WorldWideScience

Sample records for acyl-coenzyme a-dependent lysophosphatidic

  1. SLC1 and SLC4 encode partially redundant acyl-coenzyme A 1-acylglycerol-3-phosphate O-acyltransferases of budding yeast

    DEFF Research Database (Denmark)

    Benghezal, Mohammed; Roubaty, Carole; Veepuri, Vijayanath

    2007-01-01

    Phosphatidic acid is the intermediate, from which all glycerophospholipids are synthesized. In yeast, it is generated from lysophosphatidic acid, which is acylated by Slc1p, an sn-2-specific, acyl-coenzyme A-dependent 1-acylglycerol-3-phosphate O-acyltransferase. Deletion of SLC1 is not lethal...

  2. Acyl coenzyme A thioesterase 7 regulates neuronal fatty acid metabolism to prevent neurotoxicity.

    Science.gov (United States)

    Ellis, Jessica M; Wong, G William; Wolfgang, Michael J

    2013-05-01

    Numerous neurological diseases are associated with dysregulated lipid metabolism; however, the basic metabolic control of fatty acid metabolism in neurons remains enigmatic. Here we have shown that neurons have abundant expression and activity of the long-chain cytoplasmic acyl coenzyme A (acyl-CoA) thioesterase 7 (ACOT7) to regulate lipid retention and metabolism. Unbiased and targeted metabolomic analysis of fasted mice with a conditional knockout of ACOT7 in the nervous system, Acot7(N-/-), revealed increased fatty acid flux into multiple long-chain acyl-CoA-dependent pathways. The alterations in brain fatty acid metabolism were concomitant with a loss of lean mass, hypermetabolism, hepatic steatosis, dyslipidemia, and behavioral hyperexcitability in Acot7(N-/-) mice. These failures in adaptive energy metabolism are common in neurodegenerative diseases. In agreement, Acot7(N-/-) mice exhibit neurological dysfunction and neurodegeneration. These data show that ACOT7 counterregulates fatty acid metabolism in neurons and protects against neurotoxicity.

  3. Very long-chain acyl-coenzyme A dehydrogenase deficiency

    Directory of Open Access Journals (Sweden)

    A. V. Degtyareva

    2014-01-01

    Full Text Available The paper describes a case of a baby with a severe infant form of very long-chain acyl-coenzyme A dehydrogenase deficiency, a very rare genetic disorder. The basis for the disease is a disorder of mitochondrial β-oxidation of long-chain fatty acids. Accumulation of acyl-CoA-derived fatty acids causes a toxic effect on the myocardium and cardiac conduction system, liver, skeletal muscles, and other organs. The development of hypoglycemia is typical. Treatment in the acute period involves the immediately ceased delivery of long-chain triglycerides, the provision of the body with medium-chain triglycerides, and the correction of glycemia. In our observation the baby was born at term with a satisfactory condition in a family with a poor history (the first baby had suddenly died at the age of 3,5 months. The disease manifested itself as bradyarrhythmia and cardiac arrest on day 2 of life. The clinical symptom complex also included hepatomegalia, hypoglycemic episodes, lactate acidosis, and elevated blood levels of cytolytic enzymes and creatine phosphokinase. The diagnosis was suspected on the basis of the high blood values of acylcarnitines (primarily C14:1 and verified by a molecular genetic examination. Syndrome therapy and dietotherapy resulted in the abolishment of the abnormality. At the age of 2 years of life, the infant’s physical, motor, mental, and speech development corresponded to his age although he had mild right-sided hemiparesis. Thus, timely therapy determines the favorable prognosis of the disease even in its severe infant forms. 

  4. Continuous recording of long-chain acyl-coenzyme A synthetase activity using fluorescently labeled bovine serum albumin

    DEFF Research Database (Denmark)

    Demant, Erland J.F.; Nystrøm, Birthe T.

    2001-01-01

    acyl-Coenzyme A, synthetase, activity assay, fluorescence recording, fatty acid probe, serum albumin, hydroxycoumarin, detergent, micelles, Pseudomonas fragi, rat liver microsomes......acyl-Coenzyme A, synthetase, activity assay, fluorescence recording, fatty acid probe, serum albumin, hydroxycoumarin, detergent, micelles, Pseudomonas fragi, rat liver microsomes...

  5. Characterization of acyl-coenzyme A:diacylglycerol acyltransferase (DGAT) enzyme of human small intestine.

    Science.gov (United States)

    Hiramine, Yasushi; Tanabe, Toshizumi

    2011-06-01

    Acyl-coenzyme A:diacylglycerol acyltransferase (DGAT) enzyme plays a significant role in dietary triacylglycerol (TAG) absorption in the small intestine. However, the characteristics of human intestinal DGAT enzyme have not been examined in detail. The aim of our study was to characterize the human intestinal DGAT enzyme by examining acyl-CoA specificity, temperature dependency, and selectivity for 1,2-diacylglycerol (DAG) or 1,3-DAG. We detected DGAT activity of human intestinal microsome and found that the acyl-CoA specificity and temperature dependency of intestinal DGAT coincided with those of recombinant human DGAT1. To elucidate the selectivity of human intestinal DGAT to 1,2-DAG or 1,3-DAG, we conducted acyl-coenzyme A:monoacylglycerol acyltransferase assays using 1- or 2-monoacylglycerol (MAG) as substrates. When 2-MAG was used as acyl acceptor, both 1,2-DAG and TAG were generated; however, when 1-MAG was used, 1,3-DAG was predominantly observed and little TAG was detected. These findings suggest that human small intestinal DGAT, which is mainly encoded by DGAT1, utilizes 1,2-DAG as the substrate to form TAG. This study will contribute to understand the lipid absorption profile in the small intestine.

  6. Very long chain acyl-coenzyme A dehydrogenase deficiency with adult onset

    DEFF Research Database (Denmark)

    Smelt, A H; Poorthuis, B J; Onkenhout, W

    1998-01-01

    Very long chain acyl-coenzyme A (acyl-CoA) dehydrogenase (VLCAD) deficiency is a severe disorder of mitochondrial beta-oxidation in infants. We report adult onset of attacks of painful rhabdomyolysis. Gas chromatography identified strongly elevated levels of tetradecenoic acid, 14:1(n-9), tetrade......Very long chain acyl-coenzyme A (acyl-CoA) dehydrogenase (VLCAD) deficiency is a severe disorder of mitochondrial beta-oxidation in infants. We report adult onset of attacks of painful rhabdomyolysis. Gas chromatography identified strongly elevated levels of tetradecenoic acid, 14:1(n-9......), tetradecadienoic acid, 14:2(n-6), and hexadecadienoic acid, 16:2(n-6). Palmitoyl-CoA and behenoyl-CoA dehydrogenase in fibroblasts were deficient. Muscle VLCAD activity was very low. DNA analysis revealed compound heterozygosity for two missense mutations in the VLCAD gene. The relatively mild clinical course may...... be due to residual enzyme activity as a consequence of the two missense mutations. Treatment with L-carnitine and medium chain triglycerides in the diet did not reduce the attacks of rhabdomyolysis....

  7. Conserved residues and their role in the structure, function, and stability of acyl-coenzyme A binding protein

    DEFF Research Database (Denmark)

    Kragelund, B B; Poulsen, K; Andersen, K V

    1999-01-01

    In the family of acyl-coenzyme A binding proteins, a subset of 26 sequence sites are identical in all eukaryotes and conserved throughout evolution of the eukaryotic kingdoms. In the context of the bovine protein, the importance of these 26 sequence positions for structure, function, stability...

  8. How Chain Length and Charge Affect Surfactant Denaturation of Acyl Coenzyme A Binding Protein (ACBP)

    DEFF Research Database (Denmark)

    Andersen, Kell Kleiner; Otzen, Daniel

    2009-01-01

    maltoside (DDM). The aim has been to determine how surfactant chain length and micellar charge affect the denaturation mechanism. ACBP denatures in two steps irrespective of surfactant chain length, but with increasing chain length, the potency of the denaturant rises more rapidly than the critical micelle......Using intrinsic tryptophan fluorescence, equilibria and kinetics of unfolding of acyl coenzyme A binding protein (ACBP) have been investigated in sodium alkyl sulfate surfactants of different chain length (8-16 carbon atoms) and with different proportions of the nonionic surfactant dodecyl...... constants increases linearly with denaturant concentration below the cmc but declines at higher concentrations. Both shortening chain length and decreasing micellar charge reduce the overall kinetics of unfolding and makes the dependence of unfolding rate constants on surfactant concentration more complex...

  9. Fulminant lipid storage myopathy due to multiple acyl-coenzyme a dehydrogenase deficiency.

    Science.gov (United States)

    Whitaker, Charles H; Felice, Kevin J; Silvers, David; Wu, Qian

    2015-08-01

    The lipid storage myopathies, primary carnitine deficiency, neutral lipid storage disease, and multiple acyl coenzyme A dehydrogenase deficiency (MADD), are progressive disorders that cause permanent weakness. These disorders of fatty acid metabolism and intracellular triglyceride degradation cause marked fat deposition and damage to muscle cells. We describe a rapidly progressive myopathy in a previously healthy 33-year-old woman. Over 4 months, she developed a proximal and axial myopathy associated with diffuse myalgia and dysphagia, ultimately leading to respiratory failure and death. Muscle biopsy showed massive accumulation of lipid. Plasma acylcarnitine and urine organic acid analysis was consistent with MADD. This was confirmed by molecular genetic testing, which revealed 2 pathogenic mutations in the ETFDH gene. This report illustrates a late-onset case of MADD and reviews the differential diagnosis and evaluation of patients with proximal myopathy and excessive accumulation of lipid on muscle biopsy. © 2014 Wiley Periodicals, Inc.

  10. Engineered Production of Short-Chain Acyl-Coenzyme A Esters in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Krink-Koutsoubelis, Nicolas; Loechner, Anne C.; Lechner, Anna

    2018-01-01

    Short-chain acyl-coenzyme A esters serve as intermediate compounds in fatty acid biosynthesis, and the production of polyketides, biopolymers and other value-added chemicals. S. cerevisiae is a model organism that has been utilized for the biosynthesis of such biologically and economically valuable...... compounds. However, its limited repertoire of short-chain acyl-CoAs effectively prevents its application as a production host for a plethora of natural products. Therefore, we introduced biosynthetic metabolic pathways to five different acyl-CoA esters into S. cerevisiae. Our engineered strains provide......-CoA at 0.5 μM; and isovaleryl-CoA, n-butyryl-CoA, and n-hexanoyl-CoA at 6 μM each. The acyl-CoAs produced in this study are common building blocks of secondary metabolites and will enable the engineered production of a variety of natural products in S. cerevisiae. By providing this toolbox of acyl...

  11. Patients with medium-chain acyl-coenzyme a dehydrogenase deficiency have impaired oxidation of fat during exercise but no effect of L-carnitine supplementation

    DEFF Research Database (Denmark)

    Madsen, K L; Preisler, N; Orngreen, M C

    2013-01-01

    It is not clear to what extent skeletal muscle is affected in patients with medium-chain acyl-coenzyme A dehydrogenase deficiency (MCADD). l-Carnitine is commonly used as a supplement in patients with MCADD, although its beneficial effect has not been verified.......It is not clear to what extent skeletal muscle is affected in patients with medium-chain acyl-coenzyme A dehydrogenase deficiency (MCADD). l-Carnitine is commonly used as a supplement in patients with MCADD, although its beneficial effect has not been verified....

  12. Genetic Basis for Correction of Very‐Long‐Chain Acyl-Coenzyme A Dehydrogenase Deficiency by Bezafibrate in Patient Fibroblasts: Toward a Genotype‐Based Therapy

    DEFF Research Database (Denmark)

    Gobin‐Limballe, S.; Djouadi, F.; Aubey, F.

    2007-01-01

    Very‐long‐chain acyl-coenzyme A dehydrogenase (VLCAD) deficiency is an inborn mitochondrial fatty‐acid β‐oxidation (FAO) defect associated with a broad mutational spectrum, with phenotypes ranging from fatal cardiopathy in infancy to adolescent‐onset myopathy, and for which there is no established...

  13. Anesthetic agents in patients with very long-chain acyl-coenzyme A dehydrogenase deficiency: a literature review.

    Science.gov (United States)

    Redshaw, Charlotte; Stewart, Catherine

    2014-11-01

    Very long-chain acyl-coenzyme A dehydrongenase deficiency (VLCADD) is a rare disorder of fatty acid metabolism that renders sufferers susceptible to hypoglycemia, liver failure, cardiomyopathy, and rhabdomyolysis. The literature about the management of these patients is hugely conflicting, suggesting that both propofol and volatile anesthesia should be avoided. We have reviewed the literature and have concluded that the source papers do not support the statements that volatile anesthetic agents are unsafe. The reports on rhabdomyolysis secondary to anesthesia appear to be due to inadequate supply of carbohydrate not volatile agents. Catabolism must be avoided with minimal fasting, glucose infusions based on age and weight, and attenuation of emotional and physical stress. General anesthesia appears to be protective of stress-induced catabolism and may offer benefits in children and anxious patients over regional anesthesia. Propofol has not been demonstrated to be harmful in VLCADD but is presented in an emulsion containing very long-chain fatty acids which can cause organ lipidosis and itself can inhibit mitochondrial fatty acid metabolism. It is therefore not recommended. Suxamethonium-induced myalgia may mimic symptoms of rhabdomyolysis and cause raised CK therefore should be avoided. Opioids, NSAIDS, regional anesthesia, and local anesthetic techniques have all been used without complication. © 2014 John Wiley & Sons Ltd.

  14. Expression of the Acyl-Coenzyme A: Cholesterol Acyltransferase GFP Fusion Protein in Sf21 Insect Cells

    Science.gov (United States)

    Mahtani, H. K.; Richmond, R. C.; Chang, T. Y.; Chang, C. C. Y.; Rose, M. Franklin (Technical Monitor)

    2001-01-01

    The enzyme acyl-coenzyme A:cholesterol acyltransferase (ACAT) is an important contributor to the pathological expression of plaque leading to artherosclerosis n a major health problem. Adequate knowledge of the structure of this protein will enable pharmaceutical companies to design drugs specific to the enzyme. ACAT is a membrane protein located in the endoplasmic reticulum.t The protein has never been purified to homogeneity.T.Y. Chang's laboratory at Dartmouth College provided a 4-kb cDNA clone (K1) coding for a structural gene of the protein. We have modified the gene sequence and inserted the cDNA into the BioGreen His Baculovirus transfer vector. This was successfully expressed in Sf2l insect cells as a GFP-labeled ACAT protein. The advantage to this ACAT-GFP fusion protein (abbreviated GCAT) is that one can easily monitor its expression as a function of GFP excitation at 395 nm and emission at 509 nm. Moreover, the fusion protein GCAT can be detected on Western blots with the use of commercially available GFP antibodies. Antibodies against ACAT are not readily available. The presence of the 6xHis tag in the transfer vector facilitates purification of the recombinant protein since 6xHis fusion proteins bind with high affinity to Ni-NTA agarose. Obtaining highly pure protein in large quantities is essential for subsequent crystallization. The purified GCAT fusion protein can readily be cleaved into distinct GFP and ACAT proteins in the presence of thrombin. Thrombin digests the 6xHis tag linking the two protein sequences. Preliminary experiments have indicated that both GCAT and ACAT are expressed as functional proteins. The ultimate aim is to obtain large quantities of the ACAT protein in pure and functional form appropriate for protein crystal growth. Determining protein structure is the key to the design and development of effective drugs. X-ray analysis requires large homogeneous crystals that are difficult to obtain in the gravity environment of earth

  15. Five Fatty Acyl-Coenzyme A Reductases Are Involved in the Biosynthesis of Primary Alcohols in Aegilops tauschii Leaves

    Directory of Open Access Journals (Sweden)

    Meiling Wang

    2017-06-01

    Full Text Available The diploid Aegilops tauschii is the D-genome donor to hexaploid wheat (Triticum aestivum and represents a potential source for genetic study in common wheat. The ubiquitous wax covering the aerial parts of plants plays an important role in protecting plants against non-stomatal water loss. Cuticular waxes are complex mixtures of very-long-chain fatty acids, alkanes, primary and/or secondary alcohols, aldehydes, ketones, esters, triterpenes, sterols, and flavonoids. In the present work, primary alcohols were identified as the major components of leaf cuticular wax in Ae. tauschii, with C26:0-OH being the dominant primary alcohol. Analysis by scanning electron microscope revealed that dense platelet-shaped wax crystals were deposited on leaf surfaces of Ae. tauschii. Ten putative wax biosynthetic genes encoding fatty acyl-coenzyme A reductase (FAR were identified in the genome of Ae. tauschii. Five of these genes, Ae.tFAR1, Ae.tFAR2, Ae.tFAR3, Ae.tFAR4, and Ae.tFAR6, were found expressed in the leaf blades. Heterologous expression of the five Ae.tFARs in yeast (Saccharomyces cerevisiae showed that Ae.tFAR1, Ae.tFAR2, Ae.tFAR3, Ae.tFAR4, and Ae.tFAR6 were predominantly responsible for the accumulation of C16:0, C18:0, C26:0, C24:0, and C28:0 primary alcohols, respectively. In addition, nine Ae.tFAR paralogous genes were located on D chromosome of wheat and the wheat nullisomic–tetrasomic lines with the loss of Ae.tFAR3 and Ae.tFAR4 paralogous genes had significantly reduced levels of primary alcohols in the leaf blades. Collectively, these data suggest that Ae.tFAR1, Ae.tFAR2, Ae.tFAR3, Ae.tFAR4, and Ae.tFAR6 encode alcohol-forming FARs involved in the biosynthesis of primary alcohols in the leaf blades of Ae. tauschii. The information obtained in Ae. tauschii enables us to better understand wax biosynthesis in common wheat.

  16. Role of Wax Ester Synthase/Acyl Coenzyme A:Diacylglycerol Acyltransferase in Oleaginous Streptomyces sp. Strain G25

    Science.gov (United States)

    Röttig, Annika; Strittmatter, Carl Simon; Schauer, Jennifer; Hiessl, Sebastian; Daniel, Rolf

    2016-01-01

    ABSTRACT Recently, we isolated a novel Streptomyces strain which can accumulate extraordinarily large amounts of triacylglycerol (TAG) and consists of 64% fatty acids (dry weight) when cultivated with glucose and 50% fatty acids (dry weight) when cultivated with cellobiose. To identify putative gene products responsible for lipid storage and cellobiose utilization, we analyzed its draft genome sequence. A single gene encoding a wax ester synthase/acyl coenzyme A (CoA):diacylglycerol acyltransferase (WS/DGAT) was identified and heterologously expressed in Escherichia coli. The purified enzyme AtfG25 showed acyltransferase activity with C12- or C16-acyl-CoA, C12 to C18 alcohols, or dipalmitoyl glycerol. This acyltransferase exhibits 24% amino acid identity to the model enzyme AtfA from Acinetobacter baylyi but has high sequence similarities to WS/DGATs from other Streptomyces species. To investigate the impact of AtfG25 on lipid accumulation, the respective gene, atfG25, was inactivated in Streptomyces sp. strain G25. However, cells of the insertion mutant still exhibited DGAT activity and were able to store TAG, albeit in lower quantities and at lower rates than the wild-type strain. These findings clearly indicate that AtfG25 has an important, but not exclusive, role in TAG biosynthesis in the novel Streptomyces isolate and suggest the presence of alternative metabolic pathways for lipid accumulation which are discussed in the present study. IMPORTANCE A novel Streptomyces strain was isolated from desert soil, which represents an extreme environment with high temperatures, frequent drought, and nutrient scarcity. We believe that these harsh conditions promoted the development of the capacity for this strain to accumulate extraordinarily large amounts of lipids. In this study, we present the analysis of its draft genome sequence with a special focus on enzymes potentially involved in its lipid storage. Furthermore, the activity and importance of the detected

  17. Purification of a jojoba embryo fatty acyl-coenzyme A reductase and expression of its cDNA in high erucic acid rapeseed.

    Science.gov (United States)

    Metz, J G; Pollard, M R; Anderson, L; Hayes, T R; Lassner, M W

    2000-03-01

    The jojoba (Simmondsia chinensis) plant produces esters of long-chain alcohols and fatty acids (waxes) as a seed lipid energy reserve. This is in contrast to the triglycerides found in seeds of other plants. We purified an alcohol-forming fatty acyl-coenzyme A reductase (FAR) from developing embryos and cloned the cDNA encoding the enzyme. Expression of a cDNA in Escherichia coli confers FAR activity upon those cells and results in the accumulation of fatty alcohols. The FAR sequence shows significant homology to an Arabidopsis protein of unknown function that is essential for pollen development. When the jojoba FAR cDNA is expressed in embryos of Brassica napus, long-chain alcohols can be detected in transmethylated seed oils. Resynthesis of the gene to reduce its A plus T content resulted in increased levels of alcohol production. In addition to free alcohols, novel wax esters were detected in the transgenic seed oils. In vitro assays revealed that B. napus embryos have an endogenous fatty acyl-coenzyme A: fatty alcohol acyl-transferase activity that could account for this wax synthesis. Thus, introduction of a single cDNA into B. napus results in a redirection of a portion of seed oil synthesis from triglycerides to waxes.

  18. Three endoplasmic reticulum-associated fatty acyl-coenzyme a reductases were involved in the production of primary alcohols in hexaploid wheat (Triticum aestivum L.).

    Science.gov (United States)

    Chai, Guaiqiang; Li, Chunlian; Xu, Feng; Li, Yang; Shi, Xue; Wang, Yong; Wang, Zhonghua

    2018-03-05

    The cuticle covers the surface of the polysaccharide cell wall of leaf epidermal cells and forms an essential diffusion barrier between the plant and the environment. The cuticle is composed of cutin and wax. Cuticular wax plays an important role in the survival of plants by serving as the interface between plants and their biotic and abiotic environments, especially restricting nonstomatal water loss. Leaf cuticular waxes of hexaploid wheat at the seedling stage mainly consist of primary alcohols, aldehydes, fatty acids, alkane and esters. Primary alcohols account for more than 80% of the total wax load. Therefore, we cloned several genes encoding fatty acyl-coenzyme A reductases from wheat and analyzed their function in yeast and plants. We propose the potential use of these genes in wheat genetic breeding. We reported the cloning and characterization of three TaFARs, namely TaFAR6, TaFAR7 and TaFAR8, encoding fatty acyl-coenzyme A reductases (FAR) in wheat leaf cuticle. Expression analysis revealed that TaFAR6, TaFAR7 and TaFAR8 were expressed at the higher levels in the seedling leaf blades, and were expressed moderately or weakly in stamen, glumes, peduncle, flag leaf blade, sheath, spike, and pistil. The heterologous expression of three TaFARs in yeast (Saccharomyces cerevisiae) led to the production of C24:0 and C26:0 primary alcohols. Transgenic expression of the three TaFARs in tomato (Solanum lycopersicum) and rice (Oryza sativa) led to increased accumulation of C24:0-C30:0 primary alcohols. Transient expression of GFP protein-tagged TaFARs revealed that the three TaFAR proteins were localized to the endoplasmic reticulum (ER), the site of wax biosynthesis. The three TaFAR genes were transcriptionally induced by drought, cold, heat, powdery mildew (Blumeria graminis) infection, abscisic acid (ABA) and methyl jasmonate (MeJa) treatments. These results indicated that wheat TaFAR6, TaFAR7 and TaFAR8 are involved in biosynthesis of very-long-chain primary

  19. OleA Glu117 is key to condensation of two fatty-acyl coenzyme A substrates in long-chain olefin biosynthesis

    Energy Technology Data Exchange (ETDEWEB)

    Jensen, Matthew R.; Goblirsch, Brandon R.; Christenson, James K.; Esler, Morgan A.; Mohamed, Fatuma A.; Wackett, Lawrence P.; Wilmot, Carrie M. (UMM)

    2017-10-12

    In the interest of decreasing dependence on fossil fuels, microbial hydrocarbon biosynthesis pathways are being studied for renewable, tailored production of specialty chemicals and biofuels. One candidate is long-chain olefin biosynthesis, a widespread bacterial pathway that produces waxy hydrocarbons. Found in three- and four-gene clusters, oleABCD encodes the enzymes necessary to produce cis-olefins that differ by alkyl chain length, degree of unsaturation, and alkyl chain branching. The first enzyme in the pathway, OleA, catalyzes the Claisen condensation of two fatty acyl-coenzyme A (CoA) molecules to form a β-keto acid. In this report, the mechanistic role of Xanthomonas campestris OleA Glu117 is investigated through mutant enzymes. Crystal structures were determined for each mutant as well as their complex with the inhibitor cerulenin. Complemented by substrate modeling, these structures suggest that Glu117 aids in substrate positioning for productive carbon–carbon bond formation. Analysis of acyl-CoA substrate hydrolysis shows diminished activity in all mutants. When the active site lacks an acidic residue in the 117 position, OleA cannot form condensed product, demonstrating that Glu117 has a critical role upstream of the essential condensation reaction. Profiling of pH dependence shows that the apparent pKa for Glu117 is affected by mutagenesis. Taken together, we propose that Glu117 is the general base needed to prime condensation via deprotonation of the second, non-covalently bound substrate during turnover. This is the first example of a member of the thiolase superfamily of condensing enzymes to contain an active site base originating from the second monomer of the dimer.

  20. Acyl-coenzyme A oxidases 1 and 3 in brown trout (Salmo trutta f. fario): Can peroxisomal fatty acid β-oxidation be regulated by estrogen signaling?

    Science.gov (United States)

    Madureira, Tânia Vieira; Castro, L Filipe C; Rocha, Eduardo

    2016-02-01

    Acyl-coenzyme A oxidases 1 (Acox1) and 3 (Acox3) are key enzymes in the regulation of lipid homeostasis. Endogenous and exogenous factors can disrupt their normal expression/activity. This study presents for the first time the isolation and characterization of Acox1 and Acox3 in brown trout (Salmo trutta f. fario). Additionally, as previous data point to the existence of a cross-talk between two nuclear receptors, namely peroxisome proliferator-activated receptors and estrogen receptors, it was here evaluated after in vitro exposures of trout hepatocytes the interference caused by ethynylestradiol in the mRNA levels of an inducible (by peroxisome proliferators) and a non-inducible oxidase. The isolated Acox1 and Acox3 show high levels of sequence conservation compared to those of other teleosts. Additionally, it was found that Acox1 has two alternative splicing isoforms, corresponding to 3I and 3II isoforms of exon 3 splicing variants. Both isoforms display tissue specificity, with Acox1-3II presenting a more ubiquitous expression in comparison with Acox1-3I. Acox3 was expressed in almost all brown trout tissues. According to real-time PCR data, the highest estrogenic stimulus was able to cause a down-regulation of Acox1 and an up-regulation of Acox3. So, for Acox1 we found a negative association between an estrogenic input and a directly activated PPARα target gene. In conclusion, changes in hormonal estrogenic stimulus may impact the mobilization of hepatic lipids to the gonads, with ultimate consequences in reproduction. Further studies using in vivo assays will be fundamental to clarify these issues.

  1. Mangiferin treatment inhibits hepatic expression of acyl-coenzyme A:diacylglycerol acyltransferase-2 in fructose-fed spontaneously hypertensive rats: a link to amelioration of fatty liver

    Energy Technology Data Exchange (ETDEWEB)

    Xing, Xiaomang; Li, Danyang; Chen, Dilong; Zhou, Liang [Faculty of Basic Medical Sciences, Chongqing Medical University, Chongqing 400016 China (China); Chonan, Ritsu [Koei Kogyo Co., Ltd., Tokyo, 101-0063 Japan (Japan); Yamahara, Johji [Pharmafood Institute, Kyoto, 602-8136 Japan (Japan); Wang, Jianwei, E-mail: wangjianwei1968@gmail.com [Department of Traditional Chinese Medicine, Chongqing Medical University, Chongqing 400016 China (China); Li, Yuhao, E-mail: yuhao@sitcm.edu.au [Endocrinology and Metabolism Group, Sydney Institute of Health Sciences/Sydney Institute of Traditional Chinese Medicine, NSW 2000 Australia (Australia)

    2014-10-15

    Mangiferin, a xanthone glucoside, and its associated traditional herbs have been demonstrated to improve abnormalities of lipid metabolism. However, its underlying mechanisms remain largely unclear. This study investigated the anti-steatotic effect of mangiferin in fructose-fed spontaneously hypertensive rat (SHR)s that have a mutation in sterol regulatory element binding protein (SREBP)-1. The results showed that co-administration of mangiferin (15 mg/kg, once daily, by oral gavage) over 7 weeks dramatically diminished fructose-induced increases in hepatic triglyceride content and Oil Red O-stained area in SHRs. However, blood pressure, fructose and chow intakes, white adipose tissue weight and metabolic parameters (plasma concentrations of glucose, insulin, triglyceride, total cholesterol and non-esterified fatty acids) were unaffected by mangiferin treatment. Mechanistically, mangiferin treatment suppressed acyl-coenzyme A:diacylglycerol acyltransferase (DGAT)-2 expression at the mRNA and protein levels in the liver. In contrast, mangiferin treatment was without effect on hepatic mRNA and/or protein expression of SREBP-1/1c, carbohydrate response element binding protein, liver pyruvate kinase, fatty acid synthase, acetyl-CoA carboxylase-1, stearoyl-CoA desaturase-1, DGAT-1, monoacyglycerol acyltransferase-2, microsomal triglyceride transfer protein, peroxisome proliferator-activated receptor-alpha, carnitine palmitoyltransferase-1 and acyl-CoA oxidase. Collectively, our results suggest that mangiferin treatment ameliorates fatty liver in fructose-fed SHRs by inhibiting hepatic DGAT-2 that catalyzes the final step in triglyceride biosynthesis. The anti-steatotic effect of mangiferin may occur independently of the hepatic signals associated with de novo fatty acid synthesis and oxidation. - Highlights: • We investigated the anti-steatotic effect of mangiferin (MA) in fructose-fed SHR. • MA (15 mg/kg/day for 7 weeks) ameliorated fructose-induced fatty liver in

  2. FAR5, a fatty acyl-coenzyme A reductase, is involved in primary alcohol biosynthesis of the leaf blade cuticular wax in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Wang, Yong; Wang, Meiling; Sun, Yulin; Wang, Yanting; Li, Tingting; Chai, Guaiqiang; Jiang, Wenhui; Shan, Liwei; Li, Chunlian; Xiao, Enshi; Wang, Zhonghua

    2015-03-01

    A waxy cuticle that serves as a protective barrier against non-stomatal water loss and environmental damage coats the aerial surfaces of land plants. It comprises a cutin polymer matrix and waxes. Cuticular waxes are complex mixtures of very long chain fatty acids (VLCFAs) and their derivatives. Results show that primary alcohols are the major components of bread wheat (Triticum aestivum L.) leaf blade cuticular waxes. Here, the characterization of TaFAR5 from wheat cv Xinong 2718, which is allelic to TAA1b, an anther-specific gene, is reported. Evidence is presented for a new function for TaFAR5 in the biosynthesis of primary alcohols of leaf blade cuticular wax in wheat. Expression of TaFAR5 cDNA in yeast (Saccharomyces cerevisiae) led to production of C22:0 primary alcohol. The transgenic expression of TaFAR5 in tomato (Solanum lycopersicum) cv MicroTom leaves resulted in the accumulation of C26:0, C28:0, and C30:0 primary alcohols. TaFAR5 encodes an alcohol-forming fatty acyl-coenzyme A reductase (FAR). Expression analysis revealed that TaFAR5 was expressed at high levels in the leaf blades, anthers, pistils, and seeds. Fully functional green fluorescent protein-tagged TaFAR5 protein was localized to the endoplasmic reticulum (ER), the site of primary alcohol biosynthesis. SDS-PAGE analysis indicated that the TaFAR5 protein possessed a molecular mass of 58.4kDa, and it was also shown that TaFAR5 transcript levels were regulated in response to drought, cold, and abscisic acid (ABA). Overall, these data suggest that TaFAR5 plays an important role in the synthesis of primary alcohols in wheat leaf blade. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  3. Mangiferin treatment inhibits hepatic expression of acyl-coenzyme A:diacylglycerol acyltransferase-2 in fructose-fed spontaneously hypertensive rats: a link to amelioration of fatty liver

    International Nuclear Information System (INIS)

    Xing, Xiaomang; Li, Danyang; Chen, Dilong; Zhou, Liang; Chonan, Ritsu; Yamahara, Johji; Wang, Jianwei; Li, Yuhao

    2014-01-01

    Mangiferin, a xanthone glucoside, and its associated traditional herbs have been demonstrated to improve abnormalities of lipid metabolism. However, its underlying mechanisms remain largely unclear. This study investigated the anti-steatotic effect of mangiferin in fructose-fed spontaneously hypertensive rat (SHR)s that have a mutation in sterol regulatory element binding protein (SREBP)-1. The results showed that co-administration of mangiferin (15 mg/kg, once daily, by oral gavage) over 7 weeks dramatically diminished fructose-induced increases in hepatic triglyceride content and Oil Red O-stained area in SHRs. However, blood pressure, fructose and chow intakes, white adipose tissue weight and metabolic parameters (plasma concentrations of glucose, insulin, triglyceride, total cholesterol and non-esterified fatty acids) were unaffected by mangiferin treatment. Mechanistically, mangiferin treatment suppressed acyl-coenzyme A:diacylglycerol acyltransferase (DGAT)-2 expression at the mRNA and protein levels in the liver. In contrast, mangiferin treatment was without effect on hepatic mRNA and/or protein expression of SREBP-1/1c, carbohydrate response element binding protein, liver pyruvate kinase, fatty acid synthase, acetyl-CoA carboxylase-1, stearoyl-CoA desaturase-1, DGAT-1, monoacyglycerol acyltransferase-2, microsomal triglyceride transfer protein, peroxisome proliferator-activated receptor-alpha, carnitine palmitoyltransferase-1 and acyl-CoA oxidase. Collectively, our results suggest that mangiferin treatment ameliorates fatty liver in fructose-fed SHRs by inhibiting hepatic DGAT-2 that catalyzes the final step in triglyceride biosynthesis. The anti-steatotic effect of mangiferin may occur independently of the hepatic signals associated with de novo fatty acid synthesis and oxidation. - Highlights: • We investigated the anti-steatotic effect of mangiferin (MA) in fructose-fed SHR. • MA (15 mg/kg/day for 7 weeks) ameliorated fructose-induced fatty liver in

  4. Concerted elevation of acyl-coenzyme A:diacylglycerol acyltransferase (DGAT) activity through independent stimulation of mRNA expression of DGAT1 and DGAT2 by carbohydrate and insulin.

    Science.gov (United States)

    Meegalla, Rupalie L; Billheimer, Jeffrey T; Cheng, Dong

    2002-11-01

    Glucose and insulin are anabolic signals which upregulate the transcriptions of a series of lipogenic enzymes to convert excess carbohydrate into triglycerides for efficient energy storage. These enzymes include ATP-citrate lyase (ACL), acetyl-coenzyme A carboxylase (ACC), fatty acid synthase (FAS), and glycerol-3-phosphate acyltransferase (G3PA). Acyl-coenzyme A:diacylglycerol acyltransferase (DGAT) is important to synthesize fatty acids into triglycerides. Two DGATs from different gene families have recently been identified. In the current study, we report that glucose preferentially enhances DGAT1 mRNA expression, whereas insulin specifically increases the level of DGAT2 mRNA. Treatment of adipocytes with glucose and insulin together results in higher DGAT activity in the membrane than cells treated with either of the agents alone, indicating that glucose and insulin have additive effect on DGAT activation. In mice treated with fast/refeeding protocol, DGAT2 mRNA decreased upon fasting and was replenished upon refeeding in adipose tissue and liver. This pattern of change was not observed for DGAT1. Inasmuch as DGAT1 mRNA is less abundant in liver, we suggest that DGAT1 is more involved in fat absorption in the intestine and in basal level triglyceride synthesis in adipose tissue where it is more highly expressed. In contrast, DGAT2 is more likely to play important roles in assembly of de novo synthesized fatty acids into VLDL particles in the liver.

  5. Photoaffinity Labeling of Developing Jojoba Seed Microsomal Membranes with a Photoreactive Analog of Acyl-Coenzyme A (Acyl-CoA) (Identification of a Putative Acyl-CoA:Fatty Alcohol Acyltransferase.

    Science.gov (United States)

    Shockey, J. M.; Rajasekharan, R.; Kemp, J. D.

    1995-01-01

    Jojoba (Simmondsia chinensis, Link) is the only plant known that synthesizes liquid wax. The final step in liquid wax biosynthesis is catalyzed by an integral membrane enzyme, fatty acyl-coenzyme A (CoA):fatty alcohol acyltransferase, which transfers an acyl chain from acyl-CoA to a fatty alcohol to form the wax ester. To purify the acyltransferase, we have labeled the enzyme with a radioiodinated, photoreactive analog of acyl-CoA, 12-[N-(4-azidosalicyl)amino] dodecanoyl-CoA (ASD-CoA). This molecule acts as an inhibitor of acyltransferase activity in the dark and as an irreversible inhibitor upon exposure to ultraviolet light. Oleoyl-CoA protects enzymatic activity in a concentration-dependent manner. Photolysis of microsomal membranes with labeled ASD-CoA resulted in strong labeling of two polypeptides of 57 and 52 kD. Increasing concentrations of oleoyl-CoA reduced the labeling of the 57-kD polypeptide dramatically, whereas the labeling of the 52-kD polypeptide was much less responsive to oleoyl-CoA. Also, unlike the other polypeptide, the labeling of the 57-kD polypeptide was enhanced considerably when photolyzed in the presence of dodecanol. These results suggest that a 57-kD polypeptide from jojoba microsomes may be the acyl-CoA:fatty alcohol acyltransferase.

  6. Bioconversion of α-linolenic acid to n-3 LCPUFA and expression of PPAR-alpha, acyl Coenzyme A oxidase 1 and carnitine acyl transferase I are incremented after feeding rats with α-linolenic acid-rich oils.

    Science.gov (United States)

    González-Mañán, Daniel; Tapia, Gladys; Gormaz, Juan Guillermo; D'Espessailles, Amanda; Espinosa, Alejandra; Masson, Lilia; Varela, Patricia; Valenzuela, Alfonso; Valenzuela, Rodrigo

    2012-07-01

    High dietary intake of n-6 fatty acids in relation to n-3 fatty acids may generate health disorders, such as cardiovascular and other chronic diseases. Fish consumption rich in n-3 fatty acids is low in Latin America, it being necessary to seek other alternatives to provide α-linolenic acid (ALA), precursor of n-3 LCPUFA (EPA and DHA). Two innovative oils were assayed, chia (Salvia hispanica) and rosa mosqueta (Rosa rubiginosa). This study evaluated hepatic bioconversion of ALA to EPA and DHA, expression of PPAR-α, acyl-Coenzyme A oxidase 1 (ACOX1) and carnitine acyltransferase I (CAT-I), and accumulation of EPA and DHA in plasma and adipose tissue in Sprague-Dawley rats. Three experimental groups were fed 21 days: sunflower oil (SFO, control); chia oil (CO); rosa mosqueta oil (RMO). Fatty acid composition of total lipids and phospholipids from plasma, hepatic and adipose tissue was assessed by gas-liquid chromatography and TLC. Expression of PPAR-α (RT-PCR) and ACOX1 and CAT-I (Western blot). CO and RMO increased plasma, hepatic and adipose tissue levels of ALA, EPA and DHA and decreased n-6:n-3 ratio compared to SFO (p oil.

  7. Thermophilic Coenzyme B12-Dependent Acyl Coenzyme A (CoA) Mutase from Kyrpidia tusciae DSM 2912 Preferentially Catalyzes Isomerization of (R)-3-Hydroxybutyryl-CoA and 2-Hydroxyisobutyryl-CoA.

    Science.gov (United States)

    Weichler, Maria-Teresa; Kurteva-Yaneva, Nadya; Przybylski, Denise; Schuster, Judith; Müller, Roland H; Harms, Hauke; Rohwerder, Thore

    2015-07-01

    The recent discovery of a coenzyme B12-dependent acyl-coenzyme A (acyl-CoA) mutase isomerizing 3-hydroxybutyryl- and 2-hydroxyisobutyryl-CoA in the mesophilic bacterium Aquincola tertiaricarbonis L108 (N. Yaneva, J. Schuster, F. Schäfer, V. Lede, D. Przybylski, T. Paproth, H. Harms, R. H. Müller, and T. Rohwerder, J Biol Chem 287:15502-15511, 2012, http://dx.doi.org/10.1074/jbc.M111.314690) could pave the way for a complete biosynthesis route to the building block chemical 2-hydroxyisobutyric acid from renewable carbon. However, the enzyme catalyzes only the conversion of the stereoisomer (S)-3-hydroxybutyryl-CoA at reasonable rates, which seriously hampers an efficient combination of mutase and well-established bacterial poly-(R)-3-hydroxybutyrate (PHB) overflow metabolism. Here, we characterize a new 2-hydroxyisobutyryl-CoA mutase found in the thermophilic knallgas bacterium Kyrpidia tusciae DSM 2912. Reconstituted mutase subunits revealed highest activity at 55°C. Surprisingly, already at 30°C, isomerization of (R)-3-hydroxybutyryl-CoA was about 7,000 times more efficient than with the mutase from strain L108. The most striking structural difference between the two mutases, likely determining stereospecificity, is a replacement of active-site residue Asp found in strain L108 at position 117 with Val in the enzyme from strain DSM 2912, resulting in a reversed polarity at this binding site. Overall sequence comparison indicates that both enzymes descended from different prokaryotic thermophilic methylmalonyl-CoA mutases. Concomitant expression of PHB enzymes delivering (R)-3-hydroxybutyryl-CoA (beta-ketothiolase PhaA and acetoacetyl-CoA reductase PhaB from Cupriavidus necator) with the new mutase in Escherichia coli JM109 and BL21 strains incubated on gluconic acid at 37°C led to the production of 2-hydroxyisobutyric acid at maximal titers of 0.7 mM. Measures to improve production in E. coli, such as coexpression of the chaperone MeaH and repression of

  8. Ectopic expression of Crambe abyssinica lysophosphatidic acid ...

    African Journals Online (AJOL)

    USER

    2010-06-21

    Jun 21, 2010 ... lysophosphatidic acid acyltransferase in transgenic rapeseed increases its oil .... pathway [fatty acid desaturase-2 (BnFAD2, AY577313), fatty acid desaturase-3 ..... Acyltransferases from basic science to modified seed oils.

  9. In vitro effect of lysophosphatidic acid on proliferation, invasion and ...

    African Journals Online (AJOL)

    Purpose: To evaluate the effect of lysophosphatidic acid (LPA) on the proliferation, invasion and migration ... reproduction in any medium, provided the original work is properly credited. Tropical .... air dried at room temperature overnight.

  10. Spiroguanidine rhodamines as fluorogenic probes for lysophosphatidic acid

    Science.gov (United States)

    Wang, Lei; Sibrian-Vazquez, Martha; Escobedo, Jorge O.; Wang, Jialu; Moore, Richard G.

    2015-01-01

    Direct determination of total lysophosphatidic acid (LPA) was accomplished using newly developed spiroguanidines derived from rhodamine B as universal fluorogenic probes. Optimum conditions for the quantitative analysis of total LPA were investigated. The linear range for the determination of total LPA is up to 5 μM with a limit of detection of 0.512 μM. PMID:25516957

  11. In vitro effect of lysophosphatidic acid on proliferation, invasion and ...

    African Journals Online (AJOL)

    Purpose: To evaluate the effect of lysophosphatidic acid (LPA) on the proliferation, invasion and migration ability of 3AO, SKOV3 and CAOV3 human ovarian cancer cell lines. Methods: SKOV3, 3AO and CAOV3 cell lines were respectively treated with LPA. Changes in the proliferation rate of these cell lines were observed ...

  12. The ins and outs of lysophosphatidic acid signaling

    NARCIS (Netherlands)

    Moolenaar, Wouter H; van Meeteren, Laurens A; Giepmans, Ben N G

    Lysophosphatidic acid (LPA) is a lipid mediator with a wide variety of biological actions, particularly as an inducer of cell proliferation, migration and survival. LPA binds to specific G-protein-coupled receptors and thereby activates multiple signal transduction pathways, including those

  13. Lysophosphatidic acid triggers mast cell-driven atherosclerotic plaque destabilization by increasing vascular inflammation.

    NARCIS (Netherlands)

    Bot, M.; , van, Berkel T.J.C.

    2013-01-01

    Lysophosphatidic acid (LPA), a bioactive lysophospholipid, accumulates in the atherosclerotic plaque. It has the capacity to activate mast cells, which potentially exacerbates plaque progression. In this study, we thus aimed to investigate whether LPA contributes to plaque destabilization by

  14. Lysophosphatidic Acid (LPA Signaling in Human and Ruminant Reproductive Tract

    Directory of Open Access Journals (Sweden)

    Izabela Wocławek-Potocka

    2014-01-01

    Full Text Available Lysophosphatidic acid (LPA through activating its G protein-coupled receptors (LPAR 1–6 exerts diverse cellular effects that in turn influence several physiological processes including reproductive function of the female. Studies in various species of animals and also in humans have identified important roles for the receptor-mediated LPA signaling in multiple aspects of human and animal reproductive tract function. These aspects range from ovarian and uterine function, estrous cycle regulation, early embryo development, embryo implantation, decidualization to pregnancy maintenance and parturition. LPA signaling can also have pathological consequences, influencing aspects of endometriosis and reproductive tissue associated tumors. The review describes recent progress in LPA signaling research relevant to human and ruminant reproduction, pointing at the cow as a relevant model to study LPA influence on the human reproductive performance.

  15. Lysophosphatidic acid metabolism and elimination in cardiovascular disease

    Science.gov (United States)

    Salous, Abdelghaffar Kamal

    The bioactive lipids lysophosphatidic acid (LPA) and sphingosine 1-phosphate (S1P) are present in human and mouse plasma at a concentration of ~0.1-1 microM and regulate physiological and pathophysiological processes in the cardiovascular system including atherothrombosis, intimal hyperplasia, and immune function, edema formation, and permeability. PPAP2B, the gene encoding LPP3, a broad activity integral membrane enzyme that terminates LPA actions in the vasculature, has a single nucleotide polymorphism that been recently associated with coronary artery disease risk. The synthesis and signaling of LPA and S1P in the cardiovascular system have been extensively studied but the mechanisms responsible for their elimination are less well understood. The broad goal of this research was to examine the role of LPP3 in the termination of LPA signaling in models of cardiovascular disease involving vascular wall cells, investigate the role of LPP3 in the elimination of plasma LPA, and further characterize the elimination of plasma LPA. The central hypothesis is that LPP3 plays an important role in attenuating the pathological responses to LPA signaling and that it mediates the elimination of exogenously applied bioactive lipids from the plasma. These hypotheses were tested using molecular biological approaches, in vitro studies, synthetic lysophospholipid mimetics, modified surgical procedures, and mass spectrometry assays. My results indicated that LPP3 played a critical role in attenuating LPA signaling mediating the pathological processes of intimal hyperplasia and vascular leak in mouse models of disease. Additionally, enzymatic inactivation of lysophospholipids by LPP and PLA enzymes in the plasma was not a primary mechanism for the rapid elimination of plasma LPA and S1P. Instead, evidence strongly suggested a transcellular uptake mechanism by hepatic non-parenchymal cells as the predominant mechanism for elimination of these molecules. These results support a model in

  16. Lysophosphatidic acid as a lipid mediator with multiple biological actions.

    Science.gov (United States)

    Aikawa, Shizu; Hashimoto, Takafumi; Kano, Kuniyuki; Aoki, Junken

    2015-02-01

    Lysophosphatidic acid (LPA) is one of the simplest glycerophospholipids with one fatty acid chain and a phosphate group as a polar head. Although LPA had been viewed just as a metabolic intermediate in de novo lipid synthetic pathways, it has recently been paid much attention as a lipid mediator. LPA exerts many kinds of cellular processes, such as cell proliferation and smooth muscle contraction, through cognate G protein-coupled receptors. Because lipids are not coded by the genome directly, it is difficult to know their patho- and physiological roles. However, recent studies have identified several key factors mediating the biological roles of LPA, such as receptors and producing enzymes. In addition, studies of transgenic and gene knockout animals for these LPA-related genes, have revealed the biological significance of LPA. In this review we will summarize recent advances in the studies of LPA production and its roles in both physiological and pathological conditions. © The Authors 2014. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  17. Lysophosphatidic acid mediates pleiotropic responses in skeletal muscle cells

    International Nuclear Information System (INIS)

    Jean-Baptiste, Gael; Yang Zhao; Khoury, Chamel; Greenwood, Michael T.

    2005-01-01

    Lysophosphatidic acid (LPA) is a potent modulator of growth, cell survival, and apoptosis. Although all four LPA receptors are expressed in skeletal muscle, very little is known regarding the role they play in this tissue. We used RT-PCR to demonstrate that cultured skeletal muscle C2C12 cells endogenously express multiple LPA receptor subtypes. The demonstration that LPA mediates the activation of ERK1/2 MAP kinase and Akt/PKB in C2C12 cells is consistent with the widely observed mitogenic properties of LPA. In spite of these observations, LPA did not induce proliferation in C2C12 cells. Paradoxically, we found that prolonged treatment of C2C12 cells with LPA led to caspase 3 and PARP cleavage as well as the activation of stress-associated MAP kinases JNK and p38. In spite of these typically pro-apoptotic responses, LPA did not induce cell death. Blocking ERK1/2 and Akt/PKB activation with specific pharmacological inhibitors, nevertheless, stimulated LPA-mediated apoptosis. Taken together, these results suggest that both mitogenic and apoptotic responses serve to counterbalance the effects of LPA in cultured C2C12 cells

  18. Lysophosphatidic acid acyltransferase beta regulates mTOR signaling.

    Directory of Open Access Journals (Sweden)

    Michelle A Blaskovich

    Full Text Available Lysophosphatidic acid acyltransferase (LPAAT-β is a phosphatidic acid (PA generating enzyme that plays an essential role in triglyceride synthesis. However, LPAAT-β is now being studied as an important regulator of cell growth and differentiation and as a potential therapeutic target in cancer since PA is necessary for the activity of key proteins such as Raf, PKC-ζ and mTOR. In this report we determine the effect of LPAAT-β silencing with siRNA in pancreatic adenocarcinoma cell lines. We show for the first time that LPAAT-β knockdown inhibits proliferation and anchorage-independent growth of pancreatic cancer cells. This is associated with inhibition of signaling by mTOR as determined by levels of mTORC1- and mTORC2-specific phosphorylation sites on 4E-BP1, S6K and Akt. Since PA regulates the activity of mTOR by modulating its binding to FKBP38, we explored the possibility that LPAAT-β might regulate mTOR by affecting its association with FKBP38. Coimmunoprecipitation studies of FKBP38 with mTOR show increased levels of FKBP38 associated with mTOR when LPAAT-β protein levels are knocked down. Furthermore, depletion of LPAAT-β results in increased Lipin 1 nuclear localization which is associated with increased nuclear eccentricity, a nuclear shape change that is dependent on mTOR, further confirming the ability of LPAAT-β to regulate mTOR function. Our results provide support for the hypothesis that PA generated by LPAAT-β regulates mTOR signaling. We discuss the implications of these findings for using LPAAT-β as a therapeutic target.

  19. Regulation of lipolytic activity by long-chain acyl-coenzyme A in islets and adipocytes

    DEFF Research Database (Denmark)

    Hu, Liping; Deeney, Jude T; Nolan, Christopher J

    2005-01-01

    -cells. The mechanisms by which lipolysis is regulated in different tissues is, therefore, of considerable interest. Here, the effects of long-chain acyl-CoA esters (LC-CoA) on lipase activity in islets and adipocytes were compared. Palmitoyl-CoA (Pal-CoA, 1-10 microM) stimulated lipase activity in islets from both....... The inhibitory effect of LC-CoA on adipocyte HSL was dependent on phosphorylation and enhanced by acyl-CoA-binding protein (ACBP). In contrast, the stimulatory effect on islet lipase activity was blocked by ACBP, presumably due to binding and sequestration of LC-CoA. These data suggest the following intertissue...

  20. STRUCTURAL AND FUNCTIONAL ASPECTS OF ACYL-COENZYME A BINDING PROTEINS (ACBPs: A COMPREHENSIVE REVIEW

    Directory of Open Access Journals (Sweden)

    Richa Arya

    2012-06-01

    Full Text Available ACBP was originally identified as a mammalian diazepam binding inhibitor – a neuropeptide that has the ability to inhibit diazepam binding to the �-aminobutyric acid (GABA receptor (Guidotti et al., 1983. Typically, ACBPs are small (~10 kDa cytosolic proteins (Burton et al., 2005. However, a number of hybrid ACBPs are reported that are fused with ankyrin repeats, such as ACBP1 and ACBP2 in Arabidopsis thaliana (Chye et al., 1999; Li and Chye, 2003. Other functional domains, such as the human peroxisomal �3/ �2-enoyl-CoA isomerase (Geisbrecht et al., 1999, or any non-functional/ uncharacterized domain are also cited. ACBP predominantly functions as an intracellular acyl-CoA transporter and pool former, and is critical to lipid metabolism in cells (Gossett et al., 1996; Knudsen et al., 2000; Schroeder et al., 1998. Impaired lipid metabolism and other cellular functions in humans arising out of ACBP defects thus need to be explored. ACBP has only been reported in eukaryotes, not in prokaryotes, except for a few pathogenic eubacteria that might have acquired ACBP from eukaryotic hosts via lateral gene transfer (Burton et al., 2005. Whole genome sequences of several prokaryotes and pathogens being available currently, it is worthwhile to extend search for ACBPs beyond eukaryotes as well, to explore their potential as drug targets, given their essential role in lipid metabolism. As a prelude to such investigations, the current review summarizes available knowledge of ACBPs and outlines the scope of future research.

  1. Thermodynamics of ligand binding to acyl-coenzyme A binding protein studied by titration calorimetry

    DEFF Research Database (Denmark)

    Færgeman, Nils J.; Sigurskjold, B W; Kragelund, B B

    1996-01-01

    Ligand binding to recombinant bovine acyl-CoA binding protein (ACBP) was examined using isothermal microcalorimetry. Microcalorimetric measurements confirm that the binding affinity of acyl-CoA esters for ACBP is strongly dependent on the length of the acyl chain with a clear preference for acyl-...

  2. Lysophosphatidic acids are new substrates for the phosphatase domain of soluble epoxide hydrolase[S

    Science.gov (United States)

    Oguro, Ami; Imaoka, Susumu

    2012-01-01

    Soluble epoxide hydrolase (sEH) is a bifunctional enzyme that has a C-terminus epoxide hydrolase domain and an N-terminus phosphatase domain. The endogenous substrates of epoxide hydrolase are known to be epoxyeicosatrienoic acids, but the endogenous substrates of the phosphatase activity are not well understood. In this study, to explore the substrates of sEH, we investigated the inhibition of the phosphatase activity of sEH toward 4-methylumbelliferyl phosphate by using lecithin and its hydrolyzed products. Although lecithin itself did not inhibit the phosphatase activity, the hydrolyzed lecithin significantly inhibited it, suggesting that lysophospholipid or fatty acid can inhibit it. Next, we investigated the inhibition of phosphatase activity by lysophosphatidyl choline, palmitoyl lysophosphatidic acid, monopalmitoyl glycerol, and palmitic acid. Palmitoyl lysophosphatidic acid and fatty acid efficiently inhibited phosphatase activity, suggesting that lysophosphatidic acids (LPAs) are substrates for the phosphatase activity of sEH. As expected, palmitoyl, stearoyl, oleoyl, and arachidonoyl LPAs were efficiently dephosphorylated by sEH (Km, 3–7 μM; Vmax, 150–193 nmol/min/mg). These results suggest that LPAs are substrates of sEH, which may regulate physiological functions of cells via their metabolism. PMID:22217705

  3. Lysophosphatidic acids are new substrates for the phosphatase domain of soluble epoxide hydrolase.

    Science.gov (United States)

    Oguro, Ami; Imaoka, Susumu

    2012-03-01

    Soluble epoxide hydrolase (sEH) is a bifunctional enzyme that has a C-terminus epoxide hydrolase domain and an N-terminus phosphatase domain. The endogenous substrates of epoxide hydrolase are known to be epoxyeicosatrienoic acids, but the endogenous substrates of the phosphatase activity are not well understood. In this study, to explore the substrates of sEH, we investigated the inhibition of the phosphatase activity of sEH toward 4-methylumbelliferyl phosphate by using lecithin and its hydrolyzed products. Although lecithin itself did not inhibit the phosphatase activity, the hydrolyzed lecithin significantly inhibited it, suggesting that lysophospholipid or fatty acid can inhibit it. Next, we investigated the inhibition of phosphatase activity by lysophosphatidyl choline, palmitoyl lysophosphatidic acid, monopalmitoyl glycerol, and palmitic acid. Palmitoyl lysophosphatidic acid and fatty acid efficiently inhibited phosphatase activity, suggesting that lysophosphatidic acids (LPAs) are substrates for the phosphatase activity of sEH. As expected, palmitoyl, stearoyl, oleoyl, and arachidonoyl LPAs were efficiently dephosphorylated by sEH (Km, 3-7 μM; Vmax, 150-193 nmol/min/mg). These results suggest that LPAs are substrates of sEH, which may regulate physiological functions of cells via their metabolism.

  4. Lysophosphatidic acid generation by pulmonary NKT cell ENPP-2/autotaxin exacerbates hyperoxic lung injury.

    Science.gov (United States)

    Nowak-Machen, Martina; Lange, Martin; Exley, Mark; Wu, Sherry; Usheva, Anny; Robson, Simon C

    2015-12-01

    Hyperoxia is still broadly used in clinical practice in order to assure organ oxygenation in critically ill patients, albeit known toxic effects. In this present study, we hypothesize that lysophosphatidic acid (LPA) mediates NKT cell activation in a mouse model of hyperoxic lung injury. In vitro, pulmonary NKT cells were exposed to hyperoxia for 72 h, and the induction of the ectonucleotide pyrophosphatase/phosphodiesterase 2 (ENPP-2) was examined and production of lysophosphatidic acid (LPA) was measured. In vivo, animals were exposed to 100 % oxygen for 72 h and lungs and serum were harvested. Pulmonary NKT cells were then incubated with the LPA antagonist Brp-LPA. Animals received BrP-LPA prior to oxygen exposure. Autotaxin (ATX, ENPP-2) was significantly up-regulated on pulmonary NKT cells after hyperoxia (p NKT cells. LPA levels were significantly reduced by incubating NKT cells with LPA-BrP during oxygen exposure (p NKT cell numbers in vivo. BrP-LPA injection significantly improved survival as well as significantly decreased lung injury and lowered pulmonary NKT cell numbers. We conclude that NKT cell-induced hyperoxic lung injury is mediated by pro-inflammatory LPA generation, at least in part, secondary to ENPP-2 up-regulation on pulmonary NKT cells. Being a potent LPA antagonist, BrP-LPA prevents hyperoxia-induced lung injury in vitro and in vivo.

  5. Proliferation of mouse endometrial stromal cells in culture is highly sensitive to lysophosphatidic acid signaling

    International Nuclear Information System (INIS)

    Aikawa, Shizu; Kano, Kuniyuki; Inoue, Asuka; Aoki, Junken

    2017-01-01

    Endometrial stromal cells (ESCs) proliferate rapidly both in vivo and in vitro. Here we show that proliferation of ESCs in vitro is strongly dependent on lysophosphatidic acid (LPA) signaling. LPA is produced by autotaxin (ATX) and induces various kinds of cellular processes including migration, proliferation and inhibition of cell death possibly through six G protein-coupled receptors (LPA 1-6 ). We found that ESCs proliferated rapidly in vitro in an autocrine manner and that the proliferation was prominently suppressed by either an ATX inhibitor (ONO-8430506) or an LPA 1/3 antagonist (Ki16425). Among the cells lines tested, mouse ESCs were the most sensitive to these inhibitors. Proliferation of ESCs isolated from either LPA 1 - or LPA 3 -deficient mice was comparable to proliferation of ESCs isolated from control mice. An LPA receptor antagonist (AM095), which was revealed to be a dual LPA 1 /LPA 3 antagonist, also suppressed the proliferation of ESCs. The present results show that LPA signaling has a critical role in the proliferation of ESCs, and that this role is possibly mediated redundantly by LPA 1 and LPA 3 . - Highlights: • Uterine endometrial stromal cells (ESCs) proliferate rapidly both in vivo and in vitro. • ESCs proliferated in vitro in an autocrine fashion. • Proliferation of mouse ESCs was prominently suppressed by inhibitors of lysophosphatidic acid (LPA) signaling. • LPA receptors, LPA 1 and LPA 3 , had redundant role in supporting the proliferation of ESCs.

  6. Phosphorylation and Internalization of Lysophosphatidic Acid Receptors LPA1, LPA2, and LPA3.

    Directory of Open Access Journals (Sweden)

    Rocío Alcántara-Hernández

    Full Text Available The lysophosphatidic acid receptors LPA1, LPA2, and LPA3 were individually expressed in C9 cells and their signaling and regulation were studied. Agonist-activation increases intracellular calcium concentration in a concentration-dependent fashion. Phorbol myristate acetate markedly inhibited LPA1- and LPA3-mediated effect, whereas that mediated by LPA2 was only partially diminished; the actions of the phorbol ester were inhibited by bisindolylmaleimide I and by overnight incubation with the protein kinase C activator, which leads to down regulation of this protein kinase. Homologous desensitization was also observed for the three LPA receptors studied, with that of LPA2 receptors being consistently of lesser magnitude; neither inhibition nor down-regulation of protein kinase C exerted any effect on homologous desensitization. Activation of LPA1-3 receptors induced ERK 1/2 phosphorylation; this effect was markedly attenuated by inhibition of epidermal growth factor receptor tyrosine kinase activity, suggesting growth factor receptor transactivation in this effect. Lysophosphatidic acid and phorbol myristate acetate were able to induce LPA1-3 phosphorylation, in time- and concentration-dependent fashions. It was also clearly observed that agonists and protein kinase C activation induced internalization of these receptors. Phosphorylation of the LPA2 subtype required larger concentrations of these agents and its internalization was less intense than that of the other subtypes.Our data show that these three LPA receptors are phosphoproteins whose phosphorylation state is modulated by agonist-stimulation and protein kinase C-activation and that differences in regulation and cellular localization exist, among the subtypes.

  7. Blockade of lysophosphatidic acid receptors LPAR1/3 ameliorates lung fibrosis induced by irradiation

    International Nuclear Information System (INIS)

    Gan, Lu; Xue, Jian-Xin; Li, Xin; Liu, De-Song; Ge, Yan; Ni, Pei-Yan; Deng, Lin; Lu, You; Jiang, Wei

    2011-01-01

    Highlights: → Lysophosphatidic acid (LPA) levels and its receptors LPAR1/3 transcripts were elevated during the development of radiation-induced lung fibrosis. → Lung fibrosis was obviously alleviated in mice treated with the dual LPAR1/3 antagonist, VPC12249. → VPC12249 administration effectively inhibited radiation-induced fibroblast accumulation in vivo, and suppressed LPA-induced fibroblast proliferation in vitro. → LPA-LPAR1/3 signaling regulated TGFβ1 and CTGF expressions in radiation-challenged lungs, but only influenced CTGF expression in cultured fibroblasts. → LPA-LPAR1/3 signaling induced fibroblast proliferation through a CTGF-dependent pathway, rather than through TGFβ1 activation. -- Abstract: Lung fibrosis is a common and serious complication of radiation therapy for lung cancer, for which there are no efficient treatments. Emerging evidence indicates that lysophosphatidic acid (LPA) and its receptors (LPARs) are involved in the pathogenesis of fibrosis. Here, we reported that thoracic radiation with 16 Gy in mice induced development of radiation lung fibrosis (RLF) accompanied by obvious increases in LPA release and LPAR1 and LPAR3 (LPAR1/3) transcripts. RLF was significantly alleviated in mice treated with the dual LPAR1/3 antagonist, VPC12249. VPC12249 administration effectively prolonged animal survival, restored lung structure, inhibited fibroblast accumulation and reduced collagen deposition. Moreover, profibrotic cytokines in radiation-challenged lungs obviously decreased following administration of VPC12249, including transforming growth factor β1 (TGFβ1) and connective tissue growth factor (CTGF). In vitro, LPA induced both fibroblast proliferation and CTGF expression in a dose-dependent manner, and both were suppressed by blockade of LPAR1/3. The pro-proliferative activity of LPA on fibroblasts was inhibited by siRNA directed against CTGF. Together, our data suggest that the LPA-LPAR1/3 signaling system is involved in the

  8. Blockade of lysophosphatidic acid receptors LPAR1/3 ameliorates lung fibrosis induced by irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Gan, Lu [State Key Laboratory of Biotherapy, West China Hospital, Sichuan University, Chengdu (China); Xue, Jian-Xin [Department of Thoracic Oncology, Cancer Center, West China Hospital, Sichuan University, Chengdu (China); Laboratory of Stem Cell Biology, West China Hospital, Sichuan University, Chengdu (China); Li, Xin [Department of Thoracic Oncology, Cancer Center, West China Hospital, Sichuan University, Chengdu (China); Liu, De-Song [Department of Pediatrics, Sichuan Provincial Hospital of Women and Children, Chengdu (China); Ge, Yan; Ni, Pei-Yan; Deng, Lin [State Key Laboratory of Biotherapy, West China Hospital, Sichuan University, Chengdu (China); Lu, You, E-mail: radyoulu@hotmail.com [State Key Laboratory of Biotherapy, West China Hospital, Sichuan University, Chengdu (China); Department of Thoracic Oncology, Cancer Center, West China Hospital, Sichuan University, Chengdu (China); Jiang, Wei, E-mail: wcumsjw72@hotmail.com [State Key Laboratory of Biotherapy, West China Hospital, Sichuan University, Chengdu (China); Molecular Medicine Research Center, West China Hospital, Sichuan University, Chengdu (China)

    2011-05-27

    Highlights: {yields} Lysophosphatidic acid (LPA) levels and its receptors LPAR1/3 transcripts were elevated during the development of radiation-induced lung fibrosis. {yields} Lung fibrosis was obviously alleviated in mice treated with the dual LPAR1/3 antagonist, VPC12249. {yields} VPC12249 administration effectively inhibited radiation-induced fibroblast accumulation in vivo, and suppressed LPA-induced fibroblast proliferation in vitro. {yields} LPA-LPAR1/3 signaling regulated TGF{beta}1 and CTGF expressions in radiation-challenged lungs, but only influenced CTGF expression in cultured fibroblasts. {yields} LPA-LPAR1/3 signaling induced fibroblast proliferation through a CTGF-dependent pathway, rather than through TGF{beta}1 activation. -- Abstract: Lung fibrosis is a common and serious complication of radiation therapy for lung cancer, for which there are no efficient treatments. Emerging evidence indicates that lysophosphatidic acid (LPA) and its receptors (LPARs) are involved in the pathogenesis of fibrosis. Here, we reported that thoracic radiation with 16 Gy in mice induced development of radiation lung fibrosis (RLF) accompanied by obvious increases in LPA release and LPAR1 and LPAR3 (LPAR1/3) transcripts. RLF was significantly alleviated in mice treated with the dual LPAR1/3 antagonist, VPC12249. VPC12249 administration effectively prolonged animal survival, restored lung structure, inhibited fibroblast accumulation and reduced collagen deposition. Moreover, profibrotic cytokines in radiation-challenged lungs obviously decreased following administration of VPC12249, including transforming growth factor {beta}1 (TGF{beta}1) and connective tissue growth factor (CTGF). In vitro, LPA induced both fibroblast proliferation and CTGF expression in a dose-dependent manner, and both were suppressed by blockade of LPAR1/3. The pro-proliferative activity of LPA on fibroblasts was inhibited by siRNA directed against CTGF. Together, our data suggest that the LPA-LPAR1

  9. Toluene diisocyanate: Induction of the autotaxin-lysophosphatidic acid axis and its association with airways symptoms

    Energy Technology Data Exchange (ETDEWEB)

    Broström, Julia M. [Division of Occupational and Environmental Medicine, Lund University, SE 221 85 Lund (Sweden); Ye, Zhi-wei [Institute of Environmental Medicine, Karolinska Institutet, Box 210, SE 171 77 Stockholm (Sweden); Axmon, Anna; Littorin, Margareta; Tinnerberg, Håkan; Lindh, Christian H. [Division of Occupational and Environmental Medicine, Lund University, SE 221 85 Lund (Sweden); Zheng, Huiyuan; Ghalali, Aram; Stenius, Ulla [Institute of Environmental Medicine, Karolinska Institutet, Box 210, SE 171 77 Stockholm (Sweden); Jönsson, Bo A.G. [Division of Occupational and Environmental Medicine, Lund University, SE 221 85 Lund (Sweden); Högberg, Johan, E-mail: johan.hogberg@ki.se [Institute of Environmental Medicine, Karolinska Institutet, Box 210, SE 171 77 Stockholm (Sweden)

    2015-09-15

    Diisocyanates are industrial chemicals which have a wide range of applications in developed and developing countries. They are notorious lung toxicants and respiratory sensitizers. However, the mechanisms behind their adverse effects are not adequately characterized. Autotaxin (ATX) is an enzyme producing lysophosphatidic acid (LPA), and the ATX-LPA axis has been implicated in lung related inflammatory conditions and diseases, including allergic asthma, but not to toxicity of environmental low-molecular-weight chemicals. We investigated effects of toluene diisocyanate (TDI) on ATX induction in human lung epithelial cell models, and we correlated LPA-levels in plasma to biomarkers of TDI exposure in urine collected from workers exposed to < 5 ppb (parts per billion). Information on workers' symptoms was collected through interviews. One nanomolar TDI robustly induced ATX release within 10 min in vitro. A P2X7- and P2X4-dependent microvesicle formation was implicated in a rapid ATX release and a subsequent protein synthesis. Co-localization between purinergic receptors and ATX was documented by immunofluorescence and confocal microscopy. The release was modulated by monocyte chemoattractant protein-1 (MCP-1) and by extracellular ATP. In workers, we found a dose–response relationship between TDI exposure biomarkers in urine and LPA levels in plasma. Among symptomatic workers reporting “sneezing”, the LPA levels were higher than among non-symptomatic workers. This is the first report indicating induction of the ATX-LPA axis by an environmental low-molecular-weight chemical, and our data suggest a role for the ATX-LPA axis in TDI toxicity. - Highlights: • Human epithelial cells release autotaxin in response to 1 nM toluene diisocyanate (TDI). • The release involves P2X4 and P2X7 receptors and is modulated by ATP and MCP-1. • Lysophosphatidic acid (LPA) was measured in workers exposed to < 5 ppb TDI. • LPA in plasma correlated to TDI exposure

  10. Genetic basis for correction of very-long-chain acyl-coenzyme A dehydrogenase deficiency by bezafibrate in patient fibroblasts

    DEFF Research Database (Denmark)

    Gobin-Limballe, S; Djouadi, F; Aubey, F

    2007-01-01

    there is no established treatment. Recent data suggest that bezafibrate could improve the FAO capacities in beta-oxidation-deficient cells, by enhancing the residual level of mutant enzyme activity via gene-expression stimulation. Since VLCAD-deficient patients frequently harbor missense mutations with unpredictable...... values, for 21 genotypes that mainly corresponded to patients with the myopathic phenotype. In contrast, bezafibrate induced no changes in FAO for 11 genotypes corresponding to severe neonatal or infantile phenotypes. This pattern of response was not due to differential inductions of VLCAD messenger RNA......, as shown by quantitative real-time polymerase chain reaction, but reflected variable increases in measured VLCAD residual enzyme activity in response to bezafibrate. Genotype cross-analysis allowed the identification of alleles carrying missense mutations, which could account for these different...

  11. Ethylmalonic aciduria is associated with an amino acid variant of short chain acyl-coenzyme A dehydrogenase

    DEFF Research Database (Denmark)

    Corydon, M J; Gregersen, N; Lehnert, W

    1996-01-01

    Ethylmalonic aciduria is a common biochemical finding in patients with inborn errors of short chain fatty acid beta-oxidation. The urinary excretion of ethylmalonic acid (EMA) may stem from decreased oxidation by short chain acyl-CoA dehydrogenase (SCAD) of butyryl-CoA, which is alternatively...

  12. Sunflower (Helianthus annuus) long-chain acyl-coenzyme A synthetases expressed at high levels in developing seeds.

    Science.gov (United States)

    Aznar-Moreno, Jose A; Venegas Calerón, Mónica; Martínez-Force, Enrique; Garcés, Rafael; Mullen, Robert; Gidda, Satinder K; Salas, Joaquín J

    2014-03-01

    Long chain fatty acid synthetases (LACSs) activate the fatty acid chains produced by plastidial de novo biosynthesis to generate acyl-CoA derivatives, important intermediates in lipid metabolism. Oilseeds, like sunflower, accumulate high levels of triacylglycerols (TAGs) in their seeds to nourish the embryo during germination. This requires that sunflower seed endosperm supports very active glycerolipid synthesis during development. Sunflower seed plastids produce large amounts of fatty acids, which must be activated through the action of LACSs, in order to be incorporated into TAGs. We cloned two different LACS genes from developing sunflower endosperm, HaLACS1 and HaLACS2, which displayed sequence homology with Arabidopsis LACS9 and LACS8 genes, respectively. These genes were expressed at high levels in developing seeds and exhibited distinct subcellular distributions. We generated constructs in which these proteins were fused to green fluorescent protein and performed transient expression experiments in tobacco cells. The HaLACS1 protein associated with the external envelope of tobacco chloroplasts, whereas HaLACS2 was strongly bound to the endoplasmic reticulum. Finally, both proteins were overexpressed in Escherichia coli and recovered as active enzymes in the bacterial membranes. Both enzymes displayed similar substrate specificities, with a very high preference for oleic acid and weaker activity toward stearic acid. On the basis of our findings, we discuss the role of these enzymes in sunflower oil synthesis. © 2013 Scandinavian Plant Physiology Society.

  13. Involvement of the lysophosphatidic acid-generating enzyme autotaxin in lymphocyte-endothelial cell interactions.

    Science.gov (United States)

    Nakasaki, Tae; Tanaka, Toshiyuki; Okudaira, Shinichi; Hirosawa, Michi; Umemoto, Eiji; Otani, Kazuhiro; Jin, Soojung; Bai, Zhongbin; Hayasaka, Haruko; Fukui, Yoshinori; Aozasa, Katsuyuki; Fujita, Naoya; Tsuruo, Takashi; Ozono, Keiichi; Aoki, Junken; Miyasaka, Masayuki

    2008-11-01

    Autotaxin (ATX) is a secreted protein with lysophospholipase D activity that generates lysophosphatidic acid (LPA) from lysophosphatidylcholine. Here we report that functional ATX is selectively expressed in high endothelial venules (HEVs) of both lymph nodes and Peyer's patches. ATX expression was developmentally regulated and coincided with lymphocyte recruitment to the lymph nodes. In adults, ATX expression was independent of HEV-expressed chemokines such as CCL21 and CXCL13, innate immunity signals including those via TLR4 or MyD88, and of the extent of lymphocyte trafficking across the HEVs. ATX expression was induced in venules at sites of chronic inflammation. Receptors for the ATX enzyme product LPA were constitutively expressed in HEV endothelial cells (ECs). In vitro, LPA induced strong morphological changes in HEV ECs. Forced ATX expression caused cultured ECs to respond to lysophosphatidylcholine, up-regulating lymphocyte binding to the ECs in a LPA receptor-dependent manner under both static and flow conditions. Although in vivo depletion of circulating ATX did not affect lymphocyte trafficking into the lymph nodes, we surmise, based on the above data, that ATX expressed by HEVs acts on HEVs in situ to facilitate lymphocyte binding to ECs and that ATX in the general circulation does not play a major role in this process. Tissue-specific inactivation of ATX will verify this hypothesis in future studies of its mechanism of action.

  14. Lysophosphatidic Acid Upregulates Laminin-332 Expression during A431 Cell Colony Dispersal

    Directory of Open Access Journals (Sweden)

    Hironobu Yamashita

    2010-01-01

    Full Text Available Lysophosphatidic acid (LPA is a bioactive phospholipid that affects various biological functions, such as cell proliferation, migration, survival, wound healing, and tumor invasion through LPA receptors. Previously, we reported that LPA induces A431 colony dispersal, accompanied by disruption of cell-cell contacts and cell migration. However, it remains unclear how LPA affects cell migration and gene expression during A431 colony dispersal. In this paper, we performed cDNA microarray analysis to investigate this question by comparing gene expression between untreated and LPA-treated A431 cells. Interestingly, these results revealed that LPA treatment upregulates several TGF-β1 target genes, including laminin-332 (Ln-332 components (α3, β3, and γ2 chains. Western blot analysis also showed that LPA increased phosphorylation of Smad2, an event that is carried out by TGF-β1 interactions. Among the genes upregulated, we further addressed the role of Ln-332. Real-time PCR analysis confirmed the transcriptional upregulation of all α3, β3, and γ2 chains of Ln-332 by LPA, corresponding to the protein level increases revealed by western blot. Further, the addition of anti-Ln-332 antibody prevented LPA-treated A431 colonies from dispersing. Taken together, our results suggest that LPA-induced Ln-332 plays a significant role in migration of individual cells from A431 colonies.

  15. 1-Oleoyl lysophosphatidic acid: a new mediator of emotional behavior in rats.

    Directory of Open Access Journals (Sweden)

    Estela Castilla-Ortega

    Full Text Available The role of lysophosphatidic acid (LPA in the control of emotional behavior remains to be determined. We analyzed the effects of the central administration of 1-oleoyl-LPA (LPA 18∶1 in rats tested for food consumption and anxiety-like and depression-like behaviors. For this purpose, the elevated plus-maze, open field, Y maze, forced swimming and food intake tests were performed. In addition, c-Fos expression in the dorsal periaqueductal gray matter (DPAG was also determined. The results revealed that the administration of LPA 18∶1 reduced the time in the open arms of the elevated plus-maze and induced hypolocomotion in the open field, suggesting an anxiogenic-like phenotype. Interestingly, these effects were present following LPA 18∶1 infusion under conditions of novelty but not under habituation conditions. In the forced swimming test, the administration of LPA 18∶1 dose-dependently increased depression-like behavior, as evaluated according to immobility time. LPA treatment induced no effects on feeding. However, the immunohistochemical analysis revealed that LPA 18∶1 increased c-Fos expression in the DPAG. The abundant expression of the LPA1 receptor, one of the main targets for LPA 18∶1, was detected in this brain area, which participates in the control of emotional behavior, using immunocytochemistry. These findings indicate that LPA is a relevant transmitter potentially involved in normal and pathological emotional responses, including anxiety and depression.

  16. Biofunctionalized Lysophosphatidic Acid/Silk Fibroin Film for Cornea Endothelial Cell Regeneration

    Science.gov (United States)

    Jeon, Hayan; Oliveira, Joaquim Miguel; Reis, Rui Luis; Khang, Gilson

    2018-01-01

    Cornea endothelial cells (CEnCs) tissue engineering is a great challenge to repair diseased or damaged CEnCs and require an appropriate biomaterial to support cell proliferation and differentiation. Biomaterials for CEnCs tissue engineering require biocompatibility, tunable biodegradability, transparency, and suitable mechanical properties. Silk fibroin-based film (SF) is known to meet these factors, but construction of functionalized graft for bioengineering of cornea is still a challenge. Herein, lysophosphatidic acid (LPA) is used to maintain and increase the specific function of CEnCs. The LPA and SF composite film (LPA/SF) was fabricated in this study. Mechanical properties and in vitro studies were performed using a rabbit model to demonstrate the characters of LPA/SF. ATR-FTIR was characterized to identify chemical composition of the films. The morphological and physical properties were performed by SEM, AFM, transparency, and contact angle. Initial cell density and MTT were performed for adhesion and cell viability in the SF and LPA/SF film. Reverse transcription polymerase chain reactions (RT-PCR) and immunofluorescence were performed to examine gene and protein expression. The results showed that films were designed appropriately for CEnCs delivery. Compared to pristine SF, LPA/SF showed higher biocompatibility, cell viability, and expression of CEnCs specific genes and proteins. These indicate that LPA/SF, a new biomaterial, offers potential benefits for CEnCs tissue engineering for regeneration. PMID:29710848

  17. Lysophosphatidic Acid Disrupts Junctional Integrity and Epithelial Cohesion in Ovarian Cancer Cells

    Directory of Open Access Journals (Sweden)

    Yueying Liu

    2012-01-01

    Full Text Available Ovarian cancer metastasizes via exfoliation of free-floating cells and multicellular aggregates from the primary tumor to the peritoneal cavity. A key event in EOC metastasis is disruption of cell-cell contacts via modulation of intercellular junctional components including cadherins. Ascites is rich in lysophosphatidic acid (LPA, a bioactive lipid that may promote early events in ovarian cancer dissemination. The objective of this paper was to assess the effect of LPA on E-cadherin junctional integrity. We report a loss of junctional E-cadherin in OVCAR3, OVCA429, and OVCA433 cells exposed to LPA. LPA-induced loss of E-cadherin was concentration and time dependent. LPA increased MMP-9 expression and promoted MMP-9-catalyzed E-cadherin ectodomain shedding. Blocking LPA receptor signaling inhibited MMP-9 expression and restored junctional E-cadherin staining. LPA-treated cells demonstrated a significant decrease in epithelial cohesion. Together these data support a model wherein LPA induces MMP-9 expression and MMP-9-catalyzed E-cadherin ectodomain shedding, resulting in loss of E-cadherin junctional integrity and epithelial cohesion, facilitating metastatic dissemination of ovarian cancer cells.

  18. Lysophosphatidic acid-functionalised titanium as a superior surface for supporting human osteoblast (MG63 maturation

    Directory of Open Access Journals (Sweden)

    JP Mansell

    2012-05-01

    Full Text Available Covalent modifications of titanium with small molecules known to promote human osteoblast maturation are especially attractive in developing superior biomaterials. An important step in securing competent bone formation at implant sites is promoting the formation of mature osteoblasts, either from committed pre-osteoblasts or from their mesenchymal progenitors. To this end our research has focussed on identifying molecules that enhance human osteoblast formation and maturation and to develop ways of covalently attaching these molecules to implant surfaces so that they are more likely to withstand the rigors of the implantation process whilst still retaining their bioactivity. Herein we report the novel production of lipid-functionalised titanium using lysophosphatidic acid or a related compound, (3S 1-fluoro-3-hydroxy-4-butyl-1-phosphonate. Both lipids were especially effective at co-operating with calcitriol to promote human osteoblast maturation at these modified Ti surfaces in vitro. The novel findings presented offer enticing new developments towards the fabrication of next-generation implant devices with the potential to significantly enhance the osseointegration process and with it improvements in future prosthesis performance and longevity.

  19. Lysophosphatidic acid stimulates thrombomodulin lectin-like domain shedding in human endothelial cells

    International Nuclear Information System (INIS)

    Wu Hualin; Lin ChiIou; Huang Yuanli; Chen, Pin-Shern; Kuo, Cheng-Hsiang; Chen, Mei-Shing; Wu, G.C.-C.; Shi, G.-Y.; Yang, H.-Y.; Lee Hsinyu

    2008-01-01

    Thrombomodulin (TM) is an anticoagulant glycoprotein highly expressed on endothelial cell surfaces. Increased levels of soluble TM in circulation have been widely accepted as an indicator of endothelial damage or dysfunction. Previous studies indicated that various proinflammatory factors stimulate TM shedding in various cell types such as smooth muscle cells and epithelial cells. Lysophosphatidic acid (LPA) is a bioactive lipid mediator present in biological fluids during endothelial damage or injury. In the present study, we first observed that LPA triggered TM shedding in human umbilical vein endothelial cells (HUVECs). By Cyflow analysis, we showed that the LPA-induced accessibility of antibodies to the endothelial growth factor (EGF)-like domain of TM is independent of matrix metalloproteinases (MMPs), while LPA-induced TM lectin-like domain shedding is MMP-dependent. Furthermore, a stable cell line expressing TM without its lectin-like domain exhibited a higher cell proliferation rate than a stable cell line expressing full-length TM. These results imply that LPA induces TM lectin-like domain shedding, which might contribute to the exposure of its EGF-like domain for EGF receptor (EGFR) binding, thereby stimulating subsequent cell proliferation. Based on our findings, we propose a novel mechanism for the exposure of TM EGF-like domain, which possibly mediates LPA-induced EGFR transactivation

  20. Ginseng pharmacology: a new paradigm based on gintonin-lysophosphatidic acid receptor interactions

    Directory of Open Access Journals (Sweden)

    Seung-Yeol eNah

    2015-10-01

    Full Text Available Ginseng, the root of Panax ginseng, is used as a traditional medicine. Despite the long history of the use of ginseng, there is no specific scientific or clinical rationale for ginseng pharmacology besides its application as a general tonic. The ambiguous description of ginseng pharmacology might be due to the absence of a predominant active ingredient that represents ginseng pharmacology. Recent studies show that ginseng abundantly contains lysophosphatidic acids (LPAs, which are phospholipid-derived growth factor with diverse biological functions including those claimed to be exhibited by ginseng. LPAs in ginseng form a complex with ginseng proteins, which can bind and deliver LPA to its cognate receptors with a high affinity. As a first messenger, gintonin produces second messenger Ca2+ via G protein-coupled LPA receptors. Ca2+ is an intracellular mediator of gintonin and initiates a cascade of amplifications for further intercellular communications by activation of Ca2+-dependent kinases, receptors, gliotransmitter and neurotransmitter release. Ginsenosides, which have been regarded as primary ingredients of ginseng, cannot elicit intracellular [Ca2+]i transients, since they lack specific cell surface receptor. However, ginsenosides exhibit non-specific ion channel and receptor regulations. This is the key characteristic that distinguishes gintonin from ginsenosides. Although the current discourse on ginseng pharmacology is focused on ginsenosides, gintonin can definitely provide a mode of action for ginseng pharmacology that ginsenosides cannot. This review article introduces a novel concept of ginseng ligand-LPA receptor interaction and proposes to establish a paradigm that shifts the focus from ginsenosides to gintonin as a major ingredient representing ginseng pharmacology.

  1. Autotaxin-lysophosphatidic acid axis is a novel molecular target for lowering intraocular pressure.

    Directory of Open Access Journals (Sweden)

    Padma Iyer

    Full Text Available Primary open-angle glaucoma is the second leading cause of blindness in the United States and is commonly associated with elevated intraocular pressure (IOP resulting from diminished aqueous humor (AH drainage through the trabecular pathway. Developing effective therapies for increased IOP in glaucoma patients requires identification and characterization of molecular mechanisms that regulate IOP and AH outflow. This study describes the identification and role of autotaxin (ATX, a secretory protein and a major source for extracellular lysophosphatidic acid (LPA, in regulation of IOP in a rabbit model. Quantitative proteomics analysis identified ATX as an abundant protein in both human AH derived from non-glaucoma subjects and in AH from different animal species. The lysophospholipase D (LysoPLD activity of ATX was found to be significantly elevated (by ∼1.8 fold; n=20 in AH derived from human primary open angle glaucoma patients as compared to AH derived from age-matched cataract control patients. Immunoblotting analysis of conditioned media derived from primary cultures of human trabecular meshwork (HTM cells has confirmed secretion of ATX and the ability of cyclic mechanical stretch of TM cells to increase the levels of secreted ATX. Topical application of a small molecular chemical inhibitor of ATX (S32826, which inhibited AH LysoPLD activity in vitro (by >90%, led to a dose-dependent and significant decrease of IOP in Dutch-Belted rabbits. Single intracameral injection of S32826 (∼2 µM led to significant reduction of IOP in rabbits, with the ocular hypotensive response lasting for more than 48 hrs. Suppression of ATX expression in HTM cells using small-interfering RNA (siRNA caused a decrease in actin stress fibers and myosin light chain phosphorylation. Collectively, these observations indicate that the ATX-LPA axis represents a potential therapeutic target for lowering IOP in glaucoma patients.

  2. Lysophosphatidic acid rescues bone mesenchymal stem cells from hydrogen peroxide-induced apoptosis.

    Science.gov (United States)

    Wang, Xian-Yun; Fan, Xue-Song; Cai, Lin; Liu, Si; Cong, Xiang-Feng; Chen, Xi

    2015-03-01

    The increase of reactive oxygen species in infracted heart significantly reduces the survival of donor mesenchymal stem cells, thereby attenuating the therapeutic efficacy for myocardial infarction. In our previous study, we demonstrated that lysophosphatidic acid (LPA) protects bone marrow-derived mesenchymal stem cells (BMSCs) against hypoxia and serum deprivation-induced apoptosis. However, whether LPA protects BMSCs from H2O2-induced apoptosis was not examined. In this study, we report that H2O2 induces rat BMSC apoptosis whereas LPA pre-treatment effectively protects BMSCs from H2O2-induced apoptosis. LPA protection of BMSC from the induced apoptosis is mediated mostly through LPA3 receptor. Furthermore, we found that membrane G protein Gi2 and Gi3 are involved in LPA-elicited anti-apoptotic effects through activation of ERK1/2- and PI3 K-pathways. Additionally, H2O2 increases levels of type II of light chain 3B (LC3B II), an autophagy marker, and H2O2-induced autophagy thus protected BMSCs from apoptosis. LPA further increases the expression of LC3B II in the presence of H2O2. In contrast, autophagy flux inhibitor bafilomycin A1 has no effect on LPA's protection of BMSC from H2O2-induced apoptosis. Taken together, our data suggest that LPA rescues H2O2-induced apoptosis mainly by interacting with Gi-coupled LPA3, resulting activation of the ERK1/2- and PI3 K/AKT-pathways and inhibition caspase-3 cleavage, and LPA protection of BMSCs against the apoptosis is independent of it induced autophagy.

  3. Lysophosphatidic acid induces expression of genes in human oral keratinocytes involved in wound healing.

    Science.gov (United States)

    Thorlakson, Hong Huynh; Engen, Stian Andre; Schreurs, Olav; Schenck, Karl; Blix, Inger Johanne Schytte

    2017-08-01

    Epithelial cells participate in wound healing by covering wounds, but also as important mediators of wound healing processes. Topical application of the phospholipid growth factor lysophosphatidic acid (LPA) accelerates dermal wound healing and we hypothesized that LPA can play a role in human oral wound healing through its effects on human oral keratinocytes (HOK). HOK were isolated from gingival biopsies and exposed to LPA. The LPA receptor profile, signal transduction pathways, gene expression and secretion of selected cytokines were analyzed. HOK expressed the receptors LPA 1 , LPA 5 and LPA 6 and LPA activated the ERK1/2, JNK and p38 intracellular pathways, substantiated by secretion of IL-6 and IL-8. The early (2h) and intermediate (6h) gene expression profiles of HOK after LPA treatment showed a wide array of regulated genes. The majority of the strongest upregulated genes were related to chemotaxis and inflammation, and became downregulated after 6h. At 6h, genes coding for factors involved in extracellular matrix remodeling and re-epithelialization became highly expressed. IL-36γ, not earlier known to be regulated by LPA, was strongly transcribed and translated but not secreted. After stimulation with LPA, HOK responded by regulating factors and genes that are essential in wound healing processes. As LPA is found in saliva and is released by activated cells after wounding, our results indicate that LPA has a favorable physiological role in oral wound healing. This may further point towards a beneficial role for application of LPA on oral surgical or chronic wounds. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Lysophosphatidic Acid Level and the Incidence of Silent Brain Infarction in Patients with Nonvalvular Atrial Fibrillation

    Directory of Open Access Journals (Sweden)

    Li Zhou

    2010-10-01

    Full Text Available Lysophosphatidic acid (LPA, which is proposed to play an important role in normal physiological situations such as wound healing, vascular tone, vascular integrity and reproduction, may be involved in the etiology of some diseases such as atherosclerosis, cancer, obesity or myocardial infarction. Abnormal findings, including silent brain infarction (SBI, are frequently observed by magnetic resonance imaging (MRI in patients with nonvalvular atrial fibrillation (NVAF. However, whether there is a relationship between LPA level and the prevalence of SBI has not been extensively studied. In the present study, the association between them was investigated. 235 patients with NVAF, 116 cases of SBI without NVAF and 120 cases of healthy volunteers (control group, who did not receive any antithrombotic therapy, were enrolled in this study. Plasma LPA levels in the NVAF with SBI group were significantly higher than that in the control group (p < 0.01, NVAF without SBI group (p < 0.01 and SBI without NVAF group (p < 0.01. The LPA levels are lower in the control group than in the NVAF without SBI and SBI without NVAF groups (p < 0.01, however, the latter two groups did not significantly differ from each other for LPA levels (p > 0.05 There were significant differences in the positive rate of platelet activation between each of the groups (p < 0.01. The positive rate of platelet activation was significantly higher in the NVAF with SBI group. We suggest that LPA might be a novel marker for estimation of the status of platelet activation and the risk factor for SBI onset in NVAF patients. We expected that plasma LPA levels could predict the occurrence of SBI in NVAF patients.

  5. Lysophosphatidic acid acyltransferase β (LPAATβ promotes the tumor growth of human osteosarcoma.

    Directory of Open Access Journals (Sweden)

    Farbod Rastegar

    2010-12-01

    Full Text Available Osteosarcoma is the most common primary malignancy of bone with poorly characterized molecular pathways important in its pathogenesis. Increasing evidence indicates that elevated lipid biosynthesis is a characteristic feature of cancer. We sought to investigate the role of lysophosphatidic acid acyltransferase β (LPAATβ, aka, AGPAT2 in regulating the proliferation and growth of human osteosarcoma cells. LPAATβ can generate phosphatidic acid, which plays a key role in lipid biosynthesis as well as in cell proliferation and survival. Although elevated expression of LPAATβ has been reported in several types of human tumors, the role of LPAATβ in osteosarcoma progression has yet to be elucidated.Endogenous expression of LPAATβ in osteosarcoma cell lines is analyzed by using semi-quantitative PCR and immunohistochemical staining. Adenovirus-mediated overexpression of LPAATβ and silencing LPAATβ expression is employed to determine the effect of LPAATβ on osteosarcoma cell proliferation and migration in vitro and osteosarcoma tumor growth in vivo. We have found that expression of LPAATβ is readily detected in 8 of the 10 analyzed human osteosarcoma lines. Exogenous expression of LPAATβ promotes osteosarcoma cell proliferation and migration, while silencing LPAATβ expression inhibits these cellular characteristics. We further demonstrate that exogenous expression of LPAATβ effectively promotes tumor growth, while knockdown of LPAATβ expression inhibits tumor growth in an orthotopic xenograft model of human osteosarcoma.Our results strongly suggest that LPAATβ expression may be associated with the aggressive phenotypes of human osteosarcoma and that LPAATβ may play an important role in regulating osteosarcoma cell proliferation and tumor growth. Thus, targeting LPAATβ may be exploited as a novel therapeutic strategy for the clinical management of osteosarcoma. This is especially attractive given the availability of selective

  6. Lysophosphatidic acid directly induces macrophage-derived foam cell formation by blocking the expression of SRBI.

    Science.gov (United States)

    Chen, Linmu; Zhang, Jun; Deng, Xiao; Liu, Yan; Yang, Xi; Wu, Qiong; Yu, Chao

    2017-09-23

    The leading cause of morbidity and mortality is the result of cardiovascular disease, mainly atherosclerosis. The formation of macrophage foam cells by ingesting ox-LDL and focal retention in the subendothelial space are the hallmarks of the early atherosclerotic lesion. Lysophosphatidic acid (LPA), which is a low-molecular weight lysophospholipid enriched in oxidized LDL, exerts a range of effects on the cardiovascular system. Previous reports show that LPA increases the uptake of ox-LDL to promote the formation of foam cells. However, as the most active component of ox-LDL, there is no report showing whether LPA directly affects foam cell formation. The aim of this study was to investigate the effects of LPA on foam cell formation, as well as to elucidate the underlying mechanism. Oil red O staining and a Cholesterol/cholesteryl ester quantitation assay were used to evaluate foam cell formation in Raw264.7 macrophage cells. We utilized a Western blot and RT-PCR to investigate the relationship between LPA receptors and lipid transport related proteins. We found that LPA promoted foam cell formation, using 200 μM for 24 h. Meanwhile, the expression of the Scavenger receptor BI (SRBI), which promotes the efflux of free cholesterol, was decreased. Furthermore, the LPA 1/3 receptor antagonist Ki16425 significantly abolished the LPA effects, indicating that LPA 1/3 was involved in the foam cell formation and SRBI expression induced by LPA. Additionally, the LPA-induced foam cell formation was blocked with an AKT inhibitor. Our results suggest that LPA-enhanced foam cell formation is mediated by LPA 1/3 -AKT activation and subsequent SRBI expression. Copyright © 2017. Published by Elsevier Inc.

  7. Lysophosphatidic acid (LPA) effects on endometrial carcinoma in vitro proliferation, invasion, and matrix metalloproteinase activity.

    Science.gov (United States)

    Wang, Feng-qiang; Ariztia, Edgardo V; Boyd, Leslie R; Horton, Faith R; Smicun, Yoel; Hetherington, Jessica A; Smith, Phillip J; Fishman, David A

    2010-04-01

    Lysophosphatidic acid (LPA) has potent growth-regulatory effect in many cell types and has been linked to the in vivo tumor growth and metastasis in several malignancies. The goal of this study was to assess the regulation of (EC) microenvironment by LPA through the examination of its effect on cell proliferation, migration, invasion, uPA activity, and matrix metalloproteinase (MMP) secretion/activation. All experiments were performed in vitro using an EC cell line, HEC-1A. Cell proliferation was determined using the Promega MTS proliferation assay following 48 h of exposures to different concentrations of LPA (0.1, 1.0 and 10.0 microM). Cell invasion was assessed using a modified Boyden chamber assay with collagen I coated on the membrane. HEC-1A motility was examined by Boyden chamber migration assay as well as the scratch wound closure assay on type I collagen. MMP secretion/activation in HEC-1A conditioned medium was detected by gelatin zymography. MMP-7 mRNA expression was determined using real-time PCR. uPA activity was measured using a coupled colorimetric assay. LPA, at the concentrations of 0.1 and 1.0 microM, significantly induced the proliferation of HEC-1A cells (p0.05). Gelatin zymogram showed that HEC-1A cells secreted high levels of MMP-7, while MMP-2 and MMP-9 are barely detectable. In addition, LPA significantly enhanced uPA activity in HEC-1A conditioned medium in a concentration-dependent manner. LPA is a potent modulator of cellular proliferation and invasion for EC cells. It also has the capacity to stimulate the secretion/activity of uPA and MMP-7. Those results suggest that LPA is a bioactive modulator of EC microenvironment and may have a distinct regulation mechanism as observed in epithelial ovarian cancer. Copyright 2009. Published by Elsevier Inc.

  8. Lysophosphatidic acid induces chemotaxis in MC3T3-E1 osteoblastic cells

    Energy Technology Data Exchange (ETDEWEB)

    Masiello, Lisa M.; Fotos, Joseph S.; Galileo, Deni S.; Karin, Norm J.

    2006-07-01

    Lysophosphatidic acid (LPA) is a bioactive lipid that has pleiotropic effects on a variety of cell types and enhances the migration of endothelial and cancer cells, but it is not known if this lipid can alter osteoblast motility. We performed transwell migration assays using MC3T3-E1 osteoblastic cells and found LPA to be a potent chemotactic agent. Quantitative time-lapse video analysis of osteoblast migration after wounds were introduced into cell monolayers indicated that LPA stimulated both migration velocity and the average migration distance per cell. LPA also elicited substantial changes in cell shape and actin cytoskeletal structure; lipid-treated cells contained fewer stress fibers and displayed long membrane processes that were enriched in F-actin. Quantitative RT-PCR analysis showed that MC3T3-E1 cells express all four known LPA-specific G protein-coupled receptors (LPA1-LPA4) with a relative mRNA abundance of LPA1 > LPA4 > LPA2 >> LPA3. LPA-induced changes in osteoblast motility and morphology were antagonized by both pertussis toxin and Ki16425, a subtype-specific blocker of LPA1 and LPA3 receptor function. Cell migration in many cell types is linked to changes in intracellular Ca2+. Ki16425 also inhibited LPA-induced Ca2+ signaling in a dose-dependent manner, suggesting a link between LPA-induced Ca2+ transients and osteoblast chemotaxis. Our data show that LPA stimulates MC3T3-E1 osteoblast motility via a mechanism that is linked primarily to the G protein-coupled receptor LPA1.

  9. Bovine ovarian follicular growth and development correlate with lysophosphatidic acid expression.

    Science.gov (United States)

    Sinderewicz, Emilia; Grycmacher, Katarzyna; Boruszewska, Dorota; Kowalczyk-Zięba, Ilona; Staszkiewicz, Joanna; Ślężak, Tomasz; Woclawek-Potocka, Izabela

    2018-01-15

    The basis of successful reproduction is proper ovarian follicular growth and development. In addition to prostaglandins and vascular endothelial growth factor, a number of novel factors are suggested as important regulators of follicular growth and development: PGES, TFG, CD36, RABGAP1, DBI and BTC. This study focuses on examining the expression of these factors in granulosa and thecal cells that originate from different ovarian follicle types and their link with the expression of lysophosphatidic acid (LPA), known local regulator of reproductive functions in the cow. Ovarian follicles were divided into healthy, transitional, and atretic categories. The mRNA expression levels for PGES, TFG, CD36, RABGAP1, DBI and BTC in granulosa and thecal cells in different follicle types were measured by real-time PCR. The correlations among expression of enzymes synthesizing LPA (autotaxin, phospholipase A2), receptors for LPA and examined factors were measured. Immunolocalization of PGES, TFG, CD36, RABGAP1, DBI and BTC was examined by immunohistochemistry. We investigated follicle-type dependent mRNA expression of factors potentially involved in ovarian follicular growth and development, both in granulosa and thecal cells of bovine ovarian follicles. Strong correlations among receptors for LPA, enzymes synthesizing LPA, and the examined factors in healthy and transitional follicles were observed, with its strongest interconnection with TFG, DBI and RABGAP1 in granulosa cells, and TFG in thecal cells; whereas no correlations in atretic follicles were detected. A greater number of correlations were found in thecal cells than in granulosa cells as well as in healthy follicles than in transitional follicles. These data indicate the role of LPA in the growth, development and physiology of the bovine ovarian follicle. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Lysophosphatidic acid receptor-5 negatively regulates cellular responses in mouse fibroblast 3T3 cells

    Energy Technology Data Exchange (ETDEWEB)

    Dong, Yan; Hirane, Miku; Araki, Mutsumi [Division of Cancer Biology and Bioinformatics, Department of Life Science, Faculty of Science and Engineering, Kinki University, 3-4-1, Kowakae, Higashiosaka, Osaka 577-8502 (Japan); Fukushima, Nobuyuki [Division of Molecular Neurobiology, Department of Life Science, Faculty of Science and Engineering, Kinki University, 3-4-1, Kowakae, Higashiosaka, Osaka 577-8502 (Japan); Tsujiuchi, Toshifumi, E-mail: ttujiuch@life.kindai.ac.jp [Division of Cancer Biology and Bioinformatics, Department of Life Science, Faculty of Science and Engineering, Kinki University, 3-4-1, Kowakae, Higashiosaka, Osaka 577-8502 (Japan)

    2014-04-04

    Highlights: • LPA{sub 5} inhibits the cell growth and motile activities of 3T3 cells. • LPA{sub 5} suppresses the cell motile activities stimulated by hydrogen peroxide in 3T3 cells. • Enhancement of LPA{sub 5} on the cell motile activities inhibited by LPA{sub 1} in 3T3 cells. • The expression and activation of Mmp-9 were inhibited by LPA{sub 5} in 3T3 cells. • LPA signaling via LPA{sub 5} acts as a negative regulator of cellular responses in 3T3 cells. - Abstract: Lysophosphatidic acid (LPA) signaling via G protein-coupled LPA receptors (LPA{sub 1}–LPA{sub 6}) mediates a variety of biological functions, including cell migration. Recently, we have reported that LPA{sub 1} inhibited the cell motile activities of mouse fibroblast 3T3 cells. In the present study, to evaluate a role of LPA{sub 5} in cellular responses, Lpar5 knockdown (3T3-L5) cells were generated from 3T3 cells. In cell proliferation assays, LPA markedly stimulated the cell proliferation activities of 3T3-L5 cells, compared with control cells. In cell motility assays with Cell Culture Inserts, the cell motile activities of 3T3-L5 cells were significantly higher than those of control cells. The activity levels of matrix metalloproteinases (MMPs) were measured by gelatin zymography. 3T3-L5 cells stimulated the activation of Mmp-2, correlating with the expression levels of Mmp-2 gene. Moreover, to assess the co-effects of LPA{sub 1} and LPA{sub 5} on cell motile activities, Lpar5 knockdown (3T3a1-L5) cells were also established from Lpar1 over-expressing (3T3a1) cells. 3T3a1-L5 cells increased the cell motile activities of 3T3a1 cells, while the cell motile activities of 3T3a1 cells were significantly lower than those of control cells. These results suggest that LPA{sub 5} may act as a negative regulator of cellular responses in mouse fibroblast 3T3 cells, similar to the case for LPA{sub 1}.

  11. Lysophosphatidic acid receptor-5 negatively regulates cellular responses in mouse fibroblast 3T3 cells

    International Nuclear Information System (INIS)

    Dong, Yan; Hirane, Miku; Araki, Mutsumi; Fukushima, Nobuyuki; Tsujiuchi, Toshifumi

    2014-01-01

    Highlights: • LPA 5 inhibits the cell growth and motile activities of 3T3 cells. • LPA 5 suppresses the cell motile activities stimulated by hydrogen peroxide in 3T3 cells. • Enhancement of LPA 5 on the cell motile activities inhibited by LPA 1 in 3T3 cells. • The expression and activation of Mmp-9 were inhibited by LPA 5 in 3T3 cells. • LPA signaling via LPA 5 acts as a negative regulator of cellular responses in 3T3 cells. - Abstract: Lysophosphatidic acid (LPA) signaling via G protein-coupled LPA receptors (LPA 1 –LPA 6 ) mediates a variety of biological functions, including cell migration. Recently, we have reported that LPA 1 inhibited the cell motile activities of mouse fibroblast 3T3 cells. In the present study, to evaluate a role of LPA 5 in cellular responses, Lpar5 knockdown (3T3-L5) cells were generated from 3T3 cells. In cell proliferation assays, LPA markedly stimulated the cell proliferation activities of 3T3-L5 cells, compared with control cells. In cell motility assays with Cell Culture Inserts, the cell motile activities of 3T3-L5 cells were significantly higher than those of control cells. The activity levels of matrix metalloproteinases (MMPs) were measured by gelatin zymography. 3T3-L5 cells stimulated the activation of Mmp-2, correlating with the expression levels of Mmp-2 gene. Moreover, to assess the co-effects of LPA 1 and LPA 5 on cell motile activities, Lpar5 knockdown (3T3a1-L5) cells were also established from Lpar1 over-expressing (3T3a1) cells. 3T3a1-L5 cells increased the cell motile activities of 3T3a1 cells, while the cell motile activities of 3T3a1 cells were significantly lower than those of control cells. These results suggest that LPA 5 may act as a negative regulator of cellular responses in mouse fibroblast 3T3 cells, similar to the case for LPA 1

  12. Clinical significance of plasma lysophosphatidic acid levels in the differential diagnosis of ovarian cancer

    Directory of Open Access Journals (Sweden)

    Yun-Jie Zhang

    2015-01-01

    Full Text Available Objective: To investigate the value of lysophosphatidic acid (LPA in the diagnosis of ovarian cancer. Materials and Methods: We first performed a hospital-based, case-control study involving 123 ovarian cancer patients and 101 benign ovarian tumor patients, and then conducted a meta-analysis with 19 case-control studies to assess the correlation between ovarian cancer and plasma LPA levels. Results: The case-control study results demonstrated that ovarian cancer patients have increased LPA and cancer antigen (CA-125 levels compared to patients with benign ovarian tumor (LPA: Ovarian cancer vs benign ovarian tumor: 5.28 ± 1.52 vs 1.82 ± 0.77 μmol/L; CA-125: Ovarian cancer vs benign ovarian tumor: 87.17 ± 45.81 vs. 14.03 ± 10.14 U/mL, which showed statistically significant differences (both P < 0.05. LPA with advanced sensitivity, specificity, positive predictive value, negative predictive value, and accuracy rate of diagnosis excelled CA-125 in the diagnosis of ovarian cancer (both P < 0.05. The areas under the receiver operating characteristic (ROC curve in the diagnosis of ovarian cancer (LPA: 0.983; CA-125: 0.910 were statistically significant compared with the reference (both P < 0.001 and the difference of the areas of ROC curve between LPA and CA-125 in the diagnosis of ovarian cancer showed statistically significant difference (P < 0.05. The meta-analysis results suggested that plasma LPA levels were higher in ovarian cancer tissues than in benign tissues (standardized mean difference (SMD =2.36, 95% confidence interval (CI: 1.61-3.11, P < 0.001 and normal tissues (SMD = 2.32, 95% CI: 1.77-2.87, P < 0.001. Conclusion: LPA shows greater value in the diagnosis of ovarian cancer compared to CA-125 and may be employed as a biological index to diagnose ovarian cancer.

  13. Involvement of aberrant DNA methylation on reduced expression of lysophosphatidic acid receptor-1 gene in rat tumor cell lines

    International Nuclear Information System (INIS)

    Tsujiuchi, Toshifumi; Shimizu, Kyoko; Onishi, Mariko; Sugata, Eriko; Fujii, Hiromasa; Mori, Toshio; Honoki, Kanya; Fukushima, Nobuyuki

    2006-01-01

    Lysophosphatidic acid (LPA) is a bioactive phospholipid that stimulates cell proliferation, migration, and protects cells from apoptosis. It interacts with specific G protein-coupled transmembrane receptors. Recently, it has been reported that alterations of LPA receptor expression might be important in the malignant transformation of tumor cells. Therefore, to assess an involvement of DNA methylation in reduced expression of the LPA receptor-1 (lpa1) gene, we investigated the expression of the lpa1 gene and its DNA methylation patterns in rat tumor cell lines. Both rat brain-derived neuroblastoma B103 and liver-derived hepatoma RH7777 cells used in this study indicated no expression of lpa1. For the analysis of methylation status, bisulfite sequencing was performed with B103 and RH7777 cells, comparing with other lpa1 expressed cells and normal tissues of brain and liver. The lpa1 expressed cells and tissues were all unmethylated in this region of lpa1. In contrast, both B103 and RH7777 cells were highly methylated, correlating with reduced expression of the lpa1. Treatment with 5-aza 2'-deoxycytidine induced expression of lpa1 gene in B103 and RH7777 cells after 24 h. In RH7777 cells treated with 5-aza 2'-deoxycytidine, stress fiber formation was also observed in response to LPA in RH7777 cells, but not in untreated RH7777 cells. These results suggest that aberrant DNA methylation of the lpa1 gene may be involved in its reduced expression in rat tumor cells

  14. Clinical significance and correlation of the level change of plasma lysophosphatidic acid in patients before and during radiotherapy

    International Nuclear Information System (INIS)

    Yu Liang; Li Hong; Zhu Shengjie

    2011-01-01

    Objective: To investigate the effects of radiotherapy on the level of lysophosphatidic acid (LPA) in different patients. Methods: Three groups of patients (metastatic brain tumor group, non-brain tumor group and primary brain tumor group) were given external irradiation (by linear accelerator). LPA level, white blood cell count and platelet count in the blood plasma were evaluated pre-irradiation and after irradiation with 40 Gy and 60 Gy respectively. Results: The LPA level decreased gradually as irradiation doses increase in metastatic brain tumor group non-brain tumor group (after irradiation with 60 Gy 0.05), and neoplasm volume changed little. White blood cell count and platelet count gradually decreased with the increasing irradiation doses in metastatic brain tumor group and primary brain tumor group, but there was no significant correlation to LPA level. However, there was a negative correlation to LPA level in non-brain tumor group (r=-0.285 and r=-0.237, both P<0.05 ). Conclusions: There is a negative correlation between radiotherapy dose and LPA level in metastatic brain tumor patients and non-brain tumor patients. LPA level could be used as a predictor of the effect of the radiotherapy in tumor treatment. (authors)

  15. Dual Action of Lysophosphatidate-Functionalised Titanium: Interactions with Human (MG63 Osteoblasts and Methicillin Resistant Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Mette Elena Skindersoe

    Full Text Available Titanium (Ti is a widely used material for surgical implants; total joint replacements (TJRs, screws and plates for fixing bones and dental implants are forged from Ti. Whilst Ti integrates well into host tissue approximately 10% of TJRs will fail in the lifetime of the patient through a process known as aseptic loosening. These failures necessitate revision arthroplasties which are more complicated and costly than the initial procedure. Finding ways of enhancing early (osseointegration of TJRs is therefore highly desirable and continues to represent a research priority in current biomaterial design. One way of realising improvements in implant quality is to coat the Ti surface with small biological agents known to support human osteoblast formation and maturation at Ti surfaces. Lysophosphatidic acid (LPA and certain LPA analogues offer potential solutions as Ti coatings in reducing aseptic loosening. Herein we present evidence for the successful bio-functionalisation of Ti using LPA. This modified Ti surface heightened the maturation of human osteoblasts, as supported by increased expression of alkaline phosphatase. These functionalised surfaces also deterred the attachment and growth of Staphylococcus aureus, a bacterium often associated with implant failures through sepsis. Collectively we provide evidence for the fabrication of a dual-action Ti surface finish, a highly desirable feature towards the development of next-generation implantable devices.

  16. Lysophosphatidic acid induces reactive oxygen species generation by activating protein kinase C in PC-3 human prostate cancer cells

    International Nuclear Information System (INIS)

    Lin, Chu-Cheng; Lin, Chuan-En; Lin, Yueh-Chien; Ju, Tsai-Kai; Huang, Yuan-Li; Lee, Ming-Shyue; Chen, Jiun-Hong; Lee, Hsinyu

    2013-01-01

    Highlights: •LPA induces ROS generation through LPA 1 and LPA 3 . •LPA induces ROS generation by activating PLC. •PKCζ mediates LPA-induced ROS generation. -- Abstract: Prostate cancer is one of the most frequently diagnosed cancers in males, and PC-3 is a cell model popularly used for investigating the behavior of late stage prostate cancer. Lysophosphatidic acid (LPA) is a lysophospholipid that mediates multiple behaviors in cancer cells, such as proliferation, migration and adhesion. We have previously demonstrated that LPA enhances vascular endothelial growth factor (VEGF)-C expression in PC-3 cells by activating the generation of reactive oxygen species (ROS), which is known to be an important mediator in cancer progression. Using flow cytometry, we showed that LPA triggers ROS generation within 10 min and that the generated ROS can be suppressed by pretreatment with the NADPH oxidase (Nox) inhibitor diphenylene iodonium. In addition, transfection with LPA 1 and LPA 3 siRNA efficiently blocked LPA-induced ROS production, suggesting that both receptors are involved in this pathway. Using specific inhibitors and siRNA, phospholipase C (PLC) and protein kinase C (PKC) were also suggested to participate in LPA-induced ROS generation. Overall, we demonstrated that LPA induces ROS generation in PC-3 prostate cancer cells and this is mediated through the PLC/PKC/Nox pathway

  17. Endogenous lysophosphatidic acid participates in vascularisation and decidualisation at the maternal-fetal interface in the rat.

    Science.gov (United States)

    Sordelli, Micaela S; Beltrame, Jimena S; Zotta, Elsa; Gomez, Natalia; Dmytrenko, Ganna; Sales, María Elena; Blois, Sandra M; Davio, Carlos; Martinez, Silvina Perez; Franchi, Ana M; Ribeiro, María L

    2017-10-01

    Lysophosphatidic acid (LPA) affects several female reproductive functions through G-protein-coupled receptors. LPA contributes to embryo implantation via the lysophospholipid LPA 3 receptor. In the present study we investigated the participation of endogenous LPA signalling through the LPA 3 receptor in vascularisation and decidualisation, two crucial events at the maternal-fetal interface. Pregnant rats were treated with diacylglycerol pyrophosphate (DGPP), a highly selective antagonist of LPA 3 receptors, on Day 5 of gestation. Pregnant rats received intrauterine (i.u.) injections of single doses of DGPP (0.1mgkg -1 ) in a total volume of 2μL in the left horn (treated horn) in the morning of GD5. DGPP treatment produced aberrant embryo spacing and increased embryo resorption. The LPA 3 receptor antagonist decreased the cross-sectional length of the uterine and arcuate arteries and induced histological anomalies in the decidua and placentas. Marked haemorrhagic processes, infiltration of immune cells and tissue disorganisation were observed in decidual and placental tissues from sites of resorption. The mRNA expression of three vascularisation markers, namely interleukin 10 (Il10), vascular endothelial growth factor (Vegfa) and vascular endothelial growth factor receptor 1 (Vegfr1), was reduced at sites of resorption from Day 8. The results show that the disruption of endogenous LPA signalling by blocking the LPA 3 receptor modified the development of uterine vessels with consequences in the formation of the decidua and placenta and in the growth of embryos.

  18. The effects of aspirin on platelet function and lysophosphatidic acids depend on plasma concentrations of EPA and DHA.

    Science.gov (United States)

    Block, Robert C; Abdolahi, Amir; Tu, Xin; Georas, Steve N; Brenna, J Thomas; Phipps, Richard P; Lawrence, Peter; Mousa, Shaker A

    2015-05-01

    Aspirin's prevention of cardiovascular disease (CVD) events in individuals with type 2 diabetes mellitus is controversial. Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) and aspirin all affect the cyclooxygenase enzyme. The relationship between plasma EPA and DHA and aspirin's effects has not been determined. Thirty adults with type 2 diabetes mellitus ingested aspirin (81 mg/day) for 7 days, then EPA+DHA (2.6g/day) for 28 days, then both for another 7 days. Lysophosphatidic acid (LPA) species and more classic platelet function outcomes were determined. Plasma concentrations of total EPA+DHA were associated with 7-day aspirin reduction effects on these outcomes in a "V"-shaped manner for all 11 LPA species and ADP-induced platelet aggregation. This EPA+DHA concentration was quite consistent for each of the LPA species and ADP. These results support aspirin effects on lysolipid metabolism and platelet aggregation depending on plasma EPA+DHA concentrations in individuals with a disturbed lipid milieu. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Co-ordinate regulation of growth factor receptors and lipid phosphate phosphatase-1 controls cell activation by exogenous lysophosphatidate.

    Science.gov (United States)

    Pilquil, C; Ling, Z C; Singh, I; Buri, K; Zhang, Q X; Brindley, D N

    2001-11-01

    The serum-derived lipid growth factors, lysophosphatidate (LPA) and sphingosine 1-phosphate (S1P), activate cells selectively through different members of a family of endothelial differentiation gene (EDG) receptors. Activation of EDG receptors by LPA and S1P provides a variety of signalling cascades depending upon the G-protein coupling of the different EDG receptors. This leads to chemotactic and mitogenic responses, which are important in wound healing. For example, LPA stimulates fibroblast division and S1P stimulates the chemotaxis and division of endothelial cells leading to angiogenesis. Counteracting these effects of LPA and S1P, are the actions of lipid phosphate phosphatases (LPP, or phosphatidate phosphohydrolases, Type 2). The isoform LPP-1 is expressed in the plasma membrane with its active site outside the cell. This enzyme is responsible for 'ecto-phosphatase' activity leading to the degradation of exogenous lipid phosphate mediators, particularly LPA. Expression of LPP-1 decreases cell activation by exogenous LPA. The mechanism for this is controversial and several mechanisms have been proposed. Evidence will be presented that the LPPs cross-talk with EDG and other growth factor receptors, thus, regulating the responses of the cells to lipid phosphate mediators of signal transduction.

  20. Lysophosphatidic acid induces reactive oxygen species generation by activating protein kinase C in PC-3 human prostate cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Chu-Cheng; Lin, Chuan-En; Lin, Yueh-Chien [Institute of Zoology, College of Life Science, National Taiwan University, Taipei, Taiwan, ROC (China); Ju, Tsai-Kai [Instrumentation Center, National Taiwan University, Taipei, Taiwan, ROC (China); Technology Commons, College of Life Science, National Taiwan University, Taipei, Taiwan, ROC (China); Huang, Yuan-Li [Department of Biotechnology, Asia University, Taichung, Taiwan, ROC (China); Lee, Ming-Shyue [Institute of Biochemistry and Molecular Biology, College of Medicine, National Taiwan University, Taipei, Taiwan, ROC (China); Chen, Jiun-Hong [Institute of Zoology, College of Life Science, National Taiwan University, Taipei, Taiwan, ROC (China); Department of Life Science, College of Life Science, National Taiwan University, Taipei, Taiwan, ROC (China); Lee, Hsinyu, E-mail: hsinyu@ntu.edu.tw [Institute of Zoology, College of Life Science, National Taiwan University, Taipei, Taiwan, ROC (China); Department of Life Science, College of Life Science, National Taiwan University, Taipei, Taiwan, ROC (China); Center for Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Research Center for Developmental Biology and Regenerative Medicine, National Taiwan University, Taipei, Taiwan, ROC (China)

    2013-11-01

    Highlights: •LPA induces ROS generation through LPA{sub 1} and LPA{sub 3}. •LPA induces ROS generation by activating PLC. •PKCζ mediates LPA-induced ROS generation. -- Abstract: Prostate cancer is one of the most frequently diagnosed cancers in males, and PC-3 is a cell model popularly used for investigating the behavior of late stage prostate cancer. Lysophosphatidic acid (LPA) is a lysophospholipid that mediates multiple behaviors in cancer cells, such as proliferation, migration and adhesion. We have previously demonstrated that LPA enhances vascular endothelial growth factor (VEGF)-C expression in PC-3 cells by activating the generation of reactive oxygen species (ROS), which is known to be an important mediator in cancer progression. Using flow cytometry, we showed that LPA triggers ROS generation within 10 min and that the generated ROS can be suppressed by pretreatment with the NADPH oxidase (Nox) inhibitor diphenylene iodonium. In addition, transfection with LPA{sub 1} and LPA{sub 3} siRNA efficiently blocked LPA-induced ROS production, suggesting that both receptors are involved in this pathway. Using specific inhibitors and siRNA, phospholipase C (PLC) and protein kinase C (PKC) were also suggested to participate in LPA-induced ROS generation. Overall, we demonstrated that LPA induces ROS generation in PC-3 prostate cancer cells and this is mediated through the PLC/PKC/Nox pathway.

  1. Mice Deficient in lysophosphatidic acid acyltransferase delta (Lpaatδ)/acylglycerophosphate acyltransferase 4 (Agpat4) Have Impaired Learning and Memory.

    Science.gov (United States)

    Bradley, Ryan M; Mardian, Emily B; Bloemberg, Darin; Aristizabal Henao, Juan J; Mitchell, Andrew S; Marvyn, Phillip M; Moes, Katherine A; Stark, Ken D; Quadrilatero, Joe; Duncan, Robin E

    2017-11-15

    We previously characterized LPAATδ/AGPAT4 as a mitochondrial lysophosphatidic acid acyltransferase that regulates brain levels of phosphatidylcholine (PC), phosphatidylethanolamine (PE), and phosphatidylinositol (PI). Here, we report that Lpaat δ -/- mice display impaired spatial learning and memory compared to wild-type littermates in the Morris water maze and our investigation of potential mechanisms associated with brain phospholipid changes. Marker protein immunoblotting suggested that the relative brain content of neurons, glia, and oligodendrocytes was unchanged. Relative abundance of the important brain fatty acid docosahexaenoic acid was also unchanged in phosphatidylserine, phosphatidylglycerol, and cardiolipin, in agreement with prior data on PC, PE and PI. In phosphatidic acid, it was increased. Specific decreases in ethanolamine-containing phospholipids were detected in mitochondrial lipids, but the function of brain mitochondria in Lpaat δ -/- mice was unchanged. Importantly, we found that Lpaat δ -/- mice have a significantly and drastically lower brain content of the N -methyl-d-asparate (NMDA) receptor subunits NR1, NR2A, and NR2B, as well as the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunit GluR1, compared to wild-type mice. However, general dysregulation of PI-mediated signaling is not likely responsible, since phospho-AKT and phospho-mTOR pathway regulation was unaffected. Our findings indicate that Lpaat δ deficiency causes deficits in learning and memory associated with reduced NMDA and AMPA receptors. Copyright © 2017 American Society for Microbiology.

  2. Role of lysophosphatidic acid receptor LPA2 in the development of allergic airway inflammation in a murine model of asthma

    Directory of Open Access Journals (Sweden)

    Chun Jerold

    2009-11-01

    Full Text Available Abstract Background Lysophosphatidic acid (LPA plays a critical role in airway inflammation through G protein-coupled LPA receptors (LPA1-3. We have demonstrated that LPA induced cytokine and lipid mediator release in human bronchial epithelial cells. Here we provide evidence for the role of LPA and LPA receptors in Th2-dominant airway inflammation. Methods Wild type, LPA1 heterozygous knockout mice (LPA1+/-, and LPA2 heterozygous knockout mice (LPA2+/- were sensitized with inactivated Schistosoma mansoni eggs and local antigenic challenge with Schistosoma mansoni soluble egg Ag (SEA in the lungs. Bronchoalveolar larvage (BAL fluids and lung tissues were collected for analysis of inflammatory responses. Further, tracheal epithelial cells were isolated and challenged with LPA. Results BAL fluids from Schistosoma mansoni egg-sensitized and challenged wild type mice (4 days of challenge showed increase of LPA level (~2.8 fold, compared to control mice. LPA2+/- mice, but not LPA1+/- mice, exposed to Schistosoma mansoni egg revealed significantly reduced cell numbers and eosinophils in BAL fluids, compared to challenged wild type mice. Both LPA2+/- and LPA1+/- mice showed decreases in bronchial goblet cells. LPA2+/- mice, but not LPA1+/- mice showed the decreases in prostaglandin E2 (PGE2 and LPA levels in BAL fluids after SEA challenge. The PGE2 production by LPA was reduced in isolated tracheal epithelial cells from LPA2+/- mice. These results suggest that LPA and LPA receptors are involved in Schistosoma mansoni egg-mediated inflammation and further studies are proposed to understand the role of LPA and LPA receptors in the inflammatory process.

  3. CD14 is a key mediator of both lysophosphatidic acid and lipopolysaccharide induction of foam cell formation.

    Science.gov (United States)

    An, Dong; Hao, Feng; Zhang, Fuqiang; Kong, Wei; Chun, Jerold; Xu, Xuemin; Cui, Mei-Zhen

    2017-09-01

    Macrophage uptake of oxidized low-density lipoprotein (oxLDL) plays an important role in foam cell formation and the pathogenesis of atherosclerosis. We report here that lysophosphatidic acid (LPA) enhances lipopolysaccharide (LPS)-induced oxLDL uptake in macrophages. Our data revealed that both LPA and LPS highly induce the CD14 expression at messenger RNA and protein levels in macrophages. The role of CD14, one component of the LPS receptor cluster, in LPA-induced biological functions has been unknown. We took several steps to examine the role of CD14 in LPA signaling pathways. Knockdown of CD14 expression nearly completely blocked LPA/LPS-induced oxLDL uptake in macrophages, demonstrating for the first time that CD14 is a key mediator responsible for both LPA- and LPS-induced oxLDL uptake/foam cell formation. To determine the molecular mechanism mediating CD14 function, we demonstrated that both LPA and LPS significantly induce the expression of scavenger receptor class A type I (SR-AI), which has been implicated in lipid uptake process, and depletion of CD14 levels blocked LPA/LPS-induced SR-AI expression. We further showed that the SR-AI-specific antibody, which quenches SR-AI function, blocked LPA- and LPS-induced foam cell formation. Thus, SR-AI is the downstream mediator of CD14 in regulating LPA-, LPS-, and LPA/LPS-induced foam cell formation. Taken together, our results provide the first experimental evidence that CD14 is a novel connecting molecule linking both LPA and LPS pathways and is a key mediator responsible for LPA/LPS-induced foam cell formation. The LPA/LPS-CD14-SR-AI nexus might be the new convergent pathway, contributing to the worsening of atherosclerosis. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Spinal cord compression injury in lysophosphatidic acid 1 receptor-null mice promotes maladaptive pronociceptive descending control.

    Science.gov (United States)

    Suardíaz, M; Galan-Arriero, I; Avila-Martin, G; Estivill-Torrús, G; de Fonseca, F R; Chun, J; Gómez-Soriano, J; Bravo-Esteban, E; Taylor, J

    2016-02-01

    Although activation of the lysophosphatidic acid receptor 1 (LPA1) is known to mediate pronociceptive effects in peripheral pain models, the role of this receptor in the modulation of spinal nociception following spinal cord injury (SCI) is unknown. In this study, LPA1 regulation of spinal excitability mediated by supraspinal descending antinociceptive control systems was assessed following SCI in both wild-type (WT) and maLPA1-null receptor mice. The effect of a T8 spinal compression in WT and maLPA1-null mice was assessed up to 1 month after SCI using histological, immunohistochemical and behavioural techniques analysis including electrophysiological recording of noxious toes-Tibialis Anterior (TA) stimulus-response reflex activity. The effect of a T3 paraspinal transcutaneous electrical conditioning stimulus on TA noxious reflex temporal summation was also assessed. Histological analysis demonstrated greater dorsolateral funiculus damage after SCI in maLPA1-null mice, without a change in the stimulus-response function of the TA noxious reflex when compared to WT mice. While T3 conditioning stimulation in the WT group inhibited noxious TA reflex temporal summation after SCI, this stimulus strongly excited TA reflex temporal summation in maLPA1-null mice. The functional switch from descending inhibition to maladaptive facilitation of central excitability of spinal nociception demonstrated in maLPA1-null mice after SCI was unrelated to a general change in reflex activity. These data suggest that the LPA1 receptor is necessary for inhibition of temporal summation of noxious reflex activity, partly mediated via long-tract descending modulatory systems acting at the spinal level. © 2015 European Pain Federation - EFIC®

  5. Depletion of Acyl-Coenzyme A-Binding Protein Affects Sphingolipid Synthesis and Causes Vesicle Accumulation and Membrane Defects in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Gaigg, B; Neergaard, T B; Schneiter, R

    2001-01-01

    Deletion of the yeast gene ACB1 encoding Acb1p, the yeast homologue of the acyl-CoA-binding protein (ACBP), resulted in a slower growing phenotype that adapted into a faster growing phenotype with a frequency >1:10(5). A conditional knockout strain (Y700pGAL1-ACB1) with the ACB1 gene under contro...

  6. Essential oil of Pinus koraiensis leaves exerts antihyperlipidemic effects via up-regulation of low-density lipoprotein receptor and inhibition of acyl-coenzyme A: cholesterol acyltransferase.

    Science.gov (United States)

    Kim, Ji-Hyun; Lee, Hyo-Jung; Jeong, Soo-Jin; Lee, Min-Ho; Kim, Sung-Hoon

    2012-09-01

    Hyperlipidemia is an important factor to induce metabolic syndrome such as obesity, diabetes and cardiovascular diseases. Recently, some antihyperlipidemic agents from herbal medicines have been in the spotlight in the medical science field. Thus, the present study evaluated the antihyperlipidemic activities of the essential oil from the leaves of Pinus koraiensis SIEB (EOPK) that has been used as a folk remedy for heart disease. The reverse transcription polymerase chain reaction (RT-PCR) revealed that EOPK up-regulated low density lipoprotein receptor (LDLR) at the mRNA level as well as negatively suppressed the expression of sterol regulatory element-binding protein (SREBP)-1c, SREBP-2, 3-hydroxy-3-methyl-glutaryl-CoA reductase (HMGCR), fatty acid synthase (FAS) and glycerol-3-phosphate acyltransferase (GPAT) involved in lipid metabolism in HepG2 cells. Also, western blotting showed that EOPK activated LDLR and attenuated the expression of FAS at the protein level in the cells. Consistently, EOPK significantly inhibited the level of human acylcoenzyme A: cholesterol acyltransferase (hACAT)1 and 2 and reduced the low-density lipoprotein (LDL) oxidation activity. Furthermore, chromatography-mass spectrometry (GC-MS) analysis showed that EOPK, an essential oil mixture, contained camphene (21.11%), d-limonene (21.01%), α-pinene (16.74%) and borneol (11.52%). Overall, the findings suggest that EOPK can be a potent pharmaceutical agent for the prevention and treatment of hyperlipidemia. Copyright © 2012 John Wiley & Sons, Ltd.

  7. Systematic Analysis of Gene Expression Alterations and Clinical Outcomes for Long-Chain Acyl-Coenzyme A Synthetase Family in Cancer.

    Directory of Open Access Journals (Sweden)

    Wei-Ching Chen

    Full Text Available Dysregulated lipid metabolism contributes to cancer progression. Our previous study indicates that long-chain fatty acyl-Co A synthetase (ACSL 3 is essential for lipid upregulation induced by endoplasmic reticulum stress. In this report, we aimed to identify the role of ACSL family in cancer with systematic analysis and in vitro experiment. We explored the ACSL expression using Oncomine database to determine the gene alteration during carcinogenesis and identified the association between ACSL expression and the survival of cancer patient using PrognoScan database. ACSL1 may play a potential oncogenic role in colorectal and breast cancer and play a potential tumor suppressor role in lung cancer. Co-expression analysis revealed that ACSL1 was coexpressed with MYBPH, PTPRE, PFKFB3, SOCS3 in colon cancer and with LRRFIP1, TSC22D1 in lung cancer. In accordance with PrognoScan analysis, downregulation of ACSL1 in colon and breast cancer cell line inhibited proliferation, migration, and anchorage-independent growth. In contrast, increase of oncogenic property was observed in lung cancer cell line by attenuating ACSL1. High ACSL3 expression predicted a better prognosis in ovarian cancer; in contrast, high ACSL3 predicted a worse prognosis in melanoma. ACSL3 was coexpressed with SNUPN, TRIP13, and SEMA5A in melanoma. High expression of ACSL4 predicted a worse prognosis in colorectal cancer, but predicted better prognosis in breast, brain and lung cancer. ACSL4 was coexpressed with SERPIN2, HNRNPCL1, ITIH2, PROCR, LRRFIP1. High expression of ACSL5 predicted good prognosis in breast, ovarian, and lung cancers. ACSL5 was coexpressed with TMEM140, TAPBPL, BIRC3, PTPRE, and SERPINB1. Low ACSL6 predicted a worse prognosis in acute myeloid leukemia. ACSL6 was coexpressed with SOX6 and DARC. Altogether, different members of ACSLs are implicated in diverse types of cancer development. ACSL-coexpressed molecules may be used to further investigate the role of ACSL family in individual type of cancers.

  8. Role of an Essential Acyl Coenzyme A Carboxylase in the Primary and Secondary Metabolism of Streptomyces coelicolor A3(2)

    Science.gov (United States)

    Rodríguez, E.; Banchio, C.; Diacovich, L.; Bibb, M. J.; Gramajo, H.

    2001-01-01

    Two genes, accB and accE, that form part of the same operon, were cloned from Streptomyces coelicolor A3(2). AccB is homologous to the carboxyl transferase domain of several propionyl coezyme A (CoA) carboxylases and acyl-CoA carboxylases (ACCases) of actinomycete origin, while AccE shows no significant homology to any known protein. Expression of accB and accE in Escherichia coli and subsequent in vitro reconstitution of enzyme activity in the presence of the biotinylated protein AccA1 or AccA2 confirmed that AccB was the carboxyl transferase subunit of an ACCase. The additional presence of AccE considerably enhanced the activity of the enzyme complex, suggesting that this small polypeptide is a functional component of the ACCase. The impossibility of obtaining an accB null mutant and the thiostrepton growth dependency of a tipAp accB conditional mutant confirmed that AccB is essential for S. coelicolor viability. Normal growth phenotype in the absence of the inducer was restored in the conditional mutant by the addition of exogenous long-chain fatty acids in the medium, indicating that the inducer-dependent phenotype was specifically related to a conditional block in fatty acid biosynthesis. Thus, AccB, together with AccA2, which is also an essential protein (E. Rodriguez and H. Gramajo, Microbiology 143:3109–3119, 1999), are the most likely components of an ACCase whose main physiological role is the synthesis of malonyl-CoA, the first committed step of fatty acid synthesis. Although normal growth of the conditional mutant was restored by fatty acids, the cultures did not produce actinorhodin or undecylprodigiosin, suggesting a direct participation of this enzyme complex in the supply of malonyl-CoA for the synthesis of these secondary metabolites. PMID:11526020

  9. Lysophosphatidic acid signaling via LPA_1 and LPA_3 regulates cellular functions during tumor progression in pancreatic cancer cells

    International Nuclear Information System (INIS)

    Fukushima, Kaori; Takahashi, Kaede; Yamasaki, Eri; Onishi, Yuka; Fukushima, Nobuyuki; Honoki, Kanya; Tsujiuchi, Toshifumi

    2017-01-01

    Lysophosphatidic acid (LPA) signaling via G protein-coupled LPA receptors exhibits a variety of biological effects, such as cell proliferation, motility and differentiation. The aim of this study was to evaluate the roles of LPA_1 and LPA_3 in cellular functions during tumor progression in pancreatic cancer cells. LPA_1 and LPA_3 knockdown cells were generated from PANC-1 cells. The cell motile and invasive activities of PANC-1 cells were inhibited by LPA_1 and LPA_3 knockdown. In gelatin zymography, LPA_1 and LPA_3 knockdown cells indicated the low activation of matrix metalloproteinase-2 (MMP-2) in the presence of LPA. Next, to assess whether LPA_1 and LPA_3 regulate cellular functions induced by anticancer drug, PANC-1 cells were treated with cisplatin (CDDP) for approximately 6 months. The cell motile and invasive activities of long-term CDDP treated cells were markedly higher than those of PANC-1 cells, correlating with the expression levels of LPAR1 and LPAR3 genes. In soft agar assay, the long-term CDDP treated cells formed markedly large sized colonies. In addition, the cell motile and invasive activities enhanced by CDDP were significantly suppressed by LPA_1 and LPA_3 knockdown as well as colony formation. These results suggest that LPA signaling via LPA_1 and LPA_3 play an important role in the regulation of cellular functions during tumor progression in PANC-1 cells. - Highlights: • The cell motile and invasive activities of PANC-1 cells were stimulated by LPA_1 and LPA_3. • LPA_1 and LPA_3 enhanced MMP-2 activation in PANC-1 cells. • The expressions of LPAR1 and LPAR3 genes were elevated in PANC-1 cells treated with cisplatin. • The cell motile and invasive activities of PANC-1 cells treated with cisplatin were suppressed by LPA_1 and LPA_3 knockdown. • LPA_1 and LPA_3 are involved in the regulation of cellular functions during tumor progression in PANC-1 cells.

  10. Derivatives of Dictyostelium differentiation-inducing factors inhibit lysophosphatidic acid–stimulated migration of murine osteosarcoma LM8 cells

    Energy Technology Data Exchange (ETDEWEB)

    Kubohara, Yuzuru, E-mail: ykuboha@juntendo.ac.jp [Department of Molecular and Cellular Biology, Institute for Molecular and Cellular Regulation (IMCR), Gunma University, Maebashi 371-8512 (Japan); Department of Health Science, Juntendo University Graduate School of Health and Sports Science, Inzai 270-1695 (Japan); Komachi, Mayumi [Department of Molecular and Cellular Biology, Institute for Molecular and Cellular Regulation (IMCR), Gunma University, Maebashi 371-8512 (Japan); Department of Radiation Oncology, Gunma University Graduate School of Medicine, Maebashi 371-8511 (Japan); Homma, Yoshimi [Department of Biomolecular Science, Institute of Biomedical Sciences, Fukushima Medical University School of Medicine, Fukushima 960-1295 (Japan); Kikuchi, Haruhisa; Oshima, Yoshiteru [Laboratory of Natural Product Chemistry, Tohoku University Graduate School of Pharmaceutical Sciences, Aoba-yama, Aoba-ku, Sendai 980-8578 (Japan)

    2015-08-07

    Osteosarcoma is a common metastatic bone cancer that predominantly develops in children and adolescents. Metastatic osteosarcoma remains associated with a poor prognosis; therefore, more effective anti-metastatic drugs are needed. Differentiation-inducing factor-1 (DIF-1), −2, and −3 are novel lead anti-tumor agents that were originally isolated from the cellular slime mold Dictyostelium discoideum. Here we investigated the effects of a panel of DIF derivatives on lysophosphatidic acid (LPA)-induced migration of mouse osteosarcoma LM8 cells by using a Boyden chamber assay. Some DIF derivatives such as Br-DIF-1, DIF-3(+2), and Bu-DIF-3 (5–20 μM) dose-dependently suppressed LPA-induced cell migration with associated IC{sub 50} values of 5.5, 4.6, and 4.2 μM, respectively. On the other hand, the IC{sub 50} values of Br-DIF-1, DIF-3(+2), and Bu-DIF-3 versus cell proliferation were 18.5, 7.2, and 2.0 μM, respectively, in LM8 cells, and >20, 14.8, and 4.3 μM, respectively, in mouse 3T3-L1 fibroblasts (non-transformed). Together, our results demonstrate that Br-DIF-1 in particular may be a valuable tool for the analysis of cancer cell migration, and that DIF derivatives such as DIF-3(+2) and Bu-DIF-3 are promising lead anti-tumor agents for the development of therapies that suppress osteosarcoma cell proliferation, migration, and metastasis. - Highlights: • LPA induces cell migration (invasion) in murine osteosarcoma LM8 cells. • DIFs are novel lead anti-tumor agents found in Dictyostelium discoideum. • We examined the effects of DIF derivatives on LPA-induced LM8 cell migration in vitro. • Some of the DIF derivatives inhibited LPA-induced LM8 cell migration.

  11. Enhanced root growth in phosphate-starved Arabidopsis by stimulating de novo phospholipid biosynthesis through the overexpression of LYSOPHOSPHATIDIC ACID ACYLTRANSFERASE 2 (LPAT2).

    Science.gov (United States)

    Angkawijaya, Artik Elisa; Nguyen, Van Cam; Nakamura, Yuki

    2017-09-01

    Upon phosphate starvation, plants retard shoot growth but promote root development presumably to enhance phosphate assimilation from the ground. Membrane lipid remodelling is a metabolic adaptation that replaces membrane phospholipids by non-phosphorous galactolipids, thereby allowing plants to obtain scarce phosphate yet maintain the membrane structure. However, stoichiometry of this phospholipid-to-galactolipid conversion may not account for the massive demand of membrane lipids that enables active growth of roots under phosphate starvation, thereby suggesting the involvement of de novo phospholipid biosynthesis, which is not represented in the current model. We overexpressed an endoplasmic reticulum-localized lysophosphatidic acid acyltransferase, LPAT2, a key enzyme that catalyses the last step of de novo phospholipid biosynthesis. Two independent LPAT2 overexpression lines showed no visible phenotype under normal conditions but showed increased root length under phosphate starvation, with no effect on phosphate starvation response including marker gene expression, root hair development and anthocyanin accumulation. Accompanying membrane glycerolipid profiling of LPAT2-overexpressing plants revealed an increased content of major phospholipid classes and distinct responses to phosphate starvation between shoot and root. The findings propose a revised model of membrane lipid remodelling, in which de novo phospholipid biosynthesis mediated by LPAT2 contributes significantly to root development under phosphate starvation. © 2017 John Wiley & Sons Ltd.

  12. Mechanism of sphingosine 1-phosphate- and lysophosphatidic Acid-induced up-regulation of adhesion molecules and eosinophil chemoattractant in nerve cells.

    LENUS (Irish Health Repository)

    Costello, Richard W

    2012-02-01

    The lysophospholipids sphingosine 1-phosphate (S1P) and lysophosphatidic acid (LPA) act via G-protein coupled receptors S1P(1-5) and LPA(1-3) respectively, and are implicated in allergy. Eosinophils accumulate at innervating cholinergic nerves in asthma and adhere to nerve cells via intercellular adhesion molecule-1 (ICAM-1). IMR-32 neuroblastoma cells were used as an in vitro cholinergic nerve cell model. The G(i) coupled receptors S1P(1), S1P(3), LPA(1), LPA(2) and LPA(3) were expressed on IMR-32 cells. Both S1P and LPA induced ERK phosphorylation and ERK- and G(i)-dependent up-regulation of ICAM-1 expression, with differing time courses. LPA also induced ERK- and G(i)-dependent up-regulation of the eosinophil chemoattractant, CCL-26. The eosinophil granule protein eosinophil peroxidase (EPO) induced ERK-dependent up-regulation of transcription of S1P(1), LPA(1), LPA(2) and LPA(3), providing the situation whereby eosinophil granule proteins may enhance S1P- and\\/or LPA- induced eosinophil accumulation at nerve cells in allergic conditions.

  13. Mechanism of sphingosine 1-phosphate- and lysophosphatidic Acid-induced up-regulation of adhesion molecules and eosinophil chemoattractant in nerve cells.

    LENUS (Irish Health Repository)

    Costello, Richard W

    2011-05-01

    The lysophospholipids sphingosine 1-phosphate (S1P) and lysophosphatidic acid (LPA) act via G-protein coupled receptors S1P(1-5) and LPA(1-3) respectively, and are implicated in allergy. Eosinophils accumulate at innervating cholinergic nerves in asthma and adhere to nerve cells via intercellular adhesion molecule-1 (ICAM-1). IMR-32 neuroblastoma cells were used as an in vitro cholinergic nerve cell model. The G(i) coupled receptors S1P(1), S1P(3), LPA(1), LPA(2) and LPA(3) were expressed on IMR-32 cells. Both S1P and LPA induced ERK phosphorylation and ERK- and G(i)-dependent up-regulation of ICAM-1 expression, with differing time courses. LPA also induced ERK- and G(i)-dependent up-regulation of the eosinophil chemoattractant, CCL-26. The eosinophil granule protein eosinophil peroxidase (EPO) induced ERK-dependent up-regulation of transcription of S1P(1), LPA(1), LPA(2) and LPA(3), providing the situation whereby eosinophil granule proteins may enhance S1P- and\\/or LPA- induced eosinophil accumulation at nerve cells in allergic conditions.

  14. Expression of lysophosphatidic acid receptor 1 and relation with cell proliferation, apoptosis, and angiogenesis on preneoplastic changes induced by cadmium chloride in the rat ventral prostate.

    Directory of Open Access Journals (Sweden)

    Riánsares Arriazu

    Full Text Available BACKGROUND: Lysophosphatidic acid (LPA is a phospholipid growth factor involved in cell proliferation, differentiation, migration, inflammation, angiogenesis, wound healing, cancer invasion, and survival. This study was directed to evaluate the immunoexpression of LPA-1, cell proliferation, apoptosis, and angiogenesis markers in preneoplastic lesions induced with cadmium chloride in rat prostate. METHODS: The following parameters were calculated in ventral prostate of normal rats and rats that received Cd in drinking water during 24 months: percentages of cells immunoreactive to LPA-1 (LILPA1, PCNA (LIPCNA, MCM7 (LIMCM7, ubiquitin (LIUBI, apoptotic cells (LIAPO, and p53 (LIp53; volume fraction of Bcl-2 (VFBcl-2; and length of microvessels per unit of volume (LVMV/mm3. Data were analyzed using Student's t-test and Pearson correlation test. RESULTS: The LILPA1 in dysplastic lesions and normal epithelium of Cd-treated rats was significantly higher than those in the control group. Markers of proliferation were significantly increased in dysplastic lesions, whereas some apoptotic markers were significantly decreased. No significant differences between groups were found in VFBcl-2. Dysplastic lesions showed a significant increase of LIp53. The length of microvessels per unit of volume was elevated in dysplastic acini. Statistically significant correlations were found only between LILPA1 and LIUBI. CONCLUSIONS: Our results suggest that LPA-1 might be implicated in dysplastic lesions induced by cadmium chloride development. More studies are needed to confirm its potential contribution to the disease.

  15. Lysophosphatidic acid activates peroxisome proliferator activated receptor-γ in CHO cells that over-express glycerol 3-phosphate acyltransferase-1.

    Directory of Open Access Journals (Sweden)

    Cliona M Stapleton

    2011-04-01

    Full Text Available Lysophosphatidic acid (LPA is an agonist for peroxisome proliferator activated receptor-γ (PPARγ. Although glycerol-3-phosphate acyltransferase-1 (GPAT1 esterifies glycerol-3-phosphate to form LPA, an intermediate in the de novo synthesis of glycerolipids, it has been assumed that LPA synthesized by this route does not have a signaling role. The availability of Chinese Hamster Ovary (CHO cells that stably overexpress GPAT1, allowed us to analyze PPARγ activation in the presence of LPA produced as an intracellular intermediate. LPA levels in CHO-GPAT1 cells were 6-fold higher than in wild-type CHO cells, and the mRNA abundance of CD36, a PPARγ target, was 2-fold higher. Transactivation assays showed that PPARγ activity was higher in the cells that overexpressed GPAT1. PPARγ activity was enhanced further in CHO-GPAT1 cells treated with the PPARγ ligand troglitazone. Extracellular LPA, phosphatidic acid (PA or a membrane-permeable diacylglycerol had no effect, showing that PPARγ had been activated by LPA generated intracellularly. Transient transfection of a vector expressing 1-acylglycerol-3-phosphate acyltransferase-2, which converts endogenous LPA to PA, markedly reduced PPARγ activity, as did over-expressing diacylglycerol kinase, which converts DAG to PA, indicating that PA could be a potent inhibitor of PPARγ. These data suggest that LPA synthesized via the glycerol-3-phosphate pathway can activate PPARγ and that intermediates of de novo glycerolipid synthesis regulate gene expression.

  16. Heart-type fatty-acid-binding protein (FABP3 is a lysophosphatidic acid-binding protein in human coronary artery endothelial cells

    Directory of Open Access Journals (Sweden)

    Ryoko Tsukahara

    2014-01-01

    Full Text Available Fatty-acid-binding protein 3, muscle and heart (FABP3, also known as heart-type FABP, is a member of the family of intracellular lipid-binding proteins. It is a small cytoplasmic protein with a molecular mass of about 15 kDa. FABPs are known to be carrier proteins for transporting fatty acids and other lipophilic substances from the cytoplasm to the nucleus, where these lipids are released to a group of nuclear receptors such as peroxisome proliferator-activated receptors (PPARs. In this study, using lysophosphatidic acid (LPA-coated agarose beads, we have identified FABP3 as an LPA carrier protein in human coronary artery endothelial cells (HCAECs. Administration of LPA to HCAECs resulted in a dose-dependent increase in PPARγ activation. Furthermore, the LPA-induced PPARγ activation was abolished when the FABP3 expression was reduced using small interfering RNA (siRNA. We further show that the nuclear fraction of control HCAECs contained a significant amount of exogenously added LPA, whereas FABP3 siRNA-transfected HCAECs had a decreased level of LPA in the nucleus. Taken together, these results suggest that FABP3 governs the transcriptional activities of LPA by targeting them to cognate PPARγ in the nucleus.

  17. Lysophosphatidic acid receptor activation affects the C13NJ microglia cell line proteome leading to alterations in glycolysis, motility, and cytoskeletal architecture

    Science.gov (United States)

    Bernhart, Eva; Kollroser, Manfred; Rechberger, Gerald; Reicher, Helga; Heinemann, Akos; Schratl, Petra; Hallström, Seth; Wintersperger, Andrea; Nusshold, Christoph; DeVaney, Trevor; Zorn-Pauly, Klaus; Malli, Roland; Graier, Wolfgang; Malle, Ernst; Sattler, Wolfgang

    2014-01-01

    Microglia, the immunocompetent cells of the CNS, are rapidly activated in response to injury and microglia migration towards and homing at damaged tissue plays a key role in CNS regeneration. Lysophosphatidic acid (LPA) is involved in signaling events evoking microglia responses through cognate G protein-coupled receptors. Here we show that human immortalized C13NJ microglia express LPA receptor subtypes LPA1, LPA2, and LPA3 on mRNA and protein level. LPA activation of C13NJ cells induced Rho and extracellular signal-regulated kinase activation and enhanced cellular ATP production. In addition, LPA induced process retraction, cell spreading, led to pronounced changes of the actin cytoskeleton and reduced cell motility, which could be reversed by inhibition of Rho activity. To get an indication about LPA-induced global alterations in protein expression patterns a 2-D DIGE/LC-ESI-MS proteomic approach was applied. On the proteome level the most prominent changes in response to LPA were observed for glycolytic enzymes and proteins regulating cell motility and/or cytoskeletal dynamics. The present findings suggest that naturally occurring LPA is a potent regulator of microglia biology. This might be of particular relevance in the pathophysiological context of neurodegenerative disorders where LPA concentrations can be significantly elevated in the CNS. PMID:19899077

  18. Lysophosphatidic Acid Up-regulates MT1-MMP Expression through a Gi –dependent Pathway in Human Umbilical Vein Endothelial Cells

    Directory of Open Access Journals (Sweden)

    Po-Wei Lin

    2009-11-01

    Full Text Available Lysophosphatidic acid (LPA is a low molecular weight lysophospholipid (LPL. Through binding to its specific G protein-coupled receptor family, LPA regulates various cellular functions, including proliferation, migration, invasion, and differentiation. Matrix-metalloproteinases (MMPs are zinc-dependent protease and play important roles in regulating the interaction between cells and extracellular matrix (ECM. Among these MMPs, membrane type 1-metalloproteinase (MT1-MMP not only degrades ECM protein but also activates metalloproteinase-2 (MMP-2, Gelatinase A, which are important to endothelial cell migration. Our previous study showed that LPA enhances MMP-2 expression and activity in human umbilical vein endothelial cells (HUVECs. In this study, we further revealed that LPA also induce MT1-MMP mRNA and protein expressions in HUVECs through real-time PCR and Western blotting, respectively. Furthermore, by applying chemical inhibitors, we found that LPA-induced MT1-MMP expression is mainly through a Gi- and partially through a Gq-dependent pathway. Our results provide new evidence that LPA might modulate ECM through regulating the expression of MT1-MMP.

  19. Enhancement of Human Endothelial Cell Adhesion to Type I Collagen by Lysophosphatidic Acid (LPA and Sphingosine-1-Phosphate (S1P

    Directory of Open Access Journals (Sweden)

    Hsinyu Lee

    2004-06-01

    Full Text Available The diverse cellular effects of lysophosphatidic acid (LPA and sphingosine-1-phosphate (S1P are transduced by two structurally homologous subfamilies of G protein-coupled receptors, which are encoded by endothelial differentiation genes (Edg Rs. Human umbilical cord vein endothelial cells (HUVECs express Edg Rs for LPA (Edg2 and S1P (Edg1 and 3, which transduce signals for migration of HUVECs through micropore filters coated with type I collagen. Since activation of integrins is essential for optimal migration of endothelial cells, we now examine the capacity of LPA and S1P to augment integrin mediation of endothelial cell binding to type I collagen. Lysophospholipid enhancement of HUVEC adhesion to type I collagen is detectable within 20 minutes. Enhancement of adhesion by both LPA and S1P is significant at 50 nM and optimal at 5µM. Pertussis toxin (PTx, a specific inhibitor of Gi, and C3 exotoxin, a specific inhibitor of Rho, both suppress LPA and S1P enhancement of HUVEC adhesion. In contrast, PD98059, which blocks MAP kinase kinase (MEK, and wortmannin, which inhibits phosphatidylinositol 3-kinase (PI3K, had no effect on LPA- or S1P-enhancement of HUVEC adhesion. Neutralizing monoclonal antibodies specific for α2 and β1 integrin chains, concomitantly decrease LPA and S1P enhancement of HUVEC adhesion to type I collagen. LPA and S1P thus promote type I collagen-dependent adhesion and migration of HUVECs by recruiting α2 and β1 integrin through both Gi and Rho pathways. Integrin α2/β1 therefore appears to be critical on the effects of LPA and S1P on endothelial cell physiology.

  20. Lysophosphatidic acid modulates the association of PTP1B with N-cadherin/catenin complex in SKOV3 ovarian cancer cells.

    Science.gov (United States)

    Huang, Ruby Yun-Ju; Wen, Chen-Chen; Liao, Chih-Kai; Wang, Shu-Huei; Chou, Liang-Yin; Wu, Jiahn-Chun

    2012-09-01

    LPA (lysophosphatidic acid) is a natural phospholipid that plays important roles in promoting cancer cell proliferation, invasion and metastases. We previously reported that LPA induces ovarian cancer cell dispersal and disruption of AJ (adherens junction) through the activation of SFK (Src family kinases). In this study, we have investigated the regulatory mechanisms during the early phase of LPA-induced cell dispersal. An in vitro model of the ovarian cancer cell line SKOV3 for cell dispersal was used. LPA induces rapid AJ disruption by increasing the internalization of N-cadherin-β-catenin. By using immunoprecipitations, LPA was shown to induce increased tyrosine phosphorylation of β-catenin and alter the balance of β-catenin-bound SFK and PTP1B (phosphotyrosine phosphatase 1B). The altered balance of tyrosine kinase/phosphatase correlated with a concomitant disintegration of the β-catenin-α-catenin, but not the β-catenin-N-cadherin complex. This disintegration of β-catenin from α-catenin and the cell dispersal caused by LPA can be rescued by blocking SFK activity with the chemical inhibitor, PP2. More importantly, PP2 also restores the level of PTP1B bound to β-catenin. We propose that LPA signalling alters AJ stability by changing the dynamics of tyrosine kinase/phosphatase bound to AJ proteins. This work provides further understanding of the early signalling events regulating ovarian cancer cell dispersal and AJ disruption induced by LPA. © The Author(s) Journal compilation © 2012 International Federation for Cell Biology.

  1. Aromatic hydrocarbon receptor inhibits lysophosphatidic acid-induced vascular endothelial growth factor-A expression in PC-3 prostate cancer cells

    International Nuclear Information System (INIS)

    Wu, Pei-Yi; Lin, Yueh-Chien; Lan, Shun-Yan; Huang, Yuan-Li; Lee, Hsinyu

    2013-01-01

    Highlights: •LPA-induced VEGF-A expression was regulated by HIF-1α and ARNT. •PI3K mediated LPA-induced VEGF-A expression. •AHR signaling inhibited LPA-induced VEGF-A expression in PC-3 cells. -- Abstract: Lysophosphatidic acid (LPA) is a lipid growth factor with multiple biological functions and has been shown to stimulate cancer cell secretion of vascular endothelial growth factor-A (VEGF-A) and trigger angiogenesis. Hypoxia-inducible factor-1 (HIF-1), a heterodimer consisting of HIF-1α and HIF-1β (also known as aromatic hydrocarbon receptor nuclear translocator (ARNT)) subunits, is an important regulator of angiogenesis in prostate cancer (PC) through the enhancement of VEGF-A expression. In this study, we first confirmed the ability of LPA to induce VEGF-A expression in PC-3 cells and then validated that LPA-induced VEGF-A expression was regulated by HIF-1α and ARNT through phosphatidylinositol 3-kinase activation. Aromatic hydrocarbon receptor (AHR), a receptor for dioxin-like compounds, functions as a transcription factor through dimerization with ARNT and was found to inhibit prostate carcinogenesis and vanadate-induced VEGF-A production. Since ARNT is a common dimerization partner of AHR and HIF-1α, we hypothesized that AHR might suppress LPA-induced VEGF-A expression in PC-3 cells by competing with HIF-1α for ARNT. Here we demonstrated that overexpression and ligand activation of AHR inhibited HIF-1-mediated VEGF-A induction by LPA treatment of PC-3 cells. In conclusion, our results suggested that AHR activation may inhibit LPA-induced VEGF-A expression in PC-3 cells by attenuating HIF-1α signaling, and subsequently, suppressing angiogenesis and metastasis of PC. These results suggested that AHR presents a potential therapeutic target for the prevention of PC metastasis

  2. Lysophosphatidic acid signaling through its receptor initiates profibrotic epithelial cell fibroblast communication mediated by epithelial cell derived connective tissue growth factor.

    Science.gov (United States)

    Sakai, Norihiko; Chun, Jerold; Duffield, Jeremy S; Lagares, David; Wada, Takashi; Luster, Andrew D; Tager, Andrew M

    2017-03-01

    The expansion of the fibroblast pool is a critical step in organ fibrosis, but the mechanisms driving expansion remain to be fully clarified. We previously showed that lysophosphatidic acid (LPA) signaling through its receptor LPA 1 expressed on fibroblasts directly induces the recruitment of these cells. Here we tested whether LPA-LPA 1 signaling drives fibroblast proliferation and activation during the development of renal fibrosis. LPA 1 -deficient (LPA 1 -/- ) or -sufficient (LPA 1 +/+ ) mice were crossed to mice with green fluorescent protein expression (GFP) driven by the type I procollagen promoter (Col-GFP) to identify fibroblasts. Unilateral ureteral obstruction-induced increases in renal collagen were significantly, though not completely, attenuated in LPA 1 -/- Col-GFP mice, as were the accumulations of both fibroblasts and myofibroblasts. Connective tissue growth factor was detected mainly in tubular epithelial cells, and its levels were suppressed in LPA 1 -/- Col-GFP mice. LPA-LPA 1 signaling directly induced connective tissue growth factor expression in primary proximal tubular epithelial cells, through a myocardin-related transcription factor-serum response factor pathway. Proximal tubular epithelial cell-derived connective tissue growth factor mediated renal fibroblast proliferation and myofibroblast differentiation. Administration of an inhibitor of myocardin-related transcription factor/serum response factor suppressed obstruction-induced renal fibrosis. Thus, targeting LPA-LPA 1 signaling and/or myocardin-related transcription factor/serum response factor-induced transcription could be promising therapeutic strategies for renal fibrosis. Copyright © 2016 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

  3. Lysophosphatidic acid-induced RhoA signaling and prolonged macrophage infiltration worsens fibrosis and fatty infiltration following rotator cuff tears.

    Science.gov (United States)

    Davies, Michael R; Lee, Lawrence; Feeley, Brian T; Kim, Hubert T; Liu, Xuhui

    2017-07-01

    Previous studies have suggested that macrophage-mediated chronic inflammation is involved in the development of rotator cuff muscle atrophy and degeneration following massive tendon tears. Increased RhoA signaling has been reported in chronic muscle degeneration, such as muscular dystrophy. However, the role of RhoA signaling in macrophage infiltration and rotator muscle degeneration remains unknown. Using a previously established rat model of massive rotator cuff tears, we found RhoA signaling is upregulated in rotator cuff muscle following a massive tendon-nerve injury. This increase in RhoA expression is greatly potentiated by the administration of a potent RhoA activator, lysophosphatidic acid (LPA), and is accompanied by increased TNFα and TGF-β1 expression in rotator cuff muscle. Boosting RhoA signaling with LPA significantly worsened rotator cuff muscle atrophy, fibrosis, and fatty infiltration, accompanied with massive monocytic infiltration of rotator cuff muscles. Co-staining of RhoA and the tissue macrophage marker CD68 showed that CD68+ tissue macrophages are the dominant cell source of increased RhoA signaling in rotator cuff muscles after tendon tears. Taken together, our findings suggest that LPA-mediated RhoA signaling in injured muscle worsens the outcomes of atrophy, fibrosis, and fatty infiltration by increasing macrophage infiltraion in rotator cuff muscle. Clinically, inhibiting RhoA signaling may represent a future direction for developing new treatments to improve muscle quality following massive rotator cuff tears. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:1539-1547, 2017. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  4. Lysophosphatidic acid signaling via LPA{sub 1} and LPA{sub 3} regulates cellular functions during tumor progression in pancreatic cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Fukushima, Kaori; Takahashi, Kaede; Yamasaki, Eri; Onishi, Yuka [Division of Molecular Oncology, Department of Life Science, Faculty of Science and Engineering, Kindai University, 3-4-1, Kowakae, Higashiosaka, Osaka 577-8502 (Japan); Fukushima, Nobuyuki [Division of Molecular Neurobiology, Department of Life Science, Faculty of Science and Engineering, Kindai University, 3-4-1, Kowakae, Higashiosaka, Osaka 577-8502 (Japan); Honoki, Kanya [Department of Orthopedic Surgery, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Tsujiuchi, Toshifumi, E-mail: ttujiuch@life.kindai.ac.jp [Division of Molecular Oncology, Department of Life Science, Faculty of Science and Engineering, Kindai University, 3-4-1, Kowakae, Higashiosaka, Osaka 577-8502 (Japan)

    2017-03-01

    Lysophosphatidic acid (LPA) signaling via G protein-coupled LPA receptors exhibits a variety of biological effects, such as cell proliferation, motility and differentiation. The aim of this study was to evaluate the roles of LPA{sub 1} and LPA{sub 3} in cellular functions during tumor progression in pancreatic cancer cells. LPA{sub 1} and LPA{sub 3} knockdown cells were generated from PANC-1 cells. The cell motile and invasive activities of PANC-1 cells were inhibited by LPA{sub 1} and LPA{sub 3} knockdown. In gelatin zymography, LPA{sub 1} and LPA{sub 3} knockdown cells indicated the low activation of matrix metalloproteinase-2 (MMP-2) in the presence of LPA. Next, to assess whether LPA{sub 1} and LPA{sub 3} regulate cellular functions induced by anticancer drug, PANC-1 cells were treated with cisplatin (CDDP) for approximately 6 months. The cell motile and invasive activities of long-term CDDP treated cells were markedly higher than those of PANC-1 cells, correlating with the expression levels of LPAR1 and LPAR3 genes. In soft agar assay, the long-term CDDP treated cells formed markedly large sized colonies. In addition, the cell motile and invasive activities enhanced by CDDP were significantly suppressed by LPA{sub 1} and LPA{sub 3} knockdown as well as colony formation. These results suggest that LPA signaling via LPA{sub 1} and LPA{sub 3} play an important role in the regulation of cellular functions during tumor progression in PANC-1 cells. - Highlights: • The cell motile and invasive activities of PANC-1 cells were stimulated by LPA{sub 1} and LPA{sub 3}. • LPA{sub 1} and LPA{sub 3} enhanced MMP-2 activation in PANC-1 cells. • The expressions of LPAR1 and LPAR3 genes were elevated in PANC-1 cells treated with cisplatin. • The cell motile and invasive activities of PANC-1 cells treated with cisplatin were suppressed by LPA{sub 1} and LPA{sub 3} knockdown. • LPA{sub 1} and LPA{sub 3} are involved in the regulation of cellular functions during tumor

  5. 5,5'-Dithiobis-(2-nitrobenzoic acid) as a probe for a non-essential cysteine residue at the medium chain acyl-coenzyme A dehydrogenase binding site of the human 'electron transferring flavoprotein' (ETF).

    Science.gov (United States)

    Parker, A; Engel, P C

    1999-01-01

    Human 'electron transferring flavoprotein' (ETF) was inactivated by the thiol-specific reagent 5,5'-dithiobis-(2-nitrobenzoic acid) (DTNB). The kinetic profile showed the reaction followed pseudo-first-order kinetics during the initial phase of inactivation. Monitoring the release of 5-thio-2-nitrobenzoate (TNB) showed that modification of 1 cysteine residue was responsible for the loss of activity. The inactivation of ETF by DTNB could be reversed upon incubation with thiol-containing reagents. The loss of activity was prevented by the inclusion of medium chain acyl-CoA dehydrogenase (MCAD) and octanoyl-CoA. Cyanolysis of the DTNB modified-ETF with KCN led to the release of TNB accompanied presumably by the formation of the thio-cyano enzyme and with almost full recovery of activity. Conservation studies and the lack of 100% inactivation, however, suggested that this cysteine residue is not essential for the interaction with MCAD.

  6. A Dependence of Charmed Meson Production

    Energy Technology Data Exchange (ETDEWEB)

    Alves, Gilvan Augusto [Rio de Janeiro, CBPF

    1992-03-01

    One report is presented of a recent direct measurement of the nucleon number (A) dependence of the production cross sections for the charmed mesons $D^0$ and $D^+$ using $\\pi^+_{-}$ and $K^+_{-}$ beams incident on a segmented target of Be, Al, Cu and W. The data derive from the experiment E769 - Hadroproductlon of Charm at Fermilab. The experimental apparatus is described together with the following analysis. Starting from a sample of -1500 D mesons in the range of $O< x_{f} <1$, the data are found to be well described by the parameterization $\\sigma_{A}$ = $\\sigma_{O}$ , with $\\alpha = 0.99 \\pm 0.03$. The $x_f$ dependence of $\\alpha$ is examined and the results obtained are compared with those of other .experiments and wl th -theoretical expectations based on perturbatlve QCD and on an EMC like model of nuclear shadowing

  7. CcpA-dependent carbon catabolite repression in bacteria

    NARCIS (Netherlands)

    Warner, JB; Lolkema, JS; Warner, Jessica B.

    2003-01-01

    Carbon catabolite repression (CCR) by transcriptional regulators follows different mechanisms in gram-positive and gram-negative bacteria. In gram-positive bacteria, CcpA-dependent CCR is mediated by phosphorylation of the phosphoenolpyruvate:sugar phosphotransferase system intermediate HPr at a

  8. A-dependent effects in high PT reactions

    International Nuclear Information System (INIS)

    Fields, T.

    1994-01-01

    A brief summary of A-dependent effects which have been observed in various high energy scattering processes from nuclear targets is given. Reactions which are discussed include dijet production, dihadron production, Drell-Yan, deep inelastic muon scattering, and low-P t hadron production. The data are described in terms of multiple scattering of a fast parton in nuclear matter. Some suggestions for future work are given

  9. A-dependence of inclusive πsup(+-) meson photoproduction

    International Nuclear Information System (INIS)

    Alanakyan, K.V.; Amaryan, M.D.; Demirchyan, R.A.; Egiyan, K.Sh.; Kocharova, Zh.L.; Ogandjanyan, M.S.; Sharabyan, Yu.G.; Stepanyan, S.G.

    1981-01-01

    The experimental data on A-dependence of photopions in wide energy and angular intervals of secondary PI +- -mesons are discussed. It is shown that if the invariant cross section of photopion production on 12 C, 27 Al, 63 Cu, 118 Sn and 208 Pb nuclei in the γ+A→PI +- +X reaction is represented in the form of f approximately equal to BAsup(n), then in the energy dependence of exponent n one can observe the same singularities as in the analogous hadron processes. The expansion of the angular interval up to 20-160 deg in the laboratory system made it possible to study in detail the nature of these singularities. The attempts are made to explain the observed singularities in the energy dependence n=n(TPI) by taking into account additional (to tne direct process of photoproduction on nuclear nucleons) sources of the inclusive PI-meson production [ru

  10. Reference: 783 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available xpression of the Arabidopsis 10-kilodalton acyl-coenzyme A-binding protein ACBP6 en...phospholipid metabolism in Arabidopsis, including the possibility of ACBP6 in the cytosolic trafficking of phosphatidylcholine. Overe

  11. ACAT Inhibition and Progression of Carotid Atherosclerosis in Patients With Familial Hypercholesterolemia The CAPTIVATE Randomized Trial

    NARCIS (Netherlands)

    Meuwese, Marijn C.; de Groot, Eric; Duivenvoorden, Raphaël; Trip, Mieke D.; Ose, Leiv; Maritz, Frans J.; Basart, Dick C. G.; Kastelein, John J. P.; Habib, Rafik; Davidson, Michael H.; Zwinderman, Aeilko H.; Schwocho, Lee R.; Stein, Evan A.

    2009-01-01

    Context Inhibition of acyl coenzyme A: cholesterol acyltransferase (ACAT), an intracellular enzyme involved in cholesterol accumulation, with pactimibe was developed to assist in the prevention of cardiovascular disease. Objective To evaluate the efficacy and safety of pactimibe in inhibition of

  12. Eflucimibe. Pierre Fabre/Eli Lilly.

    Science.gov (United States)

    Burnett, John R

    2003-03-01

    Eflucimibe is an acyl coenzyme A:cholesterol acyltransferase inhibitor under development by Pierre Fabre SA and Eli Lilly & Co for the potential treatment of hypercholesterolemia and atherosclerosis. Phase II clinical trials commenced during 2002.

  13. Lysophosphatidic Acid Regulation and Roles in Human Prostate Cancer

    Science.gov (United States)

    2006-08-01

    IGF-II ( insulin -like growth factor-II), and hormones have been implicated in the growth and survival of prostate cancer cells [1]. A recent addition to...sphingomyelin. In the synthesis of sphingomyelin, a phosphocholine group is transferred from phosphatidylcholine to ceramide. Sphin- gomyelin synthesis...cytotoxicity of TNF-α [78]. A phosphatidylcholine -specific phospholipase C activity was also required for aSMase activa- tion [79,80]. It is assumed that

  14. Pro-lipogenic Action of Lysophosphatidic Acid in Ovarian Cancer

    Science.gov (United States)

    2014-04-01

    Function. IUBMB Life. 2008. 60: 347-354. 11. Tse C, Shoemaker AR, Adickes J, Anderson MG, Chen J, Jin S, Johnson EF, Marsh KC , Mitten MJ, Nimmer P...Ann. Oncol. 9, 437–442 14. Choi, J. W., Herr, D. R., Noguchi, K., Yung, Y. C., Lee, C. W., Mutoh, T., Lin, M. E., Teo , S. T., Park, K. E., Mosley, A

  15. A-dependence of structure functions and multiquark clusters in nuclei

    International Nuclear Information System (INIS)

    Kondratyuk, L.; Shmatikov, M.

    1984-01-01

    Assuming existence of 12q-clusters (bags) in nuclei the structure functions of deep inelastic scattering of leptons on nuclei are discussed. Universal momentum distribution of quarks in a multiquark cluster is used with high-momentum component falling exponentially PHIsub(q)sup(2)(k) approximately esup(-k/ksub(0)) with k 0 approximately equal to 50-60 MeV/c. The admixture of 12q-cluster W required for the description of SLAG data increases from 10% for 4 He to 30% for Au. The A-dependence of W agrees well with the A-dependence of cumulative particle spectra

  16. A-dependence of shadowing and the small-x EMC data

    International Nuclear Information System (INIS)

    Close, F.E.; Roberts, R.G.

    1988-06-01

    We examine the gluon-interaction model for shadowing in the light of the new EMC data on nuclear structure functions. In the model, xsub(n) and xsub(A) characterise the points where shadowing begins and becomes total. Good agreement with the data occurs when xsub(n) varies with A but xsub(A) does not -conversely to the original formulation of the model. The A-dependence of xsub(n) can be described by the same dynamics that generates the A-dependence of the EMC effect at large x. (author)

  17. A-dependence of hadron pair production with high Psub(T)

    International Nuclear Information System (INIS)

    Abramov, V.V.; Baldin, V.Yu.; Buzulutskov, A.F.

    1983-01-01

    The A-dependence of charged hadron pair production has been measured. The approximation of the invariant cross-section by the function Asup(αsub(2)) has given the value α 2 approximately 1 in the whole range 0.46 2 on the pair species has been observed

  18. On the A dependence in the process of dilepton production by high-energy nucleons

    International Nuclear Information System (INIS)

    Gevorkyan, S.R.; Zhamkochyan, V.M.

    1978-01-01

    The process of lepton pair production in nucleon-nucleus collisions for high energies is considered. It is shown, that with due regard for the N → π → μ + μ - inelastic transitions the experimentally observed A dependence of the cross section of the NA → μ + μ - X process can be explained in the framework of the multiple scattering theory

  19. The A-dependence of deep inelastic lepton-nuclear scattering from 6-quark clustering

    International Nuclear Information System (INIS)

    Chemtob, M.; Peschanszi, R.

    1984-03-01

    The correction to the nucleon valence quark structure functions implied by 6-quark clustering in nuclei are found to be in remarkable agreement with recent data from S.L.A.C. on the A-dependence of electron-nucleus deep inelastic scattering

  20. $A$--Dependence of $\\Lambda\\Lambda$ Bond Energies in Double---$\\Lambda$ Hypernuclei

    OpenAIRE

    Lanskoy, D. E.; Lurie, Yu. A.; Shirokov, A. M.

    1995-01-01

    The $A$-dependence of the bond energy $\\Delta B_{\\Lambda\\Lambda}$ of the ${\\Lambda\\Lambda}$ hypernuclear ground states is calculated in a three-body ${\\Lambda + \\Lambda + {^{A}Z}}$ model and in the Skyrme-Hartree-Fock approach. Various ${\\Lambda\\Lambda}$ and $\\Lambda$-nucleus or ${\\Lambda N}$ potentials are used and the sensitivity of $\\Delta B_{\\Lambda\\Lambda}$ to the interactions is discussed. It is shown that in medium and heavy ${\\Lambda\\Lambda}$ hypernuclei, $\\Delta B_{\\Lambda\\Lambda}$ i...

  1. Motivation as an independent and a dependent variable in medical education: a review of the literature.

    Science.gov (United States)

    Kusurkar, R A; Ten Cate, Th J; van Asperen, M; Croiset, G

    2011-01-01

    Motivation in learning behaviour and education is well-researched in general education, but less in medical education. To answer two research questions, 'How has the literature studied motivation as either an independent or dependent variable? How is motivation useful in predicting and understanding processes and outcomes in medical education?' in the light of the Self-determination Theory (SDT) of motivation. A literature search performed using the PubMed, PsycINFO and ERIC databases resulted in 460 articles. The inclusion criteria were empirical research, specific measurement of motivation and qualitative research studies which had well-designed methodology. Only studies related to medical students/school were included. Findings of 56 articles were included in the review. Motivation as an independent variable appears to affect learning and study behaviour, academic performance, choice of medicine and specialty within medicine and intention to continue medical study. Motivation as a dependent variable appears to be affected by age, gender, ethnicity, socioeconomic status, personality, year of medical curriculum and teacher and peer support, all of which cannot be manipulated by medical educators. Motivation is also affected by factors that can be influenced, among which are, autonomy, competence and relatedness, which have been described as the basic psychological needs important for intrinsic motivation according to SDT. Motivation is an independent variable in medical education influencing important outcomes and is also a dependent variable influenced by autonomy, competence and relatedness. This review finds some evidence in support of the validity of SDT in medical education.

  2. 20 CFR 10.405 - Who is considered a dependent in a claim based on disability or impairment?

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Who is considered a dependent in a claim based on disability or impairment? 10.405 Section 10.405 Employees' Benefits OFFICE OF WORKERS... Disability and Impairment § 10.405 Who is considered a dependent in a claim based on disability or impairment...

  3. Measurement of the $Z/A$ dependence of neutrino charged-current total cross-sections

    CERN Document Server

    Kayis-Topaksu, A; Van Dantzig, R; De Jong, M; Konijn, J; Melzer, O; Oldeman, R G C; Pesen, E; Van der Poel, C A F J; Spada, F R; Visschers, J L; Güler, M; Serin-Zeyrek, M; Kama, S; Sever, R; Tolun, P; Zeyrek, M T; Armenise, N; Catanesi, M G; De Serio, M; Ieva, M; Muciaccia, M T; Radicioni, E; Simone, S; Bülte, A; Winter, Klaus; El-Aidi, R; Van de Vyver, B; Vilian, P; Wilquet, G; Saitta, B; Di Capua, E; Ogawa, S; Shibuya, H; Artamonov, A V; Brunner, J; Chizhov, M; Cussans, D G; Doucet, M; Fabre, Jean-Paul; Hristova, I R; Kawamura, T; Kolev, D; Litmaath, M; Meinhard, H; Panman, J; Papadopoulos, I M; Ricciardi, S; Rozanov, A; Saltzberg, D; Tsenov, R V; Uiterwijk, J W E; Zucchelli, P; Goldberg, J; Chikawa, M; Arik, E; Song, J S; Yoon, C S; Kodama, K; Ushida, N; Aoki, S; Hara, T; Delbar, T; Favart, D; Grégoire, G; Kalinin, S; Makhlyoueva, I V; Gorbunov, P; Khovanskii, V D; Shamanov, V V; Tsukerman, I; Bruski, N; Frekers, D; Rondeshagen, D; Wolff, T; Hoshino, K; Kawada, J; Komatsu, M; Miyanishi, M; Nakamura, M; Nakano, T; Narita, K; Niu, K; Niwa, K; Nonaka, N; Sato, O; Toshito, T; Buontempo, S; Cocco, A G; D'Ambrosio, N; De Lellis, G; De Rosa, G; Di Capua, F; Ereditato, A; Fiorillo, G; Marotta, A; Messina, M; Migliozzi, P; Pistillo, C; Santorelli, R; Scotto-Lavina, L; Strolin, P; Tioukov, V; Nakamura, K; Okusawa, T; Dore, U; Loverre, P F; Ludovici, L; Maslennikov, A L; Righini, P; Rosa, G; Santacesaria, R; Satta, A; Barbuto, E; Bozza, C; Grella, G; Romano, G; Sirignano, C; Sorrentino, S; Sato, Y; Tezuka, I

    2003-01-01

    A relative measurement of total cross-sections is reported for polyethylene, marble, iron, and lead targets for the inclusive charged-current reaction nu_mu + N -> mu^- + X. The targets, passive blocks of ~100kg each, were exposed simultaneously to the CERN SPS wide-band muon-neutrino beam over a period of 18 weeks. Systematics effects due to differences in the neutrino flux and detector efficiency for the different target locations were minimised by changing the position of the four targets on their support about every two weeks. The relative neutrino fluxes on the targets were monitored within the same experiment using charged-current interactions in the calorimeter positioned directly downstream of the four targets. From a fit to the Z/A dependence of the total cross-sections a value is deduced for the effective neutron-to-proton cross-section ratio.

  4. Measurement of the Z/A dependence of neutrino charged-current total cross-sections

    CERN Document Server

    Kayis-Topasku, A; Dantzig, R V

    2003-01-01

    A relative measurement of total cross-sections is reported for polyethylene, marble, iron, and lead targets for the inclusive charged-current reaction nu submu + N -> mu sup - + X. The targets, passive blocks of propor to 100 kg each, were exposed simultaneously to the CERN SPS wide-band muon-neutrino beam over a period of 18 weeks. Systematic effects due to differences in the neutrino flux and detector efficiency for the different target locations were minimised by changing the position of the four targets on their support about every two weeks. The relative neutrino fluxes on the targets were monitored within the same experiment using charged-current interactions in the calorimeter positioned directly downstream of the four targets. From a fit to the Z/A dependence of the total cross-sections a value is deduced for the effective neutron-to-proton cross-section ratio. (orig.)

  5. A-dependence of differential multiplicity at 7 GeV/c

    International Nuclear Information System (INIS)

    Arefyev, A.V.; Bayukov, Yu.D.; Efremenko, V.I.

    1977-01-01

    Particle production in the inelastic proton-nucleus interactions have been investigated at the initial momentum psub(0)=7 GeV/c for Be, Al, C, Cu, Cd and Pb nuclei. A-dependences of both π - and p differential multiplicities are parametrized as approximately Asup(α(sub(i)))i. Similar parametrization seems to be also suitable for the normalized topological cross-section Wsup(n-)(A) of the processes with nsup(-) forward emitted negative pions. The dependence of αsub(i) on the secondary particle type and its kinematic region for (A) and on n - for Wsup(n-)(A) has been obtained. These experimental data indicate to secondary interactions of the produced particles inside nucleus. The total multiplicity distribution is observed to obey KNO scaling

  6. Identification and characterization of AckA-dependent protein acetylation in Neisseria gonorrhoeae.

    Directory of Open Access Journals (Sweden)

    Deborah M B Post

    Full Text Available Neisseria gonorrhoeae, the causative agent of gonorrhea, has a number of factors known to contribute to pathogenesis; however, a full understanding of these processes and their regulation has proven to be elusive. Post-translational modifications (PTMs of bacterial proteins are now recognized as one mechanism of protein regulation. In the present study, Western blot analyses, with an anti-acetyl-lysine antibody, indicated that a large number of gonococcal proteins are post-translationally modified. Previous work has shown that Nε-lysine acetylation can occur non-enzymatically with acetyl-phosphate (AcP as the acetyl donor. In the current study, an acetate kinase mutant (1291ackA, which accumulates AcP, was generated in N. gonorrhoeae. Broth cultures of N. gonorrhoeae 1291wt and 1291ackA were grown, proteins extracted and digested, and peptides containing acetylated-lysines (K-acetyl were affinity-enriched from both strains. Mass spectrometric analyses of these samples identified a total of 2686 unique acetylation sites. Label-free relative quantitation of the K-acetyl peptides derived from the ackA and wild-type (wt strains demonstrated that 109 acetylation sites had an ackA/wt ratio>2 and p-values <0.05 in at least 2/3 of the biological replicates and were designated as "AckA-dependent". Regulated K-acetyl sites were found in ribosomal proteins, central metabolism proteins, iron acquisition and regulation proteins, pilus assembly and regulation proteins, and a two-component response regulator. Since AckA is part of a metabolic pathway, comparative growth studies of the ackA mutant and wt strains were performed. The mutant showed a growth defect under aerobic conditions, an inability to grow anaerobically, and a defect in biofilm maturation. In conclusion, the current study identified AckA-dependent acetylation sites in N. gonorrhoeae and determined that these sites are found in a diverse group of proteins. This work lays the foundation for

  7. Angiomodulin is a specific marker of vasculature and regulates VEGF-A dependent neo-angiogenesis

    Science.gov (United States)

    Hooper, Andrea T.; Shmelkov, Sergey V.; Gupta, Sunny; Milde, Till; Bambino, Kathryn; Gillen, Kelly; Goetz, Mollie; Chavala, Sai; Baljevic, Muhamed; Murphy, Andrew J.; Valenzuela, David M.; Gale, Nicholas W.; Thurston, Gavin; Yancopoulos, George D.; Vahdat, Linda; Evans, Todd; Rafii, Shahin

    2010-01-01

    Blood vessel formation is controlled by the balance between pro- and anti-angiogenic pathways. Although much is known about the factors that drive sprouting of neovessels, the factors that stabilize and pattern neovessels are undefined. The expression of angiomodulin (AGM), a VEGF-A binding protein, was increased in the vasculature of several human tumors as compared to normal tissue, raising the hypothesis that AGM may modulate VEGF-A-dependent vascular patterning. To elucidate the expression pattern of AGM, we developed an AGM knockin reporter mouse (AGMlacZ/+) wherein we demonstrate that AGM is predominantly expressed in the vasculature of developing embryos and adult organs. During physiological and pathological angiogenesis, AGM is upregulated in the angiogenic vasculature. Using the zebrafish model, we found that AGM is restricted to developing vasculature by 17-22 hpf. Blockade of AGM activity with morpholino oligomers (MO) results in prominent angiogenesis defects in vascular sprouting and remodeling. Concurrent knockdown of both AGM and VEGF-A results in synergistic angiogenesis defects. When VEGF-A is overexpressed, the compensatory induction of the VEGF-A receptor, VEGFR-2/flk-1, is blocked by the simultaneous injection of AGM MO. These results demonstrate that the vascular-specific marker AGM modulates vascular remodeling in part by temporizing the pro-angiogenic effects of VEGF-A. PMID:19542015

  8. A dependence of quasielastic charged-current neutrino-nucleus cross sections

    Science.gov (United States)

    Van Dessel, N.; Jachowicz, N.; González-Jiménez, R.; Pandey, V.; Van Cuyck, T.

    2018-04-01

    Background: 12C has been and is still widely used in neutrino-nucleus scattering and oscillation experiments. More recently, 40Ar has emerged as an important nuclear target for current and future experiments. Liquid argon time projection chambers (LArTPCs) possess various advantages in measuring electroweak neutrino-nucleus cross sections. Concurrent theoretical research is an evident necessity. Purpose: 40Ar is larger than 12C , and one expects nuclear effects to play a bigger role in reactions. We present inclusive differential and total cross section results for charged-current neutrino scattering on 40Ar and perform a comparison with 12C , 16O , and 56Fe targets, to find out about the A -dependent behavior of model predictions. Method: Our model starts off with a Hartree-Fock description of the nucleus, with the nucleons interacting through a mean field generated by an effective Skyrme force. Long-range correlations are introduced by means of a continuum random phase approximation approach. Further methods to improve the accuracy of model predictions are also incorporated in the calculations. Results: We present calculations for 12C , 16O , 40Ar , and 56Fe , showcasing differential cross sections over a broad range of kinematic values in the quasielastic regime. We furthermore show flux-folded results for 40Ar and we discuss the differences between nuclear responses. Conclusions: At low incoming energies and forward scattering we identify an enhancement in the 40Ar cross section compared to 12C , as well as in the high ω (low Tμ) region across the entire studied Eν range. The contribution to the folded cross section of the reaction strength at values of ω lower than 50 MeV for forward scattering is sizable.

  9. Charge-dependent and A-dependent effects in isotope shifts of Coulomb displacement energies

    International Nuclear Information System (INIS)

    Sherr, R.

    1977-01-01

    Coulomb displacement energies in a series of isotopes generally decrease with A. This decrease can arise from an increase with A of the average distance of interaction between pairs of protons. In the shell model a decrease can also result from charge-independence-breaking effects if the neutron-proton interaction for the valence nucleons is more attractive than the neutron-neutron interaction. Using the model recently proposed by Sherr and Talmi for the 1d/sub 3/2/ shell, existing data for this shell and also the 1d/sub 5/2/ and 1f/sub 7/2/ shells were analyzed allowing all matrix elements to vary as A/sup -lambda/3/. Least squares calculations of the rms deviation sigma were carried out for varying values of lambda from -2 to +2. It was found that although there was a minimum in sigma vs lambda it was too shallow to exclude any lambda for -1 to +1 in the 1d/sub 3/2/ and 1f/sub 7/2/ shells or 0 to +1 in the 1d/sub 5/2/ shell. It is therefore not possible to distinguish between A dependence and charge dependence in this model. The magnitude of the latter as expressed in terms of (np-nn) matrix elements depends strongly on the former. As lambda increases from -1 to +1, these (np-nn) matrix elements decrease roughly linearly in absolute magnitude and eventually change sign. For lambda = 0 they have appreciable and reasonable magnitudes for the 1d/sub 3/2/ and 1f/sub 7/2/ shells but for the 1d/sub 5/2/ shell the values are too small to be considered significant

  10. A-dependence of the γ- and p-induced production of the Λ(1520) from nuclei

    International Nuclear Information System (INIS)

    Kaskulov, M.; Oset, E.; Roca, L.

    2006-01-01

    Using results of a recent calculation of the Λ(1520) in the nuclear medium, which show that the medium width is about five times the free width, we study the A-dependence of the Λ(1520) production cross-section in the reactions γA→K + Λ(1520)A' and pA→pK + Λ(1520)A'. We find a sizable A-dependence in the ratio of the nuclear cross-sections for heavy nuclei with respect to a light one due to the large value of the Λ(1520) width in the medium, showing that devoted experiments, easily within reach in present facilities, can provide good information on that magnitude by measuring the cross-sections studied here. (orig.)

  11. Effects of a Dependent Group Contingency on the Verbal Interactions of Middle School Students with Emotional Disturbance

    OpenAIRE

    Hansen, S.; Lignugaris/Kraft, Benjamin

    2005-01-01

    This study examined the effects of a dependent group contingency to increase positive verbal interactions among nine middle school-aged males in a self-contained classroom. Prior to implementing the group contingency, the students received social skills instruction. A withdrawal experimental design was then used to evaluate the effects of the dependent group contingency. Students' positive verbal interactions increased and negative verbal interactions decreased with the implementation of the ...

  12. A-dependence of nuclear transparency in quasielastic A(e,e'p) at high Q2

    International Nuclear Information System (INIS)

    O'Neill, T.G.; Lorenzon, W.; Arrington, J.

    1994-01-01

    The A-dependence of the quasielastic A(e,e'p) reaction has been studied with 3 H, C, Fe, and Au nuclei at momentum transfers Q 2 = 1, 3, 5, and 6.8(GeV/c) 2 . The authors extract the nuclear transparency T(A,Q 2 ), a measure of the average probability of escape of a proton from a nucleus A. Several calculations predict a significant increase in T with momentum transfer, a phenomenon known as color transparency. No statistically significant rise is seen for any of the nuclei studied

  13. Ruin Probabilities in a Dependent Discrete-Time Risk Model With Gamma-Like Tailed Insurance Risks

    Directory of Open Access Journals (Sweden)

    Xing-Fang Huang

    2017-03-01

    Full Text Available This paper considered a dependent discrete-time risk model, in which the insurance risks are represented by a sequence of independent and identically distributed real-valued random variables with a common Gamma-like tailed distribution; the financial risks are denoted by another sequence of independent and identically distributed positive random variables with a finite upper endpoint, but a general dependence structure exists between each pair of the insurance risks and the financial risks. Following the works of Yang and Yuen in 2016, we derive some asymptotic relations for the finite-time and infinite-time ruin probabilities. As a complement, we demonstrate our obtained result through a Crude Monte Carlo (CMC simulation with asymptotics.

  14. Safe and unsafe duration of fasting for children with MCAD deficiency

    NARCIS (Netherlands)

    Derks, Terry G J; van Spronsen, Francjan J; Rake, Jan Peter; van der Hilst, Christian S; Span, Mark M; Smit, G Peter A

    OBJECTIVE: To study the safe and unsafe duration of fasting in children with medium chain acyl-Coenzyme A dehydrogenase (MCAD) deficiency, the literature and the database on Dutch MCAD-deficient patients were searched for data on fasting studies in patients with MCAD deficiency. MATERIALS AND

  15. Clinical and biochemical monitoring of patients with fatty acid oxidation disorders

    DEFF Research Database (Denmark)

    Lund, Allan Meldgaard; Skovby, Flemming; Vestergaard, Helle

    2010-01-01

    carnitine is measured to monitor carnitine supplementation in patients with multiple acyl-coenzyme A dehydrogenase deficiency (MADD) and carnitine transporter deficiency (CTD) and to follow metabolic control and disclose deficiency states in other FAO disorders. We are evaluating long-chain acylcarnitines...

  16. Acyl-CoA metabolism and partitioning

    DEFF Research Database (Denmark)

    Grevengoed, Trisha J; Klett, Eric L; Coleman, Rosalind A

    2014-01-01

    Long-chain fatty acyl-coenzyme As (CoAs) are critical regulatory molecules and metabolic intermediates. The initial step in their synthesis is the activation of fatty acids by one of 13 long-chain acyl-CoA synthetase isoforms. These isoforms are regulated independently and have different tissue...

  17. Analysis of hydroxycinnamic acid degradation in Agrobacterium fabrum reveals a coenzyme A-dependent, beta-oxidative deacetylation pathway.

    Science.gov (United States)

    Campillo, Tony; Renoud, Sébastien; Kerzaon, Isabelle; Vial, Ludovic; Baude, Jessica; Gaillard, Vincent; Bellvert, Floriant; Chamignon, Cécile; Comte, Gilles; Nesme, Xavier; Lavire, Céline; Hommais, Florence

    2014-06-01

    The soil- and rhizosphere-inhabiting bacterium Agrobacterium fabrum (genomospecies G8 of the Agrobacterium tumefaciens species complex) is known to have species-specific genes involved in ferulic acid degradation. Here, we characterized, by genetic and analytical means, intermediates of degradation as feruloyl coenzyme A (feruloyl-CoA), 4-hydroxy-3-methoxyphenyl-β-hydroxypropionyl-CoA, 4-hydroxy-3-methoxyphenyl-β-ketopropionyl-CoA, vanillic acid, and protocatechuic acid. The genes atu1416, atu1417, and atu1420 have been experimentally shown to be necessary for the degradation of ferulic acid. Moreover, the genes atu1415 and atu1421 have been experimentally demonstrated to be essential for this degradation and are proposed to encode a phenylhydroxypropionyl-CoA dehydrogenase and a 4-hydroxy-3-methoxyphenyl-β-ketopropionic acid (HMPKP)-CoA β-keto-thiolase, respectively. We thus demonstrated that the A. fabrum hydroxycinnamic degradation pathway is an original coenzyme A-dependent β-oxidative deacetylation that could also transform p-coumaric and caffeic acids. Finally, we showed that this pathway enables the metabolism of toxic compounds from plants and their use for growth, likely providing the species an ecological advantage in hydroxycinnamic-rich environments, such as plant roots or decaying plant materials.

  18. Group boundary permeability moderates the effect of a dependency meta-stereotype on help-seeking behaviour.

    Science.gov (United States)

    Zhang, Lange; Kou, Yu; Zhao, Yunlong; Fu, Xinyuan

    2016-08-01

    Previous studies have found that when low-status group members are aware that their in-group is stereotyped as dependent by a specific out-group (i.e. a dependency meta-stereotype is salient), they are reluctant to seek help from the high-status out-group to avoid confirming the negative meta-stereotype. However, it is unclear whether low-status group members would seek more help in the context of a salient dependency meta-stereotype when there is low (vs. high) group boundary permeability. Therefore, we conducted two experiments to examine the moderating effect of permeability on meta-stereotype confirmation with a real group. In study 1, we manipulated the salience of the dependency meta-stereotype, measured participants' perceived permeability and examined their help-seeking behaviour in a real-world task. Participants who perceived low permeability sought more help when the meta-stereotype was salient (vs. not salient), whereas participants who perceived high permeability sought the same amount of help across conditions. In study 2, we manipulated the permeability levels and measured the dependency meta-stereotype. Participants who endorsed a high-dependency meta-stereotype sought more help than participants who endorsed a low-dependency meta-stereotype; this effect was particularly strong in the low-permeability condition. The implications of these results for social mobility and intergroup helping are discussed. © 2015 International Union of Psychological Science.

  19. Self-organising Logic of Structures as a Basis for a Dependency-based Dynamic Semantics Model

    Directory of Open Access Journals (Sweden)

    Maciej Piasecki

    2015-06-01

    Full Text Available Self-organising Logic of Structures as a Basis for a Dependency-based Dynamic Semantics Model We present Self-organising Logic of Structures (SLS, a semantic representation language of high expressive power, which was designed for a fully compositional representation of discourse anaphora following the Dynamic Semantics paradigm. The application of SLS to the description of possible meanings of Polish multiple quantifier sentences is discussed. Special attention is paid to the phenomena of: cardinality dependency/independency of Noun Phrase quantifiers and variety of quantification. Semantic representation based on several formal operators is proposed. They can be combined in many different ways, if one takes a purely theoretical perspective. However, in the paper we show that this huge number is practically reduced in the language use and is governed by several constraints motivated by the analysis of Polish language data. The Hypothesis of Local Range of Cardinality Dependency is formulated as an alternative to representations based on quantifier rising technique. SLS provides a multi-layered language description of inter-linked representation of sever antification, reference, presupposition and anaphora.

  20. Marriage is a dependent risk factor for mortality of colon adenocarcinoma without a time-varying effect.

    Science.gov (United States)

    Liu, Minling; Li, Lixian; Yu, Wei; Chen, Jie; Xiong, Weibin; Chen, Shuang; Yu, Li

    2017-03-21

    It has been well recognized that the effects of many prognostic factors could change during long-term follow-up. Although marriage has been proven to be a significant prognostic factor for the survival of colon cancer, whether the effect of marriage is constant with time remain unknown. This study analyzed the impact of marital status on the mortality of colon cancer patients with an extended Cox model that allowed for time-varying effects. We identified 71,955 patients who underwent colectomy between 2004 and 2009 to treat colon adenocarcinoma from the Surveilance, Epidemiology and End Results Database. The multivariate extended Cox model was used to evaluate the effect of marital status on all-cause mortality, while the Fine-Gray competing risks model was used for colon cancer-specific mortality, with death from other causes as the competing risk. The unmarried patients carried a 1.37-fold increased risk of all-cause mortality compared with the married patients (95%CI: 1.33-1.40; pMarriage is a dependent prognosis factor for survival of surgically treated colon adenocarcinoma patients. Psychological interventions are suggested to improve receipt of treatment among unmarried patients, as their poor survival may be due to the inefficient treatment.

  1. Cyp1a-dependent activation of xenobiotics in endothelial linings of the chorioallantoic membrane (CAM) in birds

    International Nuclear Information System (INIS)

    Annas, A.; Brittebo, E.B.

    2000-01-01

    Metabolic activation of the heterocyclic amine 3-amino-1,4-dimethyl-5H-pyrido[4,3-b]indole (Trp-P-1) and 7-ethoxyresorufin O-deethylase (EROD) activity were examined in the chorioallantoic membrane (CAM) of 15-day-old chicken and 18-day-old eider duck embryos. The embryos were pretreated with an Ah receptor agonist, i.e. β-naphthoflavone (BNF) or 3,3',4,4',5-pentachlorobiphenyl (PCB 126), or vehicle in ovo. BNF and PCB 126 induced EROD activity and covalent binding of [ 3 H]Trp-P-1 seven- to tenfold in the CAM of chicken embryos. In the CAM of eider duck embryos, which are known to be nonresponsive to coplanar PCBs, PCB 126 treatment had no effect on EROD activity or covalent binding of [ 3 H]Trp-P-1 whereas BNF treatment increased these activities five- and threefold, respectively. Light microscopic autoradiography was used to identify the cellular localization of covalent binding of [ 3 H]Trp-P-1 in the CAM. Preferential binding was observed in endothelial cells in intraepithelial capillaries in the chorionic epithelium and in blood vessels in the mesenchymal layer. The addition of the CYP1A inhibitor ellipticine abolished the covalent binding of [ 3 H]Trp-P-1 in the CAM of BNF- and PCB 126-treated chicken and eider duck embryos. The results suggest that CYP1A-dependent metabolic activity can be induced in blood vessel endothelia in the CAM of bird embryos following exposure to Ah receptor agonists and that the CAM may be a target tissue for CYP1A-activated environmental pollutants. Furthermore, the highly vascularized CAM could be used as a model for studies of Ah receptor-mediated alterations in the vasculature. (orig.)

  2. Cyp1a-dependent activation of xenobiotics in endothelial linings of the chorioallantoic membrane (CAM) in birds

    Energy Technology Data Exchange (ETDEWEB)

    Annas, A.; Brittebo, E.B. [Uppsala Univ. (Sweden). Dept. of Toxicology; Brunstroem, B. [Dept. of Environmental Toxicology, Uppsala Univ., Uppsala (Sweden)

    2000-08-01

    Metabolic activation of the heterocyclic amine 3-amino-1,4-dimethyl-5H-pyrido[4,3-b]indole (Trp-P-1) and 7-ethoxyresorufin O-deethylase (EROD) activity were examined in the chorioallantoic membrane (CAM) of 15-day-old chicken and 18-day-old eider duck embryos. The embryos were pretreated with an Ah receptor agonist, i.e. {beta}-naphthoflavone (BNF) or 3,3',4,4',5-pentachlorobiphenyl (PCB 126), or vehicle in ovo. BNF and PCB 126 induced EROD activity and covalent binding of [{sup 3}H]Trp-P-1 seven- to tenfold in the CAM of chicken embryos. In the CAM of eider duck embryos, which are known to be nonresponsive to coplanar PCBs, PCB 126 treatment had no effect on EROD activity or covalent binding of [{sup 3}H]Trp-P-1 whereas BNF treatment increased these activities five- and threefold, respectively. Light microscopic autoradiography was used to identify the cellular localization of covalent binding of [{sup 3}H]Trp-P-1 in the CAM. Preferential binding was observed in endothelial cells in intraepithelial capillaries in the chorionic epithelium and in blood vessels in the mesenchymal layer. The addition of the CYP1A inhibitor ellipticine abolished the covalent binding of [{sup 3}H]Trp-P-1 in the CAM of BNF- and PCB 126-treated chicken and eider duck embryos. The results suggest that CYP1A-dependent metabolic activity can be induced in blood vessel endothelia in the CAM of bird embryos following exposure to Ah receptor agonists and that the CAM may be a target tissue for CYP1A-activated environmental pollutants. Furthermore, the highly vascularized CAM could be used as a model for studies of Ah receptor-mediated alterations in the vasculature. (orig.)

  3. The Role of lysophosphatidic acide (LPA) in the insulin resistence of the pancreatic β-cells

    OpenAIRE

    Mourad Agha, Zein

    2016-01-01

    The pathogenesis of the type-2-diabetes mellitus underlying is characterized by a combination of peripheral insulin resistance, β-cell dysfunction and reduction in the β cell mass. The increasing of FFA level or their metabolites lead to inhibition of insulin signaling. Consequent, the ability of insulin is reduced and therefore lead to insulin resistance. LPA is a lipid mediator that is associated with a progression of T2D. It has been suggested that LPA and the development of obesity are st...

  4. The effects of S(-)-, R(+)-, and racemic bupivacaine on lysophosphatidate-induced priming of human neutrophils

    NARCIS (Netherlands)

    Hollmann, Markus W.; Kurz, Katrin; Herroeder, Susanne; Struemper, Danja; Hahnenkamp, Klaus; Berkelmans, Noud S.; den Bakker, Christel G.; Durieux, Marcel E.

    2003-01-01

    Local anesthetics modulate inflammatory responses and may therefore be potentially useful in mitigating perioperative inflammatory injury. The inflammatory modulating effects of S(-)-bupivacaine are not known. Therefore, we compared the effects of S(-)-bupivacaine, R(+)-bupivacaine, and racemic

  5. Lysophosphatidic acids are new substrates for the phosphatase domain of soluble epoxide hydrolase[S

    OpenAIRE

    Oguro, Ami; Imaoka, Susumu

    2012-01-01

    Soluble epoxide hydrolase (sEH) is a bifunctional enzyme that has a C-terminus epoxide hydrolase domain and an N-terminus phosphatase domain. The endogenous substrates of epoxide hydrolase are known to be epoxyeicosatrienoic acids, but the endogenous substrates of the phosphatase activity are not well understood. In this study, to explore the substrates of sEH, we investigated the inhibition of the phosphatase activity of sEH toward 4-methylumbelliferyl phosphate by using lecithin and its hyd...

  6. A liver-specific defect of Acyl-CoA degradation produces hyperammonemia, hypoglycemia and a distinct hepatic Acyl-CoA pattern.

    Directory of Open Access Journals (Sweden)

    Nicolas Gauthier

    Full Text Available Most conditions detected by expanded newborn screening result from deficiency of one of the enzymes that degrade acyl-coenzyme A (CoA esters in mitochondria. The role of acyl-CoAs in the pathophysiology of these disorders is poorly understood, in part because CoA esters are intracellular and samples are not generally available from human patients. We created a mouse model of one such condition, deficiency of 3-hydroxy-3-methylglutaryl-CoA lyase (HL, in liver (HLLKO mice. HL catalyses a reaction of ketone body synthesis and of leucine degradation. Chronic HL deficiency and acute crises each produced distinct abnormal liver acyl-CoA patterns, which would not be predictable from levels of urine organic acids and plasma acylcarnitines. In HLLKO hepatocytes, ketogenesis was undetectable. Carboxylation of [2-(14C] pyruvate diminished following incubation of HLLKO hepatocytes with the leucine metabolite 2-ketoisocaproate (KIC. HLLKO mice also had suppression of the normal hyperglycemic response to a systemic pyruvate load, a measure of gluconeogenesis. Hyperammonemia and hypoglycemia, cardinal features of many inborn errors of acyl-CoA metabolism, occurred spontaneously in some HLLKO mice and were inducible by administering KIC. KIC loading also increased levels of several leucine-related acyl-CoAs and reduced acetyl-CoA levels. Ultrastructurally, hepatocyte mitochondria of KIC-treated HLLKO mice show marked swelling. KIC-induced hyperammonemia improved following administration of carglumate (N-carbamyl-L-glutamic acid, which substitutes for the product of an acetyl-CoA-dependent reaction essential for urea cycle function, demonstrating an acyl-CoA-related mechanism for this complication.

  7. Diacylglycerol Acyltransferase 1 Is Regulated by Its N-Terminal Domain in Response to Allosteric Effectors.

    Science.gov (United States)

    Caldo, Kristian Mark P; Acedo, Jeella Z; Panigrahi, Rashmi; Vederas, John C; Weselake, Randall J; Lemieux, M Joanne

    2017-10-01

    Diacylglycerol acyltransferase 1 (DGAT1) is an integral membrane enzyme catalyzing the final and committed step in the acyl-coenzyme A (CoA)-dependent biosynthesis of triacylglycerol (TAG). The biochemical regulation of TAG assembly remains one of the least understood areas of primary metabolism to date. Here, we report that the hydrophilic N-terminal domain of Brassica napus DGAT1 (BnaDGAT1 1-113 ) regulates activity based on acyl-CoA/CoA levels. The N-terminal domain is not necessary for acyltransferase activity and is composed of an intrinsically disordered region and a folded segment. We show that the disordered region has an autoinhibitory function and a dimerization interface, which appears to mediate positive cooperativity, whereas the folded segment of the cytosolic region was found to have an allosteric site for acyl-CoA/CoA. Under increasing acyl-CoA levels, the binding of acyl-CoA with this noncatalytic site facilitates homotropic allosteric activation. Enzyme activation, on the other hand, is prevented under limiting acyl-CoA conditions (low acyl-CoA-to-CoA ratio), whereby CoA acts as a noncompetitive feedback inhibitor through interaction with the same folded segment. The three-dimensional NMR solution structure of the allosteric site revealed an α-helix with a loop connecting a coil fragment. The conserved amino acid residues in the loop interacting with CoA were identified, revealing details of this important regulatory element for allosteric regulation. Based on these results, a model is proposed illustrating the role of the N-terminal domain of BnaDGAT1 as a positive and negative modulator of TAG biosynthesis. © 2017 American Society of Plant Biologists. All Rights Reserved.

  8. E1A-dependent trans-activation of the human MYC promoter is mediated by the E2F factor

    International Nuclear Information System (INIS)

    Hiebert, S.W.; Lipp, M.; Nevins, J.R.

    1989-01-01

    E2F is a cellular transcription factor that binds to two sites in the adenovirus E2 promoter. Previous experiments have implicated E2F in the E1A-dependent transactivation of the E2 gene since levels of active E2F increase markedly during adenovirus infection in parallel with the increase in E2 transcription, and an E2F binding site can confer E1A inducibility to a heterologous promoter. Here the authors show that E2F binds to two sequence elements within the P2 promoter of the human MYC gene which are within a region that is critical for promoter activity. The MYC promoter can be trans-activated in an E1A-dependent manner and site-directed mutagenesis demonstrates that these E2F elements are essential for trans-activation. Finally, they also find that adenovirus infection of quiescent cells results in a stimulation of the endogenous MYC gene. They conclude that the activation of the E2F factor, which is likely responsible for the activation of viral E2 transcription, is also responsible for the E1A-dependent induction of MYC transcription

  9. Definition of a Dependent Child

    CERN Multimedia

    Human Resources Department

    2005-01-01

    The Department of Human Resources wishes to remind members of the personnel that, under the provisions of § 6 of Administrative Circular No. 5 “Dependent child”, in the case of a child over 18 years of age the status of dependent child comes to an end once a course of studies is completed. Consequently, the payment of the dependent child allowance and the child's membership of the CERN Health Insurance Scheme terminate with effect from the last day of the month in which the course of study concerned ends. In this connection, members of the personnel are reminded that children who are no longer dependent according to the Staff Rules and Regulations and who are less than 26 years of age can nevertheless opt for membership of the normal health insurance under the terms and conditions laid down in the CERN Health Insurance Rules. The Department of Human Resources also wishes to remind members of the personnel that, pursuant to Article R IV 1.17 of the Staff Regulations, a member of the personnel is requ...

  10. recA+-dependent inactivation of the lambda repressor in Escherichia coli lysogens by γ-radiation and by tif expression

    International Nuclear Information System (INIS)

    West, S.C.; Powell, K.A.; Emmerson, P.T.

    1975-01-01

    When lambda lysogens of E. coli are induced by γ-radiation the lambda repressor, as measured by its specific binding to lambda DNA, is rapidly inactivated by a recA + -dependent process which does not require new protein synthesis. This rapid inactivation is similar to inactivation of repressor by expression of the temperature sensitive E. coli mutation tif. In contrast, induction by UV irradiation or mitomycin C treatment requires new protein synthesis and there is a lag before the repressor is inactivated (Tomizawa and Ogawa, 1967; Shinagawa and Itoh, 1973). (orig.) [de

  11. Transcriptome-Based Modeling Reveals that Oxidative Stress Induces Modulation of the AtfA-Dependent Signaling Networks in Aspergillus nidulans

    Directory of Open Access Journals (Sweden)

    Erzsébet Orosz

    2017-01-01

    Full Text Available To better understand the molecular functions of the master stress-response regulator AtfA in Aspergillus nidulans, transcriptomic analyses of the atfA null mutant and the appropriate control strains exposed to menadione sodium bisulfite- (MSB-, t-butylhydroperoxide- and diamide-induced oxidative stresses were performed. Several elements of oxidative stress response were differentially expressed. Many of them, including the downregulation of the mitotic cell cycle, as the MSB stress-specific upregulation of FeS cluster assembly and the MSB stress-specific downregulation of nitrate reduction, tricarboxylic acid cycle, and ER to Golgi vesicle-mediated transport, showed AtfA dependence. To elucidate the potential global regulatory role of AtfA governing expression of a high number of genes with very versatile biological functions, we devised a model based on the comprehensive transcriptomic data. Our model suggests that an important function of AtfA is to modulate the transduction of stress signals. Although it may regulate directly only a limited number of genes, these include elements of the signaling network, for example, members of the two-component signal transduction systems. AtfA acts in a stress-specific manner, which may increase further the number and diversity of AtfA-dependent genes. Our model sheds light on the versatility of the physiological functions of AtfA and its orthologs in fungi.

  12. Creating Directed Double-strand Breaks with the Ref Protein: A Novel Rec A-Dependent Nuclease from Bacteriophage P1

    Energy Technology Data Exchange (ETDEWEB)

    Gruenig, Marielle C.; Lu, Duo; Won, Sang Joon; Dulberger, Charles L.; Manlick, Angela J.; Keck, James L.; Cox, Michael M. (UW)

    2012-03-16

    The bacteriophage P1-encoded Ref protein enhances RecA-dependent recombination in vivo by an unknown mechanism. We demonstrate that Ref is a new type of enzyme; that is, a RecA-dependent nuclease. Ref binds to ss- and dsDNA but does not cleave any DNA substrate until RecA protein and ATP are added to form RecA nucleoprotein filaments. Ref cleaves only where RecA protein is bound. RecA functions as a co-nuclease in the Ref/RecA system. Ref nuclease activity can be limited to the targeted strands of short RecA-containing D-loops. The result is a uniquely programmable endonuclease activity, producing targeted double-strand breaks at any chosen DNA sequence in an oligonucleotide-directed fashion. We present evidence indicating that cleavage occurs in the RecA filament groove. The structure of the Ref protein has been determined to 1.4 {angstrom} resolution. The core structure, consisting of residues 77-186, consists of a central 2-stranded {beta}-hairpin that is sandwiched between several {alpha}-helical and extended loop elements. The N-terminal 76 amino acid residues are disordered; this flexible region is required for optimal activity. The overall structure of Ref, including several putative active site histidine residues, defines a new subclass of HNH-family nucleases. We propose that enhancement of recombination by Ref reflects the introduction of directed, recombinogenic double-strand breaks.

  13. Effects of sodium arsenite on the survival of UV-irradiated Escherichia coli: inhibition of a recA-dependent function

    Energy Technology Data Exchange (ETDEWEB)

    Rossman, T; Meyn, M S; Troll, W [New York Univ., N.Y. (USA). Dept. of Environmental Medicine

    1975-11-01

    Epidemiological studies and clinical observations suggesting potential hazards of arsenic compounds in increasing the incidence of cancer have been in complete contradiction with experimental findings in animals. Because of the predominance of skin cancers in the epidemiological reports, it was decided to investigate the possibility that arsenic compounds might interfere with DNA repair. Using Escherichia coli as a test system, it is shown that this is indeed the case. Sodium arsenite, at concentrations of 0.1mM and higher, decreases the survival of ultraviolet-irradiated E.coli WP2, a strain which possesses the full complement of repair genes. The effect of the arsenite increases with increasing ultraviolet dose. Similar results were obtained with the excision repair deficient strains WWP2 (uvrA) and WP6(polA). Sodium arsenite had no effect on the survival of recA mutant, WP10. Survival of ultraviolet-irradiated WP5(exrA) was enhanced by sodium arsenite, the effect being greatest at low ultraviolet doses. It is postulated that arsenite inhibits a recA-dependent step in DNA repair. To account for the increased survival of the exrA mutant, it is suggested that in the absence of the exr/sup +/ gene, the arsenite-sensitive recA-dependent function is deleterious. The ability of arsenite to inhibit DNA repair may account for the clinical and epidemiological reports linking arsenicals with an increased incidence of cancer.

  14. Antimicrobial medium- and long-chain free fatty acids prevent PrfA-dependent activation of virulence genes in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Sternkopf Lillebæk, Eva Maria; Lambert Nielsen, Stine; Scheel Thomasen, Rikke

    2017-01-01

    of virulence factors required for bacterial entry, intracellular replication and cell-to-cell spread. PrfA-dependent activation of virulence genes occurs primarily in the blood and during intracellular infection. In contrast, PrfA does not play a significant role in regulation of virulence gene expression...... antimicrobial free fatty acids act to downregulate transcription of PrfA-activated virulence genes. Interestingly, the inhibitory effect is also evident in cells encoding a constitutively active variant of PrfA. Collectively, our data suggest that antimicrobial medium- and long-chain free fatty acids may act...... as signals to prevent PrfA-mediated activation of virulence genes in environments where PrfA activation is not required, such as in food and the gastrointestinal tract....

  15. On the universality of the x and A dependence of the EMC effect and its relation to parton distributions in nuclei

    International Nuclear Information System (INIS)

    Smirnov, G.I.

    1995-01-01

    It is shown that the latest results from the NMC (CERN) and E665 (Fermilab) groups on F 2 A (x)/F 2 D (x) obtained in the shadowing region bring new evidence of the universal A dependence of distortions made in a free-nucleon structure function by a nuclear medium. The observed universality implies that one can consider separately hard (A≤4) and soft (A>4) parton distribution distortions. Soft distortions, which result in differences between the deep-inelastic scattering cross sections for nuclei with masses A 1 , A 2 ≥4, can be explained as a consequence of the nuclear density variation, independent of x in the range 0.001 ≤ x ≤ 0.7. It is found that nuclear shadowing begins at x 1 = 0.0615 ± 0.0024, independent of A, which is consistent with models that allow for three-parton recombination processes. 28 refs., 2 figs

  16. Isolimonic acid interferes with Escherichia coli O157:H7 biofilm and TTSS in QseBC and QseA dependent fashion

    Science.gov (United States)

    2012-01-01

    Background E. coli O157:H7 (EHEC) is an important human pathogen. The antibiotic treatment of EHEC reportedly results in release of Shiga toxin and is therefore discouraged. Consequently, alternative preventive or therapeutic strategies for EHEC are required. The objective of the current study was to investigate the effect of citrus limonoids on cell-cell signaling, biofilm formation and type III secretion system in EHEC. Results Isolimonic acid and ichangin were the most potent inhibitors of EHEC biofilm (IC25=19.7 and 28.3 μM, respectively) and adhesion to Caco-2 cells. The qPCR analysis revealed that isolimonic acid and ichangin repressed LEE encoded genes by ≈3 to 12 fold. In addition, flhDC was repressed by the two limonoids (≈3 to 7 fold). Further studies suggested that isolimonic acid interferes with AI-3/epinephrine activated cell-cell signaling pathway. Loss of biofilm inhibitory activity of isolimonic acid in ΔqseBC mutant, which could be restored upon complementation, suggested a dependence on functional QseBC. Additionally, overexpression of qseBC in wild type EHEC abated the inhibitory effect of isolimonic acid. Furthermore, the isolimonic acid failed to differentially regulate ler in ΔqseA mutant, while plasmid borne expression of qseA in ΔqseA background restored the repressive effect of isolimonic acid. Conclusions Altogether, results of study seem to suggest that isolimonic acid and ichangin are potent inhibitors of EHEC biofilm and TTSS. Furthermore, isolimonic acid appears to interfere with AI-3/epinephrine pathway in QseBC and QseA dependent fashion. PMID:23153211

  17. The biochemical textural and sensory properties of frozen stored ...

    African Journals Online (AJOL)

    Post-rigor king scallop meats (Pecten maximus) were frozen individually for 24 h at -80°C and kept vacuum packed at -22°C for up to 301 days. Sampling was carried out on fresh meats and at days 1, 28, 91, 154, 210 and 301 of frozen storage. Tests related to muscle integrity ( -hydroxy-acyl-coenzyme –A dehydrogenase ...

  18. Involvement of Human Estrogen Related Receptor Alpha 1 (hERR 1) in Breast Cancer and Hormonally Insensitive Disease

    Science.gov (United States)

    2000-08-01

    SV40 early-to-late switch involves titration of cellular transcriptional repressors, Genes Dev. 7: 2206-19, 1993. 6. Bonnelye, E., Vanacker , J. M ...transcriptional regulator of the human medium-chain acyl coenzyme A dehydrogenase gene, Mol Cell Biol. 17: 5400-9, 1997. 8. Vanacker , J. M ., Bonnelye, E...related receptor-alpha), Mol Endocrinol. 13: 764-73, 1999. 9. Vanacker , J. M ., Pettersson, K., Gustafsson, J. A., and Laudet, V. Transcriptional

  19. A Precision Measurement of the A-Dependence of Dimuon Production in Proton - Nucleus Collisions at 800 GeV/C

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Ming-jer [Case Western Reserve U.

    1991-05-01

    Precision measurements of the A-dependence of the reaction $p + A. \\to \\mu^+ \\mu^- + X$ at 800 GeV /care reported in this thesis. Data were taken at Fermilab (E772) using a modified version of the large dimuon spectrometer in the ) Meson-East beamline. A total of 6 x $10^5$ muon pairs were recorded for targets of D, C, Ca, Fe, and W. The kinematic region spanned by the data corresponds to a dimuon invariant mass of $3 \\le M_{\\mu^+ + \\mu^-}$ 14 GeV, a Feynman-x of $-0.1 \\le x_F \\le 0.7$ and a target parton momentum fraction of $0.03 \\le x_2 \\le 0.30$. Accurate relative target normalizations were achieved by careful monitoring of beam intensity and position, cyclic interchanges of targets; maintaining nearly 100% electronic lifetime, and by use of precisely fabricated targets. The systematic errors in the relative yields are less than 2% for all targets. Results are presented on the ratios of cross sections for nuclear targets relative to deuterium for the Drell-Y an process and for the production of the $J/\\upsilon$ , $\\psi$' , and $\\Upsilon$ quarkonia. These ratios are presented as functions of variables $P_{\\tau}$ and $X_F$ , and versus $x_1$ and $x_2$ for the Drell-Yan process. Nuclear depletion at low-$x_2$ is observed for the first time in the Drell-Yan process. No nuclear enhancement of the antiquark distribution is observed in the region $x_2 \\ge 0.1$ . The data give tight constraints on models developed to explain nuclear medium effects in deep inelastic lepton scattering (EMC effect). Specifically, published models that have postulated a pion excess and 6-quark clusters are ruled out. The A-dependent behaviors on $X_F$ and $P_{\\tau}$ for $J/\\psi$ , $\\psi$' , and $\\upsilon$ production are also reported and compared with previous experiments. Substantial nuclear depletions are observed in both the $X_F$ and $P_{\\tau}$ dependence. These depletions increase with increasing $X_F$ , and decrease with increasing $P_{\\tau}$ .

  20. Modulation of phosducin-like protein 3 (PhLP3 levels promotes cytoskeletal remodelling in a MAPK and RhoA-dependent manner.

    Directory of Open Access Journals (Sweden)

    Nandini V L Hayes

    Full Text Available Phosducin-like protein 3 (PhLP3 forms a ternary complex with the ATP-dependent molecular chaperone CCT and its folding client tubulin. In vitro studies suggest PhLP3 plays an inhibitory role in β-tubulin folding while conversely in vivo genetic studies suggest PhLP3 is required for the correct folding of β-tubulin. We have a particular interest in the cytoskeleton, its chaperones and their role in determining cellular phenotypes associated with high level recombinant protein expression from mammalian cell expression systems.As studies into PhLP3 function have been largely carried out in non mammalian systems, we examined the effect of human PhLP3 over-expression and siRNA silencing using a single murine siRNA on both tubulin and actin systems in mammalian Chinese hamster ovary (CHO cell lines. We show that over-expression of PhLP3 promotes an imbalance of α and β tubulin subunits, microtubule disassembly and cell death. In contrast, β-actin levels are not obviously perturbed. On-the-other-hand, RNA silencing of PhLP3 increases RhoA-dependent actin filament formation and focal adhesion formation and promotes a dramatic elongated fibroblast-like change in morphology. This was accompanied by an increase in phosphorylated MAPK which has been associated with promoting focal adhesion assembly and maturation. Transient overexpression of PhLP3 in knockdown experiments rescues cells from the morphological change observed during PhLP3 silencing but mitosis is perturbed, probably reflecting a tipping back of the balance of PhLP3 levels towards the overexpression state.Our results support the hypothesis that PhLP3 is important for the maintenance of β-tubulin levels in mammalian cells but also that its modulation can promote actin-based cytoskeletal remodelling by a mechanism linked with MAPK phosphorylation and RhoA-dependent changes. PhLP3 levels in mammalian cells are thus finely poised and represents a novel target for engineering industrially

  1. The TAM-family receptor Mer mediates production of HGF through the RhoA-dependent pathway in response to apoptotic cells.

    Science.gov (United States)

    Park, Hyun-Jung; Baen, Ji-Yeon; Lee, Ye-Ji; Choi, Youn-Hee; Kang, Jihee Lee

    2012-08-01

    The TAM receptor protein tyrosine kinases Tyro3, Axl, and Mer play important roles in macrophage function. We investigated the roles of the TAM receptors in mediating the induction of hepatocyte growth factor (HGF) during the interaction of macrophages with apoptotic cells. Mer-specific neutralizing antibody, small interfering RNA (siRNA), and a recombinant Mer protein (Mer/Fc) inhibited HGF mRNA and protein expression, as well as activation of RhoA, Akt, and specific mitogen-activated protein (MAP) kinases in response to apoptotic cells. Inhibition of Axl or Tyro3 with specific antibodies, siRNA, or Fc-fusion proteins did not prevent apoptotic cell-induced HGF mRNA and protein expression and did not inhibit activation of the postreceptor signaling molecules RhoA and certain MAP kinases, including extracellular signal-regulated protein kinase and c-Jun NH(2)-terminal kinase. However, Axl- and Tyro3-specific blockers did inhibit the activation of Akt and p38 MAP kinase in response to apoptotic cells. In addition, none of the TAM receptors mediated the effects of apoptotic cells on transforming growth factor-β or epidermal growth factor mRNA expression. However, they were involved in the induction of vascular endothelial growth factor mRNA expression. Our data provide evidence that when macrophages interact with apoptotic cells, only Mer of the TAM-family receptors is responsible for mediating transcriptional HGF production through a RhoA-dependent pathway.

  2. CsrB, a noncoding regulatory RNA, is required for BarA-dependent expression of biocontrol traits in Rahnella aquatilis HX2.

    Science.gov (United States)

    Mei, Li; Xu, Sanger; Lu, Peng; Lin, Haiping; Guo, Yanbin; Wang, Yongjun

    2017-01-01

    Rahnella aquatilis is ubiquitous and its certain strains have the applicative potent as a plant growth-promoting rhizobacteria. R. aquatilis HX2 is a biocontrol agent to produce antibacterial substance (ABS) and showed efficient biocontrol against crown gall caused by Agrobacterium vitis on sunflower and grapevine plants. The regulatory network of the ABS production and biocontrol activity is still limited known. In this study, a transposon-mediated mutagenesis strategy was used to investigate the regulators that involved in the biocontrol activity of R. aquatilis HX2. A 366-nt noncoding RNA CsrB was identified in vitro and in vivo, which regulated ABS production and biocontrol activity against crown gall on sunflower plants, respectively. The predicted product of noncoding RNA CsrB contains 14 stem-loop structures and an additional ρ-independent terminator harpin, with 23 characteristic GGA motifs in the loops and other unpaired regions. CsrB is required for ABS production and biocontrol activity in the biocontrol regulation by a two-component regulatory system BarA/UvrY in R. aquatilis HX2. The noncoding RNA CsrB regulates BarA-dependent ABS production and biocontrol activity in R. aquatilis HX2. To the best of our knowledge, this is the first report of noncoding RNA as a regulator for biocontrol function in R. aquatilis.

  3. Antimicrobial medium- and long-chain free fatty acids prevent PrfA-dependent activation of virulence genes in Listeria monocytogenes.

    Science.gov (United States)

    Sternkopf Lillebæk, Eva Maria; Lambert Nielsen, Stine; Scheel Thomasen, Rikke; Færgeman, Nils J; Kallipolitis, Birgitte H

    The foodborne pathogen Listeria monocytogenes is the causative agent of the invasive disease listeriosis. Infection by L. monocytogenes involves bacterial crossing of the intestinal barrier and intracellular replication in a variety of host cells. The PrfA protein is the master regulator of virulence factors required for bacterial entry, intracellular replication and cell-to-cell spread. PrfA-dependent activation of virulence genes occurs primarily in the blood and during intracellular infection. In contrast, PrfA does not play a significant role in regulation of virulence gene expression in the intestinal environment. In the gastrointestinal phase of infection, the bacterium encounters a variety of antimicrobial agents, including medium- and long-chain free fatty acids that are commonly found in our diet and as active components of bile. Here we show that subinhibitory concentrations of specific antimicrobial free fatty acids act to downregulate transcription of PrfA-activated virulence genes. Interestingly, the inhibitory effect is also evident in cells encoding a constitutively active variant of PrfA. Collectively, our data suggest that antimicrobial medium- and long-chain free fatty acids may act as signals to prevent PrfA-mediated activation of virulence genes in environments where PrfA activation is not required, such as in food and the gastrointestinal tract. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  4. Lysophosphatidic acid inhibition of the accumulation of Pseudomonas aeruginosa PAO1 alginate, pyoverdin, elastase and LasA

    DEFF Research Database (Denmark)

    Laux, D.C.; Corson, J.M.; Givskov, Michael Christian

    2002-01-01

    . In the present study, a lysophospholipid, 1-paimitoyl-2-hydroxy-sn-glycero-3-phosphate [also called monopalmitoylphosphatidic acid (MPPA)], which accumulates in inflammatory exudates, was shown to inhibit the extracellular accumulation of P. aeruginosa PAO1 alginate, elastase, LasA protease and the siderophore...

  5. Brief Report: Interleukin-17A-Dependent Asymmetric Stem Cell Divisions Are Increased in Human Psoriasis: A Mechanism Underlying Benign Hyperproliferation.

    Science.gov (United States)

    Charruyer, Alexandra; Fong, Stephen; Vitcov, Giselle G; Sklar, Samuel; Tabernik, Leah; Taneja, Monica; Caputo, Melinda; Soeung, Catherine; Yue, Lili; Uchida, Yoshi; Arron, Sarah T; Horton, Karen M; Foster, Robert D; Sano, Shigetoshi; North, Jeffrey P; Ghadially, Ruby

    2017-08-01

    The balance between asymmetric and symmetric stem cell (SC) divisions is key to tissue homeostasis, and dysregulation of this balance has been shown in cancers. We hypothesized that the balance between asymmetric cell divisions (ACDs) and symmetric cell divisions (SCDs) would be dysregulated in the benign hyperproliferation of psoriasis. We found that, while SCDs were increased in squamous cell carcinoma (SCC) (human and murine), ACDs were increased in the benign hyperproliferation of psoriasis (human and murine). Furthermore, while sonic hedgehog (linked to human cancer) and pifithrinα (p53 inhibitor) promoted SCDs, interleukin (IL)-1α and amphiregulin (associated with benign epidermal hyperproliferation) promoted ACDs. While there was dysregulation of the ACD:SCD ratio, no change in SC frequency was detected in epidermis from psoriasis patients, or in human keratinocytes treated with IL-1α or amphiregulin. We investigated the mechanism whereby immune alterations of psoriasis result in ACDs. IL17 inhibitors are effective new therapies for psoriasis. We found that IL17A increased ACDs in human keratinocytes. Additionally, studies in the imiquimod-induced psoriasis-like mouse model revealed that ACDs in psoriasis are IL17A-dependent. In summary, our studies suggest an association between benign hyperproliferation and increased ACDs. This work begins to elucidate the mechanisms by which immune alteration can induce keratinocyte hyperproliferation. Altogether, this work affirms that a finely tuned balance of ACDs and SCDs is important and that manipulating this balance may constitute an effective treatment strategy for hyperproliferative diseases. Stem Cells 2017;35:2001-2007. © 2017 AlphaMed Press.

  6. A measurement of the A-dependence of the J/PSI cross section by comparing data on hydrogen and tungsten targets at 39.5 GeV/c

    International Nuclear Information System (INIS)

    Corden, M.J.; Dowell, J.D.; Garvey, J.; Homer, R.J.; Jobes, M.; Kenyon, I.R.; McMahon, T.J.; Owen, R.C.; Sumorok, K.C.T.; Vallance, R.J.

    1982-01-01

    J/PSI production on hydrogen and tungsten targets has been compared at 39.5 GeV/c and the variation of the A-dependence of the J/PSI cross section as a function of psub(t) 2 and xsub(F) has been measured. The A-dependence parameter, α, rises with increasing p 2 2 and falls with increasing xsub(F). Both effects are shown not to be due to the Fermi motion of nucleons in the tungsten nucleus. (orig.)

  7. A Influência da Confiança, Dependência e Comprometimento na Orientação de Longo Prazo de Varejistas para com os Fabricantes Líderes do Mercado de Bebidas

    Directory of Open Access Journals (Sweden)

    Ivan Lapuente Garrido

    2013-09-01

    Full Text Available O objetivo principal deste estudo é analisar como a confiança, o comprometimento e a dependência influenciam a orientação de longo prazo de varejistas para com o relacionamento com as empresas fabricantes de cervejas e refrigerantes líderes no mercado nacional. Para atingir o objetivo proposto, fizeram-se necessárias duas etapas de pesquisa. Na primeira etapa de cunho exploratório, foram realizadas entrevistas em profundidade com varejistas que possuíam relacionamento comercial com as empresas líderes do mercado nacional de cervejas e refrigerantes; esta etapa possibilitou aprofundamento sobre o campo de estudo e adequação de escalas aplicadas a segunda etapa de pesquisa. Na segunda etapa de pesquisa, por meio de questionário composto por questões fechadas, 299 varejistas avaliaram seu relacionamento com os fabricantes líderes de mercado. Utilizando-se de regressão múltipla, os resultados indicam que: (a a dependência dos varejistas influencia positivamente o comprometimento para com os fabricantes, (b a confiança influencia positivamente a orientação de longo prazo dos varejistas para com os fabricantes e, (c o comprometimento influencia positivamente a orientação de longo prazo dos varejistas para com os fabricantes. As hipóteses que consideravam a relação entre confiança e comprometimento e entre dependência e orientação de longo prazo não obtiveram significância estatística. DOI: 10.5585/remark.v12i3.2328

  8. The formation of a native-like structure containing eight conserved hydrophobic residues is rate limiting in two-state protein folding of ACBP

    DEFF Research Database (Denmark)

    Kragelund, Birthe Brandt; Osmark, Peter; Neergaard, Thomas B.

    1999-01-01

    The acyl-coenzyme A-binding proteins (ACBPs) contain 26 highly conserved sequence positions. The majority of these have been mutated in the bovine protein, and their influence on the rate of two-state folding and unfolding has been measured. The results identify eight sequence positions, out of 24...... probed, that are critical for fast productive folding. The residues are all hydrophobic and located in the interface between the N- and C-terminal helices. The results suggest that one specific site dominated by conserved hydrophobic residues forms the structure of the productive rate-determining folding...... step and that a sequential framework model can describe the protein folding reaction....

  9. [Progress in the study on mammalian diacylgycerol acyltransgerase (DGAT) gene and its biological function].

    Science.gov (United States)

    Wang, Yan; Xu, Heng-Yong; Zhu, Qing

    2007-10-01

    Diacylglycerol acyltransferase (DGAT; EC 2.3.1.20) is a microsomal enzyme that plays a central role in the metabolism of cellular glycerolipids. DGAT catalyzes the final step in triacylglycerol (TAG) biosynthesis by converting diacylgycerol (DAG) and fatty acyl-coenzyme A (CoA) into triacylglycero1. DGAT plays a fundamental role in the metabolism of cellular diacylglycerol and is important in higher eukaryotes for physiologic processes involving triacylglycerol metabolism such as intestinal fat absorption, lipoprotein assembly, adipose tissue formation, and lactation. Therefore, DGAT is not only an key factor for control triglycerides and fatty acids, but also may play a key modulatory role in animal fat deposition.

  10. [Progress in the study on diacylgycerol acyltransferase (DGAT)-related genes].

    Science.gov (United States)

    Ma, Hai-Ming; Shi, Qi-Shun; Liu, Xiao-Chun

    2005-12-01

    Diacylgycerol Acyltransferase (DGAT) plays an important role in the formation of lipid in different tissues of biological body. DGAT catalyzes the final step in triacylglycerol (TAG) biosynthesis by converting diacylgycerol (DAG) and fatty acyl-coenzyme A (CoA) into triacylglycerol. This enzyme is coded by both DGAT1 and DGAT2. DGAT1 belongs to the gene family of cholesterol acyltransferase (ACAT). DGAT2 belongs to the gene family of monoacylgycerol acyltransferases (MGAT1). This paper reviewed the structure, location on chromosome and biological effect of DGAT-related genes. The relationship between polymorphism and performance of animal was also discussed.

  11. Formation of hydrogen bonds precedes the rate-limiting formation of persistent structure in the folding of ACBP

    DEFF Research Database (Denmark)

    Teilum, K; Kragelund, B B; Knudsen, J

    2000-01-01

    A burst phase in the early folding of the four-helix two-state folder protein acyl-coenzyme A binding protein (ACBP) has been detected using quenched-flow in combination with site-specific NMR-detected hydrogen exchange. Several of the burst phase structures coincide with a structure consisting...... of eight conserved hydrophobic residues at the interface between the two N and C-terminal helices. Previous mutation studies have shown that the formation of this structure is rate limiting for the final folding of ACBP. The burst phase structures observed in ACBP are different from the previously reported...

  12. Detection of Serum Lysophosphatidic Acids Using Affinity Binding and Surface Enhanced Laser Deorption/Ionization (SELDI) Time of Flight Mass Spectrometry

    Science.gov (United States)

    2006-04-01

    proliferation, prevents apoptosis and anoikis, increases invasiveness, decreases sensitivity to cisplatin (the most effective drug in ovarian cancer...assay. The detection approach of cocrystalizing LPA and Zn is an improvement of the approach proposed in the application and has been implemented into...use of inhibitory drugs directed against LPA receptors and/or ATX/lysoPLD could be effective in suppressing tumour metastasis. O O O O O P O – O –O O

  13. Detection of Serum Lysophosphatidic Acids Using Affinity Binding and Surface Enhanced Laser Desorption/Ionization (SELDI) Time of Flight Mass Spectrometry

    Science.gov (United States)

    2005-04-01

    sensitivity to cisplatin (the most effective drug in ovarian cancer), and increases production and activity of multiple growth factors, proteases and...clinical grade assay. The detection approach of cocrystalizing LPA and Zn is an improvement of the approach proposed here and will be implemented in our...surface receptors for lysophospholipids belong to the G protein coupled receptor family. As over 40% of all drugs in current use target this family of

  14. Lysophosphatidic Acid and Apolipoprotein A1 Predict Increased Risk of Developing World Trade Center Lung Injury: A Nested Case-Control Study

    Science.gov (United States)

    Tsukiji, Jun; Cho, Soo Jung; Echevarria, Ghislaine C.; Kwon, Sophia; Joseph, Phillip; Schenck, Edward J.; Naveed, Bushra; Prezant, David J.; Rom, William N.; Schmidt, Ann Marie; Weiden, Michael D.; Nolan, Anna

    2014-01-01

    Rationale Metabolic syndrome, inflammatory and vascular injury markers measured in serum after WTC exposures predict abnormal FEV1. We hypothesized that elevated LPA levels predict FEV1

  15. The Effect of Lysophosphatidic Acid during In Vitro Maturation of Bovine Oocytes: Embryonic Development and mRNA Abundances of Genes Involved in Apoptosis and Oocyte Competence

    Directory of Open Access Journals (Sweden)

    Dorota Boruszewska

    2014-01-01

    Full Text Available In the present study we examined whether LPA can be synthesized and act during in vitro maturation of bovine cumulus oocyte complexes (COCs. We found transcription of genes coding for enzymes of LPA synthesis pathway (ATX and PLA2 and of LPA receptors (LPAR 1–4 in bovine oocytes and cumulus cells, following in vitro maturation. COCs were matured in vitro in presence or absence of LPA (10−5 M for 24 h. Supplementation of maturation medium with LPA increased mRNA abundance of FST and GDF9 in oocytes and decreased mRNA abundance of CTSs in cumulus cells. Additionally, oocytes stimulated with LPA had higher transcription levels of BCL2 and lower transcription levels of BAX resulting in the significantly lower BAX/BCL2 ratio. Blastocyst rates on day 7 were similar in the control and the LPA-stimulated COCs. Our study demonstrates for the first time that bovine COCs are a potential source and target of LPA action. We postulate that LPA exerts an autocrine and/or paracrine signaling, through several LPARs, between the oocyte and cumulus cells. LPA supplementation of maturation medium improves COC quality, and although this was not translated into an enhanced in vitro development until the blastocyst stage, improved oocyte competence may be relevant for subsequent in vivo survival.

  16. Dual Action of Lysophosphatidate-Functionalised Titanium: Interactions with Human (MG63) Osteoblasts and Methicillin Resistant Staphylococcus aureus

    DEFF Research Database (Denmark)

    Skindersø, Mette Elena; Krogfelt, Karen Angeliki; Blom, Ashley

    2015-01-01

    Titanium (Ti) is a widely used material for surgical implants; total joint replacements (TJRs), screws and plates for fixing bones and dental implants are forged from Ti. Whilst Ti integrates well into host tissue approximately 10% of TJRs will fail in the lifetime of the patient through a process...... known as aseptic loosening. These failures necessitate revision arthroplasties which are more complicated and costly than the initial procedure. Finding ways of enhancing early (osseo)integration of TJRs is therefore highly desirable and continues to represent a research priority in current biomaterial...

  17. Lysophosphatidic Acid Acyltransferase from Coconut Endosperm Mediates the Insertion of Laurate at the sn-2 Position of Triacylglycerols in Lauric Rapeseed Oil and Can Increase Total Laurate Levels

    Science.gov (United States)

    Knutzon, Deborah S.; Hayes, Thomas R.; Wyrick, Annette; Xiong, Hui; Maelor Davies, H.; Voelker, Toni A.

    1999-01-01

    Expression of a California bay laurel (Umbellularia californica) 12:0-acyl-carrier protein thioesterase, bay thioesterase (BTE), in developing seeds of oilseed rape (Brassica napus) led to the production of oils containing up to 50% laurate. In these BTE oils, laurate is found almost exclusively at the sn-1 and sn-3 positions of the triacylglycerols (T.A. Voelker, T.R. Hayes, A.C. Cranmer, H.M. Davies [1996] Plant J 9: 229–241). Coexpression of a coconut (Cocos nucifera) 12:0-coenzyme A-preferring lysophosphatitic acid acyltransferase (D.S. Knutzon, K.D. Lardizabal, J.S. Nelsen, J.L. Bleibaum, H.M. Davies, J.G. Metz [1995] Plant Physiol 109: 999–1006) in BTE oilseed rape seeds facilitates efficient laurate deposition at the sn-2 position, resulting in the acccumulation of trilaurin. The introduction of the coconut protein into BTE oilseed rape lines with laurate above 50 mol % further increases total laurate levels. PMID:10398708

  18. [Rhabdomyolysis - may it be a metabolic myopathy? Case report and diagnostic algorithm].

    Science.gov (United States)

    Sebők, Ágnes; Pál, Endre; Molnár, Gergő Attila; Wittmann, István; Berenténé Bene, Judit; Melegh, Béla; Komoly, Sámuel; Hidvégi, Tibor; Balogh, Lídia; Szabó, Attila; Zsidegh, Petra

    2017-11-01

    We report the case of a 46-year-old female patient with recurrent rhabdomyolysis. In the background of her metabolic myopathy an inherited metabolic disorder of the fatty acid oxidation, very long-chain acyl-coenzyme A-dehydrogenase deficiency was diagnosed. The diagnosis was based on abnormal acyl-carnitine- and urine organic-acid profile in addition to low residual enzyme activity, and was confirmed by genetic testing. After introduction of dietotherapy metabolic crisis necessitating hospital admission has not occurred neither have fixed myopathic changes developed. We present here the differential diagnosis of rhabdomyolysis and exertional muscle complaints, with the metabolic myopathies in focus. The main features of fatty acid oxidation disorders are highlighted, acute and chronic managements of very long-chain acyl-coenzyme A-dehydrogenase deficiency are discussed. Metabolic myopathies respond well to treatment, so good quality of life can be achieved. However, especially in fatty acid oxidation disorders, a metabolic crisis may develop quickly and can be fatal, albeit rarely. Some of these disorders can be identified by newborn screening, but occasionally the symptoms may manifest only in adulthood. With the presentation of this case we would like to point out that in the differential diagnosis of recurrent rhabdomyolysis inherited metabolic disorders should be considered regardless of the patient's age. Orv Hetil. 2017; 158(46): 1873-1882.

  19. Characterization of the mycobacterial acyl-CoA carboxylase holo complexes reveals their functional expansion into amino acid catabolism.

    Directory of Open Access Journals (Sweden)

    Matthias T Ehebauer

    2015-02-01

    Full Text Available Biotin-mediated carboxylation of short-chain fatty acid coenzyme A esters is a key step in lipid biosynthesis that is carried out by multienzyme complexes to extend fatty acids by one methylene group. Pathogenic mycobacteria have an unusually high redundancy of carboxyltransferase genes and biotin carboxylase genes, creating multiple combinations of protein/protein complexes of unknown overall composition and functional readout. By combining pull-down assays with mass spectrometry, we identified nine binary protein/protein interactions and four validated holo acyl-coenzyme A carboxylase complexes. We investigated one of these--the AccD1-AccA1 complex from Mycobacterium tuberculosis with hitherto unknown physiological function. Using genetics, metabolomics and biochemistry we found that this complex is involved in branched amino-acid catabolism with methylcrotonyl coenzyme A as the substrate. We then determined its overall architecture by electron microscopy and found it to be a four-layered dodecameric arrangement that matches the overall dimensions of a distantly related methylcrotonyl coenzyme A holo complex. Our data argue in favor of distinct structural requirements for biotin-mediated γ-carboxylation of α-β unsaturated acid esters and will advance the categorization of acyl-coenzyme A carboxylase complexes. Knowledge about the underlying structural/functional relationships will be crucial to make the target category amenable for future biomedical applications.

  20. Origin of estradiol fatty acid esters in human ovarian follicular fluid.

    Science.gov (United States)

    Pahuja, S L; Kim, A H; Lee, G; Hochberg, R B

    1995-03-01

    The estradiol fatty acid esters are the most potent of the naturally occurring steroidal estrogens. These esters are present predominantly in fat, where they are sequestered until they are hydrolyzed by esterases. Thus they act as a preformed reservoir of estradiol. We have previously shown that ovarian follicular fluid from patients undergoing gonadotropin stimulation contains very high amounts of estradiol fatty acid esters (approximately 10(-7) M). The source of these esters is unknown. They can be formed by esterification of estradiol in the follicular fluid by lecithin:cholesterol acyltransferase (LCAT), or in the ovary by an acyl coenzyme A:acyltransferase. In order to determine which of these enzymatic processes is the source of the estradiol esters in the follicular fluid, we incubated [3H]estradiol with follicular fluid and cells isolated from human ovarian follicular fluid and characterized the fatty acid composition of the [3H]estradiol esters biosynthesized in each. In addition, we characterized the endogenous estradiol fatty acid esters in the follicular fluid and compared them to the biosynthetic esters. The fatty acid composition of the endogenous esters was different than those synthesized by the cellular acyl coenzyme A:acyltransferase, and the same as the esters synthesized by LCAT, demonstrating that the esters are produced in situ in the follicular fluid. Although the role of these estradiol esters in the ovary is not known, given their remarkable estrogenic potency it is highly probable that they have an important physiological role.

  1. The nicotine dependence associated with alcohol use and other psychoactive substance A dependência da nicotina associada ao uso de álcool e outras substâncias psicoativas

    Directory of Open Access Journals (Sweden)

    Rafaela Serra Bacchi

    2008-10-01

    Full Text Available To examine an association between nicotine dependence with alcohol, other psychoactive use, and depressive disorder. Smokers were recruited from Centro de Referência de Abordagem e Tratamento do Tabagismo at the Hospital das Clínicas da Universidade Estadual de Londrina (AHC/ UEL. All subjects were informed and gave then written consent for the research as approved by the Ethics Research Committee of Universidade Estadual de Londrina. The measures used were: structured questionnaire, alcohol, smoking, and psychoactive substance involvement screening test (ASSIST v 3.0, the Fagerström test for Nicotine Dependence (FTND, and the Diagnostic Interview for Research on Depressive disorder of the World Health Organization. Smokers presented the following socio-demographic characteristics: prevalence of the female sex and mean age of 47 years old with capacity for domestic activities and work. The mean age of onset of cigarette use for smokers was 16 years old. Fagerström’s test presented a medium punctuation of 6, so much for users of substances psicoativas, as for the ones that they don’t use them. Relationship between serious depression and the of psychoactive substances use was relevant for the research. This study evidenced an association among the use of the tobacco and other psychoactive substances, and depressive disorder. The health professional in smoking cessation intervention would be to identify subgroups of adult smokers, associated with depression, psychoactive substance use, and promote an intervention in both comorbidities and larger effectiveness of the smoking cessation. Analisar a associação entre a dependência de nicotina com o uso de álcool, outras substâncias psicoativas e transtorno depressivo. Os tabagistas foram recrutados a partir do Centro de Referência de Abordagem e Tratamento do Tabagismo no Hospital de Clínicas da Universidade Estadual de Londrina (AHC/UEL. Todos os participantes foram informados e

  2. Keep Net Working - On a Dependable and Fast Networking Stack

    NARCIS (Netherlands)

    Hruby, T.; Vogt, D.; Bos, H.J.; Tanenbaum, A.S.

    2012-01-01

    For many years, multiserver 1 operating systems have been demonstrating, by their design, high dependability and reliability. However, the design has inherent performance implications which were not easy to overcome. Until now the context switching and kernel involvement in the message passing was

  3. A-dependence study of inclusive phi production

    International Nuclear Information System (INIS)

    Daum, C.; Rijk, G. de; Dijkstra, H.; Hardwick, C.; Hoogland, W.; Tiecke, H.; Wiggers, L.; Boehringer, T.; Bosman, M.; Chabaud, V.; Hyams, B.; Koetz, U.; Weilhammer, P.; Rozanska, M.; Rybicki, K.; Turala, M.; Belau, E.; Hajduk, Z.; Klanner, R.; Luetjens, G.; Lutz, G.; Maenner, W.; Neugebauer, E.; Seebrunner, H.; Stierlin, U.; Waltermann, G.; Wylie, A.; Zeludziewicz, T.; Bailey, R.; Damerell, C.; Gill, S.; Gillman, A.; Watts, S.; Wickens, F.

    1983-10-01

    The mass-number dependence of the inclusive phi-meson cross section is measured using two target materials, beryllium and tantalum, in the kinematic range 0 2 . Parametrizing the cross section with sigma(A) + and p-beams respectively. (Auth.)

  4. How a dependent's variable non-randomness affects taper equation ...

    African Journals Online (AJOL)

    In order to apply the least squares method in regression analysis, the values of the dependent variable Y should be random. In an example of regression analysis linear and nonlinear taper equations, which estimate the diameter of the tree dhi at any height of the tree hi, were compared. For each tree the diameter at the ...

  5. Developing a dependable approach for evaluating waste treatment data

    International Nuclear Information System (INIS)

    Gering, K.L.

    1997-01-01

    Decision makers involved with hazardous waste treatment issues are faced with the challenge of making objective evaluations concerning treatment formulations. This work utilizes an effectiveness factor (denoted as η) as the basis for waste treatment evaluations, which was recently developed for application to mixed waste treatability studies involving solidification and stabilization at the Idaho National Engineering and Environmental Laboratory. The effectiveness factor incorporates an arbitrary treatment criterion Φ, which in practice could be the Toxicity Characteristic Leaching Procedure, Unconfined Compressive Strength, Leachability Index, or any other criterion used to judge treatment performance. Three values for Φ are utilized when assessing a given treatment formulation: before treatment, after treatment, and a reference value (typically a treatment standard). The expression for η also incorporates the waste loading as the prime experimental parameter, and accounts for the contribution that each hazard has upon the overall treatment performance. Also discussed are general guidelines for numerical boundaries and statistical interpretations of treatment data. Case studies are presented that demonstrate the usefulness of the effectiveness factor and related numerical methods, where the typical hazards encountered are toxic metals within mixed waste

  6. A-dependence for the charmed meson production

    International Nuclear Information System (INIS)

    Alves, Gilvan Augusto.

    1992-03-01

    A report is presented of a recent direct measurement of the nucleon number (λ) dependence of the production cross sections for the charmed mesons D 0 and D + using π +- beams incident on a segmented target of Be, Al, Cu and W. The data derive from the experiment E769 - Hadroproduction of Charm - at Fermilab. The experimental apparatus is described together with the following analysis. Starting from a sample of ∼ 1500 D mesons in the range of O F A = σ O A α , with α = 0.99 ± 0.03. The X F dependence of α is examined and the results obtained are compared with those of other experiments and with theoretical expectations based on perturbative QCD and on an EMC like model of nuclear shadowing. (author). 85 refs, 61 figs, 22 tabs

  7. Care plan for the patient with a dependent personality disorder

    Directory of Open Access Journals (Sweden)

    Ana María Ruiz Galán

    2010-11-01

    Full Text Available Personality is unique for each individual and can be defined as the dynamic collection of characteristics relative to emotions, thought and behaviour.Personality trout’s only mean a Personality Disorder (PD when they are inflexible and maladjusted and cause notable functional deterioration or uneasiness.According to Bermudez personality is “the enduring organization of structural and functional features, innate and acquired under the special conditions of each one’s development that shape the particular and specific collection of behaviour to face different situations”.According to the Diagnostic a Statistical Manual of Mental Disorders (DSM-IV, a Personality Disorder is “an enduring pattern of inner experience and behavior that deviates markedly from the expectations of the person’s culture is pervasive and an inflexible, is stable over time and leads to distress or impairment. The onset of these patterns of behaviour is the beginning of the adulthood and, in rare instances, early adolescence”.There are several types of Personality Disorders (paranoid, schizoid, borderline, antisocial, dependent…. Dependent Personality Disorder is one of the most frequent in the Mental Health Services.People who suffer from this disorder are unable to take a decision by themselves because they don’t have confidence in themselves. They need a lot of social support and affection until the point of deny their individuality by subordinating their desires to other person’s desires and permitting these persons to manage their lives. Maybe they feel desolated by separation and loss and can support any situation, even maltreatment to keep a relationship.As we a deduce this diagnosis is sensible to cultural influences. This work aims to elaborate an standarized plan of cares for the patient with Dependent Personality Disorder by using nursing Diagnosis of NANDA II, Outcomes Criteria (NOC and Interventions Criteria (NIC.

  8. A dependence modelling study of extreme rainfall in Madeira Island

    Science.gov (United States)

    Gouveia-Reis, Délia; Guerreiro Lopes, Luiz; Mendonça, Sandra

    2016-08-01

    The dependence between variables plays a central role in multivariate extremes. In this paper, spatial dependence of Madeira Island's rainfall data is addressed within an extreme value copula approach through an analysis of maximum annual data. The impact of altitude, slope orientation, distance between rain gauge stations and distance from the stations to the sea are investigated for two different periods of time. The results obtained highlight the influence of the island's complex topography on the spatial distribution of extreme rainfall in Madeira Island.

  9. Annotation of the Evaluative Language in a Dependency Treebank

    Directory of Open Access Journals (Sweden)

    Šindlerová Jana

    2017-12-01

    Full Text Available In the paper, we present our efforts to annotate evaluative language in the Prague Dependency Treebank 2.0. The project is a follow-up of the series of annotations of small plaintext corpora. It uses automatic identification of potentially evaluative nodes through mapping a Czech subjectivity lexicon to syntactically annotated data. These nodes are then manually checked by an annotator and either dismissed as standing in a non-evaluative context, or confirmed as evaluative. In the latter case, information about the polarity orientation, the source and target of evaluation is added by the annotator. The annotations unveiled several advantages and disadvantages of the chosen framework. The advantages involve more structured and easy-to-handle environment for the annotator, visibility of syntactic patterning of the evaluative state, effective solving of discontinuous structures or a new perspective on the influence of good/bad news. The disadvantages include little capability of treating cases with evaluation spread among more syntactically connected nodes at once, little capability of treating metaphorical expressions, or disregarding the effects of negation and intensification in the current scheme.

  10. Commelinid Monocotyledon Lignins Are Acylated by p-Coumarate1[OPEN

    Science.gov (United States)

    Free, Heather C.A.; Smith, Bronwen G.

    2018-01-01

    Commelinid monocotyledons are a monophyletic clade differentiated from other monocotyledons by the presence of cell wall-bound ferulate and p-coumarate. The Poaceae, or grass family, is a member of this group, and most of the p-coumarate in the cell walls of this family acylates lignin. Here, we isolated and examined lignified cell wall preparations from 10 species of commelinid monocotyledons from nine families other than Poaceae, including species from all four commelinid monocotyledon orders (Poales, Zingiberales, Commelinales, and Arecales). We showed that, as in the Poaceae, lignin-linked p-coumarate occurs exclusively on the hydroxyl group on the γ-carbon of lignin unit side chains, mostly on syringyl units. Although the mechanism of acylation has not been studied directly in these species, it is likely to be similar to that in the Poaceae and involve BAHD acyl-coenzyme A:monolignol transferases. PMID:29724771

  11. 常用英文缩略语名词解释

    Institute of Scientific and Technical Information of China (English)

    2015-01-01

    AMD:年龄相关性黄斑变性(age—related macular degeneration)DR:糖尿病视网膜病变(diabetic retinopathy)OIR:氧诱导视网膜病变(oxygen—induced retinopathy)Nrf2:核因子E2相关因子2(nuclear factor—E2-related factor 2)ARE:抗氧化反应元件(antioxidant response element)Hrd1:羟甲基戊二酰辅酶A还原酶降解蛋白1(hydroxymethyl glutaric acyl coenzyme A reductase degradation protein 1)。

  12. Clinical and biochemical monitoring of patients with fatty acid oxidation disorders

    DEFF Research Database (Denmark)

    Lund, Allan Meldgaard; Skovby, Flemming; Vestergaard, Helle

    2010-01-01

    complicated assessments by a neuropsychologist, speech therapist, or physical and occupational therapists. Paraclinical measurements are not used for short-chain and medium-chain disorders; electrocardiography (including 24 h monitoring) and echocardiography are done for most patients with long......Evidence-based guidelines for monitoring patients with disorders in fatty acid oxidation (FAO) are lacking, and most protocols are based on expert statements. Here, we describe our protocol for Danish patients. Clinical monitoring is the most important measure and has the main aims of checking...... carnitine is measured to monitor carnitine supplementation in patients with multiple acyl-coenzyme A dehydrogenase deficiency (MADD) and carnitine transporter deficiency (CTD) and to follow metabolic control and disclose deficiency states in other FAO disorders. We are evaluating long-chain acylcarnitines...

  13. Green tea extract suppresses adiposity and affects the expression of lipid metabolism genes in diet-induced obese zebrafish

    Directory of Open Access Journals (Sweden)

    Hasumura Takahiro

    2012-08-01

    Full Text Available Abstract Background Visceral fat accumulation is one of the most important predictors of mortality in obese populations. Administration of green tea extract (GTE can reduce body fat and reduce the risk of obesity-related diseases in mammals. In this study, we investigated the effects and mechanisms of GTE on adiposity in diet-induced obese (DIO zebrafish. Methods Zebrafish at 3.5 to 4.5 months post-fertilization were allocated to four groups: non-DIO, DIO, DIO + 0.0025%GTE, and DIO + 0.0050%GTE. The non-DIO group was fed freshly hatched Artemia once daily (5 mg cysts/fish daily for 40 days. Zebrafish in the three DIO groups were fed freshly hatched Artemia three times daily (60 mg cysts/fish daily. Zebrafish in the DIO + 0.0025%GTE and DIO + 0.0050%GTE groups were exposed to GTE after the start of feeding three times daily for 40 days. Results Three-dimensional microcomputed tomography analysis showed that GTE exposure significantly decreased the volume of visceral but not subcutaneous fat tissue in DIO zebrafish. GTE exposure increased hepatic expression of the lipid catabolism genes ACOX1 (acyl-coenzyme A oxidase 1, palmitoyl, ACADM (acyl-coenzyme A dehydrogenase, c-4 to c-12 straight chain, and PPARA (peroxisome proliferator-activated receptor alpha. GTE exposure also significantly decreased the visceral fat expression of SOCS3 (suppressor of cytokine signaling 3b which inhibits leptin signaling. Conclusions The present results are consistent with those seen in mammals treated with GTE, supporting the validity of studying the effects of GTE in DIO zebrafish. Our results suggest that GTE exerts beneficial effects on adiposity, possibly by altering the expression of lipid catabolism genes and SOCS3.

  14. Effects of gintonin on the proliferation, migration, and tube formation of human umbilical-vein endothelial cells: involvement of lysophosphatidic-acid receptors and vascular-endothelial-growth-factor signaling

    Directory of Open Access Journals (Sweden)

    Sung-Hee Hwang

    2016-10-01

    Conclusion: The gintonin-mediated proliferation, migration, and vascular-endothelial-growth-factor release in HUVECs via LPA-receptor activation may be one of in vitro mechanisms underlying ginseng-induced angiogenic and wound-healing effects.

  15. Mass Spectrometry Analysis of Wild-Type and Knock-in Q140/Q140 Huntington's Disease Mouse Brains Reveals Changes in Glycerophospholipids Including Alterations in Phosphatidic Acid and Lyso-Phosphatidic Acid.

    Science.gov (United States)

    Vodicka, Petr; Mo, Shunyan; Tousley, Adelaide; Green, Karin M; Sapp, Ellen; Iuliano, Maria; Sadri-Vakili, Ghazaleh; Shaffer, Scott A; Aronin, Neil; DiFiglia, Marian; Kegel-Gleason, Kimberly B

    2015-01-01

    Huntington's disease (HD) is a neurodegenerative disease caused by a CAG expansion in the HD gene, which encodes the protein Huntingtin. Huntingtin associates with membranes and can interact directly with glycerophospholipids in membranes. We analyzed glycerophospholipid profiles from brains of 11 month old wild-type (WT) and Q140/Q140 HD knock-in mice to assess potential changes in glycerophospholipid metabolism. Polar lipids from cerebellum, cortex, and striatum were extracted and analyzed by liquid chromatography and negative ion electrospray tandem mass spectrometry analysis (LC-MS/MS). Gene products involved in polar lipid metabolism were studied using western blotting, immuno-electron microscopy and qPCR. Significant changes in numerous species of glycerophosphate (phosphatidic acid, PA) were found in striatum, cerebellum and cortex from Q140/Q140 HD mice compared to WT mice at 11 months. Changes in specific species could also be detected for other glycerophospholipids. Increases in species of lyso-PA (LPA) were measured in striatum of Q140/Q140 HD mice compared to WT. Protein levels for c-terminal binding protein 1 (CtBP1), a regulator of PA biosynthesis, were reduced in striatal synaptosomes from HD mice compared to wild-type at 6 and 12 months. Immunoreactivity for CtBP1 was detected on membranes of synaptic vesicles in striatal axon terminals in the globus pallidus. These novel results identify a potential site of molecular pathology caused by mutant Huntingtin that may impart early changes in HD.

  16. Cloning and characterization of an acyl-CoA-dependent diacylglycerol acyltransferase 1 (DGAT1) gene from Tropaeolum majus, and a study of the functional motifs of the DGAT protein using site-directed mutagenesis to modify enzyme activity and oil content.

    Science.gov (United States)

    Xu, Jingyu; Francis, Tammy; Mietkiewska, Elzbieta; Giblin, E Michael; Barton, Dennis L; Zhang, Yan; Zhang, Meng; Taylor, David C

    2008-10-01

    A full-length cDNA encoding a putative diacylglycerol acyltransferase 1 (DGAT1, EC 2.3.1.20) was obtained from Tropaeolum majus (garden nasturtium). The 1557-bp open reading frame of this cDNA, designated TmDGAT1, encodes a protein of 518 amino acids showing high homology to other plant DGAT1s. The TmDGAT1 gene was expressed exclusively in developing seeds. Expression of recombinant TmDGAT1 in the yeast H1246MATalpha quadruple mutant (DGA1, LRO1, ARE1, ARE2) restored the capability of the mutant host to produce triacylglycerols (TAGs). The recombinant TmDGAT1 protein was capable of utilizing a range of (14)C-labelled fatty acyl-CoA donors and diacylglycerol acceptors, and could synthesize (14)C-trierucin. Collectively, these findings confirm that the TmDGAT1 gene encodes an acyl-CoA-dependent DGAT1. In plant transformation studies, seed-specific expression of TmDGAT1 was able to complement the low TAG/unusual fatty acid phenotype of the Arabidopsis AS11 (DGAT1) mutant. Over-expression of TmDGAT1 in wild-type Arabidopsis and high-erucic-acid rapeseed (HEAR) and canola Brassica napus resulted in an increase in oil content (3.5%-10% on a dry weight basis, or a net increase of 11%-30%). Site-directed mutagenesis was conducted on six putative functional regions/motifs of the TmDGAT1 enzyme. Mutagenesis of a serine residue in a putative SnRK1 target site resulted in a 38%-80% increase in DGAT1 activity, and over-expression of the mutated TmDGAT1 in Arabidopsis resulted in a 20%-50% increase in oil content on a per seed basis. Thus, alteration of this putative serine/threonine protein kinase site can be exploited to enhance DGAT1 activity, and expression of mutated DGAT1 can be used to enhance oil content.

  17. Famílias com um idoso dependente: avaliação da coesão e adaptação Las familias con un adulto mayor dependiente: evaluación de la cohesión y de la adaptación Families with a dependent elderly member: assessment of adaptation and cohesion

    Directory of Open Access Journals (Sweden)

    Isabel Araújo

    2012-03-01

    final del desarrollo del ciclo vital. Se les consideraron familias cohesivas y adaptadas aunque idealizan una mayor cohesión y adaptación.The aim of this study was to describe the typological profile and developmental stage of families that take care of an elderly dependent person; to identify the degree of dependency of the elderly person in the family context; and to evaluate cohesion and adaptation in families with a dependent elder. Methodologically, the study is positioned in the quantitative paradigm, and is a descriptive exploratory study. We administered a questionnaire, which included FACES III and the Barthel Index, to a group of families registered at health centers or family health clinics in a district in the North of Portugal. We chose a purposive sample of 108 families with an elderly dependent member. Data collection occurred from October 2007 to June 2008. From data analysis, we verified that families that include an elderly person at a high level of dependence are nuclear families and are in the final phase of development of the life cycle. They consider themselves cohesive and adapted families but ideally would like more cohesion and adaptation.

  18. On the A-dependence of the Okamoto-Nolen-Schiffer anomaly

    International Nuclear Information System (INIS)

    Shen Hong; Ning Pingzhi; Cai Chonghai; Wang Hongyu

    1996-01-01

    A new version of the in-medium quark condensate is applied to study the Okamoto-Nolen-Schiffer anomaly. The results show that the theoretical mass difference of mirror nuclei due to the neutron-proton mass difference have the right magnitude needed to explain this anomaly, and vary slowly with nuclear mass number A

  19. LuxS impacts on LytA-dependent autolysis and on competence in Streptococcus pneumoniae.

    Science.gov (United States)

    Romao, Susana; Memmi, Guido; Oggioni, Marco R; Trombe, Marie-Claude

    2006-02-01

    The ubiquitous protein LuxS with S-ribosylhomocysteinase activity is involved in S-adenosyl methionine detoxification, C-1 unit recycling and the production of autoinducers that allow the cell to sense and respond to cell density. Independent reports describe the impact of LuxS deficiency on Streptococcus pneumoniae virulence in the mouse. In vitro, LuxS deficiency confers discrete phenotypes. A combined approach using genetic dissection and mixed-culture experiments allowed the involvement of LuxS in the developmental physiology of S. pneumoniae to be investigated. Functional LuxS was found to be related on the one hand to down-regulation of competence, and on the other hand to attenuation of autolysis in cultures entering stationary phase. The competence phenotype of luxS mutant bacteria was complemented by media conditioned by competence-defective ComAB0 bacteria, but not by BSA. The autolytic phenotype was complemented by BSA, but not by conditioned supernatants. It is suggested that the impact of LuxS on competence, but not on autolysis, involves cell-cell communication. The phenotype of luxS mutant strains reveals a hierarchy in the competence regulatory networks of S. pneumoniae.

  20. Adoption and Business Value of Mobile Retail Channel: A Dependency Perspective on Mobile Commerce

    Science.gov (United States)

    Chou, Yen-Chun

    2013-01-01

    Forrest Research estimated that revenues derived from mobile devices will grow at an annual rate of 39% to reach $31 billion by 2016. With the tremendous market growth, mobile banking, mobile marketing, and mobile retailing have been recently introduced to satisfy customer needs. Academic and practical articles have widely discussed unique…

  1. Comorbidade com a dependência de substâncias nos subtipos da fobia social

    OpenAIRE

    D’El Rey, Gustavo J. Fonseca; Pacini, Carla Alessandra

    2008-01-01

    Estudos epidemiológicos têm identifi cado 2 subtipos de fobia social: a fobia social relacionada somente com ofalar, que é caracterizada pelo temor das situações de falar em público, e a fobia social generalizada, que é caracterizada pelotemor de diversas situações sociais. A fobia social de falar em público corresponde na DSM-IV à fobia social circunscrita,enquanto o outro subtipo corresponde à fobia social ge...

  2. A dependence of exclusive vector meson production in muon-nucleus scattering

    International Nuclear Information System (INIS)

    Fang, Guang Yin

    1993-10-01

    Preliminary results on the cross section ratios of exclusive ρ 0 and φ meson production off carbon, calcium, and lead to that off deuterium in deep-inelastic muon-nucleon scattering are reported. The data were taken with the E665 spectrometer using the Fermilab Tevatron muon beam. The mean beam energy was 470 GeV. Significant increase in the cross section ratios is seen as the four-momentum squared of the virtual photon increases. The results support the idea of color transparency

  3. On the A-dependence of σL/σT: Skeletons in the shadow

    International Nuclear Information System (INIS)

    Milana, J.

    1994-01-01

    A most counter-intuitive dependence in the differential cross-section in the shadowing regime is shown to result from a higher-twist nuclear enhancement in R = σ L /σ T which severely complicates the unravelling from present data the corresponding dependence in Q 2 of the nuclear structure functions, F 2 A (x,Q 2 ). Indeed, until precision measurements close this loophole, the extrapolations of the structure functions to either higher Q 2 or other processes (as is necessary to address present data at FNAL or future experiments at RHIC) must be considered problematic. The contribution CEBAF can make in this regard by providing systematic determination of R A (x, Q 2 ) is thus emphasized. The purpose of this talk is to motivate an experiment CEBAF can and should do, especially if upgraded to higher energies. While providing information on nuclear structure that is interesting in itself, the added motivation is that precision results will have important impact on other high-energy experiments involving nuclear targets that have been, and will continue to be done all over the world

  4. A dependability modeling of software under memory faults for digital system in nuclear power plants

    International Nuclear Information System (INIS)

    Choi, J. G.; Seong, P. H.

    1997-01-01

    In this work, an analytic approach to the dependability of software in the operational phase is suggested with special attention to the hardware fault effects on the software behavior : The hardware faults considered are memory faults and the dependability measure in question is the reliability. The model is based on the simple reliability theory and the graph theory which represents the software with graph composed of nodes and arcs. Through proper transformation, the graph can be reduced to a simple two-node graph and the software reliability is derived from this graph. Using this model, we predict the reliability of an application software in the digital system (ILS) in the nuclear power plant and show the sensitivity of the software reliability to the major physical parameters which affect the software failure in the normal operation phase. We also found that the effects of the hardware faults on the software failure should be considered for predicting the software dependability accurately in operation phase, especially for the software which is executed frequently. This modeling method is particularly attractive for the medium size programs such as the microprocessor-based nuclear safety logic program. (author)

  5. Choice as a dependent measure in autoshaping: sensitivity to frequency and duration of food presentation.

    Science.gov (United States)

    Picker, M; Poling, A

    1982-01-01

    Previous investigations have shown that rate, latency, and percentage of trials with at least one response are somewhat insensitive measures of the strength of autoshaped responding. In the present studies, these measures were contrasted with the allocation of responding during simultaneous choice tests, a measure of response strength frequently used in operant paradigms. In two experiments, nine pigeons were exposed to a forward pairing autoshaping procedure. Training sessions consisted of the successive presentation of three stimuli, each followed by food on either 100%, 50%, or 0% of the trials. Choice testing involved the simultaneous presentation of the three stimuli. In Experiment I, all pigeons consistently directed their initial choice responses and the majority of subsequent responses to the stimulus always followed by food, despite the fact that during training sessions the response rates of most birds were highest in the presence of the stimulus followed by food on 50% of the trials. In Experiment II, rate, latency, and percentage of trials with at least one response did not change appreciably as a function of duration of feeder presentations. However, choice responding was lawfully affected by duration of feeder presentations. These data suggest that choice is perhaps a more sensitive measure of the strength of autoshaped responding than other, more commonly employed, indices. PMID:7097152

  6. Disruption of actin filaments in Zea mays by bisphenol A depends on their crosstalk with microtubules.

    Science.gov (United States)

    Stavropoulou, Konstantina; Adamakis, Ioannis-Dimosthenis S; Panteris, Emmanuel; Arseni, Ermioni-Makedonia; Eleftheriou, Eleftherios P

    2018-03-01

    Bisphenol A (BPA) is a widespread environmental pollutant, reportedly harmful to living organisms. In plant cells, BPA was shown to disrupt microtubule (MT) arrays and perturb mitosis, but its effects on filamentous actin (F-actin) have not been explored. Here we studied the effects of BPA on actin filaments (AFs) in meristematic root tip and leaf cells of Zea mays, by fluorescent labeling and confocal microscopy. Considering the typical dynamic interaction between MTs and AFs, the effects on these two essential components of the plant cytoskeleton were correlated. It was found that BPA disorganized rapidly AFs in a concentration- and time-dependent manner. The fine filaments were first to be affected, followed by the subcortical bundles, resulting in rod- and ring-like conformations. The observed differences in sensitivity between protodermal and cortex cells were attributed to the deeper location of the latter. Depolymerization or stabilization of MTs by relevant drugs (oryzalin, taxol) revealed that AF susceptibility to BPA depends on MT integrity. Developing leaves required harder and longer treatment to be affected by BPA. Ontogenesis of stomatal complexes was highly disturbed, arrangement of AFs and MT arrays was disordered and accuracy of cell division sequence was deranged or completely arrested. The effect of BPA confirmed that subsidiary cell mother cell polarization is not mediated by F-actin patch neither of preprophase band organization. On the overall, it is concluded that AFs in plant cells constitute a subcellular target of BPA and their disruption depends on their crosstalk with MTs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. A dependent stress-strength interference model based on mixed copula function

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Jian Xiong; An, Zong Wen; Liu, Bo [School of Mechatronics Engineering, Lanzhou University of Technology, Lanzhou (China)

    2016-10-15

    In the traditional Stress-strength interference (SSI) model, stress and strength must satisfy the basic assumption of mutual independence. However, a complex dependence between stress and strength exists in practical engineering. To evaluate structural reliability under the case that stress and strength are dependent, a mixed copula function is introduced to a new dependent SSI model. This model can fully characterize the dependence between stress and strength. The residual square sum method and genetic algorithm are also used to estimate the unknown parameters of the model. Finally, the validity of the proposed model is demonstrated via a practical case. Results show that traditional SSI model ignoring the dependence between stress and strength more easily overestimates product reliability than the new dependent SSI model.

  8. Defensive or Existential Religious Orientations and Mortality Salience Hypothesis: Using Conservatism as a Dependent Measure

    Science.gov (United States)

    Koca-Atabey, Mujde; Oner-Ozkan, Bengi

    2011-01-01

    The study examined the relationship between the defensive versus existential religious orientation and mortality salience hypothesis in a country where the predominant type of religion is Islam. It was predicted that the mortality reactions of participants would not differ in accordance with their religious orientations within a Muslim sample. The…

  9. FINAL REMINDER EXTENSION/SUPPRESSION OF ALLOWANCE FOR A DEPENDENT CHILD AGED 18 AND ABOVE

    CERN Document Server

    Human Resources Division

    2001-01-01

    Members of the personnel with dependent children aged 18 or above (or reaching 18 during the 2001/2002 school year) who have not yet provided a SCHOOL CERTIFICATE must do so as soon as possible. If we have not received this certificate by December 11, 2001 at the latest, the child allowance will be withdrawn retroactively as from September 1, 2001.

  10. A Dependable Localization Algorithm for Survivable Belt-Type Sensor Networks.

    Science.gov (United States)

    Zhu, Mingqiang; Song, Fei; Xu, Lei; Seo, Jung Taek; You, Ilsun

    2017-11-29

    As the key element, sensor networks are widely investigated by the Internet of Things (IoT) community. When massive numbers of devices are well connected, malicious attackers may deliberately propagate fake position information to confuse the ordinary users and lower the network survivability in belt-type situation. However, most existing positioning solutions only focus on the algorithm accuracy and do not consider any security aspects. In this paper, we propose a comprehensive scheme for node localization protection, which aims to improve the energy-efficient, reliability and accuracy. To handle the unbalanced resource consumption, a node deployment mechanism is presented to satisfy the energy balancing strategy in resource-constrained scenarios. According to cooperation localization theory and network connection property, the parameter estimation model is established. To achieve reliable estimations and eliminate large errors, an improved localization algorithm is created based on modified average hop distances. In order to further improve the algorithms, the node positioning accuracy is enhanced by using the steepest descent method. The experimental simulations illustrate the performance of new scheme can meet the previous targets. The results also demonstrate that it improves the belt-type sensor networks' survivability, in terms of anti-interference, network energy saving, etc.

  11. A Dependence between Average Call Duration and Voice Transmission Quality: Measurement and applications

    NARCIS (Netherlands)

    Holub, J.; Beerends, J.G.; Smid, R.

    2004-01-01

    This contribution deals with the estimation of the relation between speech transmission quality and average call duration for a given network and portfolio of customers. It uses non-intrusive speech quality measurements on live speech calls. The basic idea behind this analysis is an expectation that

  12. Towards a dependable homogeneous many-processor system-on-chip

    NARCIS (Netherlands)

    Zhang, X.

    2014-01-01

    Nowadays, dependable computing systems are widely required in mission critical and human-life critical applications. While the advance in CMOS technology enables smaller and faster circuits, the dependability of modern ICs has worsened as a result of the shrinking dimensions of MOS transistors and

  13. Obsessive passion: a dependency associated with injury-related risky behaviour in dancers.

    Science.gov (United States)

    Akehurst, Sally; Oliver, Emily J

    2014-01-01

    Grounded in self-determination theory, obsessive passion for an activity has been associated with increased risky behaviour and rigid persistence, both symptomatic of dependence. However, it is unknown whether obsessive passion may predict the development of dependence, and furthermore, theoretically important relationships between basic need satisfaction, passion, exercise dependence and subsequent risky behaviour have not been fully explored. A sample of 100 professional dancers (50(fs); 50(ms); Mage = 20.88; SD = 2.69) completed self-ratings of risk-related behaviours (doctor visits; following treatment, and warming up), passion for dance and dance dependence. Findings supported the maladaptive nature of obsessive passion in relation to risky behaviour and as predicted dance dependence mediated this relationship. Interestingly, need satisfaction was positively related to both obsessive passion and harmonious passion. Results are discussed in the light of self-determination theory and dysfunctions of obsessive passion, suggesting that professional dancers are at risk of employing maladaptive behaviours if high in obsessive passion, which may be detectable via symptoms of dance dependence.

  14. Toward a Dependable Peace: A Proposal for an Appropriate Security System.

    Science.gov (United States)

    Johansen, Robert C.

    This booklet proposes that citizens and governments think imaginatively about national and international security and take action for comprehensive arms reductions. The document is presented in eight chapters. Chapter I reports that global insecurity exists despite continuous arms control negotiations since World War II. Chapter II discusses…

  15. Enhancing a Dependable Multiserver Operating System with Temporal Protection via Resource Reservations

    OpenAIRE

    Mancin , Antonio; Lipari , Giuseppe; Herder , Jorrit N.; Gras , Ben; Tanenbaum , Andrew S.

    2008-01-01

    International audience; MINIX 3 is a microkernel-based, multiserver operating system for uniprocessors that is designed to be highly dependable. Servers are restricted according to the principle of least privilege. For example, access to resources such as system memory and device I/O is fully protected. Although MINIX 3 is a potential candidate for embedded platforms, it currently cannot safeguard processes with stringent timing requirements, such as real-time applications. In this paper, we ...

  16. SHMT2 drives glioma cell survival in ischaemia but imposes a dependence on glycine clearance.

    Science.gov (United States)

    Kim, Dohoon; Fiske, Brian P; Birsoy, Kivanc; Freinkman, Elizaveta; Kami, Kenjiro; Possemato, Richard L; Chudnovsky, Yakov; Pacold, Michael E; Chen, Walter W; Cantor, Jason R; Shelton, Laura M; Gui, Dan Y; Kwon, Manjae; Ramkissoon, Shakti H; Ligon, Keith L; Kang, Seong Woo; Snuderl, Matija; Vander Heiden, Matthew G; Sabatini, David M

    2015-04-16

    Cancer cells adapt their metabolic processes to support rapid proliferation, but less is known about how cancer cells alter metabolism to promote cell survival in a poorly vascularized tumour microenvironment. Here we identify a key role for serine and glycine metabolism in the survival of brain cancer cells within the ischaemic zones of gliomas. In human glioblastoma multiforme, mitochondrial serine hydroxymethyltransferase (SHMT2) and glycine decarboxylase (GLDC) are highly expressed in the pseudopalisading cells that surround necrotic foci. We find that SHMT2 activity limits that of pyruvate kinase (PKM2) and reduces oxygen consumption, eliciting a metabolic state that confers a profound survival advantage to cells in poorly vascularized tumour regions. GLDC inhibition impairs cells with high SHMT2 levels as the excess glycine not metabolized by GLDC can be converted to the toxic molecules aminoacetone and methylglyoxal. Thus, SHMT2 is required for cancer cells to adapt to the tumour environment, but also renders these cells sensitive to glycine cleavage system inhibition.

  17. SHMT2 drives glioma cell survival in ischaemia but imposes a dependence on glycine clearance.

    NARCIS (Netherlands)

    Kim, D.; Fiske, B.P.; Birsoy, K.; Freinkman, E.; Kami, K.; Possemato, R.L.; Chudnovsky, Y.; Pacold, M.E.; Chen, W.W.; Cantor, J.R.; Shelton, L.M.; Gui, D.Y.; Kwon, M.; Ramkissoon, S.H.; Ligon, K.L.; Kang, S.W.; Snuderl, M.; der Heiden, M.G. Van; Sabatini, D.M.

    2015-01-01

    Cancer cells adapt their metabolic processes to support rapid proliferation, but less is known about how cancer cells alter metabolism to promote cell survival in a poorly vascularized tumour microenvironment. Here we identify a key role for serine and glycine metabolism in the survival of brain

  18. Molecular underpinnings of nitrite effect on CymA-dependent respiration in Shewanella oneidensis

    Directory of Open Access Journals (Sweden)

    Miao Jin

    2016-07-01

    Full Text Available Shewanella exhibit a remarkable versatility of respiration, with a diverse array of electron acceptors (EAs. In environments where these bacteria thrive, multiple EAs are usually present. However, we know little about strategies by which these EAs and their interaction affect ecophysiology of Shewanella. In this study, we demonstrate in the model strain, Shewanella oneidensis MR-1, that nitrite, not through nitric oxide to which it may convert, inhibits respiration of fumarate, and probably many other EAs whose reduction depends on quinol dehydrogenase CymA. This is achieved via the repression of cyclic adenosine monophosphate (cAMP production, a second messenger required for activation of cAMP-receptor protein (Crp which plays a primary role in regulation of respiration. If nitrite is not promptly removed, intracellular cAMP levels drop, and this impairs Crp activity. As a result, the production of nitrite reductase NrfA, CymA, and fumarate reductase FccA is substantially reduced. In contrast, nitrite can be simultaneously respired with trimethylamine N-oxide, resulting in enhanced biomass.

  19. Regulation of 2-5A Dependent RNase at the Level of its Phosphorylation

    Science.gov (United States)

    1991-06-26

    extract as follows: 25 ul wheat germ extract 10 ul H2O 1 ul RNasin ribonuclease inhibitor (40 u/ml) 7 ul ImM amino acid mixture 1 ul IM...diacylglycerol (DAG) 2. TPA 3. Indolactam Figure 6. Chemical structure of: 1. H-7 (A kinase inhibitor) 2. okadaic acid (A phosphatase inhibitor) Figure 7...elevating agents: Forskolin and Cholera toxin Figure 17. Down-regulation of 2-5A-depRNase by Okadaic 77 acid : A phosphatase inhibitor Figure 18

  20. Economic Value Added as a Dependence on the Corporate- and Market-life Cycle

    Directory of Open Access Journals (Sweden)

    Konečný Zdeněk

    2011-06-01

    Full Text Available Economic value added (EVA is an indicator which is widely used as the main tool for financial analysis. There are two methods of calculating it. The original method which was made by Stern & Stewart is defined as the net operating profit after taxes minus the cost of capital. The second method which was developed and used by the “Czech Ministry of Industry and Trade” indicates that, the economic value added is the difference between return on equity and the alternate cost of equity that is composed of separate risk rewards, and this “spread” is consequently multiplied by the equity. Economic value added depends on many factors. Whereas some of them are controllable by the company, others are not. This article is focused on the relationship between economic value added and the corporate- vs. market life cycle. This is because, there is an assumption that conditions for developing EVA changes depending on the actual phase of corporate- and market life cycle. In this research, the model by Reiners (2004 is used to identify the phases of corporate- and market life cycle and the method provided by the “Czech Ministry of Industry and Trade” is used to calculate EVA. However, there is a consideration of the relativity of EVA in the form of “spread” because of the intercompany comparison. The study found that, the highest spread is achieved by companies that are in the phase of expansion and phase of market expansion. On the contrary, companies in the phase of declension during market declension achieved the lowest and negative spread.

  1. Modeling of a dependence between human operators in advanced main control rooms

    International Nuclear Information System (INIS)

    Lee, Seung Jun; Kim, Jaewhan; Jang, Seung-Cheol; Shin, Yeong Cheol

    2009-01-01

    For the human reliability analysis of main control room (MCR) operations, not only parameters such as the given situation and capability of the operators but also the dependence between the actions of the operators should be considered because MCR operations are team operations. The dependence between operators might be more prevalent in an advanced MCR in which operators share the same information using a computerized monitoring system or a computerized procedure system. Therefore, this work focused on the computerized operation environment of advanced MCRs and proposed a model to consider the dependence representing the recovery possibility of an operator error by another operator. The proposed model estimates human error probability values by considering adjustment values for a situation and dependence values for operators during the same operation using independent event trees. This work can be used to quantitatively calculate a more reliable operation failure probability for an advanced MCR. (author)

  2. Profiling eIF2a-Dependent Translation in Synaptic Plasticity and ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    This project will provide evidence to help direct treatment strategies in patients with memory deficits and reduce the symptoms associated with Alzheimer's disease. Addressing mental and neurological disorders. The World Health Organization (WHO) recently said that traditional epidemiological methods have seriously ...

  3. Development of a Genetic Algorithm to Automate Clustering of a Dependency Structure Matrix

    Science.gov (United States)

    Rogers, James L.; Korte, John J.; Bilardo, Vincent J.

    2006-01-01

    Much technology assessment and organization design data exists in Microsoft Excel spreadsheets. Tools are needed to put this data into a form that can be used by design managers to make design decisions. One need is to cluster data that is highly coupled. Tools such as the Dependency Structure Matrix (DSM) and a Genetic Algorithm (GA) can be of great benefit. However, no tool currently combines the DSM and a GA to solve the clustering problem. This paper describes a new software tool that interfaces a GA written as an Excel macro with a DSM in spreadsheet format. The results of several test cases are included to demonstrate how well this new tool works.

  4. A second component of the SltA-dependent cation tolerance pathway in Aspergillus nidulans.

    Science.gov (United States)

    Mellado, Laura; Calcagno-Pizarelli, Ana Maria; Lockington, Robin A; Cortese, Marc S; Kelly, Joan M; Arst, Herbert N; Espeso, Eduardo A

    2015-09-01

    The transcriptional response to alkali metal cation stress is mediated by the zinc finger transcription factor SltA in Aspergillus nidulans and probably in other fungi of the pezizomycotina subphylum. A second component of this pathway has been identified and characterized. SltB is a 1272 amino acid protein with at least two putative functional domains, a pseudo-kinase and a serine-endoprotease, involved in signaling to the transcription factor SltA. Absence of SltB activity results in nearly identical phenotypes to those observed for a null sltA mutant. Hypersensitivity to a variety of monovalent and divalent cations, and to medium alkalinization are among the phenotypes exhibited by a null sltB mutant. Calcium homeostasis is an exception and this cation improves growth of sltΔ mutants. Moreover, loss of kinase HalA in conjunction with loss-of-function sltA or sltB mutations leads to pronounced calcium auxotrophy. sltA sltB double null mutants display a cation stress sensitive phenotype indistinguishable from that of single slt mutants showing the close functional relationship between these two proteins. This functional relationship is reinforced by the fact that numerous mutations in both slt loci can be isolated as suppressors of poor colonial growth resulting from certain null vps (vacuolar protein sorting) mutations. In addition to allowing identification of sltB, our sltB missense mutations enabled prediction of functional regions in the SltB protein. Although the relationship between the Slt and Vps pathways remains enigmatic, absence of SltB, like that of SltA, leads to vacuolar hypertrophy. Importantly, the phenotypes of selected sltA and sltB mutations demonstrate that suppression of null vps mutations is not dependent on the inability to tolerate cation stress. Thus a specific role for both SltA and SltB in the VPS pathway seems likely. Finally, it is noteworthy that SltA and SltB have a similar, limited phylogenetic distribution, being restricted to the pezizomycotina subphylum. The relevance of the Slt regulatory pathway to cell structure, intracellular trafficking and cation homeostasis and its restricted phylogenetic distribution makes this pathway of general interest for future investigation and as a source of targets for antifungal drugs. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  5. 26 CFR 1.152-1 - General definition of a dependent.

    Science.gov (United States)

    2010-04-01

    ... his son during 1955, all of which sums represent his sole support during that year. The fact that the.... Consequently, since the son's contribution of $1,000 was less than one-half of the father's support ($2,200) he... for the entire part of the year preceding his death. Likewise, the period during the taxable year...

  6. A-dependence of hadron-nucleus massive lepton pair production

    International Nuclear Information System (INIS)

    Ayala Filho, A.L.; Ducati, M.B. Gay; Epele, L.N.; Canal, C.A. Garcia

    1995-01-01

    The nuclear effects in the small x region of hadron-nucleus Drell-Yan processes at 800 GeV analyzed. We employ the parton recombination model to describe the suppression in the R pA DY (x 2 ) ratio as compared with R EMC (x), in the same kinematical region. A good agreement with experimental results is obtained. (author)

  7. THE MEANING OF BEING-A-CAREGIVER OF A DEPENDENT RELATIVE SUFFERING FROM CANCER: PALLIATIVE CONTRIBUTIONS

    Directory of Open Access Journals (Sweden)

    Joisy Aparecida Marchi

    2016-01-01

    Full Text Available Se tuvo como objetivo comprender el significado de ser-cuidador de un familiar con cáncer y con gran dependencia para las actividades diarias. Estudio fenomenológico fundamentado en Martín Heidegger realizado junto a tres núcleos integrados de salud en un municipio del noroeste de Paraná. La entrevista sucedió entre noviembre de 2012 y febrero de 2013 con 17 cuidadores familiares. Del análisis propuesto surgieron dos temáticas: “El ser-cuidador vivenciando distintos modos de disposición” y “Siendo-con-el: de la ocupación cotidiana a la preocupación libertadora”. Significó para el ser-cuidador aterrarse con el diagnóstico, horrorizarse con el tratamiento, aterrorizarse con los cuidados paliativos y ser-con-el-otro en la enfermedad. Se mostró ocupado con las cosas, pero también estuvo preocupado, evidenciando la solicitud en sus acciones. Esta base para un cuidado paliativo efectivo, debe permear la labor del enfermero visando que este profesional sea un verdadero ser-del-cuidado.

  8. Flat Milling Process Simulation Taking into Consideration a Dependence of Dynamic Characteristics of the Machine

    Directory of Open Access Journals (Sweden)

    D. A. Zavarzin

    2016-01-01

    Full Text Available The milling process inherently is on/off, and therefore inevitably there is vibration excitation in the Machine/Fixture/Tool/Part (MFTP system, which results in a different quality of the treated surface, depending on the machining conditions. The objective is to identify effective operation conditions to cut a part on the 3-way easy class machines when there is no unwanted regenerative self-oscillation, leading to a significant deterioration in the quality of the surface machined. The paper describes vibrations arising during a milling process and their effect on the surface shape and the working tool. To solve this problem we apply a numerical simulation method of cutting dynamics, which consist of 4 modules. The main module is an algorithm of the geometric simulation. The second module is a phenomenological model of the cutting forces. Two remaining modules are responsible for dynamics simulation of the part machined and the cutting tool under time-varying cutting forces. The calculated values are transferred back to the geometric modelling algorithm at each step in time. Thus, the model is closed and allows us to take into account an effect of delay in a dynamic system. A finite element machine model to perform calculation in 3DCUT software has been a selected and compiled. The paper presents geometrical mapping of the machining process and natural frequencies and shapes found for the finite element model. Conducting multivariate calculations allowed us to analyse the dependences of a dynamic behaviour of the system on changing spindle speed. The multivariate modelling results are presented as the Poincare maps for a moving free end of the tool. These Poincare maps allow us to select the operation conditions domains coming both with forced vibration and with self-excited oscillations. On the Poincaré map for two operation conditions of different domains there are graphics of the cutting forces, a thickness of the cutting layer, tool movements, and a shape of the machined surface to demonstrate differences in the dynamic behaviour of the system. A milling process modelling technique considered in the paper, taking into account a dynamics of the cutting 3-way machine of easy class allows us to estimate the nature and the level of vibration in the processing system, depending on the operation conditions selected for machining through building the Poincaré maps based on the results of multivariate modelling. These results can be used to select the effective milling operation conditions that enhance the quality and processing performance.

  9. Diversification of DnaA dependency for DNA replication in cyanobacterial evolution.

    Science.gov (United States)

    Ohbayashi, Ryudo; Watanabe, Satoru; Ehira, Shigeki; Kanesaki, Yu; Chibazakura, Taku; Yoshikawa, Hirofumi

    2016-05-01

    Regulating DNA replication is essential for all living cells. The DNA replication initiation factor DnaA is highly conserved in prokaryotes and is required for accurate initiation of chromosomal replication at oriC. DnaA-independent free-living bacteria have not been identified. The dnaA gene is absent in plastids and some symbiotic bacteria, although it is not known when or how DnaA-independent mechanisms were acquired. Here, we show that the degree of dependency of DNA replication on DnaA varies among cyanobacterial species. Deletion of the dnaA gene in Synechococcus elongatus PCC 7942 shifted DNA replication from oriC to a different site as a result of the integration of an episomal plasmid. Moreover, viability during the stationary phase was higher in dnaA disruptants than in wild-type cells. Deletion of dnaA did not affect DNA replication or cell growth in Synechocystis sp. PCC 6803 or Anabaena sp. PCC 7120, indicating that functional dependency on DnaA was already lost in some nonsymbiotic cyanobacterial lineages during diversification. Therefore, we proposed that cyanobacteria acquired DnaA-independent replication mechanisms before symbiosis and such an ancestral cyanobacterium was the sole primary endosymbiont to form a plastid precursor.

  10. A dependability modeling of software under hardware faults digitized system in nuclear power plants

    International Nuclear Information System (INIS)

    Choi, Jong Gyun

    1996-02-01

    An analytic approach to the dependability evaluation of software in the operational phase is suggested in this work with special attention to the physical fault effects on the software dependability : The physical faults considered are memory faults and the dependability measure in question is the reliability. The model is based on the simple reliability theory and the graph theory with the path decomposition micro model. The model represents an application software with a graph consisting of nodes and arcs that probabilistic ally determine the flow from node to node. Through proper transformation of nodes and arcs, the graph can be reduced to a simple two-node graph and the software failure probability is derived from this graph. This model can be extended to the software system which consists of several complete modules without modification. The derived model is validated by the computer simulation, where the software is transformed to a probabilistic control flow graph. Simulation also shows a different viewpoint of software failure behavior. Using this model, we predict the reliability of an application software and a software system in a digitized system(ILS system) in the nuclear power plant and show the sensitivity of the software reliability to the major physical parameters which affect the software failure in the normal operation phase. The derived model is validated by the computer simulation, where the software is transformed to a probabilistic control flow graph. Simulation also shows a different viewpoint of software failure behavior. Using this model, we predict the reliability of an application software and a software system in a digitized system (ILS system) is the nuclear power plant and show the sensitivity of the software reliability to the major physical parameters which affect the software failure in the normal operation phase. This modeling method is particularly attractive for medium size programs such as software used in digitized systems of nuclear power plants. This modeling method is particularly attractive for medium size programs such as software used in digitized systems of nuclear power plants

  11. Nurses’ perception on The difficulties and information needs of family members caring for a dependent person

    Directory of Open Access Journals (Sweden)

    Maria José Lumini Landeiro

    2016-01-01

    Full Text Available La transición de personas con dependencia del hospital hacia la casa es una situación estresante para ellos y sus familias. Este estudio descriptivo exploratorio con abordaje cualitativo tuve como objetivo conocer la percepción de los enfermeros sobre las dificultades, necesidades de información y aplicabilidad del uso de tecnologías educacionales por los familiares cuidadores. Para la recolección de datos se realizaron entrevistas semiestructuradas a 14 enfermeros de un hospital y dos centros de sanidad de Oporto. Los resultados han mostrado participantes en su mayoría hombres con edad media 32,64 años y 9,86 años de media de ejercicio profesional. Los enfermeros han identificado necesidades de información para el desarrollo de competencias en los dominios del conocimiento instrumental relativos al auto-cuidado alimentarse, girar en la cama y transferirse y utilidad del uso de tecnología instrumental. Se concluyó que las áreas de conocimiento identificadas facilitarían la construcción y aplicación de tecnología educativa para familiares cuidadores.

  12. Profiling eIF2a-Dependent Translation in Synaptic Plasticity and ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... said that traditional epidemiological methods have seriously underestimated the ... These methods, according to the WHO, are biased toward mortality and they ... Learning, memory, and perception rely on an intricate network of proteins that ...

  13. Enhancing a Dependable Multiserver Operating System with Temporal Protection via Resource Reservation,

    NARCIS (Netherlands)

    Mancina, A.; Herder, J.N.; Gras, B.J.; Tanenbaum, A.S.; Lipari, G

    2009-01-01

    Nowadays, microkernel-based systems are getting studied and adopted with a renewed interest in a wide number of IT scenarios. Their advantages over classical monolithic solutions mainly concern the dependability domain. By being capable of dynamically detect and solve non-expected behaviours within

  14. FINAL REMINDER EXTENSION/SUPPRESSION OF ALLOWANCE FOR A DEPENDENT CHILD AGED 18 AND ABOVE

    CERN Multimedia

    Social and Statutory Conditions; Tel. 72862-74474

    2000-01-01

    Members of the personnel with dependent children aged 18 or above (or reaching 18 during the 2000/2001 school year) who have not yet provided a SCHOOL CERTIFICATE must do so as soon as possible. If we have not received this certificate by November 28, 2000 at the latest, the child allowance will be withdrawn retroactively as from September 1,2000.

  15. Identification of Farnesyl Pyrophosphate and N-Arachidonylglycine as Endogenous Ligands for GPR92*S⃞

    OpenAIRE

    Oh, Da Young; Yoon, Jung Min; Moon, Mi Jin; Hwang, Jong-Ik; Choe, Han; Lee, Ju Yeon; Kim, Jae Il; Kim, Sunoh; Rhim, Hyewhon; O'Dell, David K.; Walker, J. Michael; Na, Heung Sik; Lee, Min Goo; Kwon, Hyuk Bang; Kim, Kyungjin

    2008-01-01

    A series of small compounds acting at the orphan G protein-coupled receptor GPR92 were screened using a signaling pathway-specific reporter assay system. Lipid-derived molecules including farnesyl pyrophosphate (FPP), N-arachidonylglycine (NAG), and lysophosphatidic acid were found to activate GPR92. FPP and lysophosphatidic acid were able to activate both Gq/11- and Gs-mediated signaling pathways, whereas NAG activated only the Gq/11-mediated signaling pathway. Co...

  16. História da enfermagem psiquiátrica e a dependência química no Brasil: atravessando a história para reflexão Historia de la enfermería psiquiátrica y la dependencia química en el Brasil: atravesando la historia para la reflexión History of the psychiatric nursing and chemical dependency in Brazil: crossing the history for reflection

    Directory of Open Access Journals (Sweden)

    Amanda Márcia dos Santos Reinaldo

    2007-12-01

    Full Text Available A formação do enfermeiro em Enfermagem Psiquiátrica e na área de dependências químicas norteia a discussão desse artigo, tendo em vista a complexidade dos problemas relacionados ao ensino de enfermagem, saúde mental, psiquiatria e álcool e drogas. Trata-se de um artigo de revisão de literatura onde as autoras compilaram fontes primárias e secundárias sobre o tema e, a partir da leitura do material bibliográfico, fizeram análises e reflexões acerca dos atravessamentos históricos que permeiam a história da Enfermagem Psiquiátrica e a dependência química no Brasil. Os resultados apontam para uma evolução do tema álcool e drogas dada a magnitude do problema na sociedade contemporânea. Em relação à Enfermagem Psiquiátrica, o ensino apresenta mudanças devidas à evolução histórica da psiquiatria que devem ser consideradas durante a formação do profissional enfermeiro. Ambas as temáticas encontram pontos de aproximação e distanciamento conforme o contexto em que são analisadas.La formación del enfermero en enfermería psiquiátrica y en el área de dependencias químicas, orienta la discusión de este artículo teniendo a la vista la complejidad de los problemas relacionados con la enseñanza de enfermería, salud mental, psiquiátrica, alcohol y drogas. Se trata de un artículo de revisión de la literatura donde las autoras compilaron fuentes primarias y secundarias sobre el tema y a partir de la lectura del material bibliográfico se realizaron análisis y reflexiones acerca de los acontecimientos históricos que permean la historia de la enfermería psiquiátrica y la dependencia química en el Brasil. Los resultados apuntan para una evolución del tema alcohol y drogas debido a la magnitud del problema en la sociedad contemporánea. En relación a la enfermería psiquiátrica, la enseñanza presenta cambios debido a la evolución histórica de la psiquiátrica que deben ser consideradas durante la formaci

  17. Role of METTL20 in regulating β-oxidation and heat production in mice under fasting or ketogenic conditions.

    Science.gov (United States)

    Shimazu, Tadahiro; Furuse, Tamio; Balan, Shabeesh; Yamada, Ikuko; Okuno, Shuzo; Iwanari, Hiroko; Suzuki, Takehiro; Hamakubo, Takao; Dohmae, Naoshi; Yoshikawa, Takeo; Wakana, Shigeharu; Shinkai, Yoichi

    2018-01-19

    METTL20 is a seven-β-strand methyltransferase that is localised to the mitochondria and tri-methylates the electron transfer flavoprotein (ETF) β subunit (ETFB) at lysines 200 and 203. It has been shown that METTL20 decreases the ability of ETF to extract electrons from medium-chain acyl-coenzyme A (CoA) dehydrogenase (MCAD) and glutaryl-CoA dehydrogenase in vitro. METTL20-mediated methylation of ETFB influences the oxygen consumption rate in permeabilised mitochondria, suggesting that METTL20-mediated ETFB methylation may also play a regulatory role in mitochondrial metabolism. In this study, we generated Mettl20 knockout (KO) mice to uncover the in vivo functions of METTL20. The KO mice were viable, and a loss of ETFB methylation was confirmed. In vitro enzymatic assays revealed that mitochondrial ETF activity was higher in the KO mice than in wild-type mice, suggesting that the KO mice had higher β-oxidation capacity. Calorimetric analysis showed that the KO mice fed a ketogenic diet had higher oxygen consumption and heat production. A subsequent cold tolerance test conducted after 24 h of fasting indicated that the KO mice had a better ability to maintain their body temperature in cold environments. Thus, METTL20 regulates ETF activity and heat production through lysine methylation when β-oxidation is highly activated.

  18. Electrochemical Characterization of Escherichia coli Adaptive Response Protein AidB

    Directory of Open Access Journals (Sweden)

    Sean J. Elliott

    2012-12-01

    Full Text Available When exposed to known DNA-damaging alkylating agents, Escherichia coli cells increase production of four DNA repair enzymes: Ada, AlkA, AlkB, and AidB. The role of three enzymes (Ada, AlkA, and AlkB in repairing DNA lesions has been well characterized, while the function of AidB is poorly understood. AidB has a distinct cofactor that is potentially related to the elusive role of AidB in adaptive response: a redox active flavin adenine dinucleotide (FAD. In this study, we report the thermodynamic redox properties of the AidB flavin for the first time, both for free protein and in the presence of potential substrates. We find that the midpoint reduction potential of the AidB flavin is within a biologically relevant window for redox chemistry at −181 mV, that AidB significantly stabilizes the flavin semiquinone, and that small molecule binding perturbs the observed reduction potential. Our electrochemical results combined with structural analysis allow for fresh comparisons between AidB and the homologous acyl-coenzyme A dehydrogenase (ACAD family of enzymes. AidB exhibits several discrepancies from ACADs that suggest a novel catalytic mechanism distinct from that of the ACAD family enzymes.

  19. Plasma Metabolomics Biosignature According to HIV Stage of Infection, Pace of Disease Progression, Viremia Level and Immunological Response to Treatment.

    Directory of Open Access Journals (Sweden)

    Bruno Scarpellini

    Full Text Available We evaluated plasma samples HIV-infected individuals with different phenotypic profile among five HIV-infected elite controllers and five rapid progressors after recent HIV infection and one year later and from 10 individuals subjected to antiretroviral therapy, five of whom were immunological non-responders (INR, before and after one year of antiretroviral treatment compared to 175 samples from HIV-negative patients. A targeted quantitative tandem mass spectrometry metabolomics approach was used in order to determine plasma metabolomics biosignature that may relate to HIV infection, pace of HIV disease progression, and immunological response to treatment.Twenty-five unique metabolites were identified, including five metabolites that could distinguish rapid progressors and INRs at baseline. Severe deregulation in acylcarnitine and sphingomyelin metabolism compatible with mitochondrial deficiencies was observed. β-oxidation and sphingosine-1-phosphate-phosphatase-1 activity were down-regulated, whereas acyl-alkyl-containing phosphatidylcholines and alkylglyceronephosphate synthase levels were elevated in INRs. Evidence that elite controllers harbor an inborn error of metabolism (late-onset multiple acyl-coenzyme A dehydrogenase deficiency [MADD] was detected.Blood-based markers from metabolomics show a very high accuracy of discriminating HIV infection between varieties of controls and have the ability to predict rapid disease progression or poor antiretroviral immunological response. These metabolites can be used as biomarkers of HIV natural evolution or treatment response and provide insight into the mechanisms of the disease.

  20. Plasma Metabolomics Biosignature According to HIV Stage of Infection, Pace of Disease Progression, Viremia Level and Immunological Response to Treatment.

    Science.gov (United States)

    Scarpellini, Bruno; Zanoni, Michelle; Sucupira, Maria Cecilia Araripe; Truong, Hong-Ha M; Janini, Luiz Mario Ramos; Segurado, Ismael Dale Cotrin; Diaz, Ricardo Sobhie

    2016-01-01

    We evaluated plasma samples HIV-infected individuals with different phenotypic profile among five HIV-infected elite controllers and five rapid progressors after recent HIV infection and one year later and from 10 individuals subjected to antiretroviral therapy, five of whom were immunological non-responders (INR), before and after one year of antiretroviral treatment compared to 175 samples from HIV-negative patients. A targeted quantitative tandem mass spectrometry metabolomics approach was used in order to determine plasma metabolomics biosignature that may relate to HIV infection, pace of HIV disease progression, and immunological response to treatment. Twenty-five unique metabolites were identified, including five metabolites that could distinguish rapid progressors and INRs at baseline. Severe deregulation in acylcarnitine and sphingomyelin metabolism compatible with mitochondrial deficiencies was observed. β-oxidation and sphingosine-1-phosphate-phosphatase-1 activity were down-regulated, whereas acyl-alkyl-containing phosphatidylcholines and alkylglyceronephosphate synthase levels were elevated in INRs. Evidence that elite controllers harbor an inborn error of metabolism (late-onset multiple acyl-coenzyme A dehydrogenase deficiency [MADD]) was detected. Blood-based markers from metabolomics show a very high accuracy of discriminating HIV infection between varieties of controls and have the ability to predict rapid disease progression or poor antiretroviral immunological response. These metabolites can be used as biomarkers of HIV natural evolution or treatment response and provide insight into the mechanisms of the disease.

  1. Lipid storage myopathies.

    Science.gov (United States)

    Bruno, Claudio; Dimauro, Salvatore

    2008-10-01

    The aim of this review is to provide an update on disorders of lipid metabolism affecting skeletal muscle exclusively or predominantly and to summarize recent clinical, genetic, and therapeutic studies in this field. Over the past 5 years, new clinical phenotypes and genetic loci have been described, unusual pathogenic mechanisms have been elucidated, and novel pharmacological approaches have been developed. At least one genetic defect responsible for the myopathic form of CoQ10 deficiency has been identified, causing a disorder that is allelic with the late-onset riboflavine-responsive form of multiple acyl-coenzyme A dehydrogenation deficiency. Novel mechanisms involved in the lipolytic breakdown of cellular lipid depots have been described and have led to the identification of genes and mutations responsible for multisystemic neutral lipid storage disorders, characterized by accumulation of triglyceride in multiple tissues, including muscle. Defects in lipid metabolism can affect either the mitochondrial transport and oxidation of exogenous fatty acid or the catabolism of endogenous triglycerides. These disorders impair energy production and almost invariably involve skeletal muscle, causing progressive myopathy with muscle weakness, or recurrent acute episodes of rhabdomyolysis triggered by exercise, fasting, or infections. Clinical and genetic characterization of these disorders has important implications both for accurate diagnostic approach and for development of therapeutic strategies.

  2. A diagnostic algorithm for metabolic myopathies.

    Science.gov (United States)

    Berardo, Andres; DiMauro, Salvatore; Hirano, Michio

    2010-03-01

    Metabolic myopathies comprise a clinically and etiologically diverse group of disorders caused by defects in cellular energy metabolism, including the breakdown of carbohydrates and fatty acids to generate adenosine triphosphate, predominantly through mitochondrial oxidative phosphorylation. Accordingly, the three main categories of metabolic myopathies are glycogen storage diseases, fatty acid oxidation defects, and mitochondrial disorders due to respiratory chain impairment. The wide clinical spectrum of metabolic myopathies ranges from severe infantile-onset multisystemic diseases to adult-onset isolated myopathies with exertional cramps. Diagnosing these diverse disorders often is challenging because clinical features such as recurrent myoglobinuria and exercise intolerance are common to all three types of metabolic myopathy. Nevertheless, distinct clinical manifestations are important to recognize as they can guide diagnostic testing and lead to the correct diagnosis. This article briefly reviews general clinical aspects of metabolic myopathies and highlights approaches to diagnosing the relatively more frequent subtypes (Fig. 1). Fig. 1 Clinical algorithm for patients with exercise intolerance in whom a metabolic myopathy is suspected. CK-creatine kinase; COX-cytochrome c oxidase; CPT-carnitine palmitoyl transferase; cyt b-cytochrome b; mtDNA-mitochondrial DNA; nDNA-nuclear DNA; PFK-phosphofructokinase; PGAM-phosphoglycerate mutase; PGK-phosphoglycerate kinase; PPL-myophosphorylase; RRF-ragged red fibers; TFP-trifunctional protein deficiency; VLCAD-very long-chain acyl-coenzyme A dehydrogenase.

  3. Systematic Analysis of the 4-Coumarate:Coenzyme A Ligase (4CL Related Genes and Expression Profiling during Fruit Development in the Chinese Pear

    Directory of Open Access Journals (Sweden)

    Yunpeng Cao

    2016-10-01

    Full Text Available In plants, 4-coumarate:coenzyme A ligases (4CLs, comprising some of the adenylate-forming enzymes, are key enzymes involved in regulating lignin metabolism and the biosynthesis of flavonoids and other secondary metabolites. Although several 4CL-related proteins were shown to play roles in secondary metabolism, no comprehensive study on 4CL-related genes in the pear and other Rosaceae species has been reported. In this study, we identified 4CL-related genes in the apple, peach, yangmei, and pear genomes using DNATOOLS software and inferred their evolutionary relationships using phylogenetic analysis, collinearity analysis, conserved motif analysis, and structure analysis. A total of 149 4CL-related genes in four Rosaceous species (pear, apple, peach, and yangmei were identified, with 30 members in the pear. We explored the functions of several 4CL and acyl-coenzyme A synthetase (ACS genes during the development of pear fruit by quantitative real-time PCR (qRT-PCR. We found that duplication events had occurred in the 30 4CL-related genes in the pear. These duplicated 4CL-related genes are distributed unevenly across all pear chromosomes except chromosomes 4, 8, 11, and 12. The results of this study provide a basis for further investigation of both the functions and evolutionary history of 4CL-related genes.

  4. Saccharomyces cerevisiae Atf1p is an alcohol acetyltransferase and a thioesterase in vitro.

    Science.gov (United States)

    Nancolas, Bethany; Bull, Ian D; Stenner, Richard; Dufour, Virginie; Curnow, Paul

    2017-06-01

    The alcohol-O-acyltransferases are bisubstrate enzymes that catalyse the transfer of acyl chains from an acyl-coenzyme A (CoA) donor to an acceptor alcohol. In the industrial yeast Saccharomyces cerevisiae this reaction produces acyl esters that are an important influence on the flavour of fermented beverages and foods. There is also a growing interest in using acyltransferases to produce bulk quantities of acyl esters in engineered microbial cell factories. However, the structure and function of the alcohol-O-acyltransferases remain only partly understood. Here, we recombinantly express, purify and characterize Atf1p, the major alcohol acetyltransferase from S. cerevisiae. We find that Atf1p is promiscuous with regard to the alcohol cosubstrate but that the acyltransfer activity is specific for acetyl-CoA. Additionally, we find that Atf1p is an efficient thioesterase in vitro with specificity towards medium-chain-length acyl-CoAs. Unexpectedly, we also find that mutating the supposed catalytic histidine (H191) within the conserved HXXXDG active site motif only moderately reduces the thioesterase activity of Atf1p. Our results imply a role for Atf1p in CoA homeostasis and suggest that engineering Atf1p to reduce the thioesterase activity could improve product yields of acetate esters from cellular factories. © 2017 The Authors. Yeast published by John Wiley & Sons, Ltd. © 2017 The Authors. Yeast published by John Wiley & Sons, Ltd.

  5. Plant fatty acyl reductases: enzymes generating fatty alcohols for protective layers with potential for industrial applications.

    Science.gov (United States)

    Rowland, Owen; Domergue, Frédéric

    2012-09-01

    Primary fatty alcohols are found throughout the biological world, either in free form or in a combined state. They are common components of plant surface lipids (i.e. cutin, suberin, sporopollenin, and associated waxes) and their absence can significantly perturb these essential barriers. Fatty alcohols and/or derived compounds are also likely to have direct functions in plant biotic and abiotic interactions. An evolutionarily related set of alcohol-forming fatty acyl reductases (FARs) is present in all kingdoms of life. Plant microsomal and plastid-associated FAR enzymes have been characterized, acting on acyl-coenzymeA (acyl-CoA) or acyl-acyl carrier protein (acyl-ACP) substrates, respectively. FARs have distinct substrate specificities both with regard to chain length and chain saturation. Fatty alcohols and wax esters, which are a combination of fatty alcohol and fatty acid, have a variety of commercial applications. The expression of FARs with desired specificities in transgenic microbes or oilseed crops would provide a novel means of obtaining these valuable compounds. In the present review, we report on recent progress in characterizing plant FAR enzymes and in understanding the biological roles of primary fatty alcohols, as well as describe the biotechnological production and industrial uses of fatty alcohols. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  6. Taurine reduces the secretion of apolipoprotein B100 and lipids in HepG2 cells

    Directory of Open Access Journals (Sweden)

    Nagao Koji

    2008-10-01

    Full Text Available Abstract Background Higher concentrations of serum lipids and apolipoprotein B100 (apoB are major individual risk factors of atherosclerosis and coronary heart disease. Therefore ameliorative effects of food components against the diseases are being paid attention in the affluent countries. The present study was undertaken to investigate the effect of taurine on apoB secretion and lipid metabolism in human liver model HepG2 cells. Results The results demonstrated that an addition of taurine to the culture media reduces triacylglycerol (TG-mass in the cells and the medium. Similarly, cellular cholesterol-mass was decreased. Taurine inhibited the incorporation of [14C] oleate into cellular and medium TG, suggesting the inhibition of TG synthesis. In addition, taurine reduced the synthesis of cellular cholesterol ester and its secretion, suggesting the inhibition of acyl-coenzyme A:cholesterol acyltransferase activity. Furthermore, taurine reduced the secretion of apoB, which is a major protein component of very low-density lipoprotein. Conclusion This is a first report to demonstrate that taurine inhibits the secretion of apoB from HepG2 cells.

  7. Essential Oil of Pinus koraiensis Exerts Antiobesic and Hypolipidemic Activity via Inhibition of Peroxisome Proliferator-Activated Receptors Gamma Signaling

    Directory of Open Access Journals (Sweden)

    Hyun-Suk Ko

    2013-01-01

    Full Text Available Our group previously reported that essential oil of Pinus koraiensis (EOPK exerts antihyperlipidemic effects via upregulation of low-density lipoprotein receptor and inhibition of acyl-coenzyme A. In the present study, we investigated the antiobesity and hypolipidemic mechanism of EOPK using in vitro 3T3-L1 cells and in vivo HFD-fed rats. EOPK markedly suppressed fat accumulation and intracellular triglyceride associated with downregulation of adipogenic transcription factor expression, including PPARγ and CEBPα in the differentiated 3T3-L1 adipocytes. Additionally, EOPK attenuated the expression levels of FABP and GPDH as target genes of PPARγ during adipocyte differentiation. Furthermore, PPARγ inhibitor GW9662 enhanced the decreased expression of FABP and PPARγ and fat accumulation induced by EOPK. To confirm the in vitro activity of EOPK, animal study was performed by administering normal diet, HFD, and/or EOPK at the dose of 100 or 200 mg/kg for 6 weeks. Consistently, EOPK significantly suppressed body weight gain, serum triglyceride, total cholesterol, LDL cholesterol, and AI value and increased HDL cholesterol in a dose-dependent manner. Immunohistochemistry revealed that EOPK treatment abrogated the expression of PPARγ in the liver tissue sections of EOPK-treated rats. Taken together, our findings suggest that EOPK has the antiobesic and hypolipidemic potential via inhibition of PPARγ-related signaling.

  8. Essential Oil of Pinus koraiensis Exerts Antiobesic and Hypolipidemic Activity via Inhibition of Peroxisome Proliferator-Activated Receptors Gamma Signaling.

    Science.gov (United States)

    Ko, Hyun-Suk; Lee, Hyo-Jeong; Lee, Hyo-Jung; Sohn, Eun Jung; Yun, Miyong; Lee, Min-Ho; Kim, Sung-Hoon

    2013-01-01

    Our group previously reported that essential oil of Pinus koraiensis (EOPK) exerts antihyperlipidemic effects via upregulation of low-density lipoprotein receptor and inhibition of acyl-coenzyme A. In the present study, we investigated the antiobesity and hypolipidemic mechanism of EOPK using in vitro 3T3-L1 cells and in vivo HFD-fed rats. EOPK markedly suppressed fat accumulation and intracellular triglyceride associated with downregulation of adipogenic transcription factor expression, including PPAR γ and CEBP α in the differentiated 3T3-L1 adipocytes. Additionally, EOPK attenuated the expression levels of FABP and GPDH as target genes of PPAR γ during adipocyte differentiation. Furthermore, PPAR γ inhibitor GW9662 enhanced the decreased expression of FABP and PPAR γ and fat accumulation induced by EOPK. To confirm the in vitro activity of EOPK, animal study was performed by administering normal diet, HFD, and/or EOPK at the dose of 100 or 200 mg/kg for 6 weeks. Consistently, EOPK significantly suppressed body weight gain, serum triglyceride, total cholesterol, LDL cholesterol, and AI value and increased HDL cholesterol in a dose-dependent manner. Immunohistochemistry revealed that EOPK treatment abrogated the expression of PPAR γ in the liver tissue sections of EOPK-treated rats. Taken together, our findings suggest that EOPK has the antiobesic and hypolipidemic potential via inhibition of PPAR γ -related signaling.

  9. Cgl2 plays an essential role in cuticular wax biosynthesis in cabbage (Brassica oleracea L. var. capitata).

    Science.gov (United States)

    Liu, Dongming; Tang, Jun; Liu, Zezhou; Dong, Xin; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao; Sun, Peitian; Liu, Yumei; Li, Zhansheng; Ye, Zhibiao; Fang, Zhiyuan; Yang, Limei

    2017-11-28

    The aerial parts of most land plants are covered with cuticular wax which is important for plants to avoid harmful factors. There is still no cloning study about wax synthesis gene of the alcohol-forming pathway in Brassica species. Scanning electron microscopy (SEM) showed that, compared with wild type (WT), wax crystal are severely reduced in both the adaxial and abaxial sides of cabbage (Brassica oleracea L. var. capitata L.) leaves from the LD10GL mutant. Genetic analysis results revealed that the glossy trait of LD10GL is controlled by a single recessive gene, and fine mapping results revealed that the target gene Cgl2 (Cabbage glossy 2) is located within a physical region of 170 kb on chromosome 1. Based on sequence analysis of the genes in the mapped region, the gene designated Bol013612 was speculated to be the candidate gene. Gene Bol013612 is homologous to Arabidopsis CER4, which encodes fatty acyl-coenzyme A reductase. Sequencing identified a single nucleotide substitution at an intron/exon boundary that results in an insertion of six nucleotides in the cDNA of Bol013612 in LD10GL. The phenotypic defect of LD10GL was confirmed by a functional complementation test with Arabidopsis mutant cer4. Our results indicated that wax crystals of cabbage mutant LD10GL are severely reduced and mutation of gene Bol013612 causes a glossy phenotype in the LD10GL mutant.

  10. Natural separation of the acyl-CoA ligase reaction results in a non-adenylating enzyme.

    Science.gov (United States)

    Wang, Nan; Rudolf, Jeffrey D; Dong, Liao-Bin; Osipiuk, Jerzy; Hatzos-Skintges, Catherine; Endres, Michael; Chang, Chin-Yuan; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N; Shen, Ben

    2018-06-04

    Acyl-coenzyme A (CoA) ligases catalyze the activation of carboxylic acids via a two-step reaction of adenylation followed by thioesterification. Here, we report the discovery of a non-adenylating acyl-CoA ligase PtmA2 and the functional separation of an acyl-CoA ligase reaction. Both PtmA1 and PtmA2, two acyl-CoA ligases from the biosynthetic pathway of platensimycin and platencin, are necessary for the two steps of CoA activation. Gene inactivation of ptmA1 and ptmA2 resulted in the accumulation of free acid and adenylate intermediates, respectively. Enzymatic and structural characterization of PtmA2 confirmed its ability to only catalyze thioesterification. Structural characterization of PtmA2 revealed it binds both free acid and adenylate substrates and undergoes the established mechanism of domain alternation. Finally, site-directed mutagenesis restored both the adenylation and complete CoA activation reactions. This study challenges the currently accepted paradigm of adenylating enzymes and inspires future investigations on functionally separated acyl-CoA ligases and their ramifications in biology.

  11. Spectrum analysis of common inherited metabolic diseases in Chinese patients screened and diagnosed by tandem mass spectrometry.

    Science.gov (United States)

    Han, Lianshu; Han, Feng; Ye, Jun; Qiu, Wenjuan; Zhang, Huiwen; Gao, Xiaolan; Wang, Yu; Ji, Wenjun; Gu, Xuefan

    2015-03-01

    Information concerning inherited metabolic diseases in China is scarce. We investigated the prevalence and age distributions of amino acid, organic acid, and fatty acid oxidation disorders in Chinese patients. Blood levels of amino acids and acylcarnitines (tandem mass spectrometry) were measured in 18,303 patients with suspected inherited metabolic diseases. Diagnosis was based on clinical features, blood levels of amino acids or acylcarnitines, urinary organic acid levels (gas chromatography-mass spectrometry), and (in some) gene mutation tests. Inherited metabolic diseases were confirmed in 1,135 patients (739 males, 396 females). Median age was 12 months (1 day to 59 years). There were 28 diseases: 12 amino acid disorders (580 patients, 51.1%), with hyperphenylalaninemia (HPA) being the most common; nine organic acidemias (408 patients, 35.9%), with methylmalonic acidemia (MMA) as the most common; and seven fatty acid oxidation defects (147 patients, 13.0%), with multiple acyl-coenzyme A dehydrogenase deficiency (MADD) being the most common. Onset was mainly at 1-6 months for citrin deficiency, 0-6 months for MMA, and in newborns for ornithine transcarbamylase deficiency (OTCD). HPA was common in patients aged 1-3 years, and MADD was common in patients >18 years. In China, HPA, citrin deficiency, MMA, and MADD are the most common inherited disorders, particularly in newborns/infants. © 2014 Wiley Periodicals, Inc.

  12. Role of the DGAT gene C79T single-nucleotide polymorphism in French obese subjects.

    Science.gov (United States)

    Coudreau, Sylvie Kipfer; Tounian, Patrick; Bonhomme, Geneviève; Froguel, Philippe; Girardet, Jean-Philippe; Guy-Grand, Bernard; Basdevant, Arnaud; Clément, Karine

    2003-10-01

    Acyl-coenzyme A, diacylglycerol acyltransferase (DGAT), is a key enzyme involved in adipose-cell triglyceride storage. A 79-bp T-to-C single-nucleotide polymorphism (SNP) on the 3' region of the DGAT transcriptional site has been reported to increase promoter activity and is associated with higher BMI in Turkish women. To validate the possible role of this genetic variant in obesity, as well as the variant's possible cellular-functional significance, we performed an association study between the T79C change and several obesity-related phenotypes in 1357 obese French adults and children. The prevalence of the T79C SNP was similar between obese adults and children when each group was compared with the controls. (CC genotype carrier frequencies were 0.25 to 0.29 in the obese groups and 0.21 in controls; p > 0.05.) In each of the obese adult and child groups studied, the T79C variant was not found to be associated with any of the obesity-related phenotypes tested. Although the T79C SNP of the DGAT gene was studied in several groups of white subjects, the association between this SNP and obesity-related phenotypes, previously described, was not confirmed in our population.

  13. Statins Activate Human PPAR Promoter and Increase PPAR mRNA Expression and Activation in HepG2 Cells

    Directory of Open Access Journals (Sweden)

    Makoto Seo

    2008-01-01

    Full Text Available Statins increase peroxisome proliferator-activated receptor (PPAR mRNA expression, but the mechanism of this increased PPAR production remains elusive. To examine the regulation of PPAR production, we examined the effect of 7 statins (atorvastatin, cerivastatin, fluvastatin, pitavastatin, pravastatin, rosuvastatin, and simvastatin on human PPAR promoter activity, mRNA expression, nuclear protein levels, and transcriptional activity. The main results are as follows. (1 Majority of statins enhanced PPAR promoter activity in a dose-dependent manner in HepG2 cells transfected with the human PPAR promoter. This enhancement may be mediated by statin-induced HNF-4. (2 PPAR mRNA expression was increased by statin treatment. (3 The PPAR levels in nuclear fractions were increased by statin treatment. (4 Simvastatin, pravastatin, and cerivastatin markedly enhanced transcriptional activity in 293T cells cotransfected with acyl-coenzyme A oxidase promoter and PPAR/RXR expression vectors. In summary, these data demonstrate that PPAR production and activation are upregulated through the PPAR promoter activity by statin treatment.

  14. Research for Developing Renewable Biofuels from Algae

    Energy Technology Data Exchange (ETDEWEB)

    Black, Paul N. [Univ. of Nebraska, Lincoln, NE (United States)

    2012-12-15

    Task A. Expansion of knowledge related to lipid production and secretion in algae A.1 Lipid biosynthesis in target algal species; Systems biology approaches are being used in combination with recent advances in Chlorella and Chlamydomonas genomics to address lipid accumulation in response to defined nutrient regimes. The UNL Algal Group continues screening additional species of Chlorella and other naturally occurring algae for those with optimal triglyceride production; Of the strains examined by the DOE's Aquatic Species Program, green algae, several species of Chlorella represent the largest group from which oleaginous candidates have been identified; A.1.1. Lipid profiling; Neutral lipid accumulation is routinely monitored by Nile red and BODIPY staining using high throughput strategies to screen for naturally occurring algae that accumulate triglyceride. These strategies complement those using spectrofluorometry to quantify lipid accumulation; Neutral lipid accumulation is routinely monitored by high performance thin-layer chromatography (HPTLC) and high performance liquid chromatography (HPLC) of lipid extracts in conjunction with; Carbon portioning experiments have been completed and the data currently are being analyzed and prepared for publication; Methods in the Black lab were developed to identify and quantify triacylglycerol (TAG), major membrane lipids [diacylglycerol trimethylhomoserine, phosphatidylethanolamine and chloroplast glycolipids], biosynthetic intermediates such as diacylglycerol, phosphatidic acid and lysophospholipids and different species of acyl-coenzyme A (acyl CoA).

  15. Cyclic vomiting syndrome masking a fatal metabolic disease.

    LENUS (Irish Health Repository)

    Fitzgerald, Marianne

    2013-05-01

    Disorders of fatty acid oxidation are rare but can be fatal. Hypoglycaemia with acidosis is a cardinal feature. Cases may present during early childhood or can be delayed into adolescence or beyond. We present a case of multiple acyl-coenzyme A dehydrogenase deficiency (MADD), an extremely rare disorder of fatty acid oxidation. Our 20-year-old patient presented with cardiovascular collapse, raised anion gap metabolic acidosis and non-ketotic hypoglycaemia. She subsequently developed multi-organ failure and sadly died. She had a previous diagnosis of cyclic vomiting syndrome (CVS) for more than 10 years, warranting frequent hospital admissions. The association between CVS and MADD has been made before though the exact relationship is unclear. All patients with persistent severe CVS should have metabolic investigations to exclude disorders of fatty acid oxidation. In case of non-ketotic hypoglycaemia with acidosis, the patient should be urgently referred to a specialist in metabolic diseases. All practitioners should be aware of these rare disorders as a cause of unexplained acidosis.

  16. Purification of a jojoba embryo wax synthase, cloning of its cDNA, and production of high levels of wax in seeds of transgenic arabidopsis.

    Science.gov (United States)

    Lardizabal, K D; Metz, J G; Sakamoto, T; Hutton, W C; Pollard, M R; Lassner, M W

    2000-03-01

    Wax synthase (WS, fatty acyl-coenzyme A [coA]: fatty alcohol acyltransferase) catalyzes the final step in the synthesis of linear esters (waxes) that accumulate in seeds of jojoba (Simmondsia chinensis). We have characterized and partially purified this enzyme from developing jojoba embryos. A protein whose presence correlated with WS activity during chromatographic fractionation was identified and a cDNA encoding that protein was cloned. Seed-specific expression of the cDNA in transgenic Arabidopsis conferred high levels of WS activity on developing embryos from those plants. The WS sequence has significant homology with several Arabidopsis open reading frames of unknown function. Wax production in jojoba requires, in addition to WS, a fatty acyl-CoA reductase (FAR) and an efficient fatty acid elongase system that forms the substrates preferred by the FAR. We have expressed the jojoba WS cDNA in Arabidopsis in combination with cDNAs encoding the jojoba FAR and a beta-ketoacyl-CoA synthase (a component of fatty acid elongase) from Lunaria annua. (13)C-Nuclear magnetic resonance analysis of pooled whole seeds from transgenic plants indicated that as many as 49% of the oil molecules in the seeds were waxes. Gas chromatography analysis of transmethylated oil from individual seeds suggested that wax levels may represent up to 70% (by weight) of the oil present in those seeds.

  17. 3,5-Diiodo-L-Thyronine Modifies the Lipid Droplet Composition in a Model of Hepatosteatosis

    Directory of Open Access Journals (Sweden)

    Elena Grasselli

    2014-02-01

    Full Text Available Background/Aims: Fatty acids are the main energy stores and the major membrane components of the cells. In the hepatocyte, fatty acids are esterified to triacylglycerols (TAGs and stored in lipid droplets (LDs. The lipid lowering action of 3,5-diiodo-L-thyronine (T2 on an in vitro model of hepatosteatosis was investigated in terms of fatty acid and protein content of LDs, lipid oxidation and secretion. Methods: FaO cells were exposed to oleate/palmitate, then treated with T2. Results: T2 reduced number and size of LDs, and modified their acyl composition by decreasing the content of saturated (SFA vs monounsaturated (MUFA fatty acids thus reversing the SFA/MUFA ratio. The expression of the LD-associated proteins adipose differentiation-related protein (ADRP, oxidative tissue-enriched PAT protein (OXPAT, and adipose triglyceride lipase (ATGL was increased in ‘steatotic' cells and further up-regulated by T2. Moreover, T2 stimulated the mitochondrial oxidation by up-regulating carnitine-palmitoyl-transferase (CPT1, uncoupling protein 2 (UCP2 and very long-chain acyl-coenzyme A dehydrogenase (VLCAD. Conclusions: T2 leads to mobilization of TAGs from LDs and stimulates mitochondrial oxidative metabolism of fatty acids, in particular of SFAs, and thus enriches of MUFAs the LDs. This action may protect the hepatocyte from excess of SFAs that are more toxic than MUFAs.

  18. Angiogenin activates phospholipase C and elicits a rapid incorporation of fatty acid into cholesterol esters in vascular smooth muscle cells

    International Nuclear Information System (INIS)

    Moore, F.; Riordan, J.F.

    1990-01-01

    Angiogenin activates the phosphoinositide-specific phospholipase C (PLC) in cultured rat aortic smooth muscle cells to yield a transient (30 s) peak of 1,2-diacylglycerol (DG) and inositol trisphosphate. Within 1 min, the DG level falls below that of the control and remains so for at least 20 min. A transient increase in monoacylglycerol indicates that depletion of DG may be the consequence of hydrolysis by DG lipase. In addition to these changes in second messengers, a rapid increase in incorporating of radiolabeled tracer into cellular cholesterol esters is observed. Stimulated cholesterol ester labeling is inhibited by preincubation with either the DG lipase inhibitor RHC 80267 or the acyl coenzyme A:cholesterol acyltransferase inhibitor Sandoz 58035. Cells prelabeled with [ 3 H]arachidonate show a sustained increase in labeling of cholesterol esters following exposure to angiogenin. In contrast, cells prelabeled with [ 3 H]oleate show only a transient elevation that returns to the basal level by 5 min. This suggests initial cholesterol esterification by oleate followed by arachidonate that is released by stimulation of the PLC/DG lipase pathway

  19. Regulation of very-long acyl chain ceramide synthesis by acyl-CoA-binding protein

    DEFF Research Database (Denmark)

    Ferreira, Natalia Santos; Engelsby, Hanne; Neess, Ditte

    2017-01-01

    and cardiovascular diseases, as well as neurological disorders. Here we show that acyl-coenzyme A-binding protein (ACBP) potently facilitates very-long acyl chain ceramide synthesis. ACBP increases the activity of ceramide synthase 2 (CerS2) by more than 2-fold and CerS3 activity by 7-fold. ACBP binds very......-long-chain acyl-CoA esters, which is required for its ability to stimulate CerS activity. We also show that high-speed liver cytosol from wild-type mice activates CerS3 activity, whereas cytosol from ACBP knock-out mice does not. Consistently, CerS2 and CerS3 activities are significantly reduced in the testes...... of ACBP(-/-) mice, concomitant with a significant reduction in long- and very-long-chain ceramide levels. Importantly, we show that ACBP interacts with CerS2 and CerS3. Our data uncover a novel mode of regulation of very-long acyl chain ceramide synthesis by ACBP, which we anticipate is of crucial...

  20. Molecular characterization of medium-chain acyl-CoA dehydrogenase (MCAD) deficiency

    DEFF Research Database (Denmark)

    Gregersen, N; Andresen, B S; Bross, P

    1991-01-01

    . All clones sequenced from the patient exhibited a single base substitution from adenine (A) to guanine (G) at position 985 in the MCAD cDNA as the only consistent base-variation compared with control cDNA. In contrast, the parents contained cDNA with the normal and the mutated sequence, revealing......A series of experiments has established the molecular defect in the medium-chain acyl-coenzyme A (CoA) dehydrogenase (MCAD) gene in a family with MCAD deficiency. Demonstration of intra-mitochondrial mature MCAD indistinguishable in size (42.5-kDa) from control MCAD, and of mRNA with the correct...... size of 2.4 kb, indicated a point-mutation in the coding region of the MCAD gene to be disease-causing. Consequently, cloning and DNA sequencing of polymerase chain reaction (PCR) amplified complementary DNA (cDNA) from messenger RNA of fibroblasts from the patient and family members were performed...

  1. De novo biosynthesis of biodiesel by Escherichia coli in optimized fed-batch cultivation.

    Directory of Open Access Journals (Sweden)

    Yangkai Duan

    Full Text Available Biodiesel is a renewable alternative to petroleum diesel fuel that can contribute to carbon dioxide emission reduction and energy supply. Biodiesel is composed of fatty acid alkyl esters, including fatty acid methyl esters (FAMEs and fatty acid ethyl esters (FAEEs, and is currently produced through the transesterification reaction of methanol (or ethanol and triacylglycerols (TAGs. TAGs are mainly obtained from oilseed plants and microalgae. A sustainable supply of TAGs is a major bottleneck for current biodiesel production. Here we report the de novo biosynthesis of FAEEs from glucose, which can be derived from lignocellulosic biomass, in genetically engineered Escherichia coli by introduction of the ethanol-producing pathway from Zymomonas mobilis, genetic manipulation to increase the pool of fatty acyl-CoA, and heterologous expression of acyl-coenzyme A: diacylglycerol acyltransferase from Acinetobacter baylyi. An optimized fed-batch microbial fermentation of the modified E. coli strain yielded a titer of 922 mg L(-1 FAEEs that consisted primarily of ethyl palmitate, -oleate, -myristate and -palmitoleate.

  2. Inhibition of the NLRP3 inflammasome attenuates foam cell formation of THP-1 macrophages by suppressing ox-LDL uptake and promoting cholesterol efflux.

    Science.gov (United States)

    Chen, Liang; Yao, Qiying; Xu, Siwei; Wang, Hongyan; Qu, Peng

    2018-01-01

    The NOD-like receptor family, pyrin domain-containing protein 3 (NLRP3) inflammasome plays an important role in the development of atherosclerosis. The activated NLRP3 inflammasome has been reported to promote macrophage foam cell formation, but not all studies have obtained the same result, and how NLRP3 inflammasome is involved in the formation of foam cells remains elusive. We used selective NLRP3 inflammasome inhibitors and NLRP3-deficient THP-1 cells to assess the effect of NLRP3 inflammasome inhibition on macrophage foam cell formation, oxidized low-density lipoprotein (ox-LDL) uptake, esterification, and cholesterol efflux, as well as the expression of associated proteins. Inhibition of the NLRP3 inflammasome attenuated foam cell formation, diminished ox-LDL uptake, and promoted cholesterol efflux from THP-1 macrophages. Moreover, it downregulated CD36, acyl coenzyme A: cholesterol acyltransferase-1 and neutral cholesterol ester hydrolase expression; upregulated ATP-binding cassette transporter A1 (ABCA1) and scavenger receptor class B type I (SR-BI) expression; but had no effect on the expression of scavenger receptor class A and ATP-binding cassette transporter G1. Collectively, our findings show that inhibition of the NLRP3 inflammasome decreases foam cell formation of THP-1 macrophages via suppression of ox-LDL uptake and enhancement of cholesterol efflux, which may be due to downregulation of CD36 expression and upregulation of ABCA1 and SR-BI expression, respectively. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Silencing of ACO decreases reproduction and energy metabolism in triazophos-treated female brown plant hoppers, Nilaparvata lugens Stål (Hemiptera: Delphacidae).

    Science.gov (United States)

    Liu, Zong-Yu; Jiang, Yi-Ping; Li, Lei; You, Lin-Lin; Wu, You; Xu, Bin; Ge, Lin-Quan; Wu, Jin-Cai

    2016-03-01

    The brown plant hopper (BPH), Nilaparvata lugens Stål (Hemiptera: Delphacidae), is a major pest affecting rice in Asia, and outbreaks of this pest are closely linked to pesticide-induced stimulation of reproduction. Therefore, the BPH is a classic example of a resurgent pest. However, the effects of different genes on the regulation of pesticide-induced reproductive stimulation in the BPH are unclear. In this study, the regulatory effects of acyl-coenzyme A oxidase (ACO) on the reproduction and biochemistry of the BPH were investigated with gene silencing. The number of eggs laid per female by triazophos (TZP)+dsACO BPH females was significantly lower than those of TZP-treated (without ACO silencing) or TZP+GFP females (negative control), with the number of eggs decreasing by 30.8% (from 529.5 to 366.3) and 32.0% (from 540.5 to 366.3), respectively. The preoviposition period, oviposition period, and longevity of the TZP-treated females were also influenced by dsACO treatment. Additionally, the amounts of crude fat, protein, and some fatty acids (oleic acid, palmitic acid, linoleic acid, stearic acid, and myristoleic acid) in TZP+dsACO females were significantly lower than in TZP-treated females. Thus, ACO is one of the key genes regulating the TZP-induced stimulation of reproduction in BPH females. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. ACBD5 and VAPB mediate membrane associations between peroxisomes and the ER.

    Science.gov (United States)

    Costello, Joseph L; Castro, Inês G; Hacker, Christian; Schrader, Tina A; Metz, Jeremy; Zeuschner, Dagmar; Azadi, Afsoon S; Godinho, Luis F; Costina, Victor; Findeisen, Peter; Manner, Andreas; Islinger, Markus; Schrader, Michael

    2017-02-01

    Peroxisomes (POs) and the endoplasmic reticulum (ER) cooperate in cellular lipid metabolism and form tight structural associations, which were first observed in ultrastructural studies decades ago. PO-ER associations have been suggested to impact on a diverse number of physiological processes, including lipid metabolism, phospholipid exchange, metabolite transport, signaling, and PO biogenesis. Despite their fundamental importance to cell metabolism, the mechanisms by which regions of the ER become tethered to POs are unknown, in particular in mammalian cells. Here, we identify the PO membrane protein acyl-coenzyme A-binding domain protein 5 (ACBD5) as a binding partner for the resident ER protein vesicle-associated membrane protein-associated protein B (VAPB). We show that ACBD5-VAPB interaction regulates PO-ER associations. Moreover, we demonstrate that loss of PO-ER association perturbs PO membrane expansion and increases PO movement. Our findings reveal the first molecular mechanism for establishing PO-ER associations in mammalian cells and report a new function for ACBD5 in PO-ER tethering. © 2017 Costello et al.

  5. A condition-based maintenance of a dependent degradation-threshold-shock model in a system with multiple degradation processes

    International Nuclear Information System (INIS)

    Caballé, N.C.; Castro, I.T.; Pérez, C.J.; Lanza-Gutiérrez, J.M.

    2015-01-01

    This paper proposes a condition-based maintenance strategy for a system subject to two dependent causes of failure: degradation and sudden shocks. The internal degradation is reflected by the presence of multiple degradation processes in the system. Degradation processes start at random times following a Non-homogeneous Poisson process and their growths are modelled by using a gamma process. When the deterioration level of a degradation process exceeds a predetermined value, we assume that a degradation failure occurs. Furthermore, the system is subject to sudden shocks that arrive at the system following a Doubly Stochastic Poisson Process. A sudden shock provokes the total breakdown of the system. Thus, the state of the system is evaluated at inspection times and different maintenance tasks can be carried out. If the system is still working at an inspection time, a preventive maintenance task is performed if the deterioration level of a degradation process exceeds a certain threshold. A corrective maintenance task is performed if the system is down at an inspection time. A preventive (corrective) maintenance task implies the replacement of the system by a new one. Under this maintenance strategy, the expected cost rate function is obtained. A numerical example illustrates the analytical results. - Highlights: • A condition-based maintenance model is proposed. • Two dependent causes of failure are considered: deterioration and external shocks. • Deterioration is given by multiple degradation processes growing by a gamma process. • The initiation of degradation processes follows a Non-homogeneous Poisson process. • External shocks arrive at the system by using a Doubly Stochastic Poisson Process

  6. Myeloid Malignancies with Chromosome 5q Deletions Acquire a Dependency on an Intrachromosomal NF-κB Gene Network

    Directory of Open Access Journals (Sweden)

    Jing Fang

    2014-09-01

    Full Text Available Chromosome 5q deletions (del[5q] are common in high-risk (HR myelodysplastic syndrome (MDS and acute myeloid leukemia (AML; however, the gene regulatory networks that sustain these aggressive diseases are unknown. Reduced miR-146a expression in del(5q HR MDS/AML and miR-146a−/− hematopoietic stem/progenitor cells (HSPCs results in TRAF6/NF-κB activation. Increased survival and proliferation of HSPCs from miR-146alow HR MDS/AML is sustained by a neighboring haploid gene, SQSTM1 (p62, expressed from the intact 5q allele. Overexpression of p62 from the intact allele occurs through NF-κB-dependent feedforward signaling mediated by miR-146a deficiency. p62 is necessary for TRAF6-mediated NF-κB signaling, as disrupting the p62-TRAF6 signaling complex results in cell-cycle arrest and apoptosis of MDS/AML cells. Thus, del(5q HR MDS/AML employs an intrachromosomal gene network involving loss of miR-146a and haploid overexpression of p62 via NF-κB to sustain TRAF6/NF-κB signaling for cell survival and proliferation. Interfering with the p62-TRAF6 signaling complex represents a therapeutic option in miR-146a-deficient and aggressive del(5q MDS/AML.

  7. VeriML: A Dependently-Typed, User-Extensible and Language-Centric Approach to Proof Assistants

    Science.gov (United States)

    2013-01-01

    newly-arrived members of the FLINT group, especially Xinyu Feng, Alex Vaynberg, Rodrigo Ferreira, David Costanzo, Shu-Chun Weng, Jan Hoffmann and Mike...Constable, S.F. Allen, H.M. Bromley, W.R. Cleaveland, J.F. Cremer , R.W. Harper, D.J. Howe, T.B. Knoblock, N.P. Mendler, P. Panangaden, et al. Implementing

  8. circRNA Mediates Silica-Induced Macrophage Activation Via HECTD1/ZC3H12A-Dependent Ubiquitination

    Science.gov (United States)

    Zhou, Zewei; Jiang, Rong; Yang, Xiyue; Guo, Huifang; Fang, Shencun; Zhang, Yingming; Cheng, Yusi; Wang, Jing; Yao, Honghong; Chao, Jie

    2018-01-01

    Rationale: Phagocytosis of silicon dioxide (SiO2) into lung cells causes an inflammatory cascade that results in fibroblast proliferation and migration, followed by fibrosis. Circular RNAs (circRNAs) are a subclass of non-coding RNAs detected within mammalian cells; however, researchers have not determined whether circRNAs are involved in the pathophysiological process of silicosis. The upstream molecular mechanisms and functional effects on cell apoptosis, proliferation and migration were investigated to elucidate the role of circRNAs in SiO2-induced inflammation in pulmonary macrophages. Methods: Primary cultures of alveolar macrophages from healthy donors and patients as well as the RAW264.7 macrophage cell line were used to explore the functions of circHECTD1 (HECT domain E3 ubiquitin protein ligase 1) in macrophage activation. Results: The results of the experiments indicated that 1) SiO2 concomitantly decreased circHECTD1 levels and increased HECTD1 protein expression; 2) circHECTD1 and HECTD1 were involved in SiO2-induced macrophage activation via ubiquitination; and 3) SiO2-activated macrophages promoted fibroblast proliferation and migration via the circHECTD1/HECTD1 pathway. Tissue samples from silicosis patients confirmed the upregulation of HECTD1. Conclusions: Our study elucidated a link between SiO2-induced macrophage activation and the circHECTD1/HECTD1 pathway, thereby providing new insight into the potential use of HECTD1 in the development of novel therapeutic strategies for treating silicosis. PMID:29290828

  9. circRNA Mediates Silica-Induced Macrophage Activation Via HECTD1/ZC3H12A-Dependent Ubiquitination.

    Science.gov (United States)

    Zhou, Zewei; Jiang, Rong; Yang, Xiyue; Guo, Huifang; Fang, Shencun; Zhang, Yingming; Cheng, Yusi; Wang, Jing; Yao, Honghong; Chao, Jie

    2018-01-01

    Rationale: Phagocytosis of silicon dioxide (SiO 2 ) into lung cells causes an inflammatory cascade that results in fibroblast proliferation and migration, followed by fibrosis. Circular RNAs (circRNAs) are a subclass of non-coding RNAs detected within mammalian cells; however, researchers have not determined whether circRNAs are involved in the pathophysiological process of silicosis. The upstream molecular mechanisms and functional effects on cell apoptosis, proliferation and migration were investigated to elucidate the role of circRNAs in SiO 2 -induced inflammation in pulmonary macrophages. Methods: Primary cultures of alveolar macrophages from healthy donors and patients as well as the RAW264.7 macrophage cell line were used to explore the functions of circHECTD1 (HECT domain E3 ubiquitin protein ligase 1) in macrophage activation. Results: The results of the experiments indicated that 1) SiO 2 concomitantly decreased circHECTD1 levels and increased HECTD1 protein expression; 2) circHECTD1 and HECTD1 were involved in SiO 2 -induced macrophage activation via ubiquitination; and 3) SiO 2 -activated macrophages promoted fibroblast proliferation and migration via the circHECTD1/HECTD1 pathway. Tissue samples from silicosis patients confirmed the upregulation of HECTD1. Conclusions: Our study elucidated a link between SiO 2 -induced macrophage activation and the circHECTD1/HECTD1 pathway, thereby providing new insight into the potential use of HECTD1 in the development of novel therapeutic strategies for treating silicosis.

  10. Subinhibitory Concentrations of Bacteriostatic Antibiotics Induce relA-Dependent and relA-Independent Tolerance to beta-Lactams

    Czech Academy of Sciences Publication Activity Database

    Kudrin, P.; Varik, V.; Oliveira, S. R. A.; Beljantseva, J.; Del Peso Santos, T.; Dzhygyr, I.; Rejman, Dominik; Cava, F.; Tenson, T.; Hauryliuk, V.

    2017-01-01

    Roč. 61, č. 4 (2017), č. článku e02173-16. ISSN 0066-4804 R&D Projects: GA ČR GA15-11711S Institutional support: RVO:61388963 Keywords : beta-lactam * RelA * antibiotics * mupirocin * persistence * ppGpp Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 4.302, year: 2016 http://aac.asm.org/content/61/4/e02173-16.full

  11. How (not) to train a dependency parser: The curious case of jackknifing part-of-speech taggers

    DEFF Research Database (Denmark)

    Agic, Zeljko; Schluter, Natalie

    2017-01-01

    In dependency parsing, jackknifing taggers is indiscriminately used as a simple adaptation strategy. Here, we empirically evaluate when and how (not) to use jackknifing in parsing. On 26 languages, we reveal a preference that conflicts with, and surpasses the ubiquitous ten-folding. We show no cl...

  12. SHMT2 drives glioma cell survival in the tumor microenvironment but imposes a dependence on glycine clearance

    Science.gov (United States)

    Kim, Dohoon; Fiske, Brian P.; Birsoy, Kivanc; Freinkman, Elizaveta; Kami, Kenjiro; Possemato, Richard; Chudnovsky, Yakov; Pacold, Michael E.; Chen, Walter W.; Cantor, Jason R.; Shelton, Laura M.; Gui, Dan Y.; Kwon, Manjae; Ramkissoon, Shakti H.; Ligon, Keith L.; Kang, Seong Woo; Snuderl, Matija; Heiden, Matthew G. Vander; Sabatini, David M.

    2015-01-01

    SUMMARY Cancer cells adapt their metabolic processes to support rapid proliferation, but less is known about how cancer cells alter metabolism to promote cell survival in a poorly vascularized tumor microenvironment1–3. Here, we identify a key role for serine and glycine metabolism in the survival of brain cancer cells within the ischemic zones of gliomas. In human glioblastoma multiforme (GBM), mitochondrial serine hydroxymethyltransferase (SHMT2) and glycine decarboxylase (GLDC) are highly expressed in the pseudopalisading cells that surround necrotic foci. We find that SHMT2 activity limits that of pyruvate kinase (PKM2) and reduces oxygen consumption, eliciting a metabolic state that confers a profound survival advantage to cells in poorly vascularized tumor regions. GLDC inhibition impairs cells with high SHMT2 levels as the excess glycine not metabolized by GLDC can be converted to the toxic molecules aminoacetone and methylglyoxal. Thus, SHMT2 is required for cancer cells to adapt to the tumor environment, but also renders these cells sensitive to glycine cleavage system inhibition. PMID:25855294

  13. EIF2A-dependent translational arrest protects leukemia cells from the energetic stress induced by NAMPT inhibition

    International Nuclear Information System (INIS)

    Zucal, Chiara; D’Agostino, Vito G.; Casini, Antonio; Mantelli, Barbara; Thongon, Natthakan; Soncini, Debora; Caffa, Irene; Cea, Michele; Ballestrero, Alberto; Quattrone, Alessandro; Indraccolo, Stefano; Nencioni, Alessio; Provenzani, Alessandro

    2015-01-01

    Nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting enzyme in NAD + biosynthesis from nicotinamide, is one of the major factors regulating cancer cells metabolism and is considered a promising target for treating cancer. The prototypical NAMPT inhibitor FK866 effectively lowers NAD + levels in cancer cells, reducing the activity of NAD + -dependent enzymes, lowering intracellular ATP, and promoting cell death. We show that FK866 induces a translational arrest in leukemia cells through inhibition of MTOR/4EBP1 signaling and of the initiation factors EIF4E and EIF2A. Specifically, treatment with FK866 is shown to induce 5′AMP-activated protein kinase (AMPK) activation, which, together with EIF2A phosphorylation, is responsible for the inhibition of protein synthesis. Notably, such an effect was also observed in patients’ derived primary leukemia cells including T-cell Acute Lymphoblastic Leukemia. Jurkat cells in which AMPK or LKB1 expression was silenced or in which a non-phosphorylatable EIF2A mutant was ectopically expressed showed enhanced sensitivity to the NAMPT inhibitor, confirming a key role for the LKB1-AMPK-EIF2A axis in cell fate determination in response to energetic stress via NAD + depletion. We identified EIF2A phosphorylation as a novel early molecular event occurring in response to NAMPT inhibition and mediating protein synthesis arrest. In addition, our data suggest that tumors exhibiting an impaired LBK1- AMPK- EIF2A response may be especially susceptible to NAMPT inhibitors and thus become an elective indication for this type of agents. The online version of this article (doi:10.1186/s12885-015-1845-1) contains supplementary material, which is available to authorized users

  14. Thanks, but No Thanks: Women's Avoidance of Help-Seeking in the Context of a Dependency-Related Stereotype

    Science.gov (United States)

    Wakefield, Juliet R. H.; Hopkins, Nick; Greenwood, Ronni M.

    2012-01-01

    The stereotype that women are dependent on men is a commonly verbalized, potentially damaging aspect of benevolent sexism. We investigated how women may use behavioral disconfirmation of the personal applicability of the stereotype to negotiate such sexism. In an experiment (N = 86), we manipulated female college students' awareness that women may…

  15. Application of global rainbow technique in sprays with a dependence of the refractive index on droplet size

    Science.gov (United States)

    Saengkaew, S.; Bodoc, V.; Lavergne, G.; Grehan, G.

    2013-01-01

    In liquid combustion, the evaporation process is one of the key parameters which controls combustion efficiency. To understand the combustion process, and to be able to develop an efficient combustor which produces less pollutant, it is necessary to be able to measure evaporation properties. Several techniques exist to measure the physical properties of fuel droplets, but very few exist to measure the thermo-chemical properties. The global rainbow technique (GRT) has been proposed and successfully used to measure the average temperature and the size distribution of sprays under the assumption that all the droplets are at the same temperature. This paper explores the applicability of GRT to sprays where the refractive index is a function of the particle size. A first result proves that the refractive index measured by GRT is weighted by the droplet diameter to the power of 7/3. This result permits accurate and fast comparisons between the numerical simulations and the experiments. A second result is the measurement of the refractive index by the size class by coupling GRT and Phase Doppler Anemometry (PDA) measurements (or another measurement technique with a low sensitivity to the refractive index such as holography, diffractometry, etc).

  16. A dependência da política: Fernando Henrique Cardoso e a sociologia no Brasil

    Directory of Open Access Journals (Sweden)

    Afrânio Garcia Jr.

    2004-06-01

    Full Text Available Este artigo analisa a trajetória social, intelectual e profissional de Fernando Henrique Cardoso para entender os diferentes recursos sociais e disposições pessoais utilizados em sua carreira como sociólogo e em suas atividades como especialista da política. Busca demonstrar que os capitais sociais e as disposições responsáveis pelo prestígio como pesquisador e professor de ciências sociais foram distintos dos aplicados no domínio da política, permitindo sua rápida ascensão à presidência da República. Depois de estudar suas origens familiares, focaliza seus investimentos escolares e a escolha do ofício de sociólogo, a carreira promissora sendo bloqueada pelo golpe de 1964. O exílio permitiu a extensão das atividades e o reconhecimento internacional, reinvestidos em novo concurso para a USP; o AI-5 o conduzirá à dupla condição de cientista social e de um dos líderes da frente de oposições aos militares. Por fim, analisa-se a reconversão de seus recursos sociais e pessoais na profissão política.This article analyzes Fernando Henrique Cardoso's social, intellectual and professional trajectory in order to understand the different social resources and personal dispositions carried out in his career as sociologist or in his activities as a professional politician. It seeks to prove that the social capitals and the dispositions that might explain his prestige as researcher and professor of social sciences were very different from those required in the political domain, the ones allowing his fast rise to be the president of the Republic. After having examined his family origins, it focuses his scholar investments and the choice of the sociologist's occupation, a promising career suddenly blocked by the 1964 military coup. The exile encouraged new initiatives and brought him international appraisal, this moment being crowned with his access to the chair of political science at the University of São Paulo; the AI-5 enforced by the military rulers will enable him to assume a double condition, as social scientist and as an important opposition leader facing the military. Finally, it analyzes how he was able to reconvert his social and personal resources into the political profession.

  17. Ghrelin Partially Protects Against Cisplatin-Induced Male Murine Gonadal Toxicity in a GHSR-1a-Dependent Manner1

    Science.gov (United States)

    Whirledge, Shannon D.; Garcia, Jose M.; Smith, Roy G.; Lamb, Dolores J.

    2015-01-01

    ABSTRACT The chemotherapeutic drug cisplatin causes a number of dose-dependent side effects, including cachexia and testicular damage. Patients receiving a high cumulative dose of cisplatin may develop permanent azoospermia and subsequent infertility. Thus, the development of chemotherapeutic regimens with the optimal postsurvival quality of life (fertility) is of high importance. This study tested the hypothesis that ghrelin administration can prevent or minimize cisplatin-induced testicular damage and cachexia. Ghrelin and its receptor, the growth hormone secretagogue receptor (GHSR-1a), are expressed and function in the testis. Targeted deletion of ghrelin, or its receptor, significantly increases the rate of cell death in the testis, suggesting a protective role. Intraperitoneal administration of vehicle, ghrelin, or cisplatin alone or in combination with ghrelin, in cycles of 9 or 18 days, to adult male C57Bl/6 mice was performed. Body weight was measured daily and testicular and epididymal weight, sperm density and motility, testicular histology, and testicular cell death were analyzed at the time of euthanization. Ghrelin coadministration decreased the severity of cisplatin-induced cachexia and gonadal toxicity. Body, testicular, and epididymal weights significantly increased as testicular cell death decreased with ghrelin coadministration. The widespread damage to the seminiferous epithelium induced by cisplatin administration was less severe in mice simultaneously treated with ghrelin. Furthermore, ghrelin diminished the deleterious effects of cisplatin on testis and body weight homeostasis in wild-type but not Ghsr−/− mice, showing that ghrelin's actions are mediated via GHSR. Ghrelin or more stable GHSR agonists potentially offer a novel therapeutic approach to minimize the testicular damage that occurs after gonadotoxin exposure. PMID:25631345

  18. Mass-metallicity relation explored with CALIFA I. Is there a dependence on the star-formation rate?

    Czech Academy of Sciences Publication Activity Database

    Sánchez, Sebastián F.; Rosales-Ortega, F.F.; Jungwiert, Bruno; Iglesias-Paramo, J.; Vílchez, J.M.; Marino, R.A.; Walcher, C.J.; Husemann, B.; Mast, D.; Monreal-Ibero, A.

    2013-01-01

    Roč. 554, June (2013), A58/1-A58/19 ISSN 0004-6361 Grant - others:Rada Programu interní podpory projektů mezinárodní spolupráce AV ČR(CZ) M100031201; Rada Programu interní podpory projektů mezinárodní spolupráce AV ČR(CZ) M100031241 Program:M Institutional support: RVO:67985815 Keywords : galaxies * ISM * undamental parameters Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 4.479, year: 2013

  19. Snf1 Phosphorylates Adenylate Cyclase and Negatively Regulates Protein Kinase A-dependent Transcription in Saccharomyces cerevisiae.

    Science.gov (United States)

    Nicastro, Raffaele; Tripodi, Farida; Gaggini, Marco; Castoldi, Andrea; Reghellin, Veronica; Nonnis, Simona; Tedeschi, Gabriella; Coccetti, Paola

    2015-10-09

    In eukaryotes, nutrient availability and metabolism are coordinated by sensing mechanisms and signaling pathways, which influence a broad set of cellular functions such as transcription and metabolic pathways to match environmental conditions. In yeast, PKA is activated in the presence of high glucose concentrations, favoring fast nutrient utilization, shutting down stress responses, and boosting growth. On the contrary, Snf1/AMPK is activated in the presence of low glucose or alternative carbon sources, thus promoting an energy saving program through transcriptional activation and phosphorylation of metabolic enzymes. The PKA and Snf1/AMPK pathways share common downstream targets. Moreover, PKA has been reported to negatively influence the activation of Snf1/AMPK. We report a new cross-talk mechanism with a Snf1-dependent regulation of the PKA pathway. We show that Snf1 and adenylate cyclase (Cyr1) interact in a nutrient-independent manner. Moreover, we identify Cyr1 as a Snf1 substrate and show that Snf1 activation state influences Cyr1 phosphorylation pattern, cAMP intracellular levels, and PKA-dependent transcription. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. A-dependence for the charmed meson production; Dependencia em A para a producao de mesons charmosos

    Energy Technology Data Exchange (ETDEWEB)

    Alves, Gilvan Augusto

    1992-03-01

    A report is presented of a recent direct measurement of the nucleon number ({lambda}) dependence of the production cross sections for the charmed mesons D{sup 0} and D{sup +} using {pi}{sup +-} beams incident on a segmented target of Be, Al, Cu and W. The data derive from the experiment E769 - Hadroproduction of Charm - at Fermilab. The experimental apparatus is described together with the following analysis. Starting from a sample of {approx} 1500 D mesons in the range of O < X{sub F} < 1, the data are found to be well described by the parameterization {sigma}{sub A} = {sigma}{sub O} A{sup {alpha}}, with {alpha} = 0.99 {+-} 0.03. The X{sub F} dependence of {alpha} is examined and the results obtained are compared with those of other experiments and with theoretical expectations based on perturbative QCD and on an EMC like model of nuclear shadowing. (author). 85 refs, 61 figs, 22 tabs.

  1. Investigation of the Mössbauer Spectrum Quality as a Dependence on the Frequency of the Velocity Signal

    Science.gov (United States)

    Pechousek, J.; Prochazka, R.; Cuda, J.; Frydrych, J.; Jancik, D.

    2010-07-01

    This paper is focused on a quality characterizing the Mössbauer spectra measured for various frequencies of the velocity signal. Standard electromechanical double-loudspeaker drive and digital PID velocity controller were used for calibration spectra measurement in the frequency interval from 4 up to 100 Hz. Several parameters were evaluated for recommendation of the suitable velocity signal frequency.

  2. On the A-dependence of {sigma}{sub L}/{sigma}{sub T}: Skeletons in the shadow

    Energy Technology Data Exchange (ETDEWEB)

    Milana, J. [Univ. of Maryland, College Park (United States)

    1994-04-01

    A most counter-intuitive dependence in the differential cross-section in the shadowing regime is shown to result from a higher-twist nuclear enhancement in R = {sigma}{sub L}/{sigma}{sub T} which severely complicates the unravelling from present data the corresponding dependence in Q{sup 2} of the nuclear structure functions, F{sub 2}{sup A}(x,Q{sup 2}). Indeed, until precision measurements close this loophole, the extrapolations of the structure functions to either higher Q{sup 2} or other processes (as is necessary to address present data at FNAL or future experiments at RHIC) must be considered problematic. The contribution CEBAF can make in this regard by providing systematic determination of R{sub A}(x, Q{sup 2}) is thus emphasized. The purpose of this talk is to motivate an experiment CEBAF can and should do, especially if upgraded to higher energies. While providing information on nuclear structure that is interesting in itself, the added motivation is that precision results will have important impact on other high-energy experiments involving nuclear targets that have been, and will continue to be done all over the world.

  3. Sex-biased dispersal creates spatial genetic structure in a parthenogenetic ant with a dependent-lineage reproductive system.

    Science.gov (United States)

    Kuhn, A; Bauman, D; Darras, H; Aron, S

    2017-10-01

    Reproduction and dispersal are key aspects of species life history that influence spatial genetic structure in populations. Several ant species in the genus Cataglyphis have evolved a unique breeding system in which new reproductives (that is, queens and males) are produced asexually by parthenogenesis; in contrast, non-reproductives (that is, workers) are produced via sexual reproduction by mates from distinct genetic lineages. We investigated how these two coexisting reproductive methods affect population-level spatial genetic structure using the ant Cataglyphis mauritanica as a model. We obtained genotypes for queens and their male mates from 338 colonies, and we found that the two lineages present in the study population occurred with equal frequency. Furthermore, analysis of spatial genetic structure revealed strong sex-biased dispersal. Because queens were produced by parthenogenesis and because they dispersed over short distances, there was an extreme level of spatial structuring: a mosaic of patches composed of clonal queens was formed. Males, on the other hand, dispersed over several hundred metres and, thus, across patches, ensuring successful interlineage mating.

  4. Long-chain acyl-CoA-dependent regulation of gene expression in bacteria, yeast and mammals

    DEFF Research Database (Denmark)

    Black, P N; Færgeman, Nils J.; DiRusso, C C

    2000-01-01

    ). Both repression and activation are dependent upon the function of either of the acyl-CoA synthetases Faa1p or Faa4p. In mammals, purified hepatocyte nuclear transcription factor 4alpha (HNF-4alpha) like E. coli FadR, binds long chain acyl-CoA directly. Coexpression of HNF-4alpha and acyl-CoA synthetase...

  5. Utilization of dE/dx approx E sup n /a dependence for DELTA E - E-spectrometer calibration

    CERN Document Server

    Gorpinich, O K; Jachmenov, O O

    2002-01-01

    The method of calibration of DELTA E - E-spectrometers by the use of known empiric form dE/dx approx E sup n /a which describes the specific energy loss of charge particles in the matter for energy calibration of DELTA E - E-spectrometer was designed.

  6. Opioid withdrawal increases transient receptor potential vanilloid 1 activity in a protein kinase A-dependent manner.

    Science.gov (United States)

    Spahn, Viola; Fischer, Oliver; Endres-Becker, Jeannette; Schäfer, Michael; Stein, Christoph; Zöllner, Christian

    2013-04-01

    Hyperalgesia is a cardinal symptom of opioid withdrawal. The transient receptor potential vanilloid 1 (TRPV1) is a ligand-gated ion channel expressed on sensory neurons responding to noxious heat, protons, and chemical stimuli such as capsaicin. TRPV1 can be inhibited via μ-opioid receptor (MOR)-mediated reduced activity of adenylyl cyclases (ACs) and decreased cyclic adenosine monophosphate (cAMP) levels. In contrast, opioid withdrawal following chronic activation of MOR uncovers AC superactivation and subsequent increases in cAMP and protein kinase A (PKA) activity. Here we investigated (1) whether an increase in cAMP during opioid withdrawal increases the activity of TRPV1 and (2) how opioid withdrawal modulates capsaicin-induced nocifensive behavior in rats. We applied whole-cell patch clamp, microfluorimetry, cAMP assays, radioligand binding, site-directed mutagenesis, and behavioral experiments. Opioid withdrawal significantly increased cAMP levels and capsaicin-induced TRPV1 activity in both transfected human embryonic kidney 293 cells and dissociated dorsal root ganglion (DRG) neurons. Inhibition of AC and PKA, as well as mutations of the PKA phosphorylation sites threonine 144 and serine 774, prevented the enhanced TRPV1 activity. Finally, capsaicin-induced nocifensive behavior was increased during opioid withdrawal in vivo. In summary, our results demonstrate an increased activity of TRPV1 in DRG neurons as a new mechanism contributing to opioid withdrawal-induced hyperalgesia. Copyright © 2013 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved.

  7. SIRT1/PGC1a-dependent increase in oxidative phosphorylation supports chemotherapy resistance of colon cancer

    NARCIS (Netherlands)

    Vellinga, T.T.; Borovski, T.; Boer, de V.C.J.; Kranenburg, O.

    2015-01-01

    PURPOSE:
    Chemotherapy treatment of metastatic colon cancer ultimately fails due to development of drug resistance. Identification of chemotherapy-induced changes in tumor biology may provide insight into drug resistance mechanisms.
    EXPERIMENTAL DESIGN:
    We studied gene expression

  8. A single arginine residue is required for the interaction of the electron transferring flavoprotein (ETF) with three of its dehydrogenase partners.

    Science.gov (United States)

    Parker, Antony R

    2003-12-01

    The interaction of several dehydrogenases with the electron transferring flavoprotein (ETF) is a crucial step required for the successful transfer of electrons into the electron transport chain. The exact determinants regarding the interaction of ETF with its dehydrogenase partners are still unknown. Chemical modification of ETF with arginine-specific reagents resulted in the loss, to varying degrees, of activity with medium chain acyl-coenzyme A dehydrogenase (MCAD). The kinetic profiles showed the inactivations followed pseudo-first-order kinetics for all reagents used. For activity with MCAD, maximum inactivation of ETF was accomplished by 2,3-butanedione (4% residual activity after 120 min) and it was shown that modification of one arginine residue was responsible for the inactivation. Almost 100% restoration of this ETF activity was achieved upon incubation with free arginine. However, the same 2,3-butanedione modified ETF only possessed decreased activity with dimethylglycine-(DMGDH, 44%) and sarcosine- (SDH, 27%) dehydrogenases unlike the abolition with MCAD. Full protection of ETF from arginine modification by 2,3-butanedione was achieved using substrate-protected DMGDH, MCAD and SDH respectively. Cross-protection studies of ETF with the three dehydrogenases implied use of the same single arginine residue in the binding of all three dehydrogenases. These results lead us to conclude that this single arginine residue is essential in the binding of the ETF to MCAD, but only contributes partially to the binding of ETF to SDH and DMGDH and thus, the determinants of the dehydrogenase binding sites overlap but are not identical.

  9. Disrupted fat distribution and composition due to medium-chain triglycerides in mice with a β-oxidation defect.

    Science.gov (United States)

    Tucci, Sara; Flögel, Ulrich; Sturm, Marga; Borsch, Elena; Spiekerkoetter, Ute

    2011-08-01

    Because of the enhanced recognition of inherited long-chain fatty acid oxidation disorders by worldwide newborn screening programs, an increasing number of asymptomatic patients receive medium-chain triglyceride (MCT) supplements to prevent the development of cardiomyopathy and myopathy. MCT supplementation has been recognized as a safe dietary intervention, but long-term observations into later adulthood are still not available. We investigated the consequences of a prolonged MCT diet on abdominal fat distribution and composition and on liver fat. Mice with very-long-chain acyl-coenzyme A dehydrogenase deficiency (VLCAD(-/-)) were supplemented for 1 y with a diet in which MCTs replaced long-chain triglycerides without increasing the total fat content. The dietary effects on abdominal fat accumulation and composition were analyzed by in vivo (1)H- and (13)C-magnetic resonance spectroscopy (9.4 Tesla). After 1 y of MCT supplementation, VLCAD(-/-) mice accumulated massive visceral fat and had a dramatic increase in the concentration of serum free fatty acids. Furthermore, we observed a profound shift in body triglyceride composition, ie, concentrations of physiologically important polyunsaturated fatty acids dramatically decreased. (1)H-Magnetic resonance spectroscopy analysis and histologic evaluation of the liver also showed pronounced fat accumulation and marked oxidative stress. Although the MCT-supplemented diet has been reported to prevent the development of cardiomyopathy and skeletal myopathy in fatty acid oxidation disorders, our data show that long-term MCT supplementation results in a severe clinical phenotype similar to that of nonalcoholic steatohepatitis and the metabolic syndrome.

  10. Orphan drugs in development for long-chain fatty acid oxidation disorders: challenges and progress

    Directory of Open Access Journals (Sweden)

    Sun A

    2015-04-01

    Full Text Available Angela Sun, J Lawrence Merritt II Department of Pediatrics, University of Washington, Seattle, WA, USA Abstract: Fatty acid oxidation disorders are inborn errors of metabolism resulting in failure of ß-oxidation within or transport of fatty acids into the mitochondria. The long-chain fatty acid oxidation disorders are characterized by variable presentations ranging from newborn cardiomyopathy, to infantile hypoketotic hypoglycemia resulting from liver involvement, to skeletal myopathy often resulting in rhabdomyolysis in adolescents and adults. Treatments for these long-chain fatty acid oxidation disorders have typically focused upon avoidance of fasting with dietary fat restriction and medium-chain triglyceride supplementation. These treatments have resulted in only a partial response with improvements in hypoglycemia, reduction in frequency of rhabdomyolysis, and improvement in cardiomyopathy with early therapy, but significant risk remains. Recent advances in therapies for long-chain fatty acid oxidation disorders are reviewed in this article. These include sodium D,L-3-hydroxybutyrate, triheptanoin, gene therapy, and bezafibrates. Sodium D,L-3-hydroxybutyrate has shown clinical effect, with improvements in muscle tone, neurological abnormalities, and some cases of cardiomyopathy and leukodystrophy. Triheptanoin has been used as an alternative medium-chain triglyceride in a number of fatty acid oxidation disorders and has shown promising findings in the treatment of cardiomyopathy and hypoglycemia. However, it does not significantly reduce episodes of rhabdomyolysis. Gene therapy has been shown to improve acylcarnitine levels in very-long-chain acyl-coenzyme A dehydrogenase deficiency mouse models, with preservation of glucose levels. Bezafibrates have shown improvements in acylcarnitine concentrations in fibroblast studies, but clinical observations have not demonstrated consistent effects. Together, these treatments have shown some

  11. Analysis of lipid profile in lipid storage myopathy.

    Science.gov (United States)

    Aguennouz, M'hammed; Beccaria, Marco; Purcaro, Giorgia; Oteri, Marianna; Micalizzi, Giuseppe; Musumesci, Olimpia; Ciranni, Annmaria; Di Giorgio, Rosa Maria; Toscano, Antonio; Dugo, Paola; Mondello, Luigi

    2016-09-01

    Lipid dysmetabolism disease is a condition in which lipids are stored abnormally in organs and tissues throughout the body, causing muscle weakness (myopathy). Usually, the diagnosis of this disease and its characterization goes through dosage of Acyl CoA in plasma accompanied with evidence of droplets of intra-fibrils lipids in the patient muscle biopsy. However, to understand the pathophysiological mechanisms of lipid storage diseases, it is useful to identify the nature of lipids deposited in muscle fiber. In this work fatty acids and triglycerides profile of lipid accumulated in the muscle of people suffering from myopathies syndromes was characterized. In particular, the analyses were carried out on the muscle biopsy of people afflicted by lipid storage myopathy, such as multiple acyl-coenzyme A dehydrogenase deficiency, and neutral lipid storage disease with myopathy, and by the intramitochondrial lipid storage dysfunctions, such as deficiencies of carnitine palmitoyltransferase II enzyme. A single step extraction and derivatization procedure was applied to analyze fatty acids from muscle tissues by gas chromatography with a flame ionization detector and with an electronic impact mass spectrometer. Triglycerides, extracted by using n-hexane, were analyzed by high performance liquid chromatography coupled to mass spectrometer equipped with an atmospheric pressure chemical ionization interface. The most representative fatty acids in all samples were: C16:0 in the 13-24% range, C18:1n9 in the 20-52% range, and C18:2n6 in the 10-25% range. These fatty acids were part of the most representative triglycerides in all samples. The data obtained was statistically elaborated performing a principal component analysis. A satisfactory discrimination was obtained among the different diseases. Using component 1 vs component 3 a 43.3% of total variance was explained. Such results suggest the important role that lipid profile characterization can have in supporting a correct

  12. Reveal genes functionally associated with ACADS by a network study.

    Science.gov (United States)

    Chen, Yulong; Su, Zhiguang

    2015-09-15

    Establishing a systematic network is aimed at finding essential human gene-gene/gene-disease pathway by means of network inter-connecting patterns and functional annotation analysis. In the present study, we have analyzed functional gene interactions of short-chain acyl-coenzyme A dehydrogenase gene (ACADS). ACADS plays a vital role in free fatty acid β-oxidation and regulates energy homeostasis. Modules of highly inter-connected genes in disease-specific ACADS network are derived by integrating gene function and protein interaction data. Among the 8 genes in ACADS web retrieved from both STRING and GeneMANIA, ACADS is effectively conjoined with 4 genes including HAHDA, HADHB, ECHS1 and ACAT1. The functional analysis is done via ontological briefing and candidate disease identification. We observed that the highly efficient-interlinked genes connected with ACADS are HAHDA, HADHB, ECHS1 and ACAT1. Interestingly, the ontological aspect of genes in the ACADS network reveals that ACADS, HAHDA and HADHB play equally vital roles in fatty acid metabolism. The gene ACAT1 together with ACADS indulges in ketone metabolism. Our computational gene web analysis also predicts potential candidate disease recognition, thus indicating the involvement of ACADS, HAHDA, HADHB, ECHS1 and ACAT1 not only with lipid metabolism but also with infant death syndrome, skeletal myopathy, acute hepatic encephalopathy, Reye-like syndrome, episodic ketosis, and metabolic acidosis. The current study presents a comprehensible layout of ACADS network, its functional strategies and candidate disease approach associated with ACADS network. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. ACSL1 Is Associated With Fetal Programming of Insulin Sensitivity and Cellular Lipid Content.

    Science.gov (United States)

    Joseph, Roy; Poschmann, Jeremie; Sukarieh, Rami; Too, Peh Gek; Julien, Sofi G; Xu, Feng; Teh, Ai Ling; Holbrook, Joanna D; Ng, Kai Lyn; Chong, Yap Seng; Gluckman, Peter D; Prabhakar, Shyam; Stünkel, Walter

    2015-06-01

    Individuals who are born small for gestational age (SGA) have a risk to develop various metabolic diseases during their life course. The biological memory of the prenatal state of growth restricted individuals may be reflected in epigenetic alterations in stem cell populations. Mesenchymal stem cells (MSCs) from the Wharton's jelly of umbilical cord tissue are multipotent, and we generated primary umbilical cord MSC isolates from SGA and normal neonates, which were subsequently differentiated into adipocytes. We established chromatin state maps for histone marks H3K27 acetylation and H3K27 trimethylation and tested whether enrichment of these marks was associated with gene expression changes. After validating gene expression levels for 10 significant chromatin immunoprecipitation sequencing candidate genes, we selected acyl-coenzyme A synthetase 1 (ACSL1) for further investigations due to its key roles in lipid metabolism. The ACSL1 gene was found to be highly associated with histone acetylation in adipocytes differentiated from MSCs with SGA background. In SGA-derived adipocytes, the ACSL1 expression level was also found to be associated with increased lipid loading as well as higher insulin sensitivity. ACSL1 depletion led to changes in expression of candidate genes such as proinflammatory chemokines and down-regulated both, the amount of cellular lipids and glucose uptake. Increased ACSL1, as well as modulated downstream candidate gene expression, may reflect the obese state, as detected in mice fed a high-fat diet. In summary, we believe that ACSL1 is a programmable mediator of insulin sensitivity and cellular lipid content and adipocytes differentiated from Wharton's jelly MSCs recapitulate important physiological characteristics of SGA individuals.

  14. Anti-diabetic potential of the essential oil of Pinus koraiensis leaves toward streptozotocin-treated mice and HIT-T15 pancreatic β cells.

    Science.gov (United States)

    Joo, Hye-Eun; Lee, Hyo-Jung; Sohn, Eun Jung; Lee, Min-Ho; Ko, Hyun-Suk; Jeong, Soo-Jin; Lee, Hyo-Jeong; Kim, Sung-Hoon

    2013-01-01

    The metabolic syndrome creates risk factors for coronary heart disease, diabetes, fatty liver, obesity and several cancers. Our group has already reported that the essential oil from leaves of Pinus koraiensis SIEB (EOPK) exerted antihyperlipidemic effects by upregulating the low-density lipoprotein receptor and inhibiting acyl-coenzyme A, cholesterol acyltransferases. We evaluated in the current study the anti-diabetic effects of EOPK on mice with streptozotocin (STZ)-induced type I diabetes and on HIT-T15 pancreatic β cells. EOPK significantly protected HIT-T15 cells from STZ-induced cytotoxicity and reduced the blood glucose level in STZ-induced diabetic mice when compared with the untreated control. EOPK consistently and significantly suppressed the α-amylase activity in a dose-dependent manner and enhanced the expression of insulin at the mRNA level in STZ-treated HIT-T15 cells, while the expression of insulin was attenuated. EOPK also significantly abrogated the population of reactive oxygen species when compared to the untreated control in STZ-treated HIT-T15 cells. Furthermore, EOPK significantly reduce nitric oxide production, suppressed the phosphorylation of endothelial nitric oxide (NO) synthase and suppressed the production of vascular endothelial growth factor (VEGF) in STZ-treated HIT-T15 cells, implying its potential application to diabetic retinopathy. Overall, our findings suggest that EOPK had hypoglycemic potential by inhibiting reactive oxygene species (ROS), endothelial NO synthase (eNOS) and VEGF in STZ-treated mice and HIT-T15 pancreatic β cells as a potent anti-diabetic agent.

  15. The acyl-CoA binding protein affects Monascus pigment production in Monascus ruber CICC41233.

    Science.gov (United States)

    Long, Chuannan; Liu, Mengmeng; Chen, Xia; Wang, Xiaofang; Ai, Mingqiang; Cui, Jingjing; Zeng, Bin

    2018-02-01

    The present study verified whether acyl-coenzyme A (acyl-CoA)-binding protein (ACBP) affected the production of Monascus pigments (MPs) in Monascus ruber CICC41233 (MrACBP). Phylogenetic analysis revealed that the cloned Mracbp gene, which encoded the MrACBP protein, exhibited the closest match (99% confidence level) to the gene from Penicilliopsis zonata . The MrACBP and maltose-binding protein (MBP) were simultaneously expressed in Escherichia coli Rosetta DE3 in the form of a fusion protein. The microscale thermophoresis binding assay revealed that the purified MBP-MrACBP exhibited a higher affinity for myristoyl-CoA (Kd = 88.16 nM) than for palmitoyl-CoA (Kd = 136.07 nM) and octanoyl-CoA (Kd = 270.9 nM). Further, the Mracbp gene was homologously overexpressed in M. ruber CICC41233, and a positive transformant M. ruber ACBP5 was isolated. The fatty acid myristic acid in M. ruber ACBP5 was lower than that in the parent strain M. ruber CICC41233. However, when compared with the parent strain, the production of total MPs, water-soluble pigment, and ethanol-soluble pigment in M. ruber ACBP5 increased by 11.67, 9.80, and 12.70%, respectively, after 6 days. The relative gene expression level, as determined by a quantitative real-time polymerase chain reaction analysis, of the key genes acbp , pks , mppr1 , fasA , and fasB increased by 4.03-, 3.58-, 1.67-, 2.11-, and 2.62-fold after 6 days. These data demonstrate the binding preference of MrACBP for myristoyl-CoA, and its influence on MPs production.

  16. Decreased liver triglyceride content in adult rats exposed to protein restriction during gestation and lactation: role of hepatic triglyceride utilization.

    Science.gov (United States)

    Qasem, Rani J; Li, Jing; Tang, Hee Man; Browne, Veron; Mendez-Garcia, Claudia; Yablonski, Elizabeth; Pontiggia, Laura; D'Mello, Anil P

    2015-04-01

    We have previously demonstrated that protein restriction throughout gestation and lactation reduces liver triglyceride content in adult rat offspring. However, the mechanisms mediating the decrease in liver triglyceride content are not understood. The aim of the current study was to use a new group of pregnant animals and their offspring and determine the contribution of increased triglyceride utilization via the hepatic fatty-acid oxidation and triglyceride secretory pathways to the reduction in liver triglyceride content. Pregnant Sprague-Dawley rats received either a control or a low protein diet throughout pregnancy and lactation. Pups were weaned onto laboratory chow on day 28 and killed on day 65. Liver triglyceride content was reduced in male, but not female, low-protein offspring, both in the fed and fasted states. The reduction was accompanied by a trend towards higher liver carnitine palmitoyltransferase-1a activity, suggesting increased fatty-acid transport into the mitochondrial matrix. However, medium-chain acyl coenzyme A dehydrogenase activity within the mitochondrial matrix, expression of nuclear peroxisome proliferator activated receptor-α, and plasma levels of β-hydroxybutyrate were similar between low protein and control offspring, indicating a lack of change in fatty-acid oxidation. Hepatic triglyceride secretion, assessed by blocking peripheral triglyceride utilization and measuring serum triglyceride accumulation rate, and the activity of microsomal transfer protein, were similar between low protein and control offspring. Because enhanced triglyceride utilization is not a significant contributor, the decrease in liver triglyceride content in male low-protein offspring is likely due to alterations in liver fatty-acid transport or triglyceride biosynthesis. © 2015 Wiley Publishing Asia Pty Ltd.

  17. Newer antiatherosclerosis treatment strategies.

    Science.gov (United States)

    Aggarwal, Amitesh; Singh, Safal

    2011-01-01

    Atherosclerosis has been a target of much clinical and molecular research. As a result of this extensive research, it is amply clear that atherogenesis is a multifactorial process involving an interplay of metabolic, immune and inflammatory mechanisms. Antiatherosclerotic strategies are today aiming for a multipronged approach targeting each arm of this multifactorial process. The newer agents under development can be divided into three broad categories: anti-inflammatory agents, modulators of intermediary metabolism and antiatherosclerosis vaccines. Potential targets for anti-inflammatory agents include inhibition of conversion of low-density lipoprotein (LDL) to oxidised LDL, blocking or downregulation of cell adhesion molecules, chemokine modulation and macrophage receptor blockade. Beyond inhibition of plaque formation, efforts are also ongoing to develop agents which stabilise the plaque by increasing its fibrous content and inhibiting its disruption. So far as research in the sphere of intermediary metabolism is concerned, the focus is now primarily on raising high-density lipoprotein and promoting reverse cholesterol transport; potential targets include cholesteryl ester transfer protein, liver X-receptor, lecithin cholesterol acyltransferase and high-density lipoprotein mimetics. Acyl-coenzymeA: cholesterol acyltransferase is another enzyme whose selective and differential inhibition is under active investigation. The concept of immunisation against a non-communicable disease such as atherosclerosis is still in its nascent stages. However, with increasing evidence to suggest the role of antigen-specific T-cell-mediated immunity in atherogenesis, this approach is potentially promising. Possible antigens under evaluation include oxidised LDL and its subparticles, heat-shock proteins and cholesteryl ester transfer protein. With cardiovascular disease being the single leading cause of death worldwide, the development of a safe and successful antiatherosclerosis

  18. Nationwide survey of extended newborn screening by tandem mass spectrometry in Taiwan.

    Science.gov (United States)

    Niu, Dau-Ming; Chien, Yin-Hsiu; Chiang, Chuan-Chi; Ho, Hui-Chen; Hwu, Wuh-Liang; Kao, Shu-Min; Chiang, Szu-Hui; Kao, Chuan-Hong; Liu, Tze-Tze; Chiang, Hung; Hsiao, Kwang-Jen

    2010-10-01

    In Taiwan, during the period March 2000 to June 2009, 1,495,132 neonates were screened for phenylketonuria (PKU) and homocystinuria (HCU), and 1,321,123 neonates were screened for maple syrup urine disease (MSUD), methylmalonic academia (MMA), medium-chain acyl-coenzyme A (CoA) dehydrogenase (MCAD) deficiency, isovaleric academia (IVA), and glutaric aciduria type 1 (GA-1) using tandem mass spectrometry (MS/MS). In a pilot study, 592,717 neonates were screened for citrullinemia, 3-methylcrotonyl-CoA carboxylase deficiency (3-MCC) and other fatty acid oxidation defects in the MS/MS newborn screening. A total of 170 newborns and four mothers were confirmed to have inborn errors of metabolism. The overall incidence was approximately 1/5,882 (1/6,219 without mothers). The most common inborn errors were defects of phenylalanine metabolism [five classic PKU, 20 mild PKU, 40 mild hyperphenylalaninemia (HPA), and 13 6-pyruvoyl-tetrahydropterin synthase (PTPS) deficiency]. MSUD was the second most common amino acidopathy and, significantly, most MSUD patients (10/13) belonged to the Austronesian aboriginal tribes of southern Taiwan. The most frequently detected among organic acid disorders was 3-MCC deficiency (14 newborns and four mothers). GA-1 and MMA were the second most common organic acid disorders (13 and 13 newborns, respectively). In fatty acid disorders, five carnitine transport defect (CTD), five short-chain acyl-CoA dehydrogenase deficiency (SCAD), and two medium-chain acyl-CoA dehydrogenase (MCAD) deficiency were confirmed. This is the largest case of MS/MS newborn screening in an East-Asian population to date. We hereby report the incidences and outcomes of metabolic inborn error diseases found in our nationwide MS/MS newborn screening program.

  19. Butenolides from Streptomyces albus J1074 Act as External Signals To Stimulate Avermectin Production in Streptomyces avermitilis.

    Science.gov (United States)

    Nguyen, Thao Bich; Kitani, Shigeru; Shimma, Shuichi; Nihira, Takuya

    2018-05-01

    In streptomycetes, autoregulators are important signaling compounds that trigger secondary metabolism, and they are regarded as Streptomyces hormones based on their extremely low effective concentrations (nM) and the involvement of specific receptor proteins. Our previous distribution study revealed that butenolide-type Streptomyces hormones, including avenolide, are a general class of signaling molecules in streptomycetes and that Streptomyces albus strain J1074 may produce butenolide-type Streptomyces hormones. Here, we describe metabolite profiling of a disruptant of the S. albus aco gene, which encodes a key biosynthetic enzyme for butenolide-type Streptomyces hormones, and identify four butenolide compounds from S. albus J1074 that show avenolide activity. The compounds structurally resemble avenolide and show different levels of avenolide activity. A dual-culture assay with imaging mass spectrometry (IMS) analysis for in vivo metabolic profiling demonstrated that the butenolide compounds of S. albus J1074 stimulate avermectin production in another Streptomyces species, Streptomyces avermitilis , illustrating the complex chemical interactions through interspecies signals in streptomycetes. IMPORTANCE Microorganisms produce external and internal signaling molecules to control their complex physiological traits. In actinomycetes, Streptomyces hormones are low-molecular-weight signals that are key to our understanding of the regulatory mechanisms of Streptomyces secondary metabolism. This study reveals that acyl coenzyme A (acyl-CoA) oxidase is a common and essential biosynthetic enzyme for butenolide-type Streptomyces hormones. Moreover, the diffusible butenolide compounds from a donor Streptomyces strain were recognized by the recipient Streptomyces strain of a different species, resulting in the initiation of secondary metabolism in the recipient. This is an interesting report on the chemical interaction between two different streptomycetes via Streptomyces

  20. Neutral lipid biosynthesis in engineered Escherichia coli: jojoba oil-like wax esters and fatty acid butyl esters.

    Science.gov (United States)

    Kalscheuer, Rainer; Stöveken, Tim; Luftmann, Heinrich; Malkus, Ursula; Reichelt, Rudolf; Steinbüchel, Alexander

    2006-02-01

    Wax esters are esters of long-chain fatty acids and long-chain fatty alcohols which are of considerable commercial importance and are produced on a scale of 3 million tons per year. The oil from the jojoba plant (Simmondsia chinensis) is the main biological source of wax esters. Although it has a multitude of potential applications, the use of jojoba oil is restricted, due to its high price. In this study, we describe the establishment of heterologous wax ester biosynthesis in a recombinant Escherichia coli strain by coexpression of a fatty alcohol-producing bifunctional acyl-coenzyme A reductase from the jojoba plant and a bacterial wax ester synthase from Acinetobacter baylyi strain ADP1, catalyzing the esterification of fatty alcohols and coenzyme A thioesters of fatty acids. In the presence of oleate, jojoba oil-like wax esters such as palmityl oleate, palmityl palmitoleate, and oleyl oleate were produced, amounting to up to ca. 1% of the cellular dry weight. In addition to wax esters, fatty acid butyl esters were unexpectedly observed in the presence of oleate. The latter could be attributed to solvent residues of 1-butanol present in the medium component, Bacto tryptone. Neutral lipids produced in recombinant E. coli were accumulated as intracytoplasmic inclusions, demonstrating that the formation and structural integrity of bacterial lipid bodies do not require specific structural proteins. This is the first report on substantial biosynthesis and accumulation of neutral lipids in E. coli, which might open new perspectives for the biotechnological production of cheap jojoba oil equivalents from inexpensive resources employing recombinant microorganisms.

  1. Characterization of the Xylella fastidiosa PD1311 gene mutant and its suppression of Pierce's disease on grapevines.

    Science.gov (United States)

    Hao, Lingyun; Johnson, Kameka; Cursino, Luciana; Mowery, Patricia; Burr, Thomas J

    2017-06-01

    Xylella fastidiosa causes Pierce's disease (PD) on grapevines, leading to significant economic losses in grape and wine production. To further our understanding of X. fastidiosa virulence on grapevines, we examined the PD1311 gene, which encodes a putative acyl-coenzyme A (acyl-CoA) synthetase, and is highly conserved across Xylella species. It was determined that PD1311 is required for virulence, as the deletion mutant, ΔPD1311, was unable to cause disease on grapevines. The ΔPD1311 strain was impaired in behaviours known to be associated with PD development, including motility, aggregation and biofilm formation. ΔPD1311 also expressed enhanced sensitivity to H 2 O 2 and polymyxin B, and showed reduced survival in grapevine sap, when compared with wild-type X. fastidiosa Temecula 1 (TM1). Following inoculation, ΔPD1311 could not be detected in grape shoots, which may be related to its altered growth and sensitivity phenotypes. Inoculation with ΔPD1311 2 weeks prior to TM1 prevented the development of PD in a significant fraction of vines and eliminated detectable levels of TM1. In contrast, vines inoculated simultaneously with TM1 and ΔPD1311 developed disease at the same level as TM1 alone. In these vines, TM1 populations were distributed similarly to populations in TM1-only inoculated plants. These findings suggest that, through an indirect mechanism, pretreatment of vines with ΔPD1311 suppresses pathogen population and disease. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  2. Computational analysis of a novel mutation in ETFDH gene highlights its long-range effects on the FAD-binding motif

    Directory of Open Access Journals (Sweden)

    Chang Jan-Gowth

    2011-10-01

    Full Text Available Abstract Background Multiple acyl-coenzyme A dehydrogenase deficiency (MADD is an autosomal recessive disease caused by the defects in the mitochondrial electron transfer system and the metabolism of fatty acids. Recently, mutations in electron transfer flavoprotein dehydrogenase (ETFDH gene, encoding electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO have been reported to be the major causes of riboflavin-responsive MADD. To date, no studies have been performed to explore the functional impact of these mutations or their mechanism of disrupting enzyme activity. Results High resolution melting (HRM analysis and sequencing of the entire ETFDH gene revealed a novel mutation (p.Phe128Ser and the hotspot mutation (p.Ala84Thr from a patient with MADD. According to the predicted 3D structure of ETF:QO, the two mutations are located within the flavin adenine dinucleotide (FAD binding domain; however, the two residues do not have direct interactions with the FAD ligand. Using molecular dynamics (MD simulations and normal mode analysis (NMA, we found that the p.Ala84Thr and p.Phe128Ser mutations are most likely to alter the protein structure near the FAD binding site as well as disrupt the stability of the FAD binding required for the activation of ETF:QO. Intriguingly, NMA revealed that several reported disease-causing mutations in the ETF:QO protein show highly correlated motions with the FAD-binding site. Conclusions Based on the present findings, we conclude that the changes made to the amino acids in ETF:QO are likely to influence the FAD-binding stability.

  3. Effects of lipid-lowering pharmaceuticals bezafibrate and clofibric acid on lipid metabolism in fathead minnow (Pimephales promelas).

    Science.gov (United States)

    Weston, Anna; Caminada, Daniel; Galicia, Hector; Fent, Karl

    2009-12-01

    The lipid-lowering agents bezafibrate and clofibric acid, which occur at concentrations up to 3.1 and 1.6 microg/L, respectively, are among the most frequently found human pharmaceuticals in the aquatic environment. In contrast to knowledge about their environmental occurrence, little is known about their effects in the environment. The aim of the present study was to analyze effects of these lipid-lowering agents in fish by focusing on their modes of action, lipid metabolism. Fathead minnows were exposed in aquaria to measured concentrations of 0.1, 1.27, 10.18, 101.56, and 106.7 mg/L bezafibrate and to 1.07, 10.75, and 108.91 mg/L clofibric acid for 14 and 21 d, respectively. After exposure, fish liver was analyzed for expression of peroxisome proliferator-activated receptor alpha (PPARalpha) by quantitative polymerase chain reaction (PCR), and the PPAR-regulated enzyme fatty acyl-coenzyme-A oxidase (FAO) involved in fatty acid oxidation. Bezafibrate had no effect, either on PPARalpha expression or on FAO activity, at all concentrations. In contrast, clofibric acid induced FAO activity in male fathead minnows at 108.91 mg/L. No increase in expression of PPARalpha messenger ribonucleic acid was observed. Egg production was apparently decreased after 21 d of exposure to 108.91 mg/L clofibric acid. The present study demonstrates that bezafibrate has very little or no effect on PPARalpha expression and FAO activity, but clofibric acid affects FAO activity.

  4. A dynamic, mechanistic model of metabolism in adipose tissue of lactating dairy cattle.

    Science.gov (United States)

    McNamara, J P; Huber, K; Kenéz, A

    2016-07-01

    Research in dairy cattle biology has resulted in a large body of knowledge on nutrition and metabolism in support of milk production and efficiency. This quantitative knowledge has been compiled in several model systems to balance and evaluate rations and predict requirements. There are also systems models for metabolism and reproduction in the cow that can be used to support research programs. Adipose tissue plays a significant role in the success and efficiency of lactation, and recent research has resulted in several data sets on genomic differences and changes in gene transcription of adipose tissue in dairy cattle. To fully use this knowledge, we need to build and expand mechanistic, dynamic models that integrate control of metabolism and production. Therefore, we constructed a second-generation dynamic, mechanistic model of adipose tissue metabolism of dairy cattle. The model describes the biochemical interconversions of glucose, acetate, β-hydroxybutyrate (BHB), glycerol, C16 fatty acids, and triacylglycerols. Data gathered from our own research and published references were used to set equation forms and parameter values. Acetate, glucose, BHB, and fatty acids are taken up from blood. The fatty acids are activated to the acyl coenzyme A moieties. Enzymatically catalyzed reactions are explicitly described with parameters including maximal velocity and substrate sensitivity. The control of enzyme activity is partially carried out by insulin and norepinephrine, portraying control in the cow. Model behavior was adequate, with sensitive responses to changing substrates and hormones. Increased nutrient uptake and increased insulin stimulate triacylglycerol synthesis, whereas a reduction in nutrient availability or increase in norepinephrine increases triacylglycerol hydrolysis and free fatty acid release to blood. This model can form a basis for more sophisticated integration of existing knowledge and future studies on metabolic efficiency of dairy cattle

  5. The mechanisms underlying the hypolipidaemic effects of Grifola frondosa in the liver of rats

    Directory of Open Access Journals (Sweden)

    Yinrun Ding

    2016-08-01

    Full Text Available The present study investigated the hypolipidaemic effects of Grifola frondosa and its regulation mechanism involved in lipid metabolism in liver of rats fed a high-cholesterol diet. The body weights and serum lipid levels of control rats, of hyperlipidaemic rats and of hyperlipidaemic rats treated with oral Grifola frondosa were determined. mRNA expression and concentration of key lipid metabolism enzymes were investigated. Serum cholesterol, triacylglycerol and low-density lipoprotein cholesterol levels were markedly decreased in hyperlipidaemic rats treated with Grifola frondosa compared with untreated hyperlipidaemic rats. mRNA expression of 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR, acyl-coenzyme A: cholesterol acyltransferase (ACAT2, apolipoprotein B (ApoB, fatty acid synthase (FAS and acetyl-CoA carboxylase (ACC1 were significantly down-regulated, while expression of cholesterol 7-alpha-hydroxylase (CYP7A1 was significantly up-regulated in the livers of treated rats compared with untreated hyperlipidaemic rats. The concentrations of these enzymes also paralleled the observed changes in mRNA expression. Two-dimensional polyacrylamide gel electrophoresis (2-DE and Matrix-Assisted Laser Desorption/Ionization Time of Flight Mass Spectrometry (MALDI-TOF-MS were used to identify twenty proteins differentially expressed in livers of rats treated with Grifola frondosa compared with untreated hyperlipidemic rats. Of these twenty proteins, seven proteins were down-regulated and thirteen proteins were up-regulated. These findings indicate that the hypolipidaemic effects of Grifola frondosa reflected its modulation of key enzymes involved in cholesterol and triacylglycerol biosynthesis, absorption and catabolic pathways. Grifola frondosa may exert anti-atherosclerotic effects by inhibiting LDL oxidation through down-regulation and up-regulating proteins expression in the liver of rats. Therefore, Grifola frondosa may produce both hypolipidaemic

  6. The hexanoyl-CoA precursor for cannabinoid biosynthesis is formed by an acyl-activating enzyme in Cannabis sativa trichomes.

    Science.gov (United States)

    Stout, Jake M; Boubakir, Zakia; Ambrose, Stephen J; Purves, Randy W; Page, Jonathan E

    2012-08-01

    The psychoactive and analgesic cannabinoids (e.g. Δ(9) -tetrahydrocannabinol (THC)) in Cannabis sativa are formed from the short-chain fatty acyl-coenzyme A (CoA) precursor hexanoyl-CoA. Cannabinoids are synthesized in glandular trichomes present mainly on female flowers. We quantified hexanoyl-CoA using LC-MS/MS and found levels of 15.5 pmol g(-1) fresh weight in female hemp flowers with lower amounts in leaves, stems and roots. This pattern parallels the accumulation of the end-product cannabinoid, cannabidiolic acid (CBDA). To search for the acyl-activating enzyme (AAE) that synthesizes hexanoyl-CoA from hexanoate, we analyzed the transcriptome of isolated glandular trichomes. We identified 11 unigenes that encoded putative AAEs including CsAAE1, which shows high transcript abundance in glandular trichomes. In vitro assays showed that recombinant CsAAE1 activates hexanoate and other short- and medium-chained fatty acids. This activity and the trichome-specific expression of CsAAE1 suggest that it is the hexanoyl-CoA synthetase that supplies the cannabinoid pathway. CsAAE3 encodes a peroxisomal enzyme that activates a variety of fatty acid substrates including hexanoate. Although phylogenetic analysis showed that CsAAE1 groups with peroxisomal AAEs, it lacked a peroxisome targeting sequence 1 (PTS1) and localized to the cytoplasm. We suggest that CsAAE1 may have been recruited to the cannabinoid pathway through the loss of its PTS1, thereby redirecting it to the cytoplasm. To probe the origin of hexanoate, we analyzed the trichome expressed sequence tag (EST) dataset for enzymes of fatty acid metabolism. The high abundance of transcripts that encode desaturases and a lipoxygenase suggests that hexanoate may be formed through a pathway that involves the oxygenation and breakdown of unsaturated fatty acids. © 2012 National Research Council of Canada. The Plant Journal © 2012 Blackwell Publishing Ltd.

  7. Breeding of a sake yeast mutant with enhanced ethyl caproate productivity in sake brewing using rice milled at a high polishing ratio.

    Science.gov (United States)

    Takahashi, Toshinari; Ohara, Yusuke; Sueno, Kazuo

    2017-06-01

    Sake yeast produces a fruity flavor known as ginjo-ko-which is mainly attributable to ethyl caproate and isoamyl acetate-during fermentation in sake brewing. The production of these flavor components is inhibited by unsaturated fatty acids derived from the outer layer of rice as raw material. We isolated three mutants (hec2, hec3, and hec6) with enhanced ethyl caproate productivity in sake brewing using rice milled at a high polishing ratio from a cerulenin-resistant mutant derived from the hia1 strain, which shows enhanced isoamyl acetate productivity. The hec2 mutant had the homozygous FAS2 mutation Gly1250Ser, which is known to confer high ethyl caproate productivity. When the homozygous FAS2 mutation Gly1250Ser was introduced into strain hia1, ethyl caproate productivity was increased but neither this nor intracellular caproic acid content approached the levels observed in the hec2 mutant, indicating that a novel mutation was responsible for the high ethyl caproate productivity. We also found that the expression of EEB1 encoding acyl-coenzyme A:ethanol O-acyltransferase (AEATase) and enzymatic activity were increased in the hec2 mutant. These results suggest that the upregulation of EEB1 expression and AEATase activity may also have contributed to the enhancement of ethyl caproate synthesis from ethanol and caproyl-CoA. Our findings are useful for the brewing of sake with improved flavor due to high levels of isoamyl acetate and ethyl caproate. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  8. Acyl-CoA-Binding Protein ACBP1 Modulates Sterol Synthesis during Embryogenesis1[OPEN

    Science.gov (United States)

    Hsiao, An-Shan; Xue, Yan

    2017-01-01

    Fatty acids (FAs) and sterols are primary metabolites that exert interrelated functions as structural and signaling lipids. Despite their common syntheses from acetyl-coenzyme A, homeostatic cross talk remains enigmatic. Six Arabidopsis (Arabidopsis thaliana) acyl-coenzyme A-binding proteins (ACBPs) are involved in FA metabolism. ACBP1 interacts with PHOSPHOLIPASE Dα1 and regulates phospholipid composition. Here, its specific role in the negative modulation of sterol synthesis during embryogenesis is reported. ACBP1, likely in a liganded state, interacts with STEROL C4-METHYL OXIDASE1-1 (SMO1-1), a rate-limiting enzyme in the sterol pathway. Proembryo abortion in the double mutant indicated that the ACBP1-SMO1-1 interaction is synthetic lethal, corroborating with their strong promoter activities in developing ovules. Gas chromatography-mass spectrometry revealed quantitative and compositional changes in FAs and sterols upon overexpression or mutation of ACBP1 and/or SMO1-1. Aberrant levels of these metabolites may account for the downstream defect in lipid signaling. GLABRA2 (GL2), encoding a phospholipid/sterol-binding homeodomain transcription factor, was up-regulated in developing seeds of acbp1, smo1-1, and ACBP1+/−smo1-1 in comparison with the wild type. Consistent with the corresponding transcriptional alteration of GL2 targets, high-oil, low-mucilage phenotypes of gl2 were phenocopied in ACBP1+/−smo1-1. Thus, ACBP1 appears to modulate the metabolism of two important lipid classes (FAs and sterols) influencing cellular signaling. PMID:28500265

  9. Acyl-CoA-Binding Protein ACBP1 Modulates Sterol Synthesis during Embryogenesis.

    Science.gov (United States)

    Lung, Shiu-Cheung; Liao, Pan; Yeung, Edward C; Hsiao, An-Shan; Xue, Yan; Chye, Mee-Len

    2017-07-01

    Fatty acids (FAs) and sterols are primary metabolites that exert interrelated functions as structural and signaling lipids. Despite their common syntheses from acetyl-coenzyme A, homeostatic cross talk remains enigmatic. Six Arabidopsis ( Arabidopsis thaliana ) acyl-coenzyme A-binding proteins (ACBPs) are involved in FA metabolism. ACBP1 interacts with PHOSPHOLIPASE Dα1 and regulates phospholipid composition. Here, its specific role in the negative modulation of sterol synthesis during embryogenesis is reported. ACBP1, likely in a liganded state, interacts with STEROL C4-METHYL OXIDASE1-1 (SMO1-1), a rate-limiting enzyme in the sterol pathway. Proembryo abortion in the double mutant indicated that the ACBP1-SMO1-1 interaction is synthetic lethal, corroborating with their strong promoter activities in developing ovules. Gas chromatography-mass spectrometry revealed quantitative and compositional changes in FAs and sterols upon overexpression or mutation of ACBP1 and/or SMO1-1 Aberrant levels of these metabolites may account for the downstream defect in lipid signaling. GLABRA2 ( GL2 ), encoding a phospholipid/sterol-binding homeodomain transcription factor, was up-regulated in developing seeds of acbp1 , smo1-1 , and ACBP1 +/- smo1-1 in comparison with the wild type. Consistent with the corresponding transcriptional alteration of GL2 targets, high-oil, low-mucilage phenotypes of gl2 were phenocopied in ACBP1 +/- smo1-1 Thus, ACBP1 appears to modulate the metabolism of two important lipid classes (FAs and sterols) influencing cellular signaling. © 2017 American Society of Plant Biologists. All Rights Reserved.

  10. Functional expression and characterization of five wax ester synthases in Saccharomyces cerevisiae and their utility for biodiesel production

    Directory of Open Access Journals (Sweden)

    Shi Shuobo

    2012-02-01

    Full Text Available Abstract Background Wax ester synthases (WSs can synthesize wax esters from alcohols and fatty acyl coenzyme A thioesters. The knowledge of the preferred substrates for each WS allows the use of yeast cells for the production of wax esters that are high-value materials and can be used in a variety of industrial applications. The products of WSs include fatty acid ethyl esters, which can be directly used as biodiesel. Results Here, heterologous WSs derived from five different organisms were successfully expressed and evaluated for their substrate preference in Saccharomyces cerevisiae. We investigated the potential of the different WSs for biodiesel (that is, fatty acid ethyl esters production in S. cerevisiae. All investigated WSs, from Acinetobacter baylyi ADP1, Marinobacter hydrocarbonoclasticus DSM 8798, Rhodococcus opacus PD630, Mus musculus C57BL/6 and Psychrobacter arcticus 273-4, have different substrate specificities, but they can all lead to the formation of biodiesel. The best biodiesel producing strain was found to be the one expressing WS from M. hydrocarbonoclasticus DSM 8798 that resulted in a biodiesel titer of 6.3 mg/L. To further enhance biodiesel production, acetyl coenzyme A carboxylase was up-regulated, which resulted in a 30% increase in biodiesel production. Conclusions Five WSs from different species were functionally expressed and their substrate preference characterized in S. cerevisiae, thus constructing cell factories for the production of specific kinds of wax ester. WS from M. hydrocarbonoclasticus showed the highest preference for ethanol compared to the other WSs, and could permit the engineered S. cerevisiae to produce biodiesel.

  11. Genome-wide screening and transcriptional profile analysis of desaturase genes in the European corn borer moth

    Institute of Scientific and Technical Information of China (English)

    Bingye Xue; Alejandro P. Rooney; Wendell L. Roelofs

    2012-01-01

    Acyl-coenzyme A (Acyl-CoA) desaturases play a key role in the biosynthesis of female moth sex pheromones.Desaturase genes are encoded by a large multigene family,and they have been divided into five subgroups on the basis of biochemical functionality and phylogenetic affinity.In this study both copy numbers and transcriptional levels of desaturase genes in the European corn borer (ECB),Ostrinia nubilalis,were investigated.The results from genome-wide screening of ECB bacterial artificial chromosome (BAC)library indicated there are many copies of some desaturase genes in the genome.An open reading frame (ORF) has been isolated for the novel desaturase gene ECB ezi-△11β from ECB gland complementary DNA and its functionality has been analyzed by two yeast expression systems.No functional activities have been detected for it.The expression levels of the four desaturase genes both in the pheromone gland and fat body of ECB and Asian corn borer (ACB),O.furnacalis,were determined by real-time polymerase chain reaction.In the ECB gland,△ 11 is the most abundant,although the amount of △14 is also considerable.In the ACB gland,△14 is the most abundant and is 100 times more abundant than all the other three combined.The results from the analysis of evolution of desaturase gene transcription in the ECB,ACB and other moths indicate that the pattern of △ 11 gene transcription is significantly different from the transcriptional patterns of other desaturase genes and this difference is tied to the underlying nucleotide composition bias of the genome.

  12. ApoB-100 secretion by HepG2 cells is regulated by the rate of triglyceride biosynthesis but not by intracellular lipid pools.

    Science.gov (United States)

    Benoist, F; Grand-Perret, T

    1996-10-01

    Triglycerides (TGs), cholesteryl esters (CEs), cholesterol, and phosphatidylcholine have been independently proposed as playing regulatory roles in apoB-100 secretion; the results depended on the cellular model used. In this study, we reinvestigate the role of lipids in apoB-100 production in HepG2 cells and in particular, we clarify the respective roles of intracellular mass and the biosynthesis of lipids in the regulation of apoB-100 production. In a first set of experiments, the pool size of cholesterol, CEs, and TGs was modulated by a 3-day treatment with either lipid precursors or inhibitors of enzymes involved in lipid synthesis. We used simvastatin (a hydroxymethylglutaryl coenzyme A reductase inhibitor), 58-035 (an acyl coenzyme A cholesterol acyltransferase inhibitor), 5-tetradecyloxy-2-furancarboxylic acid (TOFA, an inhibitor of fatty acid synthesis), and oleic acid. The secretion rate of apoB-100 was not affected by the large modulation of lipid mass induced by these various pre-treatments. In a second set of experiments, the same lipid modulators were added during a 4-hour labeling period. Simvastatin and 58-035 inhibited cholesterol and CE synthesis without affecting apoB-100 secretion. By contrast, treatment of HepG2 cells with TOFA resulted in the inhibition of TG synthesis and apoB-100 secretion. This effect was highly specific for apoB-100 and was reversed by adding oleic acid, which stimulated both TG synthesis and apoB-100 secretion. Moreover, a combination of oleic acid and 58-035 inhibited CE biosynthesis and increased both TG synthesis and apoB-100 secretion. These results show that in HepG2 cells TG biosynthesis regulates apoB-100 secretion, whereas the rate of cholesterol or CE biosynthesis has no effect.

  13. Structural and Functional Studies of Fatty Acyl Adenylate Ligases from E. coli and L. pneumophila

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Z.; Swaminathan, S.; Zhou, R.; Sauder, J. M.; Tonge, P. J.; Burley, S. K.

    2011-02-18

    Fatty acyl-AMP ligase (FAAL) is a new member of a family of adenylate-forming enzymes that were recently discovered in Mycobacterium tuberculosis. They are similar in sequence to fatty acyl-coenzyme A (CoA) ligases (FACLs). However, while FACLs perform a two-step catalytic reaction, AMP ligation followed by CoA ligation using ATP and CoA as cofactors, FAALs produce only the acyl adenylate and are unable to perform the second step. We report X-ray crystal structures of full-length FAAL from Escherichia coli (EcFAAL) and FAAL from Legionella pneumophila (LpFAAL) bound to acyl adenylate, determined at resolution limits of 3.0 and 1.85 {angstrom}, respectively. The structures share a larger N-terminal domain and a smaller C-terminal domain, which together resemble the previously determined structures of FAAL and FACL proteins. Our two structures occur in quite different conformations. EcFAAL adopts the adenylate-forming conformation typical of FACLs, whereas LpFAAL exhibits a unique intermediate conformation. Both EcFAAL and LpFAAL have insertion motifs that distinguish them from the FACLs. Structures of EcFAAL and LpFAAL reveal detailed interactions between this insertion motif and the interdomain hinge region and with the C-terminal domain. We suggest that the insertion motifs support sufficient interdomain motions to allow substrate binding and product release during acyl adenylate formation, but they preclude CoA binding, thereby preventing CoA ligation.

  14. Production and release of acylcarnitines by primary myotubes reflect the differences in fasting fat oxidation of the donors.

    Science.gov (United States)

    Wolf, Magnus; Chen, Shili; Zhao, Xinjie; Scheler, Mika; Irmler, Martin; Staiger, Harald; Beckers, Johannes; de Angelis, Martin Hrabé; Fritsche, Andreas; Häring, Hans-Ulrich; Schleicher, Erwin D; Xu, Guowang; Lehmann, Rainer; Weigert, Cora

    2013-06-01

    Acylcarnitines are biomarkers of incomplete β-oxidation and mitochondrial lipid overload but indicate also high rates of mitochondrial fatty acid oxidation. It is unknown whether the production of acylcarnitines in primary human myotubes obtained from lean, metabolically healthy subjects reflects the fat oxidation in vivo. Our objective was to quantify the acylcarnitine production in myotubes obtained from subjects with low and high fasting respiratory quotient (RQ). Fasting RQ was determined by indirect calorimetry. Muscle biopsies from the vastus lateralis muscle were taken from 6 subjects with low fasting RQ (mean 0.79 ± 0.03) and 6 with high fasting RQ (0.90 ± 0.03), and satellite cells were isolated, cultured, and differentiated to myotubes. Myotubes were cultivated with 125 μM (13)C-labeled palmitate for 30 minutes and 4 and 24 hours. Quantitative profiling of 42 intracellular and 31 extracellular acylcarnitines was performed by stable isotope dilution-based metabolomics analysis by liquid chromatography coupled to mass spectrometry. Myotubes from donors with high fasting RQ produced and released significant higher amounts of medium-chain acylcarnitines. High (13)C8 and (13)C10 acylcarnitine levels in the extracellular compartment correlated with high fasting RQ. The decreased expression of medium-chain acyl-coenzyme A dehydrogenase (MCAD) in these myotubes can explain the higher rate of incomplete fatty acid oxidation. A lower intracellular [(13)C]acetylcarnitine to carnitine and lower intracellular (13)C16/(13)C18 acylcarnitine to carnitine ratio indicate reduced fatty acid oxidation capacity in these myotubes. Mitochondrial DNA content was not different. Acylcarnitine production and release from primary human myotubes of donors with high fasting RQ indicate a reduced fatty acid oxidation capacity and a higher rate of incomplete fatty acid oxidation. Thus, quantitative profiling of acylcarnitine production in human myotubes can be a suitable tool to

  15. Characterization of Trichome-Expressed BAHD Acyltransferases in Petunia axillaris Reveals Distinct Acylsugar Assembly Mechanisms within the Solanaceae1[OPEN

    Science.gov (United States)

    Uebler, Joseph B.; Liu, Xiaoxiao

    2017-01-01

    Acylsugars are synthesized in the glandular trichomes of the Solanaceae family and are implicated in protection against abiotic and biotic stress. Acylsugars are composed of either sucrose or glucose esterified with varying numbers of acyl chains of differing length. In tomato (Solanum lycopersicum), acylsugar assembly requires four acylsugar acyltransferases (ASATs) of the BAHD superfamily. Tomato ASATs catalyze the sequential esterification of acyl-coenzyme A thioesters to the R4, R3, R3ʹ, and R2 positions of sucrose, yielding a tetra-acylsucrose. Petunia spp. synthesize acylsugars that are structurally distinct from those of tomato. To explore the mechanisms underlying this chemical diversity, a Petunia axillaris transcriptome was mined for trichome preferentially expressed BAHDs. A combination of phylogenetic analyses, gene silencing, and biochemical analyses coupled with structural elucidation of metabolites revealed that acylsugar assembly is not conserved between tomato and petunia. In P. axillaris, tetra-acylsucrose assembly occurs through the action of four ASATs, which catalyze sequential addition of acyl groups to the R2, R4, R3, and R6 positions. Notably, in P. axillaris, PaxASAT1 and PaxASAT4 catalyze the acylation of the R2 and R6 positions of sucrose, respectively, and no clear orthologs exist in tomato. Similarly, petunia acylsugars lack an acyl group at the R3ʹ position, and congruently, an ortholog of SlASAT3, which catalyzes acylation at the R3ʹ position in tomato, is absent in P. axillaris. Furthermore, where putative orthologous relationships of ASATs are predicted between tomato and petunia, these are not supported by biochemical assays. Overall, these data demonstrate the considerable evolutionary plasticity of acylsugar biosynthesis. PMID:28701351

  16. Characterization of Trichome-Expressed BAHD Acyltransferases in Petunia axillaris Reveals Distinct Acylsugar Assembly Mechanisms within the Solanaceae.

    Science.gov (United States)

    Nadakuduti, Satya Swathi; Uebler, Joseph B; Liu, Xiaoxiao; Jones, A Daniel; Barry, Cornelius S

    2017-09-01

    Acylsugars are synthesized in the glandular trichomes of the Solanaceae family and are implicated in protection against abiotic and biotic stress. Acylsugars are composed of either sucrose or glucose esterified with varying numbers of acyl chains of differing length. In tomato ( Solanum lycopersicum ), acylsugar assembly requires four acylsugar acyltransferases (ASATs) of the BAHD superfamily. Tomato ASATs catalyze the sequential esterification of acyl-coenzyme A thioesters to the R4, R3, R3', and R2 positions of sucrose, yielding a tetra-acylsucrose. Petunia spp. synthesize acylsugars that are structurally distinct from those of tomato. To explore the mechanisms underlying this chemical diversity, a Petunia axillaris transcriptome was mined for trichome preferentially expressed BAHDs. A combination of phylogenetic analyses, gene silencing, and biochemical analyses coupled with structural elucidation of metabolites revealed that acylsugar assembly is not conserved between tomato and petunia. In P. axillaris , tetra-acylsucrose assembly occurs through the action of four ASATs, which catalyze sequential addition of acyl groups to the R2, R4, R3, and R6 positions. Notably, in P. axillaris , PaxASAT1 and PaxASAT4 catalyze the acylation of the R2 and R6 positions of sucrose, respectively, and no clear orthologs exist in tomato. Similarly, petunia acylsugars lack an acyl group at the R3' position, and congruently, an ortholog of SlASAT3, which catalyzes acylation at the R3' position in tomato, is absent in P. axillaris Furthermore, where putative orthologous relationships of ASATs are predicted between tomato and petunia, these are not supported by biochemical assays. Overall, these data demonstrate the considerable evolutionary plasticity of acylsugar biosynthesis. © 2017 American Society of Plant Biologists. All Rights Reserved.

  17. Early energy metabolism-related molecular events in skeletal muscle of diabetic rats: The effects of l-arginine and SOD mimic.

    Science.gov (United States)

    Stancic, Ana; Filipovic, Milos; Ivanovic-Burmazovic, Ivana; Masovic, Sava; Jankovic, Aleksandra; Otasevic, Vesna; Korac, Aleksandra; Buzadzic, Biljana; Korac, Bato

    2017-06-25

    Considering the vital role of skeletal muscle in control of whole-body metabolism and the severity of long-term diabetic complications, we aimed to reveal the molecular pattern of early diabetes-related skeletal muscle phenotype in terms of energy metabolism, focusing on regulatory mechanisms, and the possibility to improve it using two redox modulators, l-arginine and superoxide dismutase (SOD) mimic. Alloxan-induced diabetic rats (120 mg/kg) were treated with l-arginine or the highly specific SOD mimic, M40403, for 7 days. As appropriate controls, non-diabetic rats received the same treatments. We found that l-arginine and M40403 restored diabetes-induced impairment of phospho-5'-AMP-activated protein kinase α (AMPKα) signaling by upregulating AMPKα protein itself and its downstream effectors, peroxisome proliferator-activated receptor-γ coactivator-1α and nuclear respiratory factor 1. Also, there was a restitution of the protein levels of oxidative phosphorylation components (complex I, complex II and complex IV) and mitofusin 2. Furthermore, l-arginine and M40403 induced translocation of glucose transporter 4 to the membrane and upregulation of protein of phosphofructokinase and acyl coenzyme A dehydrogenase, diminishing negative diabetic effects on limiting factors of glucose and lipid metabolism. Both treatments abolished diabetes-induced downregulation of sarcoplasmic reticulum calcium-ATPase proteins (SERCA 1 and 2). Similar effects of l-arginine and SOD mimic treatments suggest that disturbances in the superoxide/nitric oxide ratio may be responsible for skeletal muscle mitochondrial and metabolic impairment in early diabetes. Our results provide evidence that l-arginine and SOD mimics have potential in preventing and treating metabolic disturbances accompanying this widespread metabolic disease. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Serum starvation of ARPE-19 changes the cellular distribution of cholesterol and Fibulin3 in patterns reminiscent of age-related macular degeneration.

    Science.gov (United States)

    Rajapakse, Dinusha; Peterson, Katherine; Mishra, Sanghamitra; Wistow, Graeme

    2017-12-15

    Retinal pigment epithelium (RPE) has been implicated as key source of cholesterol-rich deposits at Bruch's membrane (BrM) and in drusen in aging human eye. We have shown that serum-deprivation of confluent RPE cells is associated with upregulation of cholesterol synthesis and accumulation of unesterified cholesterol (UC). Here we investigate the cellular processes involved in this response. We compared the distribution and localization of UC and esterified cholesterol (EC); the age-related macular degeneration (AMD) associated EFEMP1/Fibulin3 (Fib3); and levels of acyl-coenzyme A (CoA): cholesterol acyltransferases (ACAT) ACAT1, ACAT2 and Apolipoprotein B (ApoB) in ARPE-19 cells cultured in serum-supplemented and serum-free media. The results were compared with distributions of these lipids and proteins in human donor eyes with AMD. Serum deprivation of ARPE-19 was associated with increased formation of FM dye-positive membrane vesicles, many of which co-labeled for UC. Additionally, UC colocalized with Fib3 in distinct granules. By day 5, serum-deprived cells grown on transwells secreted Fib3 basally into the matrix. While mRNA and protein levels of ACTA1 were constant over several days of serum-deprivation, ACAT2 levels increased significantly after serum-deprivation, suggesting increased formation of EC. The lower levels of intracellular EC observed under serum-deprivation were associated with increased formation and secretion of ApoB. The responses to serum-deprivation in RPE-derived cells: accumulation and secretion of lipids, lipoproteins, and Fib3 are very similar to patterns seen in human donor eyes with AMD and suggest that this model mimics processes relevant to disease progression. Published by Elsevier Inc.

  19. to view fulltext PDF

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    Although originally described as an intracellular second messenger, sphingosine 1-phosphate (S1P) has recently been shown to ... lysophosphatidic acid; LPS, lipopolysaccharides; mDC, mature DC; MHC, major histocompatibility complex; NK, natural killer; PCR, ..... -the enigmatic lipid class: biochemistry, physiology, and.

  20. The Cirque du Soleil of Golgi membrane dynamics.

    Science.gov (United States)

    Bankaitis, Vytas A

    2009-07-27

    The role of lipid metabolic enzymes in Golgi membrane remodeling is a subject of intense interest. Now, in this issue, Schmidt and Brown (2009. J. Cell Biol. doi:10.1083/jcb.200904147) report that lysophosphatidic acid-specific acyltransferase, LPAAT3, contributes to Golgi membrane dynamics by suppressing tubule formation.

  1. The Cirque du Soleil of Golgi membrane dynamics

    OpenAIRE

    Bankaitis, Vytas A.

    2009-01-01

    The role of lipid metabolic enzymes in Golgi membrane remodeling is a subject of intense interest. Now, in this issue, Schmidt and Brown (2009. J. Cell Biol. doi:10.1083/jcb.200904147) report that lysophosphatidic acid?specific acyltransferase, LPAAT3, contributes to Golgi membrane dynamics by suppressing tubule formation.

  2. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Lysophosphatidyl acyltransferase (LPAT) is the important enzyme responsible for the acylation of lysophosphatidic acid (LPA), leading to the generation of phosphatidic acid (PA) in plant. Its encoding gene is an essential candidate for oil crops to improve oil composition and increase seed oil content through genetic ...

  3. Association of connexin43 with a receptor protein tyrosine phosphatase

    NARCIS (Netherlands)

    Giepmans, Ben N G; Feiken, Elles; Gebbink, Martijn F B G; Moolenaar, Wouter H

    2003-01-01

    Connexin-43(Cx43)-based gap junctional communication is transiently inhibited by certain G protein-coupled receptor agonists, including lysophosphatidic acid, endothelin and thrombin. Our previous studies have implicated the c-Src protein tyrosine kinase in mediating closure of Cx43 based gap

  4. Predictive role of caregiver type, dependency level and time caring on the impact of caring for a dependent relative as a stressor

    OpenAIRE

    Teresa Lanzón Serra; Amelia Díaz Martínez

    2014-01-01

    El trabajo presenta la evaluación de sintomatología de estrés asociada a la tarea de cuidar a un familiar dependiente en el hogar. Se estudia el papel que desempeñan variables como el tipo de cuidador (enfermero/no enfermero), nivel de dependencia de la persona cuidada, horas al día de cuidado y años que se lleva cuidando al familiar. La muestra está compuesta por 100 cuidadores y las variables asociadas a estrés son intrusión, evitación y activación. Los resultados indican que los no enferme...

  5. Protein kinase A-dependent Neuronal Nitric Oxide Synthase Activation Mediates the Enhancement of Baroreflex Response by Adrenomedullin in the Nucleus Tractus Solitarii of Rats

    Directory of Open Access Journals (Sweden)

    Ho I-Chun

    2011-05-01

    Full Text Available Abstract Background Adrenomedullin (ADM exerts its biological functions through the receptor-mediated enzymatic mechanisms that involve protein kinase A (PKA, or neuronal nitric oxide synthase (nNOS. We previously demonstrated that the receptor-mediated cAMP/PKA pathway involves in ADM-enhanced baroreceptor reflex (BRR response. It remains unclear whether ADM may enhance BRR response via activation of nNOS-dependent mechanism in the nucleus tractus solitarii (NTS. Methods Intravenous injection of phenylephrine was administered to evoke the BRR before and at 10, 30, and 60 min after microinjection of the test agents into NTS of Sprague-Dawley rats. Western blotting analysis was used to measure the level and phosphorylation of proteins that involved in BRR-enhancing effects of ADM (0.2 pmol in NTS. The colocalization of PKA and nNOS was examined by immunohistochemical staining and observed with a laser confocal microscope. Results We found that ADM-induced enhancement of BRR response was blunted by microinjection of NPLA or Rp-8-Br-cGMP, a selective inhibitor of nNOS or protein kinase G (PKG respectively, into NTS. Western blot analysis further revealed that ADM induced an increase in the protein level of PKG-I which could be attenuated by co-microinjection with the ADM receptor antagonist ADM22-52 or NPLA. Moreover, we observed an increase in phosphorylation at Ser1416 of nNOS at 10, 30, and 60 min after intra-NTS administration of ADM. As such, nNOS/PKG signaling may also account for the enhancing effect of ADM on BRR response. Interestingly, biochemical evidence further showed that ADM-induced increase of nNOS phosphorylation was prevented by co-microinjection with Rp-8-Br-cAMP, a PKA inhibitor. The possibility of PKA-dependent nNOS activation was substantiated by immunohistochemical demonstration of co-localization of PKA and nNOS in putative NTS neurons. Conclusions The novel finding of this study is that the signal transduction cascade that underlies the enhancement of BRR response by ADM in NTS is composed sequentially of cAMP/PKA and nNOS/PKG pathways.

  6. Glucose triggers protein kinase A-dependent insulin secretion in mouse pancreatic islets through activation of the K+ATP channel-dependent pathway

    DEFF Research Database (Denmark)

    Thams, Peter; Anwar, Mohammad R; Capito, Kirsten

    2005-01-01

    pancreatic islets was determined by radioimmunoassay. RESULTS: In islets cultured at 5.5 mmol/l glucose, and then perifused in physiological Krebs-Ringer medium, the PKA inhibitors, H89 (10 micromol/l) and PKI 6-22 amide (30 micromol/l) did not inhibit glucose (16.7 mmol/l)-induced insulin secretion...

  7. Adiponectin promotes VEGF-A-dependent angiogenesis in human chondrosarcoma through PI3K, Akt, mTOR, and HIF-α pathway.

    Science.gov (United States)

    Lee, Hsiang-Ping; Lin, Chih-Yang; Shih, Jhao-Sheng; Fong, Yi-Chin; Wang, Shih-Wei; Li, Te-Mao; Tang, Chih-Hsin

    2015-11-03

    Chondrosarcoma is a type of highly malignant tumor with a potent capacity to invade locally and cause distant metastasis. Adiponectin is a protein hormone secreted predominantly by differentiated adipocytes. On the other hand, angiogenesis is a critical step in tumor growth and metastasis. However, the relationship of adiponectin with vascular endothelial growth factor-A (VEGF-A) expression and angiogenesis in human chondrosarcoma is mostly unknown. In this study we first demonstrated that the expression of adiponectin was correlated with tumor stage of human chondrosarcoma tissues. In addition, we also found that adiponectin increased VEGF-A expression in human chondrosarcoma cells and subsequently induced migration and tube formation in human endothelial progenitor cells (EPCs). Adiponectin promoted VEGF-A expression through adiponectin receptor (AdipoR), phosphoinositide 3 kinase (PI3K), Akt, mammalian target of rapamycin (mTOR), and hypoxia-inducible factor-1α (HIF)-1α signaling cascades. Knockdown of adiponectin decreased VEGF-A expression and also abolished chondrosarcoma conditional medium-mediated tube formation in EPCs in vitro as well as angiogenesis effects in the chick chorioallantoic membrane and Matrigel plug nude mice model in vivo. Therefore, adiponectin is crucial for tumor angiogenesis and growth, which may represent a novel target for anti-angiogenic therapy in human chondrosarcoma.

  8. Measurements of observables in the pion-nucleon system, nuclear a- dependence of heavy quark production and rare decays of D and B mesons

    International Nuclear Information System (INIS)

    Sadler, M.E.; Isenhower, L.D.

    1992-01-01

    This report discusses research on the following topics: pion-nucleon interactions; detector tomography facility; nuclear dependence of charm and beauty quark production and a study of two-prong decays of neutral D and B mesons; N* collaboration at CEBAF; and pilac experiments

  9. Self-Management as a Class-Wide Intervention: An Evaluation of the "Self & Match" System Embedded within a Dependent Group Contingency

    Science.gov (United States)

    Bulla, Andrew J.

    2017-01-01

    The U.S. Department of Education (2015) indicated that about 95% of students with special education eligibility receive some form of education in the general education setting. Students with disabilities tend to engage in more disruptive behaviors than their non-disabled peers (e.g., Murphy, Beadle-Brown, Wing, Gould, Shah, & Homes, 2005). If…

  10. Tauroursodeoxycholate Protects Rat Hepatocytes from Bile Acid-Induced Apoptosis via β1-Integrin- and Protein Kinase A-Dependent Mechanisms

    Directory of Open Access Journals (Sweden)

    Annika Sommerfeld

    2015-05-01

    Full Text Available Background/Aims: Ursodeoxycholic acid, which in vivo is rapidly converted into its taurine conjugate, is frequently used for the treatment of cholestatic liver disease. Apart from its choleretic effects, tauroursodeoxycholate (TUDC can protect hepatocytes from bile acid-induced apoptosis, but the mechanisms underlying its anti-apoptotic effects are poorly understood. Methods: These mechanisms were investigated in perfused rat liver and isolated rat hepatocytes. Results: It was found that TUDC inhibited the glycochenodeoxycholate (GCDC-induced activation of the CD95 death receptor at the level of association between CD95 and the epidermal growth factor receptor. This was due to a rapid TUDC-induced β1-integrin-dependent cyclic AMP (cAMP signal with induction of the dual specificity mitogen-activated protein (MAP kinase phosphatase 1 (MKP-1, which prevented GCDC-induced phosphorylation of mitogen-activated protein kinase kinase 4 (MKK4 and c-jun-NH2-terminal kinase (JNK activation. Furthermore, TUDC induced a protein kinase A (PKA-mediated serine/threonine phosphorylation of the CD95, which was recently identified as an internalization signal for CD95. Furthermore, TUDC inhibited GCDC-induced CD95 targeting to the plasma membrane in a β1-integrin-and PKA-dependent manner. In line with this, the β1-integrin siRNA knockdown in sodium taurocholate cotransporting polypeptide (Ntcp-transfected HepG2 cells abolished the protective effect of TUDC against GCDC-induced apoptosis. Conclusion: TUDC exerts its anti-apoptotic effect via a β1-integrin-mediated formation of cAMP, which prevents CD95 activation by hydrophobic bile acids at the levels of JNK activation and CD95 serine/threonine phosphorylation.

  11. Protein kinase a dependent phosphorylation of apical membrane antigen 1 plays an important role in erythrocyte invasion by the malaria parasite.

    Directory of Open Access Journals (Sweden)

    Kerstin Leykauf

    2010-06-01

    Full Text Available Apicomplexan parasites are obligate intracellular parasites that infect a variety of hosts, causing significant diseases in livestock and humans. The invasive forms of the parasites invade their host cells by gliding motility, an active process driven by parasite adhesion proteins and molecular motors. A crucial point during host cell invasion is the formation of a ring-shaped area of intimate contact between the parasite and the host known as a tight junction. As the invasive zoite propels itself into the host-cell, the junction moves down the length of the parasite. This process must be tightly regulated and signalling is likely to play a role in this event. One crucial protein for tight-junction formation is the apical membrane antigen 1 (AMA1. Here we have investigated the phosphorylation status of this key player in the invasion process in the human malaria parasite Plasmodium falciparum. We show that the cytoplasmic tail of P. falciparum AMA1 is phosphorylated at serine 610. We provide evidence that the enzyme responsible for serine 610 phosphorylation is the cAMP regulated protein kinase A (PfPKA. Importantly, mutation of AMA1 serine 610 to alanine abrogates phosphorylation of AMA1 in vivo and dramatically impedes invasion. In addition to shedding unexpected new light on AMA1 function, this work represents the first time PKA has been implicated in merozoite invasion.

  12. Accumulation of cyclin B1 requires E2F and cyclin-A-dependent rearrangement of the anaphase-promoting complex

    DEFF Research Database (Denmark)

    Lukas, C; Sørensen, Claus Storgaard; Kramer, E

    1999-01-01

    In mammalian somatic-cell cycles, progression through the G1-phase restriction point and initiation of DNA replication are controlled by the ability of the retinoblastoma tumour-suppressor protein (pRb) family to regulate the E2F/DP transcription factors. Continuing transcription of E2F target...

  13. Characterization of the gacA-dependent surface and coral mucus colonization by an opportunistic coral pathogen Serratia marcescens PDL100.

    Science.gov (United States)

    Krediet, Cory J; Carpinone, Emily M; Ritchie, Kim B; Teplitski, Max

    2013-05-01

    Opportunistic pathogens rely on global regulatory systems to assess the environment and to control virulence and metabolism to overcome host defenses and outcompete host-associated microbiota. In Gammaproteobacteria, GacS/GacA is one such regulatory system. GacA orthologs direct the expression of the csr (rsm) small regulatory RNAs, which through their interaction with the RNA-binding protein CsrA (RsmA), control genes with functions in carbon metabolism, motility, biofilm formation, and virulence. The csrB gene was controlled by gacA in Serratia marcescens PDL100. A disruption of the S. marcescens gacA gene resulted in an increased fitness of the mutant on mucus of the host coral Acropora palmata and its high molecular weight fraction, whereas the mutant was as competitive as the wild type on the low molecular weight fraction of the mucus. Swarming motility and biofilm formation were reduced in the gacA mutant. This indicates a critical role for gacA in the efficient utilization of specific components of coral mucus and establishment within the surface mucopolysaccharide layer. While significantly affecting early colonization behaviors (coral mucus utilization, swarming motility, and biofilm formation), gacA was not required for virulence of S. marcescens PDL100 in either a model polyp Aiptasia pallida or in brine shrimp Artemia nauplii. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  14. On-Chip Scan-Based Test Strategy for a Dependable Many-Core Processor Using a NoC as a Test Access Mechanism

    NARCIS (Netherlands)

    Zhang, X.; Kerkhoff, Hans G.; Vermeulen, Bart

    2010-01-01

    Periodic on-chip scan-based tests have to be applied to a many-core processor SoC to improve its dependability. An infrastructural IP module has been designed and incorporated into the SoC to function as an ATE. This paper introduces the reuse of a Network-on-Chip as a test access mechanism. Since

  15. New scan-based test strategy for a dependable many-core processor using a NoC as a Test Access Mechanism

    NARCIS (Netherlands)

    Zhang, X.; Kerkhoff, Hans G.; Vermeulen, Bart

    2010-01-01

    Periodic on-chip scan-based tests have to be applied to a many-core processor to improve its dependability. This paper describes an infrastructural IP module that has been designed and incorporated into an SoC to function as an ATE. The Network-on-Chip inside the SoC is reused as a test access

  16. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    OpenAIRE

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

  17. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    Science.gov (United States)

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  18. Dual inhibition of γ-oryzanol on cellular melanogenesis: inhibition of tyrosinase activity and reduction of melanogenic gene expression by a protein kinase A-dependent mechanism.

    Science.gov (United States)

    Jun, Hee-jin; Lee, Ji Hae; Cho, Bo-Ram; Seo, Woo-Duck; Kang, Hang-Won; Kim, Dong-Woo; Cho, Kang-Jin; Lee, Sung-Joon

    2012-10-26

    The in vitro effects on melanogenesis of γ-oryzanol (1), a rice bran-derived phytosterol, were investigated. The melanin content in B16F1 cells was significantly and dose-dependently reduced (-13% and -28% at 3 and 30 μM, respectively). Tyrosinase enzyme activity was inhibited by 1 both in a cell-free assay and when analyzed based on the measurement of cellular tyrosinase activity. Transcriptome analysis was performed to investigate the biological pathways altered by 1, and it was found that gene expression involving protein kinase A (PKA) signaling was markedly altered. Subsequent analyses revealed that 1 stimulation in B16 cells reduced cytosolic cAMP concentrations, PKA activity (-13% for cAMP levels and -40% for PKA activity), and phosphorylation of the cAMP-response element binding protein (-57%), which, in turn, downregulated the expression of microphthalmia-associated transcription factor (MITF; -59% for mRNA and -64% for protein), a key melanogenic gene transcription factor. Accordingly, tyrosinase-related protein 1 (TRP-1; -69% for mRNA and -82% for protein) and dopachrome tautomerase (-51% for mRNA and -92% for protein) in 1-stimulated B16F1 cells were also downregulated. These results suggest that 1 has dual inhibitory activities for cellular melanogenesis by inhibiting tyrosinase enzyme activity and reducing MITF and target genes in the PKA-dependent pathway.

  19. Fibroblast growth factor-2-induced host stroma reaction during initial tumor growth promotes progression of mouse melanoma via vascular endothelial growth factor A-dependent neovascularization.

    Science.gov (United States)

    Tsunoda, Satoshi; Nakamura, Toshiyuki; Sakurai, Hiroaki; Saiki, Ikuo

    2007-04-01

    Fibroblast growth factor (FGF)-2 has been considered to play a critical role in neovascularization in several tumors; however, its precise role in tumor progression is not fully understood. In the present study, we have characterized the role of FGF-2 in B16-BL6 mouse melanoma cells, focusing on effects during the initial phase of tumor growth. FGF-2 was injected at the tumor inoculation site of dorsal skin during the initial phase. FGF-2 induced marked tumor growth and lymph node metastasis. This was well correlated with an increase in neovascularization in the host stroma. FGF-2 also recruited inflammatory and mesenchymal cells in host stroma. Marked tumor growth, pulmonary metastasis and intensive neovascularization in tumor parenchyma were also observed after a single injection of FGF-2 into the footpad inoculation site. In contrast, repeated injections of FGF-2 at a site remote from the footpad tumor were ineffective in promoting tumor growth and metastasis. These promoting activities of FGF-2 were blocked by local injections of a glucocorticoid hormone, suggesting that host inflammatory responses induced by FGF-2 are associated with FGF-2-induced tumor progression. In addition, although FGF-2 did not promote cellular proliferation and vascular endothelial growth factor A (VEGFA) mRNA expression in B16-BL6 cells in vitro, FGF-2 induced VEGFA expression in host stroma rather than tumor tissue, and local injections of a neutralizing antibody against VEGFA inhibited these activities of FGF-2 in vivo. These results indicate that abundant FGF-2 during the initial phase of tumor growth induces VEGFA-dependent intensive neovascularization in host stroma, and supports marked tumor growth and metastasis.

  20. Self-Management as a Class-Wide Intervention: An Evaluation of the "Self & Match" System Embedded within a Dependent Group Contingency

    Science.gov (United States)

    Bulla, Andrew J.; Frieder, Jessica E.

    2018-01-01

    Teachers are responsible for providing an education to students of all ability levels. Recent data suggest that roughly 95% of students with a disability are receiving some form of education in their general education setting. Individuals with disabilities tend to engage in higher levels of disruptive behaviors (e.g., talking out in class,…

  1. Group psycho-education in patients with bipolar disorder associated with a dependency of toxic substances in patients who are in abstinence

    Directory of Open Access Journals (Sweden)

    Patricia González Alegre

    2009-01-01

    Full Text Available The high comorbility that exists among psychiatric disorders and addictive is important. In the latest years it is produced an increase of the sensibility related to this problem. A great deal it is due to the demand of Mental Health Services and also due to drug dependency, as a consequence of the lack of an integral approach. Because of this fact and because of the mentioned demand, we though it should be pertinent developing a research project in order to check if the carrying the psycho-educative preventive group project out in patients with a diagnose of bipolar disorder with an abuse of drugs history and/or dependency of toxic substance in abstinence at the moment influents in a positive way in the course of the number of relapses in the toxic consumption during at least six months subsequent to the intervention. And at this way, these patients will purchase a greater consciousness of the important of healthy habits in the bipolar disorder and the recovery in the toxic substance abuse. The program will be developed in an experimental research where the patients will be randomly assigned in group control/ experimentally, the intervention will last twenty sessions, each session will be an hour and a half long and will be held weekly. In these sessions we will deal with topics related to the psychiatric disorder and the toxic consume. At the same time we will bank on the development of practical relaxation workshops on in some of the sessions with the object of providing a resource in view of stress situations.

  2. E-selectin: sialyl Lewis, a dependent adhesion of colon cancer cells, is inhibited differently by antibodies against E-selectin ligands.

    Science.gov (United States)

    Srinivas, U; Påhlsson, P; Lundblad, A

    1996-09-01

    Recent studies have demonstrated that selectins, a new family of cell-adhesion molecules with similar domain structures, mediate the adhesion of peripheral blood cells to interleukin-1 (IL-1)-activated endothelium. In the present study the authors evaluated the role of E-selectin-Sialyl Lewis x (SLe(x))/ Sialyl Lewis a (SLe(a)) interaction in mediating in vitro adhesion of two colon cancer cell lines, HT-29 and COLO 201, to human umbilical cord endothelial cells (HUVEC). Colon cancer cell lines had a strong expression of blood group-related carbohydrate epitopes as evaluated by fluorescence-activated cell sorter (FACS) analysis. It was established that adhesion of HT-29 and COLO 201 cells to IL-1 stimulated HUVEC was calcium dependent and could be inhibited by a monoclonal antibody directed against E-selectin. Prior incubation of cells with two different antibodies directed against SLe(x) and antibodies directed against related Lewis epitopes, Le(x) and Le(a), had no significant effect on adhesion. Three antibodies directed against SLe(a) differed in their capacity to inhibit the adhesion of HT-29 and COLO 201 cells to HUVEC. Only one antibody directed against the SLe(a) structure was effective in inhibiting adhesion of both COLO 201 and HT-29 cells. The difference could not be attributed to titre, the type or number of glycoproteins, or to a difference in the amount of SLe(a) present on individual proteins, suggesting that presence and right presentation of SLe(a) epitope might be important for adhesion of colon cancer cells. Finally, in the in vitro system used, adhesion of HT-29 and COLO 201 cells to activated HUVEC is mediated predominantly by E-selectin/SLe(a) interaction. SLe(x) and related epitopes, Le(x) and Le(a), seem to have limited relevance for colon cancer cell recognition of E-selectin.

  3. COMPARISON OF POND AND RACEWAY PRODUCTION METHODS ON TEXTURE OF CHANNEL CATFISH (Ictalurus punctatus) FILLETS, SHOWING A DEPENDENCY ON SIZE AND FILLET POSITION

    Science.gov (United States)

    The objective of this study was to compare the effect of the production environment (pond vs in-pond raceway) on the chemical composition, color, and textural properties of channel catfish fillets. Compositional analysis consisted of percent moisture, lipid, protein, and ash content. Additional sa...

  4. Molecular Characterization of Two Lysophospholipid:acyl-CoA Acyltransferases Belonging to the MBOAT Family in Nicotiana benthamiana.

    Directory of Open Access Journals (Sweden)

    Donghui Zhang

    Full Text Available In the remodeling pathway for the synthesis of phosphatidylcholine (PC, acyl-CoA-dependent lysophosphatidylcholine (lysoPC acyltransferase (LPCAT catalyzes the reacylation of lysoPC. A number of genes encoding LPCATs have been cloned and characterized from several plants in recent years. Using Arabidopsis and other plant LPCAT sequences to screen the genome database of Nicotiana benthamiana, we identified two cDNAs encoding the putative tobacco LPCATs (NbLPCAT1 and NbLPCAT2. Both of them were predicted to encode a protein of 463 amino acids with high similarity to LPCATs from other plants. Protein sequence features such as the presence of at least eight putative transmembrane regions, four highly conserved signature motifs and several invariant residues indicate that NbLPCATs belong to the membrane bound O-acyltransferase family. Lysophospholipid acyltransferase activity of NbLPCATs was confirmed by testing lyso-platelet-activating factor (lysoPAF sensitivity through heterologous expression of each full-length cDNA in a yeast mutant Y02431 (lca1△ disrupted in endogenous LPCAT enzyme activity. Analysis of fatty acid profiles of phospholipids from the NbLPCAT-expressing yeast mutant Y02431 cultures supplemented with polyunsaturated fatty acids suggested more incorporation of linoleic acid (18:2n6, LA and α-linolenic acid (18:3n3, ALA into PC compared to yeast mutant harbouring empty vector. In vitro enzymatic assay demonstrated that NbLPCAT1had high lysoPC acyltransferase activity with a clear preference for α-linolenoyl-CoA (18:3, while NbLPCAT2 showed a high lysophosphatidic acid (lysoPA acyltransferase activity towards α-linolenoyl-CoA and a weak lysoPC acyltransferase activity. Tissue-specific expression analysis showed a ubiquitous expression of NbLPCAT1 and NbLPCAT2 in roots, stems, leaves, flowers and seeds, and a strong expression in developing flowers. This is the first report on the cloning and characterization of lysophospholipid

  5. mRNA expression of genes regulating lipid metabolism in ringed seals (Pusa hispida) from differently polluted areas

    International Nuclear Information System (INIS)

    Castelli, Martina Galatea; Rusten, Marte; Goksøyr, Anders; Routti, Heli

    2014-01-01

    Highlights: •Genes regulating lipid metabolism were studied in ringed seals. •We compared highly contaminated Baltic seals and less contaminated Svalbard seals. •mRNA expression of hepatic PPARγ was higher in the Baltic seals. •mRNA expression of adipose PPARγ target genes was higher in the Baltic seals. •Contaminant exposure may affect lipid metabolism in the Baltic ringed seals. -- Abstract: There is a growing concern about the ability of persistent organic pollutants (POPs) to influence lipid metabolism. Although POPs are found at high concentrations in some populations of marine mammals, for example in the ringed seal (Pusa hispida) from the Baltic Sea, little is known about the effects of POPs on their lipid metabolism. An optimal regulation of lipid metabolism is crucial for ringed seals during the fasting/molting season. This is a physiologically stressful period, during which they rely on the energy stored in their fat reserves. The mRNA expression levels for seven genes involved in lipid metabolism were analyzed in liver and/or blubber tissue from molting ringed seals from the polluted Baltic Sea and a less polluted reference location, Svalbard (Norway). mRNA expression of genes encoding peroxisome proliferator-activated receptors (PPAR) α and γ and their target genes acyl-coenzyme A oxidase 1 (ACOX1) and cluster of differentiation 36 (CD36) were analyzed in liver. mRNA expression level of genes encoding PPARβ, PPARγ and their target genes encoding fatty acid binding protein 4 (FABP4) and adiponectin (ADIPOQ) were measured in inner and middle blubber layers. In addition, we evaluated the influence of molting status on hepatic mRNA expression of genes encoding PPARs and their target genes in ringed seals from Svalbard. Our results show higher mRNA expression of genes encoding hepatic PPARγ and adipose PPARβ, FABP4, and ADIPOQ in the Baltic seals compared to the Svalbard seals. A positive relationship between mRNA expressions of genes

  6. Mechanisms of toxicity of di(2-ethylhexyl) phthalate on the reproductive health of male zebrafish

    Energy Technology Data Exchange (ETDEWEB)

    Uren-Webster, Tamsyn M.; Lewis, Ceri; Filby, Amy L.; Paull, Gregory C. [Hatherly Laboratories, School of Biosciences, University of Exeter, Prince of Wales Road, Exeter, Devon EX4 4PS (United Kingdom); Santos, Eduarda M., E-mail: e.santos@exeter.ac.uk [Hatherly Laboratories, School of Biosciences, University of Exeter, Prince of Wales Road, Exeter, Devon EX4 4PS (United Kingdom)

    2010-09-01

    Phthalates are ubiquitous in the aquatic environment and are known to adversely affect male reproductive health in mammals through interactions with multiple receptor systems. However, little is known about the risks they pose to fish. This project investigated the effects of di(2-ethylhexyl) phthalate (DEHP), the most commonly used phthalate, on the reproductive health of male zebrafish (Danio rerio). Males were treated with 0.5, 50 and 5000 mg DEHP kg{sup -1} (body weight) for a period of 10 days via intraperitoneal injection. The effects of the exposure were assessed by analysing fertilisation success, testis histology, sperm DNA integrity and transcript profiles of the liver and testis. A significant increase in the hepatosomatic index and levels of hepatic vitellogenin transcript were observed following exposure to 5000 mg DEHP kg{sup -1}. Exposure to 5000 mg DEHP kg{sup -1} also resulted in a reduction in fertilisation success of oocytes spawned by untreated females. However, survival and development of the resulting embryos were unaffected by all treatments, and no evidence of DEHP-induced sperm DNA damage was observed. Exposure to 50 and 5000 mg DEHP kg{sup -1} caused alterations in the proportion of germ cells at specific stages of spermatogenesis in the testis, including a reduction in the proportion of spermatozoa and an increase in the proportion of spermatocytes, suggesting that DEHP may inhibit the progression of meiosis. In parallel, exposure to 5000 mg DEHP kg{sup -1} increased the levels of two peroxisome proliferator-activated receptor (PPAR) responsive genes (acyl-coenzyme A oxidase 1 (acox1) and enoyl-coenzyme A, hydratase/3-hydroxyacyl coenzyme A dehydrogenase (ehhadh). These data demonstrated that exposure to high concentrations of DEHP disrupts spermatogenesis in adult zebrafish with a consequent decrease in their ability to fertilise oocytes spawned by untreated females. Furthermore, our data suggest that the adverse effects caused by

  7. Treatment of rats with Jiangzhi Capsule improves liquid fructose-induced fatty liver: modulation of hepatic expression of SREBP-1c and DGAT-2.

    Science.gov (United States)

    Zhao, Yuanyang; Pan, Yongquan; Yang, Yifan; Batey, Robert; Wang, Jianwei; Li, Yuhao

    2015-06-02

    Jiangzhi Capsule is an Australian listed patented traditional Chinese medicine and has been used for management of lipid abnormalities over the past 10 years. To obtain a better understanding regarding Jiangzhi Capsule, the present study investigated the effects and underlying mechanisms of Jiangzhi Capsule on chronic fructose overconsumption-induced lipid abnormalities. Male rats were treated with liquid fructose in their drinking water over 14 weeks. Jiangzhi Capsule was co-administered (once daily, by oral gavage) during the last 7 weeks. Indexes of lipid and glucose homeostasis were determined enzymatically, by ELISA and/or histologically. Gene expression was analyzed by real-time PCR, Western blot and/or immunohistochemistry. Treatment with Jiangzhi Capsule (100 mg/kg) attenuated fructose-induced excessive triglyceride accumulation and Oil Red O-stained area in the liver. This effect was accompanied by amelioration of hyperinsulinemia. There was no significant difference in intakes of fructose and chow, and body weight between fructose control and fructose Jiangzhi Capsule-treated groups. Mechanistically, Jiangzhi Capsule downregulated fructose-stimulated hepatic overexpression of sterol regulatory element binding protein (SREBP)-1/1c at the mRNA and protein levels. Accordingly, the SREBP-1c downstream genes, acetyl-CoA carboxylase-1 and stearoyl-CoA desaturase-1, were also inhibited. In addition, acyl-coenzyme A:diacylglycerol acyltransferase (DGAT)-2 expression at the mRNA and protein levels in the liver was also inhibited after Jiangzhi Capsule treatment. In contrast, Jiangzhi Capsule affected neither carbohydrate response element binding protein, peroxisome proliferator-activated receptor (PPAR)-gamma and DGAT-1, nor PPAR-alpha and its target genes. These findings demonstrate the anti-steatotic action of Jiangzhi Capsule in fructose-fed rats, and modulation of hepatic SREBP-1c and DGAT-2 involved in hepatic de novo synthesis of fatty acids and triglyceride

  8. Brain transcriptional responses to high-fat diet in Acads-deficient mice reveal energy sensing pathways.

    Directory of Open Access Journals (Sweden)

    Claudia Kruger

    Full Text Available How signals from fatty acid metabolism are translated into changes in food intake remains unclear. Previously we reported that mice with a genetic inactivation of Acads (acyl-coenzyme A dehydrogenase, short-chain, the enzyme responsible for mitochondrial beta-oxidation of C4-C6 short-chain fatty acids (SCFAs, shift consumption away from fat and toward carbohydrate when offered a choice between diets. In the current study, we sought to indentify candidate genes and pathways underlying the effects of SCFA oxidation deficiency on food intake in Acads-/- mice.We performed a transcriptional analysis of gene expression in brain tissue of Acads-/- and Acads+/+ mice fed either a high-fat (HF or low-fat (LF diet for 2 d. Ingenuity Pathway Analysis revealed three top-scoring pathways significantly modified by genotype or diet: oxidative phosphorylation, mitochondrial dysfunction, and CREB signaling in neurons. A comparison of statistically significant responses in HF Acads-/- vs. HF Acads+/+ (3917 and Acads+/+ HF vs. LF Acads+/+ (3879 revealed 2551 genes or approximately 65% in common between the two experimental comparisons. All but one of these genes were expressed in opposite direction with similar magnitude, demonstrating that HF-fed Acads-deficient mice display transcriptional responses that strongly resemble those of Acads+/+ mice fed LF diet. Intriguingly, genes involved in both AMP-kinase regulation and the neural control of food intake followed this pattern. Quantitative RT-PCR in hypothalamus confirmed the dysregulation of genes in these pathways. Western blotting showed an increase in hypothalamic AMP-kinase in Acads-/- mice and HF diet increased, a key protein in an energy-sensing cascade that responds to depletion of ATP.Our results suggest that the decreased beta-oxidation of short-chain fatty acids in Acads-deficient mice fed HF diet produces a state of energy deficiency in the brain and that AMP-kinase may be the cellular energy

  9. ACAT inhibition and progression of carotid atherosclerosis in patients with familial hypercholesterolemia: the CAPTIVATE randomized trial.

    Science.gov (United States)

    Meuwese, Marijn C; de Groot, Eric; Duivenvoorden, Raphaël; Trip, Mieke D; Ose, Leiv; Maritz, Frans J; Basart, Dick C G; Kastelein, John J P; Habib, Rafik; Davidson, Michael H; Zwinderman, Aeilko H; Schwocho, Lee R; Stein, Evan A

    2009-03-18

    Inhibition of acyl coenzyme A:cholesterol acyltransferase (ACAT), an intracellular enzyme involved in cholesterol accumulation, with pactimibe was developed to assist in the prevention of cardiovascular disease. To evaluate the efficacy and safety of pactimibe in inhibition of atherosclerosis. A prospective, randomized, stratified, double-blind, placebo-controlled study (Carotid Atherosclerosis Progression Trial Investigating Vascular ACAT Inhibition Treatment Effects [CAPTIVATE]) of 892 patients heterozygous for familial hypercholesterolemia conducted at 40 lipid clinics in the United States, Canada, Europe, South Africa, and Israel between February 1, 2004, and December 31, 2005. Study was terminated on October 26, 2005. Participants received either 100 mg/d of pactimibe (n = 443) or matching placebo (n = 438), in addition to standard lipid-lowering therapy. Carotid atherosclerosis, assessed by ultrasound carotid intima-media thickness (CIMT), at baseline, 12, 18, and 24 months. Maximum CIMT was the primary end point and mean CIMT the secondary end point. Because pactimibe failed to show efficacy in the intravascular coronary ultrasound ACTIVATE study, the CAPTIVATE study was terminated prematurely after a follow-up of 15 months. After 6 months of treatment with pactimibe, low-density lipoprotein cholesterol increased by 7.3% (SD, 23%) compared with 1.4% (SD, 28%) in the placebo group (P = .001). The carotid ultrasonographic scans of the 716 patients with at least 2 scans and obtained at least 40 weeks apart were analyzed. Maximum CIMT measurements did not show a pactimibe treatment effect (difference, 0.004 mm; 95% confidence interval [CI], -0.023 to 0.015 mm; P = .64); however, the less variable mean CIMT measurement revealed an increase of 0.014 mm (95% CI, -0.027 to 0.000 mm; P = .04) in patients administered pactimibe vs placebo. Major cardiovascular events (cardiovascular death, myocardial infarction, and stroke) occurred more often in patients administered

  10. Peroxisome proliferator-activated receptors, estrogenic responses and biotransformation system in the liver of salmon exposed to tributyltin and second messenger activator

    International Nuclear Information System (INIS)

    Pavlikova, Nela; Kortner, Trond M.; Arukwe, Augustine

    2010-01-01

    The mechanisms by which organotin compounds produce modulations of the endocrine systems and other biological responses are not fully understood. In this study, juvenile salmon were force-fed diet containing TBT (0: solvent control, 0.1, 1 and 10 mg/kg fish) for 72 h. Subsequently, fish exposed to solvent control and 10 mg TBT were exposed to waterborne concentration (200 μg/l) of the adenylate cyclase (AC) stimulator, forskolin for 2 and 4 h. The overall aim of the study was to explore whether TBT endocrine disruptive effects involve second messenger activation. Liver was sampled from individual fish (n = 8) at the end of the exposures. The transcription patterns of peroxisome proliferator-activated receptor (PPAR) isotype and acyl-coenzyme A oxidase 1 (ACOX1), aromatase isoform, estrogen receptor-α (ERα), pregnane X receptor (PXR), CYP3A and glutathione S-transferase (GST) genes were measured by quantitative polymerase chain reaction (qPCR). Our data showed a consistent increase in PPARα, PPARβ and PPARγ mRNA and protein expression after TBT exposure that were inversely correlated with ACOX1 mRNA levels. Forskolin produced PPAR isotype-specific mRNA and protein effects that were modulated by TBT. ACOX1 expression was decreased (at 2 h) and increased (at 4 h) by forskolin and the presence of TBT potentiated these effects. TBT apparently increased mRNA and protein levels of cyp19a, compared to the solvent control, whereas cyp19b mRNA levels were unaffected by TBT treatment. Combined TBT and forskolin exposure produced respective decrease and increase of mRNA levels of cyp19a and cyp19b, compared with control. TBT decreased ERα mRNA at low dose (1 mg/kg) and forskolin exposure alone produced a consistent decrease of ERα mRNA levels that were not affected by the presence of TBT. Interestingly, PXR and CYP3A mRNA levels were differentially affected, either decreased or increased, after exposure to TBT and forskolin, singly and also in combination. GST mRNA was

  11. Skeletal Muscle Magnetic Resonance Imaging of the Lower Limbs in Late-onset Lipid Storage Myopathy with Electron Transfer Flavoprotein Dehydrogenase Gene Mutations

    Institute of Scientific and Technical Information of China (English)

    Xin-Yi Liu; Ming Jin; Zhi-Qiang Wang; Dan-Ni Wang; Jun-Jie He; Min-Ting Lin; Hong-Xia Fu

    2016-01-01

    Background:Lipid storage myopathy (LSM) is a genetically heterogeneous group with variable clinical phenotypes.Late-onset multiple acyl-coenzyme A dehydrogenation deficiency (MADD) is a rather common form of LSM in China.Diagnosis and clinical management of it remain challenging,especially without robust muscle biopsy result and genetic detection.As the noninvasion and convenience,muscle magnetic resonance imaging (MRI) is a helpful assistant,diagnostic tool for neuromuscular disorders.However,the disease-specific MRI patterns of muscle involved and its diagnostic value in late-onset MADD have not been systematic analyzed.Methods:We assessed the MRI pattern and fat infiltration degree of the lower limb muscles in 28 late-onset MADD patients,combined with detailed clinical features and gene spectrum.Fat infiltration degree of the thigh muscle was scored while that ofgluteus was described as obvious or not.Associated muscular atrophy was defined as obvious muscle bulk reduction.Results:The mean scores were significantly different among the anterior,medial,and posterior thigh muscle groups.The mean of fat infiltration scores on posterior thigh muscle group was significantly higher than either anterior or medial thigh muscle group (P < 0.001).Moreover,the mean score on medial thigh muscle group was significantly higher than that of anterior thigh muscle group (P < 0.01).About half of the patients displayed fat infiltration and atrophy in gluteus muscles.Of 28 patients,12 exhibited atrophy in medial and/or posterior thigh muscle groups,especially in posterior thigh muscle group.Muscle edema pattern was not found in all the patients.Conclusions:Late-onset MADD patients show a typical muscular imaging pattern of fat infiltration and atrophy on anterior,posterior,and medial thigh muscle groups,with major involvement of posterior thigh muscle group and gluteus muscles and a sparing involvement of anterior thigh compartment.Our findings also suggest that muscle MRI of

  12. ATR-101, a selective ACAT1 inhibitor, decreases ACTH-stimulated cortisol concentrations in dogs with naturally occurring Cushing's syndrome.

    Science.gov (United States)

    Langlois, Daniel K; Fritz, Michele C; Schall, William D; Bari Olivier, N; Smedley, Rebecca C; Pearson, Paul G; Bailie, Marc B; Hunt, Stephen W

    2018-05-02

    Cushing's syndrome in humans shares many similarities with its counterpart in dogs in terms of etiology (pituitary versus adrenal causes), clinical signs, and pathophysiologic sequelae. In both species, treatment of pituitary- and adrenal-dependent disease is met with limitations. ATR-101, a selective inhibitor of ACAT1 (acyl coenzyme A:cholesterol acyltransferase 1), is a novel small molecule therapeutic currently in clinical development for the treatment of adrenocortical carcinoma, congenital adrenal hyperplasia, and Cushing's syndrome in humans. Previous studies in healthy dogs have shown that ATR-101 treatment led to rapid, dose-dependent decreases in adrenocorticotropic hormone (ACTH) stimulated cortisol levels. The purpose of this clinical study was to investigate the effects of ATR-101 in dogs with Cushing's syndrome. ATR-101 pharmacokinetics and activity were assessed in 10 dogs with naturally-occurring Cushing's syndrome, including 7 dogs with pituitary-dependent disease and 3 dogs with adrenal-dependent disease. ATR-101 was administered at 3 mg/kg PO once daily for one week, followed by 30 mg/kg PO once daily for one (n = 4) or three (n = 6) weeks. Clinical, biochemical, adrenal hormonal, and pharmacokinetic data were obtained weekly for study duration. ATR-101 exposure increased with increasing dose. ACTH-stimulated cortisol concentrations, the primary endpoint for the study, were significantly decreased with responders (9 of 10 dogs) experiencing a mean ± standard deviation reduction in cortisol levels of 50 ± 17% at study completion. Decreases in pre-ACTH-stimulated cortisol concentrations were observed in some dogs although overall changes in pre-ACTH cortisol concentrations were not significant. The compound was well-tolerated and no serious drug-related adverse effects were reported. This study highlights the potential utility of naturally occurring canine Cushing's syndrome as a model for human disease and provides proof of

  13. In HepG2 cells, coexisting carnitine deficiency masks important indicators of marginal biotin deficiency.

    Science.gov (United States)

    Bogusiewicz, Anna; Boysen, Gunnar; Mock, Donald M

    2015-01-01

    A large number of birth defects are related to nutrient deficiencies; concern that biotin deficiency is teratogenic in humans is reasonable. Surprisingly, studies indicate that increased urinary 3-hydroxyisovalerylcarnitine (3HIAc), a previously validated marker of biotin deficiency, is not a valid biomarker in pregnancy. In this study we hypothesized that coexisting carnitine deficiency can prevent the increase in 3HIAc due to biotin deficiency. We used a 2-factor nutrient depletion design to induce isolated and combined biotin and carnitine deficiency in HepG2 cells and then repleted cells with carnitine. To elucidate the metabolic pathogenesis, we quantitated intracellular and extracellular free carnitine, acylcarnitines, and acylcarnitine ratios using liquid chromatography-tandem mass spectrometry. Relative to biotin-sufficient, carnitine-sufficient cells, intracellular acetylcarnitine increased by 90%, propionylcarnitine more than doubled, and 3HIAc increased by >10-fold in biotin-deficient, carnitine-sufficient (BDCS) cells, consistent with a defensive mechanism in which biotin-deficient cells transesterify the acyl-coenzyme A (acyl-CoA) substrates of the biotin-dependent carboxylases to the related acylcarnitines. Likewise, in BDCS cells, the ratio of acetylcarnitine to malonylcarnitine and the ratio of propionylcarnitine to methylmalonylcarnitine both more than tripled, and the ratio of 3HIAc to 3-methylglutarylcarnitine (MGc) increased by >10-fold. In biotin-deficient, carnitine-deficient (BDCD) cells, the 3 substrate-derived acylcarnitines changed little, but the substrate:product ratios were masked to a lesser extent. Moreover, carnitine repletion unmasked biotin deficiency in BDCD cells as shown by increases in acetylcarnitine, propionylcarnitine, and 3HIAc (each increased by >50-fold). Likewise, ratios of acetylcarnitine:malonylcarnitine, propionylcarnitine:methylmalonylcarnitine, and 3HIAc:MGc all increased by >8-fold. Our findings provide strong

  14. In HepG2 Cells, Coexisting Carnitine Deficiency Masks Important Indicators of Marginal Biotin Deficiency123

    Science.gov (United States)

    Bogusiewicz, Anna; Boysen, Gunnar; Mock, Donald M

    2015-01-01

    Background: A large number of birth defects are related to nutrient deficiencies; concern that biotin deficiency is teratogenic in humans is reasonable. Surprisingly, studies indicate that increased urinary 3-hydroxyisovalerylcarnitine (3HIAc), a previously validated marker of biotin deficiency, is not a valid biomarker in pregnancy. Objective: In this study we hypothesized that coexisting carnitine deficiency can prevent the increase in 3HIAc due to biotin deficiency. Methods: We used a 2-factor nutrient depletion design to induce isolated and combined biotin and carnitine deficiency in HepG2 cells and then repleted cells with carnitine. To elucidate the metabolic pathogenesis, we quantitated intracellular and extracellular free carnitine, acylcarnitines, and acylcarnitine ratios using liquid chromatography–tandem mass spectrometry. Results: Relative to biotin-sufficient, carnitine-sufficient cells, intracellular acetylcarnitine increased by 90%, propionylcarnitine more than doubled, and 3HIAc increased by >10-fold in biotin-deficient, carnitine-sufficient (BDCS) cells, consistent with a defensive mechanism in which biotin-deficient cells transesterify the acyl-coenzyme A (acyl-CoA) substrates of the biotin-dependent carboxylases to the related acylcarnitines. Likewise, in BDCS cells, the ratio of acetylcarnitine to malonylcarnitine and the ratio of propionylcarnitine to methylmalonylcarnitine both more than tripled, and the ratio of 3HIAc to 3-methylglutarylcarnitine (MGc) increased by >10-fold. In biotin-deficient, carnitine-deficient (BDCD) cells, the 3 substrate-derived acylcarnitines changed little, but the substrate:product ratios were masked to a lesser extent. Moreover, carnitine repletion unmasked biotin deficiency in BDCD cells as shown by increases in acetylcarnitine, propionylcarnitine, and 3HIAc (each increased by >50-fold). Likewise, ratios of acetylcarnitine:malonylcarnitine, propionylcarnitine:methylmalonylcarnitine, and 3HIAc:MGc all increased

  15. Homozygous and heterozygous GH transgenesis alters fatty acid composition and content in the liver of Amago salmon (Oncorhynchus masou ishikawae

    Directory of Open Access Journals (Sweden)

    Manabu Sugiyama

    2012-08-01

    Growth hormone (GH transgenic Amago (Oncorhynchus masou ishikawae, containing the sockeye GH1 gene fused with metallothionein-B promoter from the same species, were generated and the physiological condition through lipid metabolism compared among homozygous (Tg/Tg and heterozygous GH transgenic (Tg/+ Amago and the wild type control (+/+. Previously, we have reported that the adipose tissue was generally smaller in GH transgenic fish compared to the control, and that the Δ-6 fatty acyl desaturase gene was down-regulated in the Tg/+ fish. However, fatty acid (FA compositions have not been measured previously in these fish. In this study we compared the FAs composition and content in the liver using gas chromatography. Eleven kinds of FA were detected. The composition of saturated and monounsaturated fatty acids (SFA and MUFA such as myristic acid (14:0, palmitoleic acid (16:1n-7, and cis-vaccenic acid (cis-18:1n-7 was significantly (P<0.05 decreased in GH transgenic Amago. On the other hand, the composition of polyunsaturated fatty acids (PUFAs such as linoleic acid (18:2n-6, arachidonic acid (20:4n-6, and docosapentaenoic acid (22:5n-3 was significantly (P<0.05 increased. Levels of serum glucose and triacylglycerol were significantly (P<0.05 decreased in the GH transgenics compared with +/+ fish. Furthermore, 3′-tag digital gene expression profiling was performed using liver tissues from Tg/Tg and +/+ fish, and showed that Mid1 interacting protein 1 (Mid1ip1, which is an important factor to activate Acetyl-CoA carboxylase (ACC, was down-regulated in Tg/Tg fish, while genes involved in FA catabolism were up-regulated, including long-chain-fatty-acid–CoA ligase 1 (ACSL1 and acyl-coenzyme A oxidase 3 (ACOX3. These data suggest that liver tissue from GH transgenic Amago showed starvation by alteration in glucose and lipid metabolism due to GH overexpression. The decrease of serum glucose suppressed Mid1ip1, and caused a decrease of de novo FA synthesis, resulting

  16. mRNA expression of genes regulating lipid metabolism in ringed seals (Pusa hispida) from differently polluted areas

    Energy Technology Data Exchange (ETDEWEB)

    Castelli, Martina Galatea [Norwegian Polar Institute, Fram Centre, 9296 Tromsø (Norway); University of Bergen, Department of Biology, 5020 Bergen (Norway); Rusten, Marte; Goksøyr, Anders [University of Bergen, Department of Biology, 5020 Bergen (Norway); Routti, Heli, E-mail: heli.routti@npolar.no [Norwegian Polar Institute, Fram Centre, 9296 Tromsø (Norway)

    2014-01-15

    Highlights: •Genes regulating lipid metabolism were studied in ringed seals. •We compared highly contaminated Baltic seals and less contaminated Svalbard seals. •mRNA expression of hepatic PPARγ was higher in the Baltic seals. •mRNA expression of adipose PPARγ target genes was higher in the Baltic seals. •Contaminant exposure may affect lipid metabolism in the Baltic ringed seals. -- Abstract: There is a growing concern about the ability of persistent organic pollutants (POPs) to influence lipid metabolism. Although POPs are found at high concentrations in some populations of marine mammals, for example in the ringed seal (Pusa hispida) from the Baltic Sea, little is known about the effects of POPs on their lipid metabolism. An optimal regulation of lipid metabolism is crucial for ringed seals during the fasting/molting season. This is a physiologically stressful period, during which they rely on the energy stored in their fat reserves. The mRNA expression levels for seven genes involved in lipid metabolism were analyzed in liver and/or blubber tissue from molting ringed seals from the polluted Baltic Sea and a less polluted reference location, Svalbard (Norway). mRNA expression of genes encoding peroxisome proliferator-activated receptors (PPAR) α and γ and their target genes acyl-coenzyme A oxidase 1 (ACOX1) and cluster of differentiation 36 (CD36) were analyzed in liver. mRNA expression level of genes encoding PPARβ, PPARγ and their target genes encoding fatty acid binding protein 4 (FABP4) and adiponectin (ADIPOQ) were measured in inner and middle blubber layers. In addition, we evaluated the influence of molting status on hepatic mRNA expression of genes encoding PPARs and their target genes in ringed seals from Svalbard. Our results show higher mRNA expression of genes encoding hepatic PPARγ and adipose PPARβ, FABP4, and ADIPOQ in the Baltic seals compared to the Svalbard seals. A positive relationship between mRNA expressions of genes

  17. Glucagon-like peptide-1 analogue prevents nonalcoholic steatohepatitis in non-obese mice.

    Science.gov (United States)

    Yamamoto, Takaya; Nakade, Yukiomi; Yamauchi, Taeko; Kobayashi, Yuji; Ishii, Norimitsu; Ohashi, Tomohiko; Ito, Kiyoaki; Sato, Ken; Fukuzawa, Yoshitaka; Yoneda, Masashi

    2016-02-28

    To investigate whether a glucagon-like peptide-1 (GLP-1) analogue inhibits nonalcoholic steatohepatitis (NASH), which is being increasingly recognized in Asia, in non-obese mice. A methionine-choline-deficient diet (MCD) along with exendin-4 (20 μg/kg per day, ip), a GLP-1 analogue, or saline was administered to male db/db mice (non-obese NASH model). Four or eight weeks after commencement of the diet, the mice were sacrificed and their livers were excised. The excised livers were examined by histochemistry for evidence of hepatic steatosis and inflammation. Hepatic triglyceride (TG) and free fatty acid (FFA) content was measured, and the expression of hepatic fat metabolism- and inflammation-related genes was evaluated. Oxidative stress-related parameters and macrophage recruitment were also examined using immunohistochemistry. Four weeks of MCD feeding induced hepatic steatosis and inflammation and increased the hepatic TG and FFA content. The expression of fatty acid transport protein 4 (FATP4), a hepatic FFA influx-related gene; macrophage recruitment; and the level of malondialdehyde (MDA), an oxidative stress marker, were significantly augmented by a 4-wk MCD. The levels of hepatic sterol regulatory element-binding protein-1c (SREBP-1c) mRNA (lipogenesis-related gene) and acyl-coenzyme A oxidase 1 (ACOX1) mRNA (β-oxidation-related gene) had decreased at 4 wk and further decreased at 8 wk. However, the level of microsomal triglyceride transfer protein mRNA (a lipid excretion-related gene) remained unchanged. The administration of exendin-4 significantly attenuated the MCD-induced increase in hepatic steatosis, hepatic TG and FFA content, and FATP4 expression as well as the MCD-induced augmentation of hepatic inflammation, macrophage recruitment, and MDA levels. Additionally, it further decreased the hepatic SREBP-1c level and alleviated the MCD-mediated inhibition of the ACOX1 mRNA level. These results suggest that GLP-1 inhibits hepatic steatosis and

  18. Adaptive Immune Responses Regulate the Pathophysiology of Lymphedema

    Science.gov (United States)

    2012-09-01

    A, Hennig B (2000) Effect of complex decongestive physiotherapy on gene expression for the inflammatory response in peripheral lymphedema. Lymphology...pharmacologic antagonism of lysophosphatidic acid receptor 1 in a mouse model of scleroderma. Arthritis Rheum 63: 1405-1415. 51. Romani L, Mencacci A, Grohmann...severe disease in collagen-induced arthritis . Arthritis Rheum 48: 1452-1460. 29. Nakamura K, Radhakrishnan K, Wong YM, Rockson SG (2009) Anti

  19. Identification and Manipulation of a Novel Signaling Mechanism to Improve Articular Cartilage Restoration After Posttraumatic Joint Injury

    Science.gov (United States)

    2014-10-01

    collagen II (COL II). As a result, the newly-formed fibrocartilage has poor biomechanical properties and often evidences poor integration with the... fibrocartilage generation at the site of injury defines a new potential avenue of intervention in the field of cartilage restoration. We defined the...lysophosphatidic acid (LPA)-autotaxin (ATX; encoded by the ENPP2 gene) signaling axis as an important mediator of fibrocartilage formation both in vitro and in

  20. Autotaxin: Its Role in Biology of Melanoma Cells and as a Pharmacological Target

    Directory of Open Access Journals (Sweden)

    Maciej Jankowski

    2011-01-01

    Full Text Available Autotaxin (ATX is an extracellular lysophospholipase D (lysoPLD released from normal cells and cancer cells. Activity of ATX is detected in various biological fluids. The lysophosphatidic acid (LPA is the main product of ATX. LPA acting through specific G protein-coupled receptors (LPA1-LPA6 affects immunological response, normal development, and malignant tumors' formation and progression. In this review, the impact of autotoxin on biology of melanoma cells and potential treatment is discussed.

  1. Genetic and Functional Evidence Supports LPAR1 as a Susceptibility Gene for Hypertension.

    Science.gov (United States)

    Xu, Ke; Ma, Lu; Li, Yang; Wang, Fang; Zheng, Gu-Yan; Sun, Zhijun; Jiang, Feng; Chen, Yundai; Liu, Huirong; Dang, Aimin; Chen, Xi; Chun, Jerold; Tian, Xiao-Li

    2015-09-01

    Essential hypertension is a complex disease affected by genetic and environmental factors and serves as a major risk factor for cardiovascular diseases. Serum lysophosphatidic acid correlates with an elevated blood pressure in rats, and lysophosphatidic acid interacts with 6 subtypes of receptors. In this study, we assessed the genetic association of lysophosphatidic acid receptors with essential hypertension by genotyping 28 single-nucleotide polymorphisms from genes encoding for lysophosphatidic acid receptors, LPAR1, LPAR2, LPAR3, LPAR4, LPAR5, and LPAR6 and their flanking sequences, in 3 Han Chinese cohorts consisting of 2630 patients and 3171 controls in total. We identified a single-nucleotide polymorphism, rs531003 in the 3'-flanking genomic region of LPAR1, associated with hypertension (the Bonferroni corrected P=1.09×10(-5), odds ratio [95% confidence interval]=1.23 [1.13-1.33]). The risk allele C of rs531003 is associated with the increased expression of LPAR1 and the susceptibility of hypertension, particularly in those with a shortage of sleep (P=4.73×10(-5), odds ratio [95% confidence interval]=1.75 [1.34-2.28]). We further demonstrated that blood pressure elevation caused by sleep deprivation and phenylephrine-induced vasoconstriction was both diminished in LPAR1-deficient mice. Together, we show that LPAR1 is a novel susceptibility gene for human essential hypertension and that stress, such as shortage of sleep, increases the susceptibility of patients with risk allele to essential hypertension. © 2015 American Heart Association, Inc.

  2. Revisiting syntactic development in deaf and hearing children from a dependency approach. Comment on "Dependency distance: a new perspective on syntactic patterns in natural languages" by Haitao Liu et al.

    Science.gov (United States)

    Yan, Jingqi

    2017-07-01

    Linguists are always endeavoring to discover universal rules to explain the language phenomena and interrelations [1]. Through a handful of corpus-based studies and a vast body of supporting evidence from psychological experiments, Liu, Xu and Liang [2] arrive at a conclusion on a general tendency toward dependency distance minimization (DDM) and relate this linguistic universal to the constraints of memory. Dependency distance (DD) is hereby introduced as a linguistic property, with quantitative features of frequency, and profound cognitive grounding as well. However, since the authors do not include language development, in this comment, I would like to discuss some future prospects from this perspective.

  3. Mastopexia tridimensional con anclaje efectivo: Una respuesta a la ptosis, alteraciones de volumen, flacidez y recidiva en las mamoplastias 3D Mastopexy with a dependable anchoring site: A logical response to ptosis, volume alterations, flaccidity and relapse in mammaplasties

    Directory of Open Access Journals (Sweden)

    G. Peña Cabús

    2010-09-01

    Full Text Available La mastopexia es la técnica quirúrgica común que la Cirugía Plástica realiza en las mamas. En la literatura, se han expuesto múltiples y muy buenas técnicas sin terminar la búsqueda del elemento que sea consistente y que provea la mayor permanencia de resultados. De manera habitual, la atención se ha enfocado hacia la modificación anatómica del polo inferior, tratando de rellenar el polo superior de la mama de manera indirecta, con la confusión generalmente establecida de que, en la mayoría de las técnicas descritas, se considera el sostenimiento como sinónimo de suspensión. De manera descriptiva, exponemos una alternativa de suspensión que resulta tan interesante como sencilla, produciendo los resultados esperados a largo plazo y simplificando la técnica al reducir de manera importante la falta de mantenimiento del relleno del polo superior de la mama, el tiempo operatorio y facilitar la reconstrucción del molde mamario. La detección de un punto anatómico de fusión entre la fascia superficial, que es una continuación de la glándula mamaria y la propia fascia pectoral en la pared torácica, de importancia quirúrgica para el anclaje de la glándula mamaria, y el desarrollo de una técnica simple de suspensión glandular, logran cambiar los conceptos acostumbrados de nuestra práctica. La remodelación de la glándula se vuelve más sencilla y se autonomiza el manejo de la cubierta cutánea, permitiendo reducir la longitud final de las cicatrices.The elusive long term result in mastopexy, reveals the lack of an element that provides with certainty, an alternative that maintains the result surgically obtained. Although myriads of alternatives have been proposed in modern literature, most of them referred to lower pole anatomical molding as an indirect way to modify the upper pole as well, which is in fact the main target expectation for a good and sustained surgically outcome. There is a factor of confusion that has not been currently clarified; sustenance is not necessarily a synonym of suspension, being the latter our main objective that induced to present this technical proposal. The anatomical site of fusion of the superficial fascia which is in continuity with the mammary gland, and the proper pectoralis fascia, means that this structure can be used as a reinforced tissue that becomes as an anchoring site for the breast gland. An easily placement transglandular sutures stablishes the expected real suspension and the technical benefits derived from it, with the advantage of the use of non absorbable suture material that provides the occasion of change for a better good.

  4. A dependência pela prática de exercícios físicos e o uso de recursos ergogênicos = Physical exercise dependence and the use of ergogenic resources

    Directory of Open Access Journals (Sweden)

    José Luiz Lopes Vieira

    2010-01-01

    Full Text Available Objetivou-se Investigar a ocorrência de dependência por exercícios físicos quanto às características de praticantes de musculação e ginástica em academias, como uso de recursos ergogênicos, sexo e índice de massa corporal. Participaram do estudo 80 sujeitos (27,12 ± 6,60 anos, praticantes de ginástica e/ou musculação em academias, de ambos os sexos. Utilizou-se a Escala de Dependência por Exercícios Físicos, a listagem do tipo de suplemento alimentar utilizado como recurso ergogênico e o Índice de Massa Corporal – IMC (Kg/cm². A análise estatística foi realizada por meio da correlação de Spearman e o teste de Wilcoxon (p The aim of this study is to investigate the occurrence of physical exercise dependence in regards to the characteristics of participants in weight training and exercises at gyms, such as the use ofergogenic resources, gender and body mass index. Eighty subjects (27.12 ± 6.60 years from both genders took part in the study, all of whom practiced gymnastics and/or weight training in gyms. The study utilized the Exercise Dependence Scale, a check list of the kinds of nutritional supplementation used as ergogenic resources, and the Body Mass Index – BMI (Kg cm-². Statistical analysis was performed using Spearman's correlation and the Wilcoxon test (p < 0.05. The results showed that there was no statistically significant difference between physical exercise dependence in men (5.14 ± 1.28 and women (5.60 ± 1.45. The body mass index did not show statistically significant correlation with the scores of dependency, either. However, dependentmen showed high prevalence of use of ergogenic resources (63.63%, p = 0.01, while for dependent women there were no statistically significant results. The body mass index does not relate to the scores of exercise dependence. However, even with a normal BMI, the use of ergogenic resources presents high prevalence among dependent men. As a result, there is evidence that physical exercise dependence is a risk factor for the development of emotional disturbances related to exercise, such as muscle dysmorphia and overtraining.

  5. Gli2a protein localization reveals a role for Iguana/DZIP1 in primary ciliogenesis and a dependence of Hedgehog signal transduction on primary cilia in the zebrafish

    Directory of Open Access Journals (Sweden)

    van Eeden Freek

    2010-04-01

    Full Text Available Abstract Background In mammalian cells, the integrity of the primary cilium is critical for proper regulation of the Hedgehog (Hh signal transduction pathway. Whether or not this dependence on the primary cilium is a universal feature of vertebrate Hedgehog signalling has remained contentious due, in part, to the apparent divergence of the intracellular transduction pathway between mammals and teleost fish. Results Here, using a functional Gli2-GFP fusion protein, we show that, as in mammals, the Gli2 transcription factor localizes to the primary cilia of cells in the zebrafish embryo and that this localization is modulated by the activity of the Hh pathway. Moreover, we show that the Igu/DZIP1protein, previously implicated in the modulation of Gli activity in zebrafish, also localizes to the primary cilium and is required for its proper formation. Conclusion Our findings demonstrate a conserved role of the primary cilium in mediating Hedgehog signalling activity across the vertebrate phylum and validate the use of the zebrafish as a representative model for the in vivo analysis of vertebrate Hedgehog signalling.

  6. The transtheoretical model and substance dependence: theoretical and practical aspects O modelo transteórico e a dependência química: aspectos teóricos e práticos

    Directory of Open Access Journals (Sweden)

    Fabiana Andrioni De Biaze Vilela

    2009-12-01

    Full Text Available OBJECTIVE: This paper aims to present and discuss the Transtheoretical Model and its importance for the treatment of substance abuse disorders. METHOD: A literature review was made based on articles from the last 10 years in substance use with human subjects found in PubMed (Medline and the Scientific Electronic Library Online, as well as on the main books written by the creators of the model. From the initial collection of articles related to the Transtheoretical Model, the University of Rhode Island Assessment and substance abuse, those related to other health conditions were excluded. Although articles related to hospitalization were also excluded, as were those related to the Minnesota Model, treatment proposals were included. RESULTS: Although the TTM has been studied for over 20 years, new concerns regarding the initial idea continue to arise. Such concerns include the cross-sectional design of studies employing the model, as well as the prescriptive versus descriptive point of view. DISCUSSION: The review of the Transtheoretical Model brought intentional behavior change to light, which could broaden the understanding of addictive behaviors. Together with its concepts of processes and stages of change, the Transtheoretical Model provides professionals with the idea that the effectiveness of therapy is dependent upon the capability of the therapist to match the technique to the current motivational stage of the patient in the process of change. This demonstrates the importance of identifying the stage of change of the patient when they present for treatment. Here, we describe the principal elements of the Transtheoretical Model, as well as the instruments currently used to identify the stage of change. Finally, criticisms and limitations of the model are discussed.OBJETIVO: Este artigo tem como objetivos a apresentação e discussão do Modelo Transteórico e sua importância para o tratamento da dependência química. MÉTODO: Foi feita revisão de literatura baseada em artigos dos últimos 10 anos sobre abuso de substâncias com sujeitos humanos encontrados no PubMed (Medline e a Scientific Electronic Library Online, bem como as principais obras dos idealizadores da Teoria. Dos artigos encontrados inicialmente sobre o Modelo, University of Rhode Island Assessment e dependência química, aqueles relacionados a outras condições de saúde foram excluídos. Propostas de tratamento foram consideradas (exceto Modelo Minnesota e internação. RESULTADOS: Novas diretrizes surgem sobre a idéia inicial da teoria, apesar da mesma já ser estudada há mais de 20 anos: estudos transversais empregando o modelo, bem como a avaliação do potencial prescritivo ou descritivo do mesmo. DISCUSSÃO: Esta teoria enfoca a mudança intencional de comportamento, o que ampliou a compreensão dos comportamentos aditivos. O Modelo Transteórico sugere aos profissionais que a efetividade do tratamento depende da capacidade do mesmo de aplicar a técnica adequada à situação motivacional do paciente no processo de mudança. Isto demonstra porque é tão importante identificar o estágio de mudança do paciente quando este ingressa no tratamento. O artigo descreve os principais elementos da teoria bem como os principais instrumentos usados atualmente para identificar os estágios. Por fim, são discutidas as críticas e as limitações do modelo.

  7. A dependência pela prática de exercícios físicos e o uso de recursos ergogênicos = Physical exercise dependence and the use of ergogenic resources

    OpenAIRE

    José Luiz Lopes Vieira; Priscila Garcia Marques da Rocha; Ricardo Aparecido Ferrarezzi

    2010-01-01

    Objetivou-se Investigar a ocorrência de dependência por exercícios físicos quanto às características de praticantes de musculação e ginástica em academias, como uso de recursos ergogênicos, sexo e índice de massa corporal. Participaram do estudo 80 sujeitos (27,12 ± 6,60 anos), praticantes de ginástica e/ou musculação em academias, de ambos os sexos. Utilizou-se a Escala de Dependência por Exercícios Físicos, a listagem do tipo de suplemento alimentar utilizado como recurso ergogênico e o Índ...

  8. China y Argentina: "Oportunidades y desafíos", o cristalización de una asociación dependiente | China and Argentina: opportunities and challenges or the result of a dependent association

    Directory of Open Access Journals (Sweden)

    Pablo Alejandro NACHT

    2012-06-01

    Full Text Available El presente artículo tiene como objetivo central realizar un análisis del proceso de vinculación y articulación de los diferentes actores argentinos con la República Popular China. Se busca entender el rol de las fracciones del bloque en el poder (burguesía rural, burguesía industrial nacional relevantes en la vinculación con China en el período planteado. El trabajo abarca desde 2002 hasta 2007 y da cuenta del cambio del régimen de acumulación capitalista, evidenciando una nueva configuración de fuerzas dentro del bloque y que encuentra, en la relación argentina con el gigante asiático, un socio destacado. Los sectores agroexportadores y las petroleras se erigen como las más beneficiadas en esta vinculación, al tiempo que la burguesía mercado internista menos competitiva presiona para frenar la entrada de manufacturas chinas. El estado argentino, lejos de ser un actor neutral, recibe importantes recursos por lo recaudado como derechos de exportación y es utilizado por el Gobierno; plasmándose de esta manera un escenario de tensiones y pujas entre los sectores, al tiempo que se cristaliza un modelo neo-extractivista con el monocultivo de soja transgénica como commoditie de exportación.This research article focus on the process of vinculation and coordination between different argentinian actors and China. It seeks to understand the role of the fractions of the power bloc (rural bourgeoisie, national industrial bourgeoisie, etc. relevant to the relationship with China in the period stated. The work ranges from 2002 to 2007 and shows the capitalist accumulation regime´s change, showing a new configuration of forces within the bloc and the relationship with the asian giant as leading partner. The agro-exporters and oil sectors stand as the main beneficiaries in this relationship, while the national industrial bourgeoisie pressed to stem the flow of Chinese products. The argentine state far from being a neutral actor, receives substantial resources from the proceeds as export duties and is used by the Government, shaping itself in this way scenario tensions and struggles between sectors, crystallizes as a neo extractive model with transgenic soybean monoculture and export commodities.

  9. Renal-Specific Silencing of TNF (Tumor Necrosis Factor) Unmasks Salt-Dependent Increases in Blood Pressure via an NKCC2A (Na+-K+-2Cl- Cotransporter Isoform A)-Dependent Mechanism.

    Science.gov (United States)

    Hao, Shoujin; Hao, Mary; Ferreri, Nicholas R

    2018-06-01

    We tested the hypothesis that TNF (tumor necrosis factor)-α produced within the kidney and acting on the renal tubular system is part of a regulatory mechanism that attenuates increases in blood pressure in response to high salt intake. Intrarenal administration of a lentivirus construct, which specifically silenced TNF in the kidney, did not affect baseline blood pressure. However, blood pressure increased significantly 1 day after mice with intrarenal silencing of TNF ingested 1% NaCl in the drinking water. The increase in blood pressure, which was continuously observed for 11 days, promptly returned to baseline levels when mice were switched from 1% NaCl to tap water. Silencing of renal TNF also increased NKCC2 (Na + -K + -2Cl - cotransporter) phosphorylation and induced a selective increase in NKCC2A (NKCC2 isoform A) mRNA accumulation in both the cortical and medullary thick ascending limb of Henle loop that was neither associated with a compensatory decrease of NKCC2F in the medulla nor NKCC2B in the cortex. The NaCl-mediated increases in blood pressure were completely absent when NKCC2A, using a lentivirus construct that did not alter expression of NKCC2F or NKCC2B, and TNF were concomitantly silenced in the kidney. Moreover, the decrease in urine volume and NaCl excretion induced by renal TNF silencing was abolished when NKCC2A was concurrently silenced, suggesting that this isoform contributes to the transition from a salt-resistant to salt-sensitive phenotype. Collectively, the data are the first to demonstrate a role for TNF produced by the kidney in the modulation of sodium homeostasis and blood pressure regulation. © 2018 American Heart Association, Inc.

  10. Peroxisome proliferator-activated receptors, estrogenic responses and biotransformation system in the liver of salmon exposed to tributyltin and second messenger activator

    Energy Technology Data Exchange (ETDEWEB)

    Pavlikova, Nela [Department of Biology, Norwegian University of Science and Technology (NTNU), Hogskoleringen 5, 7491 Trondheim (Norway); RECETOX Research Centre for Environmental Chemistry and Ecotoxicology, Masaryk University, Kamenice 3, CZ62500 Brno (Czech Republic); Kortner, Trond M. [Department of Biology, Norwegian University of Science and Technology (NTNU), Hogskoleringen 5, 7491 Trondheim (Norway); Arukwe, Augustine, E-mail: arukwe@bio.ntnu.no [Department of Biology, Norwegian University of Science and Technology (NTNU), Hogskoleringen 5, 7491 Trondheim (Norway)

    2010-08-15

    The mechanisms by which organotin compounds produce modulations of the endocrine systems and other biological responses are not fully understood. In this study, juvenile salmon were force-fed diet containing TBT (0: solvent control, 0.1, 1 and 10 mg/kg fish) for 72 h. Subsequently, fish exposed to solvent control and 10 mg TBT were exposed to waterborne concentration (200 {mu}g/l) of the adenylate cyclase (AC) stimulator, forskolin for 2 and 4 h. The overall aim of the study was to explore whether TBT endocrine disruptive effects involve second messenger activation. Liver was sampled from individual fish (n = 8) at the end of the exposures. The transcription patterns of peroxisome proliferator-activated receptor (PPAR) isotype and acyl-coenzyme A oxidase 1 (ACOX1), aromatase isoform, estrogen receptor-{alpha} (ER{alpha}), pregnane X receptor (PXR), CYP3A and glutathione S-transferase (GST) genes were measured by quantitative polymerase chain reaction (qPCR). Our data showed a consistent increase in PPAR{alpha}, PPAR{beta} and PPAR{gamma} mRNA and protein expression after TBT exposure that were inversely correlated with ACOX1 mRNA levels. Forskolin produced PPAR isotype-specific mRNA and protein effects that were modulated by TBT. ACOX1 expression was decreased (at 2 h) and increased (at 4 h) by forskolin and the presence of TBT potentiated these effects. TBT apparently increased mRNA and protein levels of cyp19a, compared to the solvent control, whereas cyp19b mRNA levels were unaffected by TBT treatment. Combined TBT and forskolin exposure produced respective decrease and increase of mRNA levels of cyp19a and cyp19b, compared with control. TBT decreased ER{alpha} mRNA at low dose (1 mg/kg) and forskolin exposure alone produced a consistent decrease of ER{alpha} mRNA levels that were not affected by the presence of TBT. Interestingly, PXR and CYP3A mRNA levels were differentially affected, either decreased or increased, after exposure to TBT and forskolin, singly

  11. Two bifunctional enzymes from the marine protist Thraustochytrium roseum: biochemical characterization of wax ester synthase/acyl-CoA:diacylglycerol acyltransferase activity catalyzing wax ester and triacylglycerol synthesis.

    Science.gov (United States)

    Zhang, Nannan; Mao, Zejing; Luo, Ling; Wan, Xia; Huang, Fenghong; Gong, Yangmin

    2017-01-01

    Triacylglycerols (TAGs) and wax esters (WEs) are important neutral lipids which serve as energy reservoir in some plants and microorganisms. In recent years, these biologically produced neutral lipids have been regarded as potential alternative energy sources for biofuel production because of the increased interest on developing renewable and environmentally benign alternatives for fossil fuels. In bacteria, the final step in TAG and WE biosynthetic pathway is catalyzed by wax ester synthase/acyl coenzyme A (acyl-CoA):diacylglycerol acyltransferase (WS/DGAT). This bifunctional WS/DGAT enzyme is also a key enzyme in biotechnological production of liquid WE via engineering of plants and microorganisms. To date, knowledge about this class of biologically and biotechnologically important enzymes is mainly from biochemical characterization of WS/DGATs from Arabidopsis, jojoba and some bacteria that can synthesize both TAGs and WEs intracellularly, whereas little is known about WS/DGATs from eukaryotic microorganisms. Here, we report the identification and characterization of two bifunctional WS/DGAT enzymes (designated TrWSD4 and TrWSD5) from the marine protist Thraustochytrium roseum . Both TrWSD4 and TrWSD5 comprise a WS-like acyl-CoA acyltransferase domain and the recombinant proteins purified from Escherichia coli Rosetta (DE3) have substantial WS and lower DGAT activity. They exhibit WS activity towards various-chain-length saturated and polyunsaturated acyl-CoAs and fatty alcohols ranging from C 10 to C 18 . TrWSD4 displays WS activity with the lowest K m value of 0.14 μM and the highest k cat / K m value of 1.46 × 10 5  M -1  s -1 for lauroyl-CoA (C 12:0 ) in the presence of 100 μM hexadecanol, while TrWSD5 exhibits WS activity with the lowest K m value of 0.96 μM and the highest k cat / K m value of 9.83 × 10 4  M -1  s -1 for decanoyl-CoA (C 10:0 ) under the same reaction condition. Both WS/DGAT enzymes have the highest WS activity at 37 and 47

  12. A comparative study: Difference in omega-6/omega-3 balance and saturated fat in diets for Atlantic salmon (Salmo salar) affect immune-, fat metabolism-, oxidative and apoptotic-gene expression, and eicosanoid secretion in head kidney leukocytes.

    Science.gov (United States)

    Holen, Elisabeth; Araujo, Pedro; Sissener, Nini H; Rosenlund, Grethe; Waagbø, Rune

    2018-01-01

    The aim of this study was to compare how different dietary vegetable oil n-6/n-3 ratios affect gene responses involved in inflammation, signaling pathways, fatty acid synthesis and oxidation, oxidation and apoptosis as well as eicosanoid production in salmon head kidney tissues and isolated head kidney leukocytes. Salmon smolts (200 g) were fed four different diets where the main lipid components were palm oil (n-6/n-3 ratio = 0.7), rapeseed oil (n-6/n-3 ratio = 0.9), and soybean oil (n-6/n-3 ratio = 2.4) and a high soybean oil diet with an n-6/n-3 ratio = 4. Both head kidney tissue and leukocytes isolated from head kidneys were sampled from the four diets, but from different fish. Leukocytes isolated from the head kidneys were seeded into culture wells and added lipopolysaccharide (LPS) to induce inflammatory responses. Controls without LPS were included. Head kidney leukocytes and the tissues should have the same phenotype reflecting the different diets. Interleukin 1β (IL-1β) transcription was elevated in head kidney tissue and especially in LPS treated leukocytes isolated from soybean oil (n-6/n-3 = 2.4) fed salmon, which confirmed the suitability of the in vitro model in this experiment. Leukocytes, treated with LPS, and isolated from salmon fed the soybean oil diet (n-6/n-3 = 2.4) also upregulated tumor necrosis factor alpha (tnf-α), cyclooxygenase (cox2), prostaglandin D and E synthase (ptgds, ptges), fatty acyl synthase (fas), 5 and 6 desaturases (5des, 6 des) and a fatty acid translocase protein (cd36) when compared to the other diets. The results suggest that diets with a specific n-6/n-3 ratio influence the transcription of pro-inflammatory genes and may be cross-linked to transcription of selected fatty acid metabolism genes. Salmon fed the palm oil diet (n-6/n-3 = 0.7) showed a lower expression of inflammatory genes. Instead, peroxisome proliferator activated receptor β1 (pparβ1), acyl coenzyme A (aco), apoptosis regulator (bax) and

  13. PSI1 is responsible for the stearic acid enrichment that is characteristic of phosphatidylinositol in yeast

    DEFF Research Database (Denmark)

    Le Guédard, Marina; Bessoule, Jean-Jacques; Boyer, Valérie

    2009-01-01

    complete disappearance of stearic (but not of palmitic acid) at the sn-1 position of this phospholipid. Moreover, it was found that, whereas glycerol 3-phosphate, lysophosphatidic acid and 1-acyl lysophosphatidylinositol acyltransferase activities were similar in microsomal membranes isolated from wild......-acyl-1-lysolysophosphatidylinositol acyltransferase activity was recovered, and was accompanied by a strong increase in the stearic acid content of lysophosphatidylinositol. As previously suggested for phosphatidylinositol from animal cells (which contains almost exclusively stearic acid...... as the saturated fatty acid), the results obtained in the present study demonstrate that the existence of phosphatidylinositol species containing stearic acid in yeast results from a remodeling of neo-synthesized molecules of phosphatidylinositol....

  14. Multiple Mechanisms are Responsible for Transactivation of the Epidermal Growth Factor Receptor in Mammary Epithelial Cells

    Energy Technology Data Exchange (ETDEWEB)

    Rodland, Karin D.; Bollinger, Nikki; Ippolito, Danielle L.; Opresko, Lee; Coffey, Robert J.; Zangar, Richard C.; Wiley, H. S.

    2008-11-14

    REVIEW ENTIRE DOCUMENT AT: https://pnlweb.pnl.gov/projects/bsd/ERICA%20Manuscripts%20for%20Review/KD%20Rodland%20D7E80/HMEC_transactivation_ms01_15+Figs.pdf ABSTRACT: Using a single nontransformed strain of human mammary epithelial cells, we found that the ability of multiple growth factors and cytokines to induce ERK phosphorylation was dependent on EGFR activity. These included lysophosphatidic acid (LPA), uridine triphosphate, growth hormone, vascular endothelial growth factor, insulin-like growth factor-1 (IGF-1), and tumor necrosis factoralpha. In contrast, hepatocyte growth factor could stimulate ERK phosphorylation independent of EGFR activity...

  15. Large scale purification and characterization of recombinant human autotaxin/lysophospholipase D from mammalian cells

    OpenAIRE

    Song, Yuanda; Dilger, Emily; Bell, Jessica; Barton, William A; Fang, Xianjun

    2010-01-01

    We utilized a mammalian expression system to purify and characterize autotaxin (ATX)/lysophospholipase D, an enzyme present in the blood responsible for biosynthesis of lysophosphatidic acid. The human ATX cDNA encoding amino acids 29–915 was cloned downstream of a secretion signal of CD5. At the carboxyl terminus was a thrombin cleavage site followed by the constant domain (Fc) of IgG to facilitate protein purification. The ATX-Fc fusion protein was expressed in HEK293 cells and isolated fro...

  16. Pruritus in chronic cholestatic liver diseases

    Directory of Open Access Journals (Sweden)

    E. V. Vinnitskaya

    2017-01-01

    Full Text Available Pruritus can be a prominent symptom  in patients with chronic liver disorders, especially those  with cholestasis,  and  substantially  affects  quality  of life. Management of pruritus  in cholestatic  liver diseases  remains  a  complicated   medical  problem. The review article deals with pathophysiological mechanisms of pruritus in cholestatic liver diseases, in particular, with the role of bile acids, endogenous opioids, serotonin, and histamine. There is new data on the key pathophysiological elements, such as neuronal activation lysophosphatidic acid and autotaxin, an enzyme that produces lysophosphatidic acid and whose serum activity is associated with the intensity of pruritus. Pathophysiology-based management approaches include administration of anionic exchange resin cholestyramine, ursodeoxycholic acid, rifampicin agonists, an opioid antagonist naltrexone and a  serotonin-reuptake inhibitor sertraline. These agents are recommended for the use as a stepped treatment algorithm. Patients who do not respond to these therapies can become candidates for albumin dialysis, plasmapheresis, ultraviolet B phototherapy, or need some other individualized approaches. New knowledge on the pathophysiology of pruritus may potentially result in the development of new agents for cholestatic pruritus.

  17. Autotaxin: A protein with two faces

    Energy Technology Data Exchange (ETDEWEB)

    Tania, Mousumi; Khan, Md. Asaduzzaman; Zhang, Huaiyuan; Li, Jinhua [Department of Biochemistry, School of Biological Science and Technology, Central South University, Changsha, Hunan 410013 (China); Song, Yuanda, E-mail: yuanda_song@hotmail.com [Department of Biochemistry, School of Biological Science and Technology, Central South University, Changsha, Hunan 410013 (China)

    2010-10-29

    Research highlights: {yields} Autotaxin (ATX) has lysophospholipase D activity. {yields} ATX catalyzes the formation of lysophosphatidic acid (LPA). {yields} LPA is a mitogen, and thus is responsible for cancer. {yields} ATX also catalyzes the formation of anti-cancerous cyclic phosphatidic acid. {yields} Autotaxin is a novel target of cancer therapy research. -- Abstract: Autotaxin (ATX) is a catalytic protein, which possesses lysophospholipase D activity, and thus involved in cellular membrane lipid metabolism and remodeling. Primarily, ATX was thought as a culprit protein for cancer, which potently stimulates cancer cell proliferation and tumor cell motility, augments the tumorigenicity and induces angiogenic responses. The product of ATX catalyzed reaction, lysophosphatidic acid (LPA) is a potent mitogen, which facilitates cell proliferation and migration, neurite retraction, platelet aggregation, smooth muscle contraction, actin stress formation and cytokine and chemokine secretion. In addition to LPA formation, later ATX has been found to catalyze the formation of cyclic phosphatidic acid (cPA), which have antitumor role by antimitogenic regulation of cell cycle, inhibition of cancer invasion and metastasis. Furthermore, the very attractive information to the scientists is that the LPA/cPA formation can be altered at different physiological conditions. Thus the dual role of ATX with the scope of product manipulation has made ATX a novel target for cancer treatment.

  18. Effect of detergents, trypsin, and bivalent metal ions on interfacial activation and functioning of phospholipase D.

    Science.gov (United States)

    Madyarov, Sh R

    2014-07-01

    The effects of detergents, trypsin, and bivalent metal ions on production of phosphatidic and lysophosphatidic acids by the action of phospholipase D (PLD) on lecithin and lysolecithin were studied. It was found that these reaction products and dodecyl sulfate ions activate PLD, whereas other anionic detergents are less effective. A protective effect of the functioning enzyme against its hydrolytic inactivation by trypsin was found. Bivalent metal ions can be arranged in the following sequence by their ability to activate PLD in the hydrolysis of lecithin and lysolecithin: Ca2+>Sr2+>Ba2+>Mg2+. These results are considered in relation to a proposed mechanism of activation and functioning of PLD with the participation of clusters of phosphatidates and lysophosphatidates. Such Me2+-induced formation of rafts or microdomains from the products of hydrolysis of phospholipids can rationalize not only PLD activation and self-regulation, but also the action of this mechanism on other components and properties of biomembranes. PLD and other lipolytic enzymes can be classified as lateral vector enzymes.

  19. ATX-LPA1 axis contributes to proliferation of chondrocytes by regulating fibronectin assembly leading to proper cartilage formation.

    Science.gov (United States)

    Nishioka, Tatsuji; Arima, Naoaki; Kano, Kuniyuki; Hama, Kotaro; Itai, Eriko; Yukiura, Hiroshi; Kise, Ryoji; Inoue, Asuka; Kim, Seok-Hyung; Solnica-Krezel, Lilianna; Moolenaar, Wouter H; Chun, Jerold; Aoki, Junken

    2016-03-23

    The lipid mediator lysophosphatidic acid (LPA) signals via six distinct G protein-coupled receptors to mediate both unique and overlapping biological effects, including cell migration, proliferation and survival. LPA is produced extracellularly by autotaxin (ATX), a secreted lysophospholipase D, from lysophosphatidylcholine. ATX-LPA receptor signaling is essential for normal development and implicated in various (patho)physiological processes, but underlying mechanisms remain incompletely understood. Through gene targeting approaches in zebrafish and mice, we show here that loss of ATX-LPA1 signaling leads to disorganization of chondrocytes, causing severe defects in cartilage formation. Mechanistically, ATX-LPA1 signaling acts by promoting S-phase entry and cell proliferation of chondrocytes both in vitro and in vivo, at least in part through β1-integrin translocation leading to fibronectin assembly and further extracellular matrix deposition; this in turn promotes chondrocyte-matrix adhesion and cell proliferation. Thus, the ATX-LPA1 axis is a key regulator of cartilage formation.

  20. Yap is required for ependymal integrity and is suppressed in LPA-induced hydrocephalus

    Science.gov (United States)

    Park, Raehee; Moon, Uk Yeol; Park, Jun Young; Hughes, Lucinda J.; Johnson, Randy L.; Cho, Seo-Hee; Kim, Seonhee

    2016-01-01

    Timely generation and normal maturation of ependymal cells along the aqueduct are critical for preventing physical blockage between the third and fourth ventricles and the development of fetal non-communicating hydrocephalus. Our study identifies Yap, the downstream effector of the evolutionarily conserved Hippo pathway, as a central regulator for generating developmentally controlled ependymal cells along the ventricular lining of the aqueduct. Yap function is necessary for proper proliferation of progenitors and apical attachment of ependymal precursor cells. Importantly, an injury signal initiated by lysophosphatidic acid (LPA), an upstream regulator of Yap that can cause fetal haemorrhagic hydrocephalus, deregulates Yap in the developing aqueduct. LPA exposure leads to the loss of N-cadherin concentrations at the apical endfeet, which can be partially restored by forced Yap expression and more efficiently by phosphomimetic Yap. These results reveal a novel function of Yap in retaining tissue junctions during normal development and after fetal brain injury. PMID:26754915

  1. Stability of sonicated aqueous suspensions of phospholipids under air.

    Science.gov (United States)

    Almog, R; Forward, R; Samsonoff, C

    1991-12-01

    The stability of phospholipids in liposomal aqueous suspension against oxidative degradation in air was investigated using spectrophotometric indices, glutathione peroxidase reactivity and thin layer chromatography. Zwitterionic phospholipid was found to be susceptible to degradation via oxidation of polyunsaturated hydrocarbon chains and ester hydrolysis, producing oxidized lysophosphatide and free fatty acid derivatives. These products were characterized as hydroperoxides based on their reactivity with the selenium-dependent glutathione peroxidase isolated from human erythrocytes. Lecithin in Tris buffer was more resistant to hydrolysis than in water. The sonication of 8.0 mM of soybean phosphatidylcholine (SB-PC) suspension in 0.1 M Tris (pH 7.5) in the presence of air produced relatively high concentration of conjugated diene hydroperoxide, but a small amount of hydrolyzed products. Anionic phospholipids, such as egg-phosphatidylglycerol (egg-PG), demonstrated higher resistance to air oxidation than the zwitterionic lecithin, but its oxidation was promoted by sonication.

  2. Phospholipase A and the interaction of Rickettsia prowazekii and mouse fibroblasts (L-929 cells)

    International Nuclear Information System (INIS)

    Winkler, H.H.; Miller, E.T.

    1982-01-01

    L-929 cells were killed when approximately 50 viable Rickettsia prowazekii organisms per L-cell were centrifuged onto a monolayer. The glycerophospholipids of the L-cell were hydrolyzed to lysophosphatides and free fatty acids. Concomitantly, there was a loss of membrane integrity as shown by release of lactate dehydrogenase and 86Rb and permeability to trypan blue dye. No glycerophospholipid hydrolysis or cytotoxicity occurred when the rickettsiae were inactivated by heat, UV irradiation, N-ethylmaleimide, or metabolic inhibitors before their addition to the L-929 cells. On the other hand, treatment of the L929 cells with the cytoskeleton agents colchicine or cytochalasin B or with N-ethylmaleimide inhibited neither the phospholipase A activity nor the loss of membrane integrity. Cytochalasin B-treated cells could be damaged by even small numbers of rickettsiae. We suggest that this phospholipase A activity is used by the rickettsiae to escape from the phagosomes into the cytoplasm of host cells

  3. New insights into the autotaxin/LPA axis in cancer development and metastasis

    Energy Technology Data Exchange (ETDEWEB)

    Leblanc, Raphaël; Peyruchaud, Olivier, E-mail: olivier.peyruchaud@inserm.fr

    2015-05-01

    Lysophosphatidic acid (LPA) is a simple lipid with a single fatty acyl chain linked to a glycerophosphate backbone. Despite the simplicity of its structure but owing to its interactions with a series of at least six G protein-coupled receptors (LPA{sub 1–6}), LPA exerts pleiotropic bioactivities including stimulation of proliferation, migration and survival of many cell types. Autotaxin (ATX) is a unique enzyme with a lysophospholipase D (lysoPLD) activity that is responsible for the levels of LPA in the blood circulation. Both LPA receptor family members and ATX/LysoPLD are aberrantly expressed in many human cancers. This review will present the more striking as well as novel experimental evidences using cell lines, cancer mouse models and transgenic animals identifying the roles for ATX and LPA receptors in cancer progression, tumor cell invasion and metastasis.

  4. Regulation of insulin-like growth factor I transcription by cyclic adenosine 3',5'-monophosphate (cAMP) in fetal rat bone cells through an element within exon 1: protein kinase A-dependent control without a consensus AMP response element

    Science.gov (United States)

    McCarthy, T. L.; Thomas, M. J.; Centrella, M.; Rotwein, P.

    1995-01-01

    Insulin-like growth factor I (IGF-I) is a locally synthesized anabolic growth factor for bone. IGF-I synthesis by primary fetal rat osteoblasts (Ob) is stimulated by agents that increase the intracellular cAMP concentration, including prostaglandin E2 (PGE2). Previous studies with Ob cultures demonstrated that PGE2 enhanced IGF-I transcription through selective use of IGF-I promoter 1, with little effect on IGF-I messenger RNA half-life. Transient transfection of Ob cultures with an array of promoter 1-luciferase reporter fusion constructs has now allowed localization of a potential cis-acting promoter element(s) responsible for cAMP-stimulated gene expression to the 5'-untranslated region (5'-UTR) of IGF-I exon 1, within a segment lacking a consensus cAMP response element. Our evidence derives from three principal observations: 1) a transfection construct containing only 122 nucleotides (nt) of promoter 1 and 328 nt of the 5'-UTR retained full PGE2-stimulated reporter expression; 2) maximal PGE2-driven reporter expression required the presence of nt 196 to 328 of exon 1 when tested within the context of IGF-I promoter 1; 3) cotransfection of IGF-I promoter-luciferase-reporter constructs with a plasmid encoding the alpha-isoform of the catalytic subunit of murine cAMP-dependent protein kinase (PKA) produced results comparable to those seen with PGE2 treatment, whereas cotransfection with a plasmid encoding a mutant regulatory subunit of PKA that cannot bind cAMP blocked PGE2-induced reporter expression. Deoxyribonuclease I footprinting of the 5'-UTR of exon 1 demonstrated protected sequences at HS3A, HS3B, and HS3D, three of six DNA-protein binding sites previously characterized with rat liver nuclear extracts. Of these three regions, only the HS3D binding site is located within the functionally identified hormonally responsive segment of IGF-I exon 1. These results directly implicate PKA in the control of IGF-I gene transcription by PGE2 and identify a segment of IGF-I exon 1 as being essential for this hormonal regulation.

  5. O estresse físico e a dependência de exercício físico El estrés físico y la dependencia de ejercicio físico Physical stress and physical exercise dependence

    Directory of Open Access Journals (Sweden)

    Hanna K.M. Antunes

    2006-10-01

    Full Text Available O objetivo do presente estudo foi verificar os escores referentes à escala de dependência de exercício, qualidade de vida, bem como os escores indicativos de humor em atletas de corrida de aventura (CA. Participaram deste estudo 17 atletas de ambos os gêneros com histórico de prática da modalidade de pelo menos três anos, com experiência em provas nacionais e internacionais e que figuram nas primeiras posições do ranking brasileiro. A média (± desvio-padrão da idade, altura, massa corporal, índice de massa corpórea (IMC e consumo de oxigênio foram: 31,11 ± 6,30 anos; 1,73 ± 0,07cm; 70,75 ± 7,96kg; 23,48 ± 1,48kg/m² e 58,70 ± 6,63ml.min¹.kg¹, respectivamente. Os voluntários responderam aos seguintes questionários: Escala de Dependência de Exercício (EDE, Idate Traço e Estado, Profile of Mood States (POMS, SF-36 Pesquisa em Saúde e Questionário de Padrão Social. Os resultados revelaram que os escores observados na EDE foram indicativos de dependência de exercício; já os questionários de humor revelaram ansiedade moderada, enquanto o POMS não detectou escores indicativos de distúrbios de humor. Quanto à qualidade de vida, a média das oito dimensões referentes ao questionário SF-36 se mostrou acima de 85%, sugerindo que, apesar de haver dependência de exercício, parece que esse fato não foi capaz de promover alterações significativas no estado de humor e na qualidade de vida. Esses dados sugerem que atletas de CA apresentam dependência de exercício não associada aos distúrbios de humor.El objetivo del presente estudio ha sido el de verificar los escores referentes a la escala de dependencia de ejercicio, calidad de vida, así como los escores indicativos de humor en atletas de Carrera de Aventura (CA. Participaron de este estudio 17 atletas de ambos géneros con histórico de práctica de la modalidad de por lo menos tres años, con experiencia en pruebas nacionales e internacionales y que figuran en las primeras posiciones del ranking brasileño. La media (± desvío padrón de edad, altura, masa corporal, índice de masa corpórea (IMC y consumo de oxígeno fueron: 31,11 ± 6,30 años; 1,73 ± 0,07 cm; 70,75 ± 7,96 kg; 23,48 ± 1,48 kg/m² y 58,70 ± 6,63 ml.min-1.kg-1, respectivamente. Los voluntarios respondieron a los siguientes cuestionarios: Escala de Dependencia de Ejercicio (EDE, "Idate Traço" y Estado, Profile of Mood States (POMS, SF-36 Investigación e Salud y Cuestionario de Padrón Social. Los resultados revelaron que los escores observados en la EDE fueron indicativos de dependencia de ejercicio, mientras que los cuestionarios de humor revelaron ansiedad moderada, entretanto el POMS no detectó escores indicativos de disturbios de humor. En relación a la calidad de vida, la media de las 8 dimensiones referentes al cuestionario SF-36 se mostró por encima de 85%, lo que sugiere que a pesar de haber dependencia de ejercicio, parece que ese hecho no fue capaz de promover alteraciones significativas en el estado de humor y en la calidad de vida. Nuestros datos sugieren que atletas de CA presentan dependencia de ejercicio no asociada a los disturbios de humor.The aim of this study was to verify the referring scores of exercise dependence, quality of life as well as the mood indicators in adventure race (AR athletes. 17 athletes of both sexes participated in the study and all had a history of three years in this modality, with national and international experience, and figured in the first positions in the Brazilian ranking. The age, height, weight, body mass index (BMI and oxygen uptake averages ± standard deviations were: 31.11 ± 6.30 years; 1.73 ± 0.07 cm; 70.75 ± 7.96 kg; 23.48 ± 1.48 wt/ht² and 58.70 ± 6.63 ml.min-1.kg-1, respectively. The volunteers were given the following questionnaires: Exercise Dependency Scale (EDE, Idate Trait and State, Profile of Mood States (POMS, SF-36 Health Research and Social Patterns Questionnaire. The results showed that scores in EDE indicated exercise dependence, and the mood questionnaires revealed moderate anxiety, while the POMS did not detect any indicative scores of mood disorders. Concerning the quality of life, the average of 8 dimensions of the SF-36 was higher than 85%, suggesting that although there was exercise dependence, this fact alone did not promote significant alterations in mood and quality of life. Thus, our data suggested that athletes of AR have exercise dependence not associated to mood disorders.

  6. A dependência pela prática de exercícios físicos e o uso de recursos ergogênicos - DOI: 10.4025/actascihealthsci.v32i1.4475 Physical exercise dependence and the use of ergogenic resources - DOI: 10.4025/actascihealthsci.v32i1.4475

    Directory of Open Access Journals (Sweden)

    Ricardo Aparecido Ferrarezi

    2009-12-01

    Full Text Available Objetivou-se Investigar a ocorrência de dependência por exercícios físicos quanto às características de praticantes de musculação e ginástica em academias, como uso de recursos ergogênicos, sexo e índice de massa corporal. Participaram do estudo 80 sujeitos (27,12 ± 6,60 anos, praticantes de ginástica e/ou musculação em academias, de ambos os sexos. Utilizou-se a Escala de Dependência por Exercícios Físicos, a listagem do tipo de suplemento alimentar utilizado como recurso ergogênico e o Índice de Massa Corporal – IMC (Kg/cm². A análise estatística foi realizada por meio da correlação de Spearman e o teste de Wilcoxon (p The aim of this study is to investigate the occurrence of physical exercise dependence in regards to the characteristics of participants in weight training and exercises at gyms, such as the use of ergogenic resources, gender and body mass index. Eighty subjects (27.12 ± 6.60 years from both genders took part in the study, all of whom practiced gymnastics and/or weight training in gyms. The study utilized the Exercise Dependence Scale, a check list of the kinds of nutritional supplementation used as ergogenic resources, and the Body Mass Index – BMI (Kg cm-². Statistical analysis was performed using Spearman's correlation and the Wilcoxon test (p < 0.05. The results showed that there was no statistically significant difference between physical exercise dependence in men (5.14 ± 1.28 and women (5.60 ± 1.45. The body mass index did not show statistically significant correlation with the scores of dependency, either. However, dependent men showed high prevalence of use of ergogenic resources (63.63%, p = 0.01, while for dependent women there were no statistically significant results. The body mass index does not relate to the scores of exercise dependence. However, even with a normal BMI, the use of ergogenic resources presents high prevalence among dependent men. As a result, there is evidence that physical exercise dependence is a risk factor for the development of emotional disturbances related to exercise, such as muscle dysmorphia and overtraining.

  7. A dependência pela prática de exercícios físicos e o uso de recursos ergogênicos - DOI: 10.4025/actascihealthsci.v32i1.4475 Physical exercise dependence and the use of ergogenic resources - DOI: 10.4025/actascihealthsci.v32i1.4475

    OpenAIRE

    Ricardo Aparecido Ferrarezi; Priscila Garcia Marques Rocha; José Luiz Lopes Vieira

    2009-01-01

    Objetivou-se Investigar a ocorrência de dependência por exercícios físicos quanto às características de praticantes de musculação e ginástica em academias, como uso de recursos ergogênicos, sexo e índice de massa corporal. Participaram do estudo 80 sujeitos (27,12 ± 6,60 anos), praticantes de ginástica e/ou musculação em academias, de ambos os sexos. Utilizou-se a Escala de Dependência por Exercícios Físicos, a listagem do tipo de suplemento alimentar utilizado como recurso ergogênico e o Índ...

  8. ¿La democracia es un sistema dependiente de valores como el conformismo y la obediencia? Un estudio comparado sobre las valoraciones que jóvenes y adultos españoles hacen de la democracia (Is democracy a dependent value such as conformity and obedience? A comparative study on the assestments that young and adult Spanish do of democracy

    Directory of Open Access Journals (Sweden)

    Liberto Carratalá Puertas

    2016-12-01

    Full Text Available Las investigaciones sobre la calidad de la democracia y la valoración que la ciudadanía realiza de ella han girado en torno a la influencia que el sistema económico o el político ejerce sobre las dimensiones que la componen. Los resultados han tenido un alcance explicativo limitado. Para superar este déficit se propone llevar a cabo un análisis de la cuestión desde una perspectiva que articule el nivel macro, la estructura política y económica, y micro, la subjetividad de la ciudadanía. Este trabajo abre una línea de investigación alternativa y complementaria a las ya existentes, con el objetivo de comprender cómo los valores humanos influyen en la valoración de la experiencia democrática de los jóvenes y adultos españoles. Los resultados, derivados del análisis de los datos con la técnica de los modelos de ecuaciones estructurales (SEM, ponen de relieve la diferencia existente entre jóvenes y adultos en sus respectivas valoraciones de la democracia, aunque coinciden en que es insatisfactoria. | The researches on democracy’s quality and the assessment citizens make of it have usually turned around the influence of economic or political systems applied on its dimensions. The results have had a limited explanatory range. In order to get over this shortfall, the proposal is the analysis from a perspective that will articulate macro and micro levels. This work will open an alternative and complementary research line to existing ones with the aim to understand how human values have influence on the assessment of the democratic experience from young and adult Spanish people. The results derived from data analysed with Structural Equation Models (SEM underline the difference between young’s and adult’s values of democracy even though they agree it is unsatisfying.

  9. Association of fatty acids and lipids metabolism in placenta with early spontaneous pregnancy loss in Chinese women.

    Science.gov (United States)

    Li, Kelei; Zhang, Xiaotian; Chen, Gong; Pei, Lijun; Xiao, Hailong; Jiang, Jiajing; Li, Jiaomei; Zheng, Xiaoying; Li, Duo

    2018-02-21

    The aim of the present study was to evaluate the association of fatty acids and lipids metabolism in placenta with early spontaneous pregnancy loss (ESPL) in Chinese women. Seventy women with ESPL and 29 healthy pregnant women who asked for legal induced abortion were included in the case and control groups, respectively. The gestational age of the subject foetuses in both the case and control groups ranged from 4 to 10 weeks. The total fatty acids composition in the decidual and villous tissues was detected by gas-liquid chromatography using a standard method. Metabonomics analysis of the decidual and villous tissues was conducted by ultra-performance liquid chromatography quadrupole time of flight mass spectrometry (UPLC-QTOFMS). The total C18:3n-3 in the decidual and villous tissues, total n-3 polyunsaturated fatty acid (n-3 PUFA) in the decidual tissue, and total C18:2n-6 in the villous tissue were all significantly lower in the case group than in the control group. The ratio of C20:4n-6/C20:5n-3 in villous tissue was significantly higher, but prostaglandin I 2 as well as hydroxyeicosapentaenoic acid, leukotriene B 5 and thromboxane B 3 in the villous tissue were significantly lower in the case group than in the control group. In addition, the low content of lysophosphatide in the decidual and villous tissues and the low content of diacylglycerol in the villous tissue were also associated with the occurance of ESPL. In conclusion, the lack of essential fatty acids, high ratio of C20:4n-6/C20:5n-3, abnormal eicosanoids metabolism and low content of lysophosphatide and diacylglycerol in the placenta were all potential risk factors for ESPL in Chinese.

  10. Silymarin and caffeine combination ameliorates experimentally-induced hepatic fibrosis through down-regulation of LPAR1 expression.

    Science.gov (United States)

    Eraky, Salma M; El-Mesery, Mohamed; El-Karef, Amro; Eissa, Laila A; El-Gayar, Amal M

    2018-05-01

    Lysophosphatidic acid is a lipid mediator that is supposed to be implicated in hepatic fibrosis. Silymarin and caffeine are natural compounds known for their anti-inflammatory and antioxidant effects. Our study aimed to explore the effect of silymarin, caffeine, and their combination on lysophosphatidic acid receptor 1 (LPAR1) pathway in thioacetamide (TAA)-induced hepatic fibrosis. Hepatic fibrosis was induced in male Sprague-Dawley rats by intraperitoneal injection of 200 mg/kg of TAA twice a week for 8 weeks. Silymarin (50 mg/kg), caffeine (50 mg/kg), and their combination (50 mg/kg silymarin + 50 mg/kg caffeine) were orally given to rats every day for 8 weeks along with TAA injection. Liver functions were measured. Histopathological examination of liver tissues was performed using hematoxylin and eosin and Masson's trichrome staining. mRNA expressions of LPAR1, transforming growth factor beta 1 (TGF-β1), connective tissue growth factor (CTGF), and alpha smooth muscle actin (α-SMA) were measured using RT-PCR. LPAR1 tissue expression was scored using immunohistochemistry. Silymarin, caffeine, and their combination significantly improved liver function. They caused significant decrease in fibrosis and necro-inflammatory scores. Combination of silymain and caffeine caused a significant decrease in the necro-inflammatory score than the single treatment with silymarin or caffeine. In addition, silymarin, caffeine, and their combination significantly decreased hepatic LPAR1, TGF-β1, CTGF, and α-SMA gene expressions and LPAR1 tissue expression. Silymarin, caffeine, and their combination protect against liver fibrosis through down-regulation of LPAR1, TGF-β1, and CTGF. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  11. The Peanut (Arachis hypogaea L. Gene AhLPAT2 Increases the Lipid Content of Transgenic Arabidopsis Seeds.

    Directory of Open Access Journals (Sweden)

    Silong Chen

    Full Text Available Lysophosphatidic acid acyltransferase (LPAT, which converts lysophosphatidic acid (LPA to phosphatidic acid (PA, catalyzes the addition of fatty acyl moieties to the sn-2 position of the LPA glycerol backbone in triacylglycerol (TAG biosynthesis. We recently reported the cloning and temporal-spatial expression of a peanut (Arachis hypogaea AhLPAT2gene, showing that an increase in AhLPAT2 transcript levels was closely correlated with an increase in seed oil levels. However, the function of the enzyme encoded by the AhLPAT2 gene remains unclear. Here, we report that AhLPAT2 transcript levels were consistently higher in the seeds of a high-oil cultivar than in those of a low-oil cultivar across different seed developmental stages. Seed-specific overexpression of AhLPAT2 in Arabidopsis results in a higher percentage of oil in the seeds and greater-than-average seed weight in the transgenic plants compared with the wild-type plants, leading to a significant increase in total oil yield per plant. The total fatty acid (FA content and the proportion of unsaturated FAs also increased. In the developing siliques of AhLPAT2-overexpressing plants, the expression levels of genes encoding crucial enzymes involved in de novo FA synthesis, acetyl-CoA subunit (AtBCCP2 and acyl carrier protein 1 (AtACP1 were elevated. AhLPAT2 overexpression also promoted the expression of several key genes related to TAG assembly, sucrose metabolism, and glycolysis. These results demonstrate that the expression of AhLPAT2 plays an important role in glycerolipid production in peanuts.

  12. A negative modulatory role for rho and rho-associated kinase signaling in delamination of neural crest cells

    Directory of Open Access Journals (Sweden)

    Kalcheim Chaya

    2008-10-01

    Full Text Available Abstract Background Neural crest progenitors arise as epithelial cells and then undergo a process of epithelial to mesenchymal transition that precedes the generation of cellular motility and subsequent migration. We aim at understanding the underlying molecular network. Along this line, possible roles of Rho GTPases that act as molecular switches to control a variety of signal transduction pathways remain virtually unexplored, as are putative interactions between Rho proteins and additional known components of this cascade. Results We investigated the role of Rho/Rock signaling in neural crest delamination. Active RhoA and RhoB are expressed in the membrane of epithelial progenitors and are downregulated upon delamination. In vivo loss-of-function of RhoA or RhoB or of overall Rho signaling by C3 transferase enhanced and/or triggered premature crest delamination yet had no effect on cell specification. Consistently, treatment of explanted neural primordia with membrane-permeable C3 or with the Rock inhibitor Y27632 both accelerated and enhanced crest emigration without affecting cell proliferation. These treatments altered neural crest morphology by reducing stress fibers, focal adhesions and downregulating membrane-bound N-cadherin. Reciprocally, activation of endogenous Rho by lysophosphatidic acid inhibited emigration while enhancing the above. Since delamination is triggered by BMP and requires G1/S transition, we examined their relationship with Rho. Blocking Rho/Rock function rescued crest emigration upon treatment with noggin or with the G1/S inhibitor mimosine. In the latter condition, cells emigrated while arrested at G1. Conversely, BMP4 was unable to rescue cell emigration when endogenous Rho activity was enhanced by lysophosphatidic acid. Conclusion Rho-GTPases, through Rock, act downstream of BMP and of G1/S transition to negatively regulate crest delamination by modifying cytoskeleton assembly and intercellular adhesion.

  13. Characterization of substrate preference for Slc1p and Cst26p in Saccharomyces cerevisiae using lipidomic approaches and an LPAAT activity assay.

    Directory of Open Access Journals (Sweden)

    Guanghou Shui

    Full Text Available BACKGROUND: Phosphatidic acid (PA is a key regulated intermediate and precursor for de novo biosynthesis of all glycerophospholipids. PA can be synthesized through the acylation of lysophosphatidic acid (LPA by 1-acyl-3-phosphate acyltransferase (also called lysophosphatidic acid acyltransferase, LPAAT. Recent findings have substantiated the essential roles of acyltransferases in various biological functions. METHODOLOGIES/PRINCIPAL FINDINGS: We used a flow-injection-based lipidomic approach with approximately 200 multiple reaction monitoring (MRM transitions to pre-screen fatty acyl composition of phospholipids in the yeast Saccharomyces cerevisiae mutants. Dramatic changes were observed in fatty acyl composition in some yeast mutants including Slc1p, a well-characterized LPAAT, and Cst26p, a recently characterized phosphatidylinositol stearoyl incorporating 1 protein and putative LPAAT in S. cerevisiae. A comprehensive high-performance liquid chromatography-based multi-stage MRM approach (more than 500 MRM transitions was developed and further applied to quantify individual phospholipids in both strains to confirm these changes. Our data suggest potential fatty acyl substrates as well as fatty acyls that compensate for defects in both Cst26p and Slc1p mutants. These results were consistent with those from a non-radioactive LPAAT enzymatic assay using C17-LPA and acyl-CoA donors as substrates. CONCLUSIONS: We found that Slc1p utilized fatty acid (FA 18:1 and FA 14:0 as substrates to synthesize corresponding PAs; moreover, it was probably the only acyltransferase responsible for acylation of saturated short-chain fatty acyls (12:0 and 10:0 in S. cerevisiae. We also identified FA 18:0, FA 16:0, FA 14:0 and exogenous FA 17:0 as preferred substrates for Cst26p because transformation with a GFP-tagged CST26 restored the phospholipid profile of a CST26 mutant. Our current findings expand the enzymes and existing scope of acyl-CoA donors for

  14. Amyloid fibril formation of peptides derived from the C-terminus of CETP modulated by lipids

    Energy Technology Data Exchange (ETDEWEB)

    García-González, Victor [Instituto de Fisiología Celular, Universidad Nacional Autónoma de México, 04510 México, DF (Mexico); Mas-Oliva, Jaime, E-mail: jmas@ifc.unam.mx [Instituto de Fisiología Celular, Universidad Nacional Autónoma de México, 04510 México, DF (Mexico); División de Investigación, Facultad de Medicina, Universidad Nacional Autónoma de México, 04510 México, DF (Mexico)

    2013-04-26

    Highlights: •The secondary structure of a C-terminal peptide derived from CETP was studied. •Lipids modulate secondary structure changes of a C-terminal peptide derived from CETP. •Lysophosphatidic acid maintains a functional α-helix and prevents fibril formation. •Transfer of lipids by CETP is related to the presence of an α-helix at its C-end. -- Abstract: Cholesteryl-ester transfer protein (CETP) is a plasmatic protein involved in neutral lipid transfer between lipoproteins. Focusing on the last 12 C-terminus residues we have previously shown that mutation D{sub 470}N promotes a conformational change towards a β-secondary structure. In turn, this modification leads to the formation of oligomers and fibrillar structures, which cause cytotoxic effects similar to the ones provoked by amyloid peptides. In this study, we evaluated the role of specific lipid arrangements on the structure of peptide helix-Z (D{sub 470}N) through the use of thioflavin T fluorescence, peptide bond absorbance, circular dichroism and electron microscopy. The results indicate that the use of micelles formed with lysophosphatidylcholine and lysophosphatidic acid (LPA) under neutral pH induce a conformational transition of peptide helix-Z containing a β-sheet conformation to a native α-helix structure, therefore avoiding the formation of amyloid fibrils. In contrast, incubation with phosphatidic acid does not change the profile for the β-sheet conformation. When the electrostatic charge at the surface of micelles or vesicles is regulated through the use of lipids such as phospholipid and LPA, minimal changes and the presence of β-structures were recorded. Mixtures with a positive net charge diminished the percentage of β-structure and the amount of amyloid fibrils. Our results suggest that the degree of solvation determined by the presence of a free hydroxyl group on lipids such as LPA is a key condition that can modulate the secondary structure and the consequent formation of

  15. Amyloid fibril formation of peptides derived from the C-terminus of CETP modulated by lipids

    International Nuclear Information System (INIS)

    García-González, Victor; Mas-Oliva, Jaime

    2013-01-01

    Highlights: •The secondary structure of a C-terminal peptide derived from CETP was studied. •Lipids modulate secondary structure changes of a C-terminal peptide derived from CETP. •Lysophosphatidic acid maintains a functional α-helix and prevents fibril formation. •Transfer of lipids by CETP is related to the presence of an α-helix at its C-end. -- Abstract: Cholesteryl-ester transfer protein (CETP) is a plasmatic protein involved in neutral lipid transfer between lipoproteins. Focusing on the last 12 C-terminus residues we have previously shown that mutation D 470 N promotes a conformational change towards a β-secondary structure. In turn, this modification leads to the formation of oligomers and fibrillar structures, which cause cytotoxic effects similar to the ones provoked by amyloid peptides. In this study, we evaluated the role of specific lipid arrangements on the structure of peptide helix-Z (D 470 N) through the use of thioflavin T fluorescence, peptide bond absorbance, circular dichroism and electron microscopy. The results indicate that the use of micelles formed with lysophosphatidylcholine and lysophosphatidic acid (LPA) under neutral pH induce a conformational transition of peptide helix-Z containing a β-sheet conformation to a native α-helix structure, therefore avoiding the formation of amyloid fibrils. In contrast, incubation with phosphatidic acid does not change the profile for the β-sheet conformation. When the electrostatic charge at the surface of micelles or vesicles is regulated through the use of lipids such as phospholipid and LPA, minimal changes and the presence of β-structures were recorded. Mixtures with a positive net charge diminished the percentage of β-structure and the amount of amyloid fibrils. Our results suggest that the degree of solvation determined by the presence of a free hydroxyl group on lipids such as LPA is a key condition that can modulate the secondary structure and the consequent formation of amyloid

  16. Characterization of tissue biomechanics and mechanical signaling in uterine leiomyoma☆

    Science.gov (United States)

    Norian, John M.; Owen, Carter M.; Taboas, Juan; Korecki, Casey; Tuan, Rocky; Malik, Minnie; Catherino, William H.; Segars, James H.

    2012-01-01

    Leiomyoma are common tumors arising within the uterus that feature excessive deposition of a stiff, disordered extracellular matrix (ECM). Mechanical stress is a critical determinant of excessive ECM deposition and increased mechanical stress has been shown to be involved in tumorigenesis. Here we tested the viscoelastic properties of leiomyoma and characterized dynamic and static mechanical signaling in leiomyoma cells using three approaches, including measurement of active RhoA. We found that the peak strain and pseudo-dynamic modulus of leiomyoma tissue was significantly increased relative to matched myometrium. In addition, leiomyoma cells demonstrated an attenuated response to applied cyclic uniaxial strain and to variation in substrate stiffness, relative to myometrial cells. However, on a flexible pronectin-coated silicone substrate, basal levels and lysophosphatidic acid-stimulated levels of activated RhoA were similar between leiomyoma and myometrial cells. In contrast, leiomyoma cells plated on a rigid polystyrene substrate had elevated levels of active RhoA, compared to myometrial cells. The results indicate that viscoelastic properties of the ECM of leiomyoma contribute significantly to the tumor’s inherent stiffness and that leiomyoma cells have an attenuated sensitivity to mechanical cues. The findings suggest there may be a fundamental alteration in the communication between the external mechanical environment (extracellular forces) and reorganization of the actin cytoskeleton mediated by RhoA in leiomyoma cells. Additional research will be needed to elucidate the mechanism(s) responsible for the attenuated mechanical signaling in leiomyoma cells. PMID:21983114

  17. Jaundice associated pruritis: a review of pathophysiology and treatment.

    Science.gov (United States)

    Bassari, Ramez; Koea, Jonathan B

    2015-02-07

    To review the underlying pathophysiology and currently available treatments for pruritis associated with jaundice. English language literature was reviewed using MEDLINE, PubMed, EMBASE and clinicaltrials.gov for papers and trails addressing the pathophysiology and potential treatments for pruritis associated with jaundice. Recent advances in the understanding of the peripheral anatomy of itch transmission have defined a histamine stimulated pathway and a cowhage stimulated pathway with sensation conveyed centrally via the contralateral spinothalamic tract. Centrally, cowhage and histamine stimulated neurons terminate widely within the thalamus and sensorimotor cortex. The causative factors for itch in jaundice have not been clarified although endogenous opioids, serotonin, steroid and lysophosphatidic acid all play a role. Current guidelines for the treatment of itching in jaundice recommend initial management with biliary drainage where possible and medical management with ursodeoxycholic acid, followed by cholestyramine, rifampicin, naltrexone and sertraline. Other than biliary drainage no single treatment has proved universally effective. Pruritis associated with jaundice is a common but poorly understood condition for which biliary drainage is the most effective therapy. Pharmacological therapy has advanced but remains variably effective.

  18. Regulation of T cell motility in vitro and in vivo by LPA and LPA2.

    Directory of Open Access Journals (Sweden)

    Sara A Knowlden

    Full Text Available Lysophosphatidic acid (LPA and the LPA-generating enzyme autotaxin (ATX have been implicated in lymphocyte trafficking and the regulation of lymphocyte entry into lymph nodes. High local concentrations of LPA are thought to be present in lymph node high endothelial venules, suggesting a direct influence of LPA on cell migration. However, little is known about the mechanism of action of LPA, and more work is needed to define the expression and function of the six known G protein-coupled receptors (LPA 1-6 in T cells. We studied the effects of 18∶1 and 16∶0 LPA on naïve CD4+ T cell migration and show that LPA induces CD4+ T cell chemorepulsion in a Transwell system, and also improves the quality of non-directed migration on ICAM-1 and CCL21 coated plates. Using intravital two-photon microscopy, lpa2-/- CD4+ T cells display a striking defect in early migratory behavior at HEVs and in lymph nodes. However, later homeostatic recirculation and LPA-directed migration in vitro were unaffected by loss of lpa2. Taken together, these data highlight a previously unsuspected and non-redundant role for LPA2 in intranodal T cell motility, and suggest that specific functions of LPA may be manipulated by targeting T cell LPA receptors.

  19. Microtubule Destabilizer KIF2A Undergoes Distinct Site-Specific Phosphorylation Cascades that Differentially Affect Neuronal Morphogenesis

    Directory of Open Access Journals (Sweden)

    Tadayuki Ogawa

    2015-09-01

    Full Text Available Neurons exhibit dynamic structural changes in response to extracellular stimuli. Microtubules (MTs provide rapid and dramatic cytoskeletal changes within the structural framework. However, the molecular mechanisms and signaling networks underlying MT dynamics remain unknown. Here, we have applied a comprehensive and quantitative phospho-analysis of the MT destabilizer KIF2A to elucidate the regulatory mechanisms of MT dynamics within neurons in response to extracellular signals. Interestingly, we identified two different sets of KIF2A phosphorylation profiles that accelerate (A-type and brake (B-type the MT depolymerization activity of KIF2A. Brain-derived neurotrophic factor (BDNF stimulates PAK1 and CDK5 kinases, which decrease the MT depolymerizing activity of KIF2A through B-type phosphorylation, resulting in enhanced outgrowth of neural processes. In contrast, lysophosphatidic acid (LPA induces ROCK2 kinase, which suppresses neurite outgrowth from round cells via A-type phosphorylation. We propose that these two mutually exclusive forms of KIF2A phosphorylation differentially regulate neuronal morphogenesis during development.

  20. The reorientation of cell nucleus promotes the establishment of front-rear polarity in migrating fibroblasts.

    Science.gov (United States)

    Maninová, Miloslava; Klímová, Zuzana; Parsons, J Thomas; Weber, Michael J; Iwanicki, Marcin P; Vomastek, Tomáš

    2013-06-12

    The establishment of cell polarity is an essential step in the process of cell migration. This process requires precise spatiotemporal coordination of signaling pathways that in most cells create the typical asymmetrical profile of a polarized cell with nucleus located at the cell rear and the microtubule organizing center (MTOC) positioned between the nucleus and the leading edge. During cell polarization, nucleus rearward positioning promotes correct microtubule organizing center localization and thus the establishment of front-rear polarity and directional migration. We found that cell polarization and directional migration require also the reorientation of the nucleus. Nuclear reorientation is manifested as temporally restricted nuclear rotation that aligns the nuclear axis with the axis of cell migration. We also found that nuclear reorientation requires physical connection between the nucleus and cytoskeleton mediated by the LINC (linker of nucleoskeleton and cytoskeleton) complex. Nuclear reorientation is controlled by coordinated activity of lysophosphatidic acid (LPA)-mediated activation of GTPase Rho and the activation of integrin, FAK (focal adhesion kinase), Src, and p190RhoGAP signaling pathway. Integrin signaling is spatially induced at the leading edge as FAK and p190RhoGAP are predominantly activated or localized at this location. We suggest that integrin activation within lamellipodia defines cell front, and subsequent FAK, Src, and p190RhoGAP signaling represents the polarity signal that induces reorientation of the nucleus and thus promotes the establishment of front-rear polarity. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. A role for Pyk2 and Src in linking G-protein-coupled receptors with MAP kinase activation.

    Science.gov (United States)

    Dikic, I; Tokiwa, G; Lev, S; Courtneidge, S A; Schlessinger, J

    1996-10-10

    The mechanisms by which mitogenic G-protein-coupled receptors activate the MAP kinase signalling pathway are poorly understood. Candidate protein tyrosine kinases that link G-protein-coupled receptors with MAP kinase include Src family kinases, the epidermal growth factor receptor, Lyn and Syk. Here we show that lysophosphatidic acid (LPA) and bradykinin induce tyrosine phosphorylation of Pyk2 and complex formation between Pyk2 and activated Src. Moreover, tyrosine phosphorylation of Pyk2 leads to binding of the SH2 domain of Src to tyrosine 402 of Pyk2 and activation of Src. Transient overexpression of a dominant interfering mutant of Pyk2 or the protein tyrosine kinase Csk reduces LPA- or bradykinin-induced activation of MAP kinase. LPA- or bradykinin-induced MAP kinase activation was also inhibited by overexpression of dominant interfering mutants of Grb2 and Sos. We propose that Pyk2 acts with Src to link Gi- and Gq-coupled receptors with Grb2 and Sos to activate the MAP kinase signalling pathway in PC12 cells.

  2. The PDZ protein GIPC regulates trafficking of the LPA1 receptor from APPL signaling endosomes and attenuates the cell's response to LPA.

    Directory of Open Access Journals (Sweden)

    Tal Varsano

    Full Text Available Lysophosphatidic acid (LPA mediates diverse cellular responses through the activation of at least six LPA receptors--LPA(1-6, but the interacting proteins and signaling pathways that mediate the specificity of these receptors are largely unknown. We noticed that LPA(1 contains a PDZ binding motif (SVV identical to that present in two other proteins that interact with the PDZ protein GIPC. GIPC is involved in endocytic trafficking of several receptors including TrkA, VEGFR2, lutropin and dopamine D2 receptors. Here we show that GIPC binds directly to the PDZ binding motif of LPA(1 but not that of other LPA receptors. LPA(1 colocalizes and coimmunoprecipitates with GIPC and its binding partner APPL, an activator of Akt signaling found on APPL signaling endosomes. GIPC depletion by siRNA disturbed trafficking of LPA(1 to EEA1 early endosomes and promoted LPA(1 mediated Akt signaling, cell proliferation, and cell motility. We propose that GIPC binds LPA(1 and promotes its trafficking from APPL-containing signaling endosomes to EEA1 early endosomes and thus attenuates LPA-mediated Akt signaling from APPL endosomes.

  3. Origin and evolution of group XI secretory phospholipase A2 from flax (Linum usitatissimum) based on phylogenetic analysis of conserved domains.

    Science.gov (United States)

    Gupta, Payal; Saini, Raman; Dash, Prasanta K

    2017-07-01

    Phospholipase A 2 (PLA 2 ) belongs to class of lipolytic enzymes (EC 3.1.1.4). Lysophosphatidic acid (LPA) and free fatty acids (FFAs) are the products of PLA 2 catalyzed hydrolysis of phosphoglycerides at sn-2 position. LPA and FFA that act as second mediators involved in the development and maturation of plants and animals. Mining of flax genome identified two phospholipase A 2 encoding genes, viz., LusPLA 2 I and LusPLA 2 II (Linum usitatissimum secretory phospholipase A 2 ). Molecular simulation of LusPLA 2 s with already characterized plant sPLA 2 s revealed the presence of conserved motifs and signature domains necessary to classify them as secretory phospholipase A 2 . Phylogenetic analysis of flax sPLA 2 with representative sPLA 2 s from other organisms revealed that they evolved rapidly via gene duplication/deletion events and shares a common ancestor. Our study is the first report of detailed phylogenetic analysis for secretory phospholipase A 2 in flax. Comparative genomic analysis of two LusPLA 2 s with earlier reported plant sPLA 2 s, based on their gene architectures, sequence similarities, and domain structures are presented elucidating the uniqueness of flax sPLA 2 .

  4. Platelets Promote Metastasis via Binding Tumor CD97 Leading to Bidirectional Signaling that Coordinates Transendothelial Migration

    Directory of Open Access Journals (Sweden)

    Yvona Ward

    2018-04-01

    Full Text Available Summary: Tumor cells initiate platelet activation leading to the secretion of bioactive molecules, which promote metastasis. Platelet receptors on tumors have not been well-characterized, resulting in a critical gap in knowledge concerning platelet-promoted metastasis. We identify a direct interaction between platelets and tumor CD97 that stimulates rapid bidirectional signaling. CD97, an adhesion G protein-coupled receptor (GPCR, is an overexpressed tumor antigen in several cancer types. Purified CD97 extracellular domain or tumor cell-associated CD97 stimulated platelet activation. CD97-initiated platelet activation led to granule secretion, including the release of ATP, a mediator of endothelial junction disruption. Lysophosphatidic acid (LPA derived from platelets induced tumor invasiveness via proximal CD97-LPAR heterodimer signaling, coupling coincident tumor cell migration and vascular permeability to promote transendothelial migration. Consistent with this, CD97 was necessary for tumor cell-induced vascular permeability in vivo and metastasis formation in preclinical models. These findings support targeted blockade of tumor CD97 as an approach to ameliorate metastatic spread. : Tumor-initiated platelet activation promotes tissue invasion of cancer cells and metastasis. Ward et al. demonstrate that a common tumor-associated antigen, CD97, accounts for platelet activation and participates directly in LPA-mediated signal transduction leading to tumor cell invasion. CD97 promotes vascular extravasation and metastasis in pre-clinical models. Keywords: platelets, metastasis, transendothelial migration, circulating tumor cells, CD97, adhesion GPCR, LPA

  5. The regulatory effects of low-dose ionizing radiation on Ikaros-autotaxin interaction

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Hana; Cho, Seong Jun; Kim, Sung Jin; Nam, Seon Young; Yang, Kwang Hee [KHNP Radiation Health Institute, Korea Hydro and Nuclear Power Co, Seoul (Korea, Republic of)

    2016-11-15

    Ikaros, a transcription factor containing zinc-finger motif, has known as a critical regulator of hematopoiesis in immune system. Ikaros protein modulates the transcription of target genes via binding to the regulatory elements of the genes promoters. However the regulatory function of Ikaros in other organelle except nuclear remains to be determined. This study explored radiation-induced modulatory function of Ikaros in cytoplasm. The results showed that Ikaros protein lost its DNA binding ability after LDIR (low-dose ionizing radiation) exposure. Cell fractionation and Western blot analysis showed that Ikaros protein was translocated into cytoplasm from nuclear by LDIR. This was confirmed by immunofluorescence assay. We identified Autotaxin as a novel protein which potentially interacts with Ikaros through in vitro protein-binding screening. Co-immunoprecipitation assay revealed that Ikaros and Autotaxin are able to bind each other. Autotaxin is a crucial enzyme generating lysophosphatidic acid (LPA), a phospholipid mediator, which has potential regulatory effects on immune cell growth and motility. Our results indicate that LDIR potentially regulates immune system via protein-protein interaction of Ikaros and Autotaxin.

  6. Fc-receptor-mediated phagocytosis is regulated by mechanical properties of the target

    Science.gov (United States)

    Beningo, Karen A.; Wang, Yu-li

    2002-01-01

    Phagocytosis is an actin-based process used by macrophages to clear particles greater than 0.5 microm in diameter. In addition to its role in immunological responses, phagocytosis is also necessary for tissue remodeling and repair. To prevent catastrophic autoimmune reactions, phagocytosis must be tightly regulated. It is commonly assumed that the recognition/selection of phagocytic targets is based solely upon receptor-ligand binding. Here we report an important new criterion, that mechanical parameters of the target can dramatically affect the efficiency of phagocytosis. When presented with particles of identical chemical properties but different rigidity, macrophages showed a strong preference to engulf rigid objects. Furthermore, phagocytosis of soft particles can be stimulated with the microinjection of constitutively active Rac1 but not RhoA, and with lysophosphatidic acid, an agent known to activate the small GTP-binding proteins of the Rho family. These data suggest a Rac1-dependent mechanosensory mechanism for phagocytosis, which probably plays an important role in a number of physiological and pathological processes from embryonic development to autoimmune diseases.

  7. Mechanisms of spinal cord injury regeneration in zebrafish: a systematic review

    Directory of Open Access Journals (Sweden)

    Zeynab Noorimotlagh

    2017-12-01

    Full Text Available Objective(s:To determine the molecular and cellular mechanisms of spinal cord regeneration in zebrafish. Materials and Methods: Medical databases of PubMed and Scopus were searched with following key words: Zebrafish; spinal cord injuries; regeneration; recovery of function. The map of mechanisms was performed using Xmind software. Results: Wnt/ß-catenin signaling, L1.1, L1.2, Major vault protein (MVP, contactin-2 and High mobility group box1 (HMGB1 had positive promoting effects on axonal re-growth while Ptena had an inhibitory effect. Neurogenesis is stimulated by Wnt/ß-catenin signaling as well as HMGB1, but inhibited by Notch signaling. Glial cells proliferate in response to fibroblast growth factor (fgf signaling and Lysophosphatidic acid (LPA. Furthermore, fgf signaling pathway causes glia bridge formation in favor of axonal regeneration. LPA and HMGB1 in acute phase stimulate inflammatory responses around injury and suppress regeneration. LPA also induces microglia activation and neuronal death in addition to glia cell proliferation, but prevents neurite sprouting. Conclusion: This study provides a comprehensive review of the known molecules and mechanisms in the current literature involved in the spinal cord injury (SCI regeneration in zebrafish, in a time course manner. A better understanding of the whole determining mechanisms for the SCI regeneration should be considered as a main goal for future studies.

  8. Volume-sensitive NADPH oxidase activity and taurine efflux in NIH3T3 mouse fibroblasts

    DEFF Research Database (Denmark)

    Friis, Martin Barfred; Vorum, Katrine Gribel; Lambert, Ian Henry

    2008-01-01

    Reactive oxygen species (ROS) are produced in NIH3T3 fibroblasts during hypotonic stress, and H(2)O(2) potentiates the concomitant release of the organic osmolyte taurine (Lambert IH. J Membr Biol 192: 19-32, 2003). The increase in ROS production [5-(and-6)-carboxy-2', 7'-dichlorodihydrofluorescein......+-mobilizing agonist ATP (10 microM) potentiates the release of taurine but has no effect on ROS production under hypotonic conditions. On the other hand, addition of the protein kinase C (PKC) activator phorbol 12-myristate 13-acetate (PMA, 100 nM) or the lipid messenger lysophosphatidic acid (LPA, 10 n......M) potentiates the swelling-induced taurine release as well as the ROS production. Overexpression of Rac1 or p47 phox or p47 phox knockdown [small interfering (si)RNA] had no effect on the swelling-induced ROS production or taurine release. NOX4 knockdown (siRNA) impairs the increase in the ROS production...

  9. In silico structural determination of GPAT enzyme from Ostreococcus lucimarinus for biotechnological application of microalgal biofuel production

    International Nuclear Information System (INIS)

    Baral, Maitree; Misra, Namrata; Panda, Prasanna Kumar; Thirunavoukkarasu, Manakkannan

    2012-01-01

    Glycerol-3-phosphate acyltransferase (GPAT) is an enzyme in the triacylglycerol (TAG) biosynthetic pathway that catalyses the conversion of glycerol-3-phosphate to lysophosphatidic acid. Targeting key enzymes involved in TAG pathway is considered to be a powerful strategy for augmented lipid accumulation in microorganisms. In the present study three-dimensional structure of the marine microalgae, Ostreococcus lucimarinus GPAT protein was developed based on the crystal structure of Cucurbita moschata GPAT protein. Besides, several structure validation tools were employed to confirm the reliability of the developed model. The predicted and validated model reveals the tertiary structure of GPAT monomer comprising of two domains, the smaller domain I, which folds into a four helix bundle, and the larger domain II, which is constructed from alternating α/β secondary structural elements that give rise to 9-stranded β sheet flanked by 11α helices. Critical structural analysis of the developed model reveals the presence of H(X) 4D motif; the latter being, a consensus sequence conserved amongst many glycerolipid acyltransferase. The detected cluster of positively charged residues H189, K243, H244, R285 and R287 in the model could be conjectured to be important in glycerol-3-phosphate recognition. The structural insight obtained from this in silico study may provide useful clues to further advanced biotechnological studies of strategic site-specific genetic and metabolic engineering of microalgae for enhanced biofuel production.

  10. Cholesterol inhibits entotic cell-in-cell formation and actomyosin contraction.

    Science.gov (United States)

    Ruan, Banzhan; Zhang, Bo; Chen, Ang; Yuan, Long; Liang, Jianqing; Wang, Manna; Zhang, Zhengrong; Fan, Jie; Yu, Xiaochen; Zhang, Xin; Niu, Zubiao; Zheng, You; Gu, Songzhi; Liu, Xiaoqing; Du, Hongli; Wang, Jufang; Hu, Xianwen; Gao, Lihua; Chen, Zhaolie; Huang, Hongyan; Wang, Xiaoning; Sun, Qiang

    2018-01-01

    Cell-in-cell structure is prevalent in human cancer, and associated with several specific pathophysiological phenomena. Although cell membrane adhesion molecules were found critical for cell-in-cell formation, the roles of other membrane components, such as lipids, remain to be explored. In this study, we attempted to investigate the effects of cholesterol and phospholipids on the formation of cell-in-cell structures by utilizing liposome as a vector. We found that Lipofectamine-2000, the reagent commonly used for routine transfection, could significantly reduce entotic cell-in-cell formation in a cell-specific manner, which is correlated with suppressed actomyosin contraction as indicated by reduced β-actin expression and myosin light chain phosphorylation. The influence on cell-in-cell formation was likely dictated by specific liposome components as some liposomes affected cell-in-cell formation while some others didn't. Screening on a limited number of lipids, the major components of liposome, identified phosphatidylethanolamine (PE), stearamide (SA), lysophosphatidic acid (LPA) and cholesterol (CHOL) as the inhibitors of cell-in-cell formation. Importantly, cholesterol treatment significantly inhibited myosin light chain phosphorylation, which resembles the effect of Lipofectamine-2000, suggesting cholesterol might be partially responsible for liposomes' effects on cell-in-cell formation. Together, our findings supporting a role of membrane lipids and cholesterol in cell-in-cell formation probably via regulating actomyosin contraction. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. The Role of PPARγ in the Transcriptional Control by Agonists and Antagonists

    Directory of Open Access Journals (Sweden)

    Tamotsu Tsukahara

    2012-01-01

    Full Text Available In recent years, peroxisome proliferator-activated receptor gamma (PPARγ has been reported to be a target for the treatment of type II diabetes. Furthermore, it has received attention for its therapeutic potential in many other human diseases, including atherosclerosis, obesity, and cancers. Recent studies have provided evidence that the endogenously produced PPARγ antagonist, 2,3-cyclic phosphatidic acid (cPA, which is similar in structure to lysophosphatidic acid (LPA, inhibits cancer cell invasion and metastasis in vitro and in vivo. We recently observed that cPA negatively regulates PPARγ function by stabilizing the binding of the corepressor protein, silencing mediator of retinoic acid and thyroid hormone receptor. We also showed that cPA prevents neointima formation, adipocyte differentiation, lipid accumulation, and upregulation of PPARγ target gene transcription. We then analyzed the molecular mechanism of cPA's action on PPARγ. In this paper, we summarize the current knowledge on the mechanism of PPARγ-mediated transcriptional activity and transcriptional repression in response to novel lipid-derived ligands, such as cPA.

  12. Sphingolipids in human synovial fluid--a lipidomic study.

    Directory of Open Access Journals (Sweden)

    Marta Krystyna Kosinska

    Full Text Available Articular synovial fluid (SF is a complex mixture of components that regulate nutrition, communication, shock absorption, and lubrication. Alterations in its composition can be pathogenic. This lipidomic investigation aims to quantify the composition of sphingolipids (sphingomyelins, ceramides, and hexosyl- and dihexosylceramides and minor glycerophospholipid species, including (lysophosphatidic acid, (lysophosphatidylglycerol, and bis(monoacylglycerophosphate species, in the SF of knee joints from unaffected controls and from patients with early (eOA and late (lOA stages of osteoarthritis (OA, and rheumatoid arthritis (RA. SF without cells and cellular debris from 9 postmortem donors (control, 18 RA, 17 eOA, and 13 lOA patients were extracted to measure lipid species using electrospray ionization tandem mass spectrometry--directly or coupled with hydrophilic interaction liquid chromatography. We provide a novel, detailed overview of sphingolipid and minor glycerophospholipid species in human SF. A total of 41, 48, and 50 lipid species were significantly increased in eOA, lOA, and RA SF, respectively when compared with normal SF. The level of 21 lipid species differed in eOA SF versus SF from lOA, an observation that can be used to develop biomarkers. Sphingolipids can alter synovial inflammation and the repair responses of damaged joints. Thus, our lipidomic study provides the foundation for studying the biosynthesis and function of lipid species in health and most prevalent joint diseases.

  13. Glycerol-3-phosphate Acyltransferase 1 Promotes Tumor Cell Migration and Poor Survival in Ovarian Carcinoma.

    Science.gov (United States)

    Marchan, Rosemarie; Büttner, Bettina; Lambert, Jörg; Edlund, Karolina; Glaeser, Iris; Blaszkewicz, Meinolf; Leonhardt, Gregor; Marienhoff, Lisa; Kaszta, Darius; Anft, Moritz; Watzl, Carsten; Madjar, Katrin; Grinberg, Marianna; Rempel, Eugen; Hergenröder, Roland; Selinski, Silvia; Rahnenführer, Jörg; Lesjak, Michaela S; Stewart, Joanna D; Cadenas, Cristina; Hengstler, Jan G

    2017-09-01

    Glycerophosphodiesterase EDI3 (GPCPD1; GDE5; GDPD6) has been suggested to promote cell migration, adhesion, and spreading, but its mechanisms of action remain uncertain. In this study, we targeted the glycerol-3-phosphate acyltransferase GPAM along with choline kinase-α (CHKA), the enzymes that catabolize the products of EDI3 to determine which downstream pathway is relevant for migration. Our results clearly showed that GPAM influenced cell migration via the signaling lipid lysophosphatidic acid (LPA), linking it with GPAM to cell migration. Analysis of GPAM expression in different cancer types revealed a significant association between high GPAM expression and reduced overall survival in ovarian cancer. Silencing GPAM in ovarian cancer cells decreased cell migration and reduced the growth of tumor xenografts. In contrast to these observations, manipulating CHKA did not influence cell migration in the same set of cell lines. Overall, our findings show how GPAM influences intracellular LPA levels to promote cell migration and tumor growth. Cancer Res; 77(17); 4589-601. ©2017 AACR . ©2017 American Association for Cancer Research.

  14. Lipidomics profiling reveals the role of glycerophospholipid metabolism in psoriasis.

    Science.gov (United States)

    Zeng, Chunwei; Wen, Bo; Hou, Guixue; Lei, Li; Mei, Zhanlong; Jia, Xuekun; Chen, Xiaomin; Zhu, Wu; Li, Jie; Kuang, Yehong; Zeng, Weiqi; Su, Juan; Liu, Siqi; Peng, Cong; Chen, Xiang

    2017-10-01

    Psoriasis is a common and chronic inflammatory skin disease that is complicated by gene-environment interactions. Although genomic, transcriptomic, and proteomic analyses have been performed to investigate the pathogenesis of psoriasis, the role of metabolites in psoriasis, particularly of lipids, remains unclear. Lipids not only comprise the bulk of the cellular membrane bilayers but also regulate a variety of biological processes such as cell proliferation, apoptosis, immunity, angiogenesis, and inflammation. In this study, an untargeted lipidomics approach was used to study the lipid profiles in psoriasis and to identify lipid metabolite signatures for psoriasis through ultra-performance liquid chromatography-tandem quadrupole mass spectrometry. Plasma samples from 90 participants (45 healthy and 45 psoriasis patients) were collected and analyzed. Statistical analysis was applied to find different metabolites between the disease and healthy groups. In addition, enzyme-linked immunosorbent assay was performed to validate differentially expressed lipids in psoriatic patient plasma. Finally, we identified differential expression of several lipids including lysophosphatidic acid (LPA), lysophosphatidylcholine (LysoPC), phosphatidylinositol (PI), phosphatidylcholine (PC), and phosphatidic acid (PA); among these metabolites, LPA, LysoPC, and PA were significantly increased, while PC and PI were down-regulated in psoriasis patients. We found that elements of glycerophospholipid metabolism such as LPA, LysoPC, PA, PI, and PC were significantly altered in the plasma of psoriatic patients; this study characterizes the circulating lipids in psoriatic patients and provides novel insight into the role of lipids in psoriasis. © The Author 2017. Published by Oxford University Press.

  15. LPA is a chemorepellent for B16 melanoma cells: action through the cAMP-elevating LPA5 receptor.

    Directory of Open Access Journals (Sweden)

    Maikel Jongsma

    Full Text Available Lysophosphatidic acid (LPA, a lipid mediator enriched in serum, stimulates cell migration, proliferation and other functions in many cell types. LPA acts on six known G protein-coupled receptors, termed LPA(1-6, showing both overlapping and distinct signaling properties. Here we show that, unexpectedly, LPA and serum almost completely inhibit the transwell migration of B16 melanoma cells, with alkyl-LPA(18:1 being 10-fold more potent than acyl-LPA(18:1. The anti-migratory response to LPA is highly polarized and dependent on protein kinase A (PKA but not Rho kinase activity; it is associated with a rapid increase in intracellular cAMP levels and PIP3 depletion from the plasma membrane. B16 cells express LPA(2, LPA(5 and LPA(6 receptors. We show that LPA-induced chemorepulsion is mediated specifically by the alkyl-LPA-preferring LPA(5 receptor (GPR92, which raises intracellular cAMP via a noncanonical pathway. Our results define LPA(5 as an anti-migratory receptor and they implicate the cAMP-PKA pathway, along with reduced PIP3 signaling, as an effector of chemorepulsion in B16 melanoma cells.

  16. Changeover from signalling to energy-provisioning lipids during transition from colostrum to mature milk in the giant panda (Ailuropoda melanoleuca).

    Science.gov (United States)

    Zhang, Tong; Watson, David G; Zhang, Rong; Hou, Rong; Loeffler, I Kati; Kennedy, Malcolm W

    2016-11-03

    Among the large placental mammals, ursids give birth to the most altricial neonates with the lowest neonatal:maternal body mass ratios. This is particularly exemplified by giant pandas. To examine whether there is compensation for the provision of developmentally important nutrients that other species groups may provide in utero, we examined changes in the lipids of colostrum and milk with time after birth in giant pandas. Lipids that are developmental signals or signal precursors, and those that are fundamental to nervous system construction, such as docosahexaenoic acid (DHA) and phosphatidylserines, appear early and then fall dramatically in concentration to a baseline at 20-30 days. The dynamics of lysophosphatidic acid and eicosanoids display similar patterns, but with progressive differences between mothers. Triglycerides occur at relatively low levels initially and increase in concentration until a plateau is reached at about 30 days. These patterns indicate an early provision of signalling lipids and their precursors, particularly lipids crucial to brain, retinal and central nervous system development, followed by a changeover to lipids for energy metabolism. Thus, in giant pandas, and possibly in all bears, lactation is adapted to provisioning a highly altricial neonate to a degree that suggests equivalence to an extension of gestation.

  17. Drosophila homologue of Diaphanous 1 (DIAPH1) controls the metastatic potential of colon cancer cells by regulating microtubule-dependent adhesion.

    Science.gov (United States)

    Lin, Yuan-Na; Bhuwania, Ridhirama; Gromova, Kira; Failla, Antonio Virgilio; Lange, Tobias; Riecken, Kristoffer; Linder, Stefan; Kneussel, Matthias; Izbicki, Jakob R; Windhorst, Sabine

    2015-07-30

    Drosophila homologue of Diaphanous 1 (DIAPH1) regulates actin polymerization and microtubule (MT) stabilization upon stimulation with lysophosphatidic acid (LPA). Recently, we showed strongly reduced lung metastasis of DIAPH1-depleted colon cancer cells but we found accumulations of DIAPH1-depleted cells in bone marrow. Here, we analyzed possible organ- or tissue-specific metastasis of DIAPH1-depleted HCT-116 cells. Our data confirmed that depletion of DIAPH1 strongly inhibited lung metastasis and revealed that, in contrast to control cells, DIAPH1-depleted cells did not form metastases in further organs. Detailed mechanistic analysis on cells that were not stimulated with LPA to activate the cytoskeleton-modulating activity of DIAPH1, revealed that even under basal conditions DIAPH1 was essential for cellular adhesion to collagen. In non-stimulated cells DIAPH1 did not control actin dynamics but, interestingly, was essential for stabilization of microtubules (MTs). Additionally, DIAPH1 controlled directed vesicle trafficking and with this, local clustering of the adhesion protein integrin-β1 at the plasma membrane. Therefore, we conclude that under non-stimulating conditions DIAPH1 controls cellular adhesion by stabilizing MTs required for local clustering of integrin-β1 at the plasma membrane. Thus, blockade of DIAPH1-tubulin interaction may be a promising approach to inhibit one of the earliest steps in the metastatic cascade of colon cancer.

  18. Non-invasive imaging of tumors by monitoring autotaxin activity using an enzyme-activated near-infrared fluorogenic substrate.

    Directory of Open Access Journals (Sweden)

    Damian Madan

    Full Text Available Autotaxin (ATX, an autocrine motility factor that is highly upregulated in metastatic cancer, is a lysophospholipase D enzyme that produces the lipid second messenger lysophosphatidic acid (LPA from lysophosphatidylcholine (LPC. Dysregulation of the lysolipid signaling pathway is central to the pathophysiology of numerous cancers, idiopathic pulmonary fibrosis, rheumatoid arthritis, and other inflammatory diseases. Consequently, the ATX/LPA pathway has emerged as an important source of biomarkers and therapeutic targets. Herein we describe development and validation of a fluorogenic analog of LPC (AR-2 that enables visualization of ATX activity in vivo. AR-2 exhibits minimal fluorescence until it is activated by ATX, which substantially increases fluorescence in the near-infrared (NIR region, the optimal spectral window for in vivo imaging. In mice with orthotopic ATX-expressing breast cancer tumors, ATX activated AR-2 fluorescence. Administration of AR-2 to tumor-bearing mice showed high fluorescence in the tumor and low fluorescence in most healthy tissues with tumor fluorescence correlated with ATX levels. Pretreatment of mice with an ATX inhibitor selectively decreased fluorescence in the tumor. Together these data suggest that fluorescence directly correlates with ATX activity and its tissue expression. The data show that AR-2 is a non-invasive and selective tool that enables visualization and quantitation of ATX-expressing tumors and monitoring ATX activity in vivo.

  19. Insulin-like Growth Factor 1 (IGF-1) Stabilizes Nascent Blood Vessels*

    Science.gov (United States)

    Jacobo, Sarah Melissa P.; Kazlauskas, Andrius

    2015-01-01

    Here we report that VEGF-A and IGF-1 differ in their ability to stabilize newly formed blood vessels and endothelial cell tubes. Although VEGF-A failed to support an enduring vascular response, IGF-1 stabilized neovessels generated from primary endothelial cells derived from various vascular beds and mouse retinal explants. In these experimental systems, destabilization/regression was driven by lysophosphatidic acid (LPA). Because previous studies have established that Erk antagonizes LPA-mediated regression, we considered whether Erk was an essential component of IGF-dependent stabilization. Indeed, IGF-1 lost its ability to stabilize neovessels when the Erk pathway was inhibited pharmacologically. Furthermore, stabilization was associated with prolonged Erk activity. In the presence of IGF-1, Erk activity persisted longer than in the presence of VEGF or LPA alone. These studies reveal that VEGF and IGF-1 can have distinct inputs in the angiogenic process. In contrast to VEGF, IGF-1 stabilizes neovessels, which is dependent on Erk activity and associated with prolonged activation. PMID:25564613

  20. Requirement of Osteopontin in the migration and protection against Taxol-induced apoptosis via the ATX-LPA axis in SGC7901 cells

    Directory of Open Access Journals (Sweden)

    Huang Zuhu

    2011-03-01

    Full Text Available Abstract Background Autotaxin (ATX possesses lysophospholipase D (lyso PLD activity, which converts lysophosphatidylcholine (LPC into lysophosphatidic acid (LPA. The ATX-LPA signaling axis has been implicated in angiogenesis, chronic inflammation and tumor progression. Osteopontin (OPN is an important chemokine involved in the survival, proliferation, migration, invasion and metastasis of gastric cancer cells. The focus of the present study was to investigate the relationship between the ATX-LPA axis and OPN. Results In comparison with non-treated cells, we found that the ATX-LPA axis up-regulated OPN expression by 1.92-fold in protein levels and 1.3-fold in mRNA levels. The ATX-LPA axis activates LPA2, Akt, ERK and ELK-1 and also protects SGC7901 cells from apoptosis induced by Taxol treatment. Conclusions This study provides the first evidence that expression of OPN induced by ATX-LPA axis is mediated by the activation of Akt and MAPK/ERK pathways through the LPA2 receptor. In addition, OPN is required for the protective effects of ATX-LPA against Taxol-induced apoptosis and ATX-LPA-induced migration of SGC7901 cells.

  1. The Expression Profiles of Lysophospholipid Receptors (LPLRs in Different Endothelial Cells

    Directory of Open Access Journals (Sweden)

    Yu-Wei Lee

    2006-03-01

    Full Text Available Sphingosine-1-phosphate (S1P and lysophosphatidic acid (LPA are two bioactive lysophospholipids (LPLs, stored primarily in platelets and released during platelet activation. Both LPLs are capable of regulating endothelial cell functions. The physiological functions of S1P and LPA are mediated by interacting with eight different G-protein coupled receptors: S1P1 through 5 and LPA1 through 3, which activate three different heterotrimeric GTP proteins-including Gi、Gq and G(12/13. The expression of LPL receptors in endothelial cells would affect the responses of S1P and LPA to these cells. There is no previous report discussing the expression profiles of LPL receptors in different endothelial cells from various species. In this study, we aim to investigate the expression profiles of S1P and LPA receptors in different endothelial cells isolated from human, rat, mouse and bovine origin. We used RT-PCR to determine LPLs receptors expression profiles in different endothelial cells. Our results indicated that endothelial cells from various species express different LPL receptors. Endothelial cells isolated from the same source of different species also had different LPLs receptors expression profiles. Therefore, different endothelial cells should respond to LPLs in different manners.

  2. Lysophospholipid Receptors Are Differentially Expressed in Rat Terminal Schwann Cells, As Revealed by a Single Cell RT-PCR and In Situ Hybridization

    International Nuclear Information System (INIS)

    Kobashi, Hiroaki; Yaoi, Takeshi; Oda, Ryo; Okajima, Seiichiro; Fujiwara, Hiroyoshi; Kubo, Toshikazu; Fushiki, Shinji

    2006-01-01

    Terminal Schwann cells (TSCs) that cover motor neuron terminals, are known to play an important role in maintaining neuromuscular junctions, as well as in the repair process after nerve injury. However, the molecular characteristics of TSCs remain unknown, because of the difficulties in analyzing them due to their paucity. By using our previously reported method of selectively and efficiently collecting TSCs, we have analyzed the difference in expression patterns of lysophospholipid (LPL) receptor genes (LPA 1 , LPA 2 , LPA 3 , S1P 1 , S1P 2 , S1P 3 , S1P 4 , and S1P 5 ) between TSCs and myelinating Schwann cells (MSCs). LPL, which includes lysophosphatidic acid (LPA) and sphingosine 1-phosphate (S1P), is the bioactive lipid that induces a myriad of cellular responses through specific members of G-protein coupled receptors for LPA. It turned out that LPA 3 was expressed only in TSCs, whereas S1P 1 was expressed in TSCs and skeletal muscle, but not in MSCs. Other types of LPL receptor genes, including LPA 1 , S1P 2 , S1P 3 , S1P 4 , were expressed in both types of Schwann cells. None of the LPL receptor gene family showed MSCs-specific expression

  3. Proteomic screening of human targets of viral microRNAs reveals functions associated with immune evasion and angiogenesis.

    Directory of Open Access Journals (Sweden)

    Amelia M Gallaher

    Full Text Available Kaposi's sarcoma (KS is caused by infection with Kaposi's sarcoma-associated herpesvirus (KSHV. The virus expresses unique microRNAs (miRNAs, but the targets and functions of these miRNAs are not completely understood. In order to identify human targets of viral miRNAs, we measured protein expression changes caused by multiple KSHV miRNAs using pulsed stable labeling with amino acids in cell culture (pSILAC in primary endothelial cells. This led to the identification of multiple human genes that are repressed at the protein level, but not at the miRNA level. Further analysis also identified that KSHV miRNAs can modulate activity or expression of upstream regulatory factors, resulting in suppressed activation of a protein involved in leukocyte recruitment (ICAM1 following lysophosphatidic acid treatment, as well as up-regulation of a pro-angiogenic protein (HIF1α, and up-regulation of a protein involved in stimulating angiogenesis (HMOX1. This study aids in our understanding of miRNA mechanisms of repression and miRNA contributions to viral pathogenesis.

  4. Protein kinase D is increased and activated in lung epithelial cells and macrophages in idiopathic pulmonary fibrosis.

    Science.gov (United States)

    Gan, Huachen; McKenzie, Raymond; Hao, Qin; Idell, Steven; Tang, Hua

    2014-01-01

    Idiopathic pulmonary fibrosis (IPF) is a relentlessly progressive and usually fatal lung disease of unknown etiology for which no effective treatments currently exist. Hence, there is a profound need for the identification of novel drugable targets to develop more specific and efficacious therapeutic intervention in IPF. In this study, we performed immunohistochemical analyses to assess the cell type-specific expression and activation of protein kinase D (PKD) family kinases in normal and IPF lung tissue sections. We also analyzed PKD activation and function in human lung epithelial cells. We found that PKD family kinases (PKD1, PKD2 and PKD3) were increased and activated in the hyperplastic and regenerative alveolar epithelial cells lining remodeled fibrotic alveolar septa and/or fibroblast foci in IPF lungs compared with normal controls. We also found that PKD family kinases were increased and activated in alveolar macrophages, bronchiolar epithelium, and honeycomb cysts in IPF lungs. Interestingly, PKD1 was highly expressed and activated in the cilia of IPF bronchiolar epithelial cells, while PKD2 and PKD3 were expressed in the cell cytoplasm and nuclei. In contrast, PKD family kinases were not apparently increased and activated in IPF fibroblasts or myofibroblasts. We lastly found that PKD was predominantly activated by poly-L-arginine, lysophosphatidic acid and thrombin in human lung epithelial cells and that PKD promoted epithelial barrier dysfunction. These findings suggest that PKD may participate in the pathogenesis of IPF and may be a novel target for therapeutic intervention in this disease.

  5. Quantitative Glycoproteomic Analysis Identifies Platelet-Induced Increase of Monocyte Adhesion via the Up-Regulation of Very Late Antigen 5.

    Science.gov (United States)

    Huang, Jiqing; Kast, Juergen

    2015-08-07

    Physiological stimuli, such as thrombin, or pathological stimuli, such as lysophosphatidic acid (LPA), activate platelets circulating in blood. Once activated, platelets bind to monocytes via P-selectin-PSGL-1 interactions but also release the stored contents of their granules. These platelet releasates, in addition to direct platelet binding, activate monocytes and facilitate their recruitment to atherosclerotic sites. Consequently, understanding the changes platelet releasates induce in monocyte membrane proteins is critical. We studied the glyco-proteome changes of THP-1 monocytic cells affected by LPA- or thrombin-induced platelet releasates. We employed lectin affinity chromatography combined with filter aided sample preparation to achieve high glyco- and membrane protein and protein sequence coverage. Using stable isotope labeling by amino acids in cell culture, we quantified 1715 proteins, including 852 membrane and 500 glycoproteins, identifying the up-regulation of multiple proteins involved in monocyte extracellular matrix binding and transendothelial migration. Flow cytometry indicated expression changes of integrin α5, integrin β1, PECAM-1, and PSGL-1. The observed increase in monocyte adhesion to fibronectin was determined to be mediated by the up-regulation of very late antigen 5 via a P-selectin-PSGL-1 independent mechanism. This novel aspect could be validated on CD14+ human primary monocytes, highlighting the benefits of the improved enrichment method regarding high membrane protein coverage and reliable quantification.

  6. Biosynthesis of triacylglycerols containing very long chain monounsaturated acyl moieties in developing seeds

    International Nuclear Information System (INIS)

    Fehling, E.; Murphy, D.J.; Mukherjee, K.D.

    1990-01-01

    Particulate (15,000g) fractions from developing seeds of honesty (Lunaria annua L.) and mustard (Sinapis alba L.) synthesize radioactive very long chain monounsaturated fatty acids (gadoleic, erucic, and nervonic) from [1- 14 C]oleoyl-CoA and malonyl-CoA or from oleoyl-CoA and [2- 14 C]malonyl-CoA. The very long chain monounsaturated fatty acids are rapidly channeled to triacylglycerols and other acyl lipids without intermediate accumulation of their CoA thioesters. When [1- 14 C]oleoyl-CoA is used as the radioactive substrate, phosphatidylcholines and other phospholipids are most extensively radiolabeled by oleoyl moieties rather than by very long chain monounsaturated acyl moieties. When [2- 14 C]malonyl-CoA is used as the radioactive substrate, no radioactive oleic acid is formed and the newly synthesized very long chain monounsaturated fatty acids are extensively incorporated into phosphatidylcholines and other phospholipids as well as triacylglycerols. The pattern of labeling of the key intermediates of the Kennedy pathway, e.g. lysophosphatidic acids, phosphatidic acids, and diacylglycerols by the newly synthesized very long chain monounsaturated fatty acids is consistent with the operation of this pathway in the biosynthesis of triacylglycerols

  7. TrkB-T1 regulates the RhoA signaling and actin cytoskeleton in glioma cells

    International Nuclear Information System (INIS)

    Ohira, Koji; Homma, Koichi J.; Hirai, Hirohisa; Nakamura, Shun; Hayashi, Motoharu

    2006-01-01

    Recently, the truncated TrkB receptor, T1, has been reported to be involved in the control of cell morphology via the regulation of Rho proteins, through which T1 binds Rho guanine nucleotide dissociation inhibitor (Rho GDI) 1 and dissociates it in a brain-derived neurotrophic factor (BDNF)-dependent manner. However, it is unclear whether T1 signaling regulates the downstream of Rho signaling and the actin cytoskeleton. In this study, we investigated this question using C6 rat glioma cells, which express T1 endogenously. Rho GDI1 was dissociated from T1 in a BDNF-dependent manner, which also causes decreases in the activities of Rho-signaling molecules such as RhoA, Rho-associated kinase, p21-activated kinase, and extracellular-signal regulated kinase1/2. Moreover, BDNF treatment resulted in the disappearance of stress fibers in the cells treated with lysophosphatidic acid, an activator of RhoA, and in morphological changes in cells. Furthermore, a competitive assay with cyan fluorescent protein fusion proteins of T1-specific sequences reduced the effects of BDNF. These results suggest that T1 regulates the Rho-signaling pathways and the actin cytoskeleton

  8. Crystallization and preliminary X-ray diffraction analysis of a class II phospholipase D from Loxosceles intermedia venom

    International Nuclear Information System (INIS)

    Ullah, Anwar; Giuseppe, Priscila Oliveira de; Murakami, Mario Tyago; Trevisan-Silva, Dilza; Wille, Ana Carolina Martins; Chaves-Moreira, Daniele; Gremski, Luiza Helena; Silveira, Rafael Bertoni da; Sennf-Ribeiro, Andrea; Chaim, Olga Meiri; Veiga, Silvio Sanches; Arni, Raghuvir Krishnaswamy

    2011-01-01

    Wild-type and H12A-mutant class II phospholipase D from L. intermedia venom were crystallized; the crystals diffracted to maximum resolutions of 1.95 and 1.60 Å, respectively. Phospholipases D are the major dermonecrotic component of Loxosceles venom and catalyze the hydrolysis of phospholipids, resulting in the formation of lipid mediators such as ceramide-1-phosphate and lysophosphatidic acid which can induce pathological and biological responses. Phospholipases D can be classified into two classes depending on their catalytic efficiency and the presence of an additional disulfide bridge. In this work, both wild-type and H12A-mutant forms of the class II phospholipase D from L. intermedia venom were crystallized. Wild-type and H12A-mutant crystals were grown under very similar conditions using PEG 200 as a precipitant and belonged to space group P12 1 1, with unit-cell parameters a = 50.1, b = 49.5, c = 56.5 Å, β = 105.9°. Wild-type and H12A-mutant crystals diffracted to maximum resolutions of 1.95 and 1.60 Å, respectively

  9. Fibroblast Cluster Formation on 3D Collagen Matrices Requires Cell Contraction-Dependent Fibronectin Matrix Organization

    Science.gov (United States)

    da Rocha-Azevedo, Bruno; Ho, Chin-Han; Grinnell, Frederick

    2012-01-01

    Fibroblasts incubated on 3D collagen matrices in serum or lysophosphatidic acid (LPA)-containing medium self-organize into clusters through a mechanism that requires cell contraction. However, in platelet-derived growth factor (PDGF)-containing medium, cells migrate as individuals and do not form clusters even though they constantly encounter each other. Here, we present evidence that a required function of cell contraction in clustering is formation of fibronectin fibrillar matrix. We found that in serum or LPA but not in PDGF or basal medium, cells organized FN (both serum and cellular) into a fibrillar, detergent-insoluble matrix. Cell clusters developed concomitant with FN matrix formation. FN fibrils accumulated beneath cells and along the borders of cell clusters in regions of cell-matrix tension. Blocking Rho kinase or myosin II activity prevented FN matrix assembly and cell clustering. Using siRNA silencing and function-blocking antibodies and peptides, we found that cell clustering and FN matrix assembly required α5β1 integrins and fibronectin. Cells were still able to exert contractile force and compact the collagen matrix under the latter conditions, which showed that contraction was not sufficient for cell clustering to occur. Our findings provide new insights into how procontractile (serum/LPA) and promigratory (PDGF) growth factor environments can differentially regulate FN matrix assembly by fibroblasts interacting with collagen matrices and thereby influence mesenchymal cell morphogenetic behavior under physiologic circumstances such as wound repair, morphogenesis and malignancy. PMID:23117111

  10. Fibroblast cluster formation on 3D collagen matrices requires cell contraction dependent fibronectin matrix organization.

    Science.gov (United States)

    da Rocha-Azevedo, Bruno; Ho, Chin-Han; Grinnell, Frederick

    2013-02-15

    Fibroblasts incubated on 3D collagen matrices in serum or lysophosphatidic acid (LPA)-containing medium self-organize into clusters through a mechanism that requires cell contraction. However, in platelet-derived growth factor (PDGF)-containing medium, cells migrate as individuals and do not form clusters even though they constantly encounter each other. Here, we present evidence that a required function of cell contraction in clustering is formation of fibronectin (FN) fibrillar matrix. We found that in serum or LPA but not in PDGF or basal medium, cells organized FN (both serum and cellular) into a fibrillar, detergent-insoluble matrix. Cell clusters developed concomitant with FN matrix formation. FN fibrils accumulated beneath cells and along the borders of cell clusters in regions of cell-matrix tension. Blocking Rho kinase or myosin II activity prevented FN matrix assembly and cell clustering. Using siRNA silencing and function-blocking antibodies and peptides, we found that cell clustering and FN matrix assembly required α5β1 integrins and fibronectin. Cells were still able to exert contractile force and compact the collagen matrix under the latter conditions, which showed that contraction was not sufficient for cell clustering to occur. Our findings provide new insights into how procontractile (serum/LPA) and promigratory (PDGF) growth factor environments can differentially regulate FN matrix assembly by fibroblasts interacting with collagen matrices and thereby influence mesenchymal cell morphogenetic behavior under physiologic circumstances such as wound repair, morphogenesis and malignancy. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Lipopolysaccharide induces autotaxin expression in human monocytic THP-1 cells

    International Nuclear Information System (INIS)

    Li Song; Zhang Junjie

    2009-01-01

    Autotaxin (ATX) is a secreted enzyme with lysophospholipase D (lysoPLD) activity, which converts lysophosphatidylcholine (LPC) into lysophosphatidic acid (LPA), a bioactive phospholipid involved in numerous biological activities, including cell proliferation, differentiation, and migration. In the present study, we found that bacterial lipopolysaccharide (LPS), a well-known initiator of the inflammatory response, induced ATX expression in monocytic THP-1 cells. The activation of PKR, JNK, and p38 MAPK was required for the ATX induction. The LPS-induced ATX in THP-1 cells was characterized as the β isoform. In the presence of LPC, ATX could promote the migrations of THP-1 and Jurkat cells, which was inhibited by pertussis toxin (PTX), an inhibitor of Gi-mediated LPA receptor signaling. In summary, LPS induces ATX expression in THP-1 cells via a PKR, JNK and p38 MAPK-mediated mechanism, and the ATX induction is likely to enhance immune cell migration in proinflammatory response by regulating LPA levels in the microenvironment.

  12. Alkaline phosphatase binds tenaciously to titanium; implications for biological surface evaluation following bone implant retrieval.

    Science.gov (United States)

    Mansell, J P; Shiel, A I; Harwood, C; Stephens, D

    2017-07-01

    Enhancing the performance and longevity of titanium (Ti) implants continues to be a significant developmental theme in contemporary biomaterials design. Our specific focus pertains to the surface functionalisation of Ti using the bioactive lipid, lysophosphatidic acid (LPA) and certain phosphatase-resistant analogues of LPA. Coating survivorship to a plethora of testing regimens is required to align with due regulatory process before novel biomaterials can enter clinical trials. One of the key acceptance criteria is coating retention to the physical stresses experienced during implantation. In assessing coating stability to insertion into porcine bone we found that a subsequent in vitro assessment to confirm coating persistence was masked by abundant alkaline phosphatase (ALP) contamination adsorbed to the metal surface. Herein we report that ALP can bind to Ti in a matter of minutes by simply immersing Ti samples in aqueous solutions of the enzyme. We strongly discourage the in vitro monitoring of osteoblast and stromal cell ALP expression when assessing bioactive coating survivorship following Ti implant retrieval form native bone tissue. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Purinergic signaling is required for fluid shear stress-induced NF-{kappa}B translocation in osteoblasts

    Energy Technology Data Exchange (ETDEWEB)

    Genetos, Damian C., E-mail: dgenetos@ucdavis.edu [Department of Anatomy, Cell Biology, and Physiology, School of Veterinary Medicine, University of California, Davis, CA (United States); Karin, Norman J. [Cell Biology and Biochemistry, Pacific Northwest National Laboratory, Richland, WA (United States); Geist, Derik J. [Department of Orthopaedic Surgery, Indiana University School of Medicine, Indianapolis, IN (United States); Donahue, Henry J. [Division of Musculoskeletal Sciences, Department of Orthopaedics and Rehabilitation, Pennsylvania State College of Medicine, Hershey, PA (United States); Duncan, Randall L. [Department of Orthopaedic Surgery, Indiana University School of Medicine, Indianapolis, IN (United States)

    2011-04-01

    Fluid shear stress regulates gene expression in osteoblasts, in part by activation of the transcription factor NF-{kappa}B. We examined whether this process was under the control of purinoceptor activation. MC3T3-E1 osteoblasts under static conditions expressed the NF-{kappa}B inhibitory protein I{kappa}B{alpha} and exhibited cytosolic localization of NF-{kappa}B. Under fluid shear stress, I{kappa}B{alpha} levels decreased, and concomitant nuclear localization of NF-{kappa}B was observed. Cells exposed to fluid shear stress in ATP-depleted medium exhibited no significant reduction in I{kappa}B{alpha}, and NF-{kappa}B remained within the cytosol. Similar results were found using oxidized ATP or Brilliant Blue G, P2X{sub 7} receptor antagonists, indicating that the P2X{sub 7} receptor is responsible for fluid shear-stress-induced I{kappa}B{alpha} degradation and nuclear accumulation of NF-{kappa}B. Pharmacologic blockage of the P2Y6 receptor also prevented shear-induced I{kappa}B{alpha} degradation. These phenomena involved neither ERK1/2 signaling nor autocrine activation by P2X{sub 7}-generated lysophosphatidic acid. Our results suggest that fluid shear stress regulates NF-{kappa}B activity through the P2Y{sub 6} and P2X{sub 7} receptor.

  14. Rapid and dynamic arginylation of the leading edge β-actin is required for cell migration.

    Science.gov (United States)

    Pavlyk, Iuliia; Leu, Nicolae A; Vedula, Pavan; Kurosaka, Satoshi; Kashina, Anna

    2018-04-01

    β-actin plays key roles in cell migration. Our previous work demonstrated that β-actin in migratory non-muscle cells is N-terminally arginylated and that this arginylation is required for normal lamellipodia extension. Here, we examined the function of β-actin arginylation in cell migration. We found that arginylated β-actin is concentrated at the leading edge of lamellipodia and that this enrichment is abolished after serum starvation as well as in contact-inhibited cells in confluent cultures, suggesting that arginylated β-actin at the cell leading edge is coupled to active migration. Arginylated actin levels exhibit dynamic changes in response to cell stimuli, lowered after serum starvation and dramatically elevating within minutes after cell stimulation by readdition of serum or lysophosphatidic acid. These dynamic changes require active translation and are not seen in confluent contact-inhibited cell cultures. Microinjection of arginylated actin antibodies into cells severely and specifically inhibits their migration rates. Together, these data strongly suggest that arginylation of β-actin is a tightly regulated dynamic process that occurs at the leading edge of locomoting cells in response to stimuli and is integral to the signaling network that regulates cell migration. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Changes in oil content of transgenic soybeans expressing the yeast SLC1 gene.

    Science.gov (United States)

    Rao, Suryadevara S; Hildebrand, David

    2009-10-01

    The wild type (Wt) and mutant form of yeast (sphingolipid compensation) genes, SLC1 and SLC1-1, have been shown to have lysophosphatidic acid acyltransferase (LPAT) activities (Nageic et al. in J Biol Chem 269:22156-22163, 1993). Expression of these LPAT genes was reported to increase oil content in transgenic Arabidopsis and Brassica napus. It is of interest to determine if the TAG content increase would also be seen in soybeans. Therefore, the wild type SLC1 was expressed in soybean somatic embryos under the control of seed specific phaseolin promoter. Some transgenic somatic embryos and in both T2 and T3 transgenic seeds showed higher oil contents. Compared to controls, the average increase in triglyceride values went up by 1.5% in transgenic somatic embryos. A maximum of 3.2% increase in seed oil content was observed in a T3 line. Expression of the yeast Wt LPAT gene did not alter the fatty acid composition of the seed oil.

  16. Inducible Inhibition of Gβγ Reveals Localization-dependent Functions at the Plasma Membrane and Golgi*

    Science.gov (United States)

    Klayman, Lauren M.; Wedegaertner, Philip B.

    2017-01-01

    Heterotrimeric G proteins signal at a variety of endomembrane locations, in addition to their canonical function at the cytoplasmic surface of the plasma membrane (PM), where they are activated by cell surface G protein-coupled receptors. Here we focus on βγ signaling at the Golgi, where βγ activates a signaling cascade, ultimately resulting in vesicle fission from the trans-Golgi network (TGN). To develop a novel molecular tool for inhibiting endogenous βγ in a spatial-temporal manner, we take advantage of a lipid association mutant of the widely used βγ inhibitor GRK2ct (GRK2ct-KERE) and the FRB/FKBP heterodimerization system. We show that GRK2ct-KERE cannot inhibit βγ function when expressed in cells, but recruitment to a specific membrane location recovers the ability of GRK2ct-KERE to inhibit βγ signaling. PM-recruited GRK2ct-KERE inhibits lysophosphatidic acid-induced phosphorylation of Akt, whereas Golgi-recruited GRK2ct-KERE inhibits cargo transport from the TGN to the PM. Moreover, we show that Golgi-recruited GRK2ct-KERE inhibits model basolaterally targeted but not apically targeted cargo delivery, for both PM-destined and secretory cargo, providing the first evidence of selectivity in terms of cargo transport regulated by βγ. Last, we show that Golgi fragmentation induced by ilimaquinone and nocodazole is blocked by βγ inhibition, demonstrating that βγ is a key regulator of multiple pathways that impact Golgi morphology. Thus, we have developed a new molecular tool, recruitable GRK2ct-KERE, to modulate βγ signaling at specific subcellular locations, and we demonstrate novel cargo selectivity for βγ regulation of TGN to PM transport and a novel role for βγ in mediating Golgi fragmentation. PMID:27994056

  17. Hydrogen peroxide stimulates cell motile activity through LPA receptor-3 in liver epithelial WB-F344 cells

    Energy Technology Data Exchange (ETDEWEB)

    Shibata, Ayano; Tanabe, Eriko; Inoue, Serina; Kitayoshi, Misaho; Okimoto, Souta; Hirane, Miku; Araki, Mutsumi [Division of Cancer Biology and Bioinformatics, Department of Life Science, Faculty of Science and Engineering, Kinki University, 3-4-1, Kowakae, Higashiosaka, Osaka 577-8502 (Japan); Fukushima, Nobuyuki [Division of Molecular Neurobiology, Department of Life Science, Faculty of Science and Engineering, Kinki University, 3-4-1, Kowakae, Higashiosaka, Osaka 577-8502 (Japan); Tsujiuchi, Toshifumi, E-mail: ttujiuch@life.kindai.ac.jp [Division of Cancer Biology and Bioinformatics, Department of Life Science, Faculty of Science and Engineering, Kinki University, 3-4-1, Kowakae, Higashiosaka, Osaka 577-8502 (Japan)

    2013-04-12

    Highlights: •Hydrogen peroxide stimulates cell motility of WB-F344 cells. •LPA{sub 3} is induced by hydrogen peroxide in WB-F344 cells. •Cell motility by hydrogen peroxide is inhibited in LPA{sub 3} knockdown cells. •LPA signaling is involved in cell migration by hydrogen peroxide. -- Abstract: Hydrogen peroxide which is one of reactive oxygen species (ROS) mediates a variety of biological responses, including cell proliferation and migration. In the present study, we investigated whether lysophosphatidic acid (LPA) signaling is involved in cell motile activity stimulated by hydrogen peroxide. The rat liver epithelial WB-F344 cells were treated with hydrogen peroxide at 0.1 or 1 μM for 48 h. In cell motility assays, hydrogen peroxide treated cells showed significantly high cell motile activity, compared with untreated cells. To measure the expression levels of LPA receptor genes, quantitative real time RT-PCR analysis was performed. The expressions of LPA receptor-3 (Lpar3) in hydrogen peroxide treated cells were significantly higher than those in control cells, but not Lpar1 and Lpar2 genes. Next, to assess the effect of LPA{sub 3} on cell motile activity, the Lpar3 knockdown cells from WB-F344 cells were also treated with hydrogen peroxide. The cell motile activity of the knockdown cells was not stimulated by hydrogen peroxide. Moreover, in liver cancer cells, hydrogen peroxide significantly activated cell motility of Lpar3-expressing cells, but not Lpar3-unexpressing cells. These results suggest that LPA signaling via LPA{sub 3} may be mainly involved in cell motile activity of WB-F344 cells stimulated by hydrogen peroxide.

  18. The p110beta isoform of phosphoinositide 3-kinase signals downstream of G protein-coupled receptors and is functionally redundant with p110gamma.

    Science.gov (United States)

    Guillermet-Guibert, Julie; Bjorklof, Katja; Salpekar, Ashreena; Gonella, Cristiano; Ramadani, Faruk; Bilancio, Antonio; Meek, Stephen; Smith, Andrew J H; Okkenhaug, Klaus; Vanhaesebroeck, Bart

    2008-06-17

    The p110 isoforms of phosphoinositide 3-kinase (PI3K) are acutely regulated by extracellular stimuli. The class IA PI3K catalytic subunits (p110alpha, p110beta, and p110delta) occur in complex with a Src homology 2 (SH2) domain-containing p85 regulatory subunit, which has been shown to link p110alpha and p110delta to Tyr kinase signaling pathways. The p84/p101 regulatory subunits of the p110gamma class IB PI3K lack SH2 domains and instead couple p110gamma to G protein-coupled receptors (GPCRs). Here, we show, using small-molecule inhibitors with selectivity for p110beta and cells derived from a p110beta-deficient mouse line, that p110beta is not a major effector of Tyr kinase signaling but couples to GPCRs. In macrophages, both p110beta and p110gamma contributed to Akt activation induced by the GPCR agonist complement 5a, but not by the Tyr kinase ligand colony-stimulating factor-1. In fibroblasts, which express p110beta but not p110gamma, p110beta mediated Akt activation by the GPCR ligands stromal cell-derived factor, sphingosine-1-phosphate, and lysophosphatidic acid but not by the Tyr kinase ligands PDGF, insulin, and insulin-like growth factor 1. Introduction of p110gamma in these cells reduced the contribution of p110beta to GPCR signaling. Taken together, these data show that p110beta and p110gamma can couple redundantly to the same GPCR agonists. p110beta, which shows a much broader tissue distribution than the leukocyte-restricted p110gamma, could thus provide a conduit for GPCR-linked PI3K signaling in the many cell types where p110gamma expression is low or absent.

  19. Impaired Integrin-mediated Adhesion and Signaling in Fibroblasts Expressing a Dominant-negative Mutant PTP1B

    Science.gov (United States)

    Arregui, Carlos O.; Balsamo, Janne; Lilien, Jack

    1998-01-01

    To investigate the role of nonreceptor protein tyrosine phosphatase 1B (PTP1B) in β1-integrin– mediated adhesion and signaling, we transfected mouse L cells with normal and catalytically inactive forms of the phosphatase. Parental cells and cells expressing the wild-type or mutant PTP1B were assayed for (a) adhesion, (b) spreading, (c) presence of focal adhesions and stress fibers, and (d) tyrosine phosphorylation. Parental cells and cells expressing wild-type PTP1B show similar morphology, are able to attach and spread on fibronectin, and form focal adhesions and stress fibers. In contrast, cells expressing the inactive PTP1B have a spindle-shaped morphology, reduced adhesion and spreading on fibronectin, and almost a complete absence of focal adhesions and stress fibers. Attachment to fibronectin induces tyrosine phosphorylation of focal adhesion kinase (FAK) and paxillin in parental cells and cells transfected with the wild-type PTP1B, while in cells transfected with the mutant PTP1B, such induction is not observed. Additionally, in cells expressing the mutant PTP1B, tyrosine phosphorylation of Src is enhanced and activity is reduced. Lysophosphatidic acid temporarily reverses the effects of the mutant PTP1B, suggesting the existence of a signaling pathway triggering focal adhesion assembly that bypasses the need for active PTP1B. PTP1B coimmunoprecipitates with β1-integrin from nonionic detergent extracts and colocalizes with vinculin and the ends of actin stress fibers in focal adhesions. Our data suggest that PTP1B is a critical regulatory component of integrin signaling pathways, which is essential for adhesion, spreading, and formation of focal adhesions. PMID:9813103

  20. Human neural progenitors express functional lysophospholipid receptors that regulate cell growth and morphology

    Directory of Open Access Journals (Sweden)

    Callihan Phillip

    2008-12-01

    Full Text Available Abstract Background Lysophospholipids regulate the morphology and growth of neurons, neural cell lines, and neural progenitors. A stable human neural progenitor cell line is not currently available in which to study the role of lysophospholipids in human neural development. We recently established a stable, adherent human embryonic stem cell-derived neuroepithelial (hES-NEP cell line which recapitulates morphological and phenotypic features of neural progenitor cells isolated from fetal tissue. The goal of this study was to determine if hES-NEP cells express functional lysophospholipid receptors, and if activation of these receptors mediates cellular responses critical for neural development. Results Our results demonstrate that Lysophosphatidic Acid (LPA and Sphingosine-1-phosphate (S1P receptors are functionally expressed in hES-NEP cells and are coupled to multiple cellular signaling pathways. We have shown that transcript levels for S1P1 receptor increased significantly in the transition from embryonic stem cell to hES-NEP. hES-NEP cells express LPA and S1P receptors coupled to Gi/o G-proteins that inhibit adenylyl cyclase and to Gq-like phospholipase C activity. LPA and S1P also induce p44/42 ERK MAP kinase phosphorylation in these cells and stimulate cell proliferation via Gi/o coupled receptors in an Epidermal Growth Factor Receptor (EGFR- and ERK-dependent pathway. In contrast, LPA and S1P stimulate transient cell rounding and aggregation that is independent of EGFR and ERK, but dependent on the Rho effector p160 ROCK. Conclusion Thus, lysophospholipids regulate neural progenitor growth and morphology through distinct mechanisms. These findings establish human ES cell-derived NEP cells as a model system for studying the role of lysophospholipids in neural progenitors.

  1. PKD1 mediates negative feedback of PI3K/Akt activation in response to G protein-coupled receptors.

    Directory of Open Access Journals (Sweden)

    Yang Ni

    Full Text Available We examined whether protein kinase D1 (PKD1 mediates negative feeback of PI3K/Akt signaling in intestinal epithelial cells stimulated with G protein-coupled receptor (GPCR agonists. Exposure of intestinal epithelial IEC-18 cells to increasing concentrations of the PKD family inhibitor kb NB 142-70, at concentrations that inhibited PKD1 activation, strikingly potentiated Akt phosphorylation at Thr(308 and Ser(473 in response to the mitogenic GPCR agonist angiotensin II (ANG II. Enhancement of Akt activation by kb NB 142-70 was also evident in cells with other GPCR agonists, including vasopressin and lysophosphatidic acid. Cell treatment with the structurally unrelated PKD family inhibitor CRT0066101 increased Akt phosphorylation as potently as kb NB 142-70 [corrected]. Knockdown of PKD1 with two different siRNAs strikingly enhanced Akt phosphorylation in response to ANG II stimulation in IEC-18 cells. To determine whether treatment with kb NB 142-70 enhances accumulation of phosphatidylinositol (3,4,5-trisphosphate (PIP3 in the plasma membrane, we monitored the redistribution of Akt-pleckstrin homology domain-green fluorescent protein (Akt-PH-GFP in single IEC-18 cells. Exposure to kb NB 142-70 strikingly increased membrane accumulation of Akt-PH-GFP in response to ANG II. The translocation of the PIP3 sensor to the plasma membrane and the phosphorylation of Akt was completed prevented by prior exposure to the class I p110α specific inhibitor A66. ANG II markedly increased the phosphorylation of p85α detected by a PKD motif-specific antibody and enhanced the association of p85α with PTEN. Transgenic mice overexpressing PKD1 showed a reduced phosphorylation of Akt at Ser(473 in intestinal epithelial cells compared to wild type littermates. Collectively these results indicate that PKD1 activation mediates feedback inhibition of PI3K/Akt signaling in intestinal epithelial cells in vitro and in vivo.

  2. Effect of CLA and other C18 unsaturated fatty acids on DGAT in bovine milk fat biosynthetic systems.

    Science.gov (United States)

    Sørensen, Brent M; Chris Kazala, E; Murdoch, Gordon K; Keating, Aileen F; Cruz-Hernandez, Cristina; Wegner, Jochen; Kennelly, John J; Okine, Erasmus K; Weselake, Randall J

    2008-10-01

    Production of dairy products with increased amounts of nutraceutic FA such as conjugated linoleic acid (CLA) represents a recent approach for dairy producers and processors to increase the value of their products. The effect of CLA and other FA on the expression of diacylglycerol acyltransferase-1 (DGAT-1) and DGAT-2, and DGAT activity were investigated in bovine mammary gland epithelial (MAC-T) cells. DGAT gene expression analyses were also conducted using bovine mammary gland tissue from dairy cows. In the studies with MAC-T cells, there were no significant effects of CLA isomers or other FA on DGAT1 expression, whereas all FA tested showed enhanced DGAT2 expression (P < 0.05 to P < 0.001), with alpha-linolenic acid (alpha-18:3) having the greatest effect. Additionally, DGAT2 expression was co-ordinated with expression of lysophosphatidic acid acyltransferase (LPAAT), an observation that was also apparent in mammary gland from lactating dairy cows. In contrast, treatment of MAC-T cells with trans-10, cis-12 18:2 or alpha-18:3 resulted in a significant (P < 0.05) decrease in overall DGAT enzyme activity, although the mechanisms resulting in these effects are unclear. Competition assays using microsomes from bovine mammary gland tissue and 1-[(14)C]oleoyl-CoA suggested that DGAT activity was more selective for oleoyl (cis-9 18:1)-CoA than cis-9, trans-11 18:2-, trans-10, cis-12 18:2- or cis-9, cis-12 18:2-CoA. Collectively, the results suggest the relationship between trans-10, cis-12 18:2 and reduced TAG production in bovine milk is not linked to the production of DGAT1 or DGAT2 transcripts, but probably involves effects of this CLA isomer at events beyond transcription, such as post-translational and/or enzyme activity effects.

  3. Association between Promoter Hypomethylation and Overexpression of Autotaxin with Outcome Parameters in Biliary Atresia.

    Directory of Open Access Journals (Sweden)

    Wanvisa Udomsinprasert

    Full Text Available Biliary atresia (BA is a progressive fibroinflammatory liver disease. Autotaxin (ATX has a profibrotic effect resulting from lysophosphatidic acid activity. The purpose of this study was to examine ATX expression and ATX promoter methylation in peripheral blood leukocytes and liver tissues from BA patients and controls and investigate their associations with outcome parameters in BA patients.A total of 130 subjects (65 BA patients and 65 age-matched controls were enrolled. DNA was extracted from circulating leukocytes and liver tissues of BA patients and from and age-matched controls. ATX promoter methylation status was determined by bisulfite pyrosequencing. ATX expression was analyzed using quantitative real-time polymerase chain reaction and enzyme-linked immunosorbent assay.Decreased methylation of specific CpGs were observed at the ATX promoter in BA patients. Subsequent analysis revealed that BA patients with advanced stage had lower methylation levels of ATX promoter than those with early stage. ATX promoter methylation levels were found to be associated with hepatic dysfunction in BA. In addition, ATX expression was significantly elevated and correlated with a decrease in ATX promoter methylation in BA patients compared to the controls. Furthermore, promoter hypomethylation and overexpression of ATX were inversely associated with jaundice status, hepatic dysfunction, and liver stiffness in BA patients.Accordingly, it has been hypothesized that ATX promoter methylation and ATX expression in peripheral blood may serve as possible biomarkers reflecting the progression of liver fibrosis in postoperative BA. These findings suggest that the promoter hypomethylation and overexpression of ATX might play a contributory role in the pathogenesis of liver fibrosis in BA.

  4. ATP-dependent paracrine communication between enteric neurons and glia in a primary cell culture derived from embryonic mice.

    Science.gov (United States)

    Gomes, P; Chevalier, J; Boesmans, W; Roosen, L; van den Abbeel, V; Neunlist, M; Tack, J; Vanden Berghe, P

    2009-08-01

    The importance of dynamic interactions between glia and neurons is increasingly recognized, both in the central and enteric nervous system. However, apart from their protective role, little is known about enteric neuro-glia interaction. The aim was to investigate neuro-glia intercellular communication in a mouse culture model using optical techniques. Complete embryonic (E13) guts were enzymatically dissociated, seeded on coverslips and studied with immunohistochemistry and Ca(2+)-imaging. Putative progenitor-like cells (expressing both PGP9.5 and S-100) differentiated over approximately 5 days into glia or neurons expressing typical cell-specific markers. The glia-neuron ratio could be manipulated by specific supplements (N2, G5). Neurons and glia were functionally identified both by their Ca(2+)-response to either depolarization (high K(+)) or lysophosphatidic acid and by the expression of typical markers. Neurons responded to ACh, DMPP, 5-HT, ATP and electrical stimulation, while glia responded to ATP and ADPbetas. Inhibition of glial responses by MRS2179 suggests involvement of P2Y1 receptors. Neuronal stimulation also caused delayed glial responses, which were reduced by suramin and by exogenous apyrases that catalyse nucleotide breakdown. Conversely, glial responses were enhanced by ARL-67156, an ecto-ATPase inhibitor. In this mouse enteric co-culture, functional glia and neurons can be easily monitored using optical techniques. Glial cells can be activated directly by ATP or ADPbetas. Activation of neuronal cells (DMPP, K(+)) causes secondary responses in glial cells, which can be modulated by tuning ATP and ADP breakdown. This strongly supports the involvement of paracrine purinergic communication between enteric neurons and glia.

  5. Ghrelin is involved in the paracrine communication between neurons and glial cells.

    Science.gov (United States)

    Avau, B; De Smet, B; Thijs, T; Geuzens, A; Tack, J; Vanden Berghe, P; Depoortere, I

    2013-09-01

    Ghrelin is the only known peripherally active orexigenic hormone produced by the stomach that activates vagal afferents to stimulate food intake and to accelerate gastric emptying. Vagal sensory neurons within the nodose ganglia are surrounded by glial cells, which are able to receive and transmit chemical signals. We aimed to investigate whether ghrelin activates or influences the interaction between both types of cells. The effect of ghrelin was compared with that of leptin and cholecystokinin (CCK). Cultures of rat nodose ganglia were characterized by immunohistochemistry and the functional effects of peptides, neurotransmitters, and pharmacological blockers were measured by Ca(2+) imaging using Fluo-4-AM as an indicator. Neurons responded to KCl and were immunoreactive for PGP-9.5 whereas glial cells responded to lysophosphatidic acid and had the typical SOX-10-positive nuclear staining. Neurons were only responsive to CCK (31 ± 5%) whereas glial cells responded equally to the applied stimuli: ghrelin (27 ± 2%), leptin (21 ± 2%), and CCK (30 ± 2%). In contrast, neurons stained more intensively for the ghrelin receptor than glial cells. ATP induced [Ca(2+) ]i rises in 90% of the neurons whereas ACh and the NO donor, SIN-1, mainly induced [Ca(2+) ]i changes in glial cells (41 and 51%, respectively). The percentage of ghrelin-responsive glial cells was not affected by pretreatment with suramin, atropine, hexamethonium or 1400 W, but was reduced by l-NAME and by tetrodotoxin. Neurons were shown to be immunoreactive for neuronal NO-synthase (nNOS). Our data show that ghrelin induces Ca(2+) signaling in glial cells of the nodose ganglion via the release of NO originating from the neurons. © 2013 John Wiley & Sons Ltd.

  6. Studies on the antibacterial activity of dodecylglycerol

    International Nuclear Information System (INIS)

    Brissette, J.L.

    1985-01-01

    The antimicrobial activity of lipids has been known for many years, with dodecanoylglycerol (dodecanoic acid esterified to glycerol) being one of the most potential. However, the antibacterial potency of dodecylglycerol (DDG), the corresponding 1-O-alkyl glycerol ether, is considerably greater. The superior efficacy of DDG can be attributed, at least in part, to the greater chemical and metabolic stability of the ether bond as compared to esters. In an attempt towards elucidating the mode of action of DDG, the effect of DDG on bacterial lipid metabolism was examined using Streptococcus mutans BHT, a tolerant bacterium. The metabolic fate of the ether was also determined with the use of three radioactive tracers, 14 C-glycerol, 32 Pi, and 14 C-DDG. Treatment of exponentially growing cultures of S. mutans BHI with growth inhibitory concentrations of DDG (10 and 20 μg/ml) inhibited the incorporation of 14 C-glycerol into lipid. In vivo studies using 14 C-DDG showed that the 14 C-ether was readily incorporated almost exclusively into phosphatidic (PA) and lysophosphatidic (LPA) acids. When cells prelabelled with either 14 C-glycerol or 32 Pi were exposed to 10 and 20 + g/ml DDG for 2 h, the accumulation of PA and diphosphatidylglycerol (diPG) was greatly stimulated. However, diPG accumulated at the expense of its precursor, glycerol, which greatly decreased. These data suggest that the ether-containing PA inhibits the synthesis of CDP-diglyceride. Moreover, these results clearly demonstrate that DDG functions as a metabolic rather than physical effector, disputing the conventional notion that bactericidal lipids act as detergents, physically dissolving the cellular envelope

  7. ATM-activated autotaxin (ATX) propagates inflammation and DNA damage in lung epithelial cells: a new mode of action for silica-induced DNA damage?

    Science.gov (United States)

    Zheng, Huiyuan; Högberg, Johan; Stenius, Ulla

    2017-12-07

    Silica exposure is a common risk factor for lung cancer. It has been claimed that key elements in cancer development are activation of inflammatory cells that indirectly induce DNA damage and proliferative stimuli in respiratory epithelial cells. We studied DNA damage induced by silica particles in respiratory epithelial cells and focused the role of the signaling enzyme autotaxin (ATX). A549 and 16 bronchial epithelial cells (16HBE) lung epithelial cells were exposed to silica particles. Reactive oxygen species (ROS), NOD-like receptor family pyrin domain containing-3 (NLRP3) inflammasome activation, ATX, ataxia telangiectasia mutated (ATM), and DNA damage (γH2AX, pCHK1, pCHK2, comet assay) were end points. Low doses of silica induced NLRP3 activation, DNA damage accumulation, and ATM phosphorylation. A novel finding was that ATM induced ATX generation and secretion. Not only silica but also rotenone, camptothecin and H2O2 activated ATX via ATM, suggesting that ATX is part of a generalized ATM response to double-strand breaks (DSBs). Surprisingly, ATX inhibition mitigated DNA damage accumulation at later time points (6-16 h), and ATX transfection caused NLRP3 activation and DNA damage. Furthermore, the product of ATX enzymatic activity, lysophosphatidic acid, recapitulated the effects of ATX transfection. These data indicate an ATM-ATX-dependent loop that propagates inflammation and DSB accumulation, making low doses of silica effective inducers of DSBs in epithelial cells. We conclude that an ATM-ATX axis interconnects DSBs with silica-induced inflammation and propagates these effects in epithelial cells. Further studies of this adverse outcome pathway may give an accurate assessment of the lowest doses of silica that causes cancer. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. First International Conference on Lysophospholipids and Related Bioactive Lipids in Biology and Disease Sponsored by the Federation of American Societies of Experimental Biology

    Directory of Open Access Journals (Sweden)

    Edward J. Goetzl

    2001-01-01

    Full Text Available The First International Conference on “Lysophospholipids and Related Bioactive Lipids in Biology and Diseases” was held in Tucson, AZ on June 10�14, 2001, under the sponsorship of the Federation of American Societies of Experimental Biology (FASEB. More than 100 scientists from 11 countries discussed the recent results of basic and clinical research in the broad biology of this emerging field. Immense progress was reported in defining the biochemistry of generation and biology of cellular effects of the bioactive lysophospholipids (LPLs. These aspects of LPLs described at the conference parallel in many ways those of the eicosanoid mediators, such as prostaglandins and leukotrienes. As for eicosanoids, the LPLs termed lysophosphatidic acid (LPA and sphingosine 1-phosphate (S1P are produced enzymatically from phospholipid precursors in cell membranes and act on cells at nanomolar concentrations through subfamilies of receptors of the G protein–coupled superfamily. The rate-limiting steps in production of LPLs were reported to be controlled by specific phospholipases for LPA and sphingosine kinases for S1P. The receptor subfamilies formerly were designated endothelial differentiation gene-encoded receptors or Edg Rs for their original discovery in endothelial cells. A currently active nomenclature committee at this conference suggested the ligand-based names: S1P1 = Edg-1, S1P2 = Edg-5, S1P3 = Edg-3, S1P4 = Edg-6, and S1P5 = Edg-8; LPA1 = Edg-2, LPA2 = Edg-4, and LPA3 = Edg-7 receptors. Several families of lysophospholipid phosphatases (LPPs have been characterized, which biodegrade LPA, whereas S1P is inactivated with similar rapidity by both a lyase and S1P phosphatases.

  9. Autotaxin is induced by TSA through HDAC3 and HDAC7 inhibition and antagonizes the TSA-induced cell apoptosis.

    Science.gov (United States)

    Li, Song; Wang, Baolu; Xu, Yan; Zhang, Junjie

    2011-02-12

    Autotaxin (ATX) is a secreted glycoprotein with the lysophospholipase D (lysoPLD) activity to convert lysophosphatidylcholine (LPC) into lysophosphatidic acid (LPA), a bioactive lysophospholipid involved in diverse biological actions. ATX is highly expressed in some cancer cells and contributes to their tumorigenesis, invasion, and metastases, while in other cancer cells ATX is silenced or expressed at low level. The mechanism of ATX expression regulation in cancer cells remains largely unknown. In the present study, we demonstrated that trichostatin A (TSA), a well-known HDAC inhibitor (HDACi), significantly induced ATX expression in SW480 and several other cancer cells with low or undetectable endogenous ATX expression. ATX induction could be observed when HDAC3 and HDAC7 were down-regulated by their siRNAs. It was found that HDAC7 expression levels were low in the cancer cells with high endogenous ATX expression. Exogenous over-expression of HDAC7 inhibited ATX expression in these cells in a HDAC3-dependent manner. These data indicate that HDAC3 and HDAC7 collaboratively suppress ATX expression in cancer cells, and suggest that TSA induce ATX expression by inhibiting HDAC3 and HDAC7. The biological significance of this regulation mechanism was revealed by demonstrating that TSA-induced ATX protected cancer cells against TSA-induced apoptosis by producing LPA through its lysoPLD activity, which could be reversed by BrP-LPA and S32826, the inhibitors of the ATX-LPA axis. We have demonstrated that ATX expression is repressed by HDAC3 and HDAC7 in cancer cells. During TSA treatment, ATX is induced due to the HDAC3 and HDAC7 inhibition and functionally antagonizes the TSA-induced apoptosis. These results reveal an internal HDACi-resistant mechanism in cancer cells, and suggest that the inhibition of ATX-LPA axis would be helpful to improve the efficacy of HDACi-based therapeutics against cancer.

  10. Reassessing the Potential Activities of Plant CGI-58 Protein.

    Directory of Open Access Journals (Sweden)

    Abdallah Khatib

    Full Text Available Comparative Gene Identification-58 (CGI-58 is a widespread protein found in animals and plants. This protein has been shown to participate in lipolysis in mice and humans by activating Adipose triglyceride lipase (ATGL, the initial enzyme responsible for the triacylglycerol (TAG catabolism cascade. Human mutation of CGI-58 is the cause of Chanarin-Dorfman syndrome, an orphan disease characterized by a systemic accumulation of TAG which engenders tissue disorders. The CGI-58 protein has also been shown to participate in neutral lipid metabolism in plants and, in this case, a mutation again provokes TAG accumulation. Although its roles as an ATGL coactivator and in lipid metabolism are quite clear, the catalytic activity of CGI-58 is still in question. The acyltransferase activities of CGI-58 have been speculated about, reported or even dismissed and experimental evidence that CGI-58 expressed in E. coli possesses an unambiguous catalytic activity is still lacking. To address this problem, we developed a new set of plasmids and site-directed mutants to elucidate the in vivo effects of CGI-58 expression on lipid metabolism in E. coli. By analyzing the lipid composition in selected E. coli strains expressing CGI-58 proteins, and by reinvestigating enzymatic tests with adequate controls, we show here that recombinant plant CGI-58 has none of the proposed activities previously described. Recombinant plant and mouse CGI-58 both lack acyltransferase activity towards either lysophosphatidylglycerol or lysophosphatidic acid to form phosphatidylglycerol or phosphatidic acid and recombinant plant CGI-58 does not catalyze TAG or phospholipid hydrolysis. However, expression of recombinant plant CGI-58, but not mouse CGI-58, led to a decrease in phosphatidylglycerol in all strains of E. coli tested, and a mutation of the putative catalytic residues restored a wild-type phenotype. The potential activities of plant CGI-58 are subsequently discussed.

  11. LPA, HGF, and EGF utilize distinct combinations of signaling pathways to promote migration and invasion of MDA-MB-231 breast carcinoma cells

    International Nuclear Information System (INIS)

    Harrison, Susan MW; Knifley, Teresa; Chen, Min; O’Connor, Kathleen L

    2013-01-01

    Various pathways impinge on the actin-myosin pathway to facilitate cell migration and invasion including members of the Rho family of small GTPases and MAPK. However, the signaling components that are considered important for these processes vary substantially within the literature with certain pathways being favored. These distinctions in signaling pathways utilized are often attributed to differences in cell type or physiological conditions; however, these attributes have not been systematically assessed. To address this question, we analyzed the migration and invasion of MDA-MB-231 breast carcinoma cell line in response to various stimuli including lysophosphatidic acid (LPA), hepatocyte growth factor (HGF) and epidermal growth factor (EGF) and determined the involvement of select signaling pathways that impact myosin light chain phosphorylation. LPA, a potent stimulator of the Rho-ROCK pathway, surprisingly did not require the Rho-ROCK pathway to stimulate migration but instead utilized Rac and MAPK. In contrast, LPA-stimulated invasion required Rho, Rac, and MAPK. Of these three major pathways, EGF-stimulated MDA-MB-231 migration and invasion required Rho; however, Rac was essential only for invasion and MAPK was dispensable for migration. HGF signaling, interestingly, utilized the same pathways for migration and invasion, requiring Rho but not Rac signaling. Notably, the dependency of HGF-stimulated migration and invasion as well as EGF-stimulated invasion on MAPK was subject to the inhibitors used. As expected, myosin light chain kinase (MLCK), a convergence point for MAPK and Rho family GTPase signaling, was required for all six conditions. These observations suggest that, while multiple signaling pathways contribute to cancer cell motility, not all pathways operate under all conditions. Thus, our study highlights the plasticity of cancer cells to adapt to multiple migratory cues

  12. Reassessing the Potential Activities of Plant CGI-58 Protein

    Science.gov (United States)

    Khatib, Abdallah; Arhab, Yani; Bentebibel, Assia; Abousalham, Abdelkarim; Noiriel, Alexandre

    2016-01-01

    Comparative Gene Identification-58 (CGI-58) is a widespread protein found in animals and plants. This protein has been shown to participate in lipolysis in mice and humans by activating Adipose triglyceride lipase (ATGL), the initial enzyme responsible for the triacylglycerol (TAG) catabolism cascade. Human mutation of CGI-58 is the cause of Chanarin-Dorfman syndrome, an orphan disease characterized by a systemic accumulation of TAG which engenders tissue disorders. The CGI-58 protein has also been shown to participate in neutral lipid metabolism in plants and, in this case, a mutation again provokes TAG accumulation. Although its roles as an ATGL coactivator and in lipid metabolism are quite clear, the catalytic activity of CGI-58 is still in question. The acyltransferase activities of CGI-58 have been speculated about, reported or even dismissed and experimental evidence that CGI-58 expressed in E. coli possesses an unambiguous catalytic activity is still lacking. To address this problem, we developed a new set of plasmids and site-directed mutants to elucidate the in vivo effects of CGI-58 expression on lipid metabolism in E. coli. By analyzing the lipid composition in selected E. coli strains expressing CGI-58 proteins, and by reinvestigating enzymatic tests with adequate controls, we show here that recombinant plant CGI-58 has none of the proposed activities previously described. Recombinant plant and mouse CGI-58 both lack acyltransferase activity towards either lysophosphatidylglycerol or lysophosphatidic acid to form phosphatidylglycerol or phosphatidic acid and recombinant plant CGI-58 does not catalyze TAG or phospholipid hydrolysis. However, expression of recombinant plant CGI-58, but not mouse CGI-58, led to a decrease in phosphatidylglycerol in all strains of E. coli tested, and a mutation of the putative catalytic residues restored a wild-type phenotype. The potential activities of plant CGI-58 are subsequently discussed. PMID:26745266

  13. Ginseng gintonin activates the human cardiac delayed rectifier K+ channel: involvement of Ca2+/calmodulin binding sites.

    Science.gov (United States)

    Choi, Sun-Hye; Lee, Byung-Hwan; Kim, Hyeon-Joong; Jung, Seok-Won; Kim, Hyun-Sook; Shin, Ho-Chul; Lee, Jun-Hee; Kim, Hyoung-Chun; Rhim, Hyewhon; Hwang, Sung-Hee; Ha, Tal Soo; Kim, Hyun-Ji; Cho, Hana; Nah, Seung-Yeol

    2014-09-01

    Gintonin, a novel, ginseng-derived G protein-coupled lysophosphatidic acid (LPA) receptor ligand, elicits [Ca(2+)]i transients in neuronal and non-neuronal cells via pertussis toxin-sensitive and pertussis toxin-insensitive G proteins. The slowly activating delayed rectifier K(+) (I(Ks)) channel is a cardiac K(+) channel composed of KCNQ1 and KCNE1 subunits. The C terminus of the KCNQ1 channel protein has two calmodulin-binding sites that are involved in regulating I(Ks) channels. In this study, we investigated the molecular mechanisms of gintonin-mediated activation of human I(Ks) channel activity by expressing human I(Ks) channels in Xenopus oocytes. We found that gintonin enhances IKs channel currents in concentration- and voltage-dependent manners. The EC50 for the I(Ks) channel was 0.05 ± 0.01 μg/ml. Gintonin-mediated activation of the I(Ks) channels was blocked by an LPA1/3 receptor antagonist, an active phospholipase C inhibitor, an IP3 receptor antagonist, and the calcium chelator BAPTA. Gintonin-mediated activation of both the I(Ks) channel was also blocked by the calmodulin (CaM) blocker calmidazolium. Mutations in the KCNQ1 [Ca(2+)]i/CaM-binding IQ motif sites (S373P, W392R, or R539W)blocked the action of gintonin on I(Ks) channel. However, gintonin had no effect on hERG K(+) channel activity. These results show that gintonin-mediated enhancement of I(Ks) channel currents is achieved through binding of the [Ca(2+)]i/CaM complex to the C terminus of KCNQ1 subunit.

  14. Altered synaptic phospholipid signaling in PRG-1 deficient mice induces exploratory behavior and motor hyperactivity resembling psychiatric disorders.

    Science.gov (United States)

    Schneider, Patrick; Petzold, Sandra; Sommer, Angela; Nitsch, Robert; Schwegler, Herbert; Vogt, Johannes; Roskoden, Thomas

    2018-01-15

    Plasticity related gene 1 (PRG-1) is a neuron specific membrane protein located at the postsynaptic density of glutamatergic synapses. PRG-1 modulates signaling pathways of phosphorylated lipid substrates such as lysophosphatidic acid (LPA). Deletion of PRG-1 increases presynaptic glutamate release probability leading to neuronal over-excitation. However, due to its cortical expression, PRG-1 deficiency leading to increased glutamatergic transmission is supposed to also affect motor pathways. We therefore analyzed the effects of PRG-1 function on exploratory and motor behavior using homozygous PRG-1 knockout (PRG-1 -/- ) mice and PRG-1/LPA 2 -receptor double knockout (PRG-1 -/- /LPA 2 -/- ) mice in two open field settings of different size and assessing motor behavior in the Rota Rod test. PRG-1 -/- mice displayed significantly longer path lengths and higher running speed in both open field conditions. In addition, PRG-1 -/- mice spent significantly longer time in the larger open field and displayed rearing and self-grooming behavior. Furthermore PRG-1 -/- mice displayed stereotypical behavior resembling phenotypes of psychiatric disorders in the smaller sized open field arena. Altogether, this behavior is similar to the stereotypical behavior observed in animal models for psychiatric disease of autistic spectrum disorders which reflects a disrupted balance between glutamatergic and GABAergic synapses. These differences indicate an altered excitation/inhibition balance in neuronal circuits in PRG-1 -/- mice as recently shown in the somatosensory cortex [38]. In contrast, PRG-1 -/- /LPA 2 -/- did not show significant changes in behavior in the open field suggesting that these specific alterations were abolished when the LPA 2 -receptor was lacking. Our findings indicate that PRG-1 deficiency led to over-excitability caused by an altered LPA/LPA 2 -R signaling inducing a behavioral phenotype typically observed in animal models for psychiatric disorders. Copyright

  15. Lysophospholipid Growth Factors and Their G Protein-Coupled Receptors in Immunity, Coronary Artery Disease, and Cancer

    Directory of Open Access Journals (Sweden)

    Edward J. Goetzl

    2002-01-01

    Full Text Available The physiological lysophospholipids (LPLs, exemplified by lysophosphatidic acid (LPA and sphingosine 1-phosphate (S1P, are omnific mediators of normal cellular proliferation, survival, and functions. Although both LPA and S1P attain micromolar concentrations in many biological fluids, numerous aspects of their biosynthesis, transport, and metabolic degradation are unknown. Eight members of a new subfamily of G protein-coupled LPA/S1P receptors, originally termed Edg Rs, bind either LPA or S1P with high affinity and transduce a series of growth-related and/or cytoskeleton-based functional responses. The most critical areas of LPL biology and pathobiology are neural development and neurodegeneration, immunity, atherosclerosis and myocardial injury, and cancer. Data from analyses of T cells established two basic points: (1 the plasticity and adaptability of expression of LPA/S1P Rs by some cells as a function of activation, and (2 the role of opposing signals from two different receptors for the same ligand as a mechanism for fine control of effects of LPLs. In the heart, LPLs may promote coronary atherosclerosis, but are effectively cytoprotective for hypoxic cardiac myocytes and those exposed to oxygen free radicals. The findings of production of LPA by some types of tumor cells, overexpression of selected sets of LPA receptors by the same tumor cells, and augmentation of the effects of protein growth factors by LPA have suggested pathogenetic roles for the LPLs in cancer. The breadth of physiologic and pathologic activities of LPLs emphasizes the importance of developing bioavailable nonlipid agonists and antagonists of the LPA/S1P receptors for diverse therapeutic applications.

  16. Enzymatic hydrolysis of 1-monoacyl-SN-glycerol-3-phosphoryl-choline (1-lysolecithin) by phospholipases from peanut seeds.

    Science.gov (United States)

    Strauss, H; Leibovitz-Ben Gershon, Z; Heller, M

    1976-06-01

    Hydrolysis of 1-lysolecithin (1-acyl glycerophosphorylcholine [1-acyl GPC]) by preparations of phospholipase D from peanut seeds was investigated. 1-Lysolecithin was hydrolyzed at a much slower rate than phosphatidylcholine (lecithin). Although Ca+2 ions are required for the cleavage of lecithin by the enzyme, their effect on the hydrolysis of lysolecithin depended upon the concentration of the substrate: at 0.2 mM 1-lysolecithin, Ca+2 ions increased the reaction rates, whereas at concentrations of the substrate lower than 0.1 mM, Ca+2 ions were inhibitory. A broad pH activity curve between 5 and 8 was obtained with higher rates in the alkaline range, both in the absence and presence of Ca+2 ions. The increased hydrolysis of lysolecithin due to Ca+2 was noticed over the entire pH range. Upon storage of the enzyme solutions at 4 C, decreased rates of hydrolysis of lecithin were observed, with t 1/2 values of ca. 50 and 100 days depending on the purity of the preparation. During the same period, no reduction occurred in the activity of these preparations on lysolecithin as substrate. The effects of Ca+2 ions and the analysis of the products of 1-acyl GPC cleavage by the enzyme preparations revealed the presence of more than one enzyme and the formation of the following compounds: lysophosphatidic acids (1 acyl glycerophosphoric acids), free fatty acids, glycerophosphorylcholine, and choline. The possible pathways leading to the degradation of lysolecithin and the formation of these products include reactions catalyzed by lysophospholipase A1 (lysophosphatidylcholine 1-acyl hydrolase, E.C. 3.1.1.5) and a phosphodiesterase (L-3-glycerylphosphorylcholine glycerophosphohydrolase, E.C.3.1.4.2), in addition to phospholipase D (phosphatidyl-choline phosphatidohydrolase, E.C. 3.1.4.4).

  17. A rhodium(III)-based inhibitor of autotaxin with antiproliferative activity.

    Science.gov (United States)

    Kang, Tian-Shu; Wang, Wanhe; Zhong, Hai-Jing; Liang, Jia-Xin; Ko, Chung-Nga; Lu, Jin-Jian; Chen, Xiu-Ping; Ma, Dik-Lung; Leung, Chung-Hang

    2017-02-01

    Cancer of the skin is by far the most common of all cancers. Melanoma accounts for only about 1% of skin cancers but causes a large majority of skin cancer deaths. Autotaxin (ATX), also known as ectonucleotide pyrophosphatase/phosphodiesterase 2 (ENPP2), regulates physiological and pathological functions of lysophosphatidic acid (LPA), and is thus an important therapeutic target. We synthesized ten metal-based complexes and a novel cyclometalated rhodium(III) complex 1 was identified as an ATX enzymatic inhibitor using multiple methods, including ATX enzymatic assay, thermal shift assay, western immunoblotting and so on. Protein thermal shift assays showed that 1 increased the melting temperature (T m ) of ATX by 3.5°C. 1 also reduced ATX-LPA mediated downstream survival signal pathway proteins such as ERK and AKT, and inhibited the activation of the transcription factor nuclear factor κB (NF-κB) and signal transducer and activator of transcription 3 (STAT3). 1 also exhibited strong anti-proliferative activity against A2058 melanoma cells (IC 50 =0.58μM). Structure-activity relationship indicated that both the rhodium(III) center and the auxiliary ligands of complex 1 are important for bioactivity. 1 represents a promising scaffold for the development of small-molecule ATX inhibitors for anti-tumor applications. To our knowledge, complex 1 is the first metal-based ATX inhibitor reported to date. Rhodium complexes will have the increased attention in therapeutic and bioanalytical applications. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Transforming growth factor β-induced superficial zone protein accumulation in the surface zone of articular cartilage is dependent on the cytoskeleton.

    Science.gov (United States)

    McNary, Sean M; Athanasiou, Kyriacos A; Reddi, A Hari

    2014-03-01

    ), and Y27632 (Rho effector Rho Kinase). On the other hand, lysophosphatidic acid, an upstream activator of Rho, increased SZP synthesis in response to TGFβ1. These results suggest that SZP production is dependent on the functional cytoskeleton, and Rho GTPases contribute to SZP accumulation by modulating the actions of TGFβ.

  19. The p110β isoform of phosphoinositide 3-kinase signals downstream of G protein-coupled receptors and is functionally redundant with p110γ

    Science.gov (United States)

    Guillermet-Guibert, Julie; Bjorklof, Katja; Salpekar, Ashreena; Gonella, Cristiano; Ramadani, Faruk; Bilancio, Antonio; Meek, Stephen; Smith, Andrew J. H.; Okkenhaug, Klaus; Vanhaesebroeck, Bart

    2008-01-01

    The p110 isoforms of phosphoinositide 3-kinase (PI3K) are acutely regulated by extracellular stimuli. The class IA PI3K catalytic subunits (p110α, p110β, and p110δ) occur in complex with a Src homology 2 (SH2) domain-containing p85 regulatory subunit, which has been shown to link p110α and p110δ to Tyr kinase signaling pathways. The p84/p101 regulatory subunits of the p110γ class IB PI3K lack SH2 domains and instead couple p110γ to G protein-coupled receptors (GPCRs). Here, we show, using small-molecule inhibitors with selectivity for p110β and cells derived from a p110β-deficient mouse line, that p110β is not a major effector of Tyr kinase signaling but couples to GPCRs. In macrophages, both p110β and p110γ contributed to Akt activation induced by the GPCR agonist complement 5a, but not by the Tyr kinase ligand colony-stimulating factor-1. In fibroblasts, which express p110β but not p110γ, p110β mediated Akt activation by the GPCR ligands stromal cell-derived factor, sphingosine-1-phosphate, and lysophosphatidic acid but not by the Tyr kinase ligands PDGF, insulin, and insulin-like growth factor 1. Introduction of p110γ in these cells reduced the contribution of p110β to GPCR signaling. Taken together, these data show that p110β and p110γ can couple redundantly to the same GPCR agonists. p110β, which shows a much broader tissue distribution than the leukocyte-restricted p110γ, could thus provide a conduit for GPCR-linked PI3K signaling in the many cell types where p110γ expression is low or absent. PMID:18544649

  20. Non-transactivational, dual pathways for LPA-induced Erk1/2 activation in primary cultures of brown pre-adipocytes

    International Nuclear Information System (INIS)

    Holmstroem, Therese E.; Mattsson, Charlotte L.; Wang, Yanling; Iakovleva, Irina; Petrovic, Natasa; Nedergaard, Jan

    2010-01-01

    In many cell types, G-protein-coupled receptor (GPCR)-induced Erk1/2 MAP kinase activation is mediated via receptor tyrosine kinase (RTK) transactivation, in particular via the epidermal growth factor (EGF) receptor. Lysophosphatidic acid (LPA), acting via GPCRs, is a mitogen and MAP kinase activator in many systems, and LPA can regulate adipocyte proliferation. The mechanism by which LPA activates the Erk1/2 MAP kinase is generally accepted to be via EGF receptor transactivation. In primary cultures of brown pre-adipocytes, EGF can induce Erk1/2 activation, which is obligatory and determinant for EGF-induced proliferation of these cells. Therefore, we have here examined whether LPA, via EGF transactivation, can activate Erk1/2 in brown pre-adipocytes. We found that LPA could induce Erk1/2 activation. However, the LPA-induced Erk1/2 activation was independent of transactivation of EGF receptors (or PDGF receptors) in these cells (whereas in transformed HIB-1B brown adipocytes, the LPA-induced Erk1/2 activation indeed proceeded via EGF receptor transactivation). In the brown pre-adipocytes, LPA instead induced Erk1/2 activation via two distinct non-transactivational pathways, one G i -protein dependent, involving PKC and Src activation, the other, a PTX-insensitive pathway, involving PI3K (but not Akt) activation. Earlier studies showing LPA-induced Erk1/2 activation being fully dependent on RTK transactivation have all been performed in cell lines and transfected cells. The present study implies that in non-transformed systems, RTK transactivation may not be involved in the mediation of GPCR-induced Erk1/2 MAP kinase activation.

  1. Kaempferol suppresses lipid accumulation by inhibiting early adipogenesis in 3T3-L1 cells and zebrafish.

    Science.gov (United States)

    Lee, Yeon-Joo; Choi, Hyeon-Son; Seo, Min-Jung; Jeon, Hui-Jeon; Kim, Kui-Jin; Lee, Boo-Yong

    2015-08-01

    Kaempferol is a flavonoid present in Kaempferia galanga and Opuntia ficus indica var. saboten. Recent studies have suggested that it has anti-oxidant, anti-inflammatory, anti-cancer, and anti-obesity effects. In this study, we focused on the anti-adipogenic effects of kaempferol during adipocyte differentiation. The results showed that kaempferol inhibits lipid accumulation in adipocytes and zebrafish. Oil Red O and Nile Red staining showed that the number of intracellular lipid droplets decreased in adipocytes and zebrafish treated with kaempferol. LPAATθ (lysophosphatidic acid acyltransferase), lipin1, and DGAT1 (triglyceride synthetic enzymes) and FASN and SREBP-1C (fatty acid synthetic proteins) showed decreased expression levels in the presence of kaempferol. In addition, treatment of kaempferol showed an inhibitory activity on cell cycle progression. Kaempferol delayed cell cycle progression from the S to G2/M phase through the regulation of cyclins in a dose-dependent manner. Kaempferol blocked the phosphorylation of AKT (protein kinase B) and mammalian target of rapamycin (mTOR) signaling pathway during the early stages of adipogenesis. In addition, kaempferol down-regulated pro-early adipogenic factors such as CCAAT-enhancer binding proteins β (C/EBPβ), and Krüppel-like factors (KLFs) 4 and 5, while anti-early adipogenic factors, such as KLF2 and pref-1(preadipocyte factor-1), were upregulated. These kaempferol-mediated regulations of early adipogenic factors resulted in the attenuation of late adipogenic factors such as C/EBPα and peroxisome proliferator-activated receptor γ (PPARγ). These results were supported in zebrafish based on the decrease in lipid accumulation and expression of adipogenic factors. Our results indicated that kaempferol might have an anti-obesity effect by regulating lipid metabolism.

  2. Metabolic, Reproductive, and Neurologic Abnormalities in Agpat1-Null Mice.

    Science.gov (United States)

    Agarwal, Anil K; Tunison, Katie; Dalal, Jasbir S; Nagamma, Sneha S; Hamra, F Kent; Sankella, Shireesha; Shao, Xinli; Auchus, Richard J; Garg, Abhimanyu

    2017-11-01

    Defects in the biosynthesis of phospholipids and neutral lipids are associated with cell membrane dysfunction, disrupted energy metabolism, and diseases including lipodystrophy. In these pathways, the 1-acylglycerol-3-phosphate O-acyltransferase (AGPAT) enzymes transfer a fatty acid to the sn-2 carbon of sn-1-acylglycerol-3-phosphate (lysophosphatidic acid) to form sn-1, 2-acylglycerol-3-phosphate [phosphatidic acid (PA)]. PA is a precursor for key phospholipids and diacylglycerol. AGPAT1 and AGPAT2 are highly homologous isoenzymes that are both expressed in adipocytes. Genetic defects in AGPAT2 cause congenital generalized lipodystrophy, indicating that AGPAT1 cannot compensate for loss of AGPAT2 in adipocytes. To further explore the physiology of AGPAT1, we characterized a loss-of-function mouse model (Agpat1-/-). The majority of Agpat1-/- mice died before weaning and had low body weight and low plasma glucose levels, independent of plasma insulin and glucagon levels, with reduced percentage of body fat but not generalized lipodystrophy. These mice also had decreased hepatic messenger RNA expression of Igf-1 and Foxo1, suggesting a decrease in gluconeogenesis. In male mice, sperm development was impaired, with a late meiotic arrest near the onset of round spermatid production, and gonadotropins were elevated. Female mice showed oligoanovulation yet retained responsiveness to gonadotropins. Agpat1-/- mice also demonstrated abnormal hippocampal neuron development and developed audiogenic seizures. In summary, Agpat1-/- mice developed widespread disturbances of metabolism, sperm development, and neurologic function resulting from disrupted phospholipid homeostasis. AGPAT1 appears to serve important functions in the physiology of multiple organ systems. The Agpat1-deficient mouse provides an important model in which to study the contribution of phospholipid and triacylglycerol synthesis to physiology and diseases. Copyright © 2017 Endocrine Society.

  3. Sphingosine 1-phosphate stimulates hydrogen peroxide generation through activation of phospholipase C-Ca2+ system in FRTL-5 thyroid cells: possible involvement of guanosine triphosphate-binding proteins in the lipid signaling.

    Science.gov (United States)

    Okajima, F; Tomura, H; Sho, K; Kimura, T; Sato, K; Im, D S; Akbar, M; Kondo, Y

    1997-01-01

    Exogenous sphingosine 1-phosphate (S1P) stimulated hydrogen peroxide (H2O2) generation in association with an increase in intracellular Ca2+ concentration in FRTL-5 thyroid cells. S1P also induced inositol phosphate production, reflecting activation of phospholipase C (PLC) in the cells. These three S1P-induced events were inhibited partially by pertussis toxin (PTX) and markedly by U73122, a PLC inhibitor, and were conversely potentiated by N6-(L-2-phenylisopropyl)adenosine, an A1-adenosine receptor agonist. In FRTL-5 cell membranes, S1P also activated PLC in the presence of guanosine 5'-O-(3-thiotriphosphate) (GTP gamma S), but not in its absence. Guanosine 5'-O-(2-thiodiphosphate) inhibited the S1P-induced GTP gamma S-dependent activation of the enzyme. To characterize the signaling pathways, especially receptors and G proteins involved in the S1P-induced responses, cross-desensitization experiments were performed. Under the conditions where homologous desensitization occurred in S1P-, lysophosphatidic acid (LPA)-, and bradykinin-induced induction of Ca2+ mobilization, no detectable cross-desensitization of S1P and bradykinin was observed. This suggests that the primary action of S1P in its activation of the PLC-Ca2+ system was not the activation of G proteins common to S1P and bradykinin, but the activation of a putative S1P receptor. On the other hand, there was a significant cross-desensitization of S1P and LPA; however, a still significant response to S1P (50-80% of the response in the nontreated control cells) was observed depending on the lipid dose employed after a prior LPA challenge. S1P also inhibited cAMP accumulation in a PTX-sensitive manner. We conclude that S1P stimulates H2O2 generation through a PLC-Ca2+ system and also inhibits adenylyl cyclase in FRTL-5 thyroid cells. The S1P-induced responses may be mediated partly through a putative lipid receptor that is coupled to both PTX-sensitive and insensitive G proteins.

  4. Inducible Inhibition of Gβγ Reveals Localization-dependent Functions at the Plasma Membrane and Golgi.

    Science.gov (United States)

    Klayman, Lauren M; Wedegaertner, Philip B

    2017-02-03

    Heterotrimeric G proteins signal at a variety of endomembrane locations, in addition to their canonical function at the cytoplasmic surface of the plasma membrane (PM), where they are activated by cell surface G protein-coupled receptors. Here we focus on βγ signaling at the Golgi, where βγ activates a signaling cascade, ultimately resulting in vesicle fission from the trans-Golgi network (TGN). To develop a novel molecular tool for inhibiting endogenous βγ in a spatial-temporal manner, we take advantage of a lipid association mutant of the widely used βγ inhibitor GRK2ct (GRK2ct-KERE) and the FRB/FKBP heterodimerization system. We show that GRK2ct-KERE cannot inhibit βγ function when expressed in cells, but recruitment to a specific membrane location recovers the ability of GRK2ct-KERE to inhibit βγ signaling. PM-recruited GRK2ct-KERE inhibits lysophosphatidic acid-induced phosphorylation of Akt, whereas Golgi-recruited GRK2ct-KERE inhibits cargo transport from the TGN to the PM. Moreover, we show that Golgi-recruited GRK2ct-KERE inhibits model basolaterally targeted but not apically targeted cargo delivery, for both PM-destined and secretory cargo, providing the first evidence of selectivity in terms of cargo transport regulated by βγ. Last, we show that Golgi fragmentation induced by ilimaquinone and nocodazole is blocked by βγ inhibition, demonstrating that βγ is a key regulator of multiple pathways that impact Golgi morphology. Thus, we have developed a new molecular tool, recruitable GRK2ct-KERE, to modulate βγ signaling at specific subcellular locations, and we demonstrate novel cargo selectivity for βγ regulation of TGN to PM transport and a novel role for βγ in mediating Golgi fragmentation. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. A functional and transcriptomic analysis of NET1 bioactivity in gastric cancer

    LENUS (Irish Health Repository)

    Bennett, Gayle

    2011-02-01

    Abstract Background NET1, a RhoA guanine exchange factor, is up-regulated in gastric cancer (GC) tissue and drives the invasive phenotype of this disease. In this study, we aimed to determine the role of NET1 in GC by monitoring the proliferation, motility and invasion of GC cells in which NET1 has been stably knocked down. Additionally, we aimed to determine NET1-dependent transcriptomic events that occur in GC. Methods An in vitro model of stable knockdown of NET1 was achieved in AGS human gastric adenocarcinoma cells via lentiviral mediated transduction of short-hairpin (sh) RNA targeting NET1. Knockdown was assessed using quantitative PCR. Cell proliferation was assessed using an MTS assay and cell migration was assessed using a wound healing scratch assay. Cell invasion was assessed using a transwell matrigel invasion assay. Gene expression profiles were examined using affymetrix oligonucleotide U133A expression arrays. A student\\'s t test was used to determine changes of statistical significance. Results GC cells were transduced with NET1 shRNA resulting in a 97% reduction in NET1 mRNA (p < 0.0001). NET1 knockdown significantly reduced the invasion and migration of GC cells by 94% (p < 0.05) and 24% (p < 0.001) respectively, while cell proliferation was not significantly altered following NET1 knockdown. Microarray analysis was performed on non-target and knockdown cell lines, treated with and without 10 μM lysophosphatidic acid (LPA) allowing us to identify NET1-dependent, LPA-dependent and NET1-mediated LPA-induced gene transcription. Differential gene expression was confirmed by quantitative PCR. Shortlisted NET1-dependent genes included STAT1, TSPAN1, TGFBi and CCL5 all of which were downregulatd upon NET1 downregulation. Shortlisted LPA-dependent genes included EGFR and PPARD where EGFR was upregulated and PPARD was downregulated upon LPA stimulation. Shortlisted NET1 and LPA dependent genes included IGFR1 and PIP5K3. These LPA induced genes were

  6. Involvement of PlsX and the acyl-phosphate dependent sn-glycerol-3-phosphate acyltransferase PlsY in the initial stage of glycerolipid synthesis in Bacillus subtilis.

    Science.gov (United States)

    Hara, Yoshinori; Seki, Masahide; Matsuoka, Satoshi; Hara, Hiroshi; Yamashita, Atsushi; Matsumoto, Kouji

    2008-12-01

    The gene responsible for the first acylation of sn-glycerol-3-phosphate (G3P) in Bacillus subtilis has not yet been determined with certainty. The product of this first acylation, lysophosphatidic acid (LPA), is subsequently acylated again to form phosphatidic acid (PA), the primary precursor to membrane glycerolipids. A novel G3P acyltransferase (GPAT), the gene product of plsY, which uses acyl-phosphate formed by the plsX gene product, has recently been found to synthesize LPA in Streptococcus pneumoniae. We found that in B. subtilis growth arrests after repression of either a plsY homologue or a plsX homologue were overcome by expression of E. coli plsB, which encodes an acyl-acylcarrier protein (acyl-ACP)-dependent GPAT, although in the case of plsX repression a high level of plsB expression was required. B. subtilis has, therefore, a capability to use the acyl-ACP dependent GPAT of PlsB. Simultaneous expression of plsY and plsX suppressed the glycerol requirement of a strict glycerol auxotrophic derivative of the E. coli plsB26 mutant, although either one alone did not. Membrane fractions from B. subtilis cells catalyzed palmitoylphosphate-dependent acylation of [14C]-labeled G3P to synthesize [14C]-labeled LPA, whereas those from DeltaplsY cells did not. The results indicate unequivocally that PlsY is an acyl-phosphate dependent GPAT. Expression of plsX corrected the glycerol auxotrophy of a DeltaygiH (the deleted allele of an E. coli homologue of plsY) derivative of BB26-36 (plsB26 plsX50), suggesting an essential role of plsX other than substrate supply for acyl-phosphate dependent LPA synthesis. Two-hybrid examinations suggested that PlsY is associated with PlsX and that each may exist in multimeric form.

  7. Evaluation of 11C-Acetate and 18 F-FDG PET/CT in mouse multidrug resistance gene-2 deficient mouse model of hepatocellular carcinoma

    International Nuclear Information System (INIS)

    Territo, Paul R.; Maluccio, Mary; Riley, Amanda A.; McCarthy, Brian P.; Fletcher, James; Tann, Mark; Saxena, Romil; Skill, Nicholas J.

    2015-01-01

    Hepatocellular carcinoma (HCC) remains a global health problem with unique diagnostic and therapeutic challenges, including difficulties in identifying the highest risk patients. Previous work from our lab has established the murine multidrug resistance-2 mouse (MDR2) model of HCC as a reasonable preclinical model that parallels the changes seen in human inflammatory associated HCC. The purpose of this study is to evaluate modalities of PET/CT in MDR2 −/− mice in order to facilitate therapeutic translational studies from bench to bedside. 18 F-FDG and 11 C-acetate PET/CT was performed on 12 m MDR2 −/− mice (n = 3/tracer) with HCC and 12 m MDR2 −/+ control mice (n = 3/tracer) without HCC. To compare PET/CT to biological markers of HCC and cellular function, serum alpha-fetoprotein (AFP), lysophosphatidic acid (LPA), cAMP and hepatic tumor necrosis factor α (TNFα) were quantified in 3-12 m MDR2 −/− (n = 10) mice using commercially available ELISA analysis. To translate results in mice to patients 11 C-acetate PET/CT was also performed in 8 patents suspected of HCC recurrence following treatment and currently on the liver transplant wait list. Hepatic 18 F-FDG metabolism was not significantly increased in MDR2 −/− mice. In contrast, hepatic 11 C-acetate metabolism was significantly elevated in MDR2 −/− mice when compared to MDR2 −/+ controls. Serum AFP and LPA levels increased in MDR2 −/− mice contemporaneous with the emergence of HCC. This was accompanied by a significant decrease in serum cAMP levels and an increase in hepatic TNFα. In patients suspected of HCC recurrence there were 5 true positives, 2 true negatives and 1 suspected false 11 C-acetate negative. Hepatic 11 C-acetate PET/CT tracks well with HCC in MDR2 −/− mice and patients with underlying liver disease. Consequently 11 C-acetate PET/CT is well suited to study 1) HCC emergence/progression in patients and 2) reduce animal numbers required to study new

  8. A knockout mutation of a constitutive GPCR in Tetrahymena decreases both G-protein activity and chemoattraction.

    Directory of Open Access Journals (Sweden)

    Thomas J Lampert

    Full Text Available Although G-protein coupled receptors (GPCRs are a common element in many chemosensory transduction pathways in eukaryotic cells, no GPCR or regulated G-protein activity has yet been shown in any ciliate. To study the possible role for a GPCR in the chemoresponses of the ciliate Tetrahymena, we have generated a number of macronuclear gene knockouts of putative GPCRs found in the Tetrahymena Genome database. One of these knockout mutants, called G6, is a complete knockout of a gene that we call GPCR6 (TTHERM_00925490. Based on sequence comparisons, the Gpcr6p protein belongs to the Rhodopsin Family of GPCRs. Notably, Gpcr6p shares highest amino acid sequence homologies to GPCRs from Paramecium and several plants. One of the phenotypes of the G6 mutant is a decreased responsiveness to the depolarizing ions Ba²⁺ and K⁺, suggesting a decrease in basal excitability (decrease in Ca²⁺ channel activity. The other major phenotype of G6 is a loss of chemoattraction to lysophosphatidic acid (LPA and proteose peptone (PP, two known chemoattractants in Tetrahymena. Using microsomal [³⁵S]GTPγS binding assays, we found that wild-type (CU427 have a prominent basal G-protein activity. This activity is decreased to the same level by pertussis toxin (a G-protein inhibitor, addition of chemoattractants, or the G6 mutant. Since the basal G-protein activity is decreased by the GPCR6 knockout, it is likely that this gene codes for a constitutively active GPCR in Tetrahymena. We propose that chemoattractants like LPA and PP cause attraction in Tetrahymena by decreasing the basal G-protein stimulating activity of Gpcr6p. This leads to decreased excitability in wild-type and longer runs of smooth forward swimming (less interrupted by direction changes towards the attractant. Therefore, these attractants may work as inverse agonists through the constitutively active Gpcr6p coupled to a pertussis-sensitive G-protein.

  9. Role of LPAR3, PKC and EGFR in LPA-induced cell migration in oral squamous carcinoma cells

    International Nuclear Information System (INIS)

    Brusevold, Ingvild J; Tveteraas, Ingun H; Aasrum, Monica; Ødegård, John; Sandnes, Dagny L; Christoffersen, Thoralf

    2014-01-01

    Oral squamous cell carcinoma is an aggressive neoplasm with serious morbidity and mortality, which typically spreads through local invasive growth. Lysophosphatidic acid (LPA) is involved in a number of biological processes, and may have a role in cancer cell migration and invasiveness. LPA is present in most tissues and can activate cells through six different LPA receptors (LPAR1-6). Although LPA is predominantly promigratory, some of the receptors may have antimigratory effects in certain cells. The signalling mechanisms of LPA are not fully understood, and in oral carcinoma cells the specific receptors and pathways involved in LPA-stimulated migration are unknown. The oral carcinoma cell lines E10, SCC-9, and D2 were investigated. Cell migration was studied in a scratch wound assay, and invasion was demonstrated in organotypic three dimensional co-cultures. Protein and mRNA expression of LPA receptors was studied with Western blotting and qRT-PCR. Activation of signalling proteins was examined with Western blotting and isoelectric focusing, and signalling mechanisms were further explored using pharmacological agents and siRNA directed at specific receptors and pathways. LPA stimulated cell migration in the two oral carcinoma cell lines E10 and SCC-9, but was slightly inhibitory in D2. The receptor expression profile and the effects of specific pharmacological antagonist and agonists indicated that LPA-stimulated cell migration was mediated through LPAR3 in E10 and SCC-9. Furthermore, in both these cell lines, the stimulation by LPA was dependent on PKC activity. However, while LPA induced transactivation of EGFR and the stimulated migration was blocked by EGFR inhibitors in E10 cells, LPA did not induce EGFR transactivation in SCC-9 cells. In D2 cells, LPA induced EGFR transactivation, but this was associated with slowing of a very high inherent migration rate in these cells. The results demonstrate LPA-stimulated migration in oral carcinoma cells through LPAR3

  10. Rac1-stimulated macropinocytosis enhances Gβγ activation of PI3Kβ.

    Science.gov (United States)

    Erami, Zahra; Khalil, Bassem D; Salloum, Gilbert; Yao, Yanhua; LoPiccolo, Jaclyn; Shymanets, Aliaksei; Nürnberg, Bernd; Bresnick, Anne R; Backer, Jonathan M

    2017-11-16

    Phosphoinositide 3-kinases (PI 3-kinases) are regulated by a diverse range of upstream activators, including receptor tyrosine kinases (RTKs), G-protein-coupled receptors (GPCRs), and small GTPases from the Ras, Rho and Rab families. For the Class IA PI 3-kinase PI3Kβ, two mechanisms for GPCR-mediated regulation have been described: direct binding of Gβγ subunits to the C2-helical domain linker of p110β, and Dock180/Elmo1-mediated activation of Rac1, which binds to the Ras-Binding Domain of p110β. We now show that the integration of these dual pathways is unexpectedly complex. In breast cancer cells, expression of constitutively activated Rac1 (CA-Rac1) along with either GPCR stimulation or expression of Gβγ led to an additive PI3Kβ-dependent activation of Akt. Whereas CA-Rac1-mediated activation of Akt was blocked in cells expressing a mutated PI3Kβ that cannot bind Gβγ, Gβγ and GPCR-mediated activation of Akt was preserved when Rac1 binding to PI3Kβ was blocked. Surprisingly, PI3Kβ-dependent CA-Rac1 signaling to Akt was still seen in cells expressing a mutant p110β that cannot bind Rac1. Instead of directly binding to PI3Kβ, CA-Rac1 acts by enhancing Gβγ coupling to PI3Kβ, as CA-Rac1-mediated Akt activation was blocked by inhibitors of Gβγ. Cells expressing CA-Rac1 exhibited a robust induction of macropinocytosis, and inhibitors of macropinocytosis blocked the activation of Akt by CA-Rac1 or lysophosphatidic acid. Our data suggest that Rac1 can potentiate the activation of PI3Kβ by GPCRs through an indirect mechanism, by driving the formation of macropinosomes that serve as signaling platforms for Gβγ coupling to PI3Kβ. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  11. Protein Kinase Cα and P-Type Ca2+ Channel CaV2.1 in Red Blood Cell Calcium Signalling

    Directory of Open Access Journals (Sweden)

    Lisa Wagner-Britz

    2013-06-01

    Full Text Available Background/Aims: Protein kinase Cα (PKCα is activated by an increase in cytosolic Ca2+ in red blood cells (RBCs. Previous work has suggested that PKCα directly stimulates the CaV2.1 channel, whereas other studies revealed that CaV2.1 is insensitive to activation by PKC. The aim of this study was to resolve this discrepancy. Methods: We performed experiments based on a single cell read-out of the intracellular Ca2+ concentration in terms of Fluo-4 fluorescence intensity and phosphatidylserine exposure to the external membrane leaflet. Measurement modalities included flow cytometry and live cell imaging. Results: Treatment of RBCs with phorbol 12-myristate 13-acetate (PMA led to two distinct populations of cells with an increase in intracellular Ca2+: a weak-responding and a strong-responding population. The EC50 of PMA for the number of cells with Ca2+ elevation was 2.7±1.2 µM; for phosphatidylserine exposure to the external membrane surface, it was 2.8±0.5 µM; and for RBC haemolysis, it was 2.9±0.5 µM. Using pharmacological manipulation with the CaV2.1 inhibitor ω-agatoxin TK and the broad protein kinase C inhibitor Gö6983, we are able to show that there are two independent PMA-activated Ca2+ entry processes: the first is independent of CaV2.1 and directly PKCα-activated, while the second is associated with a likely indirect activation of CaV2.1. Further studies using lysophosphatidic acid (LPA as a stimulation agent have provided additional evidence that PKCα and CaV2.1 are not directly interconnected in a signalling chain. Conclusion: Although we provide evidence for a lack of interaction between PKCα and CaV2.1 in RBCs, further studies are required to decipher the signalling relationship between LPA, PKCα and CaV2.1.

  12. Regulation of neurite morphogenesis by interaction between R7 regulator of G protein signaling complexes and G protein subunit Gα13.

    Science.gov (United States)

    Scherer, Stephanie L; Cain, Matthew D; Kanai, Stanley M; Kaltenbronn, Kevin M; Blumer, Kendall J

    2017-06-16

    The R7 regulator of G protein signaling family (R7-RGS) critically regulates nervous system development and function. Mice lacking all R7-RGS subtypes exhibit diverse neurological phenotypes, and humans bearing mutations in the retinal R7-RGS isoform RGS9-1 have vision deficits. Although each R7-RGS subtype forms heterotrimeric complexes with Gβ 5 and R7-RGS-binding protein (R7BP) that regulate G protein-coupled receptor signaling by accelerating deactivation of G i/o α-subunits, several neurological phenotypes of R7-RGS knock-out mice are not readily explained by dysregulated G i/o signaling. Accordingly, we used tandem affinity purification and LC-MS/MS to search for novel proteins that interact with R7-RGS heterotrimers in the mouse brain. Among several proteins detected, we focused on Gα 13 because it had not been linked to R7-RGS complexes before. Split-luciferase complementation assays indicated that Gα 13 in its active or inactive state interacts with R7-RGS heterotrimers containing any R7-RGS isoform. LARG (leukemia-associated Rho guanine nucleotide exchange factor (GEF)), PDZ-RhoGEF, and p115RhoGEF augmented interaction between activated Gα 13 and R7-RGS heterotrimers, indicating that these effector RhoGEFs can engage Gα 13 ·R7-RGS complexes. Because Gα 13 /R7-RGS interaction required R7BP, we analyzed phenotypes of neuronal cell lines expressing RGS7 and Gβ 5 with or without R7BP. We found that neurite retraction evoked by Gα 12/13 -dependent lysophosphatidic acid receptors was augmented in R7BP-expressing cells. R7BP expression blunted neurite formation evoked by serum starvation by signaling mechanisms involving Gα 12/13 but not Gα i/o These findings provide the first evidence that R7-RGS heterotrimers interact with Gα 13 to augment signaling pathways that regulate neurite morphogenesis. This mechanism expands the diversity of functions whereby R7-RGS complexes regulate critical aspects of nervous system development and function. © 2017 by

  13. mTOR signaling promotes foam cell formation and inhibits foam cell egress through suppressing the SIRT1 signaling pathway.

    Science.gov (United States)

    Zheng, Haixiang; Fu, Yucai; Huang, Yusheng; Zheng, Xinde; Yu, Wei; Wang, Wei

    2017-09-01

    Atherosclerosis (AS) is a chronic immuno‑inflammatory disease accompanied by dyslipidemia. The authors previously demonstrated that sirtuin 1 (SIRT1) may prevent atherogenesis through influencing the liver X receptor/C‑C chemokine receptor type 7/nuclear factor‑κB (LXR‑CCR7/NF‑κB) signaling pathway. Previous studies have suggested a role for mammalian target of rapamycin (mTOR) signaling in the pathogenesis of cardiovascular diseases. The present study investigated the potential association between mTOR signaling and SIRT1‑LXR‑CCR7/NF‑κB signaling (SIRT1 signaling) in AS pathogenesis. To induce foam cell formation, U937 cells were differentiated into macrophages by exposure to phorbol 12‑myristate 13‑acetate (PMA) for 24 h, followed by treatment with palmitate and oxidized low density lipoprotein for a further 24 h. Oil red O staining revealed a large accumulation of lipid droplets present in foam cells. Western blot analysis demonstrated increased protein levels of phosphorylated (p)‑mTOR and its downstream factor p‑ribosomal protein S6 kinase (p70S6K). Reverse transcription‑quantitative polymerase chain reaction and western blot analyses additionally revealed decreased expression of SIRT1, LXRα and CCR7 and increased expression of NF‑κB and its downstream factor tumor necrosis factor‑α (TNF‑α) in an atherogenetic condition induced by lysophosphatidic acid (LPA). In addition, abundant lipid droplets accumulated in U937‑LPA‑treated foam cells. Rapamycin, an mTOR inhibitor, suppressed the expression and activity of mTOR and p70S6K, however enhanced expression of SIRT1, LXRα, and CCR7. Conversely, rapamycin deceased TNF‑α and NF‑κB activity, the latter of which was further confirmed by immunofluorescence analysis demonstrating increased levels of NF‑κB present in the cytoplasm compared with the nucleus. The findings of the present study suggest that mTOR signaling promotes foam cell formation and inhibits foam

  14. A functional and transcriptomic analysis of NET1 bioactivity in gastric cancer

    International Nuclear Information System (INIS)

    Bennett, Gayle; Sadlier, Denise; Doran, Peter P; MacMathuna, Padraic; Murray, David W

    2011-01-01

    NET1, a RhoA guanine exchange factor, is up-regulated in gastric cancer (GC) tissue and drives the invasive phenotype of this disease. In this study, we aimed to determine the role of NET1 in GC by monitoring the proliferation, motility and invasion of GC cells in which NET1 has been stably knocked down. Additionally, we aimed to determine NET1-dependent transcriptomic events that occur in GC. An in vitro model of stable knockdown of NET1 was achieved in AGS human gastric adenocarcinoma cells via lentiviral mediated transduction of short-hairpin (sh) RNA targeting NET1. Knockdown was assessed using quantitative PCR. Cell proliferation was assessed using an MTS assay and cell migration was assessed using a wound healing scratch assay. Cell invasion was assessed using a transwell matrigel invasion assay. Gene expression profiles were examined using affymetrix oligonucleotide U133A expression arrays. A student's t test was used to determine changes of statistical significance. GC cells were transduced with NET1 shRNA resulting in a 97% reduction in NET1 mRNA (p < 0.0001). NET1 knockdown significantly reduced the invasion and migration of GC cells by 94% (p < 0.05) and 24% (p < 0.001) respectively, while cell proliferation was not significantly altered following NET1 knockdown. Microarray analysis was performed on non-target and knockdown cell lines, treated with and without 10 μM lysophosphatidic acid (LPA) allowing us to identify NET1-dependent, LPA-dependent and NET1-mediated LPA-induced gene transcription. Differential gene expression was confirmed by quantitative PCR. Shortlisted NET1-dependent genes included STAT1, TSPAN1, TGFBi and CCL5 all of which were downregulatd upon NET1 downregulation. Shortlisted LPA-dependent genes included EGFR and PPARD where EGFR was upregulated and PPARD was downregulated upon LPA stimulation. Shortlisted NET1 and LPA dependent genes included IGFR1 and PIP5K3. These LPA induced genes were downregulated in NET1 knockdown cells

  15. Characterization of Microvesicles Released from Human Red Blood Cells

    Directory of Open Access Journals (Sweden)

    Duc Bach Nguyen

    2016-03-01

    Full Text Available Background/Aims: Extracellular vesicles (EVs are spherical fragments of cell membrane released from various cell types under physiological as well as pathological conditions. Based on their size and origin, EVs are classified as exosome, microvesicles (MVs and apoptotic bodies. Recently, the release of MVs from human red blood cells (RBCs under different conditions has been reported. MVs are released by outward budding and fission of the plasma membrane. However, the outward budding process itself, the release of MVs and the physical properties of these MVs have not been well investigated. The aim of this study is to investigate the formation process, isolation and characterization of MVs released from RBCs under conditions of stimulating Ca2+ uptake and activation of protein kinase C. Methods: Experiments were performed based on single cell fluorescence imaging, fluorescence activated cell sorter/flow cytometer (FACS, scanning electron microscopy (SEM, atomic force microscopy (AFM and dynamic light scattering (DLS. The released MVs were collected by differential centrifugation and characterized in both their size and zeta potential. Results: Treatment of RBCs with 4-bromo-A23187 (positive control, lysophosphatidic acid (LPA, or phorbol-12 myristate-13 acetate (PMA in the presence of 2 mM extracellular Ca2+ led to an alteration of cell volume and cell morphology. In stimulated RBCs, exposure of phosphatidylserine (PS and formation of MVs were observed by using annexin V-FITC. The shedding of MVs was also observed in the case of PMA treatment in the absence of Ca2+, especially under the transmitted bright field illumination. By using SEM, AFM and DLS the morphology and size of stimulated RBCs, MVs were characterized. The sizes of the two populations of MVs were 205.8 ± 51.4 nm and 125.6 ± 31.4 nm, respectively. Adhesion of stimulated RBCs and MVs was observed. The zeta potential of MVs was determined in the range from - 40 mV to - 10 m

  16. The prevention of benign prostatic hyperplasia (bph).

    Science.gov (United States)

    Roper, W G

    2017-03-01

    Barry Marshall and Robin Warren were the first to show that the chronic diseases (gastric ulcer and chronic gastritis) were caused by an infection (Helicobacter pylori). The chronic disease benign prostatic hyperplasia belongs to the same ilk, except that the infection process is much more subtle and complex. The enzyme Phospholipase D (PLD) which is attached to the outer membrane of Escherichia coli (E. coli) has now been almost completely proven to be the basic cause of BPH. The evidence for this process is now extremely strong and compelling. PLD obtained from the organism Streptomyces chromofuscus has been used in past research because of its PLD content. It is commercially available. In vitro, on a culture of prostatic smooth muscle, PLD stimulated the production of lysophosphatidic acid (LPA) which acted on and caused substantial growth of that muscle in accordance with the quantity of PLD/ LPA generated. It has been asserted that repeated colonization by E. coli of the transitional zone of the prostate gland and the release of PLD following repeated destruction of these colonized bacteria, is the basic cause of BPH. The evidence for colonizing and re-colonizing infection is now overwhelming. PLD is a simple lipid consisting of a phosphate, glycerol and a fatty acid. After absorption into the prostatic stroma (which consists of connective tissue and of smooth muscle), it stimulates the production of LPA which, in turn, apart from directly stimulating prostatic smooth muscle, also acts on the connective tissue in the prostate and induces a complex mixture of growth regulatory proteins, which include members of the fibroblast, insulin-like and growth transforming factor families and implicates autocrine hormones acting on the stroma and paracrine hormones acting on epithelium. Also involved, are a variety of interleukins and other inflammatory cell cytokines, secreted by the stroma, which may further promote autocrine/paracrine proliferation of BPH cells

  17. Tumor cell invasion of collagen matrices requires coordinate lipid agonist-induced G-protein and membrane-type matrix metalloproteinase-1-dependent signaling

    Directory of Open Access Journals (Sweden)

    Anthis Nicholas J

    2006-12-01

    Full Text Available Abstract Background Lysophosphatidic acid (LPA and sphingosine 1-phosphate (S1P are bioactive lipid signaling molecules implicated in tumor dissemination. Membrane-type matrix metalloproteinase 1 (MT1-MMP is a membrane-tethered collagenase thought to be involved in tumor invasion via extracellular matrix degradation. In this study, we investigated the molecular requirements for LPA- and S1P-regulated tumor cell migration in two dimensions (2D and invasion of three-dimensional (3D collagen matrices and, in particular, evaluated the role of MT1-MMP in this process. Results LPA stimulated while S1P inhibited migration of most tumor lines in Boyden chamber assays. Conversely, HT1080 fibrosarcoma cells migrated in response to both lipids. HT1080 cells also markedly invaded 3D collagen matrices (~700 μm over 48 hours in response to either lipid. siRNA targeting of LPA1 and Rac1, or S1P1, Rac1, and Cdc42 specifically inhibited LPA- or S1P-induced HT1080 invasion, respectively. Analysis of LPA-induced HT1080 motility on 2D substrates vs. 3D matrices revealed that synthetic MMP inhibitors markedly reduced the distance (~125 μm vs. ~45 μm and velocity of invasion (~0.09 μm/min vs. ~0.03 μm/min only when cells navigated 3D matrices signifying a role for MMPs exclusively in invasion. Additionally, tissue inhibitors of metalloproteinases (TIMPs-2, -3, and -4, but not TIMP-1, blocked lipid agonist-induced invasion indicating a role for membrane-type (MT-MMPs. Furthermore, MT1-MMP expression in several tumor lines directly correlated with LPA-induced invasion. HEK293s, which neither express MT1-MMP nor invade in the presence of LPA, were transfected with MT1-MMP cDNA, and subsequently invaded in response to LPA. When HT1080 cells were seeded on top of or within collagen matrices, siRNA targeting of MT1-MMP, but not other MMPs, inhibited lipid agonist-induced invasion establishing a requisite role for MT1-MMP in this process. Conclusion LPA is a

  18. Management Versus Non-Management Knowledge Transfer from Training to Real Work Environments: A Meta-Analysis

    National Research Council Canada - National Science Library

    2007-01-01

    .... A meta-analysis was performed with training transfer as a dependent variable and post-training independent variables of supervisor support, subordinate support, peer support, workplace support...

  19. Dynamic spatial panels : models, methods, and inferences

    NARCIS (Netherlands)

    Elhorst, J. Paul

    This paper provides a survey of the existing literature on the specification and estimation of dynamic spatial panel data models, a collection of models for spatial panels extended to include one or more of the following variables and/or error terms: a dependent variable lagged in time, a dependent

  20. Comprendre le rôle de l'interféron de type 1 dans la résistance à l ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Profiling eIF2a-Dependent Translation in Synaptic Plasticity and Memory. This project will provide evidence to help direct treatment strategies in patients with memory deficits and reduce the symptoms associated with Alzheimer's disease. View moreProfiling eIF2a-Dependent Translation in Synaptic Plasticity and Memory ...

  1. The stress of life

    National Research Council Canada - National Science Library

    Selye, H

    1978-01-01

    .... This is also a dependable personal guide that tells you how to combat both physical and mental stress, how to handle yourself during the stress of everyday life, and how your bodily changes can help...

  2. Detecting modularity "smells" in dependencies injected with Java annotations

    NARCIS (Netherlands)

    Roubtsov, S.; Serebrenik, A.; Brand, van den M.G.J.

    2010-01-01

    Dependency injection is a recent programming mechanism reducing dependencies among components by delegating them to an external entity, called a dependency injection framework. An increasingly popular approach to dependency injection implementation relies upon using Java annotations, a special form

  3. Maritime Military Decision Making in Environments of Extreme Information Ambiguity: An Initial Exploration

    National Research Council Canada - National Science Library

    Reeves, Andrew T

    2005-01-01

    ... to make effective decisions. An environment of extreme information ambiguity, a dependent variable, is one of the most difficult components of a battle where the decision maker may reach a confusing and debilitating point...

  4. Quarks in nuclei

    International Nuclear Information System (INIS)

    Roberts, R.G.

    1984-11-01

    The paper concerns the behaviour of quarks in nuclei. Confinement size changes and dynamical rescaling; A dependence; low-x region; gluons and confinement size; and nucleons in a nucleus; are all discussed. (U.K.)

  5. 78 FR 12364 - Proposed Extension of Existing Collection; Comment Request

    Science.gov (United States)

    2013-02-22

    ...). SUPPLEMENTARY INFORMATION: I. Background In order to qualify as a dependent that is eligible for black lung benefits, a child aged 18 to 23 must be a full-time student as described in the Black Lung Benefits Act, 30...

  6. Correlation between in vitro Elastomeric Force Degradation and Glass Transition Temperature determined by Dynamic Mechanical Analysis

    Directory of Open Access Journals (Sweden)

    Manu Krishnan

    2012-01-01

    Conclusion: Tg can be considered as a dependable parameter in envisaging the force properties of an elastomeric chain. Clinically, it suggested that a polymer with higher Tg can give higher or optimum levels of force for tooth movement.

  7. 78 FR 39014 - Agency Information Collection Activities; Submission for OMB Review; Comment Request; Claim for...

    Science.gov (United States)

    2013-06-28

    ... addition, notwithstanding any other provisions of law, no person shall generally be subject to penalty for.... 3507(a)(1)(D). This ICR covers forms a dependent of a deceased Federal employee, whose death is work...

  8. A digital intake approach in specialized mental health care : Study protocol of a cluster randomised controlled trial

    NARCIS (Netherlands)

    Metz, M.J.; Elfeddali, I.; Krol, D.G.H.; Veerbeek, M.A.; De Beurs, E.; Beekman, A.T.F.; van der Feltz-Cornelis, C.M.

    2017-01-01

    Background Enhancing patient participation is becoming increasingly important in mental health care as patients use to have a dependent, inactive role and nonadherence to treatment is a regular problem. Research shows promising results of initiatives stimulating patient participation in partnership

  9. Learning Styles in Continuing Medical Education.

    Science.gov (United States)

    Bennet, Nancy L.; Fox, Robert D.

    1984-01-01

    Synthesizes literature on cognitive style and considers issues about its role in continuing medical education research, including whether it should be used as a dependent or independent variable and how it may be used in causal models. (SK)

  10. Justus Freiherr von Liebig

    Indian Academy of Sciences (India)

    IAS Admin

    istry research, Liebig was full of ideas as to how to develop an excellent laboratory ... Application of chemical methods to compounds of plant and ... and organic qualitative analysis by classifying a substance in a ..... depended on the soil type.

  11. Making medical treatments resilient to technological disruptions in telemedicine systems

    NARCIS (Netherlands)

    Larburu Rubio, Nekane; Widya, I.A.; Bults, Richard G.A.; Hermens, Hermanus J.

    Telemedicine depends on Information and Communication Technology (ICT) to support remote treatment of patients. This dependency requires the telemedicine system design to be resilient for ICT performance degradation or subsystem failures. Nevertheless, using telemedicine systems create a dependency

  12. Rôle des mitochondries dans les voies immunitaires innées | IDRC ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Institution. The Royal Institution for the Advancement of Learning/McGill University ... Deciphering the Cognitive and Neural Mechanisms Underlying Auditory Learning ... Profiling eIF2a-Dependent Translation in Synaptic Plasticity and Memory.

  13. Anxiety, Affect, Self-Esteem, and Stress: Mediation and Moderation Effects on Depression

    OpenAIRE

    Nima, Ali Al; Rosenberg, Patricia; Archer, Trevor; Garcia, Danilo

    2013-01-01

    Background Mediation analysis investigates whether a variable (i.e., mediator) changes in regard to an independent variable, in turn, affecting a dependent variable. Moderation analysis, on the other hand, investigates whether the statistical interaction between independent variables predict a dependent variable. Although this difference between these two types of analysis is explicit in current literature, there is still confusion with regard to the mediating and moderating effects of differ...

  14. Colour dynamics in large psub(T) hadron production on nuclei

    International Nuclear Information System (INIS)

    Kopeliovich, B.Z.; Niedermayer, F.

    1984-01-01

    The color dynamics of hadron production with large transverse momentum (psub(T)) on nuclei is investigated. Retardation by colour forces of colour objects propagating through nuclear matter leads to considerable shadowing of hard processes inside the nucleus. This explains the weak A dependence of the production cross section for large psub(T) meson pairs. The small absorption of compressed hadronic configurations inside the nucleus explains the linear A dependence of pp-pair production

  15. Nuclear Dependence of the Transverse-Single-Spin Asymmetry for Forward Neutron Production in Polarized p +A Collisions at √{sN N}=200 GeV

    Science.gov (United States)

    Aidala, C.; Akiba, Y.; Alfred, M.; Andrieux, V.; Aoki, K.; Apadula, N.; Asano, H.; Ayuso, C.; Azmoun, B.; Babintsev, V.; Bagoly, A.; Bandara, N. S.; Barish, K. N.; Bathe, S.; Bazilevsky, A.; Beaumier, M.; Belmont, R.; Berdnikov, A.; Berdnikov, Y.; Blau, D. S.; Boer, M.; Bok, J. S.; Brooks, M. L.; Bryslawskyj, J.; Bumazhnov, V.; Butler, C.; Campbell, S.; Canoa Roman, V.; Cervantes, R.; Chi, C. Y.; Chiu, M.; Choi, I. J.; Choi, J. B.; Citron, Z.; Connors, M.; Cronin, N.; Csanád, M.; Csörgő, T.; Danley, T. W.; Daugherity, M. S.; David, G.; Deblasio, K.; Dehmelt, K.; Denisov, A.; Deshpande, A.; Desmond, E. J.; Dion, A.; Dixit, D.; Do, J. H.; Drees, A.; Drees, K. A.; Dumancic, M.; Durham, J. M.; Durum, A.; Elder, T.; Enokizono, A.; En'yo, H.; Esumi, S.; Fadem, B.; Fan, W.; Feege, N.; Fields, D. E.; Finger, M.; Finger, M.; Fokin, S. L.; Frantz, J. E.; Franz, A.; Frawley, A. D.; Fukuda, Y.; Gal, C.; Gallus, P.; Garg, P.; Ge, H.; Giordano, F.; Goto, Y.; Grau, N.; Greene, S. V.; Grosse Perdekamp, M.; Gunji, T.; Guragain, H.; Hachiya, T.; Haggerty, J. S.; Hahn, K. I.; Hamagaki, H.; Hamilton, H. F.; Han, S. Y.; Hanks, J.; Hasegawa, S.; Haseler, T. O. S.; He, X.; Hemmick, T. K.; Hill, J. C.; Hill, K.; Hollis, R. S.; Homma, K.; Hong, B.; Hoshino, T.; Hotvedt, N.; Huang, J.; Huang, S.; Imai, K.; Imrek, J.; Inaba, M.; Iordanova, A.; Isenhower, D.; Ito, Y.; Ivanishchev, D.; Jacak, B. V.; Jezghani, M.; Ji, Z.; Jiang, X.; Johnson, B. M.; Jorjadze, V.; Jouan, D.; Jumper, D. S.; Kang, J. H.; Kapukchyan, D.; Karthas, S.; Kawall, D.; Kazantsev, A. V.; Khachatryan, V.; Khanzadeev, A.; Kim, C.; Kim, D. J.; Kim, E.-J.; Kim, M.; Kim, M. H.; Kincses, D.; Kistenev, E.; Klatsky, J.; Kline, P.; Koblesky, T.; Kotov, D.; Kudo, S.; Kurita, K.; Kwon, Y.; Lajoie, J. G.; Lallow, E. O.; Lebedev, A.; Lee, S.; Leitch, M. J.; Leung, Y. H.; Lewis, N. A.; Li, X.; Lim, S. H.; Liu, L. D.; Liu, M. X.; Loggins, V.-R.; Lökös, S.; Lovasz, K.; Lynch, D.; Majoros, T.; Makdisi, Y. I.; Makek, M.; Malaev, M.; Manko, V. I.; Mannel, E.; Masuda, H.; McCumber, M.; McGaughey, P. L.; McGlinchey, D.; McKinney, C.; Mendoza, M.; Metzger, W. J.; Mignerey, A. C.; Mihalik, D. E.; Milov, A.; Mishra, D. K.; Mitchell, J. T.; Mitsuka, G.; Miyasaka, S.; Mizuno, S.; Montuenga, P.; Moon, T.; Morrison, D. P.; Morrow, S. I. M.; Murakami, T.; Murata, J.; Nagai, K.; Nagashima, K.; Nagashima, T.; Nagle, J. L.; Nagy, M. I.; Nakagawa, I.; Nakagomi, H.; Nakano, K.; Nattrass, C.; Niida, T.; Nouicer, R.; Novák, T.; Novitzky, N.; Novotny, R.; Nyanin, A. S.; O'Brien, E.; Ogilvie, C. A.; Orjuela Koop, J. D.; Osborn, J. D.; Oskarsson, A.; Ottino, G. J.; Ozawa, K.; Pantuev, V.; Papavassiliou, V.; Park, J. S.; Park, S.; Pate, S. F.; Patel, M.; Peng, W.; Perepelitsa, D. V.; Perera, G. D. N.; Peressounko, D. Yu.; Perezlara, C. E.; Perry, J.; Petti, R.; Phipps, M.; Pinkenburg, C.; Pisani, R. P.; Pun, A.; Purschke, M. L.; Radzevich, P. V.; Read, K. F.; Reynolds, D.; Riabov, V.; Riabov, Y.; Richford, D.; Rinn, T.; Rolnick, S. D.; Rosati, M.; Rowan, Z.; Runchey, J.; Safonov, A. S.; Sakaguchi, T.; Sako, H.; Samsonov, V.; Sarsour, M.; Sato, K.; Sato, S.; Schaefer, B.; Schmoll, B. K.; Sedgwick, K.; Seidl, R.; Sen, A.; Seto, R.; Sexton, A.; Sharma, D.; Shein, I.; Shibata, T.-A.; Shigaki, K.; Shimomura, M.; Shioya, T.; Shukla, P.; Sickles, A.; Silva, C. L.; Silvermyr, D.; Singh, B. K.; Singh, C. P.; Singh, V.; Skoby, M. J.; Slunečka, M.; Smith, K. L.; Snowball, M.; Soltz, R. A.; Sondheim, W. E.; Sorensen, S. P.; Sourikova, I. V.; Stankus, P. W.; Stoll, S. P.; Sugitate, T.; Sukhanov, A.; Sumita, T.; Sun, J.; Syed, S.; Sziklai, J.; Takeda, A.; Tanida, K.; Tannenbaum, M. J.; Tarafdar, S.; Taranenko, A.; Tarnai, G.; Tieulent, R.; Timilsina, A.; Todoroki, T.; Tomášek, M.; Towell, C. L.; Towell, R. S.; Tserruya, I.; Ueda, Y.; Ujvari, B.; van Hecke, H. W.; Vazquez-Carson, S.; Velkovska, J.; Virius, M.; Vrba, V.; Vukman, N.; Wang, X. R.; Wang, Z.; Watanabe, Y.; Watanabe, Y. S.; Wong, C. P.; Woody, C. L.; Xu, C.; Xu, Q.; Xue, L.; Yalcin, S.; Yamaguchi, Y. L.; Yamamoto, H.; Yanovich, A.; Yin, P.; Yoo, J. H.; Yoon, I.; Yu, H.; Yushmanov, I. E.; Zajc, W. A.; Zelenski, A.; Zharko, S.; Zou, L.; Phenix Collaboration

    2018-01-01

    During 2015, the Relativistic Heavy Ion Collider (RHIC) provided collisions of transversely polarized protons with Au and Al nuclei for the first time, enabling the exploration of transverse-single-spin asymmetries with heavy nuclei. Large single-spin asymmetries in very forward neutron production have been previously observed in transversely polarized p +p collisions at RHIC, and the existing theoretical framework that was successful in describing the single-spin asymmetry in p +p collisions predicts only a moderate atomic-mass-numbe