WorldWideScience

Sample records for acute exogenous lipoid

  1. Exogenous lipoid pneumonia – a case report of a fire-eater

    International Nuclear Information System (INIS)

    Pielaszkiewicz-Wydra, Magdalena; Homola-Piekarska, Bożena; Szcześniak, Ewa; Ciołek-Zdun, Monika; Fall, Andrzej

    2012-01-01

    Exogenous lipoid pneumonia is an uncommon condition caused by inhalation or aspiration of a fatty substance. It usually presents as chronic respiratory illness mimicking interstitial lung diseases. Acute exogenous lipoid pneumonia is uncommon and typically is caused by an episode of aspiration of a large quantity of a petroleum-based product. Radiological findings vary and may imitate many other diseases. We present a rare case of acute exogenous lipoid pneumonia in a fire-eater who aspirated liquid paraffin during his flame-blowing show (fire-eater’s lung). He was admitted to the hospital with productive cough, fever, hemoptysis, chest pain and dyspnea. Diagnosis was made on the basis of history of exposure to fatty substance, characteristic findings in CT examination and presence of lipid-laden macrophages in bronchoalveolar lavage fluid. Acute exogenous lipoid pneumonia is a very rare disease that typically occurs in fire-eaters and is called a fire-eater’s lung. The diagnosis is made on the basis of typical history and radiological, as well as histopathological findings

  2. Exogenous lipoid pneumonia: high-resolution CT findings

    International Nuclear Information System (INIS)

    Lee, J.S.; Song, K.S.; Lim, T.H.; Im, J.G.; Seo, J.B.

    1999-01-01

    The aim of this study was to assess high-resolution computed tomography (HRCT) findings of exogenous lipoid pneumonia. High-resolution computed tomography was obtained in 25 patients with proven exogenous lipoid pneumonia resulting from aspiration of squalene (derived from shark liver oil). Diagnosis was based on biopsy (n = 9), bronchoalveolar lavage (n = 8), or sputum cytology and clinical findings (n = 8). The clinical history of taking squalene was confirmed in all patients. The CT findings were classified into three patterns: diffuse ground-glass opacity, consolidation, and interstitial abnormalities. Distribution of the abnormalities, duration of taking squalene, predisposing factors for aspiration, and route of administration were analyzed. Ten patients showed diffuse ground-glass opacity pattern. Seven of 10 patients had predisposing conditions such as unconsciousness, pharyngeal dysmotility, or motor disturbances, and 6 patients had a recent history of taking large amount of squalene through nasal route. Seven patients who had consolidation pattern had a history of taking squalene for several months and did not have any predisposing factor. All of the 5 patients who had a pattern of interstitial abnormalities had a history of taking squalene longer than 1 year and showed segmental distribution of interstitial thickening with interposing ground-glass opacities. Three patients simultaneously had two different patterns at different lobes of the lung. The HRCT findings of lipoid pneumonia are ground-glass opacities, consolidation, and interstitial abnormalities. These HRCT findings with appropriate inquiries could be useful for diagnosis of exogeneous lipoid pneumonia. (orig.)

  3. Exogenous lipoid pneumonia after ingestion of shark liver oil: a case report

    International Nuclear Information System (INIS)

    Yang, Jae Bum; Seong, Hyeon Lim; Park, Chan Sup; Park, Yang Hee; Lee, Sang Sun

    1991-01-01

    Exogenous lipoid pneumonia was first described in 1925 by Laughlen and a sizeable literature developed, reaching a peak in the 1940s. Two cases of exogenous lipoid pneumonia in children were reported domestically. We wish to report a case of exogenous lipoid pneumonia presented with bilateral air-space consolidation in a 53-year-old man who had a long history of ingestion of shark liver oil. This report describes its radiological findings, along with a review of the literature

  4. Exogenous lipoid pneumonia: HRCT, MR, and pathologic findings

    International Nuclear Information System (INIS)

    Laurent, F.; Philippe, J.C.; Vergier, B.; Granger-Veron, B.; Darpeix, B.; Vergeret, J.; Blanc, P.; Velly, J.F.

    1999-01-01

    The objective of this study was to describe high-resolution CT (HRCT) and MR findings of exogenous lipoid pneumonia and to correlate them with pathologic findings. A retrospective review of the medical records of our institution revealed seven patients with a diagnosis of lipoid pneumonia based on clinical data, chest films, bronchoalveolar lavage, and follow-up. Both HRCT and MR imaging were reviewed by two readers. Pathologic examination of the resected specimen or surgical biopsies were also reviewed in the four available cases. The HRCT findings were pulmonary consolidations (n = 6) with fatty (n = 3) or unspecific but low attenuation values (n = 3), areas of ground-glass opacities (n = 5), septal lines, and centrilobular interstitial thickening (n = 5). In five of the seven cases, a crazy-paving pattern of various spread was also present, either isolated (n = 1) or surrounding a pulmonary consolidation. In two cases traction bronchiectasis and cystic changes consistent with fibrosis were seen. At MR imaging (n = 2) a pulmonary consolidation of high signal intensity on T1-weighted image consistent with lipid content was present in one case. Pathologic examination (n = 4) showed the coexistence of lobules with lesions of various ages, sometimes in contiguous lobules, within the same patient. Recent lesions were those with alveolar fill-in by spumous macrophages and almost normal alveolar walls and septae. In more advanced lesions, lobules were filled in with larger vacuoles often surrounded by inflammatory infiltrates of alveolar walls, bronchiolar walls, and septa. The oldest lesions were characterized by fibrosis and parenchymal distortion around large lipid-containing vacuoles. The HRCT findings reflect pathologic findings in exogenous lipoid pneumonia. Although non-specific, consolidation areas of low attenuation values and crazy-paving pattern are frequently associated in exogenous lipoid pneumonia and are indicative of the diagnosis. (orig.)

  5. Exogenous lipoid pneumonia caused by paraffin in an amateur fire breather.

    Science.gov (United States)

    Weinberg, I; Fridlender, Z G

    2010-05-01

    Paraffin has characteristics that make it popular among fire breathers. To describe a case of paraffin-induced lipoid pneumonia in a fire breather. The patient was evaluated clinically in relation to his occupational history. A 32-year-old man presented with dyspnoea, tachypnoea and non-productive cough of 2 h duration that started immediately following an attempt to blow fire using paraffin as the volatile substance. He was discharged from the emergency ward but returned the next day presenting again with dyspnoea accompanied by mid-sternal pain, fever (38.1 degrees C) and leucocytosis. Chest radiography showed perihilar punctuate infiltrations. A diagnosis of exogenous lipoid pneumonia caused by paraffin was made, and the patient was treated, with full recovery within a week. Fire breathers must be viewed as a population at risk of paraffin-induced lipoid pneumonia.

  6. Lipoid Pneumonia in a Gas Station Attendant

    Directory of Open Access Journals (Sweden)

    Gladis Isabel Yampara Guarachi

    2014-01-01

    Full Text Available The exogenous lipoid pneumonia, uncommon in adults, is the result of the inhalation and/or aspiration of lipid material into the tracheobronchial tree. This is often confused with bacterial pneumonia and pulmonary tuberculosis due to a nonspecific clinical and radiologic picture. It presents acutely or chronically and may result in pulmonary fibrosis. We describe here a case of lipoid pneumonia in a gas station attendant who siphoned gasoline to fill motorcycles; he was hospitalized due to presenting with a respiratory infection that was hard to resolve. The patient underwent bronchoscopy with bronchoalveolar lavage, which, on cytochemical (oil red O evaluation, was slightly positive for lipid material in the foamy cytoplasm of alveolar macrophages. Due to his occupational history and radiographic abnormalities suggestive of lipoid pneumonia, a lung biopsy was performed to confirm the diagnosis. The patient was serially treated with segmental lung lavage and showed clinical, functional, and radiological improvement.

  7. Exogenous lipoid pneumonia caused by chronic improper use of baby body oil in adult patient

    Directory of Open Access Journals (Sweden)

    M. Doubková

    2013-09-01

    Full Text Available Introduction: Exogenous lipoid pneumonia (ELP is an uncommon condition resulting from aspirating or inhaling fatlike material. These substances elicit a foreign body reaction and proliferative fibrosis in the lung. Case report: We report a case of a 38-year-old woman with bilateral pulmonary infiltration. There were no clinical symptoms of this infiltration at diagnosis. The infiltration was found coincidentally during the pre-operation examination before surgery. A chest computed tomography scan revealed bilateral lung consolidation, particularly in the S6 area on the right side. The transthoracic lung biopsy led to suspicion of ELP. Precise anamnesis confirms the diagnosis of ELP caused by chronic improper use of baby body oil. Two years after discontinuing “baby body oil therapy”, a chest CT scan revealed partial regression of pulmonary infiltration. Conclusion: The diagnosis of exogenous lipoid pneumonia is often difficult as symptoms, signs, and radiographic findings are all rather non-specific. We would like to emphasize the role of precise case history in better identification of ELP. Resumo: Introdução: A pneumonia lipoide exógena (ELP é uma condição incomum resultante da aspiração ou inalação de material gorduroso. Estas substâncias provocam uma reação a corpo estranho que pode resultar em fibrose pulmonar proliferativa. Caso clínico: Neste trabalho relatamos o caso de uma doente de 38 anos com infiltrado pulmonar bilateral. Não houve sintomas resultantes desta infiltração infiltração no momento do diagnóstico. Esta alteração imagiológica foi encontrada, por acaso, durante o exame pré-operatório. A tomografia computadorizada do tórax revelou consolidação pulmonar bilateral, particularmente na área S6 do lado direito. A biópsia transtorácica pulmonar conduziu a uma suspeita de ELP. Uma análise precisa do histórico da paciente

  8. Teppanyaki/Hibachi Pneumonitis: An Exotic Cause of Exogenous Lipoid Pneumonia

    Directory of Open Access Journals (Sweden)

    Franck Rahaghi

    2016-01-01

    Full Text Available Exogenous lipoid pneumonia (ELP is a rare type of inflammatory lung disease caused by aspiration and/or inhalation of fatty substances and characterized by a chronic foreign body-type reaction to intra-alveolar lipid deposits. The usual clinical presentation occurs with insidious onset of nonspecific respiratory symptoms and radiographic findings that can mimic other pulmonary diseases. Diagnosis of ELP is often missed or delayed as it requires a high index of suspicion and familiarity with the constellation of appropriate history and radiologic and pathologic features. We herein report a case of occupational exposure to tabletop “Teppanyaki” entertainment cooking as a cause of ELP, confirmed by surgical lung biopsies in a 63-year-old Asian woman who worked as a Hibachi-Teppanyaki chef for 25 years.

  9. An experimental study of exogenous lipoid pneumonia : sequential changes in high-resolution CT and MR findings

    International Nuclear Information System (INIS)

    Kim, Kyeong Ah; Kang, Eun Young; Kim, Dae Hyun; Park, Sang Woo; Choi, Jeong Cheol; Kim, Ae Ree; Kim, Han Kyum; Cha, In Ho

    1999-01-01

    To evaluate sequential changes in high-resolution CT(HRCT) and MR findings of exogenous lipoid pneumonia in rabbits and to compare the radiologic and histopathologic findings. A single endobronchial administration of shark liver oil(0.5 or 1 ml/kg of body weight) was given to 25 rabbits. HRCT scans were obtained immediately(n=17), at 1 day(n=14), 3 days(n=10), 1 week(n=15), 2 weeks(n=10), 4 weeks(n=9), 6 weeks(n=5), 8 weeks(n=6), 10 weeks(n=4), 12 weeks(n=2), 14 weeks(n=3), and 16 weeks(n=2) after administration. Changes in distribution, extent, and attenuation were assessed on HRCT scans. MR scans were obtained immediately(n=12), at 1 day(n=9), 3 days(n=9), 1 week(n=15), 2 weeks(n=9), 4 weeks(n=11), 6 weeks(n=5), 8 weeks(n=7), 10 weeks(n=3), 14 weeks(n=3), and at 16 weeks(n=2) after administration. Changes in distribution, extent, and signal intensity were assessed on MR scans. In 16 rabbits, CT and MR findings were compared with histopatholo-gic findings obtained in the same plane. HRCT findings included consolidation with air-bronchogram, ground-glass attenuation and fat attenuation within the lesion at earlier stages(immediate-2 weeks). The extent of lesions was greatest at 1 week, and was then seen to gradually decrease on follow-up CT scans. T1-weighted MR images(T1WI) showed high or intermediate signal intensity(SI) at earlier stages and intermediate SI at later stages, while T2-weighted MR images(T2WI) showed high SI at both earlier and later stages. Histopathologic correlation showed that ground-glass attenuation and consolidation on HRCT reflected intraalveolar lipid-laden macrophages, cuboidal metaplasia of alveolar epithelial cells, and alveolar septal widening with inflammatory cell infiltration. Maximal infiltration of oil in the lung correlated closely with the peak low-attenuation seen on CT scans and the high signal intensity seen on T1WI. Shark liver oil-induced exogenous lipoid pneumonia in rabbits is reliably diagnosed by HRCT and MR during

  10. MR findings of lipoid pneumonia: report of two cases

    International Nuclear Information System (INIS)

    Seo, Jung Wook; Cho, Eun Ok; Kim, Joung Sook; Hur, Gham

    1995-01-01

    Exogenous lipoid pneumonia is an unusual disease resulting from aspiration of oil particles. A history of oil ingestion strongly suggests the diagnosis, but the radiological presentation varies from mild perihilar consolidation to diffuse and extensive bilateral involvement, particularly of the posterior basal segment of both lower lung. Since magnetic resonance (MR) provides greater contrast resolution than CT, it offers the potential for tissue characterization. In particular, fatty tissue and lipid containing substances are known to have high signal intensities on T1-and T2-weighted spin-echo (SE) images. We report MR findings in two case of exogenous lipoid pneumonia caused by ingestion of shark liver oil (Squalene)

  11. Lipoid pneumonia in adults: findings on high-resolution computed tomography

    International Nuclear Information System (INIS)

    Marchiori, Edson; Escuissato, Dante L.; Souza Junior, Arthur Soares; Araujo Neto, Cesar; Nobre, Luiz Felipe; Irion, Klaus L.; Rodrigues, Rosana; Mancano, Alexandre Dias; Capone, Domenico; Fialho, Suzane Mansur; Souza, Carolina Althoff

    2007-01-01

    Objective: The present study was aimed at describing the findings on high-resolution computed tomography in patients with exogenous lipoid pneumonia secondary to mineral oil aspiration. Materials and methods: Eight adult patients - four men and four women - with mean age of 69.4 years were studied. All of the patients were users of mineral oil for treating intestinal constipation. High-resolution computed tomography studies of these patients were blindly evaluated by two radiologists. Results: Air-space consolidation with areas of fat density and crazy paving pattern were the most frequent findings. The lesions were bilateral in six cases and unilateral in two. Conclusion: Air-space consolidation with areas of fat density, associated with a clinical history of mineral oil ingestion virtually indicates a diagnosis of exogenous lipoid pneumonia. (author)

  12. Lipoid pneumonia in adults: findings on high-resolution computed tomography

    Energy Technology Data Exchange (ETDEWEB)

    Marchiori, Edson [Universidade Federal Fluminense (UFF), Niteroi, RJ (Brazil). Dept. of Radiology]. E-mail: edmarchiori@gmail.com; Zanetti, Glaucia [Faculdade de Medicina de Petropolis, RJ (Brazil); Escuissato, Dante L. [Universidade Federal do Parana (UFPR), Curitiba, PR (Brazil); Souza Junior, Arthur Soares [Faculdade de Medicina de Sao Jose do Rio Preto (FAMERP), SP (Brazil); Araujo Neto, Cesar [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil); Nobre, Luiz Felipe [Universidade Federal de Santa Catarina (UFSC), Florianopolis, SC (Brazil); Irion, Klaus L. [The Cardiothoracic Centre NHS Trust, Liverpool (United Kingdom); Rodrigues, Rosana [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil). Hospital Universitario Clementino Fraga Filho (HUCFF); Mancano, Alexandre Dias [Hospital Regional de Taguatinga, Brasilia, DF (Brazil); Capone, Domenico [Universidade Estadual do Rio de Janeiro (UERJ), RJ (Brazil); Fialho, Suzane Mansur [Centro Nuclear da Guanabara, Rio de Janeiro, RJ (Brazil); Souza, Carolina Althoff [University of Ottawa (Canada)

    2007-09-15

    Objective: The present study was aimed at describing the findings on high-resolution computed tomography in patients with exogenous lipoid pneumonia secondary to mineral oil aspiration. Materials and methods: Eight adult patients - four men and four women - with mean age of 69.4 years were studied. All of the patients were users of mineral oil for treating intestinal constipation. High-resolution computed tomography studies of these patients were blindly evaluated by two radiologists. Results: Air-space consolidation with areas of fat density and crazy paving pattern were the most frequent findings. The lesions were bilateral in six cases and unilateral in two. Conclusion: Air-space consolidation with areas of fat density, associated with a clinical history of mineral oil ingestion virtually indicates a diagnosis of exogenous lipoid pneumonia. (author)

  13. Lipoid pneumonia in children following aspiration of mineral oil used in the treatment of constipation: high-resolution CT findings in 17 patients

    International Nuclear Information System (INIS)

    Zanetti, Glaucia; Marchiori, Edson; Gasparetto, Taisa D.; Escuissato, Dante L.; Soares Souza, Arthur

    2007-01-01

    Exogenous lipoid pneumonia is a rare disorder caused by aspiration of mineral, vegetable and animal oils. High-resolution CT findings of lipoid pneumonia in children taking mineral oil for constipation have been rarely reported. To evaluate the high-resolution CT findings in 17 children with exogenous lipoid pneumonia following aspiration of mineral oil. The study included nine boys and eight girls, with ages ranging from 2 months to 9 years. All patients underwent high-resolution CT and the images were reviewed by two radiologists who reached decisions by consensus. The inclusion criteria were an abnormal radiograph, history of taking mineral oil and the presence of intrapulmonary lipids proved by bronchoalveolar lavage or open lung biopsy. The most common symptoms were cough (n = 13), mild fever (n = 11), and progressive dyspnea (n = 9). The main CT findings were air-space consolidations (100%), usually with areas of fatty attenuation (70.6%), areas of ground-glass attenuation (52.9%), and a crazy-paving pattern (17.6%), predominating bilaterally in the posterior and lower regions of the lungs. The high-resolution CT features in children with exogenous lipoid pneumonia are air-space consolidations and ground-glass attenuation, occasionally with a crazy-paving pattern, distributed bilaterally in the posterior and lower zones of the lungs. (orig.)

  14. Lipoid pneumonia in children following aspiration of mineral oil used in the treatment of constipation: high-resolution CT findings in 17 patients

    Energy Technology Data Exchange (ETDEWEB)

    Zanetti, Glaucia [University of Rio de Janeiro, Department of Radiology, Rio de Janeiro (Brazil); Marchiori, Edson [University of Rio de Janeiro, Department of Radiology, University Federal Fluminense, Rio de Janeiro (Brazil); Gasparetto, Taisa D. [University Federal Fluminense, Department of Radiology, Rio de Janeiro (Brazil); Escuissato, Dante L. [University of Parana, Department of Radiology, Curitiba (Brazil); Soares Souza, Arthur [School of Medicine of Sao Jose do Rio Preto (ASSJ), Department of Radiology, Sao Jose do Rio Preto (Brazil)

    2007-11-15

    Exogenous lipoid pneumonia is a rare disorder caused by aspiration of mineral, vegetable and animal oils. High-resolution CT findings of lipoid pneumonia in children taking mineral oil for constipation have been rarely reported. To evaluate the high-resolution CT findings in 17 children with exogenous lipoid pneumonia following aspiration of mineral oil. The study included nine boys and eight girls, with ages ranging from 2 months to 9 years. All patients underwent high-resolution CT and the images were reviewed by two radiologists who reached decisions by consensus. The inclusion criteria were an abnormal radiograph, history of taking mineral oil and the presence of intrapulmonary lipids proved by bronchoalveolar lavage or open lung biopsy. The most common symptoms were cough (n = 13), mild fever (n = 11), and progressive dyspnea (n = 9). The main CT findings were air-space consolidations (100%), usually with areas of fatty attenuation (70.6%), areas of ground-glass attenuation (52.9%), and a crazy-paving pattern (17.6%), predominating bilaterally in the posterior and lower regions of the lungs. The high-resolution CT features in children with exogenous lipoid pneumonia are air-space consolidations and ground-glass attenuation, occasionally with a crazy-paving pattern, distributed bilaterally in the posterior and lower zones of the lungs. (orig.)

  15. Exogenous lipoid pneumonia due to inhalation of spray lubricant (WD-40 lung).

    Science.gov (United States)

    Glynn, K P; Gale, N A

    1990-05-01

    An elderly woman developed lipoid pneumonia due to the inhalation of mist from a spray lubricant that she was using as a liniment for sore back and neck muscles. This unusual practice is reported to be common among older people bothered by rheumatism. The potential for this complication to occur in other patients leads us to present this case report.

  16. Characterization of novel StAR (steroidogenic acute regulatory protein mutations causing non-classic lipoid adrenal hyperplasia.

    Directory of Open Access Journals (Sweden)

    Christa E Flück

    Full Text Available CONTEXT: Steroidogenic acute regulatory protein (StAR is crucial for transport of cholesterol to mitochondria where biosynthesis of steroids is initiated. Loss of StAR function causes lipoid congenital adrenal hyperplasia (LCAH. OBJECTIVE: StAR gene mutations causing partial loss of function manifest atypical and may be mistaken as familial glucocorticoid deficiency. Only a few mutations have been reported. DESIGN: To report clinical, biochemical, genetic, protein structure and functional data on two novel StAR mutations, and to compare them with published literature. SETTING: Collaboration between the University Children's Hospital Bern, Switzerland, and the CIBERER, Hospital Vall d'Hebron, Autonomous University, Barcelona, Spain. PATIENTS: Two subjects of a non-consanguineous Caucasian family were studied. The 46,XX phenotypic normal female was diagnosed with adrenal insufficiency at the age of 10 months, had normal pubertal development and still has no signs of hypergonodatropic hypogonadism at 32 years of age. Her 46,XY brother was born with normal male external genitalia and was diagnosed with adrenal insufficiency at 14 months. Puberty was normal and no signs of hypergonadotropic hypogonadism are present at 29 years of age. RESULTS: StAR gene analysis revealed two novel compound heterozygote mutations T44HfsX3 and G221S. T44HfsX3 is a loss-of-function StAR mutation. G221S retains partial activity (∼30% and is therefore responsible for a milder, non-classic phenotype. G221S is located in the cholesterol binding pocket and seems to alter binding/release of cholesterol. CONCLUSIONS: StAR mutations located in the cholesterol binding pocket (V187M, R188C, R192C, G221D/S seem to cause non-classic lipoid CAH. Accuracy of genotype-phenotype prediction by in vitro testing may vary with the assays employed.

  17. Acute exogenous lipoid pneumonia, on a fire eating

    International Nuclear Information System (INIS)

    Quintanilla-Gallo, Juvel; Jimenez-Navarrete, Manuel Fco.; Gourzong-Taylor, Charles

    2006-01-01

    A case of an adult 19 years of age, fire juggler and manipulator is presented. The young came in to the medical emergency service of the Hospital Dr. Rafael A. Calderon Guardia, because of a sudden episode of right thoracic pain and dyspnea. A right pleural effusion was documented and a round mass at the base of the left lung. A suggestive clinic of bronchopneumonia started after hours, it was localized first as community acquired pneumonia. Considering his work history and clinical characteristics, the case was reoriented and concluded that this is what the medical literature in English is called f ire-eater pneumonia , uncommon aspiration pneumonia which was a literature review. (author) [es

  18. Pulmonary alveolar proteinosis versus exogenous lipoid pneumonia showing crazy-paving pattern: Comparison of their clinical features and high-resolution CT findings

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Hei Kyung; Park, Chang Min; Goo, Jin Mo; Lee, Hyun Ju (Dept. of Radiology, Seoul National Univ. College of Medicine, and Inst. of Radiation Medicine, Seoul National Univ. Medical Research Center, Seoul (Korea)), e-mail: cmpark@radiol.snu.ac.kr

    2010-05-15

    Background: Although pulmonary alveolar proteinosis (PAP) and exogenous lipoid pneumonia (ELP) require different treatment strategies, both manifest as a crazy-paving pattern on CT and often have similar clinical manifestations and radiologic features. Purpose: To investigate the clinical features and high-resolution computed tomography (HRCT) findings of PAP and ELP showing the crazy-paving pattern. Material and Methods: The clinical features and HRCT findings of eight patients with pathologically proven PAP and six patients with pathologically proven ELP showing the crazy-paving pattern were retrospectively evaluated. Two radiologists analyzed the HRCT findings of PAP and ELP in consensus in terms of the presence, severity, and extent of illdefined centrilobular nodules, consolidations, ground-glass opacities (GGOs), reticulations, and the crazy-paving pattern. Results: With respect to the clinical features of these two diseases, all patients with ELP were retrospectively found to have a history of oil ingestion. In terms of the HRCT findings, ill-defined centrilobular nodules were seen in five of six patients (83%) with ELP, whereas they were not present in any patient with PAP (P=0.003). Consolidation was also more frequently present in patients with ELP (83%) than in those with PAP (11%), which was statistically different (P=0.0265). In terms of the severity and extent, the crazy-paving pattern and reticulations on HRCT were significantly more extensive and severe in patients with PAP than in those with ELP. Conclusion: PAP and ELP with the crazy-paving pattern have several distinctive characteristics with respect to their HRCT findings as well as history of oil ingestion, and can therefore be distinguished from one another

  19. Lipoid proteinosis (Urbach-Wiethe disease: A case report

    Directory of Open Access Journals (Sweden)

    Munise Daye

    2014-12-01

    Full Text Available Lipoid proteinosis, which is known as “Urbach-Wiethe disease”, was first described in 1929 as “lipoidosis cutis et mucosae” by Urbach and Wiethe. It is a rare autosomal recessive inherited genodermatosis. There are PAS-positive hyaline material deposits in the skin, mucosa and visceral organs. A 23-year-old man, who was suffering from swelling of the lower lip and a fissure on the inner side of the lip, presented to our outpatient clinic. On dermatological examination, there were lower lip edema and infiltration, as well as macroglossia. There were bilateral yellowish papules along his eyelashes. For his ocular findings; it was learned that he had been treated for trichiasis at his childhood. There were multiple atrophic scars on his face, elbows, axilla, knees, and the skin overlying his spinous processes. He had no hoarseness. There was no consanguinity between his mother and father. Physical examination was normal. Three punch biopsies were carried out from his tongue, lips and elbow with the preliminary diagnoses of lipoid proteinosis, Melkersson-Rosenthal syndrome, focal epithelial hyperplasia, amyloidosis, granulomatous cheilitis, atrofoderma, and anetoderma. Deposition of hyaline PAS-positive materials was observed on his histopathological examination. According to the clinical and histopathological findings, the patient was diagnosed as having lipoid proteinosis. Otorhinolaryngologists, ophthalmologists, dermatologists, and neurologists should keep this rare condition in mind in the differential diagnosis.

  20. Analysis of fatty acids in Ghee and olive oil and their probable causal effect in lipoid pneumonia

    Directory of Open Access Journals (Sweden)

    Zein Mirghani

    2010-11-01

    Full Text Available Aim: To analyze and identify the fatty acids found in homemade ghee and in olive oil and compare those to fatty acids found in bronchoalevolar lavage of children with lipoid pneumonia.Methods: The fatty acids found in homemade fat ”Ghee” and olive oil were analyzed by gas chromatography. Methyl ester derivatives suitable for GC analysis were prepared directly from olive oil or from Ghee using anhydrous methanolic-HCl. Bronchoscopy and bronchoalevolar lavage was performed in eight children aged between 2 and 4 years, all with history of using homemade ghee and/or olive oil in the recumbent position.Results: The analysis of fatty acids in Ghee and olive oil show similar gas chromatographic pattern as those of bronchoalevolar lavage.Conclusion: The three fatty acids responsible for the deleterious effects of lipoid pneumonia were identified. Lipoid pneumonia should be one of the differentials diagnosis in children  presenting with respiratory distress. (Med J Indones 2010; 19:252-7Keywords: Bronchoalevolar lavage, gas chromatography, Ghee, methyl esters, lipoid pneumonia

  1. Radiological findings of congenital lipoid adrenal hyperplasia: a case report

    International Nuclear Information System (INIS)

    Kim, Mi Jeong; Shin, Joo Yong; Lee, Hee Jung; Lee, Jin Hee; Sohn, Cheol Ho; Lee, Sung Moon; Kim, Hong; Woo, Seong Ku; Suh, Soo Ji

    2001-01-01

    Congenital lipoid adrenal hyperplasia (CLAH) is a rare autosomal recessive disorder characterized by the marked accumulation of lipids and cholesterol in the adrenal cortex, and the failure of adrenal steroids to synthesise. We report the ultrasound (US), computed tomographic (CT), and magnetic resonance (MR) imaging findings in a four-day-old female neonate with CLAH

  2. Lipoid proteinosis.

    Science.gov (United States)

    Bozdağ, K E; Gül, Y; Karaman, A

    2000-03-01

    A 21-year-old man presented with a complaint of hoarseness as well as lesions along the eyelids and on his knees, elbows, and fingers. Hoarseness had developed in childhood, followed by lesions along the eyelids and on the elbows and fingers. He had developed lesions on the knees, feet, scrotum, penis, and axilla over the last 2 years. His parents were relatives, but nobody in the family showed similar features. His physical examination was normal. On dermatologic examination, there were beaded papules along the eyelids and small, yellow-white infiltrations on the tongue, buccal mucosa, palate, scrotum, and penis (Fig. 1). His tongue was firm and its mobility was limited. He also had infiltration of the frenulum (Fig. 2) and warty and hyperkeratotic papular and nodular lesions on the hands, knees, elbows (Fig. 3), and axilla. The laboratory findings and laryngoscopic examination were normal. Ophthalmologic, neurologic, and psychiatric examinations were also normal. Electroencephalogram (EEG), electromyogram (EMG), craniography, and cranial computed tomography (CT) scanning revealed no abnormality. The histopathologic examination of the skin biopsy specimens obtained from the axilla, elbow, and dorsum of the hand showed hyperkeratosis and periodic acid-Schiff-positive (PAS(+)) staining hyaline material around the dermal capillaries and sweat glands, and confirmed the diagnosis of lipoid proteinosis.

  3. Clinical Laboratory Tests in Some Acute Exogenous Poisonings.

    Science.gov (United States)

    Tufkova, Stoilka G; Yankov, Ivan V; Paskaleva, Diana A

    2017-09-01

    There is no specific toxicological screening of clinical laboratory parameters in clinical toxicology when it comes to acute exogenous poisoning. To determine routine clinical laboratory parameters and indicators for assessment of vital functions in patients with acute intoxications. One hundred and fifty-three patients were included in the present study. They were hospitalized in the Department of Clinical Toxicology at St. George University Hospital, Plovdiv for cerebral toxicity inducing medication (n = 45), alcohol (n = 40), heroin abuse (n = 33). The controls were 35. The laboratory tests were conducted in compliance with the standards of the clinical laboratory. We used the following statistical analyses: analysis of variance (the ucriterion of normal distribution, the Student's t-test, dispersion analysis based on ANOVA) and non-parametric analysis. Based on the routine hematological parameters with statistically significant changes in three groups of poisoning are: red blood cells, hematocrit, hemoglobin (except alcohol intoxication) and leukocytes. We found statistically significant changes in serum total protein, sodium and bilirubin. The highest statistical significance is the increased activity of AST and ALT. We present a model for selection of clinical laboratory tests for severe acute poisoning with modern equipment under standardized conditions. The results of the study suggest that the clinical laboratory constellation we used can be used as a mandatory element in the diagnosis of moderate and severe intoxication with the mentioned toxic substances.

  4. Exogenous hydrogen sulfide eliminates spatial memory retrieval impairment and hippocampal CA1 LTD enhancement caused by acute stress via promoting glutamate uptake.

    Science.gov (United States)

    He, Jin; Guo, Ruixian; Qiu, Pengxin; Su, Xingwen; Yan, Guangmei; Feng, Jianqiang

    2017-05-14

    Acute stress impairs the hippocampus-dependent spatial memory retrieval, and its synaptic mechanisms are associated with hippocampal CA1 long-term depression (LTD) enhancement in the adult rats. Endogenous hydrogen sulfide (H 2 S) is recognized as a novel gasotransmitter and has the neural protective roles. However, very little attention has been paid to understanding the effects of H 2 S on spatial memory retrieval impairment. We observed the protective effects of NaHS (a donor of H 2 S) against spatial memory retrieval impairment caused by acute stress and its synaptic mechanisms. Our results showed that NaHS abolished spatial memory retrieval impairment and hippocampal CA1 LTD enhancement caused by acute stress, but not by glutamate transporter inhibitor l-trans-pyrrolidine-2,4-dicarboxylic (tPDC), indicating that the activation of glutamate transporters is necessary for exogenous H 2 S to exert its roles. Moreover, NaHS restored the decreased glutamate uptake in the hippocampal CA1 synaptosomal fraction caused by acute stress. Dithiothreitol (DTT, a disulfide reducing agent) abolished a decrease in the glutamate uptake caused by acute stress, and NaHS eradicated the decreased glutamate uptake caused by 5,5'-dithio-bis(2-nitrobenzoic)acid (DTNB, a thiol oxidizing agent), collectively, revealing that exogenous H 2 S increases glutamate uptake by reducing disulfide bonds of the glutamate transporters. Additionally, NaHS inhibited the increased expression level of phosphorylated c-Jun-N-terminal kinase (JNK) in the hippocampal CA1 region caused by acute stress. The JNK inhibitor SP600125 eliminated spatial memory retrieval impairment, hippocampal CA1 LTD enhancement and the decreased glutamate uptake caused by acute stress, indicating that exogenous H 2 S exerts these roles by inhibiting the activation of JNK signaling pathway. Copyright © 2017 IBRO. Published by Elsevier Ltd. All rights reserved.

  5. Molecular analysis of lipoid proteinosis: identification of a novel nonsense mutation in the ECM1 gene in a Pakistani family

    Directory of Open Access Journals (Sweden)

    Naeem Muhammad

    2011-07-01

    Full Text Available Abstract Lipoid proteinosis is a rare autosomal recessive disease characterized by cutaneous and mucosal lesions and hoarseness appearing in early childhood that is caused by homozygous or compound heterozygous mutations in the ECM1 gene located on chromosome 1q21. The aim of the study was to investigate the molecular genetic defect underlying lipoid proteinosis in a consanguineous Pakistani family. Methods Genotyping of seven members of the family was performed by amplifying microsatellite markers, tightly linked to the ECM1 gene. To screen for mutations in the ECM1 gene, all of its exons and splice junctions were PCR amplified from genomic DNA and analyzed by SSCP and sequenced directly in an ABI 3130 genetic analyzer. Results The results revealed linkage of the LP family to the ECM1 locus. Sequence analysis of the coding exons and splice junctions of the ECM1 gene revealed a novel homozygous mutation (c.616C > T in exon 6, predicted to replace glutamine with stop codon (p.Q206X at amino acid position 206. Conclusions The finding of a novel mutation in Pakistani family extends the body of evidence that supports the importance of ECM1 gene for the development of lipoid proteinosis.

  6. Lipoid pneumonia: computed tomography findings - a case report

    International Nuclear Information System (INIS)

    Farias, Janos; Martins, Erick Malheiro Leoncio; Pozes, Aline Serfaty; Marchiori, Edson

    2004-01-01

    The authors report a case of lipoid pneumonia in an 80 year old man with chronic constipation in regular use of mineral oil as a laxative. According to his family, he experienced coughing episodes when he took his medication. He also presented dyspnoea at rest and diminished consciousness levels. Chest radiographs showed a consolidation area in the posterior segment of right upper lobe, which did not change on successive exams. High resolution computed tomography demonstrated low-density consolidation with negative Hounsfield units (-29 to -83 UH) and ground-glass opacities in the right upper lobe and inferior lobes. These opacities predominated in the posterior regions of the lungs. The diagnosis was confirmed by the presence of oil material on bronchoalveolar washing. The patient was advised to discontinue the ingestion of mineral oil and did not return for follow-up. (author)

  7. Pollinator-independent orchid attracts biotic pollinators due the production of lipoidal substances.

    Science.gov (United States)

    Pansarin, E R; Bergamo, P J; Ferreira-Caliman, M J

    2018-03-01

    Flowering plants often depend on the attraction of biotic pollinators for sexual reproduction. Consequently, the emergence and maintenance of selected floral attributes related to pollinator attraction and rewarding are driven by pollinator pressure. In this paper we explore the effect of pollinators, rainfall, temperature and air humidity on the reproduction of a Brazilian terrestrial orchid, Cranichis candida based on data of phenology, flower resources, olfactory and visual attraction cues, pollinators and breeding system. The flowers of C. candida are strongly protandrous and pollinated by workers of the social native bee Tetragonisca angustula. The bees collect labellar lipoidal substances (wax scales), which are transported to the nest. The lipoidal substance is composed of sterols, hydrocarbons and terpenes. The last presumably protects the bees and their nests against pathogens and other arthropods. C. candida sets fruits through biotic self- and cross-pollination, and spontaneously due the action of raindrops on flowers. Our results indicate that in C. candida, although rain-mediated spontaneous self-pollination happens, fructification mediated by biotic pollinations also occurs, which may result in fruit set by cross-pollination. A mixed pollination system must result in higher genetic variability when compared to species whose fruits are produced entirely by self-pollination. On the other hand, autogamy is a form of reproductive assurance, and has commonly evolved where pollination services are rare or absent. © 2017 German Society for Plant Sciences and The Royal Botanical Society of the Netherlands.

  8. The impact of acute psychosocial stress on magnetoencephalographic correlates of emotional attention and exogenous visual attention.

    Directory of Open Access Journals (Sweden)

    Ludger Elling

    Full Text Available Stress-induced acute activation of the cerebral catecholaminergic systems has often been found in rodents. However, little is known regarding the consequences of this activation on higher cognitive functions in humans. Theoretical inferences would suggest increased distractibility in the sense of increased exogenous attention and emotional attention. The present study investigated the influence of acute stress responses on magnetoencephalographic (MEG correlates of visual attention. Healthy male subjects were presented emotional and neutral pictures in three subsequent MEG recording sessions after being exposed to a TSST-like social stressor, intended to trigger a HPA-response. The subjects anticipation of another follow-up stressor was designed to sustain the short-lived central catecholaminergic stress reactions throughout the ongoing MEG recordings. The heart rate indicates a stable level of anticipatory stress during this time span, subsequent cortisol concentrations and self-report measures of stress were increased. With regard to the MEG correlates of attentional functions, we found that the N1m amplitude remained constantly elevated during stressor anticipation. The magnetic early posterior negativity (EPNm was present but, surprisingly, was not at all modulated during stressor anticipation. This suggests that a general increase of the influence of exogenous attention but no specific effect regarding emotional attention in this time interval. Regarding the time course of the effects, an influence of the HPA on these MEG correlates of attention seems less likely. An influence of cerebral catecholaminergic systems is plausible, but not definite.

  9. The impact of acute psychosocial stress on magnetoencephalographic correlates of emotional attention and exogenous visual attention.

    Science.gov (United States)

    Elling, Ludger; Schupp, Harald; Bayer, Janine; Bröckelmann, Ann-Kathrin; Steinberg, Christian; Dobel, Christian; Junghofer, Markus

    2012-01-01

    Stress-induced acute activation of the cerebral catecholaminergic systems has often been found in rodents. However, little is known regarding the consequences of this activation on higher cognitive functions in humans. Theoretical inferences would suggest increased distractibility in the sense of increased exogenous attention and emotional attention. The present study investigated the influence of acute stress responses on magnetoencephalographic (MEG) correlates of visual attention. Healthy male subjects were presented emotional and neutral pictures in three subsequent MEG recording sessions after being exposed to a TSST-like social stressor, intended to trigger a HPA-response. The subjects anticipation of another follow-up stressor was designed to sustain the short-lived central catecholaminergic stress reactions throughout the ongoing MEG recordings. The heart rate indicates a stable level of anticipatory stress during this time span, subsequent cortisol concentrations and self-report measures of stress were increased. With regard to the MEG correlates of attentional functions, we found that the N1m amplitude remained constantly elevated during stressor anticipation. The magnetic early posterior negativity (EPNm) was present but, surprisingly, was not at all modulated during stressor anticipation. This suggests that a general increase of the influence of exogenous attention but no specific effect regarding emotional attention in this time interval. Regarding the time course of the effects, an influence of the HPA on these MEG correlates of attention seems less likely. An influence of cerebral catecholaminergic systems is plausible, but not definite.

  10. High-pressure liquid chromatographic analysis of pramoxine hydrochloride in high lipoid aerosol foam dosage form.

    Science.gov (United States)

    Weinberger, R; Mann, B; Posluszny, J

    1980-04-01

    A rapid and quantitative method for the determination of pramoxine hydrochloride by high-pressure liquid chromatography is presented. The drug is extracted as the salt from a preparation with a high lipoid composition by partitioning it to the aqueous phase of an ether-methanol-water-acetic acid system. The extract is chromatographed on an octadecylsilane bonded packing with a methanol-water-acetic acid-methanesulfonic acid mobile phase. The time required for each separation is approximately 6 min. Analytical recoveries of 100.4 +/- 1.5% were obtained.

  11. Marker of Bone Resorption in Acute Response to Exogenous or Endogenous Parathyroid Hormone

    Directory of Open Access Journals (Sweden)

    Vit Zikan

    2008-01-01

    Full Text Available Parathyroid hormone (PTH changes morphology of osteoclasts within minutes after its systemic administration. The aim of our study was to test in healthy men whether both exogenous and endogenous PTH could change acutely (minutes to hours the serum cross-linked C-telopeptide of type I collagen (beta CTX, which is released during osteoclastic resorption of bone. Twelve healthy men (age range 24–34 yr were each studied during 180 min on a control period, after a single subcutaneous injection of teriparatide, and after 30 min EDTA infusion to stimulate endogenous PTH secretion. The tests were started after overnight fast, 3 h after a standard calcium load. The EDTA infusion induced a significant decrease in serum ionized calcium (by 8.5% at 33 min and a significant increase in plasma PTH (by 305% at 33 min. Both the EDTA and teriparatide resulted in a significant increase in beta CTX (p < 0.001 with maximum increases of 64% and 80%, respectively. A mild, but significant decrease in beta CTX was observed during the control test period. In conclusion, single-dose teriparatide injection as well as a stimulation of endogenous PTH in healthy men results in an acute increase of the bone resorption marker.

  12. Influence of long-term drinking alcohol on the cytokines in the rats with endogenous and exogenous lung injury.

    Science.gov (United States)

    Liu, Y D; Liu, W; Liu, Z

    2013-02-01

    Acute lung injury (ALI) and the acute respiratory distress syndrome (ARDS) are syndromes of acute respiratory failure. Exploration of the impacts of long-term drinking alcohol on the cytokines of rats with endogenous and exogenous lung injuries. Through giving the model rats long-term drinking alcohol or water, we acquired the changes of the cytokines in the serum and bronchoalveolar lavage fluid (BALF) of these rats with lung injuries due to different incentives. The partial pressure of oxygen in rats with lung damage after long-term drinking alcohol were significantly lower than those drinking water group (p exogenous lung injury were higher than those of rats with endogenous lung injury (p endogenous lung injury were higher than those with exogenous lung injury (p exogenous lung injury. The expression of TNF-α, IL-6 and IL-10 are different according to the different ways that lead to the acute lung injury.

  13. The mechanism of exogenous adiponectin in the prevention of no-reflow phenomenon in type 2 diabetic patients with acute myocardial infarction during PCI treatment.

    Science.gov (United States)

    Zhang, C-J; Deng, Y-Z; Lei, Y-H; Zhao, J-B; Wei, W; Li, Y-H

    2018-04-01

    To investigate the mechanism of exogenous adiponectin in the prevention of no-reflow phenomenon in type 2 diabetic (T2DM) patients with acute myocardial infarction (AMI) during percutaneous coronary intervention (PCI) treatment. 66 patients were randomly divided into control group and observation group, 33 cases in each group. According to the percutaneous coronary intervention (PCI) emergency treatment principle, patients from the control group were treated with an intracoronary injection of adenosine combined with a micro-pump intravenous infusion of tirofiban. Patients from the observation group were injected with exogenous adiponectin in addition to the adenosine and tirofiban treatments. There were no significant differences in gender, age, location of the target lesion, degree of stenosis, stent implantation number, length and the inner diameter between control and observation group (p > 0.05). Lower frequent of slow blood flow and no-reflow and shorter interventional procedures were observed in observation group compared with those of control group (p Exogenous adiponectin further reduced the no-reflow phenomenon during PCI treatment of the patients with T2DM combined with AMI. The function of exogenous adiponectin is associated with the reduced myocardial and endothelial cell injury and the inhibited inflammation and apoptosis. The application of exogenous adiponectin can significantly improve the clinical outcomes.

  14. Variability of individual normal tissue radiation sensitivity. An international empirical evaluation of endogenous and exogenous

    International Nuclear Information System (INIS)

    Zimmermann, J.S.; Kumpf, L.; Kimmig, B.

    1998-01-01

    Background: The variability of normal-tissue response is of major concern for radiation therapy. Multiple endogenous and exogenous factors are qualitatively known to alter the acute and late tissue response. Which of them are regarded most important by the European radiation oncologists and what is, empirically, their quantitative influence on the acute or late tissue tolerance? Methods: In August 1997, we sent a questionnaire to 255 European radiation oncology departments. Among others, the questionnaire asked for endogenous and exogenous factors modifying the tissue response to radiation therapy and their quantitative influence on the acute and late radiation morbidity (TD5/5). Fifty-five questionnaires (21.5%) were answered. Results: Empirically, the most important endogenous factors to modify the acute tissue tolerance are (a) metabolic/other diseases with macro- or microangiopathia (17 answers [a]/32% mean decrease of tissue tolerance), (b) collagen diseases (9 a/37%) and (c) immune diseases (5 a/53%). As endogenous response modifiers for the TD5/5 are recognized (a) metabolic or other diseases leading to marcro- or microangiopathia (15 a/31%), (b) collagen diseases (11 a/38%) and (c) immune diseases (2 a/50%). Inflammations from any reason are assumed to alter the acute tissue tolerance by (6 a/26%) and the TD5/5 by (10 a/24%). Exogenous modifiers of the acute tissue response mentioned are (a) smoking (34 a/44%), (b) alcohol (23 a/45%), (c) nutrition/diets (16 a/45%), (d) hygiene (9 a/26%) and (e) medical therapies (10 a/37%). Exogenous factors assumed to influence the TD5/5 are (a) smoking (22 a/40%), (b) alcohol (15 a/38%), (c) nutrition/diets (9 a/48%), (d) hygiene (5 a/34%) and (e) medical therapies (10 a/30%). Conclusions: Exogenous factors are regarded more important by number and extent on the acute and late tissue response than endogenous modifiers. Both may have an important influence on the individual expression of normal tissue response. (orig

  15. ACUTE EXOGENOUS INTOXICATIONS WITH ORGANOPHOSPHORUS PESTICIDES: DURATION OF THE HOSPITAL TREATMENT AND CLINICAL CRITERIA FOR PROGNOSIS

    Directory of Open Access Journals (Sweden)

    Petko Marinov

    2017-05-01

    Full Text Available Purpose: Several criteria have been suggested to estimate the intoxication severity, yet so far no system of clinical criteria has been developed to determine the duration of hospitalisation. The forecast is linked to the influence of the extended corrected QT interval and GCS (Glasgow Coma Scale on the frequency of the developing acute pulmonary insufficiency and lethality. The average duration of hospital treatment is also crucial. First of all, it is determined by the intoxication severity and lasts from 3 to 26 days. The aim of this study is to develop an individual forecast about the duration of hospitalisation for patients suffering from acute exogenous intoxication with organophosphorus pesticides (OPP. Materials/Methods: The subjects are 160 patients. We use statistical regression analysis to study the significance of 5 of the most typical clinical indicators of organophosphorus intoxication on the duration of hospitalisation: type of conscience, presence of spasms, pulmonary oedema, shock and multi-organ insufficiency syndrome (MOIS. To forecast the treatment length, we obtain simplified mathematical expressions in the form of score estimates. Results: The significance of the clinical indicators “MOIS”, “conscience” and “spasm” has been confirmed. A forecast matrix that gives the opportunity to forecast the personal duration of hospital treatment for each patient has been built.

  16. Removal of nitrobenzene from aqueous solution by a novel lipoid adsorption material (LAM)

    Energy Technology Data Exchange (ETDEWEB)

    Wen, Qinxue [State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology (SKLUWRE, HIT), Harbin 150090 (China); Chen, Zhiqiang, E-mail: czq0521@tom.com [State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology (SKLUWRE, HIT), Harbin 150090 (China); Lian, Jiaxiang; Feng, Yujie; Ren, Nanqi [State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology (SKLUWRE, HIT), Harbin 150090 (China)

    2012-03-30

    Highlights: Black-Right-Pointing-Pointer We synthesized a novel adsorbent-lipoid adsorption material (LAM). Black-Right-Pointing-Pointer We investigate the adsorption behavior isotherms of nitrobenzene on LAM. Black-Right-Pointing-Pointer We investigate the adsorption kinetics of nitrobenzene on LAM. Black-Right-Pointing-Pointer We proved that the reaction is spontaneous and is an exothermic reaction. Black-Right-Pointing-Pointer The removal efficiency of LAM was higher than that of GAC. - Abstract: In this study, a novel adsorbent referred to as a lipoid adsorption material (LAM) was synthesized with a hydrophobic nucleolus (triolein) and hydrophilic membrane structure (polyamide). The LAM was applied to the adsorption and removal of nitrobenzene from aqueous systems. Experiments were carried out to investigate the adsorption behavior of nitrobenzene on LAM, including the development of adsorption isotherms, the determination of adsorption kinetics, and to explore the influence of adsorbent dosage, contact time, temperature and the initial concentration of nitrobenzene on adsorption. The performance of LAM was compared with equal amounts of granular activated carbon (GAC) for adsorption. The adsorption isotherms for LAM were found to be described by the Linear equation, while the adsorption isotherms for granular activated carbon (GAC) were described by the Freundlich equation. Results indicated that the adsorption of nitrobenzene by LAM occurred mainly due to the partition function caused by the triolein nucleolus. Two kinetics models, pseudo-first-order and pseudo-second-order models were used to fit the experimental data for LAM adsorption. By comparing the correlation coefficients, it was found that the pseudo-first-order model was most suitable to describe the adsorption of nitrobenzene on LAM. The results also indicated that the factors that affect the adsorption rate would be either the nitrobenzene concentration or the character of the adsorbent

  17. Removal of nitrobenzene from aqueous solution by a novel lipoid adsorption material (LAM)

    International Nuclear Information System (INIS)

    Wen, Qinxue; Chen, Zhiqiang; Lian, Jiaxiang; Feng, Yujie; Ren, Nanqi

    2012-01-01

    Highlights: ► We synthesized a novel adsorbent-lipoid adsorption material (LAM). ► We investigate the adsorption behavior isotherms of nitrobenzene on LAM. ► We investigate the adsorption kinetics of nitrobenzene on LAM. ► We proved that the reaction is spontaneous and is an exothermic reaction. ► The removal efficiency of LAM was higher than that of GAC. - Abstract: In this study, a novel adsorbent referred to as a lipoid adsorption material (LAM) was synthesized with a hydrophobic nucleolus (triolein) and hydrophilic membrane structure (polyamide). The LAM was applied to the adsorption and removal of nitrobenzene from aqueous systems. Experiments were carried out to investigate the adsorption behavior of nitrobenzene on LAM, including the development of adsorption isotherms, the determination of adsorption kinetics, and to explore the influence of adsorbent dosage, contact time, temperature and the initial concentration of nitrobenzene on adsorption. The performance of LAM was compared with equal amounts of granular activated carbon (GAC) for adsorption. The adsorption isotherms for LAM were found to be described by the Linear equation, while the adsorption isotherms for granular activated carbon (GAC) were described by the Freundlich equation. Results indicated that the adsorption of nitrobenzene by LAM occurred mainly due to the partition function caused by the triolein nucleolus. Two kinetics models, pseudo-first-order and pseudo-second-order models were used to fit the experimental data for LAM adsorption. By comparing the correlation coefficients, it was found that the pseudo-first-order model was most suitable to describe the adsorption of nitrobenzene on LAM. The results also indicated that the factors that affect the adsorption rate would be either the nitrobenzene concentration or the character of the adsorbent. Thermodynamic calculations indicated that the adsorption of nitrobenzene on LAM was spontaneous and was an exothermic reaction. With

  18. Research on the Relationships between Endogenous Biomarkers and Exogenous Toxic Substances of Acute Toxicity in Radix Aconiti.

    Science.gov (United States)

    Zhou, Haonan; Zhang, Pengjie; Hou, Zhiguo; Xie, Jiabin; Wang, Yuming; Yang, Bin; Xu, Yanyan; Li, Yubo

    2016-11-25

    Radix Aconiti , a classic traditional Chinese medicine (TCM), has been widely used throughout China for disease treatment due to its various pharmacological activities, such as anti-inflammatory, cardiotonic, and analgesic effects. However, improper use of Radix Aconiti often generated severe acute toxicity. Currently, research on the toxic substances of Radix Aconiti is not rare. In our previous study, acute toxic biomarkers of Radix Aconiti have been found. However, few studies were available to find the relationships between these endogenous biomarkers and exogenous toxic substances. Therefore, in this study, toxic substances of Radix Aconiti have been found using UPLC-Q-TOF-MS technology. Then, we used biochemical indicators as a bridge to find the relationships between biomarkers and toxic substances of Radix Aconiti through Pearson correlation analysis and canonical correlation analysis (CCA). Finally, the CCA results showed that LysoPC(22:5) is related to 14-acetyl-talatisamine, mesaconitine, talatisamine and deoxyaconitine in varying degrees; l-acetylcarnitine is negatively correlated with deoxyaconitine and demethyl-14-acetylkaracoline; shikimic acid has a good correlation with karacoline, demethyl-14-acetylkaracoline and deoxyaconitine; and valine is correlated with talatisamine and deoxyaconitine. Research on these relationships provides an innovative way to interpret the toxic mechanism of traditional Chinese medicine, and plays a positive role in the overall study of TCM toxicity.

  19. Exogenous lipid pneumonia

    International Nuclear Information System (INIS)

    Bernasconi, A.; Gavelli, G.; Zompatori, M.; Galleri, C.; Zanasi, A.; Fabbri, M.; Bazzocchi, F.

    1988-01-01

    Exogenous lipid pneumonia (ELP) is caused by the aspiration of animal, vegetal or, more often, mineral oils. Even though it may also be acute, ELP is most frequently a chronic disease, affecting people with predisposing factors, such as neuromuscular disorders, structural abnormalities and so on; very often exogenous lipid pneumonia is found in tracheotomized patients. The pathology of lipid pneumonia is a chronic inflammatory process evolving in foreign-body-like reaction, and eventually in ''end-stage lung'' condition. Clinically, most patients are asymptomatic; few cases only present with cough, dyspnea and chest pain. Eight cases of ELP, studied over the past 3 years, are described in this paper. All the patients were examined by chest radiographs and standard tomograms; 3 patients underwent CT. X-ray features were mono/bilateral consolidation of the lower zones, with air bronchogram and variable reduction in volume. CT density was not specific for fat tissue. In all cases the diagnosis was confirmed at biopsy. In 5 patients, followed for at least one year, clinical-radiological features showed no change. Thus, complications of ELP (especially malignant evolution) could be excluded. The authors conclude that lipid pneumonia must be considered in differential diagnosis of patients with history of usage of oils and compatible X-ray findings. The usefulness of an accurate follow-up is stressed

  20. Research on the Relationships between Endogenous Biomarkers and Exogenous Toxic Substances of Acute Toxicity in Radix Aconiti

    Directory of Open Access Journals (Sweden)

    Haonan Zhou

    2016-11-01

    Full Text Available Radix Aconiti, a classic traditional Chinese medicine (TCM, has been widely used throughout China for disease treatment due to its various pharmacological activities, such as anti-inflammatory, cardiotonic, and analgesic effects. However, improper use of Radix Aconiti often generated severe acute toxicity. Currently, research on the toxic substances of Radix Aconiti is not rare. In our previous study, acute toxic biomarkers of Radix Aconiti have been found. However, few studies were available to find the relationships between these endogenous biomarkers and exogenous toxic substances. Therefore, in this study, toxic substances of Radix Aconiti have been found using UPLC-Q-TOF-MS technology. Then, we used biochemical indicators as a bridge to find the relationships between biomarkers and toxic substances of Radix Aconiti through Pearson correlation analysis and canonical correlation analysis (CCA. Finally, the CCA results showed that LysoPC(22:5 is related to 14-acetyl-talatisamine, mesaconitine, talatisamine and deoxyaconitine in varying degrees; l-acetylcarnitine is negatively correlated with deoxyaconitine and demethyl-14-acetylkaracoline; shikimic acid has a good correlation with karacoline, demethyl-14-acetylkaracoline and deoxyaconitine; and valine is correlated with talatisamine and deoxyaconitine. Research on these relationships provides an innovative way to interpret the toxic mechanism of traditional Chinese medicine, and plays a positive role in the overall study of TCM toxicity.

  1. The insulinotropic effect of exogenous GLP-1 is not affected by acute vagotomy in anaesthetized pigs

    DEFF Research Database (Denmark)

    Veedfald, Simon; Hansen, Marie; Christensen, Louise Wulff

    2016-01-01

    importance? We found no effect of truncal vagotomy on the insulinotropic effect of exogenous GLP-1 and speculate that high circulating levels of GLP-1 after intravenous infusion may have overshadowed any neural signalling component. We propose that further investigations in to the possible vagal afferent...... the vagal trunks were severed in 4/6 groups (vagal trunks were left intact in 2/6 groups), whereupon all infusions were repeated. We found no effect of vagotomy on insulin or glucagon secretion during administration of exogenous GLP-1 in any experiment. We speculate that the effect of exogenous GLP-1...

  2. Lipoid pneumonia: computed tomography findings - a case report; Pneumonia lipidica: aspectos na tomografia computadorizada - relato de caso

    Energy Technology Data Exchange (ETDEWEB)

    Farias, Janos; Martins, Erick Malheiro Leoncio; Pozes, Aline Serfaty; Marchiori, Edson [Universidade Federal Fluminense, Niteroi, RJ (Brazil). Dept. de Radiologia; Fialho, Suzane Mansur [Clinica Radiologica Emilio Amorim, Rio de Janeiro, RJ (Brazil)

    2004-02-01

    The authors report a case of lipoid pneumonia in an 80 year old man with chronic constipation in regular use of mineral oil as a laxative. According to his family, he experienced coughing episodes when he took his medication. He also presented dyspnoea at rest and diminished consciousness levels. Chest radiographs showed a consolidation area in the posterior segment of right upper lobe, which did not change on successive exams. High resolution computed tomography demonstrated low-density consolidation with negative Hounsfield units (-29 to -83 UH) and ground-glass opacities in the right upper lobe and inferior lobes. These opacities predominated in the posterior regions of the lungs. The diagnosis was confirmed by the presence of oil material on bronchoalveolar washing. The patient was advised to discontinue the ingestion of mineral oil and did not return for follow-up. (author)

  3. Exogenous deposits

    International Nuclear Information System (INIS)

    Khasanov, A.Kh.

    1988-01-01

    Exogenous deposits forming as a result of complex exogenous processes, passed under the influence of outside forces on the Earth surface. To them relate physical and chemical weathering, decomposition and decay of mineral masses, redistribution and transportation of material, forming and deposit of new minerals and ores steady on the earth surface conditions

  4. Diminished adrenal sensitivity to endogenous and exogenous adrenocorticotropic hormone in critical illness: a prospective cohort study.

    Science.gov (United States)

    de Jong, Margriet F C; Molenaar, Nienke; Beishuizen, Albertus; Groeneveld, A B Johan

    2015-01-06

    Adrenal dysfunction may represent critical illness-related corticosteroid insufficiency (CIRCI), as evidenced by a diminished cortisol response to exogenous adrenocorticotropic hormone (ACTH), but this concept and its clinical significance remain highly controversial. We studied the adrenal response to exogenous ACTH as a function of the endogenous cortisol-to-ACTH ratio, a measure of adrenal sensitivity, and of clinical variables, during critical illness and recovery from the acute phase. We prospectively included 59 consecutive septic and nonseptic patients in the intensive care unit with treatment-insensitive hypotension in whom CIRCI was suspected; patients having received etomidate and prolonged corticosteroids were excluded. An ACTH test (250 μg) was performed, followed by a second test after ≥7 days in acute-phase survivors. Serum total and free cortisol, ACTH, and clinical variables were assessed. Patients were divided according to responses (delta, Δ) of cortisol to ACTH at the first and second tests. Patients with low (endogenous ACTH predicts a low increase of cortisol to exogenous ACTH, suggesting adrenal dysfunction, irrespective of the stage of disease. The data further suggest a role of disease severity and culture-positive sepsis.

  5. CT and HR-CT of exogenous allergic alveolitis

    International Nuclear Information System (INIS)

    Lederer, A.; Kullnig, P.; Pongratz, M.

    1992-01-01

    The CT changes on conventional and high resolution CT in 14 patients with exogeneous allergic alveolitis (EAA) were analysed retrospectively. There were 8 patients with clinically subacute disease, 5 patients in a chronic stage and 1 patient with acute EAA. The appearances and their distribution were examined. Seven of the 8 patients in the subacute stage showed a ground glass pattern and multiple nodules of less than 2 mm. All patients in the chronic stage showed a combination of fine infiltrates, small nodules and irregular linear densities; distortion of the pulmonary pattern was present in 3 cases. The patient with acute EAA showed diffuse dense areas of consolidation in both lungs as well as multiple nodules and a ground glass pattern. The CT appearances of EAA correspond with the basic micropathology and, within the clinical context, permit diagnostic classification. (orig.) [de

  6. Is Money Really Exogenous? Testing for Weak Exogeneity in Swiss Money Demand.

    OpenAIRE

    Fischer, Andreas M

    1993-01-01

    Although exogeneity is often associated with controllable policy variables, Engle, Hendry, and Richard (1983) show that the one condition is neither necessary nor sufficient for the other. Whether variables such as monetary aggregates are (weakly) exogenous depends on the conditioning properties of the data generating process. Testing exogeneity claims represents an important step in analyzing money demand functions. Although Switzerland adheres to fairly strict monetarist prescriptions, we r...

  7. The effects of exogenous surfactant administration on ventilation-induced inflammation in mouse models of lung injury.

    Science.gov (United States)

    Puntorieri, Valeria; Hiansen, Josh Qua; McCaig, Lynda A; Yao, Li-Juan; Veldhuizen, Ruud A W; Lewis, James F

    2013-11-20

    Mechanical ventilation (MV) is an essential supportive therapy for acute lung injury (ALI); however it can also contribute to systemic inflammation. Since pulmonary surfactant has anti-inflammatory properties, the aim of the study was to investigate the effect of exogenous surfactant administration on ventilation-induced systemic inflammation. Mice were randomized to receive an intra-tracheal instillation of a natural exogenous surfactant preparation (bLES, 50 mg/kg) or no treatment as a control. MV was then performed using the isolated and perfused mouse lung (IPML) set up. This model allowed for lung perfusion during MV. In experiment 1, mice were exposed to mechanical ventilation only (tidal volume =20 mL/kg, 2 hours). In experiment 2, hydrochloric acid or air was instilled intra-tracheally four hours before applying exogenous surfactant and ventilation (tidal volume =5 mL/kg, 2 hours). For both experiments, exogenous surfactant administration led to increased total and functional surfactant in the treated groups compared to the controls. Exogenous surfactant administration in mice exposed to MV only did not affect peak inspiratory pressure (PIP), lung IL-6 levels and the development of perfusate inflammation compared to non-treated controls. Acid injured mice exposed to conventional MV showed elevated PIP, lung IL-6 and protein levels and greater perfusate inflammation compared to air instilled controls. Instillation of exogenous surfactant did not influence the development of lung injury. Moreover, exogenous surfactant was not effective in reducing the concentration of inflammatory cytokines in the perfusate. The data indicates that exogenous surfactant did not mitigate ventilation-induced systemic inflammation in our models. Future studies will focus on altering surfactant composition to improve its immuno-modulating activity.

  8. Exogenous cortisol acutely influences motivated decision making in healthy young men.

    Science.gov (United States)

    Putman, Peter; Antypa, Niki; Crysovergi, Panagiota; van der Does, Willem A J

    2010-02-01

    The glucocorticoid (GC) hormone cortisol is the end product of the hypothalamic-pituitary-adrenal axis (HPA axis). Acute psychological stress increases HPA activity and GC release. In humans, chronic disturbances in HPA activity have been observed in affective disorders and in addictive behaviour. Recent research indicates that acute effects of GCs may be anxiolytic and increase reward sensitivity. Furthermore, cortisol acutely influences early cognitive processing of emotional stimuli. In order to extend such findings to more complex emotional-cognitive behaviour, the present study tested acute effects of 40 mg cortisol on motivated decision making in 30 healthy young men. Results showed that cortisol indeed increased risky decision making, as predicted. This effect occurred for decisions where making a risky choice could potentially yield a big reward. These results are discussed with respect to currently proposed mechanisms for cortisol's potential anxiolytic effect and GCs' involvement in reward systems.

  9. Exogenous fatty acid metabolism in bacteria.

    Science.gov (United States)

    Yao, Jiangwei; Rock, Charles O

    2017-10-01

    Bacterial type II fatty acid synthesis (FASII) is a target for novel antibiotic development. All bacteria encode for mechanisms to incorporate exogenous fatty acids, and some bacteria can use exogenous fatty acids to bypass FASII inhibition. Bacteria encode three different mechanisms for activating exogenous fatty acids for incorporation into phospholipid synthesis. Exogenous fatty acids are converted into acyl-CoA in Gammaproteobacteria such as E. coli. Acyl-CoA molecules constitute a separate pool from endogenously synthesized acyl-ACP. Acyl-CoA can be used for phospholipid synthesis or broken down by β-oxidation, but cannot be used for lipopolysaccharide synthesis. Exogenous fatty acids are converted into acyl-ACP in some Gram-negative bacteria. The resulting acyl-ACP undergoes the same fates as endogenously synthesized acyl-ACP. Exogenous fatty acids are converted into acyl-phosphates in Gram-positive bacteria, and can be used for phospholipid synthesis or become acyl-ACP. Only the order Lactobacillales can use exogenous fatty acids to bypass FASII inhibition. FASII shuts down completely in presence of exogenous fatty acids in Lactobacillales, allowing Lactobacillales to synthesize phospholipids entirely from exogenous fatty acids. Inhibition of FASII cannot be bypassed in other bacteria because FASII is only partially down-regulated in presence of exogenous fatty acid or FASII is required to synthesize essential metabolites such as β-hydroxyacyl-ACP. Certain selective pressures such as FASII inhibition or growth in biofilms can select for naturally occurring one step mutations that attenuate endogenous fatty acid synthesis. Although attempts have been made to estimate the natural prevalence of these mutants, culture-independent metagenomic methods would provide a better estimate. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  10. Investigation of rare chronic lipoid pneumonia associated with occupational exposure to paraffin aerosol.

    Science.gov (United States)

    Han, Chenghong; Liu, Lihai; Du, Shiping; Mei, Jianhua; Huang, Ling; Chen, Min; Lei, Yongliang; Qian, Junwen; Luo, Jianyong; Zhang, Meibian

    2016-09-30

    Occupational exposure to paraffin is an infrequent cause of lipoid pneumonia (LP) and related data are scare. We investigated the possible relationship between three rare cases of chronic LP and occupational exposure to paraffin aerosol in an iron foundry. The three cases of LP and their workplaces were investigated using data from field investigations, air monitoring, pulmonary radiological examinations, cell staining, and lung biopsies. The patients had long-term occupational exposure to paraffin. X-ray diffraction testing revealed that the raw material from the workshop was paraffin crystal. The air concentrations of paraffin aerosol in workplaces were significantly higher than outdoor background levels. Small diffuse and miliary shadows with unclear edges were observed throughout the whole lungs via radiography. Computed tomography revealed diffuse punctate nodules and a high density of stripe-like shadows in both lungs (ground-glass opacity in a lower lobe, and a mass-like lesion and high translucent area near the bottom of the lung). Lipid-laden macrophages were found in the sputum and bronchial lavage. A broadened alveolar septum and local focal fibrosis were also discovered via lung biopsy. The inflammatory reaction in the lung tissues appeared to resolve over time. These three rare cases of chronic LP in workers during molding and repair processes were associated with occupational paraffin aerosol exposure. Therefore, primary prevention is essential for molding or repairing workers in the iron foundry, and a differential diagnosis of occupational chronic LP (vs. pneumoconiosis) should be considered when treating these workers.

  11. Exogenous lipoid pneumonia caused by Nigella sativa oil – A case report

    Directory of Open Access Journals (Sweden)

    K. Bouti

    2013-10-01

    The patient was advised to stop taking N. sativa oil. The only treatment that was instituted was N-acetylcysteine. A clinically significant change in symptoms and chest radiograph was observed. The patient has remained stable 18 months after the diagnosis.

  12. Exogenous vs. Endogenous Separation

    OpenAIRE

    Ramey, Garey

    2008-01-01

    This paper assesses how various approaches to modelling the separation margin a¤ect the ability of the Mortensen-Pissarides job matching model to explain key facts about the aggregate labor market. Allowing for realistic time variation in the separation rate, whether exogenous or endogenous, greatly in- creases the unemployment variability generated by the model. Speci…cations with exogenous separation rates, whether constant or time-varying, fail to pro- duce realistic volatility and prod...

  13. Exogenous surfactant application in a rat lung ischemia reperfusion injury model: effects on edema formation and alveolar type II cells

    Directory of Open Access Journals (Sweden)

    Richter Joachim

    2008-01-01

    Full Text Available Abstract Background Prophylactic exogenous surfactant therapy is a promising way to attenuate the ischemia and reperfusion (I/R injury associated with lung transplantation and thereby to decrease the clinical occurrence of acute lung injury and acute respiratory distress syndrome. However, there is little information on the mode by which exogenous surfactant attenuates I/R injury of the lung. We hypothesized that exogenous surfactant may act by limiting pulmonary edema formation and by enhancing alveolar type II cell and lamellar body preservation. Therefore, we investigated the effect of exogenous surfactant therapy on the formation of pulmonary edema in different lung compartments and on the ultrastructure of the surfactant producing alveolar epithelial type II cells. Methods Rats were randomly assigned to a control, Celsior (CE or Celsior + surfactant (CE+S group (n = 5 each. In both Celsior groups, the lungs were flush-perfused with Celsior and subsequently exposed to 4 h of extracorporeal ischemia at 4°C and 50 min of reperfusion at 37°C. The CE+S group received an intratracheal bolus of a modified natural bovine surfactant at a dosage of 50 mg/kg body weight before flush perfusion. After reperfusion (Celsior groups or immediately after sacrifice (Control, the lungs were fixed by vascular perfusion and processed for light and electron microscopy. Stereology was used to quantify edematous changes as well as alterations of the alveolar epithelial type II cells. Results Surfactant treatment decreased the intraalveolar edema formation (mean (coefficient of variation: CE: 160 mm3 (0.61 vs. CE+S: 4 mm3 (0.75; p 3 (0.90 vs. CE+S: 0 mm3; p 3 (0.39 vs. CE+S: 268 mm3 (0.43; p 3(0.10 and CE+S (481 μm3(0.10 compared with controls (323 μm3(0.07; p Conclusion Intratracheal surfactant application before I/R significantly reduces the intraalveolar edema formation and development of atelectases but leads to an increased development of

  14. Visible propagation from invisible exogenous cueing.

    Science.gov (United States)

    Lin, Zhicheng; Murray, Scott O

    2013-09-20

    Perception and performance is affected not just by what we see but also by what we do not see-inputs that escape our awareness. While conscious processing and unconscious processing have been assumed to be separate and independent, here we report the propagation of unconscious exogenous cueing as determined by conscious motion perception. In a paradigm combining masked exogenous cueing and apparent motion, we show that, when an onset cue was rendered invisible, the unconscious exogenous cueing effect traveled, manifesting at uncued locations (4° apart) in accordance with conscious perception of visual motion; the effect diminished when the cue-to-target distance was 8° apart. In contrast, conscious exogenous cueing manifested in both distances. Further evidence reveals that the unconscious and conscious nonretinotopic effects could not be explained by an attentional gradient, nor by bottom-up, energy-based motion mechanisms, but rather they were subserved by top-down, tracking-based motion mechanisms. We thus term these effects mobile cueing. Taken together, unconscious mobile cueing effects (a) demonstrate a previously unknown degree of flexibility of unconscious exogenous attention; (b) embody a simultaneous dissociation and association of attention and consciousness, in which exogenous attention can occur without cue awareness ("dissociation"), yet at the same time its effect is contingent on conscious motion tracking ("association"); and (c) underscore the interaction of conscious and unconscious processing, providing evidence for an unconscious effect that is not automatic but controlled.

  15. Pneumonia lipóide exógena – Caso clínico

    Directory of Open Access Journals (Sweden)

    Daniela Ferreira

    2005-11-01

    Full Text Available Resumo: A pneumonia lipóide exógena (PLE é uma patologia pouco frequente que resulta da aspiração ou inalação de hidrocarbonetos exógenos. A forma aguda pode observar-se em casos de aspiração acidental de material lipídico descrita tradicionalmente em cuspidores-de-fogo.Os autores apresentam o caso clínico de uma PLE aguda de um paciente de 19 anos, cuspidor de fogo, que recorreu ao Serviço de Urgência após inalação de petróleo.Tecem-se ainda breves considerações sobre os aspectos clínico-imagiológicos mais relevantes desta situação.Rev Port Pneumol 2005; XI (6: 567-572 Abstract: Exogenous lipoid pneumonia (ELP is an infrequent pathology that results from the aspiration or inhalation of exogenous hydrocarbon. The acute form may be seen in cases of accidental aspiration of fatlike material traditionally described in fire-eaters.The authors present the case report of an acute ELP in a 19 year-old patient, fire-eater, admitted at the Emergency Room after inhalation of petroleum.By conclusion, some brief considerations on clinical-imagiological aspects of this situation are discussed.Rev Port Pneumol 2005; XI (6: 567-572 Palavras-chave: Aspiração, hidrocarbonetos, broncofibroscopia, oil-red, Key-words: Aspiration, hydrocarbon, bronchoscopy, “oil red”

  16. Thrombolysis in acute myocardial infarction : factors determining its efficacy

    NARCIS (Netherlands)

    Brügemann, Johannes

    1994-01-01

    Insight in the mechanisms leading to acute myocardial infarction (MI) has resulted in the administration of exogenous plasminogen activator, later called thrombolytic therapy. This treatment was associated with a significant reduction in mortality and morbidity. However, success has not always been

  17. Exogenous spatial attention influences figure-ground assignment.

    Science.gov (United States)

    Vecera, Shaun P; Flevaris, Anastasia V; Filapek, Joseph C

    2004-01-01

    In a hierarchical stage account of vision, figure-ground assignment is thought to be completed before the operation of focal spatial attention. Results of previous studies have supported this account by showing that unpredictive, exogenous spatial precues do not influence figure-ground assignment, although voluntary attention can influence figure-ground assignment. However, in these studies, attention was not summoned directly to a region in a figure-ground display. In three experiments, we addressed the relationship between figure-ground assignment and visuospatial attention. In Experiment 1, we replicated the finding that exogenous precues do not influence figure-ground assignment when they direct attention outside of a figure-ground stimulus. In Experiment 2, we demonstrated that exogenous attention can influence figure-ground assignment if it is directed to one of the regions in a figure-ground stimulus. In Experiment 3, we demonstrated that exogenous attention can influence figure-ground assignment in displays that contain a Gestalt figure-ground cue; this result suggests that figure-ground processes are not entirely completed prior to the operation of focal spatial attention. Exogenous spatial attention acts as a cue for figure-ground assignment and can affect the outcome of figure-ground processes.

  18. Consequences and detection of invalid exogeneity conditions

    NARCIS (Netherlands)

    Niemczyk, J.

    2009-01-01

    Estimators for econometric relationships require observations on at least as many exogenous variables as the model has unknown coefficients. This thesis examines techniques to classify variables as being either exogenous or endogenous, and investigates the consequences of invalid classifications.

  19. International Environmental Agreements with Endogenous or Exogenous Risk

    OpenAIRE

    Fuhai Hong; Larry Karp

    2014-01-01

    We examine the effect of endogenous and exogenous risk on the equilibrium (expected) membership of an International Environmental Agreement when countries are risk averse. Endogenous risk arises when countries use mixed rather than pure strategies at the participation game, and exogenous risk arises from the inherent uncertainty about the costs and benefits of increased abate- ment. Under endogenous risk, an increase in risk aversion increases expected participation. Under exogenous risk and ...

  20. VEGF-A is increased in exogenous endophthalmitis.

    Science.gov (United States)

    Seamone, Mark E; Lewis, Darrell R; Haidl, Ian D; Gupta, R Rishi; O' Brien, Daniel M; Dickinson, John; Samad, Arif; Marshall, Jean S; Cruess, Alan F

    2017-06-01

    Exogenous endophthalmitis is an ophthalmologic emergency defined by panocular inflammation. Vascular endothelial growth factor A (VEGF-A) contributes to inflammation by promoting chemotaxis of monocytes and granulocytes and by increasing vascular permeability. The purpose of this article is to determine if VEGF-A is elevated in the vitreous samples obtained from individuals with exogenous endophthalmitis. Vitreous samples from individuals with exogenous endophthalmitis (n = 18) were analyzed via Luminex assay and enzyme-linked immunosorbent assay for the cytokines VEGF-A, tumor necrosis factor (TNF), interleukin 6 (IL-6), IL-8 (chemokine [CXCL]-8), IL-1β, IL-10, IL-12p70, IL-33, interferon (IFN)-γ, IFN-α, IFN-β, chemokine ligand (CCL)-3, IL-2, IL-5, IL-15, CXCL-10, CCL-2, IL-1Ra, CCL-5, IL-17, and CCL-11. Vitreous samples obtained at the time of macular hole surgery served as controls (n = 8). Concentrations of VEGF-A were significantly elevated in vitreous samples from individuals with exogenous endophthalmitis compared with macular hole (p exogenous endophthalmitis after cataract surgery (p = 0.001), vitrectomy (p = 0.024), and intravitreal injection (p = 0.012). VEGF-A concentrations were similar in both culture-positive and culture-negative populations (p > 0.05). In a linear regression model, levels of VEGF-A correlated significantly with the chemokine CXCL-8 (p = 0.028). We demonstrate that VEGF-A is potently upregulated in exogenous endophthalmitis. This observation provides a foundation for future studies of targeted VEGF-A blockade in the management of endophthalmitis. Crown Copyright © 2017. Published by Elsevier Inc. All rights reserved.

  1. Exogenous melatonin administration is beneficial for male ...

    African Journals Online (AJOL)

    ABSTRACT. Background: A concern in the use of exogenous melatonin as a therapeutic intervention is that it may interfere with reproductive function. Herein, we report that chronic exogenous melatonin administration does not impair male reproductive function during ageing and at old age in male Sprague Dawley rats.

  2. The Endogenous-Exogenous Partition in Attribution Theory

    Science.gov (United States)

    Kruglanski, Arie W.

    1975-01-01

    Within lay explanation of actions, several significant inferences are assumed to follow from the partition between endogenous and exogenous attributions. An endogenous action is judged to constitute an end in itself; an exogenous action is judged to serve as a means to some further end. (Editor/RK)

  3. CENTRAL SEROUS CHORIORETINOPATHY IN POSTMENOPAUSAL WOMEN RECEIVING EXOGENOUS TESTOSTERONE.

    Science.gov (United States)

    Conway, Mandi D; Noble, Jason A; Peyman, Gholam A

    2017-01-01

    Central serous chorioretinopathy (CSR) is a serous detachment of the neurosensory retina commonly associated with male sex, Type-A personality and corticosteroid use. Exogenous administration of androgens and development of CSR in men has been reported. Only one case of CSR in a postmenopausal woman receiving exogenous androgen therapy has been reported. The authors describe three cases of chronic CSR in postmenopausal women receiving exogenous testosterone therapy. Diagnosis was based on characteristic clinical, fluorescein angiographic, and optical coherence tomography findings. The three women were being treated with exogenous testosterone and progesterone therapy for symptoms of menopause and libido loss. Average age at presentation was 54.7 years (53-56 years), average duration of exogenous androgen use was 61 months (36-87 months), with average 19.7-month follow-up. Resolution of symptoms seemed correlated with cessation of androgen use despite treatment with oscillatory photodynamic therapy and intravitreal pharmacotherapy with antivascular endothelial growth factor agents. Exogenous testosterone is increasingly prescribed for menopausal symptoms and libido loss. Treatment with oscillatory photodynamic therapy, supplemental bevacizumab intravitreal pharmacotherapy, and cessation of exogenous androgen therapy was successful in three cases of chronic, therapy-resistant CSR. Ophthalmologists should inquire about androgen usage in patients who present with CSR, especially in the setting of therapy resistance.

  4. Exogenous melatonin administration is beneficial for male ...

    African Journals Online (AJOL)

    Background: A concern in the use of exogenous melatonin as a therapeutic intervention is that it may interfere with reproductive function. Herein, we report that chronic exogenous melatonin administration does not impair male reproductive function during ageing and at old age in male Sprague Dawley rats. Methods: ...

  5. Interaction between endogenous and exogenous orienting in crossmodal attention.

    Science.gov (United States)

    Chen, Xiaoxi; Chen, Qi; Gao, Dingguo; Yue, Zhenzhu

    2012-08-01

    Using a cue-target paradigm, we investigated the interaction between endogenous and exogenous orienting in cross-modal attention. A peripheral (exogenous) cue was presented after a central (endogenous) cue with a variable time interval. The endogenous and exogenous cues were presented in one sensory modality (auditory in Experiment 1 and visual in Experiment 2) whereas the target was presented in another modality. Both experiments showed a significant endogenous cuing effect (longer reaction times in the invalid condition than in the valid condition). However, exogenous cuing produced a facilitatory effect in both experiments in response to the target when endogenous cuing was valid, but it elicited a facilitatory effect in Experiment 1 and an inhibitory effect in Experiment 2 when endogenous cuing was invalid. These findings indicate that endogenous and exogenous cuing can co-operate in orienting attention to the crossmodal target. Moreover, the interaction between endogenous and exogenous orienting of attention is modulated by the modality between the cue and the target. © 2012 The Authors. Scandinavian Journal of Psychology © 2012 The Scandinavian Psychological Associations.

  6. Radioprotective effect of exogenic hypoxia in fractionated irradiation

    International Nuclear Information System (INIS)

    Kazymbetov, P.; Yarmonenko, S.P.; Vajnson, A.A.

    1988-01-01

    During the experiments with mice it is established, that exogenic hypoxia protective effect (8%O 2 ), evaluated according to survival rate, decreases at the change from single to fractionated irradiation. Dose change factor (DCF) is equal to 1.55 and 1.22-1.31, respectively. Skin protection using exogenic hypoxia at the local fractionated irradiation is expressed more, than at the fractionated one. DCF is equal to 1.56 and 1.28, respectively. Exogenic hypoxia protection effect in the tumor is expressed rather weakly. DCF at single and fractionated irradiation constitutes 1.03 and 1.07-1.13, respectively. Due to skin preferential protection the therapeutic gain factor at irradiation under the exogenic hypoxia conditions constitutes 1.24 and 1.38-1.46, respectively, at single and fractionated irradiation

  7. Explaining Cigarette Smoking: An Endogenous-Exogenous Analysis.

    Science.gov (United States)

    McKillip, Jack

    Kruglanski's endogenous-exogenous partition, when applied to reasons given by smokers for smoking cigarettes, distinguishes two types of actions: (1) endogenous reasons implying that the behavior of consuming the cigarette is the goal of the action and the actor is positive toward the behavior, and (2) exogenous reasons implying that the behavior…

  8. Association between Use of Exogenous Testosterone Therapy and Risk of Venous Thrombotic Events among Exogenous Testosterone Treated and Untreated Men with Hypogonadism.

    Science.gov (United States)

    Li, Hu; Benoit, Karin; Wang, Wei; Motsko, Stephen

    2016-04-01

    Limited information exists about whether exogenous testosterone therapy is associated with a risk of venous thrombotic events. We investigated via cohort and nested case-control analyses whether exogenous testosterone therapy is associated with the risk of venous thrombotic events in men with hypogonadism. Databases were reviewed to identify men prescribed exogenous testosterone therapy and/or men with a hypogonadism diagnosis. Propensity score 1:1 matching was used to select patients for cohort analysis. Cases (men with venous thrombotic events) were matched 1:4 with controls (men without venous thrombotic events) for the nested case-control analysis. Primary outcome was defined as incident idiopathic venous thrombotic events. Cox regression and conditional logistic regression were used to assess HRs and ORs, respectively. Sensitivity analyses were also performed. A total of 102,650 exogenous testosterone treated and 102,650 untreated patients were included in cohort analysis after matching, and 2,785 cases and 11,119 controls were included in case-control analysis. Cohort analysis revealed a HR of 1.08 for all testosterone treated patients (95% CI 0.91, 1.27, p = 0.378). Case-control analysis resulted in an OR of 1.02 (95% CI 0.92, 1.13, p = 0.702) for current exogenous testosterone therapy exposure and an OR of 0.92 (95% CI 0.82, 1.03, p = 0.145) for past exogenous testosterone therapy exposure. These results remained nonstatistically significant after stratifying by exogenous testosterone therapy administration route and age category. Most sensitivity analyses yielded consistent results. No significant association was found between exogenous testosterone therapy and incidents of idiopathic or overall venous thrombotic events in men with hypogonadism. However, some discrepant findings exist for the association between injectable formulations and the risk of overall venous thrombotic events. Copyright © 2016 American Urological Association Education and Research

  9. Exogenous ciliary neurotrophic factor (CNTF) reduces synaptic depression during repetitive stimulation.

    Science.gov (United States)

    Garcia, Neus; Santafé, Manel M; Tomàs, Marta; Priego, Mercedes; Obis, Teresa; Lanuza, Maria A; Besalduch, Nuria; Tomàs, Josep

    2012-09-01

    It has been shown that ciliary neurotrophic factor (CNTF) has trophic and maintenance effects on several types of peripheral and central neurons, glia, and cells outside the nervous system. Both CNTF and its receptor, CNTF-Rα, are expressed in the muscle. We use confocal immunocytochemistry to show that the trophic cytokine and its receptor are present in the pre- and post-synaptic sites of the neuromuscular junctions (NMJs). Applied CNTF (7.5-200 ng/ml, 60 min-3 h) does not acutely affect spontaneous potentials (size or frequency) or quantal content of the evoked acetylcholine release from post-natal (in weak or strong axonal inputs on dually innervated end plates or in the most mature singly innervated synapses at P6) or adult (P30) NMJ of Levator auris longus muscle of the mice. However, CNTF reduces roughly 50% the depression produced by repetitive stimulation (40 Hz, 2 min) on the adult NMJs. Our findings indicate that, unlike neurotrophins, exogenous CNTF does not acutely modulate transmitter release locally at the mammalian neuromuscular synapse but can protect mature end plates from activity-induced synaptic depression. © 2012 Peripheral Nerve Society.

  10. P-wave dispersion in endogenous and exogenous subclinical hyperthyroidism.

    Science.gov (United States)

    Gen, R; Akbay, E; Camsari, A; Ozcan, T

    2010-02-01

    The aim of this study was to measure maximum P wave duration (Pmax) and P wave dispersion (PWD), which can be indicators for the risk of paroxysmal atrial fibrillation when increased, and to reveal their relationship with thyroid hormone levels in patients with endogenous and exogenous subclinical hyperthyroidism. Seventy-one patients with sublinical thyrotoxicosis (34 endogenous, 37 exogenous) and 69 healthy individuals were enrolled in the study. Pmax and minimum P wave duration (Pmin) on electrocardiogram recordings were measured and PWD was calculated as Pmax-Pmin. Pmax (pendogenous subclinical hyperthyroidism compared with the control group. Pmax (pexogenous subclinical thyrotoxicosis compared with the control group. Pmax (p=0.710) and PWD (p=0.127) were not significantly different in patients with endogenous subclinical hyperthyroidism compared with exogenous subclinical hyperthyroid patients. Pmax and PWD negatively associated with TSH in endogenous and exogenous subclinical hyperthyroidism. In the present study, we observed that Pmax and PWD were longer in patients with endogenous and exogenous subclinical hyperthyroidism. Lack of a difference in Pmax and PWD between patients with endogenous and exogenous subclinical hyperthyroidism seems to support the idea that hormone levels rather than the etiology of thyrotoxicosis affect the heart.

  11. Behavioral effects of endogenous or exogenous estradiol and progesterone on cocaine sensitization in female rats

    Energy Technology Data Exchange (ETDEWEB)

    Souza, M.F. [Universidade Federal de Ciências da Saúde de Porto Alegre, Laboratório de Neurociência Comportamental, Porto Alegre, RS, Brasil, Laboratório de Neurociência Comportamental, Universidade Federal de Ciências da Saúde de Porto Alegre, Porto Alegre, RS (Brazil); Couto-Pereira, N.S. [Universidade Federal do Rio Grande do Sul, Instituto de Ciências Básicas da Saúde, Departamento de Bioquímica, Porto Alegre, RS, Brasil, Departamento de Bioquímica, Instituto de Ciências Básicas da Saúde, Universidade Federal do Rio Grande do Sul, Porto Alegre, RS (Brazil); Freese, L.; Costa, P.A.; Caletti, G.; Bisognin, K.M. [Universidade Federal de Ciências da Saúde de Porto Alegre, Laboratório de Neurociência Comportamental, Porto Alegre, RS, Brasil, Laboratório de Neurociência Comportamental, Universidade Federal de Ciências da Saúde de Porto Alegre, Porto Alegre, RS (Brazil); Nin, M.S. [Universidade Federal de Ciências da Saúde de Porto Alegre, Laboratório de Neurociência Comportamental, Porto Alegre, RS, Brasil, Laboratório de Neurociência Comportamental, Universidade Federal de Ciências da Saúde de Porto Alegre, Porto Alegre, RS (Brazil); Instituto Porto Alegre, Centro Metodista do Sul, Curso de Farmácia, Porto Alegre, RS, Brasil, Curso de Farmácia, Centro Metodista do Sul, Instituto Porto Alegre, Porto Alegre, RS (Brazil); Gomez, R. [Universidade Federal do Rio Grande do Sul, Instituto de Ciências Básicas da Saúde, Departamento de Farmacologia, Porto Alegre, RS, Brasil, Departamento de Farmacologia, Instituto de Ciências Básicas da Saúde, Universidade Federal do Rio Grande do Sul, Porto Alegre, RS (Brazil); Barros, H.M.T. [Universidade Federal de Ciências da Saúde de Porto Alegre, Laboratório de Neurociência Comportamental, Porto Alegre, RS, Brasil, Laboratório de Neurociência Comportamental, Universidade Federal de Ciências da Saúde de Porto Alegre, Porto Alegre, RS (Brazil)

    2014-05-09

    Cocaine sensitization is a marker for some facets of addiction, is greater in female rats, and may be influenced by their sex hormones. We compared the modulatory effects of endogenous or exogenous estradiol and progesterone on cocaine-induced behavioral sensitization in 106 female rats. Ovariectomized female rats received progesterone (0.5 mg/mL), estradiol (0.05 mg/mL), progesterone plus estradiol, or the oil vehicle. Sham-operated control females received oil. Control and acute subgroups received injections of saline, while the repeated group received cocaine (15 mg/kg, ip) for 8 days. After 10 days, the acute and repeated groups received a challenge dose of cocaine, after which locomotion and stereotypy were monitored. The estrous cycle phase was evaluated and blood was collected to verify hormone levels. Repeated cocaine treatment induced overall behavioral sensitization in female rats, with increased locomotion and stereotypies. In detailed analysis, ovariectomized rats showed no locomotor sensitization; however, the sensitization of stereotypies was maintained. Only females with endogenous estradiol and progesterone demonstrated increased locomotor activity after cocaine challenge. Estradiol replacement enhanced stereotyped behaviors after repeated cocaine administration. Cocaine sensitization of stereotyped behaviors in female rats was reduced after progesterone replacement, either alone or concomitant with estradiol. The behavioral responses (locomotion and stereotypy) to cocaine were affected differently, depending on whether the female hormones were of an endogenous or exogenous origin. Therefore, hormonal cycling appears to be an important factor in the sensitization of females. Although estradiol increases the risk of cocaine sensitization, progesterone warrants further study as a pharmacological treatment in the prevention of psychostimulant abuse.

  12. Behavioral effects of endogenous or exogenous estradiol and progesterone on cocaine sensitization in female rats

    International Nuclear Information System (INIS)

    Souza, M.F.; Couto-Pereira, N.S.; Freese, L.; Costa, P.A.; Caletti, G.; Bisognin, K.M.; Nin, M.S.; Gomez, R.; Barros, H.M.T.

    2014-01-01

    Cocaine sensitization is a marker for some facets of addiction, is greater in female rats, and may be influenced by their sex hormones. We compared the modulatory effects of endogenous or exogenous estradiol and progesterone on cocaine-induced behavioral sensitization in 106 female rats. Ovariectomized female rats received progesterone (0.5 mg/mL), estradiol (0.05 mg/mL), progesterone plus estradiol, or the oil vehicle. Sham-operated control females received oil. Control and acute subgroups received injections of saline, while the repeated group received cocaine (15 mg/kg, ip) for 8 days. After 10 days, the acute and repeated groups received a challenge dose of cocaine, after which locomotion and stereotypy were monitored. The estrous cycle phase was evaluated and blood was collected to verify hormone levels. Repeated cocaine treatment induced overall behavioral sensitization in female rats, with increased locomotion and stereotypies. In detailed analysis, ovariectomized rats showed no locomotor sensitization; however, the sensitization of stereotypies was maintained. Only females with endogenous estradiol and progesterone demonstrated increased locomotor activity after cocaine challenge. Estradiol replacement enhanced stereotyped behaviors after repeated cocaine administration. Cocaine sensitization of stereotyped behaviors in female rats was reduced after progesterone replacement, either alone or concomitant with estradiol. The behavioral responses (locomotion and stereotypy) to cocaine were affected differently, depending on whether the female hormones were of an endogenous or exogenous origin. Therefore, hormonal cycling appears to be an important factor in the sensitization of females. Although estradiol increases the risk of cocaine sensitization, progesterone warrants further study as a pharmacological treatment in the prevention of psychostimulant abuse

  13. Endogenous versus exogenous shocks in systems with memory

    Science.gov (United States)

    Sornette, D.; Helmstetter, A.

    2003-02-01

    Systems with long-range persistence and memory are shown to exhibit different precursory as well as recovery patterns in response to shocks of exogenous versus endogenous origins. By endogenous, we envision either fluctuations resulting from an underlying chaotic dynamics or from a stochastic forcing origin which may be external or be an effective coarse-grained description of the microscopic fluctuations. In this scenario, endogenous shocks result from a kind of constructive interference of accumulated fluctuations whose impacts survive longer than the large shocks themselves. As a consequence, the recovery after an endogenous shock is in general slower at early times and can be at long times either slower or faster than after an exogenous perturbation. This offers the tantalizing possibility of distinguishing between an endogenous versus exogenous cause of a given shock, even when there is no “smoking gun”. This could help in investigating the exogenous versus self-organized origins in problems such as the causes of major biological extinctions, of change of weather regimes and of the climate, in tracing the source of social upheaval and wars, and so on. Sornette et al., Volatility fingerprints of large stocks: endogenous versus exogenous, cond-mat/0204626 has already shown how this concept can be applied concretely to differentiate the effects on financial markets of the 11 September 2001 attack or of the coup against Gorbachev on 19 August 1991 (exogenous) from financial crashes such as October 1987 (endogenous).

  14. Acute Pathophysiological Effects of Intratracheal Instillation of Budesonide and Exogenous Surfactant in a Neonatal Surfactant-depleted Piglet Model

    Directory of Open Access Journals (Sweden)

    Chia-Feng Yang

    2010-08-01

    Conclusions: Intratracheal instillation of surfactant or surfactant plus budesonide can improve oxygenation and pulmonary histologic outcome in neonatal surfactant-depleted lungs. The additional use of budesonide does not disturb the function of the exogenous surfactant. Intratracheal administration of a corticosteroid combined with surfactant may be an effective method for alleviating local pulmonary inflammation in severe RDS.

  15. Endogenous vs. exogenous regulations in the commons

    DEFF Research Database (Denmark)

    Abatayo, Anna Lou; Lynham, John

    2016-01-01

    It is widely believed that there is strong experimental evidence to support the idea that exogenously imposed regulations crowd out the intrinsic motivations of common pool resource (CPR) users to refrain from over-harvesting. We introduce a novel experimental design that attempts to disentangle...... potential confounds in previous experiments. A key feature of our experimental design is to have the exact same regulations chosen endogenously as those that are imposed exogenously. When we compare the same regulations chosen endogenously to those externally imposed, we observe no differences in extraction...... endogenous regulations with communication and exogenous regulations without communication. Our results suggest that externally imposed regulations do not crowd out intrinsic motivations in the lab and they confirm that communication facilitates cooperation to reduce extraction....

  16. Interplay between endogenous and exogenous fluctuations in financial markets

    OpenAIRE

    Gontis, Vygintas

    2016-01-01

    We address microscopic, agent based, and macroscopic, stochastic, modeling of the financial markets combining it with the exogenous noise. The interplay between the endogenous dynamics of agents and the exogenous noise is the primary mechanism responsible for the observed long-range dependence and statistical properties of high volatility return intervals. By exogenous noise we mean information flow or/and order flow fluctuations. Numerical results based on the proposed model reveal that the ...

  17. Exogenous reinfection of tuberculosis in a low-burden area.

    Science.gov (United States)

    Schiroli, Consuelo; Carugati, Manuela; Zanini, Fabio; Bandera, Alessandra; Di Nardo Stuppino, Silvia; Monge, Elisa; Morosi, Manuela; Gori, Andrea; Matteelli, Alberto; Codecasa, Luigi; Franzetti, Fabio

    2015-12-01

    Recurrence of tuberculosis (TB) can be the consequence of relapse or exogenous reinfection. The study aimed to assess the factors associated with exogenous TB reinfection. Prospective cohort study based on the TB database, maintained at the Division of Infectious Diseases, Luigi Sacco Hospital (Milan, Italy). Time period: 1995-2010. (1) ≥2 episodes of culture-confirmed TB; (2) cure of the first episode of TB; (3) availability of one Mycobacterium tuberculosis isolate for each episode. Genotyping of the M. tuberculosis strains to differentiate relapse and exogenous reinfection. Logistic regression analysis was used to assess the influence of risk factors on exogenous reinfections. Of the 4682 patients with TB, 83 were included. Of these, exogenous reinfection was diagnosed in 19 (23 %). It was independently associated with absence of multidrug resistance at the first episode [0, 10 (0.01-0.95), p = 0.045] and with prolonged interval between the first TB episode and its recurrence [7.38 (1.92-28.32) p = 0.004]. However, TB relapses occurred until 4 years after the first episode. The risk associated with being foreign born, extrapulmonary site of TB, and HIV infection was not statistically significant. In the relapse and re-infection cohort, one-third of the patients showed a worsened drug resistance profile during the recurrent TB episode. Exogenous TB reinfections have been documented in low endemic areas, such as Italy. A causal association with HIV infection could not be confirmed. Relapses and exogenous reinfections shared an augmented risk of multidrug resistance development, frequently requiring the use of second-line anti-TB regimens.

  18. Characteristics of exogenous carbon monoxide deliveries

    Directory of Open Access Journals (Sweden)

    Hui-jun Hu

    2016-01-01

    Full Text Available Carbon monoxide (CO has long been considered an environmental pollutant and a poison. Exogenous exposure to amounts of CO beyond the physiologic level of the body can result in a protective or adaptive response. However, as a gasotransmitter, endogenous CO is important for multiple physiologic functions. To date, at least seven distinct methods of delivering CO have been utilized in animal and clinical studies. In this mini-review, we summarize the exogenous CO delivery methods and compare their advantages and disadvantages.

  19. Synthesis of phosphatidylcholine in rats with oleic acid-induced pulmonary edema and effect of exogenous pulmonary surfactant on its De Novo synthesis.

    Science.gov (United States)

    Gao, Xiwen; Qian, Peiyu; Cen, Dong; Hong, Weijun; Peng, Qing; Xue, Min

    2018-01-01

    In mammals, oleic acid (OA) induces pulmonary edema (PE), which can initiate acute lung injury (ALI) and lead to acute respiratory distress syndrome (ARDS). Pulmonary surfactant (PS) plays a key role in a broad range of treatments for ARDS. The aim of the present investigation was to assess changes in the synthesis of phosphatidylcholine (PC) from choline and determine the effect of exogenous PS on its de novo synthesis in rats with OA-induced PE. Experimental rats were randomized into three groups, including a control group, OA-induced PE group, and OA-induced group treated with exogenous PS (OA-PS). Twenty-four rats were sacrificed 4 h after induction of the OA model, and tissue was examined by light and electron microscopy to assess the severity of ALI using an established scoring system at the end of the experiment. After 15 μCi 3H-choline chloride was injected intravenously, eight rats in each group were sacrificed at 4, 8, and 16 h. The radioactivity of 3H incorporated into total phospholipid (TPL) and desaturated phosphatidylcholine (DSPC) was measured in bronchoalveolar lavage fluid (BALF) and lung tissue (LT) using a liquid scintillation counter and was expressed as counts per minute (CPM). Results showed that TPL, DSPC, and the ratio of DSPC/total protein (TP) in lung tissue decreased 4 h after challenge with OA, but the levels recovered after 8 and 16 h. At 8 h after injection, 3H-TPL and 3H-DSPC radioactivity in the lungs reached its peak. Importantly, 3H-DSPC CPM were significantly lower in the PS treatment group (LT: Control: 62327 ± 9108; OA-PE: 97315 ± 10083; OA-PS: 45127 ± 10034, P exogenous PS treatments may adversely affect endogenous de novo synthetic and secretory phospholipid pathways via feedback inhibition. This novel finding reveals the specific involvement of exogenous PS in endogenous synthetic and secretory phospholipid pathways during the treatment of ARDS. This information improves our understanding of how PS treatment is

  20. Independent effects of endogenous and exogenous attention in touch.

    Science.gov (United States)

    Jones, Alexander; Forster, Bettina

    2013-12-01

    Endogenous and exogenous attention in touch have typically been investigated separately. Here we use a double-cueing paradigm manipulating both types of orienting in each trial. Bilateral endogenous cues induced long-lasting facilitation of endogenous attention up to 2 s. However, the exogenous cue only elicited an effect at short intervals. Our results favour a supramodal account of attention and this study provides new insight into how endogenous and exogenous attention operates in the tactile modality.

  1. Exogenous Testosterone Rapidly Increases Aggressive Behavior in Dominant and Impulsive Men.

    Science.gov (United States)

    Carré, Justin M; Geniole, Shawn N; Ortiz, Triana L; Bird, Brian M; Videto, Amber; Bonin, Pierre L

    2017-08-15

    Although traditional wisdom suggests that baseline levels of testosterone (T) promote aggressive behavior, decades of research have produced findings that have been largely weak and inconsistent. However, more recent experimental work suggests that exogenous administration of T rapidly potentiates amygdala and hypothalamus responses to angry facial expressions. Notably, these brain regions are rich in androgen receptors and play a key role in modulating aggressive behavior in animal models. The present experiment extends this work by examining whether acutely increasing T potentiates aggressive behavior in men. In a double-blind, placebo-controlled, between-subject design, healthy adult men (n = 121) were administered either T or placebo, and subsequently engaged in a well-validated decision-making game that measures aggressive behavior in response to social provocation. In light of prior correlational research, we also assessed the extent to which T's effects on aggressive behavior would depend on variability in trait dominance and/or trait self-control. Exogenous T on its own did not modulate aggressive behavior. However, T's effects on aggression were strongly influenced by variation in trait dominance and trait self-control. Specifically, T caused an increase in aggressive behavior, but only among men scoring relatively high in trait dominance or low in trait self-control. These findings are the first to demonstrate that T can rapidly (within 60 minutes) potentiate aggressive behavior, but only among men with dominant or impulsive personality styles. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  2. Behavioral effects of endogenous or exogenous estradiol and progesterone on cocaine sensitization in female rats

    Directory of Open Access Journals (Sweden)

    M.F. Souza

    2014-06-01

    Full Text Available Cocaine sensitization is a marker for some facets of addiction, is greater in female rats, and may be influenced by their sex hormones. We compared the modulatory effects of endogenous or exogenous estradiol and progesterone on cocaine-induced behavioral sensitization in 106 female rats. Ovariectomized female rats received progesterone (0.5 mg/mL, estradiol (0.05 mg/mL, progesterone plus estradiol, or the oil vehicle. Sham-operated control females received oil. Control and acute subgroups received injections of saline, while the repeated group received cocaine (15 mg/kg, ip for 8 days. After 10 days, the acute and repeated groups received a challenge dose of cocaine, after which locomotion and stereotypy were monitored. The estrous cycle phase was evaluated and blood was collected to verify hormone levels. Repeated cocaine treatment induced overall behavioral sensitization in female rats, with increased locomotion and stereotypies. In detailed analysis, ovariectomized rats showed no locomotor sensitization; however, the sensitization of stereotypies was maintained. Only females with endogenous estradiol and progesterone demonstrated increased locomotor activity after cocaine challenge. Estradiol replacement enhanced stereotyped behaviors after repeated cocaine administration. Cocaine sensitization of stereotyped behaviors in female rats was reduced after progesterone replacement, either alone or concomitant with estradiol. The behavioral responses (locomotion and stereotypy to cocaine were affected differently, depending on whether the female hormones were of an endogenous or exogenous origin. Therefore, hormonal cycling appears to be an important factor in the sensitization of females. Although estradiol increases the risk of cocaine sensitization, progesterone warrants further study as a pharmacological treatment in the prevention of psychostimulant abuse.

  3. The novel cytokine interleukin-33 activates acinar cell proinflammatory pathways and induces acute pancreatic inflammation in mice.

    Directory of Open Access Journals (Sweden)

    Duraisamy Kempuraj

    Full Text Available Acute pancreatitis is potentially fatal but treatment options are limited as disease pathogenesis is poorly understood. IL-33, a novel IL-1 cytokine family member, plays a role in various inflammatory conditions but its role in acute pancreatitis is not well understood. Specifically, whether pancreatic acinar cells produce IL-33 when stressed or respond to IL-33 stimulation, and whether IL-33 exacerbates acute pancreatic inflammation is unknown.In duct ligation-induced acute pancreatitis in mice and rats, we found that (a IL-33 concentration was increased in the pancreas; (b mast cells, which secrete and also respond to IL-33, showed degranulation in the pancreas and lung; (c plasma histamine and pancreatic substance P concentrations were increased; and (d pancreatic and pulmonary proinflammatory cytokine concentrations were increased. In isolated mouse pancreatic acinar cells, TNF-α stimulation increased IL-33 release while IL-33 stimulation increased proinflammatory cytokine release, both involving the ERK MAP kinase pathway; the flavonoid luteolin inhibited IL-33-stimulated IL-6 and CCL2/MCP-1 release. In mice without duct ligation, exogenous IL-33 administration induced pancreatic inflammation without mast cell degranulation or jejunal inflammation; pancreatic changes included multifocal edema and perivascular infiltration by neutrophils and some macrophages. ERK MAP kinase (but not p38 or JNK and NF-kB subunit p65 were activated in the pancreas of mice receiving exogenous IL-33, and acinar cells isolated from the pancreas of these mice showed increased spontaneous cytokine release (IL-6, CXCL2/MIP-2α. Also, IL-33 activated ERK in human pancreatic tissue.As exogenous IL-33 does not induce jejunal inflammation in the same mice in which it induces pancreatic inflammation, we have discovered a potential role for an IL-33/acinar cell axis in the recruitment of neutrophils and macrophages and the exacerbation of acute pancreatic inflammation

  4. Rapid metabolism of exogenous angiotensin II by catecholaminergic neuronal cells in culture media.

    Science.gov (United States)

    Basu, Urmi; Seravalli, Javier; Madayiputhiya, Nandakumar; Adamec, Jiri; Case, Adam J; Zimmerman, Matthew C

    2015-02-01

    Angiotensin II (AngII) acts on central neurons to increase neuronal firing and induce sympathoexcitation, which contribute to the pathogenesis of cardiovascular diseases including hypertension and heart failure. Numerous studies have examined the precise AngII-induced intraneuronal signaling mechanism in an attempt to identify new therapeutic targets for these diseases. Considering the technical challenges in studying specific intraneuronal signaling pathways in vivo, especially in the cardiovascular control brain regions, most studies have relied on neuronal cell culture models. However, there are numerous limitations in using cell culture models to study AngII intraneuronal signaling, including the lack of evidence indicating the stability of AngII in culture media. Herein, we tested the hypothesis that exogenous AngII is rapidly metabolized in neuronal cell culture media. Using liquid chromatography-tandem mass spectrometry, we measured levels of AngII and its metabolites, Ang III, Ang IV, and Ang-1-7, in neuronal cell culture media after administration of exogenous AngII (100 nmol/L) to a neuronal cell culture model (CATH.a neurons). AngII levels rapidly declined in the media, returning to near baseline levels within 3 h of administration. Additionally, levels of Ang III and Ang-1-7 acutely increased, while levels of Ang IV remained unchanged. Replenishing the media with exogenous AngII every 3 h for 24 h resulted in a consistent and significant increase in AngII levels for the duration of the treatment period. These data indicate that AngII is rapidly metabolized in neuronal cell culture media, and replenishing the media at least every 3 h is needed to sustain chronically elevated levels. © 2015 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  5. Exogenous sample contamination. Sources and interference.

    Science.gov (United States)

    Cornes, Michael P

    2016-12-01

    Clinical laboratory medicine is involved in the vast majority of patient care pathways. It has been estimated that pathology results inform 60-70% of critical patient care decisions. The primary goal of the laboratory is to produce precise and accurate results which reflect the true situation in vivo. It is not surprising that interference occurs in laboratory analysis given the complexity of some of the assays used to perform them. Interference is defined as "the effect of a substance upon any step in the determination of the concentration or catalytic activity of the metabolite". Exogenous interferences are defined as those that derive from outside of the body and are therefore not normally found in a specimen and can cause either a positive or negative bias in analytical results. Interferences in analysis can come from various sources and can be classified as endogenous or exogenous. Exogenous substances could be introduced at any point in the sample journey. The laboratory must take responsibility for the quality of results produced. It has a responsibility to have processes in place to identify and minimise the occurrence and effect contamination and interference. To do this well the laboratory needs to work with clinicians and manufacturers. Failure to identify an erroneous result could have an impact on patient care, patient safety and also on hospital budgets. However it is not always easy to recognise interferences. This review summarises the types and sources of exogenous interference and some steps to minimise the impact they have. Crown Copyright © 2016. Published by Elsevier Inc. All rights reserved.

  6. Exogenous (automatic) attention to emotional stimuli: a review.

    Science.gov (United States)

    Carretié, Luis

    2014-12-01

    Current knowledge on the architecture of exogenous attention (also called automatic, bottom-up, or stimulus-driven attention, among other terms) has been mainly obtained from studies employing neutral, anodyne stimuli. Since, from an evolutionary perspective, exogenous attention can be understood as an adaptive tool for rapidly detecting salient events, reorienting processing resources to them, and enhancing processing mechanisms, emotional events (which are, by definition, salient for the individual) would seem crucial to a comprehensive understanding of this process. This review, focusing on the visual modality, describes 55 experiments in which both emotional and neutral irrelevant distractors are presented at the same time as ongoing task targets. Qualitative and, when possible, meta-analytic descriptions of results are provided. The most conspicuous result is that, as confirmed by behavioral and/or neural indices, emotional distractors capture exogenous attention to a significantly greater extent than do neutral distractors. The modulatory effects of the nature of distractors capturing attention, of the ongoing task characteristics, and of individual differences, previously proposed as mediating factors, are also described. Additionally, studies reviewed here provide temporal and spatial information-partially absent in traditional cognitive models-on the neural basis of preattention/evaluation, reorienting, and sensory amplification, the main subprocesses involved in exogenous attention. A model integrating these different levels of information is proposed. The present review, which reveals that there are several key issues for which experimental data are surprisingly scarce, confirms the relevance of including emotional distractors in studies on exogenous attention.

  7. Monocyte Trafficking, Engraftment, and Delivery of Nanoparticles and an Exogenous Gene into the Acutely Inflamed Brain Tissue - Evaluations on Monocyte-Based Delivery System for the Central Nervous System.

    Directory of Open Access Journals (Sweden)

    Hsin-I Tong

    Full Text Available The ability of monocytes and monocyte-derived macrophages (MDM to travel towards chemotactic gradient, traverse tissue barriers, and accumulate precisely at diseased sites makes them attractive candidates as drug carriers and therapeutic gene delivery vehicles targeting the brain, where treatments are often hampered by the blockade of the blood brain barrier (BBB. This study was designed to fully establish an optimized cell-based delivery system using monocytes and MDM, by evaluating their homing efficiency, engraftment potential, as well as carriage and delivery ability to transport nano-scaled particles and exogenous genes into the brain, following the non-invasive intravenous (IV cell adoptive transfer in an acute neuroinflammation mouse model induced by intracranial injection of Escherichia coli lipopolysaccharides. We demonstrated that freshly isolated monocytes had superior inflamed-brain homing ability over MDM cultured in the presence of macrophage colony stimulating factor. In addition, brain trafficking of IV infused monocytes was positively correlated with the number of adoptive transferred cells, and could be further enhanced by transient disruption of the BBB with IV administration of Mannitol, Bradykinin or Serotonin right before cell infusion. A small portion of transmigrated cells was detected to differentiate into IBA-1 positive cells with microglia morphology in the brain. Finally, with the use of superparamagnetic iron oxide nanoparticles SHP30, the ability of nanoscale agent-carriage monocytes to enter the inflamed brain region was validated. In addition, lentiviral vector DHIV-101 was used to introduce green fluorescent protein (GFP gene into monocytes, and the exogenous GFP gene was detected in the brain at 48 hours following IV infusion of the transduced monocytes. All together, our study has set up the optimized conditions for the more-in-depth tests and development of monocyte-mediated delivery, and our data supported

  8. Exogenic and endogenic Europa minerals

    Science.gov (United States)

    Maynard-Casely, H. E.; Brand, H. E. A.; Wilson, S. A.

    2016-12-01

    The Galileo Near Infrared Mapping Spectrometer (NIMS) identified a significant `non-ice' component upon the surface of Jupiter's moon Europa. Current explanations invoke both endogenic and exogenic origins for this material. It has long been suggested that magnesium and sodium sulfate minerals could have leached from the rock below a putative ocean (endogenic) 1 and that sulfuric acid hydrate minerals could have been radiologically produced from ionised sulfur originally from Io's volcanoes (exogenic) 2. However, a more recent theory proposes that the `non-ice' component could be radiation damaged NaCl leached from Europa's speculative ocean 3. What if the minerals are actually from combination of both endogenic and exogenic sources? To investigate this possibility we have focused on discovering new minerals that might form in the combination of the latter two cases, that is a mixture of leached sulfates hydrates with radiologically produced sulfuric acid. To this end we have explored a number of solutions in the MgSO4-H2SO4-H2O and Na2SO4-H2SO4-H2O systems, between 80 and 280 K with synchrotron x-ray powder diffraction. We report a number of new materials formed in this these ternary systems. This suggests that it should be considered that the `non-ice' component of the Europa's surface could be a material derived from endogenic and exogenic components. 1 Kargel, J. S. Brine volcanism and the interior structures of asteroids and icy satellites. Icarus 94, 368-390 (1991). 2 Carlson, R. W., Anderson, M. S., Mehlman, R. & Johnson, R. E. Distribution of hydrate on Europa: Further evidence for sulfuric acid hydrate. Icarus 177, 461-471, doi:10.1016/j.icarus.2005.03.026 (2005). 3 Hand, K. P. & Carlson, R. W. Europa's surface color suggests an ocean rich with sodium chloride. Geophysical Research Letters, 2015GL063559, doi:10.1002/2015gl063559 (2015).

  9. A novel pathway to detect and cope with exogenous dsDNA.

    Science.gov (United States)

    Kobayashi, Shouhei; Haraguchi, Tokuko

    2015-01-01

    How a living cell responds to exogenous materials is one of the fundamental questions in the life sciences. In particular, understanding the mechanisms by which a cell recognizes exogenous double-stranded DNA (dsDNA) is important for immunology research because it will facilitate the control of pathogen infections that entail the presence of exogenous dsDNA in the cytoplasm of host cells. Several cytosolic dsDNA sensor proteins that trigger innate immune responses have been identified and the downstream signaling pathways have been investigated. However, the events that occur at the site of exogenous dsDNA when it is exposed to the cytosol of the host cell remain unknown. Using dsDNA-coated polystyrene beads incorporated into living cells, we recently found that barrier-to-autointegration factor (BAF) binds to the exogenous dsDNA immediately after its appearance in the cytosol and plays a role in DNA avoidance of autophagy. Our findings reveal a novel pathway in which BAF plays a key role in the detection of and response to exogenous dsDNA.

  10. The cellular receptors of exogenous RNA

    Directory of Open Access Journals (Sweden)

    Patryk Reniewicz

    2016-04-01

    Full Text Available One of the key determinants of survival for organisms is proper recognition of exogenous and endogenous nucleic acids. Therefore, high eukaryotes developed a number of receptors that allow for discrimination between friend or foe DNA and RNA. Appearance of exogenous RNA in cytoplasm provides a signal of danger and triggers cellular responses that facilitate eradication of a pathogen. Recognition of exogenous RNA is additionally complicated by fact that large amount of endogenous RNA is present in cytoplasm Thus, number of different receptors, found in eukaryotic cells, is able to recognize that nucleic acid. First group of those receptors consist endosomal Toll like receptors, namely TLR3, TLR7, TLR8 and TLR13. Those receptors recognize RNA released from pathogens that enter the cell by endocytosis. The second group includes cytoplasmic sensors like PKR and the family of RLRs comprised of RIG-I, MDA5 and LGP2. Cytoplasmic receptors recognize RNA from pathogens invading the cell by non-endocytic pathway. In both cases binding of RNA by its receptors results in activation of the signalling cascades that lead to the production of interferon and other cytokines.

  11. Endogenous versus exogenous generic reference pricing for pharmaceuticals.

    Science.gov (United States)

    Antoñanzas, F; Juárez-Castelló, C A; Rodríguez-Ibeas, R

    2017-12-01

    In this paper we carry out a vertical differentiation duopoly model applied to pharmaceutical markets to analyze how endogenous and exogenous generic reference pricing influence competition between generic and branded drugs producers. Unlike the literature, we characterize for the exogenous case the equilibrium prices for all feasible relevant reference prices. Competition is enhanced after the introduction of a reference pricing system. We also compare both reference pricing systems on welfare grounds, assuming two different objective functions for health authorities: (i) standard social welfare and (ii) gross consumer surplus net of total pharmaceutical expenditures. We show that regardless of the objective function, health authorities will never choose endogenous reference pricing. When health authorities are paternalistic, the exogenous reference price that maximizes standard social welfare is such that the price of the generic drug is the reference price while the price of the branded drug is higher than the reference price. When health authorities are not paternalistic, the optimal exogenous reference price is such that the price of the branded drug is the reference price while the price of the generic drug is lower than the reference price.

  12. Induced effect of irradiated exogenous DNA on wheat

    International Nuclear Information System (INIS)

    Li Zhongjie; Sun Guangzu; Wang Guangjin

    1996-01-01

    Irradiated exogenous DNA introduced into wheat can give rise to break of DNA-chain and damage of part of alkali radicals. Introducing exogenous DNA irradiated by γ rays could increase Do fructification rate and decrease seed size and plumpness. These tendencies became obvious with dose increase. In comparison with control DNA, introducing DNA irradiated could raise evidently mutagenic effect of pollen tube pathway technique

  13. CHANGES IN LUNG FUNCTION IN THE TREATMENT OF PATIENTS WITH EXOGENOUS ALLERGIC ALVEOLITIS

    Directory of Open Access Journals (Sweden)

    V. B. Nefedov

    2014-01-01

    Full Text Available Total lung capacity (TLC, lung capacity (LC, forced LC (FLC, intrathoracic volume (ITV, pulmonary residual volume (PRV, forced expiratory volume in one second (FEV1 , (FEV1 /LC%, peak expiratory flow (PEF, maximum expiratory flow rate (MEFR25, MEFR50, MEFR75, Raw, Rin, Rex, DLCO-SB, DLCO-SB/VА, РаО2 , and РаСО2 were determined in 43 patients with exogenous allergic alveolitis (EAA before, during, and after treatment with glucocorticosteroids, hemapheresis, ambroxol, and fluimucil. Lung function became better in more than half (53.5% of the patients and worse in one fourth (25.6%; a combination of positive and negative functional changes was detected in 14.0%. Improved lung function was noted in 75.0, 50.0, and 38.5% of the patients with acute, subacute, and chronic EAA, respectively. Deterioration of lung function was determined in 46.2, 22.2, and 8.3% of the patients with chronic, subacute, and acute alveolitis, respectively. Better lung function manifested itself mainly as positive changes in lung volumes and capacities and pulmonary gas exchange function, less frequently as improved bronchial patency in the patients with acute and subacute EAA whereas the rate of positive functional changes in lung volumes and capacities, bronchial patency, and pulmonary gas exchange function was equal in those with chronic EAA. Poorer lung function appeared as negative changes in lung volumes and capacities in the patients with acute EAA, as worse pulmonary gas exchange function and negative changes in lung volumes and capacities and deteriorated bronchial patency in those with subacute and chronic EAA.

  14. Contrast media inhibit exogenous surfactant therapy in rats with acute respiratory distress syndrome

    NARCIS (Netherlands)

    Kesecioglu, Jozef; Haitsma, Jack J.; Schultz, Marcus J.; den Heeten, Gerard J.; Lachmann, Burkhard

    2006-01-01

    AIM: To test the effects of various contrast media on the pulmonary surfactant system. MATERIAL AND METHODS: In a rat model of acute respiratory distress syndrome (ARDS) induced by lung lavage, the effects of surfactant suspended in saline were compared with surfactant suspended in the contrast

  15. Assessment of Health Effects of Exogenous Urea: Summary and Key Findings.

    Science.gov (United States)

    Dickerson, Aisha S; Lee, Janice S; Keshava, Channa; Hotchkiss, Andrew; Persad, Amanda S

    2018-05-01

    Urea has been utilized as a reductant in diesel fuels to lower emission of nitrogen oxides, igniting interest in probable human health hazards associated with exposure to exogenous urea. Here, we summarize and update key findings on potential health effects of exogenous urea, including carcinogenicity. No definitive target organs for oral exposure were identified; however, results in animal studies suggest that the liver and kidney could be potential target organs of urea toxicity. The available human-subject literature suggests that the impact on lung function is minimal. Based on the literature on exogenous urea, we concluded that there was inadequate information to assess the carcinogenic potential of urea, or perform a quantitative assessment to derive reference values. Given the limited information on exogenous urea, additional research to address gaps for exogenous urea should include long-term cancer bioassays, two-generation reproductive toxicity studies, and mode-of-action investigations.

  16. Exogenous (automatic) attention to emotional stimuli: a review

    OpenAIRE

    Carretié, Luis

    2014-01-01

    Current knowledge on the architecture of exogenous attention (also called automatic, bottom-up, or stimulus-driven attention, among other terms) has been mainly obtained from studies employing neutral, anodyne stimuli. Since, from an evolutionary perspective, exogenous attention can be understood as an adaptive tool for rapidly detecting salient events, reorienting processing resources to them, and enhancing processing mechanisms, emotional events (which are, by definition, salient for the in...

  17. Effect Of Exogenous Progesterone On Blood Chemistry Of Large ...

    African Journals Online (AJOL)

    Exogenous hormones are major economic factors in swine production. This study evaluate the effects of exogenous administration of progesterone on the blood chemistry of pigs.Experiment involved weekly injections of progesterone to 24 pigs (12 males and 12 females)from day old to 24 weeks and only corn oil to another ...

  18. Exogenous and endogenous spatial attention effects on visuospatial working memory.

    Science.gov (United States)

    Botta, Fabiano; Santangelo, Valerio; Raffone, Antonino; Lupiáñez, Juan; Belardinelli, Marta Olivetti

    2010-08-01

    In this study, we investigate how exogenous and endogenous orienting of spatial attention affect visuospatial working memory (VSWM). Specifically, we focused on two attentional effects and their consequences on storage in VSWM, when exogenous (Experiment 1) or endogenous (Experiment 2) orienting cues were used. The first effect, known as the meridian effect, is given by a decrement in behavioural performance when spatial cues and targets are presented in locations separated by vertical and/or horizontal meridians. The second effect, known as the distance effect, is given by a decrement in the orienting effects as a function of the spatial distance between cues and targets. Our results revealed a dissociation between exogenous and endogenous orienting mechanisms in terms of both meridian and distance effects. We found that meridian crossing affects performance only when endogenous cues were used. Specifically, VSWM performance with endogenous cueing depended more on the number of meridian crossings than on distance between cue and target. By contrast, a U-shaped distance dependency was observed using exogenous cues. Our findings therefore suggest that exogenous and endogenous orienting mechanisms lead to different forms of attentional bias for storage in VSWM.

  19. Exogenous ethylene inhibits sprout growth in onion bulbs.

    Science.gov (United States)

    Bufler, Gebhard

    2009-01-01

    Exogenous ethylene has recently gained commercial interest as a sprouting inhibitor of onion bulbs. The role of ethylene in dormancy and sprouting of onions, however, is not known. A cultivar (Allium cepa 'Copra') with a true period of dormancy was used. Dormant and sprouting states of onion bulbs were treated with supposedly saturating doses of ethylene or with the ethylene-action inhibitor 1-methylcyclopropene (1-MCP). Initial sprouting was determined during storage at 18 degrees C by monitoring leaf blade elongation in a specific size class of leaf sheaths. Changes in ATP content and sucrose synthase activity in the sprout leaves, indicators of the sprouting state, were determined. CO(2) and ethylene production of onion bulbs during storage were recorded. Exogenous ethylene suppressed sprout growth of both dormant and already sprouting onion bulbs by inhibiting leaf blade elongation. In contrast to this growth-inhibiting effect, ethylene stimulated CO(2) production by the bulbs about 2-fold. The duration of dormancy was not significantly affected by exogenous ethylene. However, treatment of dormant bulbs with 1-MCP caused premature sprouting. Exogenous ethylene proved to be a powerful inhibitor of sprout growth in onion bulbs. The dormancy breaking effect of 1-MCP indicates a regulatory role of endogenous ethylene in onion bulb dormancy.

  20. Spatial orienting around the fovea: exogenous and endogenous cueing effects.

    Science.gov (United States)

    Yang, Taoxi; Zhang, Jiyuan; Bao, Yan

    2015-09-01

    The effect of covert attention in perifoveal and peripheral locations has been studied extensively. However, it is less clear whether attention operates similarly in the foveal area itself. The present study aims to investigate whether the attentional orienting elicited by an exogenous or endogenous cue can operate within the foveal area and whether attentional orienting operates similarly between foveal and perifoveal regions. By manipulating exogenous orienting in Experiment 1 and endogenous orienting in Experiment 2, we observed both forms of cueing in the foveal area. Specifically, we observed a larger exogenous cue-induced inhibitory effect (i.e., inhibition of return effect) and a similar endogenous cue-elicited facilitatory effect for the perifoveal relative to the foveal targets. We conclude that exogenous and endogenous orienting subject to two independent attentional systems with distinct modulation patterns in the foveal area.

  1. Exogenous insulin antibody syndrome (EIAS): a clinical syndrome associated with insulin antibodies induced by exogenous insulin in diabetic patients.

    Science.gov (United States)

    Hu, Xiaolei; Chen, Fengling

    2018-01-01

    Insulin has been used for diabetes therapy and has achieved significant therapeutic effect. In recent years, the use of purified and recombinant human insulin preparations has markedly reduced, but not completely suppressed, the incidence of insulin antibodies (IAs). IAs induced by exogenous insulin in diabetic patients is associated with clinical events, which is named exogenous insulin antibody syndrome (EIAS). The present review is based on our research and summarizes the characterization of IAs, the factors affecting IA development, the clinical significance of IAs and the treatments for EIAS. © 2018 The authors.

  2. [Farmer's lung--a form of exogenous allergic alveolitis].

    Science.gov (United States)

    Sambale, M; Liebetrau, G

    1990-11-15

    Exogenic allergic alveolitides are caused by organic dusts which contain bacteria, moulds or vegetable and animal antigens. The farmer's lung as a form of the exogenic allergic alveolitis is a rare disease. The uncharacteristic symptomatology in the initial phase and in particular the retarded beginning of the symptom after several hours handicap the timely recognition in an early phase of the disease so that curative therapeutic measures are rarely possible. The cases of the disease are found only at the chronic stage, at the stage of the pulmonary fibrosis. Then the prognosis is unfavourable. In the Central Clinic for Heart and Lung Diseases Bad Berka 1,110 patients with alveolitides and lung fibroses were diagnosed in the period from 1975 to 1988. 306 of them could be clarified as exogenic allergic alveolitis, 61 of them (19.8%) were farmer's lungs.

  3. Do endogenous and exogenous action control compete for perception?

    Science.gov (United States)

    Pfister, Roland; Heinemann, Alexander; Kiesel, Andrea; Thomaschke, Roland; Janczyk, Markus

    2012-04-01

    Human actions are guided either by endogenous action plans or by external stimuli in the environment. These two types of action control seem to be mediated by neurophysiologically and functionally distinct systems that interfere if an endogenously planned action suddenly has to be performed in response to an exogenous stimulus. In this case, the endogenous representation has to be deactivated first to give way to the exogenous system. Here we show that interference of endogenous and exogenous action control is not limited to motor-related aspects but also affects the perception of action-related stimuli. Participants associated two actions with contingent sensory effects in learning blocks. In subsequent test blocks, preparing one of these actions specifically impaired responding to the associated effect in an exogenous speeded detection task, yielding a blindness-like effect for arbitrary, learned action effects. In accordance with the theory of event coding, this finding suggests that action planning influences perception even in the absence of any physical similarities between action and to-be-perceived stimuli.

  4. Exogenous Ochronosis

    Directory of Open Access Journals (Sweden)

    Prachi A Bhattar

    2015-01-01

    Full Text Available Exogenous ochronosis (EO is a cutaneous disorder characterized by blue-black pigmentation resulting as a complication of long-term application of skin-lightening creams containing hydroquinone but may also occur due to topical contact with phenol or resorcinol in dark-skinned individuals. It can also occur following the use of systemic antimalarials such as quinine. EO is clinically and histologically similar to its endogenous counterpart viz., alkaptonuria, which, however, exhibits systemic effects and is an inherited disorder. Dermoscopy and in vivo skin reflectance confocal microscopy are noninvasive in vivo diagnostic tools. It is very difficult to treat EO, a cosmetically disfiguring and troubling disorder with disappointing treatment options.

  5. The analgesic effects of exogenous melatonin in humans.

    Science.gov (United States)

    Andersen, Lars Peter Holst

    2016-10-01

    The hormone, melatonin is produced with circadian rhythm by the pineal gland in humans. The melatonin rhythm provides an endogenous synchronizer, modulating e.g. blood pressure, body temperature, cortisol rhythm, sleep-awake-cycle, immune function and anti-oxidative defence. Interestingly, a number of experimental animal studies demonstrate significant dose-dependent anti-nociceptive effects of exogenous melatonin. Similarly, recent experimental- and clinical studies in humans indicate significant analgesic effects. In study I, we systematically reviewed all randomized studies investigating clinical effects of perioperative melatonin. Meta-analyses demonstrated significant analgesic and anxiolytic effects of melatonin in surgical patients, equating reductions of 20 mm and 19 mm, respectively on a VAS, compared with placebo. Profound heterogeneity between the included studies was, however, present. In study II, we aimed to investigate the analgesic, anti-hyperalgesic and anti-inflammatory effects of exogenous melatonin in a validated human inflammatory pain model, the human burn model. The study was performed as a randomized, double blind placebo-controlled crossover study. Primary outcomes were pain during the burn injury and areas of secondary hyperalgesia. No significant effects of exogenous melatonin were observed with respect to primary or secondary outcomes, compared to placebo. Study III and IV estimated the pharmacokinetic variables of exogenous melatonin. Oral melatonin demonstrated a t max value of 41 minutes. Bioavailability of oral melatonin was only 3%. Elimination t 1/2 were approximately 45 minutes following both oral and intravenous administration, respectively. High-dose intravenous melatonin was not associated with increased sedation, in terms of simple reaction times, compared to placebo. Similarly, no other adverse effects were reported. In Study V, we aimed to re-analyse data obtained from a randomized analgesic drug trial by a selection of

  6. Distribution of exogenous DNA in upland cotton by pollen tube pathway

    International Nuclear Information System (INIS)

    Yang Shuhua; Ge Cailin; Zhu Jing; Wang Zegang; Luo Shishi; Ni Wanchao

    2007-01-01

    The distribution of exogenous DNA in upland cotton by pollen tube pathway was studied. The results showed that the exogenous DNA could be transported into ovules by dripping and injection. The optimum time for treatment is at 33 h after pollination. The radioactivity in ovules by dripping exogenous DNA was lower than that by injecting. In autoradiogram, the number of sliver grains in the treated ovules was more than that in the controls. (authors)

  7. Static magnetic field reduced exogenous oligonucleotide uptake by spermatozoa using magnetic nanoparticle gene delivery system

    International Nuclear Information System (INIS)

    Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran

    2016-01-01

    Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer. - Highlights: • Core/shell type Iron oxide nanoparticles were used as a novel and efficient method. • This method increases exogenous DNA uptake by rooster spermatozoa. • Static magnetic field decreased DNA uptake by rooster spermatozoa.

  8. Static magnetic field reduced exogenous oligonucleotide uptake by spermatozoa using magnetic nanoparticle gene delivery system

    Energy Technology Data Exchange (ETDEWEB)

    Katebi, Samira; Esmaeili, Abolghasem, E-mail: aesmaeili@sci.ui.ac.ir; Ghaedi, Kamran

    2016-03-15

    Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer. - Highlights: • Core/shell type Iron oxide nanoparticles were used as a novel and efficient method. • This method increases exogenous DNA uptake by rooster spermatozoa. • Static magnetic field decreased DNA uptake by rooster spermatozoa.

  9. Neural correlates of endogenous attention, exogenous attention and inhibition of return in touch.

    Science.gov (United States)

    Jones, Alexander; Forster, Bettina

    2014-07-01

    Selective attention helps process the myriad of information constantly touching our body. Both endogenous and exogenous mechanisms are relied upon to effectively process this information; however, it is unclear how they relate in the sense of touch. In three tasks we contrasted endogenous and exogenous event-related potential (ERP) and behavioural effects. Unilateral tactile cues were followed by a tactile target at the same or opposite hand. Clear behavioural effects showed facilitation of expected targets both when the cue predicted targets at the same (endogenous predictive task) and opposite hand (endogenous counter-predictive task), and these effects also correlated with ERP effects of endogenous attention. In an exogenous task, where the cue was non-informative, inhibition of return (IOR) was observed. The electrophysiological results demonstrated early effects of exogenous attention followed by later endogenous attention modulations. These effects were independent in both the endogenous predictive and exogenous tasks. However, voluntarily directing attention away from a cued body part influenced the early exogenous marker (N80). This suggests that the two mechanisms are interdependent, at least when the task requires more demanding shifts of attention. The early marker of exogenous tactile attention, the N80, was not directly related to IOR, which may suggest that exogenous attention and IOR are not necessarily two sides of the same coin. This study adds valuable new insight into how we process and select information presented to our body, showing both independent and interdependent effects of endogenous and exogenous attention in touch. © 2014 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  10. The effects of exogenous proline and osmotic stress on morpho ...

    African Journals Online (AJOL)

    USER

    2010-06-21

    Jun 21, 2010 ... For evaluation of growth parameters of strawberry callus under osmotic stress and exogenous proline, embryonic calli were transferred to Murashige and Skoog (MS) medium containing four sucrose. (osmotic stress) treatments including 3, 6, 9 and 12% and various concentrations of exogenous L- proline ...

  11. Exogenous insulin antibody syndrome (EIAS: a clinical syndrome associated with insulin antibodies induced by exogenous insulin in diabetic patients

    Directory of Open Access Journals (Sweden)

    Xiaolei Hu

    2018-01-01

    Full Text Available Insulin has been used for diabetes therapy and has achieved significant therapeutic effect. In recent years, the use of purified and recombinant human insulin preparations has markedly reduced, but not completely suppressed, the incidence of insulin antibodies (IAs. IAs induced by exogenous insulin in diabetic patients is associated with clinical events, which is named exogenous insulin antibody syndrome (EIAS. The present review is based on our research and summarizes the characterization of IAs, the factors affecting IA development, the clinical significance of IAs and the treatments for EIAS.

  12. The effects of exogenous proline and osmotic stress on morpho ...

    African Journals Online (AJOL)

    For evaluation of growth parameters of strawberry callus under osmotic stress and exogenous proline, embryonic calli were transferred to Murashige and Skoog (MS) medium containing four sucrose (osmotic stress) treatments including 3, 6, 9 and 12% and various concentrations of exogenous Lproline (0, 2.5, 5 and 10 ...

  13. Repair effects of exogenous SOD on Bacillus subtilis against gamma radiation exposure

    International Nuclear Information System (INIS)

    Chen, Xiaoming; Zhang, E.; Fang, Liu; Zhang, Jianguo; Zhu, Jie; He, Wei; Luo, Xuegang

    2013-01-01

    Superoxide dismutase (SOD) is an enzyme that removes free radicals from cells in many organisms. In order to further characterize these repair effects and their mechanism when subjected to radiation, Bacillus subtilis cells were exposed to gamma radiation and the cell survival rate, intracellular SOD activity, and DNA double-strand breakage were investigated. Vegetative cells of B. subtilis were irradiated by 60 Co gamma radiation at varying doses and subsequently exposed to varying levels of exogenous SOD. Standard plate-count, xanthine oxidase, and pulsed-field gel electrophoresis (PFGE) methods were employed to investigate the repair effects. The results showed that the exogenous SOD could significantly improve cell survival rate and intracellular SOD activity after gamma radiation. The cell survival rate was elevated 30–87 times above levels observed in control samples. Adding exogenous SOD into gamma irradiated cells may dramatically increase intracellular SOD activity (p 60 Co γ radiation and exposed to exogenous SOD. • Adding exogenous SOD into γ-irradiated cells may dramatically increase cell survival rate. • DNA strand scission may be prevented by addition of SOD. • Exogenous SOD may have the ability to repair cell damage after γ-rays radiation

  14. A comparative analysis of property of lychee polyphenoloxidase using endogenous and exogenous substrates.

    Science.gov (United States)

    Sun, Jian; Shi, John; Zhao, Mouming; Xue, Sophia Jun; Ren, Jiaoyan; Jiang, Yueming

    2008-06-01

    Lychee polyphenoloxidase (PPO) was extracted and partially purified using ammonium sulphate precipitation and dialysis. The comparative analysis of PPO property was performed using its endogenous substrate (-)-epicatechin and exogenous substrate catechol. The pH optima for activity and activation temperature profiles of lychee PPO were very different when the enzyme reacted with endogenous and exogenous substrates. The addition of ethylenediaminetetraacetic acid disodium salt into the endogenous or exogenous substrate-enzyme system exhibited the same lowest inhibition of the PPO activity. However, l-cysteine was most effective in inhibiting enzymatic activity in the endogenous substrate-enzyme system while ascorbic acid was the best inhibitor in the exogenous substrate-enzyme system. Fe(2+) greatly accelerated the enzymatic reaction between endogenous substrate and PPO, but Cu(2+) exerted the same effect on the reaction between exogenous substrate and PPO. Based on the kinetic analysis, lychee PPO could strongly bind endogenous substrate but it possessed a higher catalytic efficiency to exogenous substrate. Copyright © 2007 Elsevier Ltd. All rights reserved.

  15. Fructose and Sucrose Intake Increase Exogenous Carbohydrate Oxidation during Exercise

    Science.gov (United States)

    Trommelen, Jorn; Fuchs, Cas J.; Beelen, Milou; Lenaerts, Kaatje; Jeukendrup, Asker E.; Cermak, Naomi M.; van Loon, Luc J. C.

    2017-01-01

    Peak exogenous carbohydrate oxidation rates typically reach ~1 g·min−1 during exercise when ample glucose or glucose polymers are ingested. Fructose co-ingestion has been shown to further increase exogenous carbohydrate oxidation rates. The purpose of this study was to assess the impact of fructose co-ingestion provided either as a monosaccharide or as part of the disaccharide sucrose on exogenous carbohydrate oxidation rates during prolonged exercise in trained cyclists. Ten trained male cyclists (VO2peak: 65 ± 2 mL·kg−1·min−1) cycled on four different occasions for 180 min at 50% Wmax during which they consumed a carbohydrate solution providing 1.8 g·min−1 of glucose (GLU), 1.2 g·min−1 glucose + 0.6 g·min−1 fructose (GLU + FRU), 0.6 g·min−1 glucose + 1.2 g·min−1 sucrose (GLU + SUC), or water (WAT). Peak exogenous carbohydrate oxidation rates did not differ between GLU + FRU and GLU + SUC (1.40 ± 0.06 vs. 1.29 ± 0.07 g·min−1, respectively, p = 0.999), but were 46% ± 8% higher when compared to GLU (0.96 ± 0.06 g·min−1: p exogenous carbohydrate oxidation rates during the latter 120 min of exercise were 46% ± 8% higher in GLU + FRU or GLU + SUC compared with GLU (1.19 ± 0.12, 1.13 ± 0.21, and 0.82 ± 0.16 g·min−1, respectively, p exogenous carbohydrate oxidation rates during prolonged exercise in trained cyclists. PMID:28230742

  16. Static magnetic field reduced exogenous oligonucleotide uptake by spermatozoa using magnetic nanoparticle gene delivery system

    Science.gov (United States)

    Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran

    2016-03-01

    Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (Prooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer.

  17. Respiratory and Systemic Effects of LASSBio596 Plus Surfactant in Experimental Acute Respiratory Distress Syndrome

    Directory of Open Access Journals (Sweden)

    Johnatas Dutra Silva

    2016-02-01

    Full Text Available Background/Aims: Exogenous surfactant has been proposed as adjunctive therapy for acute respiratory distress syndrome (ARDS, but it is inactivated by different factors present in the alveolar space. We hypothesized that co-administration of LASSBio596, a molecule with significant anti-inflammatory properties, and exogenous surfactant could reduce lung inflammation, thus enabling the surfactant to reduce edema and improve lung function, in experimental ARDS. Methods: ARDS was induced by cecal ligation and puncture surgery in BALB/c mice. A sham-operated group was used as control (CTRL. After surgery (6 hours, CTRL and ARDS animals were assigned to receive: (1 sterile saline solution; (2 LASSBio596; (3 exogenous surfactant or (4 LASSBio596 plus exogenous surfactant (n = 22/group. Results: Regardless of exogenous surfactant administration, LASSBio596 improved survival rate and reduced collagen fiber content, total number of cells and neutrophils in PLF and blood, cell apoptosis, protein content in BALF, and urea and creatinine levels. LASSBio596 plus surfactant yielded all of the aforementioned beneficial effects, as well as increased BALF lipid content and reduced surface tension. Conclusion: LASSBio596 exhibited major anti-inflammatory and anti-fibrogenic effects in experimental sepsis-induced ARDS. Its association with surfactant may provide further advantages, potentially by reducing surface tension.

  18. Hemin offers neuroprotection through inducing exogenous neuroglobin in focal cerebral hypoxic-ischemia in rats

    Science.gov (United States)

    Song, Xue; Xu, Rui; Xie, Fei; Zhu, Haiyuan; Zhu, Ji; Wang, Xin

    2014-01-01

    Objective: To investigate the inducible effect of hemin on exogenous neuroglobin (Ngb) in focal cerebral hypoxic-ischemia in rats. Methods: 125 healthy SD rats were randomly divided into five groups: sham-operation control group, operation group, hemin treatment group, exogenous Ngb treatment group, and hemin and exogenous Ngb joint treatment group. Twenty-four hours after focal cerebral hypoxic-ischemia, Ngb expression was evaluated by immunocytochemistry, RT-PCR, and western blot analyses, while the brain water content and infarct volume were examined. Results: Immunocytochemistry, RT-PCR, and western blot analyses showed more pronounced Ngb expression in the hemin and exogenous Ngb joint operation group than in the hemin or exogenous Ngb individual treatment groups, thus producing significant differences in brain water content and infarct volume (p exogenous Ngb. PMID:24966924

  19. Endogenous versus Exogenous Growth Factor Regulation of Articular Chondrocytes

    Science.gov (United States)

    Shi, Shuiliang; Chan, Albert G.; Mercer, Scott; Eckert, George J.; Trippel, Stephen B.

    2014-01-01

    Anabolic growth factors that regulate the function of articular chondrocytes are candidates for articular cartilage repair. Such factors may be delivered by pharmacotherapy in the form of exogenous proteins, or by gene therapy as endogenous proteins. It is unknown whether delivery method influences growth factor effectiveness in regulating articular chondrocyte reparative functions. We treated adult bovine articular chondrocytes with exogenous recombinant insulin-like growth factor-I (IGF-I) and transforming growth factor-beta1 (TGF-β1), or with the genes encoding these growth factors for endogenous production. Treatment effects were measured as change in chondrocyte DNA content, glycosaminoglycan production, and aggrecan gene expression. We found that IGF-I stimulated chondrocyte biosynthesis similarly when delivered by either exogenous or endogenous means. In contrast, exogenous TGF-ß1 stimulated these reparative functions, while endogenous TGF-ß1 had little effect. Endogenous TGF-ß1 became more bioactive following activation of the transgene protein product. These data indicate that effective mechanisms of growth factor delivery for articular cartilage repair may differ for different growth factors. In the case of IGF-I, gene therapy or protein therapy appear to be viable options. In contrast, TGF-ß1 gene therapy may be constrained by a limited ability of chondrocytes to convert latent complexes to an active form. PMID:24105960

  20. Optimizing Multireservoir System Operating Policies Using Exogenous Hydrologic Variables

    Science.gov (United States)

    Pina, Jasson; Tilmant, Amaury; Côté, Pascal

    2017-11-01

    Stochastic dual dynamic programming (SDDP) is one of the few available algorithms to optimize the operating policies of large-scale hydropower systems. This paper presents a variant, called SDDPX, in which exogenous hydrologic variables, such as snow water equivalent and/or sea surface temperature, are included in the state space vector together with the traditional (endogenous) variables, i.e., past inflows. A reoptimization procedure is also proposed in which SDDPX-derived benefit-to-go functions are employed within a simulation carried out over the historical record of both the endogenous and exogenous hydrologic variables. In SDDPX, release policies are now a function of storages, past inflows, and relevant exogenous variables that potentially capture more complex hydrological processes than those found in traditional SDDP formulations. To illustrate the potential gain associated with the use of exogenous variables when operating a multireservoir system, the 3,137 MW hydropower system of Rio Tinto (RT) located in the Saguenay-Lac-St-Jean River Basin in Quebec (Canada) is used as a case study. The performance of the system is assessed for various combinations of hydrologic state variables, ranging from the simple lag-one autoregressive model to more complex formulations involving past inflows, snow water equivalent, and winter precipitation.

  1. Matching cue size and task properties in exogenous attention.

    Science.gov (United States)

    Burnett, Katherine E; d'Avossa, Giovanni; Sapir, Ayelet

    2013-01-01

    Exogenous attention is an involuntary, reflexive orienting response that results in enhanced processing at the attended location. The standard view is that this enhancement generalizes across visual properties of a stimulus. We test whether the size of an exogenous cue sets the attentional field and whether this leads to different effects on stimuli with different visual properties. In a dual task with a random-dot kinematogram (RDK) in each quadrant of the screen, participants discriminated the direction of moving dots in one RDK and localized one red dot. Precues were uninformative and consisted of either a large or a small luminance-change frame. The motion discrimination task showed attentional effects following both large and small exogenous cues. The red dot probe localization task showed attentional effects following a small cue, but not a large cue. Two additional experiments showed that the different effects on localization were not due to reduced spatial uncertainty or suppression of RDK dots in the surround. These results indicate that the effects of exogenous attention depend on the size of the cue and the properties of the task, suggesting the involvement of receptive fields with different sizes in different tasks. These attentional effects are likely to be driven by bottom-up mechanisms in early visual areas.

  2. Object-centered representations support flexible exogenous visual attention across translation and reflection.

    Science.gov (United States)

    Lin, Zhicheng

    2013-11-01

    Visual attention can be deployed to stimuli based on our willful, top-down goal (endogenous attention) or on their intrinsic saliency against the background (exogenous attention). Flexibility is thought to be a hallmark of endogenous attention, whereas decades of research show that exogenous attention is attracted to the retinotopic locations of the salient stimuli. However, to the extent that salient stimuli in the natural environment usually form specific spatial relations with the surrounding context and are dynamic, exogenous attention, to be adaptive, should embrace these structural regularities. Here we test a non-retinotopic, object-centered mechanism in exogenous attention, in which exogenous attention is dynamically attracted to a relative, object-centered location. Using a moving frame configuration, we presented two frames in succession, forming either apparent translational motion or in mirror reflection, with a completely uninformative, transient cue presented at one of the item locations in the first frame. Despite that the cue is presented in a spatially separate frame, in both translation and mirror reflection, behavioralperformance in visual search is enhanced when the target in the second frame appears at the same relative location as the cue location than at other locations. These results provide unambiguous evidence for non-retinotopic exogenous attention and further reveal an object-centered mechanism supporting flexible exogenous attention. Moreover, attentional generalization across mirror reflection may constitute an attentional correlate of perceptual generalization across lateral mirror images, supporting an adaptive, functional account of mirror images confusion. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Survey Study of Lipid Effect on Nisin Nanoliposome Formation and Application in Pasteurized Milk as a Food Model

    Directory of Open Access Journals (Sweden)

    Say-yed Hesameddin Tafreshi

    2015-03-01

    Full Text Available The use of bacteriocins, mainly nisin, is one of the most significant preservation technologies in food industries. Nisin encapsulation can improve stability and homogenous distribution in food matrices. In this study, liposomes of four various lipids (lipoid S 100, lipoid S PC-3, lipoid S PC and lipoid PC (DPPC were prepared by dehydration-rehydration method, compared for entrapment efficiency and lipid with the highest entrapment efficiency (DPPC was characterized. Inhibitory effects of encapsulated (DPPC nanoliposomes and free nisin on spoilage of pasteurized milk were also studied. Entrapment efficiency ranged from 14% (lipoid S 100 to 49% (DPPC. DPPC nanoliposomes were large unilamellar vesicles (LUV and had an asymmetric oval shape (elliptical with a mean diameter of 136 nm. Our study revealed that pasteurized milk spoilage was delayed by both of free and encapsulated nisin, but free nisin (with 38 days was significantly more efficient in comparison with encapsulated nisin (14 days.

  4. Function of endothelium at adolescents with constitutional exogenous obesity before and after rehabilitation

    OpenAIRE

    Miroshnichenko, O.

    2011-01-01

    Function of endothelium at 43 adolescents with constitutional exogenous obesity before rehabilitation and at 33 healthy adolescents has been studied. Disorder of endothelial function has been established in 32 (74.4%) adolescents with constitutional exogenous obesity and in 7 (21.2%) healthy adolescents. We showed the efficiency of the rehabilitation program on restoration of endothelial function at adolescents with constitutional exogenous obesity.

  5. Structure and texture of uranium ores in exogenous deposits

    International Nuclear Information System (INIS)

    Danchev, V.I.

    1977-01-01

    Structure and texture signs of uranium rock exogenous deposits have been systematized for the first time, taking into account the slaging of the ore-formation process, connected with formation and change of containing sedimentary rocks, starting with the sedimentogenesis stage and early sediment diagenesis and their subsequent transformation in katagenesis and metamorphism processes. The main features of uranium geochemistry in the exogenous process are considered. Suggested is the genetic classification of uranium exogenous deposits in rocks of sedimentary cover, made with respect to conjugation and various ore-forming productivity of the litogenesis stage. Described are the main combinations of various rock texture and structure properties, characteristic of deposits of genetic classes and groups of the above classification. Eight most frequently occuring textures (lamellar, concretion, oolitic, coagulate, crack, mixed and impregnated) and their types are described and illustrated. Materials of soviet and foreign authors have been used to compile the atlas

  6. A method for tracing exogenous DNA uptake in live spermatozoa and embryos.

    Science.gov (United States)

    Mu, Y; Jiao, M; Zhao, Y; Lv, J; Wang, J; Hao, J; Zhang, X; Kong, Q; Liu, Z

    2018-03-01

    Sperm-mediated gene transfer(SMGT) is a simple method for producing transgenic animals. Due to the lack of repeatability in spermatozoa binding and internalization of exogenous DNA, the efficiency of SMGT is still low. Considering this point, the present work aims to develop a method for evaluating the spermatozoa capacity of binding exogenous DNA after co-incubation with DNA. The main approach is using a Cy5-labelled DNA to trace the exogenous DNA and assess the ability of spermatozoa to take up exogenous DNA. Using this technique, we found that the percentage of spermatozoa that are binding and uptaking DNA is higher at concentration of 10 μg/mL and 100 μg/mL than 5 μg/mL, 1 μg/mL and 0 μg/mL after incubation with Cy5-DNA for 30min at 37oC. After fertilization, the DNA fluorescence signal was also detected in zygotes in groups where spermatozoa were incubated with 10 μg/mL and 100 μg/mL of Cy5-DNA. These results showed a simple and convenient method to trace the exogenous DNA in spermatozoa and zygote when compared to conventional methods of labeling DNA during fertilization, resulting in a real-time observation of the exogenous DNA in spermatozoa and zygote. Copyright© by the Polish Academy of Sciences.

  7. Differences between endogenous and exogenous emotion inhibition in the human brain.

    Science.gov (United States)

    Kühn, Simone; Haggard, Patrick; Brass, Marcel

    2014-05-01

    The regulation of emotions is an integral part of our mental health. It has only recently been investigated using brain imaging techniques. In most studies, participants are instructed by a cue to inhibit a specific emotional reaction. The aim of the present study was to investigate the alternative situation where a person decides to inhibit an emotion as an act of endogenous self-control. Healthy participants viewed highly arousing pictures with negative valence. In the endogenous condition, participants could freely choose on each trial to inhibit or feel the emotions elicited by the picture. In an exogenous condition, a visual cue instructed them to either feel or inhibit the emotion elicited by the picture. Participants' subjective ratings of intensity of experienced emotion showed an interaction effect between source of control (endogenous/exogenous) and feel/inhibit based on a stronger modulation between feel and inhibition for the endogenous compared to the exogenous condition. Endogenous inhibition of emotions was associated with dorso-medial prefrontal cortex activation, whereas exogenous inhibition was found associated with lateral prefrontal cortex activation. Thus, the brain regions for both endogenous and exogenous inhibition of emotion are highly similar to those for inhibition of motor actions in Brass and Haggard (J Neurosci 27:9141-9145, 2007), Kühn et al. (Hum Brain Mapp 30:2834-2843, 2009). Functional connectivity analyses showed that dorsofrontomedial cortex exerts greater control onto pre-supplementary motor area during endogenous inhibition compared to endogenous feel. This functional dissociation between an endogenous, fronto-medial and an exogenous, fronto-lateral inhibition centre has important implications for our understanding of emotion regulation in health and psychopathology.

  8. Elongator Plays a Positive Role in Exogenous NAD-Induced Defense Responses in Arabidopsis.

    Science.gov (United States)

    An, Chuanfu; Ding, Yezhang; Zhang, Xudong; Wang, Chenggang; Mou, Zhonglin

    2016-05-01

    Extracellular NAD is emerging as an important signal molecule in animal cells, but its role in plants has not been well-established. Although it has been shown that exogenous NAD(+) activates defense responses in Arabidopsis, components in the exogenous NAD(+)-activated defense pathway remain to be fully discovered. In a genetic screen for mutants insensitive to exogenous NAD(+) (ien), we isolated a mutant named ien2. Map-based cloning revealed that IEN2 encodes ELONGATA3 (ELO3)/AtELP3, a subunit of the Arabidopsis Elongator complex, which functions in multiple biological processes, including histone modification, DNA (de)methylation, and transfer RNA modification. Mutations in the ELO3/AtELP3 gene compromise exogenous NAD(+)-induced expression of pathogenesis-related (PR) genes and resistance to the bacterial pathogen Pseudomonas syringae pv. maculicola ES4326, and transgenic expression of the coding region of ELO3/AtELP3 in elo3/Atelp3 restores NAD(+) responsiveness to the mutant plants, demonstrating that ELO3/AtELP3 is required for exogenous NAD(+)-induced defense responses. Furthermore, mutations in genes encoding the other five Arabidopsis Elongator subunits (ELO2/AtELP1, AtELP2, ELO1/AtELP4, AtELP5, and AtELP6) also compromise exogenous NAD(+)-induced PR gene expression and resistance to P. syringae pv. maculicola ES4326. These results indicate that the Elongator complex functions as a whole in exogenous NAD(+)-activated defense signaling in Arabidopsis.

  9. Research on the Relationships between Endogenous Biomarkers and Exogenous Toxic Substances of Acute Toxicity in Radix Aconiti

    OpenAIRE

    Haonan Zhou; Pengjie Zhang; Zhiguo Hou; Jiabin Xie; Yuming Wang; Bin Yang; Yanyan Xu; Yubo Li

    2016-01-01

    Radix Aconiti, a classic traditional Chinese medicine (TCM), has been widely used throughout China for disease treatment due to its various pharmacological activities, such as anti-inflammatory, cardiotonic, and analgesic effects. However, improper use of Radix Aconiti often generated severe acute toxicity. Currently, research on the toxic substances of Radix Aconiti is not rare. In our previous study, acute toxic biomarkers of Radix Aconiti have been found. However, few studies were availabl...

  10. Squalene aspiration pneumonia : thin-section CT and histopathologic findings

    International Nuclear Information System (INIS)

    Lee, Jin Seong; Gong, Gyung Yub; Lim, Tae Hwan

    1998-01-01

    The purpose of this study was to describe the thin-section computed tomography (CT) findings and histopathologic findings of squalene aspiration pneumonia. Thin-section CT scans were obtained from nine patients with proven exogenous lipoid pneumonia resulting from aspiration of squalene (derived from shark liver oil). The condition was diagnosed by biopsy (n=3), bronchoalveolar lavage(n=4), or sputum cytology and clinical history (n=2) of squalene use was confirmed in all patients. Specimens of transbronchial lung biopsy were also reviewed and compared with thin-section CT findings. On the basis of these results, we concluded that squalene aspiration pneumonia can be reliably diagnosed by thin-section CT findings particularly when the appropriate history is known. (author). 19 refs., 3 figs

  11. Perceptual load affects exogenous spatial orienting while working memory load does not.

    Science.gov (United States)

    Santangelo, Valerio; Finoia, Paola; Raffone, Antonino; Belardinelli, Marta Olivetti; Spence, Charles

    2008-01-01

    We examined whether or not increasing visual perceptual load or visual working memory (WM) load would affect the exogenous orienting of visuo-spatial attention, in order to assess whether or not exogenous orienting is genuinely automatic. In Experiment 1, we manipulated visual perceptual load by means of a central morphing shape that in some trials morphed into a particular target shape (a rectangle) that participants had to detect. In Experiment 2, the possibility that the presentation of any changing stimulus at fixation would eliminate exogenous orienting was ruled out, by presenting two alternating letters at fixation. In Experiment 3, we manipulated visual WM load by means of arrays consisting of three (low-load) or five (high-load) randomly located coloured squares. The participants had to remember these items in order to judge whether a cued square had been presented in the same or different colour at the end of each trial. In all the experiments, exogenous visuo-spatial attentional orienting was measured by means of an orthogonal spatial cuing task, in which the participants had to discriminate the elevation (up vs. down) of a visual target previously cued by a spatially nonpredictive visual cue. The results showed that increasing the perceptual load of the task eliminated the exogenous orienting of visuo-spatial attention. By contrast, increasing the WM load had no effect on spatial orienting. These results are discussed in terms of the light that they shed on claims regarding the automaticity of visuo-spatial exogenous orienting.

  12. An Exogenous Surfactant-Producing Bacillus subtilis Facilitates Indigenous Microbial Enhanced Oil Recovery.

    Science.gov (United States)

    Gao, Peike; Li, Guoqiang; Li, Yanshu; Li, Yan; Tian, Huimei; Wang, Yansen; Zhou, Jiefang; Ma, Ting

    2016-01-01

    This study used an exogenous lipopeptide-producing Bacillus subtilis to strengthen the indigenous microbial enhanced oil recovery (IMEOR) process in a water-flooded reservoir in the laboratory. The microbial processes and driving mechanisms were investigated in terms of the changes in oil properties and the interplay between the exogenous B. subtilis and indigenous microbial populations. The exogenous B. subtilis is a lipopeptide producer, with a short growth cycle and no oil-degrading ability. The B. subtilis facilitates the IMEOR process through improving oil emulsification and accelerating microbial growth with oil as the carbon source. Microbial community studies using quantitative PCR and high-throughput sequencing revealed that the exogenous B. subtilis could live together with reservoir microbial populations, and did not exert an observable inhibitory effect on the indigenous microbial populations during nutrient stimulation. Core-flooding tests showed that the combined exogenous and indigenous microbial flooding increased oil displacement efficiency by 16.71%, compared with 7.59% in the control where only nutrients were added, demonstrating the application potential in enhanced oil recovery in water-flooded reservoirs, in particular, for reservoirs where IMEOR treatment cannot effectively improve oil recovery.

  13. Using synergistic exogenous phytohormones to enhance somatic ...

    African Journals Online (AJOL)

    Southern Forests: a Journal of Forest Science ... Eucalyptus spp. has been limited to germinated seeds, flowers, lignotubers or zygotic embryos. ... explants could be enhanced through pairing of synergistic exogenous plant growth regulators, ...

  14. INVESTMENT EFFECTS OF ENDOGENOUS AND EXOGENOUS DEPRECIATION: IMPROVED PASTURES IN URUGUAY

    OpenAIRE

    Ekboir, Javier M.; Jarvis, Lovell S.; Rey, Carlos

    1998-01-01

    The depreciation rate for capital assets may have endogenous and exogenous components. Change in the exogenous component depends on technological change and/or environmental factors, shifts the production function, and independently affects profitability and investment. Change in the endogenous component does not. These hypotheses are tested using data on Uruguayan grass-legume pastures.

  15. Cortisol acutely reduces selective attention for erotic words in healthy young men.

    Science.gov (United States)

    Putman, Peter; Berling, Sylvia

    2011-10-01

    Psychological stress prompts activity of the hypothalamic-pituitary-adrenal (HPA) axis resulting in increased release of cortisol. Long-term HPA aberrations have been observed for stress-related affective disorders but research into acute effects of cortisol on affect-regulation has only recently begun. Previous studies reported that exogenous cortisol acutely attenuated automatic attentional processing of task-irrelevant threatening information. This has been taken to suggest that cortisol may have acute anxiolytic properties, possibly through facilitating inhibition of threatening information. However, the role of cortisol in attentional inhibition of non-threatening arousing stimuli remained unclear. Therefore acute effects of 40 mg cortisol on performance of a masked and unmasked emotional Stroop task (EST) were assessed. Results for only the unmasked task demonstrated EST interference (interpreted as increased automatic attention) for erotic stimuli which was abolished by cortisol administration. This implies that effects of cortisol may not be restricted to attenuation of specifically anxiogenic information processing, as previously suggested. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. Differential effects of exogenous and endogenous attention on second-order texture contrast sensitivity

    Science.gov (United States)

    Barbot, Antoine; Landy, Michael S.; Carrasco, Marisa

    2012-01-01

    The visual system can use a rich variety of contours to segment visual scenes into distinct perceptually coherent regions. However, successfully segmenting an image is a computationally expensive process. Previously we have shown that exogenous attention—the more automatic, stimulus-driven component of spatial attention—helps extract contours by enhancing contrast sensitivity for second-order, texture-defined patterns at the attended location, while reducing sensitivity at unattended locations, relative to a neutral condition. Interestingly, the effects of exogenous attention depended on the second-order spatial frequency of the stimulus. At parafoveal locations, attention enhanced second-order contrast sensitivity to relatively high, but not to low second-order spatial frequencies. In the present study we investigated whether endogenous attention—the more voluntary, conceptually-driven component of spatial attention—affects second-order contrast sensitivity, and if so, whether its effects are similar to those of exogenous attention. To that end, we compared the effects of exogenous and endogenous attention on the sensitivity to second-order, orientation-defined, texture patterns of either high or low second-order spatial frequencies. The results show that, like exogenous attention, endogenous attention enhances second-order contrast sensitivity at the attended location and reduces it at unattended locations. However, whereas the effects of exogenous attention are a function of the second-order spatial frequency content, endogenous attention affected second-order contrast sensitivity independent of the second-order spatial frequency content. This finding supports the notion that both exogenous and endogenous attention can affect second-order contrast sensitivity, but that endogenous attention is more flexible, benefitting performance under different conditions. PMID:22895879

  17. Differential effects of exogenous and endogenous attention on second-order texture contrast sensitivity.

    Science.gov (United States)

    Barbot, Antoine; Landy, Michael S; Carrasco, Marisa

    2012-08-15

    The visual system can use a rich variety of contours to segment visual scenes into distinct perceptually coherent regions. However, successfully segmenting an image is a computationally expensive process. Previously we have shown that exogenous attention--the more automatic, stimulus-driven component of spatial attention--helps extract contours by enhancing contrast sensitivity for second-order, texture-defined patterns at the attended location, while reducing sensitivity at unattended locations, relative to a neutral condition. Interestingly, the effects of exogenous attention depended on the second-order spatial frequency of the stimulus. At parafoveal locations, attention enhanced second-order contrast sensitivity to relatively high, but not to low second-order spatial frequencies. In the present study we investigated whether endogenous attention-the more voluntary, conceptually-driven component of spatial attention--affects second-order contrast sensitivity, and if so, whether its effects are similar to those of exogenous attention. To that end, we compared the effects of exogenous and endogenous attention on the sensitivity to second-order, orientation-defined, texture patterns of either high or low second-order spatial frequencies. The results show that, like exogenous attention, endogenous attention enhances second-order contrast sensitivity at the attended location and reduces it at unattended locations. However, whereas the effects of exogenous attention are a function of the second-order spatial frequency content, endogenous attention affected second-order contrast sensitivity independent of the second-order spatial frequency content. This finding supports the notion that both exogenous and endogenous attention can affect second-order contrast sensitivity, but that endogenous attention is more flexible, benefitting performance under different conditions.

  18. Exogenous and endogenous landforms in the Mediterranean

    Science.gov (United States)

    Acar, Julia

    2017-04-01

    11th graders have already learned about endogenous forces and now we are having a closer look at the exogenous forces which act on the Earth's surface. The Po River-system, for example, is responsible for the formation of the alpine region. Students are asked to find out how this works with the help of the rock-cycle scheme, several suitable maps and information on weathering and the texture of rocks, erosion, etc. We will form groups that will look at different types of rock formations (including an example in the Mediterranean region each). Depending on the number of lessons available we will add the exogenous effect of flowing water and ice (glacial over forming) to the topic. At the end every group will present their findings explaining the scientific context by using topographic examples.

  19. Endogenous versus exogenous growth factor regulation of articular chondrocytes.

    Science.gov (United States)

    Shi, Shuiliang; Chan, Albert G; Mercer, Scott; Eckert, George J; Trippel, Stephen B

    2014-01-01

    Anabolic growth factors that regulate the function of articular chondrocytes are candidates for articular cartilage repair. Such factors may be delivered by pharmacotherapy in the form of exogenous proteins, or by gene therapy as endogenous proteins. It is unknown whether delivery method influences growth factor effectiveness in regulating articular chondrocyte reparative functions. We treated adult bovine articular chondrocytes with exogenous recombinant insulin-like growth factor-I (IGF-I) and transforming growth factor-beta1 (TGF-β1), or with the genes encoding these growth factors for endogenous production. Treatment effects were measured as change in chondrocyte DNA content, glycosaminoglycan production, and aggrecan gene expression. We found that IGF-I stimulated chondrocyte biosynthesis similarly when delivered by either exogenous or endogenous means. In contrast, exogenous TGF-β1 stimulated these reparative functions, while endogenous TGF-β1 had little effect. Endogenous TGF-β1 became more bioactive following activation of the transgene protein product. These data indicate that effective mechanisms of growth factor delivery for articular cartilage repair may differ for different growth factors. In the case of IGF-I, gene therapy or protein therapy appear to be viable options. In contrast, TGF-β1 gene therapy may be constrained by a limited ability of chondrocytes to convert latent complexes to an active form. Published 2013 by Wiley Periodicals, Inc. on behalf of the Orthopaedic Research Society. This article is a U.S. Government work and is in the public domain in the USA.

  20. Trajectory Control of Scale-Free Dynamical Networks with Exogenous Disturbances

    International Nuclear Information System (INIS)

    Yang Hongyong; Zhang Shun; Zong Guangdeng

    2011-01-01

    In this paper, the trajectory control of multi-agent dynamical systems with exogenous disturbances is studied. Suppose multiple agents composing of a scale-free network topology, the performance of rejecting disturbances for the low degree node and high degree node is analyzed. Firstly, the consensus of multi-agent systems without disturbances is studied by designing a pinning control strategy on a part of agents, where this pinning control can bring multiple agents' states to an expected consensus track. Then, the influence of the disturbances is considered by developing disturbance observers, and disturbance observers based control (DOBC) are developed for disturbances generated by an exogenous system to estimate the disturbances. Asymptotical consensus of the multi-agent systems with disturbances under the composite controller can be achieved for scale-free network topology. Finally, by analyzing examples of multi-agent systems with scale-free network topology and exogenous disturbances, the verities of the results are proved. Under the DOBC with the designed parameters, the trajectory convergence of multi-agent systems is researched by pinning two class of the nodes. We have found that it has more stronger robustness to exogenous disturbances for the high degree node pinned than that of the low degree node pinned. (interdisciplinary physics and related areas of science and technology)

  1. Exogenous mRNA encoding tetanus or botulinum neurotoxins expressed in Aplysia neurons

    NARCIS (Netherlands)

    Mochida, Sumiko; Poulain, Bernard; Eisel, Ulrich; Binz, Thomas; Kurazono, Hisao; Niemann, Heiner; Tauc, Ladislav; Bullock, Theodore H.

    1990-01-01

    Injection of exogenous mRNA purified from various tissue preparations into cellular translation systems such as Xenopus oocytes has allowed expression of complex proteins (e.g., receptors for neurotransmitters). No evidence for expression of injected exogenous mRNA, however, has been reported in

  2. Robust Consensus of Multi-Agent Systems with Uncertain Exogenous Disturbances

    International Nuclear Information System (INIS)

    Yang Hong-Yong; Guo Lei; Han Chao

    2011-01-01

    The objective of this paper is to investigate the consensus of the multi-agent systems with nonlinear coupling function and external disturbances. The disturbance includes two parts, one part is supposed to be generated by an exogenous system, which is not required to be neutrally stable as in the output regulation theory, the other part is the modeling uncertainty in the exogenous disturbance system. A novel composite disturbance observer based control (DOBC) and H ∞ control scheme is presented so that the disturbance with the exogenous system can be estimated and compensated and the consensus of the multi-agent systems with fixed and switching graph can be reached by using H ∞ control law. Simulations demonstrate the advantages of the proposed DOBC and H ∞ control scheme. (interdisciplinary physics and related areas of science and technology)

  3. Neuronal Rat Brain Damage Caused by Endogenous and Exogenous Hyperthermia

    Directory of Open Access Journals (Sweden)

    Mustafa Aydın

    2012-03-01

    Full Text Available OBJECTIVE: Hyperthermia may induce pathologic alterations within body systems and organs including brain. In this study, neuronal effects of endogenous and exogenous hyperthermia (41°C were studied in rats. METHODS: The endogenous hyperthermia (41°C was induced by lipopolysaccharide and the exogenous by an (electric heater. Possible neuronal damage was evaluated by examining healthy, apoptotic and necrotic cells, and heat shock proteins (HSP 27, HSP 70 in the cerebral cortex, cerebellum and hypothalamus RESULTS: At cellular level, when all neuronal tissues are taken into account; (i a significant increase in the necrotic cells was observed in the both groups (p0.05. CONCLUSION: The neural tissue of brain can show different degree of response to hyperthermia. But we can conclude that endogenous hyperthermia is more harmful to central nervous system than exogenous hyperthermia

  4. Mobilization of endogenous retroviruses in mice after infection with an exogenous retrovirus.

    Science.gov (United States)

    Evans, Leonard H; Alamgir, A S M; Owens, Nick; Weber, Nick; Virtaneva, Kimmo; Barbian, Kent; Babar, Amenah; Malik, Frank; Rosenke, Kyle

    2009-03-01

    Mammalian genomes harbor a large number of retroviral elements acquired as germ line insertions during evolution. Although many of the endogenous retroviruses are defective, several contain one or more intact viral genes that are expressed under certain physiological or pathological conditions. This is true of the endogenous polytropic retroviruses that generate recombinant polytropic murine leukemia viruses (MuLVs). In these recombinants the env gene sequences of exogenous ecotropic MuLVs are replaced with env gene sequences from an endogenous polytropic retrovirus. Although replication-competent endogenous polytropic retroviruses have not been observed, the recombinant polytropic viruses are capable of replicating in numerous species. Recombination occurs during reverse transcription of a virion RNA heterodimer comprised of an RNA transcript from an endogenous polytropic virus and an RNA transcript from an exogenous ecotropic MuLV RNA. It is possible that homodimers corresponding to two full-length endogenous RNA genomes are also packaged. Thus, infection by an exogenous virus may result not only in recombination with endogenous sequences, but also in the mobilization of complete endogenous retrovirus genomes via pseudotyping within exogenous retroviral virions. We report that the infection of mice with an ecotropic virus results in pseudotyping of intact endogenous viruses that have not undergone recombination. The endogenous retroviruses infect and are integrated into target cell genomes and subsequently replicate and spread as pseudotyped viruses. The mobilization of endogenous retroviruses upon infection with an exogenous retrovirus may represent a major interaction of exogenous retroviruses with endogenous retroviruses and may have profound effects on the pathogenicity of retroviral infections.

  5. Transurethral lithotripsy with holmium-YAG laser of a large exogenous prostatic calculus.

    Science.gov (United States)

    Hasegawa, Masanori; Ohara, Rei; Kanao, Kent; Nakajima, Yosuke

    2011-04-01

    Prostatic calculi are classified into two types, endogenous and exogenous calculi, based on their origin. Endogenous calculi are commonly observed in elderly men; however, exogenous prostatic calculi are extremely rare. We report here the case of a 51-year-old man who suffered incontinence and pollakiuria with a giant exogenous prostatic calculus almost completely replacing the prostatic tissue. X-rays and computed tomography demonstrated a large calculus of 65 × 58 mm in the small pelvic cavity. The patient underwent a transurethral lithotripsy with a holmium-YAG laser and a total of 85 g of disintegrated stones was retrieved and chemical stone analysis revealed the presence of magnesium ammonium phosphate. The incontinence improved and the voiding volume increased dramatically, and no stone recurrence in the prostatic fossa occurred at the 2 years follow-up. The etiology of this stone formation seemed to be based on some exogenous pathways combined with urinary stasis and chronic urinary infection due to compression fracture of the lumbar vertebra.

  6. Incorporation of exogenous L-phenylalanine into C-glycosylflavones in buckwheat cotyledons

    International Nuclear Information System (INIS)

    Margna, U.; Margna, E.

    1978-01-01

    By tracer experiments it was demonstrated that in excised buckwheat cotyledons L-phenylalanine fed exogeneously was incorporated predominantly into the luteolinic C-glycosylflavones orientin and iso-orientin, but not into their simpler apigeninic analogues vitexin and isovitexin, as it could be expected theoretically. Evidence is presented that L-phenylalanine supplied exogenously does not mix with the endogenous pool of that precursor, and that ratios of L-phenylalanine distribution between pathways of apigeninic and luteolinic C-glycosylflavones are different depending on wether the flavonoids are synthesized from endogenous or exogenous material. This phenomenon is suggested to be caused by the differences between enzyme complexes responsible for the biosynthesis of separate C-glycosylflavones in their capability of consuming common endogenous precursors. (author)

  7. Use of Exogenous Testosterone for the Treatment of Male Factor Infertility: A Survey of Nigerian Doctors.

    Science.gov (United States)

    Omisanjo, Olufunmilade Akinfolarin; Ikuerowo, Stephen Odunayo; Abdulsalam, Moruf Adekunle; Ajenifuja, Sheriff Olabode; Shittu, Khadijah Adebisi

    2017-01-01

    Though exogenous testosterone is known for its contraceptive effects in men, it is sometimes prescribed by medical practitioners for the treatment of male factor infertility in the mistaken belief that exogenous testosterone improves sperm count. The aim of this study was to evaluate the scope of testosterone use in the treatment of male factor infertility by medical practitioners in Lagos, Nigeria. A survey using a structured questionnaire was carried out amongst doctors attending a regular Continuing Medical Education (CME) programme in Lagos, Nigeria. There were 225 respondents. Most of the respondents (69.8%, n = 157) indicated that exogenous testosterone increases sperm count. Only 22 respondents (9.8%) indicated (correctly) that exogenous testosterone decreases sperm count. Seventy-seven respondents (34.2%) had prescribed some form of exogenous testosterone in the treatment of male factor infertility. The vast majority of respondents who had prescribed testosterone (81.8%, n = 63) thought exogenous testosterone increases sperm count. There was no statistically significant difference in the pattern of prescription across the respondents' specialty ( p = 0.859) or practice type ( p = 0.747). The misuse of exogenous testosterone for the treatment of male infertility was common amongst the respondents, with most of them wrongly believing that exogenous testosterone increases sperm count.

  8. Exogenous stimuli and circadian peak expiratory flow variation in allergic asthmatic children

    NARCIS (Netherlands)

    Meijer, G. G.; Postma, D. S.; van der Heide, S.; de Reus, D. M.; Roorda, R. J.; Koëter, G. H.; van Aalderen, W. M.

    1996-01-01

    The influence of exogenous factors in the home on the circadian variation of airway obstruction has not been fully assessed in children with asthma. The aim of the present study was to investigate the contribution of exogenous stimuli to the degree of peak expiratory flow (PEF) variability during 24

  9. Exogenous stimuli and circadian peak expiratory flow variation in allergic asthmatic children

    NARCIS (Netherlands)

    Postma, DS; VanderHeide, S; DeReus, DM; Koeter, GH; VanAalderen, WMC; Meijer, G.

    The influence of exogenous factors in the home on the circadian variation of airway obstruction has not been fully assessed in children with asthma. The aim of the present study was to investigate the contribution of exogenous stimuli to the degree of peak expiratory flow (PEF) variability during 24

  10. Ocularity Feature Contrast Attracts Attention Exogenously

    Directory of Open Access Journals (Sweden)

    Li Zhaoping

    2018-02-01

    Full Text Available An eye-of-origin singleton, e.g., a bar shown to the left eye among many other bars shown to the right eye, can capture attention and gaze exogenously or reflexively, even when it appears identical to other visual input items in the scene and when the eye-of-origin feature is irrelevant to the observer’s task. Defining saliency as the strength of exogenous attraction to attention, we say that this eye-of-origin singleton, or its visual location, is salient. Defining the ocularity of a visual input item as the relative difference between its left-eye input and its right-eye input, this paper shows the general case that an ocularity singleton is also salient. For example, a binocular input item among monocular input items is salient, so is a left-eye-dominant input item (e.g., a bar with a higher input contrast to the left eye than to the right eye among right-eye-dominant items. Saliency by unique input ocularity is analogous to saliency by unique input colour (e.g., a red item among green ones, as colour is determined by the relative difference(s between visual inputs to different photoreceptor cones. Just as a smaller colour difference between a colour singleton and background items makes this singleton less salient, so does a smaller ocularity difference between an ocularity singleton and background items. While a salient colour difference is highly visible, a salient ocularity difference is often perceptually invisible in some cases and discouraging gaze shifts towards it in other cases, making its behavioural manifestation not as apparent. Saliency by ocularity contrast provides another support to the idea that the primary visual cortex creates a bottom-up saliency map to guide attention exogenously.

  11. ACUTE NARCOTIC DRUG INTOXICATIONS: ETIOLOGY, SEX/AGE DISTRIBUTION AND CLINICAL OUTCOME

    Directory of Open Access Journals (Sweden)

    Petko Marinov

    2017-01-01

    Full Text Available Purpose: Poisoning with drugs is a serious medical and social problem worldwide. Retrospective analysis of acute poisoning with narcotic drugs had been performed in Varna region for 25 years (1991-2015. Material and Methods: The number of patients received hospital treatment after poisonings with narcotic substances was 677, which represented 3.9% of all acute exogenous intoxications. Results: Narcotic poisonings were more common in men – 546 (80.6%, than in women – 131 (19.4 %. The ratio male/ female was 4.17:1. The largest number of intoxications were in the age group up to 24 years – 1123 (66%, and only 2.65% of patients were over 45 years. Death was registered in 6 (0.9% patients.

  12. Stem cells in sepsis and acute lung injury.

    Science.gov (United States)

    Cribbs, Sushma K; Matthay, Michael A; Martin, Greg S

    2010-12-01

    Sepsis and acute lung injury continue to be major causes of morbidity and mortality worldwide despite advances in our understanding of pathophysiology and the discovery of new management strategies. Recent investigations show that stem cells may be beneficial as prognostic biomarkers and novel therapeutic strategies in these syndromes. This article reviews the potential use of endogenous adult tissue-derived stem cells in sepsis and acute lung injury as prognostic markers and also as exogenous cell-based therapy. A directed systematic search of the medical literature using PubMed and OVID, with particular emphasis on the time period after 2002, was done to evaluate topics related to 1) the epidemiology and pathophysiology of sepsis and acute lung injury; and 2) the definition, characterization, and potential use of stem cells in these diseases. DATA SYNTHESIS AND FINDINGS: When available, preferential consideration was given to prospective nonrandomized clinical and preclinical studies. Stem cells have shown significant promise in the field of critical care both for 1) prognostic value and 2) treatment strategies. Although several recent studies have identified the potential benefit of stem cells in sepsis and acute lung injury, further investigations are needed to more completely understand stem cells and their potential prognostic and therapeutic value.

  13. A single-centre prospective, cohort study of the natural history of acute pancreatitis.

    Science.gov (United States)

    Cavestro, Giulia Martina; Leandro, Gioacchino; Di Leo, Milena; Zuppardo, Raffaella Alessia; Morrow, Olivia B; Notaristefano, Chiara; Rossi, Gemma; Testoni, Sabrina Gloria Giulia; Mazzoleni, Giorgia; Alessandri, Matteo; Goni, Elisabetta; Singh, Satish K; Giliberti, Aurore; Bianco, Margherita; Fanti, Lorella; Viale, Edi; Arcidiacono, Paolo Giorgio; Mariani, Alberto; Petrone, Maria Chiara; Testoni, Pier Alberto

    2015-03-01

    The natural history of acute pancreatitis is based on clinical studies that aim to elucidate the course of disease on the basis of predicted risk factors. To evaluate the long-term occurrence of recurrent acute pancreatitis and chronic pancreatitis in a cohort of patients following an initial episode of acute pancreatitis. 196 patients were enrolled consecutively and studied prospectively. Clinical characteristics, exogenously/endogenously-associated factors, and evolution to recurrent acute pancreatitis and chronic pancreatitis were analyzed. 40 patients developed recurrent acute pancreatitis 13 of whom developed chronic pancreatitis. In a univariate analysis, recurrent acute pancreatitis was associated with an idiopathic aetiology (pChronic pancreatitis was associated with a severe first episode of acute pancreatitis (p=0.048), PD (p=0.03), and cigarette smoking (p=0.038). By multivariate analysis, pancreas divisum was an independent risk factor for recurrent acute pancreatitis (OR 11.5, 95% CI 1.6-83.3). A severe first-episode of acute pancreatitis increased the risk of progressing to chronic pancreatitis by nine-fold. Special attention should be given to patients who experience a severe first attack of acute pancreatitis as there appears to be an increased risk of developing chronic pancreatitis over the long term. Copyright © 2014 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

  14. A panel Granger-causality test of endogenous vs. exogenous growth

    OpenAIRE

    Jochen Hartwig

    2009-01-01

    The paper proposes a new test of endogenous vs. exogenous growth theories based on the Granger-causality methodology and applies it to a panel of 20 OECD countries. The test yields divergent evidence with respect to physical and human capital. For physical capital, the test results favor Solow-type exogenous growth theory over AK-type endogenous growth models. On the other hand, the test results lend support to human capital oriented endogenous growth models - like the Uzawa-Lucas model - rat...

  15. Exogenous and endogenous attention during perceptual learning differentially affect post-training target thresholds

    Science.gov (United States)

    Mukai, Ikuko; Bahadur, Kandy; Kesavabhotla, Kartik; Ungerleider, Leslie G.

    2012-01-01

    There is conflicting evidence in the literature regarding the role played by attention in perceptual learning. To further examine this issue, we independently manipulated exogenous and endogenous attention and measured the rate of perceptual learning of oriented Gabor patches presented in different quadrants of the visual field. In this way, we could track learning at attended, divided-attended, and unattended locations. We also measured contrast thresholds of the Gabor patches before and after training. Our results showed that, for both exogenous and endogenous attention, accuracy in performing the orientation discrimination improved to a greater extent at attended than at unattended locations. Importantly, however, only exogenous attention resulted in improved contrast thresholds. These findings suggest that both exogenous and endogenous attention facilitate perceptual learning, but that these two types of attention may be mediated by different neural mechanisms. PMID:21282340

  16. Effects of exogenous polyamines and inhibitors of polyamine ...

    African Journals Online (AJOL)

    guanylhydrazone) (MGBG) and dicyclohexylamine (DCHA) or three exogenous polyamines (putrescine, spermidine and spermine) were added into a modified HLM-1 maturation medium inoculated with embryogenic tissues. Medium responses were ...

  17. Exogenous DNA internalisation by sperm cells is improved by combining lipofection and restriction enzyme mediated integration.

    Science.gov (United States)

    Churchil, R R; Gupta, J; Singh, A; Sharma, D

    2011-06-01

    1. Three types of exogenous DNA inserts, i.e. complete linearised pVIVO2-GFP/LacZ vector (9620 bp), the LacZ gene (5317 bp) and the GFP gene (2152 bp) were used to transfect chicken spermatozoa through simple incubation of sperm cells with insert. 2. PCR assay, Dot Blot hybridisation and Southern hybridisation showed the successful internalisation of exogenous DNA by chicken sperm cells. 3. Lipofection and Restriction Enzyme Mediated Integration (REMI) were used to improve the rate of internalisation of exogenous DNA by sperm cells. 4. Results from dot blot as well as Southern hybridisation were semi-quantified and improved exogenous DNA uptake by sperm cells through lipofection and REMI. Stronger signals were observed from hybridisation of LacZ as well as GFP specific probe with the DNA from lipofected exogenous DNA transfected sperm DNA in comparison with those transfected with nude exogenous DNA.

  18. Dynamics of tuberculosis transmission with exogenous reinfections and endogenous reactivation

    Science.gov (United States)

    Khajanchi, Subhas; Das, Dhiraj Kumar; Kar, Tapan Kumar

    2018-05-01

    We propose and analyze a mathematical model for tuberculosis (TB) transmission to study the role of exogenous reinfection and endogenous reactivation. The model exhibits two equilibria: a disease free and an endemic equilibria. We observe that the TB model exhibits transcritical bifurcation when basic reproduction number R0 = 1. Our results demonstrate that the disease transmission rate β and exogenous reinfection rate α plays an important role to change the qualitative dynamics of TB. The disease transmission rate β give rises to the possibility of backward bifurcation for R0 < 1, and hence the existence of multiple endemic equilibria one of which is stable and another one is unstable. Our analysis suggests that R0 < 1 may not be sufficient to completely eliminate the disease. We also investigate that our TB transmission model undergoes Hopf-bifurcation with respect to the contact rate β and the exogenous reinfection rate α. We conducted some numerical simulations to support our analytical findings.

  19. [Effect of exogenous sucrose on growth and active ingredient content of licorice seedlings under salt stress conditions].

    Science.gov (United States)

    Liu, Fu-zhi; Yang, Jun

    2015-11-01

    Licorice seedlings were taken as experimental materials, an experiment was conducted to study the effects of exogenous sucrose on growth and active ingredient content of licorice seedlings under NaCl stress conditions. The results of this study showed that under salt stress conditions, after adding a certain concentration of exogenous sucrose, the licorice seedlings day of relative growth rate was increasing, and this stress can be a significant weakening effect, indicating that exogenous sucrose salt stress-relieving effect. The total flavonoids and phenylalanine ammonia lyase (PAL) activity were significantly increased, the exogenous sucrose can mitigated the seedling roots under salt stress, the licorice flavonoid content in the enhanced growth was largely due to the activity of PAL an increased, when the concentration of exogenous sucrose wae 10 mmol x L(-1), PAL activity reaching a maximum, when the concentration of exogenous sucrose was 15 mmol x L(-1), PAL activity turned into a downward trend, the results indicating that this mitigation has concentration effect. After applying different concentrations of exogenous sugar, the contents of liquiritin changes with the change of flavonoids content was similar. After applying different concentrations of exogenous sucrose, the content of licorice acid under salt stress was higher than the levels were not reached during salt stress, the impact of exogenous sucrose concentration gradient of licorice acid accumulation was not obvious.

  20. Metabolic response to exogenous ethanol in yeast

    Indian Academy of Sciences (India)

    In this study, we applied this approach to evaluate the effects of increasing concentration of exogenous ethanol on the Saccharomyces cerevisiae fermentative metabolism. We show that the STOCSY analysis correctly identifies the different types of correlations among the enriched metabolites involved in the fermentation, ...

  1. Is subclinical hypothyroidism increasing exogen obesity in children?

    Directory of Open Access Journals (Sweden)

    Ceyda Tuna Kirsaclioglu

    2015-03-01

    Conclusion:.Thyrotropin releasing hormone stimulation test may be helpful to determine subclinical hypothyroidism in exogen obese children, if basal TSH levels were elevated. [J Contemp Med 2015; 5(1.000: 1-7

  2. Feature integration and spatial attention: common processes for endogenous and exogenous orienting.

    Science.gov (United States)

    Henderickx, David; Maetens, Kathleen; Soetens, Eric

    2010-05-01

    Briand (J Exp Psychol Hum Percept Perform 24:1243-1256, 1998) and Briand and Klein (J Exp Psychol Hum Percept Perform 13:228-241, 1987) demonstrated that spatial cueing effects are larger for detecting conjunction of features than for detecting simple features when spatial attention is oriented exogenously, and not when attention is oriented endogenously. Their results were interpreted as if only exogenous attention affects the posterior spatial attention system that performs the feature binding function attributed to spatial attention by Treisman's feature integration theory (FIT; 1980). In a series of 6 experiments, we attempted to replicate Briand's findings. Manipulations of distractor string size and symmetry of stimulus presentation left and right from fixation were implemented in Posner's cueing paradigm. The data indicate that both exogenous and endogenous cueing address the same attentional mechanism needed for feature binding. The results also limit the generalisability of Briand's proposal concerning the role of exogenous attention in feature integration. Furthermore, the importance to control the effect of unintended attentional capture in a cueing task is demonstrated.

  3. Hypoxia Potentiates Anabolic Effects of Exogenous Hyaluronic Acid in Rat Articular Cartilage.

    Science.gov (United States)

    Ichimaru, Shohei; Nakagawa, Shuji; Arai, Yuji; Kishida, Tsunao; Shin-Ya, Masaharu; Honjo, Kuniaki; Tsuchida, Shinji; Inoue, Hiroaki; Fujiwara, Hiroyoshi; Shimomura, Seiji; Mazda, Osam; Kubo, Toshikazu

    2016-06-25

    Hyaluronic acid (HA) is used clinically to treat osteoarthritis (OA), but its pharmacological effects under hypoxic conditions remain unclear. Articular chondrocytes in patients with OA are exposed to a hypoxic environment. This study investigated whether hypoxia could potentiate the anabolic effects of exogenous HA in rat articular cartilage and whether these mechanisms involved HA receptors. HA under hypoxic conditions significantly enhanced the expression of extracellular matrix genes and proteins in explant culture, as shown by real-time reverse transcription-polymerase chain reaction (RT-PCR), Western blotting, and dimethylmethylene blue (DMMB) assays. Staining with Safranin-O and immunohistochemical staining with antibody to type II collagen were also enhanced in pellet culture. The expression of CD44 was increased by hypoxia and significantly suppressed by transfection with siRNAs targeting hypoxia-inducible factor 1 alpha (siHIF-1α). These findings indicate that hypoxia potentiates the anabolic effects of exogenous HA by a mechanism in which HIF-1α positively regulates the expression of CD44, enhancing the binding affinity for exogenous HA. The anabolic effects of exogenous HA may increase as OA progresses.

  4. Neuropsychiatric findings in Cushing syndrome and exogenous glucocorticoid administration.

    Science.gov (United States)

    Starkman, Monica N

    2013-09-01

    This article reviews the neuropsychiatric presentations elicited by spontaneous hypercortisolism and exogenous supraphysiologic glucocorticoids. Patients with Cushing disease and syndrome develop a depressive syndrome: irritable and depressed mood, decreased libido, disrupted sleep and cognitive decrements. Exogenous short-term glucocorticoid administration may elicit a hypomanic syndrome with mood, sleep and cognitive disruptions. Treatment options are discussed. Brain imaging and neuropsychological studies indicate elevated cortisol and other glucocorticoids are especially deleterious to hippocampus and frontal lobe. The research findings also shed light on neuropsychiatric abnormalities in conditions that have substantial subgroups exhibiting elevated and dysregulated cortisol: aging, major depressive disorder and Alzheimer's disease. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. BAF is a cytosolic DNA sensor that leads to exogenous DNA avoiding autophagy.

    Science.gov (United States)

    Kobayashi, Shouhei; Koujin, Takako; Kojidani, Tomoko; Osakada, Hiroko; Mori, Chie; Hiraoka, Yasushi; Haraguchi, Tokuko

    2015-06-02

    Knowledge of the mechanisms by which a cell detects exogenous DNA is important for controlling pathogen infection, because most pathogens entail the presence of exogenous DNA in the cytosol, as well as for understanding the cell's response to artificially transfected DNA. The cellular response to pathogen invasion has been well studied. However, spatiotemporal information of the cellular response immediately after exogenous double-stranded DNA (dsDNA) appears in the cytosol is lacking, in part because of difficulties in monitoring when exogenous dsDNA enters the cytosol of the cell. We have recently developed a method to monitor endosome breakdown around exogenous materials using transfection reagent-coated polystyrene beads incorporated into living human cells as the objective for microscopic observations. In the present study, using dsDNA-coated polystyrene beads (DNA-beads) incorporated into living cells, we show that barrier-to-autointegration factor (BAF) bound to exogenous dsDNA immediately after its appearance in the cytosol at endosome breakdown. The BAF(+) DNA-beads then assembled a nuclear envelope (NE)-like membrane and avoided autophagy that targeted the remnants of the endosome membranes. Knockdown of BAF caused a significant decrease in the assembly of NE-like membranes and increased the formation of autophagic membranes around the DNA-beads, suggesting that BAF-mediated assembly of NE-like membranes was required for the DNA-beads to evade autophagy. Importantly, BAF-bound beads without dsDNA also assembled NE-like membranes and avoided autophagy. We propose a new role for BAF: remodeling intracellular membranes upon detection of dsDNA in mammalian cells.

  6. THE SPECIAL STATUS OF EXOGENOUS WORD-FORMATION WITHIN THE GERMAN WORD-FORMATION SYSTEM

    Directory of Open Access Journals (Sweden)

    Zhilyuk Sergey Aleksandrovich

    2014-06-01

    Full Text Available The article presents the properties of exogenous word-formation system taking into account the existence of two word-formation systems in modern German. On the basis of foreign research which reveal modern trends in German word-formation connected with the internationalization and the development of new European Latin language. The author defines key features of exogenous word-formation, i.e. foreign origin of wordformation units, unmotivated units, unmotivated interchange in base and affixes as well as limited distribution rules in combination with German word-formation. The article analyzes various approaches to word-division, as well as motivated and unmotivated interchange of consonants in bases and in affixes. Unmotivated interchange showcases a special status of the exogenous word-formation within German. Another item covered by the article is the issue of confix. The article has opinions of researchers about correctness of its separation and a list of its features. The author presents his definition of confix: a confix is a bound exogenous word-formation unit with a certain lexical and semantic meaning and joining other units directly or indirectly (through linking morpheme -o-, which is able to make a base. Moreover, some confixes are able to participate at word-combination and have unlimited distribution. So far, confix showcases the integration of exogenous word-formation and traditional German word-formation. The research proves the special status of exogenous word-formation in German. Its results can be used as a base for further analysis of co-existing word-formation systems in German and determination of their characteristic features.

  7. Association between exogenous testosterone and cardiovascular events: an overview of systematic reviews.

    Science.gov (United States)

    Onasanya, Oluwadamilola; Iyer, Geetha; Lucas, Eleanor; Lin, Dora; Singh, Sonal; Alexander, G Caleb

    2016-11-01

    Given the conflicting evidence regarding the association between exogenous testosterone and cardiovascular events, we systematically assessed published systematic reviews for evidence of the association between exogenous testosterone and cardiovascular events. We searched PubMed, MEDLINE, Embase, Cochrane Collaboration Clinical Trials, ClinicalTrials.gov, and the US Food and Drug Administration website for systematic reviews of randomised controlled trials published up to July 19, 2016. Two independent reviewers screened 954 full texts from 29 335 abstracts to identify systematic reviews of randomised controlled trials in which the cardiovascular effects of exogenous testosterone on men aged 18 years or older were examined. We extracted data for study characteristics, analytic methods, and key findings, and applied the AMSTAR (A Measurement Tool to Assess Systematic Reviews) checklist to assess methodological quality of each review. Our primary outcome measure was the direction and magnitude of association between exogenous testosterone and cardiovascular events. We identified seven reviews and meta-analyses, which had substantial clinical heterogeneity, differing statistical methods, and variable methodological quality and quality of data abstraction. AMSTAR scores ranged from 3 to 9 out of 11. Six systematic reviews that each included a meta-analysis showed no significant association between exogenous testosterone and cardiovascular events, with summary estimates ranging from 1·07 to 1·82 and imprecise confidence intervals. Two of these six meta-analyses showed increased risk in subgroup analyses of oral testosterone and men aged 65 years or older during their first treatment year. One meta-analysis showed a significant association between exogenous testosterone and cardiovascular events, in men aged 18 years or older generally, with a summary estimate of 1·54 (95% CI 1·09-2·18). Our optimal information size analysis showed that any randomised controlled

  8. Sacred Hearts Nursing Home, Roslea Road, Clones, Monaghan.

    LENUS (Irish Health Repository)

    Dahab, Taqua

    2017-08-01

    This case presentation relates to a 53 year old male, cachectic in appearance, who presented with progressively worsening dyspnoea, cough, intermittent haemoptysis and a history of nasal dryness ongoing over five months. The patient had received multiple courses of oral antibiotics for suspected community acquired pneumonia with no significant improvement. He was referred to our Respiratory Department for further evaluation of his symptoms. His HRCT showed right middle lobe consolidation with central cavitations. Furthermore, the transbronchial biopsy had been performed and the cytological examination revealed lipid laden macrophage with interstitial inflammatory changes. With return to the patient over the counter drug history, he described the frequent use of petroleum jelly to alleviate the symptoms of nasal dryness. This is the first report case of exogenous lipoid pneumonia presented with haemoptysis and cavitations in the HRCT.

  9. An unusual case of recurrent chest infections.

    LENUS (Irish Health Repository)

    Dahab, Taqua

    2017-08-01

    This case presentation relates to a 53 year old male, cachectic in appearance, who presented with progressively worsening dyspnoea, cough, intermittent haemoptysis and a history of nasal dryness ongoing over five months. The patient had received multiple courses of oral antibiotics for suspected community acquired pneumonia with no significant improvement. He was referred to our Respiratory Department for further evaluation of his symptoms. His HRCT showed right middle lobe consolidation with central cavitations. Furthermore, the transbronchial biopsy had been performed and the cytological examination revealed lipid laden macrophage with interstitial inflammatory changes. With return to the patient over the counter drug history, he described the frequent use of petroleum jelly to alleviate the symptoms of nasal dryness. This is the first report case of exogenous lipoid pneumonia presented with haemoptysis and cavitations in the HRCT.

  10. Bias Correction in a Stable AD (1,1) Model: Weak versus Strong Exogeneity

    NARCIS (Netherlands)

    van Giersbergen, N.P.A.

    2001-01-01

    This paper compares the behaviour of a bias-corrected estimator assuming strongly exogenous regressors to the behaviour of a bias-corrected estimator assuming weakly exogenous regressors, when in fact the marginal model contains a feedback mechanism. To this end, the effects of a feedback mechanism

  11. Acute stress may induce ovulation in women

    Directory of Open Access Journals (Sweden)

    Cano Antonio

    2010-05-01

    Full Text Available Abstract Background This study aims to gather information either supporting or rejecting the hypothesis that acute stress may induce ovulation in women. The formulation of this hypothesis is based on 2 facts: 1 estrogen-primed postmenopausal or ovariectomized women display an adrenal-progesterone-induced ovulatory-like luteinizing hormone (LH surge in response to exogenous adrenocorticotropic hormone (ACTH administration; and 2 women display multiple follicular waves during an interovulatory interval, and likely during pregnancy and lactation. Thus, acute stress may induce ovulation in women displaying appropriate serum levels of estradiol and one or more follicles large enough to respond to a non-midcycle LH surge. Methods A literature search using the PubMed database was performed to identify articles up to January 2010 focusing mainly on women as well as on rats and rhesus monkeys as animal models of interaction between the hypothalamic-pituitary-adrenal (HPA and hypothalamic-pituitary-gonadal (HPG axes. Results Whereas the HPA axis exhibits positive responses in practically all phases of the ovarian cycle, acute-stress-induced release of LH is found under relatively high plasma levels of estradiol. However, there are studies suggesting that several types of acute stress may exert different effects on pituitary LH release and the steroid environment may modulate in a different way (inhibiting or stimulating the pattern of response of the HPG axis elicited by acute stressors. Conclusion Women may be induced to ovulate at any point of the menstrual cycle or even during periods of amenorrhea associated with pregnancy and lactation if exposed to an appropriate acute stressor under a right estradiol environment.

  12. Long-term fate of exogenous metals in a sandy Luvisol subjected to intensive irrigation with raw wastewater

    International Nuclear Information System (INIS)

    Dere, C.; Lamy, I.; Jaulin, A.; Cornu, S.

    2007-01-01

    From 1899 to 2002, sandy Luvisol in the Paris region has been intensively irrigated with raw wastewater, resulting in major soil pollution by metallic trace elements (MTE). To identify the soil phases implicated in retaining these metals, sequential extractions were performed on a solum irrigated with untreated wastewater and another reference solum. The endogenous and exogenous fractions of MTE in the contaminated soil were discriminated using correlations between MTE and major elements defined from unpolluted soils of the area. In the contaminated soil no exogenous lead and chromium are present below the surface horizon, whereas exogenous zinc and copper are found down to the base of the solum. The endogenous MTE are mainly found in the residual fraction. Exogenous MTE appear to be associated with organic matter in the surface horizon, and exogenous zinc seems to be readsorbed on iron and manganese oxyhydroxides in the underlying horizons. - After 100 years of intensive irrigation with wastewater, no exogenous Pb and Cr are found in the subsoil, while exogenous Zn and Cu are found down to the base of the solum, mostly readsorbed

  13. Preventive effects of chronic exogenous growth hormone levels on diet-induced hepatic steatosis in rats

    Directory of Open Access Journals (Sweden)

    Tian Ya-ping

    2010-07-01

    Full Text Available Abstract Background Non-alcoholic fatty liver disease (NAFLD, which is characterized by hepatic steatosis, can be reversed by early treatment. Several case reports have indicated that the administration of recombinant growth hormone (GH could improve fatty liver in GH-deficient patients. Here, we investigated whether chronic exogenous GH levels could improve hepatic steatosis induced by a high-fat diet in rats, and explored the underlying mechanisms. Results High-fat diet-fed rats developed abdominal obesity, fatty liver and insulin resistance. Chronic exogenous GH improved fatty liver, by reversing dyslipidaemia, fat accumulation and insulin resistance. Exogenous GH also reduced serum tumour necrosis factor-alpha (TNF-alpha levels, and ameliorated hepatic lipid peroxidation and oxidative stress. Hepatic fat deposition was also reduced by exogenous GH levels, as was the expression of adipocyte-derived adipokines (adiponectin, leptin and resistin, which might improve lipid metabolism and hepatic steatosis. Exogenous GH seems to improve fatty liver by reducing fat weight, improving insulin sensitivity and correcting oxidative stress, which may be achieved through phosphorylation or dephosphorylation of a group of signal transducers and activators of hepatic signal transduction pathways. Conclusions Chronic exogenous GH has positive effects on fatty liver and may be a potential clinical application in the prevention or reversal of fatty liver. However, chronic secretion of exogenous GH, even at a low level, may increase serum glucose and insulin levels in rats fed a standard diet, and thus increase the risk of insulin resistance.

  14. Tectonic regime and evolution of exogenous uranium ore formation in sedimentary rocks

    International Nuclear Information System (INIS)

    Danchev, V.I.; Shumlyanskij, V.A.; AN Ukrainskoj SSR, Kiev. Inst. Geokhimii i Fiziki Mineralov)

    1981-01-01

    Regularities of the formation and location of exogenous uranium deposits are studied depending on the tectonics regime. It is shown that the successive alternation of sedimentogenous deposits by diagenetic and, subsequently, catogene ones takes place from early Proterozoic to Cenozoic, i.e. exogenous ore formation in the history of the Earth proceeds from early to late stages of lithogenesis [ru

  15. Open Syllable Once Again. Endogenous or Exogenous?

    Directory of Open Access Journals (Sweden)

    Raffaele Caldarelli

    2013-02-01

    Full Text Available After a brief reply to some critical remarks raised by Mario Enrietti in a paper published in “Studi Slavistici”, VI (2009, the Author tries to explain why Enrietti’s theory of an exogenous, namely Romance origin of the Slavic open syllable structure should be rejected.

  16. Out with the new, in with the old: Exogenous orienting to locations with physically constant stimulation.

    Science.gov (United States)

    Taylor, J Eric T; Hilchey, Matthew D; Pratt, Jay

    2018-01-24

    Dominant methods of investigating exogenous orienting presume that attention is captured most effectively at locations containing new events. This is evidenced by the ubiquitous use of transient stimuli as cues in the literature on exogenous orienting. In the present study, we showed that attention can be oriented exogenously toward a location containing a completely unchanging stimulus by modifying Posner's landmark exogenous spatial-cueing paradigm. Observers searched a six-element array of placeholder stimuli for an onset target. The target was preceded by a decrement in luminance to five of the six placeholders, such that one location remained physically constant. This "nonset" stimulus (so named to distinguish it from a traditional onsetting transient) acted as an exogenous cue, eliciting patterns of facilitation and inhibition at the nonset location and demonstrating that exogenous orienting is not always evident at the location of a visual transient. This method eliminates the decades-long confounding of orienting to a location with the processing of new events at that location, permitting alternative considerations of the nature of attentional selection.

  17. [Experience of diagnosis and treatment of exogenous high-grade fever].

    Science.gov (United States)

    Xiong, Xing-jiang; Wang, Jie

    2011-06-01

    There is a regular pattern in the diagnosis and treatment of exogenous high-grade fever, of which the key point is formula syndrome identification. Syndrome differentiation of the six channels is appropriate for not only exogenous cold but also various other conditions. The diagnosis and treatment of high-grade fever can also follow the law of syndrome differentiation of the six channels. The theory of epidemic febrile diseases stems from and elaborates on an understanding of exogenous febrile conditions, so many effective formulas used to treat epidemic febrile diseases also have great value in the treatment of high-grade fever. Deteriorated syndrome, which is central to this condition, is very commonly seen in cases of high-grade fever, the key therapeutic principle of which is established according to syndromes. Allowing analysis that does not rigidly adhere to either established modern diagnosis or traditional Chinese syndromes, prominent achievements could be made in treating high-grade fever by summarizing the regular presenting patterns in terms of the constitution and symptoms.

  18. Effect of Exogenous Phytase Addition on Soil Phosphatase Activities: a Fluorescence Spectroscopy Study.

    Science.gov (United States)

    Yang, Xiao-zhu; Chen, Zhen-hua; Zhang, Yu-lan; Chen, Li-jun

    2015-05-01

    The utilization of organic phosphorus (P) has directly or indirectly improved after exogenous phytase was added to soil. However, the mechanism by which exogenous phytase affected the soil phosphatases (phosphomonoesterase and phosphodiesterase) activities was not clear. The present work was aimed to study red soil, brown soil and cinnamon soil phosphomonoesterase (acid and alkaline) (AcP and AlP) and phosphodiesterase (PD) activities responding to the addition of exogenous phytase (1 g phytase/50 g air dry soil sample) based on the measurements performed via a fluorescence detection method combined with 96 microplates using a TECAN Infinite 200 Multi-Mode Microplate Reader. The results indicated that the acid phosphomonoesterase activity was significantly enhanced in red soil (p≤0. 01), while it was significantly reduced in cinnamon soil; alkaline phosphomonoesterase activity was significantly enhanced in cinnamon soil (p≤ 0. 01), while it was significantly reduced in red soil; phosphodiesterase activity was increased in three soils but it was significantly increased in brown soil (p≤0. 01) after the addition of exogenous phytase. The activities still remained strong after eight days in different soils, which indicated that exogenous phytase addition could be enhance soil phosphatases activities effectively. This effect was not only related to soil properties, such as pH and phosphorus forms, but might also be related to the excreted enzyme amount of the stimulating microorganism. Using fluorescence spectroscopy to study exogenous phytase addition influence on soil phosphatase activities was the first time at home and abroad. Compared with the conventional spectrophotometric method, the fluorescence microplate method is an accurate, fast and simple to use method to determine the relationships among the soil phosphatases activities.

  19. Two cognitive and neural systems for endogenous and exogenous spatial attention.

    Science.gov (United States)

    Chica, Ana B; Bartolomeo, Paolo; Lupiáñez, Juan

    2013-01-15

    Orienting of spatial attention is a family of phylogenetically old mechanisms developed to select information for further processing. Information can be selected via top-down or endogenous mechanisms, depending on the goals of the observers or on the task at hand. Moreover, salient and potentially dangerous events also attract spatial attention via bottom-up or exogenous mechanisms, allowing a rapid and efficient reaction to unexpected but important events. Fronto-parietal brain networks have been demonstrated to play an important role in supporting spatial attentional orienting, although there is no consensus on whether there is a single attentional system supporting both endogenous and exogenous attention, or two anatomical and functionally different attentional systems. In the present paper we review behavioral evidence emphasizing the differential characteristics of both systems, as well as their possible interactions for the control of the final orienting response. Behavioral studies reporting qualitative differences between the effects of both systems as well as double dissociations of the effects of endogenous and exogenous attention on information processing, suggest that they constitute two independent attentional systems, rather than a single one. Recent models of attentional orienting in humans have put forward the hypothesis of a dorsal fronto-parietal network for orienting spatial attention, and a more ventral fronto-parietal network for detecting unexpected but behaviorally relevant events. Non-invasive neurostimulation techniques, as well as neuropsychological data, suggest that endogenous and exogenous attention are implemented in overlapping, although partially segregated, brain circuits. Although more research is needed in order to refine our anatomical and functional knowledge of the brain circuits underlying spatial attention, we conclude that endogenous and exogenous spatial orienting constitute two independent attentional systems, with

  20. Elongation of exogenous fatty acids by the bioluminescent bacterium Vibrio harveyi

    Energy Technology Data Exchange (ETDEWEB)

    Byers, D.M.

    1989-01-01

    Bioluminescent bacteria require myristic acid (C14:0) to produce the myristaldehyde substrate of the light-emitting luciferase reaction. Since both endogenous and exogenous C14:0 can be used for this purpose, the metabolism of exogenous fatty acids by luminescent bacteria has been investigated. Both Vibrio harveyi and Vibrio fischeri incorporated label from (1-14C)myristic acid (C14:0) into phospholipid acyl chains as well as into CO2. In contrast, Photobacterium phosphoreum did not exhibit phospholipid acylation or beta-oxidation using exogenous fatty acids. Unlike Escherichia coli, the two Vibrio species can directly elongate fatty acids such as octanoic (C8:0), lauric (C12:0), and myristic acid, as demonstrated by radio-gas liquid chromatography. The induction of bioluminescence in late exponential growth had little effect on the ability of V. harveyi to elongate fatty acids, but it did increase the amount of C14:0 relative to C16:0 labeled from (14C)C8:0. This was not observed in a dark mutant of V. harveyi that is incapable of supplying endogenous C14:0 for luminescence. Cerulenin preferentially decreased the labeling of C16:0 and of unsaturated fatty acids from all 14C-labeled fatty acid precursors as well as from (14C)acetate, suggesting that common mechanisms may be involved in elongation of fatty acids from endogenous and exogenous sources. Fatty acylation of the luminescence-related synthetase and reductase enzymes responsible for aldehyde synthesis exhibited a chain-length preference for C14:0, which also was indicated by reverse-phase thin-layer chromatography of the acyl groups attached to these enzymes. The ability of V. harveyi to activate and elongate exogenous fatty acids may be related to an adaptive requirement to metabolize intracellular C14:0 generated by the luciferase reaction during luminescence development.

  1. Elongation of exogenous fatty acids by the bioluminescent bacterium Vibrio harveyi

    International Nuclear Information System (INIS)

    Byers, D.M.

    1989-01-01

    Bioluminescent bacteria require myristic acid (C14:0) to produce the myristaldehyde substrate of the light-emitting luciferase reaction. Since both endogenous and exogenous C14:0 can be used for this purpose, the metabolism of exogenous fatty acids by luminescent bacteria has been investigated. Both Vibrio harveyi and Vibrio fischeri incorporated label from [1-14C]myristic acid (C14:0) into phospholipid acyl chains as well as into CO2. In contrast, Photobacterium phosphoreum did not exhibit phospholipid acylation or beta-oxidation using exogenous fatty acids. Unlike Escherichia coli, the two Vibrio species can directly elongate fatty acids such as octanoic (C8:0), lauric (C12:0), and myristic acid, as demonstrated by radio-gas liquid chromatography. The induction of bioluminescence in late exponential growth had little effect on the ability of V. harveyi to elongate fatty acids, but it did increase the amount of C14:0 relative to C16:0 labeled from [14C]C8:0. This was not observed in a dark mutant of V. harveyi that is incapable of supplying endogenous C14:0 for luminescence. Cerulenin preferentially decreased the labeling of C16:0 and of unsaturated fatty acids from all 14C-labeled fatty acid precursors as well as from [14C]acetate, suggesting that common mechanisms may be involved in elongation of fatty acids from endogenous and exogenous sources. Fatty acylation of the luminescence-related synthetase and reductase enzymes responsible for aldehyde synthesis exhibited a chain-length preference for C14:0, which also was indicated by reverse-phase thin-layer chromatography of the acyl groups attached to these enzymes. The ability of V. harveyi to activate and elongate exogenous fatty acids may be related to an adaptive requirement to metabolize intracellular C14:0 generated by the luciferase reaction during luminescence development

  2. Hypoxia Potentiates Anabolic Effects of Exogenous Hyaluronic Acid in Rat Articular Cartilage

    Directory of Open Access Journals (Sweden)

    Shohei Ichimaru

    2016-06-01

    Full Text Available Hyaluronic acid (HA is used clinically to treat osteoarthritis (OA, but its pharmacological effects under hypoxic conditions remain unclear. Articular chondrocytes in patients with OA are exposed to a hypoxic environment. This study investigated whether hypoxia could potentiate the anabolic effects of exogenous HA in rat articular cartilage and whether these mechanisms involved HA receptors. HA under hypoxic conditions significantly enhanced the expression of extracellular matrix genes and proteins in explant culture, as shown by real-time reverse transcription-polymerase chain reaction (RT-PCR, Western blotting, and dimethylmethylene blue (DMMB assays. Staining with Safranin-O and immunohistochemical staining with antibody to type II collagen were also enhanced in pellet culture. The expression of CD44 was increased by hypoxia and significantly suppressed by transfection with siRNAs targeting hypoxia-inducible factor 1 alpha (siHIF-1α. These findings indicate that hypoxia potentiates the anabolic effects of exogenous HA by a mechanism in which HIF-1α positively regulates the expression of CD44, enhancing the binding affinity for exogenous HA. The anabolic effects of exogenous HA may increase as OA progresses.

  3. Exogenous lactate supply affects lactate kinetics of rainbow trout, not swimming performance

    Science.gov (United States)

    Omlin, Teye; Langevin, Karolanne

    2014-01-01

    Intense swimming causes circulatory lactate accumulation in rainbow trout because lactate disposal (Rd) is not stimulated as strongly as lactate appearance (Ra). This mismatch suggests that maximal Rd is limited by tissue capacity to metabolize lactate. This study uses exogenous lactate to investigate what constrains maximal Rd and minimal Ra. Our goals were to determine how exogenous lactate affects: 1) Ra and Rd of lactate under baseline conditions or during graded swimming, and 2) exercise performance (critical swimming speed, Ucrit) and energetics (cost of transport, COT). Results show that exogenous lactate allows swimming trout to boost maximal Rd lactate by 40% and reach impressive rates of 56 μmol·kg−1·min−1. This shows that the metabolic capacity of tissues for lactate disposal is not responsible for setting the highest Rd normally observed after intense swimming. Baseline endogenous Ra (resting in normoxic water) is not significantly reduced by exogenous lactate supply. Therefore, trout have an obligatory need to produce lactate, either as a fuel for oxidative tissues and/or from organs relying on glycolysis. Exogenous lactate does not affect Ucrit or COT, probably because it acts as a substitute for glucose and lipids rather than extra fuel. We conclude that the observed 40% increase in Rd lactate is made possible by accelerating lactate entry into oxidative tissues via monocarboxylate transporters (MCTs). This observation together with the weak expression of MCTs and the phenomenon of white muscle lactate retention show that lactate metabolism of rainbow trout is significantly constrained by transmembrane transport. PMID:25121611

  4. Exogenous cathepsin V protein protects human cardiomyocytes HCM from angiotensin Ⅱ-Induced hypertrophy.

    Science.gov (United States)

    Huang, Kun; Gao, Lu; Yang, Ming; Wang, Jiliang; Wang, Zheng; Wang, Lin; Wang, Guobin; Li, Huili

    2017-08-01

    Angiotensin (Ang) Ⅱ-induced cardiac hypertrophy can deteriorate to heart failure, a leading cause of mortality. Endogenous Cathepsin V (CTSV) has been reported to be cardioprotective against hypertrophy. However, little is known about the effect of exogenous CTSV on cardiac hypertrophy. We used the human cardiomyocytes HCM as a cell model to investigate the effects of exogenous CTSV on Ang Ⅱ-induced cardiac cell hypertrophy. Cell surface area and expression of classical markers of hypertrophy were analyzed. We further explored the mechanism of CTSV cardioprotective by assessing the levels and activities of PI3K/Akt/mTOR and MAPK signaling pathway proteins. We found that pre-treating cardiomyocytes with CTSV could significantly inhibit Ang Ⅱ-induced hypertrophy. The mRNA expression of hypertrophy markers ANP, BNP and β-MHC was obviously elevated in Ang Ⅱ-treated cardiac cells. Whereas, exogenous CTSV effectively halted this elevation. Further study revealed that the protective effects of exogenous CTSV might be mediated by repressing the phosphorylation of proteins in the PI3K/Akt/mTOR and MAPK pathways. Based on our results, we concluded that exogenous CTSV inhibited Ang Ⅱ-induced hypertrophy in HCM cells by inhibiting PI3K/Akt/mTOR. This study provides experimental evidence for the application of CTSV protein for the treatment of cardiac hypertrophy. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Exogenous normal lymph alleviates microcirculation disturbances and abnormal hemorheological properties in rats with disseminated intravascular coagulation

    Energy Technology Data Exchange (ETDEWEB)

    Niu, Chun-Yu; Zhao, Zi-Gang; Zhang, Yu-Ping [Institute of Microcirculation, Hebei North University, Zhangjiakou (China); Hou, Ya-Li [Department of Clinical Laboratory, First Affiliated Hospital, Hebei North University, Zhangjiakou (China); Li, Jun-Jie; Jiang, Hua; Zhang, Jing [Institute of Microcirculation, Hebei North University, Zhangjiakou (China)

    2013-02-01

    Disturbances of the microcirculation and abnormal hemorheological properties are important factors that play an important role in disseminated intravascular coagulation (DIC) and result in organ dysfunction or failure. In the present study, we established an animal model of DIC using intravenous Dextran 500 in rats, and used exogenous normal lymph corresponding to 1/15 of whole blood volume for injection through the left jugular vein. We found that normal lymph could improve the blood pressure and survival time of rats with DIC. The results regarding the mesenteric microcirculation showed that the abnormality of the diameter of mesenteric microvessels and micro-blood flow speed in the DIC+lymph group was significantly less than in the DIC+saline group. Whole blood viscosity, relative viscosity, plasma viscosity, hematocrit (Hct), erythrocyte sedimentation rate (ESR), and electrophoresis time of erythrocytes were significantly increased in the DIC+saline group compared to the control group. The electrophoretic length and migration of erythrocytes from the DIC+saline and DIC+lymph groups were significantly slower than the control group. Blood relative viscosity, Hct, ESR, and electrophoretic time of erythrocytes were significantly increased in the DIC+lymph group compared to the control group. Whole blood viscosity, relative viscosity and reduced viscosity were significantly lower in the DIC+lymph group than in the DIC+saline group, and erythrocyte deformability index was also significantly higher than in the DIC+saline and control groups. These results suggest that exogenous normal lymph could markedly improve the acute microcirculation disturbance and the abnormal hemorheological properties in rats with DIC induced by Dextran 500.

  6. Exogenous normal lymph alleviates microcirculation disturbances and abnormal hemorheological properties in rats with disseminated intravascular coagulation

    International Nuclear Information System (INIS)

    Niu, Chun-Yu; Zhao, Zi-Gang; Zhang, Yu-Ping; Hou, Ya-Li; Li, Jun-Jie; Jiang, Hua; Zhang, Jing

    2013-01-01

    Disturbances of the microcirculation and abnormal hemorheological properties are important factors that play an important role in disseminated intravascular coagulation (DIC) and result in organ dysfunction or failure. In the present study, we established an animal model of DIC using intravenous Dextran 500 in rats, and used exogenous normal lymph corresponding to 1/15 of whole blood volume for injection through the left jugular vein. We found that normal lymph could improve the blood pressure and survival time of rats with DIC. The results regarding the mesenteric microcirculation showed that the abnormality of the diameter of mesenteric microvessels and micro-blood flow speed in the DIC+lymph group was significantly less than in the DIC+saline group. Whole blood viscosity, relative viscosity, plasma viscosity, hematocrit (Hct), erythrocyte sedimentation rate (ESR), and electrophoresis time of erythrocytes were significantly increased in the DIC+saline group compared to the control group. The electrophoretic length and migration of erythrocytes from the DIC+saline and DIC+lymph groups were significantly slower than the control group. Blood relative viscosity, Hct, ESR, and electrophoretic time of erythrocytes were significantly increased in the DIC+lymph group compared to the control group. Whole blood viscosity, relative viscosity and reduced viscosity were significantly lower in the DIC+lymph group than in the DIC+saline group, and erythrocyte deformability index was also significantly higher than in the DIC+saline and control groups. These results suggest that exogenous normal lymph could markedly improve the acute microcirculation disturbance and the abnormal hemorheological properties in rats with DIC induced by Dextran 500

  7. Mixed Causal-Noncausal Autoregressions with Strictly Exogenous Regressors

    NARCIS (Netherlands)

    Hecq, Alain; Issler, J.V.; Telg, Sean

    2017-01-01

    The mixed autoregressive causal-noncausal model (MAR) has been proposed to estimate economic relationships involving explosive roots in their autoregressive part, as they have stationary forward solutions. In previous work, possible exogenous variables in economic relationships are substituted into

  8. Effect of exogenous phytohormones and sucrose on ...

    African Journals Online (AJOL)

    The effect of exogenous phytohormones and sucrose on micropropagation and microtuberization from nodal cuttings of Manihot esculenta was studied. Direct and indirect organogeneses were established from these explants. When nodal cuttings were cultured in the presence of 0.01 to 0.1 mg.L-1 of BAP or NAA there was ...

  9. Isolating Exogenous and Endogenous Modes of Temporal Attention

    Science.gov (United States)

    Lawrence, Michael A.; Klein, Raymond M.

    2013-01-01

    The differential allocation of information processing resources over time, here termed "temporal attention," may be achieved by relatively automatic "exogenous" or controlled "endogenous" mechanisms. Over 100 years of research has confounded these theoretically distinct dimensions of temporal attention. The current…

  10. Evidence for nuclear internalization of exogenous DNA into mammalian sperm cells

    International Nuclear Information System (INIS)

    Francolini, M.; Lavitrano, M.; Lamia, C.L.; French, D.; Frati, L.; Cotelli, F.; Spadafora, C.

    1993-01-01

    Mature sperm cells have the spontaneous capacity to take up exogenous DNA. Such DNA specifically interacts with the subacrosomal segment of the sperm head corresponding to the nuclear area. Part of the sperm-bound foreign DNA is further internalized into nuclei. Using end-labelled plasmid DNA we have found that 15-22% of the total sperm bound DNA is associated with nuclei as determined on isolated nuclei. On the basis of autoradiographic analysis, nuclear permeability to exogenous DNA seems to be a wide phenomenon involving the majority of the sperm nuclei. In fact, the foreign DNA, incubated with sperm cells for different lengths of time, is found in 45% (10 min) to 65% (2 hr) of the sperm nuclei. Ultrastructural autoradiography on thin sections of mammalian spermatozoa, preincubated with end-labelled plasmid DNA, shows that the exogenous DNA is internalized into the nucleus. This conclusion is further supported by ultrastructural autoradiographic analysis on thin sections of nuclei isolated from spermatozoa preincubated with end-labelled DNA

  11. Discrepancy of neural response between exogenous and endogenous task switching: an event-related potentials study.

    Science.gov (United States)

    Miyajima, Maki; Toyomaki, Atsuhito; Hashimoto, Naoki; Kusumi, Ichiro; Murohashi, Harumitsu; Koyama, Tsukasa

    2012-08-01

    Task switching is a well-known cognitive paradigm to explore task-set reconfiguration processes such as rule shifting. In particular, endogenous task switching is thought to differ qualitatively from stimulus-triggered exogenous task switching. However, no previous study has examined the neural substrate of endogenous task switching. The purpose of the present study is to explore the differences between event-related potential responses to exogenous and endogenous rule switching at cue stimulus. We modified two patterns of cued switching tasks: exogenous (bottom-up) rule switching and endogenous (top-down) rule switching. In each task cue stimulus was configured to induce switching or maintaining rule. In exogenous switching tasks, late positive deflection was larger in the switch rule condition than in the maintain rule condition. However, in endogenous switching tasks late positive deflection was unexpectedly larger in the maintain-rule condition than in the switch-rule condition. These results indicate that exogenous rule switching is explicit stimulus-driven processes, whereas endogenous rule switching is implicitly parallel processes independent of external stimulus.

  12. Endogenously and exogenously driven selective sustained attention: Contributions to learning in kindergarten children.

    Science.gov (United States)

    Erickson, Lucy C; Thiessen, Erik D; Godwin, Karrie E; Dickerson, John P; Fisher, Anna V

    2015-10-01

    Selective sustained attention is vital for higher order cognition. Although endogenous and exogenous factors influence selective sustained attention, assessment of the degree to which these factors influence performance and learning is often challenging. We report findings from the Track-It task, a paradigm that aims to assess the contribution of endogenous and exogenous factors to selective sustained attention within the same task. Behavioral accuracy and eye-tracking data on the Track-It task were correlated with performance on an explicit learning task. Behavioral accuracy and fixations to distractors during the Track-It task did not predict learning when exogenous factors supported selective sustained attention. In contrast, when endogenous factors supported selective sustained attention, fixations to distractors were negatively correlated with learning. Similarly, when endogenous factors supported selective sustained attention, higher behavioral accuracy was correlated with greater learning. These findings suggest that endogenously and exogenously driven selective sustained attention, as measured through different conditions of the Track-It task, may support different kinds of learning. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Exogenous pyruvate facilitates cancer cell adaptation to hypoxia by serving as an oxygen surrogate.

    Science.gov (United States)

    Yin, Chengqian; He, Dan; Chen, Shuyang; Tan, Xiaoling; Sang, Nianli

    2016-07-26

    Molecular oxygen is the final electron acceptor in cellular metabolism but cancer cells often become adaptive to hypoxia, which promotes resistance to chemotherapy and radiation. The reduction of endogenous glycolytic pyruvate to lactate is known as an adaptive strategy for hypoxic cells. Whether exogenous pyruvate is required for hypoxic cell proliferation by either serving as an electron acceptor or a biosynthetic substrate remains unclear. By using both hypoxic and ρ0 cells defective in electron transfer chain, we show that exogenous pyruvate is required to sustain proliferation of both cancer and non-cancer cells that cannot utilize oxygen. Particularly, we show that absence of pyruvate led to glycolysis inhibition and AMPK activation along with decreased NAD+ levels in ρ0 cells; and exogenous pyruvate increases lactate yield, elevates NAD+/NADH ratio and suppresses AMPK activation. Knockdown of lactate dehydrogenase significantly inhibits the rescuing effects of exogenous pyruvate. In contrast, none of pyruvate-derived metabolites tested (including acetyl-CoA, α-ketoglutarate, succinate and alanine) can replace pyruvate in supporting ρ0 cell proliferation. Knockdown of pyruvate carboxylase, pyruvate dehydrogenase and citrate synthase do not impair exogenous pyruvate to rescue ρ0 cells. Importantly, we show that exogenous pyruvate relieves ATP insufficiency and mTOR inhibition and promotes proliferation of hypoxic cells, and that well-oxygenated cells release pyruvate, providing a potential in vivo source of pyruvate. Taken together, our data support a novel pyruvate cycle model in which oxygenated cells release pyruvate for hypoxic cells as an oxygen surrogate. The pyruvate cycle may be targeted as a new therapy of hypoxic cancers.

  14. Investigations into the differential reactivity of endogenous and exogenous mercury species in coastal sediments.

    Science.gov (United States)

    Bouchet, S; Rodriguez-Gonzalez, P; Bridou, R; Monperrus, M; Tessier, E; Anschutz, P; Guyoneaud, R; Amouroux, D

    2013-03-01

    Stable isotopic tracer methodologies now allow the evaluation of the reactivity of the endogenous (ambient) and exogenous (added) Hg to further predict the potential effect of Hg inputs in ecosystems. The differential reactivity of endogenous and exogenous Hg was compared in superficial sediments collected in a coastal lagoon (Arcachon Bay) and in an estuary (Adour River) from the Bay of Biscay (SW France). All Hg species (gaseous, aqueous, and solid fraction) and ancillary data were measured during time course slurry experiments under variable redox conditions. The average endogenous methylation yield was higher in the estuarine (1.2 %) than in the lagoonal sediment (0.5 %), although both methylation and demethylation rates were higher in the lagoonal sediment in relation with a higher sulfate-reducing activity. Demethylation was overall more consistent than methylation in both sediments. The endogenous and exogenous Hg behaviors were always correlated but the exogenous inorganic Hg (IHg) partitioning into water was 2.0-4.3 times higher than the endogenous one. Its methylation was just slightly higher (1.4) in the estuarine sediment while the difference in the lagoonal sediment was much larger (3.6). The relative endogenous and exogenous methylation yields were not correlated to IHg partitioning, demonstrating that the bioavailable species distributions were different for the two IHg pools. In both sediments, the exogenous IHg partitioning equaled the endogenous one within a week, while its higher methylation lasted for months. Such results provide an original assessment approach to compare coastal sediment response to Hg inputs.

  15. Exogenous fibrolytic enzymes to unlock nutrients: Histological ...

    African Journals Online (AJOL)

    There is a need for a better understanding of the mode-of-action of exogenous fibrolytic enzymes (EFE) used as additives in ruminant feeds. Four forages, treated with EFE, were evaluated in vitro and histologically, in an attempt to determine the effect of EFE on tissue degradation. Weeping love grass, kikuyu leaf material, ...

  16. Endogenous and Exogenous Attention Shifts are Mediated by the Same Large-Scale Neural Network.

    NARCIS (Netherlands)

    Peelen, M.V.; Heslenfeld, D.J.; Theeuwes, J.

    2004-01-01

    Event-related fMRI was used to examine the neural basis of endogenous (top-down) and exogenous (bottom-up) spatial orienting. Shifts of attention were induced by central (endogenous) or peripheral (exogenous) cues. Reaction times on subsequently presented targets showed the expected pattern of

  17. Lagrange-multiplier tests for weak exogeneity: a synthesis.

    NARCIS (Netherlands)

    Boswijk, H.P.; Urbain, J.P.

    1997-01-01

    This paper unifies two seemingly separate approaches to test weak exogeneity in dynamic regression models with Lagrange-multiplier statistics. The first class of tests focuses on the orthogonality between innovations and conditioning variables, and thus is related to the Durbin-Wu-Hausman

  18. Exogenous fatty acid binding protein 4 promotes human prostate cancer cell progression.

    Science.gov (United States)

    Uehara, Hisanori; Takahashi, Tetsuyuki; Oha, Mina; Ogawa, Hirohisa; Izumi, Keisuke

    2014-12-01

    Epidemiologic studies have found that obesity is associated with malignant grade and mortality in prostate cancer. Several adipokines have been implicated as putative mediating factors between obesity and prostate cancer. Fatty acid binding protein 4 (FABP4), a member of the cytoplasmic fatty acid binding protein multigene family, was recently identified as a novel adipokine. Although FABP4 is released from adipocytes and mean circulating concentrations of FABP4 are linked with obesity, effects of exogenous FABP4 on prostate cancer progression are unclear. In this study, we examined the effects of exogenous FABP4 on human prostate cancer cell progression. FABP4 treatment promoted serum-induced prostate cancer cell invasion in vitro. Furthermore, oleic acid promoted prostate cancer cell invasion only if FABP4 was present in the medium. These promoting effects were reduced by FABP4 inhibitor, which inhibits FABP4 binding to fatty acids. Immunostaining for FABP4 showed that exogenous FABP4 was taken up into DU145 cells in three-dimensional culture. In mice, treatment with FABP4 inhibitor reduced the subcutaneous growth and lung metastasis of prostate cancer cells. Immunohistochemical analysis showed that the number of apoptotic cells, positive for cleaved caspase-3 and cleaved PARP, was increased in subcutaneous tumors of FABP4 inhibitor-treated mice, as compared with control mice. These results suggest that exogenous FABP4 might promote human prostate cancer cell progression by binding with fatty acids. Additionally, exogenous FABP4 activated the PI3K/Akt pathway, independently of binding to fatty acids. Thus, FABP4 might be a key molecule to understand the mechanisms underlying the obesity-prostate cancer progression link. © 2014 UICC.

  19. Fate of exogenously supplied bacterial DNA in soybean

    Energy Technology Data Exchange (ETDEWEB)

    Ndiku, Luyindula [Commissariat des Sciences Nucleaires, Kinshasa (Zaire). Centre Regional d' Etudes Nucleaires

    1980-01-01

    The fate of exogenously supplied radiolabelled DNA from agrobacterium tumefaciens and micrococcus lysodeikticus was investigated in soybean tissues growing under various physiological conditions. The following observations are made: (a) Rapid degradation and reutilization of the donor DNA was observed in callus tissue culture. (b) Germinating seeds and five-day old seedlings were shown to degrade DNA in the incubation medium and to ultilize these degradation products for their own DNA synthesis. Reutilization could be almost totally suppressed the addition of unlabelled thymidine as a competitor. This allowed a detection of significant amounts of residuel donor closely but transiently associated with the plant tissues. (c) In soybean shoots dipped into a solution of donor DNA, partly this DNA was found to first migrate to the leaves where mostly labelled endogenous DNA was later found. Very large amounts of polymerized exogenous DNA were found in the regenerated roots after 12 days of culture.

  20. Mitigation of waterlogging-induced damages to pepper by exogenous meja

    International Nuclear Information System (INIS)

    Jun, O.; Bin, L.; Zhi, Y.B.

    2017-01-01

    In this study, we studied the mitigation effects of exogenous Methyl jasmonate (MeJA) on waterlogging-induced damages to Xinyou No.5 wrinkled skin pepper cultivar by spraying MeJA on leave's surface at different waterlogging periods and investigated its underlying mechanisms. The results showed that administration of MeJA increased antioxidant enzymes' activities, proline and soluble sugar contents and alcohol dehydrogenase (ADH) activity, reduced relative conductivity, malondialdehyde (MDA) and hydroxyl free radical (.OH) accumulation, lactate dehydrogenase (LDH) activity and lactic acid and acetaldehyde accumulation, and maintained high root malate dehydrogenase (MDH) and succinate dehydrogenase (SDH) activities and certain aerobic respiratory metabolism. The study also found that there were significant differences among exogenous MeJA treatments at different waterlogging periods. Peppers treated with exogenous MeJA 1 day and 2 days prior to waterlogging had optimal agronomic traits, higher chlorophyll content, enzymatic activities and osmolytic substances, as well as lower relative conductivity, MDA and ·OH accumulation. Overall, the results suggest that MeJA mitigates waterlogging-induced damages to pepper by adjusting osmolytic substances contents, antioxidant enzymatic activities and root respiration and metabolism and achieves better alleviation effects by spraying prior to waterlogging. (author)

  1. Effect of exogenously added rhamnolipids on citric acid production ...

    African Journals Online (AJOL)

    Effect of exogenously added rhamnolipids on citric acid production yield. Wojciech Białas, Roman Marecik, Alicja Szulc, Łukasz Ławniczak, Łukasz Chrzanowski, Filip Ciesielczyk, Teofil Jesionowski, Andreas Aurich ...

  2. The use of exogenous microbial species to enhance the ...

    African Journals Online (AJOL)

    film bioreactor with exogenous bacterial and diatoma species would increase the removal of chemical oxygen demand, nitrogenous compounds and suspended solids from a real-time coal gasification wastewater to meet environmental ...

  3. Exogenous shocks and governing energy security

    OpenAIRE

    Diriöz, Ali Oğuz

    2017-01-01

    Cataloged from PDF version of article. Thesis (Ph.D.): Bilkent University, Department of International Relations, İhsan Doğramacı Bilkent University, 2017. Includes bibliographical references (leaves 219-248). The research examines how governments maintain energy security when faced with exogenous shocks. The main focus of inquiry examines the relative influence of markets vs. geopolitics in the area of energy security using the comparative case studies of Turkey, France, and Netherl...

  4. Glucocorticoid-related bone changes from endogenous or exogenous glucocorticoids.

    Science.gov (United States)

    Warriner, Amy H; Saag, Kenneth G

    2013-12-01

    Glucocorticoids have a negative impact on bone through direct effects on bone cells and indirect effects on calcium absorption. Here, recent findings regarding glucocorticoid-induced osteoporosis, bone changes in patients with endogenous glucocorticoid derangements, and treatment of steroid-induced bone disease are reviewed. Although the majority of our understanding arises from the outcomes of patients treated with exogenous steroids, endogenous overproduction appears to be similarly destructive to bone, but these effects are reversible with cure of the underlying disease process. Additionally, there are bone changes that occur in diseases that interrupt adrenal glucocorticoid production, both in response to our inability to perfectly match glucocorticoid replacement and also related to the underlying disease process. More investigation is required to understand which patients with endogenous overproduction or underproduction of glucocorticoid would benefit from osteoporosis treatment. Better understood is the benefit that can be achieved with currently approved treatments for glucocorticoid-induced osteoporosis from exogenous steroids. With growing concern of long-term use of bisphosphonates, however, further investigation into the duration of use and use in certain populations, such as children and premenopausal women, is essential. Glucocorticoid-induced osteoporosis is a complex disease that is becoming better understood through advances in the study of exogenous and endogenous glucocorticoid exposure. Further advancement of proper treatment and prevention is on the horizon.

  5. Robust consensus algorithm for multi-agent systems with exogenous disturbances under convergence conditions

    Science.gov (United States)

    Jiang, Yulian; Liu, Jianchang; Tan, Shubin; Ming, Pingsong

    2014-09-01

    In this paper, a robust consensus algorithm is developed and sufficient conditions for convergence to consensus are proposed for a multi-agent system (MAS) with exogenous disturbances subject to partial information. By utilizing H∞ robust control, differential game theory and a design-based approach, the consensus problem of the MAS with exogenous bounded interference is resolved and the disturbances are restrained, simultaneously. Attention is focused on designing an H∞ robust controller (the robust consensus algorithm) based on minimisation of our proposed rational and individual cost functions according to goals of the MAS. Furthermore, sufficient conditions for convergence of the robust consensus algorithm are given. An example is employed to demonstrate that our results are effective and more capable to restrain exogenous disturbances than the existing literature.

  6. Exogenous fibroblast growth factor 9 attenuates cartilage degradation and aggravates osteophyte formation in post-traumatic osteoarthritis.

    Science.gov (United States)

    Zhou, S; Wang, Z; Tang, J; Li, W; Huang, J; Xu, W; Luo, F; Xu, M; Wang, J; Wen, X; Chen, L; Chen, H; Su, N; Shen, Y; Du, X; Xie, Y; Chen, L

    2016-12-01

    The aim of the present study is to investigate the effects of exogenous fibroblast growth factor (FGF)9 on the progression of post-traumatic osteoarthritis (OA). The expression of FGF9 in articular cartilage with OA is detected by immunohistochemistry (IHC). The effects of intra-articular exogenous FGF9 injection on post-traumatic OA induced by the destabilization of the medial meniscus (DMM) surgery are evaluated. Cartilage changes and osteophyte formation in knee joints are investigated by histological analysis. Changes in subchondral bone are evaluated by microcomputed tomography (micro-CT). The effect of exogenous FGF9 on an interleukin-1β (IL-1β)-induced ex vivo OA model of human articular cartilage tissues is also evaluated. FGF9 expression was down-regulated in articular chondrocytes of OA but ectopically induced at sites of osteophyte formation. Intra-articular injection of exogenous FGF9 attenuated articular cartilage degradation in mice after DMM surgery. Exogenous FGF9 suppressed collagen X and MMP13 expressions in OA cartilage, while promoted collagen II expression. Similar results were observed in IL-1β-induced ex vivo OA model. Intra-articular injection of FGF9 had no significant effect on the subchondral bone of knee joints after DMM surgery, but aggravated osteophyte formation. The expressions of SOX9 and collagen II, and cell proliferation were up-regulated at sites of initial osteophyte formation in mice with exogenous FGF9 treatment. Intra-articular injection of exogenous FGF9 delays articular cartilage degradation in post-traumatic OA, while aggravates osteophyte formation. Copyright © 2016. Published by Elsevier Ltd.

  7. Treatment with exogenous surfactant stimulates endogenous surfactant synthesis in premature infants with respiratory distress syndrome

    NARCIS (Netherlands)

    Bunt, JEH; Carnielli, VP; Janssen, DJ; Wattimena, JLD; Hop, WC; Sauer, PJ; Zimmermann, LJI

    2000-01-01

    Objective: Treatment of preterm infants with respiratory distress syndrome (RDS) with exogenous surfactant has greatly improved clinical outcome. Some infants require multiple doses, and it has not been studied whether these large amounts of exogenous surfactant disturb endogenous surfactant

  8. Exogenous application of plant growth regulators increased the total ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-02

    Nov 2, 2009 ... the exogenous application of flavonoids reports plant growth regulation ... method used for extraction and quantification of endogenous gibberellins was ... 365 nm) while separation was done on a C18 reverse-phase HPLC.

  9. Exogenous lactate interferes with cell-cycle control in BALB/3T3 mouse fibroblasts

    International Nuclear Information System (INIS)

    Rutz, H. Peter; Little, John B.

    1995-01-01

    Purpose: Previous studies have shown that exogenous lactate may influence proliferation rates, radiation sensitivity, and postirradiation repair capacity of mammalian cells. In the present study, we addressed the question of potential underlying mechanisms and, therefore, examined effects of exogenous lactate on proliferation rates and cell-cycle distribution in immortal but nontumorigenic mammalian cells. Methods and Materials: Cells were grown at 37 deg. C in an incubator with 5% CO 2 and 95% air, in a culture medium supplemented or not with lactate at a 10 mM concentration. Daily, we changed the culture medium and counted cells per dish. On selected days, cell-cycle distribution was determined by flow cytometry. Balb/3T3 mouse fibroblasts were used. Results: During the exponential phase of cell proliferation, mean population doubling time was significantly increased from 17.7 to 19.9 h, due to selective prolongation of G 2 /M. However, in density-inhibited cultures, exogenous lactate stimulated entry into S and proliferation to a significantly higher saturation density. Conclusions: These findings indicate that exogenous lactate interferes with mechanisms of cell-cycle control at two different points in the cell-cycle, depending on cell density and the resulting absence or presence of inhibition of cell proliferation. Interference with cell-cycle control may underlay the modification by exogenous lactate of radiosensitivity and postirradiation repair capacity in mammalian cells

  10. Exogenous and endogenous angiotensin‐II decrease renal cortical oxygen tension in conscious rats by limiting renal blood flow

    Science.gov (United States)

    Emans, Tonja W.; Janssen, Ben J.; Pinkham, Maximilian I.; Ow, Connie P. C.; Evans, Roger G.; Joles, Jaap A.; Malpas, Simon C.; Krediet, C. T. Paul

    2016-01-01

    Key points Our understanding of the mechanisms underlying the role of hypoxia in the initiation and progression of renal disease remains rudimentary.We have developed a method that allows wireless measurement of renal tissue oxygen tension in unrestrained rats.This method provides stable and continuous measurements of cortical tissue oxygen tension (PO2) for more than 2 weeks and can reproducibly detect acute changes in cortical oxygenation.Exogenous angiotensin‐II reduced renal cortical tissue PO2 more than equi‐pressor doses of phenylephrine, probably because it reduced renal oxygen delivery more than did phenylephrine.Activation of the endogenous renin–angiotensin system in transgenic Cyp1a1Ren2 rats reduced cortical tissue PO2; in this model renal hypoxia precedes the development of structural pathology and can be reversed acutely by an angiotensin‐II receptor type 1 antagonist.Angiotensin‐II promotes renal hypoxia, which may in turn contribute to its pathological effects during development of chronic kidney disease. Abstract We hypothesised that both exogenous and endogenous angiotensin‐II (AngII) can decrease the partial pressure of oxygen (PO2) in the renal cortex of unrestrained rats, which might in turn contribute to the progression of chronic kidney disease. Rats were instrumented with telemeters equipped with a carbon paste electrode for continuous measurement of renal cortical tissue PO2. The method reproducibly detected acute changes in cortical oxygenation induced by systemic hyperoxia and hypoxia. In conscious rats, renal cortical PO2 was dose‐dependently reduced by intravenous AngII. Reductions in PO2 were significantly greater than those induced by equi‐pressor doses of phenylephrine. In anaesthetised rats, renal oxygen consumption was not affected, and filtration fraction was increased only in the AngII infused animals. Oxygen delivery decreased by 50% after infusion of AngII and renal blood flow (RBF) fell by 3.3 ml min−1

  11. Exogenous vs. endogenous governance in innovation communities: Effects on motivation, conflict and justice - An experimental investigation

    OpenAIRE

    Störmer, Niclas; Herstatt, Cornelius

    2014-01-01

    In this study we examine the effects of exogenous vs. endogenous governance rules on a virtual community handling an innovative task. Specifically we investigate the relationship between the two modes (exogenous vs. endogenous) and factors such as motivation, conflict and justice. We conducted an experiment with 70 students, divided into teams of five. We manipulated procedural legitimacy by allowing one group to choose a set of rules and giving the other group the same rules exogenously. Our...

  12. [Alleviation of salt stress during maize seed germination by presoaking with exogenous sugar].

    Science.gov (United States)

    Zhao, Ying; Yang, Ke-jun; Li, Zuo-tong; Zhao, Chang-jiang; Xu, Jing-yu; Hu, Xue- wei; Shi, Xin-xin; Ma, Li-feng

    2015-09-01

    The maize variety Kenyu 6 was used to study the effects of exogenous glucose (Glc) and sucrose (Suc) on salt tolerance of maize seeds at germination stage under 150 mmol · L(-1) NaCl treatment. Results showed that under salt stress condition, 0.5 mmol · L(-1) exogenous Glc and Suc presoaking could promote seed germination and early seedling growth. Compared with the salt treatment, Glc presoaking increased the shoot length, radicle length and corresponding dry mass up to 1.5, 1.3, 2.1 and 1.8 times, and those of the Suc presoaking treatment increased up to 1.7, 1.3. 2.7 and 1.9 times, respectively. Exogenous Glc and Suc presoaking resulted in decreased levels of thiobarbituric acid reactive substances (TBARS) and hydrogen peroxide (H2O2) content of maize shoot under salt stress, which were lowered by 24.9% and 20.6% respectively. Exogenous Glc and Suc presoaking could increase the activities of superoxide dismutase (SOD), ascorbate peroxidase (APX), glutathione peroxidase (GPX), glutathione reductase (GR) and induce glucose-6-phosphate dehydrogenase (G6PDH) activity of maize shoot under salt stress. Compared with the salt treatment. Glc presoaking increased the activity of SOD, APX, GPX, GR and G6PDH by 66.2%, 62.9%, 32.0%, 38.5% and 50.5%, and those of the Suc presoaking increased by 67.5%, 59.8%, 30.0%, 38.5% and 50.4%, respectively. Glc and Suc presoaking also significantly increased the contents of ascorbic acid (ASA) and glutathione (GSH), ASA/DHA and GSH/GSSG. The G6PDH activity was found closely related with the strong antioxidation capacity induced by exogenous sugars. In addition, Glc and Suc presoaking enhanced K+/Na+ in maize shoot by 1.3 and 1.4 times of water soaking salt treatment, respectively. These results indicated that exogenous Glc and Suc presoaking could improve antioxidation capacity of maize seeds and maintain the in vivo K+/Na+ ion balance to alleviate the inhibitory effect of salt stress on maize seed germination.

  13. Exogenous Calcium Enhances the Photosystem II Photochemistry Response in Salt Stressed Tall Fescue.

    Science.gov (United States)

    Wang, Guangyang; Bi, Aoyue; Amombo, Erick; Li, Huiying; Zhang, Liang; Cheng, Cheng; Hu, Tao; Fu, Jinmin

    2017-01-01

    Calcium enhances turfgrass response to salt stress. However, little is known about PSII photochemical changes when exogenous calcium was applied in salinity-stressed turfgrass. Here, we probe into the rearrangements of PSII electron transport and endogenous ion accumulation in tall fescue ( Festuca arundinacea Schreber) treated with exogenous calcium under salt stress. Three-month-old seedlings of genotype "TF133" were subjected to the control (CK), salinity (S), salinity + calcium nitrate (SC), and salinity + ethylene glycol tetraacetic acid (SE). Calcium nitrate and ethylene glycol tetraacetic acid was used as exogenous calcium donor and calcium chelating agent respectively. At the end of a 5-day duration treatment, samples in SC regime had better photochemistry performance on several parameters than salinity only. Such as the Area (equal to the plastoquinone pool size), N (number of [Formula: see text] redox turnovers until F m is reached), ψE 0 , or δRo (Efficiencdy/probability with which a PSII trapped electron is transferred from Q A to Q B or PSI acceptors), ABS/RC (Absorbed photon flux per RC). All the above suggested that calcium enhanced the electron transfer of PSII (especially beyond [Formula: see text]) and prevented reaction centers from inactivation in salt-stressed tall fescue. Furthermore, both grass shoot and root tissues generally accumulated more C, N, Ca 2+ , and K + in the SC regime than S regime. Interrelated analysis indicated that ψE 0 , δRo, ABS/RC, C, and N content in shoots was highly correlated to each other and significantly positively related to Ca 2+ and K + content in roots. Besides, high salt increased ATP6E and CAMK2 transcription level in shoot at 1 and 5 day, respectively while exogenous calcium relieved it. In root, CAMK2 level was reduced by Salinity at 5 day and exogenous calcium recovered it. These observations involved in electron transport capacity and ion accumulation assist in understanding better the protective role

  14. Exogenous Calcium Enhances the Photosystem II Photochemistry Response in Salt Stressed Tall Fescue

    Directory of Open Access Journals (Sweden)

    Guangyang Wang

    2017-11-01

    Full Text Available Calcium enhances turfgrass response to salt stress. However, little is known about PSII photochemical changes when exogenous calcium was applied in salinity-stressed turfgrass. Here, we probe into the rearrangements of PSII electron transport and endogenous ion accumulation in tall fescue (Festuca arundinacea Schreber treated with exogenous calcium under salt stress. Three-month-old seedlings of genotype “TF133” were subjected to the control (CK, salinity (S, salinity + calcium nitrate (SC, and salinity + ethylene glycol tetraacetic acid (SE. Calcium nitrate and ethylene glycol tetraacetic acid was used as exogenous calcium donor and calcium chelating agent respectively. At the end of a 5-day duration treatment, samples in SC regime had better photochemistry performance on several parameters than salinity only. Such as the Area (equal to the plastoquinone pool size, N (number of QA- redox turnovers until Fm is reached, ψE0, or δRo (Efficiencdy/probability with which a PSII trapped electron is transferred from QA to QB or PSI acceptors, ABS/RC (Absorbed photon flux per RC. All the above suggested that calcium enhanced the electron transfer of PSII (especially beyond QA- and prevented reaction centers from inactivation in salt-stressed tall fescue. Furthermore, both grass shoot and root tissues generally accumulated more C, N, Ca2+, and K+ in the SC regime than S regime. Interrelated analysis indicated that ψE0, δRo, ABS/RC, C, and N content in shoots was highly correlated to each other and significantly positively related to Ca2+ and K+ content in roots. Besides, high salt increased ATP6E and CAMK2 transcription level in shoot at 1 and 5 day, respectively while exogenous calcium relieved it. In root, CAMK2 level was reduced by Salinity at 5 day and exogenous calcium recovered it. These observations involved in electron transport capacity and ion accumulation assist in understanding better the protective role of exogenous calcium in tall

  15. Bullet trains and steam engines: exogenous attention zips but endogenous attention chugs along.

    Science.gov (United States)

    Chakravarthi, Ramakrishna; VanRullen, Rufin

    2011-04-20

    Analyzing a scene requires shifting attention from object to object. Although several studies have attempted to determine the speed of these attentional shifts, there are large discrepancies in their estimates. Here, we adapt a method pioneered by T. A. Carlson, H. Hogendoorn, and F. A. J. Verstraten (2006) that directly measures pure attentional shift times. We also test if attentional shifts can be handled in parallel by the independent resources available in the two cortical hemispheres. We present 10 "clocks," with single revolving hands, in a ring around fixation. Observers are asked to report the hand position on one of the clocks at the onset of a transient cue. The delay between the reported time and the veridical time at cue onset can be used to infer processing and attentional shift times. With this setup, we use a novel subtraction method that utilizes different combinations of exogenous and endogenous cues to determine shift times for both types of attention. In one experiment, subjects shift attention to an exogenously cued clock (baseline condition) in one block, and in other blocks, subjects perform one further endogenous shift to a nearby clock (test condition). In another experiment, attention is endogenously cued to one clock (baseline condition), and on other trials, an exogenous cue further shifts attention to a nearby clock (test condition). Subtracting report delays in the baseline condition from those obtained in the test condition allows us to isolate genuine attentional shift times. In agreement with previous studies, our results reveal that endogenous attention is much slower than exogenous attention (endogenous: 250 ms; exogenous: 100 ms). Surprisingly, the dependence of shift time on distance is minimal for exogenous attention, whereas it is steep for endogenous attention. In the final experiment, we find that endogenous shifts are faster across hemifields than within a hemifield suggesting that the two hemispheres can simultaneously

  16. [Effects of exogenous AsA and GSH on the growth of Dianthus chinensis seedlings exposed to Cd].

    Science.gov (United States)

    Ding, Ji-Jun; Liu, Shi-Liang; Pan, Yuan-Zhi; Li, Li

    2014-02-01

    A pot experiment was carried out under greenhouse condition to investigate the effects of different concentrations (0, 20, 40, 60, 80 and 100 mg x L(-1)) of exogenous AsA, GSH on Dianthus chinensis seedlings which were stressed by 50 mg x kg(-1) Cd in the soil. The results indicated that 50 mg x kg(-1) of Cd significantly inhibited the growth of D. chinensis seedlings. An appropriate concentration of exogenous AsA significantly improved the biomass, plant height, tiller number, GAT and APX activities, and AsA and GSH contents. However, with the increase of exogenous AsA concentration, the ameliorating effect decreased and prooxidant effect occurred. Exogenous GSH could replenish the non-enzymatic antioxidants of D. chinensis seedlings, but the changes of antioxidant enzyme activities were relatively slight. The main mechanisms of GSH to alleviate Cd toxicity might be promoting root PCs synthesis, thereby reducing the Cd concentration in the seedlings. Both 35-45 mg x L(-1) exogenous AsA and 55-65 mg x L(-1) exogenous GSH could alleviate the Cd toxicity on D. chinensis seedlings, and the former was superior to the latter.

  17. Quantifying the timescales over which exogenous and endogenous conditions affect soil respiration.

    Science.gov (United States)

    Barron-Gafford, Greg A; Cable, Jessica M; Bentley, Lisa Patrick; Scott, Russell L; Huxman, Travis E; Jenerette, G Darrel; Ogle, Kiona

    2014-04-01

    Understanding how exogenous and endogenous factors and above-ground-below-ground linkages modulate carbon dynamics is difficult because of the influences of antecedent conditions. For example, there are variable lags between above-ground assimilation and below-ground efflux, and the duration of antecedent periods are often arbitrarily assigned. Nonetheless, developing models linking above- and below-ground processes is crucial for estimating current and future carbon dynamics. We collected data on leaf-level photosynthesis (Asat ) and soil respiration (Rsoil ) in different microhabitats (under shrubs vs under bunchgrasses) in the Sonoran Desert. We evaluated timescales over which endogenous and exogenous factors control Rsoil by analyzing data in the context of a semimechanistic temperature-response model of Rsoil that incorporated effects of antecedent exogenous (soil water) and endogenous (Asat ) conditions. For both microhabitats, antecedent soil water and Asat significantly affected Rsoil , but Rsoil under shrubs was more sensitive to Asat than that under bunchgrasses. Photosynthetic rates 1 and 3 d before the Rsoil measurement were most important in determining current-day Rsoil under bunchgrasses and shrubs, respectively, indicating a significant lag effect. Endogenous and exogenous controls are critical drivers of Rsoil , but the relative importance and the timescale over which each factor affects Rsoil depends on above-ground vegetation and ecosystem structure characteristics. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  18. Exogenous cellulases of thermophilic micromycetes. Pt. 1. Selection of producers

    Energy Technology Data Exchange (ETDEWEB)

    Kvesitadze, G; Kvachadze, L; Aleksidze, T; Chartishvili, D K

    1986-01-01

    More than 600 micromycetes - representatives of different genera have been investigated for their ability to produce exogenous cellulases. Most of the investigated cultures were found to produce these enzymes, 24 cultures being thermophilic, and 18 thermotolerant. Cellulase or its derivatives proved to be the most favourable carbon source for cellulase secretion. None of the thermophilic cultures studied manifested the ability of exogenous exoglucanase biosynthesis. Using UV-rays as mutagen, a mutant strain A. terreus T-49 has been obtained being characterized by an increased endo-glucanase and cellobiase activity, as compared to the initial strains. The cellulase preparations of thermophilic micromycetes contain one cellulasic component: endo-glucanase, or two: endo-glucanase and cellobiase.

  19. Exogenous attention enhances 2nd-order contrast sensitivity

    Science.gov (United States)

    Barbot, Antoine; Landy, Michael S.; Carrasco, Marisa

    2011-01-01

    Natural scenes contain a rich variety of contours that the visual system extracts to segregrate the retinal image into perceptually coherent regions. Covert spatial attention helps extract contours by enhancing contrast sensitivity for 1st-order, luminance-defined patterns at attended locations, while reducing sensitivity at unattended locations, relative to neutral attention allocation. However, humans are also sensitive to 2nd-order patterns such as spatial variations of texture, which are predominant in natural scenes and cannot be detected by linear mechanisms. We assess whether and how exogenous attention—the involuntary and transient capture of spatial attention—affects the contrast sensitivity of channels sensitive to 2nd-order, texture-defined patterns. Using 2nd-order, texture-defined stimuli, we demonstrate that exogenous attention increases 2nd-order contrast sensitivity at the attended location, while decreasing it at unattended locations, relative to a neutral condition. By manipulating both 1st- and 2nd-order spatial frequency, we find that the effects of attention depend both on 2nd-order spatial frequency of the stimulus and the observer’s 2nd-order spatial resolution at the target location. At parafoveal locations, attention enhances 2nd-order contrast sensitivity to high, but not to low 2nd-order spatial frequencies; at peripheral locations attention also enhances sensitivity to low 2nd-order spatial frequencies. Control experiments rule out the possibility that these effects might be due to an increase in contrast sensitivity at the 1st-order stage of visual processing. Thus, exogenous attention affects 2nd-order contrast sensitivity at both attended and unattended locations. PMID:21356228

  20. Coping with an exogenous glucose overload: glucose kinetics of rainbow trout during graded swimming.

    Science.gov (United States)

    Choi, Kevin; Weber, Jean-Michel

    2016-03-15

    This study examines how chronically hyperglycemic rainbow trout modulate glucose kinetics in response to graded exercise up to critical swimming speed (Ucrit), with or without exogenous glucose supply. Our goals were 1) to quantify the rates of hepatic glucose production (Ra glucose) and disposal (Rd glucose) during graded swimming, 2) to determine how exogenous glucose affects the changes in glucose fluxes caused by exercise, and 3) to establish whether exogenous glucose modifies Ucrit or the cost of transport. Results show that graded swimming causes no change in Ra and Rd glucose at speeds below 2.5 body lengths per second (BL/s), but that glucose fluxes may be stimulated at the highest speeds. Excellent glucoregulation is also achieved at all exercise intensities. When exogenous glucose is supplied during exercise, trout suppress hepatic production from 16.4 ± 1.6 to 4.1 ± 1.7 μmol·kg(-1)·min(-1) and boost glucose disposal to 40.1 ± 13 μmol·kg(-1)·min(-1). These responses limit the effects of exogenous glucose to a 2.5-fold increase in glycemia, whereas fish showing no modulation of fluxes would reach dangerous levels of 114 mM of blood glucose. Exogenous glucose reduces metabolic rate by 16% and, therefore, causes total cost of transport to decrease accordingly. High glucose availability does not improve Ucrit because the fish are unable to take advantage of this extra fuel during maximal exercise and rely on tissue glycogen instead. In conclusion, trout have a remarkable ability to adjust glucose fluxes that allows them to cope with the cumulative stresses of a glucose overload and graded exercise. Copyright © 2016 the American Physiological Society.

  1. [Exogenous Sr2+ sedimentation on otolith of chum salmon embryos].

    Science.gov (United States)

    Wang, Chen; Liu, Wei; Zhan, Pei-rong; Wang, Ji-long; Li, Pei-lun

    2015-10-01

    To explore the exogenous Sr2+ sedimentation on otolith of chum salmon embryos, chum salmon embryos were exposed to culture water contained Sr2+ at Sr2+ concentration of 50, 100, 200 or 400 mg . L-1 for 48 h to imitate Sr2+ sedimentation. After a culturing period of 12 d and 100 d, the otoliths of the chum salmon were taken to detect exogenous Sr2+ sedimentation with electro-probe microanalyzer (EPMA). The results showed that obvious deep red strontium signatures were produced in the otolith of chum salmon at different concentrations of Sr2+. The mean and extreme values of peak strontium area were not stable for the same Sr2+ dose, but the lowest of all the peak values was 35.1 times as much as that of control. Overall, the strontium value increased with the increase of Sr2+concentration. The strontium peak had no signs of abating after a culture period of 100 d. The results also showed that strontium was gradually deposited in the otolith, and had obvious hysteresis to immersion. Strontium sedimentation could also return to a normal level after the peak. These characteristics accorded exactly with the requirement of discharge tag technology, which indicated that exogenous Sr2+ was suitable in the marking of salmon otolith.

  2. [Effect of cadmium stress on physiological characteristics of garlic seedlings and the alleviation effects of exogenous calcium].

    Science.gov (United States)

    Li, He; Lian, Hai-feng; Liu, Shi-qi; Yu, Xin-hui; Sun, Ya-li; Guo, Hui-ping

    2015-04-01

    In the experiment, the effects of exogenous cadmium (Cd2+) and calcium (Ca2+) in nutrient solution on growth, photosynthetic characteristics, enzymes activities, main mineral elements absorption of garlic seedlings were studied. The results showed that cadmium could obviously inhibit the growth of garlic seedlings, decrease the pigment contents and photosynthetic parameters (P(n), E, g(s)) of leaves, reduced the enzymes (SOD, POD, CAT) activities and increase the MDA content of leaves, and also could reduce the N, P, K, Ca, Mg contents and increase the Cd content of roots. The growth was promoted after adding exogenous calcium to garlic seedlings under cadmium stress, which reflected that the morphological indexes were increased at first and then decreased with the increase of exogenous calcium concentrations, and were maximized when the exogenous calcium was 2 or 3 mmol x L(-1). At the same time, the pigment contents and photosynthetic parameters (P(n), E, g(s)) of leaves showed a similar tendency with the morphological indexes, and they were the highest when the exogenous calcium was 2 or 3 mmol x L(-1). In addition, adding exogenous calcium to garlic seedlings under cadmium stress enhanced the enzymes (SOD, POD, CAT) activities and decreased the MDA content of leaves, also added the N, P, K, Ca, Mg contents and reduced the Cd content of roots, and the effect was best when the exogenous calcium concentration was 2 or 3 mmol x L(-1).

  3. Using exogenous variables in testing for monotonic trends in hydrologic time series

    Science.gov (United States)

    Alley, William M.

    1988-01-01

    One approach that has been used in performing a nonparametric test for monotonic trend in a hydrologic time series consists of a two-stage analysis. First, a regression equation is estimated for the variable being tested as a function of an exogenous variable. A nonparametric trend test such as the Kendall test is then performed on the residuals from the equation. By analogy to stagewise regression and through Monte Carlo experiments, it is demonstrated that this approach will tend to underestimate the magnitude of the trend and to result in some loss in power as a result of ignoring the interaction between the exogenous variable and time. An alternative approach, referred to as the adjusted variable Kendall test, is demonstrated to generally have increased statistical power and to provide more reliable estimates of the trend slope. In addition, the utility of including an exogenous variable in a trend test is examined under selected conditions.

  4. Exogenous iron and γ-irradiation induce NO-synthase synthesis in mouse liver

    International Nuclear Information System (INIS)

    Mikoyan, V.D.; Voevodskaya, N.V.; Kubrina, L.N.; Malenkova, I.V.; Vanin, A.F.

    1994-01-01

    Protein synthesis inhibitor (cycloheximide, CHI) and exogenous antioxidant (phenazan) suppress the synthesis of NO in mouse liver in vivo which is induced by administration to the animals of γ-irradiation, bacterial lipopolysaccharide (LPS), or Fe 2+ -citrate together with LPS. Biosynthesis of NO was monitored by the ESR signal of paramagnetic mononitrosyl iron complexes with the exogenous ligand diethyldithiocarbamate (MNIC-DETC) 30 min after addition of the ligand. The complexes arise from NO binding to DETC complexes with exogenous and endogenous Fe 2+ , which act as selective NO traps. The enhancement of NO biosynthesis after γ-irradiation or LPS or LPS + Fe 2+ -citrate is apparently due to the induction of the synthesis of NO-synthase, which is inhibited by cycloheximide. This process is triggered by reactive oxygen species, presumably through the activation of the transcription factor protein NFkB. The accumulation of free radical oxygen species is inhibited by the antioxidant phenazan

  5. Utilization of exogenous ethanol by pea seedlings in an oxygen-free environment

    International Nuclear Information System (INIS)

    Ivanov, B.F.; Zemlyanukhin, A.A.; Salam, A.M.M.

    1991-01-01

    The authors investigated the metabolism of exogenous [2- 14 C]-ethanol in pea seedlings (Pisum sativum L.) exposed to different gaseous media, viz.,air, helium, or CO 2 . The 14 C label from ethanol most actively entered amino acids (glutamic and aspartic acids, alanine, glycine, and serine) and organic acids (citrate, malate, succinate, and malonate). Conversion of ethanol to organic acids and separate amino acids (gamma-aminobutyric acid and valine) was intensified under conditions of oxygen stress. A high concentration of CO 2 stimulated transformations of ethanol into these two amino acids, but sharply inhibited overall entry of the label from exogenous ethanol into metabolites of the seedlings. Lengthening the time of exposure lowered this inhibition. Exogenous ethanol did not take part in stress accumulation of alanine in seedlings deprived of oxygen. It is concluded that ethanol participates actively in the metabolic response of pea plants to oxygen stress, and that CO 2 exerts strong modifying action on this response

  6. Effect of exogenous phytase on degradation of inositol phosphate in dairy cows

    DEFF Research Database (Denmark)

    Brask-Pedersen, Dorte Buus; Glitsø, Lene Vibe; Skov, L.K.

    2013-01-01

    The effect of exogenous phytase on inositol phosphate degradation in the rumen of dairy cows was investigated in a 4 × 4 Latin square design. Four lactating Danish Holstein cows fitted with ruminal, duodenal, and ileal cannulas were offered a total mixed ration (TMR) with a high content of inositol...... phosphate and supplemented with 1 of 4 concentrations of phytase [none, low, medium, or high, corresponding to 23, 2,023, 3,982, and 6,015 phytase units/kg of dry matter (DM)]. Exogenous phytase lead to a higher rumen pool of phytase. Inositol phosphate content in digesta samples from rumen, duodenum, ileum...... and in samples of the TMR revealed that the exogenous phytase started degrading the inositol phosphate when feeds and phytase were mixed, and thus the InsP6 phosphorus (InsP6-P) content in the TMR was found to decrease with higher doses of phytase (1.69, 1.51, 1.39, and 1.25 g/kg of DM for the none, low, medium...

  7. Evaluation of the efficacy of laparoscopic resection for the management of exogenous cesarean scar pregnancy.

    Science.gov (United States)

    Wang, Guangwei; Liu, Xiaofei; Bi, Fangfang; Yin, Lili; Sa, Rina; Wang, Dandan; Yang, Qing

    2014-05-01

    To retrospectively analyze the clinical data of 71 patients with exogenous cesarean scar pregnancy (CSP) treated in our hospital in the past 2 years, to compare the outcomes of exogenous CSP treated with different methods, and to evaluate the safety and feasibility of laparoscopic resection of exogenous CSP. Comparative observational study. Tertiary medical centers. 71 women with exogenous cesarean scar pregnancy. Hysteroscopic resection of CSP, and laparoscopic resection of CSP. Operation time, intraoperative blood loss, postoperative drainage of the uterine cavity, postoperative days in hospital, time for β-human chorionic gonadotropin (β-hCG) to return to normal levels, absorption time of the mass. For the laparoscopic group, the time for serum β-hCG to return normal levels and the postoperative drainage of the uterine cavity were significantly lower than in the patients who had undergone hysteroscopic resection. We found no statistically significant difference in the intraoperative blood loss and postoperative days in hospital between the two groups, but the operation time was longer in laparoscopic group. Laparoscopic surgery for a cesarean scar pregnancy has the advantages of a high success rate, fewer complications, and a shorter time for β-hCG levels to normalize. This procedure is especially suitable for the treatment of exogenous CSP. Copyright © 2014. Published by Elsevier Inc.

  8. [Effects of exogenous spermidine on Cucumis sativus L. seedlings photosynthesis under root zone hypoxia stress].

    Science.gov (United States)

    Wang, Tian; Wang, Suping; Guo, Shirong; Sun, Yanjun

    2006-09-01

    With water culture, this paper studied the effects of exogenous spermidine (Spd) on the net photosynthetic rate (Pn), intercellular CO2 concentrations (Ci), stomatal conductance (Gs), transpiration rate (Tr), apparent quantum yield (phi c), and carboxylation efficiency (CE) of cucumber seedlings tinder hypoxia stress. The results showed that the Pn decreased gradually under hypoxia stress, and reached the minimum 10 days after by 63. 33% of the control. Compared with that of hypoxia-stressed plants, the Pn after 10 days application of exogenous Spd increased 1.25 times. A negative correlation (R2 = 0.4730 - 0.7118) was found between Pn and Ci. Gs and Tr changed in wider ranges, which decreased under hypoxia-stress, but increased under hypoxia-stress plus exogenous Spd application. There was a significant positive correlation between Gs and Tr (R2 = 0.7821 - 0.9458), but these two parameters had no significant correlation with Pn; Hypoxia stress induced a decrease of phi c and CE by 63.01% and 72.33%, respectively, while hypoxia stress plus exogenous Spd application made phi c and CE increase by 23% and 14%, respectively. The photo-inhibition of cucumber seedlings under hypoxia stress was mainly caused by non-stomatal limitation, while exogenous Spd alleviated the hypoxia stress by repairing photosynthesis system.

  9. Assessing of distribution, mobility and bioavailability of exogenous Pb in agricultural soils using isotopic labeling method coupled with BCR approach

    International Nuclear Information System (INIS)

    Huang, Zhi-Yong; Xie, Hong; Cao, Ying-Lan; Cai, Chao; Zhang, Zhi

    2014-01-01

    Highlights: • Large amounts of exogenous Pb were found to distribute in reducible fractions. • Very few of exogenous Pb were found to distribute in acid-extractable fractions. • More than 60% of exogenous Pb in rhizosphere soils lost after planting. • Isotopic labeling method and SEP enable to explore Pb bioavailability in soil. -- Abstract: The contamination of Pb in agricultural soils is one of the most important ecological problems, which potentially results in serious health risk on human health through food chain. Hence, the fate of exogenous Pb contaminated in agricultural soils is needed to be deeply explored. By spiking soils with the stable enriched isotopes of 206 Pb, the contamination of exogenous Pb 2+ ions in three agricultural soils sampled from the estuary areas of Jiulong River, China was simulated in the present study, and the distribution, mobility and bioavailability of exogenous Pb in the soils were investigated using the isotopic labeling method coupled with a four-stage BCR (European Community Bureau of Reference) sequential extraction procedure. Results showed that about 60–85% of exogenous Pb was found to distribute in reducible fractions, while the exogenous Pb in acid-extractable fractions was less than 1.0%. After planting, the amounts of exogenous Pb presenting in acid-extractable, reducible and oxidizable fractions in rhizospheric soils decreased by 60–66%, in which partial exogenous Pb was assimilated by plants while most of the metal might transfer downward due to daily watering and applying fertilizer. The results show that the isotopic labeling technique coupled with sequential extraction procedures enables us to explore the distribution, mobility and bioavailability of exogenous Pb contaminated in soils, which may be useful for the further soil remediation

  10. Assessing of distribution, mobility and bioavailability of exogenous Pb in agricultural soils using isotopic labeling method coupled with BCR approach

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Zhi-Yong, E-mail: zhyhuang@jmu.edu.cn [College of Bioengineering, Jimei University, Xiamen 361021 (China); Xie, Hong [College of Bioengineering, Jimei University, Xiamen 361021 (China); Shandong Vocational Animal Science and Veterinary College, Weifang 261061 (China); Cao, Ying-Lan [College of Bioengineering, Jimei University, Xiamen 361021 (China); Cai, Chao [Key Laboratory of Urban Environment and Health, Institute of Urban Environment, Chinese Academy of Sciences, Xiamen 361021 (China); Zhang, Zhi [College of Bioengineering, Jimei University, Xiamen 361021 (China)

    2014-02-15

    Highlights: • Large amounts of exogenous Pb were found to distribute in reducible fractions. • Very few of exogenous Pb were found to distribute in acid-extractable fractions. • More than 60% of exogenous Pb in rhizosphere soils lost after planting. • Isotopic labeling method and SEP enable to explore Pb bioavailability in soil. -- Abstract: The contamination of Pb in agricultural soils is one of the most important ecological problems, which potentially results in serious health risk on human health through food chain. Hence, the fate of exogenous Pb contaminated in agricultural soils is needed to be deeply explored. By spiking soils with the stable enriched isotopes of {sup 206}Pb, the contamination of exogenous Pb{sup 2+} ions in three agricultural soils sampled from the estuary areas of Jiulong River, China was simulated in the present study, and the distribution, mobility and bioavailability of exogenous Pb in the soils were investigated using the isotopic labeling method coupled with a four-stage BCR (European Community Bureau of Reference) sequential extraction procedure. Results showed that about 60–85% of exogenous Pb was found to distribute in reducible fractions, while the exogenous Pb in acid-extractable fractions was less than 1.0%. After planting, the amounts of exogenous Pb presenting in acid-extractable, reducible and oxidizable fractions in rhizospheric soils decreased by 60–66%, in which partial exogenous Pb was assimilated by plants while most of the metal might transfer downward due to daily watering and applying fertilizer. The results show that the isotopic labeling technique coupled with sequential extraction procedures enables us to explore the distribution, mobility and bioavailability of exogenous Pb contaminated in soils, which may be useful for the further soil remediation.

  11. Silver resistance in Gram-negative bacteria: a dissection of endogenous and exogenous mechanisms.

    Science.gov (United States)

    Randall, Christopher P; Gupta, Arya; Jackson, Nicole; Busse, David; O'Neill, Alex J

    2015-04-01

    To gain a more detailed understanding of endogenous (mutational) and exogenous (horizontally acquired) resistance to silver in Gram-negative pathogens, with an emphasis on clarifying the genetic bases for resistance. A suite of microbiological and molecular genetic techniques was employed to select and characterize endogenous and exogenous silver resistance in several Gram-negative species. In Escherichia coli, endogenous resistance arose after 6 days of exposure to silver, a consequence of two point mutations that were both necessary and sufficient for the phenotype. These mutations, in ompR and cusS, respectively conferred loss of the OmpC/F porins and derepression of the CusCFBA efflux transporter, both phenotypic changes previously linked to reduced intracellular accumulation of silver. Exogenous resistance involved derepression of the SilCFBA efflux transporter as a consequence of mutation in silS, but was additionally contingent on expression of the periplasmic silver-sequestration protein SilE. Silver resistance could be selected at high frequency (>10(-9)) from Enterobacteriaceae lacking OmpC/F porins or harbouring the sil operon and both endogenous and exogenous resistance were associated with modest fitness costs in vitro. Both endogenous and exogenous silver resistance are dependent on the derepressed expression of closely related efflux transporters and are therefore mechanistically similar phenotypes. The ease with which silver resistance can become selected in some bacterial pathogens in vitro suggests that there would be benefit in improved surveillance for silver-resistant isolates in the clinic, along with greater control over use of silver-containing products, in order to best preserve the clinical utility of silver. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy.

  12. Effects of exogenous salinity (NaCl) gradient on Cd release in acidified contaminated brown soil

    Science.gov (United States)

    Zhang, Lina; Rong, Yong; Mao, Li; Gao, Zhiyuan; Liu, Xiaoyu; Dong, Zhicheng

    2018-02-01

    Taking acidified Cd contaminated brown soil in Yantai as the research object, based on different exogenous salinity (NaCl) gradient (0%, 0.3%, 0.6%, 0.9%, 1.5%, 2% and 5%), indoor simulation experiments of Cd release were carried out after field investigation. Results showed that there was a significantly positive relation (r>0.90) between Cd release concentration/amount/ratio and exogenous salt (NaCl). Besides, the more exogenous salt (NaCl) was added; maximum release concentration/amount of Cd appeared the earlier. It was found that exogenous salt (NaCl) addition could obviously promote Cd release from acidified Cd contaminated brown soil. It was believed that this could be mainly due to the cation exchange between Cd2+ and Na+, together with the dissociation and/or complexation between Cl- and Cd2+. In addition, available adsorption sites reduction by exchange base in soil causing Cd changed from solid state to soil solution was also a probable reason.

  13. Restoring the encoding properties of a stochastic neuron model by an exogenous noise

    Science.gov (United States)

    Paffi, Alessandra; Camera, Francesca; Apollonio, Francesca; d'Inzeo, Guglielmo; Liberti, Micaela

    2015-01-01

    Here we evaluate the possibility of improving the encoding properties of an impaired neuronal system by superimposing an exogenous noise to an external electric stimulation signal. The approach is based on the use of mathematical neuron models consisting of stochastic HH-like circuit, where the impairment of the endogenous presynaptic inputs is described as a subthreshold injected current and the exogenous stimulation signal is a sinusoidal voltage perturbation across the membrane. Our results indicate that a correlated Gaussian noise, added to the sinusoidal signal can significantly increase the encoding properties of the impaired system, through the Stochastic Resonance (SR) phenomenon. These results suggest that an exogenous noise, suitably tailored, could improve the efficacy of those stimulation techniques used in neuronal systems, where the presynaptic sensory neurons are impaired and have to be artificially bypassed. PMID:25999845

  14. Restoring the encoding properties of a stochastic neuron model by an exogenous noise

    Directory of Open Access Journals (Sweden)

    Alessandra ePaffi

    2015-05-01

    Full Text Available Here we evaluate the possibility of improving the encoding properties of an impaired neuronal system by superimposing an exogenous noise to an external electric stimulation signal. The approach is based on the use of mathematical neuron models consisting of stochastic HH-like circuit, where the impairment of the endogenous presynaptic inputs is described as a subthreshold injected current and the exogenous stimulation signal is a sinusoidal voltage perturbation across the membrane. Our results indicate that a correlated Gaussian noise, added to the sinusoidal signal can significantly increase the encoding properties of the impaired system, through the Stochastic Resonance (SR phenomenon. These results suggest that an exogenous noise, suitably tailored, could improve the efficacy of those stimulation techniques used in neuronal systems, where the presynaptic sensory neurons are impaired and have to be artificially bypassed.

  15. Molecular verification on male sterile mutant after injected exogenous λDNA into wheat

    International Nuclear Information System (INIS)

    Yang Jingcheng; Yu Yuanjie; Liu Fengzhen; Qi Yanfang; Shen Fafu

    2000-01-01

    A cytoplasmic male sterile mutant and then a stable CMS line named D-type sterile line were obtained after injected exogenous λDNA into wheat line 814527, and line 814527 could be its maintainer line. By using λDNA labelled with 32 P as probe, unlabelled λDNA as positive check, dot blotting of nuclear DNA and chloroplast DNA of receptor 814527, D-type sterile line and its hybrid F 1 with Lumai 14 were carried out. Positive dots appeared in nuclear DNA and chloroplast DNA of D-type sterile line and its hybrid F 1 , but did not appear in the receptor. It showed that fragments of exogenous λDNA existed in nuclear genome and chloroplast genome of D-type sterile line, and could be inherited stably. All these results, on a molecular level, proved the reliability of exogenous DNA injection

  16. Neural correlates of endogenous attention, exogenous attention and inhibition of return in touch

    OpenAIRE

    Jones, A.; Forster, B.

    2014-01-01

    Selective attention helps process the myriad of information constantly touching our body. Both endogenous and exogenous mechanisms are relied upon to effectively process this information; however, it is unclear how they relate in the sense of touch. In three tasks we contrasted endogenous and exogenous event-related potential (ERP) and behavioural effects. Unilateral tactile cues were followed by a tactile target at the same or opposite hand. Clear behavioural effects showed facilitation of e...

  17. THE SPECIAL STATUS OF EXOGENOUS WORD-FORMATION WITHIN THE GERMAN WORD-FORMATION SYSTEM

    OpenAIRE

    Zhilyuk Sergey Aleksandrovich

    2014-01-01

    The article presents the properties of exogenous word-formation system taking into account the existence of two word-formation systems in modern German. On the basis of foreign research which reveal modern trends in German word-formation connected with the internationalization and the development of new European Latin language. The author defines key features of exogenous word-formation, i.e. foreign origin of wordformation units, unmotivated units, unmotivated interchange in base and affixes...

  18. Exogenous vs. endogenous attention: Shifting the balance of fronto-parietal activity.

    Science.gov (United States)

    Meyer, Kristin N; Du, Feng; Parks, Emily; Hopfinger, Joseph B

    2018-03-01

    Despite behavioral and electrophysiological evidence for dissociations between endogenous (voluntary) and exogenous (reflexive) attention, fMRI results have yet to consistently and clearly differentiate neural activation patterns between these two types of attention. This study specifically aimed to determine whether activity in the dorsal fronto-parietal network differed between endogenous and exogenous conditions. Participants performed a visual discrimination task in endogenous and exogenous attention conditions while undergoing fMRI scanning. Analyses revealed robust and bilateral activation throughout the dorsal fronto-parietal network for each condition, in line with many previous results. In order to investigate possible differences in the balance of neural activity within this network with greater sensitivity, a priori regions of interest (ROIs) were selected for analysis, centered on the frontal eye fields (FEF) and intraparietal sulcus (IPS) regions identified in previous studies. The results revealed a significant interaction between region, condition, and hemisphere. Specifically, in the left hemisphere, frontal areas were more active than parietal areas, but only during endogenous attention. Activity in the right hemisphere, in contrast, remained relatively consistent for these regions across conditions. Analysis of this activity over time indicates that this left-hemispheric regional imbalance is present within the FEF early, at 3-6.5 s post-stimulus presentation, whereas a regional imbalance in the exogenous condition is not evident until 6.5-8 s post-stimulus presentation. Overall, our results provide new evidence that although the dorsal fronto-parietal network is indeed associated with both types of attentional orienting, regions of the network are differentially engaged over time and across hemispheres depending on the type of attention. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Purification of the Membrane Compartment for Endoplasmic Reticulum-associated Degradation of Exogenous Antigens in Cross-presentation.

    Science.gov (United States)

    Imai, Jun; Otani, Mayu; Sakai, Takahiro; Hatta, Shinichi

    2017-08-21

    Dendritic cells (DCs) are highly capable of processing and presenting internalized exogenous antigens upon major histocompatibility class (MHC) I molecules also known as cross-presentation (CP). CP plays an important role not only in the stimulation of naïve CD8 + T cells and memory CD8 + T cells for infectious and tumor immunity but also in the inactivation of self-acting naïve T cells by T cell anergy or T cell deletion. Although the critical molecular mechanism of CP remains to be elucidated, accumulating evidence indicates that exogenous antigens are processed through endoplasmic reticulum-associated degradation (ERAD) after export from non-classical endocytic compartments. Until recently, characterizations of these endocytic compartments were limited because there were no specific molecular markers other than exogenous antigens. The method described here is a new vesicle isolation protocol, which allows for the purification of these endocytic compartments. Using this purified microsome, we reconstituted the ERAD-like transport, ubiquitination, and processing of the exogenous antigen in vitro, suggesting that the ubiquitin-proteasome system processed the exogenous antigen after export from this cellular compartment. This protocol can be further applied to other cell types to clarify the molecular mechanism of CP.

  20. Endotoxicosis as the Contents of Posresuscitative Disease in Acute Poisoning

    Directory of Open Access Journals (Sweden)

    Ye. A. Luzhnikov

    2007-01-01

    Full Text Available Objective: to study the specific features of the diagnosis and treatment of endothoxicosis as a manifestation of postresus-citative disease in acute exogenous poisoning.Subjects and methods. Clinical, laboratory, and statistical methods of the diagnosis of endotoxicosis complicating the course of acute poisoning by narcotics, psychopharmacological agents, and cauterants, as well as complex physicochemical detoxification were applied to 554 patients.Results. The study pathology has been ascertained to have 3 developmental stages — from functional (primary to developed and terminal clinical and laboratory manifestations as multiple organ dysfunctions. The best therapeutic results are achieved by effective therapeutic measures just in early-stage endotoxicosis, by substantially reducing the rates of death and pneumonia and the time of the latter’s resolution. The major contribution to the reduction in the rate of death due acute poisoning is associated with physicochemical detoxification that considerably lessens the influence of the intoxication factors of postresuscitative disease.Conclusion. When diagnosing endotoxicosis in patients with acute endogenous intoxication, it is necessary to keep in mind a whole spectrum of typical changes in endotoxicosis markers and homeostatic parameters: hematologi-cal, blood rheological, lipid peroxidation/antioxidative systems, which should be timely corrected by the basic efferent artificial detoxification techniques (hemosorption, hemodiafiltration, hemofiltration, by compulsorily employing physio-and chemohemotherapy (laser-ultraviolet hemotherapy, sodium hypochlorite infusion. 

  1. Effect of exogenous IAA on radiation-induced seedling growth in rice

    International Nuclear Information System (INIS)

    Bhattacharya, Shakuntala; Shama Rao, H.K.

    1978-01-01

    Rice seeds of var. D-6-2-2 were used to ascertain the interaction between exogenous IAA and low and high dose of γ-rays on seedling growth. Low doses of radiation (1,2 kR) and low concentrations of IAA(5,10 ppm) stimulated growth when applied independently. However, they proved inhibitory in combination, indicating the possibility of native IAA involvement at optimum level in radiation-induced stimulation. At a higher dose (5 kR), higher concentrations of exogenous IAA (50,100 ppm) resulted in a significant growth recovery over control. These results suggest that low doses of ionizing radiations probably accelerate the IAA synthesizing system leading to stimulation. (author)

  2. Exogenous melatonin improves Malus resistance to Marssonina apple blotch.

    Science.gov (United States)

    Yin, Lihua; Wang, Ping; Li, Mingjun; Ke, Xiwang; Li, Cuiying; Liang, Dong; Wu, Shan; Ma, Xinli; Li, Chao; Zou, Yangjun; Ma, Fengwang

    2013-05-01

    We examined whether exogenously applied melatonin could improve resistance to Marssonina apple blotch (Diplocarpon mali) by apple [Malus prunifolia (Willd.) Borkh. cv. Donghongguo]. This serious disease leads to premature defoliation in the main regions of apple production. When plants were pretreated with melatonin, resistance was increased in the leaves. We investigated the potential roles for melatonin in modulating levels of hydrogen peroxide (H2O2), as well the activities of antioxidant enzymes and pathogenesis-related proteins during these plant-pathogen interactions. Pretreatment enabled plants to maintain intracellular H2O2 concentrations at steady-state levels and enhance the activities of plant defence-related enzymes, possibly improving disease resistance. Because melatonin is safe and beneficial to animals and humans, exogenous pretreatment might represent a promising cultivation strategy to protect plants against this pathogen infection. © 2012 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

  3. Exogenous factors in panic disorder: clinical and research implications.

    Science.gov (United States)

    Roy-Byrne, P P; Uhde, T W

    1988-02-01

    Because panic disorder has an underlying biologic and probably genetic basis, the role of factors outside the organism in initiating and sustaining panic is often overlooked. The authors review certain exogenous factors that seem capable of triggering attacks and/or increasing their frequency and intensity: self-administered pharmacologic agents (caffeine, alcohol, nicotine, over-the-counter cold preparations, cannabis, cocaine); habits (sleep deprivation, diet, exercise, relaxation, hyperventilation); and aspects of the environment (fluorescent lighting, life stressors). There may be a specificity to the action of some of these factors, because certain factors previously thought to trigger panic attacks (e.g., pain, hypoglycemia) have been proved not to have this effect. Although the clinical significance of many of the exogenous factors discussed still awaits empirical confirmation, attention to such factors during the initial evaluation of a patient with panic disorder may be helpful in formulating a successful treatment plan.

  4. Comparative proteomic analysis reveals the positive effect of exogenous spermidine on photosynthesis and salinity tolerance in cucumber seedlings.

    Science.gov (United States)

    Sang, Ting; Shan, Xi; Li, Bin; Shu, Sheng; Sun, Jin; Guo, Shirong

    2016-08-01

    Our results based on proteomics data and physiological alterations proposed the putative mechanism of exogenous Spd enhanced salinity tolerance in cucumber seedlings. Current studies showed that exogenous spermidine (Spd) could alleviate harmful effects of salinity. It is important to increase our understanding of the beneficial physiological responses of exogenous Spd treatment, and to determine the molecular responses underlying these responses. Here, we combined a physiological analysis with iTRAQ-based comparative proteomics of cucumber (Cucumis sativus L.) leaves, treated with 0.1 mM exogenous Spd, 75 mM NaCl and/or exogenous Spd. A total of 221 differentially expressed proteins were found and involved in 30 metabolic pathways, such as photosynthesis, carbohydrate metabolism, amino acid metabolism, stress response, signal transduction and antioxidant. Based on functional classification of the differentially expressed proteins and the physiological responses, we found cucumber seedlings treated with Spd under salt stress had higher photosynthesis efficiency, upregulated tetrapyrrole synthesis, stronger ROS scavenging ability and more protein biosynthesis activity than NaCl treatment, suggesting that these pathways may promote salt tolerance under high salinity. This study provided insights into how exogenous Spd protects photosynthesis and enhances salt tolerance in cucumber seedlings.

  5. Effects of Different Organic Materials and Exogenous Zn on Zn Distribution in Soil

    OpenAIRE

    HAO Jia-li; BU Yu-shan; JIA Zheng-rong; XI Ji-long; YAO Jing-zhen; DUAN Chao

    2015-01-01

    A pot experiment with a complete combinatorial design of two factors was conducted to study the effects of different organic materials and different concentrations of exogenous zinc on the soil total zinc, available zinc, zinc forms and zinc content distribution of pak-choi. The results showed that the total zinc, available zinc, and different forms of zinc contents in soil all increased as the concentration of exogenous zinc increased. Both lawn grass and maize straw decreased the total zinc...

  6. Interaction between exogenous insulin, endogenous insulin, and glucose in type 2 diabetes patients.

    Science.gov (United States)

    Janukonyté, Jurgita; Parkner, Tina; Bruun, Niels Henrik; Lauritzen, Torsten; Christiansen, Jens Sandahl; Laursen, Torben

    2015-05-01

    Little is known about the influence of exogenous insulin and actual glucose levels on the release of endogenous insulin in insulin-treated type 2 diabetes mellitus (T2DM) patients. This study investigated the interaction among serum endogenous insulin (s-EI), serum exogenous insulin aspart (s-IAsp), and blood glucose levels in an experimental short-term crossover design. Eight T2DM patients (63.52 years old; range, 49-69 years; mean body mass index, 28.8±3.8 kg/m(2)) were randomized to treatment with individual fixed doses of insulin aspart (0.5-1.5 IU/h) as a continuous subcutaneous insulin infusion (CSII) during a 10-h period on two occasions with different duration of hyperglycemia: (1) transient hyperglycemia for 2 h (visit TH) and (2) continuous hyperglycemia for 12 h (visit CH). During steady state the variances of plasma glucose (p-glucose), s-IAsp, and s-EI were equal within visit TH and within visit CH, but variances were significantly higher during visit CH compared with visit TH. The s-IAsp reached lower levels at visit CH compared with visit TH (test for slope=1, P=0.005). The s-EI depended on p-glucose in a nonlinear fashion during the first 100 min of both visits when s-IAsp was undetectable (adjusted R(2)=0.9). A complex but statistically significant interaction among s-IAsp, s-EI, p-glucose, and patients was observed during measurable s-IAsp levels (adjusted R(2)=0.70). Endogenous and exogenous insulin showed higher variation during continuous hyperglycemia. Significantly lower levels of exogenous insulin were observed following CSII during continuous hyperglycemia compared with transient hyperglycemia. Endogenous insulin levels could in a complex way be explained by an individual interaction among p-glucose and serum exogenous insulin, if present.

  7. Dry-grind processing using amylase corn and superior yeast to reduce the exogenous enzyme requirements in bioethanol production.

    Science.gov (United States)

    Kumar, Deepak; Singh, Vijay

    2016-01-01

    Conventional corn dry-grind ethanol production process requires exogenous alpha and glucoamylases enzymes to breakdown starch into glucose, which is fermented to ethanol by yeast. This study evaluates the potential use of new genetically engineered corn and yeast, which can eliminate or minimize the use of these external enzymes, improve the economics and process efficiencies, and simplify the process. An approach of in situ ethanol removal during fermentation was also investigated for its potential to improve the efficiency of high-solid fermentation, which can significantly reduce the downstream ethanol and co-product recovery cost. The fermentation of amylase corn (producing endogenous α-amylase) using conventional yeast and no addition of exogenous α-amylase resulted in ethanol concentration of 4.1 % higher compared to control treatment (conventional corn using exogenous α-amylase). Conventional corn processed with exogenous α-amylase and superior yeast (producing glucoamylase or GA) with no exogenous glucoamylase addition resulted in ethanol concentration similar to control treatment (conventional yeast with exogenous glucoamylase addition). Combination of amylase corn and superior yeast required only 25 % of recommended glucoamylase dose to complete fermentation and achieve ethanol concentration and yield similar to control treatment (conventional corn with exogenous α-amylase, conventional yeast with exogenous glucoamylase). Use of superior yeast with 50 % GA addition resulted in similar increases in yield for conventional or amylase corn of approximately 7 % compared to that of control treatment. Combination of amylase corn, superior yeast, and in situ ethanol removal resulted in a process that allowed complete fermentation of 40 % slurry solids with only 50 % of exogenous GA enzyme requirements and 64.6 % higher ethanol yield compared to that of conventional process. Use of amylase corn and superior yeast in the dry-grind processing industry

  8. Cassava Leaf Meal and Exogenous Enzyme as Supplements in ...

    African Journals Online (AJOL)

    %, 50% and 66.67% such that the levels of cassava leaf meal (CLM) supplementation were 5%, 7.5% and 10% but in addition Avizyme® (an exogenous commercial polysaccharidase) was added to the diets at the rate of 100g kg-1. The birds ...

  9. MECHANISMS IN ENDOCRINOLOGY: Exogenous insulin does not increase muscle protein synthesis rate when administered systemically: a systematic review.

    Science.gov (United States)

    Trommelen, Jorn; Groen, Bart B L; Hamer, Henrike M; de Groot, Lisette C P G M; van Loon, Luc J C

    2015-07-01

    Though it is well appreciated that insulin plays an important role in the regulation of muscle protein metabolism, there is much discrepancy in the literature on the capacity of exogenous insulin administration to increase muscle protein synthesis rates in vivo in humans. To assess whether exogenous insulin administration increases muscle protein synthesis rates in young and older adults. A systematic review of clinical trials was performed and the presence or absence of an increase in muscle protein synthesis rate was reported for each individual study arm. In a stepwise manner, multiple models were constructed that excluded study arms based on the following conditions: model 1, concurrent hyperaminoacidemia; model 2, insulin-induced hypoaminoacidemia; model 3, supraphysiological insulin concentrations; and model 4, older, more insulin resistant, subjects. From the presented data in the current systematic review, we conclude that: i) exogenous insulin and amino acid administration effectively increase muscle protein synthesis, but this effect is attributed to the hyperaminoacidemia; ii) exogenous insulin administered systemically induces hypoaminoacidemia which obviates any insulin-stimulatory effect on muscle protein synthesis; iii) exogenous insulin resulting in supraphysiological insulin levels exceeding 50, 000  pmol/l may effectively augment muscle protein synthesis; iv) exogenous insulin may have a diminished effect on muscle protein synthesis in older adults due to age-related anabolic resistance; and v) exogenous insulin administered systemically does not increase muscle protein synthesis in healthy, young adults. © 2015 European Society of Endocrinology.

  10. Methadone, monoamine oxidase, and depression: opioid distribution and acute effects on enzyme activity

    International Nuclear Information System (INIS)

    Kaufmann, C.A.; Kreek, M.J.; Raghunath, J.; Arns, P.

    1983-01-01

    Narcotic withdrawal is often accompanied by an atypical depression which responds to resumption of narcotics. It was hypothesized that methadone might exert its antidepressant effects through monoamine oxidase (MAO) inhibition. The current study examined 3 H-methadone distribution in rat brain and effects on regional MAO activity with acute doses (2.5 mg/kg) which approximate those found during chronic methadone maintenance in man. Limbic areas (amygdala, basomedial hypothalamus, caudate-putamen, hippocampus, preoptic nucleus), as well as pituitary and liver were assayed for MAO activity and methadone concentration. MAO activities did not differ significantly in acute methadone or saline-treated cage-mates at 1 or 24 hr. The concentrations of methadone at 1 hr ranged between 17 and 223 ng/100 mg wet wt tissue in the preoptic nucleus and pituitary, respectively. No significant correlation was found between change in MAO activity (MAO methadone/MAO saline) and methadone concentration in any region at 1 or 24 hr. This study does not support the hypothesis that methadone acts as an antidepressant through MAO inhibition, at least not following acute administration of this exogenous opioid

  11. Altitude Acclimatization and Blood Volume: Effects of Exogenous Erythrocyte Volume Expansion

    National Research Council Canada - National Science Library

    Sawka, M

    1996-01-01

    ...: (a) altitude acclimatization effects on erythrocyte volume and plasma volume; (b) if exogenous erythrocyte volume expansion alters subsequent erythrocyte volume and plasma volume adaptations; (c...

  12. Exogenous attention to fear: Differential behavioral and neural responses to snakes and spiders.

    Science.gov (United States)

    Soares, Sandra C; Kessel, Dominique; Hernández-Lorca, María; García-Rubio, María J; Rodrigues, Paulo; Gomes, Nuno; Carretié, Luis

    2017-05-01

    Research has consistently shown that threat stimuli automatically attract attention in order to activate the defensive response systems. Recent findings have provided evidence that snakes tuned the visual system of evolving primates for their astute detection, particularly under challenging perceptual conditions. The goal of the present study was to measure behavioral and electrophysiological indices of exogenous attention to snakes, compared with spiders - matched for rated fear levels but for which sources of natural selection are less well grounded, and to innocuous animals (birds), which were presented as distracters, while participants were engaged in a letter discrimination task. Duration of stimuli, consisting in a letter string and a concurrent distracter, was either presented for 180 or 360ms to explore if the stimulus duration was a modulating effect of snakes in capturing attention. Results showed a specific early (P1) exogenous attention-related brain potential with maximal amplitude to snakes in both durations, which was followed by an enhanced late attention-related potential (LPP) showing enhanced amplitudes to spiders, particularly under the longer exposure durations. These results suggest that exogenous attention to different classes of threat stimuli follows a gradual process, with the most evolutionary-driven stimulus, i.e., snakes, being more efficient at attracting early exogenous attention, thus more dependent on bottom-up processes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Spatial attention triggered by unimodal, crossmodal, and bimodal exogenous cues: a comparison of reflexive orienting mechanisms

    NARCIS (Netherlands)

    Santangelo, Valerio; van der Lubbe, Robert Henricus Johannes; Belardinelli, Marta Olivetti; Postma, Albert

    The aim of this study was to establish whether spatial attention triggered by bimodal exogenous cues acts differently as compared to unimodal and crossmodal exogenous cues due to crossmodal integration. In order to investigate this issue, we examined cuing effects in discrimination tasks and

  14. Exogenous estrogen as mediator of racial differences in bioactive insulin-like growth factor-I levels among postmenopausal women.

    Science.gov (United States)

    Jung, Su Yon; Vitolins, Mara Z; Paskett, Electra D; Chang, Shine

    2015-04-01

    The role of exogenous estrogen use in racial differences in insulin-like growth factor-I (IGF-I) levels which affect cancer risk is unclear. We investigated whether the relationship between race and circulating bioactive IGF-I proteins was mediated by exogenous estrogen and the extent to which exogenous estrogen influenced the race-IGF-I relationship in postmenopausal women. This cross-sectional study included 636 white and 133 African American postmenopausal women enrolled in an ancillary study of the Women's Health Initiative Observational Study. To assess exogenous estrogen use (nonusers [n = 262] vs users [n = 507]) as a mediator of the race-IGF-I relationship, we used the Baron-Kenny method and an estimation of the proportional change in the odd ratios for IGF-I levels on race plus a bootstrapping test for the significance of the mediation effect. Compared with white women, African American women were more likely to have high IGF-I levels and less likely to use exogenous estrogen. After accounting for race, estrogen nonusers had higher IGF-I levels than estrogen users did. Among oral contraceptive ever users, exogenous estrogen had a strong mediation effect (67%; p = .018) in the race-IGF-I relationship. In the women with a history of hypertension, exogenous estrogen explained racial differences in IGF-I levels to a modest degree (23%; p = .029). Exogenous estrogen use has a potentially important role in disparities in IGF-I bioactivity between postmenopausal African American and white women. A history of oral contraceptive use and hypertension may be part of the interconnected hormonal pathways related to racial differences in IGF-I levels. © The Author 2014. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Study on character variation induced by introducing exogenous DNA into upland cotton with ion implantation

    International Nuclear Information System (INIS)

    Cheng Beijiu; Tian Qiuyuan; Li Zhan; Zhou Liren

    1996-01-01

    The exogenous DNAs of G. Bickll P. and H. Cannabinus were introduced into the upland cotton Si 2 by Ar + implantation and DNA solution trickling method. The results showed that the exogenous DNA introduction was promoted significantly and the types and frequencies of character variation in progeny were increased by Ar + implantation. Furthermore, most of the variation tend to be stable. Among the Ar + implantation doses tested, 2 x 10 15 Ar + /cm 2 was the best for introducing exogenous DNA and inducing character variation, the variation rate reached to 16.2%. Some new lines with character of resistance to wilt disease, early maturity, few gland in seed and fine fiber quality have been obtained

  16. Exogenous Glutathione Enhances Mercury Tolerance by Inhibiting Mercury Entry into Plant Cells

    Science.gov (United States)

    Kim, Yeon-Ok; Bae, Hyeun-Jong; Cho, Eunjin; Kang, Hunseung

    2017-01-01

    Despite the increasing understanding of the crucial roles of glutathione (GSH) in cellular defense against heavy metal stress as well as oxidative stress, little is known about the functional role of exogenous GSH in mercury (Hg) tolerance in plants. Here, we provide compelling evidence that GSH contributes to Hg tolerance in diverse plants. Exogenous GSH did not mitigate the toxicity of cadmium (Cd), copper (Cu), or zinc (Zn), whereas application of exogenous GSH significantly promoted Hg tolerance during seed germination and seedling growth of Arabidopsis thaliana, tobacco, and pepper. By contrast, addition of buthionine sulfoximine, an inhibitor of GSH biosynthesis, severely retarded seed germination and seedling growth of the plants in the presence of Hg. The effect of exogenous GSH on Hg specific tolerance was also evident in the presence of other heavy metals, such as Cd, Cu, and Zn, together with Hg. GSH treatment significantly decreased H2O2 and O2- levels and lipid peroxidation, but increased chlorophyll content in the presence of Hg. Importantly, GSH treatment resulted in significantly less accumulation of Hg in Arabidopsis plants, and thin layer chromatography and nuclear magnetic resonance analysis revealed that GSH had much stronger binding affinity to Hg than to Cd, Cu, or Zn, suggesting that tight binding of GSH to Hg impedes Hg uptake, leading to low Hg accumulation in plant cells. Collectively, the present findings reveal that GSH is a potent molecule capable of conferring Hg tolerance by inhibiting Hg accumulation in plants. PMID:28507557

  17. Exogenous Glutathione Enhances Mercury Tolerance by Inhibiting Mercury Entry into Plant Cells

    Directory of Open Access Journals (Sweden)

    Yeon-Ok Kim

    2017-05-01

    Full Text Available Despite the increasing understanding of the crucial roles of glutathione (GSH in cellular defense against heavy metal stress as well as oxidative stress, little is known about the functional role of exogenous GSH in mercury (Hg tolerance in plants. Here, we provide compelling evidence that GSH contributes to Hg tolerance in diverse plants. Exogenous GSH did not mitigate the toxicity of cadmium (Cd, copper (Cu, or zinc (Zn, whereas application of exogenous GSH significantly promoted Hg tolerance during seed germination and seedling growth of Arabidopsis thaliana, tobacco, and pepper. By contrast, addition of buthionine sulfoximine, an inhibitor of GSH biosynthesis, severely retarded seed germination and seedling growth of the plants in the presence of Hg. The effect of exogenous GSH on Hg specific tolerance was also evident in the presence of other heavy metals, such as Cd, Cu, and Zn, together with Hg. GSH treatment significantly decreased H2O2 and O2- levels and lipid peroxidation, but increased chlorophyll content in the presence of Hg. Importantly, GSH treatment resulted in significantly less accumulation of Hg in Arabidopsis plants, and thin layer chromatography and nuclear magnetic resonance analysis revealed that GSH had much stronger binding affinity to Hg than to Cd, Cu, or Zn, suggesting that tight binding of GSH to Hg impedes Hg uptake, leading to low Hg accumulation in plant cells. Collectively, the present findings reveal that GSH is a potent molecule capable of conferring Hg tolerance by inhibiting Hg accumulation in plants.

  18. Protein as chemical cue: non-nutritional growth enhancement by exogenous protein in Pseudomonas putida KT2440.

    Directory of Open Access Journals (Sweden)

    Hiren Joshi

    Full Text Available Research pertaining to microbe-microbe and microbe-plant interactions has been largely limited to small molecules like quorum sensing chemicals. However, a few recent reports have indicated the role of complex molecules like proteins and polysaccharides in microbial communication. Here we demonstrate that exogenous proteins present in culture media can considerably accelerate the growth of Pseudomonas putida KT2440, even when such proteins are not internalized by the cells. The growth enhancement is observed when the exogenous protein is not used as a source of carbon or nitrogen. The data show non-specific nature of the protein inducing growth; growth enhancement was observed irrespective of the protein type. It is shown that growth enhancement is mediated via increased siderophore secretion in response to the exogenous protein, leading to better iron uptake. We highlight the ecological significance of the observation and hypothesize that exogenous proteins serve as chemical cues in the case of P.putida and are perceived as indicator of the presence of competitors in the environment. It is argued that enhanced siderophore secretion in response to exogenous protein helps P.putida establish numerical superiority over competitors by way of enhanced iron assimilation and quicker utilization of aromatic substrates.

  19. The isotopic composition of lead: a useful tool to estimate the distribution of exogenous and natural lead in soils

    International Nuclear Information System (INIS)

    Semlali, R.M.; Van Oort, F.; Loubet, M.; Denaix, L.

    2000-01-01

    Pb isotopic ratios were analysed in oil horizons and in grain size fractions of two soils, with contrasting pedogenesis. For an andosol, the results highlighted a progressive distribution of exogenous Pb with depth and, at the scale of the soil constituents, an increasing incorporation of exogenous Pb with decreasing particle size. For a podzol, the distribution of exogenous Pb was linked to the dynamics of the organic matter. In the BPh horizon, the 100-200 μm fraction was found to be a predominant soil compartment accumulating exogenous Pb ascribed to the precipitation of Pb on organic compounds around quartz grains. (authors)

  20. Analyzing Bullwhip Effect in Supply Networks under Exogenous Uncertainty

    Directory of Open Access Journals (Sweden)

    Mitra Darvish

    2014-05-01

    Full Text Available This paper explains a model for analyzing and measuring the propagation of order amplifications (i.e. bullwhip effect for a single-product supply network topology considering exogenous uncertainty and linear and time-invariant inventory management policies for network entities. The stream of orders placed by each entity of the network is characterized assuming customer demand is ergodic. In fact, we propose an exact formula in order to measure the bullwhip effect in the addressed supply network topology considering the system in Markovian chain framework and presenting a matrix of network member relationships and relevant order sequences. The formula turns out using a mathematical method called frequency domain analysis. The major contribution of this paper is analyzing the bullwhip effect considering exogenous uncertainty in supply networks and using the Fourier transform in order to simplify the relevant calculations. We present a number of numerical examples to assess the analytical results accuracy in quantifying the bullwhip effect.

  1. Exogenous and endogenous shifts of attention in perihand space.

    Science.gov (United States)

    Le Bigot, Nathalie; Grosjean, Marc

    2016-07-01

    While some studies have found that attentional orienting is altered in perihand space, most have not. One reason for such discrepancies may be related to the types of cues (uninformative and informative) that have been used, as they are known to induce different types of shifts of attention (exogenous and endogenous, respectively). To systematically address this question, two experiments were performed in which an uninformative peripheral cue (Experiment 1) or an informative central cue (Experiment 2) preceded a peripheral target with a short (100-150 ms) stimulus-onset asynchrony. Participants performed the task with their left hand, right hand, both hands, or no hands near the display. Cueing effects were obtained in both experiments, but they were only modulated by hand position in Experiment 1, with larger effects observed in the right- and both-hand conditions. These findings suggest that exogenous attention shifts are affected by hand proximity, while endogenous shifts are not.

  2. Partial Granger causality--eliminating exogenous inputs and latent variables.

    Science.gov (United States)

    Guo, Shuixia; Seth, Anil K; Kendrick, Keith M; Zhou, Cong; Feng, Jianfeng

    2008-07-15

    Attempts to identify causal interactions in multivariable biological time series (e.g., gene data, protein data, physiological data) can be undermined by the confounding influence of environmental (exogenous) inputs. Compounding this problem, we are commonly only able to record a subset of all related variables in a system. These recorded variables are likely to be influenced by unrecorded (latent) variables. To address this problem, we introduce a novel variant of a widely used statistical measure of causality--Granger causality--that is inspired by the definition of partial correlation. Our 'partial Granger causality' measure is extensively tested with toy models, both linear and nonlinear, and is applied to experimental data: in vivo multielectrode array (MEA) local field potentials (LFPs) recorded from the inferotemporal cortex of sheep. Our results demonstrate that partial Granger causality can reveal the underlying interactions among elements in a network in the presence of exogenous inputs and latent variables in many cases where the existing conditional Granger causality fails.

  3. Human CD4+ T cells require exogenous cystine for glutathione and DNA synthesis

    DEFF Research Database (Denmark)

    Levring, Trine B; Kongsbak-Wismann, Martin; Rode, Anna Kathrine Obelitz

    2015-01-01

    . The aim of this study was to elucidate why activated human T cells require exogenous Cys2 in order to proliferate. We activated purified naïve human CD4+ T cells and found that glutathione (GSH) levels and DNA synthesis were dependent on Cys2 and increased in parallel with increasing concentrations of Cys......Adaptive immune responses require activation and expansion of antigen-specific T cells. Whereas early T cell activation is independent of exogenous cystine (Cys2), T cell proliferation is dependent of Cys2. However, the exact roles of Cys2 in T cell proliferation still need to be determined...... for the activity of ribonucleotide reductase (RNR), the enzyme responsible for generation of the deoxyribonucleotide DNA building blocks. In conclusion, we show that activated human T cells require exogenous Cys2 to proliferate and that this is partly explained by the fact that Cys2 is required for production...

  4. The Influence of Endogenous and Exogenous Spatial Attention on Decision Confidence.

    Science.gov (United States)

    Kurtz, Phillipp; Shapcott, Katharine A; Kaiser, Jochen; Schmiedt, Joscha T; Schmid, Michael C

    2017-07-25

    Spatial attention allows us to make more accurate decisions about events in our environment. Decision confidence is thought to be intimately linked to the decision making process as confidence ratings are tightly coupled to decision accuracy. While both spatial attention and decision confidence have been subjected to extensive research, surprisingly little is known about the interaction between these two processes. Since attention increases performance it might be expected that confidence would also increase. However, two studies investigating the effects of endogenous attention on decision confidence found contradictory results. Here we investigated the effects of two distinct forms of spatial attention on decision confidence; endogenous attention and exogenous attention. We used an orientation-matching task, comparing the two attention conditions (endogenous and exogenous) to a control condition without directed attention. Participants performed better under both attention conditions than in the control condition. Higher confidence ratings than the control condition were found under endogenous attention but not under exogenous attention. This finding suggests that while attention can increase confidence ratings, it must be voluntarily deployed for this increase to take place. We discuss possible implications of this relative overconfidence found only during endogenous attention with respect to the theoretical background of decision confidence.

  5. Nitric oxide from both exogenous and endogenous sources activates mitochondria-dependent events and induces insults to human chondrocytes.

    Science.gov (United States)

    Wu, Gong-Jhe; Chen, Tyng-Guey; Chang, Huai-Chia; Chiu, Wen-Ta; Chang, Chia-Chen; Chen, Ruei-Ming

    2007-08-15

    During inflammation, overproduction of nitric oxide (NO) can damage chondrocytes. In this study, we separately evaluated the toxic effects of exogenous and endogenous NO on human chondrocytes and their possible mechanisms. Human chondrocytes were exposed to sodium nitroprusside (SNP), an NO donor, or a combination of lipopolysaccharide (LPS) and interferon-gamma (IFN-gamma) as the exogenous and endogenous sources of NO, respectively. Administration of SNP or a combination of LPS and IFN-gamma in human chondrocytes increased cellular NO levels but decreased cell viability. Exposure to exogenous or endogenous NO significantly induced apoptosis of human chondrocytes. When treated with exogenous or endogenous NO, the mitochondrial membrane potential time-dependently decreased. Exposure to exogenous or endogenous NO significantly enhanced cellular reactive oxygen species (ROS) and cytochrome c (Cyt c) levels. Administration of exogenous or endogenous NO increased caspase-3 activity and consequently induced DNA fragmentation. Suppression of caspase-3 activation by Z-DEVD-FMK decreased NO-induced DNA fragmentation and cell apoptosis. Similar to SNP, exposure of human chondrocytes to S-nitrosoglutathione (GSNO), another NO donor, caused significant increases in Cyt c levels, caspase-3 activity, and DNA fragmentation, and induced cell apoptosis. Pretreatment with N-monomethyl arginine (NMMA), an inhibitor of NO synthase, significantly decreased cellular NO levels, and lowered endogenous NO-induced alterations in cellular Cyt c amounts, caspase-3 activity, DNA fragmentation, and cell apoptosis. Results of this study show that NO from exogenous and endogenous sources can induce apoptotic insults to human chondrocytes via a mitochondria-dependent mechanism.

  6. Accounting for Exogenous Influences in Performance Evaluations of Teachers

    Science.gov (United States)

    De Witte, Kristof; Rogge, Nicky

    2011-01-01

    Students' evaluations of teacher performance (SETs) are increasingly used by universities. However, SETs are controversial mainly due to two issues: (1) teachers value various aspects of excellent teaching differently, and (2) SETs should not be determined on exogenous influences. Therefore, this paper constructs SETs using a tailored version of…

  7. Exogenous and endogenous angiotensin-II decrease renal cortical oxygen tension in conscious rats by limiting renal blood flow.

    Science.gov (United States)

    Emans, Tonja W; Janssen, Ben J; Pinkham, Maximilian I; Ow, Connie P C; Evans, Roger G; Joles, Jaap A; Malpas, Simon C; Krediet, C T Paul; Koeners, Maarten P

    2016-11-01

    Our understanding of the mechanisms underlying the role of hypoxia in the initiation and progression of renal disease remains rudimentary. We have developed a method that allows wireless measurement of renal tissue oxygen tension in unrestrained rats. This method provides stable and continuous measurements of cortical tissue oxygen tension (PO2) for more than 2 weeks and can reproducibly detect acute changes in cortical oxygenation. Exogenous angiotensin-II reduced renal cortical tissue PO2 more than equi-pressor doses of phenylephrine, probably because it reduced renal oxygen delivery more than did phenylephrine. Activation of the endogenous renin-angiotensin system in transgenic Cyp1a1Ren2 rats reduced cortical tissue PO2; in this model renal hypoxia precedes the development of structural pathology and can be reversed acutely by an angiotensin-II receptor type 1 antagonist. Angiotensin-II promotes renal hypoxia, which may in turn contribute to its pathological effects during development of chronic kidney disease. We hypothesised that both exogenous and endogenous angiotensin-II (AngII) can decrease the partial pressure of oxygen (PO2) in the renal cortex of unrestrained rats, which might in turn contribute to the progression of chronic kidney disease. Rats were instrumented with telemeters equipped with a carbon paste electrode for continuous measurement of renal cortical tissue PO2. The method reproducibly detected acute changes in cortical oxygenation induced by systemic hyperoxia and hypoxia. In conscious rats, renal cortical PO2 was dose-dependently reduced by intravenous AngII. Reductions in PO2 were significantly greater than those induced by equi-pressor doses of phenylephrine. In anaesthetised rats, renal oxygen consumption was not affected, and filtration fraction was increased only in the AngII infused animals. Oxygen delivery decreased by 50% after infusion of AngII and renal blood flow (RBF) fell by 3.3 ml min -1 . Equi-pressor infusion of

  8. Assessing of distribution, mobility and bioavailability of exogenous Pb in agricultural soils using isotopic labeling method coupled with BCR approach.

    Science.gov (United States)

    Huang, Zhi-Yong; Xie, Hong; Cao, Ying-Lan; Cai, Chao; Zhang, Zhi

    2014-02-15

    The contamination of Pb in agricultural soils is one of the most important ecological problems, which potentially results in serious health risk on human health through food chain. Hence, the fate of exogenous Pb contaminated in agricultural soils is needed to be deeply explored. By spiking soils with the stable enriched isotopes of (206)Pb, the contamination of exogenous Pb(2+) ions in three agricultural soils sampled from the estuary areas of Jiulong River, China was simulated in the present study, and the distribution, mobility and bioavailability of exogenous Pb in the soils were investigated using the isotopic labeling method coupled with a four-stage BCR (European Community Bureau of Reference) sequential extraction procedure. Results showed that about 60-85% of exogenous Pb was found to distribute in reducible fractions, while the exogenous Pb in acid-extractable fractions was less than 1.0%. After planting, the amounts of exogenous Pb presenting in acid-extractable, reducible and oxidizable fractions in rhizospheric soils decreased by 60-66%, in which partial exogenous Pb was assimilated by plants while most of the metal might transfer downward due to daily watering and applying fertilizer. The results show that the isotopic labeling technique coupled with sequential extraction procedures enables us to explore the distribution, mobility and bioavailability of exogenous Pb contaminated in soils, which may be useful for the further soil remediation. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Minnesota urban partnership agreement national evaluation : exogenous factors test plan.

    Science.gov (United States)

    2009-11-17

    This report presents the exogenous factors test plan for the national evaluation of the Minnesota Urban Partnership Agreement (UPA) under the United States Department of Transportation (U.S. DOT) UPA Program. The Minnesota UPA projects focus on reduc...

  10. Improved exogenous DNA uptake in bovine spermatozoa and gene expression in embryos using membrane destabilizing agents in ICSI-SMGT.

    Science.gov (United States)

    Sánchez-Villalba, Esther; Arias, María Elena; Zambrano, Fabiola; Loren, Pía; Felmer, Ricardo

    2018-02-01

    Sperm-mediated gene transfer (SMGT) is a simple, fast, and economical biotechnological tool for producing transgenic animals. However, transgene expression with this technique in bovine embryos is still inefficient due to low uptake and binding of exogenous DNA in spermatozoa. The present study evaluated the effects of sperm membrane destabilization on the binding capacity, location and quantity of bound exogenous DNA in cryopreserved bovine spermatozoa using Triton X-100 (TX-100), lysolecithin (LL) and sodium hydroxide (NaOH). Effects of these treatments were also evaluated by intracytoplasmic sperm injection (ICSI)-SMGT. Results showed that all treatments bound exogenous DNA to spermatozoa including the control. Spermatozoa treated with different membrane destabilizing agents bound the exogenous DNA throughout the head and tail of spermatozoa, compared with the control, in which binding occurred mainly in the post-acrosomal region and tail. The amount of exogenous DNA bound to spermatozoa was much higher for the different sperm treatments than the control (P Exogenous gene expression in embryos was also improved by these treatments. These results demonstrated that sperm membrane destabilization could be a novel strategy in bovine SMGT protocols for the generation of transgenic embryos by ICSI.

  11. Theory of endogenous and exogenous motivation in L2 migration

    Directory of Open Access Journals (Sweden)

    Kambon, Obadele Bakari

    2015-09-01

    Full Text Available Implied in theories of Second Language Acquisition (SLA is the notion that language learning is analogous to obtaining or acquiring a possession – thus the use of the term ‘acquisition.’ While this interpretation has gone relatively unchallenged in the literature, this article introduces a new analogy whereby language learning is seen as analogous to a process of permanent or semi-permanent migration towards a new socio-linguistic L2 space. As such, a theory of endogenous and exogenous motivation is delineated, entailing a dynamic interplay between internal (primarily psychological and external (primarily sociological push-pull factors. Endogenous and exogenous push-pull factors, together with various other personal factors, contribute to learner decisions to migrate towards, move away from or remain inert with regard to the target language. Further, motivation is framed in the larger theoretical context of causation.

  12. Estudos sobre tuberculose

    Directory of Open Access Journals (Sweden)

    A. Fontes

    1917-01-01

    Full Text Available Assim em resumo pensamos que a hipersensibilidade na infeção tuberculosa é a expressão duma reação celular, autonoma e individual, consequente á agressão brusca e á destruição (dijestão incompleta dos toxicos bacilares (proteinas, globulinas e lipoides, em combinação intima ou isoladamente; a adição aos toxicos bacilares de lipoides diversos (cholesterina, lecitina, esters e principios mal definidos existentes no oleo de figado de bacalhau, atenua a sua função hipersensibilidade porque torna esses toxicos mais facilmente incorporaveis á celula sensivel por adsorpção da substancia toxica ao lipoide. Esses corpos penetram assim no interior das celulas levando comsigo ativadores dos processos enzimaticos que não so favorecem uma elaboração dijestiva mais perfeita como ainda uma melhor produção de anticorpos. O aparecimento de pequenas modalidades reacionarias no decurso duma immunisação ativa contra os antijenos saturados por lipoides mostra a necessidade dum processo de desintegração para que a função toxica se manifeste.

  13. Competition Between Endogenous and Exogenous Orienting of Visual Attention

    Science.gov (United States)

    Berger, Andrea; Henik, Avishai; Rafal, Robert

    2005-01-01

    The relation between reflexive and voluntary orienting of visual attention was investigated with 4 experiments: a simple detection task, a localization task, a saccade toward the target task, and a target identification task in which discrimination difficulty was manipulated. Endogenous and exogenous orienting cues were presented in each trial and…

  14. [Effects of exogenous silicon on physiological characteristics of cucumber seedlings under ammonium stress].

    Science.gov (United States)

    Gao, Qing-Hai; Wang, Ya-Kun; Lu, Xiao-Min; Jia, Shuang-Shuang

    2014-05-01

    The present study evaluated the effects of exogenous silicon on growth and physiological characteristics of hydroponically cultured cucumber seedlings under ammonium stress. The results showed that the growth, especially the aerial part growth of cucumber seedlings cultured with ammonium were significantly inhibited than those with nitrate, especially after treatment for 10 d, the aerial part fresh mass of cucumber seedlings were reduced 6.17 g per plant. The accumulation of reactive oxygen species (ROS) was also promoted in cucumber seedlings under ammonium, and the contents of O2*- and H2O2 were significantly increased in cucumber leaves. With the exogenous silicon treatment, the activities of superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), ascorbate peroxidase (APX) were significantly improved, the ability to remove reactive oxygen species was enhanced, the contents of O2*- and H2O2 were significantly reduced in cucumber leaves, decreasing the reactive oxygen damage to the cell membrane, and the ratio of electrolyte leakage and the content of MDA in cucumber leaves. Also, with exogenous silicon treatment, the plasma membrane and activity of vacuolar membrane H(+)-ATP was significantly increased, transport capacity of intracellular proton was improved, and the level of ammonium in cucumber body was significantly reduced, thereby reducing the toxicity of ammonium. In conclusion, exogenous silicon could relieve ammonium stress, by increasing the antioxidant enzyme activity, H(+)-ATP activity, and decreasing the ammonium content in cucumber seedlings.

  15. Post-stimulus endogenous and exogenous oscillations are differentially modulated by task difficulty.

    Science.gov (United States)

    Li, Yun; Lou, Bin; Gao, Xiaorong; Sajda, Paul

    2013-01-01

    We investigate the modulation of post-stimulus endogenous and exogenous oscillations when a visual discrimination is made more difficult. We use exogenous frequency tagging to induce steady-state visually evoked potentials (SSVEP) while subjects perform a face-car discrimination task, the difficulty of which varies on a trial-to-trial basis by varying the noise (phase coherence) in the image. We simultaneously analyze amplitude modulations of the SSVEP and endogenous alpha activity as a function of task difficulty. SSVEP modulation can be viewed as a neural marker of attention toward/away from the primary task, while modulation of post-stimulus alpha is closely related to cortical information processing. We find that as the task becomes more difficult, the amplitude of SSVEP decreases significantly, approximately 250-450 ms post-stimulus. Significant changes in endogenous alpha amplitude follow SSVEP modulation, occurring at approximately 400-700 ms post-stimulus and, unlike the SSVEP, the alpha amplitude is increasingly suppressed as the task becomes less difficult. Our results demonstrate simultaneous measurement of endogenous and exogenous oscillations that are modulated by task difficulty, and that the specific timing of these modulations likely reflects underlying information processing flow during perceptual decision-making.

  16. Induction of virus resistance by exogenous application of double-stranded RNA.

    Science.gov (United States)

    Mitter, Neena; Worrall, Elizabeth A; Robinson, Karl E; Xu, Zhi Ping; Carroll, Bernard J

    2017-10-01

    Exogenous application of double-stranded RNA (dsRNA) for virus resistance in plants represents a very attractive alternative to virus resistant transgenic crops or pesticides targeting virus vectors. However, the instability of dsRNA sprayed onto plants is a major challenge as spraying naked dsRNA onto plants provides protection against homologous viruses for only 5 days. Innovative approaches, such as the use of nanoparticles as carriers of dsRNA for improved stability and sustained release, are emerging as key disruptive technologies. Knowledge is still limited about the mechanism of entry, transport and processing of exogenously applied dsRNA in plants. Cost of dsRNA and regulatory framework will be key influencers towards practical adoption of this technology. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Flow cytometric sex sorting affects CD4 membrane distribution and binding of exogenous DNA on bovine sperm cells.

    Science.gov (United States)

    Domingues, William Borges; da Silveira, Tony Leandro Rezende; Komninou, Eliza Rossi; Monte, Leonardo Garcia; Remião, Mariana Härter; Dellagostin, Odir Antônio; Corcini, Carine Dahl; Varela Junior, Antônio Sergio; Seixas, Fabiana Kömmling; Collares, Tiago; Campos, Vinicius Farias

    2017-08-01

    Bovine sex-sorted sperm have been commercialized and successfully used for the production of transgenic embryos of the desired sex through the sperm-mediated gene transfer (SMGT) technique. However, sex-sorted sperm show a reduced ability to internalize exogenous DNA. The interaction between sperm cells and the exogenous DNA has been reported in other species to be a CD4-like molecule-dependent process. The flow cytometry-based sex-sorting process subjects the spermatozoa to different stresses causing changes in the cell membrane. The aim of this study was to elucidate the relationship between the redistribution of CD4-like molecules and binding of exogenous DNA to sex-sorted bovine sperm. In the first set of experiments, the membrane phospholipid disorder and the redistribution of the CD4 were evaluated. The second set of experiments was conducted to investigate the effect of CD4 redistribution on the mechanism of binding of exogenous DNA to sperm cells and the efficiency of lipofection in sex-sorted bovine sperm. Sex-sorting procedure increased the membrane phospholipid disorder and induced the redistribution of CD4-like molecules. Both X-sorted and Y-sorted sperm had decreased DNA bound to membrane in comparison with the unsorted sperm; however, the binding of the exogenous DNA was significantly increased with the addition of liposomes. Moreover, we demonstrated that the number of sperm-bound exogenous DNA was decreased when these cells were preincubated with anti-bovine CD4 monoclonal antibody, supporting our hypothesis that CD4-like molecules indeed play a crucial role in the process of exogenous DNA/bovine sperm cells interaction.

  18. Exogenous subclinical hyperthyroidism: effect on the cardiovascular system.

    Science.gov (United States)

    Federico Moreno, Karol; Paoli de Valeri, Mariela; Odreman, Rodolfo; Núñez, Tulio; Arata-Bellabarba, Gabriela

    2008-06-01

    To evaluate the effects of exogenous subclinical hyperthyroidism on left ventricular structure and function. Twenty-three patients of both sexes, aged 27 to 70 years, with a diagnosis of exogenous subclinical hyperthyroidism (serum thyroid-stimulating hormone [TSH] ≤ 0.4mU/ml and normal free thyroxine [FT4]) were evaluated. The patients had been taking levothyroxine in suppressive doses for an average of 6.7 years (1 to 35 years). Twenty euthyroid individuals matched for age, sex and body mass index were selected as controls. A medical history was obtained and symptoms of thyrotoxicosis were quantified in all subjects. To evaluate left ventricular structure and function, as well as atrial conduction time, a two-dimensional echocardiogram and pulsed echo and tissue echo Doppler with electrocardiography monitoring were performed. The index of hemodynamic compensation of the left ventricular mass was calculated. Hyperthyroid symptom scores were significantly higher in patients than in controls (p=0.0001). A positive correlation was found between hyperthyroidism scores and FT4 (p=0.005) and ejection fraction (p=0.04) and a negative correlation was found with TSH levels (p=0.03). End-diastolic volume, stroke volume, cardiac output and stroke work were significantly higher in patients with SH (p=0.04, p=0.02, p=0.05 and p=0.01, respectively). A positive correlation was found between fractional shortening and FT4 level (p=0.022) and levothyroxine dose (p=0.016) and between stroke work and FT4 level (p=0.034). Left ventricular mass, diastolic function and atrial conduction time were similar in patients and controls. Our study suggests that patients with exogenous subclinical hyperthyroidism have hemodynamic changes resulting from adaptation to the biological effects of levothyroxine on the cardiovascular system. However, structural changes are not produced. Copyright © 2008 Sociedad Española de Endocrinología y Nutrición. Published by Elsevier Espana. All rights

  19. Enhancement of microbial 2,4,6-trinitrotoluene transformation with increased toxicity by exogenous nutrient amendment.

    Science.gov (United States)

    Liang, Shih-Hsiung; Hsu, Duen-Wei; Lin, Chia-Ying; Kao, Chih-Ming; Huang, Da-Ji; Chien, Chih-Ching; Chen, Ssu-Ching; Tsai, Isheng Jason; Chen, Chien-Cheng

    2017-04-01

    In this study, the bacterial strain Citrobacter youngae strain E4 was isolated from 2,4,6-trinitrotoluene (TNT)-contaminated soil and used to assess the capacity of TNT transformation with/without exogenous nutrient amendments. C. youngae E4 poorly degraded TNT without an exogenous amino nitrogen source, whereas the addition of an amino nitrogen source considerably increased the efficacy of TNT transformation in a dose-dependent manner. The enhanced TNT transformation of C. youngae E4 was mediated by increased cell growth and up-regulation of TNT nitroreductases, including NemA, NfsA and NfsB. This result indicates that the increase in TNT transformation by C. youngae E4 via nitrogen nutrient stimulation is a cometabolism process. Consistently, TNT transformation was effectively enhanced when C. youngae E4 was subjected to a TNT-contaminated soil slurry in the presence of an exogenous amino nitrogen amendment. Thus, effective enhancement of TNT transformation via the coordinated inoculation of the nutrient-responsive C. youngae E4 and an exogenous nitrogen amendment might be applicable for the remediation of TNT-contaminated soil. Although the TNT transformation was significantly enhanced by C. youngae E4 in concert with biostimulation, the 96-h LC50 value of the TNT transformation product mixture on the aquatic invertebrate Tigriopus japonicas was higher than the LC50 value of TNT alone. Our results suggest that exogenous nutrient amendment can enhance microbial TNT transformation; however, additional detoxification processes may be needed due to the increased toxicity after reduced TNT transformation. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Exogenous spermidine is enhancing tomato tolerance to salinity-alkalinity stress by regulating chloroplast antioxidant system and chlorophyll metabolism.

    Science.gov (United States)

    Li, Jianming; Hu, Lipan; Zhang, Li; Pan, Xiongbo; Hu, Xiaohui

    2015-12-29

    Salinity-alkalinity stress is known to adversely affect a variety of processes in plants, thus inhibiting growth and decreasing crop yield. Polyamines protect plants against a variety of environmental stresses. However, whether exogenous spermidine increases the tolerance of tomato seedlings via effects on chloroplast antioxidant enzymes and chlorophyll metabolism is unknown. In this study, we examined the effect of exogenous spermidine on chlorophyll synthesis and degradation pathway intermediates and related enzyme activities, as well as chloroplast ultrastructure, gene expression, and antioxidants in salinity-alkalinity-stressed tomato seedlings. Salinity-alkalinity stress disrupted chlorophyll metabolism and hindered uroorphyrinogen III conversion to protoporphyrin IX. These effects were more pronounced in seedlings of cultivar Zhongza No. 9 than cultivar Jinpengchaoguan. Under salinity-alkalinity stress, exogenous spermidine alleviated decreases in the contents of total chlorophyll and chlorophyll a and b in seedlings of both cultivars following 4 days of stress. With extended stress, exogenous spermidine reduced the accumulation of δ-aminolevulinic acid, porphobilinogen, and uroorphyrinogen III and increased the levels of protoporphyrin IX, Mg-protoporphyrin IX, and protochlorophyllide, suggesting that spermidine promotes the conversion of uroorphyrinogen III to protoporphyrin IX. The effect occurred earlier in cultivar Jinpengchaoguan than in cultivar Zhongza No. 9. Exogenous spermidine also alleviated the stress-induced increases in malondialdehyde content, superoxide radical generation rate, chlorophyllase activity, and expression of the chlorophyllase gene and the stress-induced decreases in the activities of antioxidant enzymes, antioxidants, and expression of the porphobilinogen deaminase gene. In addition, exogenous spermidine stabilized the chloroplast ultrastructure in stressed tomato seedlings. The tomato cultivars examined exhibited different

  1. Exogenous DKK-3/REIC inhibits Wnt/β-catenin signaling and cell proliferation in human kidney cancer KPK1.

    Science.gov (United States)

    Xu, Jiaqi; Sadahira, Takuya; Kinoshita, Rie; Li, Shun-Ai; Huang, Peng; Wada, Koichiro; Araki, Motoo; Ochiai, Kazuhiko; Noguchi, Hirofumi; Sakaguchi, Masakiyo; Nasu, Yasutomo; Watanabe, Masami

    2017-11-01

    The third member of the Dickkopf family (DKK-3), also known as reduced expression in immortalized cells (REIC), is a tumor suppressor present in a variety of tumor cells. Regarding the regulation of the Wnt/β-catenin signaling pathway, exogenous DKK-1 and DKK-2 are reported to inhibit Wnt signaling by binding the associated effectors. However, whether exogenous DKK-3 inhibits Wnt signaling remains unclear. A recombinant protein of human full-length DKK-3 was used to investigate the exogenous effects of the protein in vitro in KPK1 human renal cell carcinoma cells. It was demonstrated that the expression of phosphorylated (p-)β-catenin (inactive form as the transcriptional factor) was increased in KPK1 cells treated with the exogenous DKK-3 protein. The levels of non-p-β-catenin (activated form of β-catenin) were consistently decreased. It was revealed that the expression of transcription factor (TCF) 1 and c-Myc, the downstream transcription factors of the Wnt/β-catenin signaling pathway, was inhibited following treatment with DKK-3. A cancer cell viability assay confirmed the anti-proliferative effects of exogenous DKK-3 protein, which was consistent with a suppressed Wnt/β-catenin signaling cascade. In addition, as low-density lipoprotein receptor-related protein 6 (LRP6) is a receptor of DKK-1 and DKK-2 and their interaction on the cell surface inhibits Wnt/β-catenin signaling, it was examined whether the exogenous DKK-3 protein affects LRP6-mediated Wnt/β-catenin signaling. The LRP6 gene was silenced and the effects of DKK-3 on the time course of the upregulation of p-β-catenin expression were subsequently analyzed. Notably, LRP6 depletion elevated the base level of p-β-catenin; however, there was no significant effect on its upregulation course or expression pattern. These findings indicate that exogenous DKK-3 upregulates p-β-catenin and inhibits Wnt/β-catenin signaling in an LRP6-independent manner. Therefore, exogenous DKK-3 protein may inhibit

  2. Glucose acutely reduces cytosolic and mitochondrial H2O2 in rat pancreatic beta-cells.

    Science.gov (United States)

    Deglasse, Jean-Philippe; Roma, Leticia Prates; Pastor-Flores, Daniel; Gilon, Patrick; Dick, Tobias P; Jonas, Jean-Christophe

    2018-05-14

    Whether H2O2 contributes to the glucose-dependent stimulation of insulin secretion by pancreatic β-cells is highly controversial. We used two H2O2-sensitive probes, roGFP2-Orp1 and HyPer with its pH-control SypHer, to test the acute effects of glucose, monomethylsuccinate, leucine with glutamine, and α-ketoisocaproate, on β-cell cytosolic and mitochondrial H2O2 concentrations. We then tested the effects of low H2O2 and menadione concentrations on insulin secretion. RoGFP2-Orp1 was more sensitive than HyPer to H2O2 (response at 2-5 vs. 10µM) and less pH-sensitive. Under control conditions, stimulation with glucose reduced mitochondrial roGFP2-Orp1 oxidation without affecting cytosolic roGFP2-Orp1 and HyPer fluorescence ratios, except for the pH-dependent effects on HyPer. However, stimulation with glucose decreased the oxidation of both cytosolic probes by 15µM exogenous H2O2. The glucose effects were not affected by overexpression of catalase, mitochondrial catalase or superoxide dismutase 1 and 2. They followed the increase in NAD(P)H autofluorescence, were maximal at 5mM glucose in the cytosol and 10mM glucose in the mitochondria, and were partly mimicked by the other nutrients. Exogenous H2O2 (1-15µM) did not affect insulin secretion. By contrast, menadione (1-5µM) did not increase basal insulin secretion but reduced the stimulation of insulin secretion by 20mM glucose. Subcellular changes in β-cell H2O2 levels are better monitored with roGFP2-Orp1 than HyPer/SypHer. Nutrients acutely lower mitochondrial H2O2 levels in β-cells and promote degradation of exogenously supplied H2O2 in both cytosolic and mitochondrial compartments. The glucose-dependent stimulation of insulin secretion occurs independently of a detectable increase in β-cell cytosolic or mitochondrial H2O2 levels.

  3. Differentiation of stem cells upon deprivation of exogenous FGF2

    DEFF Research Database (Denmark)

    Kjartansdóttir, Kristín Rós; Gabrielsen, Anette; Reda, Ahmed

    2012-01-01

    Establishing a model for in vitro differentiation of human embryonic stem cells (hESCs) towards the germ cell lineage could be used to identify molecular mechanisms behind germ cell differentiation that may help in understanding human infertility. Here, we evaluate whether a lack of exogenous...... fibroblast growth factor 2 (FGF2) is supporting spontaneous differentiation of hESCs cultured on human foreskin fibroblast (hFF) monolayers towards germ cell lineage. Additionally to depriving the hESCs of exogenous FGF2, cells were stimulated with all-trans retinoic acid (ATRA). To get a more comprehensive...... impression on effects of removal of FGF2 and stimulation with ATRA, we combined the results of three cell lines for each experimental setting. When combining gene expression profiles of three cell lines for 96 genes, only 6 genes showed a significant up-regulation in all cell lines, when no FGF2 was added...

  4. A Comparison of Exogenous Labels for the Histological Identification of Transplanted Neural Stem Cells

    Science.gov (United States)

    Nicholls, Francesca J.; Liu, Jessie R.; Modo, Michel

    2017-01-01

    The interpretation of cell transplantation experiments is often dependent on the presence of an exogenous label for the identification of implanted cells. The exogenous labels Hoechst 33342, 5-bromo-2′-deoxyuridine (BrdU), PKH26, and Qtracker were compared for their labeling efficiency, cellular effects, and reliability to identify a human neural stem cell (hNSC) line implanted intracerebrally into the rat brain. Hoechst 33342 (2 mg/ml) exhibited a delayed cytotoxicity that killed all cells within 7 days. This label was hence not progressed to in vivo studies. PKH26 (5 μM), Qtracker (15 nM), and BrdU (0.2 μM) labeled 100% of the cell population at day 1, although BrdU labeling declined by day 7. BrdU and Qtracker exerted effects on proliferation and differentiation. PKH26 reduced viability and proliferation at day 1, but this normalized by day 7. In an in vitro coculture assay, all labels transferred to unlabeled cells. After transplantation, the reliability of exogenous labels was assessed against the gold standard of a human-specific nuclear antigen (HNA) antibody. BrdU, PKH26, and Qtracker resulted in a very small proportion (Exogenous labels can therefore be reliable to identify transplanted cells without exerting major cellular effects, but validation is required. The interpretation of cell transplantation experiments should be presented in the context of the label's limitations. PMID:27938486

  5. Endo- vs. exogenous shocks and relaxation rates in book and music “sales”

    Science.gov (United States)

    Lambiotte, R.; Ausloos, M.

    2006-04-01

    In this paper, we analyse the response of music and book sales to an external field and a buyer herding. We distinguish endogenous and exogenous shocks. We focus on some case studies, whose data have been collected from ranking on amazon.com. We show that an ensemble of equivalent systems quantitatively respond in a same way to a similar “external shock”, indicating roads to universality features. In contrast to Sornette et al. [Phys. Rev. Lett. 93 (2004) 228701] who seemed to find power-law behaviours, in particular at long times, a law interpreted in terms of an epidemic activity, we observe that the relaxation process can be as well seen as an exponential one that saturates toward an asymptotic state, itself different from the pre-shock state. By studying an ensemble of 111 shocks, on books or records, we show that exogenous and endogenous shocks are discriminated by their short-time behaviour: the relaxation time seems to be twice shorter in endogenous shocks than in exogenous ones. We interpret the finding through a simple thermodynamic model with a dissipative force.

  6. Endogenous and exogenously-induced immunomodulation of tumour-host responsiveness

    Directory of Open Access Journals (Sweden)

    Richard J. Ablin

    1987-01-01

    Full Text Available In spite of the availability of multiple effector mechanisms of the immune system to combat tumour growth and metastases, their impairment frequently accompanies the appearance of cancer. Factors contributing to this impairment may be related to properties of the host and/or the tumour itself and may be with respect to their origin -endogenous or exogenour. Based on the unique biological behavior of prostate cancer (PCa, and its apparent escape from immune surveillance in the presence of tumour immuno genicity, continuing investigation of endogenous and exogenous factors thought to be relevant to its pathogenesis have been made. For this purpose further studies of the suggested role of human seminal plasma (SePl and the synthetic oestrogen, diethylstiboestrol (DES, as representative endogenous and exogenous immunomodulatory factors (IMF of tumour-host responsiveness, together with evaluation of human prostatic tissue extracts and leuprolide (the luteinizing-hormone-releasing-hormone proposed as an alternate to DES therapy have been made by evaluating their effect on the lytic activity of natural killer (NK cells. SePl and prostate extracts significantly suppressed NK cell lysis. Physicochemical studies suggest SePl and prostate IMF to be associated with high and low molecular weight macromolecules; and implicate the participation of transglutaminase and prostaglandins. Comparative study of therapeutic levels of DES vs. leuprolide on NK cell lysis demonstrated significant suppression by DES vs. a negligible effect of leuprolide. Metastases are highly prevalent in PCa, and contribute significantly to its morbidity and mortality. Further knowledge of the range of effects of endogenous and exogenous IMF on effector mechanisms of tumour-host responsiveness, to include suppression of NK cells, and elucidation of their nature, may contribute toward our understanding of the unique biological behavior of tumours of the prostate, in addition to

  7. Do Endogenous and Exogenous Action Control Compete for Perception?

    Science.gov (United States)

    Pfister, Roland; Heinemann, Alexander; Kiesel, Andrea; Thomaschke, Roland; Janczyk, Markus

    2012-01-01

    Human actions are guided either by endogenous action plans or by external stimuli in the environment. These two types of action control seem to be mediated by neurophysiologically and functionally distinct systems that interfere if an endogenously planned action suddenly has to be performed in response to an exogenous stimulus. In this case, the…

  8. Improved control of exogenous attention in action video game players

    Directory of Open Access Journals (Sweden)

    Matthew S Cain

    2014-02-01

    Full Text Available Action video game players have demonstrated a number of attentional advantages over non-players. Here, we propose that many of those benefits might be underpinned by improved control over exogenous (i.e., stimulus-driven attention. To test this we used an anti-cuing task, in which a sudden-onset cue indicated that the target would likely appear in a separate location on the opposite side of the fixation point. When the time between the cue onset and the target onset was short (40 ms, non-players (nVGPs showed a typical exogenous attention effect. Their response times were faster to targets presented at the cued (but less probable location compared with the opposite (more probable location. Video game players (VGPs, however, were less likely to have their attention drawn to the location of the cue. When the onset asynchrony was long (600 ms, VGPs and nVGPs were equally able to endogenously shift their attention to the likely (opposite target location. In order to rule out processing-speed differences as an explanation for this result, we also tested VGPs and nVGPs on an attentional blink task. In a version of the attentional blink task that minimized demands on task switching and iconic memory, VGPs and nVGPs did not differ in second target identification performance (i.e., VGPs had the same magnitude of attentional blink as nVGPs, suggesting that the anti-cuing results were due to flexible control over exogenous attention rather than to more general speed-of-processing differences.

  9. Exogenous gibberellins inhibit coffee (Coffea arabica cv. Rubi) seed germination and cause cell death in the embryo

    NARCIS (Netherlands)

    Silva, Da E.A.A.; Toorop, P.E.; Nijsse, J.; Bewley, J.D.; Hilhorst, H.W.M.

    2005-01-01

    The mechanism of inhibition of coffee (Coffea arabica cv. Rubi) seed germination by exogenous gibberellins (GAs) and the requirement of germination for endogenous GA were studied. Exogenous GA4+7 inhibited coffee seed germination. The response to GA4+7 showed two sensitivity thresholds: a lower one

  10. Computational analysis for biodegradation of exogenously depolymerizable polymer

    Science.gov (United States)

    Watanabe, M.; Kawai, F.

    2018-03-01

    This study shows that microbial growth and decay in a biodegradation process of exogenously depolymerizable polymer are controlled by consumption of monomer units. Experimental outcomes for residual polymer were incorporated in inverse analysis for a degradation rate. The Gauss-Newton method was applied to an inverse problem for two parameter values associated with the microbial population. A biodegradation process of polyethylene glycol was analyzed numerically, and numerical outcomes were obtained.

  11. Functional Forms, Exogenous Shifts, and Economic Surplus Changes

    OpenAIRE

    Xueyan Zhao; John D. Mullen; Gary R. Griffith

    1997-01-01

    Conditions for exact welfare measures in equilibrium displacement modeling are examined. These relate to the functional form of supply and demand, the nature of the exogenous shift, and the definition of percentage changes. Approximation errors when these conditions are not met in empirical applications are investigated and analytical expressions for the errors derived. Significant errors are possible when a proportional shift is assumed. The assumptions underlying Alston and Wohlgenant's emp...

  12. Measuring Concentration in Data with an Exogenous Order

    OpenAIRE

    Abedieh, Jasmin; Groll, Andreas; Eugster, Manuel J. A.

    2013-01-01

    Concentration measures order the statistical units under observation according to their market share. However, there are situations where an order according to an exogenous variable is more appropriate or even required. The present article introduces a generalized definition of market concentration and defines a corresponding concentration measure. It is shown that this generalized concept of market concentration satisfies the common axioms of (classical) concentration measures. In an appl...

  13. Chronic levothyroxine and acute T3 treatments enhance the amplitude and time course of uterine contractions in human.

    Science.gov (United States)

    Corriveau, Stéphanie; Pasquier, Jean-Charles; Blouin, Simon; Bellabarba, Diego; Rousseau, Éric

    2013-03-01

    This study compares the functional consequences of levothyroxine (T4) treatment during pregnancy as well as the acute affects of triiodothyronine (T3) on spontaneous uterine contractile activities observed in vitro. Uterine biopsies were obtained from consenting women undergoing elective caesarean at term (n = 28). Spontaneous contractile activities from T4-treated pregnant women (n = 8) were compared with control patients (n = 20) by isometric tension measurements. Effects of acute T3 and T4 on control tissues were also monitored. Area under the curve, amplitude, time to peak, duration, and frequency were quantified. In uterine strips from women treated for hypothyroidism, phasic uterine contractions of larger amplitude (+77%) were observed, with a prolonged duration at 90% relaxation (+138%) and reduced frequency (-55%) compared with values of the control group. The addition of exogenous T3 in vitro on control strips induced a significant increase in the duration of the contractions and a significant decrease in frequency (P women. Significant modifications of contractile properties were observed in strips from pregnant women treated with levothyroxine, consistent with those observed with the addition of exogenous T3. Clinical practices of modern obstetrics should take into account the effect of thyroid hormones on uterine contractions' time course to ensure a tighter followup at the end of pregnancy to achieve safer delivery.

  14. S-ketamine influences strategic allocation of attention but not exogenous capture of attention.

    Science.gov (United States)

    Fuchs, Isabella; Ansorge, Ulrich; Huber-Huber, Christoph; Höflich, Anna; Lanzenberger, Rupert

    2015-09-01

    We investigated whether s-ketamine differentially affects strategic allocation of attention. In Experiment 1, (1) a less visible cue was weakly masked by the onsets of competing placeholders or (2) a better visible cue was not masked because it was presented in isolation. Both types of cue appeared more often opposite of the target (75%) than at target position (25%). With this setup, we tested for strategic attention shifts to the opposite side of the cues and for exogenous attentional capture toward the cue's side in a short cue-target interval, as well as for (reverse) cueing effects in a long cue-target interval after s-ketamine and after placebo treatment in a double-blind within-participant design. We found reduced strategic attention shifts after cues presented without placeholders for the s-ketamine compared to the placebo treatment in the short interval, indicating an early effect on the strategic allocation of attention. No differences between the two treatments were found for exogenous attentional capture by less visible cues, suggesting that s-ketamine does not affect exogenous attentional capture in the presence of competing distractors. Experiment 2 confirmed that the competing onsets of the placeholders prevented the strategic cueing effect. Taken together, the results indicate that s-ketamine affects strategic attentional capture, but not exogenous attentional capture. The findings point to a more prominent role of s-ketamine during top-down controlled forms of attention that require suppression of automatic capture than during automatic capture itself. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Modulation of Neuronal Responses by Exogenous Attention in Macaque Primary Visual Cortex.

    Science.gov (United States)

    Wang, Feng; Chen, Minggui; Yan, Yin; Zhaoping, Li; Li, Wu

    2015-09-30

    Visual perception is influenced by attention deployed voluntarily or triggered involuntarily by salient stimuli. Modulation of visual cortical processing by voluntary or endogenous attention has been extensively studied, but much less is known about how involuntary or exogenous attention affects responses of visual cortical neurons. Using implanted microelectrode arrays, we examined the effects of exogenous attention on neuronal responses in the primary visual cortex (V1) of awake monkeys. A bright annular cue was flashed either around the receptive fields of recorded neurons or in the opposite visual field to capture attention. A subsequent grating stimulus probed the cue-induced effects. In a fixation task, when the cue-to-probe stimulus onset asynchrony (SOA) was visual fields weakened or diminished both the physiological and behavioral cueing effects. Our findings indicate that exogenous attention significantly modulates V1 responses and that the modulation strength depends on both novelty and task relevance of the stimulus. Significance statement: Visual attention can be involuntarily captured by a sudden appearance of a conspicuous object, allowing rapid reactions to unexpected events of significance. The current study discovered a correlate of this effect in monkey primary visual cortex. An abrupt, salient, flash enhanced neuronal responses, and shortened the animal's reaction time, to a subsequent visual probe stimulus at the same location. However, the enhancement of the neural responses diminished after repeated exposures to this flash if the animal was not required to react to the probe. Moreover, a second, simultaneous, flash at another location weakened the neuronal and behavioral effects of the first one. These findings revealed, beyond the observations reported so far, the effects of exogenous attention in the brain. Copyright © 2015 the authors 0270-6474/15/3513419-11$15.00/0.

  16. Chemical Atherogenesis: Role of Endogenous and Exogenous Poisons in Disease Development

    Directory of Open Access Journals (Sweden)

    Matthew K. Ross

    2014-01-01

    Full Text Available Chemical atherogenesis is an emerging field that describes how environmental pollutants and endogenous toxins perturb critical pathways that regulate lipid metabolism and inflammation, thus injuring cells found within the vessel wall. Despite growing awareness of the role of environmental pollutants in the development of cardiovascular disease, the field of chemical atherogenesis can broadly include both exogenous and endogenous poisons and the study of molecular, biochemical, and cellular pathways that become dysregulated during atherosclerosis. This integrated approach is logical because exogenous and endogenous toxins often share the same mechanism of toxicity. Chemical atherogenesis is a truly integrative discipline because it incorporates concepts from several different fields, including biochemistry, chemical biology, pharmacology, and toxicology. This review will provide an overview of this emerging research area, focusing on cellular and animal models of disease.

  17. Chemical Atherogenesis: Role of Endogenous and Exogenous Poisons in Disease Development.

    Science.gov (United States)

    Ross, Matthew K; Matthews, Anberitha T; Mangum, Lee C

    Chemical atherogenesis is an emerging field that describes how environmental pollutants and endogenous toxins perturb critical pathways that regulate lipid metabolism and inflammation, thus injuring cells found within the vessel wall. Despite growing awareness of the role of environmental pollutants in the development of cardiovascular disease, the field of chemical atherogenesis can broadly include both exogenous and endogenous poisons and the study of molecular, biochemical, and cellular pathways that become dysregulated during atherosclerosis. This integrated approach is logical because exogenous and endogenous toxins often share the same mechanism of toxicity. Chemical atherogenesis is a truly integrative discipline because it incorporates concepts from several different fields, including biochemistry, chemical biology, pharmacology, and toxicology. This review will provide an overview of this emerging research area, focusing on cellular and animal models of disease.

  18. Fiber optic-based fluorescence detection system for in vivo studies of exogenous chromophore pharmacokinetics

    Science.gov (United States)

    Doiron, Daniel R.; Dunn, J. B.; Mitchell, W. L.; Dalton, Brian K.; Garbo, Greta M.; Warner, Jon A.

    1995-05-01

    The detection and quantification of the concentration of exogenous chromophores in-vivo by their fluorescence is complicated by many physical and geometrical parameters. Measurement of such signals is advantageous in determining the pharmacokinetics of photosensitizers such as those used in photodynamic therapy (PDT) or to assist in the diagnosis of tissue histological state. To overcome these difficulties a ratio based fiber optic contact fluorometer has been developed. This fluorescence detection system (FDS) uses the ratio of the fluorescence emission peak of the exogenous chromophore to that of endogenous chromophores, i.e. autofluorescence, to correct for a variety of parameters affecting the magnitude of the measured signals. By doing so it also minimizes the range of baseline measurements prior to exogenous drug injection, for various tissue types. Design of the FDS and results of its testing in animals and patients using the second generation photosensitizer Tin ethyletiopurpurin (SnET2) are presented. These results support the feasibility and usefulness of the Ratio FDS system.

  19. Human cultured cells are capable to incorporate isolated plant mitochondria loaded with exogenous DNA

    Directory of Open Access Journals (Sweden)

    Laktionov P. P.

    2012-07-01

    Full Text Available Aim. To investigate the possibility of human cultured cells to incorporate isolated mitochondria together with exogenous DNA introduced into organelles. Methods. Two approaches were used for this purpose, fluorescent labelling of mitochondria and/or DNA with subsequent analysis of the cells subjected to incubation by microscopy or by quantitative PCR. Results. We have shown that human cultured cells lines, HeLa and HUVEC, are capable to uptake isolated plant mitochondria and that this process depends on the incubation time and concentration of organelles present in medium. The incorporated mitochondria can serve as vehicles to deliver exogenous DNA into human cells, this DNA is then distributed in different cell compartments. Conclusions. These results are preliminary and need further investigations, including testing the possibility of human cells to incorporate the mitochondria of human or animal origin and creating genetic construction which could provide certain selectivity or stability of the transferred exogenous DNA upon cell uptake of the mitochondria as vectors.

  20. Differences in clinical ocular outcomes between exogenous and endogenous endophthalmitis caused by Sporothrix: a systematic review of published literature.

    Science.gov (United States)

    Ramírez Soto, Max Carlos

    2017-09-28

    Sporotrichosis is an implantation mycosis caused by Sporothrix species prevalent worldwide, which occasionally can also result in intraocular infection presenting as an exogenous or endogenous infection (disseminated sporotrichosis). Knowledge in its clinical recognition and management is limited. To systematically review and analyse data from published literature with a view to comparing clinical outcomes between exogenous and endogenous endophthalmitis caused by Sporothrix . Case reports of intraocular sporotrichosis, published from 1960 to 2016, were retrieved from MEDLINE, Embase, Cochrane, LILACS and SciELO databases. The entire data set was divided into two patient groups: (1) exogenous endophthalmitis and (2) endogenous endophthalmitis. Primary outcomes were differences in ocular findings and clinical ocular outcomes between the two groups. From 16 publications retrieved, a total of 8 eyes of 8 patients with exogenous endophthalmitis and 13 eyes of 10 patients with endogenous endophthalmitis were identified. Compared with exogenous endophthalmitis, endogenous endophthalmitis was more common in patients infected with HIV (p=0.001) and those from hyperendemic areas (p=0.036). Anterior uveitis (p=0.015) and posterior uveitis (p=0.04) were more common in the exogenous and endogenous endophthalmitis groups, respectively. The majority of patients with endogenous endophthalmitis had partial or full clinical resolution of ocular lesions with systemic amphotericin B alone or in combination with an oral antifungal, whereas patients with exogenous endophthalmitis had poor outcomes with irreversible vision loss, enucleation and evisceration. Anterior uveitis is more common in exogenous endophthalmitis with worse overall outcomes and complications, compared with endogenous endophthalmitis where posterior uveitis is the most common clinical manifestation, especially in patients infected with HIV and those from hyperendemic areas. Sporothrix infection should be included in

  1. Detection of exogenous gene doping of IGF-I by a real-time quantitative PCR assay.

    Science.gov (United States)

    Zhang, Jin-Ju; Xu, Jing-Feng; Shen, Yong-Wei; Ma, Shi-Jiao; Zhang, Ting-Ting; Meng, Qing-Lin; Lan, Wen-Jun; Zhang, Chun; Liu, Xiao-Mei

    2017-07-01

    Gene doping can be easily concealed since its product is similar to endogenous protein, making its effective detection very challenging. In this study, we selected insulin-like growth factor I (IGF-I) exogenous gene for gene doping detection. First, the synthetic IGF-I gene was subcloned to recombinant adeno-associated virus (rAAV) plasmid to produce recombinant rAAV2/IGF-I-GFP vectors. Second, in an animal model, rAAV2/IGF-I-GFP vectors were injected into the thigh muscle tissue of mice, and then muscle and blood specimens were sampled at different time points for total DNA isolation. Finally, real-time quantitative PCR was employed to detect the exogenous gene doping of IGF-I. In view of the characteristics of endogenous IGF-I gene sequences, a TaqMan probe was designed at the junction of exons 2 and 3 of IGF-I gene to distinguish it from the exogenous IGF-I gene. In addition, an internal reference control plasmid and its probe were used in PCR to rule out false-positive results through comparison of their threshold cycle (Ct) values. Thus, an accurate exogenous IGF-I gene detection approach was developed in this study. © 2016 International Union of Biochemistry and Molecular Biology, Inc.

  2. Methadone, monoamine oxidase, and depression: opioid distribution and acute effects on enzyme activity

    Energy Technology Data Exchange (ETDEWEB)

    Kaufmann, C.A.; Kreek, M.J.; Raghunath, J.; Arns, P.

    1983-09-01

    Narcotic withdrawal is often accompanied by an atypical depression which responds to resumption of narcotics. It was hypothesized that methadone might exert its antidepressant effects through monoamine oxidase (MAO) inhibition. The current study examined /sub 3/H-methadone distribution in rat brain and effects on regional MAO activity with acute doses (2.5 mg/kg) which approximate those found during chronic methadone maintenance in man. Limbic areas (amygdala, basomedial hypothalamus, caudate-putamen, hippocampus, preoptic nucleus), as well as pituitary and liver were assayed for MAO activity and methadone concentration. MAO activities did not differ significantly in acute methadone or saline-treated cage-mates at 1 or 24 hr. The concentrations of methadone at 1 hr ranged between 17 and 223 ng/100 mg wet wt tissue in the preoptic nucleus and pituitary, respectively. No significant correlation was found between change in MAO activity (MAO methadone/MAO saline) and methadone concentration in any region at 1 or 24 hr. This study does not support the hypothesis that methadone acts as an antidepressant through MAO inhibition, at least not following acute administration of this exogenous opioid.

  3. Exogenous CO2 in South American sparkling wine

    Directory of Open Access Journals (Sweden)

    Leonardelli Susiane

    2016-01-01

    Full Text Available The sparkling wine production and consumption have increased significantly in the last years. With the increased demand appear the necessity to check the sparkling wine authenticity, because the practice of adding CO2 in sparkling wine is not allow. A way to control the carbonation process is through the determination of CO2 δ13C, because the sugar added during the second fermentation define the CO2 isotopic value, according to elaboration process. For this reason, the aim of this study was to evaluate the relationship between values of δ13C from still wines and sparkling wines, in order to set up limit values to exogenous carbonation control. Thirty-eight still wines elaborated by microvinification and 59 samples of commercial sparkling wines were analyzed, using an isotope ratio mass spectrometer (IRMS. The most negative value of natural δ13C from still wine found was − 24.7‰, it can be to estimate that lowest values are an indicative of industrial CO2 addition. Among the commercial sparkling wine from South America evaluated in this study, 10% from the samples showed signs of carbonation. Through this research was possible to establish limits of isotopic values to determine the presence of exogenous CO2.

  4. On the fate of exogenously supplied bacterial DNA in soybean

    International Nuclear Information System (INIS)

    Luyindula Ndiku

    1980-01-01

    The fate of exogenously supplied radiolabelled DNA from agrobacterium tumefaciens and micrococcus lysodeikticus was investigated in soybean tissues growing under various physiological conditions. The following observations are made: a) Rapid degradation and reutilization of the donor DNA was observed in callus tissue culture. b) Germinating seeds and five-day old seedlings were shown to degrade DNA in the incubation medium and to ultilize these degradation products for their own DNA synthesis. Reutilization could be almost totally suppressed the addition of unlabelled thymidine as a competitor. This allowed a detection of significant amounts of residuel donor closely but transiently associated with the plant tissues. c) In soybean shoots dipped into a solution of donor DNA, partly this DNA was found to first migrate to the leaves where mostly labelled endogenous DNA was later found. Very large amounts of polymerized exogenous DNA were found in the regenerated roots after 12 days of culture. (author)

  5. The interactions of multisensory integration with endogenous and exogenous attention

    Science.gov (United States)

    Tang, Xiaoyu; Wu, Jinglong; Shen, Yong

    2016-01-01

    Stimuli from multiple sensory organs can be integrated into a coherent representation through multiple phases of multisensory processing; this phenomenon is called multisensory integration. Multisensory integration can interact with attention. Here, we propose a framework in which attention modulates multisensory processing in both endogenous (goal-driven) and exogenous (stimulus-driven) ways. Moreover, multisensory integration exerts not only bottom-up but also top-down control over attention. Specifically, we propose the following: (1) endogenous attentional selectivity acts on multiple levels of multisensory processing to determine the extent to which simultaneous stimuli from different modalities can be integrated; (2) integrated multisensory events exert top-down control on attentional capture via multisensory search templates that are stored in the brain; (3) integrated multisensory events can capture attention efficiently, even in quite complex circumstances, due to their increased salience compared to unimodal events and can thus improve search accuracy; and (4) within a multisensory object, endogenous attention can spread from one modality to another in an exogenous manner. PMID:26546734

  6. Photoacoustic imaging at 1064nm wavelength with exogenous contrast agents

    Science.gov (United States)

    Upputuri, Paul Kumar; Jiang, Yuyan; Pu, Kanyi; Pramanik, Manojit

    2018-02-01

    Photoacoustic (PA) imaging is a promising imaging modality for both preclinical research and clinical practices. Laser wavelengths in the first near infrared window (NIR-I, 650-950 nm) have been widely used for photoacoustic imaging. As compared with NIR-I window, scattering of photons by biological tissues is largely reduced in the second NIR (NIR-II) window, leading to enhanced imaging fidelity. However, the lack of biocompatible NIR-II absorbing exogenous agents prevented the use of this window for in vivo imaging. In recent years, few studies have been reported on photoacoustic imaging in NIR-II window using exogenous contrast agents. In this work, we discuss the recent work on PA imaging using 1064 nm wavelength, the fundamental of Nd:YAG laser, as an excitation wavelength. The PA imaging at 1064 nm is advantageous because of the low and homogeneous signal from tissue background, enabling high contrast in PA imaging when NIR-II absorbing contrast agents are employed.

  7. Peer Effects in Exogenously Formed University Student Groups

    OpenAIRE

    Gregory Androushchak; Oleg Poldin; Maria Yudkevich

    2012-01-01

    We estimate the influence of classmates’ ability characteristics on student achievement in exogenously formed student groups. The study uses administrative data on undergraduate students at a large selective university in Russia. The presence of high-ability classmates has a positive effect on individual academic performance, and students at the top of the ability distribution derive the greatest benefit from their presence. An increase in the proportion of less able students has an insignifi...

  8. Exogenous hydrogen sulfide promotes cell proliferation and differentiation by modulating autophagy in human keratinocytes

    International Nuclear Information System (INIS)

    Xie, Xin; Dai, Hui; Zhuang, Binyu; Chai, Li; Xie, Yanguang; Li, Yuzhen

    2016-01-01

    The effects and the underlying mechanisms of hydrogen sulfide (H 2 S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H 2 S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H 2 S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H 2 S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H 2 S promotes keratinocyte proliferation and differentiation. • The effects of H 2 S on proliferation and differentiation is modulated by autophagy. • Exogenous H 2 S has no effect on keratinocyte apoptosis.

  9. Reference Pricing with Endogenous or Exogenous Payment Limits: Impacts on Insurer and Consumer Spending.

    Science.gov (United States)

    Brown, Timothy T; Robinson, James C

    2016-06-01

    Reference pricing (RP) theories predict different outcomes when reference prices are fixed (exogenous) versus being a function of market prices (MPs) (endogenous). Exogenous RP results in MPs at both high-price and low-price firms converging towards the reference price from above and below, respectively. Endogenous RP results in MPs at both high-price and low-price firms decreasing, with low-price firms acting strategically to decrease the reference price in order to gain market share. We extend these models to a hospital context focusing on insurer and consumer payments. Under exogenous RP, insurer and consumer payments to low-price hospitals increase, and insurer payments to high-price hospitals decrease, but predictions regarding consumer payments are ambiguous for high-price hospitals. Under endogenous RP, insurer payments to high-price and low-price hospitals decrease, and consumer payments to low-price hospitals decrease, but predictions regarding consumer payments are ambiguous for high-price hospitals. We test these predictions with difference-in-differences specifications using 2008-2013 data on patients undergoing joint replacement. For 2 years following RP implementation, insurer payments to high-price and low-price hospitals moved downward, consistent with endogenous RP. However, when the reference price was not reset to account for changes in MPs, insurer payments to low-price hospitals reverted to pre-implementation levels, consistent with exogenous RP. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  10. Effects of exogenous human insulin dose adjustment on body mass ...

    African Journals Online (AJOL)

    glycaemic control by frequent exogenous insulin injections. To maintain fasting ... mass index in adult patients with type 1 diabetes mellitus at Kalafong Hospital ..... The Diabetes Control and Complications Trial cited in the review by Kaufman[2] also .... in obese insulin-resistant children: A randomized clinical trial. Diabetes ...

  11. Discussion on spatial emplacement of exogenic-epigenetic infiltration-type uranium deposit

    International Nuclear Information System (INIS)

    Zhao Fengmin

    2005-01-01

    Exogenic-epigenetic infiltration-type uranium deposit is a kind of deposit with large resources, low exploitation cost, and less environmental pollution being the recent important prospecting target in China. Prospecting practice for uranium during recent decade indicates that the metallogenic model and prospecting-evaluation criteria obtained from sandstone-hosted uranium deposits in Middle Asia are not applicable to the case in China. China is a country which has been subject to intense neotectonism, and Meso-Cenozoic basins in China have experienced various tectonic reworking. According to the spatial relation to orogenic belts sedimentary basins may be divided into: basins in orogenic belt; basins near orogenic belt and basins with weak tectonic activation far away from orogenic belt. Then, based on the structural features, basins may be further divided into corresponding subtypes. The author discusses the favourability of each type basin for the formation of exogenic-epigenetic uranium mineralization, as well as the paleo-climatic conditions for uranium ore-formation. Then, the author proposes that, for small intracontinental basins recharged by natural groundwater, the arid climatic period is not totally a favourable factor for uranium ore-formation, it even could be an unfavourable factor. In contrast, basins located in humid climatic region may be advantageous to uranium ore-formation. For improving the prospecting efficiency, a metallogenic model for exogenic-epigenetic infiltration uranium deposits and corresponding prospecting-evaluation criteria suitable for geologic situation of China have to be established as soon as possible. (authors)

  12. San Francisco urban partnership agreement, national evaluation : exogenous factors test plan.

    Science.gov (United States)

    2011-06-01

    This report presents the test plan for collecting and analyzing exogenous factors data for the San Francisco Urban : Partnership Agreement (UPA) under the United States Department of Transportation (U.S. DOT) UPA Program. : The San Francisco UPA proj...

  13. On the relative contributions of multisensory integration and crossmodal exogenous spatial attention to multisensory response enhancement.

    Science.gov (United States)

    Van der Stoep, N; Spence, C; Nijboer, T C W; Van der Stigchel, S

    2015-11-01

    Two processes that can give rise to multisensory response enhancement (MRE) are multisensory integration (MSI) and crossmodal exogenous spatial attention. It is, however, currently unclear what the relative contribution of each of these is to MRE. We investigated this issue using two tasks that are generally assumed to measure MSI (a redundant target effect task) and crossmodal exogenous spatial attention (a spatial cueing task). One block of trials consisted of unimodal auditory and visual targets designed to provide a unimodal baseline. In two other blocks of trials, the participants were presented with spatially and temporally aligned and misaligned audiovisual (AV) targets (0, 50, 100, and 200ms SOA). In the integration block, the participants were instructed to respond to the onset of the first target stimulus that they detected (A or V). The instruction for the cueing block was to respond only to the onset of the visual targets. The targets could appear at one of three locations: left, center, and right. The participants were instructed to respond only to lateral targets. The results indicated that MRE was caused by MSI at 0ms SOA. At 50ms SOA, both crossmodal exogenous spatial attention and MSI contributed to the observed MRE, whereas the MRE observed at the 100 and 200ms SOAs was attributable to crossmodal exogenous spatial attention, alerting, and temporal preparation. These results therefore suggest that there may be a temporal window in which both MSI and exogenous crossmodal spatial attention can contribute to multisensory response enhancement. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. On the spatial specificity of audiovisual crossmodal exogenous cuing effects.

    Science.gov (United States)

    Lee, Jae; Spence, Charles

    2017-06-01

    It is generally-accepted that the presentation of an auditory cue will direct an observer's spatial attention to the region of space from where it originates and therefore facilitate responses to visual targets presented there rather than from a different position within the cued hemifield. However, to date, there has been surprisingly limited evidence published in support of such within-hemifield crossmodal exogenous spatial cuing effects. Here, we report two experiments designed to investigate within- and between-hemifield spatial cuing effects in the case of audiovisual exogenous covert orienting. Auditory cues were presented from one of four frontal loudspeakers (two on either side of central fixation). There were eight possible visual target locations (one above and another below each of the loudspeakers). The auditory cues were evenly separated laterally by 30° in Experiment 1, and by 10° in Experiment 2. The potential cue and target locations were separated vertically by approximately 19° in Experiment 1, and by 4° in Experiment 2. On each trial, the participants made a speeded elevation (i.e., up vs. down) discrimination response to the visual target following the presentation of a spatially-nonpredictive auditory cue. Within-hemifield spatial cuing effects were observed only when the auditory cues were presented from the inner locations. Between-hemifield spatial cuing effects were observed in both experiments. Taken together, these results demonstrate that crossmodal exogenous shifts of spatial attention depend on the eccentricity of both the cue and target in a way that has not been made explicit by previous research. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Isolation of Salmonella typhimurium strains that utilize exogenous 3-deoxy-D-manno-Octulosonate for synthesis of lipopolysaccharide

    International Nuclear Information System (INIS)

    Goldman, R.C.; Devine, E.M.

    1987-01-01

    Spontaneous mutants of Salmonella typhimurium LT2 were selected for the ability to accumulate exogenous 3-deoxy-D-manno-octulosonate (KDO). Bacteria containing a gene (kdsA) which codes for a temperature-sensitive KDO-8-phosphate synthetase were plated at the restrictive temperature of 42 0 C on medium containing 5 mM KDO. Since bacteria containing the kdsA lesion are unable to grown at 42 0 C due to inhibition of lipopolysaccharide (LPS) synthesis and accumulation of lipid A precursor, this method allowed direct, positive selection of mutants capable of utilizing exogenous KDO for LPS synthesis. Spontaneous mutants, selected at a frequency of about 10 -6 , required exogenous KDO for growth at 42 0 C. The growth rate at 42 0 C was nearly normal in the presence of 20 mM KDO and was directly proportional to KDO concentrations below 20 mM. Exogenous KDO also suppressed accumulation of lipid A precursor. The apparent K/sub m/ for KDO accumulation was 23 mM, and the maximum rate of transport was calculated to be 505 pmol of DKO per min per 10 8 cells. Bacteria incorporated exogenous [ 3 H]KDO exclusively into LPS, with less that 10% dilution in specific activity due to residual endogenous KDO synthesis. The mutation giving rise to the ability to accumulate exogenous KDO was extremely useful in the direct screening for new mutations in the kdsA gene after localized mutagenesis. Five mutations in kdsA were isolated, four of which were new alleles as determined by on fine-structure analysis. The ability to introduce labeled ( 3 H, 13 C, and 14 C) KDO in vivo should simplify and extend the analysis of this critical metabolic pathway in gram-negative bacteria

  16. Introduction of exogenous wild soybean DNA into cultivated soybean and RAPD molecular verification

    Institute of Scientific and Technical Information of China (English)

    谢纬武; 王斌; 雷勃钧; 李希臣; 卢翠华; 钱华; 周思君

    1995-01-01

    The exogenous total DNA of the wild high-protein soybean was transferred to cultivatedsoybean through the pollen tube channel and the genomic variation of the transformed progeny was detected bythe method of RAPD(Random Amplified Polymorphic DNA).Distinguished variations were found in one of the 7 transformed plants of the first generation(D1),ofwhich the traits of fruition,outward appearance,leaf shape and flower colour were almost identical withthose of the recipient parent;of which grain weight,seed coat colour and stem strength were situated betweenthe two parents;and there were greatly more pods per plant and 12.5% higher content of protein in seedsthan that of the recipient parent.All the properties have been invariably inherited for 3 generations.Through RAPD analysis of the genomes of the donor,the recipient and the transformed progeny(D3)as agroup,DNA polyrnorphisms were found in amplified products by 24 of 150 primers.The results prove thatthe exogenous DNA caused the distinct variance of the genome.The authors infer that the homogeneousrecombination of large exogenous DNA is the main cause for the variance.

  17. Exogenous Cortisol Administration; Effects on Risk Taking Behavior, Exercise Performance, and Physiological and Neurophysiological Responses.

    Science.gov (United States)

    Robertson, Caroline V; Immink, Maarten A; Marino, Frank E

    2016-01-01

    Rationale: Exogenous cortisol is a modulator of behavior related to increased motivated decision making (Putman et al., 2010), where risky choices yield potentially big reward. Making risk based judgments has been shown to be important to athletes in optimizing pacing during endurance events (Renfree et al., 2014; Micklewright et al., 2015). Objectives: Therefore, the aims of this study were to examine the effect of 50 mg exogenous cortisol on neurophysiological responses and risk taking behavior in nine healthy men. Further to this, to examine the effect of exogenous cortisol on exercise performance. Methods: Using a double blind counterbalanced design, cyclists completed a placebo (PLA), and a cortisol (COR) trial (50 mg cortisol), with drug ingestion at 0 min. Each trial consisted of a rest period from 0 to 60 min, followed by a risk taking behavior task, a 30 min time trial (TT) with 5 × 30 s sprints at the following time intervals; 5, 11, 17, 23, and 29 min. Salivary cortisol (SaCOR), Electroencephalography (EEG) and Near Infrared Spectroscopy (NIRs) were measured at 15, 30, 45, and 60 min post-ingestion. Glucose and lactate samples were taken at 0 and 60 min post-ingestion. During exercise, power output (PO), heart rate (HR), EEG, and NIRS were measured. SaCOR was measured 10 min post-exercise. Results: Cortisol increased risk taking behavior from baseline testing. This was in line with significant neurophysiological changes at rest and during exercise. At rest, SaCOR levels were higher ( P exogenous cortisol on exercise performance. These results are in line with previous research showing altered risk taking behavior following exogenous cortisol, however the altered behavior did not translate into changes in exercise performance.

  18. Modification of radiation changes of the blood-brain barrier by exogenous hypoxia

    International Nuclear Information System (INIS)

    Antipov, V.V.; Fedorov, V.P.; Kordenko, A.N.; Ushakov, I.B.

    1987-01-01

    The authors conducted an experimental study of a radiomodifying effect of exogenous hypoxia on the structures of the blood-brain barrier in rats early after irradiation of the head at a dose of 10 Gy. Histochemical and histological methods were used to assess the status of the endothelium, basal membrane tissue basophils and astrocytic junction. They indicated change of these structures in irradiation and action of GHM-8 gaseous mixture. Exogenous hypoxia was shown to promote the normalization of transport through the capillary wall as a result of the prevention of injury of the structure and metabollic processes in endothelial cells and basal membrane. The astrocytic junction and, to a certain degree, tissue basophils exhibited synergy in the action of the studied fators

  19. Regulation of mutagenesis by exogenous biological factors in the eukaryotic cell systems

    Directory of Open Access Journals (Sweden)

    Lukash L. L.

    2013-07-01

    Full Text Available The representations of the mutations and the nature of spontaneous mutation process and mutagenesis induced by exogenous oncoviruses, DNAs and proteins-mitogens are analysed. Exogenous biological factors induce DNA damages in regulatory-informational way, acting on the cellular systems for maintenance of genetical stability. Molecular mechanisms are the same as at spontaneous mutagenesis but they are realized with the participation of alien genetical material. Among biological mutagens, the oncoviruses and mobile genetic elements (MGEs are distinguished as the strongest destabilizing factors which direct tumor transformation of somatic mammalian cells. Genetical reprogramming or changing the programs of gene expression at the differentiation of stem and progenitor cells under growth factors and citokines is probably followed by mutations and recombinations as well.

  20. A single administration of cortisol acutely reduces preconscious attention for fear in anxious young men.

    Science.gov (United States)

    Putman, Peter; Hermans, Erno J; Koppeschaar, Hans; van Schijndel, Alexandra; van Honk, Jack

    2007-08-01

    Chronically elevated HPA activity has often been associated with fear and anxiety, but there is evidence that single administrations of glucocorticoids may acutely reduce fear. Moreover, peri-traumatic cortisol elevation may protect against development of post-traumatic stress disorder. Hypervigilant processing of threat information plays a role in anxiety disorders and although relations with HPA functioning have been established, causality of these relations remains unclear. Presently, self-reported anxiety and response time patterns on a masked emotional Stroop task with fearful faces were measured in 20 healthy young men after double-blind, placebo-controlled oral administration of 40 mg cortisol. The masked fearful Stroop task measures vocal colornaming response latencies for pictures of neutral and fearful faces presented below the threshold for conscious perception. Results showed increased response times on trials for fearful compared to neutral faces after placebo, but this emotional Stroop effect was acutely abolished by cortisol administration. This effect was most pronounced in subjects with heightened anxiety levels. This is the first evidence showing that exogenous cortisol acutely reduces anxiety-driven selective attention to threat. These results extend earlier findings of acute fear reduction after glucocorticoid administration. This suggests interactions of HPA functioning and vigilant attention in the pathogenesis of anxiety disorders. Possible neuroendocrine mechanisms of action are discussed.

  1. Exogenous cycilc AMP and cycilc GMP influence the metabolism of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-09-01

    Sep 1, 2009 ... well with the metabolic dynamics of exogenous 3H-glycerol within 30 h after injection. Moreover, ... low molecular weight that exist widely in organism and exhibit very ... endogenous tracers for the study of protein and lipid metabolism ..... DM (1998). SAAM ⁄: simulation, analysis, and modeling software for.

  2. The Effect of Reward on Orienting and Reorienting in Exogenous Cueing

    NARCIS (Netherlands)

    Bucker, B.; Theeuwes, J.

    2014-01-01

    It is thought that reward-induced motivation influences perceptual, attentional, and cognitive control processes to facilitate behavioral performance. In this study, we investigated the effect of reward-induced motivation on exogenous attention orienting and inhibition of return (IOR). Attention was

  3. Exogenous regucalcin suppresses the growth of human liver cancer HepG2 cells in vitro.

    Science.gov (United States)

    Yamaguchi, Masayoshi; Murata, Tomiyasu

    2018-04-05

    Regucalcin, which its gene is localized on the X chromosome, plays a pivotal role as a suppressor protein in signal transduction in various types of cells and tissues. Regucalcin gene expression has been demonstrated to be suppressed in various tumor tissues of animal and human subjects, suggesting a potential role of regucalcin in carcinogenesis. Regucalcin, which is produced from the tissues including liver, is found to be present in the serum of human subjects and animals. This study was undertaken to determine the effects of exogenous regucalcin on the proliferation in cloned human hepatoma HepG2 cells in vitro. Proliferation of HepG2 cells was suppressed after culture with addition of regucalcin (0.01 – 10 nM) into culture medium. Exogenous regucalcin did not reveal apoptotic cell death in HepG2 cells in vitro. Suppressive effects of regucalcin on cell proliferation were not enhanced in the presence of various signaling inhibitors including tumor necrosis factor-α (TNF-α), Bay K 8644, PD98059, staurosporine, worthomannin, 5,6-dichloro-1-β-D-ribofuranosylbenzimidazole (DRB) or gemcitabine, which were found to suppress the proliferation. In addition, exogenous regucalcin suppressed the formation of colonies of cultured hepatoma cells in vitro. These findings demonstrated that exogenous regucalcin exhibits a suppressive effect on the growth of human hepatoma HepG2 cells, proposing a strategy with the gene therapy for cancer treatment.

  4. Expression of β-nerve growth factor and homeobox A10 in experimental cryptorchidism treated with exogenous nerve growth factor.

    Science.gov (United States)

    Xian, Hua; Xian, Yun; Liu, Lili; Wang, Yongjun; He, Jianghong; Huang, Jianfei

    2015-04-01

    With the exception of standard inguinal orchidopexy, treatment of cryptorchidism with human chorionic gonadotropin has been performed for several years; however, its side effects have limited its application. The β‑nerve growth factor (NGF) and homeobox A10 (HoxA10) genes are closely associated with the development of the testes. To the best of our knowledge, whether exogenous NGF alters the endogenous levels of NGF and HoxA10 in cryptorchidism in rats remains to be elucidated. The aim of the present study was to evaluate the gene and protein expression of NGF and HoxA10 in experimental cryptorchidism following treatment with exogenous NGF. A unilateral mechanical cryptorchidism model in Sprague-Dawley rats was established and different concentrations of exogenous NGF were administered to observe the effects of NGF on cryptorchidism. Changes in the gene and protein expression levels of NGF and HoxA10 in the cryptorchid tissues of each group were identified using one step reverse transcription-quantitative polymerase chain reaction, in situ hybridization with digoxigenin‑labeled‑β‑NGF RNA probes, immunofluorescence and immunohistochemistry, respectively. The expression levels of NGF and HoxA10 were markedly higher in the group treated with a high dose of exogenous NGF compared with the group treated with a low dose of exogenous NGF and the group treated with human chorionic gonadotropin. These results confirmed the potential therapeutic effect of exogenous NGF in human cryptorchidism.

  5. Increases in the amounts of Vibrio spp. in oysters upon addition of exogenous bacteria.

    Science.gov (United States)

    Froelich, Brett; Oliver, James

    2013-09-01

    The bacterial pathogen Vibrio vulnificus is found naturally in brackish coastal waters but can be greatly concentrated by filter-feeding organisms such as shellfish. Numerous experiments in which exogenous V. vulnificus cells are added to oysters in an attempt to measure uptake and depuration have been performed. In nearly all cases, results have shown that laboratory-grown bacteria are rapidly taken up by the oysters but ultimately eliminated, while naturally present Vibrio populations in oysters are resistant to depuration. In this study, oysters harvested during winter months, with low culturable Vibrio concentrations, were incubated in aquaria supplemented with strains of V. vulnificus that were either genotypically or phenotypically distinct from the background bacteria. These exogenous cells were eliminated from the oysters, as previously seen, but other vibrios already inhabiting the oysters responded to the V. vulnificus inoculum by rapidly increasing in number and maintaining a large stable population. The presence of such an oyster-adapted Vibrio population would be expected to prevent colonization by exogenous V. vulnificus cells, thus explaining the rapid depuration of these added bacteria.

  6. Acute mesenteric ischemia and hepatic infarction after treatment of ectopic Cushing's syndrome.

    Science.gov (United States)

    Takayasu, Shinobu; Murasawa, Shingo; Yamagata, Satoshi; Kageyama, Kazunori; Nigawara, Takeshi; Watanuki, Yutaka; Kimura, Daisuke; Tsushima, Takao; Sakamoto, Yoshiyuki; Hakamada, Kenichi; Terui, Ken; Daimon, Makoto

    2017-01-01

    Patients with Cushing's syndrome and excess exogenous glucocorticoids have an increased risk for venous thromboembolism, as well as arterial thrombi. The patients are at high risk of thromboembolic events, especially during active disease and even in cases of remission and after surgery in Cushing's syndrome and withdrawal state in glucocorticoid users. We present a case of Cushing's syndrome caused by adrenocorticotropic hormone-secreting lung carcinoid tumor. Our patient developed acute mesenteric ischemia after video-assisted thoracoscopic surgery despite administration of sufficient glucocorticoid and thromboprophylaxis in the perioperative period. In addition, our patient developed hepatic infarction after surgical resection of the intestine. Then, the patient was supported by total parenteral nutrition. Our case report highlights the risk of microthrombi, which occurred in our patient after treatment of ectopic Cushing's syndrome. Guidelines on thromboprophylaxis and/or antiplatelet therapy for Cushing's syndrome are acutely needed. The present case showed acute mesenteric thromboembolism and hepatic infarction after treatment of ectopic Cushing's syndrome.Patients with Cushing's syndrome are at increased risk for thromboembolic events and increased morbidity and mortality.An increase in thromboembolic risk has been observed during active disease, even in cases of remission and postoperatively in Cushing's syndrome.Thromboprophylaxis and antiplatelet therapy should be considered in treatment of glucocorticoid excess or glucocorticoid withdrawal.

  7. Effects of whey, molasses and exogenous enzymes on the ensiling ...

    African Journals Online (AJOL)

    The study was conducted to assess the effects of whey, molasses and exogenous enzymes on fermentation, aerobic stability and nutrient composition of ensiled maize cobs. Five treatments were ensiled in 1.5 L anaerobic glass jars over 32 days, namely i) control (maize cobs without additives (CON); ii) maize cobs with ...

  8. Expression and analysis of exogenous proteins in epidermal cells.

    Science.gov (United States)

    Dagnino, Lina; Ho, Ernest; Chang, Wing Y

    2010-01-01

    In this chapter we review protocols for transient transfection of primary keratinocytes. The ability to transfect primary epidermal cells regardless of their differentiation status allows the biochemical and molecular characterization of multiple proteins. We review methods to analyze exogenous protein abundance in transfected keratinocytes by immunoblot and immunoprecipitation. We also present protocols to determine the subcellular distribution of these proteins by indirect immunofluorescence microscopy approaches.

  9. Endogenous and Exogenous Natural Adjuvants for Vaccine Development.

    Science.gov (United States)

    Bolhassani, Azam; Talebi, Somayeh; Anvar, Ali

    2017-01-01

    Objective & Background: Various adjuvants are usually co-injected with an antigen for stimulation of effective immune responses. Adjuvants are able to elicit innate immune responses at the injection site. Depending on the activated type of innate responses, adjuvants can modify the quality and quantity of adaptive immune responses. Their mechanisms of action in vaccine development include: a) enhancement of the total antibody titers; b) reduction of the antigen dose; c) induction of potent cell-mediated immunity; d) increase in the speed and duration of the protective response; e) stimulation of mucosal immunity; and f) cross-protection. Up to now, different exogenous adjuvants have been identified to boost immune responses including inorganic compounds, mineral oil, bacterial products, non-bacterial organics, detergents or Quil A, plant saponins, Freund's complete or incomplete adjuvants, and delivery systems. However, some immune responses can be generated in the absence of the exogenous adjuvants. Indeed, endogenous adjuvants released from the cells were known as the danger signals and immunogenic compounds. Several main endogenous adjuvants contain cytokines, chemokines, alarmins, dendritic cells (DCs), toll like receptor (TLR) ligands or agonists, and antibodies. In this review, the immune activities of the natural adjuvants especially endogenous adjuvants and their mechanisms of action are discussed. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  10. Exogenous hydrogen sulfide promotes cell proliferation and differentiation by modulating autophagy in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Xin [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Dai, Hui [Department of Cardiology, The First Affiliated Hospital of Harbin Medical University, Harbin, 150001, Heilongjiang Province (China); Zhuang, Binyu [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Chai, Li; Xie, Yanguang [Institute of Dermatology of Heilongjiang Province, Harbin, 150001, Heilongjiang Province (China); Li, Yuzhen, E-mail: liyuzhen@medmail.com.cn [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China)

    2016-04-08

    The effects and the underlying mechanisms of hydrogen sulfide (H{sub 2}S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H{sub 2}S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H{sub 2}S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H{sub 2}S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H{sub 2}S promotes keratinocyte proliferation and differentiation. • The effects of H{sub 2}S on proliferation and differentiation is modulated by autophagy. • Exogenous H{sub 2}S has no effect on keratinocyte apoptosis.

  11. Mini Review: Basic Physiology and Factors Influencing Exogenous Enzymes Activity in the Porcine Gastrointestinal Tract

    DEFF Research Database (Denmark)

    Strube, Mikael Lenz; Meyer, Anne S.; Boye, Mette

    2013-01-01

    activity during intestinal transit are few, it is known that the enzymes, being protein molecules, can be negatively affected by the gastrointestinal proteolytic enzymes and the low pH in the stomach ventricle. In this review, the pH-values, endogenous proteases and other factors native to the digestive......The addition of exogenous enzymes to pig feed is used to enhance general nutrient availability and thus increase daily weight gain per feed unit. The enzymes used are mainly beta-glucanase (EC 3.2.1.4) and xylanase (EC 3.2.1.8) and phytase (EC 3.1.3.8). Although in vivo data assessing feed enzyme...... tract of the adult pig and the piglet are discussed in relation to the stability of exogenous feed enzymes. Development of more consistent assessment methods which acknowledge such factors is warranted both in vitro and in vivo for proper evaluation and prediction of the efficiency of exogenous enzymes...

  12. In Vivo Real-Time Imaging of Exogenous HGF-Triggered Cell Migration in Rat Intact Soleus Muscles

    International Nuclear Information System (INIS)

    Ishido, Minenori; Kasuga, Norikatsu

    2012-01-01

    The transplantation of myogenic cells is a potentially effective therapy for muscular dystrophy. However, this therapy has achieved little success because the diffusion of transplanted myogenic cells is limited. Hepatocyte growth factor (HGF) is one of the primary triggers to induce myogenic cell migration in vitro. However, to our knowledge, whether exogenous HGF can trigger the migration of myogenic cells (i.e. satellite cells) in intact skeletal muscles in vivo has not been reported. We previously reported a novel in vivo real-time imaging method in rat skeletal muscles. Therefore, the present study examined the relationship between exogenous HGF treatment and cell migration in rat intact soleus muscles using this imaging method. As a result, it was indicated that the cell migration velocity was enhanced in response to increasing exogenous HGF concentration in skeletal muscles. Furthermore, the expression of MyoD was induced in satellite cells in response to HGF treatment. We first demonstrated in vivo real-time imaging of cell migration triggered by exogenous HGF in intact soleus muscles. The experimental method used in the present study will be a useful tool to understand further the regulatory mechanism of HGF-induced satellite cell migration in skeletal muscles in vivo

  13. Exogenous L-arginine reduces matrix metalloproteinase-2 and -9 activities and oxidative stress in patients with hypertension

    DEFF Research Database (Denmark)

    Garcia, Vinicius P; Rocha, Helena N M; Silva, Gustavo M.

    2016-01-01

    Aims Increased matrix metalloproteinases activity and reduced nitric oxide (NO) bioavailability contributes to development of hypertension and this may be associated with a defective L-arginine-NO pathway. Exogenous L-arginine improves endothelial function to prevent the onset of cardiovascular...... disease, but the mechanism by which this is accomplished remains unclear. We determined the effects of exogenous L-arginine infusion on vascular biomarkers in patients with hypertension. Main methods Venous blood samples were obtained from seven patients with hypertension (45 ± 5 yrs., HT group...... biomarkers between groups during the saline infusion (P > 0.05). Significance Exogenous L-arginine diminished metalloproteinase-2 and -9 activities and MMP-9/TIMP-1 ratio along with restoring the oxidative stress balance in patients with hypertension....

  14. Verification of Bioanalytical Method for Quantification of Exogenous Insulin (Insulin Aspart) by the Analyser Advia Centaur® XP.

    Science.gov (United States)

    Mihailov, Rossen; Stoeva, Dilyana; Pencheva, Blagovesta; Pentchev, Eugeni

    2018-03-01

    In a number of cases the monitoring of patients with type I diabetes mellitus requires measurement of the exogenous insulin levels. For the purpose of a clinical investigation of the efficacy of a medical device for application of exogenous insulin aspart, a verification of the method for measurement of this synthetic analogue of the hormone was needed. The information in the available medical literature for the measurement of the different exogenous insulin analogs is insufficient. Thus, verification was required to be in compliance with the active standards in Republic of Bulgaria. A manufactured method developed for ADVIA Centaur XP Immunoassay, Siemens Healthcare, was used which we verified using standard solutions and a patient serum pool by adding the appropriate quantity exogenous insulin aspart. The method was verified in accordance with the bioanalytical method verification criteria and regulatory requirements for using a standard method: CLIA chemiluminescence immunoassay ADVIA Centaur® XP. The following parameters are determined and monitored: intra-day precision and accuracy, inter-day precision and accuracy, limit of detection and lower limit of quantification, linearity, analytical recovery. The routine application of the method for measurement of immunoreactive insulin using the analyzer ADVIA Centaur® XP is directed to the measurement of endogenous insulin. The method is applicable for measuring different types of exogenous insulin, including insulin aspart.

  15. Micro-dose hCG as luteal phase support without exogenous progesterone administration

    DEFF Research Database (Denmark)

    Andersen, C Yding; Fischer, R; Giorgione, V

    2016-01-01

    RHa trigger to induce ovulation showed that exogenous progesterone administration without hCG supplementation was insufficient to obtain satisfactory pregnancy rates. This has prompted development of alternative strategies for LPS. Augmenting the local endogenous production of progesterone by the multiple......For the last two decades, exogenous progesterone administration has been used as luteal phase support (LPS) in connection with controlled ovarian stimulation combined with use of the human chorionic gonadotropin (hCG) trigger for the final maturation of follicles. The introduction of the Gn...... corpora lutea has been one focus with emphasis on one hand to avoid development of ovarian hyper-stimulation syndrome and, on the other hand, to provide adequate levels of progesterone to sustain implantation. The present study evaluates the use of micro-dose hCG for LPS support and examines the potential...

  16. Protection of honeybee Apis mellifera by its endogenous and exogenous lactic flora against bacterial infections

    Directory of Open Access Journals (Sweden)

    Irakli Janashia

    2016-09-01

    Three exogenous bacteriocin-producing LAB strains were tested against the same pathogens and against 25 endogenous bacterial isolates representing 11 different LAB species. The screening showed that all the tested exogenous bacteriocin-producing strains inhibited the tested P. larvae strains. The endogenous LAB strains exhibited varied sensitivity profiles when treated with bacteriocin-producing strains. This raises similar challenges to those observed in antibiotic applications leading to dysbacteriosis, even though the efficacy of these bacteriocins against P. larvae in an in vitro system is evident.

  17. Exogenic geomorphic processes dynamics at the Black Sea coast, Russia

    Science.gov (United States)

    Kuznetsova, Yulia; Tsvetkova, Daria

    2017-04-01

    Nowadays there is an obvious grow of anthropogenic load going on in many areas worldwide. Under such conditions, intensive activation of a number of exogenic geomorphic processes may be observed. Moreover, if natural environment is aggressive itself their dynamics and rates may reach enormous values. Our work is conducted at the Black Sea coast, known for its mountainous topography, wet subtropical climate and intensive anthropogenic development (especially during the last decade due to the recent Olympic games). We chose two key basins near Sochi, Russia to study a number of presented exogenic processes, including rill, gully and channel erosion, weathering, suffusion and piping, soil creep. A set of field study methods is used to monitor the processes dynamics since 2005 (and late 1970s for soil creep). In addition, soil erosion rates and landslide susceptibility were modelled to get information of the watersheds dynamics. This is ongoing work, but the results of the passed period of observations will be resented. Special attention is paid to the processes connectivity and their input into sediment redistribution over the river basins.

  18. The interactions of multisensory integration with endogenous and exogenous attention.

    Science.gov (United States)

    Tang, Xiaoyu; Wu, Jinglong; Shen, Yong

    2016-02-01

    Stimuli from multiple sensory organs can be integrated into a coherent representation through multiple phases of multisensory processing; this phenomenon is called multisensory integration. Multisensory integration can interact with attention. Here, we propose a framework in which attention modulates multisensory processing in both endogenous (goal-driven) and exogenous (stimulus-driven) ways. Moreover, multisensory integration exerts not only bottom-up but also top-down control over attention. Specifically, we propose the following: (1) endogenous attentional selectivity acts on multiple levels of multisensory processing to determine the extent to which simultaneous stimuli from different modalities can be integrated; (2) integrated multisensory events exert top-down control on attentional capture via multisensory search templates that are stored in the brain; (3) integrated multisensory events can capture attention efficiently, even in quite complex circumstances, due to their increased salience compared to unimodal events and can thus improve search accuracy; and (4) within a multisensory object, endogenous attention can spread from one modality to another in an exogenous manner. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Release of [3H]GABA formed from [3H]glutamate in rat hippocampal slices: comparison with endogenous and exogenous labeled GABA

    International Nuclear Information System (INIS)

    Szerb, J.C.

    1983-01-01

    To compare the storage and release of endogenous GABA, of [ 3 H]GABA formed endogenously from glutamate, and of exogenous [ 14 C]GABA, hippocampal slices were incubated with 5 microCi/ml [3,4- 3 H]1-glutamate and 0.5 microCi/ml [U- 14 C]GABA and then were superfused in the presence or absence of Ca + with either 50 mM K + or 50 microM veratridine. Exogenous [ 14 C]GABA content of the slices declined spontaneously while endogenous GABA and endogenously formed [ 3 H]GABA stayed constant over a 48 min period. In the presence of Ca + 50 mM K + and in the presence or absence of Ca2 + veratridine released exogenous [ 14 C]GABA more rapidly than endogenous or endogenously formed [ 3 H]GABA, the release of the latter two occurring always in parallel. The initial specific activity of released exogenous [ 14 C]GABA was three times, while that of endogenously formed [ 3 H]GABA was only 50% higher than that in the slices. The observation that endogenous GABA and [ 3 H]GABA formed endogenously from glutamate are stored and released in parallel but differently from exogenous labelled GABA, suggests that exogenous [ 3 H] glutamate can enter a glutamate pool that normally serves as precursor of GABA

  20. Fructose and Sucrose Intake Increase Exogenous  Carbohydrate Oxidation during Exercise.

    Science.gov (United States)

    Trommelen, Jorn; Fuchs, Cas J; Beelen, Milou; Lenaerts, Kaatje; Jeukendrup, Asker E; Cermak, Naomi M; van Loon, Luc J C

    2017-02-20

    Peak exogenous carbohydrate oxidation rates typically reach ~1 g∙min-1 during exercise when ample glucose or glucose polymers are ingested. Fructose co-ingestion has been shown to further increase exogenous carbohydrate oxidation rates. The purpose of this study was to assess the impact of fructose co-ingestion provided either as a monosaccharide or as part of the disaccharide sucrose on exogenous carbohydrate oxidation rates during prolonged exercise in trained cyclists. Ten trained male cyclists (VO2peak: 65 ± 2 mL∙kg-1∙min-1) cycled on four different occasions for 180 min at 50% Wmax during which they consumed a carbohydrate solution providing 1.8 g∙min-1 of glucose (GLU), 1.2 g∙min-1 glucose + 0.6 g∙min-1 fructose (GLU + FRU), 0.6 g∙min-1 glucose + 1.2 g∙min-1 sucrose (GLU + SUC), or water (WAT). Peak exogenous carbohydrate oxidation rates did not differ between GLU + FRU and GLU + SUC (1.40 ± 0.06 vs. 1.29 ± 0.07 g∙min-1, respectively, p = 0.999), but were 46% ± 8% higher when compared to GLU (0.96 ± 0.06 g∙min-1: p exogenous carbohydrate oxidation rates during the latter 120 min of exercise were 46% ± 8% higher in GLU + FRU or GLU + SUC compared with GLU (1.19 ± 0.12, 1.13 ± 0.21, and 0.82 ± 0.16 g∙min-1, respectively, p exogenous carbohydrate oxidation rates during prolonged exercise in trained cyclists.

  1. Immune responses of eastern fence lizards (Sceloporus undulatus) to repeated acute elevation of corticosterone.

    Science.gov (United States)

    McCormick, Gail L; Langkilde, Tracy

    2014-08-01

    Prolonged elevations of glucocorticoids due to long-duration (chronic) stress can suppress immune function. It is unclear, however, how natural stressors that result in repeated short-duration (acute) stress, such as frequent agonistic social encounters or predator attacks, fit into our current understanding of the immune consequences of stress. Since these types of stressors may activate the immune system due to increased risk of injury, immune suppression may be reduced at sites where individuals are repeatedly exposed to potentially damaging stressors. We tested whether repeated acute elevation of corticosterone (CORT, a glucocorticoid) suppresses immune function in eastern fence lizards (Sceloporus undulatus), and whether this effect varies between lizards from high-stress (high baseline CORT, invaded by predatory fire ants) and low-stress (low baseline CORT, uninvaded) sites. Lizards treated daily with exogenous CORT showed higher hemagglutination of novel proteins by their plasma (a test of constitutive humoral immunity) than control lizards, a pattern that was consistent across sites. There was no significant effect of CORT treatment on bacterial killing ability of plasma. These results suggest that repeated elevations of CORT, which are common in nature, produce immune effects more typical of those expected at the acute end of the acute-chronic spectrum and provide no evidence of modulated consequences of elevated CORT in animals from high-stress sites. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Activation of Exogenous Fatty Acids to Acyl-Acyl Carrier Protein Cannot Bypass FabI Inhibition in Neisseria*

    Science.gov (United States)

    Yao, Jiangwei; Bruhn, David F.; Frank, Matthew W.; Lee, Richard E.; Rock, Charles O.

    2016-01-01

    Neisseria is a Gram-negative pathogen with phospholipids composed of straight chain saturated and monounsaturated fatty acids, the ability to incorporate exogenous fatty acids, and lipopolysaccharides that are not essential. The FabI inhibitor, AFN-1252, was deployed as a chemical biology tool to determine whether Neisseria can bypass the inhibition of fatty acid synthesis by incorporating exogenous fatty acids. Neisseria encodes a functional FabI that was potently inhibited by AFN-1252. AFN-1252 caused a dose-dependent inhibition of fatty acid synthesis in growing Neisseria, a delayed inhibition of growth phenotype, and minimal inhibition of DNA, RNA, and protein synthesis, showing that its mode of action is through inhibiting fatty acid synthesis. Isotopic fatty acid labeling experiments showed that Neisseria encodes the ability to incorporate exogenous fatty acids into its phospholipids by an acyl-acyl carrier protein-dependent pathway. However, AFN-1252 remained an effective antibacterial when Neisseria were supplemented with exogenous fatty acids. These results demonstrate that extracellular fatty acids are activated by an acyl-acyl carrier protein synthetase (AasN) and validate type II fatty acid synthesis (FabI) as a therapeutic target against Neisseria. PMID:26567338

  3. Role of fructose and fructokinase in acute dehydration-induced vasopressin gene expression and secretion in mice.

    Science.gov (United States)

    Song 宋志林, Zhilin; Roncal-Jimenez, Carlos A; Lanaspa-Garcia, Miguel A; Oppelt, Sarah A; Kuwabara, Masanari; Jensen, Thomas; Milagres, Tamara; Andres-Hernando, Ana; Ishimoto, Takuji; Garcia, Gabriela E; Johnson, Ginger; MacLean, Paul S; Sanchez-Lozada, Laura-Gabriela; Tolan, Dean R; Johnson, Richard J

    2017-02-01

    Fructose stimulates vasopressin in humans and can be generated endogenously by activation of the polyol pathway with hyperosmolarity. We hypothesized that fructose metabolism in the hypothalamus might partly control vasopressin responses after acute dehydration. Wild-type and fructokinase-knockout mice were deprived of water for 24 h. The supraoptic nucleus was evaluated for vasopressin and markers of the aldose reductase-fructokinase pathway. The posterior pituitary vasopressin and serum copeptin levels were examined. Hypothalamic explants were evaluated for vasopressin secretion in response to exogenous fructose. Water restriction increased serum and urine osmolality and serum copeptin in both groups of mice, although the increase in copeptin in wild-type mice was larger than that in fructokinase-knockout mice. Water-restricted, wild-type mice showed an increase in vasopressin and aldose reductase mRNA, sorbitol, fructose and uric acid in the supraoptic nucleus. In contrast, fructokinase-knockout mice showed no change in vasopressin or aldose reductase mRNA, and no changes in sorbitol or uric acid, although fructose levels increased. With water restriction, vasopressin in the pituitary of wild-type mice was significantly less than that of fructokinase-knockout mice, indicating that fructokinase-driven vasopressin secretion overrode synthesis. Fructose increased vasopressin release in hypothalamic explants that was not observed in fructokinase-knockout mice. In situ hybridization documented fructokinase mRNA in the supraoptic nucleus, paraventricular nucleus and suprachiasmatic nucleus. Acute dehydration activates the aldose reductase-fructokinase pathway in the hypothalamus and partly drives the vasopressin response. Exogenous fructose increases vasopressin release in hypothalamic explants dependent on fructokinase. Nevertheless, circulating vasopressin is maintained and urinary concentrating is not impaired. This study increases our understanding of the

  4. Distinct roles of exogenous opioid agonists and endogenous opioid peptides in the peripheral control of neuropathy-triggered heat pain.

    Science.gov (United States)

    Labuz, Dominika; Celik, Melih Ö; Zimmer, Andreas; Machelska, Halina

    2016-09-08

    Neuropathic pain often results from peripheral nerve damage, which can involve immune response. Local leukocyte-derived opioid peptides or exogenous opioid agonists inhibit neuropathy-induced mechanical hypersensitivity in animal models. Since neuropathic pain can also be augmented by heat, in this study we investigated the role of opioids in the modulation of neuropathy-evoked heat hypersensitivity. We used a chronic constriction injury of the sciatic nerve in wild-type and opioid peptide-knockout mice, and tested opioid effects in heat and mechanical hypersensitivity using Hargreaves and von Frey tests, respectively. We found that although perineural exogenous opioid agonists, including peptidergic ligands, were effective, the endogenous opioid peptides β-endorphin, Met-enkephalin and dynorphin A did not alleviate heat hypersensitivity. Specifically, corticotropin-releasing factor, an agent triggering opioid peptide secretion from leukocytes, applied perineurally did not attenuate heat hypersensitivity in wild-type mice. Exogenous opioids, also shown to release opioid peptides via activation of leukocyte opioid receptors, were equally analgesic in wild-type and opioid peptide-knockout mice, indicating that endogenous opioids do not contribute to exogenous opioid analgesia in heat hypersensitivity. Furthermore, exogenously applied opioid peptides were ineffective as well. Conversely, opioid peptides relieved mechanical hypersensitivity. Thus, both opioid type and sensory modality may determine the outcome of neuropathic pain treatment.

  5. A comparison of exogenous and endogenous CEST MRI methods for evaluating in vivo pH.

    Science.gov (United States)

    Lindeman, Leila R; Randtke, Edward A; High, Rachel A; Jones, Kyle M; Howison, Christine M; Pagel, Mark D

    2018-05-01

    Extracellular pH (pHe) is an important biomarker for cancer cell metabolism. Acido-chemical exchange saturation transfer (CEST) MRI uses the contrast agent iopamidol to create spatial maps of pHe. Measurements of amide proton transfer exchange rates (k ex ) from endogenous CEST MRI were compared to pHe measurements by exogenous acido-CEST MRI to determine whether endogenous k ex could be used as a proxy for pHe measurements. Spatial maps of pHe and k ex were obtained using exogenous acidoCEST MRI and an endogenous CEST MRI analyzed with the omega plot method, respectively, to evaluate mouse kidney, a flank tumor model, and a spontaneous lung tumor model. The pHe and k ex results were evaluated using pixelwise comparisons. The k ex values obtained from endogenous CEST measurements did not correlate with the pHe results from exogenous CEST measurements. The k ex measurements were limited to fewer pixels and had a limited dynamic range relative to pHe measurements. Measurements of k ex with endogenous CEST MRI cannot substitute for pHe measurements with acidoCEST MRI. Whereas endogenous CEST MRI may still have good utility for evaluating some specific pathologies, exogenous acido-CEST MRI is more appropriate when evaluating pathologies based on pHe values. Magn Reson Med 79:2766-2772, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

  6. Influence of exogenous lead pollution on enzyme activities and organic matter degradation in the surface of river sediment.

    Science.gov (United States)

    Huang, Danlian; Xu, Juanjuan; Zeng, Guangming; Lai, Cui; Yuan, Xingzhong; Luo, Xiangying; Wang, Cong; Xu, Piao; Huang, Chao

    2015-08-01

    As lead is one of the most hazardous heavy metals in river ecosystem, the influence of exogenous lead pollution on enzyme activities and organic matter degradation in the surface of river sediment with high moisture content were studied at laboratory scale. The dynamic changes of urease, catalase, protease activities, organic matter content, and exchangeable or ethylenediaminetetraacetic acid (EDTA)-extractable Pb concentration in sediment were monitored during different levels of exogenous lead infiltrating into sediment. At the early stage of incubation, the activities of catalase and protease were inhibited, whereas the urease activities were enhanced with different levels of exogenous lead. Organic matter content in polluted sediment with exogenous lead was lower than control and correlated with enzyme activities. In addition, the effects of lead on the three enzyme activities were strongly time-dependent and catalase activities showed lower significant difference (P < 0.05) than urease and protease. Correlations between catalase activities and EDTA-extractable Pb in the experiment were significantly negative. The present findings will improve the understandings about the ecotoxicological mechanisms in sediment.

  7. Effects of exogenous glutathione and cysteine on growth, lead accumulation, and tolerance of Iris lactea var. chinensis.

    Science.gov (United States)

    Yuan, Haiyan; Zhang, Yongxia; Huang, Suzhen; Yang, Yongheng; Gu, Chunsun

    2015-02-01

    Effects of exogenous reduced glutathione (GSH) and cysteine (Cys) on growth, lead (Pb) accumulation, and nonprotein thiol (NPT) contents of Iris lactea var. chinensis under 100 and 500 mg L(-1) Pb stress were studied. Our results showed that 500 mg L(-1) Pb stress caused a dramatical decline in fresh weights, while the reduction of aboveground biomass was alleviated by exogenous GSH and Cys even though keeping higher Pb contents in roots and shoots. Exogenous GSH and Cys could enhance Pb accumulation in the shoots and roots compared with single Pb treatment. The promoting effect of GSH to Pb accumulation was larger than the effect of Cys, and the Pb contents in the shoots and roots treated with 500 mg L(-1) Pb + GSH reached 1,712 and 14,603 mg kg(-1), about 4.19 and 2.78 times of single 500 mg L(-1) Pb treatment, respectively. Microscopic imaging of Pb in roots and leaves showed that higher intensive fluorescence was observed in cell wall of root epidermis, stele, vascular tissues of the roots, and sclerenchyma cells of leaves treated with 500 mg L(-1) Pb + GSH and treated with 500 mg L(-1) Pb + Cys. Exogenous GSH had an apparent promoting effect on root and shoot GSH synthesis, while exogenous Cys reduced the synthesis of cellular GSH in shoot and increased Cys contents. Pb only induced the synthesis of phytochelatin (PC)2 in roots, and the PC2 content declined in GSH- and Cys-treated plant roots. These results suggested that GSH synthesis was a more effective approach to improve Pb accumulation and translocation of I. lactea var. chinensis. Further analysis of protein expression in plants by exogenous GSH and buthionine sulfoximine (BSO) application showed that the proteins regulated by GSH and BSO may constitute various enzymes involved in GSH biosynthesis and play certain roles in Pb accumulation and tolerance of I. lactea var. chinensis.

  8. Residual volume measurements in CAPD patients with exogenous and endogenous solutes

    NARCIS (Netherlands)

    Imholz, A. L.; Koomen, G. C.; Struijk, D. G.; Arisz, L.; Krediet, R. T.

    1992-01-01

    Accurate residual volume (RV) measurements are needed in studies on fluid kinetics during CAPD. In this study 10 stable CAPD patients were examined twice within 1 week. On both occasions RV after drainage was calculated by the indicator dilution method. Exogenous (dextran 70, inulin) and endogenous

  9. Cardiovascular Risks of Exogenous Testosterone Use Among Men: A Systematic Review and Meta-Analysis.

    Science.gov (United States)

    Alexander, G Caleb; Iyer, Geetha; Lucas, Eleanor; Lin, Dora; Singh, Sonal

    2017-03-01

    We sought to evaluate whether exogenous testosterone therapy is associated with increased risk of serious cardiovascular events as compared with other treatments or placebo. Study selection included randomized controlled trials (RCTs) and observational studies that enrolled men aged 18 years or older receiving exogenous testosterone for 3 or more days. The primary outcomes were death due to all causes, myocardial infarction, and stroke. Secondary outcomes were other hard clinical outcomes such as heart failure, arrhythmia, and cardiac procedures. Peto odds ratio was used to pool data from RCTs. Risk of bias was assessed using Cochrane Collaboration tool and Newcastle and Ottawa scale, respectively. The strength of evidence was evaluated using the Grades of Recommendation, Assessment, Development, and Evaluation Working Group approach. A total of 39 RCTs and 10 observational studies were included. Meta-analysis was done using data from 30 RCTs. Compared with placebo, exogenous testosterone treatment did not show any significant increase in risk of myocardial infarction (odds ratio [OR] 0.87; 95% CI, 0.39-1.93; 16 RCTs), stroke (OR 2.17; 95% CI, 0.63-7.54; 9 RCTs), or mortality (OR 0.88; 95% CI, 0.55-1.41; 20 RCTs). Observational studies showed marked clinical and methodological heterogeneity. The evidence was rated as very low quality due to the high risk of bias, imprecision, and inconsistency. We did not find any significant association between exogenous testosterone treatment and myocardial infarction, stroke, or mortality in randomized controlled trials. The very low quality of the evidence precludes definitive conclusion on the cardiovascular effects of testosterone. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Cholecystokinin receptor-1 mediates the inhibitory effects of exogenous cholecystokinin octapeptide on cellular morphine dependence

    Directory of Open Access Journals (Sweden)

    Wen Di

    2012-06-01

    Full Text Available Abstract Background Cholecystokinin octapeptide (CCK-8, the most potent endogenous anti-opioid peptide, has been shown to regulate the processes of morphine dependence. In our previous study, we found that exogenous CCK-8 attenuated naloxone induced withdrawal symptoms. To investigate the precise effect of exogenous CCK-8 and the role of cholecystokinin (CCK 1 and/or 2 receptors in morphine dependence, a SH-SY5Y cell model was employed, in which the μ-opioid receptor, CCK1/2 receptors, and endogenous CCK are co-expressed. Results Forty-eight hours after treating SH-SY5Y cells with morphine (10 μM, naloxone (10 μM induced a cAMP overshoot, indicating that cellular morphine dependence had been induced. The CCK receptor and endogenous CCK were up-regulated after chronic morphine exposure. The CCK2 receptor antagonist (LY-288,513 at 1–10 μM inhibited the naloxone-precipitated cAMP overshoot, but the CCK1 receptor antagonist (L-364,718 did not. Interestingly, CCK-8 (0.1-1 μM, a strong CCK receptor agonist, dose-dependently inhibited the naloxone-precipitated cAMP overshoot in SH-SY5Y cells when co-pretreated with morphine. The L-364,718 significantly blocked the inhibitory effect of exogenous CCK-8 on the cAMP overshoot at 1–10 μM, while the LY-288,513 did not. Therefore, the CCK2 receptor appears to be necessary for low concentrations of endogenous CCK to potentiate morphine dependence in SH-SY5Y cells. An additional inhibitory effect of CCK-8 at higher concentrations appears to involve the CCK1 receptor. Conclusions This study reveals the difference between exogenous CCK-8 and endogenous CCK effects on the development of morphine dependence, and provides the first evidence for the participation of the CCK1 receptor in the inhibitory effects of exogenous CCK-8 on morphine dependence.

  11. Interactive Effects of Endogenous and Exogenous Nutrition on Larval Development for Crown-Of-Thorns Starfish

    Directory of Open Access Journals (Sweden)

    Ciemon Frank Caballes

    2017-03-01

    Full Text Available Outbreaks of crown-of-thorns starfish are often attributed to step-changes in larval survivorship following anomalous increases in nutrients and food availability. However, larval growth and development is also influenced by the nutritional condition of spawning females, such that maternal provisioning may offset limitations imposed by limited access to exogenous sources of nutrients during the formative stages of larval development. This study examined the individual, additive, and interactive effects of endogenous (maternal diet: Acropora, Porites, mixed, and starved and exogenous (larval diet: high concentration at 104 cells·mL−1, low concentration at 103 algal cells·mL−1, and starved nutrition on the survival, growth, morphology, and development of larvae of the crown-of-thorns starfish. Female starfish on Acropora and mixed diet produced bigger oocytes compared to Porites-fed and starved treatments. Using oocyte size as a proxy for maternal provisioning, endogenous reserves in the oocyte had a strong influence on initial larval survival and development. This suggests that maternal reserves can delay the onset of obligate exogenous food acquisition and allow larvae to endure prolonged periods of poor environmental nutritive conditions or starvation. The influence of exogenous nutrition became more prominent in later stages, whereby none of the starved larvae reached the mid-to-late brachiolaria stage 16 days after the onset of the ability to feed. There was no significant difference in the survival, development, and competency of larvae between high and low food treatments. Under low algal food conditions, larvae compensate by increasing the length of ciliated feeding bands in relation to the maximum length and width, which improve food capture and feeding efficiency. However, the effects of endogenous nutrition persisted in the later developmental stages, as larvae from starved females were unable to develop larger feeding structures

  12. Enhancing tolerance of rice (Oryza sativa) to simulated acid rain by exogenous abscisic acid.

    Science.gov (United States)

    Wu, Xi; Liang, Chanjuan

    2017-02-01

    Abscisic acid (ABA) regulates much important plant physiological and biochemical processes and induces tolerance to different stresses. Here, we studied the regulation of exogenous ABA on adaptation of rice seedlings to simulated acid rain (SAR) stress by measuring biomass dry weight, stomatal conductance, net photosynthesis rate, nutrient elements, and endogenous hormones. The application of 10 μM ABA alleviated the SAR-induced inhibition on growth, stomatal conductance, net photosynthesis rate, and decreases in contents of nutrient (K, Mg, N, and P) and hormone (auxin, gibberellins, and zeatin). Moreover, 10 μM ABA could stimulate the Ca content as signaling molecules under SAR stress. Contrarily, the application of 100 μM ABA aggravated the SAR-induced inhibition on growth, stomatal conductance, net photosynthesis rate, and contents of nutrient and hormone. The results got after a 5-day recovery (without SAR) show that exogenous 10 μM ABA can promote self-restoration process in rice whereas 100 μM ABA hindered the restoration by increasing deficiency of nutrients and disturbing the balance of hormones. These results confirmed that exogenous ABA at proper concentration could enhance the tolerance of rice to SAR stress.

  13. Hypothyroidism in Pancreatic Cancer: Role of Exogenous Thyroid Hormone in Tumor Invasion—Preliminary Observations

    Directory of Open Access Journals (Sweden)

    Konrad Sarosiek

    2016-01-01

    Full Text Available According to the epidemiological studies, about 4.4% of American general elderly population has a pronounced hypothyroidism and relies on thyroid hormone supplements daily. The prevalence of hypothyroidism in our patients with pancreatic cancer was much higher, 14.1%. A retrospective analysis was performed on patients who underwent pancreaticoduodenectomy (Whipple procedure or distal pancreatectomy and splenectomy (DPS at Thomas Jefferson University Hospital, Philadelphia, from 2005 to 2012. The diagnosis of hypothyroidism was correlated with clinicopathologic parameters including tumor stage, grade, and survival. To further understand how thyroid hormone affects pancreatic cancer behavior, functional studies including wound-induced cell migration, proliferation, and invasion were performed on pancreatic cancer cell lines, MiaPaCa-2 and AsPC-1. We found that hypothyroid patients taking exogenous thyroid hormone were more than three times likely to have perineural invasion, and about twice as likely to have higher T stage, nodal spread, and overall poorer prognostic stage (P<0.05. Pancreatic cancer cell line studies demonstrated that exogenous thyroid hormone treatment increased cell proliferation, migration, and invasion (P<0.05. We conclude that exogenous thyroid hormone may contribute to the progression of pancreatic cancer.

  14. Site-Specific Integration of Exogenous Genes Using Genome Editing Technologies in Zebrafish

    Directory of Open Access Journals (Sweden)

    Atsuo Kawahara

    2016-05-01

    Full Text Available The zebrafish (Danio rerio is an ideal vertebrate model to investigate the developmental molecular mechanism of organogenesis and regeneration. Recent innovation in genome editing technologies, such as zinc finger nucleases (ZFNs, transcription activator-like effector nucleases (TALENs and the clustered regularly interspaced short palindromic repeats (CRISPR/CRISPR associated protein 9 (Cas9 system, have allowed researchers to generate diverse genomic modifications in whole animals and in cultured cells. The CRISPR/Cas9 and TALEN techniques frequently induce DNA double-strand breaks (DSBs at the targeted gene, resulting in frameshift-mediated gene disruption. As a useful application of genome editing technology, several groups have recently reported efficient site-specific integration of exogenous genes into targeted genomic loci. In this review, we provide an overview of TALEN- and CRISPR/Cas9-mediated site-specific integration of exogenous genes in zebrafish.

  15. Effects of exogenous melatonin on antioxidant capacity in Actinidia seedlings under salt stress

    Science.gov (United States)

    Xia, Hui; Ni, Zhiyou; Pan, Dongming

    2017-11-01

    To investigate the alleviation of exogenous melatonin (MT) in Actinidia seedlings under 100 mM NaCl stress, one-year-old Actinidia deliciosa seedlings were treated with 0.1, 0.5 and 1μM of exogenous melatonin solution, respectively. The results showed that the antioxidant substance (ASA, TPC, TFC and TFAC) contents and antioxidative capacity (DPPH, ABTS and FRAP) of Actinidia seedlings under salt stress were significantly increased compared with the CK. At the same time, the antioxidant substance contents of Actinidia seedlings with MT pretreatment were significantly higher than those of CK and S, then the antioxidative capacity was improved, and the damage of Actinidia seedlings under salt stress was alleviated. And the treatment with 0.1μM MT solution was the most significant.

  16. Thyroid functions and trace elements in pediatric patients with exogenous obesity.

    Science.gov (United States)

    Cayir, Atilla; Doneray, Hakan; Kurt, Nezahat; Orbak, Zerrin; Kaya, Avni; Turan, Mehmet Ibrahim; Yildirim, Abdulkadir

    2014-02-01

    Obesity is a multifactorial disease developing following impairment of the energy balance. The endocrine system is known to be affected by the condition. Serum thyroid hormones and trace element levels have been shown to be affected in obese children. Changes in serum thyroid hormones may result from alterations occurring in serum trace element levels. The aim of this study was to evaluate whether or not changes in serum thyroid hormone levels in children with exogenous obesity are associated with changes in trace element levels. Eighty-five children diagnosed with exogenous obesity constituted the study group, and 24 age- and sex-matched healthy children made up the control group. Serum thyroid stimulating hormone (TSH), free thyroxine (fT4), free triiodothyronine (fT3), thyroglobulin (TG), selenium (Se), zinc (Zn), copper (Cu), and manganese (Mn) levels in the study group were measured before and at the third and sixth months of treatment, and once only in the control group. Pretreatment fT4 levels in the study group rose significantly by the sixth month (p = 0.006). Zn levels in the patient group were significantly low compared to the control group (p = 0.009). Mn and Se levels in the obese children before and at the third and sixth months of treatment were significantly higher than those of the control group (p = 0.001, p = 0.001). In conclusion, fT4, Zn, Cu, Mn, and Se levels are significantly affected in children diagnosed with exogenous obesity. The change in serum fT4 levels is not associated with changes in trace element concentrations.

  17. An interpretable LSTM neural network for autoregressive exogenous model

    OpenAIRE

    Guo, Tian; Lin, Tao; Lu, Yao

    2018-01-01

    In this paper, we propose an interpretable LSTM recurrent neural network, i.e., multi-variable LSTM for time series with exogenous variables. Currently, widely used attention mechanism in recurrent neural networks mostly focuses on the temporal aspect of data and falls short of characterizing variable importance. To this end, our multi-variable LSTM equipped with tensorized hidden states is developed to learn variable specific representations, which give rise to both temporal and variable lev...

  18. Exogenous ochronosis after prolonged use of topical hydroquinone (2% in a 50-year-old Indian female

    Directory of Open Access Journals (Sweden)

    Vijay Gandhi

    2012-01-01

    Full Text Available Ochronosis is a rare disease characterized by speckled and diffuse pigmentation symmetrically over the face, neck, and photo-exposed areas. It is characterized histologically by banana-shaped ochre-colored deposits in the dermis. It can present in exogenous or endogenous form. We report a case of exogenous ochronosis in a 50-year-old Indian woman after prolonged use of topical hydroquinone which is a rare complication with a commonly used drug which is available over the counter.

  19. Multivariate Self-Exciting Threshold Autoregressive Models with eXogenous Input

    OpenAIRE

    Addo, Peter Martey

    2014-01-01

    This study defines a multivariate Self--Exciting Threshold Autoregressive with eXogenous input (MSETARX) models and present an estimation procedure for the parameters. The conditions for stationarity of the nonlinear MSETARX models is provided. In particular, the efficiency of an adaptive parameter estimation algorithm and LSE (least squares estimate) algorithm for this class of models is then provided via simulations.

  20. Response to exogenous surfactant is different during open lung and conventional ventilation

    NARCIS (Netherlands)

    van Kaam, Anton H.; Haitsma, Jack J.; Dik, Willem A.; Naber, Birgitta A.; Alblas, Elise H.; de Jaegere, Anne; Kok, Joke H.; Lachmann, Burkhard

    2004-01-01

    Objective: Previous studies have shown that the efficacy of exogenous surfactant is dose-dependent during conventional positive pressure ventilation (PPVCON). The present study aimed to determine whether this dose-dependent relationship is also present during open lung (OLC) ventilation. We also

  1. Neutral endopeptidase 24.11 is important for the degradation of both endogenous and exogenous glucagon in anesthetized pigs

    DEFF Research Database (Denmark)

    Trebbien, Ramona; Klarskov, Letty; Olesen, Mette

    2004-01-01

    , a selective NEP inhibitor, on plasma levels of endogenous and exogenous glucagon was examined in anesthetized pigs. Candoxatril increased endogenous glucagon concentrations, from 6.3 +/- 2.5 to 20.7 +/- 6.3 pmol/l [COOH-terminal (C)-RIA, P ...-RIA). This study provides evidence that NEP 24.11 is an important mediator of the degradation of both endogenous and exogenous glucagon in vivo....

  2. Discriminating the endogenous and exogenous urinary estrogens in human by isotopic ratio mass spectrometry and its potential clinical value.

    Science.gov (United States)

    Yang, Sheng; Zhang, Dapeng; Xu, Youxuan; Wang, Xiaobing; Liu, Xin; Wang, Shan; Wang, Jingzhu; Wu, Moutian; He, Zhenwen; Zhao, Jian; Yuan, Hong

    2013-02-01

    Estrogens were prohibited in the food producing animals by European Union (96/22/EC directive) and added to the Report on Carcinogens in United States since 2002. Due to very low concentration in serum or urine (~pg/mL), the method of control its abuse had not been fully developed. The endogenous estrogens were separated from urines of 18 adult men and women. The exogenous estrogens were chemical reference standards and over the counter preparations. Two patients of dysfunctional uterine bleeding (DUB) administered exogenous estradiol and the urines were collected for 72 h. The urinary estrogens were separated by high-performance liquid chromatography (HPLC) and confirmed. The exogenous and exogenous estrogens were analyzed by gas chromatography combustion isotope ratio mass spectrometry (GC-C-IRMS) to determine the (13)C/(12)C ratio (δ(13)C‰). The δ(13)C‰ values of reference standard of E1, E2, and E3 were -29.36±0.72, -27.98±0.35, -27.62±0.51, respectively. The δ(13)C‰ values of the endogenous E1, E2, and E3 were -21.62±1.07, -22.14±0.98, and -21.88±1.16, with Pendogenous and exogenous urinary estrogen in human. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. The influence of endogenous and exogenous sex hormones on systemic lupus erythematosus in pre- and postmenopausal women.

    Science.gov (United States)

    Grygiel-Górniak, Bogna; Puszczewicz, Mariusz Jacek

    2014-09-01

    Systemic lupus erythematosus (SLE or lupus) is a chronic inflammatory disease that occurs mainly in women. Typically, symptoms appear within the first few years of adolescence, but currently an increase can be observed in the percentage of postmenopausal women with this condition. This is possibly due to the sophisticated treatment of the disease, which significantly improves the survival curve and prognosis. Genetic and environmental factors are involved in the development of SLE. Both regulation of the immune system and the activity of this disease are influenced by a variety of hormones, including: 17β-estradiol, testosterone, prolactin, progesterone and dehydroepiandrosterone (DHEA). Early menarche, menstrual cyclicity, the total number of years characterized by ovulatory cycles and early menopause are correlated with the development of SLE. Because of the health risks, attempts are increasingly being made to evaluate the impact of exogenous hormones (especially those applied exogenously) on the course of SLE. In particular, the role of estrogens is being highlighted, either endo- or exogenous, including oral contraceptives (OC), therapy used in the treatment of infertility, and hormonal replacement therapy (HRT). The purpose of this manuscript is the revision of the literature concerning the impact of both endo- and exogenous estrogens on the development of lupus, inducement of flares and any possible complications.

  4. Exogenous reference gene normalization for real-time reverse transcription-polymerase chain reaction analysis under dynamic endogenous transcription.

    Science.gov (United States)

    Johnston, Stephen; Gallaher, Zachary; Czaja, Krzysztof

    2012-05-15

    Quantitative real-time reverse transcription-polymerase chain reaction (qPCR) is widely used to investigate transcriptional changes following experimental manipulations to the nervous system. Despite the widespread utilization of qPCR, the interpretation of results is marred by the lack of a suitable reference gene due to the dynamic nature of endogenous transcription. To address this inherent deficiency, we investigated the use of an exogenous spike-in mRNA, luciferase, as an internal reference gene for the 2(-∆∆Ct) normalization method. To induce dynamic transcription, we systemically administered capsaicin, a neurotoxin selective for C-type sensory neurons expressing the TRPV-1 receptor, to adult male Sprague-Dawley rats. We later isolated nodose ganglia for qPCR analysis with the reference being either exogenous luciferase mRNA or the commonly used endogenous reference β-III tubulin. The exogenous luciferase mRNA reference clearly demonstrated the dynamic expression of the endogenous reference. Furthermore, variability of the endogenous reference would lead to misinterpretation of other genes of interest. In conclusion, traditional reference genes are often unstable under physiologically normal situations, and certainly unstable following the damage to the nervous system. The use of exogenous spike-in reference provides a consistent and easily implemented alternative for the analysis of qPCR data.

  5. Leaves Of Cut Rose Flower Convert Exogenously Applied Glucose To Sucrose And Translocate It To Petals

    Directory of Open Access Journals (Sweden)

    Horibe Takanori

    2014-12-01

    Full Text Available To understand the role that the leaves play in the translocation of soluble carbohydrates in cut rose flowers, we first evaluated the effect of leaf removal on flower quality and the sugar content in petals. Cut rose flowers with leaves had higher soluble sugar content in petals compared with cut flower without leaves. Next, we treated cut flowers with radioactive glucose to clarify translocation routes of exogenously applied sugar. There was no significant difference between the specific radioactivity of sucrose and glucose in leaves, but specific radioactivity of sucrose in petals was much higher than that of glucose. These results suggested that most of the exogenously applied glucose first moved to the leaves, where it was converted into sucrose and then the synthesised sucrose was translocated to the petals. Our results showed that the leaves of cut rose flowers play an important role in the metabolism and transportation of exogenously applied soluble carbohydrates toward the petals, thus contributing to sustaining the post-harvest quality.

  6. In vitro investigation of the effects of exogenous sugammadex on coagulation in orthopedic surgical patients.

    Science.gov (United States)

    Lee, Il Ok; Kim, Young Sung; Chang, Hae Wone; Kim, Heezoo; Lim, Byung Gun; Lee, Mido

    2018-05-24

    Previous studies have shown that sugammadex resulted in the prolongation of prothrombin time and activated partial thromboplastin time. In this study, we aimed to investigate the in vitro effects of exogenous sugammadex on the coagulation variables of whole blood in healthy patients who underwent orthopedic surgery. The effects of sugammadex on coagulations were assessed using thromboelastography (TEG) in kaolin-activated citrated blood samples taken from 14 healthy patients who underwent orthopedic surgery. The in vitro effects of three different concentrations of sugammadex (42, 193, and 301 μg mL - 1 ) on the TEG profiles were compared with those of the control (0 μg mL - 1 ). Previous studies indicated that these exogenous concentrations correspond to the approximate maximum plasma concentrations achieved after the administration of 4, 16, and 32 mg kg - 1 sugammadex to healthy subjects. Increased sugammadex concentrations were significantly associated with reduced coagulation, as evidenced by increases in reaction time (r), coagulation time, and time to maximum rate of thrombus generation (TMRTG), and decreases in the angle, maximum amplitude, and maximum rate of thrombus generation. Compared with the control, the median percentage change (interquartile range) in the TEG values of the samples treated with the highest exogenous sugammadex concentration was the greatest for r, 53% (26, 67.3%), and TMRTG, 48% (26, 59%). This in vitro study suggests that supratherapeutic doses of exogenous sugammadex might be associated with moderate hypocoagulation in the whole blood of healthy subjects. identifier:  UMIN000029081 , registered 11 September 2017.

  7. Comprehensive RNA-Seq Analysis on the Regulation of Tomato Ripening by Exogenous Auxin.

    Directory of Open Access Journals (Sweden)

    Jiayin Li

    Full Text Available Auxin has been shown to modulate the fruit ripening process. However, the molecular mechanisms underlying auxin regulation of fruit ripening are still not clear. Illumina RNA sequencing was performed on mature green cherry tomato fruit 1 and 7 days after auxin treatment, with untreated fruit as a control. The results showed that exogenous auxin maintained system 1 ethylene synthesis and delayed the onset of system 2 ethylene synthesis and the ripening process. At the molecular level, genes associated with stress resistance were significantly up-regulated, but genes related to carotenoid metabolism, cell degradation and energy metabolism were strongly down-regulated by exogenous auxin. Furthermore, genes encoding DNA demethylases were inhibited by auxin, whereas genes encoding cytosine-5 DNA methyltransferases were induced, which contributed to the maintenance of high methylation levels in the nucleus and thus inhibited the ripening process. Additionally, exogenous auxin altered the expression patterns of ethylene and auxin signaling-related genes that were induced or repressed in the normal ripening process, suggesting significant crosstalk between these two hormones during tomato ripening. The present work is the first comprehensive transcriptome analysis of auxin-treated tomato fruit during ripening. Our results provide comprehensive insights into the effects of auxin on the tomato ripening process and the mechanism of crosstalk between auxin and ethylene.

  8. [Research on problem of exogenous pollution of Chinese medicine resources from perspective of circular economy].

    Science.gov (United States)

    Yang, Yi; Tian, Kan; Tian, Hong

    2016-08-01

    Based on the in-depth analysis of the current situation of the exogenous pollution of Chinese medicine resources, this research mainly discusses the intrinsic link and practical significance between the development of circular economy in Chinese medicine resources and the control of the problem of the exogenous pollution from the perspective of circular economy, and proposes some suggestions to develop the recycling economy of Chinese medicine resources from the establishment of legal system, mechanism of development, production norms, industry standards and regulatory system of the recycling of Chinese medicine resources. Copyright© by the Chinese Pharmaceutical Association.

  9. Exogenous fatty acids and niacin on acute prostaglandin D2 production in human myeloid cells.

    Science.gov (United States)

    Montserrat-de la Paz, Sergio; Bermudez, Beatriz; Lopez, Sergio; Naranjo, Maria C; Romero, Yolanda; Bando-Hidalgo, Maria J; Abia, Rocio; Muriana, Francisco J G

    2017-01-01

    Niacin activates HCA 2 receptor that results in the release of PGD 2 . However, little is known on PGD 2 -producing cells and the role of fatty acids. Notably M-CSF macrophages exhibited a timely dependent PGD 2 production upon niacin challenge. Short pretreatment of M-CSF macrophages with autologous postprandial TRLs induced the down-regulation of HCA 2 gene and up-regulation of genes encoding COX1 and COX2 enzymes in a fatty acid-dependent manner. These effects were paralleled by a higher PGD 2 production with postprandial TRL-SFAs. The niacin-mediated transcriptional activity of all genes involved in PGD 2 biosynthesis was desensitized in a time-dependent manner by postprandial TRLs, leading to a decreased PGD 2 release. In vivo, the net excursions of PGD 2 in plasma followed similar fatty acid-dependent patterns as those found for PGD 2 release in vitro. The predominant fatty acid class in the diet acutely modulates PGD 2 biosynthetic pathway both in vitro and in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Managers with and without Style: Evidence Using Exogenous Variation

    OpenAIRE

    C. Edward Fee; Charles J. Hadlock; Joshua R. Pierce

    2013-01-01

    In a large panel of Compustat firms, we find that firm policy changes after exogenous CEO departures do not display abnormally high levels of variability, casting doubt on the presence of idiosyncratic-style effects in policy choices. After endogenous CEO departures, we do detect abnormally large policy changes. These changes are larger when the firm is likely to draw from a deeper pool of replacement CEO candidates, suggesting the presence of causal-style effects that are anticipated by the ...

  11. Control of exogenous factors affecting plasma homovanillic acid concentration.

    Science.gov (United States)

    Davidson, M; Giordani, A B; Mohs, R C; Mykytyn, V V; Platt, S; Aryan, Z S; Davis, K L

    1987-04-01

    Measurements of plasma homovanillic acid (pHVA) concentrations appear to be a valid research strategy in psychiatric disorders in which a central dopamine (DA) abnormality has been implicated. This study provides guidance about the control of some of the exogenous factors affecting pHVA concentrations. Fasting for 14 hours eliminates the dietary effects on pHVA in healthy human subjects. Changing position, walking for 30 minutes, or smoking two cigarettes has no effect on pHVA concentrations.

  12. Effects of exogenous glucagon-like peptide-2 and distal bowel resection on intestinal and systemic adaptive responses in rats.

    Science.gov (United States)

    Lai, Sarah W; de Heuvel, Elaine; Wallace, Laurie E; Hartmann, Bolette; Holst, Jens J; Brindle, Mary E; Chelikani, Prasanth K; Sigalet, David L

    2017-01-01

    To determine the effects of exogenous glucagon-like peptide-2 (GLP-2), with or without massive distal bowel resection, on adaptation of jejunal mucosa, enteric neurons, gut hormones and tissue reserves in rats. GLP-2 is a gut hormone known to be trophic for small bowel mucosa, and to mimic intestinal adaptation in short bowel syndrome (SBS). However, the effects of exogenous GLP-2 and SBS on enteric neurons are unclear. Sprague Dawley rats were randomized to four treatments: Transected Bowel (TB) (n = 8), TB + GLP-2 (2.5 nmol/kg/h, n = 8), SBS (n = 5), or SBS + GLP-2 (2.5 nmol/kg/h, n = 9). SBS groups underwent a 60% jejunoileal resection with cecectomy and jejunocolic anastomosis. All rats were maintained on parenteral nutrition for 7 d. Parameters measured included gut morphometry, qPCR for hexose transporter (SGLT-1, GLUT-2, GLUT-5) and GLP-2 receptor mRNA, whole mount immunohistochemistry for neurons (HuC/D, VIP, nNOS), plasma glucose, gut hormones, and body composition. Resection increased the proportion of nNOS immunopositive myenteric neurons, intestinal muscularis propria thickness and crypt cell proliferation, which were not recapitulated by GLP-2 therapy. Exogenous GLP-2 increased jejunal mucosal surface area without affecting enteric VIP or nNOS neuronal immunopositivity, attenuated resection-induced reductions in jejunal hexose transporter abundance (SGLT-1, GLUT-2), increased plasma amylin and decreased peptide YY concentrations. Exogenous GLP-2 attenuated resection-induced increases in blood glucose and body fat loss. Exogenous GLP-2 stimulates jejunal adaptation independent of enteric neuronal VIP or nNOS changes, and has divergent effects on plasma amylin and peptide YY concentrations. The novel ability of exogenous GLP-2 to modulate resection-induced changes in peripheral glucose and lipid reserves may be important in understanding the whole-body response following intestinal resection, and is worthy of further study.

  13. Fructose and Sucrose Intake Increase Exogenous  Carbohydrate Oxidation during Exercise

    Directory of Open Access Journals (Sweden)

    Jorn Trommelen

    2017-02-01

    Full Text Available Peak exogenous carbohydrate oxidation rates typically reach ~1 g∙min−1 during exercise when ample glucose or glucose polymers are ingested. Fructose co‐ingestion has been shown to further increase exogenous carbohydrate oxidation rates. The purpose of this study was to assess the impact of fructose co‐ingestion provided either as a monosaccharide or as part of the disaccharide sucrose on exogenous carbohydrate oxidation rates during prolonged exercise in trained cyclists. Ten trained male cyclists (VO2peak: 65 ± 2 mL∙kg−1∙min−1 cycled on four different occasions for 180 min at 50% Wmax during which they consumed a carbohydrate solution providing 1.8 g∙min−1 of glucose (GLU, 1.2 g∙min−1 glucose + 0.6 g∙min−1 fructose (GLU + FRU, 0.6 g∙min−1 glucose + 1.2 g∙min−1 sucrose (GLU + SUC, or water (WAT. Peak exogenous carbohydrate oxidation rates did not differ between GLU + FRU and GLU + SUC (1.40 ± 0.06 vs. 1.29 ± 0.07 g∙min−1, respectively, p = 0.999, but were 46% ± 8% higher when compared to GLU (0.96 ± 0.06 g∙min−1: p < 0.05. In line, exogenous carbohydrate oxidation rates during the latter 120 min of exercise were 46% ± 8% higher in GLU + FRU or GLU + SUC compared with GLU (1.19 ± 0.12, 1.13 ± 0.21, and 0.82 ± 0.16 g∙min−1, respectively, p < 0.05. We conclude that fructose co‐ingestion (0.6 g∙min−1 with glucose (1.2 g∙min−1 provided either as a monosaccharide or as sucrose strongly increases exogenous carbohydrate oxidation rates during prolonged exercise in trained cyclists.

  14. Proteomic and physiological analyses reveal the role of exogenous spermidine on cucumber roots in response to Ca(NO3)2 stress.

    Science.gov (United States)

    Du, Jing; Guo, Shirong; Sun, Jin; Shu, Sheng

    2018-05-01

    The mechanism of exogenous Spd-induced Ca(NO 3 ) 2 stress tolerance in cucumber was studied by proteomics and physiological analyses. Protein-protein interaction network revealed 13 key proteins involved in Spd-induced Ca(NO 3 ) 2 stress resistance. Ca(NO 3 ) 2 stress is one of the major reasons for secondary salinization that limits cucumber plant development in greenhouse. The conferred protective role of exogenous Spd on cucumber in response to Ca(NO 3 ) 2 stress cues involves changes at the cellular and physiological levels. To investigate the molecular foundation of exogenous Spd in Ca(NO 3 ) 2 stress tolerance, a proteomic approach was performed in our work. After a 9 days period of Ca(NO 3 ) 2 stress and/or exogenous Spd, 71 differential protein spots were confidently identified. The resulting proteins were enriched in seven different categories of biological processes, including protein metabolism, carbohydrate and energy metabolism, ROS homeostasis and stress defense, cell wall related, transcription, others and unknown. Protein metabolism (31.2%), carbohydrate and energy metabolism (15.6%), ROS homeostasis and stress defense (32.5%) were the three largest functional categories in cucumber root and most of them were significantly increased by exogenous Spd. The Spd-responsive protein interaction network revealed 13 key proteins, whose accumulation changes could be critical for Spd-induced resistance; all 13 proteins were upregulated by Spd at transcriptional and protein levels in response to Ca(NO 3 ) 2 stress. Furthermore, accumulation of antioxidant enzymes, non-enzymatic antioxidant and polyamines, along with reduction of H 2 O 2 and MDA, were detected after exogenous Spd application during Ca(NO 3 ) 2 stress. The results of these proteomic and physiological analyses in cucumber root may facilitate a better understanding of the underlying mechanism of Ca(NO 3 ) 2 stress tolerance mediated by exogenous Spd.

  15. Measurement of Endogenous versus Exogenous Formaldehyde-Induced DNA-Protein Crosslinks in Animal Tissues by Stable Isotope Labeling and Ultrasensitive Mass Spectrometry.

    Science.gov (United States)

    Lai, Yongquan; Yu, Rui; Hartwell, Hadley J; Moeller, Benjamin C; Bodnar, Wanda M; Swenberg, James A

    2016-05-01

    DNA-protein crosslinks (DPC) arise from a wide range of endogenous and exogenous chemicals, such as chemotherapeutic drugs and formaldehyde. Importantly, recent identification of aldehydes as endogenous genotoxins in Fanconi anemia has provided new insight into disease causation. Because of their bulky nature, DPCs pose severe threats to genome stability, but previous methods to measure formaldehyde-induced DPCs were incapable of discriminating between endogenous and exogenous sources of chemical. In this study, we developed methods that provide accurate and distinct measurements of both exogenous and endogenous DPCs in a structurally specific manner. We exposed experimental animals to stable isotope-labeled formaldehyde ([(13)CD2]-formaldehyde) by inhalation and performed ultrasensitive mass spectrometry to measure endogenous (unlabeled) and exogenous ((13)CD2-labeled) DPCs. We found that exogenous DPCs readily accumulated in nasal respiratory tissues but were absent in tissues distant to the site of contact. This observation, together with the finding that endogenous formaldehyde-induced DPCs were present in all tissues examined, suggests that endogenous DPCs may be responsible for increased risks of bone marrow toxicity and leukemia. Furthermore, the slow rate of DPC repair provided evidence for the persistence of DPCs. In conclusion, our method for measuring endogenous and exogenous DPCs presents a new perspective for the potential health risks inflicted by endogenous formaldehyde and may inform improved disease prevention and treatment strategies. Cancer Res; 76(9); 2652-61. ©2016 AACR. ©2016 American Association for Cancer Research.

  16. Drought and exogenous abscisic acid alter hydrogen peroxide accumulation and differentially regulate the expression of two maize RD22-like genes.

    Science.gov (United States)

    Phillips, Kyle; Ludidi, Ndiko

    2017-08-18

    Increased biosynthesis of abscisic acid (ABA) occurs in plants in response to water deficit, which is mediated by changes in the levels of reactive oxygen species such as H 2 O 2 . Water deficit and ABA induce expression of some RD22-like proteins. This study aimed to evaluate the effect of water deficit and exogenous ABA (50 µM ABA applied every 24 hours for a total of 72 hours) on H 2 O 2 content in Zea mays (maize) and to characterise genes encoding two putative maize RD22-like proteins (designated ZmRD22A and ZmRD22B). The expression profiles of the two putative maize RD22-like genes in response to water deficit and treatment with ABA were examined in leaves. In silico analyses showed that the maize RD22-like proteins share domain organisation with previously characterized RD22-like proteins. Both water deficit and exogenous ABA resulted in increased H 2 O 2 content in leaves but the increase was more pronounced in response to water deficit than to exogenous ABA. Lignin content was not affected by exogenous ABA, whereas it was decreased by water deficit. Expression of both RD22-like genes was up-regulated by drought but the ZmRD22A gene was not influenced by exogenous ABA, whereas ZmRD22B was highly responsive to exogenous ABA.

  17. Exogenous glutamate induces short and long-term potentiation in the rat medial vestibular nuclei.

    Science.gov (United States)

    Grassi, S; Frondaroli, A; Pessia, M; Pettorossi, V E

    2001-08-08

    In rat brain stem slices, high concentrations of exogenous glutamate induce long-term potentiation (LTP) of the field potentials evoked in the medial vestibular nuclei (MVN) by vestibular afferent stimulation. At low concentrations, glutamate can also induce short-term potentiation (STP), indicating that LTP and STP are separate events depending on the level of glutamatergic synapse activation. LTP and STP are prevented by blocking NMDA receptors and nitric oxide (NO) synthesis. Conversely, blocking platelet-activating factor (PAF) and group I metabotropic glutamate receptors only prevents the full development of LTP. Moreover, in the presence of blocking agents, glutamate causes transient inhibition, suggesting that when potentiation is impeded, exogenous glutamate can activate presynaptic mechanisms that reduce glutamate release.

  18. Exogenous T3 toxicosis following consumption of a contaminated weight loss supplement.

    Science.gov (United States)

    D'Arcy, R; McDonnell, M; Spence, K; Courtney, C H

    2017-01-01

    A 42-year-old male presented with a one-week history of palpitations and sweating episodes. The only significant history was of longstanding idiopathic dilated cardiomyopathy. Initial ECG demonstrated a sinus tachycardia. Thyroid function testing, undertaken as part of the diagnostic workup, revealed an un-measureable thyroid-stimulating hormone (TSH) and free thyroxine (T 4 ). Upon questioning the patient reported classical thyrotoxic symptoms over the preceding weeks. Given the persistence of symptoms free tri-iodothyronine (T 3 ) was measured and found to be markedly elevated at 48.9 pmol/L (normal range: 3.1-6.8 pmol/L). No goitre or nodular disease was palpable in the neck. Historically there had never been any amiodarone usage. Radionucleotide thyroid uptake imaging ( 123 I) demonstrated significantly reduced tracer uptake in the thyroid. Upon further questioning the patient reported purchasing a weight loss product online from India which supposedly contained sibutramine. He provided one of the tablets and laboratory analysis confirmed the presence of T 3 in the tablet. Full symptomatic resolution and normalised thyroid function ensued upon discontinuation of the supplement. Free tri-iodothyronine (T 3 ) measurement may be useful in the presence of symptoms suggestive of thyrotoxicosis with discordant thyroid function tests.Thyroid uptake scanning can be a useful aid to differentiating exogenous hormone exposure from endogenous hyperthyroidism.Ingestion of thyroid hormone may be inadvertent in cases of exogenous thyrotoxicosis.Medicines and supplements sourced online for weight loss may contain thyroxine (T 4 ) or T 3 and should be considered as a cause of unexplained exogenous hyperthyroidism.

  19. How exogenous nitric oxide regulates nitrogen assimilation in wheat seedlings under different nitrogen sources and levels.

    Science.gov (United States)

    Balotf, Sadegh; Islam, Shahidul; Kavoosi, Gholamreza; Kholdebarin, Bahman; Juhasz, Angela; Ma, Wujun

    2018-01-01

    Nitrogen (N) is one of the most important nutrients for plants and nitric oxide (NO) as a signaling plant growth regulator involved in nitrogen assimilation. Understanding the influence of exogenous NO on nitrogen metabolism at the gene expression and enzyme activity levels under different sources of nitrogen is vitally important for increasing nitrogen use efficiency (NUE). This study investigated the expression of key genes and enzymes in relation to nitrogen assimilation in two Australian wheat cultivars, a popular high NUE cv. Spitfire and a normal NUE cv. Westonia, under different combinations of nitrogen and sodium nitroprusside (SNP) as the NO donor. Application of NO increased the gene expressions and activities of nitrogen assimilation pathway enzymes in both cultivars at low levels of nitrogen. At high nitrogen supplies, the expressions and activities of N assimilation genes increased in response to exogenous NO only in cv. Spitfire but not in cv. Westonia. Exogenous NO caused an increase in leaf NO content at low N supplies in both cultivars, while under high nitrogen treatments, cv. Spitfire showed an increase under ammonium nitrate (NH4NO3) treatment but cv. Westonia was not affected. N assimilation gene expression and enzyme activity showed a clear relationship between exogenous NO, N concentration and N forms in primary plant nitrogen assimilation. Results reveal the possible role of NO and different nitrogen sources on nitrogen assimilation in Triticum aestivum plants.

  20. Dual roles of endogenous and exogenous galectin-1 in the control of testicular immunopathology.

    Science.gov (United States)

    Pérez, Cecilia V; Gómez, Leticia G; Gualdoni, Gisela S; Lustig, Livia; Rabinovich, Gabriel A; Guazzone, Vanesa A

    2015-07-30

    Galectin-1 (Gal-1), a proto-type member of galectin family, is highly expressed in immune privileged sites, including the testis. However, in spite of considerable progress the relevance of endogenous and exogenous Gal-1 in testis pathophysiology have not yet been explored. Here we evaluated the in vivo roles of Gal-1 in experimental autoimmune orchitis (EAO), a well-established model of autoimmune testicular inflammation associated with subfertility and infertility. A significant reduction in the incidence and severity of EAO was observed in mice genetically deficient in Gal-1 (Lgals1(-/-)) versus wild-type (WT) mice. Testicular histopathology revealed the presence of multifocal testicular damage in WT mice characterized by an interstitial mononuclear cell infiltrate and different degrees of germ cell sloughing of seminiferous tubules. TUNEL assay and assessment of active caspase-3 expression, revealed the prevalence of apoptotic spermatocytes mainly localized in the adluminal compartment of seminiferous tubules in EAO mice. A significant increased number of TUNEL-positive germ cells was detected in EAO testis from WT compared with Lgals1(-/-) mice. In contrast, exogenous administration of recombinant Gal-1 to WT mice undergoing EAO attenuated the severity of the disease. Our results unveil a dual role of endogenous versus exogenous Gal-1 in the control of autoimmune testis inflammation.

  1. Infection, fever, and exogenous and endogenous pyrogens: some concepts have changed.

    Science.gov (United States)

    Dinarello, Charles A

    2004-01-01

    For many years, it was thought that bacterial products caused fever via the intermediate production of a host-derived, fever-producing molecule, called endogenous pyrogen (EP). Bacterial products and other fever-producing substances were termed exogenous pyrogens. It was considered highly unlikely that exogenous pyrogens caused fever by acting directly on the hypothalamic thermoregulatory center since there were countless fever-producing microbial products, mostly large molecules, with no common physical structure. In vivo and in vitro, lipopolysaccharides (LPSs) and other microbial products induced EP, subsequently shown to be interleukin-1 (IL-1). The concept of the 'endogenous pyrogen' cause of fever gained considerable support when pure, recombinant IL-1 produced fever in humans and in animals at subnanomolar concentrations. Subsequently, recombinant tumor necrosis factor-alpha (TNF-alpha), IL-6 and other cytokines were also shown to cause fever and EPs are now termed pyrogenic cytokines. However, the concept was challenged when specific blockade of either IL-1 or TNF activity did not diminish the febrile response to LPS, to other microbial products or to natural infections in animals and in humans. During infection, fever could occur independently of IL-1 or TNF activity. The cytokine-like property of Toll-like receptor (TLR) signal transduction provides an explanation by which any microbial product can cause fever by engaging its specific TLR on the vascular network supplying the thermoregulatory center in the anterior hypothalamus. Since fever induced by IL-1, TNF-alpha, IL-6 or TLR ligands requires cyclooxygenase-2, production of prostaglandin E2 (PGE2) and activation of hypothalamic PGE2 receptors provides a unifying mechanism for fever by endogenous and exogenous pyrogens. Thus, fever is the result of either cytokine receptor or TLR triggering; in autoimmune diseases, fever is mostly cytokine mediated whereas both cytokine and TLR account for fever during

  2. [The Influence of New Medium with RGD on Cell Growth,Cell Fusion and Expression of Exogenous Gene].

    Science.gov (United States)

    Wang, Pei-Pei; Wei, Da-Peng; Zhu, Tong-Bo

    2018-03-01

    To investigate the influence of a new culture medium added with RGD on cell growth,cell fusion and expression of exogenous gene. A new medium was prepared by adding different concentrations of RGD to ordinary culture medium. The optimum concentration of RGD was determined by observation of the growth of human pancreatic epithelial cell line HPDE6-C7. After determining the optimum concentration of RGD,different concentrations of cells HPDE6-C7 (5×10 4 ,10 5 ,5×10 5 mL -1 ) were inoculated in the two mediums. The morphology,adherence,growth and density of the cells were observed by inverted microscope; The ratio of clone formation and the positive rate of cloning were compared between the two cultures after fusion; The fluorescence intensity after the transfection of plasmid with green fluorescent protein ( GFP ) and the protein expression after transfection of plasmid with KRAS were observed to campare the expression of exogenous genes between the new medium with ordinary medium. Firstly,the optimal concentration of RGD was 10 ng/mL. Compared with the normal medium,the cultured cells with RGD had better morphology,adhesion and faster proliferation. In addition,both of the number and positive rate of clones formed in the new medium were significantly higher than that in the ordinary medium ( P exogenous gene GFP in the new medium was significantly higher than that in normal medium ( P exogenous gene KRAS of the new medium was also significantly higher than that in normal medium. The new culture medium has highlighted advantages in cell growth,cell fusion and expression of exogenous genes. RGD peptide has widely prospect and potential value in the cell culture. Copyright© by Editorial Board of Journal of Sichuan University (Medical Science Edition).

  3. Degradation of endogenous and exogenous genes of genetically modified rice with Cry1Ab during food processing.

    Science.gov (United States)

    Zhang, Wei; Xing, Fuguo; Selvaraj, Jonathan Nimal; Liu, Yang

    2014-05-01

    In order to assess the degradation of endogenous and exogenous genes during food processing, genetically modified rice with Cry1Ab was used as raw material to produce 4 processed foods: steamed rice, rice noodles, rice crackers, and sweet rice wine. The results showed various processing procedures caused different degrees of degradation of both endogenous and exogenous genes. During the processing of steamed rice and rice noodles, the procedures were so mild that only genes larger than 1500 bp were degraded, and no degradation of NOS terminator and Hpt gene was detected. For rice crackers, frying was the most severe procedure, followed by microwaving, baking, boiling, 1st drying, and 2nd drying. For sweet rice wine, fermentation had more impact on degradation of genes than the other processing procedures. All procedures in this study did not lead to degradation of genes to below 200 bp, except for NOS terminator. In the case of stability of the genes studied during processing of rice crackers and sweet rice wine, SPS gene was the most, followed by the Cry1Ab gene, Hpt gene, Pubi promoter, and NOS terminator. In our study, we gained some information about the degradation of endogenous and exogenous genes during 4 foods processing, compared the different stabilities between endogenous and exogenous genes, and analyzed different effects of procedure on degradation of genes. In addition, the fragments of endogenous and exogenous genes about 200 bp could be detected in final products, except NOS terminator. As a result, we provided some base information about risk assessment of genetically modified (GM) food and appropriate length of fragment to detect GM component in processed foods. © 2014 Institute of Food Technologists®

  4. The response of antioxidant systems in Nostoc sphaeroides against UV-B radiation and the protective effects of exogenous antioxidants

    Science.gov (United States)

    Wang, Gaohong; Hu, Chunxiang; Li, Dunhai; Zhang, Delu; Li, Xiaoyan; Chen, Kun; Liu, Yongding

    UV radiation is one of many harmful factors found in space that are detrimental to organisms on earth in space exploration. In the present work, we examined the role of antioxidant system in Nostoc sphaeroides Kütz (Cyanobacterium) and the effects of exogenously applied antioxidant molecules on its photosynthetic rate under UV-B radiation. It was found that UV-B radiation promoted the activity of antioxidant system to protect photosystem II (PSII) and exogenously applied antioxidant: sodium nitroprusside (SNP) and N-acetylcysteine (NAC) had an obvious protection on PSII activity under UV-B radiation. The activity of superoxide dismutase (SOD, EC 1.15.1.1), catalase (CAT, EC 1.11.1.6), peroxidase (POD, EC 1.11.1.7) and content of MDA (malondialdehyde) and ASC (ascorbate) were improved by 0.5 mM and 1 mM SNP, but 0.1 mM SNP decreased the activity of antioxidant system. Addition of exogenous NAC decreased the activity of SOD, POD, CAT and the content MDA and ASC. In contrast, exogenously applied NAC increased GSH content. The results suggest that exogenous SNP and NAC may protect algae by different mechanisms: SNP may play double roles as both sources of reactive free radicals as well as ROS scavengers in mediating the protective role of PSII on algae under UV-B radiation. On the other hand, NAC functions as an antioxidant or precursor of glutathione, which could protect PSII directly from UV-B radiation.

  5. Clinical breath analysis: Discriminating between human endogenous compounds and exogenous (environmental) chemical confounders

    Science.gov (United States)

    Volatile organic compounds (VOCs) in exhaled breath originate from current or previous environmental exposures (exogenous compounds) and internal metabolic anabolic and catabolic) production (endogenous compounds). The origins of certain VOCs in breath presumed to be endogenous ...

  6. Exogenous abscisic acid alleviates zinc uptake and accumulation in Populus × canescens exposed to excess zinc.

    Science.gov (United States)

    Shi, Wen-Guang; Li, Hong; Liu, Tong-Xian; Polle, Andrea; Peng, Chang-Hui; Luo, Zhi-Bin

    2015-01-01

    A greenhouse experiment was conducted to study whether exogenous abscisic acid (ABA) mediates the responses of poplars to excess zinc (Zn). Populus × canescens seedlings were treated with either basal or excess Zn levels and either 0 or 10 μm ABA. Excess Zn led to reduced photosynthetic rates, increased Zn accumulation, induced foliar ABA and salicylic acid (SA), decreased foliar gibberellin (GA3 ) and auxin (IAA), elevated root H2 O2 levels, and increased root ratios of glutathione (GSH) to GSSG and foliar ratios of ascorbate (ASC) to dehydroascorbate (DHA) in poplars. While exogenous ABA decreased foliar Zn concentrations with 7 d treatments, it increased levels of endogenous ABA, GA3 and SA in roots, and resulted in highly increased foliar ASC accumulation and ratios of ASC to DHA. The transcript levels of several genes involved in Zn uptake and detoxification, such as yellow stripe-like family protein 2 (YSL2) and plant cadmium resistance protein 2 (PCR2), were enhanced in poplar roots by excess Zn but repressed by exogenous ABA application. These results suggest that exogenous ABA can decrease Zn concentrations in P. × canescens under excess Zn for 7 d, likely by modulating the transcript levels of key genes involved in Zn uptake and detoxification. © 2014 John Wiley & Sons Ltd.

  7. The influence of endogenous and exogenous sex hormones on systemic lupus erythematosus in pre- and postmenopausal women

    Directory of Open Access Journals (Sweden)

    Bogna Grygiel-Górniak

    2014-09-01

    Full Text Available Systemic lupus erythematosus (SLE or lupus is a chronic inflammatory disease that occurs mainly in women. Typically, symptoms appear within the first few years of adolescence, but currently an increase can be observed in the percentage of postmenopausal women with this condition. This is possibly due to the sophisticated treatment of the disease, which significantly improves the survival curve and prognosis. Genetic and environmental factors are involved in the development of SLE. Both regulation of the immune system and the activity of this disease are influenced by a variety of hormones, including: 17-estradiol, testosterone, prolactin, progesterone and dehydroepiandrosterone (DHEA. Early menarche, menstrual cyclicity, the total number of years characterized by ovulatory cycles and early menopause are correlated with the development of SLE. Because of the health risks, attempts are increasingly being made to evaluate the impact of exogenous hormones (especially those applied exogenously on the course of SLE. In particular, the role of estrogens is being highlighted, either endo- or exogenous, including oral contraceptives (OC, therapy used in the treatment of infertility, and hormonal replacement therapy (HRT. The purpose of this manuscript is the revision of the literature concerning the impact of both endo- and exogenous estrogens on the development of lupus, inducement of flares and any possible complications.

  8. [Inhibitory effect of exogenous insulin-like growth factor binding protein 7 on proliferation of human breast cancer cell line MDA-MB-453 and its mechanism].

    Science.gov (United States)

    Yuan, Lei; Fan, Wen-Juan; Yang, Xu-Guang; Rao, Shu-Mei; Song, Jin-Ling; Song, Guo-Hua

    2013-10-25

    The present study was to investigate the effects of exogenous insulin-like growth factor binding protein 7 (IGFBP7) on the proliferation of human breast cancer cell line MDA-MB-453 and its possible mechanism. By means of MTT method in vitro, the results showed exogenous IGFBP7 inhibited the growth of MDA-MB-453 cells (IC50 of IGFBP7 = 8.49 μg/mL) in time- and concentration-dependent manner. SB203580, p38(MAPK) inhibitor, blocked the anti-proliferative effect of exogenous IGFBP7. The flow cytometry assay showed that exogenous IGFBP7 remarkably induced G0/G1 arrest in MDA-MB-453 cells. The Western blot showed that exogenous IGFBP7 promoted phosphorylation of p38(MAPK), up-regulated expression of p21(CIP1/WAF1), and inhibited phosphorylation of Rb. SB203580 restrained exogenous IGFBP7-induced regulation of p21(CIP1/WAF1) and p-Rb in MDA-MB-453 cells. In conclusion, the present study suggests that exogenous IGFBP7 could activate the p38(MAPK) signaling pathway, upregulate p21(CIP1/WAF1) expression, inhibit phosphorylation of Rb, and finally induce G0/G1 arrest in MDA-MB-453 cells.

  9. Application of exogenous ethylene inhibits postharvest peel browning of ‘Huangguan’ pear

    Science.gov (United States)

    Peel browning disorder has an enormous impact on the exterior quality of ‘Huangguan’ pear whereas the underlying mechanism is still unclear. In this study, the effect of exogenous ethylene on peel browning of pear fruits stored at 0' was evaluated. Results showed that ethylene effectively inhibited ...

  10. Effect of exogenous fatty acids on biotin deprived death of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Shimada, Shoji; Kuraishi, Hiroshi; Aida, Ko

    1978-01-01

    The effect of exogeneous fatty acids on cell growth and death of the biotin-requiring yeast Saccharomyces cerevisiae BA-1 was examined with respect to the mechanism of synthetic pathway of fatty acid under biotin starvation. At a growth temperature of 30 0 C, exogeneous unsaturated fatty acids, such as palmitoleic, oleic, linoleic, and linolenic acids which promote the cell growth and suppress death effectively, were incorporated intactly into the cellular fatty acids, whereas the saturated fatty acid, palmitic acid, which supports growth but some what inhibits death, was once incorporated, and about 60% of incorporated palmitic acid was found to be desaturated. However, at an elevated temperature of 36 0 C, even palmitic acid showed similar effects to unsaturated fatty acids in cell growth and death; following by an increased desaturation of palmitic acid. Thus the data indicate that palmitic aicd, as well as unsaturated fatty acids directly compensate for the deficiency of endogenously synthesized fatty acids caused by biotin starvation. (auth.)

  11. Exogenous Application of GABA Improves PEG-Induced Drought Tolerance Positively Associated with GABA-Shunt, Polyamines, and Proline Metabolism in White Clover.

    Science.gov (United States)

    Yong, Bin; Xie, Huan; Li, Zhou; Li, Ya-Ping; Zhang, Yan; Nie, Gang; Zhang, Xin-Quan; Ma, Xiao; Huang, Lin-Kai; Yan, Yan-Hong; Peng, Yan

    2017-01-01

    In order to investigate the physiological effects of exogenous γ-aminobutyric acid (GABA) on drought tolerance in white clover (Trifolium repens), GABA shunt, polyamines (PAs), and proline (Pro) metabolism were examined after plants pretreated with or without GABA (8 mM) and then exposed to water or 15% PEG-induced drought stress in growth chamber. In this study, exogenous application of GABA effectively alleviated drought-induced damage in leaves, as reflected by significantly higher relative water content, lower electrolyte leakage, lipid peroxidation, and leaf wilt. Exogenous GABA further promoted drought-induced increases in GABA transaminase and alpha ketone glutarate dehydrogenase activities, but inhibited glutamate decarboxylase activity under both control and drought conditions, resulting in an increase in endogenous glutamate (Glu) and GABA content. Besides, exogenous GABA could well accelerated PAs synthesis and suppressed PAs catabolism, which lead to the extremely enhanced different types of PAs content (free Put and Spd, insoluble bound Spd and Spm, soluble conjugated Spd and Spm, and total Put, Spd and Spm) under drought stress. In addition, exogenous GABA application further activated drought-induced Δ 1 -pyrroline-5-carboxylate synthetase and proline dehydrogenase activities, but suppressed drought-facilitated ornithine -δ-amino transferase activities, leading to a higher Pro accumulation and metabolism in GABA-pretreated plants in the middle and last period of drought. The results suggested that increased endogenous GABA by exogenous GABA treatment could improve drought tolerance of white clover associated with a positive regulation in the GABA-shunt, PAs and Pro metabolism.

  12. Effects of exogenous gamma-aminobutyric acid on α-amylase activity in the aleurone of barley seeds.

    Science.gov (United States)

    Sheng, Yidi; Xiao, Huiyuan; Guo, Chunli; Wu, Hong; Wang, Xiaojing

    2018-03-03

    Gamma-aminobutyric acid (GABA), a nonprotein amino acid, often accumulates in plants exposed to certain environmental stimuli. Previous studies indicated that a closed relationship existed between endogenous GABA and seed germination. However, there are few studies on the effect of exogenous GABA on seed germination. The objective of this study was to explore whether exogenous GABA affected α-amylase activity which the activation is an important stage in seed germination. The level of endogenous GABA in barley seeds rose gradually during germination, suggesting that endogenous GABA was involved in germination. We measured starch degradation under application of various concentration GABA and found that GABA promoted seed starch degradation with a dose-responsive effect. The relationship between GABA and α-amylase activity was investigated by treating barley aleurone with exogenous GABA. The result showed that α-amylase activity began to rise after about 24 h and reached a peak at 48 h. Molecular evidence suggested that GABA increased α-amylase gene expression. We explore the possible roles played by GABA in signal transduction. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  13. Application of carbon and hydrogen stable isotope analyses to detect exogenous citric acid in Japanese apricot liqueur.

    Science.gov (United States)

    Akamatsu, Fumikazu; Oe, Takaaki; Hashiguchi, Tomokazu; Hisatsune, Yuri; Kawao, Takafumi; Fujii, Tsutomu

    2017-08-01

    Japanese apricot liqueur manufacturers are required to control the quality and authenticity of their liqueur products. Citric acid made from corn is the main acidulant used in commercial liqueurs. In this study, we conducted spiking experiments and carbon and hydrogen stable isotope analyses to detect exogenous citric acid used as an acidulant in Japanese apricot liqueurs. Our results showed that the δ 13 C values detected exogenous citric acid originating from C 4 plants but not from C 3 plants. The δ 2 H values of citric acid decreased as the amount of citric acid added increased, whether the citric acid originated from C 3 or C 4 plants. Commercial liqueurs with declared added acidulant provided higher δ 13 C values and lower δ 2 H values than did authentic liqueurs and commercial liqueurs with no declared added acidulant. Carbon and hydrogen stable isotope analyses are suitable as routine methods for detecting exogenous citric acid in Japanese apricot liqueur. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Quantifying the time scales over which exogenous and endogenous conditions affect soil respiration

    Science.gov (United States)

    Understanding how exogenous and endogenous factors and aboveground-belowground linkages modulate carbon dynamics is difficult because of influences of antecedent conditions. For example, there are variable lags between aboveground assimilation and belowground efflux, and the duration of antecedent p...

  15. Exogeneous countercurrent ultracentrifuges. Enrichment of a unitary machine out of a cascade

    International Nuclear Information System (INIS)

    Jacques, R.

    1977-01-01

    The integration of the equation giving isotope concentrations inside an exogeneous countercurrent ultracentrifuge is presented. The optimization of such a centrifuge, as for as the radius of the internal stream is concerned, is analyzed. The use of this type of centrifuge as part of a separating cascade is discussed

  16. Endogenous and exogenous control of ecosystem function: N cycling in headwater streams

    Energy Technology Data Exchange (ETDEWEB)

    Mulholland, Patrick J [ORNL; Valett, H. Maurice [Virginia Polytechnic Institute and State University (Virginia Tech); Thomas, Steve [University of Nebraska; Webster, Jackson [Virginia Polytechnic Institute and State University (Virginia Tech); Dahm, Cliff [University of New Mexico, Albuquerque; Fellows, Christine [Griffith University, Nathan, Queensland, Australia; Crenshaw, Chelsea [University of New Mexico, Albuquerque; Peterson, Chris G. [Loyola University

    2008-01-01

    Allochthonous inputs act as resource subsidies to many ecosystems, where they exert strong influences on metabolism and material cycling. At the same time, metabolic theory proposes endogenous thermal control independent of resource supply. To address the relative importance of exogenous and endogenous influences, we quantified spatial and temporal variation in ecosystem metabolism and nitrogen (N) uptake using seasonal releases of {sup 15}N as nitrate in six streams differing in riparian-stream interaction and metabolic character. Nitrate removal was quantified using a nutrient spiraling approach based on measurements of downstream decline in {sup 15}N flux. Respiration (R) and gross primary production (GPP) were measured with whole-stream diel oxygen budgets. Uptake and metabolism metrics were addressed as z scores relative to site means to assess temporal variation. In open-canopied streams, areal uptake (U; {micro}g N {center_dot} m{sup -2} {center_dot} s{sup -1}) was closely related to GPP, metabolic rates increased with temperature, and R was accurately predicted by metabolic scaling relationships. In forested streams, N spiraling was not related to GPP; instead, uptake velocity (v{sub f}; mm/s) was closely related to R. In contrast to open-canopied streams, N uptake and metabolic activity were negatively correlated to temperature and poorly described by scaling laws. We contend that streams differ along a gradient of exogenous and endogenous control that relates to the relative influences of resource subsidies and in-stream energetics as determinants of seasonal patterns of metabolism and N cycling. Our research suggests that temporal variation in the propagation of ecological influence between adjacent systems generates phases when ecosystems are alternatively characterized as endogenously and exogenously controlled.

  17. Endogenous and exogenous control of ecosystem function: N cycling in headwater streams.

    Science.gov (United States)

    Valett, H M; Thomas, S A; Mulholland, P J; Webster, J R; Dahm, C N; Fellows, C S; Crenshaw, C L; Peterson, C G

    2008-12-01

    Allochthonous inputs act as resource subsidies to many ecosystems, where they exert strong influences on metabolism and material cycling. At the same time, metabolic theory proposes endogenous thermal control independent of resource supply. To address the relative importance of exogenous and endogenous influences, we quantified spatial and temporal variation in ecosystem metabolism and nitrogen (N) uptake using seasonal releases of 15N as nitrate in six streams differing in riparian-stream interaction and metabolic character. Nitrate removal was quantified using a nutrient spiraling approach based on measurements of downstream decline in 15N flux. Respiration (R) and gross primary production (GPP) were measured with whole-stream diel oxygen budgets. Uptake and metabolism metrics were addressed as z scores relative to site means to assess temporal variation. In open-canopied streams, areal uptake (U; microg N x m(-2) x s(-1)) was closely related to GPP, metabolic rates increased with temperature, and R was accurately predicted by metabolic scaling relationships. In forested streams, N spiraling was not related to GPP; instead, uptake velocity (v(f); mm/s) was closely related to R. In contrast to open-canopied streams, N uptake and metabolic activity were negatively correlated to temperature and poorly described by scaling laws. We contend that streams differ along a gradient of exogenous and endogenous control that relates to the relative influences of resource subsidies and in-stream energetics as determinants of seasonal patterns of metabolism and N cycling. Our research suggests that temporal variation in the propagation of ecological influence between adjacent systems generates phases when ecosystems are alternatively characterized as endogenously and exogenously controlled.

  18. Effect of exogenous cellulase enzyme on feed digestibility in lamb

    International Nuclear Information System (INIS)

    Boonek, Lerchat; Shinkoi, Henrry S; Piadang, Nattayana

    2006-09-01

    The aim of this study was to determine the effect of exogenous enzyme on digestibility and N retention in lamb. Eight lambs were randomly allocated to 2 experiment group in group comparison design trial. Experimental treatments were: 1) CTL (No enzyme) and 2 50NZ (Mixed enzyme with high cellulase at 50g/100kg.feed). The digestibility study showed that Exogenous enzyme increased (P<0.05) dry matter and crude protein digestibility of treated lamb compared to those of control. A similar trend (P=0.11) was observed for the NDF digestibility. Mean values for dry matter digestibility were 57.86 and 69.83% and for protein digestibility were 64.76 and 73.38%, for CTL and 50NZ, respectively). The N intake was similar among treatment, averaging 22.57g/head/day. Percent N retained of 50 NZ treated lambs was higher (P<.05) than those of CTL group (mean value were 47.74 and 59.07 for CTC and 50NZ, respectively). Feed efficiency or feed conversion ratio was numerically improved for enzyme-treated groups. Overall, the results of this study provide evidence that mixed cellulase enzyme can be used to improver performance of lambs as compare to non-enzyme diet.

  19. Influence of ensiling, exogenous protease addition, and bacterial inoculation on fermentation profile, nitrogen fractions, and ruminal in vitro starch digestibility in rehydrated and high-moisture corn.

    Science.gov (United States)

    Ferraretto, L F; Fredin, S M; Shaver, R D

    2015-10-01

    Exogenous protease addition may be an option to increase proteolysis of zein proteins and thus starch digestibility in rehydrated and high-moisture corn (HMC) ensiled for short periods. In addition, microbial inoculation may accelerate fermentation and increase acid production and thus increase solubilization of zein proteins. Four experiments were performed to evaluate the effect on fermentation profile, N fractions, and ruminal in vitro starch digestibility (ivSD) of the following: (1) rehydration and ensiling of dry ground corn; (2) exogenous protease addition to rehydrated un-ensiled and ensiled corn; (3) exogenous protease addition or inoculation in rehydrated ensiled corn; and (4) exogenous protease addition or inoculation in HMC. Experiments 1, 2, and 3 were performed with 7 treatments: dry ground corn (DGC); DGC rehydrated to a targeted dry matter content of 70% (REH); REH treated with exogenous protease (REH+); REH ensiled for 30 d (ENS); ENS treated with exogenous protease (ENS+); ENS treated with a microbial inoculant containing Lactobacillus plantarum, Lactobacillus casei, Enterococcus faecium, and Pediococcus sp. (ENSI); and ENS treated with exogenous protease and microbial inoculant (ENSI+). Experiment 1 compared DGC, REH, and ENS with ivSD being greater for ENS (64.9%) than DGC and REH (51.7% on average). Experiment 2 compared REH and ENS without or with exogenous protease addition (REH+ and ENS+, respectively). Ensiling and exogenous protease addition increased ivSD, but exogenous protease addition was more effective in ENS than REH (6.4 vs. 2.6 percentage unit increase). Experiment 3 compared the effects of exogenous protease addition and inoculation in ENS corn (ENS, ENS+, ENSI, and ENSI+). The addition of protease, but not inoculant, increased ivSD. Inoculation reduced pH and acetate, propionate, and ethanol concentrations, and increased lactate and total acid concentrations. In experiment 4, 8 treatments were a combination of HMC noninoculated

  20. Evaluation of endothelial function in exogenous subclinical hyperthyroidism and the effect of treatment

    Directory of Open Access Journals (Sweden)

    Sayed Mohammad Hosseini

    2016-01-01

    Conclusions: This study demonstrated that FMD decreased in exogenous subclinical hyperthyroid patients which could be partially restored by treatment. These findings suggest that treatment of subclinical hyperthyroid state could improve endothelial dysfunction and at the end decreased the cardiovascular complications.

  1. Influence of exogeneous histone on DNA, RNA and protein synthesis in cells inoculated with Herpes simplex virus

    International Nuclear Information System (INIS)

    Praskov, D.; Kavaklova, L.; Todorov, S.; Tsilka, S.; Petrova, S.

    1976-01-01

    The influence of exogeneous total histone from nucleated red cells on the incorporation of basal DNA and RNA precursors and proteins in FL cells inoculated with serotype I herpes simplex virus was followed up during the infectious process. In comparison with the purely viral infection, in the presence of exogeneous histone, there was repression in the incorporation of all three labelled precursors: 3 H-thymidine, 3 H-uridine and 14 C-leucine. This repression correlates with as high as 90% decrease in infectious virus yield. (author)

  2. Effect of Exogenous Albumin on the Incidence of Postoperative Acute Kidney Injury in Patients Undergoing Off-pump Coronary Artery Bypass Surgery with a Preoperative Albumin Level of Less Than 4.0 g/dl.

    Science.gov (United States)

    Lee, Eun-Ho; Kim, Wook-Jong; Kim, Ji-Yeon; Chin, Ji-Hyun; Choi, Dae-Kee; Sim, Ji-Yeon; Choo, Suk-Jung; Chung, Cheol-Hyun; Lee, Jae-Won; Choi, In-Cheol

    2016-05-01

    Hypoalbuminemia may increase the risk of acute kidney injury (AKI). The authors investigated whether the immediate preoperative administration of 20% albumin solution affects the incidence of AKI after off-pump coronary artery bypass surgery. In this prospective, single-center, randomized, parallel-arm double-blind trial, 220 patients with preoperative serum albumin levels less than 4.0 g/dl were administered 100, 200, or 300 ml of 20% human albumin according to the preoperative serum albumin level (3.5 to 3.9, 3.0 to 3.4, or less than 3.0 g/dl, respectively) or with an equal volume of saline before surgery. The primary outcome measure was AKI incidence after surgery. Postoperative AKI was defined by maximal AKI Network criteria based on creatinine changes. Patient characteristics and perioperative data except urine output during surgery were similar between the two groups studied, the albumin group and the control group. Urine output (median [interquartile range]) during surgery was higher in the albumin group (550 ml [315 to 980]) than in the control group (370 ml [230 to 670]; P = 0.006). The incidence of postoperative AKI in the albumin group was lower than that in the control group (14 [13.7%] vs. 26 [25.7%]; P = 0.048). There were no significant between-group differences in severe AKI, including renal replacement therapy, 30-day mortality, and other clinical outcomes. There were no significant adverse events. Administration of 20% exogenous albumin immediately before surgery increases urine output during surgery and reduces the risk of AKI after off-pump coronary artery bypass surgery in patients with a preoperative serum albumin level of less than 4.0 g/dl.

  3. Activity of deferasirox in Mucorales: influences of species and exogenous iron.

    Science.gov (United States)

    Lewis, Russell E; Pongas, Georgios N; Albert, Nathaniel; Ben-Ami, Ronen; Walsh, Thomas J; Kontoyiannis, Dimitrios P

    2011-01-01

    Differences in deferasirox susceptibility among members of the order Mucorales are unknown. Here we show that Cunninghamella bertholletiae (four isolates) and Mucor species (five isolates) display higher deferasirox MICs and minimal fungicidal concentrations compared to Rhizopus species (six isolates). Exogenous iron further attenuated the deferasirox susceptibility of Mucorales isolates with low MICs. Vital staining revealed damage to subapical compartments in susceptible strains.

  4. Activity of Deferasirox in Mucorales: Influences of Species and Exogenous Iron▿

    OpenAIRE

    Lewis, Russell E.; Pongas, Georgios N.; Albert, Nathaniel; Ben-Ami, Ronen; Walsh, Thomas J.; Kontoyiannis, Dimitrios P.

    2010-01-01

    Differences in deferasirox susceptibility among members of the order Mucorales are unknown. Here we show that Cunninghamella bertholletiae (four isolates) and Mucor species (five isolates) display higher deferasirox MICs and minimal fungicidal concentrations compared to Rhizopus species (six isolates). Exogenous iron further attenuated the deferasirox susceptibility of Mucorales isolates with low MICs. Vital staining revealed damage to subapical compartments in susceptible strains.

  5. Impact of exogenous organic carbon on the removal of chemicals of concern in the high rate nitrifying trickling filters.

    Science.gov (United States)

    Mai, Lei; van den Akker, Ben; Du, Jun; Kookana, Rai S; Fallowfield, Howard

    2016-06-01

    The application of fixed bed high rate nitrifying trickling filters (NTFs) for the removal of track organic chemicals of concern (CoC) is less well known than their application to nutrient removal in water treatment. Particularly, the effect of exogenous organic carbon substrate (sucrose) loading on the performance of NTFs is not well understood. A laboratory-scale NTF system was operated in recirculation mode, with the objective of removing ammonia and CoC simultaneously. The efficiency of a high rate NTF for removal both of low concentration of ammonia (5 mg NH4-N L(-1)) and different concentrations of CoC in the presence of an exogenous organic carbon substrate (30 mg total organic carbon (TOC) L(-1)) was investigated. In the presence of exogenous organic carbon, the results demonstrated that the high rate NTF was able to successfully remove most of the CoCs investigated, with the removal ranging from 20.2% to 87.54%. High removal efficiencies were observed for acetaminophen (87.54%), bisphenol A (86.60%), trimethoprim (86.24%) and 17α-ethynylestradiol (80.60%). It was followed by the medium removal efficiency for N, N-diethyl-m-toluamide (61.31%) and atrazine (56.90%). In contrast, the removal of caffeine (28.43%) and benzotriazole (20.20%) was poorer in the presence of exogenous organic carbon. The removal efficiency for CoC was also compared with the results obtained in our previous study in the absence of exogenous organic carbon. The results showed that the addition of exogenous organic carbon was able to improve the removal of some of the CoC. Significant TOC percentage removals (45.68%-84.43%) and ammonia removal rate (mean value of 0.44 mg NH4-N L(-1) h(-1)) were also achieved in this study. The findings from this study provide valuable information for optimising the efficiency of high rate NTF for the removal of ammonia, CoC and TOC. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Effects of exogenous glucagon-like peptide-2 and distal bowel resection on intestinal and systemic adaptive responses in rats.

    Directory of Open Access Journals (Sweden)

    Sarah W Lai

    Full Text Available To determine the effects of exogenous glucagon-like peptide-2 (GLP-2, with or without massive distal bowel resection, on adaptation of jejunal mucosa, enteric neurons, gut hormones and tissue reserves in rats.GLP-2 is a gut hormone known to be trophic for small bowel mucosa, and to mimic intestinal adaptation in short bowel syndrome (SBS. However, the effects of exogenous GLP-2 and SBS on enteric neurons are unclear.Sprague Dawley rats were randomized to four treatments: Transected Bowel (TB (n = 8, TB + GLP-2 (2.5 nmol/kg/h, n = 8, SBS (n = 5, or SBS + GLP-2 (2.5 nmol/kg/h, n = 9. SBS groups underwent a 60% jejunoileal resection with cecectomy and jejunocolic anastomosis. All rats were maintained on parenteral nutrition for 7 d. Parameters measured included gut morphometry, qPCR for hexose transporter (SGLT-1, GLUT-2, GLUT-5 and GLP-2 receptor mRNA, whole mount immunohistochemistry for neurons (HuC/D, VIP, nNOS, plasma glucose, gut hormones, and body composition.Resection increased the proportion of nNOS immunopositive myenteric neurons, intestinal muscularis propria thickness and crypt cell proliferation, which were not recapitulated by GLP-2 therapy. Exogenous GLP-2 increased jejunal mucosal surface area without affecting enteric VIP or nNOS neuronal immunopositivity, attenuated resection-induced reductions in jejunal hexose transporter abundance (SGLT-1, GLUT-2, increased plasma amylin and decreased peptide YY concentrations. Exogenous GLP-2 attenuated resection-induced increases in blood glucose and body fat loss.Exogenous GLP-2 stimulates jejunal adaptation independent of enteric neuronal VIP or nNOS changes, and has divergent effects on plasma amylin and peptide YY concentrations. The novel ability of exogenous GLP-2 to modulate resection-induced changes in peripheral glucose and lipid reserves may be important in understanding the whole-body response following intestinal resection, and is worthy of further study.

  7. The effects of exogenous hormones on rooting process and the activities of key enzymes of Malus hupehensis stem cuttings.

    Science.gov (United States)

    Zhang, Wangxiang; Fan, Junjun; Tan, Qianqian; Zhao, Mingming; Zhou, Ting; Cao, Fuliang

    2017-01-01

    Malus hupehensis is an excellent Malus rootstock species, known for its strong adverse-resistance and apomixes. In the present study, stem cuttings of M. hupehensis were treated with three types of exogenous hormones, including indole acetic acid (IAA), naphthalene acetic acid (NAA), or green growth regulator (GGR). The effects and mechanisms of exogenous hormone treatment and antioxidant enzyme activity on adventitious root formation were investigated. The results showed that the apparent morphology of the adventitious root had four stages, including root pre-emergence stage (S0), early stage of root formation (S1), massive root formation stage (S2), and later stage of root formation (S3). The suitable concentrations of the three exogenous hormones, IAA, NAA and GGR, were 100 mg·L-1, 300 mg·L-1, and 300 mg·L-1, respectively. They shortened the rooting time by 25-47.4% and increased the rooting percentages of cuttings by 0.9-1.3 times, compared with that in the control. The dispersion in S0 stage was 3.6 times of that in the S1 stage after exogenous hormone application. The earlier the third critical point (P3) appeared, the shorter the rooting time and the greater the rooting percentage of the cuttings. During rhizogenesis, the activities of three antioxidant enzymes (POD, SOD, and PPO) showed an A-shaped trend. However, peak values of enzyme activity appeared at different points, which were 9 d before the P3, P3, and the fourth critical point (P4), respectively. Exogenous hormone treatment reduced the time to reach the peak value by 18 days, although the peak values of the enzymatic activities did not significantly changed. Our results suggested that exogenous hormone treatment mainly acted during the root pre-emergence stage, accelerated the synthesis of antioxidant enzymes, reduced the rooting time, and consequently promoted root formation. The three kinds of antioxidant enzymes acted on different stages of rooting.

  8. Effects of exogenous glucagon-like peptide-2 and distal bowel resection on intestinal and systemic adaptive responses in rats

    Science.gov (United States)

    de Heuvel, Elaine; Wallace, Laurie E.; Hartmann, Bolette; Holst, Jens J.; Brindle, Mary E.; Chelikani, Prasanth K.; Sigalet, David L.

    2017-01-01

    Objective To determine the effects of exogenous glucagon-like peptide-2 (GLP-2), with or without massive distal bowel resection, on adaptation of jejunal mucosa, enteric neurons, gut hormones and tissue reserves in rats. Background GLP-2 is a gut hormone known to be trophic for small bowel mucosa, and to mimic intestinal adaptation in short bowel syndrome (SBS). However, the effects of exogenous GLP-2 and SBS on enteric neurons are unclear. Methods Sprague Dawley rats were randomized to four treatments: Transected Bowel (TB) (n = 8), TB + GLP-2 (2.5 nmol/kg/h, n = 8), SBS (n = 5), or SBS + GLP-2 (2.5 nmol/kg/h, n = 9). SBS groups underwent a 60% jejunoileal resection with cecectomy and jejunocolic anastomosis. All rats were maintained on parenteral nutrition for 7 d. Parameters measured included gut morphometry, qPCR for hexose transporter (SGLT-1, GLUT-2, GLUT-5) and GLP-2 receptor mRNA, whole mount immunohistochemistry for neurons (HuC/D, VIP, nNOS), plasma glucose, gut hormones, and body composition. Results Resection increased the proportion of nNOS immunopositive myenteric neurons, intestinal muscularis propria thickness and crypt cell proliferation, which were not recapitulated by GLP-2 therapy. Exogenous GLP-2 increased jejunal mucosal surface area without affecting enteric VIP or nNOS neuronal immunopositivity, attenuated resection-induced reductions in jejunal hexose transporter abundance (SGLT-1, GLUT-2), increased plasma amylin and decreased peptide YY concentrations. Exogenous GLP-2 attenuated resection-induced increases in blood glucose and body fat loss. Conclusions Exogenous GLP-2 stimulates jejunal adaptation independent of enteric neuronal VIP or nNOS changes, and has divergent effects on plasma amylin and peptide YY concentrations. The novel ability of exogenous GLP-2 to modulate resection-induced changes in peripheral glucose and lipid reserves may be important in understanding the whole-body response following intestinal resection, and is worthy

  9. Lipoxin A4, a 5-lipoxygenase pathway metabolite, modulates immune response during acute respiratory tularemia.

    Science.gov (United States)

    Singh, Anju; Rahman, Tabassum; Bartiss, Rose; Arabshahi, Alireza; Prasain, Jeevan; Barnes, Stephen; Musteata, Florin Marcel; Sellati, Timothy J

    2017-02-01

    Respiratory infection with Francisella tularensis (Ft) is characterized by a muted, acute host response, followed by sepsis-like syndrome that results in death. Infection with Ft establishes a principally anti-inflammatory environment that subverts host-cell death programs to facilitate pathogen replication. Although the role of cytokines has been explored extensively, the role of eicosanoids in tularemia pathogenesis is not fully understood. Given that lipoxin A 4 (LXA 4 ) has anti-inflammatory properties, we investigated whether this lipid mediator affects host responses manifested early during infection. The addition of exogenous LXA 4 inhibits PGE 2 release by Ft-infected murine monocytes in vitro and diminishes apoptotic cell death. Tularemia pathogenesis was characterized in 5‑lipoxygenase-deficient (Alox5 -/- ) mice that are incapable of generating LXA 4 Increased release of proinflammatory cytokines and chemokines, as well as increased apoptosis, was observed in Alox5 -/- mice as compared with their wild-type counterparts. Alox5 -/- mice also exhibited elevated recruitment of neutrophils during the early phase of infection and increased resistance to lethal challenge. Conversely, administration of exogenous LXA 4 to Alox5 -/- mice made them more susceptible to infection thus mimicking wild-type animals. Taken together, our results suggest that 5-LO activity is a critical regulator of immunopathology observed during the acute phase of respiratory tularemia, regulating bacterial burden and neutrophil recruitment and production of proinflammatory modulators and increasing morbidity and mortality. These studies identify a detrimental role for the 5-LO-derived lipid mediator LXA 4 in Ft-induced immunopathology. Targeting this pathway may have therapeutic benefit as an adjunct to treatment with antibiotics and conventional antimicrobial peptides, which often have limited efficacy against intracellular bacteria. © Society for Leukocyte Biology.

  10. Speculative prototypes and exogenous ethnographies: Experiencing relationships beyond the human

    DEFF Research Database (Denmark)

    Jönsson, Li; Ulv Lenskjold, Tau

    2017-01-01

    This article deals with the role that speculative design prototypes have as means to intervene in contexts of everyday life in order to explore, and possibly facilitate, new types of relationships between human and non-human beings. Focusing on an off-centered design of the human, it seeks to exp...... to explore what types of new possibilities may arise when speculation in design meets the practice of doing what might be termed an "exogenous ethnography"....

  11. Influence of acute treatment with sibutramine on the sympathetic neurotransmission of the young rat vas deferens.

    Science.gov (United States)

    de Souza, Bruno Palmieri; da Silva, Edilson Dantas; Jurkiewicz, Aron; Jurkiewicz, Neide Hyppolito

    2014-09-05

    The effects of acute treatment with sibutramine on the peripheral sympathetic neurotransmission in vas deferens of young rats were still not evaluated. Therefore, we carried out this study in order to verify the effects of acute sibutramine treatment on the neuronal- and exogenous agonist-induced contractions of the young rat vas deferens. Young 45-day-old male Wistar rats were pretreated with sibutramine 6 mg/kg and after 4h the vas deferens was used for experiment. The acute treatment with sibutramine was able to increase the potency (pD2) of noradrenaline and phenylephrine. Moreover, the efficacy (Emax) of noradrenaline was increased while the efficacy of serotonin and nicotine were decreased. The maximum effect induced by a single concentration of tyramine was diminished in the vas deferens from treated group. Moreover, the leftward shift of the noradrenaline curves promoted by uptake blockers (cocaine and corticosterone) and β-adrenoceptor antagonist (propranolol) was reduced in the vas deferens of treated group. The initial phasic and secondary tonic components of the neuronal-evoked contractions of vas deferens from treated group at the frequencies of 2 Hz were decreased. Moreover, only the initial phasic component at 5 Hz was diminished by the acute treatment with sibutramine. In conclusion, we showed that the acute treatment with sibutramine in young rats was able to affect the peripheral sympathetic nervous system by inhibition of noradrenaline uptake and reduction of the neuronal content of this neurotransmitter, leading to an enhancement of vas deferens sensitivity to noradrenaline. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. The exogenous and endogenous control of attentional focusing.

    Science.gov (United States)

    Jefferies, Lisa N; Enns, James T; Di Lollo, Vincent

    2017-09-22

    Selective visual attention involves prioritizing both the location (orienting) and distribution (focusing) of processing. To date, much more research has examined attentional orienting than focusing. One of the most well-established findings is that orienting can be exogenous, as when a unique change in luminance draws attention to a spatial location (e.g., Theeuwes in Atten Percept Psychophys 51:599-606, 1992; Yantis and Jonides in J Exp Psychol Hum Percept Perform 10:601, 1984), and endogenous, as when a red distractor shape diverts attention when one is looking for a red target (e.g., Bacon and Egeth in Percept Psychophys 55:485-496, 1994; Folk et al. in J Exp Psychol Hum Percept Perform 18:1030, 1992). Here we ask whether attentional focusing-the broadening and contracting of prioritized processing-is influenced by the same two factors. Our methodology involved a dual-stream attentional blink task; participants monitored two spatially separated streams of items for two targets that could appear unpredictably either in the same stream or in opposite streams. The spatial distribution of attention was assessed by examining second-target accuracy in relation to inter-target lag and target location (same or opposite streams). In Experiment 1, we found that attentional contracting was more rapid when the targets differed in luminance from the distractor items. In Experiments 2 and 3, we found that the rate of attentional contracting was slower when there were task-relevant distractors in the stream opposite the first target. These results indicate that the rate of attentional focusing, like orienting, can be modulated by both exogenous and endogenous mechanisms.

  13. Metabolism of ketone bodies during exercise and training: physiological basis for exogenous supplementation

    Science.gov (United States)

    Evans, Mark; Cogan, Karl E.

    2016-01-01

    Abstract Optimising training and performance through nutrition strategies is central to supporting elite sportspeople, much of which has focused on manipulating the relative intake of carbohydrate and fat and their contributions as fuels for energy provision. The ketone bodies, namely acetoacetate, acetone and β‐hydroxybutyrate (βHB), are produced in the liver during conditions of reduced carbohydrate availability and serve as an alternative fuel source for peripheral tissues including brain, heart and skeletal muscle. Ketone bodies are oxidised as a fuel source during exercise, are markedly elevated during the post‐exercise recovery period, and the ability to utilise ketone bodies is higher in exercise‐trained skeletal muscle. The metabolic actions of ketone bodies can alter fuel selection through attenuating glucose utilisation in peripheral tissues, anti‐lipolytic effects on adipose tissue, and attenuation of proteolysis in skeletal muscle. Moreover, ketone bodies can act as signalling metabolites, with βHB acting as an inhibitor of histone deacetylases, an important regulator of the adaptive response to exercise in skeletal muscle. Recent development of ketone esters facilitates acute ingestion of βHB that results in nutritional ketosis without necessitating restrictive dietary practices. Initial reports suggest this strategy alters the metabolic response to exercise and improves exercise performance, while other lines of evidence suggest roles in recovery from exercise. The present review focuses on the physiology of ketone bodies during and after exercise and in response to training, with specific interest in exploring the physiological basis for exogenous ketone supplementation and potential benefits for performance and recovery in athletes. PMID:27861911

  14. Responses of rice to salinity and exogenous glycinebetaine by using positron emitting tracer imaging system

    International Nuclear Information System (INIS)

    Le Xuan Tham; Vo Huy Dang; Noriko, S.

    2002-01-01

    Effect of salinity stress (NaCl) and glycinebetaine on typical non-halophyte plants - rice (Oryza sativa L.) was examined for the growth, net photosynthesis and transpiration functions of seedlings. Using 22 Na, the inhibition of net uptake and translocation of sodium of seedlings stressed at 0.15% NaCl in solution and previously treated with exogenous glycinebetaine was observed by positron-emitting tracer imaging system, namely PETIS for diagnosis of early responses of plants to salt stress. Effects of exogenous glycinebetaine on rice plants stressed with salinity via osmotic protection and particularly stabilization of membrane permeability to inhibit Na uptake and translocation were discussed in connection with promising potentials of PETIS for researches on plants. (Author)

  15. Exogenous hydrogen peroxide reversibly inhibits root gravitropism and induces horizontal curvature of primary root during grass pea germination.

    Science.gov (United States)

    Jiang, Jinglong; Su, Miao; Wang, Liyan; Jiao, Chengjin; Sun, Zhengxi; Cheng, Wei; Li, Fengmin; Wang, Chongying

    2012-04-01

    During germination in distilled water (dH(2)O) on a horizontally positioned Petri dish, emerging primary roots of grass pea (Lathyrus sativus L.) grew perpendicular to the bottom of the Petri dish, due to gravitropism. However, when germinated in exogenous hydrogen peroxide (H(2)O(2)), the primary roots grew parallel to the bottom of the Petri dish and asymmetrically, forming a horizontal curvature. Time-course experiments showed that the effect was strongest when H(2)O(2) was applied prior to the emergence of the primary root. H(2)O(2) failed to induce root curvature when applied post-germination. Dosage studies revealed that the frequency of primary root curvature was significantly enhanced with increased H(2)O(2) concentrations. This curvature could be directly counteracted by dimethylthiourea (DMTU), a scavenger of H(2)O(2), but not by diphenylene iodonium (DPI) and pyridine, inhibitors of H(2)O(2) production. Exogenous H(2)O(2) treatment caused both an increase in the activities of H(2)O(2)-scavenging enzymes [including ascorbate peroxidase (APX: EC 1.11.1.11), catalase (CAT: EC 1.11.1.6) and peroxidase (POD: EC 1.11.1.7)] and a reduction in endogenous H(2)O(2) levels and root vitality. Although grass pea seeds absorbed exogenous H(2)O(2) during seed germination, DAB staining of paraffin sections revealed that exogenous H(2)O(2) only entered the root epidermis and not inner tissues. These data indicated that exogenously applied H(2)O(2) could lead to a reversible loss of the root gravitropic response and a horizontal curvature in primary roots during radicle emergence of the seedling. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  16. Exogenous or endogenous Toll-like receptor ligands: which is the MVP in tumorigenesis?

    Science.gov (United States)

    Yu, Li; Wang, Liantang; Chen, Shangwu

    2012-03-01

    Toll-like receptors (TLRs) are a class of pattern recognition receptors sensing microbial components and triggering an immune response against pathogens. In addition to their role in anti-infection immunity, increasing evidence indicates that engagement of TLRs can promote cancer cell survival and proliferation, induce tumor immune evasion, and enhance tumor metastasis and chemoresistance. Recent studies have demonstrated that endogenous molecules or damage-associated molecular patterns released from damaged/necrotic tissues are capable of activating TLRs and that the endogenous ligands-mediated TLR signaling is implicated in the tumor development and affects the therapeutic efficacy of tumors. Since both exogenous and endogenous TLR ligands can initiate TLR signaling, which is the most valuable player in tumor development becomes an interesting question. Here, we summarize the effect of TLR signaling on the development and progression of tumors, and discuss the role of exogenous and endogenous TLR ligands in the tumorigenesis.

  17. Endogenous Versus Exogenous Shocks in Complex Networks: An Empirical Test Using Book Sale Rankings

    Science.gov (United States)

    Sornette, D.; Deschâtres, F.; Gilbert, T.; Ageon, Y.

    2004-11-01

    We study the precursory and recovery signatures accompanying shocks in complex networks, that we test on a unique database of the Amazon.com ranking of book sales. We find clear distinguishing signatures classifying two types of sales peaks. Exogenous peaks occur abruptly and are followed by a power law relaxation, while endogenous peaks occur after a progressively accelerating power law growth followed by an approximately symmetrical power law relaxation which is slower than for exogenous peaks. These results are rationalized quantitatively by a simple model of epidemic propagation of interactions with long memory within a network of acquaintances. The observed relaxation of sales implies that the sales dynamics is dominated by cascades rather than by the direct effects of news or advertisements, indicating that the social network is close to critical.

  18. Hyperinsulinemic hypoglycemia associated with insulin antibodies caused by exogenous insulin analog

    Directory of Open Access Journals (Sweden)

    Chih-Ting Su

    2016-11-01

    Full Text Available Insulin antibodies (IA associated with exogenous insulin administration seldom caused hypoglycemia and had different characteristics from insulin autoantibodies (IAA found in insulin autoimmune syndrome (IAS, which was first described by Dr Hirata in 1970. The characteristic of IAS is the presence of insulin-binding autoantibodies and related fasting or late postprandial hypoglycemia. Here, we report a patient with type 1 diabetes mellitus under insulin glargine and insulin aspart treatment who developed recurrent spontaneous post-absorptive hyperinsulinemic hypoglycemia with the cause probably being insulin antibodies induced by exogenous injected insulin. Examinations of serial sera disclosed a high titre of insulin antibodies (33%, normal <5%, high insulin concentration (111.9 IU/mL and undetectable C-peptide when hypoglycemia occurred. An oral glucose tolerance test revealed persistent high serum levels of total insulin and undetectable C-peptide. Image studies of the pancreas were unremarkable, which excluded the diagnosis of insulinoma. The patient does not take any of the medications containing sulfhydryl compounds, which had been reported to cause IAS. After administering oral prednisolone for 3 weeks, hypoglycemic episodes markedly improved, and he was discharged smoothly.

  19. Alleviation of isoproturon toxicity to wheat by exogenous application of glutathione.

    Science.gov (United States)

    Nemat Alla, Mamdouh M; Hassan, Nemat M

    2014-06-01

    Treatment with the recommended field dose of isoproturon to 7-d-old wheat seedlings significantly decreased shoot height, fresh and dry weights during the subsequent 15days. Meanwhile contents of carotenoids, chlorophylls and anthocyanin as well as activities of δ-aminolevulinate dehydratase (ALA-D), phenylalanine ammonia lyase (PAL) and tyrosine ammonia lyase (TAL) were significantly inhibited. On the other hand, the herbicide significantly increased malondialdehyde (MDA), a naturally occurring product of lipid peroxidation and H2O2, while it significantly decreased the contents of glutathione (GSH) and ascorbic acid (AsA) and reduced the activities of superoxide dismutase (SOD), catalase (CAT) and ascorbate peroxidase (APX). These findings indicate an induction of a stress status in wheat seedlings following isoproturon treatment. However, exogenous GSH appeared to limit the toxic effects of isoproturon and seemed to overcome this stress status. Most likely, contents of pigment and activities of enzymes were raised to approximate control levels. Moreover, antioxidants were elevated and the oxidative stress indices seemed to be alleviated by GSH application. These results indicate that exogenous GSH enhances enzymatic and nonenzymatic antioxidants to alleviate the effects of isoproturon. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Reliability and Magnitude of Laterality Effects in Dichotic Listening with Exogenous Cueing

    Science.gov (United States)

    Voyer, Daniel

    2004-01-01

    The purpose of the present study was to replicate and extend to word recognition previous findings of reduced magnitude and reliability of laterality effects when exogenous cueing was used in a dichotic listening task with syllable pairs. Twenty right-handed undergraduate students with normal hearing (10 females, 10 males) completed a dichotic…

  1. The Alleviation of Heat Damage to Photosystem II and Enzymatic Antioxidants by Exogenous Spermidine in Tall Fescue.

    Science.gov (United States)

    Zhang, Liang; Hu, Tao; Amombo, Erick; Wang, Guangyang; Xie, Yan; Fu, Jinmin

    2017-01-01

    Tall fescue ( Festuca arundinacea Schreb) is a typical cool-season grass that is widely used in turf and pasture. However, high temperature as an abiotic stress seriously affects its utilization. The objective of this study was to explore the effect of spermidine (Spd) on heat stress response of tall fescue. The samples were exposed to 22°C (normal condition) or 44°C (heat stress) for 4 h. The results showed that exogenous Spd partially improved the quality of tall fescue leaves under normal temperature conditions. Nevertheless, after heat stress treatment, exogenous Spd significantly decreased the electrolyte leakage of tall fescue leaves. Spd also profoundly reduced the H 2 O 2 and O 2 ⋅- content and increased antioxidant enzymes activities. In addition, PAs can also regulate antioxidant enzymes activities including SOD, POD, and APX which could help to scavenge ROS. Moreover, application of Spd could also remarkably increase the chlorophyll content and had a positive effect on the chlorophyll α fluorescence transients under high temperature. The Spd reagent enhanced the performance of photosystem II (PSII) as observed by the JIP-test. Under heat stress, the Spd profoundly improved the partial potentials at the steps of energy bifurcations (PI ABS and PI total ) and the quantum yields and efficiencies (φP 0 , δR 0 , φR 0 , and γRC). Exogenous Spd could also reduce the specific energy fluxes per Q A - reducing PSII reaction center (RC) (TP 0 /RC and ET 0 /RC). Additionally, exogenous Spd improved the expression level of psbA and psbB , which encoded the proteins of PSII core reaction center complex. We infer that PAs can stabilize the structure of nucleic acids and protect RNA from the degradation of ribonuclease. In brief, our study indicates that exogenous Spd enhances the heat tolerance of tall fescue by maintaining cell membrane stability, increasing antioxidant enzymes activities, improving PSII, and relevant gene expression.

  2. The Alleviation of Heat Damage to Photosystem II and Enzymatic Antioxidants by Exogenous Spermidine in Tall Fescue

    Directory of Open Access Journals (Sweden)

    Liang Zhang

    2017-10-01

    Full Text Available Tall fescue (Festuca arundinacea Schreb is a typical cool-season grass that is widely used in turf and pasture. However, high temperature as an abiotic stress seriously affects its utilization. The objective of this study was to explore the effect of spermidine (Spd on heat stress response of tall fescue. The samples were exposed to 22°C (normal condition or 44°C (heat stress for 4 h. The results showed that exogenous Spd partially improved the quality of tall fescue leaves under normal temperature conditions. Nevertheless, after heat stress treatment, exogenous Spd significantly decreased the electrolyte leakage of tall fescue leaves. Spd also profoundly reduced the H2O2 and O2⋅- content and increased antioxidant enzymes activities. In addition, PAs can also regulate antioxidant enzymes activities including SOD, POD, and APX which could help to scavenge ROS. Moreover, application of Spd could also remarkably increase the chlorophyll content and had a positive effect on the chlorophyll α fluorescence transients under high temperature. The Spd reagent enhanced the performance of photosystem II (PSII as observed by the JIP-test. Under heat stress, the Spd profoundly improved the partial potentials at the steps of energy bifurcations (PIABS and PItotal and the quantum yields and efficiencies (φP0, δR0, φR0, and γRC. Exogenous Spd could also reduce the specific energy fluxes per QA- reducing PSII reaction center (RC (TP0/RC and ET0/RC. Additionally, exogenous Spd improved the expression level of psbA and psbB, which encoded the proteins of PSII core reaction center complex. We infer that PAs can stabilize the structure of nucleic acids and protect RNA from the degradation of ribonuclease. In brief, our study indicates that exogenous Spd enhances the heat tolerance of tall fescue by maintaining cell membrane stability, increasing antioxidant enzymes activities, improving PSII, and relevant gene expression.

  3. The Use of Exogenous Melatonin in Delayed Sleep Phase Disorder: a Meta-analysis

    NARCIS (Netherlands)

    Geijlswijk, I.M. van; Korzilius, H.P.L.M.; Smits, M.G.

    2010-01-01

    Study Objectives: To perform a meta-analysis of the efficacy and safety of exogenous melatonin in advancing sleep-wake rhythm in patients with delayed sleep phase disorder. Design: Meta analysis of papers indexed for PubMed, Embase, and the abstracts of sleep and chronobiologic societies

  4. Transcription factor FOXO1 promotes cell migration toward exogenous ATP via controlling P2Y1 receptor expression in lymphatic endothelial cells.

    Science.gov (United States)

    Niimi, Kenta; Ueda, Mizuha; Fukumoto, Moe; Kohara, Misaki; Sawano, Toshinori; Tsuchihashi, Ryo; Shibata, Satoshi; Inagaki, Shinobu; Furuyama, Tatsuo

    2017-08-05

    Sprouting migration of lymphatic endothelial cell (LEC) is a pivotal step in lymphangiogenic process. However, its molecular mechanism remains unclear including effective migratory attractants. Meanwhile, forkhead transcription factor FOXO1 highly expresses in LEC nuclei, but its significance in LEC migratory activity has not been researched. In this study, we investigated function of FOXO1 transcription factor associated with LEC migration toward exogenous ATP which has recently gathered attentions as a cell migratory attractant. The transwell membrane assay indicated that LECs migrated toward exogenous ATP, which was impaired by FOXO1 knockdown. RT-PCR analysis showed that P2Y1, a purinergic receptor, expression was markedly reduced by FOXO1 knockdown in LECs. Moreover, P2Y1 blockage impaired LEC migration toward exogenous ATP. Western blot analysis revealed that Akt phosphorylation contributed to FOXO1-dependent LEC migration toward exogenous ATP and its blockage affected LEC migratory activity. Furthermore, luciferase reporter assay and ChIP assay suggested that FOXO1 directly bound to a conserved binding site in P2RY1 promoter and regulated its activity. These results indicated that FOXO1 serves a pivotal role in LEC migration toward exogenous ATP via direct transcriptional regulation of P2Y1 receptor. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Activity of Deferasirox in Mucorales: Influences of Species and Exogenous Iron▿

    Science.gov (United States)

    Lewis, Russell E.; Pongas, Georgios N.; Albert, Nathaniel; Ben-Ami, Ronen; Walsh, Thomas J.; Kontoyiannis, Dimitrios P.

    2011-01-01

    Differences in deferasirox susceptibility among members of the order Mucorales are unknown. Here we show that Cunninghamella bertholletiae (four isolates) and Mucor species (five isolates) display higher deferasirox MICs and minimal fungicidal concentrations compared to Rhizopus species (six isolates). Exogenous iron further attenuated the deferasirox susceptibility of Mucorales isolates with low MICs. Vital staining revealed damage to subapical compartments in susceptible strains. PMID:20956598

  6. Uptake of endogenous and exogenous 226Ra by vegetables from soils of a highly radioactive region

    International Nuclear Information System (INIS)

    Lima, V.T.; Penna-Franca, E.

    1988-01-01

    The Pocos de Caldas Plateau is a weathered alkaline igneous intrusion where several radioactive anomalies (U and Th series) exist. Not only the local soils but also the edible vegetables produced in the region can present 226 Ra concentrations up to 10 times higher than those from areas of normal radioactivity. The aim of this work is to evaluate through greenhouse experiments, the uptake of endogenous and exogenous 226 Ra by carrots, brown beans and kale grown from four paired local natural and contaminated farm soils. Simultaneously, sequential selective extractions were performed to estimate the partitioning of 226 Ra among six geochemical fractions. The results showed that concentration ratios (CRs), related to plant dry weight, for endogenous and exogenous 226 Ra in soils, were of the order of 10 -2 -10 -1 and 10 -2 -10 0 respectively. The averages of 226 Ra exchangeable and residual fractions in soils were: 3.2% and 50.2% for endogenous and 15.4% and 6.0% for exogenous radium. The CRs calculated either in relation to total 226 Ra or to the exchangeable fraction in soils showed about the same variability. (author)

  7. The use of stable isotopes in quantitative determinations of exogenous water and added ethanol in wines

    Science.gov (United States)

    Magdas, D. A.; Moldovan, Z.; Cristea, G.

    2012-02-01

    The application of oxygen isotope ratios analysis to wine water according to EU regulation no. 822/97 to determine wine's origin and also, the possible water addition to wines, gained great importance in wines authenticity control. In the natural cycle of water isotopic fractionation, during water evaporation process, the water vapors are depleted in heavy isotopes. On the other hand inside the plants take place an isotope enrichment of heavy stable isotopes of water compared with meteoric water due to photosynthesis and plants transpiration. This process makes possible the detection of exogenous water from wines 18O/16O ratios. Carbon isotopic ratios were used to estimate the supplementary addition of ethanol obtained from C4 plants (sugar cane or corn). This work presents the way in which the isotopic fingerprints (δ13C and δ18O) were used to determine the content of exogenous water from wines and the added supplementary ethanol coming from C4 plants. By using this method, the calculated values obtained for the degree of wine adulteration were in a good agreement with the real exogenous percent of water and ethanol from investigated samples.

  8. Impact of exogenous hyperglucagonemia on postprandial concentrations of gastric inhibitory polypeptide and glucagon-like peptide-1 in humans

    DEFF Research Database (Denmark)

    Meier, Juris J; Ritter, Peter R; Jacob, Alexandra

    2010-01-01

    Postprandial secretion of glucagon-like peptide 1 (GLP-1) has been found diminished in some patients with type 2 diabetes mellitus (T2DM) and high glucagon concentrations. We examined the effects of exogenous glucagon on the release of incretin hormones.......Postprandial secretion of glucagon-like peptide 1 (GLP-1) has been found diminished in some patients with type 2 diabetes mellitus (T2DM) and high glucagon concentrations. We examined the effects of exogenous glucagon on the release of incretin hormones....

  9. Short-term starvation is a strategy to unravel the cellular capacity of oxidizing specific exogenous/endogenous substrates in mitochondria.

    Science.gov (United States)

    Zeidler, Julianna D; Fernandes-Siqueira, Lorena O; Carvalho, Ana S; Cararo-Lopes, Eduardo; Dias, Matheus H; Ketzer, Luisa A; Galina, Antonio; Da Poian, Andrea T

    2017-08-25

    Mitochondrial oxidation of nutrients is tightly regulated in response to the cellular environment and changes in energy demands. In vitro studies evaluating the mitochondrial capacity of oxidizing different substrates are important for understanding metabolic shifts in physiological adaptations and pathological conditions, but may be influenced by the nutrients present in the culture medium or by the utilization of endogenous stores. One such influence is exemplified by the Crabtree effect (the glucose-mediated inhibition of mitochondrial respiration) as most in vitro experiments are performed in glucose-containing media. Here, using high-resolution respirometry, we evaluated the oxidation of endogenous or exogenous substrates by cell lines harboring different metabolic profiles. We found that a 1-h deprivation of the main energetic nutrients is an appropriate strategy to abolish interference of endogenous or undesirable exogenous substrates with the cellular capacity of oxidizing specific substrates, namely glutamine, pyruvate, glucose, or palmitate, in mitochondria. This approach primed mitochondria to immediately increase their oxygen consumption after the addition of the exogenous nutrients. All starved cells could oxidize exogenous glutamine, whereas the capacity for oxidizing palmitate was limited to human hepatocarcinoma Huh7 cells and to C2C12 mouse myoblasts that differentiated into myotubes. In the presence of exogenous glucose, starvation decreased the Crabtree effect in Huh7 and C2C12 cells and abrogated it in mouse neuroblastoma N2A cells. Interestingly, the fact that the Crabtree effect was observed only for mitochondrial basal respiration but not for the maximum respiratory capacity suggests it is not caused by a direct effect on the electron transport system. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Auxin synthesis gene tms1 driven by tuber-specific promoter alters hormonal status of transgenic potato plants and their responses to exogenous phytohormones.

    Science.gov (United States)

    Kolachevskaya, Oksana O; Sergeeva, Lidiya I; Floková, Kristyna; Getman, Irina A; Lomin, Sergey N; Alekseeva, Valeriya V; Rukavtsova, Elena B; Buryanov, Yaroslav I; Romanov, Georgy A

    2017-03-01

    Ectopic auxin overproduction in transgenic potato leads to enhanced productivity accompanied with concerted and occasional changes in hormonal status, and causing altered response of transformants to exogenous auxin or cytokinin. Previously, we generated potato transformants expressing Agrobacterium-derived auxin synthesis gene tms1 driven by tuber-specific patatin gene promoter (B33-promoter). Here, we studied the endogenous hormonal status and the response to exogenous phytohormones in tms1 transformants cultured in vitro. Adding indole-3-acetic acid (IAA) or kinetin to culture medium affected differently tuberization of tms1-transformed and control plants, depending also on sucrose content in the medium. Exogenous phytohormones ceased to stimulate the tuber initiation in transformants at high (5-8%) sucrose concentration, while in control plants the stimulation was observed in all experimental settings. Furthermore, exogenous auxin partly inhibited the tuber initiation, and exogenous cytokinin reduced the average tuber weight in most transformants at high sucrose content. The elevated auxin level in tubers of the transformants was accompanied with a decrease in content of cytokinin bases and their ribosides in tubers and most shoots. No concerted changes in contents of abscisic, jasmonic, salicylic acids and gibberellins in tubers were detected. The data on hormonal status indicated that the enhanced productivity of tms1 transformants was due to auxin and not mediated by other phytohormones. In addition, exogenous cytokinin was shown to upregulate the expression of genes encoding orthologs of auxin receptors. Overall, the results showed that tms1 expression and local increase in IAA level in transformants affect both the balance of endogenous cytokinins and the dynamics of tuberization in response to exogenous hormones (auxin, cytokinin), the latter reaction depending also on the carbohydrate supply. We introduce a basic model for the hormonal network

  11. Formation, Accumulation, and Hydrolysis of Endogenous and Exogenous Formaldehyde-Induced DNA Damage

    Science.gov (United States)

    Yu, Rui; Lai, Yongquan; Hartwell, Hadley J.; Moeller, Benjamin C.; Doyle-Eisele, Melanie; Kracko, Dean; Bodnar, Wanda M.; Starr, Thomas B.; Swenberg, James A.

    2015-01-01

    Formaldehyde is not only a widely used chemical with well-known carcinogenicity but is also a normal metabolite of living cells. It thus poses unique challenges for understanding risks associated with exposure. N2-hydroxymethyl-dG (N2-HOMe-dG) is the main formaldehyde-induced DNA mono-adduct, which together with DNA-protein crosslinks (DPCs) and toxicity-induced cell proliferation, play important roles in a mutagenic mode of action for cancer. In this study, N2-HOMe-dG was shown to be an excellent biomarker for direct adduction of formaldehyde to DNA and the hydrolysis of DPCs. The use of inhaled [13CD2]-formaldehyde exposures of rats and primates coupled with ultrasensitive nano ultra performance liquid chromatography-tandem mass spectrometry permitted accurate determinations of endogenous and exogenous formaldehyde DNA damage. The results show that inhaled formaldehyde only reached rat and monkey noses, but not tissues distant to the site of initial contact. The amounts of exogenous adducts were remarkably lower than those of endogenous adducts in exposed nasal epithelium. Moreover, exogenous adducts accumulated in rat nasal epithelium over the 28-days exposure to reach steady-state concentrations, followed by elimination with a half-life (t1/2) of 7.1 days. Additionally, we examined artifact formation during DNA preparation to ensure the accuracy of nonlabeled N2-HOMe-dG measurements. These novel findings provide critical new data for understanding major issues identified by the National Research Council Review of the 2010 Environmental Protection Agency’s Draft Integrated Risk Information System Formaldehyde Risk Assessment. They support a data-driven need for reflection on whether risks have been overestimated for inhaled formaldehyde, whereas underappreciating endogenous formaldehyde as the primary source of exposure that results in bone marrow toxicity and leukemia in susceptible humans and rodents deficient in DNA repair. PMID:25904104

  12. Effects of exogenous glucagon-like peptide-2 and distal bowel resection on intestinal and systemic adaptive responses in rats

    DEFF Research Database (Denmark)

    Lai, Sarah W; de Heuvel, Elaine; Wallace, Laurie E

    2017-01-01

    mount immunohistochemistry for neurons (HuC/D, VIP, nNOS), plasma glucose, gut hormones, and body composition. RESULTS: Resection increased the proportion of nNOS immunopositive myenteric neurons, intestinal muscularis propria thickness and crypt cell proliferation, which were not recapitulated by GLP-2......-2 attenuated resection-induced increases in blood glucose and body fat loss. CONCLUSIONS: Exogenous GLP-2 stimulates jejunal adaptation independent of enteric neuronal VIP or nNOS changes, and has divergent effects on plasma amylin and peptide YY concentrations. The novel ability of exogenous GLP-2......OBJECTIVE: To determine the effects of exogenous glucagon-like peptide-2 (GLP-2), with or without massive distal bowel resection, on adaptation of jejunal mucosa, enteric neurons, gut hormones and tissue reserves in rats. BACKGROUND: GLP-2 is a gut hormone known to be trophic for small bowel mucosa...

  13. Exogenous proline enhances the sensitivity of Tobacco BY-2 cells to arsenate.

    Science.gov (United States)

    Nahar, Mst Nur-E-Nazmun; Islam, Mohammad Muzahidul; Hoque, Md Anamul; Yonezawa, Anna; Prodhan, Md Yeasin; Nakamura, Toshiyuki; Nakamura, Yoshimasa; Munemasa, Shintaro; Murata, Yoshiyuki

    2017-09-01

    Arsenic causes physiological and structural disorders in plants. Proline is accumulated as a compatible solute in plants under various stress conditions and mitigates stresses. Here, we investigated the effects of exogenous proline on tobacco Bright Yellow-2 (BY-2) cultured cells under [Formula: see text] stress. Arsenate did not inhibit BY-2 cell growth at 40 and 50 μM but did it at 60 μM. Proline at 0.5 to 10 mM did not affect the cell growth but delayed it at 20 mM. At 40 μM [Formula: see text], neither 0.5 mM nor 1 mM proline affected the cell growth but 10 mM proline inhibited it. In the presence of [Formula: see text], 10 mM proline increased the number of Evans Blue-stained (dead) cells and decreased the number of total cells. Together, our results suggest that exogenous proline does not alleviate arsenate toxicity but enhances the sensitivity of BY-2 cells to arsenate.

  14. Simultaneous quantification of endogenous and exogenous plasma glucose by isotope dilution LC-MS/MS with indirect MRM of the derivative tag.

    Science.gov (United States)

    Yu, Lingling; Wen, Chao; Li, Xing; Fang, Shiqi; Yang, Lichuan; Wang, Tony; Hu, Kaifeng

    2018-03-01

    Quantification of endogenous and exogenous plasma glucose can help more comprehensively evaluate the glucose metabolic status. A ratio-based approach using isotope dilution liquid chromatography tandem mass spectrometry (ID LC-MS/MS) with indirect multiple reaction monitoring (MRM) of the derivative tag was developed to simultaneously quantify endo-/exogenous plasma glucose. Using diluted D-[ 13 C 6 ] glucose as tracer of exogenous glucose, 12 C 6 / 13 C 6 glucoses were first derivatized and then data were acquired in MRM mode. The metabolism of exogenous glucose can be tracked and the concentration ratio of endo/exo-genous glucose can be measured by calculating the endo-/exo-genous glucose concentrations from peak area ratio of specific daughter ions. Joint application of selective derivatization and MRM analysis not only improves the sensitivity but also minimizes the interference from the background of plasma, which warrants the accuracy and reproducibility. Good agreement between the theoretical and calculated concentration ratios was obtained with a linear correlation coefficient (R) of 0.9969 in the range of D-glucose from 0.5 to 20.0 mM, which covers the healthy and diabetic physiological scenarios. Satisfactory reproducibility was obtained by evaluation of the intra- and inter-day precisions with relative standard deviations (RSDs) less than 5.16%, and relative recoveries of 85.96 to 95.92% were obtained at low, medium, and high concentration, respectively. The method was successfully applied to simultaneous determination of the endo-/exogenous glucose concentration in plasma of non-diabetic and type II diabetic cynomolgus monkeys. Graphical Abstract The scheme of the proposed ratio-based approach using isotope dilution LC-MS/MS with indirect MRM of the derivative tag for simultaneous quantification of endogenous and exogenous plasma glucose.

  15. Efficient Use of Exogenous Isoprenols for Protein Isoprenylation by MDA-MB-231 Cells Is Regulated Independently of the Mevalonate Pathway*

    Science.gov (United States)

    Onono, Fredrick; Subramanian, Thangaiah; Sunkara, Manjula; Subramanian, Karunai Leela; Spielmann, H. Peter; Morris, Andrew J.

    2013-01-01

    Mammalian cells can use exogenous isoprenols to generate isoprenoid diphosphate substrates for protein isoprenylation, but the mechanism, efficiency, and biological importance of this process are not known. We developed mass spectrometry-based methods using chemical probes and newly synthesized stable isotope-labeled tracers to quantitate incorporation of exogenously provided farnesol, geranylgeraniol, and unnatural analogs of these isoprenols containing an aniline group into isoprenoid diphosphates and protein isoprenylcysteines by cultured human cancer cell lines. We found that at exogenous isoprenol concentrations >10 μm, this process can generate as much as 50% of the cellular isoprenoid diphosphate pool used for protein isoprenylation. Mutational activation of p53 in MDA-MB-231 breast cancer cells up-regulates the mevalonate pathway to promote tumor invasiveness. p53 silencing or pharmacological inhibition of HMG-CoA reductase in these cells decreases protein isoprenylation from endogenously synthesized isoprenoids but enhances the use of exogenous isoprenols for this purpose, indicating that this latter process is regulated independently of the mevalonate pathway. Our observations suggest unique opportunities for design of cancer cell-directed therapies and may provide insights into mechanisms underlying pleiotropic therapeutic benefits and unwanted side effects of mevalonate pathway inhibition. PMID:23908355

  16. Intrinsic excitability changes induced by acute treatment of hippocampal CA1 pyramidal neurons with exogenous amyloid β peptide

    Science.gov (United States)

    Scullion, Sarah; Brown, Jon T.; Randall, Andrew D.

    2015-01-01

    ABSTRACT Accumulation of beta‐amyloid (Aβ) peptides in the human brain is a canonical pathological hallmark of Alzheimer's disease (AD). Recent work in Aβ‐overexpressing transgenic mice indicates that increased brain Aβ levels can be associated with aberrant epileptiform activity. In line with this, such mice can also exhibit altered intrinsic excitability (IE) of cortical and hippocampal neurons: these observations may relate to the increased prevalence of seizures in AD patients. In this study, we examined what changes in IE are produced in hippocampal CA1 pyramidal cells after 2–5 h treatment with an oligomeric preparation of synthetic human Aβ 1–42 peptide. Whole cell current clamp recordings were compared between Aβ‐(500 nM) and vehicle‐(DMSO 0.05%) treated hippocampal slices obtained from mice. The soluble Aβ treatment did not produce alterations in sub‐threshold intrinsic properties, including membrane potential, input resistance, and hyperpolarization activated “sag”. Similarly, no changes were noted in the firing profile evoked by 500 ms square current supra‐threshold stimuli. However, Aβ 500 nM treatment resulted in the hyperpolarization of the action potential (AP) threshold. In addition, treatment with Aβ at 500 nM depressed the after‐hyperpolarization that followed both a single AP or 50 Hz trains of a number of APs between 5 and 25. These data suggest that acute exposure to soluble Aβ oligomers affects IE properties of CA1 pyramidal neurons differently from outcomes seen in transgenic models of amyloidopathy. However, in both chronic and acute models, the IE changes are toward hyperexcitability, reinforcing the idea that amyloidopathy and increased incidence in seizures might be causally related in AD patients. © 2014 The Authors Hippocampus Published by Wiley Periodicals, Inc. PMID:25515596

  17. Exogenously triggered response inhibition in developmental stuttering.

    Science.gov (United States)

    Eggers, Kurt; De Nil, Luc F; Van den Bergh, Bea R H

    2018-06-01

    The purpose of the present study was to examine relations between children's exogenously triggered response inhibition and stuttering. Participants were 18 children who stutter (CWS; mean age = 9;01 years) and 18 children who not stutter (CWNS; mean age = 9;01 years). Participants were matched on age (±3 months) and gender. Response inhibition was assessed by a stop signal task (Verbruggen, Logan, & Stevens, 2008). Results suggest that CWS, compared to CWNS, perform comparable to CWNS in a task where response control is externally triggered. Our findings seem to indicate that previous questionnaire-based findings (Eggers, De Nil, & Van den Bergh, 2010) of a decreased efficiency of response inhibition cannot be generalized to all types of response inhibition. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. Terapia com surfactante pulmonar exógeno em pediatria Exogenous surfactant therapy in pediatrics

    Directory of Open Access Journals (Sweden)

    Norberto A. Freddi

    2003-11-01

    Full Text Available OBJETIVO: Revisar o estágio atual do conhecimento sobre a utilização do surfactante exógeno nas diferentes doenças pulmonares que levam à insuficiência respiratória aguda em crianças. FONTES DOS DADOS: Este manuscrito baseia-se na experiência clínica dos autores sobre o assunto e na revisão da literatura recente através de consulta aos bancos de dados ONIA, Mdconsult, Medline e Cochrane Database Library. SÍNTESE DOS DADOS: Apesar do sucesso obtido com a utilização do surfactante exógeno na síndrome de desconforto respiratório do recém-nascido, questões permanecem indefinidas, como o momento do seu emprego, muito precoce (profilático, baseado na idade gestacional ou em testes rápidos de maturidade pulmonar, ou então mais tardiamente, após o quadro clínico instalado. Em outras patologias graves que levam à insuficiência respiratória grave com necessidade de suporte ventilatório, o seu uso ainda é controverso, e os dados da literatura são limitados e conflitantes. Porém, relatos de uso clínico em várias destas situações, com sucesso, têm sido freqüentes. A pesquisa em surfactante tem-se centrado ultimamente na sua inativação por várias substâncias que podem estar presentes na via aérea. Nas patologias em que a inativação parece ser um fator importante, novos surfactantes com adição de adjuvantes para reverter a tendência à inativação (por exemplo: polietilenoglicol estão atualmente em fase de testes. CONCLUSÕES: A terapia com surfactante exógeno ainda não é um tema esgotado, nem mesmo na SDR. Os surfactantes podem ser ainda aperfeiçoados, sobretudo para resistir à inibição, e as formas de utilização em outras doenças que não a SDR deverão ser aperfeiçoadas.OBJECTIVE: To review current knowledge about the use of exogenous surfactants in the treatment of different lung diseases causing acute respiratory failure in children. SOURCE OF DATA: This review is based on the authors

  19. Dynamic Financial Constraints: Distinguishing Mechanism Design from Exogenously Incomplete Regimes.

    Science.gov (United States)

    Karaivanov, Alexander; Townsend, Robert M

    2014-05-01

    We formulate and solve a range of dynamic models of constrained credit/insurance that allow for moral hazard and limited commitment. We compare them to full insurance and exogenously incomplete financial regimes (autarky, saving only, borrowing and lending in a single asset). We develop computational methods based on mechanism design, linear programming, and maximum likelihood to estimate, compare, and statistically test these alternative dynamic models with financial/information constraints. Our methods can use both cross-sectional and panel data and allow for measurement error and unobserved heterogeneity. We estimate the models using data on Thai households running small businesses from two separate samples. We find that in the rural sample, the exogenously incomplete saving only and borrowing regimes provide the best fit using data on consumption, business assets, investment, and income. Family and other networks help consumption smoothing there, as in a moral hazard constrained regime. In contrast, in urban areas, we find mechanism design financial/information regimes that are decidedly less constrained, with the moral hazard model fitting best combined business and consumption data. We perform numerous robustness checks in both the Thai data and in Monte Carlo simulations and compare our maximum likelihood criterion with results from other metrics and data not used in the estimation. A prototypical counterfactual policy evaluation exercise using the estimation results is also featured.

  20. Effects of exogenous inosine monophosphate on growth performance, flavor compounds, enzyme activity, and gene expression of muscle tissues in chicken.

    Science.gov (United States)

    Yan, Junshu; Liu, Peifeng; Xu, Liangmei; Huan, Hailin; Zhou, Weiren; Xu, Xiaoming; Shi, Zhendan

    2018-04-01

    The goal of this experiment was to examine effects of diets supplemented with exogenous inosine monophosphate (IMP) on the growth performance, flavor compounds, enzyme activity and gene expression of chicken. A total of 1,500 healthy, 1-day-old male 3-yellow chickens were used for a 52-d experimental period. Individuals were randomly divided into 5 groups (group I, II, III, IV, V) with 6 replicates per group, and fed a basal diet supplemented with 0.0, 0.05, 0.1, 0.2, and 0.3% IMP, respectively. There was no significant response to the increasing dietary IMP level in average daily feed intake (ADFI), average daily gain (ADG), and feed:gain ratio (F/G) (P ≥ 0.05). IMP content of the breast and thigh muscle showed an exponential and linear response to the increasing dietary IMP level (P exogenous IMP was fed. There were significant effects of IMP level in diet on free amino acids (FAA) (exponential, linear and quadratic effect, P exogenous IMP was fed. Dietary IMP supplementation had a quadratic effect on 5΄-NT and the alkaline phosphatase (ALP) enzyme activity in the breast muscle (P exogenous IMP group had the highest (AMPD1) gene expression of the breast muscle and ATIC gene expression of the thigh muscle. These results indicate that dietary IMP did not affect the growth performance of chicken, the diet with 0.2 to 0.3% exogenous IMP is optimal to improve the meat flavor quality in chicken.

  1. Temperature dependence of electrical properties of mixture of exogenous neurotransmitters dopamine and epinephrine

    Science.gov (United States)

    Patki, Mugdha; Patil, Vidya

    2016-05-01

    Neurotransmitters are chemical messengers that support the communication between the neurons. In vitro study of exogenous neurotransmitters Dopamine and Epinephrine and their mixture, carried out to learn about their electrical properties being dielectric constant and conductivity amongst others. Dielectric constant and conductivity of the selected neurotransmitters are found to increase with temperature. As a result, the time constant of the system increases with temperature. This change leads to increase in the time taken by the synapse to transport the action potential. The correlation between physical properties of exogenous neurotransmitters and psychological and physiological behaviour of human being may be understood with the help of current study. The response time of Epinephrine is in microseconds whereas response time of Dopamine is in milliseconds. The response time for both the neurotransmitters and their mixture is found to be increasing with temperature indicating the symptoms such as depression, apathy, chronic fatigue and low physical energy with no desire to exercise the body, which are observed during the fever.

  2. Exogenous acetaldehyde as a tool for modulating wine color and astringency during fermentation.

    Science.gov (United States)

    Sheridan, Marlena K; Elias, Ryan J

    2015-06-15

    Wine tannins undergo modifications during fermentation and storage that can decrease their perceived astringency and increase color stability. Acetaldehyde acts as a bridging compound to form modified tannins and polymeric pigments that are less likely to form tannin-protein complexes than unmodified tannins. Red wines are often treated with oxygen in order to yield acetaldehyde, however this approach can lead to unintended consequences due to the generation of reactive oxygen species. The present study employs exogenous acetaldehyde at relatively low and high treatment concentrations during fermentation to encourage tannin modification without promoting potentially deleterious oxidation reactions. The high acetaldehyde treatment significantly increased polymeric pigments in the wine without increasing concentrations of free and sulfite-bound acetaldehyde. Protein-tannin precipitation was also significantly decreased with the addition of exogenous acetaldehyde. These results indicate a possible treatment of wines early in their production to increase color stability and lower astringency of finished wines. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Correlation of protein content to flatulent galactooligosaccharides and exogenous amino acids in seeds of Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Ryszard Kosson

    2014-01-01

    Full Text Available In order to estimate the possible correlations among constituents of Phaseolus vulgaris seeds, the contents of protein, exogenous amino acids and flatulent galactooligosaccharides (raffinose and stachyose were analyzed in 16 Polish bean cultivars for dry seeds. A negative correlation coefficient (r =-0.9490 was found between protein and methionine contents. High positive correlations among exogenous amino acids, such as lysine and isoleucine, valine and isoleucine, lysine and tyrosine, were observed indicating a chance of selecting far more than one at a time. The small-seeded bean cultivars contained higher contents of protein and galactooligosaccharides than the large-seeded ones.

  4. Molecular MRI using exogenous enzymatic sensors and endogenous chemical exchange contrast

    OpenAIRE

    Taylor, Alexander John

    2016-01-01

    Molecular magnetic resonance imaging (MRI) methods have the potential to provide detailed information regarding cellular and molecular processes at small scales within the human body. Nuclear signals from chemical samples can be probed using specialised MRI techniques, to highlight molecular contrast from particular enzymes or metabolites. The aim of the work described in this thesis is to investigate both exogenous and endogenous contrast mechanisms using fluorine MRI and chemical exchange s...

  5. A TAD further: exogenous control of gene activation.

    Science.gov (United States)

    Mapp, Anna K; Ansari, Aseem Z

    2007-01-23

    Designer molecules that can be used to impose exogenous control on gene transcription, artificial transcription factors (ATFs), are highly desirable as mechanistic probes of gene regulation, as potential therapeutic agents, and as components of cell-based devices. Recently, several advances have been made in the design of ATFs that activate gene transcription (activator ATFs), including reports of small-molecule-based systems and ATFs that exhibit potent activity. However, the many open mechanistic questions about transcriptional activators, in particular, the structure and function of the transcriptional activation domain (TAD), have hindered rapid development of synthetic ATFs. A compelling need thus exists for chemical tools and insights toward a more detailed portrait of the dynamic process of gene activation.

  6. Exogenous sphingosine-1-phosphate boosts acclimatization in rats exposed to acute hypobaric hypoxia: assessment of haematological and metabolic effects.

    Directory of Open Access Journals (Sweden)

    Sonam Chawla

    Full Text Available The physiological challenges posed by hypobaric hypoxia warrant exploration of pharmacological entities to improve acclimatization to hypoxia. The present study investigates the preclinical efficacy of sphingosine-1-phosphate (S1P to improve acclimatization to simulated hypobaric hypoxia.Efficacy of intravenously administered S1P in improving haematological and metabolic acclimatization was evaluated in rats exposed to simulated acute hypobaric hypoxia (7620 m for 6 hours following S1P pre-treatment for three days.Altitude exposure of the control rats caused systemic hypoxia, hypocapnia (plausible sign of hyperventilation and respiratory alkalosis due to suboptimal renal compensation indicated by an overt alkaline pH of the mixed venous blood. This was associated with pronounced energy deficit in the hepatic tissue along with systemic oxidative stress and inflammation. S1P pre-treatment improved blood oxygen-carrying-capacity by increasing haemoglobin, haematocrit, and RBC count, probably as an outcome of hypoxia inducible factor-1α mediated erythropoiesis and renal S1P receptor 1 mediated haemoconcentation. The improved partial pressure of oxygen in the blood could further restore aerobic respiration and increase ATP content in the hepatic tissue of S1P treated animals. S1P could also protect the animals from hypoxia mediated oxidative stress and inflammation.The study findings highlight S1P's merits as a preconditioning agent for improving acclimatization to acute hypobaric hypoxia exposure. The results may have long term clinical application for improving physiological acclimatization of subjects venturing into high altitude for occupational or recreational purposes.

  7. Reversible diastolic dysfunction after long-term exogenous subclinical hyperthyroidism: a randomized, placebo-controlled study

    NARCIS (Netherlands)

    Smit, J. W. A.; Eustatia-Rutten, C. F. A.; Corssmit, E. P. M.; Pereira, A. M.; Frölich, M.; Bleeker, G. B.; Holman, E. R.; van der Wall, E. E.; Romijn, J. A.; Bax, J. J.

    2005-01-01

    Subclinical hyperthyroidism has been reported to affect systolic and diastolic cardiac function. However, the reversibility of these effects is not well established. Our objective was to investigate the presence and reversibility of cardiac abnormalities in patients with long-term exogenous

  8. Exogenous lactobacilli mitigate microbial changes associated with grain fermentation (corn, oats, and wheat) by equine fecal microflora ex vivo.

    Science.gov (United States)

    Harlow, Brittany E; Lawrence, Laurie M; Harris, Patricia A; Aiken, Glen E; Flythe, Michael D

    2017-01-01

    Cereal grains are often included in equine diets. When starch intake exceeds foregut digestion starch will reach the hindgut, impacting microbial ecology. Probiotics (e.g., lactobacilli) are reported to mitigate GI dysbioses in other species. This study was conducted to determine the effect of exogenous lactobacilli on pH and the growth of amylolytic and lactate-utilizing bacteria. Feces were collected from 3 mature geldings fed grass hay with access to pasture. Fecal microbes were harvested by differential centrifugation, washed, and re-suspended in anaerobic media containing ground corn, wheat, or oats at 1.6% (w/v) starch and one of five treatments: Control (substrate only), L. acidophilus, L. buchneri, L. reuteri, or an equal mixture of all three (107 cells/mL, final concentration). After 24 h of incubation (37°C, 160 rpm), samples were collected for pH and enumerations of total amylolytics, Group D Gram-positive cocci (GPC; Enterococci, Streptococci), lactobacilli, and lactate-utilizing bacteria. Enumeration data were log transformed prior to ANOVA (SAS, v. 9.3). Lactobacilli inhibited pH decline in corn and wheat fermentations (P Exogenous lactobacilli decreased amylolytics, while increasing lactate-utilizers in corn and wheat fermentations (P Exogenous lactobacilli decreased the initial (first 8 h) rate of starch catalysis when wheat was the substrate, but did not decrease total (24 h) starch utilization in any case. These results indicate that exogenous lactobacilli can impact the microbial community and pH of cereal grain fermentations by equine fecal microflora ex vivo. Additionally, dead (autoclaved) exogenous lactobacilli had similar effects as live lactobacilli on fermentation. This latter result indicates that the mechanism by which lactobacilli impact other amylolytic bacteria is not simple resource competition.

  9. Associations among personal care product use patterns and exogenous hormone use in the NIEHS Sister Study.

    Science.gov (United States)

    Taylor, Kyla W; Baird, Donna D; Herring, Amy H; Engel, Lawrence S; Nichols, Hazel B; Sandler, Dale P; Troester, Melissa A

    2017-09-01

    It is hypothesized that certain chemicals in personal care products may alter the risk of adverse health outcomes. The primary aim of this study was to use a data-centered approach to classify complex patterns of exposure to personal care products and to understand how these patterns vary according to use of exogenous hormone exposures, oral contraceptives (OCs) and post-menopausal hormone therapy (HT). The NIEHS Sister Study is a prospective cohort study of 50,884 US women. Limiting the sample to non-Hispanic blacks and whites (N=47,019), latent class analysis (LCA) was used to identify groups of individuals with similar patterns of personal care product use based on responses to 48 survey questions. Personal care products were categorized into three product types (beauty, hair, and skincare products) and separate latent classes were constructed for each type. Adjusted prevalence differences (PD) were calculated to estimate the association between exogenous hormone use, as measured by ever/never OC or HT use, and patterns of personal care product use. LCA reduced data dimensionality by grouping of individuals with similar patterns of personal care product use into mutually exclusive latent classes (three latent classes for beauty product use, three for hair, and four for skin care. There were strong differences in personal care usage by race, particularly for haircare products. For both blacks and whites, exogenous hormone exposures were associated with higher levels of product use, especially beauty and skincare products. Relative to individual product use questions, latent class variables capture complex patterns of personal care product usage. These patterns differed by race and were associated with ever OC and HT use. Future studies should consider personal care product exposures with other exogenous exposures when modeling health risks.

  10. Direct and indirect exogenous contamination by pesticides of rice-farming soils in a Mediterranean wetland.

    Science.gov (United States)

    Gamón, M; Sáez, E; Gil, J; Boluda, R

    2003-02-01

    It is known that the sources of soil contamination can be endogenous or exogenous and that exogenous contamination may be direct or indirect. In this work, an environmental pesticide fate study was conducted in soil profiles collected from 23 rice field sites in an important Mediterranean wetland (Albufera Natural Park, Valencia, Spain) from April 1996 to November 1997. Temporal and spatial distribution of 44 pesticide residues in an alluvial Mediterranean soil (gleyic-calcaric Fluvisol, Fluvaquent) were monitored. During this period, the levels of pesticide residues in different soil horizons (Ap1 0-12 cm, Ap2 12-30 cm, ApCg 30-50 cm, C1gr 50-76 cm, and C2r 76-100 cm) were investigated. In addition, information was collected on agricultural pesticide application practices and soil characteristics. Distribution throughout the soil profile showed that pesticide concentrations were always higher in the topsoil (Ap1 horizon), in the autumn season, and in the border with citrus-vegetable orchard soils (calcaric Fluvisol, Xerofluvent). Chlorpyrifos (organophosphorus), endosulfan (organochlorine), and pyridaphenthion (organophosphorus) insecticides were, respectively, the most detected of all the pesticides investigated. These results were associated with processes, such as nonleaching, transport by movement into surface waters, retention, volatilization, and chemical and biological degradation in the topsoil, as well as with direct and indirect exogenous contamination sources.

  11. Staphylococcus aureus utilizes host-derived lipoprotein particles as sources of exogenous fatty acids.

    Science.gov (United States)

    Delekta, Phillip C; Shook, John C; Lydic, Todd A; Mulks, Martha H; Hammer, Neal D

    2018-03-26

    Methicillin-resistant Staphylococcus aureus (MRSA) is a threat to global health. Consequently, much effort has focused on the development of new antimicrobials that target novel aspects of S. aureus physiology. Fatty acids are required to maintain cell viability, and bacteria synthesize fatty acids using the type II fatty acid synthesis pathway (FASII). FASII is significantly different from human fatty acid synthesis, underscoring the therapeutic potential of inhibiting this pathway. However, many Gram-positive pathogens incorporate exogenous fatty acids, bypassing FASII inhibition and leaving the clinical potential of FASII inhibitors uncertain. Importantly, the source(s) of fatty acids available to pathogens within the host environment remains unclear. Fatty acids are transported throughout the body by lipoprotein particles in the form of triglycerides and esterified cholesterol. Thus, lipoproteins, such as low-density lipoprotein (LDL) represent a potentially rich source of exogenous fatty acids for S. aureus during infection. We sought to test the ability of LDLs to serve as a fatty acid source for S. aureus and show that cells cultured in the presence of human LDLs demonstrate increased tolerance to the FASII inhibitor, triclosan. Using mass spectrometry, we observed that host-derived fatty acids present in the LDLs are incorporated into the staphylococcal membrane and that tolerance to triclosan is facilitated by the fatty acid kinase A, FakA, and Geh, a triacylglycerol lipase. Finally, we demonstrate that human LDLs support the growth of S. aureus fatty acid auxotrophs. Together, these results suggest that human lipoprotein particles are a viable source of exogenous fatty acids for S. aureus during infection. IMPORTANCE Inhibition of bacterial fatty acid synthesis is a promising approach to combating infections caused by S. aureus and other human pathogens. However, S. aureus incorporates exogenous fatty acids into its phospholipid bilayer. Therefore, the

  12. Endogenously- and Exogenously-Driven Selective Sustained Attention: Contributions to Learning in Kindergarten Children

    Science.gov (United States)

    Erickson, Lucy C.; Thiessen, Erik D.; Godwin, Karrie E.; Dickerson, John P.; Fisher, Anna V.

    2015-01-01

    Selective sustained attention is vital for higher order cognition. Although endogenous and exogenous factors influence selective sustained attention, assessment of the degree to which these factors influence performance and learning is often challenging. We report findings from the Track-It task, a paradigm that aims to assess the contribution of…

  13. Modelling and predicting electricity consumption in Spain using the stochastic Gamma diffusion process with exogenous factors

    International Nuclear Information System (INIS)

    Nafidi, A.; Gutiérrez, R.; Gutiérrez-Sánchez, R.; Ramos-Ábalos, E.; El Hachimi, S.

    2016-01-01

    The aim of this study is to model electric power consumption during a period of economic crisis, characterised by declining gross domestic product. A novel aspect of this study is its use of a Gamma-type diffusion process for short and medium-term forecasting – other techniques that have been used to describe such consumption patterns are not valid in this situation. In this study, we consider a new extension of the stochastic Gamma diffusion process by introducing time functions (exogenous factors) that affect its trend. This extension is defined in terms of Kolmogorov backward and forward equations. After obtaining the transition probability density function and the moments (specifically, the trend function), the inference on the process parameters is obtained by discrete sampling of the sample paths. Finally, this stochastic process is applied to model total net electricity consumption in Spain, when affected by the following set of exogenous factors: Gross Domestic Product (GDP), Gross Fixed Capital Formation (GFCF) and Final Domestic Consumption (FDC). - Highlights: • The aim is modelling and predicting electricity consumption in Spain. • We propose a Gamma-type diffusion process for short and medium-term forecasting. • We compared the fit using diffusion processes with different exogenous factors.

  14. Influence of exogenous fibrolytic enzymes on in vitro and in sacco degradation of forages for ruminants

    Directory of Open Access Journals (Sweden)

    Lorenzo Carreón

    2010-02-01

    Full Text Available An in vitro assay was carried out to evaluate the effects of exogenous fibrolytic enzymes (1, 2, 3 and 4 g/kg DM powder preparation containing xylanase and cellulase from Aspergillus niger and Trichoderma viride on DM, NDF and ADF degradation of alfalfa hay, corn silage, corn stover, elephant grass, Guinea grass and oat straw. Kinetics data of in vitro degradations were analyzed. The potentially degradable fraction and degradation rate of NDF and ADF of alfalfa increased quadratically (P<0.05 as the inclusion level of enzyme increased up to 3 g. The others forages were not affected by the enzyme. An in sacco trail was performed using four Holstein steers fitted with ruminal cannulas to evaluate the effects of the exogenous fibrolytic enzymes (3 g/kg DM on DM, NDF and ADF degradation of alfalfa hay and corn stover. Kinetics data were also analyzed. The potentially degradable fraction degradation of NDF (62.0 vs 65.7% and ADF (52.8 vs 56.9%, of alfalfa hay were increased (P<0.05 by the exogenous fibrolytic enzymes, but no differences were found for corn stover. These results suggest that the enzymes increased in vitro and in sacco fibre degradation only for alfalfa hay.

  15. Endogenous MOV10 inhibits the retrotransposition of endogenous retroelements but not the replication of exogenous retroviruses.

    Science.gov (United States)

    Arjan-Odedra, Shetal; Swanson, Chad M; Sherer, Nathan M; Wolinsky, Steven M; Malim, Michael H

    2012-06-22

    The identification of cellular factors that regulate the replication of exogenous viruses and endogenous mobile elements provides fundamental understanding of host-pathogen relationships. MOV10 is a superfamily 1 putative RNA helicase that controls the replication of several RNA viruses and whose homologs are necessary for the repression of endogenous mobile elements. Here, we employ both ectopic expression and gene knockdown approaches to analyse the role of human MOV10 in the replication of a panel of exogenous retroviruses and endogenous retroelements. MOV10 overexpression substantially decreased the production of infectious retrovirus particles, as well the propagation of LTR and non-LTR endogenous retroelements. Most significantly, RNAi-mediated silencing of endogenous MOV10 enhanced the replication of both LTR and non-LTR endogenous retroelements, but not the production of infectious retrovirus particles demonstrating that natural levels of MOV10 suppress retrotransposition, but have no impact on infection by exogenous retroviruses. Furthermore, functional studies showed that MOV10 is not necessary for miRNA or siRNA-mediated mRNA silencing. We have identified novel specificity for human MOV10 in the control of retroelement replication and hypothesise that MOV10 may be a component of a cellular pathway or process that selectively regulates the replication of endogenous retroelements in somatic cells.

  16. Exogenous putrescine affects endogenous polyamine levels and the development of Picea abies somatic embryos

    Czech Academy of Sciences Publication Activity Database

    Vondráková, Zuzana; Eliášová, Kateřina; Vágner, Martin; Martincová, Olga; Cvikrová, Milena

    2015-01-01

    Roč. 75, č. 2 (2015), s. 405-414 ISSN 0167-6903 R&D Projects: GA MŠk(CZ) LD13050 Institutional support: RVO:61389030 Keywords : Exogenous putrescine * Somatic embryogenesis * Picea abies Subject RIV: ED - Physiology Impact factor: 2.333, year: 2015

  17. Specificity of exogenous acetate and glutamate as astrocyte substrates examined in acute brain slices from female mice using methionine sulfoximine (MSO) to inhibit glutamine synthesis

    DEFF Research Database (Denmark)

    Andersen, Jens Velde; McNair, Laura Frendrup; Schousboe, Arne

    2017-01-01

    Removal of endogenously released glutamate is mediated primarily by astrocytes and exogenous (13) C-labeled glutamate has been applied to study glutamate metabolism in astrocytes. Likewise, studies have clearly established the relevance of (13) C-labeled acetate as an astrocyte specific metabolic...... cortical slices from female NMRI mice were incubated in media containing [1,2-(13) C]acetate or [U-(13) C]glutamate, with or without methionine sulfoximine (MSO) to inhibit glutamine synthetase (GS). Tissue extracts were analyzed by gas chromatography-mass spectrometry. Blocking GS abolished the majority...... of glutamine (13) C-labeling from [1,2-(13) C]acetate as intended. However, (13) C-labeling of GABA was only 40-50% reduced by MSO, suggesting considerable neuronal uptake of acetate. Moreover, labeling of glutamate from [1,2-(13) C]acetate in the presence of MSO exceeded the level probable from exclusive...

  18. Effect of exogenous inoculants on enhancing oil recovery and indigenous bacterial community dynamics in long-term field pilot of low permeability reservoir.

    Science.gov (United States)

    Li, Jing; Xue, Shuwen; He, Chunqiu; Qi, Huixia; Chen, Fulin; Ma, Yanling

    2018-03-20

    Pseudomonas aeruginosa DN1 strain and Bacillus subtilis QHQ110 strain were chosen as rhamnolipid and lipopeptide producer respectively, to evaluate the efficiency of exogenous inoculants on enhancing oil recovery (EOR) and to explore the relationship between injected bacteria and indigenous bacterial community dynamics in long-term filed pilot of Hujianshan low permeability water-flooded reservoir for 26 months. Core-flooding tests showed that the oil displacement efficiency increased by 18.46% with addition of exogenous consortia. Bacterial community dynamics using quantitative PCR and high-throughput sequencing revealed that the exogenous inoculants survived and could live together with indigenous bacterial populations. They gradually became the dominant community after the initial activation, while their comparative advantage weakened continually after 3 months of the first injection. The bacterial populations did not exert an observable change in the process of the second injection of exogenous inoculants. On account of facilitating oil emulsification and accelerating bacterial growth with oil as the carbon source by the injection of exogenous consortia, γ-proteobacteria was finally the prominent bacterial community at class level varying from 25.55 to 32.67%, and the dominant bacterial populations were increased by 2-3 orders of magnitude during the whole processes. The content of organic acids and rhamnolipids in reservoir were promoted with the change of bacterial community diversity, respectively. Cumulative oil increments reached 26,190 barrels for 13 months after the first injection, and 55,947 barrels of oil had been accumulated in all of A20 wells block through two rounds of bacterial consortia injection. The performance of EOR has a cumulative improvement by the injection of exogenous inoculants without observable inhibitory effect on the indigenous bacterial populations, demonstrating the application potential in low permeability water

  19. Exogenous vs Endogenous Growth in the EU’s EaP and Central Asian Countries

    Directory of Open Access Journals (Sweden)

    Sharipov Ilkhom

    2016-12-01

    Full Text Available The main purpose of this paper is to determine and analyse the factors that affected economic growth in the EU’s Eastern Partnership and Central Asian countries in the 2000-2015 period. Economic growth is one of the main targets of economic policy of any country and influenced by various determinants. Of particular interest is the endogenous and exogenous nature of these factors. Having classified these factors into exogenous and endogenous ones, we examined and determined the significance and robustness of various factors influencing the economic growth in these countries, like investment, human capital, research and development, economic policies and macroeconomic conditions, openness to trade, geography, political factors and others. Correlation and factor analysis showed significance and strong association of GDP per capita with physical, human capital, and R&D in EaP countries and with natural resources and active population share in Central Asian countries.

  20. Exogenous Factors in the Development of Flexible Fuel Cars as a Local Dominant Technology

    Directory of Open Access Journals (Sweden)

    Paulo Tromboni de Souza Nascimento

    2009-12-01

    Full Text Available With flexible fuel technology, customers can choose among gasoline, ethanol, or any mix thereof at the fuel station pump. This paper presents the endogenous and exogenous factors that influnced the development of a flexible fuel electronic injection system by Magneti Marelli Automotive Systems Brazil – the first to the market. This software-based technological architecture, launched commercially in 2003, is now the dominant flexfuel design in the Brazilian market. This article documents the emergence of a local dominant technology (design in a specific car sub-system. It is shown how exogenous institutional factors played the major role in this process. The paper describes how this local dominant technological design emerged through the sharing of capabilities and interaction among the key market players, in the absence of a strong appropriability regime. All the main market pioneers were multinational affiliates, inviting questions concerning this technology diffusion outside Brazil.

  1. ON THE DEMAND DYNAMICS OF ELECTRICITY IN GHANA: DO EXOGENOUS NON-ECONOMIC VARIABLES COUNT?

    Directory of Open Access Journals (Sweden)

    Ishmael Ackah

    2014-04-01

    Full Text Available The purpose of this study is to identify and quantify the effect of endogenous and exogenous economic factors on electricity demand in Ghana. The Structural Time Series Model is employed due to its ability to capture exogenous non-economic variables. The findings reveal that education has significant effect on electricity consumption in both the short and the long run. Education has inverse relationship with electricity consumption implying that the more consumers are educated, the less electricity they consume. The study also reveals that price changes have less impact on electricity consumption in the short run and that efficiency in electricity consumption has improved since 1971 and will continue for the next twenty years. The study recommends that more public education should be carried out to enhance energy conservation and also, realistic prices should be charge for electricity consumption to allow private investment into the sector.

  2. Metabolism of ketone bodies during exercise and training: physiological basis for exogenous supplementation.

    Science.gov (United States)

    Evans, Mark; Cogan, Karl E; Egan, Brendan

    2017-05-01

    Optimising training and performance through nutrition strategies is central to supporting elite sportspeople, much of which has focused on manipulating the relative intake of carbohydrate and fat and their contributions as fuels for energy provision. The ketone bodies, namely acetoacetate, acetone and β-hydroxybutyrate (βHB), are produced in the liver during conditions of reduced carbohydrate availability and serve as an alternative fuel source for peripheral tissues including brain, heart and skeletal muscle. Ketone bodies are oxidised as a fuel source during exercise, are markedly elevated during the post-exercise recovery period, and the ability to utilise ketone bodies is higher in exercise-trained skeletal muscle. The metabolic actions of ketone bodies can alter fuel selection through attenuating glucose utilisation in peripheral tissues, anti-lipolytic effects on adipose tissue, and attenuation of proteolysis in skeletal muscle. Moreover, ketone bodies can act as signalling metabolites, with βHB acting as an inhibitor of histone deacetylases, an important regulator of the adaptive response to exercise in skeletal muscle. Recent development of ketone esters facilitates acute ingestion of βHB that results in nutritional ketosis without necessitating restrictive dietary practices. Initial reports suggest this strategy alters the metabolic response to exercise and improves exercise performance, while other lines of evidence suggest roles in recovery from exercise. The present review focuses on the physiology of ketone bodies during and after exercise and in response to training, with specific interest in exploring the physiological basis for exogenous ketone supplementation and potential benefits for performance and recovery in athletes. © 2016 The Authors. The Journal of Physiology © 2016 The Physiological Society.

  3. Low concentration of exogenous carbon monoxide protects mammalian cells against proliferation induced by radiation-induced bystander effect

    International Nuclear Information System (INIS)

    Tong, Liping; Yu, K.N.; Bao, Lingzhi; Wu, Wenqing; Wang, Hongzhi; Han, Wei

    2014-01-01

    Highlights: • We show the possibility of modulate proliferation induced by radiation-induced bystander effect with low concentration carbon monoxide. • Carbon monoxide inhibited proliferation via modulating the transforming growth factor β1 (TGF-β1)/nitric oxide (NO) signaling pathway. • Exogenous carbon monoxide has potential application in clinical radiotherapy. - Abstract: Radiation-induced bystander effect (RIBE) has been proposed to have tight relationship with the irradiation-caused secondary cancers beyond the irradiation-treated area after radiotherapy. Our previous studies demonstrated a protective effect of low concentration carbon monoxide (CO) on the genotoxicity of RIBE after α-particle irradiation. In the present work, a significant inhibitory effect of low-dose exogenous CO, generated by tricarbonyldichlororuthenium (II) dimer [CO-releasing molecule (CORM-2)], on both RIBE-induced proliferation and chromosome aberration was observed. Further studies on the mechanism revealed that the transforming growth factor β1/nitric oxide (NO) signaling pathway, which mediated RIBE signaling transduction, could be modulated by CO involved in the protective effects. Considering the potential of exogenous CO in clinical applications and its protective effect on RIBE, the present work aims to provide a foundation for potential application of CO in radiotherapy

  4. Low concentration of exogenous carbon monoxide protects mammalian cells against proliferation induced by radiation-induced bystander effect

    Energy Technology Data Exchange (ETDEWEB)

    Tong, Liping [Center of Medical Physics and Technology, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031 (China); Yu, K.N. [Department of Physics and Materials Science, City University of Hong Kong, Tat Chee Avenue, Kowloon Tong (Hong Kong); Center of Medical Physics and Technology, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031 (China); Bao, Lingzhi; Wu, Wenqing; Wang, Hongzhi [Center of Medical Physics and Technology, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031 (China); Han, Wei, E-mail: hanw@hfcas.cn [Center of Medical Physics and Technology, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031 (China)

    2014-01-15

    Highlights: • We show the possibility of modulate proliferation induced by radiation-induced bystander effect with low concentration carbon monoxide. • Carbon monoxide inhibited proliferation via modulating the transforming growth factor β1 (TGF-β1)/nitric oxide (NO) signaling pathway. • Exogenous carbon monoxide has potential application in clinical radiotherapy. - Abstract: Radiation-induced bystander effect (RIBE) has been proposed to have tight relationship with the irradiation-caused secondary cancers beyond the irradiation-treated area after radiotherapy. Our previous studies demonstrated a protective effect of low concentration carbon monoxide (CO) on the genotoxicity of RIBE after α-particle irradiation. In the present work, a significant inhibitory effect of low-dose exogenous CO, generated by tricarbonyldichlororuthenium (II) dimer [CO-releasing molecule (CORM-2)], on both RIBE-induced proliferation and chromosome aberration was observed. Further studies on the mechanism revealed that the transforming growth factor β1/nitric oxide (NO) signaling pathway, which mediated RIBE signaling transduction, could be modulated by CO involved in the protective effects. Considering the potential of exogenous CO in clinical applications and its protective effect on RIBE, the present work aims to provide a foundation for potential application of CO in radiotherapy.

  5. Exogenous melatonin administration modifies cutaneous vasoconstrictor response to whole body skin cooling in humans.

    Science.gov (United States)

    Aoki, Ken; Zhao, Kun; Yamazaki, Fumio; Sone, Ryoko; Alvarez, Guy E; Kosiba, Wojciech A; Johnson, John M

    2008-03-01

    Humans and other diurnal species experience a fall in internal temperature (T(int)) at night, accompanied by increased melatonin and altered thermoregulatory control of skin blood flow (SkBF). Also, exogenous melatonin induces a fall in T(int), an increase in distal skin temperatures and altered control of the cutaneous active vasodilator system, suggesting an effect of melatonin on the control of SkBF. To test whether exogenous melatonin also affects the more tonically active vasoconstrictor system in glabrous and nonglabrous skin during cooling, healthy males (n = 9) underwent afternoon sessions of whole body skin temperature (T(sk)) cooling (water-perfused suits) after oral melatonin (Mel; 3 mg) or placebo (Cont). Cutaneous vascular conductance (CVC) was calculated from SkBF (laser Doppler flowmetry) and non-invasive blood pressure. Baseline T(int) was lower in Mel than in Cont (P forearm CVC was first significantly reduced at T(sk) of 34.33 +/- 0.01 degrees C (P forearm CVC in Mel was significantly less than in Cont at T(sk) of 32.66 +/- 0.01 degrees C and lower (P < 0.05). In Mel, palmar CVC was significantly higher than in Cont above T(sk) of 33.33 +/- 0.01 degrees C, but not below. Thus exogenous melatonin blunts reflex vasoconstriction in nonglabrous skin and shifts vasoconstrictor system control to lower T(int). It provokes vasodilation in glabrous skin but does not suppress the sensitivity to falling T(sk). These findings suggest that by affecting the vasoconstrictor system, melatonin has a causal role in the nocturnal changes in body temperature and its control.

  6. Transcriptome profiling of postharvest strawberry fruit in response to exogenous auxin and abscisic acid.

    Science.gov (United States)

    Chen, Jingxin; Mao, Linchun; Lu, Wenjing; Ying, Tiejin; Luo, Zisheng

    2016-01-01

    Auxin and abscisic acid regulate strawberry fruit ripening and senescence through cross-talk of their signal transduction pathways that further modulate the structural genes related to physico-chemical properties of fruit. The physiological and transcriptomic changes in harvested strawberry fruits in responses to IAA, ABA and their combination were analyzed. Exogenous IAA delayed the ripening process of strawberries after harvest while ABA promoted the postharvest ripening. However, treatment with a combination of IAA and ABA did not slow down nor accelerate the postharvest ripening in the strawberry fruits. At the molecular level, exogenous IAA up regulated the expressions of genes related to IAA signaling, including AUX/IAA, ARF, TOPLESS and genes encoding E3 ubiquitin protein ligase and annexin, and down regulated genes related to pectin depolymerization, cell wall degradation, sucrose and anthocyanin biosyntheses. In contrast, exogenous ABA induced genes related to fruit softening, and genes involved in signaling pathways including SKP1, HSPs, CK2, and SRG1. Comparison of transcriptomes in responses to individual treatments with IAA or ABA or the combination revealed that there were cooperative and antagonistic actions between IAA and ABA in fruit. However, 17% of the differentially expressed unigenes in response to the combination of IAA and ABA were unique and were not found in those unigenes responding to either IAA or ABA alone. The analyses also found that receptor-like kinases and ubiquitin ligases responded to both IAA and ABA, which seemed to play a pivotal role in both hormones' signaling pathways and thus might be the cross-talk points of both hormones.

  7. Incorporation of DL(1-14C)-leucine into muscle proteins in buffalo calves and its response to exogenous insulin

    International Nuclear Information System (INIS)

    Vivekanandan, R.; Singh, L.N.

    1976-01-01

    Protein synthesis and the effect of insulin on this process have been studied in buffalo skeletal muscles using DL(1- 14 C)-leucine. The muscle fibres isolated from triceps, showed highest specific radioactivity (SRA) in the sarcoplasmic proteins followed by myofibrillar and stroma proteins. Exogenous insulin stimulated the incorporation in the myofibrillar and stroma fractions but not in the sarcoplasmic proteins. Radioscanning of the polyacrylamide gel electrophorograms further revealed preferential labelling of only some of the myofibrillar proteins in the presence of exogenous insulin. Statistically significant differences in the SRA were observed between nuclear, mitochondrial and post-mitochondrial proteins without exogenous insulin the post-mitochondrial proteins showing highest SRA. Addition of insulin to the assay medium significantly stimulated the incorporation in the nuclear fraction whereas mitochondrial and post-mitochondrial fractions did not respond. Intramuscular injection of insulin, 3 hours prior to collection of tissue, stimulated the incorporation in nuclear as well as post-mitochondrial fractions but had no effect on the mitochondrial protein synthesis. (author)

  8. [Assessment of external breathing parameters and cardiovascular function in patients with constitutive exogenous obesity and reduced body weight].

    Science.gov (United States)

    Merzlikina, N L; Romantsova, T I; Roik, O V; Lobanova, N A; Drapkina, O M; Ivashkin, V T

    2009-01-01

    The study was designed to evaluate external respiratory function (ERF) and cardiovascular function based on AP measurements, results of 24 hour AP monitoring, treadmill test, and ECG during weight loss therapy in patients with excess body mass. A total of 93 patients with grade 2-3 obesity were examined including 41 (39.8%) with type 2 diabetes mellitus (DM). Group 1 consisted of patients with constitutive exogenous obesity, group 2 of patients with constitutive exogenous obesity and DM, group 3 was used as control. Follow-up studies were conducted after 6 and 12 months. Patients of groups 1 and 2 showed positive dynamics of hemodynamic characteristics related to the loss of weight including significant reduction of heart rate, systolic and diastolic indices of hypertonic loading, specific peripheral vascular resistance, and left ventricular mass. Simultaneously, cardiac index and ERF increased while vital lung capacity, forced vital capacity, and forced respiratory volume in the first second returned to normal values. It is concluded that reduction of body weight has positive effect on ERF dynamics and hemodynamic characteristics in patients with constitutive exogenous obesity.

  9. The endogenous langur type D retrovirus PO-1-Lu and its exogenous counterparts in macaque and langur monkeys

    International Nuclear Information System (INIS)

    Sommerfelt, Maja A.; Harkestad, Nina; Hunter, Eric

    2003-01-01

    PO-1-Lu, the endogenous type D retrovirus of langurs (Trachypithecus obscurus) has previously been considered a progenitor to the prototype type D retrovirus, Mason Pfizer monkey virus (M-PMV/SRV-3), that became established in macaque monkeys (Macaca spp.) following a zoonosis. This study reevaluates this hypothesis to include other exogenous SRVs. New sequence information from the gp70(SU)-encoding region of PO-1-Lu shows striking similarity to the newly identified exogenous langur retrovirus, SRV-6, recently isolated from the Hanuman Langur (Semnopithecus entellus). An unrooted, bootstrapped neighbor-joining tree derived from env gene nucleotide sequences shows PO-1-Lu and SRV-6 appear more closely related genetically to SRV-2 than SRV-1 or SRV-3 (M-PMV). This is also reflected in our observations that the M-PMV envelope glycoprotein precursor gPr86 Env and gp70(SU) were antigenically distinct from PO-1-Lu, although the gp22(TM) glycoproteins were antigenically cross-reactive. The potential that SRV-6 represents an exogenous form of PO-1-Lu that has arisen following a recent zoonosis is discussed

  10. Exogenous Testosterone Enhances the Reactivity to Social Provocation in Males

    Directory of Open Access Journals (Sweden)

    Lisa Wagels

    2018-03-01

    Full Text Available Testosterone affects human social behavior in various ways. While testosterone effects are generally associated with muscular strength and aggressiveness, human studies also point towards enhanced status–seeking motives after testosterone administration. The current study tested the causal influence of exogenous testosterone on male behavior during a competitive provocation paradigm. In this double blind, randomized, placebo (PL-controlled study, 103 males were assigned to a PL or testosterone group receiving a colorless PL or testosterone gel. To induce provocation, males played a rigged reaction time game against an ostensible opponent. When participants lost, the opponent subtracted money from the participant who in return could subtract money from the ostensible opponent. Participants subjectively indicated anger and self-estimated treatment affiliation (testosterone or PL administration. A trial-by-trial analysis demonstrated that provocation and success during the repeated games had a stronger influence on participants’ choice to reduce money from the opponent if they had received testosterone. Participants who believed to be in the testosterone group were angrier after the experiment and increased monetary reductions during the task course. In line with theories about mechanisms of testosterone in humans, provocation is shown to be necessary for the agency of exogenous testosterone. Thus, testosterone reinforces the conditional adjustment of aggressive behavior but not aggressive behavior per se. In contrast undirected frustration is not increased by testosterone but probably interferes with cognitive appraisals about biological mechanisms of testosterone.

  11. Exogenous Testosterone Enhances the Reactivity to Social Provocation in Males.

    Science.gov (United States)

    Wagels, Lisa; Votinov, Mikhail; Kellermann, Thilo; Eisert, Albrecht; Beyer, Cordian; Habel, Ute

    2018-01-01

    Testosterone affects human social behavior in various ways. While testosterone effects are generally associated with muscular strength and aggressiveness, human studies also point towards enhanced status-seeking motives after testosterone administration. The current study tested the causal influence of exogenous testosterone on male behavior during a competitive provocation paradigm. In this double blind, randomized, placebo (PL)-controlled study, 103 males were assigned to a PL or testosterone group receiving a colorless PL or testosterone gel. To induce provocation, males played a rigged reaction time game against an ostensible opponent. When participants lost, the opponent subtracted money from the participant who in return could subtract money from the ostensible opponent. Participants subjectively indicated anger and self-estimated treatment affiliation (testosterone or PL administration). A trial-by-trial analysis demonstrated that provocation and success during the repeated games had a stronger influence on participants' choice to reduce money from the opponent if they had received testosterone. Participants who believed to be in the testosterone group were angrier after the experiment and increased monetary reductions during the task course. In line with theories about mechanisms of testosterone in humans, provocation is shown to be necessary for the agency of exogenous testosterone. Thus, testosterone reinforces the conditional adjustment of aggressive behavior but not aggressive behavior per se . In contrast undirected frustration is not increased by testosterone but probably interferes with cognitive appraisals about biological mechanisms of testosterone.

  12. Exogenous surfactant kinetics in infant respiratory distress syndrome : A novel method with stable isotopes

    NARCIS (Netherlands)

    Torresin, M; Zimmermann, LJI; Cogo, PE; Cavicchioli, P; Badon, T; Giordano, G; Zacchello, F; Sauer, PJJ; Carnielli, VP

    Little is known about surfactant metabolism in newborn infants, since radioactive isotopes cannot be used in humans. We describe here a new method for studying exogenous surfactant pharmacokinetics in vivo. We measured surfactant half-life, pool size, and turnover time in eight preterm infants

  13. Identification of microRNAs associated with the exogenous spermidine-mediated improvement of high-temperature tolerance in cucumber seedlings (Cucumis sativus L.).

    Science.gov (United States)

    Wang, Ying; Guo, Shirong; Wang, Lei; Wang, Liwei; He, Xueying; Shu, Sheng; Sun, Jin; Lu, Na

    2018-04-24

    High-temperature stress inhibited the growth of cucumber seedlings. Foliar spraying of 1.0 mmol·L - 1 exogenous spermidine (Spd) to the sensitive cucumber cultivar 'Jinchun No. 2' grown at high-temperature (42 °C/32 °C) in an artificial climate box improved the high-temperature tolerance. Although there have been many reports on the response of microRNAs (miRNAs) to high-temperature stress, the mechanism by which exogenous Spd may mitigate the damage of high-temperature stress through miRNA-mediated regulation has not been studied. To elucidate the regulation of miRNAs in response to exogenous Spd-mediated improvement of high-temperature tolerance, four small RNA libraries were constructed from cucumber leaves and sequenced: untreated-control (CW), Spd-treated (CS), high-temperature stress (HW), and Spd-treated and high-temperature stress (HS). As a result, 107 known miRNAs and 79 novel miRNAs were identified. Eight common differentially expressed miRNAs (miR156d-3p, miR170-5p, miR2275-5p, miR394a, miR479b, miR5077, miR5222 and miR6475) were observed in CS/CW, HW/CW, HS/CW and HS/HW comparison pairs, which were the first set of miRNAs that responded to not only high-temperature stress but also exogenous Spd in cucumber seedlings. Five of the eight miRNAs were predicted to target 107 potential genes. Gene function and pathway analyses highlighted the integral role that these miRNAs and target genes probably play in the improvement of the high-temperature tolerance of cucumber seedlings through exogenous Spd application. Our study identified the first set of miRNAs associated with the exogenous Spd-mediated improvement of high-temperature tolerance in cucumber seedlings. The results could help to promote further studies on the complex molecular mechanisms underlying high-temperature tolerance in cucumber and provide a theoretical basis for the high-quality and efficient cultivation of cucumber with high-temperature resistance.

  14. Does exogenous carbon extend the realized niche of canopy lichens? Evidence from sub-boreal forests in British Columbia.

    Science.gov (United States)

    Campbell, Jocelyn; Bengtson, Per; Fredeen, Arthur L; Coxson, Darwyn S; Prescott, Cindy E

    2013-05-01

    Foliose lichens with cyanobacterial bionts (bipartite and tripartite) form a distinct assemblage of epiphytes strongly associated with humid microclimatic conditions in inland British Columbia. Previous research showed that these cyano- and cephalolichen communities are disproportionately abundant and species-rich on conifer saplings beneath Populus compared to beneath other tree species. More revealing, lichens with cyanobacterial bionts were observed beneath Populus even in stands that did not otherwise support them. We experimentally test the hypothesis that this association is due to the interception of glucose-rich nectar that is exuded from Populus extra-floral nectaries (EFN). Using CO2 flux measurements and phospholipid fatty acid (PLFA) analysis with experimental applications of 13C6-labeled glucose, we demonstrate that cyano- and cephalolichens have a strong respiratory response to glucose. Lichens treated with glucose had lower net photosynthesis and higher establishment rates than control thalli. Furthermore, lichens with cyanobacterial bionts rapidly incorporate exogenous 13C into lichen fatty acid tissues. A large proportion of the 13C taken up by the lichens was incorporated into fungal biomarkers, suggesting that the mycobiont absorbed and assimilated the majority of applied 13C6 glucose. Our observations suggest that both cyanolichens and cephalolichens may utilize an exogenous source of glucose, made available by poplar EFNs. The exogenous C may enable these lichens to become established by providing a source of C for fungal respiration despite drought-induced inactivity of the cyanobacterial partner. As such, the mycobiont may adopt an alternative nutritional strategy, using available exogenous carbon to extend its realized niche.

  15. Outcome of early pars plana vitrectomy in exogenous endophthalmitis

    International Nuclear Information System (INIS)

    Dar, A.J.; Islam, Q.U.; Hanif, M.K.

    2013-01-01

    Objective: To evaluate the role of early pars plana vitrectomy (PPV) in cases of exogenous endophthalmitis in terms of final visual outcome and to determine association between various study variables and final visual outcome. Study Design: Quasi experimental study. Place and Duration of Study: Armed Forces Institute of Ophthalmology (AFIO) Rawalpindi, from Aug 2010 to May 2012. Patients and Methods: Eleven cases of exogenous endophthalmitis (post surgical/post traumatic) were managed surgically through 20 G or 23/25 G complete and early PPV. Vitreous aspirate/explanted intraocular lens (IOL) were sent for culture and sensitivity in all cases. Intra and post operative complications were recorded and best corrected visual acuity (BCVA) at 3 months post operative interval was taken as final visual acuity. Results: Median age of study population was 55 years with male preponderance (64%). Approximately 2/3 rd of study population developed endophthalmitis within 6 weeks of surgery/trauma and 55% of patients were operated within 2 weeks of presentation. Positive culture from vitreous aspirate/IOL explant was obtained in 27% of cases. All the patients had initial BCVA in the range of counting finger (CF) at 2 meter to perception of light (PL+). However, 18% of the patients achieved final BCVA of 6/12 or better and 64% achieved final BCVA of 6/36 or better. Maculopathy (macular scar, macular pucker), corneal decompensation, corneal opacity and raised intraocular pressure were the major complications associated with compromised visual outcome. Conclusion: With the advancement in vitreoretinal surgical techniques and availability of more sophisticated viewing and illumination systems, early and complete vitrectomy for post operative or post traumatic endophthalmitis results in favorable visual outcome and early rehabilitation. (author)

  16. The effect of an exogenous magnetic field on neural coding in deep spiking neural networks.

    Science.gov (United States)

    Guo, Lei; Zhang, Wei; Zhang, Jialei

    2018-01-01

    A ten-layer feed forward network is constructed in the presence of an exogenous alternating magnetic field. Specifically, our results indicate that for rate coding, the firing rate is significantly increased in the presence of an exogenous alternating magnetic field and particularly with increasing enhancement of the alternating magnetic field amplitude. For temporal coding, the interspike intervals of the spiking sequence are decreased and the distribution of the interspike intervals of the spiking sequence tends to be uniform in the presence of alternating magnetic field.

  17. Acute Pancreatitis in acute viral hepatitis

    Directory of Open Access Journals (Sweden)

    S K.C.

    2011-03-01

    Full Text Available Introduction: The association of acute viral hepatitis and acute pancreatitis is well described. This study was conducted to find out the frequency of pancreatic involvement in acute viral hepatitis in the Nepalese population. Methods: Consecutive patients of acute viral hepatitis presenting with severe abdominal pain between January 2005 and April 2010 were studied. Patients with history of significant alcohol consumption and gall stones were excluded. Acute viral hepatitis was diagnosed by clinical examination, liver function test, ultrasound examination and confirmed by viral serology. Pancreatitis was diagnosed by clinical presentation, biochemistry, ultrasound examination and CT scan. Results: Severe abdominal pain was present in 38 of 382 serologically-confirmed acute viral hepatitis patients. Twenty five patients were diagnosed to have acute pancreatitis. The pancreatitis was mild in 14 and severe in 11 patients. The etiology of pancreatitis was hepatitis E virus in 18 and hepatitis A virus in 7 patients. Two patients died of complications secondary to shock. The remaining patients recovered from both pancreatitis and hepatitis on conservative treatment. Conclusions: Acute pancreatitis occurred in 6.5 % of patients with acute viral hepatitis. Cholelithiasis and gastric ulcers are the other causes of severe abdominal pain. The majority of the patients recover with conservative management. Keywords: acute viral hepatitis, acute pancreatitis, pain abdomen, hepatitis E, hepatitis A, endemic zone

  18. Multicentric reticulohistiocytosis (lipoid dermatoarthritis)

    International Nuclear Information System (INIS)

    Fiumicelli, A.; Bruni, L.

    1990-01-01

    The authors report their experience with 3 cases of multicentric reticulohistiocytosis observed over 6 years of outpatient radiological practice. The condition presents with the following radiological patterns: 1) clear-cut erosions of the articular surfaces, especially in the distal interphalangeal joints of the hand and in the metatarso-phalangeal joints of the feet, with symmetrical distributions (not necessarily); 2) osteolytic punched-out areas in the epiphyseal spongiosa, ranging in size from 1 mm to over 1 cm; 3) no osteoporosis, no osteoproliferative or periosteal reactions, not even in the presence of large osteoarticular destructions; 4) frequent atlanto-epistropheal subluxation; 5) articular ankylosis at the sacroiliac joints only. The association of the above patterns and the relativity benign clinical course distinguish multicentric reticulohistiocytosis from rheumatoid arthritis, psoriasic arthritis, erosive osteoarthritis, and gout. Reliable diagnosis can be suggested on the basis of radiological findings alone, even before cutaneous or mucosal lesions appear -which are, at any rate, not sure to appear and typical of nails only. An unquestionable diagnosis can be made at histology of synovial and/or cutaneous nodules. Multicentric reticulohistiocytosis is considered an uncommon condition (nearly 100 cases in international literature to 1989); the authors believe it to be commoner though often misdiagnosed as a 'variant of rehumatoid arthritis'

  19. A taxonomy of endogenous and exogenous uncertainty in high-risk, high-impact contexts.

    Science.gov (United States)

    Alison, Laurence; Power, Nicola; van den Heuvel, Claudia; Waring, Sara

    2015-07-01

    By reference to a live hostage negotiation exercise, this study presents a taxonomy of uncertainty that can be usefully applied to assist in the categorization and application of findings from decision-making research conducted in naturalistic (specifically critical incident) settings. Uncertainty was measured via observational methods (during the exercise and by reference to video footage), decision logs, and postincident simulated recall interviews with trainee police officers. Transcripts were coded and analyzed thematically. Uncertainty was dichotomized as deriving from either endogenous sources (about the problem situation itself) or exogenous sources (about the operating system that is dealing with the incident). Overall, exogenous uncertainty (75%) was more prevalent than endogenous uncertainty (25%), specifically during discussions on plan formulation and execution. It was also qualitatively associated with poor role understanding and trust. Endogenous uncertainty was more prevalent during discussions on situation assessment and plan formulation. The taxonomy provides a useful way for organizational researchers to categorize uncertainty during the naturalistic observations of workplace interactions and decision making. It reduces the complexity associated with observational research to allow organizational psychologists to better tailor their recommendations for reducing uncertainty. Dealing with endogenous uncertainties would entail targeting decision making specific to the problem incident (e.g., introduce training or policy to reduce redundant fixation on rote-repetitive superordinate goals and focus on more short-term actionable goals during situation assessments). Dealing with exogenous uncertainties would entail improving decision making relating to management and team processes across critical incidents (e.g., training to clarify distributed roles in critical incident teams to aid plan formulation and execution). Organizational researchers interested

  20. Offshoring as an Exogenous Shock to the Services Production System

    DEFF Research Database (Denmark)

    Brandl, Kristin; Mol, Michael; Petersen, Bent

    Production of services involves three key elements, an output for the client, resources of a provider and task execution. Offshoring of services acts as an exogenous shock to such a production system. Using multiple case methodology we investigate how task output, execution, and resources change...... as a consequence of offshoring and particularly how these elements are realigned. The cases reveal substantial managerial challenges in the alignment process prompted by a relocation of service task execution to an emerging economy. In particular, we find that instead of some set of capabilities that proactively...

  1. Exogenous and endogenous hyaluronic acid reduces HIV infection of CD4+ T cells

    Science.gov (United States)

    Li, Peilin; Fujimoto, Katsuya; Bourguingnon, Lilly; Yukl, Steven; Deeks, Steven; Wong, Joseph K

    2014-01-01

    Preventing mucosal transmission of HIV is critical to halting the HIV epidemic. Novel approaches to preventing mucosal transmission are needed. Hyaluronic acid (HA) is a major extracellular component of mucosa and the primary ligand for the cell surface receptor CD44. CD44 enhances HIV infection of CD4+ T cells, but the role of HA in this process is not clear. To study this, virions were generated with CD44 (HIVCD44) or without CD44 (HIVmock). Exogenous HA reduced HIV infection of unstimulated CD4+ T cells in a CD44-dependent manner. Conversely, hyaluronidase-mediated reduction of endogenous HA on the cell surface enhanced HIV binding to and infection of unstimulated CD4+ T cells. Exogenous HA treatment reduced activation of protein kinase C alpha via CD44 on CD4+ T cells during infection with HIVCD44. These results reveal new roles for HA during the interaction of HIV with CD4+ T cells that may be relevant to mucosal HIV transmission and could be exploitable as a future strategy to prevent HIV infection. PMID:24957217

  2. Apicomplexa-specific tRip facilitates import of exogenous tRNAs into malaria parasites.

    Science.gov (United States)

    Bour, Tania; Mahmoudi, Nassira; Kapps, Delphine; Thiberge, Sabine; Bargieri, Daniel; Ménard, Robert; Frugier, Magali

    2016-04-26

    The malaria-causing Plasmodium parasites are transmitted to vertebrates by mosquitoes. To support their growth and replication, these intracellular parasites, which belong to the phylum Apicomplexa, have developed mechanisms to exploit their hosts. These mechanisms include expropriation of small metabolites from infected host cells, such as purine nucleotides and amino acids. Heretofore, no evidence suggested that transfer RNAs (tRNAs) could also be exploited. We identified an unusual gene in Apicomplexa with a coding sequence for membrane-docking and structure-specific tRNA binding. This Apicomplexa protein-designated tRip (tRNA import protein)-is anchored to the parasite plasma membrane and directs import of exogenous tRNAs. In the absence of tRip, the fitness of the parasite stage that multiplies in the blood is significantly reduced, indicating that the parasite may need host tRNAs to sustain its own translation and/or as regulatory RNAs. Plasmodium is thus the first example, to our knowledge, of a cell importing exogenous tRNAs, suggesting a remarkable adaptation of this parasite to extend its reach into host cell biology.

  3. Formation, Accumulation, and Hydrolysis of Endogenous and Exogenous Formaldehyde-Induced DNA Damage.

    Science.gov (United States)

    Yu, Rui; Lai, Yongquan; Hartwell, Hadley J; Moeller, Benjamin C; Doyle-Eisele, Melanie; Kracko, Dean; Bodnar, Wanda M; Starr, Thomas B; Swenberg, James A

    2015-07-01

    Formaldehyde is not only a widely used chemical with well-known carcinogenicity but is also a normal metabolite of living cells. It thus poses unique challenges for understanding risks associated with exposure. N(2-)hydroxymethyl-dG (N(2)-HOMe-dG) is the main formaldehyde-induced DNA mono-adduct, which together with DNA-protein crosslinks (DPCs) and toxicity-induced cell proliferation, play important roles in a mutagenic mode of action for cancer. In this study, N(2)-HOMe-dG was shown to be an excellent biomarker for direct adduction of formaldehyde to DNA and the hydrolysis of DPCs. The use of inhaled [(13)CD2]-formaldehyde exposures of rats and primates coupled with ultrasensitive nano ultra performance liquid chromatography-tandem mass spectrometry permitted accurate determinations of endogenous and exogenous formaldehyde DNA damage. The results show that inhaled formaldehyde only reached rat and monkey noses, but not tissues distant to the site of initial contact. The amounts of exogenous adducts were remarkably lower than those of endogenous adducts in exposed nasal epithelium. Moreover, exogenous adducts accumulated in rat nasal epithelium over the 28-days exposure to reach steady-state concentrations, followed by elimination with a half-life (t1/2) of 7.1 days. Additionally, we examined artifact formation during DNA preparation to ensure the accuracy of nonlabeled N(2)-HOMe-dG measurements. These novel findings provide critical new data for understanding major issues identified by the National Research Council Review of the 2010 Environmental Protection Agency's Draft Integrated Risk Information System Formaldehyde Risk Assessment. They support a data-driven need for reflection on whether risks have been overestimated for inhaled formaldehyde, whereas underappreciating endogenous formaldehyde as the primary source of exposure that results in bone marrow toxicity and leukemia in susceptible humans and rodents deficient in DNA repair. © The Author 2015

  4. Fruit bats (Pteropodidae) fuel their metabolism rapidly and directly with exogenous sugars.

    Science.gov (United States)

    Amitai, O; Holtze, S; Barkan, S; Amichai, E; Korine, C; Pinshow, B; Voigt, C C

    2010-08-01

    Previous studies reported that fed bats and birds mostly use recently acquired exogenous nutrients as fuel for flight, rather than endogenous fuels, such as lipids or glycogen. However, this pattern of fuel use may be a simple size-related phenomenon because, to date, only small birds and bats have been studied with respect to the origin of metabolized fuel, and because small animals carry relatively small energy reserves, considering their high mass-specific metabolic rate. We hypothesized that approximately 150 g Egyptian fruit bats (Rousettus aegyptiacus Pteropodidae), which are more than an order of magnitude heavier than previously studied bats, also catabolize dietary sugars directly and exclusively to fuel both rest and flight metabolism. We based our expectation on the observation that these animals rapidly transport ingested dietary sugars, which are absorbed via passive paracellular pathways in the intestine, to organs of high energy demand. We used the stable carbon isotope ratio in exhaled CO(2) (delta(13)C(breath)) to assess the origin of metabolized substrates in 16 Egyptian fruit bats that were maintained on a diet of C3 plants before experiments. First, we predicted that in resting bats delta(13)C(breath) remains constant when bats ingest C3 sucrose, but increases and converges on the dietary isotopic signature when C4 sucrose and C4 glucose are ingested. Second, if flying fruit bats use exogenous nutrients exclusively to fuel flight, we predicted that delta(13)C(breath) of flying bats would converge on the isotopic signature of the C4 sucrose they were fed. Both resting and flying Egyptian fruit bats, indeed, directly fuelled their metabolism with freshly ingested exogenous substrates. The rate at which the fruit bats oxidized dietary sugars was as fast as in 10 g nectar-feeding bats and 5 g hummingbirds. Our results support the notion that flying bats, irrespective of their size, catabolize dietary sugars directly, and possibly exclusively, to

  5. HEALTH STATUS OF FEMALE TEENAGERS, SUFFERING FROM CONSTITUTIVE AND EXOGENOUS OBESITY

    OpenAIRE

    S.Ya. Volgina; M.K. Valiullina

    2006-01-01

    The article deals with the research findings of the health status of 120 female teenagers, suffering from constitutive and exogenous obesity and 116 girls of the same age and standard weight. The authors gave complete characteristics for the somatic, psychic and psychological elements of the teenager's health. They have assessed the consumatory behaviour of the girls. It has been revealed that among all the examined patients with hyperphagia 6,7% are suffering from nervous bulimia. the resear...

  6. Proinflammatory effects of exogenously administered IL-10 in experimental autoimmune orchitis

    DEFF Research Database (Denmark)

    Kaneko, Tetsushi; Itoh, Masahiro; Nakamura, Yoichi

    2003-01-01

    We studied the effects of exogenously administered recombinant murine interleukin (IL)-10 on the development of experimental autoimmune orchitis (EAO) in C3H/He mice. IL-10 significantly augments histological signs of EAO when administered for 6 consecutive days from days 15 to 20 after primary...... immunisations with testicular germ cells. These data demonstrate that IL-10, in addition to its well-known antiinflammatory property, also has proinflammatory functions capable of up-regulating testicular immunoinflammatory processes in vivo....

  7. Exogenous IFN-beta regulates the RANKL-c-Fos-IFN-beta signaling pathway in the collagen antibody-induced arthritis model.

    Science.gov (United States)

    Zhao, Rong; Chen, Ni-Nan; Zhou, Xiao-Wei; Miao, Ping; Hu, Chao-Ying; Qian, Liu; Yu, Qi-Wen; Zhang, Ji-Ying; Nie, Hong; Chen, Xue-hua; Li, Pu; Xu, Rong; Xiao, Lian-Bo; Zhang, Xin; Liu, Jian-Ren; Zhang, Dong-Qing

    2014-12-10

    Although a variety of drugs have been used to treat the symptoms of rheumatoid arthritis (RA), none of them are able to cure the disease. Interferon β (IFN-β) has pleiotropic effects on RA, but whether it can be used to treat RA remains globally controversial. Thus, in this study we tested the effects of IFN-β on RA patients and on collagen antibody-induced arthritis (CAIA) model mice. The cytokine and auto-antibody expression profiles in the serum and synovial fluid (SF) from RA patients were assessed using enzyme-linked immunosorbent assay (ELISA) and compared with the results from osteoarthritis (OA) patients. Exogenous IFN-β was administered to RA patients and CAIA model mice, and the therapeutic effects were evaluated. Endogenous IFN-β expression in the joint bones of CAIA model mice was evaluated by quantitative real-time PCR (qRT-PCR). The effects of exogenous IFN-β on CAIA model mice were assessed using a clinical scoring system, hematoxylin eosin and safranin-O with fast green counterstain histology, molybdenum target X-ray, and tartrate-resistant acid phosphatase (TRAP) staining. The RANKL-RANK signaling pathway was analyzed using qRT-PCR. The RAW 264.7 cell line was differentiated into osteoclasts with RANKL stimulation and then treated with exogenous IFN-β. The expression of inflammatory cytokines (IFN-γ, IL-17, MMP-3, and RANKL) and auto-antibodies (CII antibodies, RF-IgM, and anti-CCP/GPI) were significantly higher in RA compared with OA patients. After IFN-β intervention, some clinical symptoms in RA patients were partially alleviated, and the expression of IFN-γ, IL-17, MMP-3, and OPG) returned to normal levels. In the CAIA model, the expression of endogenous IFN-β in the joint bones was decreased. After IFN-β administration, the arthritis scores were decreased; synovial inflammation, cartilage, and bone destruction were clearly attenuated; and the expression of c-Fos and NFATc1 were reduced, while RANKL and TRAF6 expression was

  8. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  9. The effects of exogenous melatonin on the morphology of thyrocytes in pinealectomized and irradiated rats

    International Nuclear Information System (INIS)

    Kundurovic, Z.; Sofic, E.

    2006-01-01

    We investigated the effects of exogenous melatonin on the thyrocytes morphology in gamma-irradiated rats under condition where the pineal gland, as a main physiological source of endogenous melatonin, was removed. Three months after pinealectomy animals were divided into two groups: one group of animals was treated with 0.5 ml of vehicle (ethanol diluted in water) and other group was injected intraperitoneally 2 mg/kg of melatonin dissolved in 0.5 ml of vehicle daily during the period of fourteen days. After this treatment all the animals were irradiated with a single dose of 8 Gy gamma rays. Ionising radiation induced apoptosis, hydropic swelling or/and necrosis in both groups of animals, however these changes were less discerned in the thyrocytes of melatonin-treated animals. Our findings demonstrate that administration of exogenous melatonin prior to irradiation reduces radiation-induced thyrocytes damage. (author)

  10. Prevention of symptomatic patent ductus arteriosus with ethamsylate in babies treated with exogenous surfactant.

    Science.gov (United States)

    Amato, M; Hüppi, P; Markus, D

    1993-01-01

    Some trials in premature infants with respiratory distress syndrome have shown an increased incidence of patent ductus arteriosus after exogenous surfactant therapy. The effect of prophylactic ethamsylate on patent ductus arteriosus after intratracheal administration of a single dose of porcine surfactant preparation (Curosurf, 2.5 ml/kg) was studied in a group of 20 preterm infants with severe respiratory distress syndrome. Gestational age of the patients was 29.2 +/- 2.5 weeks (mean +/- SD), and birth weight was 1158 +/- 319 gm. Ethamsylate (12.5 mg/kg) was given prophylactically within the first 4 hours of life followed by 6-hourly doses for 4 days. Hemodynamically significant patent ductus arteriosus occurred more frequently in the untreated group (8 of 10) than in the ethamsylate group (2 of 10) (p ethamsylate, an inhibitor of prostaglandin biosynthesis, could be useful in reducing the incidence of patent ductus arteriosus in very low birth weight infants treated with exogenous surfactant.

  11. The Influence of the Endogenous and Exogenous Factors on Credit Institutions’ Return on Equity

    Directory of Open Access Journals (Sweden)

    Baltes Nicolae

    2015-05-01

    Full Text Available The research’s purpose is to study the credit institutions’ performance, from the shareholders’ point of view, through return on equity (ROE. It aims to identify a dependency relationship between return on equity (ROE and endogenous factors (the growth rate of credit portfolio, the growth rate provisions, the solvency ratio, on the one hand and, on the other hand between ROE and the exogenous ones (GDP and inflation rate. The research was done over an horizon of 10 years (2004-2013 on the evolution of the return on equity indicator of two credit institutions listed on Bucharest Stock Exchange (Carpathian Commercial Bank SA and Banca Transilvania SA, highlights their vulnerability to economic conditions. The results obtained indicates, that in both credit institutions, the variation of return on capital is determined in a significant proportion by intern factors and it is conditioned in a insignificant share by the exogenous factors

  12. Exogenous ascorbic acid improves defence responses of sunflower (Helianthus annuus) exposed to multiple stresses.

    Science.gov (United States)

    Kaya, Armagan

    2017-09-01

    Ascorbic acid is an important antioxidant that plays role both on growth and development and also stress response of the plant. The purpose of this study was to determine the effect of ascorbate on physiological and biochemical changes of sunflower that was exposed to multiple stresses. Chlorophyll and carotenoid contents decreased and glutathione, ascorbate and malondialdehyde contents as well as antioxidant enzyme activities increased for sunflower plant that was exposed to 50 mM NaCl and pendimethalin at different concentrations. These changes were found to be more significant in groups simultaneously exposed to both stress factors. While malondialdehyde content decreased, chlorophyll, carotenoid, ascorbate, glutathione contents and antioxidant enzyme activities increased in plants treated exogenously with ascorbate, compared to the untreated samples. According to the findings of our study; compared to individual stress, the effect of stress is more pronounced in sunflower exposed to multiple stresses, and treatment with exogenous ascorbate reduces the negative effects of stress.

  13. Exogenous Social Identity Cues Differentially Affect the Dynamic Tracking of Individual Target Faces

    Science.gov (United States)

    Allen, Roy; Gabbert, Fiona

    2013-01-01

    We report on an experiment to investigate the top-down effect of exogenous social identity cues on a multiple-identity tracking task, a paradigm well suited to investigate the processes of binding identity to spatial locations. Here we simulated an eyewitness event in which dynamic targets, all to be tracked with equal effort, were identified from…

  14. Endogenous PTH deficiency impairs fracture healing and impedes the fracture-healing efficacy of exogenous PTH(1-34.

    Directory of Open Access Journals (Sweden)

    Yongxin Ren

    Full Text Available Although the capacity of exogenous PTH1-34 to enhance the rate of bone repair is well established in animal models, our understanding of the mechanism(s whereby PTH induces an anabolic response during skeletal repair remains limited. Furthermore it is unknown whether endogenous PTH is required for fracture healing and how the absence of endogenous PTH would influence the fracture-healing capacity of exogenous PTH.Closed mid-diaphyseal femur fractures were created and stabilized with an intramedullary pin in 8-week-old wild-type and Pth null (Pth(-/- mice. Mice received daily injections of vehicle or of PTH1-34 (80 µg/kg for 1-4 weeks post-fracture, and callus tissue properties were analyzed at 1, 2 and 4 weeks post-fracture. Cartilaginous callus areas were reduced at 1 week post-fracture, but were increased at 2 weeks post-fracture in vehicle-treated and PTH-treated Pth(-/- mice compared to vehicle-treated and PTH-treated wild-type mice respectively. The mineralized callus areas, bony callus areas, osteoblast number and activity, osteoclast number and surface in callus tissues were all reduced in vehicle-treated and PTH-treated Pth(-/- mice compared to vehicle-treated and PTH-treated wild-type mice, but were increased in PTH-treated wild-type and Pth(-/- mice compared to vehicle-treated wild-type and Pth(-/- mice.Absence of endogenous PTH1-84 impedes bone fracture healing. Exogenous PTH1-34 can act in the absence of endogenous PTH but callus formation, including accelerated endochondral bone formation and callus remodeling as well as mechanical strength of the bone are greater when endogenous PTH is present. Results of this study suggest a complementary role for endogenous PTH1-84 and exogenous PTH1-34 in accelerating fracture healing.

  15. Understanding the Effects of Users' Behaviors on Effectiveness of Different Exogenous Regulatory Common Pool Resource Management Institutions

    Science.gov (United States)

    Madani, K.; Dinar, A.

    2013-12-01

    Tragedy of the commons is generally recognized as one of the possible destinies for common pool resources (CPRs). To avoid the tragedy of the commons and prolonging the life of CPRs, users may show different behavioral characteristics and use different rationales for CPR planning and management. Furthermore, regulators may adopt different strategies for sustainable management of CPRs. The effectiveness of different regulatory exogenous management institutions cannot be evaluated through conventional CPR models since they assume that either users base their behavior on individual rationality and adopt a selfish behavior (Nash behavior), or that the users seek the system's optimal solution without giving priority to their own interests. Therefore, conventional models fail to reliably predict the outcome of CPR problems in which parties may have a range of behavioral characteristics, putting them somewhere in between the two types of behaviors traditionally considered. This work examines the effectiveness of different regulatory exogenous CPR management institutions through a user-based model (as opposed to a system-based model). The new modeling framework allows for consideration of sensitivity of the results to different behavioral characteristics of interacting CPR users. The suggested modeling approach is applied to a benchmark groundwater management problem. Results indicate that some well-known exogenous management institutions (e.g. taxing) are ineffective in sustainable management of CPRs in most cases. Bankruptcy-based management can be helpful, but determination of the fair level of cutbacks remains challenging under this type of institution. Furthermore, some bankruptcy rules such as the Constrained Equal Award (CEA) method are more beneficial to wealthier users, failing to establish social justice. Quota-based and CPR status-based management perform as the most promising and robust regulatory exogenous institutions in prolonging the CPR's life and

  16. Endogenous PTH deficiency impairs fracture healing and impedes the fracture-healing efficacy of exogenous PTH(1-34).

    Science.gov (United States)

    Ren, Yongxin; Liu, Bo; Feng, Yuxu; Shu, Lei; Cao, Xiaojian; Karaplis, Andrew; Goltzman, David; Miao, Dengshun

    2011-01-01

    Although the capacity of exogenous PTH1-34 to enhance the rate of bone repair is well established in animal models, our understanding of the mechanism(s) whereby PTH induces an anabolic response during skeletal repair remains limited. Furthermore it is unknown whether endogenous PTH is required for fracture healing and how the absence of endogenous PTH would influence the fracture-healing capacity of exogenous PTH. Closed mid-diaphyseal femur fractures were created and stabilized with an intramedullary pin in 8-week-old wild-type and Pth null (Pth(-/-)) mice. Mice received daily injections of vehicle or of PTH1-34 (80 µg/kg) for 1-4 weeks post-fracture, and callus tissue properties were analyzed at 1, 2 and 4 weeks post-fracture. Cartilaginous callus areas were reduced at 1 week post-fracture, but were increased at 2 weeks post-fracture in vehicle-treated and PTH-treated Pth(-/-) mice compared to vehicle-treated and PTH-treated wild-type mice respectively. The mineralized callus areas, bony callus areas, osteoblast number and activity, osteoclast number and surface in callus tissues were all reduced in vehicle-treated and PTH-treated Pth(-/-) mice compared to vehicle-treated and PTH-treated wild-type mice, but were increased in PTH-treated wild-type and Pth(-/-) mice compared to vehicle-treated wild-type and Pth(-/-) mice. Absence of endogenous PTH1-84 impedes bone fracture healing. Exogenous PTH1-34 can act in the absence of endogenous PTH but callus formation, including accelerated endochondral bone formation and callus remodeling as well as mechanical strength of the bone are greater when endogenous PTH is present. Results of this study suggest a complementary role for endogenous PTH1-84 and exogenous PTH1-34 in accelerating fracture healing.

  17. Exogenous short-term silicon application regulates macro-nutrients, endogenous phytohormones, and protein expression in Oryza sativa L.

    Science.gov (United States)

    Jang, Soo-Won; Kim, Yoonha; Khan, Abdul Latif; Na, Chae-In; Lee, In-Jung

    2018-01-04

    Silicon (Si) has been known to regulate plant growth; however, the underlying mechanisms of short-term exogenous Si application on the regulation of calcium (Ca) and nitrogen (N), endogenous phytohormones, and expression of essential proteins have been little understood. Exogenous Si application significantly increased Si content as compared to the control. Among Si treatments, 1.0 mM Si application showed increased phosphorus content as compared to other Si treatments (0.5, 2.0, and 4.0 mM). However, Ca accumulation was significantly reduced (1.8- to 2.0-fold) at the third-leaf stage in the control, whereas all Si treatments exhibited a dose-dependent increase in Ca as determined by radioisotope 45 Ca analysis. Similarly, the radioisotope 15 N for nitrogen localization and uptake showed a varying but reduced response (ranging from 1.03-10.8%) to different Si concentrations as compared to 15 N application alone. Physiologically active endogenous gibberellin (GA 1 ) was also significantly higher with exogenous Si (1.0 mM) as compared to GA 20 and the control plants. A similar response was noted for endogenous jasmonic and salicylic acid synthesis in rice plants with Si application. Proteomic analysis revealed the activation of several essential proteins, such as Fe-S precursor protein, putative thioredoxin, Ser/Thr phosphatase, glucose-6-phosphate isomerase (G6P), and importin alpha-1b (Imp3), with Si application. Among the most-expressed proteins, confirmatory gene expression analysis for G6P and Imp3 showed a similar response to those of the Si treatments. In conclusion, the current results suggest that short-term exogenous Si can significantly regulate rice plant physiology by influencing Ca, N, endogenous phytohormones, and proteins, and that 1.0 mM Si application is more beneficial to plants than higher concentrations.

  18. The actions of exogenous leucine on mTOR signalling and amino acid transporters in human myotubes

    Directory of Open Access Journals (Sweden)

    Cameron-Smith David

    2011-06-01

    Full Text Available Abstract Background The branched-chain amino acid (BCAA leucine has been identified to be a key regulator of skeletal muscle anabolism. Activation of anabolic signalling occurs via the mammalian target of rapamycin (mTOR through an undefined mechanism. System A and L solute carriers transport essential amino acids across plasma membranes; however it remains unknown whether an exogenous supply of leucine regulates their gene expression. The aim of the present study was to investigate the effects of acute and chronic leucine stimulation of anabolic signalling and specific amino acid transporters, using cultured primary human skeletal muscle cells. Results Human myotubes were treated with leucine, insulin or co-treated with leucine and insulin for 30 min, 3 h or 24 h. Activation of mTOR signalling kinases were examined, together with putative nutrient sensor human vacuolar protein sorting 34 (hVps34 and gene expression of selected amino acid transporters. Phosphorylation of mTOR and p70S6K was transiently increased following leucine exposure, independently to insulin. hVps34 protein expression was also significantly increased. However, genes encoding amino acid transporters were differentially regulated by insulin and not leucine. Conclusions mTOR signalling is transiently activated by leucine within human myotubes independently of insulin stimulation. While this occurred in the absence of changes in gene expression of amino acid transporters, protein expression of hVps34 increased.

  19. Effect of Exogenous Abscisic Acid and Methyl Jasmonate on Anthocyanin Composition, Fatty Acids, and Volatile Compounds of Cabernet Sauvignon (Vitis vinifera L.) Grape Berries.

    Science.gov (United States)

    Ju, Yan-Lun; Liu, Min; Zhao, Hui; Meng, Jiang-Fei; Fang, Yu-Lin

    2016-10-12

    The anthocyanin composition, fatty acids, and volatile aromas are important for Cabernet Sauvignon grape quality. This study evaluated the effect of exogenous abscisic acid (ABA) and methyl jasmonate (MeJA) on the anthocyanin composition, fatty acids, lipoxygenase activity, and the volatile compounds of Cabernet Sauvignon grape berries. Exogenous ABA and MeJA improved the content of total anthocyanins (TAC) and individual anthocyanins. Lipoxygenase (LOX) activity also increased after treatment. Furthermore, 16 fatty acids were detected. The linoleic acid concentration gradually increased with ABA concentration. The fatty acid content decreased with increasing MeJA concentration and then increased again, with the exception of linoleic acid. After exogenous ABA and MeJA treatment, the C6 aroma content increased significantly. Interestingly, the exogenous ABA and MeJA treatments improved mainly the content of 1-hexanol, hexanal, and 2-heptanol. These results provide insight into the effect of plant hormones on wine grapes, which is useful for grape quality improvement.

  20. Effect of Exogenous Abscisic Acid and Methyl Jasmonate on Anthocyanin Composition, Fatty Acids, and Volatile Compounds of Cabernet Sauvignon (Vitis vinifera L. Grape Berries

    Directory of Open Access Journals (Sweden)

    Yan-Lun Ju

    2016-10-01

    Full Text Available The anthocyanin composition, fatty acids, and volatile aromas are important for Cabernet Sauvignon grape quality. This study evaluated the effect of exogenous abscisic acid (ABA and methyl jasmonate (MeJA on the anthocyanin composition, fatty acids, lipoxygenase activity, and the volatile compounds of Cabernet Sauvignon grape berries. Exogenous ABA and MeJA improved the content of total anthocyanins (TAC and individual anthocyanins. Lipoxygenase (LOX activity also increased after treatment. Furthermore, 16 fatty acids were detected. The linoleic acid concentration gradually increased with ABA concentration. The fatty acid content decreased with increasing MeJA concentration and then increased again, with the exception of linoleic acid. After exogenous ABA and MeJA treatment, the C6 aroma content increased significantly. Interestingly, the exogenous ABA and MeJA treatments improved mainly the content of 1-hexanol, hexanal, and 2-heptanol. These results provide insight into the effect of plant hormones on wine grapes, which is useful for grape quality improvement.