results of this study, P2O5 application at the rate of 75 kg ha-1 and inoculation with pseudomonas bacteria are recommended for obtaining the greatest seed yield in field pea.

  20. Gas exchange and chlorophyll fluorescence of pea (Pisum sativum L.) plants in response to ambient ozone at a rural site in Egypt

    International Nuclear Information System (INIS)

    Egyptian pea cultivars (Pisum sativum L. cultivars Little Marvel, Perfection and Victory) grown in open-top chambers were exposed to either charcoal-filtered (FA) or non-filtered air (NF) for five consecutive years (2009–2013) at a rural site in northern Egypt. Net photosynthetic rates (PN), stomatal conductance (gs), intercellular CO2 (Ci) and chlorophyll fluorescence were measured. Ozone (O3) was found to be the most prevalent pollutant common at the rural site and is suspected to be involved in the alteration of the physiological parameters measured in the present investigation. PN of different cultivars were found to respond similarly; decreases of 23, 29 and 39% were observed in the cultivars Perfection, Little Marvel and Victory, respectively (averaged over the five years) due to ambient O3. The maximum impairment in PN was recorded in the cultivar Victory (46%) in 2013 when the highest O3 levels were recorded (90 nL L−1). The average stomatal conductance decreased by 20 and 18% in the cultivars Little Marvel and Perfection, respectively, while the average stomatal conductance increased on average by 27% in the cultivar Victory. A significant correlation was found between PN and Ci, indicating the importance of non-stomatal limitations of photosynthesis, especially in the cultivar Victory. The PN vs. Ci curves were fitted to a non-rectangular hyperbolic model. The actual quantum yield (ΦPSII) and photochemical quenching coefficient (qP) were significantly decreased in the leaves of plants exposed to NF air. Non-photochemical quenching (NPQ) was increased in all cultivars. Exposure to NF air caused reductions in chlorophyll (Chl a) of 19, 16 and 30% in the Little Marvel, Perfection and Victory cultivars, respectively. - Highlights: • Ozone (O3) concentrations recorded were within the ranges of phytotoxicity. • O3 has a clear influence on the physiological parameters. • O3 decreased Photosynthetic rates, chlorophyll fluorescence parameters. • The

  1. Characterization and structural analysis of wild type and a non-abscission mutant at the development funiculus (Def locus in Pisum sativum L

    Directory of Open Access Journals (Sweden)

    Ambrose Mike J


    Full Text Available Abstract Background In pea seeds (Pisum sativum L., the Def locus defines an abscission event where the seed separates from the funicle through the intervening hilum region at maturity. A spontaneous mutation at this locus results in the seed failing to abscise from the funicle as occurs in wild type peas. In this work, structural differences between wild type peas that developed a distinct abscission zone (AZ between the funicle and the seed coat and non-abscission def mutant were characterized. Results A clear abscission event was observed in wild type pea seeds that were associated with a distinct double palisade layers at the junction between the seed coat and funicle. Generally, mature seeds fully developed an AZ, which was not present in young wild type seeds. The AZ was formed exactly below the counter palisade layer. In contrast, the palisade layers at the junction of the seed coat and funicle were completely absent in the def mutant pea seeds and the cells in this region were seen to be extensions of surrounding parenchymatous cells. Conclusion The Def wild type developed a distinct AZ associated with palisade layer and counterpalisade layer at the junction of the seed coat and funicle while the def mutant pea seed showed non-abscission and an absence of the double palisade layers in the same region. We conclude that the presence of the double palisade layer in the hilum of the wild type pea seeds plays an important structural role in AZ formation by delimiting the specific region between the seed coat and the funicle and may play a structural role in the AZ formation and subsequent detachment of the seed from the funicle.

  2. Primary and secondary abscission in Pisum sativum and Euphorbia pulcherrima –how do they compare and how do they differ?

    Directory of Open Access Journals (Sweden)

    Anne Kathrine (Trine eHvoslef-Eide


    Full Text Available ABSTRACTAbscission is a highly regulated and coordinated developmental process in plants. It is important to understand the processes leading up to the event, in order to better control abscission in crop plants. This has the potential to reduce yield losses in the field and increase the ornamental value of flowers and potted plants. A reliable method of abscission induction in poinsettia (Euphorbia pulcherrima flowers has been established to study the process in a comprehensive manner. By correctly decapitating buds of the third order, abscission can be induced in one week. AFLP differential display (DD was used to search for genes regulating abscission. Through validation using qRT-PCR, more information of the genes involved during induced secondary abscission have been obtained. A study using two mutants of pea (Pisum sativum in the def (Developmental funiculus gene have been performed and compared these with wild type peas (tall and dwarf in both cases. The def mutant results in a deformed, abscission-less zone instead of normal primary abscission at the funiculus. RNA in situ hybridization studies using gene sequences from the poinsettia differential display, resulted in six genes differentially expressed for abscission specific genes in both poinsettia and pea. Two of these genes are associated with gene up- or down-regulation during the first two days after decapitation in poinsettia. Present and previous results in poinsettia (biochemically and gene expressions, enables a more detailed division of the secondary abscission phases in poinsettia than what has previously been described from primary abscission in Arabidopsis.This study compares the inducible secondary abscission in poinsettia and the non-abscising mutants/wild types in pea demonstrating primary abscission zones. The results may have wide implications on the understanding of abscission, since pea and poinsettia have been separated for 94-98 million years in evolution, hence

  3. Ultraviolet-B responses of nuclear genes encoding light-harvesting complex II proteins in pea (Pisum sativum) are altered by norflurazon- and photobleaching-induced chloroplast changes

    International Nuclear Information System (INIS)

    The role of functional and intact chloroplasts in mediating the ultraviolet-B (UV-B, 290–320 nm) regulation of two nuclear genes encoding light-harvesting complex II proteins in pea (Pisum sativum L. cv. Extra Early Alaska) was studied. Plants with chloroplasts lacking or containing carotenoids and functional photosystem II were obtained by growth under dim red light (0.2 µmol m−2 s−1) in the presence or absence of norflurazon (NF), an inhibitor of carotenoid biosynthesis. The NF-treatment resulted in an increase in AB80 (lhcb1*2) mRNA but no substantial change in Cab-8 (lhcb1*4) mRNA, indicating that the mRNA accumulations for AB80 and Cab-8 were differently correlated with the presence and absence of carotenoids. The mRNA levels for both Cab-8 and AB80 in the NF-treated plants were reduced to the same extent by partially photobleaching the chloroplasts with 3 h of higher intensity white light (W, 110 µmol m−2 s−1), suggesting that chloroplast integrity was equally important for transcript accumulation of both genes. The mRNAs of both Cab-8 and AB80 in non-NF-treated control plants were decreased by UV-B irradiation, with the level of AB80 mRNA reduced to a greater extent. The UV-B-induced mRNA reduction of both genes was inhibited by NF. The difference between the UV-B responses of the two genes was unaffected by NF, but was abolished by photobleaching the NF-treated plants prior to the UV-B irradiation. Therefore, the presence of carotenoids enhanced rather than prevented the UV-B down-regulation, and the difference in UV-B responses of the two genes may be dependent on chloroplast integrity. (author)

  4. GH3 expression and IAA-amide synthetase activity in pea (Pisum sativum L.) seedlings are regulated by light, plant hormones and auxinic herbicides. (United States)

    Ostrowski, Maciej; Jakubowska, Anna


    The formation of auxin conjugates is one of the important regulatory mechanisms for modulating IAA action. Several auxin-responsive GH3 genes encode IAA-amide synthetases that are involved in the maintenance of hormonal homeostasis by conjugating excess IAA to amino acids. Recently, the data have revealed novel regulatory functions of several GH3 proteins in plant growth, organ development, fruit ripening, light signaling, abiotic stress tolerance and plant defense responses. Indole-3-acetyl-aspartate (IAA-Asp) synthetase catalyzing IAA conjugation to aspartic acid in immature seeds of pea (Pisum sativum L.) was purified and characterized during our previous investigations. In this study, we examined the effect of auxin and other plant hormones (ABA, GA, kinetin, JA, MeJA, SA), different light conditions (red, far-red, blue, white light), and auxinic herbicides (2,4-D, Dicamba, Picloram) on the expression of a putative GH3 gene and IAA-amide synthesizing activity in 10-d-old pea seedlings. Quantitative RT-PCR analysis indicated that the PsGH3-5 gene, weakly expressed in control sample, was visibly induced in response to all plant hormones, different light wavelengths and the auxinic herbicides tested. Protein A immunoprecipitation/gel blot analysis using anti-AtGH3.5 antibodies revealed a similar pattern of changes on the protein levels in response to all treatments. IAA-amide synthetase activity determined with aspartate as a substrate, not detectable in control seedlings, was positively affected by a majority of treatments. Based on these results, we suggest that PsGH3-5 may control the growth and development of pea plants in a way similar to the known GH3 genes from other plant species. PMID:23332498

  5. Ocurrencia de tóxicos naturales en frijol colorado (Phaseolus vulgaris y arveja (Pisum sativum. Efecto del tiempo de almacenamiento y los tratamientos caseros.

    Directory of Open Access Journals (Sweden)

    Bilbao Reboredo Tania


    Full Text Available Las leguminosas, consideradas como una de los principales alimentos para el hombre pueden contener diferentes sustancias conocidas como antinutrientes las cuales tienen cierto efecto en la nutrición humana y animal si no son removidos o inactivados adecuadamente. En Cuba existe muy poca información sobre cuales son los antinutrientes y en qué concentraciones se encuentran en dos de las leguminosas de importación de mayor consumo por nuestra población: el frijol común (Phaseolus vulgaris y la arveja (Pisum sativum y tampoco se han estudiado los cambios que pueden sufrir durante su almacenamiento, así como la efectividad de los tratamientos caseros. Muestras de estos granos fueron analizadas durante un año de almacenamiento comercial a una temperatura promedio de 27 °C y 79 % de humedad relativa. Se evaluó la presencia de taninos, ácido cianhídrico, ácido fítico, inhibidores de proteasas y lectinas, en los granos crudos y después de dos tratamientos: remojo y cocción y cocción directamente, en olla de presión. Todos los antinutientes disminuyeron con el tiempo de almacenamiento (p<0,05. Los tratamientos aplicados eliminaron el ácido cianhídrico, los inhibidores de tripsina y las lectinas en los dos tipos de granos, comprobándose la efectividad de la combinación remojo-cocción sobre la aplicación únicamente del tratamiento térmico, sobre el resto de los antinutrientes.

  6. Studies on the control of ascochyta blight in field peas (Pisum sativum L. caused by Ascochyta pinodes in Zhejiang Province, China

    Directory of Open Access Journals (Sweden)

    Na eLiu


    Full Text Available Ascochyta blight, an infection caused by a complex of Ascochyta pinodes, Ascochyta pinodella, Ascochyta pisi, and/or Phoma koolunga, is a destructive disease in many field peas (Pisum sativum L.-growing regions, and it causes significant losses in grain yield. To understand the composition of fungi associated with this disease in Zhejiang Province, China, a total of 65 single-pycnidiospore fungal isolates were obtained from diseased pea samples collected from 5 locations in this region. These isolates were identified as Ascochyta pinodes by molecular techniques and their morphological and physiological characteristics. The mycelia of ZJ-1 could penetrate pea leaves across the stomas, and formed specific penetration structures and directly pierced leaves. The resistance level of 23 available pea cultivars was tested against their representative isolate A. pinodes ZJ-1 using the excised leaf-assay technique. The ZJ-1 mycelia could penetrate the leaves of all tested cultivars, and they developed typical symptoms, which suggested that all tested cultivars were susceptible to the fungus. Chemical fungicides and biological control agents were screened for management of this disease, and their efficacies were further determined. Most of the tested fungicides (11 out of 14 showed high activity towards ZJ-1 with EC50 < 5 μg/mL. Moreover, fungicides, including tebuconazole, boscalid, iprodione, carbendazim and fludioxonil, displayed more than 80% disease control efficacy under the recorded conditions. Three biocontrol strains of Bacillus sp. and one of Pantoea agglomerans were isolated from pea-related niches and significantly reduced the severity of disease under greenhouse and field conditions. To our knowledge, this is the first study on ascochyta blight in field peas, and results presented here will be useful for controlling the disease in this area.

  7. Studies on the Control of Ascochyta Blight in Field Peas (Pisum sativum L.) Caused by Ascochyta pinodes in Zhejiang Province, China. (United States)

    Liu, Na; Xu, Shengchun; Yao, Xiefeng; Zhang, Guwen; Mao, Weihua; Hu, Qizan; Feng, Zhijuan; Gong, Yaming


    Ascochyta blight, an infection caused by a complex of Ascochyta pinodes, Ascochyta pinodella, Ascochyta pisi, and/or Phoma koolunga, is a destructive disease in many field peas (Pisum sativum L.)-growing regions, and it causes significant losses in grain yield. To understand the composition of fungi associated with this disease in Zhejiang Province, China, a total of 65 single-pycnidiospore fungal isolates were obtained from diseased pea samples collected from 5 locations in this region. These isolates were identified as Ascochyta pinodes by molecular techniques and their morphological and physiological characteristics. The mycelia of ZJ-1 could penetrate pea leaves across the stomas, and formed specific penetration structures and directly pierced leaves. The resistance level of 23 available pea cultivars was tested against their representative isolate A. pinodes ZJ-1 using the excised leaf-assay technique. The ZJ-1 mycelia could penetrate the leaves of all tested cultivars, and they developed typical symptoms, which suggested that all tested cultivars were susceptible to the fungus. Chemical fungicides and biological control agents were screened for management of this disease, and their efficacies were further determined. Most of the tested fungicides (11 out of 14) showed high activity toward ZJ-1 with EC50 control efficacy under the recorded conditions. Three biocontrol strains of Bacillus sp. and one of Pantoea agglomerans were isolated from pea-related niches and significantly reduced the severity of disease under greenhouse and field conditions. To our knowledge, this is the first study on ascochyta blight in field peas, and results presented here will be useful for controlling the disease in this area. PMID:27148177

  8. The Effect of Temperature Increases on an Ant-Hemiptera-Plant Interaction. (United States)

    Sagata, Katayo; Gibb, Heloise


    Global temperature increases are significantly altering species distributions and the structure of ecological communities. However, the impact of temperature increases on multi- species interactions is poorly understood. We used an ant-Hemiptera-plant interaction to examine the potential outcomes of predicted temperature increases for each partner and for the availability of honeydew, a keystone resource in many forest ecosystems. We re-created this interaction in growth cabinets using predicted mean summer temperatures for Melbourne, Australia, for the years 2011 (23°C), 2050 (25°C) and 2100 (29°C), respectively, under an unmitigated greenhouse gas emission scenario. Plant growth and ant foraging activities increased, while scale insect growth, abundance and size, honeydew standing crop per tree and harvesting by ants decreased at 29°C, relative to lower temperatures (23 and 25°C). This led to decreased scale insect infestations of plants and reduced honeydew standing crop per tree at the highest temperature. At all temperatures, honeydew standing crop was lower when ants harvested the honeydew from scale insects, but the impact of ant harvesting was particularly significant at 29°C, where combined effects of temperature and ants reduced honeydew standing crop to below detectable levels. Although temperature increases in the next 35 years will have limited effects on this system, by the end of this century, warmer temperatures may cause the availability of honeydew to decline. Decline of honeydew may have far-reaching trophic effects on honeydew and ant-mediated interactions. However, field-based studies that consider the full complexity of ecosystems may be required to elucidate these impacts. PMID:27434232

  9. Seasonality and Distribution Pattern of Brown Marmorated Stink Bug (Hemiptera: Pentatomidae) in Virginia Vineyards. (United States)

    Basnet, S; Kuhar, T P; Laub, C A; Pfeiffer, D G


    Brown marmorated stink bug, Halyomorpha halys (Stål) (Hemiptera: Pentatomidae), is a highly polyphagous invasive insect pest from eastern Asia that feeds on numerous fruit, vegetable, and field crops. Four commercial vineyards in Virginia were sampled in 2012 and 2013 to study the basic biology, seasonality, and distribution pattern of H. halys in vineyards. At each vineyard, two blocks were selected. Weekly 3-min timed count visual samplings were performed in border and interior sections from late May until mid-September. Overwintering adult bugs were first detected in vineyards in May; however, the timing of first detection differed among vineyards. Egg masses were found primarily in June and July, and were usually found on the lower surface of grape leaves, although they were occasionally on the upper leaf surface, on the berry, or on the rachis. All developmental stages of H. halys were found in vineyards, suggesting that grape can serve as a reproductive host for H. halys. Substantial variation in H. halys densities was found among vineyards and throughout the growing season. The first instars were found on egg masses and after molting, dispersed throughout the grape vines. The date on which the first egg mass was collected was considered as a biofix. Based on a degree-day model, there were sufficient degree-days for completion of a generation in Virginia vineyards. Significantly higher numbers of H. halys were collected in border sections compared with interior sections. These results are discussed in relation to the potential pest status of H. halys in vineyards and implications for possible control strategies. PMID:26470333

  10. Recilia banda Kramer (Hemiptera: Cicadellidae), a vector of Napier stunt phytoplasma in Kenya (United States)

    Obura, Evans; Midega, Charles A. O.; Masiga, Daniel; Pickett, John A.; Hassan, Mohamed; Koji, Shinsaku; Khan, Zeyaur R.


    Napier grass ( Pennisetum purpureum) is the most important fodder crop in smallholder dairy production systems in East Africa, characterized by small zero-grazing units. It is also an important trap crop used in the management of cereal stemborers in maize in the region. However, production of Napier grass in the region is severely constrained by Napier stunt disease. The etiology of the disease is known to be a phytoplasma, 16SrXI strain. However, the putative insect vector was yet unknown. We sampled and identified five leafhopper and three planthopper species associated with Napier grass and used them as candidates in pathogen transmission experiments. Polymerase chain reaction (PCR), based on the highly conserved 16S gene, primed by P1/P6-R16F2n/R16R2 nested primer sets was used to diagnose phytoplasma on test plants and insects, before and after transmission experiments. Healthy plants were exposed for 60 days to insects that had fed on diseased plants and acquired phytoplasma. The plants were then incubated for another 30 days. Nested PCR analyses showed that 58.3% of plants exposed to Recilia banda Kramer (Hemiptera: Cicadellidae) were positive for phytoplasma and developed characteristic stunt disease symptoms while 60% of R. banda insect samples were similarly phytoplasma positive. We compared the nucleotide sequences of the phytoplasma isolated from R. banda, Napier grass on which these insects were fed, and Napier grass infected by R. banda, and found them to be virtually identical. The results confirm that R. banda transmits Napier stunt phytoplasma in western Kenya, and may be the key vector of Napier stunt disease in this region.

  11. Biology of the Huanglongbing vector Diaphorina citri (Hemiptera: Liviidae) on different host plants. (United States)

    Alves, G R; Diniz, A J F; Parra, J R P


    Although many studies have been conducted on the development and reproductive potential of Diaphorina citri Kuwayama, 1908 (Hemiptera: Liviidae) in different host species, few have evaluated these parameters on different varieties of the same host species. This study evaluated the influence of five commercial varieties of citrus (Citrus spp. L.)--Hamlin, Natal, Pêra, Ponkan, and Valencia-and orange jasmine [Murraya exotica (L.) Jack] on the development of D. citri. Survival rates for the egg stage were highest on orange jasmine (85.7%) and on Valencia (83.3%). The lowest viability of the nymphal stage was also observed on Hamlin, averaging 57.4%. Values for total viability ranged from 65.9 to 32.6%, and were highest on Valencia. The longest egg-adult development time was on Natal, with a mean of 18.4 d; the shortest total development time was on orange jasmine, with a mean of 17.3 d. Based on the fertility life table, the net reproductive rate (Ro) of D. citri was 2.5 times higher when reared on Valencia than on Hamlin. The other parameters (duration of each generation [T], finite rate of increase [lambda], and innate capacity to increase in number [r(m)]) also demonstrated that Valencia is best suited to this insect. The results obtained for the biological parameters and the fertility life table indicate that Valencia and orange jasmine were the most suitable hosts, whereas Hamlin was least suitable for the development of D. citri. These results provide information for the installation of new citrus groves, especially in the choice of varieties to be planted and the location of different varieties within the groves, with a view toward the management of Huanglongbing or HLB. PMID:24772551

  12. Comparative Mitogenomics of Plant Bugs (Hemiptera: Miridae): Identifying the AGG Codon Reassignments between Serine and Lysine (United States)

    Wang, Pei; Song, Fan; Cai, Wanzhi


    Insect mitochondrial genomes are very important to understand the molecular evolution as well as for phylogenetic and phylogeographic studies of the insects. The Miridae are the largest family of Heteroptera encompassing more than 11,000 described species and of great economic importance. For better understanding the diversity and the evolution of plant bugs, we sequence five new mitochondrial genomes and present the first comparative analysis of nine mitochondrial genomes of mirids available to date. Our result showed that gene content, gene arrangement, base composition and sequences of mitochondrial transcription termination factor were conserved in plant bugs. Intra-genus species shared more conserved genomic characteristics, such as nucleotide and amino acid composition of protein-coding genes, secondary structure and anticodon mutations of tRNAs, and non-coding sequences. Control region possessed several distinct characteristics, including: variable size, abundant tandem repetitions, and intra-genus conservation; and was useful in evolutionary and population genetic studies. The AGG codon reassignments were investigated between serine and lysine in the genera Adelphocoris and other cimicomorphans. Our analysis revealed correlated evolution between reassignments of the AGG codon and specific point mutations at the antidocons of tRNALys and tRNASer(AGN). Phylogenetic analysis indicated that mitochondrial genome sequences were useful in resolving family level relationship of Cimicomorpha. Comparative evolutionary analysis of plant bug mitochondrial genomes allowed the identification of previously neglected coding genes or non-coding regions as potential molecular markers. The finding of the AGG codon reassignments between serine and lysine indicated the parallel evolution of the genetic code in Hemiptera mitochondrial genomes. PMID:24988409

  13. The complete mitochondrial genome sequence of Geisha distinctissima (Hemiptera: Flatidae) and comparison with other hemipteran insects. (United States)

    Song, Nan; Liang, Aiping


    The complete nucleotide sequence of the mitochondrial genome (mitogenome) of Geisha distinctissima (Hemiptera: Flatidae) has been determined in this study. The genome is a circular molecule of 15,971 bp with a total A+T content of 75.1%. The gene content, order, and structure are consistent with the Drosophila yakuba genome structure and the hypothesized ancestral arthropod genome arrangement. All 13 protein-coding genes are observed to have a putative, inframe ATR methionine or ATT isoleucine codons as start signals. Canonical TAA and TAG termination codons are found in nine protein-coding genes, and the remaining four (cox1, atp6, cox3, and nad4) have incomplete termination codons. The anticodons of all transfer RNA (tRNAs) are identical to those observed in D. yakuba and Philaenus spumarius, and can be folded in the form of a typical clover-leaf structure except for tRNA(Ser(AGN)). The major non-coding region (the A+T-rich region or putative control region) between the small ribosomal subunit and the tRNA(Ile) gene includes two sets of repeat regions. The first repeat region consists of a direct 152-bp repetitive unit located near the srRNA gene end, and the second repeat region is composed of a direct repeat unit of 19 bp located toward tRNA(Ile) gene. Comparisons of gene variability across the order suggest that the gene content and arrangement of G. distinctissima mitogenome are similar to other hemipteran insects. PMID:19280059

  14. The Complete Mitochondrial Genome of Corizus tetraspilus (Hemiptera: Rhopalidae) and Phylogenetic Analysis of Pentatomomorpha (United States)

    Guo, Zhong-Long; Wang, Juan; Shen, Yu-Ying


    Insect mitochondrial genome (mitogenome) are the most extensively used genetic information for molecular evolution, phylogenetics and population genetics. Pentatomomorpha (>14,000 species) is the second largest infraorder of Heteroptera and of great economic importance. To better understand the diversity and phylogeny within Pentatomomorpha, we sequenced and annotated the complete mitogenome of Corizus tetraspilus (Hemiptera: Rhopalidae), an important pest of alfalfa in China. We analyzed the main features of the C. tetraspilus mitogenome, and provided a comparative analysis with four other Coreoidea species. Our results reveal that gene content, gene arrangement, nucleotide composition, codon usage, rRNA structures and sequences of mitochondrial transcription termination factor are conserved in Coreoidea. Comparative analysis shows that different protein-coding genes have been subject to different evolutionary rates correlated with the G+C content. All the transfer RNA genes found in Coreoidea have the typical clover leaf secondary structure, except for trnS1 (AGN) which lacks the dihydrouridine (DHU) arm and possesses a unusual anticodon stem (9 bp vs. the normal 5 bp). The control regions (CRs) among Coreoidea are highly variable in size, of which the CR of C. tetraspilus is the smallest (440 bp), making the C. tetraspilus mitogenome the smallest (14,989 bp) within all completely sequenced Coreoidea mitogenomes. No conserved motifs are found in the CRs of Coreoidea. In addition, the A+T content (60.68%) of the CR of C. tetraspilus is much lower than that of the entire mitogenome (74.88%), and is lowest among Coreoidea. Phylogenetic analyses based on mitogenomic data support the monophyly of each superfamily within Pentatomomorpha, and recognize a phylogenetic relationship of (Aradoidea + (Pentatomoidea + (Lygaeoidea + (Pyrrhocoroidea + Coreoidea)))). PMID:26042898

  15. Biology and harmfulness of Planococcus vovae (Nassonov (Hemiptera: Pseudococcidae in Belgrade area

    Directory of Open Access Journals (Sweden)

    Draga Graora


    Full Text Available Planococcus vovae (Nassonov (Hemiptera: Pseudococcidae is an important pest on plants of the family Cupressaceae. Its numerous populations have been present in recent years on Juniperus spp. in Belgrade. Feeding by sap-sucking on all aboveground plant organs, it causes growth stagnation, chlorosis, drying of needles and branches, and even of entire plants under heavy infestation. Additionally, the scale excretes large quantities of honeydew, on which sooty mold develops, reducing photosynthesis and causing faster plant deterioration. Throughout 2007 and 2008, P. vovae was recorded on Juniperus spp. in 12 localities in Belgrade, and on Thuja sp. in a single locality. The pest was found to develop three generations per year and overwinter on branches at the egg or second instar stages. The first generation adults were observed at the end of May, the second generation at the beginning of August, while the third generation was recorded at the beginning of October. Different overwintering modes, and variable oviposition, embryonic and larval development periods led to an overlapping of generations and continuous presence of all developmental stages on plants. In different localities the infestation of plants varied in abundance from a few individual specimens to very large colonies. The highest infestation intensity was recorded in the localities Bežanija, Dorćol and Voždovac. The predatory species Chrysoperla carnea (Stephens (Neuroptera: Chrysopidae and Nephus bipunctatus (Kugelann (Coleoptera: Coccinelidae were found in the scale colonies. Regarding N. bipunctatus, this was its first record as a new species in the Serbian fauna.

  16. Utilizing immunomarking techniques to track Halyomorpha halys (Hemiptera: Pentatomidae) movement and distribution within a peach orchard. (United States)

    Blaauw, Brett R; Jones, Vincent P; Nielsen, Anne L


    In this study we focus on the invasive brown marmorated stink bug, Halyomorpha halys (Stål) (Hemiptera: Pentatomidae), which has a strong dispersal capacity and has had a significant impact on several cropping systems, including peach (Prunus persica (L.)). Management of H. halys has relied on intensive insecticide use, and thus a better understanding of its dispersal behavior may assist in developing improved management strategies. In order to investigate H. halys movement and distribution patterns within a peach orchard we applied ecologically safe, food protein markers to the trees along the orchard border (chicken egg albumin in the form of liquid egg whites) and to the trees within the orchard interior (bovine casein in the form of cow's milk). We used enzyme-linked immunosorbent assays (ELISA) to assess whether collected H. halys were "marked" with either of the two protein markers, revealing where in the orchard the bugs had visited. From the density data we determined that H. halys is a perimeter-driven pest in peaches, with a significantly higher density of bugs collected along the orchard border. Interestingly, this trend is primarily driven by the distribution of male bugs. The protein marking data revealed that a small proportion of male H. halys move equally between the orchard border and interior, while a small proportion of females move predominately to the border after visiting the interior. The verification of a strong edge-effect, although potentially sex-specific, implies that H. halys displays a dispersal behavior that may also be exploited for management, which may help growers more efficiently and more effectively manage H. halys. PMID:27190711

  17. Utilizing immunomarking techniques to track Halyomorpha halys (Hemiptera: Pentatomidae) movement and distribution within a peach orchard (United States)

    Jones, Vincent P.; Nielsen, Anne L.


    In this study we focus on the invasive brown marmorated stink bug, Halyomorpha halys (Stål) (Hemiptera: Pentatomidae), which has a strong dispersal capacity and has had a significant impact on several cropping systems, including peach (Prunus persica (L.)). Management of H. halys has relied on intensive insecticide use, and thus a better understanding of its dispersal behavior may assist in developing improved management strategies. In order to investigate H. halys movement and distribution patterns within a peach orchard we applied ecologically safe, food protein markers to the trees along the orchard border (chicken egg albumin in the form of liquid egg whites) and to the trees within the orchard interior (bovine casein in the form of cow’s milk). We used enzyme-linked immunosorbent assays (ELISA) to assess whether collected H. halys were “marked” with either of the two protein markers, revealing where in the orchard the bugs had visited. From the density data we determined that H. halys is a perimeter-driven pest in peaches, with a significantly higher density of bugs collected along the orchard border. Interestingly, this trend is primarily driven by the distribution of male bugs. The protein marking data revealed that a small proportion of male H. halys move equally between the orchard border and interior, while a small proportion of females move predominately to the border after visiting the interior. The verification of a strong edge-effect, although potentially sex-specific, implies that H. halys displays a dispersal behavior that may also be exploited for management, which may help growers more efficiently and more effectively manage H. halys.

  18. Nutritional manipulation of adult female Orius pumilio (Hemiptera: Anthocoridae) enhances initial predatory performance. (United States)

    Shapiro, Jeffrey P; Reitz, Stuart R; Shirk, Paul D


    Commercial shipments of Orius spp. (Hemiptera: Anthocoridae) commonly include water and protein, the latter typically supplied by eggs from a moth such as Ephestia kuehniella (Zeller). To determine whether modified dietary conditions might improve predation, newly eclosed adult female Orius pumilio (Champion) were fed on E. kuehniella eggs plus encapsulated water, encapsulated 5% sucrose solution only, or encapsulated water only for periods of 24, 48, or 72 h. Feeding activity was assessed by measuring the area of a crop in digital images of dissected digestive tracts. Adult females fed continuously on eggs had larger crops than did females fed on encapsulated sucrose solution. When females were prefed encapsulated water or sucrose and then fed 3 h on eggs, their crops became highly engorged and were larger than those in females fed continuously on eggs for the same periods. In behavioral choice tests, adult females prefed on encapsulated water or 5% sucrose solution spent a larger portion of time in contact with eggs, presumably feeding, whereas females prefed on eggs showed no preference between eggs or encapsulated water. After overnight shipping, females prefed on water or sucrose and held for 48 h total consumed 3.6- and 4.3-fold, respectively, more western flower thrips, Frankliniella occidentalis (Pergande), in 3 h than those prefed on eggs. Survival rates when prefed on sugar or water were comparable with prefeeding on eggs. Thus, inundative releases of Orius can be enhanced by starvation, because females initially feed much more voraciously after shipment with no apparent reduction in fitness. PMID:19449628

  19. Early-season host switching in Adelphocoris spp. (Hemiptera: Miridae of differing host breadth.

    Directory of Open Access Journals (Sweden)

    Hongsheng Pan

    Full Text Available The mirid bugs Adelphocoris suturalis (Jakovlev, Adelphocoris lineolatus (Goeze and Adelphocoris fasciaticollis (Reuter (Hemiptera: Miridae are common pests of several agricultural crops. These three species have vastly different geographical distributions, phenologies and abundances, all of which are linked to their reliance on local plants. Previous work has shown notable differences in Adelphocoris spp. host use for overwintering. In this study, we assessed the extent to which each of the Adelphocoris spp. relies on some of its major overwinter hosts for spring development. Over the course of four consecutive years (2009-2012, we conducted population surveys on 77 different plant species from 39 families. During the spring, A. fasciaticollis used the broadest range of hosts, as it was found on 35 plant species, followed by A. suturalis (15 species and A. lineolatus (7 species. Abundances of the species greatly differed between host plants, with A. fasciaticollis reaching the highest abundance on Chinese date (Ziziphus jujuba Mill., whereas both A. suturalis and A. lineolatus preferred alfalfa (Medicago sativa L.. The host breadths of the three Adelphocoris spp. differed greatly between subsequent spring and winter seasons. The generalist species exhibited the least host fidelity, with A. suturalis and A. lineolatus using 8 of 22 and 4 of 12 overwinter host species for spring development, respectively. By contrast, the comparative specialist A. fasciaticollis relied on 9 of its 11 overwinter plants as early-season hosts. We highlight important seasonal changes in host breadth and interspecific differences in the extent of host switching behavior between the winter and spring seasons. These findings benefit our understanding of the evolutionary interactions between mirid bugs and their host plants and can be used to guide early-season population management.

  20. Warm-Season (C4) Turfgrass Genotypes Resistant to Spittlebugs (Hemiptera: Cercopidae). (United States)

    Gusmão, M R; Valério, J R; Matta, F P; Souza, F H D; Vigna, B B Z; Fávero, A P; Barioni, W; Inácio, G R


    Screening for resistance to insect pests is one of the early stages of grass breeding programs. Pasture spittlebugs are sap-sucking insects that potentially cause severe damage to turfgrasses, including the loss of functional quality and perenniallity. The Brazilian flora has a large number of grass species with wide morphological variability and adaptability to different soil and climate conditions that can potentially be used as lawns. However, no study has screened turfgrass genotypes for resistance to spittlebug attack. In this study, we evaluated the intra- and interspecific variability of 35 turfgrass genotypes in the genera Paspalum, Axonopus, and Zoysia for resistance to the pasture spittlebugs, Deois flavopicta (Stal) and Notozulia entreriana (Berg) (Hemiptera: Cercopidae), as measured by damage scores, densities of nymphs and adults, and level of antibiosis resistance. Genotypes were grouped into three groups using cluster analysis and principal component analysis: GroupI had genotypes associated with low damage scores and high density of adult spittlebugs; GroupII had genotypes with intermediate damage scores and low density of nymphs and adults; and GroupIII was formed by genotypes with high damage scores and high nymph density. Intra- and interspecific genotypic variability was related to antibiosis resistance and morphological variation among genotypes with some indicating nonpreference resistance and others indicating tolerance resistance. Our results indicate that besides antibiosis resistance studies, it is essential to evaluate the morphological variability of grass genotypes when screening for resistance to insects. Further studies are needed to elucidate the intraspecific variability of Paspalum notatum Flüggé genotypes for resistance to spittlebug attack. PMID:27329631

  1. Experimental Infection of Rhodnius prolixus (Hemiptera, Triatominae) with Mycobacterium leprae Indicates Potential for Leprosy Transmission (United States)

    Neumann, Arthur da Silva; Dias, Felipe de Almeida; Ferreira, Jéssica da Silva; Fontes, Amanda Nogueira Brum; Rosa, Patricia Sammarco; Macedo, Rafael Enrique; Oliveira, José Henrique; Teixeira, Raquel Lima de Figueiredo; Pessolani, Maria Cristina Vidal; Moraes, Milton Ozório; Suffys, Philip Noel; Oliveira, Pedro L.; Sorgine, Marcos Henrique Ferreira; Lara, Flavio Alves


    Leprosy is a chronic dermato-neurological disease caused by infection with Mycobacterium leprae. In 2013 almost 200,000 new cases of leprosy were detected around the world. Since the first symptoms take from years to decades to appear, the total number of asymptomatic patients is impossible to predict. Although leprosy is one of the oldest records of human disease, the mechanisms involved with its transmission and epidemiology are still not completely understood. In the present work, we experimentally investigated the hypothesis that the mosquitoes Aedes aegypti and Culex quinquefasciatus and the hemiptera Rhodnius prolixus act as leprosy vectors. By means of real-time PCR quantification of M. leprae 16SrRNA, we found that M. leprae remained viable inside the digestive tract of Rhodnius prolixus for 20 days after oral infection. In contrast, in the gut of both mosquito species tested, we were not able to detect M. leprae RNA after a similar period of time. Inside the kissing bug Rhodnius prolixus digestive tract, M. leprae was initially restricted to the anterior midgut, but gradually moved towards the hindgut, in a time course reminiscent of the life cycle of Trypanosoma cruzi, a well-known pathogen transmitted by this insect. The maintenance of M. leprae infectivity inside the digestive tract of this kissing bug is further supported by successful mice footpad inoculation with feces collected 20 days after infection. We conclude that Rhodnius prolixus defecate infective M. leprae, justifying the evaluation of the presence of M. leprae among sylvatic and domestic kissing bugs in countries endemic for leprosy. PMID:27203082

  2. Factors affecting water strider (Hemiptera: Gerridae) mercury concentrations in lotic systems. (United States)

    Jardine, Timothy D; Kidd, Karen A; Cunjak, Richard A; Arp, Paul A


    Water striders (Hemiptera: Gerridae) have been considered as a potential sentinel for mercury (Hg) contamination of freshwater ecosystems, yet little is known about factors that control Hg concentrations in this invertebrate. Striders were collected from 80 streams and rivers in New Brunswick, Canada, in August and September of 2004 through 2007 to assess the influence of factors such as diet, water chemistry, and proximity to point sources on Hg concentrations in this organism. Higher than average Hg concentrations were observed in the southwest and Grand Lake regions of the province, the latter being the location of a coal-fired power plant that is a source of Hg (approximately 100 kg annually), with elevated Hg concentrations in the lichen Old Man's Beard (Usnea spp.) in its immediate vicinity. Across all streams, pH and total organic carbon of water were relatively weak predictors of strider Hg concentrations. Female striders that were larger in body size than males had significantly lower Hg concentrations within sites, suggestive of growth dilution. There was no relationship between percent aquatic carbon in the diet and Hg concentrations in striders. For those striders feeding solely on terrestrial carbon, Hg concentrations were higher in animals occupying a higher trophic level. Mercury concentrations were highly variable in striders collected monthly over two growing seasons, suggesting short-term changes in Hg availability. These measurements highlight the importance of considering both deposition and postdepositional processes in assessing Hg bioaccumulation in this species. They also suggest that striders may be more appropriate as a terrestrial rather than an aquatic Hg sentinel, underscoring the importance of understanding the origin of food for organisms used in contaminant studies. PMID:19215185

  3. Hallazgo de Triatoma platensis Neiva, 1913 (Hemiptera, Triatominae en el estado brasileño de "Rio Grande do Sul" Finding of Triatoma platensis Neiva, 1913 (Hemiptera, Triatominae in the Brazilian State of "Rio Grande do Sul"

    Directory of Open Access Journals (Sweden)

    Roberto Salvatella


    Full Text Available Triatoma platensis Neiva 1913 (Hemiptera, Triatominae, especie ornitófila, con área de dispersión conocida en Argentina, Bolivia, Paraguay y Uruguay es notificada en un primer registro para Brasil. Hallada en el municipio de Uruguaiana (Río Grande do Sul en nidos de Anumbius annumbi (Vieillot, 1817 (Passeriformes, Furnariidae donde cohabitaba con cricétidos de la especie Orizomys flavescens. Ningún ejemplar de los siete colectados se presentó infectado por Trypanosoma cruzi.Triatoma platensis, an ornitophilic species, found in Argentina, Bolivia, Paraguay and Uruguay is reported for the first time in Brazil. It was found in the county of Uruguaiana (Rio Grande do Sul in nests of Anumbius annumbi (Vieillot, 1817 (Passeriformes, Furnariidae where it cohabited with cricetids belonging to the species Orizomys flavescens. None of the seven individuals collected were infected by Trypanosoma cruzi.

  4. Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål (Hemiptera, Pentatomidae? A agressividade da presa altera o comportamento de ataque do predador Supputius cincticeps (Stål (Hemiptera, Pentatomidae?

    Directory of Open Access Journals (Sweden)

    Rafael Braga da Silva


    Full Text Available Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål (Hemiptera, Pentatomidae? The stink bug Supputius cincticeps (Stål (Hemiptera, Pentatomidae is a predator found in several Brazilian regions, which possesses desirable attributes as a natural control agent and in biological control programs. The aim of this study was to test if the attack behavior and predation success of S. cincticeps were affected by prey species. Larvae of Tenebrio molitor (L. (Coleoptera, Tenebrionidae, Spodoptera frugiperda (J. E. Smith (Lepidoptera, Noctuidae, and Thyrinteina arnobia (Stoll (Lepidoptera, Geometridae were offered to S. cincticeps in laboratory bioassays where predatory attack and prey defensive behaviors were observed for 2-hour periods. The attack behavior of S. cincticeps changed with the prey species offered. More than 25% of T. molitor and S. frugiperda larvae were immediately attacked, but T. arnobia was not immediately attacked by S. cincticeps. Successful attack (i.e., successful insertion of the predator stylets into the prey depends on the region of the body attacked, with a greater proportion of successful attacks in the anterior than in the median or posterior regions. Larvae of T. arnobia and S. frugiperda displayed a sequence of abrupt head and body movements in response to S. cincticeps attack. Attempts of predation were more successful on T. molitor and S. frugiperda than on T. arnobia. Information about the differential attack behavior of S. cincticeps on different prey species is important for designing successful biological control programs using this hemipteran predator.A agressividade da presa altera o comportamento de ataque do predador Supputius cincticeps (Stål (Hemiptera, Pentatomidae? O percevejo Supputius cincticeps (Stål (Hemiptera, Pentatomidae é um predador encontrado em várias regiões brasileiras, que possui atributos desejáveis como agente de controle natural ou em

  5. Ecology of Meimuna mongolica (Hemiptera: Cicadidae) Nymphs: Instars, Morphological Variation, Vertical Distribution and Population Density, Host-Plant Selection, and Emergence Phenology


    Hou, Zehai; Li, Qinglong; Yang,Mingsheng; Liu, Yunxiang; Wei, Cong


    The cicada Meimuna mongolica (Distant) (Hemiptera: Cicadidae) is one of the most important pests of economic forest in Guanzhong Plain of Shaanxi Province, China. Information about ecological characteristics and some sustainable control measures of this species is urgently required for its control. In this study, nymphal instars, morphological variation, vertical distribution, and population density in soil, and emergence phenology of nymphs of M. mongolica on three main host plants (Pinus ta...

  6. Effect of a gall-inducing psylloid, Pseudophacopteron alstonium Yang et Li (Hemiptera: Phacopteronidae) on defensive chemistry of Alstonia scholaris (L.) R. Br. (Gentianales: Apocynaceae)


    Yang, Zhen-De; Lv, Wen-Ling; Zheng, Xia-Lin; Yu, Shu-Zhong; Li, Ming


    Gall-inducing insect species are capable to escape from defence of host plant species. However, effect of gall-inducing insects on defensive mechanism of host plants is still unclear. The present study was conducted to evaluate the possible chemical changes in the defensive system of Alstonia scholaris (L.) R. Br. (Gentianales: Apocynaceae) caused by Pseudophacopteron alstonium Yang et Li (Hemiptera: Phacopteronidae) feeding. Total phenolic and tannin, peroxidase, superoxide dismutase, catala...

  7. Evaluating the suitability of Laricobius nigrinus Fender (Coleoptera: Derodontidae), a biological control agent for hemlock woolly adelgid, Adelges tsugae Annand (Hemiptera: Adelgidae)


    Lamb, Ashley B.


    Hemlock woolly adelgid (HWA), Adelges tsugae Annand (Hemiptera: Adelgidae), is an introduced pest injurious to hemlock trees (Tsuga spp.) in the eastern United States. HWA currently infests hemlock in over 50% of its geographic range and has the potential to spread throughout its entire range. Since HWA populations in the eastern United States are not regulated effectively by natural enemies (Wallace and Hain 2000), classical biological control is the most promising option for controlling t...

  8. Use of Electrical Penetration Graph Technology to Examine Transmission of ‘Candidatus Liberibacter solanacearum’ to Potato by Three Haplotypes of Potato Psyllid (Bactericera cockerelli; Hemiptera: Triozidae)


    Mustafa, Tariq; Horton, David R.; Cooper, W. Rodney; Swisher, Kylie D.; Zack, Richard S.; Pappu, Hanu R.; Munyaneza, Joseph E.


    The potato psyllid, Bactericera cockerelli (Šulc) (Hemiptera: Triozidae), is a vector of the phloem-limited bacterium ‘Candidatus Liberibacter solanacearum’ (Lso), the putative causal agent of zebra chip disease of potato. Little is known about how potato psyllid transmits Lso to potato. We used electrical penetration graph (EPG) technology to compare stylet probing behaviors and efficiency of Lso transmission of three haplotypes of potato psyllid (Central, Western, Northwestern). All haploty...

  9. Behavioral, Ultrastructural and Chemical Studies on the Honeydew and Waxy Secretions by Nymphs and Adults of the Asian Citrus Psyllid Diaphorina citri (Hemiptera: Psyllidae)


    Ammar, El-Desouky; Alessandro, Rocco; Shatters Jr, Robert G.; Hall, David G.


    The Asian citrus psyllid (ACP), Diaphorina citri (Hemiptera: Psyllidae) is the primary vector of the bacterium causing citrus huanglongbing (citrus greening), the most serious disease of citrus worldwide. Psyllids and other hemipterans produce large amounts of honeydew, which has been used previously as an indicator of phloem sap composition and insect feeding or metabolism. Behavioral, ultrastructural and chemical studies on ACP, its honeydew and waxy secretions showed important differences ...

  10. Ultrastructure of Wax-Producing Structures on the Integument of the Melaleuca Psyllid Boreioglycaspis melaleucae (Hemiptera: Psyllidae), with Honeydew Excretion Behavior in Males and Females


    Ammar, El-Desouky; Hentz, Matthew; Hall, David G.; Shatters, Robert G


    The melaleuca psyllid, Boreioglycaspis melaleucae (Hemiptera: Psyllidae), was introduced to Florida as a biological control agent against Melaleuca quinquenervia, an invasive evergreen tree that has invaded large areas of Florida Everglades. Colonies of B. melaleucae nymphs are normally covered by white waxy secretions, and nymphs of various instars produce long bundles of white waxy filaments extending laterally and posteriorly from their abdomen. Scanning electron microscopy of ‘naturally w...

  11. Rôle des ennemis naturels dans la lutte biologique contre le puceron cendré, Dysaphis plantaginea Passerini (Hemiptera aphididae) en vergers de pommiers


    Dib, Hazem


    In the current political and social context (reduced use of pesticides), there is a need for the development of alternative solutions to control the rosy apple aphid, Dysaphis plantaginea Passerini (Hemiptera : Aphididae), especially in organic farming. One of these alternatives is the increased and improved use of natural enemies against this pest. In this thesis, we provided some elements of responses regarding this problem in term of research study and technical application. Based on weekl...

  12. Praon volucre (Hymenoptera: Braconidae: Aphidiinae), a natural enemy of Macrosiphum euphorbiae (Hemiptera: Aphididae): Life table and intrinsic rate of population increase


    Lins, J.C.; Bueno, V.H.P.; Silva, D.B.; Sampaio, M.V.; Lenteren, van, J.C.


    Life table data of natural enemies are often used to understand their population dynamics and estimate their potential role in the biological control of pests. Macrosiphum euphorbiae (Thomas) (Hemiptera: Aphididae) is an important pest of several crops and its intrinsic rate of population increase (rm) is 0.282 at 22°C. The life table parameters (immature mortality, developmental time, sex ratio of emerging adults, fecundity and longevity) of Praon volucre (Haliday) (Hymenoptera: Braconidae: ...

  13. Stone Lakes Virus (Family Togaviridae, Genus Alphavirus), a Variant of Fort Morgan Virus Isolated From Swallow Bugs (Hemiptera: Cimicidae) West of the Continental Divide


    Brault, Aaron C; Armijos, M. Veronica; Wheeler, Sarah; Wright, Stan; Fang, Ying; Langevin, Stanley; Reisen, William K.


    Multiple isolates of an alphaviruses within the western equine encephalomyelitis-serocomplex that were related closely to Ft. Morgan and its variant Buggy Creek virus were made from swallow bugs, Oeciacus vicarius Horvath (Hemiptera: Cimicidae), collected from cliff swallow (Petrochelidon pyrrhonota) nests at the Stone Lakes National Wildlife Refuge, Sacramento County, CA, during the summers of 2005 and 2006. This virus (hereafter Stone Lakes virus, family Togaviridae, genus Alphavirus, STLV)...

  14. An independently evolved mutualism among ants (Myrmicinae Pheidole terramorium and Paratrechina longicornis), sea hibiscus (Hibiscus tiliaceus) and Hemiptera: an invader-invader mutualism and invasion meltdown


    Thayer, Lesley K


     The role of mutualisms among invasive species in facilitating invasions remains relatively unexplored. Yet such interactions have high potential to alter intact community composition and function due to their positive fitness effects on the species involved. The following study explores an interaction that evolved independently among naturalized hibiscus and invasive ants and Hemiptera that colonized the island of Mo’orea, French Polynesia centuries apart.  For this study, a geographic surve...

  15. Scale insects (Hemiptera: Coccoidea) associated with avocado crop, Persea americana Mill. (Lauraceae) in Valle del Cauca and neighboring departments of Colombia


    Kondo, Takumasa; Muñoz, Jazmín Adriana


    Scale insects (Hemiptera: Coccoidea) of avocado, Persea americana Mill. (Lauraceae) were collected in the State of Valle del Cauca, Colombia. The study was conducted for one year, during October 2008–October 2009. As a result of this study, 34 scale insect species in seven families (Coccidae, Diaspididae, Kerriidae, Margarodidae, Monophlebidae, Pseudococcidae and Putoidae) were collected. Together with previous records, the number of scale insects collected on avocado in Colombia increa...

  16. Triatoma boliviana sp. n. (Hemiptera: Reduviidae: Triatominae) de los valles subandinos de La Paz - Bolivia, similar a Triatoma nigromaculata Stål, 1859


    Martinez Avandano, Eddy; Chávez Espada, Tamara; Sossa Gil, Dino; Aranda Asturizaga, Roberto; Vargas Mamani, Benigno; Vidaurre Pietro, Pablo


    Triatoma bolivianasp. n. (Hemiptera: Reduviidae: Triatominae) from Sub Andean valleys of La Paz - Bolivia, related to Triatoma nigromaculata Stål, 1859. We present the description of Triatoma boliviana sp. n. based on morphological external characters of 3 males and 3 females following the keys of Lent and Wygodzinsky (1979) and Carcavallo et al. (1997). The new species are very similar to Triatoma nigromaculata and was captured in Sub Andean valleys from Muñecas Province, Department of La Pa...

  17. Complete Genome Sequences of the Obligate Symbionts “Candidatus Sulcia muelleri” and “Ca. Nasuia deltocephalinicola” from the Pestiferous Leafhopper Macrosteles quadripunctulatus (Hemiptera: Cicadellidae) (United States)

    Abbà, Simona; Kube, Michael; Marzachì, Cristina


    Two bacterial symbionts of the European pest leafhopper, Macrosteles quadripunctulatus (Hemiptera: Cicadellidae), were fully sequenced. “Candidatus Sulcia muelleri” and “Ca. Nasuia deltocephalinicola” represent two of the smallest known bacterial genomes at 190 kb and 112 kb, respectively. Genome sequences are nearly identical to strains reported from the closely related host species, M. quadrilineatus. PMID:26798106

  18. NUEVO REGISTRO DE Greenidea ficicola Takahashi (Hemiptera: Sternorrhyncha: Aphididae EN GUAYABO Psidium guajava (Myrtaceae EN ANTIOQUIA, COLOMBIA NEW REGISTRATION OF Greenidea ficicola Takahashi (Hemiptera: Sternorrhyncha: Aphididae IN GUAVA Psidium guajava (Myrtaceae IN ANTIOQUIA, COLOMBIA

    Directory of Open Access Journals (Sweden)

    Rubén Darío David Giraldo


    Full Text Available Se encuentra por primera vez en el departamento de Antioquia (Colombia y asociado al guayabo (Psidium guajava L., la especie Greenidea ficicola Takahashi ( Hemiptera: Sternorrhyncha: Aphididae colectada durante muestreos intensivos realizados durante el primer semestre de 2008 en el Valle de Aburrá y municipios aledaños. Dicha especie de áfido también fue colectada en falso laurel (Ficus benjamina. Dada la importancia que tienen los frutos de guayabo en la alimentación humana y de los animales domésticos en Colombia, es necesario registrar esta especie con el fin de tomar medidas en lo referente a programas de muestreo de sus poblaciones, estudio de su ciclo de vida y determinar los posibles controladores biológicos, que conduzcan al mejor conocimiento de este insecto y faciliten la toma de medidas de contención a su dispersión en el país.It is founded for the first time, the species of aphid Greenidea ficicola, Takahashi (Hemiptera: Sternorrhyncha: Aphididae in the Antioquia Department (Colombia associated to guava plants (Psidium guajava L.. The species was collected during intensive sampling done during the first semester of 2008, in the Aburra Valley and near municipalities. The species of aphid was also collected on "false laurel" (Ficus benjamina. Due to the importance of guava as food for humans as well as wild and domestic animals, it is considered important to report this species so that contention measures can be taken specially related with more sampling, life cycle and potential biological control agents to get to know better this pest and control its spread in the country.

  19. Host plant preference of harlequin bug (Hemiptera: Pentatomidae), and evaluation of a trap cropping strategy for its control in collard. (United States)

    Wallingford, Anna K; Kuhar, Thomas P; Pfeiffer, Douglas G; Tholl, Dorothea B; Freeman, Joshua H; Doughty, Hélène B; Schultz, Peter B


    Harlequin bug, Murgantia histrionica (Hahn) (Hemiptera: Pentatomidae), is a piercing-sucking pest of cole crops, causing cosmetic damage in low populations, while heavy pest pressure can kill plants or entire fields. Field studies were conducted to evaluate a trap crop for control of harlequin bug in collard. Field-cage choice tests found that potential trap crop plant species, mustard (Brassica juncea 'Southern Giant Curled'), rapeseed (B. napus 'Athena'), rapini (B. rapa), and arugula (Eruca satica) attracted more harlequin bugs than collard (B. oleracea 'Champion') and a nonbrassica control, bean (Phaseolus vulgaris'Bronco'). Mustard was the most consistently selected by harlequin bug over collard in choice tests, and was found to be an effective trap crop for reducing feeding injury on collard at two experimental sites. Augmentation of the mustard trap crop with a systemic, neonicotinoid insecticide provided no added control of harlequin bug for the 10 wk duration in the spring season. PMID:23448042

  20. Occurrence of treehoppers (Hemiptera: Membracidae: Smiliinae) on oaks in delaware water gap national recreation area, 2004-2006. (United States)

    Wallace, Matthew S


    A total of 870 treehoppers and 24 species from the tribe Smiliini (Hemiptera: Membracidae: Smiliinae) were collected from various oaks in the Delaware Water Gap National Recreation Area in 2006 using yellow sticky cards. Combining all years and collecting methods, 27 species were found in the park. A majority of the specimens collected in 2006 were males of Cyrtolobus vau and Ophiderma pubescens, as in previous years. Most of the treehoppers were caught in mid to late June, comparable to 2004 and 2005. It appears that many species are segregated either temporally or by oak group; some treehopper species show preference for either the red or white oak group rather than for one species of oak. Color photographs for 27 treehopper species (many including both sexes) are included. PMID:20302540

  1. Occurrence of Treehoppers (Hemiptera: Membracidae: Smiliinae) on Oaks in Delaware Water Gap National Recreation Area, 2004–2006 (United States)

    Wallace, Matthew S.


    A total of 870 treehoppers and 24 species from the tribe Smiliini (Hemiptera: Membracidae: Smiliinae) were collected from various oaks in the Delaware Water Gap National Recreation Area in 2006 using yellow sticky cards. Combining all years and collecting methods, 27 species were found in the park. A majority of the specimens collected in 2006 were males of Cyrtolobus vau and Ophiderma pubescens, as in previous years. Most of the treehoppers were caught in mid to late June, comparable to 2004 and 2005. It appears that many species are segregated either temporally or by oak group; some treehopper species show preference for either the red or white oak group rather than for one species of oak. Color photographs for 27 treehopper species (many including both sexes) are included. PMID:20302540

  2. First report of Lecanodiaspis dendrobii Douglas, 1892 (Hemiptera: Lecanodiaspididae) and the associated parasitoid Cephaleta sp. (Hymenoptera: Pteromalidae) in Brazil. (United States)

    Marsaro Júnior, A L; Peronti, A L B G; Costa, V A; Morais, E G F; Pereira, P R V S


    Lecanodiaspis dendrobii Douglas, 1892 (Hemiptera: Coccoidea: Lecanodiaspididae) and the associated parasitoid Cephaleta sp. (Hymenoptera: Pteromalidae) are reported for the first time in Brazil. Specimens of this scale insect were collected on branches and stems of Acacia mangium Willd., Leucaena leucocephala (Lam.) de Wit (Fabaceae), Morus nigra L. (Moraceae), Citrus reticulata Blanco (Rutaceae), Tectona grandis L. f. (Verbenaceae), Anacardium occidentale (Anacardiaceae), Annona squamosa L. and Xylopia aromatica (Lam.) Mart. (Annonaceae), in three municipalities of the Roraima state. All plants here mentioned are recorded for the first time as a host for L. dendrobii. Morphological characters of L. dendrobii and symptoms presented by the host plants infested by this pest are included in this work. PMID:26871743

  3. Predation potential of Chilocorus cacti (Coleoptera: Coccinellidae) to the prickly pear cacti pest Dactylopius opuntiae (Hemiptera: Dactylopiidae). (United States)

    Flores, A; Olvera, H; Rodríguez, S; Barranco, J


    Functional response of the predator Chilocorus cacti (Linnaeus) (Coleoptera: Coccinellidae) on five densities of Dactylopius opuntiae (Cockerell) (Hemiptera: Dactylopiidae) female adults was assessed under laboratory conditions. The searching efficiency of C. cacti significantly decreased as prey density increased. The logistic regression for the predator had a negative and significant linear parameter indicating a type II functional response. Non-linear regression for Holling predator equation estimated a handling time of 1.79 ± 0.129 h and attack rate coefficient of 0.1003 ± 0.030. Most of this handling time was because the predator spent a lot of time removing the waxy coating that protects adult females of D. opuntiae. Chilocorus cacti consumes females of D. opuntiae in their reproductive stage; therefore, it could be an effective natural enemy to suppress or regulate low density populations of D. opuntiae, preventing them to reach high densities. PMID:23949861

  4. Three new species of mealybug (Hemiptera, Coccomorpha, Pseudococcidae) on persimmon fruit trees (Diospyros kaki) in southern Brazil (United States)

    Pacheco da Silva, Vitor C.; Kaydan, Mehmet Bora; Germain, Jean-François; Malausa, Thibaut; Botton, Marcos


    Abstract Brazil has the greatest insect diversity in the world; however, little is known about its scale insect species (Hemiptera: Coccomorpha). Mealybugs (Pseudococcidae) have been found in at least 50% of persimmon orchards Diospyros kaki L. in the southern part of the country. In this study three new mealybug species on persimmon trees located in the Serra Gaúcha Region, RS, Brazil, namely, Anisococcus granarae Pacheco da Silva & Kaydan, sp. n., Ferrisia kaki Kaydan & Pacheco da Silva, sp. n. and Pseudococcus rosangelae Pacheco da Silva & Kaydan, sp. n. are described. In addition, an identification key for the genera occurring on fruit orchards and vineyards in Brazil is provided, together with illustrations and molecular data for the new species. PMID:27199595

  5. Differences in bacterial diversity of host-associated populations of Phylloxera notabilis Pergande (Hemiptera: Phylloxeridae) in pecan and water hickory. (United States)

    Medina, R F; Nachappa, P; Tamborindeguy, C


    Host-associated differentiation (HAD) is the presence of genetically divergent, host-associated populations. It has been suggested that microbial symbionts of insect herbivores may play a role in HAD by allowing their insect hosts to use different plant species. The objective of this study was to document if host-associated populations of Phylloxera notabilis Pergande (Hemiptera: Phylloxeridae) in pecan and water hickory corresponded with differences in the composition of their associated bacteria. To test this hypothesis, we characterized the symbionts present in P. notabilis associated with these two tree species through metagenomic analyses using 454 sequencing. Differences in bacterial diversity were found between P. notabilis populations associated with pecan and water hickory. The bacteria, Pantoea agglomerans and Serratia marcescens, were absent in the P. notabilis water hickory population, whereas both species accounted for more than 69.72% of bacterial abundance in the pecan population. PMID:21261774

  6. Coccophagus scutellaris (Hymenoptera: Aphelinidae: A Highly Effective Biological Control Agent of Soft Scale Insects (Hemiptera: Coccidae in Egypt

    Directory of Open Access Journals (Sweden)

    Shaaban Abd-Rabou


    Full Text Available About 953000 individuals of the cosmopolitan parasitoid, Coccophagus scutellaris (Dalman (Hymenoptera: Aphelinidae, were released and evaluated during 2009-2010 for the control of the following soft scale insects (Hemiptera: Coccidae infesting the following economic crops in Egypt: Ceroplastes rusci on citrus in Beni Seuf, Ceroplastes floridensis Comstock on citrus in Gharbiya, Coccus hesperidum L. on guava in Giza, Pulvinaria floccifera (Westwood on mango in Sharqiya, Pulvinaria psidii Maskell on mango in Ismailia, Saissetia coffeae (Walker on olive in Marsa Matruh, and Saissetia oleae (Oliver on olive in the Northern Coast. The population of C. scutellaris showed a significant correlation with the build up of the population of the soft scale insects population in all of the release sites studied. The maximum rate of parasitism of the other species of parasitoids associated with soft scale insects at the release sites decreased after the release of C. scutellaris.

  7. Analysis of new aphid lethal paralysis virus (ALPV) isolates suggests evolution of two ALPV species. (United States)

    Liu, Sijun; Vijayendran, Diveena; Carrillo-Tripp, Jimena; Miller, W Allen; Bonning, Bryony C


    Aphid lethal paralysis virus (ALPV; family Dicistroviridae) was first isolated from the bird cherry-oat aphid, Rhopalosiphum padi. ALPV-like virus sequences have been reported from many insects and insect predators. We identified a new isolate of ALPV (ALPV-AP) from the pea aphid, Acyrthosiphon pisum, and a new isolate (ALPV-DvV) from western corn rootworm, Diabrotica virgifera virgifera. ALPV-AP has an ssRNA genome of 9940 nt. Based on phylogenetic analysis, ALPV-AP was closely related to ALPV-AM, an ALPV isolate from honeybees, Apis mellifera, in Spain and Brookings, SD, USA. The distinct evolutionary branches suggested the existence of two lineages of the ALPV virus. One consisted of ALPV-AP and ALPV-AM, whilst all other isolates of ALPV grouped into the other lineage. The similarity of ALPV-AP and ALPV-AM was up to 88 % at the RNA level, compared with 78-79 % between ALPV-AP and other ALPV isolates. The sequence identity of proteins between ALPV-AP and ALPV-AM was 98-99 % for both ORF1 and ORF2, whilst only 85-87 % for ORF1 and 91-92 % for ORF2 between ALPV-AP and other ALPV isolates. Sequencing of RACE (rapid amplification of cDNA ends) products and cDNA clones of the virus genome revealed sequence variation in the 5' UTRs and in ORF1, indicating that ALPV may be under strong selection pressure, which could have important biological implications for ALPV host range and infectivity. Our results indicated that ALPV-like viruses infect insects in the order Coleoptera, in addition to the orders Hemiptera and Hymenoptera, and we propose that ALPV isolates be classified as two separate viral species. PMID:25170050

  8. Gas exchange and chlorophyll fluorescence of pea (Pisum sativum L.) plants in response to ambient ozone at a rural site in Egypt

    Energy Technology Data Exchange (ETDEWEB)

    Ismail, I.M.; Basahi, J.M. [Air Pollution Laboratory (APL), Centre of Excellence in Environmental Studies (CEES), King Abdulaziz University, P. O. Box 80216, Jeddah 21589 (Saudi Arabia); Hassan, I.A., E-mail: [Air Pollution Laboratory (APL), Centre of Excellence in Environmental Studies (CEES), King Abdulaziz University, P. O. Box 80216, Jeddah 21589 (Saudi Arabia); Department of Botany, Faculty of Science, Alexandria University, 21526 El Shatby, Alexandria (Egypt)


    Egyptian pea cultivars (Pisum sativum L. cultivars Little Marvel, Perfection and Victory) grown in open-top chambers were exposed to either charcoal-filtered (FA) or non-filtered air (NF) for five consecutive years (2009–2013) at a rural site in northern Egypt. Net photosynthetic rates (P{sub N}), stomatal conductance (g{sub s}), intercellular CO{sub 2} (C{sub i}) and chlorophyll fluorescence were measured. Ozone (O{sub 3}) was found to be the most prevalent pollutant common at the rural site and is suspected to be involved in the alteration of the physiological parameters measured in the present investigation. P{sub N} of different cultivars were found to respond similarly; decreases of 23, 29 and 39% were observed in the cultivars Perfection, Little Marvel and Victory, respectively (averaged over the five years) due to ambient O{sub 3}. The maximum impairment in P{sub N} was recorded in the cultivar Victory (46%) in 2013 when the highest O{sub 3} levels were recorded (90 nL L{sup −1}). The average stomatal conductance decreased by 20 and 18% in the cultivars Little Marvel and Perfection, respectively, while the average stomatal conductance increased on average by 27% in the cultivar Victory. A significant correlation was found between P{sub N} and C{sub i}, indicating the importance of non-stomatal limitations of photosynthesis, especially in the cultivar Victory. The P{sub N} vs. Ci curves were fitted to a non-rectangular hyperbolic model. The actual quantum yield (Φ{sub PSII}) and photochemical quenching coefficient (qP) were significantly decreased in the leaves of plants exposed to NF air. Non-photochemical quenching (NPQ) was increased in all cultivars. Exposure to NF air caused reductions in chlorophyll (Chl a) of 19, 16 and 30% in the Little Marvel, Perfection and Victory cultivars, respectively. - Highlights: • Ozone (O{sub 3}) concentrations recorded were within the ranges of phytotoxicity. • O{sub 3} has a clear influence on the physiological

  9. The LSD1-type zinc finger motifs of Pisum sativa LSD1 are a novel nuclear localization signal and interact with importin alpha.

    Directory of Open Access Journals (Sweden)

    Shanping He

    Full Text Available BACKGROUND: Genetic studies of the Arabidopsis mutant lsd1 highlight the important role of LSD1 in the negative regulation of plant programmed cell death (PCD. Arabidopsis thaliana LSD1 (AtLSD1 contains three LSD1-type zinc finger motifs, which are involved in the protein-protein interaction. METHODOLOGY/PRINCIPAL FINDINGS: To further understand the function of LSD1, we have analyzed cellular localization and functional localization domains of Pisum sativa LSD1 (PsLSD1, which is a homolog of AtLSD1. Subcellular localization analysis of green fluorescent protein (GFP-tagged PsLSD1 indicates that PsLSD1 is localized in the nucleus. Using a series of GFP-tagged PsLSD1 deletion mutants, we found that the three LSD1-type zinc finger motifs of PsLSD1 alone can target GFP to the nucleus, whereas deletion of the three zinc finger motifs or any individual zinc finger motif causes PsLSD1 to lose its nuclear localization, indicating that the three zinc finger motifs are necessary and sufficient for its nuclear localization. Moreover, site-directed mutagenesis analysis of GFP-tagged PsLSD1 indicates that tertiary structure and basic amino acids of each zinc finger motif are necessary for PsLSD1 nuclear localization. In addition, yeast two-hybrid, pull-down, and BiFC assays demonstrate that the three zinc finger motifs of PsLSD1 directly bind to importin α in vitro and in vivo. CONCLUSIONS/SIGNIFICANCE: Our data demonstrate that the LSD1-type zinc finger motifs of PsLSD1 are a novel nuclear localization signal and directly bind to importin α, and suggest that the nuclear import of LSD1 may rely on the interaction between its zinc finger motifs and importin α. Moreover, the nuclear localization of PsLSD1 suggests that LSD1 may function as a transcription regulator involved in negatively regulating PCD.

  10. Remote Sensing Study of the Influence of Different Herbicides on the Leaf Spectral Reflectance and Fluorescence of Pea Plants (Pisum sativum L.) (United States)

    Krezhova, Dora; Yanev, Tony; Iliev, Ilko; Alexieva, Vera; Tsaneva, Mariana

    The effective use of airborne and satellite-based remote sensor systems in resource management, agriculture, mineral exploration and environmental monitoring requires an understanding of the nature and limitations of the high-resolution remote sensing data and of various strategies for processing and interpreting it. In developing the necessary knowledge base, ground-based measurements are the expedient source of information. In this study, remote sensing techniques were applied in laboratory for detection of the influence of herbicides 2.4-D, glyphosate, fluridone and acifluorfen on the leaf spectral reflectance and fluorescence of pea plants (Pisum sativum L.). According to the classification of the Herbicide Resistance Action Committee with reference to their mode of action they belong to different groups: synthetic auxins - O (2.4-D), inhibition of EPSP synthase - G (glyphosate), photobleaching - F1 (fluridone), and inhibition of PPO - E (acifluorfen). During the last 40 years, these herbicides are among the ones used most widely in agriculture worldwide. The plants studied were grown hydroponically in a growth chamber in a nutritious medium to which every herbicide was added at two low concentrations (1 µM, 0.1 µM) with respect to the field dose applied in the agricultural practice. High-resolution spectral data for leaf spectral reflectance and fluorescence were collected from freshly detached leaves using three multichannel spectrometers. Spectral reflectance characteristics were obtained from the leaf reflectance referenced against a standard (white diffuse screen) in the visible and near infrared ranges of the electromagnetic spectrum (450÷850 nm). Fluorescence spectra were taken in the spectral range 650-850 nm. To assess the changes arising in leaf spectral reflectance under the herbicide action we developed and applied an analytical approach based on discriminant analysis and other statistical methods. The spectral characteristics were analyzed in

  11. Raw Pea (Pisum sativum, raw Faba bean (Vicia faba var. minor and raw Lupin (Lupinus albus var. multitalia as alternative protein sources in broiler diets

    Directory of Open Access Journals (Sweden)

    Gianfranco Piva


    Full Text Available The ban of the meat and bone meal for entering animal diets and the concern of transgenic feeds poses a challenge toanimal nutritionists in Europe. The challenge is to find homegrown protein-rich feedstuffs, making sure no antinutritionalfactors are present which could interfere in the animals’ performance. The raw Pea (Pisum sativum (RP, raw Fababean (Vicia faba, variety minor (RFb and raw Lupin (Lupinus albus, variety multitalia (RL were evaluated as alternativeprotein sources into broiler diets. Six hundred thirty 1d-old Ross male chicks, Marek vaccinated, were randomlyassigned to seven dietary treatments (5 pens per treatment/18 birds per pen. Chicks were floor housed, ad libitum fedisocaloric and isonitrogenous diets and had free access to water. Artificial light was provided 10 h/d. The bulk of the basediet (control diet was corn (48.7%, 56.6% and 57%, solvent-extracted soybean meal (42.8%, 37.3% and 33.4%, cornoil (4.4%, 5.2% and 6.3%, plus synthetic amino acids, minerals, trace minerals and vitamins, respectively for the 1-10d-old, 11-28d-old and 29 to 42d-old growing periods. The RP, RFb and RL entered diets in substitution of the soybeanand corn according to the cost optimization (P100, Fb100 and L100, respectively for RP, RFb and RL and at half of theoptimized quantity (RP50, RFb50 and RL50, respectively for RP, RFb and RL. The amount used as fed basis for the higherlevel of inclusion were: P100: 350 g/kg for all diets; Fb100: 480 g/kg (1-10d-old and 500 g/kg (11-42d-old; L100:360 g/kg (1-10d-old and 300 g/kg (11-42d-old. The average daily gain (ADG were lower (P compared to the control group. Over the whole period of growth, the RFb group had similar ADG compared to the controlgroup and for both levels of inclusion, whereas reduced (P (P growth. Birds performance was improved (P and breast and leg quarter cuts. The RFb and RL could represent valuable protein feeds in broilers diet formulation.

  12. Repetitive DNA in the pea (Pisum sativum L. genome: comprehensive characterization using 454 sequencing and comparison to soybean and Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Navrátilová Alice


    Full Text Available Abstract Background Extraordinary size variation of higher plant nuclear genomes is in large part caused by differences in accumulation of repetitive DNA. This makes repetitive DNA of great interest for studying the molecular mechanisms shaping architecture and function of complex plant genomes. However, due to methodological constraints of conventional cloning and sequencing, a global description of repeat composition is available for only a very limited number of higher plants. In order to provide further data required for investigating evolutionary patterns of repeated DNA within and between species, we used a novel approach based on massive parallel sequencing which allowed a comprehensive repeat characterization in our model species, garden pea (Pisum sativum. Results Analysis of 33.3 Mb sequence data resulted in quantification and partial sequence reconstruction of major repeat families occurring in the pea genome with at least thousands of copies. Our results showed that the pea genome is dominated by LTR-retrotransposons, estimated at 140,000 copies/1C. Ty3/gypsy elements are less diverse and accumulated to higher copy numbers than Ty1/copia. This is in part due to a large population of Ogre-like retrotransposons which alone make up over 20% of the genome. In addition to numerous types of mobile elements, we have discovered a set of novel satellite repeats and two additional variants of telomeric sequences. Comparative genome analysis revealed that there are only a few repeat sequences conserved between pea and soybean genomes. On the other hand, all major families of pea mobile elements are well represented in M. truncatula. Conclusion We have demonstrated that even in a species with a relatively large genome like pea, where a single 454-sequencing run provided only 0.77% coverage, the generated sequences were sufficient to reconstruct and analyze major repeat families corresponding to a total of 35–48% of the genome. These data

  13. Raw and extruded pea (Pisum sativum and lupin (Lupinus albusvar. Multitalia seeds as protein sources in weaned piglets’ diets: effect on growth rate and blood parameters

    Directory of Open Access Journals (Sweden)

    Gianfranco Piva


    Full Text Available The 42 days trial was carried out using 140 piglets weaned at 28 days of age. The piglets were allocated according to  weight and sex to the 5 dietary treatments with 7 replicates for each treatments (4 pens x 4 castrated males and 3 pens  x 4 females. The piglets were fed according to the following experimental design: 1 control diet (CTR with soybean  meal (SBM 44% c.p. as protein source; 2 CRT diets with 200 g/kg of raw pea (Pisum sativum (RP; 3 CTR diet with  200 g/kg extruded pea (EP; 4 CRT diet with 170 g/kg raw lupin (Lupinus albusvar. Multitalia (RL; 5 CTR diet with  170 g/kg of extruded lupin (EL. During the trial, animals were weighed at 0 - 21 and 42 days from the start of the trial.  Feed intake was monitored and feed conversion ratio was calculated for the periods 0-21 d and 22-42 d. At the end of  the trial, blood samples were taken for 14 animals for each dietary treatment (2 animals per replicate and analysed for  total protein, urea and liver activity (ALT, AST and ALP parameters. Average daily weight gain and feed intake did not  differ according to dietary treatments whereas during the total experimental period (0-42 d, feed conversion ratio was  higher for EP vsCTR diet (2.35 vs2.09, respectively; P   compared with diets containing the raw ingredients did not differ. Feed conversion ratio for the RP was numerically high-  er than for the EP (2.35 vs2.16 and 2.76 vs2.32, respectively during 22-42 d and 0-42 d periods. Blood parameters  did not show significant difference among dietary treatments except for higher total protein for CTR diet vsRL diet, EL  and RP (67.3 vs62.2, 62.8 and 63.6 g/l, respectively; PvsRL  and RL (4.7 vs3.7 and 3.8 mmol/l respectively; P 

  14. Inventory and assessment of foliar natural enemies of the soybean aphid (Hemiptera: Aphididae) in South Dakota. (United States)

    Hesler, Louis S


    Soybean aphid (Aphis glycines Matsumura) (Hemiptera: Aphididae) is a major pest of soybean in northern production regions of North America, and insecticides have been the primary management approach while alternative methods are developed. Knowledge of arthropod natural enemies and their impact on soybean aphid is critical for developing biological control as a management tool. Soybean is a major field crop in South Dakota, but information about its natural enemies and their impact on soybean aphid is lacking. Thus, this study was conducted in field plots in eastern South Dakota during July and August of 2004 and 2005 to characterize foliar-dwelling, arthropod natural enemies of soybean aphid, and it used exclusion techniques to determine impact of natural enemies and ants (Hymenoptera: Formicidae) on soybean aphid densities. In open field plots, weekly soybean aphid densities reached a plateau of several hundred aphids per plant in 2004, and peaked at roughly 400 aphids per plant in 2005. Despite these densities, a relatively high frequency of aphid-infested plants lacked arthropod natural enemies. Lady beetles (Coleoptera: Coccinellidae) were most abundant, peaking at 90 and 52% of all natural enemies sampled in respective years, and Harmonia axyridis Pallas was the most abundant lady beetle. Green lacewings (Neuroptera: Chrysopidae) were abundant in 2005, due mainly to large numbers of their eggs. Abundances of arachnids and coccinellid larvae correlated with soybean aphid densities each year, and chrysopid egg abundance was correlated with aphid density in 2005. Three-week cage treatments of artificially infested soybean plants in 2004 showed that noncaged plants had fewer soybean aphids than caged plants, but abundance of soybean aphid did not differ among open cages and ones that provided partial or total exclusion of natural enemies. In 2005, plants within open cages had fewer soybean aphids than those within cages that excluded natural enemies, and aphid

  15. Systematics and phylogeny of the Neotropical treehopper subfamily Nicomiinae (Hemiptera, Membracidae Sistemática e filogenia das cigarrinhas neotropicais da subfamília Nicomiinae (Hemiptera, Membracidae

    Directory of Open Access Journals (Sweden)

    Jesse L. Albertson


    Full Text Available Morphological characters of adults of the treehopper subfamily Nicomiinae Haupt, 1929 (Hemiptera, Membracidae including seven genera (Eudonica gen. nov.; Euwalkeria Goding, 1926; Holdgatiella Evans, 1962; Nicomia Stål, 1858; Nodonica Dietrich, McKamey& Deitz, 2001; Stalomia gen. nov.; and Tolania Stål, 1858 and 22 species (16 new are described and illustrated. Keys are provided for genera and for species of Euwalkeria, Holdgatiella, and Nicomia. Nomenclatural changes, based on study of the primary type material of 15 species, include three new combinations, one new synonymy, and reinstatement of one junior synonym. Eudonica has one species, Eudonica nanella sp. nov.; Euwalkeria has five species, including four new species: E. colorata sp. nov., E. distincta sp. nov., E. perdita sp. nov., E. rubrica sp. nov.; Holdgatiella has two species, one of which is described as new: Holdgatiella chiloensis sp. nov.; Nicomia has twelve species, nine of which are described as new: N. buccina sp. nov., N. harenosa sp. nov., N. inscripta sp. nov., N. jucunda sp. nov., N. monticola sp. nov., N. nigrifasciata sp. nov., N. notidana sp. nov., N. pulchella sp. nov., N. serrata sp. nov.; Nodonica has one species, Nodonica bispinigera Dietrich, McKamey & Deitz; and Stalomia has one species, Stalomia veruta sp. nov. Tolania contains eleven previously described species and nearly 60 new species, which will be treated in a later publication. Three new combinations are proposed: one species described in Nicomia is placed in the tribe Abelini (Centrotinae as Abelus retrospinosus (Lethierry comb. nov.; one species previously placed in Nicomia is transferred to the genus Tolania as T. obliqua (Walker, 1858, comb. nov.; one species described in Holdgatiella is placed in the genus Tolania as T. stria (Cryan & Deitz, 2002, comb. nov. One new synonymy is proposed: Hoplophera [sic] cicadoides Walker, 1862, syn. nov., a junior synonym of Nicomia interrupta Stål, 1858. Nicomia

  16. Distribuição espacial de Aphis gossypii (Glover (Hemiptera, Aphididae e Bemisia tabaci (Gennadius biótipo B (Hemiptera, Aleyrodidae em algodoeiro Bt e não-Bt Spatial distribution of Aphis gossypii (Glover (Hemiptera, Aphididae and Bemisia tabaci (Gennadius biotype B (Hemiptera, Aleyrodidae on Bt and non-Bt cotton

    Directory of Open Access Journals (Sweden)

    Tatiana Rojas Rodrigues


    Full Text Available Distribuição espacial de Aphis gossypii (Glover (Hemiptera, Aphididae e Bemisia tabaci (Gennadius biótipo B (Hemiptera, Aleyrodidae em algodoeiro Bt e não-Bt. O estudo da distribuição espacial de adultos de Bemisia tabaci e de Aphis gossypii nas culturas do algodoeiro Bt e não-Bt é fundamental para a otimização de técnicas de amostragens, além de revelar diferenças de comportamento de espécies não-alvo dessa tecnologia Bt entre as duas cultivares. Nesse sentido, o experimento buscou investigar o padrão da distribuição espacial dessas espécies de insetos no algodoeiro convencional não-Bt e no cultivar Bt. As avaliações ocorreram em dois campos de 5.000 m² cada, nos quais se realizou 14 avaliações com contagem de adultos da mosca-branca e colônias de pulgões. Foram calculados os índices de agregação (razão variância/média, índice de Morisita e Expoente k da Distribuição Binomial Negativa e realizados os testes ajustes das classes numéricas de indivíduos encontradas e esperadas às distribuições teóricas de freqüência (Poisson, Binomial Negativa e Binomial Positiva. Todas as análises mostraram que, em ambas as cultivares, a distribuição espacial de B. tabaci ajustou-se a distribuição binomial negativa durante todo o período analisado, indicando que a cultivar transgênica não influenciou o padrão de distribuição agregada desse inseto. Já com relação às análises para A. gossypii, os índices de agregação apontaram distribuição agregada nas duas cultivares, mas as distribuições de freqüência permitiram concluir a ocorrência de distribuição agregada apenas no algodoeiro convencional, pois não houve nenhum ajuste para os dados na cultivar Bt. Isso indica que o algodão Bt alterou o padrão normal de dispersão dos pulgões no cultivo.The study of spatial distribution of the adults of Bemisia tabaci and the colonies of Aphis gossypii on Bt and non-Bt cotton crop is fundamental for



    Diana Pérez; José Iannacone; Alfredo Tueros


    Se determinó el efecto tóxico de dos extractos hidroalcohólicos procedentes de dos plantas amazónicas de importancia etnobotánica, Paullinia clavigera Schltdl. "sachayoco" (Sapindaceae) y Chondrodendron tomentosum Ruiz et Pav "curare" (Menispermaceae), ambas en desarrollo vegetativo, sobre ninfas del III estadio de Tuthillia cognata Hodkinson, Brown & Burckhardt, 1986 "piojo saltador del camu camu" (Hemiptera: Psyllidae). Las ninfas de T. cognata se colectaron en plantaciones del caserío San ...

  18. Pea seeds (Pisum sativum, faba beans (Vicia fabavar. minor and lupin seeds (Lupinus albus var. multitalia as protein sources in broiler diets: effect of extrusion on growth performance

    Directory of Open Access Journals (Sweden)

    Gianfranco Piva


    Full Text Available The effect of extrusion of pea seeds (Pisum sativum (PS, faba bean (Vicia faba, variety minor (FB and lupin seeds (Lupinus albus, variety multitalia (LS on broiler performance were evaluated. Four hundred sixty two 1d-old Ross male chicks, Marek vaccinated, were randomly assigned to seven dietary treatments (3 pens per treatment/22 birds per pen. Chicks were floor housed, ad libitum fed isocaloric and isonitrogenous diets and had free access to water. Artificial light was provided 10 h/d. The bulk of the base diet (control diet was corn (48.8%, 53.7% and 57%, solvent-extracted soy- bean meal (42.8%, 37.3% and 33.4%, corn oil (4.4%, 5.2% and 6.3%, plus synthetic amino acids, minerals, trace minerals and vitamins, respectively for the 1-10d-old, 11-28d-old and 29 to 42d-old growing periods. The amounts of PS, FB and LS used on an as fed basis were: PS and extruded PS (EPS: 353 (1-10d-old, 356 (11-28d-old and 350 (29- 42d-old g/kg; FB and extruded FB (EFB: 479 (1-10d-old, 497 (11-28d-old and 500 (29-42d old g/kg; LS and extrud- ed LS (ELS: 360 (1-10d-old and 300 (11-42d-old g/kg. High levels of pea (350 g/kg and faba bean (500 g/kg did not show negative effects on body weight gain (BWG and bird feed intake compared to control. Lupin at the 300 g/kg level reduced (P< 0.05 the BWG during the finishing period (22 to 42 d, however the effect disappeared over the whole experimental period (1-42 d compared to the control group. The ELS group had a lower (P< 0.01 feed intake com- pared to the control group and to the LS group. The feed conversion rate (FCR was similar among groups for the whole experimental period; however during the grower period the FCR was higher (P< 0.05 for the PS, FB and EFB groups com- pared to the control group. Birds consuming the PS diet had a reduced (P< 0.05 eviscerated carcass yield compared to the control group. The breast meat percent yield was higher (P< 0.01 for birds consuming the FB and EFB diets compared to the control

  19. Effect of silicon application to Eucalyptus camaldulensis on the population of Glycaspis brimblecombei (Hemiptera: Aphalaridae

    Directory of Open Access Journals (Sweden)

    Dalva Luiz de Queiroz


    Full Text Available The use of silicon in forestry has increased recently as it is directly related to improved resistance to insect pests. The red gum lerp psyllid, Glycaspis brimblecombei, occurs in all eucalypt producing regions in Brazil. Two field experiments were conducted to study the effect of silicon applied to Eucalyptus camaldulensis on the psyllid population. In the first experiment, the applications were made via soil (calcium silicate and leaves (potassium silicate in a nine months old E. camaldulensis plantation. In the second experiment, we evaluated silicon on seedlings, incorporating it into the substrate (soil or applying it on leaves (foliar. Monthly, for 24 months, the number of psyllid eggs and immatures were counted on leaf samples. The plant height was measured at 9, 12, 16 and 24 months (experiment 1 and at 4, 8, 12 and 24 months (experiment 2 after application. The numbers of eggs and immatures were lower in periods of higher precipitation, indicating less psyllid attack during the rainy season. The psyllid population was lower in treatments with application of silicon both foliar and via soil compared to control. No significant differences were found in the height of E. camaldulensis plants. Efeito da aplicação de silício em Eucalyptus camaldulensis em população de Glycaspis brimblecombei (Hemiptera: Aphalaridae O uso do silício na área florestal tem aumentado recentemente, pois o elemento está relacionado a uma melhoria na resistência a insetos pragas. O psilídeo de concha, Glycaspis brimblecombei é encontrado em todas as regiões produtoras de eucalipto no Brasil. O efeito do silício aplicado em Eucalyptus camaldulensis, na população do psilídeo, foi estudado em dois ensaios. No primeiro experimento, as aplicações foram via solo (silicato de cálcio e foliar (silicato de potássio em uma plantação de nove meses. No segundo experimento, este mineral foi aplicado em mudas de eucalipto, no substrato ou sobre as folhas

  20. Efeito da cobertura vegetal sobre a pérola-da-terra (Hemiptera: Margarodidae na cultura da videira = Effect of cover crops on brazilian ground pearl (Hemiptera: Margarodidae in vineyards

    Directory of Open Access Journals (Sweden)

    Marcos Botton


    Full Text Available O uso da cobertura vegetal em vinhedos é uma prática empregada paraminimizar a erosão e melhorar as qualidades químicas e físicas do solo. Neste trabalho, foi avaliado o efeito de coberturas vegetais sobre a população da pérola-da-terra Eurhizococcus brasiliensis (Hemiptera: Margarodidae na cultura da videira. No primeiro experimento, o vinhedo foi mantido sem cobertura vegetal por meio da aplicação trimestral do herbicida glifosato comparado com o uso de vegetação espontânea, durante o ano, de vegetação espontânea, no verão, e de aveia preta no inverno. No segundo experimento foi avaliado o efeito da mucuna-preta (Stizolobium aterrimum cultivada no vinhedo durante o verão comparado com a vegetação espontânea. No primeiro experimento, a população da pérolada-terra nas raízes de plantas de videira foi maior em áreas mantidas sem cobertura vegetal emostrou-se semelhante em áreas onde se manteve a vegetação espontânea, ao longo do ano, e com aveia preta no inverno e vegetação espontânea no verão. A infestação das plantas de videira em áreas onde foi empregada a mucuna-preta durante o verão foi equivalente à da vegetação espontânea. S. aterrimum foi registrada pela primeira vez como hospedeira de E. brasiliensis. The use of cover crops is an important strategy to reduce erosion and improve chemical and physical soil properties. In this work, we evaluate the effect of cover crops to reduce Brazilian ground pearl Eurhizococcus brasiliensis (Hemiptera: Margarodidae infestation in vineyards. In the first experiment, glyphosate was sprayed each three months to avoid cover crops. This treatment was compared with naturally occurring vegetation during the year and the use of Avena sativa in the winter. In a second experiment, Stizolobium aterrimum was cultivated during the summer compared with naturally occurringvegetation. Brazilian ground pearl population was higher in glyphosate sprayed areas than where cover

  1. Controle químico da forma galícola da filoxera Daktulosphaira vitifoliae (Fitch, 1856 (Hemiptera: Phylloxeridae na cultura da videira Chemical control of grape phylloxera Daktulosphaira vitifoliae (Fitch, 1856 leaf form (Hemiptera: Phylloxeridae on vineyards

    Directory of Open Access Journals (Sweden)

    Marcos Botton


    Full Text Available A filoxera Daktulosphaira vitifoliae (Fitch, 1856 (Hemiptera: Phylloxeridae é considerada a principal praga da videira. O inseto se alimenta da parte aérea e raízes sendo que os maiores prejuízos são observados em raízes de Vitis vinifera cultivada como pé-franco. O dano nas folhas é importante em viveiros, quando o ataque ocorre nos ramos utilizados como porta-enxertos, resistentes à forma radícola. Este trabalho foi realizado com o objetivo de selecionar inseticidas que possam ser empregados como substitutos aos fosforados e piretróides no manejo da forma galícola da filoxera. Os inseticidas imidacloprid, thiamethoxam, acephate, abamectin, deltamethrin e fenitrothion, foram avaliados em condições de campo, sob infestação natural, em plantas matrizes do porta-enxerto Paulsen 1103. Imidacloprid (Provado 200 SC, 40mL 100L-1 e thiamethoxam (Actara 250 WG, 30g 100L-1 reduziram as injúrias causadas pela forma galícola da filoxera nos ponteiros em nível superior a 90%, proporcionando controle superior aos inseticidas deltamethrin (Decis 25 CE, 40mL 100L-1 e fenitrothion (Sumithion 500 CE, 150 mL/100L considerados referência no controle do inseto. Os inseticidas acephate (Orthene 750 BR, 100g 100L-1 e abamectin (Vertimec 18 CE, 80mL 100L-1 não foram eficientes.Grape phylloxera Daktulosphaira vitifoliae (Fitch, 1856 (Hemiptera: Phylloxeridae is the main grape pest. Adults and nymphs feeds on leaves and roots but major damage is observed on roots of own rooted Vitis vinifera. Damage on leaves is important in root stock nurseries where chemical control is necessary. This study was conducted to evaluate insecticides to control the leaf form in a Paulsen 1103 nursery in field condictions. Imidacloprid (Provado 200 SC, 40mL 100L-1 and thiamethoxam (Actara 250 WG, 30g 100L-1 reduced foliar damage in more than 90%, providing better control than deltamethrin (Decis 25 CE, 40mL 100L-1 and fenitrothion (Sumithion 500 CE, 150mL 100L-1 current

  2. Patogenicidade do fungo entomopatogênico Beauveria bassiana sobre o percevejo Collaria scenica (Hemiptera: Miridae / Pathogenicity of entomopathogenic fungus Beauveria bassiana against the grass bug Collaria scenica (Hemiptera: Miridae

    Directory of Open Access Journals (Sweden)

    Marcos Roberto Barboza


    Full Text Available O percevejo Collaria scenica (Hemiptera: Miridae é uma praga de cereais cultivados e pastagens, e o controle microbiano é uma alternativa para manter estas populações abaixo do nível de dano econômico. O presente trabalho teve como objetivo avaliar a patogenicidade do isolado CG 460 de Beauveria bassiana sobre este percevejo. Insetos adultos foram inoculados em laboratório com cinco concentrações de conídios (1,0x105; 1,0x106; 1,0x107; 1,0x108 e 1,0x109 conídios.mL-1 e alimentados com folhas de trigo. A mortalidade total e confirmada (conidiogênese sobre os insetos mortos foram avaliadas durante seis dias consecutivos. O isolado apresentou alta capacidade infectiva sobre o mirideo, com mortalidade total variando de 40 a 90%. A mortalidade confirmada apresentou uma correlação linear positiva com a concentração de conídios. A taxa de conidiogênese nas concentrações mais baixas do inoculo foi em torno de 26%, sendo que nas concentrações maiores os valores chegaram a 70%. O tempo letal 50 para a concentração 109 foi de 4,3 dias.AbstractThe grass bug, Collaria scenica (Hemiptera: Miridae, is a pest of cereal crops and pastures, and the microbial control is an alternative to maintain the pest population below economic injury level. The present work had the objective to assess the pathogenicity isolate CG460 of Beauveria bassiana against this grass bug. Adult insects had been inoculated in laboratory with five conidia concentrations (1.0x105, 1.0x106, 1.0x107, 1.0x108, 1.0x109 conidia.mL-1, and fed with wheat leaves. Total and confirmed mortality (sporulation on the dead insects had been assessed during six consecutive days. CG460 showed high virulency on the grass bug, with the total mortality ranged from 40 to 90%. Confirmed mortality presented positive and linear correlation with the conidia concentrations. The conidiogenesis rates in the lowest concentrations of inoculum were around 26%, being that in the highest

  3. Rhodnius prolixus supergene families of enzymes potentially associated with insecticide resistance. (United States)

    Schama, Renata; Pedrini, Nicolás; Juárez, M Patricia; Nelson, David R; Torres, André Q; Valle, Denise; Mesquita, Rafael D


    Chagas disease or American trypanosomiasis, is a potentially life-threatening illness caused by the protozoan parasite, Trypanosoma cruzi. Once known as an endemic health problem of poor rural populations in Latin American countries, it has now spread worldwide. The parasite is transmitted by triatomine bugs, of which Rhodnius prolixus (Hemiptera, Reduviidae, Triatominae) is one of the vectors and a model organism. This species occurs mainly in Central and South American countries where the disease is endemic. Disease prevention focuses on vector control programs that, in general, rely intensely on insecticide use. However, the massive use of chemical insecticides can lead to resistance. One of the major mechanisms is known as metabolic resistance that is associated with an increase in the expression or activity of detoxification genes. Three of the enzyme families that are involved in this process - carboxylesterases (CCE), glutathione s-transferases (GST) and cytochrome P450s (CYP) - are analyzed in the R. prolixus genome. A similar set of detoxification genes to those of the Hemipteran Acyrthosiphon pisum but smaller than in most dipteran species was found in R. prolixus genome. All major CCE classes (43 genes found) are present but the pheromone/hormone processing class had fewer genes than usual. One main expansion was detected on the detoxification/dietary class. The phosphotriesterase family, recently associated with insecticide resistance, was also represented with one gene. One microsomal GST gene was found and the cytosolic GST gene count (14 genes) is extremely low when compared to the other hemipteran species with sequenced genomes. However, this is similar to Apis mellifera, a species known for its deficit in detoxification genes. In R. prolixus 88 CYP genes were found, with representatives in the four clans (CYP2, CYP3, CYP4 and mitochondrial) usually found in insects. R. prolixus seems to have smaller species-specific expansions of CYP genes than

  4. Phytoreovirus-like sequences isolated from salivary glands of the glassy-winged sharpshooter Homolodisca vitripennis (Hemiptera: Cicadellidae)

    International Nuclear Information System (INIS)

    The salivary glands of the Glassy-winged sharpshooter (GWSS), Homalodisca vitripennis Germar 1821, (syn. H. coagulata, Hemiptera: Cicadellidae) were collected and used to produce a cDNA library. Examination by BLASTX analyses identified 2 viral sequences, one a 610-base pair fragment and a second 839-base pair fragment, both of which had significant homology to viruses within the genus Phytoreovirus. Resequencing of the fragments confirmed sequence validities. These sequences were used for in silico protein translation and BLASTP analysis confirming the established homology. While the GWSS is the primary vector of Pierce's disease of grapes, this is the first report that GWSS may be a vector of a phytoreoviruses. Phylogenetic and homology comparisons with BLASTX, BLASTP, and PAUP analyses indicated that the viral sequences isolated from GWSS were closely related to the viruses in the Family Reoviridae, Genus Phytoreovirus, specifically Rice Dwarf Phytoreovirus (RDV). RDV is the only plant reovirus that is not limited to the phloem. Phytoreoviruses are transmitted in a propagative manner by cicadellid leafhoppers (Hemiptera: Cicadellidae), which acquire and transmit them during feeding. Phytoreoviruses have been reported from Agallian, Agalliopsis, Nephotettix, and Recilia, genera of leafhoppers, with evidence for transovarial transmission. The GWSS, although considered to feed primarily from the xylem, ingests from other plant tissues, such as the phloem and mesophyll during probing similar to other leafhoppers. The feeding behavior and wide host range of the GWSS provides an overlapping condition for these two organisms, leafhopper and virus. GWSS will feed from grasses as a transitory host, and on herbaceous and woody plants as primary hosts, which may favor the acquisition and transmission of Phytoreovirus by this leafhopper. Monitoring for an increase of Phytoreovirus spread in graminaceous crops that are in proximity to vineyards or tree crop orchards, where

  5. Host specificity testing and examination for plant pathogens reveals that the gall-forming psyllid, Calophya latiforceps (Hemiptera: Calophyidae), is safe to release for biological control of Schinus terebinthifolia (United States)

    Brazilian peppertree (Schinus terebinthifolia Raddi) is one of the worst upland exotic weeds in Florida. Foreign exploration for natural enemies led to the discovery of a pit-galling psyllid, Calophya latiforceps (Hemiptera: Calophyidae), in the state of Bahia, Brazil in 2010. Crawlers of C. latifor...

  6. The impact of some environmental factors on the fecundity of phenacoccus solenopsis tinsley (hemiptera: pseudococcidae): a serious pest of cotton and other crops

    International Nuclear Information System (INIS)

    Phenacoccus solenopsis Tinsley (Hemiptera: Sternorrhyncha: Pseudococcidae) was first recorded on cultivated cotton from Texas, USA in 1991. Since 2005, this New World species has emerged as serious pest of cotton in Pakistan and India, and is now a serious threat to cotton in China and other cotton-growing countries worldwide. The species is polyphagous and invasive, and can attack many other economic crops. So far, it has been reported from 173 species in 54 plant families, and from 26 countries in different ecological zones. The study found that host plant species and meteorological conditions had significant effects, whereas locality had no significant effect on the fecundity of the mealybug. (author)

  7. Control biológico del piojo rojo de California, Aonidiella aurantii (Maskell) (Hemiptera: Diaspididae) y estrategias reproductivas de su principal enemigo natural Aphytis chrysomphali (Mercet) (Hymenoptera: Aphelinidae)


    Pina Desfilis, Mª Tatiana


    RESUMEN Esta tesis describe la situación del control biológico del piojo rojo de California, Aonidiella aurantii (Maskell) (Hemiptera: Diaspididae), por parasitoides en la Comunidad Valenciana El piojo rojo de California es una de las plagas más importantes de cítricos en España. Esta plaga, a pesar de todos los tratamientos químicos que se realizan para su control, se encuentra por encima del umbral económico de daños. En este trabajo se constata, tras un muestreo realizado a lo lar...

  8. A new mealybug in the genus Pseudococcus Westwood (Hemiptera: Coccomorpha: Pseudococcidae) from North America, with a key to species of Pseudococcus from the New World. (United States)

    Ellenrieder, Natalia Von; Watson, Gillian


    A mealybug species that feeds on Agave spp., Pseudococcus variabilis sp. n. (Hemiptera: Coccomorpha: Pseudococcidae), is described from North America. Its entry into the United States was likely via the horticultural trade on its host plants in the genus Agave (Liliales: Agavaceae). Descriptions and illustrations of the adult female and male, diagnosis from congeners in the New World, and a molecular characterization based on COI are provided, as well as a key to adult females of all Pseudococcus species recorded from the New World. PMID:27394765

  9. First occurrence of Alcaeorrhynchus grandis (Dallas) (Hemiptera: Pentatomidae) preying on defoliating caterpillars of oil palm in the state of Para, Brazil

    International Nuclear Information System (INIS)

    The oil palm Elaeis guineensis is usually attacked by pests, particularly, defoliating caterpillars. Between 2004 and 2006 a stinkbug predator (Asopinae) was registered preying on caterpillars of Brassolis sophorae L., Opsiphanes invirae Hubner (Lepidoptera: Nymphalidae) and Sibine spp. (Lepidoptera: Limacodidae), reducing their populations in commercial oil palm plantations in the State of Para, Brazil. Specimens of the natural enemy were collected, mounted, and identified as Alcaeorrhynchus grandis (Dallas) (Hemiptera: Pentatomidae), corresponding to the first report of the occurrence of this stinkbug attacking defoliating caterpillars of oil palm in Brazil. (author)

  10. Presencia de Orius insidiosus Say (Hemiptera, Anthocoridae) en cultivos hortícolas minifundistas del Valle de Lerma, Salta, Argentina


    Olivo, Verónica Inés; Rodríguez, Carla A.; Coscarón,María del Carmen; Corronca, José Antonio


    En la Argentina, Orius insidiosus Say (Hemiptera, Anthocoridae) es el insecto más frecuente y abundante en el control natural de trips (Insecta: Thysanoptera), y por su hábito generalista también depreda sobre pulgones y huevos de lepidópteros, entre otros. Es un depredador muy eficiente, ya que con frecuencia habita en los mismos lugares que sus presas, pudiendo sobrevivir mucho tiempo sin alimentarse, y es relativamente fácil de producir en masa por lo que se comercializa para el control bi...

  11. EST Table: FY009682 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available golgi complex 6 [Acyrthosiphon pisum] 11/11/04 n.h 11/11/04 n.h 11/11/04 low homology 11/11/04 low homology...FY009682 bmov28c07 11/11/04 36 %/133 aa ref|NP_001153870.1| component of oligomeric... 11/11/04 30 %/140 aa gi|91078258|ref|XP_970899.1| PREDICTED: similar to GA15161-PA [Tribolium castaneum] FY005564 bmov ...

  12. Untersuchungen zum Einsatz von Pflanzenstärkungsmitteln im ökologischen Futtererbsenanbau


    Schleuß, Dr. Uwe; Böhm, Dr. Herwart; Loges, Dr Ralf


    There is a great requirement for cultivation of grain legumes (e.g. peas) in organic farming systems (protein supply for animals, biological nitrogen fixation, previous crop effects). The occurrence of pests and diseases, e.g. Acyrthosiphon pisum, leads to strong yield losses and yield fluctuations. In organic farming systems the use of plant protection products is strongly limited. Plant strengthening products are compatible to this kind of land use and enhance the resistance of plants to ha...

  13. Covariance of phenotypically plastic traits induces an adaptive shift in host selection behaviour


    Henry, Lee M; Roitberg, Bernard D.; Gillespie, David R


    Flexibility in adult body size allows generalist parasitoids to use many host species at a cost of producing a range of adult sizes. Consequently, host selection behaviour must also maintain a level of flexibility as adult size is related to capture efficiency. In the present study, we investigated covariance of two plastic traits—size at pupation and host size selection behaviour—using Aphidius ervi reared on either Acyrthosiphon pisum or Aulacorthum solani, generating females of disparate s...

  14. Drawing the line


    Saxon, Emma


    The pea aphid Acyrthosiphon pisum is an agriculturally important pest of leguminous plants including peas and broad beans. The widespread use of chemical pesticides impacts heavily on the environment, and increases pesticide-resistant pea aphid populations, so alternative strategies are being actively sought. Pseudomonas syringae bacteria are known to infect and kill the pea aphid, and offer a possible control strategy. In this study, the authors measured the effects of injecting P. syringae ...

  15. Decomposition analysis of LTREs may facilitate the design of short-term ecotoxicological tests


    Hamda, Natnael T.; Jevtić, Dragan M.; Laskowski, Ryszard


    This study compared two methods, based on re-analyzed data from a partly published life table response experiment (LTRE), to help determine the optimal approach for designing ecotoxicological assessments. The 36-day LTRE data recorded the toxic effects of cadmium (Cd) and imidacloprid, alone and in combination, on the reproduction and survivorship of aphids (Acyrthosiphon pisum Harris). We used this data to construct an age-classified matrix model (six age classes, each 6 days long) to estima...

  16. EST Table: FY020030 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FY020030 rbmov26m08 11/11/04 73 %/182 aa dbj|BAH71520.1| ACYPI001763 [Acyrthosiphon pisum] 11/11 ... 4 67 %/174 aa C15F1.6#CE20509#WBGene00000198#locus:art - 1#status:Confirmed#UniProt:Q9N5Y2#protein_id:AAF3 ... 74 aa gi|91092236|ref|XP_971180.1| PREDICTED: similar t o synaptic glycoprotein SC2 [Tribolium castaneum] ...

  17. Effects of some Insecticides Applied in Sublethal Concentrations on the Survival and Longevity of Aphidius ervi (Haliday) (Hymenoptera: Aphidiidae) Adults Efecto de algunos Insecticidas Aplicados en Concentraciones Subletales en la Supervivencia y Longevidad de Adultos de Aphidius ervi (Haliday) (Hymenoptera: Aphidiidae)


    Jaime E. Araya; Manuel Araya; María Angélica Guerrero


    The effects of four insecticides (dimethoate, pirimicarb, imidacloprid, and spinosad) applied in an ST4 Potter tower at sublethal concentrations (50% of those recommended commercially for aphid control) were studied in the laboratory on aphidiid Aphidius ervi (Haliday) adults, an important parasitoid of the pea aphid Acyrthosiphon pisum (Harris). The most selective treatment on the hymenopteran was imidacloprid, followed in decreasing order by spinosad, pirimicarb, and finally dimethoate, whi...

  18. Einfluss des Gemengepartners Leindotter (Camelina sativa L.) auf Beikrautbesatz, Schädlingsbefall und Ertrag in Körnererbsen


    Ackermann, Kerstin; Saucke, Dr. Helmut


    The effect of mixed cropping semi-leafless peas with linseed dodder (Camelina sativa (L.) Crtz.) on weed development and pest incidence was investigated in small plot experiments in Northern Hessen, Germany, over two years. Mixed cropping peas together with linseed dodder had a significant suppressive effect on weed-coverage, in average 62 % efficacy in 2003 and 54 % in 2004, compared to mono cropped peas. The infestation level of pea aphid (Acyrthosiphon pisum) and the damage incidence of pe...

  19. EST Table: FS924396 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available ivity) 10/09/28 41 %/170 aa ref|XP_001944348.1| PREDICTED: similar to tep3, partial [Acyrthosiphon pisum]|3R:10061667:10075623:-1|gene:TEP15 10/09/10 n.h 10/09/10 31 %/185 aa gi|910837...95|ref|XP_972838.1| PREDICTED: similar to tep3 [Tribolium castaneum] FS924396 fwgP ...

  20. Structure and Sensilla of the Mouthparts of the Spotted Lanternfly Lycorma delicatula (Hemiptera: Fulgoromorpha: Fulgoridae), a Polyphagous Invasive Planthopper (United States)

    Hao, Yanan; Dietrich, Christopher H.; Dai, Wu


    Mouthparts are among the most important sensory and feeding structures in insects and comparative morphological study may help explain differences in feeding behavior and diet breadth among species. The spotted lanternfly Lycorma delicatula (White) (Hemiptera: Fulgoromorpha: Fulgoridae) is a polyphagous agricultural pest originating in China, recently established and becoming widespread in Korea, and more recently introduced into eastern North America. It causes severe economic damage by sucking phloem sap and the sugary excrement produced by nymphs and adults serves as a medium for sooty mold. To facilitate future study of feeding mechanisms in this insect, the fine-structural morphology of mouthparts focusing on the distribution of sensilla located on the labium in adult L. delicatula was observed using a scanning electron microscope. The mouthparts consist of a small cone-shaped labrum, a tubular labium and a stylet fascicle consisting of two inner interlocked maxillary stylets partially surrounded by two shorter mandibular stylets similar to those found in other hemipteran insects. The five-segmented labium is unusual (most other Fulgoromorpha have four segments) and is provided with several types of sensilla and cuticular processes situated on the apex of its distal labial segment. In general, nine types of sensilla were found on the mouthparts. Six types of sensilla and four types of cuticular processes are present on sensory fields of the labial apex. The proposed taxonomic and functional significance of the sensilla are discussed. Morphological similarities in the interlocking mechanism of the stylets suggest a relationship between Fulgoromorpha and Heteroptera. PMID:27253390

  1. Characterization of microsatellite DNA libraries from three mealybug species and development of microsatellite markers for Pseudococcus viburni (Hemiptera: Pseudococcidae). (United States)

    Correa, M C G; Zaviezo, T; Le Maguet, J; Herrbach, E; Malausa, T


    Mealybugs (Hemiptera: Pseudococcidae) are important pests for crops worldwide. Different species, cryptic taxa under the same species name or even populations within a species can differ in biological characteristics, such as phenology, resistance to insecticides, virus transmission and susceptibility to natural enemies. Therefore, their management efficacy depends on their accurate identification. Microsatellite genetic markers are efficient in revealing the fine-scale taxonomic status of insects, both at inter- and intra-specific level. Despite their potential uses, microsatellites have been developed only for one mealybug species so far. Hence, it is unclear whether microsatellites may be useful to assess mealybug population differentiation and structuring. In this work, we tested the feasibility of developing microsatellite markers in mealybugs by: (i) producing and characterizing microsatellite DNA libraries for three species: Pseudococcus viburni, Pseudococcus comstocki and Heliococcus bohemicus, and (ii) by developing and testing markers for Ps. viburni. The obtained libraries contained balanced percentages of dinucleotide (ranging from 15 to 25%) and trinucleotide (from 5 to 17%) motifs. The marker setup for Ps. viburni was successful, although 70% of the primers initially tested were discarded for a lack of polymorphism. Finally, 25 markers were combined in two multiplex polymerase chain reactions with 21 displaying no evidence of deviation from Hardy-Weinberg equilibrium. Ps. viburni markers were tested on one population from France and one from Chile. The markers revealed a significant genetic differentiation between the two populations with an Fst estimate of 0.266. PMID:24345408

  2. Taxonomic status of the Bemisia tabaci complex (Hemiptera: Aleyrodidae and reassessment of the number of its constituent species.

    Directory of Open Access Journals (Sweden)

    Wonhoon Lee

    Full Text Available Bemisia tabaci (Hemiptera: Aleyrodidae is one of the most important insect pests in the world. In the present study, the taxonomic status of B. tabaci and the number of species composing the B. tabaci complex were determined based on 1059 COI sequences of B. tabaci and 509 COI sequences of 153 hemipteran species. The genetic divergence within B. tabaci was conspicuously higher (on average, 11.1% than interspecific genetic divergence within the respective genera of the 153 species (on average, 6.5%. This result indicates that B. tabaci is composed of multiple species that may belong to different genera or subfamilies. A phylogenetic tree constructed based on 212 COI sequences without duplications revealed that the B. tabaci complex is composed of a total of 31 putative species, including a new species, JpL. However, genetic divergence within six species (Asia II 1, Asia II 7, Australia, Mediterranean, New World, and Sub Saharan Africa 1 was higher than 3.5%, which has been used as a threshold of species boundaries within the B. tabaci complex. These results suggest that it is necessary to increase the threshold for species boundaries up to 4% to distinguish the constituent species in the B. tabaci complex.

  3. Toxicity and Residual Activity of Insecticides Against Tamarixia triozae (Hymenoptera: Eulophidae), a Parasitoid of Bactericera cockerelli (Hemiptera: Triozidae). (United States)

    Luna-Cruz, Alfonso; Rodríguez-Leyva, Esteban; Lomeli-Flores, J Refugio; Ortega-Arenas, Laura D; Bautista-Martínez, Néstor; Pineda, Samuel


    Bactericera cockerelli (Sulc) (Hemiptera: Triozidae) is one of the most economically important pests of potato, tomato, and peppers in Central America, Mexico, the United States, and New Zealand. Its control is based on the use of insecticides; however, recently, the potential of the eulophid parasitoid Tamarixia triozae (Burks) (Hymenoptera: Eulophidae) for population regulation has been studied. Because T. triozae is likely to be exposed to insecticides on crops, the objective of this study was to explore the compatibility of eight insecticides with this parasitoid. The toxicity and residual activity (persistence) of spirotetramat, spiromesifen, beta-cyfluthrin, pymetrozine, azadirachtin, imidacloprid, abamectin, and spinosad against T. triozae adults were assessed using a method based on the residual contact activity of each insecticide on tomato leaf discs collected from treated plants growing under greenhouse conditions. All eight insecticides were toxic to T. triozae. Following the classification of the International Organization of Biological Control, the most toxic were abamectin and spinosad, which could be placed in toxicity categories 3 and 4, respectively. The least toxic were azadirachtin, pymetrozine, spirotetramat, spiromesifen, imidacloprid, and beta-cyfluthrin, which could be placed in toxicity category 2. In terms of persistence, by day 5, 6, 9, 11, 13, 24, and 41 after application, spirotetramat, azadirachtin, spiromesifen, pymetrozine, imidacloprid, beta-cyfluthrin, abamectin, and spinosad could be considered harmless, that is, placed in toxicity category 1 (pest management programs that include T. triozae. PMID:26453717

  4. Phylogeny and niche conservatism in North and Central American triatomine bugs (Hemiptera: Reduviidae: Triatominae, vectors of Chagas' disease.

    Directory of Open Access Journals (Sweden)

    Carlos N Ibarra-Cerdeña


    Full Text Available The niche conservatism hypothesis states that related species diverge in niche characteristics at lower rates than expected, given their lineage divergence. Here we analyze whether niche conservatism is a common pattern among vector species (Hemiptera: Reduviidae: Triatominae of Trypanosoma cruzi that inhabit North and Central America, a highly heterogeneous landmass in terms of environmental gradients. Mitochondrial and nuclear loci were used in a multi-locus phylogenetic framework to reconstruct phylogenetic relationships among species and estimate time of divergence of selected clades to draw biogeographic inferences. Then, we estimated similarity between the ecological niche of sister species and tested the niche conservatism hypothesis using our best estimate of phylogeny. Triatoma is not monophyletic. A primary clade with all North and Central American (NCA triatomine species from the genera Triatoma, Dipetalogaster, and Panstrongylus, was consistently recovered. Nearctic species within the NCA clade (T. p. protracta, T. r. rubida diverged during the Pliocene, whereas the Neotropical species (T. phyllosoma, T. longipennis, T. dimidiata complex are estimated to have diverged more recently, during the Pleistocene. The hypothesis of niche conservatism could not be rejected for any of six sister species pairs. Niche similarity between sister species best fits a retention model. While this framework is used here to infer niche evolution, it has a direct impact on spatial vector dynamics driven by human population movements, expansion of transportation networks and climate change scenarios.


    Directory of Open Access Journals (Sweden)



    Full Text Available The cultivation of sweet herb of great economic importance for small farmers in the micro and Agrest Swamp of Paraíba and also in the state of Pernambuco. Among the natural enemies, the scissors Euborellia annulipes proves to be a voracious predator, that is, with high ability to attack and feed on different prey, particularly of eggs and immature stages of insects of Lepidoptera, Hemiptera, Coleoptera and Diptera. The objective of this research was to study the biological aspects of E. annulipes on H. foeniculi laboratory. The study was conducted at the Entomology Laboratory, Department of Plant Protection at the UFPB in a climatic chamber, at 25 ± 1 ºC, relative humidity of 70 ± 10% RH and 12 hours. Scissors were selected in adulthood from rearing on artificial diet in the laboratory. From these insects have made observations of posture, viability and morphology of eggs of E. annulipes. Fifty nymphs were selected for each stage of development (1, 2, 3, 4 and 5 of the scissors and fed separately with aphids (1st-2nd, 3rd and 4th instar. There has been evaluation regarding the number and duration of instars. There are five instars to the nymphal stage of E. annulipes, the average incubation period was 12.9 days, pre-oviposition period of 18.2 days and 46.75 eggs per clutch, there was an increase of nymphal E. annulipes in that it offered up more aphids developed.

  6. Performance of Three Adelphocoris spp. (Hemiptera:Miridae) on Flowering and Non-lfowering Cotton and Alfalfa

    Institute of Scientific and Technical Information of China (English)

    GAO Zhen; PAN Hong-sheng; LIU Bing; LU Yan-hui; LIANG Ge-mei


    The genus Adelphocoris (Hemiptera:Miridae) is a group of key insect pests in cotton ifelds in China that includes three dominant species:A. suturalis (Jakovlev), A. lineolatus (Goeze) and A. fasciaticollis (Reuter). Previous ifeld surveys have found that adults of these Adelphocoris species usually move onto speciifc host plants when the plants enter the lfowering stage. To determine the potential trade-offs for this host-plant preference behavior, the performance of these three Adelphocoris spp. on lfowering and non-lfowering cotton and alfalfa were compared in the laboratory. The results showed that Adelphocoris spp. had signiifcantly higher nymphal developmental and survival rates, along with increased adult longevity and fecundity on lfowering cotton and alfalfa than on non-lfowering plants of either species. In addition, compared with cotton plants, alfalfa generally promoted better performance of these three Adelphocoris species, especially for A. lineolatus. Simple correlation analysis indicated that female adult longevity was positively correlated to male adult longevity and female fecundity, and female fecundity was positively correlated to nymphal development and survival rates. This study demonstrated a positive correlation between adult preference and offspring/adult performance for all three Adelphocoris species, with no evidence of any trade-offs for this preference for lfowering host plants. These ifndings support the hypothesis that hemimetabolous insects such as mirid bugs have positive adult preference-adult/nymphal performance relationships, which is likely due to the similar feeding habits and nutritional requirements of adults and nymphs.

  7. Developmental biology, polymorphism and ecological aspects of Stiretrus decemguttatus (Hemiptera, Pentatomidae, an important predator of cassidine beetles

    Directory of Open Access Journals (Sweden)

    Lucia Maria Paleari


    Full Text Available Developmental biology, polymorphism and ecological aspects of Stiretrus decemguttatus (Hemiptera, Pentatomidae, an important predator of cassidine beetles. Stiretrus decemguttatus is an important predator of two species of cassidine beetles, Botanochara sedecimpustulata (Fabricius, 1781 and Zatrephina lineata (Fabricius, 1787 (Coleoptera, Cassidinae, on the Marajó Island, Brazil. It attacks individuals in all development stages, but preys preferentially on late-instar larvae. Its life cycle in the laboratory was 43.70 ± 1.09 days, with an egg incubation period of six days and duration from nymph and adult stages of 16.31 ± 0.11 and 22.10 ± 1.67 days, respectively. The duration of one generation (T was 12.65 days and the intrinsic population growth rate (r 0.25. These data reveal the adjustment of the life cycle of S. decemgutattus with those of the two preys, but suggest greater impact on Z. lineata. However, no preference over cassidine species was shown in the laboratory. Up to 17 different color patterns can be found in adults of S. decemguttatus, based on combinations of three basic sets of color markings. Some of them resemble the markings of chrysomelids associated with Ipomoea asarifolia (Convolvulaceae and are possibly a mimetic ring. Three color patterns were identified in nymphs, none of which was associated with any specific adult color pattern.

  8. Horizontal Transmission of "Candidatus Liberibacter solanacearum" by Bactericera cockerelli (Hemiptera: Triozidae on Convolvulus and Ipomoea (Solanales: Convolvulaceae.

    Directory of Open Access Journals (Sweden)

    Glenda L Torres

    Full Text Available "Candidatus Liberibacter solanacearum" (Proteobacteria is an important pathogen of solanaceous crops (Solanales: Solanaceae in North America and New Zealand, and is the putative causal agent of zebra chip disease of potato. This phloem-limited pathogen is transmitted to potato and other solanaceous plants by the potato psyllid, Bactericera cockerelli (Hemiptera: Triozidae. While some plants in the Convolvulaceae (Solanales are also known hosts for B. cockerelli, previous efforts to detect Liberibacter in Convolvulaceae have been unsuccessful. Moreover, studies to determine whether Liberibacter can be acquired from these plants by B. cockerelli are lacking. The goal of this study was to determine whether horizontal transmission of Liberibacter occurs among potato psyllids on two species of Convolvulaceae, sweet potato (Ipomoea batatas and field bindweed (Convolvulus arvensis, which grows abundantly in potato growing regions of the United States. Results indicated that uninfected psyllids acquired Liberibacter from both I. batatas and C. arvensis if infected psyllids were present on plants concurrently with the uninfected psyllids. Uninfected psyllids did not acquire Liberibacter from plants if the infected psyllids were removed from the plants before the uninfected psyllids were allowed access. In contrast with previous reports, PCR did detect the presence of Liberibacter DNA in some plants. However, visible amplicons were faint and did not correspond with acquisition of the pathogen by uninfected psyllids. None of the plants exhibited disease symptoms. Results indicate that horizontal transmission of Liberibacter among potato psyllids can occur on Convolvulaceae, and that the association between Liberibacter and Convolvulaceae merits additional attention.

  9. Encasing mattresses in black plastic will not provide thermal control of bed bugs, Cimex spp. (Hemiptera: Cimicidae). (United States)

    Doggett, Stephen L; Geary, Merilyn J; Russell, Richard C


    The suggestion that bed bug (Cimex spp.; Hemiptera: Cimicidae)-infested mattresses wrapped in black plastic and exposed to sunlight will be heated sufficiently to kill the bed bugs was tested. Two types of mattresses were tested: a thin mattress of solid foam rubber and a thick multilayered inner spring mattress. Temperature probes were placed on both upper and lower sides of the mattresses, which were wrapped in black plastic and placed outside on a summer day for >9 h wherein the ambient temperature peaked at 36.5 degrees C. The maximum recorded temperature on the upper (sun-exposed) sides was 85 degrees C for both mattresses, whereas lower side temperatures for the thick mattress never exceeded 35 degreesC, and some areas of the thin mattress failed to exceed 36.50C. Therefore, with published thermal death points of 40-45 degrees C depending on exposure time, and opportunities for bed bugs to avoid lethal temperatures by retreating from hot zones, this technique seems to be not suitable for bed bug management. PMID:17195683

  10. Structure and Sensilla of the Mouthparts of the Spotted Lanternfly Lycorma delicatula (Hemiptera: Fulgoromorpha: Fulgoridae, a Polyphagous Invasive Planthopper.

    Directory of Open Access Journals (Sweden)

    Yanan Hao

    Full Text Available Mouthparts are among the most important sensory and feeding structures in insects and comparative morphological study may help explain differences in feeding behavior and diet breadth among species. The spotted lanternfly Lycorma delicatula (White (Hemiptera: Fulgoromorpha: Fulgoridae is a polyphagous agricultural pest originating in China, recently established and becoming widespread in Korea, and more recently introduced into eastern North America. It causes severe economic damage by sucking phloem sap and the sugary excrement produced by nymphs and adults serves as a medium for sooty mold. To facilitate future study of feeding mechanisms in this insect, the fine-structural morphology of mouthparts focusing on the distribution of sensilla located on the labium in adult L. delicatula was observed using a scanning electron microscope. The mouthparts consist of a small cone-shaped labrum, a tubular labium and a stylet fascicle consisting of two inner interlocked maxillary stylets partially surrounded by two shorter mandibular stylets similar to those found in other hemipteran insects. The five-segmented labium is unusual (most other Fulgoromorpha have four segments and is provided with several types of sensilla and cuticular processes situated on the apex of its distal labial segment. In general, nine types of sensilla were found on the mouthparts. Six types of sensilla and four types of cuticular processes are present on sensory fields of the labial apex. The proposed taxonomic and functional significance of the sensilla are discussed. Morphological similarities in the interlocking mechanism of the stylets suggest a relationship between Fulgoromorpha and Heteroptera.

  11. Employing immunomarkers to track dispersal and trophic relationships of a piercing-sucking predator, Podisus maculiventris (Hemiptera: Pentatomidae). (United States)

    Kelly, Jessica L; Hagler, James R; Kaplan, Ian


    Immunoproteins are markers that are useful for monitoring dispersal and/or pest consumption, but current application techniques are less effective for the large guild of piercing-sucking predators important in biocontrol. We quantified the use of protein immunomarks in tracking emigration of spined soldier bug, Podisus maculiventris Say (Hemiptera: Pentatomidae) and predation on the hornworm caterpillar, Manduca sexta L. (Lepidoptera: Sphingidae). An external protein mark was topically applied to adult P. maculiventris to assess persistence under field conditions for >2 wk. Internal marks were incorporated into the artificial diet of M. sexta to test retention of the internal mark in the prey and uptake of the mark by predators. External marks remained detectable in 100% of individuals after 3 d and >50% still tested positive at 12 d after application in the field. Internal diet-based marking was also effective in tracking feeding by P. maculiventris on M. sexta, especially using rabbit IgG that was far more persistent than chicken IgY. Nearly 90% of stink bugs fed caterpillars previously reared on protein-enriched diet retained their mark for 24 h. Surprisingly, diet concentration and time reared on diet had comparatively little impact on mark retention. Development on unmarked tomato leaves clearly diluted the initial diet mark, but plant-reared individuals that were marked were still successfully detected in 35 and 20% of the predators. PMID:23321101

  12. Population genetic structure and post-LGM expansion of the plant bug Nesidiocoris tenuis (Hemiptera: Miridae) in China. (United States)

    Xun, Huaizhu; Li, Hu; Li, Shujuan; Wei, Shujun; Zhang, Lijuan; Song, Fan; Jiang, Pei; Yang, Hailin; Han, Fei; Cai, Wanzhi


    The plant bug, Nesidiocoris tenuis (Hemiptera: Miridae), is one of the most thermophilous dicyphines in agroecosystems and is widely distributed in China. Little is known regarding the genetic structure of N. tenuis and the effect of historical climatic fluctuations on N. tenuis populations. We analyzed partial sequences of three mitochondrial protein-coding genes (COI, ND2 and CytB) and nuclear genes (5.8S, ITS2 and 28S) for 516 specimens collected from 37 localities across China. Analyses of the combined mitochondrial dataset indicated that the Southwestern China group (SWC) was significantly differentiated from the remaining populations, other Chinese group (OC). Asymmetric migration and high level of gene flow across a long distance within the OC group was detected. The long-distance dispersal of N. tenuis might be affected by air currents and human interference. Both the neutrality tests and mismatch distributions revealed the occurrence of historical population expansion. Bayesian skyline plot analyses with two different substitution rates indicated that N. tenuis might follow the post-LGM (the Last Glacial Maximum) expansion pattern for temperate species. Pleistocene climatic fluctuation, complicated topography and anthropogenic factors, along with other ecological factors (e.g. temperature and air current) might have accounted for the current population structure of N. tenuis. PMID:27230109

  13. Identification of the Population Structure of Myzus persicae (Hemiptera: Aphididae) on Peach Trees in China Using Microsatellites (United States)

    Li, Jie; Cao, Jinjun; Niu, Jianqun; Liu, Xiaoxia; Zhang, Qingwen


    In this study, we characterized the genetic structure of Myzus persicae (Sulzer) (Hemiptera: Aphididae) populations in China using microsatellites. We expected that these data will reveal the genetic relationships among various populations of M. persicae and will be of value in the development of better methods for pest control. Four hundred sixty individuals from 23 areas over 13 provinces were collected in the early spring of 2010, all from their primary host, Prunus persicae. The markers analyzed were highly polymorphic, as demonstrated by the expected heterozygosity value (He = 0.861) and the Polymorphism Information Content (PIC = 0.847), which indicated that M. persicae maintains a high level of genetic diversity. Analysis of molecular variance revealed an intermediate level of population differentiation among M. persicae populations (FST = 0.1215). Geographic isolation existed among these populations, and, consequently, the genetic structure of the populations was split into a southern group and a northern group divided by the Yangtse River. PMID:26106085

  14. Infection Rate by Trypanosoma cruzi and Biased Vertebrate Host Selection in the Triatoma dimidiata (Hemiptera: Reduvidae) Species Complex. (United States)

    Ramirez-Sierra, M J; Dumonteil, E


    Chagas disease is a vector-borne disease, caused by the protozoan parasite Trypanosoma cruzi and transmitted by hematophagous insects. Triatoma dimidiata (Hemiptera: Reduvidae (Latreille 1811)) is one of the main vectors, and recent molecular studies indicate that it is a species complex, with potentially different vectorial competences. We investigated the differences in natural T. cruzi infection rate within T. dimidiata complex in Yucatan, Mexico. ITS-2 hybrid bugs had a twofold higher infection rate than ITS-2 Groups 2 and 3 bugs, and this pattern was consistent over time and in several villages. To test if T. dimidiata ITS-2 hybrid bugs could feed more frequently on T. cruzi-infected hosts, we evaluated their host-seeking behavior in a dual-choice chamber. Group 2 and 3 bugs were equally attracted to T. cruzi-infected or uninfected mice. On the contrary, ITS-2 hybrid bugs reached three times more frequently the T. cruzi-infected mouse, compared to the uninfected one, indicating a significant bias toward an infected host. This behavior may explain in part their higher natural infection rate. Further studies should explore the complex and unique interactions among T. cruzi, triatomines vectors, and mammalian hosts, as this may led to new strategies to interfere with transmission cycles and improve Chagas disease control. PMID:26474882

  15. Parasitoids associated with the black scale Saissetia oleae(Olivier (Hemiptera: Coccidae in olive trees in Minas Gerais State, Brazil

    Directory of Open Access Journals (Sweden)

    Ernesto Prado


    Full Text Available Black scale, Saissetia oleae (Olivier (Hemiptera: Coccidae is an important pest of olive trees (Olea europaea L. that requires the use insecticides for its control. Parasitoids are important regulating agents of this pest, but currently, no information on its complex of natural enemies and their impact on black scale in Brazilian conditions exists. This study focused on identifying parasitoid wasps that were associated with the black scale on olive trees to establish their relative abundance and rate of parasitism. Samplings were maintained in an olive orchard located in Maria da Fe, south of the state of Minas Gerais, Brazil, and infested branches were stored in emergence containers to recover parasitoids. Another group was kept in Flanders batteries to evaluate the rate of parasitism in approximately 100 scales. Sixteen parasitoid species were collected during the sampling period, and the most common species were Coccophagus caridei (Brèthes (Hymenoptera: Aphelinidae, Diversinervus elegans Silvestri (Hymenoptera: Encyrtidae, and Mesopeltita truncatipennis (Waterston (Hymenoptera: Pteromalidae, the latter of which was most abundant and frequent. Parasitism ranged from 3 to 31% with peaks in summer and autumn. This level could be considered insufficient to hold the black scale under the economic injury level; however, these parasitoids should be preserved for contributions to population regulation.

  16. Influence of Type of Electric Bright Light on the Attraction of the African Giant Water Bug, Lethocerus indicus (Hemiptera: Belostomatidae

    Directory of Open Access Journals (Sweden)

    Luke Chinaru Nwosu


    Full Text Available This study investigated the influence of type of electric bright light (produced by fluorescent light tube and incandescent light bulb on the attraction of the African giant water bug, Lethocerus indicus (Hemiptera: Belostomatidae. Four fluorescent light tubes of 15 watts each, producing white-coloured light and four incandescent light bulbs of 60 watts each, producing yellow-coloured light, but both producing the same amount of light, were varied and used for the experiments. Collections of bugs at experimental house were done at night between the hours of 8.30 pm and 12 mid-night on daily basis for a period of four months per experiment in the years 2008 and 2009. Lethocerus indicus whose presence in any environment has certain implications was the predominant belostomatid bug in the area. Use of incandescent light bulbs in 2009 significantly attracted more Lethocerus indicus 103 (74.6% than use of fluorescent light tubes 35 (25.41% in 2008 [4.92=0.0001]. However, bug’s attraction to light source was not found sex dependent [>0.05; (>0.18=0.4286 and >0.28=0.3897]. Therefore, this study recommends the use of fluorescent light by households, campgrounds, and other recreational centres that are potentially exposed to the nuisance of the giant water bugs. Otherwise, incandescent light bulbs should be used when it is desired to attract the presence of these aquatic bugs either for food or scientific studies.

  17. Identification guide to Nordic aphids associated with mosses, horsetails and ferns (Bryophyta, Equisetophyta, Polypodiophyta (Insecta, Hemiptera, Aphidoidea

    Directory of Open Access Journals (Sweden)

    Anders Christian Albrecht


    Full Text Available Keys and diagnoses of North European aphids (Hemiptera, Aphidoidea associated with mosses, horsetails and ferns are given, based on fresh and freeze-dried material. Numerous externally visible and thus informative characters, that are absent in cleared, slide-mounted specimens, such as body shape colours, wax coating and pattern etc., are utilized. Most of the species are illustrated by photographs of live specimens and drawings. Root-feeding species living in the moss layer or otherwise often present in moss samples are also included, even if their hosts were spermatophytes. The combination of colour images and diagnoses, utilizing easily observed characters, allows the identification of a large number of species already in the field, and many more at home with the aid of a stereo microscope. Host plant relationships and association with ants are summarised, including new records. Brief accounts on aphid life cycles, freeze-drying preparation techniques, etc. are also given to support the use of the keys.

  18. Potential of Metarrhizium anisopliae and Beauveria bassiana isolates and Neem oil to control the aphid Lipaphis erysimi (Kalt.) (Hemiptera: Aphididae)

    International Nuclear Information System (INIS)

    This work aimed to determine the efficiency of the entomopathogenic fungi Metarrhizium anisopliae and Beauveria bassiana to control the aphid Lipaphis erysimi (Kalt.) (Hemiptera:Aphididae) in kale Brassica oleracea var acephala D.C., as well as their compatibility with a neem oil formulation (NeemsetoR). Ten isolates of both fungi were tested and the most pathogenic ones were B. bassiana CG001 and M. anisopliae CG30 with 90% and 4.4 days, and 64% and 3.8 days of mortality and median lethal time, respectively. Bioassays with neem at concentrations of 0.5, 1.0 and 2.0% were done either by leaf discs dipping or spraying the aphids on the leaf discs. The neem spraying treatment at 2.0% provided 90% mortality. The use of B. bassiana isolate CG001 or M. anisopliae isolate CG30 with neem at 0.125, 0.25, and 0.5%, demonstrated that these isolates could have their spore viability or colony growth affected when exposed to neem concentrations higher than 0.25%. In absolute values, the isolates B. bassiana CG001 and M. anisopliae CG30 are the most virulent to L. erysimi, and could be utilized in the management of this pest. (author)

  19. Putting scales into evolutionary time: the divergence of major scale insect lineages (Hemiptera) predates the radiation of modern angiosperm hosts (United States)

    Vea, Isabelle M.; Grimaldi, David A.


    The radiation of flowering plants in the mid-Cretaceous transformed landscapes and is widely believed to have fuelled the radiations of major groups of phytophagous insects. An excellent group to test this assertion is the scale insects (Coccomorpha: Hemiptera), with some 8,000 described Recent species and probably the most diverse fossil record of any phytophagous insect group preserved in amber. We used here a total-evidence approach (by tip-dating) employing 174 morphological characters of 73 Recent and 43 fossil taxa (48 families) and DNA sequences of three gene regions, to obtain divergence time estimates and compare the chronology of the most diverse lineage of scale insects, the neococcoid families, with the timing of the main angiosperm radiation. An estimated origin of the Coccomorpha occurred at the beginning of the Triassic, about 245 Ma [228–273], and of the neococcoids 60 million years later [210–165 Ma]. A total-evidence approach allows the integration of extinct scale insects into a phylogenetic framework, resulting in slightly younger median estimates than analyses using Recent taxa, calibrated with fossil ages only. From these estimates, we hypothesise that most major lineages of coccoids shifted from gymnosperms onto angiosperms when the latter became diverse and abundant in the mid- to Late Cretaceous. PMID:27000526

  20. Reproductive Requirements and Life Cycle of Iberorhyzobius rondensis (Coleoptera: Coccinellidae), Potential Biological Control Agent of Matsucoccus feytaudi (Hemiptera: Matsucoccidae). (United States)

    Tavares, C; Jactel, H; van Halder, I; Branco, M


    Several pine bast scales (Hemiptera: Matsucoccidae) are important pests of pine trees in the Northern Hemisphere. Some species are invasive and cause significant economic and environmental impacts. Such is the case with Matsucoccus feytaudi Ducasse, an invasive pest of maritime pine forests in Southeastern France, Italy, and Corsica. The ladybird Iberorhyzobius rondensis (Eizaguirre) is a recently described species that is endemic to the Iberian Peninsula and is a potential candidate for the biological control of M. feytaudi. However, little is known of the biology of I. rondensis. As part of the risk assessment study for a classical biological control program, the phenology and reproductive mechanisms of the beetle were analyzed. I. rondensis is univoltine and is seasonally synchronized with the phenology of the prey M. feytaudi, which is also univoltine. An obligatory reproductive diapause of 5-6 mo and the need to feed on the eggs of the prey to begin oviposition emerged as the two primary mechanisms that assure life cycle synchronization of the ladybird with its prey. Female fecundity was also higher when the ladybirds were fed M. feytaudi eggs. Life cycle synchronization with M. feytaudi and reproduction triggered by consumption of prey eggs indicate that I. rondensis is a promising biological control agent of the pine bast scale. PMID:26313991

  1. Testing Spirotetramat as an Alternative Solution to Abamectin for Cacopsylla pyri (Hemiptera: Psyllidae) Control: Laboratory and Field Tests. (United States)

    Civolani, Stefano; Boselli, Mauro; Butturini, Alda; Chicca, Milvia; Cassanelli, Stefano; Tommasini, Maria Grazia; Aschonitis, Vassilis; Fano, Elisa Anna


    Aim of the study was to investigate the performance of the new insecticide "spirotetramat" as an alternative solution of "abamectin" for the control of Cacopsylla pyri L. (Hemiptera: Psyllidae) in the context of an IPM program in European pear, Pyrus communis L.. Laboratory bioassays for the estimation of LC50 and LC90 of both insecticides were performed using four populations collected in Emilia-Romagna (Italy) orchards where different pest management strategies were used (organic, integrated, and conventional). The same populations were also analyzed for the main insecticide detoxifying activities in nymphs by spectrofluorimetric in vitro assays. The performance of the two insecticides was also tested on field on one population under integrated pest management conditions. The laboratory experiments showed that the LC90 of spirotetramat were lower than the highest field concentration allowed in Europe (172.80 mg AI liter(-1)) giving reassurance about the efficacy of the product. Concerning the abamectin, the laboratory bioassays did not show strong indications of resistance development of C. pyri populations of Emilia-Romagna. A similarity in enzyme detoxifying activity was observed in both insecticides indicating a general absence of a significant insecticide resistance. The field trial showed a high efficacy (>90 %) of spirotetramat on C. pyri already after 15 d from application, and it was significantly higher from abamectin. Overall, spirotetramat is one more choice for C. pyri control, as well as abamectin in order to minimize the risks of occurrence of insecticide resistance. PMID:26470374

  2. First evidence for (TTAGG)n telomeric sequence and sex chromosome post-reduction in Coleorrhyncha (Insecta, Hemiptera) (United States)

    Kuznetsova, Valentina G.; Grozeva, Snejana M.; Hartung, Viktor; Anokhin, Boris A.


    Abstract Telomeric repeats are general and significant structures of eukaryotic chromosomes. However, nothing is known about the molecular structure of telomeres in the enigmatic hemipteran suborder Coleorrhyncha (moss bugs) commonly considered as the sister group to the suborder Heteroptera (true bugs). The true bugs are known to differ from the rest of the Hemiptera in that they display an inverted sequence of sex chromosome divisions in male meiosis, the so-called sex chromosome post-reduction. To date, there has been no information about meiosis in Coleorrhyncha. Here we report a cytogenetic observation of Peloridium pomponorum, a representative of the single extant coleorrhynchan family Peloridiidae, using the standard chromosome staining and fluorescence in situ hybridization (FISH) with a (TTAGG)n telomeric probe. We show that Peloridium pomponorum displays 2n = 31 (30A + X) in males, the classical insect (TTAGG)n telomere organization and sex chromosome post-reduction during spermatocyte meiosis. The plesiomorphic insect-type (TTAGG)n telomeric sequence is suggested to be preserved in Coleorrhyncha and in a basal heteropteran infraorder Nepomorpha, but absent (lost) in the advanced heteropteran lineages Cimicomorpha and Pentatomomorpha. The telomere structure in other true bug infraorders is currently unknown. We consider here the inverted sequence of sex chromosome divisions as a synapomorphy of the group Coleorrhyncha + Heteroptera. PMID:26753072

  3. Potential for classical biological control of the potato bug Closterotomus norwegicus (Hemiptera: Miridae): description, parasitism and host specificity of Peristenus closterotomae sp. n. (Hymenoptera: Braconidae). (United States)

    Haye, T; van Achterberg, C; Goulet, H; Barratt, B I P; Kuhlmann, U


    The potato bug, Closterotomus norwegicus (Gmelin) (Hemiptera: Miridae) is an introduced pest of lucerne, white clover and lotus seed crops in New Zealand and a key pest of pistachios in California, USA. Efforts were made to identify potential biological control agents of C. norwegicus in Europe. A total of eight parasitoids, including six primary parasitoids from the genus Peristenus (Hymenoptera: Braconidae) and two hyperparasitoids from the genus Mesochorus (Hymenoptera: Ichneumonidae), were reared from C. norwegicus nymphs collected in various habitats in northern Germany. With a proportion of more than 85% of all C. norwegicus parasitoids, Peristenus closterotomae (Hymenoptera: Braconidae), a new species, was the most dominant parasitoid, whereas other parasitoid species only occurred sporadically. Peristenus closterotomae did not fit in the keys to any described species and is described as new to science. Parasitism caused by P. closterotomae was on average 24% (maximum 77%). To assess the host specificity of parasitoids associated with C. norwegicus, the parasitoid complexes of various Miridae occurring simultaneously with C. norwegicus were studied. Peristenus closterotomae was frequently reared from Calocoris affinis (Herrich-Schaeffer), and a few specimens were reared from Calocoris roseomaculatus (De Geer) and the meadow plant bug, Leptopterna dolobrata (Linnaeus) (all Hemiptera: Miridae). The remaining primary parasitoids associated with C. norwegicus were found to be dominant in hosts other than C. norwegicus. Whether nymphal parasitoids may potentially be used in a classical biological control initiative against the potato bug in countries where it is introduced and considered to be a pest is discussed. PMID:16923210


    Directory of Open Access Journals (Sweden)

    Harley Nonato de Oliveira


    Full Text Available O objetivo desse trabalho foi avaliar a não preferência para a oviposição de Vatiga illudens (Drake, 1922 (Hemiptera: Tingidae importante inseto com potencial de causar danos econômicos em cultivares de mandioca. Compararam-se as cultivares Kiriris, N-25, Fécula Branca, IAC 90, M Ecu 72 e IAC 576, essas com potencial produtivo para a região sul de Mato Grosso do Sul. Foram realizados ensaios de preferência para oviposição, com o teste sem chance de escolha, em condições de semi-campo. Um casal adulto de V. illudens foi liberado nas folhas de mandioca das respectivas cultivares. Permitiu-se a alimentação e oviposição desses insetos por 72 horas. Avaliou-se o número de ovos/fêmea/folha, o número de excrementos/casal/folha e o índice de preferência para oviposição. A cultivar M Ecu 72 revelou-se altamente resistente ao percevejo-de-renda. Esse estudo evidenciou que há mecanismos de resistência a V. illudens em cultivares de mandioca, o que justifica a realização de novos estudos sobre essas cultivares em programas de seleção, visando o controle dessa praga e identificação de tais mecanismos.Non-Preference for Oviposition Cassava Lace Bug Vatiga illudens (Hemiptera: Tingidae by Cassava CultivarsThe aim of this study was to evaluate the non-preference for oviposition Vatiga illudens (Drake, 1922 (Hemiptera: Tingidae in cassava cultivars. The following cultivars were compared: Kiriris, N-25, Fécula Branca, IAC 90, M Ecu 72 and IAC 576, preference tests for oviposition were conducted, with a choice test in semi-field conditions. An adult double V. illudens was released in the leaves of cassava of their cultivars. Allowed to feeding and oviposition of these insects for 72 hours. We evaluated the number of eggs / female / leaf, the number of droppings / couple / sheet and the preference index for oviposition. The cultivar M Ecu 72 demonstrated to be highly resistant to cassava lace bug. This study showed that there are

  5. Laboratory rearing technique of Mahanarva fimbriolata (Stål (Hemiptera: Cercopidae Técnicas de criação, em latoratório, de Mahanarva fimbriolata (Stål (Hemiptera: Cercopidae

    Directory of Open Access Journals (Sweden)

    José Francisco Garcia


    Full Text Available Due to the importance of cercopids as pests in sugarcane and forage grass, researches have been conducted in order to address aspects related to the bioecology and control of these insects. The objective of this study was to develop a rearing technique for Mahanarva fimbriolata (Stål (Hemiptera: Cercopidae on sugarcane, in the laboratory (25 ± 1ºC; 70 ± 10% RH; and 14-hour photophase. Adults were isolated in cylindrical cages containing one sugarcane plant, with a moistened cotton disc surrounding the base of the plant as a site for oviposition. Eggs were removed from the cotton disc by washing it in running water over sieves and maintained in Petri dishes on moistened filter paper until the nymphs hatched. The newly hatched nymphs were transferred to sugarcane roots and placed into boxes with lids, to keep a moistened and dark environment favoring their development and maintaining the root system, providing food access to the developing nymphs. This method allowed M. fimbriolata to be maintained in laboratory conditions throughout the year, which would certainly foster research on this insect.Devido à importância da cigarrinha como praga da cultura da cana-de-açúcar, diversos estudos tem sido conduzidos para elucidar aspectos relacionados à bioecologia e controle desses insetos. Esta pesquisa foi realizada com o objetivo de desenvolver uma técnica de criação para Mahanarva fimbriolata (Stål (Hemiptera: Cercopidae sobre cana-de-açúcar, em laboratório (25 ± 1ºC, UR de 70 ± 10% e fotofase de 14 horas. Adultos foram isolados em gaiolas cilíndricas, com uma planta de cana-de-açúcar, contendo um disco de algodão úmido, envolto à base, como local de oviposição. Os ovos foram retirados mediante lavagem em água corrente sobre peneiras e mantidos em placas de Petri sobre papel filtro umedecido até a eclosão das ninfas. Logo após, as ninfas foram transferidas para raízes da planta e acondicionadas em caixa com tampa, para

  6. Danos qualitativos e quantitativos de Cinara atlantica (Wilson (Hemiptera, Aphididae em mudas de Pinus taeda Linnaeus (Pinaceae1 Qualitative and quantitative damage by Cinara atlantica (Wilson (Hemiptera, Aphididae on Pinus taeda Linnaeus seedlings (Pinaceae

    Directory of Open Access Journals (Sweden)

    Scheila R. M. Zaleski


    Full Text Available O pulgão-gigante-do-pinus, Cinara atlantica (Wilson, 1919 (Hemiptera, Aphididae, é considerado atualmente uma das principais pragas dos reflorestamentos de pinus no Brasil. Como a informação sobre os danos causados por esta praga é restrita, esta pesquisa teve como objetivo caracterizar e quantificar os danos de C. atlantica em Pinus taeda. O experimento foi desenvolvido em casa de vegetação, seguindo um delineamento inteiramente casualizado. Foram testados três níveis de infestação com densidades populacionais de zero (testemunha protegida com inseticida 10 ± 2, 20 ± 2 e 50 ± 2 afídeos por muda de P. taeda com idades de 90 e 150 dias. As mudas atacadas apresentaram redução no desenvolvimento, entortamento do fuste, superbrotação e presença abundante de fumagina devido ao desenvolvimento de fungo sobre o honeydew eliminado pelos afídeos. O diâmetro do colo diminuiu significativamente em 16,1% na densidade de 50 ± 2 afídeos/planta, nas mudas com 90 dias, quando comparado à testemunha. Nas mudas com 150 dias não houve diferença significativa no diâmetro do colo entre as parcelas infestadas e a testemunha. Houve uma redução de 24,4% na altura das mudas de 90 dias com a densidade de 50 ± 2 afídeos e 32,6% nas mudas de 150 dias, com intensidade de 20 ± 2 afídeos.The giant conifer aphid, Cinara atlantica (Wilson, 1919 (Hemiptera, Aphididae, is one of the main insect pests on pine reforestation areas in Southern Brazil, nowadays. Since there is very few information about its damage, the objective of this study was to characterize and quantify the damage of C. atlantica on Pinus taeda. The experiment was carried out in a greenhouse, using a random design, with three infestation levels: 0 (control, 10 ± 2, 20 ± 2 and 50 ± 2 aphids on each P. taeda seedling of 90 and 150 days old, with 20 replicates/treatment. The main damage observed were stunting, twisting, oversprouting and large amount of sooty mold on honeydew

  7. Aspectos biológicos, morfológicos e comportamentais de Aspidiotus nerii Bouché, 1833 (Hemiptera: Diaspididae Biological, morphological and behavioral aspects of Aspidiotus nerii Bouché, 1833 (Hemiptera: Diaspididae

    Directory of Open Access Journals (Sweden)

    Kelly Cristina Gonçales Rocha


    Full Text Available O presente trabalho teve por objetivo estudar os aspectos biológicos, morfológicos e comportamentais de uma linhagem unipariental de Aspidiotus nerii Bouché, 1833 (Hemiptera: Diaspididae, sob condições controladas (25±1oC, 70±10% de UR e 12 horas de fotofase, tendo abóboras híbridas "cabotiá" como hospedeiro. Ninfas recém-eclodidas foram transferidas da criação massal para abóboras "cabotiá", devidamente higienizadas, dispostas em câmaras climatizadas. O período médio para fixação das ninfas móveis foi de 2,4±0,33 horas. A duração média do 1° e 2° estádios, após a fixação das ninfas, foi de 8,3±0,06 e 19,4±0,11 dias, respectivamente, totalizando fase ninfal média de 27,9±0,11 dias. Das ninfas que atingiram a fase adulta, 36 fêmeas foram acompanhadas diariamente até o final do ciclo. A duração média dos períodos pré-reprodutivo e reprodutivo foi de 17,3±0,18 e 68,2±4,33 dias, respectivamente. O número total médio de ninfas/fêmea foi 175,5±10,29 e o número médio de ninfas/fêmea/dia foi 2,7±0,11. A longevidade média das fêmeas foi 100,5±4,51 dias.The objective of this work was to study the biology, morphology and behavior of Aspidiotus nerii Bouché, 1833 (Hemiptera: Diaspididae under controlled conditions (25±1°C, 70±10% R.H. and 12 hours of photophase, using "cabotiá" cucumber pumpkins as hosts. Nymphs of the 1st stage obtained of mass rearing (mother culture were transfered to "cabotiá" pumpkins, properly cleaned and disposed in acclimatized cameras. The medium period for fixation of the nymphs was of 2.4±0.33 hours. The 1st and 2nd stages, after the fixation of the nymphs, lasted 8.3±0.06 and 19.4±0.11 days, respectively, totalizing a nymphal phase of 27.9±0.11 days. 36 females were observed daily until the end of the cycle. The pre-reproductive and reproductive periods lasted 17.3±0.18 and 68.2±4.33 days, respectively. The medium total number of nymphs/female was 175.5±10

  8. Phytophagy on eucalyptus plants increases the development and reproduction of the predator Podisus nigrispinus (Hemiptera: Pentatomidae = Fitofagia em plantas de eucaliptos aumenta o desenvolvimento e a reprodução do predador Podisus nigrispinus (Hemiptera: Pentatomidae.

    Directory of Open Access Journals (Sweden)

    Anderson Mathias Holtz


    Full Text Available The effect of plant feeding on biological aspects of Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae was evaluated. Nymphs and adults of this predator were fed with Tenebrio molitor L. (Coleoptera: Tenebrionidae pupae on Eucalyptus urophylla plants inthe field or only with pupae of this prey in the laboratory. The development and nymphal survival, as well as the pre-oviposition period, number of egg masses, number, fertility and viability of eggs and the longevity of females of this predator were evaluated. The eucalyptus plants improved the development of P. nigrispinus. This demonstrates that this predator can present higher population growth with eucalyptus plants and T. molitor pupae than in the laboratory (controlled conditions only with this prey. These plants can supply nutrients that can the population growth and efficiency of P. nigrispinus for biological control in eucalyptus plantations.O efeito da alimentação em plantas sobre os aspectos biológicos de Podisus nigrispinus (Hemiptera: Pentatomidae foi avaliado. Ninfas e adultos desse predador foram alimentados com pupas de Tenebrio molitor L. (Coleotpera: Tenebrionidae em plantas de Eucalyptus urophylla no campo ou, apenas, em laboratório. O desenvolvimento e a sobrevivência ninfal desse predador, além do período de pré-oviposição, número de posturas, viabilidade dos ovos e afertilidade e longevidade de fêmeas foram avaliados. A planta de eucalipto proporcionou um incremento no desenvolvimento de P. nigrispinus. Isto demonstra que esse predador pode apresentar maior crescimento populacional com plantas de eucalipto e pupas de T. molitor alimentado com apenas a presa (condições controladas. A planta pode fornecer nutrientes que aumentam o crescimento populacional e a eficiência de P. nigrispinus para o controle biológico em plantios de eucalipto.

  9. Threecornered alfalfa hopper (Hemiptera: Membracidae): seasonal occurrence, girdle distribution, and response to insecticide treatment on peanut in South Carolina. (United States)

    Rahman, Khalidur; Bridges, William C; Chapin, Jay W; Thomas, James S


    A survey of threecornered alfalfa hopper, Spissistilus festinus (Say) (Hemiptera: Membracidae), damage in 60 South Carolina peanut, Arachis hypogaea L., fields showed that 89 and 58% of plants had feeding girdles during 2003 and 2004, respectively. Use of a foliar insecticide for other target pests reduced hopper damage. Hopper damage was not affected by sampling distance from the field edge; therefore, injury was adequately assessed at 10 m from field borders. In-furrow insecticide choice, planting date, soil texture, previous crop, or tillage did not measurably affect girdling. Subsequent field experiments demonstrated a cultivar effect on threecornered alfalfa hopper injury, with the standard runner-type cultivar ('Georgia Green') more susceptible than the standard Virginia-type ('NC-V11'). More than 50% of stem girdling occurred on the basal quarter (first five internodes) of the plant. Most feeding occurred on secondary branches of main and lateral stems. Weekly sampling of seven grower fields showed that adult hoppers colonize peanut during June and produce two generations on peanut. Only low levels of plant girding were observed in June, but plant girdling increased gradually through late July, when girdling markedly increased contemporary with peak populations of first generation nymphs and adults. A second increase in plant girdling, observed in early September, coincided with the second generation of nymphs on peanut. Foliar treatments at 45- 60 d after planting (DAP) were most effective in suppressing injury. Granular chlorpyrifos treatment also suppressed hopper injury. There was no yield response to insecticide treatments at the hopper injury levels in these tests (up to six girdles per plant). Although the economic injury level (EIL) for this pest has not been defined, our data indicate that a critical interval for monitoring hopper activity is the first 3 wk of July, before the occurrence of significant injury. Where growers have a consistent risk of

  10. Fertility life table of Lysiphlebus testaceipes (Cresson) (Hymenoptera, Braconidae, Aphidiinae) in Rhopalosiphum maidis (Fitch) and Aphis gossypii Glover (Hemiptera, Aphididae)

    International Nuclear Information System (INIS)

    Fertility life table of Lysiphlebus testaceipes (Cresson) (Hymenoptera, Braconidae, Aphidiinae) in Rhopalosiphum maidis (Fitch) and Aphis gossypii Glover (Hemiptera, Aphididae). The evaluation of the growth potential of Lysiphlebus testaceipes (Cresson) is important for its use in biological control programs of aphids. This work aimed to evaluate the fertility life table of L. testaceipes in Rhopalosiphum maidis (Fitch) and Aphis gossypii Glover. To determine the immature mortality, development and the sex ratio of the parasitoid, 12 females parasitoid, and 480 nymphs of each aphids were used. To evaluate the longevity and fertility 15 female parasitoid were used. Nymphs of each aphid (3 day old) were offered for each parasitoid female daily, until the female died, being 300 (first day); 250 (second day); 200 (third day); 150 (fourth day) and 50 nymphs in the other days. L. testaceipes showed immature mortality rates of 5.6 % in R. maidis and 9.2 % in A. gossypii. The development time of L. testaceipes in R. maidis and A. gossypii was 10.2 and 10.1 days, and the sex ratio of 0.71 and 0.66, respectively. The female of L. testaceipes had a fecundity of 498.8 eggs in R. maidis and 327.8 eggs in A. gossypii. The growth parameters the L. testaceipes in R. maidis and A. gossypii were, respectively Ro= 205.38 and 164.08 females; rm= 0.449 and 0.431 females/females/day; λ= 1.57 and 1.54 females/day; T= 11.86 and 11.83 days and TD= 10.78 and 11.27 days. L. testaceipes showed great growth potential on both aphid hosts. R. maidis could be a suitable host for proposals of mass-rearing and open rearing system using L. testaceipes. (author)

  11. Insecticidal Potential of Clove Essential Oil and Its Constituents on Cacopsylla chinensis (Hemiptera: Psyllidae) in Laboratory and Field. (United States)

    Tian, Bao-Liang; Liu, Qi-Zhi; Liu, Zhi-Long; Li, Peng; Wang, Jie-Wen


    Cacopsylla chinensis (Yang and Li) (Hemiptera: Psyllidae) is an important pest of pear in China. As an alternative to conventional chemical pesticides, botanicals including essential oils and their constituents could provide an eco-friendly and nonhazardous control method. In this study, the essential oil of clove buds (Syzygium aromaticum) was obtained by hydrodistillation. Five constituents, accounting for 99.89% of the oil, were identified by gas chromatography-mass spectrometry, and the major constituents were eugenol (88.61%) and eugenol acetate (8.89%), followed by β-caryophyllene (1.89%). In a laboratory bioassay, clove essential oil, commercial eugenol (99.00%) and β-caryophyllene (98.00%) exhibited strong contact toxicity against the summerform adults of C. chinensis with LD50 values of 0.730, 0.673, and 0.708 µg/adult, and against the nymphs with LD50 values of 1.795, 1.668, and 1.770 µg/nymph, respectively. In contrast, commercial eugenol acetate (98%) had LD50 values of 9.266 µg/adult and 9.942 µg/nymph. In a field trial, clove essential oil caused significant population reductions of 73.01% (4.80 mg/ml), 66.18% (2.40 mg/ml) and 46.56% (1.20 mg/ml), respectively. Our results demonstrated that clove essential oil and its constituents have potential as a source of natural insecticides. PMID:26470216

  12. Risk assessment of selected insecticides on Tamarixia triozae (Hymenoptera: Eulophidae), a parasitoid of Bactericera cockerelli (Hemiptera: Trizoidae). (United States)

    Liu, Tong-Xian; Zhang, Yong-Mei; Peng, Li-Nian; Rojas, Patricia; Trumble, John T


    Tamarixia triozae (Burks) (Hymenoptera: Eulophidae) is an important parasitoid of the potato or tomato psyllid, Bactericera cockerelli (Sulc) (Hemiptera: Trizoidae), a serious pest of potato (Solanum tuberosum L.), tomato (Solanum lycopersicum L.), and other solanaceous vegetables in many countries. To produce a marketable crop, insecticides are required when B. cockerelli populations reach economically damaging levels. We evaluated 11 commonly used insecticides for their effects on T. triozae. Glass-surface residues of spinetoram, imidacloprid-cyfluthrin, abamectin, and tolfenpyrad caused 100% mortality of T. triozae in 72 h, and the leaf residue of spinetoram was extremely toxic to T. triozae adults; even 15-d-old residues caused 100% mortality. Cyantraniliprole, fenpyroximate, pymetrozine, spirotetramat, spiromesifen, and chenopodium oil did not cause significant mortality in either glass surface or leaf-residue bioassays. Ingestion of spinetoram, abamectin, and imidacloprid+cyfluthrin (Leverage) by the adults resulted in 100% mortality in 12 h, and tolfenpyrad, 75.0% mortality in 12 h; whereas chenopodium oil and pymetrozine showed moderate effects on adult survival. Ingestion of abamectin, imidacloprid-cyfluthrin, and spinetoram killed all adults in the first day of treatment, whereas female adults in the treatment of pymetrozine lived 80.8 d, which was similar to those in the control. Ingestion of abamectin, imidacloprid-cyfluthrin, chenopodium oil, and spinetoram killed all male adults in the first day, whereas ingestion of other insecticides did not cause significant mortality, but reduced percent parasitism. Abamectin, imidacloprid-cyfluthrin, and spinetoram had the most deleterious effects on T. triozae, and have the least potential for use in integrated control programs using this parasitoid. PMID:22606819

  13. The complete mitochondrial genome of the stalk-eyed bug Chauliops fallax Scott, and the monophyly of Malcidae (Hemiptera: Heteroptera.

    Directory of Open Access Journals (Sweden)

    Teng Li

    Full Text Available Chauliops fallax Scott, 1874 (Hemiptera: Heteroptera: Malcidae: Chauliopinae is one of the most destructive insect pests of soybean and rice fields in Asia. Here we sequenced the complete mitochondrial genome of this pest. This genome is 15,739 bp long, with an A+T content of 73.7%, containing 37 typical animal mitochondrial genes and a control region. All genes were arranged in the same order as most of other Heteroptera. A remarkable strand bias was found for all nine protein coding genes (PCGs encoded by the majority strand were positive AT-skew and negative GC-skew, whereas the reverse were found in the remaining four PCGs encoded by the minority strand and two rRNA genes. The models of secondary structures for the two rRNA genes of sequenced true bugs and Lygaeoidea were predicted. 16S rRNA consisted of six domains (domain III is absent as in other known arthropod mitochondrial genomes and 45 helices, while three domains and 27 helices for 12S rRNA. The control region consists of five subregions: a microsatellite-like region, a tandem repeats region and other three motifs. The unusual intergenic spacer between tRNA-H and ND4 only found in the species of Lygaeoidea, not in other heteropteran species, may be the synapomorphy of this superfamily. Phylogenetic analyses were carried out based on all the 13 PCGs showed that Chauliopinae was the sister group of Malcinae and the monophyly of Lygaeoidea.

  14. The Effect of an Interspersed Refuge on Aphis glycines (Hemiptera: Aphididae), Their Natural Enemies, and Biological Control. (United States)

    Varenhorst, A J; O'Neal, M E


    Soybean production in the north central United States has relied heavily on the use of foliar and seed applied insecticides to manage Aphis glycines (Hemiptera: Aphididae). An additional management strategy is the use soybean cultivars containing A. glycines resistance genes (Rag). Previous research has demonstrated that Rag cultivars are capable of preventing yield loss equivalent to the use of foliar and seed-applied insecticides.However, the presence of virulent biotypes in North America has raised concern for the durability of Rag genes. A resistance management program that includes a refuge for avirulent biotypes could limit the frequency at which virulent biotypes increase within North America. To what extent such a refuge reduces the effectiveness of aphid-resistant soybean is not clear. We conducted an experiment to determine whether a susceptible refuge mixed into resistant soybean (i.e., interspersed refuge or refuge-in-a-bag) affects the seasonal exposure of aphids, their natural enemies, biological control, and yield protection provided by aphid resistance. We compared three ratios of interspersed refuges (resistant: susceptible; 95:5, 90:10, 75:25) to plots grown with 100%susceptible or resistant soybean. We determined that an interspersed refuge of at least 25% susceptible seed would be necessary to effectively produce avirulent individuals. Interspersed refuges had negligible effects onyield and the natural enemy community. However, there was evidence that they increased the amount of biological control that occurred within a plot. We discuss the compatibility of interspersed refuges for A. glycines management and whether resistance management can prolong the durability of Rag genes. PMID:26476557

  15. Behavioral and Toxicological Responses of Rhodnius prolixus (Hemiptera: Reduviidae) to the Insect Repellents DEET and IR3535. (United States)

    Alzogaray, Raúl A


    ,N-diethyl-3-methylbenzamide (DEET) is a broad-spectrum insect repellent used by millions of people since the 1950s. Ethyl 3-[acetyl(butyl)amino]propanoate (IR3535) is a repellent developed more recently that is still not used as extensively. This study compares the behavioral and toxicological effects of both substances in fifth-instar nymphs of the blood-sucking bug Rhodnius prolixus Stål (Hemiptera: Reduviidae), one of the main vectors of American trypanosomiasis (Chagas disease). Repellency was quantified using filter paper discs as experimental arenas. Half the discs were treated with solution of repellent in acetone, and the other half with acetone alone. The lowest observed effect level was identical for both substances, 74 µg/cm2. Nymph age (between 1-3 h and 99 d from last ecdysis) had no influence on repellency. Topical application of 750 µg of DEET per nymph produced a mortality rate between 0% (24 h after application) and 40% (7 d later). The same dose of IR3535 produced no mortality during the same period of time. Simultaneous treatment with piperonylbutoxide (a mixed function microsomal oxidase inhibitor) synergized the lethal effect of DEET. Only DEET increased locomotor activity in nymphs exposed to a treated surface. Nymph antennectomy abolished DEET repellency but not its effect on locomotor activity. The concentrations of both these compounds required to produce either behavioral or toxicological effects are too high to have any practical applications in the control of R. prolixus. PMID:26637386

  16. Lethal and Inhibitory Activities of Plant-Derived Essential Oils Against Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae) Biotype B in Tomato. (United States)

    Fanela, T L M; Baldin, E L L; Pannuti, L E R; Cruz, P L; Crotti, A E M; Takeara, R; Kato, M J


    The silverleaf whitefly Bemisia tabaci (Genn.) biotype B (Hemiptera: Aleyrodidae) is one of the most severe tomato pests in the world. The damage caused by this insect may compromise up to 100% of crop production, and management of this pest has relied on spraying of synthetic insecticides. However, due to the environmental issues associated with this practice, alternative methods such as the use of botanical pesticides are now used as a strategy of integrated pest management (IPM). We evaluated the effects of essential oils of five plant species on B. tabaci biotype B in tomato and demonstrate that the essential oils (0.5%) of Piper callosum (PC-EO), Adenocalymma alliaceum (AA-EO), Pelargonium graveolens (PG-EO), and Plectranthus neochilus (PN-EO) inhibit the settlement and oviposition of B. tabaci biotype B adults in tomato plants. In fumigation tests, A. alliaceum (AA-EO) at 0.4 μL/L of air after 72 h and 0.1 μL/L of air after 6 h was the most effective against nymphs and adults of B. tabaci biotype B, respectively. The major chemical constituents of PC-EO were identified as being safrole (29.3%), α-pinene (19.2%), and β-pinene (14.3%), whereas diallyl trisulfide (66.9%) and diallyl disulfide (23.3%) were the major compounds identified in AA-EO. This is the first report on the reduction of oviposition by the use of P. callosum (PC-EO) and A. alliaceum (AA-EO). In addition, the fumigant effect of A. alliaceum (AA-EO) on nymphs and adults has also been reported here for the first time. PMID:26712319

  17. Transgenic Cotton-Fed Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) Affects the Parasitoid Encarsia desantisi Viggiani (Hymenoptera: Aphelinidae) Development. (United States)

    Pessoa, R; Rossi, G D; Busoli, A C


    Cotton cultivars expressing Cry proteins are widely used to control lepidopteran pests. The effects of transgenic plants containing insecticidal Cry proteins on non-target species must be comprehended for a better and rational use of this technology for pest management. We investigated the influence of the Bt cotton cultivars NuOPAL and FM 975 on biological parameters of Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), a non-target pest of Bt cotton cultivars and on its parasitoid Encarsia desantisi Viggiani (Hymenoptera: Aphelinidae). The experiments were conducted in a climatized room, and the non-transgenic near isolines were used for rearing whiteflies as control hosts. The effects of the Bt cotton cultivars on the period of embryonic and larval development and the percentage of adult emergence of B. tabaci were assessed. The period required for embryonic, larval, and pupal development and the percentage of emergence and longevity of E. desantisi females were determined using Bt cotton-fed and non-Bt cotton-fed B. tabaci as hosts. Both Bt cotton cultivars resulted in a decrease of approximately 20% of adult emergence of B. tabaci. Differently, an increase of approximately 10% of adult emergence of E. desantisi was observed for parasitoids that used hosts fed with both Bt cotton cultivars. However, female parasitoid longevity decreased when their hosts were fed on Bt cotton cultivars. Our data suggest that the use of Bt cotton cultivars in association with the biological control agent E. desantisi could be functional for the management of B. tabaci in Bt cotton crops. PMID:26431703

  18. Evaluation of six different groups of insecticides for the control of citrus psylla Diaphorina citri (Hemiptera: Psyllidae

    Directory of Open Access Journals (Sweden)

    Rakhmin Gul


    Full Text Available Studies on the efficacy of different insecticides against citrus psylla, Diaphorina citri (Hemiptera: Psyllidae were carried out at Agricultural Research Institute, Tarnab, Peshawar, Pakistan. Six insecticides viz. Actara 25 WG, (thiamethoxam Cascade 10 DC (Flufenoxuron, Match 050 EC (lufenuron, Thiodan 35 EC (endosulfan, Karate 2.5 EC (α-cyhalothrin, and Supracide 40 EC (methidathion, were tested for their effectiveness against D. citri. After first spray overall mean population of D. citri was 3.63, 4.75, 5.59, 6.66, 7.47, 8.11 per six inches tender shoot on Actara 25 WG, Cascade 10 DC, Match 050 EC, Thiodan 35 EC, Karate 2.5 EC and Supracide 40 EC treated plants respectively, while on control plants the population was 12.39. Similarly, after the second spray of each of the same insecticides the population of D. citri was 2.65, 4.23, 5.61, 6.41, 7.35 and 8.73 respectively. Where in controls there were 15.18 psyllids. Percent decrease of D. citri population in comparison to control after the first spray was highest in Actara 25 WG (72.20 followed by Cascade 10 DC (62.91, Match 050 EC (54.07, Thiodan 35 EC (47.61, Karate 2.5 EC (38.94 and Supracide 40 EC (35.74. After the second spray percent decrease over control recorded was highest in Actara 25 WG (83.54, followed by Cascade 10 DC (71.08, Match 050 EC (63.94, Thiodan 35 EC (60.79, Karate 2.5 EC (52.52 and Supracide 40 EC (45.62.

  19. Morphological differences among egg nests and adult individuals of Cicadatra persica (Hemiptera, Cicadidae, distributed in Erneh, Syria

    Directory of Open Access Journals (Sweden)

    Marah Dardar


    Full Text Available The aim of this study is determining the different patterns of egg nests and the morphological differences between the specimens of Cicadatra persica Kirkalidy, 1909 (Hemiptera: Cicadidae distributed in fruit orchards in Erneh located on AL-Sheikh mountain southwest of Syria. The appearance of 80 egg nests was studied, and the results showed that there were two basic patterns of egg nests laid by C. persica, 90% of the egg nests were of the first pattern (consists of several adjacent slits, while 10% of them were of the second pattern (consists of several divergent slits. A random sample consisting of 300 specimens (150 males and 150 females were also studied concentrating on the differences in the color of the supra-antennal plate and in the number of spurs on the tibia of the hind legs. The results showed that there were two basic patterns of individuals based on the differences in the color of supra-antennal plate. The first pattern (individuals with yellow supra-antennal plates, constituted more than 90%, and the second one (individuals with black supra-antennal plates constituted less than 10%. The results also showed that there were 27 different patterns based on the number of spurs on the tibia of the hind legs. One of them was a common pattern (2, 3 whose individuals have 2 spurs on the upper side of the tibia of the hind legs and 3 spurs on the lateral side of the tibia of the hind legs. The total percent of this common pattern was 76%. The other 26 patterns were different from each other, and the total percent of all these different patterns was 24%.

  20. Asociaciones áfido-parasitoide (Hemiptera: Aphididae; Hymenoptera: Braconidae, Aphidiinae) en cultivos hortícolas orgánicos en Los Cardales, Buenos Aires, Argentina Aphid-parasitoid associations (Hemiptera: Aphididae; Hymenoptera: Braconidae, Aphidiinae) on organic vegetable crops in Los Cardales, Buenos Aires, Argentina


    Andrea V. Andorno; Silvia N. López; Eduardo N. Botto


    Diez especies de áfidos (Hemiptera: Aphididae) se hallaron parasitados por siete especies de parasitoides (Hymenoptera: Braconidae, Aphidiinae) en cultivos hortícolas orgánicos. Myzus persicae (Sulzer) fue el áfido más frecuentemente encontrado sobre una amplia variedad de cultivos, y con mayor diversidad de parasitoides asociados. Aphidius colemani Viereck fue el afidiino más usual, que ataca varias especies de áfidos. Ocho asociaciones tritróficas, involucrando Aphidius matricariae Haliday,...