WorldWideScience

Sample records for acuminata cultivars contrasting

  1. De novo transcriptome assembly of two contrasting pumpkin cultivars

    Directory of Open Access Journals (Sweden)

    Aliki Xanthopoulou

    2016-03-01

    Full Text Available Cucurbita pepo (squash, pumpkin, gourd, a worldwide-cultivated vegetable of American origin, is extremely variable in fruit characteristics. However, the information associated with genes and genetic markers for pumpkin is very limited. In order to identify new genes and to develop genetic markers, we performed a transcriptome analysis (RNA-Seq of two contrasting pumpkin cultivars. Leaves and female flowers of cultivars, ‘Big Moose’ with large round fruits and ‘Munchkin’ with small round fruits, were harvested for total RNA extraction. We obtained a total of 6 GB (Big Moose; http://www.ncbi.nlm.nih.gov/Traces/sra/?run=SRR3056882 and 5 GB (Munchkin; http://www.ncbi.nlm.nih.gov/Traces/sra/?run=SRR3056883 sequence data (NCBI SRA database SRX1502732 and SRX1502735, respectively, which correspond to 18,055,786 and 14,824,292 150-base reads. After quality assessment, the clean sequences where 17,995,932 and 14,774,486 respectively. The numbers of total transcripts for ‘Big Moose’ and ‘Munchkin’ were 84,727 and 68,051, respectively. TransDecoder identified possible coding regions in assembled transcripts. This study provides transcriptome data for two contrasting pumpkin cultivars, which might be useful for genetic marker development and comparative transcriptome analyses.

  2. De novo transcriptome assembly of two contrasting pumpkin cultivars.

    Science.gov (United States)

    Xanthopoulou, Aliki; Psomopoulos, Fotis; Ganopoulos, Ioannis; Manioudaki, Maria; Tsaftaris, Athanasios; Nianiou-Obeidat, Irini; Madesis, Panagiotis

    2016-03-01

    Cucurbita pepo (squash, pumpkin, gourd), a worldwide-cultivated vegetable of American origin, is extremely variable in fruit characteristics. However, the information associated with genes and genetic markers for pumpkin is very limited. In order to identify new genes and to develop genetic markers, we performed a transcriptome analysis (RNA-Seq) of two contrasting pumpkin cultivars. Leaves and female flowers of cultivars, 'Big Moose' with large round fruits and 'Munchkin' with small round fruits, were harvested for total RNA extraction. We obtained a total of 6 GB (Big Moose; http://www.ncbi.nlm.nih.gov/Traces/sra/?run=SRR3056882) and 5 GB (Munchkin; http://www.ncbi.nlm.nih.gov/Traces/sra/?run=SRR3056883) sequence data (NCBI SRA database SRX1502732 and SRX1502735, respectively), which correspond to 18,055,786 and 14,824,292 150-base reads. After quality assessment, the clean sequences where 17,995,932 and 14,774,486 respectively. The numbers of total transcripts for 'Big Moose' and 'Munchkin' were 84,727 and 68,051, respectively. TransDecoder identified possible coding regions in assembled transcripts. This study provides transcriptome data for two contrasting pumpkin cultivars, which might be useful for genetic marker development and comparative transcriptome analyses.

  3. EFEITO DO PERÍODO DE ARMAZENAMENTO SOBRE A BROTAÇÃO DE MUDAS DE BANANEIRA DO CULTIVAR NANICÃO (Musa acuminata AAA EFFECT OF STORAGE TIME IN THE BUDDING OF BANANA ROOTSTOCK CULTIVAR NANICÃO (Musa acuminata AAA

    Directory of Open Access Journals (Sweden)

    Ronaldo Veloso Naves

    2007-09-01

    Full Text Available

    A grande procura atual de mudas de bananeiras do cultivar Nanicão (Musa acuminata AAA em Goiás, principalmente na região do Mato Grosso Goiano, tem forçado o transporte de mudas a grandes distâncias. A maioria destas mudas são transportadas sob a forma de pedaços de rizoma com aproximadamente 1 Kg. Tem-se observado uma falha acima do previsto quando se utiliza este tipo de muda. O presente trabalho foi realizado para determinar o efeito do período de armazenamento sobre a brotação deste cultivar. Com base nos resultados concluiu-se que no período de armazenamento estudado (45 dias praticamente não houve diferença na brotação das mudas. Somente aquelas armazenadas por 5 (cinco semanas apresentaram inexplicavelmente um índice baixo de pegamento.

    Because of the tremendous current demand for Nanicão (Musa acuminata AAA banana shoots in the state of Goiás, notably in the “Mato Grosso Goiano” area, shoots have had to be imported from far away. The greater part of these shoots are transported in rootstalk form. Each rootstalk weighs approximately 1 Kg. A larger portion of these shoots than been anticipated, are defective. The present study was made to determine the effect of storage time on the budding of this particular banana rootstalk. The results of the experiment show that during the period of storage, forty-two (42 days, that was studied, there was almost no difference in budding among the rootstalks. Only those which were stored for five (5 weeks showed, unexplainably, a low budding index.

  4. Characterization of novel microsatellite markers in Musa acuminata subsp. burmannicoides, var. Calcutta 4

    Directory of Open Access Journals (Sweden)

    Amorim Edson P

    2010-05-01

    Full Text Available Abstract Background Banana is a nutritionally important crop across tropical and sub-tropical countries in sub-Saharan Africa, Central and South America and Asia. Although cultivars have evolved from diploid, triploid and tetraploid wild Asian species of Musa acuminata (A genome and Musa balbisiana (B genome, many of today's commercial cultivars are sterile triploids or diploids, with fruit developing via parthenocarpy. As a result of restricted genetic variation, improvement has been limited, resulting in a crop frequently lacking resistance to pests and disease. Considering the importance of molecular tools to facilitate development of disease resistant genotypes, the objectives of this study were to develop polymorphic microsatellite markers from BAC clone sequences for M. acuminata subsp. burmannicoides, var. Calcutta 4. This wild diploid species is used as a donor cultivar in breeding programs as a source of resistance to diverse biotic stresses. Findings Microsatellite sequences were identified from five Calcutta 4 BAC consensi datasets. Specific primers were designed for 41 loci. Isolated di-nucleotide repeat motifs were the most abundant, followed by tri-nucleotides. From 33 tested loci, 20 displayed polymorphism when screened across 21 diploid M. acuminata accessions, contrasting in resistance to Sigatoka diseases. The number of alleles per SSR locus ranged from two to four, with a total of 56. Six repeat classes were identified, with di-nucleotides the most abundant. Expected heterozygosity values for polymorphic markers ranged from 0.31 to 0.75. Conclusions This is the first report identifying polymorphic microsatellite markers from M. acuminata subsp. burmannicoides, var. Calcutta 4 across accessions contrasting in resistance to Sigatoka diseases. These BAC-derived polymorphic microsatellite markers are a useful resource for banana, applicable for genetic map development, germplasm characterization, evolutionary studies and marker

  5. The contrasting responses of soil microorganisms in two rice cultivars to elevated ground-level ozone.

    Science.gov (United States)

    Feng, Youzhi; Yu, Yongjie; Tang, Haoye; Zu, Qianhui; Zhu, Jianguo; Lin, Xiangui

    2015-02-01

    Although elevated ground-level O₃ has a species-specific impact on plant growth, the differences in soil biota responses to O₃ pollution among rice cultivars are rarely reported. Using O₃ Free-Air Concentration Enrichment, the responses of the rhizospheric bacterial communities in the O₃-tolerant (YD6) and the O₃-sensitive (IIY084) rice cultivars to O₃ pollution and their differences were assessed by pyrosequencing at rice tillering and anthesis stages. Elevated ground-level O₃ negatively influenced the bacterial community in cultivar YD6 at both rice growth stages by decreasing the bacterial phylogenetic diversities and response ratios. In contrast, in cultivar IIY084, the bacterial community responded positively at the rice tillering stage under O₃ pollution. However, several keystone bacterial guilds were consistently negatively affected by O₃ pollution in two rice cultivars. These findings indicate that continuously O₃ pollution would negatively influence rice agroecosystem and the crop cultivar is important in determining the soil biota responses to elevated O₃. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Silicon efflux transporters isolated from two pumpkin cultivars contrasting in Si uptake.

    Science.gov (United States)

    Mitani-Ueno, Namiki; Yamaji, Naoki; Ma, Jian Feng

    2011-07-01

    The accumulation of silicon (Si) differs greatly with plant species and cultivars due to different ability of the roots to take up Si. In Si accumulating plants such as rice, barley and maize, Si uptake is mediated by the influx (Lsi1) and efflux (Lsi2) transporters. Here we report isolation and functional analysis of two Si efflux transporters (CmLsi2-1 and CmLsi2-2) from two pumpkin (Cucurbita moschata Duch.) cultivars contrasting in Si uptake. These cultivars are used for rootstocks of bloom and bloomless cucumber, respectively. Different from mutations in the Si influx transporter CmLsi1, there was no difference in the sequence of either CmLsi2 between two cultivars. Both CmLsi2-1 and CmLsi2-2 showed an efflux transport activity for Si and they were expressed in both the roots and shoots. These results confirm our previous finding that mutation in CmLsi1, but not in CmLsi2-1 and CmLsi2-2 are responsible for bloomless phenotype resulting from low Si uptake.

  7. Cultivars

    Directory of Open Access Journals (Sweden)

    Oleg Blum

    2011-01-01

    Full Text Available Some modern agrochemicals with antioxidant potential were tested for their protective effect against ozone injury using clover and tobacco ozone-sensitive cultivars as model plants subjected to ambient ozone at two sites (Kyiv city in Ukraine and Szarów village in Poland. All used agrochemicals showed partial protective effects against ozone injury on clover and tobacco. Conducted studies confirmed the effectiveness of modern fungicides belonging to strobilurin group as protectants of sensitive crops against ozone damage. The effectiveness of new growth regulators “Emistym C” and “Agrostymulin” was showed for the first time. Out of the studied agrochemicals, fungicide “Strobi” and natural growth regulator “Emistym C” demonstrated the best protective effects. These agrochemicals present promise for further studies of their possible utilization for enhancement of ozone tolerance of sensitive crops.

  8. Effects of external potassium (k supply on drought tolerances of two contrasting winter wheat cultivars.

    Directory of Open Access Journals (Sweden)

    Jiguang Wei

    Full Text Available BACKGROUND: Drought is a common stress limiting crops growth and productivities worldwide. Water deficit may increase cellular membrane permeability, resulting in K outflow. Internal K starvation may disorder plant metabolism and limit plant growth. However, it is seldom reported about the effects of external K on drought tolerance of contrasting wheat cultivars. METHODOLOGY/PRINCIPAL FINDINGS: A hydroponics experiment was carried out in a non-controlled greenhouse. Seedlings of drought-tolerant SN16 and intolerant JM22 were simultaneously treated by five levels of K2CO3 (0, 2.5, 5, 7.5, 10 mM and two levels of PEG6000 (0, 20% for 7 days. External K2CO3 significantly increased shoot K(+ content, water potential, chlorophyll content as well as gas exchange, but decreased electrolyte leakage (EL and MDA content in both cultivars under PEG6000 stress. Antioxidant enzymes activities were up-regulated by PEG6000 while external K2CO3 reduced those changes. Molecular basis was explained by measuring the expression levels of antioxidant enzymes related genes. Shoot and root biomass were also increased by K2CO3 supply under drought stress. Although adequate K2CO3 application enhanced plant growth for both cultivars under drought stress, SN16 was better than JM22 due to its high drought tolerance. CONCLUSIONS/SIGNIFICANCE: Adequate external K may effectively protect winter wheat from drought injuries. We conclude that drought-tolerant wheat combined with adequate external K supply may be a promising strategy for better growth in arid and semi-arid regions.

  9. Physiological and proteome studies of responses to heat stress during grain filling in contrasting wheat cultivars

    DEFF Research Database (Denmark)

    Wang, Xiao; Dinler, Burcu Seckin; Vignjevic, Marija;

    2015-01-01

    Experiments to explore physiological and biochemical differences of the effects of heat stress in ten wheat (Triticum aestivum L) cultivars have been performed. Based on the response of photosynthesis rates, cell membrane lipid peroxide concentrations and grain yield to heat, six cultivars were...... compared to sensitive cultivars under heat stress. The tolerant cv. '810' and the sensitive cv. '1039' were selected for further proteome analysis of leaves. Proteins related to photosynthesis, glycolysis, stress defence, heat shock and ATP production were differently expressed in leaves of the tolerant...... and sensitive cultivar under heat stress in relation to the corresponding control. The abundance of proteins related to signal transduction, heat shock, photosynthesis, and antioxidants increased, while the abundance of proteins related to nitrogen metabolism decreased in the tolerant cv. '810' under heat...

  10. Constraints to hydraulic acclimation under reduced light in two contrasting Phaseolus vulgaris cultivars.

    Science.gov (United States)

    Matzner, Steven L; Rettedal, David D; Harmon, Derek A; Beukelman, MacKenzie R

    2014-08-01

    Two cultivars of Phaseolus vulgaris L. were grown under three light levels to determine if hydraulic acclimation to light occurs in herbaceous annuals and whether intraspecific trade-offs constrain hydraulic traits. Acclimation occurred in response to reduced light and included decreased stomatal density (SD) and increased specific leaf area (SLA). Reduced light resulted in lower wood density (WD); decreased cavitation resistance, measured as the xylem pressure causing a 50 % reduction in stem conductivity (P50); and increased hydraulic capacity, measured as average leaf mass specific transpiration (E(LM)). Significant or marginally significant trade-offs between P50 and WD, WD and E(LM), and E(LM) and P50 reflected variation due to both genotype and environmental effects. A trade-off between WD and P50 within one cultivar indicated that morphological adjustment was constrained. Coordinated changes in WD, P50, and E(LM) within each cultivar in response to light were consistent with trade-offs constraining plasticity. A water-use efficiency (WUE, measured as δ(13)C) versus hydraulic capacity (E(LM)) trade-off was observed within each cultivar, further indicating that hydraulic trade-offs can constrain acclimation. Larger plants had lower hydraulic capacity (E(LM)) but greater cavitation resistance, WD, and WUE. Distinct hydraulic strategies were observed with the cultivar adapted to irrigated conditions having higher stomatal conductance and stem flow rates. The cultivar adapted to rain-fed conditions had higher leaf area and greater cavitation resistance. Hydraulic trade-offs were observed within the herbaceous P. vulgaris resulting from both genotype and environmental effects. Trade-offs within a cultivar reflected constraints to hydraulic acclimation in response to changing light.

  11. Childhood Condyloma Acuminata

    Directory of Open Access Journals (Sweden)

    K. Didem Yazganoğlu

    2009-12-01

    Full Text Available Objective: Condyloma acuminata (CA in children needs a special approach. Our purpose was to review the children with CA to find the clinical features, possible transmission modes and treatment modalities.Methods: Thirteen cases of CA under the age of 12 within 441 CA patients diagnosed between the years of January 2004-April 2009 were retrospectively analyzed for the clinical characteristics and response to treatment.Results: The age at presentation was between 1,5-12 years. The duration of disease was between 1,5 months to 11 years. Nine cases were female, four were male (female/male:2,3. Perianal localization was observed in twelve cases (92,3%. Five cases had verruca vulgaris located at another anatomical site. The relatives of two cases had hand warts. CA was present in the family of three cases. Sexual abuse was not confirmed in any of our cases. Seven patients had complete clearance after therapy. Two patients are unresponsive to therapy with associated diseases namely atopic dermatitis and hyper-immunoglobulin E syndrome.Conclusion: CA in children is more common in girls, and more commonly located in the perianal area. The way of transmission is hard to identify, but non-sexual transmission is more possible. However, sexual abuse must be evaluated in every case. Treatment modalities are the same in adults, and response to treatment varies.

  12. Down-regulation of photosynthesis following girdling, but contrasting effects on fruit set and retention, in two sweet cherry cultivars.

    Science.gov (United States)

    Quentin, A G; Close, D C; Hennen, L M H P; Pinkard, E A

    2013-12-01

    Sweet cherry (Prunus avium) trees were manipulated to analyse the contribution of soluble sugars to sink feedback down-regulation of leaf net CO2 assimilation rate (Anet) and fruit set and quality attributes. Total soluble sugar concentration and Anet were measured in the morning on fully expanded leaves of girdled branches in two sweet cherry cultivars, 'Kordia' and 'Sylvia' characterised typically by low and high crop load, respectively. Leaves on girdled trees had higher soluble sugar concentrations and reduced Anet than leaves on non-girdled trees. Moreover, RuBP carboxylation capacity of Rubisco (Vcmax) and triose-phosphate utilisation (TPU) were repressed in the girdled treatments, despite Jmax remaining unchanged; suggesting an impairment of photosynthetic capacity in response to the girdling treatment. Leaf Anet was negatively correlated to soluble sugars, suggesting a sink feedback regulatory control of photosynthesis. Although there were significantly less fruit set and retained in 'Kordia' than 'Sylvia'; girdling had contrasting effects in each cultivar. Girdling significantly increased fruit set and fruitlet retention in 'Sylvia' cultivar, but had no effect in 'Kordia' cultivar. We propose that low inherent sink demand for photoassimilates of 'Kordia' fruit could have contributed to the low fruit retention rate, since both non-girdled and girdled trees exhibited similar retention rate and that increases in foliar carbohydrates was observed above the girdle. In 'Sylvia' cultivar, the carbohydrate status may be a limiting factor for 'Sylvia' fruit, since girdling improved both fruit set and retention, and leaf soluble solids accumulation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  13. Comparing hemp (Cannabis sativa L.) cultivars for dual-purpose production under contrasting environments

    NARCIS (Netherlands)

    Tang, Kailei; Struik, P.C.; Yin, X.; Thouminot, C.; Bjelková, M.; Stramkale, V.; Amaducci, S.

    2016-01-01

    Interest in hemp as a multi-purpose crop is growing worldwide and for the first time in 2015 it was cultivated in Europe on more than 20.000 ha as a dual-purpose crop, for the seeds and for the fibre. In the present study, fibre and seed productivity of 14 commercial cultivars were tested in four

  14. Comparative analysis of phytochemicals and nutrient availability in two contrasting cultivars of sweet potato (Ipomoea batatas L.).

    Science.gov (United States)

    Shekhar, Shubhendu; Mishra, Divya; Buragohain, Alak Kumar; Chakraborty, Subhra; Chakraborty, Niranjan

    2015-04-15

    Sweet potato ranks as the world's seventh most important food crop, and has major contribution to energy and phytochemical source of nutrition. To unravel the molecular basis for differential nutrient availability, and to exploit the natural genetic variation(s) of sweet potato, a series of physiochemical and proteomics experiment was conducted using two contrasting cultivars, an orange-fleshed sweet potato (OFSP) and a white-fleshed sweet potato (WFSP). Phytochemical screening revealed high percentage of carbohydrate, reducing sugar and phenolics in WFSP, whereas OFSP showed increased levels of total protein, flavonoids, anthocyanins, and carotenoids. The rate of starch and cellulose degradation was found to be less in OFSP during storage, indicating tight regulation of gene(s) responsible for starch-degradation. Comparative proteomics displayed a cultivar-dependent expression of proteins along with evolutionarily conserved proteins. These results suggest that cultivar-specific expression of proteins and/or their interacting partners might play a crucial role for nutrient acquisition in sweet potato.

  15. Identification and Expression Analyses of miRNAs from Two Contrasting Flower Color Cultivars of Canna by Deep Sequencing.

    Science.gov (United States)

    Roy, Sribash; Tripathi, Abhinandan Mani; Yadav, Amrita; Mishra, Parneeta; Nautiyal, Chandra Shekhar

    2016-01-01

    miRNAs are endogenous small RNA (sRNA) that play critical roles in plant development processes. Canna is an ornamental plant belonging to family Cannaceae. Here, we report for the first time the identification and differential expression of miRNAs in two contrasting flower color cultivars of Canna, Tropical sunrise and Red president. A total of 313 known miRNAs belonging to 78 miRNA families were identified from both the cultivars. Thirty one miRNAs (17 miRNA families) were specific to Tropical sunrise and 43 miRNAs (10 miRNA families) were specific to Red president. Thirty two and 18 putative new miRNAs were identified from Tropical sunrise and Red president, respectively. One hundred and nine miRNAs were differentially expressed in the two cultivars targeting 1343 genes. Among these, 16 miRNAs families targeting 60 genes were involved in flower development related traits and five miRNA families targeting five genes were involved in phenyl propanoid and pigment metabolic processes. We further validated the expression analysis of a few miRNA and their target genes by qRT-PCR. Transcription factors were the major miRNA targets identified. Target validation of a few randomly selected miRNAs by RLM-RACE was performed but was successful with only miR162. These findings will help in understanding flower development processes, particularly the color development in Canna.

  16. Comparative Proteomic Analysis of Two Barley Cultivars (Hordeum vulgare L.) with Contrasting Grain Protein Content

    Science.gov (United States)

    Guo, Baojian; Luan, Haiye; Lin, Shen; Lv, Chao; Zhang, Xinzhong; Xu, Rugen

    2016-01-01

    Grain protein contents (GPCs) of barley seeds are significantly different between feed and malting barley cultivars. However, there is still no insight into the proteomic analysis of seed proteins between feed and malting barley cultivars. Also, the genetic control of barley GPC is still unclear. GPCs were measured between mature grains of Yangsimai 3 and Naso Nijo. A proteome profiling of differentially expressed protein was established by using a combination of 2-DE and tandem mass spectrometry. In total, 502 reproducible protein spots in barley seed proteome were detected with a pH range of 4–7 and 6–11, among these 41 protein spots (8.17%) were detected differentially expressed between Yangsimai 3 and Naso Nijo. Thirty-four protein spots corresponding to 23 different proteins were identified, which were grouped into eight categories, including stress, protein degradation and post-translational modification, development, cell, signaling, glycolysis, starch metabolism, and other functions. Among the identified proteins, enolase (spot 274) and small subunit of ADP-glucose pyrophosphorylase (spot 271) are exclusively expressed in barley Yangsimai 3, which may be involved in regulating seed protein expression. In addition, malting quality is characterized by an accumulation of serpin protein, Alpha-amylase/trypsin inhibitor CMb and Alpha-amylase inhibitor BDAI-1. Most noticeably, globulin, an important storage protein in barley seed, undergoes post-translational processing in both cultivars, and also displays different expression patterns. PMID:27200019

  17. Cell wall glycosidase activities and protein content variations during fruit development and ripening in three texture contrasted tomato cultivars

    Science.gov (United States)

    Konozy, Emadeldin H.E.; Causse, Mathilde; Faurobert, Mireille

    2012-01-01

    Excessive softening is the main factor limiting fruit shelf life and storage. It is generally acceptable now that softening of fruit which occurs during the ripening is due to synergistic actions of several enzymes on cell wall polysaccharides. As a subject for this study, we have assayed some glycosidase activities using three tomato species (Lycopersicon esculentum) contrasted for their texture phenotypes; the cherry tomato line Cervil (Solanum lycopersicum var. cerasiforme), a common taste tomato line Levovil (S. lycopersicum Mill.) and VilB a modern line, large, firmer and with good storage capability. Four glycosidase activities namely α-galactosidase, β-galactosidase, β-mannosidase and β-glucosidase were extracted from tomato’s cell wall of the three species. Cell wall protein from fruits pericarp was extracted and compared among the three cultivars at the following stages; 14 days post anthesis (14DPA) fruit; 21 days post anthesis (21DPA), turning (breaker), red and over ripe. When glycolytic activities were also compared among these cultivars at the precited development stages, gross variations were noticed from stage to stage and also from species to species in accordance with the fruit firmness status. Interestingly, VilB cultivar, the firmer among the other two, though possessed the highest total protein content, exhibited the lowest enzymatic activities. Taken together, these results may therefore allow us to conclude that studies of glycolytic activities in a single tomato cultivar cannot be generalized to all species. On the other hand, relating fruit development to glycosidase activities should logically be coupled to these enzymes from cell wall compartment. PMID:23961187

  18. Analysis of non-TIR NBS-LRR resistance gene analogs in Musa acuminata Colla: Isolation, RFLP marker development, and physical mapping

    Directory of Open Access Journals (Sweden)

    Souza Manoel T

    2008-01-01

    Full Text Available Abstract Background Many commercial banana varieties lack sources of resistance to pests and diseases, as a consequence of sterility and narrow genetic background. Fertile wild relatives, by contrast, possess greater variability and represent potential sources of disease resistance genes (R-genes. The largest known family of plant R-genes encode proteins with nucleotide-binding site (NBS and C-terminal leucine-rich repeat (LRR domains. Conserved motifs in such genes in diverse plant species offer a means for isolation of candidate genes in banana which may be involved in plant defence. Results A computational strategy was developed for unbiased conserved motif discovery in NBS and LRR domains in R-genes and homologues in monocotyledonous plant species. Degenerate PCR primers targeting conserved motifs were tested on the wild cultivar Musa acuminata subsp. burmannicoides, var. Calcutta 4, which is resistant to a number of fungal pathogens and nematodes. One hundred and seventy four resistance gene analogs (RGAs were amplified and assembled into 52 contiguous sequences. Motifs present were typical of the non-TIR NBS-LRR RGA subfamily. A phylogenetic analysis of deduced amino-acid sequences for 33 RGAs with contiguous open reading frames (ORFs, together with RGAs from Arabidopsis thaliana and Oryza sativa, grouped most Musa RGAs within monocotyledon-specific clades. RFLP-RGA markers were developed, with 12 displaying distinct polymorphisms in parentals and F1 progeny of a diploid M. acuminata mapping population. Eighty eight BAC clones were identified in M. acuminata Calcutta 4, M. acuminata Grande Naine, and M. balbisiana Pisang Klutuk Wulung BAC libraries when hybridized to two RGA probes. Multiple copy RGAs were common within BAC clones, potentially representing variation reservoirs for evolution of new R-gene specificities. Conclusion This is the first large scale analysis of NBS-LRR RGAs in M. acuminata Calcutta 4. Contig sequences were

  19. Differential activation of genes related to aluminium tolerance in two contrasting rice cultivars.

    Science.gov (United States)

    Roselló, Maite; Poschenrieder, Charlotte; Gunsé, Benet; Barceló, Juan; Llugany, Mercè

    2015-11-01

    Rice (Oryza sativa) is a highly Al-tolerant crop. Among other mechanisms, a higher expression of STAR1/STAR2 (sensitive to Al rhizotoxicity1/2) genes and of Nrat1 (NRAMP Aluminium Transporter 1), and ALS1 (Aluminium sensitive 1) can at least in part be responsible for the inducible Al tolerance in this species. Here we analysed the responses to Al in two contrasting rice varieties. All analysed toxicity/tolerance markers (root elongation, Evans blue, morin and haematoxylin staining) indicated higher Al-tolerance in variety Nipponbare, than in variety Modan. Nipponbare accumulated much less Al in the roots than Modan. Aluminium supply caused stronger expression of STAR1 in Nipponbare than in Modan. A distinctively higher increase of Al-induced abscisic acid (ABA) accumulation was found in the roots of Nipponbare than in Modan. Highest ABA levels were observed in Nipponbare after 48 h exposure to Al. This ABA peak was coincident in time with the highest expression level of STAR1. It is proposed that ABA may be required for cell wall remodulation facilitated by the enhanced UDP-glucose transport to the walls through STAR1/STAR2. Contrastingly, in the roots of Modan the expression of both Nrat1 coding for a plasma membrane Al-transporter and of ALS1 coding for a tonoplast-localized Al transporter was considerably enhanced. Moreover, Modan had a higher Al-induced expression of ASR1 a gene that has been proposed to code for a reactive oxygen scavenging protein. In conclusion, the Al-exclusion strategy of Nipponbare, at least in part mediated by STAR1 and probably regulated by ABA, provided better protection against Al toxicity than the accumulation and internal detoxification strategy of Modan mediated by Nrat1, ALS1 and ARS1. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. A saturated SSR/DArT linkage map of Musa acuminata addressing genome rearrangements among bananas

    Directory of Open Access Journals (Sweden)

    Matsumoto Takashi

    2010-04-01

    Full Text Available Abstract Background The genus Musa is a large species complex which includes cultivars at diploid and triploid levels. These sterile and vegetatively propagated cultivars are based on the A genome from Musa acuminata, exclusively for sweet bananas such as Cavendish, or associated with the B genome (Musa balbisiana in cooking bananas such as Plantain varieties. In M. acuminata cultivars, structural heterozygosity is thought to be one of the main causes of sterility, which is essential for obtaining seedless fruits but hampers breeding. Only partial genetic maps are presently available due to chromosomal rearrangements within the parents of the mapping populations. This causes large segregation distortions inducing pseudo-linkages and difficulties in ordering markers in the linkage groups. The present study aims at producing a saturated linkage map of M. acuminata, taking into account hypotheses on the structural heterozygosity of the parents. Results An F1 progeny of 180 individuals was obtained from a cross between two genetically distant accessions of M. acuminata, 'Borneo' and 'Pisang Lilin' (P. Lilin. Based on the gametic recombination of each parent, two parental maps composed of SSR and DArT markers were established. A significant proportion of the markers (21.7% deviated (p Conclusions We propose a synthetic map with 11 linkage groups containing 489 markers (167 SSRs and 322 DArTs covering 1197 cM. This first saturated map is proposed as a "reference Musa map" for further analyses. We also propose two complete parental maps with interpretations of structural rearrangements localized on the linkage groups. The structural heterozygosity in P. Lilin is hypothesized to result from a duplication likely accompanied by an inversion on another chromosome. This paper also illustrates a methodological approach, transferable to other species, to investigate the mapping of structural rearrangements and determine their consequences on marker

  1. Antioxidant response and Lea genes expression under salt stress and combined salt plus water stress in two wheat cultivars contrasting in drought tolerance.

    Science.gov (United States)

    Bhagi, Priyanka; Zhawar, Vikramjit Kaur; Gupta, Anil Kumar

    2013-09-01

    Two wheat cultivars, C306 and PBW343 contrasting in drought tolerance were compared for their antioxidant response and Lea genes' expression under salt stress (SS) and combined stress (CS) of salt stress plus water stress during seedlings growth. The drought susceptible cultivar (PBW343) behaved different towards SS/CS than towards WS. It accumulated more dry masses in shoots, more ascorbate, had higher ascorbate to dehydroascorbate ratio, lesser dehydroascorbate, lesser malondialdehyde (MDA), more proline and higher antioxidant enzymes under SS than under WS. CS increased dry masses, ascorbate, ascorbate to dehydroascorbate ratio, antioxidant enzymes and decreased dehydroascorbate and MDA contents from levels under WS. The drought tolerant cultivar (C306) though showed higher levels of ascorbate, ascorbate to dehydroascorbate ratio, lower levels of dehydroascorbate, showed lesser dry biomasses in shoots, higher MDA and lesser ascorbate peroxidase and catalase activities under SS than under WS and these features were improved on combining WS with SS. All lea genes were induced under all stresses in both cultivars except Wrab17 in C306 only, was not induced under any stress. Eight Lea genes out of ten were induced higher under WS than SS in C306 but induced same in PBW343. Wdhn13 gene was higher salt-responsive than other lea genes in both cultivars.

  2. Peanut Seed Cultivars with Contrasting Resistance to Aspergillus parasiticus Colonization Display Differential Temporal Response of Protease Inhibitors.

    Science.gov (United States)

    Müller, Virginia; Bonacci, Gustavo; Batthyany, Carlos; Amé, María V; Carrari, Fernando; Gieco, Jorge; Asis, Ramón

    2017-04-01

    Significant efforts are being made to minimize aflatoxin contamination in peanut seeds and one possible strategy is to understand and exploit the mechanisms of plant defense against fungal infection. In this study we have identified and characterized, at biochemical and molecular levels, plant protease inhibitors (PPIs) produced in peanut seeds of the resistant PI 337394 and the susceptible Forman cultivar during Aspergillus parasiticus colonization. With chromatographic methods and 2D-electrophoresis-mass spectrometry we have isolated and identified four variants of Bowman-Birk trypsin inhibitor (BBTI) and a novel Kunitz-type protease inhibitor (KPI) produced in response to A. parasiticus colonization. KPI was detected only in the resistant cultivar, while BBTI was produced in the resistant cultivar in a higher concentration than susceptible cultivar and with different isoforms. The kinetic expression of KPI and BBTI genes along with trypsin inhibitory activity was analyzed in both cultivars during infection. In the susceptible cultivar an early PPI activity response was associated with BBTI occurrence. Meanwhile, in the resistant cultivar a later response with a larger increase in PPI activity was associated with BBTI and KPI occurrence. The biological significance of PPI in seed defense against fungal infection was analyzed and linked to inhibitory properties on enzymes released by the fungus during infection, and to the antifungal effect of KPI.

  3. Influence of transplant size on the above- and below-ground performance of four contrasting field-grown lettuce cultivars

    Directory of Open Access Journals (Sweden)

    Pauline Julie Kerbiriou

    2013-09-01

    Full Text Available Background and aims: Modern lettuce cultivars underperform under conditions of variable temporal and spatial resource availability, common in organic or low-input production systems. Information is scarce on the impact of below-ground traits on such resource acquisition and performance of field-grown lettuce; exploring genetic variation in such traits might contribute to strategies to select for cultivars robust enough to perform well in the field, even under stress.Methods: To investigate the impact of below-ground (root development and resource capture on above-ground (shoot weight, leaf area traits, different combinations of shoot and root growth were created using transplants of different sizes in three field experiments. Genetic variation in morphological and physiological below- and above-ground responses to different types of transplant shocks was assessed using four cultivars. Results: Transplanting over-developed seedling did not affect final yield of any of the four cultivars. Small transplant size persistently impacted growth and delayed maturity. The cultivars with overall larger root weights and rooting depth, ‘Matilda’ and ‘Pronto’, displayed a slightly higher growth rate in the linear phase leading to better yields than ‘Mariska’ which had a smaller root system and a slower linear growth despite a higher maximal exponential growth rate. ‘Nadine’, which had the highest physiological nitrogen-use efficiency (NUE, g dry matter produced per g N accumulated in the head among the tested cultivars, gave most stable yields over seasons and locations. Conclusions: Robustness was conferred by a large root system exploring deep soil layers. More roots generally correlated with improved nitrate capture in a soil layer and cultivars with a larger root system may therefore perform better in harsh environmental conditions; increased NUE can also confer robustness at low cost for the plant, and secure stable yields under a wide

  4. Management of a giant perineal condylomata acuminata

    Directory of Open Access Journals (Sweden)

    Hemper, Evelyn

    2016-01-01

    Full Text Available A condylomata acuminata infection is caused by human papillomaviridae (HPV. This sexually transmitted condition most often affects the perineal region. Importantly, infections with types 16 and 18 are associated with an increased risk for anal and cervix cancer. In most cases topical therapy is sufficient for successfully treating condylomata acuminata. Here, we report the case of a 51-year old patient who suffered from a giant perianal located condylomata acuminata which had developed over a period of more than 10 years. Imaging by MRI revealed a possible infiltration of the musculus sphincter ani externus. Because a topical treatment or a radiotherapy was considered unfeasible, a surgical treatment was the only therapeutic option in this unusual case. First, a colostomy was performed and subsequently a resection of the tumor with circular resection of the external portion of the musculus sphincter ani externus was performed. The large skin defect was closed by two gluteus flaps. The rectum wall was reinserted in the remnant of the musculus sphincter ani externus. Postoperatively, parts of the flaps developed necrosis. Therefore, a vacuum sealing therapy was initiated. Subsequently, the remaining skin defects were closed by autologous skin transplantation. Six months later the colostomy could be reversed. To date, one year after first surgery, the patient has still a normal sphincter function and no recurrence of the condylomata acuminata. This case report demonstrates how giant condylomata acuminata can be successfully treated by extended surgical procedures including colostomy and plastic reconstruction of resulting defects upon resection.

  5. Influence of transplant size on the above- and below-ground performance of four contrasting field-grown lettuce cultivars

    NARCIS (Netherlands)

    Kerbiriou, P.J.; Stomph, T.J.; Lammerts Van Bueren, E.; Struik, P.C.

    2013-01-01

    Background and aims: Modern lettuce cultivars underperform under conditions of variable temporal and spatial resource availability, common in organic or low-input production systems. Information is scarce on the impact of below-ground traits on such resource acquisition and performance of field-grow

  6. Influence of transplant size on the above- and below-ground performance of four contrasting field-grown lettuce cultivars

    NARCIS (Netherlands)

    Kerbiriou, P.J.; Stomph, T.J.; Lammerts Van Bueren, E.; Struik, P.C.

    2013-01-01

    Background and aims: Modern lettuce cultivars underperform under conditions of variable temporal and spatial resource availability, common in organic or low-input production systems. Information is scarce on the impact of below-ground traits on such resource acquisition and performance of field-grow

  7. Atividade antiviral de Musa acuminata Colla, Musaceae Antiviral activity of Musa acuminata Colla, Musaceae

    Directory of Open Access Journals (Sweden)

    Fernanda Otaviano Martins

    2009-09-01

    Full Text Available O presente trabalho avalia a atividade antiviral de extratos e frações de Musa acuminata Colla, Musaceae, coletada em duas regiões do Estado do Rio de Janeiro (Petrópolis e Santo Antônio de Pádua. As inflorescências de M. acuminata apresentaram excelente atividade para os dois vírus avaliados: herpesvírus simples humano tipo 1 e herpesvírus simples humano tipo 2, ambos resistentes ao Aciclovir. Os resultados indicam que os extratos de M. acuminata testados podem constituir alvo potencial para uso em terapias antivirais.This study evaluates the antiviral activity of extracts and fractions of Musa acuminata Colla collected in two regions of Rio de Janeiro State (Petrópolis and Santo Antônio de Pádua. The inflorescences of M. acuminata showed excellent activity for the two virus evaluated: simple human herpesvirus type 1 and simple human herpesvirus type 2, both resistant to Acyclovir. The results indicate that the tested extracts of M. acuminata can be potential target for use in antiviral therapy.

  8. Isolation and functional characterization of an influx silicon transporter in two pumpkin cultivars contrasting in silicon accumulation.

    Science.gov (United States)

    Mitani, Namiki; Yamaji, Naoki; Ago, Yukiko; Iwasaki, Kozo; Ma, Jian Feng

    2011-04-01

    A high accumulation of silicon (Si) is required for overcoming abiotic and biotic stresses, but the molecular mechanisms of Si uptake, especially in dicotyledonous species, is poorly understood. Herein, we report the identification of an influx transporter of Si in two Cucurbita moschata (pumpkin) cultivars greatly differing in Si accumulation, which are used for the rootstocks of bloom and bloomless Cucumis sativus (cucumber), respectively. Heterogeneous expression in both Xenopus oocytes and rice mutant defective in Si uptake showed that the influx transporter from the bloom pumpkin rootstock can transport Si, whereas that from the bloomless rootstock cannot. Analysis with site-directed mutagenesis showed that, among the two amino acid residues differing between the two types of rootstocks, only changing a proline to a leucine at position 242 results in the loss of Si transport activity. Furthermore, all pumpkin cultivars for bloomless rootstocks tested have this mutation. The transporter is localized in all cells of the roots, and investigation of the subcellular localization with different approaches consistently showed that the influx Si transporter from the bloom pumpkin rootstock was localized at the plasma membrane, whereas the one from the bloomless rootstock was localized at the endoplasmic reticulum. Taken together, our results indicate that the difference in Si uptake between two pumpkin cultivars is probably the result of allelic variation in one amino acid residue of the Si influx transporter, which affects the subcellular localization and subsequent transport of Si from the external solution to the root cells.

  9. Contrasting response of biomass and grain yield to severe drought in Cappelle Desprez and Plainsman V wheat cultivars

    Directory of Open Access Journals (Sweden)

    Kenny Paul

    2016-02-01

    Full Text Available We report a case study of natural variations and correlations of some photosynthetic parameters, green biomass and grain yield in Cappelle Desprez and Plainsman V winter wheat (Triticum aestivum L. cultivars, which are classified as being drought sensitive and tolerant, respectively. We monitored biomass accumulation from secondary leaves in the vegetative phase and grain yield from flag leaves in the grain filling period. Interestingly, we observed higher biomass production, but lower grain yield stability in the sensitive Cappelle cultivar, as compared to the tolerant Plainsman cv. Higher biomass production in the sensitive variety was correlated with enhanced water-use efficiency. Increased cyclic electron flow around PSI was also observed in the Cappelle cv. under drought stress as shown by light intensity dependence of the ratio of maximal quantum yields of Photosystem I and Photosystem II, as well by the plot of the Photosystem I electron transport rate as a function of Photosystem II electron transport rate. Higher CO2 uptake rate in flag leaves of the drought-stressed Plainsman cv. during grain filling period correlates well with its higher grain yield and prolonged transpiration rate through spikes. The increase in drought factor (DFI and performance (PI indices calculated from variable chlorophyll fluorescence parameters of secondary leaves also showed correlation with higher biomass in the Cappelle cultivar during the biomass accumulation period. However, during the grain filling period, DFI and PI parameters of the flag leaves were higher in the tolerant Plainsman V cultivar and showed correlation with grain yield stability. Our results suggest that overall biomass and grain yield may respond differentially to drought stress in different wheat cultivars and therefore phenotyping for green biomass cannot be used as a general approach to predict grain yield. We also conclude that photosynthetic efficiency of flag and secondary leaves

  10. Transcriptional analysis of cell wall and cuticle related genes during fruit development of two sweet cherry cultivars with contrasting levels of cracking tolerance

    Directory of Open Access Journals (Sweden)

    Cristián Balbontín

    2014-04-01

    Full Text Available Rain-induced cracking before harvest is the major cause of crop loss in sweet cherry (Prunus avium [L.] L. In order to better understand the relationship between cherry fruit cracking and gene expression, the transcriptional patterns of six genes related to cell wall modification and cuticular wax biosynthesis were analyzed during fruit setting (FS, fruit color change (FC and fruit ripening (FR, employing two contrasting cultivars: the cracking resistant 'Kordia' and the cracking susceptible 'Bing'. The transcription levels of AP2/EREBP-type transcription factor (PaWINB, wax synthase (WS, ß-ketoacyl-CoA synthase (PaKCS6, and ß-galactosidase (ß-Gal showed higher levels in 'Kordia' than in 'Bing' during the FS stage, while similar values were observed in both cultivars at FR stage. In contrast to that pattern, transcription levels of expansin (PaEXPl were higher at FR stage in 'Kordia' than in 'Bing'. Transcript profile of lipid transport protein gene (PaLTPGl decreased during fruit development, with higher levels in 'Bing' than in 'Kordia' at FC and FR stages suggesting no relation with cracking tolerance. The expression profiles of PaWINB, WS, PaKCS6, and ß-Gal suggest that they are genes involved in conferring cracking tolerance, likely due to their function in cuticle deposition during early stages of fruit development. In addition, a greater expression level of expansin gene would allow for a faster growth rate in 'Kordia' at FR stage.

  11. Comparative Study of Phenolic Profile, Antioxidant Capacity, and Color-composition Relation of Roselle Cultivars with Contrasting Pigmentation.

    Science.gov (United States)

    Camelo-Méndez, Gustavo A; Jara-Palacios, M José; Escudero-Gilete, M Luisa; Gordillo, Belén; Hernanz, Dolores; Paredes-López, Octavio; Vanegas-Espinoza, Pablo E; Del Villar-Martínez, Alma A; Heredia, Francisco J

    2016-03-01

    Roselle is a plant that accumulates anthocyanins significantly, hence its importance as food coloring and as a source of antioxidant compounds for human health. This study was aimed to determine phenolic composition and antioxidant capacity of methanolic extracts, and beverages obtained from native roselle cultivars in Mexico (Negra, Sudan, Rosa and Blanca) with different degrees of pigmentation, and to establish the color-composition relationship. Chromatographic methods were used to determine phenolic compounds: flavanols, flavonols, benzoic, hibiscus and phenolic acids as well as two main anthocyanins (cyanidin 3-sambubioside and delphinidin 3-sambubioside). The antioxidant capacity was evaluated by ABTS and FRAP assays. Tristimulus colorimetry showed to be a useful technique to determine the color-composition relationship, leading to equations that allowed to predict anthocyanin content of roselle (R > 0.84). Also, a stepwise linear discriminant analysis (SLDA) was developed in order to classify roselle cultivars. The obtained mathematical model could be an important tool to be used in colorimetric characterization of functional compounds used in food processing.

  12. Photoperiodic effects on short-pulse 14C assimilation and overall carbon and nitrogen allocation patterns in contrasting quinoa cultivars

    DEFF Research Database (Denmark)

    Bendevis, Mira Arpe; Sun, Yujie; Rosenqvist, Eva

    2014-01-01

    Further understanding of the range of environmental influence on source-sink relationships in quinoa is important to streamlining future crop improvement and efforts concerning geographic expansion of cultivation areas. In the present study a photoperiod sensitive quinoa cv. 'Achachino......' and photoperiod neutral cv. 'Titicaca' were studied under short (10h) and long (17.5h) days, with respect to C and N distribution as well as partitioning of newly assimilated C to plant organs. An extended photoperiod resulted in 14C decreasingly being allocated to stem growth and lower leaves in 'Titicaca...... with an immediate increase in carbon allocation to upper leaves, and over time to the reproductive structures, resulting in a more than 50% increase in final yield. Collectively the results indicate that even though the photoperiod sensitive cultivar flowered under long photoperiod it did not develop seeds, whereas...

  13. Different stress responsive strategies to drought and heat in two durum wheat cultivars with contrasting water use efficiency.

    Science.gov (United States)

    Aprile, Alessio; Havlickova, Lenka; Panna, Riccardo; Marè, Caterina; Borrelli, Grazia M; Marone, Daniela; Perrotta, Carla; Rampino, Patrizia; De Bellis, Luigi; Curn, Vladislav; Mastrangelo, Anna M; Rizza, Fulvia; Cattivelli, Luigi

    2013-11-22

    Durum wheat often faces water scarcity and high temperatures, two events that usually occur simultaneously in the fields. Here we report on the stress responsive strategy of two durum wheat cultivars, characterized by different water use efficiency, subjected to drought, heat and a combination of both stresses. The cv Ofanto (lower water use efficiency) activated a large set of well-known drought-related genes after drought treatment, while Cappelli (higher water use efficiency) showed the constitutive expression of several genes induced by drought in Ofanto and a modulation of a limited number of genes in response to stress. At molecular level the two cvs differed for the activation of molecular messengers, genes involved in the regulation of chromatin condensation, nuclear speckles and stomatal closure. Noteworthy, the heat response in Cappelli involved also the up-regulation of genes belonging to fatty acid β-oxidation pathway, glyoxylate cycle and senescence, suggesting an early activation of senescence in this cv. A gene of unknown function having the greatest expression difference between the two cultivars was selected and used for expression QTL analysis, the corresponding QTL was mapped on chromosome 6B. Ofanto and Cappelli are characterized by two opposite stress-responsive strategies. In Ofanto the combination of drought and heat stress led to an increased number of modulated genes, exceeding the simple cumulative effects of the two single stresses, whereas in Cappelli the same treatment triggered a number of differentially expressed genes lower than those altered in response to heat stress alone. This work provides clear evidences that the genetic system based on Cappelli and Ofanto represents an ideal tool for the genetic dissection of the molecular response to drought and other abiotic stresses.

  14. Expression Differences of Pigment Structural Genes and Transcription Factors Explain Flesh Coloration in Three Contrasting Kiwifruit Cultivars

    Directory of Open Access Journals (Sweden)

    Yanfei Liu

    2017-09-01

    Full Text Available Fruits of kiwifruit cultivars (Actinidia chinensis and A. deliciosa generally have green or yellow flesh when ripe. A small number of genotypes have red flesh but this coloration is usually restricted to the inner pericarp. Three kiwifruit cultivars having red (‘Hongyang’, or yellow (‘Jinnong-2’, or green (‘Hayward’ flesh were investigated for their color characteristics and pigment contents during development and ripening. The results show the yellow of the ‘Jinnong-2’ fruit is due to the combined effects of chlorophyll degradation and of beta-carotene accumulation. The red inner pericarps of ‘Hongyang’ fruit are due to anthocyanin accumulation. Expression differences of the pathway genes in the inner pericarps of the three different kiwifruits suggest that stay-green (SGR controls the degradation of chlorophylls, while lycopene beta-cyclase (LCY-β controls the biosynthesis of beta-carotene. The abundance of anthocyanin in the inner pericarps of the ‘Hongyang’ fruit is the results of high expressions of UDP flavonoid glycosyltransferases (UFGT. At the same time, expressions of anthocyanin transcription factors show that AcMYBF110 expression parallels changes in anthocyanin concentration, so seems to be a key R2R3 MYB, regulating anthocyanin biosynthesis. Further, transient color assays reveal that AcMYBF110 can autonomously induce anthocyanin accumulation in Nicotiana tabacum leaves by activating the transcription of dihydroflavonol 4-reductase (NtDFR, anthocyanidin synthase (NtANS and NtUFGT. For basic helix-loop-helix proteins (bHLHs and WD-repeat proteins (WD40s, expression differences show these may depend on AcMYBF110 forming a MYB-bHLH-WD40 complex to regulate anthocyanin biosynthesis, instead of it having a direct involvement.

  15. The natural impact of banana inflorescences (Musa acuminata on human nutrition

    Directory of Open Access Journals (Sweden)

    Catharina E. Fingolo

    2012-12-01

    Full Text Available Banana inflorescences are popularly known as 'navels,' and they are used in Brazil as nutritional complements. However, the nutritional value of banana inflorescences (male flowers and bracts has never been studied. Therefore, plant material of Musa acuminata, cultivar "ouro", was collected in Rio de Janeiro state, Brazil, and then submitted to chemical procedures to determine its nutritional composition. The experiment was arranged a completely randomized design and performed in triplicate. The sample composition analysis showed percentual average value for moisture, protein, fat and ash as 8.21, 14.50, 4.04 and 14.43, respectively. The dehydrated inflorescences were found to contain a significant nutritive complement based on their high content of potassium (5008.26 mg / 100 g and fiber 49.83% (lignin, cellulose and hemicelluloses revealing important functional and nutritional properties. In a parallel evaluation, the anatomical study revealed key elements for the recognition of Musa acuminata when reduced to fragments.Inflorescências de bananeira são popularmente conhecidas como "umbigos", e esses são usados no Brasil como complementos nutricionais. No entanto, o valor nutricional das inflorescências (flores masculinas e brácteas de bananeira nunca foi estudado. Portanto, o material vegetal de Musa acuminata cultivar "ouro" foi coletado no Rio de Janeiro, Brasil e, em seguida, submetido aos procedimentos químicos para determinar a sua composição nutricional. As análises foram realizadas em triplicata. A análise da composição da amostra apresentou teor percentual médio de umidade, proteína, lipídeos e cinza de 8,21, 14,50, 4,04 e 14,43, respectivamente. As inflorescências secas mostraram significativo complemento nutritivo baseado no alto conteúdo de potássio (5.008,26 mg / 100 g e de fibra 49,83% (lignina, celulose e hemiceluloses revelando importantes propriedades funcional e nutritiva. Em uma avaliação paralela, o estudo

  16. CONTRAST

    DEFF Research Database (Denmark)

    Kristensen, Thomas Krogsgaard

    2007-01-01

    Dette er en afrapportering fra den årlige CONTRAST workshop, der i 2007 blev afholdt i Yaoundé, Cameroon.......Dette er en afrapportering fra den årlige CONTRAST workshop, der i 2007 blev afholdt i Yaoundé, Cameroon....

  17. Allometric models for estimating biomass and carbon in Alnus acuminata

    National Research Council Canada - National Science Library

    William Fonseca; Laura Ruíz; Marylin Rojas; Federico Allice

    2013-01-01

    ... (leaves, branches, stem and root) and total tree biomass in Alnus acuminata (Kunth) in Costa Rica. Additionally, models were developed to estimate biomass and carbon in trees per hectare and for total plant biomass per hectare...

  18. Corrosion Inhibition Studies of Mild Steel in Acid Medium Using Musa Acuminata Fruit Peel Extract

    Directory of Open Access Journals (Sweden)

    N. Gunavathy

    2012-01-01

    Full Text Available The inhibition effect of unripe fruit peel extract of Musa acuminata (Cultivar variety – Nendran (MNP on corrosion of mild steel in 1 N HCl has been investigated by weight loss and electrochemical impedance spectroscopy (EIS with various concentrations of the extract. The effect of temperature on the corrosion inhibition of mild steel in the temperature range of 30°C – 80°C was carried out. The results indicate that MNP extract act as an effective inhibitor in the acid environment and is of mixed type inhibitor having efficiency as high as 96% at 2% inhibitor concentration. The inhibition efficiency of MNP extract increases with the increase of concentration but decreases with the increase in temperature. The inhibitor achieves its inhibition by physical adsorption of nutrients of the peel extract on the surface of the mild steel. The experimental data revealed that the adsorption occurred according to the Langmuir and Temkin adsorption isotherm.

  19. Identification and Characterization of Differentially Expressed Genes in Inferior and Superior Spikelets of Rice Cultivars with Contrasting Panicle-Compactness and Grain-Filling Properties.

    Directory of Open Access Journals (Sweden)

    Sudhanshu Sekhar

    Full Text Available Breeding programs for increasing spikelet number in rice have resulted in compactness of the panicle, accompanied by poor grain filling in inferior spikelets. Although the inefficient utilization of assimilate has been indicated as responsible for this poor grain filling, the underlying cause remains elusive. The current study utilized the suppression subtractive hybridization technique to identify 57 and 79 genes that overexpressed in the superior and inferior spikelets (with respect to each other, respectively, of the compact-panicle rice cultivar Mahalaxmi. Functional categorization of these differentially expressed genes revealed a marked metabolic difference between the spikelets according to their spatial location on the panicle. The expression of genes encoding seed storage proteins was dominant in inferior spikelets, whereas genes encoding regulatory proteins, such as serine-threonine kinase, zinc finger protein and E3 ligase, were highly expressed in superior spikelets. The expression patterns of these genes in the inferior and superior spikelets of Mahalaxmi were similar to those observed in another compact-panicle cultivar, OR-1918, but differed from those obtained in two lax-panicle cultivars, Upahar and Lalat. The results first suggest that the regulatory proteins abundantly expressed in the superior spikelets of compact-panicle cultivars and in both the superior and inferior spikelets of lax-panicle cultivars but poorly expressed in the inferior spikelets of compact-panicle cultivars promote grain filling. Second, the high expression of seed-storage proteins observed in the inferior spikelets of compact-panicle cultivars appears to inhibit the grain filling process. Third, the low expression of enzymes of the Krebs cycle in inferior spikelets compared with superior spikelets of compact-panicle cultivars is bound to lead to poor ATP generation in the former and consequently limit starch biosynthesis, an ATP-consuming process

  20. Agrobacterium-mediated genetic transformation of Camptotheca acuminata

    Institute of Scientific and Technical Information of China (English)

    WANG Hui-mei; ZU Yuan-gang

    2007-01-01

    UGPase gene related with wood cellulose synthesis was transferred into C. Acuminata using the method of Agrobacterium-mediated genetic transformation, and an efficient transformation system was developed for C. Acuminata on the basis of evaluations of several factors affecting Agrobacterium-mediated DNA transfer rate. The highest transformation rate was achieved when pre-cultured leaf explants were infected with an Agrobacterium culture corresponding to OD600 (0.5) for 10 min, and cultured on explant regeneration medium for three days. The results of Southern hybridization showed that genomic DNA of the kanamycin-resistant shoots to an UGPase gene probe substantiated the integration of the transgene. Transformation efficiency (6%) was achieved under the optimized transformation procedure. This system should facilitate the introduction of important useful genes into C. Acuminata.

  1. Isolation and characterization of endophytic fungi from Camptotheca acuminata.

    Science.gov (United States)

    Ding, Xiaowei; Liu, Kaihui; Deng, Baiwan; Chen, Wenqiang; Li, Wenjun; Liu, Feihu

    2013-10-01

    In this study, a total of 161 endophytic fungal isolates from Camptotheca acuminata were obtained and classified to 16 taxa according to morphological and molecular analysis. These taxa were composed of 2 frequent genera (Botryosphaeria and Fusarium) and 14 infrequent groups such as Xylaria, Diaporthe, Rhizopus, Epicoccum, and Preussia, demonstrating that fungal endophytes in C. acuminata were highly abundant and diverse. Antimicrobial activity screening using filter-paper diffusion method showed that 47.6 % of the tested isolates had antimicrobial activity against at least one of the test microorganisms. Screening of fungal endophyte-derived camptothecin analogues by TLC and LC-MS/MS³ demonstrated that a strain Botryosphaeria dothidea, X-4 could produce 9-methoxycamptothecin (9-MCPT) when cultured in Sabouraud's dextrose broth for 12 days under shake flask and bench-scale fermention conditions. This work showed that the fungal endophytes from C. acuminata could be an alternative source for the production of 9-MCPT and other natural antimicrobial compounds.

  2. Correlation between differential drought tolerability of two contrasting drought-responsive chickpea cultivars and differential expression of a subset of CaNAC genes under normal and dehydration conditions.

    Science.gov (United States)

    Nguyen, Kien Huu; Ha, Chien Van; Watanabe, Yasuko; Tran, Uyen Thi; Nasr Esfahani, Maryam; Nguyen, Dong Van; Tran, Lam-Son Phan

    2015-01-01

    Drought causes detrimental effect to growth and productivity of many plants, including crops. NAC transcription factors have been reported to play important role in drought tolerance. In this study, we assessed the expression profiles of 19 dehydration-responsive CaNAC genes in roots and leaves of two contrasting drought-responsive chickpea varieties treated with water (control) and dehydration to examine the correlation between the differential expression levels of the CaNAC genes and the differential drought tolerability of these two cultivars. Results of real-time quantitative PCR indicated a positive relationship between the number of dehydration-inducible and -repressible CaNAC genes and drought tolerability. The higher drought-tolerant capacity of ILC482 cultivar vs. Hashem cultivar might be, at least partly, attributed to the higher number of dehydration-inducible and lower number of dehydration-repressible CaNAC genes identified in both root and leaf tissues of ILC482 than in those of Hashem. In addition, our comparative expression analysis of the selected CaNAC genes in roots and leaves of ILC482 and Hashem cultivars revealed different dehydration-responsive expression patterns, indicating that CaNAC gene expression is tissue- and genotype-specific. Furthermore, the analysis suggested that the enhanced drought tolerance of ILC482 vs. Hashem might be associated with five genes, namely CaNAC02, 04, 05, 16, and 24. CaNAC16 could be a potential candidate gene, contributing to the better drought tolerance of ILC482 vs. Hashem as a positive regulator. Conversely, CaNAC02 could be a potential negative regulator, contributing to the differential drought tolerability of these two cultivars. Thus, our results have also provided a solid foundation for selection of promising tissue-specific and/or dehydration-responsive CaNAC candidates for detailed in planta functional analyses, leading to development of transgenic chickpea varieties with improved productivity under

  3. Correlation between differential drought tolerability of two contrasting drought-responsive chickpea cultivars and differential expression of a subset of CaNAC genes under normal and dehydration conditions

    Directory of Open Access Journals (Sweden)

    Kien Huu Nguyen

    2015-06-01

    Full Text Available Drought causes detrimental effect to growth and productivity of many plants, including crops. NAC transcription factors (TFs have been reported to play important role in drought tolerance. In this study, we assessed the expression profiles of 19 dehydration-responsive CaNAC genes in roots and leaves of two contrasting drought-responsive chickpea varieties treated with water (control and dehydration to examine the correlation between the differential expression levels of the CaNACs and the differential drought tolerability of these two cultivars. Results of real-time quantitative PCR indicated a positive relationship between the number of dehydration-inducible and -repressible CaNAC genes and drought tolerability. The higher drought-tolerant capacity of ICL482 cultivar vs. Hashem cultivar might be, at least partly, attributed to the higher number of dehydration-inducible and lower number of dehydration-repressible CaNAC genes identified in both root and leaf tissues of ICL482 than in those of Hashem. In addition, our comparative expression analysis of the selected CaNACs in roots and leaves of ICL482 and Hashem cultivars revealed different dehydration-responsive expression patterns, indicating that CaNAC gene expression is tissue- and genotype-specific. Furthermore, the analysis suggested that the enhanced drought tolerance of ICL482 vs. Hashem might be associated with 5 genes, namely CaNAC02, 04, 05, 16 and 24. CaNAC16 could be a potential candidate contributing to the better drought tolerance of ICL482 vs. Hashem as a positive regulator. Conversely, CaNAC02 could be a potential negative regulator, contributing to the differential drought tolerability of these two cultivars. Thus, our results have also provided a solid foundation for selection of promising tissue-specific and/or dehydration-responsive CaNAC candidates for detailed in planta functional analyses, leading to development of transgenic chickpea varieties with improved productivity

  4. Diversity of nifH gene pools in the rhizosphere of two cultivars of sorghum (Sorghum bicolor) treated with contrasting levels of nitrogen fertilizer

    NARCIS (Netherlands)

    Coelho, M.R.R.; Vos, de M.; Carneiro, N.P.; Marriel, I.E.; Paiva, E.; Seldin, L.

    2008-01-01

    The diversity of nitrogen-fixing bacteria was assessed in the rhizospheres of two cultivars of sorghum (IS 5322-C and IPA 1011) sown in Cerrado soil amended with two levels of nitrogen fertilizer (12 and 120 kg ha(-1)). The nifH gene was amplified directly from DNA extracted from the rhizospheres, a

  5. Diversity of nifH gene pools in the rhizosphere of two cultivars of sorghum (Sorghum bicolor) treated with contrasting levels of nitrogen fertilizer

    NARCIS (Netherlands)

    Coelho, M.R.R.; Vos, de M.; Carneiro, N.P.; Marriel, I.E.; Paiva, E.; Seldin, L.

    2008-01-01

    The diversity of nitrogen-fixing bacteria was assessed in the rhizospheres of two cultivars of sorghum (IS 5322-C and IPA 1011) sown in Cerrado soil amended with two levels of nitrogen fertilizer (12 and 120 kg ha(-1)). The nifH gene was amplified directly from DNA extracted from the rhizospheres,

  6. External potassium (K(+)) application improves salinity tolerance by promoting Na(+)-exclusion, K(+)-accumulation and osmotic adjustment in contrasting peanut cultivars.

    Science.gov (United States)

    Chakraborty, Koushik; Bhaduri, Debarati; Meena, Har Narayan; Kalariya, Kuldeepsingh

    2016-06-01

    Achieving salt-tolerance is highly desirable in today's agricultural context. Apart from developing salt-tolerant cultivars, possibility lies with management options, which can improve crop yield and have significant impact on crop physiology as well. Thus present study was aimed to evaluate the ameliorative role of potassium (K(+)) in salinity tolerance of peanut. A field experiment was conducted using two differentially salt-responsive cultivars and three levels of salinity treatment (control, 2.0 dS m(-1), 4.0 dS m(-1)) along with two levels (with and without) of potassium fertilizer (0 and 30 kg K2O ha(-1)). Salinity treatment incurred significant changes in overall physiology in two peanut cultivars, though the responses varied between the tolerant and the susceptible one. External K(+) application resulted in improved salinity tolerance in terms of plant water status, biomass produced under stress, osmotic adjustment and better ionic balance. Tolerant cv. GG 2 showed better salt tolerance by excluding Na(+) from uptake and lesser accumulation in leaf tissue and relied more on organic osmolyte for osmotic adjustment. On the contrary, susceptible cv. TG 37A allowed more Na(+) to accumulate in the leaf tissue and relied more on inorganic solute for osmotic adjustment under saline condition, hence showed more susceptibility to salinity stress. Application of K(+) resulted in nullifying the negative effect of salinity stress with slightly better response in the susceptible cultivar (TG 37A). The present study identified Na(+)-exclusion as a key strategy for salt-tolerance in tolerant cv. GG 2 and also showed the ameliorating role of K(+) in salt-tolerance with varying degree of response amongst tolerant and susceptible cultivars.

  7. Effects of Aqueous Stem Extract of Massularia Acuminata on Some Liver Function Indices of Male Rats

    Directory of Open Access Journals (Sweden)

    Musa Toyin Yakubu

    2012-09-01

    Full Text Available Background: Massularia acuminata has been claimed to be used in managingseveral ailments in folk medicine and in some instances substantiated withscientific data. This however has been without recourse to its safety. Therefore,aqueous stem extract of M. acuminata was evaluated for its effects on somefunction indices of the liver of male rats.Methods: Sixty, male rats were grouped into 4 (A, B, C and D such that Group A(control was orally administered 1cm3 of distilled water while those in groups B, Cand D received orally 1 cm3 of extract corresponding to 250, 500 and 1000 mg/kgbody weight respectively. Some biochemical parameters of liver function wereevaluated in the animals after 1, 7 and 21 daily doses.Results: The extract significantly decreased (P<0.05 the activity of alkalinephosphatase in the liver of rats throughout the experimental period. This decreasewas accompanied by corresponding increase in the serum enzyme. In contrast, allthe doses of the extract increased the activities of both the AST and ALT in the liverand serum aspartate aminotransferase and alanine aminotransferase as well asthe concentrations of serum total bilirubin, protein and albumin.Conclusion: This study has revealed that the aqueous stem extract of Massulariaacuminata at the doses of 250-1000 mg/kg body weight hampered the normalfunctioning of the liver of male rats and is therefore not safe for oral consumption atthe doses investigated.

  8. BARLEY CULTIVARS

    African Journals Online (AJOL)

    1993-06-13

    Jun 13, 1993 ... models were each based on several parametric statistics: 1. Thevarianceofacultivaracrossenvironments. This approach uses the variance of a cultivar ... The predicted yield values areadjusted ... Subsistence farmers risks.

  9. Development of expressed sequence tag and expressed sequence tag–simple sequence repeat marker resources for Musa acuminata

    Science.gov (United States)

    Passos, Marco A. N.; de Oliveira Cruz, Viviane; Emediato, Flavia L.; de Camargo Teixeira, Cristiane; Souza, Manoel T.; Matsumoto, Takashi; Rennó Azevedo, Vânia C.; Ferreira, Claudia F.; Amorim, Edson P.; de Alencar Figueiredo, Lucio Flavio; Martins, Natalia F.; de Jesus Barbosa Cavalcante, Maria; Baurens, Franc-Christophe; da Silva, Orzenil Bonfim; Pappas, Georgios J.; Pignolet, Luc; Abadie, Catherine; Ciampi, Ana Y.; Piffanelli, Pietro; Miller, Robert N. G.

    2012-01-01

    Background and aims Banana (Musa acuminata) is a crop contributing to global food security. Many varieties lack resistance to biotic stresses, due to sterility and narrow genetic background. The objective of this study was to develop an expressed sequence tag (EST) database of transcripts expressed during compatible and incompatible banana–Mycosphaerella fijiensis (Mf) interactions. Black leaf streak disease (BLSD), caused by Mf, is a destructive disease of banana. Microsatellite markers were developed as a resource for crop improvement. Methodology cDNA libraries were constructed from in vitro-infected leaves from BLSD-resistant M. acuminata ssp. burmaniccoides Calcutta 4 (MAC4) and susceptible M. acuminata cv. Cavendish Grande Naine (MACV). Clones were 5′-end Sanger sequenced, ESTs assembled with TGICL and unigenes annotated using BLAST, Blast2GO and InterProScan. Mreps was used to screen for simple sequence repeats (SSRs), with markers evaluated for polymorphism using 20 diploid (AA) M. acuminata accessions contrasting in resistance to Mycosphaerella leaf spot diseases. Principal results A total of 9333 high-quality ESTs were obtained for MAC4 and 3964 for MACV, which assembled into 3995 unigenes. Of these, 2592 displayed homology to genes encoding proteins with known or putative function, and 266 to genes encoding proteins with unknown function. Gene ontology (GO) classification identified 543 GO terms, 2300 unigenes were assigned to EuKaryotic orthologous group categories and 312 mapped to Kyoto Encyclopedia of Genes and Genomes pathways. A total of 624 SSR loci were identified, with trinucleotide repeat motifs the most abundant in MAC4 (54.1 %) and MACV (57.6 %). Polymorphism across M. acuminata accessions was observed with 75 markers. Alleles per polymorphic locus ranged from 2 to 8, totalling 289. The polymorphism information content ranged from 0.08 to 0.81. Conclusions This EST collection offers a resource for studying functional genes, including

  10. Rendimento de grãos e margem bruta de cultivares de milho com variabilidade genética contrastante em diferentes sistemas de manejo Grain yield and gross income of maize cultivars with contrasting genetic variability at different management systems

    Directory of Open Access Journals (Sweden)

    Luís Sangoi

    2006-06-01

    investir em práticas culturais que otimizem a performance agronômica e o potencial produtivo da cultivar.The optimization of maize production systems in southern Brazil depends on the adequate combination between genotype traits and the type of management system. This work was carried out aiming at evaluating the grain yield and gross income of maize cultivars with contrasting genetic variability at different management levels. The experiment was conducted in Lages, SC, using randomized block design with split-plots. Four production systems, equivalent to low (S1, medium (S2, high (S3 and very high (S4 management levels were tested in the main plots. The single-cross hybrid Pioneer 32R21, the double cross hybrid Traktor, and the open-pollinated variety BRS Planalto were assessed in the split-plots. The management systems differed in relation to the quantity and timing of fertilizer application, plant density, row spacing, and water irrigation. The trials were sown in 11/20/2002 and 10/22/2003, under the no-till soil tillage system. Regardless cultivar, maize grain yield and gross income increased with the enhancement in management level, ranging from 1,781 (S1 to 13,848 (S4kg ha-1 and from 206,00 (S1 to 2,937,00 (S4R$ ha-1, depending on the cultivar and growing season. The larger genetic variability of the cultivar BRS Planalto did not improve its grain yield when compared to the hybrids in S1. The hybrids were more productive and profitable than the open pollinated variety in S2. The use of a single-cross hybrid promoted the greatest grain yield and gross income in S3 and S4, showing that it is possible to match maximum technical and economic efficiency with a high yield plateau, as long as there is financial condition to invest in cultural practices that optimize maize agronomic performance and genetic potential to explore them.

  11. Unraveling Key Metabolomic Alterations in Wheat Embryos Derived from Freshly Harvested and Water-Imbibed Seeds of Two Wheat Cultivars with Contrasting Dormancy Status

    Directory of Open Access Journals (Sweden)

    Aayudh Das

    2017-07-01

    Full Text Available Untimely rains in wheat fields during harvest season can cause pre-harvest sprouting (PHS, which deteriorates the yield and quality of wheat crop. Metabolic homeostasis of the embryo plays a role in seed dormancy, determining the status of the maturing grains either as dormant (PHS-tolerant or non-dormant (PHS-susceptible. Very little is known for direct measurements of global metabolites in embryonic tissues of dormant and non-dormant wheat seeds. In this study, physiologically matured and freshly harvested wheat seeds of PHS-tolerant (cv. Sukang, dormant and PHS-susceptible (cv. Baegjoong, non-dormant cultivars were water-imbibed, and the isolated embryos were subjected to high-throughput, global non-targeted metabolomic profiling. A careful comparison of identified metabolites between Sukang and Baegjoong embryos at 0 and 48 h after imbibition revealed that several key metabolic pathways [such as: lipids, fatty acids, oxalate, hormones, the raffinose family of oligosaccharides (RFOs, and amino acids] and phytochemicals were differentially regulated between dormant and non-dormant varieties. Most of the membrane lipids were highly reduced in Baegjoong compared to Sukang, which indicates that the cell membrane instability in response to imbibition could also be a key factor in non-dormant wheat varieties for their untimely germination. This study revealed that several key marker metabolites (e.g., RFOs: glucose, fructose, maltose, and verbascose, were highly expressed in Baegjoong after imbibition. Furthermore, the data showed that the key secondary metabolites and phytochemicals (vitexin, chrysoeriol, ferulate, salidroside and gentisic acid, with known antioxidant properties, were comparatively low at basal levels in PHS-susceptible, non-dormant cultivar, Baegjoong. In conclusion, the results of this investigation revealed that after imbibition the metabolic homeostasis of dormant wheat is significantly less affected compared to non

  12. N-partitioning, nitrate reductase and glutamine synthetase activities in two contrasting varieties of maize Partição de nitrogênio e atividade das enzimas nitrato redutase e glutamina sintetase em duas cultivares contrastantes de milho

    Directory of Open Access Journals (Sweden)

    Altair Toledo Machado

    2001-02-01

    Full Text Available In order to identify useful parameters for maize genetic breeding programs aiming at a more efficient use of N, two maize varieties of contrasting N efficiency, Sol da Manhã NF (efficient and Catetão (inefficient were compared. Experiments were carried out under field and greenhouse conditions, at low and high N levels. The parameters analysed included total and relative plant and grain N content, biomass and the activities of nitrate reductase and glutamine synthetase in different parts of the plant. It was found that the translocation efficiency of N and photoassimilates to the developing seeds and the source-sink relations were significantly different for the two varieties. N content of the whole plant and grain, cob weight and the relative ear dry weight were useful parameters for characterizing the variety Sol da Manhã NF as to its efficient use of N. Enzymes activity of glutamine synthetase (transferase reaction and nitrate reductase did not differ among the varieties.Com o objetivo de identificar parâmetros que possam ser utilizados em programas de melhoramento genético em milho para uso eficiente de N, duas cultivares de milho contrastantes quanto ao uso deste nutriente, Sol da Manhã NF (eficiente e Catetão (não-eficiente, foram avaliadas em dois experimentos conduzidos no campo e em casa de vegetação, respectivamente, sob nível baixo e alto de N. Os caracteres avaliados foram: teor e conteúdo de N em diferentes partes da planta; massa seca; peso dos grãos e de diferentes partes da planta; biomassa, e atividade das enzimas nitrato redutase e glutamina sintetase. O mecanismo de translocação de N e de fotoassimilados para os grãos e a relação fonte/dreno foram importantes para diferenciar a cultivar eficiente da não-eficiente. Conteúdo de N nos grãos e total das plantas, peso do sabugo e relação peso de espiga/matéria seca foram importantes para caracterizar a cultivar Sol da Manhã NF eficiente no uso do N. A

  13. Activation of salicylic acid metabolism and signal transduction can enhance resistance to Fusarium wilt in banana (Musa acuminata L. AAA group, cv. Cavendish).

    Science.gov (United States)

    Wang, Zhuo; Jia, Caihong; Li, Jingyang; Huang, Suzhen; Xu, Biyu; Jin, Zhiqiang

    2015-01-01

    Fusarium wilt caused by the fungus Fusarium oxysporum f. sp. cubens (Foc) is the most serious disease that attacks banana plants. Salicylic acid (SA) can play a key role in plant-microbe interactions. Our study is the first to examine the role of SA in conferring resistance to Foc TR4 in banana (Musa acuminata L. AAA group, cv. Cavendish), which is the greatest commercial importance cultivar in Musa. We used quantitative real-time reverse polymerase chain reaction (qRT-PCR) to analyze the expression profiles of 45 genes related to SA biosynthesis and downstream signaling pathways in a susceptible banana cultivar (cv. Cavendish) and a resistant banana cultivar (cv. Nongke No. 1) inoculated with Foc TR4. The expression of genes involved in SA biosynthesis and downstream signaling pathways was suppressed in a susceptible cultivar and activated in a resistant cultivar. The SA levels in each treatment arm were measured using high-performance liquid chromatography. SA levels were decreased in the susceptible cultivar and increased in the resistant cultivar. Finally, we examined the contribution of exogenous SA to Foc TR4 resistance in susceptible banana plants. The expression of genes involved in SA biosynthesis and signal transduction pathways as well as SA levels were significantly increased. The results suggest that one reason for banana susceptibility to Foc TR4 is that expression of genes involved in SA biosynthesis and SA levels are suppressed and that the induced resistance observed in banana against Foc TR4 might be a case of salicylic acid-dependent systemic acquired resistance.

  14. Micorrizas arbusculares en plantines de Alnus acuminata (Betulaceae inoculados con Glomus intraradices (Glomaceae Arbuscular mycorrhizas in Alnus acuminata (Betulaceae seedlings inoculated with Glomus intraradices (Glomaceae

    Directory of Open Access Journals (Sweden)

    Alejandra Becerra

    Full Text Available En este trabajo se cita y describe por primera vez la asociación de Alnus acuminata Kunth «aliso del cerro» con el hongo formador de micorrizas arbusculares (MA Glomus intraradices Schenk & Smith. En un bioensayo en invernadero, se inocularon plantines de A. acuminata con fragmentos radicales de Medicago sativa L. colonizados por G. intraradices . Se describe la colonización MA y el tipo anatómico Arum . Se establece la funcionalidad de la simbiosis por la presencia de arbúsculos en las células corticales de la raíz.This work described for the first time the arbuscular mycorrhiza (AM development in A. acuminata Kunth «andean alder» with G. intraradices Schenk & Smith. Seedlings of A. acuminata were inoculated with root fragments of Medicago sativa L. colonized by G. intraradices in a greenhouse. The Arum -type and AM colonization are described in A. acuminata seedlings. The presence of arbuscules in A. acuminata cortical cells define a functional symbiosis.

  15. In vitro propagation and assessment of the genetic fidelity of Musa acuminata (AAA) cv. Vaibalhla derived from immature male flowers.

    Science.gov (United States)

    Hrahsel, Lalremsiami; Basu, Adreeja; Sahoo, Lingaraj; Thangjam, Robert

    2014-02-01

    An efficient in vitro propagation method has been developed for the first time for Musa acuminata (AAA) cv. Vaibalhla, an economically important banana cultivar of Mizoram, India. Immature male flowers were used as explants. Murashige and Skoog's (MS) medium supplemented with plant growth regulators (PGRs) were used for the regeneration process. Out of different PGR combinations, MS medium supplemented with 2 mg L(-1) 6-benzylaminopurine (BAP) + 0.5 mg L(-1) α-naphthalene acetic acid (NAA) was optimal for production of white bud-like structures (WBLS). On this medium, explants produced the highest number of buds per explant (4.30). The highest percentage (77.77) and number (3.51) of shoot formation from each explants was observed in MS medium supplemented with 2 mg L(-1) kinetin + 0.5 mg L(-1) NAA. While MS medium supplemented with a combination of 2 mg L(-1) BAP + 0.5 mg L(-1) NAA showed the maximum shoot length (14.44 cm). Rooting efficiency of the shoots was highest in the MS basal medium without any PGRs. The plantlets were hardened successfully in the greenhouse with 96% survival rate. Random amplified polymorphic DNA (RAPD) and inter-simple sequence repeat (ISSR) markers were employed to assess the genetic stability of in vitro regenerated plantlets of M. acuminata (AAA) cv. Vaibalhla. Eight RAPD and 8 ISSR primers were successfully used for the analysis from the 40 RAPD and 30 ISSR primers screened initially. The amplified products were monomorphic across all the regenerated plants and were similar to the mother plant. The present standardised protocol will find application in mass production, conservation and genetic transformation studies of this commercially important banana.

  16. Giant condylomata acuminata of Buschke-Lowenstein: a case report

    Directory of Open Access Journals (Sweden)

    Maria Silian Mandu Fonseca

    2016-11-01

    Full Text Available The giant condylomata acuminata of Buschke-Lowenstein is a sexually transmitted disease caused by the human papillomavirus, clinically characterized by genital warts, with high potential to develop into squamous cell carcinoma. This article seeks to report the case of a male patient, HIV-negative, who had bleeding, purulent discharge and injury with vegetative aspect in the perianal region. Biopsy of the lesion showed condyloma of Buschke-Lowenstein, and, after six months, surgery with wide excision of the lesion and rectum amputation was performed. The anatomopathological examination of the surgical specimen showed squamous cells carcinoma.

  17. Número de cromosomas de Alnus acuminata H.B. K. Chromosomes number of specie Alnus acuminata H.B.K.

    Directory of Open Access Journals (Sweden)

    Coba de Gutierrez Bertha

    1989-12-01

    Full Text Available El árbol de Aliso, Alnus scuminsta H.B.K. es una de -las especies más recomendadas en reforestación y por su economía
    es motivo de estudio. Se comprobó que su número cromosómico es de 2n= 28.The Aliso tree, Alnus acuminata H.B.K., is one of fue species more recommended in reforestation, and studed due to its economical value. It was reconfirmed that its chromosome nlumber is 2 n= 28

  18. Role of food uptake for photosynthesis, growth and survival of the mixotrophic dinoflagellate Dinophysis acuminata

    DEFF Research Database (Denmark)

    Riisgaard, Karen; Hansen, Per Juel

    2009-01-01

    Dinophysis acuminata is a mixotrophic dinoflagellate frequently causing diarrhetic shellfish poisoning. D. acuminata was isolated from Danish coastal waters and cultivated using the mixotrophic ciliate Mesodinium rubrum as prey. The roles of food uptake and photosynthesis for the growth......) and subsequently allowed to deplete the prey. When the ciliate prey was added, the photosynthetic rate of D. acuminata increased from about 7 to 38 pg C cell-1 h-1 within the first 2 d. When subsequently subjected to starvation, the photosynthetic activity rapidly decreased to a pre-feeding level, and, without...... a minimum food uptake, D. acuminata was not able to maintain photosynthetic growth. At high prey concentrations, 70 to 90% of the gross C uptake can be explained by food uptake. However, at low prey concentrations, only 0 to 55% of the gross C uptake is likely to be derived from food uptake. The data...

  19. Characterization of 10 microsatellite markers for the understorey Amazonian herb Heliconia acuminata.

    Science.gov (United States)

    Côrtes, M C; Gowda, V; Kress, W J; Bruna, E M; Uriarte, M

    2009-07-01

    We characterized 10 microsatellite loci for the plant Heliconia acuminata from the Biological Dynamics of Forest Fragments Project (Manaus, Brazil). Markers were screened in 61 individuals from one population and were found to be polymorphic with an average of eight alleles per locus. We found moderate to high levels of polymorphic information content, and observed and expected heterozygosities. All 10 markers are suitable for spatial genetic structure and parentage analyses and will be used for understanding H. acuminata dynamics across a fragmented landscape.

  20. Nitrogenous nutrients promote the growth and toxicity of Dinophysis acuminata during estuarine bloom events.

    Science.gov (United States)

    Hattenrath-Lehmann, Theresa K; Marcoval, Maria A; Mittlesdorf, Heidi; Goleski, Jennifer A; Wang, Zhihong; Haynes, Bennie; Morton, Steve L; Gobler, Christopher J

    2015-01-01

    Diarrhetic Shellfish Poisoning (DSP) is a globally significant human health syndrome most commonly caused by dinoflagellates within the genus Dinophysis. While blooms of harmful algae have frequently been linked to excessive nutrient loading, Dinophysis is a mixotrophic alga whose growth is typically associated with prey availability. Consequently, field studies of Dinophysis and nutrients have been rare. Here, the temporal dynamics of Dinophysis acuminata blooms, DSP toxins, and nutrients (nitrate, ammonium, phosphate, silicate, organic compounds) were examined over four years within two New York estuaries (Meetinghouse Creek and Northport Bay). Further, changes in the abundance and toxicity of D. acuminata were assessed during a series of nutrient amendment experiments performed over a three year period. During the study, Dinophysis acuminata blooms exceeding one million cells L-1 were observed in both estuaries. Highly significant (pnutrients significantly enhanced D. acuminata densities in nearly all (13 of 14) experiments performed. Ammonium significantly increased cell densities in 10 of 11 experiments, while glutamine significantly enhanced cellular DSP content in 4 of 5 experiments examining this compound. Nutrients may have directly or indirectly enhanced D. acuminata abundances as densities of this mixotroph during experiments were significantly correlated with multiple members of the planktonic community (phytoflagellates and Mesodinium). Collectively, this study demonstrates that nutrient loading and more specifically N-loading promotes the growth and toxicity of D. acuminata populations in coastal zones.

  1. Structural and Function Prediction of Musa acuminata subsp. Malaccensis Protein

    Directory of Open Access Journals (Sweden)

    Anum Munir

    2016-03-01

    Full Text Available Hypothetical proteins (HPs are the proteins whose presence has been anticipated, yet in vivo function has not been built up. Illustrating the structural and functional privileged insights of these HPs might likewise prompt a superior comprehension of the protein-protein associations or networks in diverse types of life. Bananas (Musa acuminata spp., including sweet and cooking types, are giant perennial monocotyledonous herbs of the order Zingiberales, a sister grouped to the all-around considered Poales, which incorporate oats. Bananas are crucial for nourishment security in numerous tropical and subtropical nations and the most prominent organic product in industrialized nations. In the present study, the hypothetical protein of M. acuminata (Banana was chosen for analysis and modeling by distinctive bioinformatics apparatuses and databases. As indicated by primary and secondary structure analysis, XP_009393594.1 is a stable hydrophobic protein containing a noteworthy extent of α-helices; Homology modeling was done utilizing SWISS-MODEL server where the templates identity with XP_009393594.1 protein was less which demonstrated novelty of our protein. Ab initio strategy was conducted to produce its 3D structure. A few evaluations of quality assessment and validation parameters determined the generated protein model as stable with genuinely great quality. Functional analysis was completed by ProtFun 2.2, and KEGG (KAAS, recommended that the hypothetical protein is a transcription factor with cytoplasmic domain as zinc finger. The protein was observed to be vital for translation process, involved in metabolism, signaling and cellular processes, genetic information processing and Zinc ion binding. It is suggested that further test approval would help to anticipate the structures and functions of other uncharacterized proteins of different plants and living being.

  2. Nitrogenous nutrients promote the growth and toxicity of Dinophysis acuminata during estuarine bloom events.

    Directory of Open Access Journals (Sweden)

    Theresa K Hattenrath-Lehmann

    Full Text Available Diarrhetic Shellfish Poisoning (DSP is a globally significant human health syndrome most commonly caused by dinoflagellates within the genus Dinophysis. While blooms of harmful algae have frequently been linked to excessive nutrient loading, Dinophysis is a mixotrophic alga whose growth is typically associated with prey availability. Consequently, field studies of Dinophysis and nutrients have been rare. Here, the temporal dynamics of Dinophysis acuminata blooms, DSP toxins, and nutrients (nitrate, ammonium, phosphate, silicate, organic compounds were examined over four years within two New York estuaries (Meetinghouse Creek and Northport Bay. Further, changes in the abundance and toxicity of D. acuminata were assessed during a series of nutrient amendment experiments performed over a three year period. During the study, Dinophysis acuminata blooms exceeding one million cells L-1 were observed in both estuaries. Highly significant (p<0.001 forward stepwise multivariate regression models of ecosystem observations demonstrated that D. acuminata abundances were positively dependent on multiple environmental parameters including ammonium (p = 0.007 while cellular toxin content was positively dependent on ammonium (p = 0.002 but negatively dependent on nitrate (p<0.001. Nitrogen- (N and phosphorus- (P containing inorganic and organic nutrients significantly enhanced D. acuminata densities in nearly all (13 of 14 experiments performed. Ammonium significantly increased cell densities in 10 of 11 experiments, while glutamine significantly enhanced cellular DSP content in 4 of 5 experiments examining this compound. Nutrients may have directly or indirectly enhanced D. acuminata abundances as densities of this mixotroph during experiments were significantly correlated with multiple members of the planktonic community (phytoflagellates and Mesodinium. Collectively, this study demonstrates that nutrient loading and more specifically N-loading promotes the

  3. Parâmetros cinéticos e morfológicos da absorção de nutrientes em cultivares de milho com variabilidade genética contrastante Nutrient uptake kinetics and morphological traits of roots of maize cultivars with contrasting genetic variability

    Directory of Open Access Journals (Sweden)

    Delson Horn

    2006-02-01

    Full Text Available Genótipos de milho com variabilidade genética contrastante apresentam potenciais produtivos diferentes. Isso pode ser causado, pelo menos em parte, por diferenças morfológicas no sistema radicular e nos parâmetros cinéticos de absorção de nutrientes. Este trabalho objetivou quantificar esses parâmetros em três cultivares de milho. Foram comparados um híbrido simples (HS, um híbrido duplo (HD e uma variedade de polinização aberta (VPA. Determinaram-se os parâmetros de absorção (influxo máximo, Imax, constante de Michalies-Menten, Km, e concentração na solução onde a absorção cessa, Cmin para N, P, K, Ca e Mg, além de atributos morfológicos radiculares, em experimentos efetuados em câmara de crescimento, com solução nutritiva. A morfologia das raízes variou pouco entre os genótipos, provavelmente por causa do cultivo das plantas em meio líquido. As diferenças entre genótipos quanto aos parâmetros cinéticos de absorção dependeram do nutriente. O Imax diferiu entre os cultivares para P; o Km, para N e P, e o Cmin, para N e K. A VPA, por apresentar maior variabilidade genética, deveria apresentar menores valores para Km e Cmin do que os híbridos. Contudo, isso só aconteceu para P em relação ao Km. O HS, por apresentar maior potencial produtivo, deveria expressar os maiores valores para Imax, mas isso não ocorreu com nenhum dos macronutrientes avaliados. Portanto, a absorção de nutrientes não parece ser um fator determinante nas diferenças de rendimento de grãos entre genótipos de milho com bases genéticas contrastantes.Maize genotypes with contrasting genetic variability have different yield potential. This distinct yield potential may be partially caused by differences in the root system morphology or in the nutrient uptake kinetics parameters. This study aimed to assess such morphological and physiological plant attributes of three maize genotypes with different genetic bases. A single-cross hybrid

  4. A BAC end view of the Musa acuminata genome

    Directory of Open Access Journals (Sweden)

    Town Christopher D

    2007-06-01

    Full Text Available Abstract Background Musa species contain the fourth most important crop in developing countries. Here, we report the analysis of 6,252 BAC end-sequences, in order to view the sequence composition of the Musa acuminata genome in a cost effective and efficient manner. Results BAC end sequencing generated 6,252 reads representing 4,420,944 bp, including 2,979 clone pairs with an average read length after cleaning and filtering of 707 bp. All sequences have been submitted to GenBank, with the accession numbers DX451975 – DX458350. The BAC end-sequences, were searched against several databases and significant homology was found to mitochondria and chloroplast (2.6%, transposons and repetitive sequences (36% and proteins (11%. Functional interpretation of the protein matches was carried out by Gene Ontology assignments from matches to Arabidopsis and was shown to cover a broad range of categories. From protein matching regions of Musa BAC end-sequences, it was determined that the GC content of coding regions was 47%. Where protein matches encompassed a start codon, GC content as a function of position (5' to 3' across 129 bp sliding windows generates a "rice-like" gradient. A total of 352 potential SSR markers were discovered. The most abundant simple sequence repeats in four size categories were AT-rich. After filtering mitochondria and chloroplast matches, thousands of BAC end-sequences had a significant BLASTN match to the Oryza sativa and Arabidopsis genome sequence. Of these, a small number of BAC end-sequence pairs were shown to map to neighboring regions of the Oryza sativa genome representing regions of potential microsynteny. Conclusion Database searches with the BAC end-sequences and ab initio analysis identified those reads likely to contain transposons, repeat sequences, proteins and simple sequence repeats. Approximately 600 BAC end-sequences contained protein sequences that were not found in the existing available Musa expressed

  5. Anatomy and morphology character of five Indonesian banana cultivars (Musa spp. of different ploidy level

    Directory of Open Access Journals (Sweden)

    ISSIREP SUMARDI

    2010-04-01

    Full Text Available Sumardi I, Wulandari M (2011 Anatomy and morphology character of five Indonesian banana cultivars (Musa spp. of different ploidy level. Biodiversitas 12: 167-175. In Indonesia there are many cultivars of banana, and some of them produce edible fruits. Beside their morphology, the character which necessary as a tool for classification is anatomical character. The aim of this research were to describe the anatomical character and morphology of fives Indonesian banana cultivars based on their level of ploidy. The cultivars were collected from Banana Germplasm Plantation, Yogyakarta District, Indonesia. The samples of roots, rhizome, and leaf were collected from five banana cultivars i.e.: Musa acuminata cv Penjalin, M.balbisiana cv Kluthuk warangan, M.acuminata cv Ambon warangan, M.paradisiaca cv Raja nangka , and M. paradisiaca cv Kluthuk susu. For anatomy observation samples were prepared using paraffin method, stained with 1% safranin in 70% ethanol. To observe the structure of stomata and epidermis surface, slide were prepared using modification of whole mount method. Slides were observed using Olympus BHB microscope completed with Olympus camera BM-10A. Stem and leaf morphology character of diploid level (AA and BB genome is different with triploid level (AAA, AAB, and ABB genome. Anatomy and morphology character of root and rhizome of banana in diploid level (AA and BB genome and triploid level (AAA, AAB, and ABB genome is quite similar. Distribution of stomata is found in leaf and pseudostem. Stomata is found in adaxial and abaxial epidermis layer. The size of guard cells in triploid cultivars was longer than that diploid cultivars. The root composse of epidermis layer, cortex and cylinder vascular of five cultivar’s root show anomalous structure. Rhizome consist of peripheric and centre zone. Anatomically, this was no differences in the rizome structur among five banana cultivars. The row of vascular bundles act as demarcation area

  6. Modelling bloom formation of the toxic dinoflagellates Dinophysis acuminata and Dinophysis caudata in a highly modified estuary, south eastern Australia

    Science.gov (United States)

    Ajani, Penelope; Larsson, Michaela E.; Rubio, Ana; Bush, Stephen; Brett, Steve; Farrell, Hazel

    2016-12-01

    Dinoflagellates belonging to the toxigenic genus Dinophysis are increasing in abundance in the Hawkesbury River, south-eastern Australia. This study investigates a twelve year time series of abundance and physico-chemical data to model these blooms. Four species were reported over the sampling campaign - Dinophysis acuminata, Dinophysis caudata, Dinophysis fortii and Dinophysis tripos-with D. acuminata and D. caudata being most abundant. Highest abundance of D. acuminata occurred in the austral spring (max. abundance 4500 cells l-1), whilst highest D. caudata occurred in the summer to autumn (max. 12,000 cells l-1). Generalised additive models revealed abundance of D. acuminata was significantly linked to season, thermal stratification and nutrients, whilst D. caudata was associated with nutrients, salinity and dissolved oxygen. The models' predictive capability was up to 60% for D. acuminata and 53% for D. caudata. Altering sampling strategies during blooms accompanied with in situ high resolution monitoring will further improve Dinophysis bloom prediction capability.

  7. Allometric models for estimating biomass and carbon in Alnus acuminata

    Directory of Open Access Journals (Sweden)

    William Fonseca

    2013-12-01

    Full Text Available In order to quantify the climate change mitigation potential of forest plantations, information on total biomass and its growth rate is required. Depending on the method used, the study of the biomass behavior can be a complex and expensive activity. The main objective of this research was to develop allometric models to estimate biomass for different tree components (leaves, branches, stem and root and total tree biomass in Alnus acuminata (Kunth in Costa Rica. Additionally, models were developed to estimate biomass and carbon in trees per hectare and for total plant biomass per hectare (trees + herbaceous vegetation + necromass. To construct the tree models, 41 sampling plots were evaluated in seven sites from which 47 trees with a diametric from 4.5 to 44.5 cm were selected to be harvested. In the selected models for the stem, root and total tree biomass, a r 2 >93.87 % was accomplished, while the r 2aj for leaves and branches was 88 %. For the biomass and carbon models for total trees and total plant biomass per hectare the r2 was >99 %. Average biomass expansion factor was 1.22 for aboveground and 1.43 for total biomass (when the root was included. The carbon fraction in plant biomass varied between 32.9 and 46.7 % and the percentage of soil carbon was 3 %.

  8. Photodynamic therapy of condyloma acuminata in pregnant women

    Institute of Scientific and Technical Information of China (English)

    YANG Yu-guang; ZOU Xian-biao; ZHAO Hua; ZHANG Yun-jie; LI Heng-jin

    2012-01-01

    Background Photodynamic therapy (PDT) with 5-aminolevulinic acid (ALA) is an emerging technique for the treatment of genital human papillomavirus (HPV)-induced benign and premalignant lesions.We report here in a case series of condyloma acuminata (CA) in pregnancy successfully treated with ALA-PDT.Methods Five pregnant patients with CA received three to four times treatment respectively.Patients were followed up for 6-23 months after treatment.Results The clearance rate of genital warts was 100%.No recurrence was found during the follow-up period.Major adverse events reported were mild erosion,pain,and local edema.All pregnancies resulted in healthy live births without delivery complications.Conclusions PDT with topical ALA seems to be safe and effective in the treatment of CA in pregnancy.It demonstrated high clearance rate of warts,was well-tolerated by patients,and showed no adverse effects on mothers or fetuses.ALA-PDT may be an ideal strategy of treatment for pregnant women with CA.

  9. Homogenate extraction technology of camptothecine and hydroxycamptothecin from Camptotheca acuminata leaves

    Institute of Scientific and Technical Information of China (English)

    SHI Wei-guo; ZU Yuan-gang; ZHAO Chun-jian; YANG Lei

    2009-01-01

    Camptothecine (CPT) and hydroxycamptothecin (HCPT), two kinds of anti-cancer alkaloids, were extracted from Camptotheca acuminata leaves using homogenate extraction technology under different conditions such as the ratio of material to liquid, ethanol concentration, and homogenate time. The optimum technology parameters for homogenate extraction of CPT and HCPT from C. acuminata leaves were determined as homogenate time at 8 min, ethanol concentration at 55% and the ratio of material to liquid at 1:15 (g:mL). By using the optimized parameters, we obtained 0.639‰ extraction rate for CPT and 0.437‰ for HCPT. The extraction yields of CPT and HCPT extracted by homogenating technology were higher than those by other extractive methods, such as ultrasonic, reflux, shaking in water bath. It is concluded that the homogenate extraction technology was an efficient method for extracting CPT and HCPT from C. acuminata leaves, with characteristics of less extraction time and high yield.

  10. The ectomycorrhizas of Lactarius cuspidoaurantiacus and Lactarius herrerae associated with Alnus acuminata in Central Mexico.

    Science.gov (United States)

    Montoya, Leticia; Bandala, Victor M; Garay-Serrano, Edith

    2015-08-01

    Two pure Alnus acuminata stands established in a montane forest in central Mexico (Puebla State) were monitored between 2010 and 2013 to confirm and recognize the ectomycorrhizal (EcM) systems of A. acuminata with Lactarius cuspidoaurantiacus and Lactarius herrerae, two recently described species. Through comparison of internal transcribed spacer (ITS) of nuclear ribosomal DNA sequences from basidiomes and ectomycorrhizas sampled in the forest stands, we confirmed their ectomycorrhizal association. The phytobiont was corroborated by comparing ITS sequences obtained from EcM root tips and leaves collected in the study site and from other sequences of A. acuminata available in Genbank. Detailed morphological and anatomical descriptions of the ectomycorrhizal systems are presented and complemented with photographs.

  11. PINZOTE de Musa balbisiana y Musa acuminata como Fuente de Fibras para Papel RACHIS of Muse balbisiana and Muse acuminata as Source of Fibers for Paper Structure

    Directory of Open Access Journals (Sweden)

    José Turrado

    2009-01-01

    Full Text Available Este trabajo presenta una alternativa de uso industrial del pinzote (centro leñoso del racimo de banano como fuente de fibra para la estructuración de papel. El pinzote se considera residuo agroindustrial en los países productores de banano, material que representa el 2.8 % del racimo en la variedad de Musa balbisiana y el 4.4 % en la de Musa acuminata. Por sus características similares a la del bagazo caña de azúcar, se utilizó un proceso químico similar al empleado para obtener fibras a partir de este material. El proceso de obtención de fibras se llevó a cabo de acuerdo a un diseño experimental factorial, diseño que permite relacionar variables las independientes (tiempo de cocción, concentración de reactivo en cuatro niveles con variables independientes (rendimiento, consumo de reactivos, rechazo y lignina residual. El pinzote de Musa acuminata requiere menor temperatura y reactivo para liberar las fibras con respecto al pinzote de Musa balbisiana. Por lo tanto, el rendimiento en fibra para Musa acuminata es mayor al de Musa balbisiana.This work presents an alternative of industrial use of the banana rachis (the woody center of the cluster of bananas, as source of fibers for the structure of paper. Banana rachis is considered to be an agroindustrial residue in producing countries of banana it represents 2.8 % of the cluster of Muse balbisiana and 4.4 % of the cluster of Muse acuminata. The physical and chemical structure of the rachis is almost simliar to that of the sugar cane so a chemical process similar to that employed to obtain fibers from the sugar bagasse cane was used. An experimental factorial design that allows the correlation of independent variables (cooking time, reagent concentration in four levels with response parameters (yield, reagents consumption, rejects and residual lignin was adopted. The rachis of Muse acuminata needs lower temperature and less reagent consumption to liberate fibers in comparison with

  12. Determination of contents of 10-Hydroxycamptothecin in Camptotheca acuminata by high-performance liquid chromatogram

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The determination method of 10-hydroxycamptothecin in Camptotheca acuminata fruits by high-performance liquid chromatogram (HPLC) was studied. The HPLC analysis was performed on a HIQ sil C18(4.6×250 mm) column with mobile phase of acetonitrile-water (3:7, V:V), flow rate 1 mL@(min-1 and UV detective wavelength 266 nm. Extracting 10-hydroxycamptothecin by ultrasonic method from fruits of C. acuminata to prepare samples for analysis was systematically discussed. The optimal extraction condition was carried out by 60% alcohol solution at 60℃ for 50 minutes.

  13. Fluorescence of the 'fire-chaser' beetle Melanophila acuminata

    Energy Technology Data Exchange (ETDEWEB)

    Israelowitz, Meir [Biomimetics Technologies, 191 Ellis Avenue, Toronto, Ont., M6S 2X4 (Canada); Rizvi, Syed H.W. [Biomimetics Technologies, 191 Ellis Avenue, Toronto, Ont., M6S 2X4 (Canada); Schroeder, Herbert P. von [Biomimetics Technologies, 191 Ellis Avenue, Toronto, Ont., M6S 2X4 (Canada)]. E-mail: herb.vonschroeder@uhn.on.ca

    2007-09-15

    Melanophila acuminata beetles are attracted to forest fires over long distances by a pair of specialized infrared sensory organs. To date, there is no knowledge of their ability to detect or emit fluorescent radiation. We studied the Melanophila acuminata infrared sensory organs histologically and by using fluorescent microscopy, acoustic-optic tunable filter microscopy, and two-photon microscopy to identify fluorescence. We found fluorescent absorption at radiation wavelengths of 480 nm and emission at 570 nm. The functional role of this novel fluorescence is, as of yet, unknown but may be applied to species classification, identification and behavioral studies.

  14. Pyrosequencing of the Camptotheca acuminata transcriptome reveals putative genes involved in camptothecin biosynthesis and transport

    Directory of Open Access Journals (Sweden)

    Sun Yongzhen

    2011-10-01

    Full Text Available Abstract Background Camptotheca acuminata is a Nyssaceae plant, often called the "happy tree", which is indigenous in Southern China. C. acuminata produces the terpenoid indole alkaloid, camptothecin (CPT, which exhibits clinical effects in various cancer treatments. Despite its importance, little is known about the transcriptome of C. acuminata and the mechanism of CPT biosynthesis, as only few nucleotide sequences are included in the GenBank database. Results From a constructed cDNA library of young C. acuminata leaves, a total of 30,358 unigenes, with an average length of 403 bp, were obtained after assembly of 74,858 high quality reads using GS De Novo assembler software. Through functional annotation, a total of 21,213 unigenes were annotated at least once against the NCBI nucleotide (Nt, non-redundant protein (Nr, Uniprot/SwissProt, Kyoto Encyclopedia of Genes and Genomes (KEGG, and Arabidopsis thaliana proteome (TAIR databases. Further analysis identified 521 ESTs representing 20 enzyme genes that are involved in the backbone of the CPT biosynthetic pathway in the library. Three putative genes in the upstream pathway, including genes for geraniol-10-hydroxylase (CaPG10H, secologanin synthase (CaPSCS, and strictosidine synthase (CaPSTR were cloned and analyzed. The expression level of the three genes was also detected using qRT-PCR in C. acuminata. With respect to the branch pathway of CPT synthesis, six cytochrome P450s transcripts were selected as candidate transcripts by detection of transcript expression in different tissues using qRT-PCR. In addition, one glucosidase gene was identified that might participate in CPT biosynthesis. For CPT transport, three of 21 transcripts for multidrug resistance protein (MDR transporters were also screened from the dataset by their annotation result and gene expression analysis. Conclusion This study produced a large amount of transcriptome data from C. acuminata by 454 pyrosequencing. According to

  15. Altered Cultivar Resistance of Kimchi Cabbage Seedlings Mediated by Salicylic Acid, Jasmonic Acid and Ethylene

    Directory of Open Access Journals (Sweden)

    Young Hee Lee

    2014-09-01

    Full Text Available Two cultivars Buram-3-ho (susceptible and CR-Hagwang (moderate resistant of kimchi cabbage seedlings showed differential defense responses to anthracnose (Colletotrichum higginsianum, black spot (Alternaria brassicicola and black rot (Xanthomonas campestris pv. campestris, Xcc diseases in our previous study. Defense-related hormones salicylic acid (SA, jasmonic acid (JA and ethylene led to different transcriptional regulation of pathogenesis-related (PR gene expression in both cultivars. In this study, exogenous application of SA suppressed basal defenses to C. higginsianum in the 1st leaves of the susceptible cultivar and cultivar resistance of the 2nd leaves of the resistant cultivar. SA also enhanced susceptibility of the susceptible cultivar to A. brassicicola. By contrast, SA elevated disease resistance to Xcc in the resistant cultivar, but not in the susceptible cultivar. Methyl jasmonate (MJ treatment did not affect the disease resistance to C. higginsianum and Xcc in either cultivar, but it compromised the disease resistance to A. brassicicola in the resistant cultivar. Treatment with 1-aminocyclopropane-1-carboxylic acid (ACC ethylene precursor did not change resistance of the either cultivar to C. higginsianum and Xcc. Effect of ACC pretreatment on the resistance to A. brassicicola was not distinguished between susceptible and resistant cultivars, because cultivar resistance of the resistant cultivar was lost by prolonged moist dark conditions. Taken together, exogenously applied SA, JA and ethylene altered defense signaling crosstalk to three diseases of anthracnose, black spot and black rot in a cultivar-dependent manner.

  16. Progression of Intravesical Condyloma Acuminata to Locally Advanced Poorly Differentiated Squamous Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    A. Khambati

    2016-07-01

    Full Text Available Condyloma acuminata (CA is a common sexually transmitted disease caused by Human Papilloma Virus (HPV infection. CA of the bladder, however, is an exceedingly rare lesion. We present a rare case of poorly differentiated locally invasive squamous cell carcinoma (SCC arising from recurrent CA of the bladder in an immunocompetent patient and discuss pathophysiology and management of this unusual condition.

  17. Ectomycorrhizal and arbuscular mycorrhizal colonization of Alnus acuminata from Calilegua National Park (Argentina).

    Science.gov (United States)

    Becerra, Alejandra; Zak, Marcelo R; Horton, Thomas R; Micolini, Jorge

    2005-11-01

    The objective of this study was to determine patterns of ectomycorrhizas (ECM) and arbuscular mycorrhizas (AM) colonization associated with Alnus acuminata (Andean alder), in relation to soil parameters (electrical conductivity, field H(2)O holding capacity, pH, available P, organic matter, and total N) at two different seasons (autumn and spring). The study was conducted in natural forests of A. acuminata situated in Calilegua National Park (Jujuy, Argentina). Nine ECM morphotypes were found on A. acuminata roots. The ECM colonization was affected by seasonality and associated positively with field H(2)O holding capacity, pH, and total N and negatively associated with organic matter. Two morphotypes (Russula alnijorullensis and Tomentella sp. 3) showed significant differences between seasons. Positive and negative correlations were found between five morphotypes (Alnirhiza silkacea, Lactarius omphaliformis, Tomentella sp. 1, Tomentella sp. 3, and Lactarius sp.) and soil parameters (total N, pH, and P). A significant negative correlation was found between field H(2)O holding capacity and organic matter with AM colonization. Results of this study provide evidence that ECM and AM colonization of A. acuminata can be affected by some soil chemical edaphic parameters and indicate that some ECM morphotypes are sensitive to changes in seasonality and soil parameters.

  18. DIFFERENTIATION OF PSEUDOCONDYLOMA OF VULVA AND CONDYLOMA ACUMINATA BY DOT BLOT HYBRIDIZATION AND POLYMERASE CHAIN REACTION

    Institute of Scientific and Technical Information of China (English)

    刘跃华; 王家璧; 司静懿

    1996-01-01

    This study differentiated pseudocondyloma of vulva from condyloma acunainata using dot blot hybridization and polymerase chain reaction (PCR). A total of 27 cases o{ pseudocondyloma of vulva and 65 cases of condyloma acuminata were selected for the sttldy. The genital lesions were examined clinically and were biopsled. Each biopsy v-as subjected to histological examination and HPV DNA analysis by dot blot hybridization and PCR. Dot blot analysis detected HPV DNA in 19(82.6%) out of 23 cases of condyloma acuminata and 2(25%) out of 8 cases pseudocondyloma of vulvae(P<0. 05). PCR detected HPV DNA in 51(92.7%) our of 55 cases of eondyloma acuminata, compared with none in 23 cases of pseudocondylorna(P<0. 001). HPV DNA was present in the majority of condyloma acuminata specimens, HPV 6 and 11 were the predominant types. Peudocondyloma is probably not associated with HPV. PCR was the most sensitive and useful techntque for HPV DNA detection.

  19. Effect of planting density on plant growth and camptothecin content of Camptotheca acuminata seedlings

    Institute of Scientific and Technical Information of China (English)

    WEIHuan-yong; WANGYang; WANGZhen-yue; YANXiu-feng

    2005-01-01

    C. acuminata seedlings cultivated in greenhouse were transplanted into the fields with 5 designed planting densities (11, 16, 25,44 and 100 plants·m-2) in May of 2004 and were harvested in the middle of September of 2004. The seedling growth indexes including plant height and crown width, biomass allocation, camptothecin (CPT) content and CPT yield of different organs (young leaf, old leaf, stem,and root) were studied. For the 5 selected planting densities, the plant biomass, height, crown width, and total leaf area of C. acuminata seedlings all showed highest values at the planting density of 25 plants ·m-2. CPT content in young leaves was higher than that in other organs of seedlings and presented an obvious change with the variation of planting densities and with the highest value at density of 100plants·m-2, while for other organs no significant variation in CPT content was found with change of planting density. The accumulation of CPT was enhanced significantly at the planting density of 25 plants·m-2. It is concluded that for the purpose to get raw materials with more CPT from C. acuminata, the optimal planting density of C. acuminata seedlings should be designed as 25 plants·m-2.

  20. Diploid Musa acuminata genetic diversity assayed with sequence-tagged microsatellite sites.

    Science.gov (United States)

    Grapin, A; Noyer, J L; Carreel, F; Dambier, D; Baurens, F C; Lanaud, C; Lagoda, P J

    1998-06-01

    The sequence-tagged microsatellite site (STMS) discrimination potential was explored using nine microsatellite primer pairs. STMS polymorphism was assayed by nonradioactive urea-polyacrylamide gel electrophoresis. Genetic relationships were examined among 59 genotypes of wild or cultivated accessions of diploid Musa acuminata. The organization of the subspecies was confirmed and some clone relationships were clarified.

  1. Effect of surface coating on ripening and early peel spotting in 'Sucrier' banana (Musa acuminata)

    NARCIS (Netherlands)

    Promyou, S.; Ketsa, S.; Doorn, van W.G.

    2007-01-01

    Sucrier¿ bananas (Musa acuminata, AA Group) show peel spotting when the peel is just about as yellow as green, which coincides with optimum eating quality. As consumers might relate the spotting to overripe fruit, early spotting is considered undesirable, especially for export markets. Fruit were le

  2. Musculature of Notholca acuminata (Rotifera : Ploima : Brachionidae) revealed by confocal scanning laser microscopy

    DEFF Research Database (Denmark)

    Sørensen, M.V.; Funch, P.; Hooge, M.

    2003-01-01

    The body-wall and visceral musculature of Notholca acuminata was visualized using phalloidin-linked fluorescent dye under confocal laser scanning microscopy. The body-wall musculature includes dorsal, lateral, and ventral pairs of longitudinally oriented body retractor muscles, two pairs of head...

  3. Musculature of Notholca acuminata (Rotifera: Ploima: Brachionidae) revealed by confocal scanning laser microscopy

    DEFF Research Database (Denmark)

    Sørensen, M.V.; Funch, P.; Hooge, M.

    2003-01-01

    he body-wall and visceral musculature of Notholca acuminata was visualized using phalloidin-linked fluorescent dye under confocal laser scanning microscopy. The body-wall musculature includes dorsal, lateral, and ventral pairs of longitudinally oriented body retractor muscles, two pairs of head...

  4. Potential roles of fish, birds, and water in swamp privet (Forestiera acuminata) seed dispersal

    Science.gov (United States)

    Susan B. Adams; Paul B. Hamel; Kristina Connor; Bryce Burke; Emile S. Gardiner; David Wise

    2007-01-01

    Forestiera acuminata (swamp privet) is a common wetland shrub/small tree native to the southeastern United States. We examined several possible dispersal avenues for the plant. We tested germination of seeds exposed to various treatments, including passage through Ictalurus punctatus (Channel Catfi sh) guts, and conducted other...

  5. Synergistic effect of Croton caudatus (fruits) and Tiliacora acuminata (flowers) extracts against filarial vector Culex quinquefasciatus

    Institute of Scientific and Technical Information of China (English)

    Someshwar Singha; Siddharthasankar Banerjee; Goutam Chandra

    2011-01-01

    Objective:To investigate the synergistic effect of crude and solvent extract of Croton caudatus (C. caudatus ) (fruits) and Tiliacora acuminata (T. acuminata) (flowers) against the larval form of Culex quinquefasciatus (Cx. quinquefasciatus). Methods: Crude and solvent [chloroform:methanol (1:1 v/v), benzene and ethyl acetate] extracts of two plants, C. caudatus (fruits) and T. acuminata (flowers) were examined separately against filarial vector Cx. quinquefasciatus larvae with gradually increasing concentration i.e. from 0.1%to 0.5%of crude extract and 25 ppm to 75 ppm of solvent extracts. To observe the synergistic effect, if any, extracts of these two plant parts were mixed at different concentrations and treated against mosquito larvae. Phytochemical analyses of extracts of both the plant parts were carried out. Results: In a 72-h bioassay experiment with plant extracts, highest mortalities were recorded at 0.5% (crude) and 75 ppm (solvent) concentration for fruits of C. caudatus and flowers of T. acuminata individually. For synergistic effect, only 0.2%of the mixture of these two crude extracts and 75 ppm concentration of chloroform:methanol (1:1 v/v) and ethyl acetate extracts showed 100%mortality after 24 h and 48 h of exposure respectively. Conclusions:In the field of mosquito control, insecticides of plant origin may serve as suitable alternative to the toxic chemicals. Some secondary metabolites in combination may be responsible for better larvicidal activity.

  6. Anticholinesterase and Antioxidative Properties of Aqueous Extract of Cola acuminata Seed In Vitro

    Directory of Open Access Journals (Sweden)

    Ganiyu Oboh

    2014-01-01

    Full Text Available Background. Cola acuminata seed, a commonly used stimulant in Nigeria, has been reportedly used for the management of neurodegenerative diseases in folklore without scientific basis. This study sought to investigate the anticholinesterase and antioxidant properties of aqueous extracts from C. acuminata seed in vitro. Methodology. The aqueous extract of C. acuminata seed was prepared (w/v and its effect on acetylcholinesterase (AChE and butyrylcholinesterase activities, as well as some prooxidant (FeSO4, sodium nitroprusside (SNP, and quinolinic acid (QA induced lipid peroxidation in rat brain in vitro, was investigated. Results. The results revealed that C. acuminata seed extract inhibited AChE (IC50 = 14.6 μg/mL and BChE (IC50 = 96.2 μg/mL activities in a dose-dependent manner. Furthermore, incubation of rat’s brain homogenates with some prooxidants caused a significant increase P<0.05 in the brain malondialdehyde (MDA content and inhibited MDA production dose-dependently and also exhibited further antioxidant properties as typified by their high radicals scavenging and Fe2+ chelating abilities. Conclusion. Inhibition of AChE and BChE activities has been the primary treatment method for mild Alzheimer’s disease (AD. Therefore, one possible mechanism through which the seed exerts its neuroprotective properties is by inhibiting cholinesterase activities as well as preventing oxidative-stress-induced neurodegeneration. However, this is a preliminary study with possible physiological implications.

  7. Structures of Chlorophyll Catabolites in Bananas (Musa acuminata) Reveal a Split Path of Chlorophyll Breakdown in a Ripening Fruit

    Science.gov (United States)

    Moser, Simone; Müller, Thomas; Holzinger, Andreas; Lütz, Cornelius; Kräutler, Bernhard

    2012-01-01

    Abstract The disappearance of chlorophyll is a visual sign of fruit ripening. Yet, chlorophyll breakdown in fruit has hardly been explored; its non-green degradation products are largely unknown. Here we report the analysis and structure elucidation of colorless tetrapyrrolic chlorophyll breakdown products in commercially available, ripening bananas (Musa acuminata, Cavendish cultivar). In banana peels, chlorophyll catabolites were found in an unprecedented structural richness: a variety of new fluorescent chlorophyll catabolites (FCCs) and nonfluorescent chlorophyll catabolites (NCCs) were detected. As a rule, FCCs exist only "fleetingly" and are hard to observe. However, in bananas several of the FCCs (named Mc-FCCs) were persistent and carried an ester function at the propionate side-chain. NCCs were less abundant, and exhibited a free propionic acid group, but functional modifications elsewhere. The modifications of NCCs in banana peels were similar to those found in NCCs from senescent leaves. They are presumed to be introduced by enzymatic transformations at the stage of the mostly unobserved, direct FCC-precursors. The observed divergent functional group characteristics of the Mc-FCCs versus those of the Mc-NCCs indicated two major "late" processing lines of chlorophyll breakdown in ripening bananas. The "last common precursor" at the branching point to either the persistent FCCs, or towards the NCCs, was identified as a temporarily abundant "secondary" FCC. The existence of two "downstream" branches of chlorophyll breakdown in banana peels, and the striking accumulation of persistent Mc-FCCs call for attention as to the still-elusive biological roles of the resulting colorless linear tetrapyrroles. PMID:22807397

  8. Structures of chlorophyll catabolites in bananas (Musa acuminata) reveal a split path of chlorophyll breakdown in a ripening fruit.

    Science.gov (United States)

    Moser, Simone; Müller, Thomas; Holzinger, Andreas; Lütz, Cornelius; Kräutler, Bernhard

    2012-08-27

    The disappearance of chlorophyll is a visual sign of fruit ripening. Yet, chlorophyll breakdown in fruit has hardly been explored; its non-green degradation products are largely unknown. Here we report the analysis and structure elucidation of colorless tetrapyrrolic chlorophyll breakdown products in commercially available, ripening bananas (Musa acuminata, Cavendish cultivar). In banana peels, chlorophyll catabolites were found in an unprecedented structural richness: a variety of new fluorescent chlorophyll catabolites (FCCs) and nonfluorescent chlorophyll catabolites (NCCs) were detected. As a rule, FCCs exist only "fleetingly" and are hard to observe. However, in bananas several of the FCCs (named Mc-FCCs) were persistent and carried an ester function at the propionate side-chain. NCCs were less abundant, and exhibited a free propionic acid group, but functional modifications elsewhere. The modifications of NCCs in banana peels were similar to those found in NCCs from senescent leaves. They are presumed to be introduced by enzymatic transformations at the stage of the mostly unobserved, direct FCC-precursors. The observed divergent functional group characteristics of the Mc-FCCs versus those of the Mc-NCCs indicated two major "late" processing lines of chlorophyll breakdown in ripening bananas. The "last common precursor" at the branching point to either the persistent FCCs, or towards the NCCs, was identified as a temporarily abundant "secondary" FCC. The existence of two "downstream" branches of chlorophyll breakdown in banana peels, and the striking accumulation of persistent Mc-FCCs call for attention as to the still-elusive biological roles of the resulting colorless linear tetrapyrroles.

  9. CULTIVAR RELEASE - BRS Saturno – triticale cultivar

    Directory of Open Access Journals (Sweden)

    Alfredo do Nascimento Junior

    2011-01-01

    Full Text Available The triticale cultivar BRS Saturno was developed by Embrapa (Brazilian Agricultural Research Corporation inpartnership with the Fundação Pró-Sementes de Apoio à Pesquisa. It is the result of a cross between the genotypes PFT 512 and CEP28 – Guará, adapted to the environmental conditions of cultivation in southern Brazil.

  10. Oral isotretinoin in the treatment of recalcitrant condylomata acuminata of the cervix: a randomised placebo controlled trial

    National Research Council Canada - National Science Library

    Georgala, S; Katoulis, A C; Georgala, C; Bozi, E; Mortakis, A

    2004-01-01

    .... The use of a systemic agent may more effectively control the virus. To investigate the efficacy and safety of low dose oral isotretinoin in recalcitrant condylomata acuminata (RCA) of the cervix...

  11. Occurrence of white rust (Albugo ipomoeae-panduratae on Ipomoea acuminata in the brazilian mid-west

    Directory of Open Access Journals (Sweden)

    A.P.S Pagani

    2012-03-01

    Full Text Available Spontaneous plants of Ipomoea acuminata ("morning glory" exhibiting white rust pustules were found in a field crop area of Planaltina, DF, in the fall season of 2010 and the disease causal agent was identified as Albugo ipomoea-panduratae (Oomycota. No reports of the association between A. ipomoea-panduratae and I. acuminata were known in Brazil previously to 2010. A reference specimen was deposited at the University of Brasilia Mycological Reference Collection.

  12. Spatial and temporal effects on seed dispersal and seed predation of Musa acuminata in southern Yunnan, China.

    Science.gov (United States)

    Meng, Lingzeng; Gao, Xiuxia; Chen, Jin; Martin, Konrad

    2012-03-01

    Wild bananas are abundant in tropical areas and many ecologists have observed that the succession process is quicker following increased disturbance. This study was conducted to analyze animal-seed interactions and their effects on the seed fate of a wild banana species (Musa acuminata) in tropical southern Yunnan (China) through experiments considering spatial (site and habitat) and temporal (seasons) variation. The largest proportion of fruits (81%) was removed by frugivorous seed dispersers, especially by bats at nighttime. Only 13% of the fruits were removed by climbing seed predators (different species of rats). In the exclosure treatment, rodents accounted for a significantly higher total artificially exposed seed removal number than ants, but with spatial and temporal differences. The highest seed predation rate by rodents (70%) was found in forest with wild banana stands, corresponding with the highest rodent diversity (species numbers and abundance) among the habitat types. In contrast, the seed removal number by ants (57%) was highest in the open land habitats, but there was no close correlation with ant diversity. Seed removal numbers by ants were significantly higher in the dry compared to the rainy season, but rodent activity showed no differences between seasons. The overall results suggest that the largest proportion of seeds produced by wild banana are primarily dispersed by bats. Primary seed dispersal by bats at nighttime is essential for wild banana seeds to escape seed predation. © 2012 ISZS, Blackwell Publishing and IOZ/CAS.

  13. Behavioural responses of the snail Lymnaea acuminata to carbohydrates in snail-attractant pellets

    Science.gov (United States)

    Tiwari, Farindra; Singh, D. K.

    Snail control is one of the most important tools in the campaign to reduce the incidence of fascioliasis. In order to attain this objective, the method of bait formulation in order to contain an attractant and a molluscicide is an expedient approach to lure the target snail population to the molluscicide. This study identifies certain carbohydrates, namely sucrose, maltose, glucose, fructose and starch, for preparing such baits. These were tested on Lymnaea acuminata, an intermediate host of the digenean trematodes Fasciola hepatica and Fasciola gigantica. The behavioural responses of snails to these carbohydrates were examined. Significant variations in behavioural responses were observed in the snail even when the five carbohydrates were used in low concentrations in snail-attractant pellets. Starch emerged as the strongest attractant for Lymnaea acuminata, followed by maltose.

  14. The toxic dinoflagellate Dinophysis acuminata harbors permanent chloroplasts of cryptomomad prigin, not kleptochloroplasts

    DEFF Research Database (Denmark)

    Garcia, Lydia; Moestrup, Øjvind; Hansen, Per Juel

    2010-01-01

    Most species belonging to the toxigenic genus Dinophysis have chloroplasts of cryptophyte origin. Whether these chloroplasts are temporarily sequestered from the prey, or permanently established under the control of the dinoflagellate is currently disputed. To investigate this, a culture...... of Dinophysis acuminata was established by feeding it the phototrophic ciliate Mesodinium rubrum (= Myrionecta rubra), which again was fed the cryptophyte Teleaulax amphioxeia. Molecular analysis comprising the nucleomorph LSU and two chloroplast markers (tufA gene and a fragment from the end of 16S r...... the chloroplast as well as the position and the arrangement of the pyrenoids were strikingly different. Considering both molecular and ultrastructural evidence, our data indicated that the chloroplasts in D. acuminata are permanent chloroplasts originating within Teleaulax or another closely related cryptophyte...

  15. Two new species of Lactarius associated with Alnus acuminata subsp. arguta in Mexico.

    Science.gov (United States)

    Montoya, Leticia; Bandala, Victor M; Garay, Edith

    2014-01-01

    In pure stands of Alnus acuminata subsp. arguta trees from Sierra Norte de Puebla (central Mexico) two undescribed ectomycorrhizal species of Lactarius were discovered. Distinction of the two new species is based on morphological characters and supported with phylogenetic analyses of the nuclear ribosomal DNA ITS region and part of the gene that encodes for the second largest subunit of RNA polymerase II (rpb2). The phylogenies inferred recovered the two species in different clades strongly supported by posterior probabilities and bootstrap values. The new Lactarius species are recognized as part of the assemblage of ectomycorrhizal fungi associated with Alnus acuminata. Information about these taxa includes the morphological variation achieved along 16 monitories 2010-2013. Descriptions are provided. They are accompanied by photos including SEM photomicrographs of basidiospores and information on differences between them and other related taxa from Europe and the United States. © 2014 by The Mycological Society of America.

  16. Ectomycorrhizas of Cortinarius helodes and Gyrodon monticola with Alnus acuminata from Argentina.

    Science.gov (United States)

    Becerra, Alejandra; Nouhra, Eduardo; Daniele, Graciela; Domínguez, Laura; McKay, Donaraye

    2005-01-01

    Field ectomycorrhizas of Cortinarius helodes Moser, Matheny & Daniele (sp. nov) and Gyrodon monticola Sing. on Alnus acuminata Kunth (Andean alder, aliso del cerro) are described based on morphological and anatomical features. Ectomycorrhizal roots were sampled beneath fruitbodies of C. helodes and G. monticola from two homogeneous A. acuminata forest sites located in Tucuman and Catamarca Provinces in Argentina. C. helodes ectomycorrhizas showed a thick white to beige mantle exuding a milky juice when injured, were bluish toward the apex, and had hyphal strands in the mantle. G. monticola ectomycorrhizas showed some conspicuous features like highly differentiated rhizomorphs, inflated brown cells on the mantle surface, and hyaline and brown emanating hyphae with dolipores. Restriction fragment length polymorphism analysis of the nuclear rDNA internal transcribed spacer provided a distinctive profile for each of the collections of fruitbodies and the mycorrhizal morphotypes.

  17. Toxicity of Bauhinia variegata and Mimusops elengi with plant molluscicides against Lymnaea acuminata

    Directory of Open Access Journals (Sweden)

    Kanchan Lata Singh

    2012-01-01

    Full Text Available Molluscicidal activity of binary combination of Bauhinia variegata and Mimusops elengi with other plant molluscicides Saraca asoca and Thuja orientalis against snail Lymnaea acuminata have been studied. It was observed that toxicity of binary combinations of plant molluscicides with other plant molluscicides were toxic against fresh water snail L. acuminata. Among all combinations of toxicity Mimusops elengi leaf + Saraca asoca bark (24h LC50: 98.25 mg/l; 96h LC50: 40.40 mg/l and Bauhinia variegata leaf powder + Saraca asoca leaf (24h LC50: 123.98 mg/l; 96h LC50: 57.91 mg/l was more toxic than other binary combinations of plant molluscicides. Mimusops elengi leaf powder + Saraca asoca leaf powder and Bauhinia variegata leaf powder + Saraca asoca leaf powder are more potent molluscicides.

  18. Behavioural responses of the snail Lymnaea acuminata to carbohydrates and amino acids in bait pellets.

    Science.gov (United States)

    Agrahari, P; Singh, D K

    2010-12-01

    Snail control could play an important role in programmes against fascioliasis, especially if the methods used for molluscicide delivery could be improved, such as by the development of bait formulations containing both an effective attractant and a molluscicide, to ensure good levels of contact between the molluscicide and the target snail populations. In a recent study, the attractiveness to Lymnaea acuminata (an intermediate host of the digenean trematode Fasciola gigantica) of potential components of snail-attractant pellets was investigated. Carbohydrates (glucose, maltose, sucrose or starch, each at 10 mM) and amino acids (citrulline, tryptophan, proline or serine, each at 20 mM), were tested in aquaria, with the snails initially placed 22.5, 30 or 45 cm from an agar pellet containing the component under test. Under these conditions, starch and proline emerged as the strongest attractants for L. acuminata, followed by maltose and serine.

  19. TREATMENT OF CONDYLOMATA ACUMINATA AND BOWENOID PAPULOSIS WITH CO2 LASER AND IMIQUIMOD.

    Directory of Open Access Journals (Sweden)

    Ilko Bakardzhiev

    2012-05-01

    Full Text Available Some of the most common manifestation of Human Papilloma Virus (HPV infection in venereology are Condylomata acuminata and Bowenoid Papulosis. These diseases are often difficult to diagnose by dermatologists, obstetricians, gynecologists and urologists. This article represents our entire clinical experience with the use of carbon dioxide (CO-2 laser in the treatment of 58 (40 male and 18 female patients with Condylomata Acuminata after other treatments had failed. Successful eradication was accomplished in 53 patients with wide distribution of condylomatous lesions, with 88% per cent responding to a single laser treatment. In our experience there are no side effects, damage to the surrounding tissue is minimal and the lesions have not reccured. In 82.3% of the patients the treatment resulted in complete disappearance of the lesions, whereas in the other two to three percent treatments were required. The advantages of the laser treatment are discussed in this article.

  20. Construction and characterization of a plant transformation-competent BIBAC library of the black Sigatoka-resistant banana Musa acuminata cv. Tuu Gia (AA).

    Science.gov (United States)

    Ortiz-Vázquez, E; Kaemmer, D; Zhang, H-B; Muth, J; Rodríguez-Mendiola, M; Arias-Castro, C; James, Andrew

    2005-02-01

    A plant transformation-competent binary bacterial artificial chromosome (BIBAC) library was constructed from Musa acuminata cv. Tuu Gia (AA), a black Sigatoka-resistant diploid banana. After digestion of high-molecular-weight banana DNA by HindIII, several methods of DNA size selection were tested, followed by ligation, using a vector/insert molar ratio of 4:1. The library consists of 30,700 clones stored in 80 384-well microtiter plates. The mean insert size was estimated to be 100 kb, and the frequency of inserts with internal NotI sites was 61%. The majority of insert sizes fell into the range of 100+/-20 kb, making them suitable for Agrobacterium-mediated transformation. Only 1% and 0.9% of the clones contain chloroplast and mitochondrial DNA, respectively. This is the first BIBAC library for banana, estimated to represent five times its haploid genome (600 Mbp). It was demonstrated by hybridization that the library contains typical members of resistance gene and defense gene families that can be used for transformation of disease susceptible banana cultivars for banana genetic improvement.

  1. Anti-inflammatory activities, triterpenoids, and diarylheptanoids of Alnus acuminata ssp. arguta.

    Science.gov (United States)

    Aguilar, María I; Rovelo, Ricardo; Verjan, Juan G; Illescas, Oscar; Baeza, Ana E; De La Fuente, Marcela; Avila, Ileana; Navarrete, Andrés

    2011-10-01

    The main use of stem bark infusions of Alnus acuminata ssp. arguta (Schlecht.) Furlow (Betulaceae) includes treatments for acute inflammation in Mexican traditional medicine. n-Hexane (CHE), chloroform (CCE), and methanol (CME) extracts of the stem bark were investigated for anti-inflammatory activity and its safety. The anti-inflammatory effects of the orally administered CME, CCE, and CHE extracts, using carrageenan-induced rat hind paw edema model, and acute oral toxicity in mice, using Lorke's method, were determined. The column chromatographic fraction (CME-3) showed a higher anti-inflammatory activity (92.2%) (IC(50): 60.8 mg/mL) as compared with CME (76.9%); both were in the same order of magnitude as that of indomethacin, the positive control drug. Safety parameters for acute oral toxicity test showed that CME was not toxic (LD(50): >5000). Several triterpenoids (1-7) from hexane extracts and diarylheptanoids (10-14) from methanol extracts of A. acuminata ssp. arguta were isolated and characterized. These results confirm the traditional uses of A. acuminata in acute inflammatory conditions and its safety for consumption.

  2. Nitrate reductase activity and its diurnal variation rhythm for Camptotheca acuminata seedlings

    Institute of Scientific and Technical Information of China (English)

    SUNShi-qin; YANXiu-feng

    2004-01-01

    Nitrate reductase activity (NRA) in different plant organs and leaves in different positions of Camptotheca acuminata seedlings was determined by an In vivo assay, the diurnal variation rhythm of NRA in leaves of different positions was observed,and the correlations between leaf NRA, leaf area and lamina mass per unit area (LMA) were also examined. The results showed that NRA in the leaf was significantly highest, compared with that in other organs such as roots, stems and leaves. In this experiment, the 10 leaves were selected from the apex to the base of the seedlings in order. The different NRA occurred obviously in leaves of different positions of C. acuminata seedlings from the apex to the base, and NRA was higher in the 4th-6th leaves.The diurnal change rhythm of leaf NRA showed a one peak curve, and maximum NRA value appeared at about midday (at 12:30 or so). No obvious correlations between NRA and leaf area or lamina mass per unit area were observed. This study offered scientific foundation for the further research on nitrogen metabolism of C. acuminata.

  3. Climate Variability and Oceanographic Settings Associated with Interannual Variability in the Initiation of Dinophysis acuminata Blooms

    Directory of Open Access Journals (Sweden)

    Henrick Berger

    2013-08-01

    Full Text Available In 2012, there were exceptional blooms of D. acuminata in early spring in what appeared to be a mesoscale event affecting Western Iberia and the Bay of Biscay. The objective of this work was to identify common climatic patterns to explain the observed anomalies in two important aquaculture sites, the Galician Rías Baixas (NW Spain and Arcachon Bay (SW France. Here, we examine climate variability through physical-biological couplings, Sea Surface Temperature (SST anomalies and time of initiation of the upwelling season and its intensity over several decades. In 2012, the mesoscale features common to the two sites were positive anomalies in SST and unusual wind patterns. These led to an atypical predominance of upwelling in winter in the Galician Rías, and increased haline stratification associated with a southward advection of the Gironde plume in Arcachon Bay. Both scenarios promoted an early phytoplankton growth season and increased stability that enhanced D. acuminata growth. Therefore, a common climate anomaly caused exceptional blooms of D. acuminata in two distant regions through different triggering mechanisms. These results increase our capability to predict intense diarrhetic shellfish poisoning outbreaks in the early spring from observations in the preceding winter.

  4. Enzyme inhibition by molluscicidal agents of Bauhinia variegata and Mimusops elengi in the nervous tissue of Lymnaea acuminata

    Directory of Open Access Journals (Sweden)

    Kanchan Lata Singh

    2015-10-01

    Full Text Available Objective: To evaluate the effect of enzymatic activity in the nervous tissue of snail Lymnaea acuminata (L. acuminata by Bauhinia variegata (B. variegata and Mimusops elengi (M. elengi and their active molluscicidal components quercetin and saponin. Methods: Treatment of sublethal concentration (40% and 80% of 96-h LC50 in vivo of column-purified fraction of B. variegata leaf and M. elengi bark and their molluscicidal agents quercetin and saponin inhibit the acetylcholinesterase (AChE, acid and alkaline phosphatase (ACP and ALP activities in the nervous tissue of L. acuminata. Results: AChE activity was more inhibited than ACP and ALP in snail exposed to columnpurified fraction of M. elengi bark and saponin. Among all the treatments the highest inhibition in AChE activity (27.77% was noted in snail L. acuminata exposed to 80% of 96-h LC50 of saponin at 96-h exposure period. Conclusions: It can be concluded from the present study that inhibition of AChE, ACP and ALP by B. variegata leaf (quercetin and M. elengi bark (saponin in snail L. acuminata could be the cause of snail mortality.

  5. Analysis of traumatic ulcer healing time under the treatment of the Mauli banana (Musa acuminata 25% stem extract gel

    Directory of Open Access Journals (Sweden)

    Dewi Puspitasari

    2017-03-01

    Full Text Available ABSTRACT Introduction: Traumatic ulcer is one of oral disorders that often occur. The prevalence is quite high, between 3-24% of population. Therapy of traumatic ulcer is symptomatic. People usually use Aloe vera extract gel. Previous research showed that the Aloe vera gel is equivalent with ethanol extract of 25% Mauli banana (Musa acuminata stem in accelerating wound healing based on the number of macrophages and neovascular. The objective of the study is to find out the time difference of traumatic ulcer healing using 25% Musa acuminata stem extract gel compared to a gel containing Aloe vera extract. Methods: The research was post test design. Subjects were patients of Oral Medicine Installation in Gusti Hasan Aman Dental Hospital Banjarmasin with diagnosis of traumatic ulcer using completely random sampling method. Eight patients as samples were determined by the formula of Lemeshow. Results: there was no significant difference with p=0,724 (p>0,05 between healing time using Aloe vera gel and 25% Musa acuminata stem extract. Conclusion: At the concentration of 25% Musa acuminata stem extract gel concentration has the same healing time with Aloe vera gel, therefore can be recommended as a topical use for traumatic ulcer healing. Keywords: Musa acuminata stem, Healing time, Traumatic ulcer

  6. A combined spectroscopic and TDDFT study of natural dyes extracted from fruit peels of Citrus reticulata and Musa acuminata for dye-sensitized solar cells

    Science.gov (United States)

    Prima, Eka Cahya; Hidayat, Novianto Nur; Yuliarto, Brian; Suyatman; Dipojono, Hermawan Kresno

    2017-01-01

    This study reports the novel spectroscopic investigations and enhanced the electron transfers of Citrus reticulata and Musa acuminata fruit peels as the photosensitizers for the dye-sensitized solar cells. The calculated TD-DFT-UB3LYP/6-31 + G(d,p)-IEFPCM(UAKS), experiment spectra of ultra-violet-visible spectroscopy, and Fourier transform infrared spectroscopy studies indicate the main flavonoid (hesperidin and gallocatechin) structures of the dye extracts. The optimized flavonoid structures are calculated using Density functional theory (DFT) at 6-31 + G(d,p) level. The rutinosyl group of the hesperidin pigment (Citrus reticulata) will be further investigated compared to the gallocatechin (Musa acuminata) pigment. The acidity of the dye extract is treated by adding 2% acetic acid. The energy levels of the HOMO-LUMO dyes are measured by a combined Tauc plot and cyclic voltammetry contrasted with the DFT data. The electrochemical impedance spectroscopy will be performed to model the dye electron transfer. As for the rutinosyl group presence and the acidic treatment, the acidified Citrus reticulata cell under continuous light exposure of 100 mW·cm- 2 yields a short-circuit current density (Jsc) of 3.23 mA/cm2, a photovoltage (Voc) of 0.48 V, and a fill factor of 0.45 corresponding to an energy conversion efficiency (η) of 0.71% because the shifting down HOMO-LUMO edges and the broadening dye's absorbance evaluated by a combined spectroscopic and TD-DFT method. The result also leads to the longest diffusion length of 32.2 μm, the fastest electron transit of 0.22 ms, and the longest electron lifetime of 4.29 ms.

  7. Pessegueiro: cultivar BRS kampai

    Directory of Open Access Journals (Sweden)

    Maria do Carmo Bassols Raseira

    2010-12-01

    Full Text Available RESUMO O programa de Melhoramento Genético de Pessegueiros da Embrapa Clima Temperado tem, entre seus objetivos, a obtenção de cultivares produtoras de frutas para consumo in natura, com características que satisfaçam às exigências dos consumidores. Alguns dos grandes centros consumidores, como é o caso de São Paulo e Curitiba, preferem pêssegos de polpa branca e sabor doce. A cultivar BRS Kampai, obtida de um cruzamento entre 'Chimarrita' e 'Flordaprince', alia a baixa necessidade em frio, o que é uma vantagem em regiões subtropicais, à boa aparência, com sabor superior a qualquer um dos parentais. A colheita dos frutos desta cultivar inicia-se geralmente, em meados de novembro, em Pelotas-RS (em Atibaia, São Paulo, inicia-se na segunda quinzena de outubro, poucos dias antes das cultivares Rubimel (polpa amarela e Premier (polpa branca, sendo ótima substituta para esta última.

  8. Genetic variability among 18 cultivars of cooking bananas and plantains by RAPD and ISSR markers

    Directory of Open Access Journals (Sweden)

    YUYU SURYASARI POERBA

    2010-07-01

    Full Text Available Poerba YS, Ahmad F (2010 Genetic variability among 18 cultivars of cooking bananas and plantains by RAPD and ISSR markers. Biodiversitas 11: 118-123. This study was done to assess the molecular diversity of 36 accessions (18 cultivars of the plantain and cooking bananas (Musa acuminata x M. balbisiana, AAB, ABB subgroups based on Random amplified polymorphic DNA (RAPD and and Inter Simple Sequence Repeats (ISSR markers and to determine genetic relationships in the bananas. RAPD and ISSR fingerprinting of these banana varieties was carried out by five primers of RAPDs and two primers of ISSRs. RAPD primers produced 63 amplified fragments varying from 250 to 2500 bp in size. 96.82% of the amplification bands were polymorphic. ISSR primers produced 26 amplified fragments varying from 350 bp to 2000 bp in size. The results showed that 92.86% of the amplification bands were polymorphic. The range of genetic distance of 18 cultivars was from 0.06-0.67.

  9. Amplifying the benefits of agroecology by using the right cultivars.

    Science.gov (United States)

    Noguera, D; Laossi, K-R; Lavelle, P; De Carvalho, M H Cruz; Asakawa, N; Botero, C; Barot, S

    2011-10-01

    Tropical soils are particularly vulnerable to fertility losses due to their low capacity to retain organic matter and mineral nutrients. This urges the development of new agricultural practices to manage mineral nutrients and organic matter in a more sustainable way while relying less on fertilizer inputs. Two methods pertaining to ecological engineering and agroecology have been tested with some success: (1) the addition of biochar to the soil, and (2) the maintenance of higher earthworm densities. However, modern crop varieties have been selected to be adapted to agricultural practices and to the soil conditions they lead to and common cultivars might not be adapted to new practices. Using rice as a model plant, we compared the responsiveness to biochar and earthworms of five rice cultivars with contrasted selection histories. These cultivars had contrasted responsivenesses to earthworms, biochar, and the combination of both. The mean relative increase in grain biomass, among all treatments and cultivars, was 94% and 32%, respectively, with and without fertilization. Choosing the best combination of cultivar and treatment led to a more than fourfold increase in this mean benefit (a 437% and a 353% relative increase in grain biomass, respectively, with and without fertilization). Besides, the more rustic cultivar, a local landrace adapted to diverse and difficult conditions, responded the best to earthworms in terms of total biomass, while a modern common cultivar responded the best in term of grain biomass. This suggests that cultivars could be selected to amplify the benefit of biochar- and earthworm-based practices. Overall, selecting new cultivars interacting more closely with soil organisms and soil heterogeneity could increase agriculture sustainability, fostering the positive feedback loop between soils and plants that has evolved in natural ecosystems.

  10. Enzyme Inhibition by Molluscicidal Components of Myristica fragrans Houtt. in the Nervous Tissue of Snail Lymnaea acuminata

    Directory of Open Access Journals (Sweden)

    Preetee Jaiswal

    2010-01-01

    Full Text Available This study was designed to investigate the effects of molluscicidal components of Myristica fragrans Houtt. (Myristicaceae on certain enzymes in the nervous tissue of freshwater snail Lymnaea acuminata Lamarck (Lymnaeidae. In vivo and in vitro treatments of trimyristin and myristicin (active molluscicidal components of Myristica fragrans Houtt. significantly inhibited the acetylcholinesterase (AChE, acid and alkaline phosphatase (ACP/ALP activities in the nervous tissue of Lymnaea acuminata. The inhibition kinetics of these enzymes indicates that both the trimyristin and myristicin caused competitive noncompetitive inhibition of AChE. Trimyristin caused uncompetitive and competitive/noncompetitive inhibitions of ACP and ALP, respectively whereas the myristicin caused competitive and uncompetitive inhibition of ACP and ALP, respectively. Thus results from the present study suggest that inhibition of AChE, ACP, and ALP by trimyristin and myristicin in the snail Lymnaea acuminata may be the cause of the molluscicidal activity of Myristica fragrans.

  11. Heliconia acuminata reproductive success is independent of local floral density O sucesso reprodutivo de Heliconia acuminata é independente da densidade floral local

    Directory of Open Access Journals (Sweden)

    Emilio M. Bruna

    2004-09-01

    Full Text Available Reproductive plants in tropical forests are patchily distributed, with some in large aggregations of reproductive consepecifics while others are relatively isolated. This variation in floral density is hypothesized to have a major effect on plant reproductive success, since individuals in higher density neighborhoods can attract more or higher quality pollinators. We experimentally tested this hypothesis with populations of the understory herb Heliconia acuminata in central Amazonia. We created replicated plots in which reproductive plant density spanned the range of naturally occurring floral neighborhood size, then measured three surrogates of plant fitness in focal plants in each array. There was no significant difference between any of the three floral neighborhood treatments in total seed production, fruit set, or the number of seeds produced per fruit. Pollinator visitation rates to plants in all treatments were extremely low, with many plants not visited at all during the observation period. This could be because H. acuminata's hummingbird pollinators are unable to find the widely scattered reproductive plants, however this hypothesis appears unlikely. Instead, natural flowering plant densities may simply be below the threshold value at which neighborhood effects become important, even in "high-density" aggregations. Nutrient limitation, selective fruit abortion, and reproduction via male rather than female function may also be playing a role. We argue the absence of neighborhood effects may be a general phenomenon in central Amazonian forests, though additional experiments with other plant-pollinator systems are needed to determine the extent to which this hypothesis is supported.Plantas reprodutivas em florestas tropicas são distribuidas em manchas, com algumas em grandes agregações coespecíficas e outras relativamente isoladas. A hipótese é que esta variação na densidade de flores em um local tem um grande efeito no sucesso

  12. Antifungal constituents in alnus acuminata H.B.K. nodules Constituyentes antifungicos en nódulos radicales de Alnus Acuminata H.B.K.

    Directory of Open Access Journals (Sweden)

    Gonzalez Jaime

    1988-12-01

    Full Text Available Alnus acuminata. H.B.K. is a native specimen of economic importance. that is characterized for having root nodules
    that can fix nitrogen. The nodules chemical composition has not been sstablished, but, it has been seen that it has influence over the soil microflora. In order to establish the chemical composition and the activity of the obtained fractions, there were made extractions of the alder nodules. The insulated compounds were; xylose and ribose; an aromatic carboxylicaeid, an fatty aeid, an phenolic biarylheptanoid and a flavonoid glycosic. were also founded. The Fusarium oxysporum and Pythium sp. growing was inhibited by this last one sustance.Alnus acuminata. H.B.K. es una especie nativa de importancia económica que se caracteriza por tener nódulos radicales
    fijadores de nitrógeno. La composición química de los nódulos no se ha establecido; sin embargo, se ha observado que actúa sobre la microflora del suelo. Con el fin de establecer la composición química de las fracciones obtenidas, se.realizaron extracciones a partir de nódulos de Aliso. Los compuestos
    aislados 'fueron: xilosa y ribosa; además se caracterizaron un ácido carboxílico aromático, un ácido graso, un biariheptanoide
    fenólico y un glicósido de flavonoide. Esta última sustancia inhibió el crecimiento de Fusarium oxvsporum y Pythium sp.

  13. Maternal inheritance of chloroplast genome and paternal inheritance of mitochondrial genome in bananas (Musa acuminata).

    Science.gov (United States)

    Fauré, S; Noyer, J L; Carreel, F; Horry, J P; Bakry, F; Lanaud, C

    1994-03-01

    Restriction fragment length polymorphisms (RFLPs) were used as markers to determine the transmission of cytoplasmic DNA in diploid banana crosses. Progenies from two controlled crosses were studied with heterologous cytoplasmic probes. This analysis provided evidence for a strong bias towards maternal transmission of chloroplast DNA and paternal transmission of mitochondrial DNA in Musa acuminata. These results suggest the existence of two separate mechanisms of organelle transmission and selection, but no model to explain this can be proposed at the present time. Knowledge of the organelle mode of inheritance constitutes an important point for phylogeny analyses in bananas and may offer a powerful tool to confirm hybrid origins.

  14. COMPARISON BETWEEN IMMUNOFLUORESCENCE AND PCR IN DETECTING HUMAN PAPILLOMA VIRUS IN CONDYLOMA ACUMINATA

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Objective To compare the effectiveness of immunofluorescence and polymerase chain reaction (PCR) in detecting human papilloma virus (HPV) in condyloma acuminata (CA).Methods HPVs in CA tissues from 60 patients were detected by immunofluorescence and PCR, respectively. Different subtypes of HPVs were also identified with restriction fragment length polymorphism (RFLP).Results The positive detective rates of immunofluorescence and PCR were 56. 67 % (34/60) and 96.67 % (58/60), respectively (P<0.01). RFLP results showed HPV6 and HPVl1 were the main subtypes in the detected virus,which accounted for 98. 28 %.Conclusion The sensibility of PCR is superior to that of immunofluorescence.

  15. New camptothecin and ellagic acid analogues from the root bark of Camptotheca acuminata.

    Science.gov (United States)

    Zhang, Zhizhen; Li, Shiyou; Zhang, Shanmin; Liang, Chun; Gorenstein, David; Beasley, R Scott

    2004-12-01

    As part of a study on chemical constituents of Camptotheca species, one new natural camptothecin analogue (2), two new alkaloids (3, 4), one new ellagic acid analogue (5), and 19 known compounds (1, 6-23) have been isolated from the root bark, stem bark, fruits, and leaves of Camptotheca acuminata Decaisne. The structures of 2-5 were determined from spectral data to be 10-methoxy-20-O-acetylcamptothecin (2), 20-O-beta-glucopyranosyl 18-hydroxycamptothecin (3), 20-formylbenz indolizino [1,2-b]quino-line-11(13H)-one (4), and 3,4-methylenedioxy-3'-O-methyl-5'-hydroxyellagic acid (5).

  16. Giant Condyloma Acuminata in Indonesian Females with SLE under Immunosuppressant and Steroid Therapy

    Directory of Open Access Journals (Sweden)

    Andhika Rachman

    2016-01-01

    Full Text Available Introduction. Immunosuppressant and steroid therapy in systemic lupus erythematosus (SLE increases the risk of human papillomavirus (HPV infections, one of which is giant condyloma acuminata (GCA. To our knowledge, there is no report evaluating the correlation between immunosuppressive and steroid therapy in patients with SLE and the prevalence of GCA. Case Report. A 42-year-old female was diagnosed with SLE a year ago and has been treated with steroids and immunosuppressive drugs. In the last few months she presented GCA involving the genital area recurring almost every two months. Type 6 and 11 HPVs were identified in vulva, vagina, and cervix. Methods. PubMed, EBSCO, and Cochrane Library literature were searched from inception to July 2015. Authors screened all titles and abstracts and read full text article, and two case-control studies were found relevant. Results. SLE patients in both studies were under immunosuppressive and steroid therapy. Condyloma acuminata was diagnosed at 108 months (latest and 1 month (earliest after SLE. Type 6, 11, 16, 42, and oncogenic group of HPV were identified. Conclusions. GCA is a type of HPV infection seldom observed in SLE patients. Therefore, their correlation is still unclear. Period of time since SLE was diagnosed and GCA varies from months to years. A more thorough physical and laboratory examination leading to HPV and other infectious disease is recommended.

  17. EXTRACTION AND QUANTITATIVE DETERMINATION OF ASCORBIC ACID FROM BANANA PEEL MUSA ACUMINATA ‘KEPOK’

    Directory of Open Access Journals (Sweden)

    Khairul Anwar Mohamad Said

    2016-04-01

    Full Text Available This paper discusses the extraction of an antioxidant compound, which is ascorbic acid or vitamin C, from a banana peel using an ultrasound-assisted extraction (UAE method. The type of banana used was Musa acuminata also known as “PisangKepok” in Malaysia. The investigation includes the effect of solvent/solid ratio (4.5, 5 g and 10  ml/g, sonication time (15, 30 and 45 mins and temperature variation (30 , 45  and 60oC on the extraction of ascorbic acid compounds from the banana peel to determine the best or optimum condition of the operation. Out of all extract samples analyzed by redox titration method using iodine solution, it was found that the highest yield was 0.04939 ± 0.00080 mg that resulted from an extraction at 30oC for 15 mins with 5 ml/g solvent-to-solute ratio.KEYWORDS:  Musa acuminata; ultrasound-assisted extraction; vitamin C; redox titration

  18. Condylomata acuminata of the urinary bladder. Natural history, viral typing, and DNA content.

    Science.gov (United States)

    Del Mistro, A; Koss, L G; Braunstein, J; Bennett, B; Saccomano, G; Simons, K M

    1988-03-01

    Three patients with condylomata acuminata of the urinary bladder are reported. Two of the patients were immunosuppressed, and one had longstanding extensive condylomata acuminata of the external genitalia and adjacent areas. All lesions recurred at least once and were difficult to treat. The diagnosis was confirmed by in situ hybridization on archival material with human papillomavirus (HPV) DNA probes under stringent conditions. In two of the patients, probes for HPV types 6 and 11 were positive; HPV 11 only was identified in one patient. Probes for HPV types 16 and 18 and pBR322 vector controls were negative. In one patient with a strong hybridization signal, the lesion was also positive for common papillomavirus antigen. DNA content measured by cytophotometry of Feulgen-stained whole nuclei isolated from lesions in two patients revealed a markedly aneuploid DNA pattern. Whether this is a factor in the behavior of the lesions is not known at this time. Although rare, HPV infection of the urinary bladder may result in widespread condylomatosis and may mimic giant condylomas of Buschke-Löwenstein or even verrucous carcinomas, sometimes necessitating radical treatment. Nevertheless, until there is proof to the contrary, the lesions must be considered benign and should not be confused with squamous cancer of the bladder.

  19. TLMA Expression in Condyloma Acuminata from Patients with High and Low Risk HPV

    Institute of Scientific and Technical Information of China (English)

    涂亚庭; 陈善娟; 范超; 林能兴; 刘厚君; 刘志香

    2002-01-01

    Objective: To detect the activated expression oftelomerase in condyloma acuminata lesions in low-risk (6/11)and high-risk (16/18) human papilloma virus (HPV)infection and examine the role played by telomerase in theoccurrence, development and carcinomatous change ofcondyloma acuminata. Methods: Assaying the expression of telomerase and thetype of HPV in damaged skin of 42 CA patients and normalskin of 30 healthy control individuals through telomeraserepeat amplification protocol (TRAP) and polymerase chainreaction (PCR). Results: In all the normal skin controls, PCR for HPV wasnegative and only 16.7% of samples were positive for TLMAexpression; in CA lesions, HPV testing was positive in all (32cases were low-risk, 3 were high-risk, and 7 were of mixedtype) and all were positive for TLMA expression. Conclusion: TLMA may be activated by HPV infection,and in turn cause the hyperplasia of epidermal cells. It wasalso indicated that HPV, especially high risk types, canactivate TLMA. The activation of TLMA may play animportant role in abnormal hyperplasia and carcinomatouschanges in CA lesions.

  20. Attraction to amino acids by Lymnaea acuminata, the snail host of Fasciola species.

    Science.gov (United States)

    Tiwari, F; Singh, D K

    2004-04-01

    Adult Lymnaea acuminata (average length 20-22 mm) were collected locally from lakes and low-lying submerged fields from Gorakhpur. The chemoattraction studies were made in round glass aquaria measuring 30 cm in diameter and filled to a depth of 10 mm with 500 ml dechlorinated tap water. Each aquarium was divided into four concentric zones. At the starting time of the assay 10 snails were placed on the circumference of outermost zone 0. Snail attractant pellets (SAP) were added simultaneously in the center of central zone 3. SAP of different amino acids were prepared at concentrations of 10, 20, 50, 80 and 100 mM/2% agar solution and, subsequently, spread to a uniform thickness of 5 mm. After cooling, SAP were cut in small pieces of 5 mm in diameter. Lymnaea acuminata's attraction to amino acids was studied using different amino acid concentrations in SAP. Pellets containing amino acids with non-polar R groups (proline and tryptophan), a charged polar group (arginine) and uncharged polar R groups (serine, citrulline and asparagine) were tested. The snails were more attracted to the uncharged polar R group amino acid serine than to other groups of amino acids. The preferred amino acid concentration was 80 mM. The attraction of snails to different amino acids was concentration dependent. Snails could discriminate amongst the different amino acids at > or = 50 mM.

  1. Attraction to amino acids by Lymnaea acuminata, the snail host of Fasciola species

    Directory of Open Access Journals (Sweden)

    Tiwari F.

    2004-01-01

    Full Text Available Adult Lymnaea acuminata (average length 20-22 mm were collected locally from lakes and low-lying submerged fields from Gorakhpur. The chemoattraction studies were made in round glass aquaria measuring 30 cm in diameter and filled to a depth of 10 mm with 500 ml dechlorinated tap water. Each aquarium was divided into four concentric zones. At the starting time of the assay 10 snails were placed on the circumference of outermost zone 0. Snail attractant pellets (SAP were added simultaneously in the center of central zone 3. SAP of different amino acids were prepared at concentrations of 10, 20, 50, 80 and 100 mM/2% agar solution and, subsequently, spread to a uniform thickness of 5 mm. After cooling, SAP were cut in small pieces of 5 mm in diameter. Lymnaea acuminata's attraction to amino acids was studied using different amino acid concentrations in SAP. Pellets containing amino acids with non-polar R groups (proline and tryptophan, a charged polar group (arginine and uncharged polar R groups (serine, citrulline and asparagine were tested. The snails were more attracted to the uncharged polar R group amino acid serine than to other groups of amino acids. The preferred amino acid concentration was 80 mM. The attraction of snails to different amino acids was concentration dependent. Snails could discriminate amongst the different amino acids at > or = 50 mM.

  2. 5-aminolaevulinic Acid-photodynamic Therapy for the Treatment of Cervical Condylomata Acuminata

    Institute of Scientific and Technical Information of China (English)

    Yong-xin Liu; He-yi Zheng; Xiu-rong Liu

    2009-01-01

    Objective To investigate the efficacy and safety of photodynamic therapy(PDT)with topical 5-aminolaevulinic acid(ALA)on cervical condylomata acuminata.Methods Patients with cervical condylomata(n=30)were allocated into primary and recurrent group,and were given topical ALA under occlusive dressing for 3 hours followed by irradiation with semiconductor laser at a dose of 100 Jcm2 and a power of 100 mW.The treatment was repeated 7 days later if the lesion was not completely removed after the first treatment.Complete response rate and recurrence rate of wart lesions as well as rate of adverse reaction were analyzed.Results The total complete response rate of PDT was 100% and the total recurrence rate was 5% after 3 months of follow-up.Recurrence rate of recurrent group was significantly lower than that of prior managements(100% ,P<0.01).The side effects of PDT in patients mainly included mild burning and/or stinging restricted to the illuminated areas,and was significant lower than their own control(25% vs.100% ,P<0.05).Conclusion Compared with conventional therapies,topical application of ALA-PDT is a simple,effective,safe,well-tolerated,and low recurrence rate treatment for cervical condylomata acuminata.

  3. Optimization of ultrasound-assisted extraction of camptothecin from Camptotheca acuminata seeds

    Institute of Scientific and Technical Information of China (English)

    JING Li-jia; LI Si-yang; CHANG Zui; WANG Yang; YAN Xiu-feng

    2011-01-01

    Naturally occurring camptothecin (CPT) is an important source of chemotherapeutic agents. The extraction from Camptotheca acuminata is still the main approach to obtain CPT compared with total synthesis. In the present study, ultrasound-assisted extractions (UAE) of CPT from C. acuminata seeds with alkaline solutions were investigated and CPT yield were determined by High Performance Liquid Chromatography. The conditions of alkaline species and concentrations, extraction time, extraction temperature and ultrasonic power were optimized.Results show that both Na3PO4 and Na2CO3 solutions gain good extraction yields, whereas Na3PO4 solution has stronger basicity and need higher concentration than Na2CO3 solution does, thus aqueous Na2CO3 is more beneficial for the extraction. The optimal condition was ultrasonically extracted with 0.5% aqueous Na2CO3 at 50℃ and ultrasonic power of 400 W for 60 min. Comparing with UAE with ethanol, the extraction with 0.5% Na2CO3 solution achieves higher yield. Moreover, aqueous Na2CO3 as a solvent has various advantages including non-toxicity, inflammable, non-corrosive and low cost, which ensure this UAE method is a superior method with high utilizing prospect.

  4. Giant Condyloma Acuminata in Indonesian Females with SLE under Immunosuppressant and Steroid Therapy

    Science.gov (United States)

    2016-01-01

    Introduction. Immunosuppressant and steroid therapy in systemic lupus erythematosus (SLE) increases the risk of human papillomavirus (HPV) infections, one of which is giant condyloma acuminata (GCA). To our knowledge, there is no report evaluating the correlation between immunosuppressive and steroid therapy in patients with SLE and the prevalence of GCA. Case Report. A 42-year-old female was diagnosed with SLE a year ago and has been treated with steroids and immunosuppressive drugs. In the last few months she presented GCA involving the genital area recurring almost every two months. Type 6 and 11 HPVs were identified in vulva, vagina, and cervix. Methods. PubMed, EBSCO, and Cochrane Library literature were searched from inception to July 2015. Authors screened all titles and abstracts and read full text article, and two case-control studies were found relevant. Results. SLE patients in both studies were under immunosuppressive and steroid therapy. Condyloma acuminata was diagnosed at 108 months (latest) and 1 month (earliest) after SLE. Type 6, 11, 16, 42, and oncogenic group of HPV were identified. Conclusions. GCA is a type of HPV infection seldom observed in SLE patients. Therefore, their correlation is still unclear. Period of time since SLE was diagnosed and GCA varies from months to years. A more thorough physical and laboratory examination leading to HPV and other infectious disease is recommended. PMID:27843658

  5. Molluscicidal activity of Sapindus mukorossi and Terminalia chebula against the freshwater snail Lymnaea acuminata.

    Science.gov (United States)

    Upadhyay, Aparna; Singh, D K

    2011-04-01

    The molluscicidal activity of Sapindus mukorossi and Terminalia chebula fruit powder against the vector snail Lymnaea acuminata was time and concentration dependent. The molluscicidal activity of T. chebula fruit powder (96 h LC(50):93.59 mg L(-1)) was more pronounced than that of S. mukorossi fruit powder (96 h LC(50):119.57 mg L(-1)). Ethanolic extracts of S. mukorossi and T. chebula fruit powder were more toxic than their other organic solvent extracts. The molluscicidal activity of ethanolic extract of S. mukorossi fruit powder (24h LC(50):2.75 mg L(-1)) was more effective than the ethanolic extract of T. chebula fruit powder (24h LC(50):124.06 mg L(-1)). The 96 h LC(50) of column-purified fraction of S. mukorossi fruit powder was 5.43 mg L(-1) whereas those of T. chebula fruit powder was 7.49 mg L(-1). Column, thin layer and high performance liquid chromatography analysis demonstrates that the active molluscicidal component in S. mukorossi and T. chebula is saponin (96 h LC(50):1.31 mg L(-1)) and tannic acid (96 h LC(50):1.64 mg L(-1)), respectively. These plants may be used as potent source of molluscicides against the snail L. acuminata.

  6. A new bioactive thiophenolic glycoside from the leaf of Massularia acuminata (g. Don Bullock) ex Hoyle (Rubiaceae).

    Science.gov (United States)

    Oriola, A O; Aladesanmi, A J; Idowu, T O; Akinkunmi, E O; Obuotor, E M; Ogunsina, M O

    2014-01-01

    Massularia acuminata is a small tree or shrub of tropical rainforest. The leaves are used in Nigerian ethno-medicine for the treatment of microbial infections and pharmacological report suggested the leaf extract as possessing antioxidant activity. This study was therefore carried out to determine the most antioxidant and antimicrobial active fraction(s) of Massularia acuminata leaf and the constituent(s) responsible for the activities. The leaf of Massularia acuminata was investigated for in vitro antioxidant and antimicrobial activities, using a 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging assay and agar dilution method respectively. The ethyl acetate fraction demonstrated the best activities among the partitioned fractions tested. Bioassay guided purification of the most active ethyl acetate fraction led to isolation of a new thiophenolic glycoside, characterized as 4-(3',3'-dihydroxy-1-mercaptopropyl)phenyl glycosylpyranoside. The isolated compound from the leaf of Massularia acuminata demonstrated antioxidant and antimicrobial activities and may be responsible for the activities of leaf extract and its ethyl acetate fraction, hence this may justify its ethnomedicinal use.

  7. Analysis of expressed sequence tags from Musa acuminata ssp. burmannicoides, var. Calcutta 4 (AA) leaves submitted to temperature stresses

    NARCIS (Netherlands)

    Santos, C.R.; Martins, N.F.; Horberg, H.M.; Almeida, E.R.P.; Coelho, M.C.F.; Togawa, R.; Silva, F.R.; Caetano, A.R.; Miller, R.N.G.; Souza, M.T.

    2005-01-01

    In order to discover genes expressed in leaves of Musa acuminata ssp. burmannicoides var. Calcutta 4 (AA), from plants submitted to temperature stress, we produced and characterized two full-length enriched cDNA libraries. Total RNA from plants subjected to temperatures ranging from 5°C to 25°C and

  8. The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

    OpenAIRE

    Takaiwa, F.; Kusuda, M; SUGIURA, M.

    1982-01-01

    The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and shows strong homology with those from flowering plants.

  9. Phenotyping of wheat cultivars for heat tolerance using chlorophyll a fluorescence

    DEFF Research Database (Denmark)

    Sharma, Dew Kumari; Andersen, Svend Bode; Ottosen, Carl-Otto

    2012-01-01

    Abstract. In view of the global climate change, heat stress is an increasing constraint for the productivity of wheat (Triticum aestivum L.). Our aim was to identify contrasting cultivars in terms of heat tolerance by mass screening of 1274 wheat cultivars of diverse origin, based on a physiologi...

  10. Highly efficient Agrobacterium-mediated transformation of embryogenic cell suspensions of Musa acuminata cv. Mas (AA) via a liquid co-cultivation system.

    Science.gov (United States)

    Huang, Xia; Huang, Xue-Lin; Xiao, Wang; Zhao, Jie-Tang; Dai, Xue-Mei; Chen, Yun-Feng; Li, Xiao-Ju

    2007-10-01

    A high efficient protocol of Agrobacterium-mediated transformation of Musa acuminata cv. Mas (AA), a major banana variety of the South East Asia region, was developed in this study. Male-flower-derived embryogenic cell suspensions (ECS) were co-cultivated in liquid medium with Agrobacterium strain EHA105 harboring a binary vector pCAMBIA2301 carrying nptII and gusA gene in the T-DNA. Depending upon conditions and duration of co-cultivation in liquid medium, 0-490 transgenic plants per 0.5 ml packed cell volume (PCV) of ECS were obtained. The optimum duration of inoculation was 2 h, and the highest transformation frequency was achieved when infected ECS were co-cultivated in liquid medium first for 12 h at 40 rpm and then for 156 h at 100 rpm on a rotary shaker. Co-cultivation for a shorter duration (72 h) or shaking constantly at 100 rpm at the same duration gave 1.6 and 1.8 folds lower transformation efficiency, respectively. No transgenic plants were obtained in parallel experiments carried on semi-solid media. Histochemical GUS assay and molecular analysis in several tissues of the transgenic plants demonstrated that foreign genes were stably integrated into the banana genome. Compared to semi-solid co-cultivation transformation in other banana species, it is remarkable that liquid co-cultivation was much more efficient for transformation of the Mas cultivar, and was at least 1 month faster for regenerating transgenic plants.

  11. Contrast Materials

    Science.gov (United States)

    ... Physician Resources Professions Site Index A-Z Contrast Materials What are contrast materials and how do they ... material? Pregnancy and contrast materials What are contrast materials and how do they work? Contrast materials, also ...

  12. EVALUATION FOR SALT STRESS TOLERANCE IN TWO STRAWBERRY CULTIVARS

    Directory of Open Access Journals (Sweden)

    W. Al-Shorafa

    2014-01-01

    Full Text Available Salt stress conditions have been found to destroy the vital physiological process in plant where slower cell division and cell enlargement or both and limit mineral nutrient uptake with clearly nutritional imbalance. A greenhouse pot experiment was carried out at Agricultural Research Station, Mu’tah University, Jordan to evaluate growth responses and mineral composition of two strawberry cultivars to salt stress by different NaCl levels. Six NaCl levels (0, 25, 50, 75, 100 and 150 mM and two strawberry cultivars, Camarosa and Albino, were used. Nutrient elements were added at the 0.5-strength Hoagland nutrient concentration. Distilled water supplemented with half strength Hoagland solution was used as control. Number of leaves and runners of both strawberry cultivars were significantly reduced by increasing NaCl level. Growth parameters (shoot, root and total dry weights and root: Shoot ratios were significantly reduced with each increase in salinity level. Camarosa had higher value for all these parameters compared with Albino. Leaf chlorophyll content of both strawberry cultivars was significantly decreased when 25 mM NaCl or higher was applied. Regardless of NaCl level, Camarosa cultivar had significantly higher chlorophyll content compared with Albino. Elevated salinity level significantly increased leaf proline content of both cultivars. Albino leaves accumulated higher proline compared with Camarosa at salinized and non-salinized treatments. Both strawberry cultivars had significantly higher leaf and root Na and Cl contents under salinized conditions compared with non-salinized conditions. Each increase in NaCl level resulted in an increase in leaf and root Na and Cl contents of both cultivars. On contrast, leaf K content was decreased with salinity, root content of this mineral was significantly increased with salinity. It could be recommended to avoid growing ‘Camarosa’ and ‘Albino’ strawberry using irrigation water of 25 m

  13. Assessment of factors affecting in vitro shoot regeneration from axillary bud explant of Camptotheca acuminata

    Institute of Scientific and Technical Information of China (English)

    WANG Hui-Mei; ZU Yuan-Gang; DONG Feng-Li; ZHAO Xiao-Ju

    2005-01-01

    Axillary buds from 3-yr.-old seedlings of Camptotheca acuminata in the greenhouse were cultured on the different basal media with different concentrations of growth regulators for shoot regeneration for studying the effects of different basal media, different concentrations of growth regulators (BA or TDZ), sucrose, agar and pH value on shoot regeneration from axillary bud. The results showed that B5 and WPM media were the optimal basal media and the optimal phyotohormone was BA of 1.0 mg/L or TDZ of 0.1mg/L; The concentrations of sucrose of 30g/L and agar of 6g/L were most suitable for the shoot regeneration; pH value from 5.8 to 6.6 were broadly effective, but the best at pH 5.8.

  14. Description and identification of Alnus acuminata ectomycorrhizae from Argentinean alder stands.

    Science.gov (United States)

    Pritsch, Karin; Becerra, Alejandra; Põlme, Sergei; Tedersoo, Leho; Schloter, Michael; Agerer, Reinhard

    2010-01-01

    The objective of this study was to describe the morphological and anatomical features of five unidentified ectomycorrhizal types of Alnus acuminata and to complement their identification based on ITS-rDNA sequence analysis. The combined approach of morphotyping and sequence analysis based on ITS sequence comparison with sequences contained in GenBank and the UNITE database let us assign three of the five field-collected ectomycorrhiza morphotypes to the tomentella-thelephora lineage that closely matched European and North American species. The sequencing results within Tomentella point toward alder specific clades within T. sublilacina, T. ellisii and T. stuposa sensu lato. The two other EcM morphotypes matched Lactarius omphaliiformis and a Russula sp. Better focused, concomitant fruit body surveys are needed for accurate identification of South American ectomycorrhizal fungi because of the evidence of cryptic speciation in both agaricoid and resupinate mycobionts.

  15. A molecular marker-based linkage map of diploid bananas (Musa acuminata).

    Science.gov (United States)

    Fauré, S; Noyer, J L; Horry, J P; Bakry, F; Lanaud, C; Gońzalez de León, D

    1993-12-01

    A partial molecular linkage map of the Musa acuminata diploid genome is presented. This map is based on 58 RFLP, four isozyme and 28 RAPD markers segregating in an F2 population of 92 individuals. A total of 90 loci was detected, 77 of which were placed on 15 linkage groups while 13 segregated independently. Segregation distortions were shown by 36% of all loci, mostly favoring the male parent. Chromosome structural rearrangements were believed to be one of the main causes of these distortions. The use of genetic linkage data to further the genetic and evolutionary knowledge of the genus Musa, as well as to help improve the design of breeding strategies, is discussed.

  16. Mechanism of Infrared Detection and Transduction by Beetle Melanophila Acuminata In memory of Jerry Wolken

    Institute of Scientific and Technical Information of China (English)

    Meir Israelowitz; Jeong-Ah Kwon; Syed W. H. Rizvi; Christoph Gille; Herb P. von Schroeder

    2011-01-01

    The Melanophila acuminata beetle is attracted to forest fires via a pair of infrared sensory organs composed of sensilla. Our histological work showed that each sensillum contains lipid layers surrounding a protein layer and a unique polysaccharide base that is associated with a neuron to each sensillum. Infrared microscopy showed that the protein region maximally absorbs infrared radiation at 3 μm wavelength and at 10 μm, which corresponds to the known radiation produced by forest fires at 3 μm.Mathematical calculations showed that the physical properties of the sensilla are such that the expected temperature rise is insufficient for transduction of the infrared signal through mechanical means or as a thermal receptor as previously thought;hence the protein plays the pivotal role in perception of single photons and transmission of the signal within the sensilla.

  17. Controlled green synthesis of silver nanoparticles by Allium cepa and Musa acuminata with strong antimicrobial activity

    Science.gov (United States)

    Sahni, Geetika; Panwar, Amit; Kaur, Balpreet

    2015-02-01

    A controlled "green synthesis" approach to synthesize silver nanoparticles by Allium cepa and Musa acuminata plant extract has been reported. The effect of different process parameters, such as pH, temperature and time, on synthesis of Ag nanoparticles from plant extracts has been highlighted. The work reports an easy approach to control the kinetics of interaction of metal ions with reducing agents, stabilized by ammonia to achieve sub-10 nm particles with narrow size distribution. The nanoparticles have been characterized by UV-Visible spectra and TEM analysis. Excellent antimicrobial activity at extremely low concentration of the nanoparticles was observed against Escherichia coli, Pseudomonas aeruginosa, Bacillus subtilis and Fusarium oxysporum which may allow their exploitation as a new generation nanoproduct in biomedical and agricultural applications.

  18. Relationship Between Apoptosis and PCNA Expression of Keratinocytes in Condylomata Acuminata

    Institute of Scientific and Technical Information of China (English)

    樊翌明; 马泽粦; 冯进云; 吴志华; 李顺凡

    2002-01-01

    Objective: To investigate the relationship betweenapoptosis and proliferating cell nuclear antigen (PCNA)expression of keratinocytes in Condylomata acuminata (CA). Methods: PCNA expression was observed byimmunohistochemistry technique (ABC method) in 51 CAspecimens and 18 normal specimens of foreskin or vaginalmucosae. 55 specimens (40 in the CA group and 15 in thecontrol group) were randomly sampled for in situ labelingof apoptotic cells using the TUNEL method. Results: Positive expression of PCNA in CA and controlgroups were 90.2% and 77.8%, respectively, and theproliferation index in CA group was significantly higherthan that in the control group (P0.05). The proliferation indexshowed a significant negative correlation with theapoptosis-proliferation ratio (r=-0.62, P=0.01) in the CAgroup. Conclusion: It is suggested that the proliferativeappearance of CA could be due to the imbalance betweencell growth and cell death which is caused by moreproliferation and less apoptosis in keratinocytes.

  19. [Establishment of embryogenic cell suspension culture and plant regeneration of edible banana Musa acuminata cv. Mas (AA)].

    Science.gov (United States)

    Wei, Yue-Rong; Huang, Xue-Lin; Li, Jia; Huang, Xia; Li, Zhe; Li, Xiao-Ju

    2005-01-01

    Conventional breeding for dual resistance of disease and pest of Musa cultivars remains a difficult endeavor, as the plant is polyploidic and high in sterility. Biotechnological techniques, eg., genetic engineering, in vitro mutation breeding, or protoplast fusion, may overcome the difficulties and improve the germplasm. Establishment of a stable embryogenic cell suspension (ECS) is a prerequisite for any of the biotechnological breeding methods. In this study an embryogenic cell suspension was established from immature male flower of Musa acuminata cv. Mas (AA), a popular commercial variety of banana in the South-East Asian region. After culture for 5-6 months on callus induction media, which consisted of MS salts, different concentrations of 2,4-dichlorophenoxyacetic acid (2,4-D), 4.1 micromol/L biotin, 5.7 micromol/L indoleacetic acid (IAA), 5.4 micromol/L naphthaleneacetic acid (NAA), other vitamins, 87 mmol/L sucrose, and solidified with 7 g/L agarose, meristematic globules and yellow, friable embryogenic cultures were induced from the explants of 1-15th row young floral hands of immature male flowers. Of the four treatments of 2,4-D, 9 micromol/L was the most effective on the callus induction, it transformed 40.96% and 7.45% of the cultivated male floral hands into callus and embryogenic callus respectively. The explants to produce highest frequency of the embryogenic calli were floral hands of 6 to 12th rows, which generated 5.79% of the embryogenic calli. Suspension cultures were initiated from these embryogenic calli in liquid medium supplemented with 4.5 micromol/L 2, 4-D. After sieving selection of the cultures using a stainless steel metallic strainer with pore sizes of 154 microm at 15 day intervals for 3 months, homogeneous and yellow embryogenic cell suspensions, composed of single cells and small cell aggregates, were established. Based upon the growth quantity and growth rate of ECS, it was determined that the appropriate inoculum was 2.0 mL PCV

  20. Seasonal variation in abiotic factors and toxicity of thymol against the snail Lymnaea acuminata

    Directory of Open Access Journals (Sweden)

    Shefali Srivastava

    2013-01-01

    Full Text Available Toxicity of thymol against Lymnaea acuminata was conducted in each month of the year 2010-2011. The 24, 48, 72 and 96 h LC50 values of a molluscicide thymol were determined, with the concomitant estimation of levels of temperature, pH, dissolved oxygen, carbon dioxide and electrical conductivity, both in control and test water. On the basis of a 24h toxicity assay, it was observed that 24h LC50 value of 6.41 mg/l in month of May, was most effective in killing the snails, while the thymol was least effective in month of April, when its 24h LC50 was 15.25 mg/l. There was a significant positive correlation between LC50 of thymol and levels of carbon dioxide/ pH of water in corresponding months. On the contrary, a negative correlation was noted between LC50 of thymol and dissolved oxygen/ temperature of test water in the same months. In order to confirm that relationship between toxicity and abiotic factors is not coincidental, activity of acetylcholinesterase (AChE, acid phosphatase (ACP and alkaline phosphatase (ALP in the nervous tissue of control as well as sublethal thymol (60% of 24hLC50 treated snail, were assayed during each of the 12 months of the same year. A significant positive rank correlation was noted between AChE/ACP/ALP activity and corresponding sublethal treatment of thymol. Maximum inhibition of AChE, ACP and ALP activity was observed in the month of May. This study shows conclusively that the best time to control the L. acuminata population with thymol is during the month of May to July.

  1. Molluscicidal activity of Morus nigra against the freshwater snail Lymnaea acuminata

    Directory of Open Access Journals (Sweden)

    Farheen Hanif

    2012-01-01

    Full Text Available The molluscicidal activity of Morus nigra fruit, bark and leaf powder against the snail Lymnaea acuminata was time and concentration dependent. Toxicity of fruit powder (96h LC50: 166.92 mg/L was more pronounced in comparison to bark powder (96h LC50: 173.17 mg/L and leaf powder (96h LC50: 173.69 mg/L. Ethanolic extracts of M. nigra fruit, bark and leaf was more toxic than their other organic solvent extracts. The molluscicidal activity of ethanolic extract of M. nigra fruit powder (24h LC50: 116.23 mg/L was more effective than the ethanolic extract of bark powder (24h LC50: 154.41 mg/L and leaf powder (24h LC50: 139.80 mg/L. The 96h LC50 of column-purified fraction of M. nigra fruit powder was, 10.03 mg/L whereas that of bark and leaf powder was 8.69 mg/L and 4.97 mg/L, respectively. Column and thin layer chromatography analysis demonstrates that the active molluscicidal component in M. nigra is quercetin (96h LC50: 1.11 mg/L, apigenin (96h LC50: 1.92 mg/L and morusin (96h LC50: 2.12 mg/L, respectively. Co-migration of quercetin (Rf 0.49, apigenin (Rf 0.51 and morusin (Rf 0.52 with column-purified fruit, bark and leaf of M. nigra on thin layer chromatography demonstrates same Rf value. The present study indicates that M. nigra may be used as potent source of molluscicides against the snail Lymnaea acuminata.

  2. Toxicity of Chlorophyllin against Lymnaea acuminata at Different Wavelengths of Visible Light.

    Science.gov (United States)

    Chaturvedi, Divya; Singh, Vinay Kumar

    2016-08-01

    Fasciolosis is a water and food-borne disease caused by the liver fluke Fasciola hepatica and Fasciola gigantica. This disease is widespread in different parts of the world. Lymnaeidae and Planorbidae snails are the intermediate hosts of these flukes. Snail population management is a good tool to control fasciolosis because gastropods represent the weakest link in the life-cycle of trematodes. Chlorophyll can be extracted from any green plant. Chlorophyllin was prepared from spinach in 100% ethanol by using different types of chemicals. The chlorophyll obtained from spinach was transformed into water-soluble chlorophyllin. In the present paper, toxicity of chlorophyllin against the snail Lymnaea acuminata was time and concentration dependent. The toxicity of extracted and pure chlorophyllin at continuous 4 h exposure of sunlight was highest with lethal concentration (LC50) of 331.01 mg/L and 2.60 mg/L, respectively, than discontinuous exposure of sunlight up to 8 h with LC50 of 357.04 mg/L and 4.94 mg/L, respectively. Toxicity of extracted chlorophyllin was noted in the presence of different monochromatic visible lights. The highest toxicity was noted in yellow light (96 h, LC50 392.77 mg/L) and the lowest in green light (96 h, LC50 833.02 mg/L). Chlorophyllin in combination with solar radiation or different wavelength of monochromatic visible lights may become a latent remedy against the snail L. acuminata. It was demonstrated that chlorophyllin was more toxic in sunlight. Chlorophyllin is ecologically safe and more economical than synthetic molluscicides which have the potential to control the incidence of fasciolosis in developing countries.

  3. Low plant density enhances gene dispersal in the Amazonian understory herb Heliconia acuminata.

    Science.gov (United States)

    Côrtes, Marina C; Uriarte, María; Lemes, Maristerra R; Gribel, Rogério; Kress, W John; Smouse, Peter E; Bruna, Emilio M

    2013-11-01

    In theory, conservation genetics predicts that forest fragmentation will reduce gene dispersal, but in practice, genetic and ecological processes are also dependent on other population characteristics. We used Bayesian genetic analyses to characterize parentage and propagule dispersal in Heliconia acuminata L. C. Richard (Heliconiaceae), a common Amazonian understory plant that is pollinated and dispersed by birds. We studied these processes in two continuous forest sites and three 1-ha fragments in Brazil's Biological Dynamics of Forest Fragments Project. These sites showed variation in the density of H. acuminata. Ten microsatellite markers were used to genotype flowering adults and seedling recruits and to quantify realized pollen and seed dispersal distances, immigration of propagules from outside populations, and reproductive dominance among parents. We tested whether gene dispersal is more dependent on fragmentation or density of reproductive plants. Low plant densities were associated with elevated immigration rates and greater propagule dispersal distances. Reproductive dominance among inside-plot parents was higher for low-density than for high-density populations. Elevated local flower and fruit availability is probably leading to spatially more proximal bird foraging and propagule dispersal in areas with high density of reproductive plants. Nevertheless, genetic diversity, inbreeding coefficients and fine-scale spatial genetic structure were similar across populations, despite differences in gene dispersal. This result may indicate that the opposing processes of longer dispersal events in low-density populations vs. higher diversity of contributing parents in high-density populations balance the resulting genetic outcomes and prevent genetic erosion in small populations and fragments.

  4. Toxicity of Chlorophyllin against Lymnaea acuminata at Different Wavelengths of Visible Light

    Science.gov (United States)

    Chaturvedi, Divya; Singh, Vinay Kumar

    2016-01-01

    Fasciolosis is a water and food-borne disease caused by the liver fluke Fasciola hepatica and Fasciola gigantica. This disease is widespread in different parts of the world. Lymnaeidae and Planorbidae snails are the intermediate hosts of these flukes. Snail population management is a good tool to control fasciolosis because gastropods represent the weakest link in the life-cycle of trematodes. Chlorophyll can be extracted from any green plant. Chlorophyllin was prepared from spinach in 100% ethanol by using different types of chemicals. The chlorophyll obtained from spinach was transformed into water-soluble chlorophyllin. In the present paper, toxicity of chlorophyllin against the snail Lymnaea acuminata was time and concentration dependent. The toxicity of extracted and pure chlorophyllin at continuous 4 h exposure of sunlight was highest with lethal concentration (LC50) of 331.01 mg/L and 2.60 mg/L, respectively, than discontinuous exposure of sunlight up to 8 h with LC50 of 357.04 mg/L and 4.94 mg/L, respectively. Toxicity of extracted chlorophyllin was noted in the presence of different monochromatic visible lights. The highest toxicity was noted in yellow light (96 h, LC50 392.77 mg/L) and the lowest in green light (96 h, LC50 833.02 mg/L). Chlorophyllin in combination with solar radiation or different wavelength of monochromatic visible lights may become a latent remedy against the snail L. acuminata. It was demonstrated that chlorophyllin was more toxic in sunlight. Chlorophyllin is ecologically safe and more economical than synthetic molluscicides which have the potential to control the incidence of fasciolosis in developing countries. PMID:27688849

  5. Variación del contenido foliar de nutrimentos de alnus acuminata

    Directory of Open Access Journals (Sweden)

    Manuel Segura

    2006-01-01

    Full Text Available Se encontró que la posición de las muestras en la copa provenientes de árboles de 3 y 5 años de A. acuminata no afecta la concentración foliar para la mayoría de los nutrimentos de manera significativa. La única excepción la constituye el Ca en árboles de 5 años, cuya concentración en la parte alta fue menor que en la parte media de la copa. Aunque no significativa, se observó que la concentración de Fe, Mn y Zn tiende a ser mayor en la sección alta externa de la copa a los 3 años; mientras que, a la edad de 5 años tiende a ser mayor en la parte media externa de la copa. No se observó diferencias significativas en la concentración foliar de los nutrimentos con la edad de la plantación entre 2 y 8 años, en ninguna de las épocas comparadas, excepto para el Mn, elemento que tiende a disminuir con la edad de las plantaciones (86 a 26 mg kg-1. La concentración foliar de Mg, Fe, Zn, Mn, Cu y B fue mayor durante la época seca que durante la época lluviosa, mientras que los contenidos foliares de N y P fueron más elevados durante la época lluviosa y no se observó variación alguna en las concentraciones foliares de Ca, K y S debidas la época de muestreo. Con base a lo encontrado, se define en forma tentativa los niveles críticos foliares para la especie A. acuminata.

  6. Pessegueiro: cultivar BRS kampai Peach cultivar BRS kampai

    Directory of Open Access Journals (Sweden)

    Maria do Carmo Bassols Raseira

    2010-12-01

    Full Text Available RESUMO O programa de Melhoramento Genético de Pessegueiros da Embrapa Clima Temperado tem, entre seus objetivos, a obtenção de cultivares produtoras de frutas para consumo in natura, com características que satisfaçam às exigências dos consumidores. Alguns dos grandes centros consumidores, como é o caso de São Paulo e Curitiba, preferem pêssegos de polpa branca e sabor doce. A cultivar BRS Kampai, obtida de um cruzamento entre 'Chimarrita' e 'Flordaprince', alia a baixa necessidade em frio, o que é uma vantagem em regiões subtropicais, à boa aparência, com sabor superior a qualquer um dos parentais. A colheita dos frutos desta cultivar inicia-se geralmente, em meados de novembro, em Pelotas-RS (em Atibaia, São Paulo, inicia-se na segunda quinzena de outubro, poucos dias antes das cultivares Rubimel (polpa amarela e Premier (polpa branca, sendo ótima substituta para esta última.The peach breeding program of Embrapa Clima Temperado has, among the objectives the development of fresh market cultivars that fulfill the consumer's preference. Some of the largest consumer centers, such as São Paulo and Curitiba, prefer white flesh peaches with sweet flavor. Cultivar BRS Kampai originated from a cross between 'Chimarrita' and 'Flordaprince', adds the low chilling requirement, advantageous for subtropical areas, to the good appearance and flavor superior to any of the parents. The harvest period of this cultivar begins mid November, in Pelotas, RS, a few days before Rubimel (yellow flesh and Premier (white flesh cultivars (and in the second half of October, in Atibaia, SP being a good substitute for the later.

  7. Cultivar development of allogamous crops

    National Research Council Canada - National Science Library

    Souza Jr., Cláudio Lopes de

    2011-01-01

    .... It was reviewed the genetic structure of these species and its relationship with the development of cultivars, the technologies used to develop hybrids and improved open-pollinated varieties and their F1...

  8. How to maintain improved cultivars

    NARCIS (Netherlands)

    Parlevliet, J.E.

    2007-01-01

    Improved cultivars loose their identity and healthiness unless maintained properly. Contaminating and degrading forces, such as outcrossing, volunteer plants, mixing, natural selection, mutation and seed-borne diseases, are at the root of this. Maintenance selection can prevent this deterioration.

  9. BRS Progresso – Rye cultivar

    Directory of Open Access Journals (Sweden)

    Alfredo do Nascimento Junior

    2014-10-01

    Full Text Available The rye cultivar BRS Progresso, developed by the Brazilian Agricultural Research Corporation (Embrapa, is the result of a synthetic cross of 18 open-pollinated, self-incompatible lines, resistant to stem rust.

  10. Ectomycorrhizae between Alnus acuminata H.B.K. and Naucoria escharoides (Fr.:Fr.) Kummer from Argentina.

    Science.gov (United States)

    Becerra, Alejandra; Daniele, Graciela; Domínguez, Laura; Nouhra, Eduardo; Horton, Tom

    2002-04-01

    Field ectomycorrhizae of Naucoria escharoides on Alnus acuminata ("andean alder", "aliso del cerro") are described in detail for the first time. Naturally occurring ectomycorrhizal roots were sampled beneath sporocarps of N. escharoides. The samples were taken from four natural forest plots at two homogeneous A. acuminata sites (Tucumán and Catamarca Provinces, Argentina). The ectomycorrhizae were characterized morphologically and compared by means of PCR/RFLP analysis of the internal transcribed spacer region of the nuclear rDNA. The most important morphological features of the ectomycorrhizae are a white to pale yellow mantle, simple to monopodial branches, hyaline emanating hyphae, abundant hyphal bundles emerging more or less perpendicularly from a plectenchymatous mantle, and an acute or rounded apex with or without a mantle. N. escharoides fruitbodies have white basal mycelium with emanating hyphae similar to those of andean alder ectomycorrhizae. The RFLP profiles of sporocarps and mycorrhizae were the same.

  11. Micropropagation of four blueberry cultivars

    Directory of Open Access Journals (Sweden)

    Arturo Brenes Angulo

    2015-06-01

    Full Text Available Sharpblue, Woodard, Bonita and Delite cultivars were propagated from leaf explants. Leaf sections from in vitro singlenode explants were compared with those from plants in the field. The explants were placed in WPM medium supplemented with 1.5 mg.l-1 TDZ to promote sprouting, then subcultured to fresh WPM medium supplemented with 0.5 or 1.0 mg.l-1 zeatin to enhance adventitious shoot growth. Shoot clump length and number of shoots >2mm and >1cm in each clump were determined. Shoots 8 to 10 cm were harvested at 8 weeks and subcultured in WPM medium supplemented with 0, 1, 2, 4 or 8 mg.l-1 IBA for rooting. After 10 weeks, shoots were transplanted to greenhouse for acclimatization. The leaf segments cultured in WPM medium with TDZ formed adventitious shoot clumps in all varieties, regardless of leaf source. A significant effect of cultivar, source of explant and interaction cultivar x leaf source was found for shoots >2 mm. Clump size varied significantly among cultivars, leaf source, and interaction cultivars x source x zeatin concentration, when transfering to a medium with 2 concentrations of the growth regulator, but no differences due to cytokinin concentration were found. Number of shoots >2mm and length of the longest shoot varied significantly with cultivar and the interaction cultivar x source of explant in WPM + zeatin medium. Woodard explants from in vitro leaf sections produced the highest number of shoots (44.70±13.34 and Delite the lowest (21.50±4.99. Shoots subcultured in WPM with different IBA concentrations had les than 10% rooting in all treatments. However, when transplanted to greenhouse 100% rooting was obtained, regardless of in vitro treatment with IBA or leaf explant source. All the microshoots of the 4 cultivars were successfully greenhouse acclimatized and plantlets later established in the field.

  12. Bait Formulations of Chlorophyllin against Infected/Uninfected Lymnaea acuminata in Red and Sunlight

    OpenAIRE

    Navneet Kumar; Vinay Kumar Singh

    2015-01-01

    Control of snail population is an important tool in fasciolosis control programme. In order to achive this objective the method of bait formulation containing an attractant and a molluscicide is an appropriate approach to ensure the death of host snail. Chlorophyllin bait pellets were prepared by addition of attractants starch (10 mM)/serine (20 mM) and Chlorophyllin 2% agar solution. These baits were used against host snail Lymnaea acuminata. The behavioral response of snail against attracta...

  13. Tertiary combination of freeze-dried urine of Indian breeds of cow with plant products against snail Lymnaea acuminata.

    Science.gov (United States)

    Kumar, Shiv; Singh, D K; Singh, Vinay Kumar

    2012-10-15

    Snail Lymnaea acuminata is the intermediate host of liver fluke Fasciola gigantica, which cause endemic fasciolosis among cattle population of eastern Uttar Pradesh. Control of snail population by molluscicides is one of the effective methods to control fasciolosis. In the present study molluscicidal activity of tertiary combination of freeze-dried urine of different Indian breeds of cow Sahiwal, Geer and Tharparkar with Annona squamosa seed powder, Ferula asafoetida root latex, Azadirachta indica oil and Camellia sinensis leaves have been tested against Lymnaea acuminata. It was noted that the toxicity of tertiary combination (1:1:5) of cow urine kept for 15 days in sunlight or laboratory condition with different plant products were highly toxic against snail L. acuminata. 96 h LC50 of tertiary combinations with Sahiwal urine kept for 15 days in sunlight with A. squamosa, F. asafoetida, A. indica oil and C. sinensis were 35.47 mg L(-1), 37.13 mg L(-1), 33.66 mg L(-1), respectively higher than the Geer and Tharparkar. The toxicity of Sahiwal urine kept for 15 days in laboratory condition with A. squamosa and C. sinensis (96 h LC50 28.28 mg L(-1)) was more potent than the all other combinations. Cow urine in combination with plant product can be used for effective control of snail.

  14. Feeding of Bait to Snail Lymnaea acuminata and Their Effect on Certain Enzyme in the Nervous Tissue.

    Science.gov (United States)

    Kumar, Pradeep; Singh, V K; Singh, D K

    2012-01-01

    Fascioliasis, a snail-borne parasitic zoonosis, has been recognized for a long time because of its major veterinary and human impact. Different Bait formulations were fed to the snail Lymnaea acuminata in clear glass aquaria having diameter of 30 cm. Snail attractant containing bait formulations was prepared from different binary combination (1 : 1 ratio) of carbohydrates (glucose, starch 10 mM) and amino acid (methionine, histidine 10 mM) in 100 ml of 2% agar solution + sublethal (20% and 60% of 24 h and 96 h LC50) doses of different molluscicides (eugenol, ferulic acid, umbelliferone, and limonene). Snails fed on bait containing sub-lethal concentration of different molluscicides and the snail attractant, causing a significant inhibition in alkaline phosphatase (ALP) and acetylcholinesterase (AChE) activity in the nervous tissue of the vector snail L. acuminata. Maximum inhibition in ALP (20% of control) and AChE (49.49% of control) activity was observed in the nervous tissue of the L. acuminata exposed to 60% of 96 h LC50 of eugenol in the bait pellets containing starch + histidine, starch + methionine, respectively.

  15. Methods to classify maize cultivars in use efficiency and response to nitrogen

    Directory of Open Access Journals (Sweden)

    Cleiton Lacerda Godoy

    2013-10-01

    Full Text Available n plant breeding programs that aim to obtain cultivars with nitrogen (N use efficiency, the focus is on methods of selection and experimental procedures that present low cost, fast response, high repeatability, and can be applied to a large number of cultivars. Thus, the objectives of this study were to classify maize cultivars regarding their use efficiency and response to N in a breeding program, and to validate the methodology with contrasting doses of the nutrient. The experimental design was a randomized block with the treatments arranged in a split-plot scheme with three replicates and five N doses (0, 30, 60, 120 and 200 kg ha-1 in the plots, and six cultivars in subplots. We compared a method examining the efficiency and response (ER with two contrasting doses of N. After that, the analysis of variance, mean comparison and regression analysis were performed. In conclusion, the method of the use efficiency and response based on two N levels classifies the cultivars in the same way as the regression analysis, and it is appropriate in plant breeding routine. Thus, it is necessary to identify the levels of N required to discriminate maize cultivars in conditions of low and high N availability in plant breeding programs that aim to obtain efficient and responsive cultivars. Moreover, the analysis of the interaction genotype x environment at experiments with contrasting doses is always required, even when the interaction is not significant.

  16. Arbuscular mycorrhizal colonization of Alnus acuminata Kunth in northwestern Argentina in relation to season and soil parameters Colonización micorrícico arbuscular de Alnus acuminata Kunth en el noroeste argentino en relación a la estacionalidad y a los parámetros edáficos

    National Research Council Canada - National Science Library

    Alejandra Gabriela Becerra; Nilda Marta Arrigo; Norberto Bartoloni; Laura Susana Domínguez; María Noelia Cofré

    2007-01-01

    The objective of this study was to determine patterns of arbuscular mycorrhizal (AM) colonization of Alnus acuminata Kunth at two natural forests in relation to soil parameters at two different seasons...

  17. Content of free phenolic compounds in cultivars of potatoes harvested in Tenerife (Canary Islands).

    Science.gov (United States)

    Verde Méndez, Candelaria del Mar; Rodríguez Delgado, Miguel Angel; Rodríguez Rodríguez, Elena María; Díaz Romero, Carlos

    2004-03-10

    Determination of free phenolic compounds in potato samples was optimized using a high-performance liquid chromatographic (HPLC) method with on-line diode array detection. This method was applied to samples of four cultivars of potatoes harvested in Tenerife (Canary Islands). The free phenolic compounds found in the potato samples were (+)-catechin, chlorogenic acid, caffeic acid, p-coumaric acid, and ferulic acid. Potato samples belonging to Colorada cultivar, ssp. andigena, had mean concentrations of total phenolic compounds and chlorogenic acid higher than those found for Kerr's Pink and Cara cultivars, ssp. tuberosum, and for Negra cultivar, S. x chaucha. In contrast, p-coumaric acid was not detected in any potato samples of the Colorada cultivar. Traditional potatoes presented a higher mean concentration of ferulic acid than recently imported potatoes. A significant and negative correlation was established between (+)-catechin and p-coumaric acid. A considerable contribution to the daily intake of flavonoids was observed with the actual consumption of potatoes.

  18. Efficacy of topical imiquimod in HIV-positive patients with recurrent anal condylomata acuminata

    Directory of Open Access Journals (Sweden)

    Sidney Roberto Nadal

    2012-03-01

    Full Text Available INTRODUCTION: Imiquimod is a topical chemotherapic and immunostimulant agent with antitumoral and antiviral activities, used for anal condylomata acuminata treatment, mainly in recurrences. OBJECTIVE: Evaluate the imiquimod efficiency in chronic and recurrent anal condylomata acuminata in HIV-infected persons. METHOD: A prospective study that analyzed 61 patients with recurrent anal condylomata treated with topic 5% imiquimod, for at least 8 weeks. These patients had already been submitted to other topical and surgical treatments for anal warts. We evaluated the efficiency of this agent, through wart remission, with clinical examination and high-resolution anoscopy, CD4+ T lymphocyte count and side effects. The patients were 55 males and 6 females, from 22 to 63 years old. RESULTS: Remission was seen in 90%, being 46% complete remission and 44% partial remission. Other 10% did not respond to the treatment with imiquimod within the 16th week. Recurrences were observed in 11% of patients in 24-week follow-up. Statistics showed no differences in CD4+ T cell scores when groups with and without complete remission were compared. Adverse effects were reported by 45% of patients. They were mild to moderate burning (25%, intense burning (7%, ulcerative dermatitis (8% and systemic symptoms (5%. CONCLUSION: Imiquimod was effective in controlling recurrent anal condylomata acuminata in HIV-positive patients, regardless of CD4+ T cell count.INTRODUÇÃO: O imiquimode é agente tópico quimioterápico e imunoestimulante, com atividades antitumoral e antiviral, usado para tratamento dos condilomas acuminados perianais, principalmente os recidivantes. OBJETIVO: Avaliar a eficácia do imiquimode nos condilomas acuminados perianais crônicos e multirrecidivantes dos doentes soropositivos para o vírus da imunodeficiência adquirida (HIV. CASUÍSTICA E MÉTODO: Estudo clínico prospectivo por 12 meses em que observamos o uso tópico de imiquimode creme 5%, por no

  19. [Prevalence of condyloma acuminata in women who went to opportune detection of cervicouterine cancer].

    Science.gov (United States)

    Jiménez-Vieyra, Carlos Ramón

    2010-02-01

    It has been considered the incidence and the prevalence of the disease of sexual transmission with base in the different data banks. Unfortunately, each of these sources has limitations. To evaluate annual prevalence of genital condiloma acuminate in the women who go to opportune detection of cervicouterine cancer. Study realized in a first level of attention, the Zaragoza clinic of the System of Collective Transport Metro of Mexico City; of January of the year 2000 to June of year 2009. All the patients included themselves in the study that went to opportune detection of cervicouterine cancer. 3,232 cervicovaginal cytologist were realized of which 106 cases presented condylomata acuminata genital confirmed by clinic and biopsy, settling down an annual prevalence of 3.2%; the prevalence by ages the greater number of cases appear between the 30 and 34 years with rate of 21.6%. The prevalence of the infection by human virus papailoma varies in the different regions from the world; usually they reach from 20 to 30% in the women of 20 to 24 years of age and falls later to 3 to 10% in the women majors of 30 years. It is important to establish measures of prevention directed to prevent the contagion, exhorting to the adolescent population men and women to have a responsible sexuality.

  20. The banana (Musa acuminata) genome and the evolution of monocotyledonous plants.

    Science.gov (United States)

    D'Hont, Angélique; Denoeud, France; Aury, Jean-Marc; Baurens, Franc-Christophe; Carreel, Françoise; Garsmeur, Olivier; Noel, Benjamin; Bocs, Stéphanie; Droc, Gaëtan; Rouard, Mathieu; Da Silva, Corinne; Jabbari, Kamel; Cardi, Céline; Poulain, Julie; Souquet, Marlène; Labadie, Karine; Jourda, Cyril; Lengellé, Juliette; Rodier-Goud, Marguerite; Alberti, Adriana; Bernard, Maria; Correa, Margot; Ayyampalayam, Saravanaraj; Mckain, Michael R; Leebens-Mack, Jim; Burgess, Diane; Freeling, Mike; Mbéguié-A-Mbéguié, Didier; Chabannes, Matthieu; Wicker, Thomas; Panaud, Olivier; Barbosa, Jose; Hribova, Eva; Heslop-Harrison, Pat; Habas, Rémy; Rivallan, Ronan; Francois, Philippe; Poiron, Claire; Kilian, Andrzej; Burthia, Dheema; Jenny, Christophe; Bakry, Frédéric; Brown, Spencer; Guignon, Valentin; Kema, Gert; Dita, Miguel; Waalwijk, Cees; Joseph, Steeve; Dievart, Anne; Jaillon, Olivier; Leclercq, Julie; Argout, Xavier; Lyons, Eric; Almeida, Ana; Jeridi, Mouna; Dolezel, Jaroslav; Roux, Nicolas; Risterucci, Ange-Marie; Weissenbach, Jean; Ruiz, Manuel; Glaszmann, Jean-Christophe; Quétier, Francis; Yahiaoui, Nabila; Wincker, Patrick

    2012-08-09

    Bananas (Musa spp.), including dessert and cooking types, are giant perennial monocotyledonous herbs of the order Zingiberales, a sister group to the well-studied Poales, which include cereals. Bananas are vital for food security in many tropical and subtropical countries and the most popular fruit in industrialized countries. The Musa domestication process started some 7,000 years ago in Southeast Asia. It involved hybridizations between diverse species and subspecies, fostered by human migrations, and selection of diploid and triploid seedless, parthenocarpic hybrids thereafter widely dispersed by vegetative propagation. Half of the current production relies on somaclones derived from a single triploid genotype (Cavendish). Pests and diseases have gradually become adapted, representing an imminent danger for global banana production. Here we describe the draft sequence of the 523-megabase genome of a Musa acuminata doubled-haploid genotype, providing a crucial stepping-stone for genetic improvement of banana. We detected three rounds of whole-genome duplications in the Musa lineage, independently of those previously described in the Poales lineage and the one we detected in the Arecales lineage. This first monocotyledon high-continuity whole-genome sequence reported outside Poales represents an essential bridge for comparative genome analysis in plants. As such, it clarifies commelinid-monocotyledon phylogenetic relationships, reveals Poaceae-specific features and has led to the discovery of conserved non-coding sequences predating monocotyledon-eudicotyledon divergence.

  1. Bait Formulations of Chlorophyllin against Infected/Uninfected Lymnaea acuminata in Red and Sunlight

    Directory of Open Access Journals (Sweden)

    Navneet Kumar

    2015-01-01

    Full Text Available Control of snail population is an important tool in fasciolosis control programme. In order to achive this objective the method of bait formulation containing an attractant and a molluscicide is an appropriate approach to ensure the death of host snail. Chlorophyllin bait pellets were prepared by addition of attractants starch (10 mM/serine (20 mM and Chlorophyllin 2% agar solution. These baits were used against host snail Lymnaea acuminata. The behavioral response of snail against attractant (starch/serine and chlorophyllin was examined in red and sunlight. The fraction of snail that was in contact with chlorophyllin bait in zone-3 was used as measure of attraction process. Infected snails were more attracted with red light+starch (57.7%. Uninfected snails were more attracted by red light+serine (58.0%. The molluscicidal activity of chlorophyllin against infected snails in red light (96h LC50-1.88% chlorophyllin in bait and sunlight (96h LC50-2.40% chlorophyllin in bait was more pronounced than uninfected snail in red light (96h LC50-1.76% Chlorophyllin in bait and sunlight (96h LC50-3.62% chlorophyllin in bait.

  2. Treatment of condyloma acuminata in pregnant women with cryotherapy combined with proanthocyanidins: Outcome and safety.

    Science.gov (United States)

    Yang, Li-Juan; Zhu, Dong-Ning; Dang, Yan-Ling; Zhao, Xiong

    2016-06-01

    Patients with condyloma acuminata (CA) during pregnancy represent a special risk group. The outcomes of many treatment methods for such cases are not satisfactory. The purpose of the present study was to evaluate the treatment outcome and safety of cryotherapy combined with proanthocyanidins (PCs) for CA in pregnant women. In this study, 46 pregnant women with CA were treated with cryotherapy combined with PCs. The lesions were sprayed with liquid nitrogen until the color of the wart changed from flesh colored to purple. A PC-containing formulation was then sprayed onto a non-woven fabric or single-layer gauze and applied to the affected area. The PC treatment was applied for 20 min, 2 or 3 times per day. All patients were followed up at 1 and 3 months. No visible warts remained after the cryotherapy and PC treatment. At the 1-month follow-up, only 1 case of recurrence was identified. At 3 months, 5 cases of recurrence were identified, and the recurrence rate was 10.9%. The satisfaction rate of the patients was 94% at 1 month and 87% at 3 months after treatment. All pregnancies resulted in healthy live births without delivery complications. Cryotherapy combined with PCs is indicated to be a safe and effective procedure and may serve as a treatment option for pregnant women with CA.

  3. Formulation and evaluation of semisolid jelly produced by Musa acuminata Colla (AAA Group) peels

    Institute of Scientific and Technical Information of China (English)

    Noor Azwani Mohd Rasidek; Mariam Firdhaus Mad Nordin; Kamyar Shameli

    2016-01-01

    Objective: To study the jelly formulation produced by Musa acuminata Colla (AAA Group) peels and evaluate its antioxidant properties which are related to the product quality. Methods: The formulations of peel jelly were established under two-level full factorial designs within two blocks and one center point. Regarding response optimizer, the amount of sugar and citric acid was obtained; hence, the peel jellies were produced. The evaluation of antioxidant properties was conducted by using total phenolic content (TPC) assay and 1,1 diphenyl-2-picrylhydrazyl (DPPH) free radical assay. Results: The TPC of peel powder varied from 91.8 to 602.26 mg gallic acid equivalents/100 g dry weight, and 5%–7% peel jellies had phenolic content ranging from 29.38 to 48.31 mg gallic acid equivalents/100 g dry weight. The results of DPPH test indicated that at 10 mg/mL, the peel powder showed 89% DPPH inhibition, while 7% peel jelly prominently exhibited 84% DPPH inhibition. The correlation between DPPH IC50 value and TPC of peel powder as well as peel jelly was quite reasonably high with correlation coefficient ranging from 0.843 7 to 0.995. Conclusions: TPC can be used as an indicator in assessing the antioxidant activity of fruits and vegetables. The present investigation reveals that TPC is mainly responsible for DPPH free radical scavenging capacity.

  4. Formulation and evaluation of semisolid jelly produced by Musa acuminata Colla(AAA Group) peels

    Institute of Scientific and Technical Information of China (English)

    Noor Azwani Mohd Rasidek; Mariam Firdhaus Mad Nordin; Kamyar Shameli

    2016-01-01

    Objective:To study the jelly formulation produced by Musa acuminata Colla(AAA Group) peels and evaluate its antioxidant properties which are related to the product quality.Methods:The formulations of peel jelly were established under two-level full factorial designs within two blocks and one center point.Regarding response optimizer,the amount of sugar and citric acid was obtained;hence,the peel jellies were produced.The evaluation of antioxidant properties was conducted by using total phenolic content(TPC)assay and 1,1 diphenyl-2-picrylhydrazyl(DPPH) free radical assay.Results:The TPC of peel powder varied from 91.8 to 602.26 mg gallic acid equivalents/100 g dry weight,and 5%-7% peel jellies had phenolic content ranging from 29.38 to 48.31 mg gallic acid equivalents/100 g dry weight.The results of DPPH test indicated that at 10 mg/mL,the peel powder showed 89% DPPH inhibition,while 7% peel jelly prominently exhibited 84% DPPH inhibition.The correlation between DPPH IC50 value and TPC of peel powder as well as peel jelly was quite reasonably high with correlation coefficient ranging from 0.843 7 to 0.995.Conclusions:TPC can be used as an indicator in assessing the antioxidant activity of fruits and vegetables.The present investigation reveals that TPC is mainly responsible for DPPH free radical scavenging capacity.

  5. Study of Post-Harvest Ambon Banana (Musa acuminata) Preservation Using X-Ray

    Science.gov (United States)

    Dwijananti, P.; Handayani, L.; Marwoto, P.; Iswari, R. S.

    2016-08-01

    An exposure to Ambon banana (Musa Acuminata) samples has been done by using X-rays with current, voltage and exposure time are control parameters. This study aimed to determine storage ability of the post-harvest sample. Five samples were exposured by x-rays with the dose of (3-5) × 10-14 Gy. The samples were stored at room temperature. Their mass and physical condition (color and smell) were evaluated every 3 days. It was found that the control sample which was not exposured by X-ray was ripe in the sixth day indicated by the yellow color and good smell of the banana. Meanwhile, the samples which were exposured by (3 - 5) × 10-14 Gy doze of X-ray looked fresher and still had green color. These samples showed their ripening in the ninth day and their mass decrease was (12-13)% which is lower than the control sample. The preservation of banana can be done through low-dose X-ray exposure.

  6. A randomized, controlled, molecular study of condylomata acuminata clearance during treatment with imiquimod.

    Science.gov (United States)

    Tyring, S K; Arany, I; Stanley, M A; Tomai, M A; Miller, R L; Smith, M H; McDermott, D J; Slade, H B

    1998-08-01

    Imiquimod, an immune response modifier, has been demonstrated to be safe and effective in the treatment of external genital and perianal warts caused by human papillomavirus (HPV). To identify the molecular mechanism(s) by which condylomata acuminata clear during topical treatment with imiquimod, wart skin biopsies were taken from patients before treatment, at treatment week 6, and at the end of treatment. Tissues were analyzed for HPV DNA and for mRNA of several cytokines and HPV gene products. Wart clearance was associated with evidence of tissue production of interferon-alpha, -beta, and -gamma and tumor necrosis factor-alpha. Regression of warts was strongly associated with a decrease in HPV DNA and in mRNA expression for both early and late viral proteins. Thus, topical imiquimod treatment of anogenital warts led to significant increases in local production of multiple interferon mRNAs and a significant reduction in virus load as measured by decreases in HPV DNA and mRNA for early HPV proteins.

  7. SOURCES OF MYCORRHIZAL INFECTION OF SHOREA ACUMINATA SEEDLINGS UNDER LABORATORY CONDITIONS

    Directory of Open Access Journals (Sweden)

    LEE Su SEE

    1995-01-01

    Full Text Available Uninoculated dipterocarp seedlings raised in normal field soil in nurseries were always found to have mycorrhizas after a few months. This study set out to determine whether dipterocarp seedlings could continue to grow and develop in the absence of mycorrhizas and also to determine possible sources of mycorrhizal infection of dipterocarp seedlings raised under laboratory conditions using Shorea acuminata as a typical example. Seedlings were planted in capped or uncapped perspex boxes containing sterile or non-sterile field soil and watered daily with sterile water or tap water. Seedling growth and development of mycorrhizas were monitored at monthly intervals for up to seven months. Seedlings grown in sterile soil remained uninfected after seven months while infection was found in some of the seedlings grown in normal soil regardless of whether they had been watered with tap water or sterile water. This showed that field soil (i.e. under grass far from the forest contained suitable inoculum for forest tree seedlings. Tap water and the air were not important sources of infection. However, mycorrhizal infection was very uneven indicating that the inoculum was probably very unevenly distributed in the soil or that the inoculum density was rather low. Seedlings grown in sterile soil showed better growth than those grown in normal soil and infection of roots by parasitic fungi in the latter was also observed.

  8. 中国球兰属新记录植物——长瓣球兰(Hoya acuminata)%Hoya acuminata (Wight) Benth.ex Hook.f.(Apocynaceae, Asclepiadoideae),A Newly Recorded Species from China

    Institute of Scientific and Technical Information of China (English)

    桂凌健; 彭玉德; 黄宝优; 兰小中; 余丽莹

    2017-01-01

    报道了夹竹桃科萝藦亚科长瓣球兰[Hoya acuminata (Wight) Benth.ex Hook.f.]在中国的新分布记录.长瓣球兰过去记录在不丹、印度东北部(Sikkim, Khasia)和缅甸,2015年在中国西南部的西藏墨脱县内、海拔1 577 m的山林树上发现长瓣球兰.该物种与景洪球兰相近,但前者枝条光滑无毛,每个花序着花3~5朵,花冠直径达5 cm,花冠裂片长2 cm.凭证标本存放于广西药用植物园标本馆(GXMG).%Hoya acuminata (Wight) Benth.ex Hook.f.is reported as a new record species of Apocynaceae, Asclepiadoideae from China.H.acuminata has been recorded in Bhutan, Sikkim, Khasia and Myanmar and it was found on a tree of dense moist forest in Medog County, China at the altitude of 1 577 m in 2015.It is related to H.chinghungensis, but differs in its branches quite glabrous, umbels 3-5 flowered, with corollas up to 5 cm in diameter and lobes 2 cm.The voucher specimens are preserved in the herbarium of Guangxi Botanical Garden of Medicinal Plants (GXMG).

  9. IPR 118 - Bread wheat cultivar

    Directory of Open Access Journals (Sweden)

    Carlos Roberto Riede

    2007-01-01

    Full Text Available Wheat cultivar IPR 118 developed by IAPAR has a good yield potential and is widely adapted. It is earlymaturing and moderately tolerant to shattering and soil aluminum, moderately resistant to leaf rust and presents high glutenstrength for bread-making. The overall yield exceeded controls by 13%.

  10. Evaluation of the Effectiveness of Nd: YAG Laser under Urethroscope in the Treatment of Intraurethral Condyloma Acuminata (CA) in Males

    Institute of Scientific and Technical Information of China (English)

    赵冬; 曾伟宏; 翟胜

    2001-01-01

    Objective: To evaluate the therapeutic effect of Nd:YAG laser under urethroscope for the treatment of intraurethral Candyloma Acuminata (CA) in males.Method: Nd:YAG laser under urethroscope was employed to remove the warts.Result: Seventeen patients out of eighteen cases with CA were cured after the first procedure. The ure rate was 94.4%.For second treatment, the cure rate was 100% and no relapse occurred after observation for 12 - 4 months.Conclusion: Nd:YAG laser by urethroscope is a very good method for the treatment of intraurethral CA.

  11. Ripening of fruits of 'Dwarf Prata' banana (Musa acuminata x Musa balbisiana, AAB group)irradiated and treated with calcium carbide

    Energy Technology Data Exchange (ETDEWEB)

    Martineli, Maristella [Instituto de Quimica. Universidade Federal do Rio de Janeiro (UFRJ), Rio de Janeiro, RJ (Brazil); Coneglian, Regina C.C.; Vasconcellos, Marco A.S.; Silva, Eduardo, E-mail: rccconeg@ufrrj.br, E-mail: masv@ufrrj.br [Departamento de Fitotecnia. Instituto de Agronomia. Universidade Federal Rural do Rio de Janeiro (UFRRJ), Seropedica, RJ (Brazil); Vital, Helio C., E-mail: vital@ctex.eb.br [Secao de Defesa Nuclear. Divisao de Defesa Quimica, Biologica e Nuclear. Centro Tecnologico do Exercito (CTEx), Guaratiba, Rio de Janeiro, RJ (Brazil)

    2011-07-01

    The competing effects resulting from the exposure of fruits of 'warf prata' banana (Musa acuminata x Musa balbisiana, AAB group) to gamma radiation and to calcium carbide have been investigated in this work. The fruits were harvested in a pre-climateric stage (green colored though physiologically developed) in the city of Jaiba, state of Minas Gerais, and gamma irradiated with doses of 0.25 or 0.50 kGy in a research irradiating facility at the Brazilian Army Technology Center (CTEx) in the city of Rio de Janeiro. Some samples were also exposed to calcium carbide for 32 hours in order to accelerate ripening. Quantitative estimates of peel color, disease index and fresh mass loss were performed for 9 days while the fruits were kept at an average temperature of 23 deg C. The analyses were performed in the Federal Rural University of Rio de Janeiro, located in the city of Seropedica. The following treatments or combination of processes have been tested: untreated (control); treated only with irradiation with doses of 0.25 kGy or 0.50 kGy; treated with irradiation with doses of 0.25 kGy or 0.50 kGy and then exposed to calcium carbide. The fruits treated solely with irradiation with 0.25 kGy exhibited a better response during the first days of storage, although their initial green coloration vanished with time. In addition, the fungi Colletotrichum musae and Lasidioplodia theobroma were detected in samples submitted to the combination of both processes. In contrast, such fungi were not observed in fruits that had only been exposed to 0.25 kGy and exhibited low disease indices. Also, 1-2 cm lesions were detected on fruits.(author)

  12. Genetic base of Brazilian irrigated rice cultivars

    Directory of Open Access Journals (Sweden)

    Hudson de Oliveira Rabelo

    2015-08-01

    Full Text Available The aim of this study was to estimate the genetic base of Brazilian irrigated rice cultivars released in the period from 1965 to 2012. The genealogies of the cultivars were obtained based on information from marketing folders, websites, crossings records, and scientific articles. The following factors were calculated: relative genetic contribution (RGC, accumulated genetic contribution (AGC, frequency (in percentage of each ancestor in the genealogy (FAG, number of ancestors that constitute each cultivar (NAC,number of ancestors responsible for 60%, 70%, 80% and 90% of the genetic base (NAGB, and average number of ancestor per cultivar (ANAC. The cultivars were also grouped based on the period of release (1965-1980, 1981-1990, 1991-2000 and 2001-2012. For each grouping, the previously described factors were also estimated. A total of 110 cultivars were studied and it was concluded that the genetic base of Brazilian irrigated rice cultivars is narrow.

  13. Comparative anatomy of leaflets of Zamia acuminata and Z. pseudomonticola (Zamiaceae in Costa Rica

    Directory of Open Access Journals (Sweden)

    Rafael Acuña-Castillo

    2013-06-01

    Full Text Available The genus Zamia is morphologically and ecologically the most diverse of the order Cycadales. Throughout its history this genus has been restricted to the New World and is presently almost entirely restricted to the Neotropics. Unusual anatomical traits of the leaflets, such as the sunken stomata and thick cuticle, are common in this and related genera. The objective of this research was to study and compare the leaflet anatomy of Zamia acuminata and Z. pseudomonticola and establish possible phylogenetic relationships between the anatomical traits and the near relatives of these species. The leaf material was obtained from living plants and then processed for electron microscopy study. We found that both species are very similar to each other and to Z. fairchildiana, and that they share several unusual traits with other species of the genus, such as the parenchyma morphology, the spatial distribution of tissues between the veins and the stomata morphology. The main differences between these species were seen in their fiber clusters and in the abundance of trichome basal cells on the epidermis. The anatomical similarities between the three species could be the result of their close phylogenetic relationship and the divergences between them could be the result of recent speciation during the Pleistocene, resulting from geological changes in Southern Costa Rica.Zamia es morfológica y ecológicamente el género más diverso del orden Cycadales. Este género siempre ha estado restringido a América, pero en la actualidad habita principalmente en la región neotropical. Características anatómicas inusuales en los foliolos como los estomas hundidos y las cutículas gruesas son comunes en Zamia y géneros afines. El objetivo de este trabajo consiste en comparar la anatomía de los foliolos de Zamia acuminata y Z. pseudomonticola y establecer posibles relaciones filogenéticas entre las características anatómicas y los parientes cercanos de esta

  14. The infrared sensilla in the beetle Melanophila acuminata as model for new infrared sensors

    Science.gov (United States)

    Schmitz, Helmut; Norkus, Volkmar; Hess, Norbert; Bousack, Herbert

    2009-05-01

    For the detection of forest fires the "fire-loving" (pyrophilous) jewel beetle Melanophila acuminata uses a pair of sensor arrays each consisting of about 90 infrared (IR) receptors which are located on either sides of the body. The IR receptors most likely have evolved from common contact hair mechanoreceptors. Compared to a mechanoreceptor, an IR receptor shows the following special features: (i) the formation of a complex cuticular sphere instead of the bristle; the sphere consists of a hard outer exocuticular shell as well as of an inner softer and spongy mesocuticular core. (ii) The enclosure of the dendritic tip of the mechanosensitive neuron inside the sphere in a fluid-filled inner pressure chamber which is connected with the system of microcavities and nanocanals in the mesocuticular core. Hence we propose that an IR sensillum most probably acts as a microfluidic converter of infrared radiation into an increase in internal pressure inside the sphere which is measured by the mechanosensitive neuron. Because the miniaturized receptors respond within a few milliseconds to a brief pulse of IR radiation an approach is made to develop technical IR sensors based on the Melanophila IR receptors. Numerical simulations of sensor performance suggest that the sensitivity of a single IR receptor is in the range of 15 mW/cm2. Theoretical calculations which are based on a hypothetical fire of defined temperature and size demonstrate that a beetle should be able to detect a forest fire from a distance of 10 km. A fluidfilled Golay cell was taken as a basis for the design of a first sensor prototype.

  15. Micropropagation of Malaxis acuminata D. Don: A Rare Orchid of High Therapeutic Value

    Directory of Open Access Journals (Sweden)

    Saranjeet Kaur

    2011-01-01

    Full Text Available Regeneration potential of pseudobulb segments of Malaxis acuminata, procured from in vitro grown cultures, was analysed in Mitra et al., 1976 medium and its combinations with growth adjuncts. Juvenility of the tissues and chemical stimulus emerged as important factors in eliciting response in the explants. The explants from relatively older pseudobulbs (greater than 0.5cm in length remained recalcitrant to regeneration whereas those representing younger ones (less than 0.5cm in length responded positively. The response frequency, pathway of regeneration, and time taken for their development into complete plantlets was directly related to the growth stimulus in the nutrient regime. Shoot buds were induced in an individual treatment with growth regulators (BAP/NAA; 1mg L-1 each whereas their combination [BAP (1.0 mg L-1 + NAA (1.0 mg L-1] promoted protocorm-like body formation in the explants. Additional activated charcoal invariably proved beneficial in accelerating the morphogenetic processes leading to plantlet development. NAA (1 mg L-1 impaired the response frequency and delayed subsequent morphogenetic processes leading to plantlet development. BAP+NAA (1.0 mg L-leach+AC (2 g L-1 was used best for early initiation, highest regeneration frequency, proliferation of protocorm-like bodies (PLB, and plantlet development. Plantlets were transferred to clay pots containing potting mixture (sand, soil, leaf compost in the ratio of 1:1:1. Nearly 70-80% of plantlets survival was recorded. Histological investigation confirmed that neoformations were dermal and multicellular in origin.

  16. Serological test results of sexually transmitted diseases in patients with condyloma acuminata.

    Science.gov (United States)

    Ünal, Emine; Gönül, Müzeyyen; Çakmak, Seray; Yalçınkaya Iyidal, Ayşegül; Kılıç, Arzu; Gül, Ülker; Doner, Pinar

    2015-08-01

    Human papillomavirus (HPV) is one of the most common causes of sexually transmitted diseases (STD). The incidence of condyloma acuminata (CA) has increased in recent years. To determine demographical features and serological test results of STD in patients with CA. A cross-sectional survey was conducted on 94 patients presenting to a dermatology clinic in Ankara, Middle Anatolia, Turkey. Dermatological examinations were made and the patients completed a questionnaire which consisted of questions about their marital status, partners and condom use. In all cases, VDRL/RPR, anti-HIV, HBsAg, anti-HCV and in 57 cases - HSV type 1-2 IgM and IgG were studied. If the value of VDRL or RPR was positive, TPHA was conducted. In our study, 83 men and 11 women had CA. We could not analyze whether our cases had multiple partners and a habit of condom use as some of the patients did not answer questions about their sexual life. We observed VDRL and TPHA positivity in 3 (3.1%) cases, none of those cases had clinical findings of syphilis and they denied using any therapy for syphilis. HBsAg positivity was found in 3 cases. No anti-HIV and anti-HCV antibody positivity was detected. The seroprevalence of HBsAg in our study was similar to that of the general population of Turkey. But as we found positive syphilis serology in 3 patients, we suggest that syphilis serology should be investigated in patients with CA.

  17. 'Gloriosa': cultivar de alface americana tropicalizada 'Gloriosa': crisphead tropicalized cultivar

    Directory of Open Access Journals (Sweden)

    Fernando C. Sala

    2008-09-01

    Full Text Available 'Gloriosa' é uma cultivar de alface (Lactuca sativa L. americana tropicalizada e resistente a Thielaviopsis basicola. Foi selecionada a partir de variantes da cultivar Lucy Brown, pelo método genealógico. Progênies S1 a S6 foram selecionadas para resistência a T. basicola, características hortícolas, tolerância ao pendoamento precoce e adaptação ao cultivo de verão. Apresenta ciclo precoce de 40 a 50 dias pós-transplante, pendoamento lento, cabeças grandes e três camadas de folhas externas. Possui tolerância a Xanthomonas campestris pv. vitians e suporta o cultivo nos períodos de elevadas temperaturas e pluviosidade. Trata-se da primeira cultivar de alface americana tropicalizada no Brasil.'Gloriosa' is a tropicalized crisphead lettuce (Lactuca sativa L. resistant to Thielaviopsis basicola. It was derived by selection from cv. Lucy Brown variants by pedigree method. Progenies S1 to S6 were selected for T. basicola resistance, desirable horticulture traits, slowbolting and adaptation for Brazilian summer crop. It presents a precocious cycle within 40 to 50 days of being planted, slowbolting, large head and three layers of frame levels. It is tolerant to Xanthomonas campestris pv. vitians and is able to be grown under high temperature and rainy summer in southern of Brazil. It is the first crisphead lettuce type developed for tropical regions of Brazil.

  18. Effect of Fe Deficiency on Antioxidant System in Leaves of Three Flax Cultivars

    Directory of Open Access Journals (Sweden)

    Zeinab Abd El-Rahman SALAMA

    2009-06-01

    Full Text Available The potential role of antioxidant enzymes as well as antioxidant compounds in protecting plant from the deleterious effect of iron deficiency was examined in different flax Linum usitassimum L. cultivars. Three flax cultivars (Sakha 1, Sakha 2 and Giza 8 were grown in water culture with (Fe-sufficient plants, +Fe or without (Fe-deficient plants,-Fe iron supply for 40 days. The obtained results showed that, iron deficiency severely decreased dry weight and concentration of iron in all cultivars leaf tissue. Besides this, to verify whether iron deficiency could induce alteration in reactive oxygen species, high concentration of lipid peroxidation (TBARS and H2O2 content in leaves of flax cultivars were detected under (-Fe compared to (+Fe treatments. Iron deficiency can also modulate the content of glutathione (GSH level, which were significantly increased in Fe deficient treatment compared to Fe-sufficient treatment among cultivars. Activity of superoxide dismutase (SOD was increased under deficient treatment. In contrast, significant differences were observed between cultivars in the activity of Fe containing enzymes such as ascorbate peroxidase (APX, peroxidase (POD and catalase (CAT that was greater under Fe sufficient treatment, suggesting higher amounts of physiological iron in leaf tissue of all cultivars. In addition, some changes in POD isoenzyme profile was detected under iron stress.These results suggested that, these antioxidant compounds are the key compounds to protect cell from oxidative injury.

  19. Contrastive Lexicology.

    Science.gov (United States)

    Hartmann, R. R. K.

    This paper deals with the relation between etymologically related words in different languages. A survey is made of seven stages in the development of contrastive lexicology. These are: prelinguistic word studies, semantics, lexicography, translation, foreign language learning, bilingualism, and finally contrastive analysis. Concerning contrastive…

  20. Cultivar de soja BRS 205

    Directory of Open Access Journals (Sweden)

    Bonato Emídio Rizzo

    2002-01-01

    Full Text Available A BRS 205, cultivar de soja de ciclo semiprecoce, obtida do cruzamento [BR-16(2 x Ocepar 8] x Tracy-M, é indicada para o Rio Grande do Sul, em semeaduras de novembro. Possui crescimento determinado, plantas de flor branca, pubescência marrom, porte baixo e grãos de hilo preto. Tem resistência ao cancro-da-haste (Diaporthe phaseolorum f. sp. meridionalis, à podridão-parda-da-haste (Phialophora gregata, à mancha-olho-de-rã (Cercospora sojina e à pústula bacteriana (Xanthomonas axonopodis pv. glycines. É moderadamente resistente ao oídio (Microsphaera diffusa. O rendimento médio de grãos foi 6% e 11% superior ao das cultivares RS 7-Jacuí e BR-16, respectivamente.

  1. Genomic analysis of NAC transcription factors in banana (Musa acuminata) and definition of NAC orthologous groups for monocots and dicots.

    Science.gov (United States)

    Cenci, Albero; Guignon, Valentin; Roux, Nicolas; Rouard, Mathieu

    2014-05-01

    Identifying the molecular mechanisms underlying tolerance to abiotic stresses is important in crop breeding. A comprehensive understanding of the gene families associated with drought tolerance is therefore highly relevant. NAC transcription factors form a large plant-specific gene family involved in the regulation of tissue development and responses to biotic and abiotic stresses. The main goal of this study was to set up a framework of orthologous groups determined by an expert sequence comparison of NAC genes from both monocots and dicots. In order to clarify the orthologous relationships among NAC genes of different species, we performed an in-depth comparative study of four divergent taxa, in dicots and monocots, whose genomes have already been completely sequenced: Arabidopsis thaliana, Vitis vinifera, Musa acuminata and Oryza sativa. Due to independent evolution, NAC copy number is highly variable in these plant genomes. Based on an expert NAC sequence comparison, we propose forty orthologous groups of NAC sequences that were probably derived from an ancestor gene present in the most recent common ancestor of dicots and monocots. These orthologous groups provide a curated resource for large-scale protein sequence annotation of NAC transcription factors. The established orthology relationships also provide a useful reference for NAC function studies in newly sequenced genomes such as M. acuminata and other plant species.

  2. Alnus acuminata in dual symbiosis with Frankia and two different ectomycorrhizal fungi (Alpova austroalnicola and Alpova diplophloeus) growing in soilless growth medium

    Science.gov (United States)

    Alejandra G. Becerra; Euginia Menoyo; Irene Lett; Ching Y. Li

    2009-01-01

    In this study we investigated the capacity of Andean alder (Alnus acuminata Kunth), inoculated with Frankia and two ectomycorrhizal fungi (Alpova austroalnicola Dominguez and Alpova diplophloeus [Zeller and Dodge] Trappe and Smith), for nodulation and growth in pots of a soilless medium...

  3. Antitumor Effects and Biological Mechanism of Action of the Aqueous Extract of the Camptotheca acuminata Fruit in Human Endometrial Carcinoma Cells

    Directory of Open Access Journals (Sweden)

    Chi-Shian Lin

    2014-01-01

    Full Text Available The aqueous extracts of the leaves and fruit of Camptotheca acuminata have long been used in traditional Chinese medicine (TCM for treating cancer patients. The chemotherapeutic drug, camptothecin (CPT, and related analogs were first isolated from C. acuminata in the 1970s. Although the antitumor effects of CPT have been characterized in recent years, the antitumor effects of aqueous extracts of C. acuminata have not been clarified. The aims of our current study were to determine the tumor-suppression efficiency of an aqueous extract of the fruit of C. acuminata (AE-CA in the human endometrial carcinoma cell lines, HEC-1A, HEC-1B, and KLE, and compare its antitumor effects with those of CPT. Cell viability assays indicated that a dosage of AE-CA containing 0.28 mg/mL of CPT demonstrated enhanced cytotoxicity, compared with CPT treatment. The effects of AE-CA on the induction of cell cycle arrest, the accumulation of cyclin-A2 and -B1, and the activation of caspase-3 and caspase-7 were similar to those of CPT. Furthermore, AE-CA exhibited a synergistic effect on the cytotoxicity of cisplatin in HEC-1A and HEC-1B cells. These results indicated that AE-CA is a potent antitumor agent and can be combined with cisplatin for the treatment of human endometrial cancer.

  4. Microsporogenesis of Apricot Cultivars in Hungary

    Directory of Open Access Journals (Sweden)

    Veronika HAJNAL

    2013-12-01

    Full Text Available Like all phenological processes, microsporogenesis is mainly determined genetically, but its phenotypical expression is greatly influenced by environmental factors, particularly the temperature. During the 3-year experimental period, the process of microsporogenesis was examined in eight apricot cultivars originated in North America and in Romania. The Hungarian cultivar ‘Gönci magyar kajszi’ was used as the control. Based on the results it was possible to rank the cultivars in terms of their microsporogenesis schedule. The same order was found in all three years. This order also indicates the yield reliability of the cultivars. Endodormancy ended between January 10th and 25th in the buds of the earliest cultivar ‘Pinkcot’, but not until February 5-10th in the latest cultivar ‘Harlayne’. Three of the cultivars had faster flower bud development than the control, in the order ‘Pinkcot’, ‘Orange Red’ and ‘Harcot’. Growing these cultivars thus involves greater risk than for ‘Gönci magyar kajszi’ in Hungary, due to their rapid winter flower bud development. Some cultivars found to have slower flower bud development than ‘Gönci magyar kajszi’; ‘Litoral’, ‘Harogem’, ‘Comandor’, ‘Sirena’ and ‘Harlayne’ – thus these cultivars can be grown more reliably.

  5. High efficiency transformation of banana [Musa acuminata L. cv. Matti (AA)] for enhanced tolerance to salt and drought stress through overexpression of a peanut salinity-induced pathogenesis-related class 10 protein.

    Science.gov (United States)

    Rustagi, Anjana; Jain, Shalu; Kumar, Deepak; Shekhar, Shashi; Jain, Mukesh; Bhat, Vishnu; Sarin, Neera Bhalla

    2015-01-01

    Bananas and plantains (Musa spp. L.) are important subsistence crops and premium export commodity in several countries, and susceptible to a wide range of environmental and biotic stress conditions. Here, we report efficient, rapid, and reproducible Agrobacterium-mediated transformation and regeneration of an Indian niche cultivar of banana [M. acuminata cv. Matti (AA)]. Apical meristem-derived highly proliferative multiple shoot clump (MSC) explants were transformed with the Agrobacterium strain EHA105 harboring a binary vector pCAMBIA-1301 carrying hptII and uidA. Sequential agro-infiltration (10 min, 400 mmHg), infection (additional 35 min, Agrobacterium density A 600 = 0.8) and co-cultivation (18 h) regimen in 100 µM acetosyringone containing liquid medium were critical factors yielding high transformation efficiency (~81 %) corroborated by transient GUS expression assay. Stable transgenic events were recovered following two cycles of meristem initiation and selection on hygromycin containing medium. Histochemical GUS assay in several tissues of transgenic plants and molecular analyses confirmed stable integration and expression of transgene. The protocol described here allowed recovery of well-established putative transgenic plantlets in as little as 5 months. The transgenic banana plants could be readily acclimatized under greenhouse conditions, and were phenotypically similar to the wild-type untransformed control plants (WT). Transgenic plants overexpressing Salinity-Induced Pathogenesis-Related class 10 protein gene from Arachis hypogaea (AhSIPR10) in banana cv. Matti (AA) showed better photosynthetic efficiency and less membrane damage (P < 0.05) in the presence of NaCl and mannitol in comparison to WT plants suggesting the role of AhSIPR10 in better tolerance of salt stress and drought conditions.

  6. Micropropagación de la planta medicinalPsychotria acuminata

    Directory of Open Access Journals (Sweden)

    Alfonso Lara

    2003-01-01

    Full Text Available Psychotria acuminata es una planta medicinal que produce los alcaloides emetina, cephaelina y psychotrina, usados como expectorantes y eméticos. Hoy día estos alcaloides son extraídos de plantas silvestres pues esta especie no ha sido domesticada. Debido al uso potencial de los principios fitoquímicos, y a la escasa población de esta especie en el país, se desarrolló métodos de cultivo de tejidos para la reproducción clonal y masiva de esta planta. El material vegetal fue recolectado en 4 localidades de Costa Rica. En un medio de cultivo de Murashige y Skoog (MS, 1962, suplementado con 3 mg l-1 de BAP, 0,01 mg l-1 de ANA, 3% de azúcar y 2 g l-1 de phytagel, se logró la inducción de múltiples brotes a partir de las yemas axilares de microestacas (segmentos nodales de 1 cm de largo y de hojas provenientes de plántulas de 5 cm establecidas in vitro para 3 localidades. La formación de los brotes en las hojas ocurrió mediante organogénesis y embriogénesis. El enraizamiento in vitro de los brotes fue de un 100% cuando se utilizó un MS/2 suplementado con 6 mg l-1 de AIA. Debido a que el sistema radical generado in vitro muere una vez que las plántulas son sembradas en el sustrato en el invernadero, se utilizó Agriroot 1 DP® para generar raíces nuevas. Después de 8 semanas fue posible aclimatizar un 80% de las plántulas. La tasa de multiplicación, cuando se utiliza microestacas como explante, así como el tiempo para que ocurrieran los eventos morfogenéticos, fueron diferentes para los materiales de las 3 procedencias, lo que indica que las plantas de cada localidad son genéticamente diferentes.

  7. EIN3-like gene expression during fruit ripening of Cavendish banana (Musa acuminata cv. Grande naine).

    Science.gov (United States)

    Mbéguié-A-Mbéguié, Didier; Hubert, Olivier; Fils-Lycaon, Bernard; Chillet, Marc; Baurens, Franc-Christophe

    2008-06-01

    Ethylene signal transduction initiates with ethylene binding at receptor proteins and terminates in a transcription cascade involving the EIN3/EIL transcription factors. Here, we have isolated four cDNAs homologs of the Arabidopsis EIN3/EIN3-like gene, MA-EILs (Musa acuminata ethylene insensitive 3-like) from banana fruit. Sequence comparison with other banana EIL gene already registered in the database led us to conclude that, at this day, at least five different genes namely MA-EIL1, MA-EIL2/AB266318, MA-EIL3/AB266319, MA-EIL4/AB266320 and AB266321 exist in banana. Phylogenetic analyses included all banana EIL genes within a same cluster consisting of rice OsEILs, a monocotyledonous plant as banana. However, MA-EIL1, MA-EIL2/AB266318, MA-EIL4/AB266320 and AB266321 on one side, and MA-EIL3/AB266319 on the other side, belong to two distant subclusters. MA-EIL mRNAs were detected in all examined banana tissues but at lower level in peel than in pulp. According to tissues, MA-EIL genes were differentially regulated by ripening and ethylene in mature green fruit and wounding in old and young leaves. MA-EIL2/AB266318 was the unique ripening- and ethylene-induced gene; MA-EIL1, MA-EIL4/Ab266320 and AB266321 genes were downregulated, while MA-EIL3/AB266319 presented an unusual pattern of expression. Interestingly, a marked change was observed mainly in MA-EIL1 and MA-EIL3/Ab266319 mRNA accumulation concomitantly with changes in ethylene responsiveness of fruit. Upon wounding, the main effect was observed in MA-EIL4/AB266320 and AB266321 mRNA levels, which presented a markedly increase in both young and old leaves, respectively. Data presented in this study suggest the importance of a transcriptionally step control in the regulation of EIL genes during banana fruit ripening.

  8. NS Pudarka: A new winter wheat cultivar

    Directory of Open Access Journals (Sweden)

    Hristov Nikola

    2014-01-01

    Full Text Available The high-yielding, medium late winter wheat cultivar NS Pudarka was developed by crossing genetic divergent parents: line NMNH-07 and cv. NS 40S and Simonida. In cultivar NS Pudarka genes responsible for high yield potential, very good technological quality, resistance to lodging, low temperature and diseases, were successfully combined. It was registered by Ministry of agriculture, forestry and water management of Serbia Republic in 2013. This cultivar has wide adaptability and stability of yield that enable growing in different environments with optimal agricultural practice. On the base of technological quality this cultivar belongs to the second quality class, A2 farinograph subgroup and second technological group.

  9. Distinct cell surface appendages produced by Sinorhizobium fredii USDA257 and S. fredii USDA191, cultivar-specific and nonspecific symbionts of soybean

    Science.gov (United States)

    Sinorhizobium fredii USDA257 and S. fredii USDA191 are fast-growing rhizobia that form nitrogen-fixing nodules on soybean roots. In contrast to USDA191, USDA257 exhibits cultivar specificity and can form nodules only on primitive soybean cultivars. In response to flavonoids released from soybean ro...

  10. Use of multiline cultivars and cultivar mixtures for disease management.

    Science.gov (United States)

    Mundt, C C

    2002-01-01

    The usefulness of mixtures (multiline cultivars and cultivar mixtures) for disease management has been well demonstrated for rusts and powdery mildews of small grain crops. Such mixtures are more useful under some epidemiological conditions than under others, and experimental methodology, especially problems of scale, may be crucial in evaluating the potential efficacy of mixtures on disease. There are now examples of mixtures providing both low and high degrees of disease control for a wide range of pathosystems, including crops with large plants, and pathogens that demonstrate low host specificity, or are splash dispersed, soilborne, or insect vectored. Though most analyses of pathogen evolution in mixtures consider static costs of virulence to be the main mechanism countering selection for pathogen complexity, many other potential mechanisms need to be investigated. Agronomic and marketing considerations must be carefully evaluated when implementing mixture approaches to crop management. Practical difficulties associated with mixtures have often been overestimated, however, and mixtures will likely play an increasingly important role as we develop more sustainable agricultural systems.

  11. �Saruman� Apple Cultivar

    Directory of Open Access Journals (Sweden)

    Radu SESTRAS

    2010-06-01

    Full Text Available The apple cultivar Saruman was obtained at Fruit Research Station Cluj, Romania (FRS Cluj, and homologated in 2007. Saruman was released by hybridization between Cluj III-VI-5-26 selection (Parmain dOr, open pollinated and NJ 46. The trees are vigorous, spreading shape, and with medium crop yield. The fruits have large size, conic shape and mostly red (purple coloration; they have white flesh with a sweet, crisp, aromatic flavour and low acidity. Fruits become ripe in the last decade of August, first decade of September and the fruits are proper for dessert and well suited for cooking, applesauce, cider, pies.

  12. RESPONSE OF CABBAGE CULTIVARS TO BLACK ROT INFECTION

    African Journals Online (AJOL)

    Yield stability of white cabbage (Brassica oleracea var. capitata) cultivars were ... and stable cultivar(s) with adequate resistance to black rot caused by ..... Principles and Procedures of Statistics: ... black rot development in introduced cabbage.

  13. CULTIVAR IMPACT ON THE CHEMICAL CONTENT AND GRAIN TECHNOLOGICAL QUALITIES OF SOME DURUM WHEAT CULTIVARS

    Directory of Open Access Journals (Sweden)

    Tanko Kolev

    2011-11-01

    Full Text Available A comparative experiment was carried out with five Bulgarian and five foreign durum wheat cultivars. The aim of the experiment was to determine the chemical content and grain technological quality of some Bulgarian and foreign durum wheat cultivars grown under the agriecological conditions of Southern Bulgaria. The Vazhod cultivar proved to give the highest durum wheat grain yield, followed by Beloslava cultivar. Out of the foreign durum wheat cultivars the Durumko was notable for its higher productivity. The crude protein content in the grain was highest in Zagorka, Yavor and Yukon. The highest yield of gluten was reported in Beloslava, Vazhod and Zagorka.

  14. Cannabis - from cultivar to chemovar.

    Science.gov (United States)

    Hazekamp, A; Fischedick, J T

    2012-01-01

    The medicinal use of Cannabis is increasing as countries worldwide are setting up official programs to provide patients with access to safe sources of medicinal-grade Cannabis. An important question that remains to be answered is which of the many varieties of Cannabis should be made available for medicinal use. Drug varieties of Cannabis are commonly distinguished through the use of popular names, with a major distinction being made between Indica and Sativa types. Although more than 700 different cultivars have already been described, it is unclear whether such classification reflects any relevant differences in chemical composition. Some attempts have been made to classify Cannabis varieties based on chemical composition, but they have mainly been useful for forensic applications, distinguishing drug varieties, with high THC content, from the non-drug hemp varieties. The biologically active terpenoids have not been included in these approaches. For a clearer understanding of the medicinal properties of the Cannabis plant, a better classification system, based on a range of potentially active constituents, is needed. The cannabinoids and terpenoids, present in high concentrations in Cannabis flowers, are the main candidates. In this study, we compared cultivars obtained from multiple sources. Based on the analysis of 28 major compounds present in these samples, followed by principal component analysis (PCA) of the quantitative data, we were able to identify the Cannabis constituents that defined the samples into distinct chemovar groups. The study indicates the usefulness of a PCA approach for chemotaxonomic classification of Cannabis varieties.

  15. Effects of Soybean Cultivars on Soymilk Quality

    Directory of Open Access Journals (Sweden)

    Aziadekey, M.

    2001-01-01

    Full Text Available Soymilk was prepared from twelve soybean cultivars grown under the same environmental conditions to evaluate their effects on soymilk characteristics. Significant correlations were observed between the Chemical composition of the seeds and the resultant soymilk. Soymilk solids were significantly affected by seed size and seed phosphorus contents. Cultivars with dark hilum produced soymilk with less attractive colour.

  16. Effects of medium nutrition on cell growth and isocamptothecin A and B production by suspension cell culture of Camptotheca acuminata

    Institute of Scientific and Technical Information of China (English)

    Zhang Dongyan; Yu Fang; Bai Fengwu; An Lijia

    2006-01-01

    The effects of initial sucrose concentration, nitrate to ammonium ratio, total N concentration and phosphate concentration in medium on cell growth and isocamptothecin A and B synthesis by suspension cell culture of Camptotheca acuminata were investigated in 250 mL shake flasks. 30 g L-1 sucrose concentration was beneficial to secondary metabolites synthesis. The cell growth and metabolites synthesis were also affected by the ratio of NO-3/NH+4, and nitrate was favourable for cell growth. The maximum dry weight was achieved when nitrate was used as the sole N source. The effect of total initial N on the cell cultures was also investigated with NO-3/NH+4 ratio of 1∶2. The final dry cell weight was similar throughout culture period and 50 mM initial N was favourable for secondary metabolite synthesis. 50 mM initial phosphate concentration facilitated both cell growth and secondary metabolites synthesis.

  17. Anatomical and molecular characterization of Lactarius aff. omphaliformis, Russula alnijorullensis and Cortinarius tucumanensis ectomycorrhizae on Alnus acuminata.

    Science.gov (United States)

    Becerra, Alejandra; Beenken, Ludwig; Pritsch, Karin; Daniele, Graciela; Schloter, Michael; Agerer, Reinhard

    2005-01-01

    Ectomycorrhizae (ECM) of Lactarius aff. omphaliformis Romagn., Russula alnijorullensis (Sing.) Sing. and Cortinarius tucumanensis Mos. on Andean alder (Alnus acuminata Kunth) were characterized and identified. The identification of the fungal symbionts was achieved by morpho-anatomical observations of mycorrhizae and by comparison of ITS-RFLP patterns obtained from ECM and fruitbodies. L. aff omphaliformis ECM differed in some morphological details such as ramification and mantle type from ECM of the same species on A. glutinosa. L. aff omphaliformis ECM show an orange to ochre mantle containing latex cells, which stain with sulpho-vanillin, emanating hyphae without clamps. R. alnijorullensis ECM represent a typical Russula-type-ECM, light yellow to pinkish, the outer mantle being composed of triangular latex-filled cells staining with sulpho-vanillin, emanating hyphae without clamps. C. tucumanensis ECM exhibit a white (silvery) to yellowish brown mantle covered with soil particles, emanating hyphae with clamps.

  18. �Saruman� Apple Cultivar

    Directory of Open Access Journals (Sweden)

    Radu SESTRAS

    2010-06-01

    Full Text Available The apple cultivar �Saruman� was obtained at Fruit Research Station Cluj, Romania (FRS Cluj, and homologated in 2007. �Saruman� was released by hybridization between �Cluj III-VI-5-26� selection (�Parmain d�Or�, open pollinated and �NJ 46�. The trees are vigorous, spreading shape, and with medium crop yield. The fruits have large size, conic shape and mostly red (purple coloration; they have white flesh with a sweet, crisp, aromatic flavour and low acidity. Fruits become ripe in the last decade of August, first decade of September and the fruits are proper for dessert and well suited for cooking, applesauce, cider, pies.

  19. �Sauron� Apple Cultivar

    Directory of Open Access Journals (Sweden)

    Radu SESTRAS

    2010-06-01

    Full Text Available The new apple cultivar Sauron was obtained at Fruit Research Station Cluj, Romania (FRS Cluj, and homologated in 2007. Sauron was identified in open pollinated population of Cluj 3/83 selection [Cluj III-VI-5-26 selection (Parmain dOr, open pollinated x NJ 46]. The trees have moderate vigour, upright then spread, with moderate productivity. Fruits are medium to large, usually red, with a portion being greenish or yellow-green and purple red vertically striped. The fruit has good quality, being soft eating apple due to their lack of crispness. Quality indices include firmness, crispness and excellent flavour. Fruits become ripe between 15 August and 5 September and the fruits are good quality, being proper for dessert and industrialization (juice, applesauce, pies, and cider.

  20. �Sauron� Apple Cultivar

    Directory of Open Access Journals (Sweden)

    Radu SESTRAS

    2010-06-01

    Full Text Available The new apple cultivar �Sauron� was obtained at Fruit Research Station Cluj, Romania (FRS Cluj, and homologated in 2007. �Sauron� was identified in open pollinated population of �Cluj 3/83� selection [�Cluj III-VI-5-26� selection (�Parmain d�Or�, open pollinated x �NJ 46�]. The trees have moderate vigour, upright then spread, with moderate productivity. Fruits are medium to large, usually red, with a portion being greenish or yellow-green and purple red vertically striped. The fruit has good quality, being soft eating apple due to their lack of crispness. Quality indices include firmness, crispness and excellent flavour. Fruits become ripe between 15 August and 5 September and the fruits are good quality, being proper for dessert and industrialization (juice, applesauce, pies, and cider.

  1. Cultivar de soja BRS 66

    Directory of Open Access Journals (Sweden)

    Bertagnolli Paulo Fernando

    2002-01-01

    Full Text Available BRS 66, oriunda do cruzamento BR 83-147 x FT-Abyara, é indicada para cultivo no Rio Grande do Sul. Na média de 21 ambientes no RS, no período de 1993/94 a 1995/96, essa cultivar apresentou rendimento médio de grãos de 2.883 kg/ha. Apresenta resistência ao cancro-da-haste, à podridão-parda-da-haste, à mancha-olho-de-rã, à raça 1 de Phytophthora sojae, à pústula-bacteriana e ao oídio. Tem flor branca, pubescência marrom, tegumento da semente amarelo-fosco, hilo marrom e tipo de crescimento determinado. É de ciclo médio e apresenta estatura da planta de média a alta, com boa resistência ao acamamento.

  2. Relation between the concentration of Dinophysis acuminata and diarrheic shellfish poisoning toxins in blue mussels (Mytilus edulis) during a toxic episode in the Limfjord (Denmark), 2006

    DEFF Research Database (Denmark)

    Jørgensen, Kevin; Andersen, Per

    2008-01-01

    were observed. The maximum concentration level of approximately 600-700 mu g OA equivalents kg(-1) was reached at approximately 5,000 cells1(-1) of D. acuminata. A further increase in the concentration of D. acuminata did not lead to any further increase in the concentration of OA in the blue mussels...... equivalents in the raw blue mussels was 706 mu g/kg. Single cell toxicity measurements showed a mean content of 31 pg OA cell(-1) (min 19; max 72 pg OA cell(-1)). The impact of the concentration procedure was investigated using a range of volumes filtered from 0,21-101 filter(-1). Toxins were lost during...

  3. Evaluación in vitro de compuestos presentes en Critoniella acuminata y Salvia rubescens frente a enzimas de desgranulación leucocitaria

    OpenAIRE

    Jaimes Galvis, Diana Carolina

    2010-01-01

    En el presente trabajo se implementaron técnicas in vitro con el fin de contribuir al estudio farmacológico de principios activos de plantas medicinales colombianas con potencial antiinflamatorio como: ayapina, aislada de Critoniella acuminata, amarisolide y arbutina aisladas de Salvia rubescens previamente en el Grupo de Investigación de Principios Bioactivos de Plantas. Se evaluaron enzimas relacionadas con el proceso de desgranulación leucocitaria: Mieloperoxidasa, Elastasa, Lisozima y Bet...

  4. Bait formulations of molluscicides and their effects on biochemical changes in the ovotestis of snail Lymnaea acuminata (Mollusca; Gastropoda:Lymnaeidae

    Directory of Open Access Journals (Sweden)

    Pradeep Kumar

    2011-10-01

    Full Text Available The effect of sub-lethal feeding of bait formulations containing molluscicidal component of Ferula asafoetida (ferulic acid, umbelliferone, Syzygium aromaticum (eugenol and Carum carvi (limonene on biochemical changes in the ovotestis of snail Lymnaea acuminata were studied. Bait formulations feeding to L. acuminata were studied in clear glass aquaria having diameter of 30 cm. Baits were prepared from different binary combinations of attractant amino acid (valine, aspartic acid, lysine and alanine 10 mM in 100 mL of 2% agar solution + sub-lethal (20% and 60% of 24h LC50 doses of different molluscicides (ferulic acid, umbelliferone, eugenol and limonene. These baits caused maximum significant reduction in free amino acid, protein, DNA, RNA levels i.e. 41.37, 23.56, 48.36 and 14.29% of control in the ovotestis of the snail, respectively. Discontinuation of feeding after treatment of 60% of 96h LC50 of molluscicide containing bait for next 72h caused a significant recovery in free amino acid, protein, DNA and RNA levels in the ovotestis of L. acuminata.

  5. CHARACTERIZATION OF MOLLUSCICIDAL COMPONENT OF Moringa oleifera LEAF AND Momordica charantia FRUITS AND THEIR MODES OF ACTION IN SNAIL Lymnaea acuminata

    Directory of Open Access Journals (Sweden)

    Aparna Upadhyay

    2013-07-01

    Full Text Available SUMMARY The molluscicidal activity of the leaf powder of Moringa oleifera and lyophilized fruit powder of Momordica charantia against the snail Lymnaea acuminata was time and concentration dependent. M. oleifera leaf powder (96 h LC50: 197.59 ppm was more toxic than M. charantia lyophilized fruit powder (96 h LC50: 318.29 ppm. The ethanolic extracts of M. oleifera leaf powder and Momordica charantia lyophilized fruit powder were more toxic than other organic solvent extracts. The 96 h LC50 of the column purified fraction of M. oleifera leaf powder was 22.52 ppm, while that of M. charantia lyophilized fruit powder was 6.21 ppm. Column, thin layer and high performance liquid chromatography analysis show that the active molluscicidal components in M. oleifera leaf powder and lyophilized fruit of M. charantia are benzylamine (96 h LC50: 2.3 ppm and momordicine (96 h LC50: 1.2 ppm, respectively. Benzylamine and momordicine significantly inhibited, in vivo and in vitro, the acetylcholinesterase (AChE, acid and alkaline phosphatase (ACP/ALP activities in the nervous tissues of L. acuminata. Inhibition of AChE, ACP and ALP activity in the nervous tissues of L. acuminata by benzylamine and momordicine may be responsible for the molluscicidal activity of M. oleifera and M. charantia fruits, respectively.

  6. EFEITO DO PESO DE MUDA TIPO PEDAÇO DE RIZOMA NO ENRAIZAMENTO INICIAL DA BANANEIRA DO CULTIVAR NANICÃO (Musa acuminata AAA EFFECT OF THE WEIGHT OF RHIZOME TYPE SEEDLING IN THE INITIAL ROOTING OF BANANA CULTIVAR NANICÃO (Musa acuminata AAA

    Directory of Open Access Journals (Sweden)

    Lincoln F. Zica

    2007-09-01

    Full Text Available

    O uso de mudas do tipo pedaço de rizoma, vem, a cada dia, sendo procurado intensivamente como material de propagação de bananeiras. Porém, ao se trabalhar com esse tipo de mudas há necessidades de se conhecer o efeito do peso do rizoma em relação ao seu enraizamento inicial, pois quanto maior o peso das raízes, melhores serão as mudas. De acordo com a análise estatística concluiu-se que há um maior enraizamento em pedaços de rizomas de maior peso.

    Pieces of rootstalk are being used more and more intensively as a means of reproducing banana plants. However, in order to work effectively with this means of reproduction, it is necessary to know the effect of the rootstalk’s weight when it is first planted, because the greater the weight of the rootstalk, the better the shoots will be. On the basis of statistical analysis, it was concluded that the heavier pieces of rootstalk root better.

  7. Exploring the genetic variability in water use efficiency: Evaluation of inter and intra cultivar genetic diversity in grapevines.

    Science.gov (United States)

    Tortosa, Ignacio; Escalona, José Mariano; Bota, Josefina; Tomás, Magdalena; Hernández, Esther; Escudero, Enrique García; Medrano, Hipólito

    2016-10-01

    Genetic improvement of crop Water Use Efficiency (WUE) is a general goal because the increasing water scarcity and the trend to a more sustainable agriculture. For grapevines, this subject is relevant and need an urgent response because their wide distribution in semi-arid areas. New cultivars are difficult to introduce in viticulture due to the narrow dependency of consumer appreciation often linked to a certain particular wine taste. Clones of reputed cultivars would presumably be more accepted but little is known on the intra-cultivar genetic variability of the WUE. The present work compares, on the basis of two field assays, the variability of intrinsic water use efficiency (WUEi) in a large collection of cultivars in contrast with a collection of clones of Tempranillo cultivar. The results show that clonal variability of WUEi was around 80% of the inter-cultivar, thus providing a first assessment on the opportunity for clonal selection by WUE. Plotting the WUEi data against stem water potential or stomatal conductance it was possible to identify cultivars and clones out of the confidence intervals of this linear regression thus with significantly higher and lower WUEi values. The present results contribute to open the expectative for a genetic improvement of grapevine WUE. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  8. Physiological and biochemical parameters for evaluation and clustering of rice cultivars differing in salt tolerance at seedling stage

    Directory of Open Access Journals (Sweden)

    Sumitahnun Chunthaburee

    2016-07-01

    Full Text Available Salinity tolerance levels and physiological changes were evaluated for twelve rice cultivars, including four white rice and eight black glutinous rice cultivars, during their seedling stage in response to salinity stress at 100 mM NaCl. All the rice cultivars evaluated showed an apparent decrease in growth characteristics and chlorophyll accumulation under salinity stress. By contrast an increase in proline, hydrogen peroxide, peroxidase (POX activity and anthocyanins were observed for all cultivars. The K+/Na+ ratios evaluated for all rice cultivars were noted to be highly correlated with the salinity scores thus indicating that the K+/Na+ ratio serves as a reliable indicator of salt stress tolerance in rice. Principal component analysis (PCA based on physiological salt tolerance indexes could clearly distinguish rice cultivars into 4 salt tolerance clusters. Noteworthy, in comparison to the salt-sensitive ones, rice cultivars that possessed higher degrees of salt tolerance displayed more enhanced activity of catalase (CAT, a smaller increase in anthocyanin, hydrogen peroxide and proline content but a smaller drop in the K+/Na+ ratio and chlorophyll accumulation.

  9. Flower colours and pigments in tulip cultivars

    NARCIS (Netherlands)

    Eijk, van J.P.; Keulen, van H.A.; Dijk, van A.J.

    1987-01-01

    Aanvullend op eerder onderzoek, waarbij bijna 500 oude en nieuwe tulpencultivars op bloempigmenten werden geanalyseerd, worden in tabelvorm van diezelfde cultivars nu de bloemkleur en de relatieve hoeveelheden carotenoiden, delfinidine, cyanidine, pelargonidine en flavonolen aangegeven

  10. Phenotypic profiles of Armenian grape cultivars

    Directory of Open Access Journals (Sweden)

    Aroutiounian Rouben

    2015-01-01

    Full Text Available The conservation and sustainable use of grapevine biodiversity in Armenia is particularly important due to the large number of traditional local varieties. Being partially different from European grapevine gene pool, the material of Armenian local cultivars significantly contributes to the understanding of the genetic variation and is valuable source for target selection. During last years many Armenian grapevine cultivars have been already described and their genotypes determined, but some local varieties and wild accessions remain unidentified and their phenotypic characteristics overlooked. The comprehensive analysis of phenotypes is essential for research, including genetic association studies, cultivar evaluation and selection. The goal of our research was the phenotyping on the base of reproductive, carpological and analytical characteristics of 80 Armenian aboriginal and new grape cultivars. Description of phenotypic profiles is important step towards identification and conservation of genetic resources of Armenian grapes. In future, these data can be applied for breeding of improved grape varieties targeted to fresh consumption and wine production.

  11. Parental Selection in Rice Cultivar Improvement

    Institute of Scientific and Technical Information of China (English)

    Stanley Omar P B.SAMONTE; Rodante E.TABIEN; Lloyd T.WILSON

    2013-01-01

    The evaluation of rice (Oryza sativa L.) cultivars assists breeders in identifying useful trait relationships and in selecting parents as donors of specific traits.This study was conducted to compare long-grain rice cultivars using genotype x trait (GT) biplot analysis and determine potential donors of traits related to grain yield and quality.Seventeen cultivars in the 2005 and 2006 Uniform Regional Rice Nursery in Beaumont,Texas,USA were analyzed for 20 traits using GT biplot analysis.The GT biplots showed the diversity among cultivars with regards to yield-related traits.Cultivars recommended as donor parents were:Trenasse,Spring,Presidio,and Cocodrie for high grain yield and head rice rate;Trenasse and Presidio for semi-dwarfness; Banks for tall plant height; Wells for high flag leaf area,panicle weight,and number and mass of filled grains per panicle; Hidalgo for high tiller density; Francis for high number of spikelets per panicle; Spring and Trenasse for short flowering duration; Cheniere for more days to heading and maturity and Spring for less days; and Spring and Hidalgo for high grain weight.Breeders can use these cultivars with specific traits to increase grain yield and quality.

  12. Dendrocronología de Alnus acuminata en el bosque reservado de San Pedro de Saño, Huancayo

    Directory of Open Access Journals (Sweden)

    Edilson Requena Rojas

    2015-12-01

    Full Text Available En este trabajo evaluamos el potencial de Alnus acuminata para su uso posterior en estudios dendroclimatológicos. Se analizó una cronología de ancho de anillos para un bosque de A. acuminata en San Pedro de Saño y se relacionó el crecimiento de los árboles con los registros instrumentales de temperatura media, máxima y mínima, precipitación y horas sol de las estaciones meteorológicas de Huayao (12° 02´ 18.1¨ S - 75° 19´22.2¨ O y Santa Ana (12° 00´ 15¨ S - 75° 13´ 15¨ O. La cronología de ancho de anillos está compuesta por 33 series de 22 árboles y cubre el período 1968-2013. El crecimiento de los árboles estuvo relacionado negativamente con la temperatura mínima mensual del mes de abril del año corriente. Se observó una relación positiva y significativa entre la cronología de crecimiento y la precipitación de la estación de Santa Ana para los meses de marzo del año previo y diciembre del año actual de crecimiento. Las horas sol mensuales de abril del año corriente tienen una correlación significativa con el crecimiento radial. Existe influencia de las precipitaciones del verano previo y primavera del año corriente favoreciendo el crecimiento del árbol. El árbol entra en dormancia, posiblemente por las bajas temperaturas de otoño. El amplio rango de distribución y la utilización histórica de su madera en construcciones en el pasado, abre la posibilidad de extender temporalmente los registros dendrocronológicos, en los Andes centrales de Perú.

  13. Productivity and drought tolerance of cassava cultivars in the Coastal Tablelands of Northeastern Brazil

    Directory of Open Access Journals (Sweden)

    Luciana Marques de Carvalho

    2016-05-01

    Full Text Available ABSTRACT: Ten cassava cultivars were grown in the field and evaluated to identify the most adapted to the Coastal Tablelands of northeast Brazil. The cultivars showed differences in proline and chlorophyll contents, plant height, number of leaves and branches, canopy area and root production, however they did not differ on photosynthetic rates. Cultivars 'Tianguá' and '9783-13' presented lower root yield, whereas 'BRS Tapioqueira' and 'Irará' had the highest root yield. Few leaves coupled with the highest water use efficiency for CO2 assimilation was found in 'BRS Kiriris' in contrast to 'BRS Jarina' and '9783-13'. 'BRS Caipira' had high proline content in both Umbaúba and Frei Paulo areas, traits usually associated to drought tolerance, that contribute to the adaptation. It is also important to consider that cultivar 'BRS Caipira' was the first to present increase in chlorophyll content after extended period of drought, that indicates a faster recovery after dry season. Furthermore, the results indicated that the most adapted cultivars for cultivation in this area are 'Irará', 'BRS Tapioqueira', 'BRS Kiriris' and 'BRS Caipira'.

  14. Relative Infestation Level and Sensitivity of Grapevine Cultivars to the Leafhopper Empoasca vitis (Hemiptera: Cicadellidae).

    Science.gov (United States)

    Fornasiero, D; Pavan, F; Pozzebon, A; Picotti, P; Duso, C

    2016-02-01

    The leafhopper Empoasca vitis (Göthe) (Hemiptera: Cicadellidae) feeds on veins of grapevine leaves, mainly on the phloem, causing physiological injury, color change and drying of leaf margins, yield and sugar content reduction. The relative infestation level (i.e., the probability that a plant is attacked by herbivores) of E. vitis on different grapevine cultivars and their sensitivity (i.e., the incidence of symptoms expression in response to herbivore feeding or other stimuli) to this pest were studied over four years in two vineyards located in northeastern Italy. Some cultivars (e.g., Carménère and Sauvignon Blanc) were usually more infested than others (e.g., Cabernet Sauvignon and Pinot Gris), although some differences were observed among years and sites. The sensitivity varied among cultivars, i.e., some of them showed more symptoms than expected on the basis of infestation levels (e.g., Carménère and Merlot), in contrast with others (e.g., Rhine Riesling and Chardonnay). Information obtained can be used within the framework of integrated pest management in vineyards. Action thresholds should differ on the basis of sensitivity. Sampling must first be carried out on the most susceptible cultivar and, if the action threshold is exceeded, it should be extended to the remaining cultivars based on their decreasing relative infestation level.

  15. CULTIVAR RELEASE-IPR 98: Rust-resistant dwarf arabica coffee cultivar for dense spacing

    Directory of Open Access Journals (Sweden)

    Tumoru Sera

    2008-01-01

    Full Text Available The IPR 98 coffee cultivar is a dwarf plant smaller than the Catuaí Vermelho IAC-81 cultivar, completelyresistant to Hemileia vastatrix Berk. et Br. with medium precocity in ripening and superior quality and high yields with semidense,dense and super dense spacing in lower temperature coffee regions of the state of Paraná.

  16. Cultivar identification and genetic relationship of pineapple (Ananas comosus) cultivars using SSR markers.

    Science.gov (United States)

    Lin, Y S; Kuan, C S; Weng, I S; Tsai, C C

    2015-11-25

    The genetic relationships among 27 pineapple [Ananas comosus (L.) Merr.] cultivars and lines were examined using 16 simple sequence repeat (SSR) markers. The number of alleles per locus of the SSR markers ranged from 2 to 6 (average 3.19), for a total of 51 alleles. Similarity coefficients were calculated on the basis of 51 amplified bands. A dendrogram was created according to the 16 SSR markers by the unweighted pair-group method. The banding patterns obtained from the SSR primers allowed most of the cultivars and lines to be distinguished, with the exception of vegetative clones. According to the dendrogram, the 27 pineapple cultivars and lines were clustered into three main clusters and four individual clusters. As expected, the dendrogram showed that derived cultivars and lines are closely related to their parental cultivars; the genetic relationships between pineapple cultivars agree with the genealogy of their breeding history. In addition, the analysis showed that there is no obvious correlation between SSR markers and morphological characters. In conclusion, SSR analysis is an efficient method for pineapple cultivar identification and can offer valuable informative characters to identify pineapple cultivars in Taiwan.

  17. Molecular Characterization of Banana streak virus Isolate from Musa Acuminata in China

    Institute of Scientific and Technical Information of China (English)

    Jun Zhuang; Jian-hua Wang; Xin Zhang; Zhi-xinLiu

    2011-01-01

    Banana streak virus (BSV),a member of genus Badnavirus,is a causal agent of banana streak disease throughout the world.The genetic diversity of BSVs from different regions of banana plantations has previously been investigated,but there are relatively few reports of the genetic characteristic of episomal (non-integrated)BSV genomes isolated from China.Here,the complete genome,a total of 7722bp (GenBank accession number DQ092436),of an isolate of Banana streak virus (BSV) on cultivar Cavendish (BSAcYNV) in Yunnan,China was determined.The genome organises in the typical manner of badnaviruses.The intergenic region of genomic DNA contains a large stem-loop,which may contribute to the ribosome shift into the following open reading frames (ORFs).The coding region of BSAcYNV consists of three overlapping ORFs,ORF 1 with a non-AUG start eodon and ORF2 encoding two small proteins are individually involved in viral movement and ORF3 encodes a polyprotein.Besides the complete genome,a defective genome lacking the whole RNA leader region and a majority of ORF1 and which encompasses 6525bp was also isolated and sequenced from this BSV DNA reservoir in infected banana plants.Sequence analyses showed that BSAcYNV has closest similarity in terms of genome organization and the coding assignments with an BSV isolate from Vientam (BSAcVNV).The corresponding coding regions shared identities of 88% and ~95% at nucleotide and amino acid levels,respectively.Phylogenetic analysis also indicated BSAcYNV shared the closest geographical evolutionary relationship to BSAcVNV among sequenced banana streak badnaviruses.

  18. A model for μ-biomimetic thermal infrared sensors based on the infrared receptors of Melanophila acuminata.

    Science.gov (United States)

    Siebke, Georg; Holik, Peter; Schmitz, Sam; Schmitz, Helmut; Lacher, Manfred; Steltenkamp, Siegfried

    2014-09-01

    Beetles of the genus Melanophila acuminata detect forest fires from distances as far as 130 km with infrared-sensing organs. Inspired by this extremely sensitive biological device, we are developing an IR sensor that operates at ambient temperature using MEMS technology. The sensor consists of two liquid-filled chambers that are connected by a micro-fluidic system. Absorption of IR radiation by one of these chambers leads to heating and expansion of a liquid. The increasing pressure deflects a membrane covered by one electrode of a plate capacitor. The micro-fluidic system and the second chamber represent a fluidic low-pass filter, preventing slow, but large pressure changes. However, the strong frequency dependence of the filter demands a precise characterization of its properties. Here, we present a theoretical model that describes the frequency-dependent response of the sensor based on material properties and geometrical dimensions. Our model is divided into four distinct parts that address different aspects of the sensor. The model describes the frequency-dependent behaviour of the fluidic filter and a thermal low-pass filter as well as saturation effects at low frequencies. This model allows the calculation of optimal design parameters, and thereby provides the foundation for the development of such a sensor.

  19. Molluscicidal activity of Ferula asafoetida, Syzygium aromaticum and Carum carvi and their active components against the snail Lymnaea acuminata.

    Science.gov (United States)

    Kumar, Pradeep; Singh, D K

    2006-06-01

    The molluscicidal activity of dried root latex powder of Ferula asafoetida, flower-bud powder of Syzygium aromaticum and seed powder of Carum carvi against the snail Lymnaea acuminata was studied. The molluscicidal activity of all the three plant products was found to be both time and concentration dependent. The toxicity of S. aromaticum flower-bud powder (96 h LC(50):51.98 mg/l) was more pronounced than that of root latex powder of F. asafoetida (96 h LC(50):82.71 mg/l) and seed powder of C. carvi (96 h LC(50):140.58 mg/l). Ethanol extract was more toxic than other organic extracts. The ethanol extract of S. aromaticum (24h LC(50):83.53 mg/l) was more effective than that of F. asafoetida (24h LC(50):132.31 mg/l) and C. carvi (24h LC(50):130.61 mg/l) in killing the test animals. The 96 h LC(50) of column purified fraction of seed powder of C. carvi was 5.40 mg/l whereas those of flower-bud powder of S. aromaticum and dried root latex powder of F. asafoetida were 7.87 and 9.67 mg/l, respectively. The product of F. asafoetida, S. aromaticum and C. carvi may be used as potent molluscicides.

  20. Three hydroxylated lupeol-based triterpenoid esters isolated from the Eastern Nigeria mistletoe parasitic on Kola acuminata.

    Science.gov (United States)

    Omeje, Edwin Ogechukwu; Osadebe, Patience Ogoamaka; Esimone, Charles Okechukwu; Nworu, Chukwuemeka Sylvester; Kawamura, Akira; Proksch, Peter

    2012-01-01

    Column fractionation and purification of an n-hexane fraction led to the isolation of three lupeol-based triterpenoid esters from the leaves of the Eastern Nigeria mistletoe, Loranthus micranthus Linn parasitic on a local kola nut tree, Kola acuminata. These three compounds were adequately characterised using a combination of UV/visible, IR, NMR (¹³C-NMR and ¹H-NMR), DEPT, MS and two-dimensional correlation (H-H COSY, Hetero-nuclear Single Quantum Correlation (HSQC), HMBC, NOE and NOESY) studies as 7β,15α-dihydroxyl-lup-20(29)-ene-3β-esters of palmitic (I), stearic (II) and eicosanoic acids (III). The characterisation of other isolated compounds is ongoing. Remarkably, this is the first report of the existence of fatty acid esters of an unusual 7β,15α-dihydroxylated lupeol in the Eastern Nigeria mistletoe. These isolated compounds might contribute in part to the numerous established bio-activities of the Eastern Nigeria mistletoes.

  1. Characterization of the molluscicidal activity of Bauhinia variegata and Mimusops elengi plant extracts against the fasciola vector Lymnaea acuminata.

    Science.gov (United States)

    Singh, Kanchan Lata; Singh, D K; Singh, Vinay Kumar

    2012-01-01

    The molluscicidal activity of Bauhinia variegata leaf and Mimusops elengi bark was studied against vector snail Lymnaea acuminata. The toxicity of both plants was time and concentration-dependent. Among organic extracts, ethanol extracts of both plants were more toxic. Toxicity of B. variegata leaf ethanolic extract (96h LC50- 14.4 mg/L) was more pronounced than M. elengi bark ethanolic extract (96h LC50-15.0 mg/L). The 24h LC50 of column purified fraction of B. variegata and M. elengi bark were 20.3 mg/L and 18.3 mg/L, respectively. Saponin and quercetin were characterized and identified as active molluscicidal component. Co-migration of saponin (Rf 0.48) and quercetin (Rf 0.52) with column purified bark of M. elengi and leaf of B. variegata on thin layer chromatography demonstrate same Rf value i.e. 0.48 and 0.52, respectively. The present study clearly indicates the possibility of using M. elengi and/or B. variegata as potent molluscicide.

  2. Characterization of the molluscicidal activity of Bauhinia variegata and Mimusops elengi plant extracts against the fasciola vector lymnaea acuminata

    Directory of Open Access Journals (Sweden)

    Kanchan Lata Singh

    2012-06-01

    Full Text Available The molluscicidal activity of Bauhinia variegata leaf and Mimusops elengi bark was studied against vector snail Lymnaea acuminata. The toxicity of both plants was time and concentration-dependent. Among organic extracts, ethanol extracts of both plants were more toxic. Toxicity of B. variegata leaf ethanolic extract (96h LC50- 14.4 mg/L was more pronounced than M. elengi bark ethanolic extract (96h LC50-15.0 mg/L. The 24h LC50 of column purified fraction of B. variegata and M. elengi bark were 20.3 mg/L and 18.3 mg/L, respectively. Saponin and quercetin were characterized and identified as active molluscicidal component. Co-migration of saponin (Rf 0.48 and quercetin (Rf 0.52 with column purified bark of M. elengi and leaf of B. variegata on thin layer chromatography demonstrate same Rf value i.e. 0.48 and 0.52, respectively. The present study clearly indicates the possibility of using M. elengi and/or B. variegata as potent molluscicide.

  3. Behavioral Responses of the Snail Lymnaea acuminata towards Photo and Chemo Attractants: A New Step in Control Program of Fasciolosis

    Directory of Open Access Journals (Sweden)

    Anupam Pati Tripathi

    2013-01-01

    Full Text Available Fasciolosis is water and food borne disease, caused by Fasciola hepatica and F. gigantica. Snail Lymnaea acuminata is an intermediate host of these flukes. Snail control is one of the major methods to reduce the incidences of fasciolosis. Trapping of snails with the help of photo- and chemoattractants for treatment purposes will be a new tool in control program of fasciolosis. The present study shows that maximum numbers of snails were attracted (52 to 60%, when exposed to photo- and chemostimulant simultaneously, rather than when only chemo- (control (18 to 24% or photo- (control (14 to 19% stimulus was given. Maximum change in AChE activity in nervous tissue was observed when red monochromatic light was used (258.37% of white light control as opposed to blue (243.44% of white light control and orange (230.37% of white light control. The exposure of light directly stimulated the photoreceptors in eye which transmit the signals through nerves to the brain and snail response accordingly. In this signal transmission AChE is one of the important enzymes involved in this process.

  4. Carbohydrate binding properties of banana (Musa acuminata) lectin I. Novel recognition of internal alpha1,3-linked glucosyl residues.

    Science.gov (United States)

    Mo, H; Winter, H C; Van Damme, E J; Peumans, W J; Misaki, A; Goldstein, I J

    2001-05-01

    Examination of lectins of banana (Musa acuminata) and the closely related plantain (Musa spp.) by the techniques of quantitative precipitation, hapten inhibition of precipitation, and isothermal titration calorimetry showed that they are mannose/glucose binding proteins with a preference for the alpha-anomeric form of these sugars. Both generate precipitin curves with branched chain alpha-mannans (yeast mannans) and alpha-glucans (glycogens, dextrans, and starches), but not with linear alpha-glucans containing only alpha1,4- and alpha1,6-glucosidic bonds (isolichenan and pullulan). The novel observation was made that banana and plantain lectins recognize internal alpha1,3-linked glucosyl residues, which occur in the linear polysaccharides elsinan and nigeran. Concanavalin A and lectins from pea and lentil, also mannose/glucose binding lectins, did not precipitate with any of these linear alpha-glucans. This is, the authors believe, the first report of the recognition of internal alpha1,3-glucosidic bonds by a plant lectin. It is possible that these lectins are present in the pulp of their respective fruit, complexed with starch.

  5. CO2, H2O exchange and stomatal regulation of regenerated Camptotheca acuminata plantlets during ex vitro acclimatization

    Institute of Scientific and Technical Information of China (English)

    WANG Hui-mei; LI Yan-hua; GAO Yin-xiang; ZU Yuan-gang

    2006-01-01

    For finding the changes in CO2, H2O exchange and their stomatal regulation during ex vitro acclimatization of regenerated Camptotheca acuminata plantlets, the net photosynthesis rate (Pn), respiration rate (Rd), light compensation point (Lc) and light saturation point (Ls), transpiration rate (Tr), stomatal conductance (gs) and water use efficiency(WUE) were measured during 37 days of ex vitro acclimatization. The results showed that Pn sharply increased until 29 days, then slightly decreased. A substantial decrease in Lc and a substantial increase of Ls in the former two weeks were observed, indicating the light regime enlargement for effective leaf photosynthesis. Tr and gs abruptly decreased during the first week then linearly increased until 29days ex vitro acclimatization, reflecting the strong regulation effect of stomata on water changes of ex vitro acclimating plantlets. Stomatal regulation effect on CO2 exchange was different from that on water exchange, i.e. Pn was almost independent of gs during the first week, while Pn was significantly correlated with gs thereafter (i.e. dual patterns). Different from dual patterns of gs-Pn relation, the Tr monotonously linearly increased with gs. Furthermore, WUE was almost independent on gs during the first week, while a marked decreasing tendency with gs was found thereafter. At the beginning of the acclimatization, WUE was mainly determined by photosynthetic capacity, while transpiration becomes a main determinant factor for WUE from 7 to 37 days' acclimatization.

  6. Resistance of some commercial winter wheat cultivars to Tilletia tritici

    Directory of Open Access Journals (Sweden)

    Staletić Mirjana D.

    2007-01-01

    Full Text Available This paper deals with the resistance of twenty commercial winter wheat cultivars to common bunt causal agent (Tilletia tritici. Significant differences among the cultivars concerning the infection percent were observed, as well as the differences in the level of commercial cultivars' resistance to T. tritici. Most of the studied cultivars belonged to susceptible categories, and just few of them to the resistant ones. Cultivar Lasta was classified as highly resistant during the both investigation years in Kragujevac, while in Leposavić Lasta and Tiha were classified as resistant. The other studied cultivars were more or less susceptible.

  7. Soil Carbon and Nitrogen Stocks of Different Hawaiian Sugarcane Cultivars

    Directory of Open Access Journals (Sweden)

    Rebecca Tirado-Corbalá

    2015-06-01

    Full Text Available Sugarcane has been widely used as a biofuel crop due to its high biological productivity, ease of conversion to ethanol, and its relatively high potential for greenhouse gas reduction and lower environmental impacts relative to other derived biofuels from traditional agronomic crops. In this investigation, we studied four sugarcane cultivars (H-65-7052, H-78-3567, H-86-3792 and H-87-4319 grown on a Hawaiian commercial sugarcane plantation to determine their ability to store and accumulate soil carbon (C and nitrogen (N across a 24-month growth cycle on contrasting soil types. The main study objective establish baseline parameters for biofuel production life cycle analyses; sub-objectives included (1 determining which of four main sugarcane cultivars sequestered the most soil C and (2 assessing how soil C sequestration varies among two common Hawaiian soil series (Pulehu-sandy clay loam and Molokai-clay. Soil samples were collected at 20 cm increments to depths of up to 120 cm using hand augers at the three main growth stages (tillering, grand growth, and maturity from two experimental plots at to observe total carbon (TC, total nitrogen (TN, dissolved organic carbon (DOC and nitrates (NO−3 using laboratory flash combustion for TC and TN and solution filtering and analysis for DOC and NO−3. Aboveground plant biomass was collected and subsampled to determine lignin and C and N content. This study determined that there was an increase of TC with the advancement of growing stages in the studied four sugarcane cultivars at both soil types (increase in TC of 15–35 kg·m2. Nitrogen accumulation was more variable, and NO−3 (<5 ppm were insignificant. The C and N accumulation varies in the whole profile based on the ability of the sugarcane cultivar’s roots to explore and grow in the different soil types. For the purpose of storing C in the soil, cultivar H-65-7052 (TC accumulation of ~30 kg·m−2 and H-86-3792 (25 kg·m−2 rather H-78

  8. Cadmium accumulation in different pakchoi cultivars and screening for pollution-safe cultivars

    Institute of Scientific and Technical Information of China (English)

    Ying CHEN; Ting-qiang LI; Xuan HAN; Zhe-li DING; Xiao-e YANG; Ye-fei JIN

    2012-01-01

    The selection and breeding of pollution-safe cultivars (PSCs) is a practicable and cost-effective approach to minimize the influx of heavy metal to the human food chain.In this study,both pot-culture and field experiments were conducted to identify and screen out cadmium pollution-safe cultivars (Cd-PSCs) from 50 pakchoi (Brassica rapa L.ssp.chinensis) cultivars for food safety.When treated with 1.0 or 2.5 mg/kg Cd,most of the pakchoi cultlvars (>70%)showed greater or similar shoot biomass when compared with the control.This result indicates that pakchoi has a considerable tolerance to soil Cd stress.Cd concentrations in the shoot varied significantly (P<0.05) between cultivars:in two Cd treatments (1.0 and 2.5 mg/kg),the average values were 0.074 and 0.175 mg/kg fresh weight (FW),respectively.Cd concentrations in the shoots of 14 pakchoi cultivars were lower than 0.05 mg/kg FW.In pot-culture experiments,both enrichment factors (EFs) and translocation factors (TFs) of six pakchoi cultivars were lower than 1.0.The field studies further confirmed that the Hangzhouyoudonger,Aijiaoheiye 333,and Zaoshenghuajing cultivars are Cd-PSCs,and are therefore suitable for growth in low Cd-contaminated soils (≤1.2 mg/kg) without any risk to food safety.

  9. Capacidade produtiva de cultivares de berinjela

    Directory of Open Access Journals (Sweden)

    Antonini Antonio C. C.

    2002-01-01

    Full Text Available Determinou-se a capacidade produtiva de diferentes híbridos e cultivares de berinjela. Sete híbridos (Nápoli, Diamante Negro, Ciça, F-100, Super F-100, Kiko e F-2000 e duas cultivares de polinização aberta (Suzuki e Florida Market foram avaliados. O delineamento experimental foi em blocos ao acaso, constituído de nove tratamentos e três repetições. Cada repetição foi composta de oito plantas. As mudas foram plantadas no espaçamento 1,5m x 1,0m. A cultivar Suzuki produziu a maior quantidade de frutos por planta (27 frutos embora tenha apenas diferido significativamente da cultivar Flórida Market (13 frutos. Os híbridos testados apresentaram número de frutos variando de 20 a 25. Não foi verificada diferença significativa para o número de frutos de 1ª e 2ª categoria entre os materiais testados. Flórida Market e Kiko apresentaram a maior massa média do fruto (362,5 e 358,7 g, respectivamente, diferindo significativamente da cultivar Suzuki, que produziu frutos com a menor massa (178,9 g. As maiores produções por planta foram obtidas com o híbrido Kiko que diferiu significativamente da cultivar Suzuki. Foi verificado que os híbridos Kiko, Diamante Negro, Ciça e F-2000 apresentam potencial de produção semelhante ao Nápoli, atual padrão de mercado.

  10. CULTIVAR RELEASE-IAC-Alvorada and IAC-Diplomata: new common bean cultivars

    Directory of Open Access Journals (Sweden)

    Sérgio Augusto Morais Carbonell

    2008-01-01

    Full Text Available The aim of common bean breeding programs is the development of high-yielding cultivars, with multipledisease resistance and high technological and nutritional grain quality. Two cultivars, IAC-Alvorada with carioca grain, andIAC-Diplomata with black grain, meet these standards, according to the results of trials of Value for Cultivation and Use(VCU 2005/2006/2007 in São Paulo. The cultivars, developed by the Instituto Agronômico de Campinas, were registered bythe MAPA/RNC.

  11. Introgression between cultivars and wild populations of Momordica charantia L. (Cucurbitaceae) in Taiwan.

    Science.gov (United States)

    Liao, Pei-Chun; Tsai, Chi-Chu; Chou, Chang-Hung; Chiang, Yu-Chung

    2012-01-01

    The landrace strains of Momordica charantia are widely cultivated vegetables throughout the tropics and subtropics, but not in Taiwan, a continental island in Southeast Asia, until a few hundred years ago. In contrast, the related wild populations with smaller fruit sizes are native to Taiwan. Because of the introduction of cultivars for agricultural purposes, these two accessions currently exhibit a sympatric or parapatric distribution in Taiwan. In this study, the cultivars and wild samples from Taiwan, India, and Korea were collected for testing of their hybridization and evolutionary patterns. The cpDNA marker showed a clear distinction between accessions of cultivars and wild populations of Taiwan and a long divergence time. In contrast, an analysis of eight selectively neutral nuclear microsatellite loci did not reveal a difference between the genetic structures of these two accessions. A relatively short divergence time and frequent but asymmetric gene flows were estimated based on the isolation-with-migration model. Historical and current introgression from cultivars to wild populations of Taiwan was also inferred using MIGRATE-n and BayesAss analyses. Our results showed that these two accessions shared abundant common ancestral polymorphisms, and the timing of the divergence and colonization of the Taiwanese wild populations is consistent with the geohistory of the Taiwan Strait land bridge of the Last Glacial Maximum (LGM). Long-term and recurrent introgression between accessions indicated the asymmetric capacity to receive foreign genes from other accessions. The modern introduction of cultivars of M. charantia during the colonization of Taiwan by the Han Chinese ethnic group enhanced the rate of gene replacement in the native populations and resulted in the loss of native genes.

  12. Response of broccoli and cabbage hybrid cultivars to clomazone

    Science.gov (United States)

    Clomazone herbicide (Command 3ME) is registered for cabbage in the U.S., but not for other cultivar groups within Brassica oleracea. Cabbage cultivars vary in clomazone tolerance, and recommended use rates can cause severe foliar chlorosis and yield reduction to susceptible cultivars. The objectiv...

  13. Distinguishing Nonpareil marketing group almond cultivars through multivariate analyses.

    Science.gov (United States)

    Ledbetter, Craig A; Sisterson, Mark S

    2013-09-01

    More than 80% of the world's almonds are grown in California with several dozen almond cultivars available commercially. To facilitate promotion and sale, almond cultivars are categorized into marketing groups based on kernel shape and appearance. Several marketing groups are recognized, with the Nonpareil Marketing Group (NMG) demanding the highest prices. Placement of cultivars into the NMG is historical and no objective standards exist for deciding whether newly developed cultivars belong in the NMG. Principal component analyses (PCA) were used to identify nut and kernel characteristics best separating the 4 NMG cultivars (Nonpareil, Jeffries, Kapareil, and Milow) from a representative of the California Marketing Group (cultivar Carmel) and the Mission Marketing Group (cultivar Padre). In addition, discriminant analyses were used to determine cultivar misclassification rates between and within the marketing groups. All 19 evaluated carpological characters differed significantly among the 6 cultivars and during 2 harvest seasons. A clear distinction of NMG cultivars from representatives of the California and Mission Marketing Groups was evident from a PCA involving the 6 cultivars. Further, NMG kernels were successfully discriminated from kernels representing the California and Mission Marketing Groups with overall kernel misclassification of only 2% using 16 of the 19 evaluated characters. Pellicle luminosity was the most discriminating character, regardless of the character set used in analyses. Results provide an objective classification of NMG almond kernels, clearly distinguishing them from kernels of cultivars representing the California and Mission Marketing Groups.

  14. Characteristics of the microbial community in rhizosphere of Camptotheca acuminata cultured with exotic invasive plant Eupatorium adenophorum

    Institute of Scientific and Technical Information of China (English)

    ZU YuanGang; GAO ChongYang; WANG WenJie; YANG FengJian; LIU Ying; WANG Min; ZHAO YangGuo

    2007-01-01

    The traditional culture-dependent plate counting and culture-independent small-subunit-ribosomal RNA gene-targeted molecular techniques, Single-Strand Conformation Polymorphism (SSCP) and terminal Restriction Fragment Length Polymorphism (tRFLP) combined with 16S rDNA clone library were adopted to investigate the impacts of secretion from Camptotheca acuminata (abbreviated to Ca) roots on the quantities and structure of eukaryotic microbes and bacteria in the rhizosphere, and the possibility that Ca controls exotic invasive plant Eupatorium adenophorum (Ea). The counting results indicated that the number of bacteria increased in turn in rhizospheres of Ea, Ca-Ea mixed culture and Ca, while that of eukaryotic microbes decreased. PCR-SSCP profiles showed eukaryotic microbial bands (corresponding to biodiversity) in rhizosphere of Ea were more complex than those of Ca and CE. Meristolohmannia sp., Termitomyces sp. And Rhodophyllus sp. Were the dominant populations in the rhizosphere of Ca. Bacterial terminal restriction fragments (TRFs) profiles showed no difference among three kinds of rhizospheres, and the sequences of the 16S rDNA clone library from Ca rhizospheres were distributed in 10 known phyla, in which phylum Proteobacteria were the absolute dominant group and accounted for 24.71% of the cloned sequences (δ-Proteobacteria accounted for up to 17.65%), and phyla Acidobacteria and Bacteroidetes accounted for 16.47% and 10.59% of the cloned sequences, respectively. In addition, high performance liquid chromatography detected a trace amount of camptothecin and hydroxycamptothecin in the rhizospheric soil of Ca and CE, but examined neither camptothecin nor hydroxycamptothecin in rhizospheric soil of Ea. Therefore, invasion and diffusion of Ea evidently depended on distinguishing the eukaryotic community structure, but not on that of the bacterial pattern. Ca was able to alter the eukaryotic community structure of invasive Ea by secreting camptothecin and

  15. Combination of molluscicides with attractant carbohydrates and amino acids in bait formulation against the snail Lymnaea acuminata.

    Science.gov (United States)

    Kumar, P; Singh, V K; Singh, D K

    2011-05-01

    Fascioliasis is an important helminth disease caused by Fasciola (F.) hepatica and F gigantica of Asia and Africa. This disease belongs to the plant-borne trematode zoonoses. Human infection has been reported in 51 different countries from 5 continents. One of the possible approaches to control this problem is to interrupt the life cycle of the parasitic trematodes by eliminating the snail. Snails attractant pellets (SAP) were prepared from binary combination of carbohydrate + amino acid (20 mM) in 2% agar solution with active molluscicidal component Ferula asafoetida (ferulic acid, umbelliferone), Syzygium aromaticum (eugenol), Carum carvi (limonene). Attraction of snails to different combinations was studied by using clear glass aquaria having diameter of 30 cm. Each aquarium was divided into four concentric zones; zone-3 (central zone), zone-2 and zone-1 (middie zone) and zone-0 (outer zone) had a diameter of 13, 18, 24, and 30 cm, respectively. The behavioral responses of snails to these binary combinations of carbohydrate and amino acid in bait formulation were examined. The fraction of snails that was in contact with the SAP at different times was used as a measure of attraction. Among all the binary combination of carbohydrate+amino acid+molluscicide after 2h of experiment, highest attraction of snail (54.71%) was observed towards the SAP containing starch+histidine+limolene. Limonene+ starch+histidine containing SAP emerged as the strongest bait formulation (96h LC50 0.74%) against Lymnaea acuminata. The present study suggested that the molluscicides of plant origin could be used with varying degrees of success in bait formulation.

  16. Growth and development in Achimenes cultivars

    NARCIS (Netherlands)

    Vlahos, J.C.

    1991-01-01

    Achimenes is a herbaceous perennial of the Gesneriaceae family. Its origin is Central and South America. It has been cultivated as a pot plant since the Victorian era. Extensive hybridization has produced many attractive cultivars which have been Introduced in

  17. Blueberry Cultivars for Oregon (EC 1308)

    Science.gov (United States)

    This Extension publication gives an overview of the types of blueberries and the blueberry cultivars that might be grown in Oregon or elsewhere in the Pacific Northwest. Bush and berry characteristics, yield potential, and suitability for commercial or home garden production are given for over 30 bl...

  18. Growth and development in Achimenes cultivars.

    NARCIS (Netherlands)

    Vlahos, J.C.

    1991-01-01

    Achimenes is a herbaceous perennial of the Gesneriaceae family. Its origin is Central and South America. It has been cultivated as a pot plant since the Victorian era. Extensive hybridization has produced many attractive cultivars which have been Introduced in commercial floriculture both In the Uni

  19. Micropropagation of peach rootstocks and cultivars.

    Science.gov (United States)

    Balla, Ildikó; Mansvelt, Lucienne

    2013-01-01

    Peach (Prunus persica (L.) Batsch) is one of the most popular stone fruits, commercially produced largely in Mediterranean and, to a lesser extent, in continental climatic conditions. Several breeding programs with different aims release annually large numbers of new cultivars. Micropropagation offers a suitable method to provide the growers of sufficient quantities of rootstocks, as well as of pathogen-free planting material of old and new cultivars.An effective four-step micropropagation procedure for cultivar and rootstock production is described here, based on the use of modified MS and WPM media. The health status of the initial shoot tips is very important, also because the growth and proliferation rate of shoot cultures from virus-infected clones are generally very poor. Proliferation and elongation phases depend on the major macro-elements, as well as the content and ratio of plant growth regulators. It is important to grow the cultures at 22°C, as hyperhydricity may develop at higher temperatures. Although sucrose is the most common carbon source used during proliferation and rooting, for some peach cultivars and rootstocks the replacement of sucrose (10 g/L) with glucose (20 g/L) in the rooting medium improves the rooting and survival rates of plants in the acclimatization phase. The rooting rate of the rootstock "Cadaman" is improved with the chelated form of iron FeEDDHA at 150 mg/L. Rooted plants are acclimatized in greenhouse under high humidity conditions.

  20. Distribution of Glucosinolates in Brassica oleracea cultivars

    NARCIS (Netherlands)

    Castro, A; Aires, A; Rosa, E; Bloem, E; Stulen, I.; De Kok, LJ

    2004-01-01

    Glucosinolates are important secondary compounds, commonly found in Brassicaceae. To what extent these sulfur and nitrogen containing compounds contribute to the total sulfur pool was investigated. In various cultivars of Brassica oleracea viz. curly kale, pointed cabbage, red cabbage, savoy cabbage

  1. Substrates in the development potted gerbera cultivar

    Directory of Open Access Journals (Sweden)

    Fernanda Ludwig

    2015-11-01

    Full Text Available The gerbera is a prominent culture that has gained in the Brazilian market of flowers and ornamental plants and there is a great demand for adequate substrates for its production. This study was conducted to evaluate the growth and distribution of dry mass and nitrogen in potted gerbera, depending on the substrates and cultivars. Experimental design was randomized blocks in a 5x2 factorial arrangement (5 substrates and 2 cultivars. Red and Cherry cultivars were evaluated at 1, 15, 29, 43 and 50 days of acclimation (DAA to the leaves number, leaf area, dry mass of aerial parts (leaf and flower and accumulation of nitrogen. From 29 DAA, the inflorescence has established as the drain and has contributed significantly to the total dry mass. The accumulation of nitrogen was similar in vegetative and reproductive periods. The traits evaluated varied depending on the substrate used, influenced by physical and chemical properties of the same. The growth, dry matter and nitrogen distribution potted gerbera cultivars Cherry and Red are influenced by physical and chemical characteristics of substrates, with better results in substrates with bulk density of less than 530 kg m-3 and pH values between 5.5 and 6.8

  2. Yield potential of pigeon pea cultivars

    Science.gov (United States)

    Yield potential of twelve vegetable pigeon pea (Cajanus cajun) cultivars was evaluated at two locations in eastern Kenya during 2012 and 2013 cropping years. Pigeon pea pod numbers, seeds per pod, seed mass, grain yield and shelling percentage were quantified in three replicated plots, arranged in a...

  3. CULTIVAR RELEASE-CD 115: Soft Wheat Cultivar for colder regions

    Directory of Open Access Journals (Sweden)

    Volmir Sergio Marchioro

    2008-01-01

    Full Text Available The cultivar CD 115 was developed by the Cooperativa Central de Pesquisa Agrícola (COODETEC and isrecommended for cultivation in the states of Rio Grande do Sul, Santa Catarina and Paraná. The cultivar is tolerant todiseases and pre-harvest sprouting. The mean grain yield in four years of evaluation was 3,420 kg ha-1, exceeding thecontrols by 7%.

  4. CULTIVAR RELEASE - BRSMG União: common bean cultivar with jalo grain for the state of Minas Gerais

    Directory of Open Access Journals (Sweden)

    Magno Antonio Patto Ramalho

    2012-12-01

    Full Text Available The bean cultivar BRSMG União as a new option of a bean cultivar with jalo grains for the state of Minas Gerais. The cultivar BRSMG União had an average grain yield of 9.8% above the mean of the controls (Jalo EEP 558 and BRS Radiante and was resistant to powdery-mildew.

  5. Anatomía de la lámina de hoja en ocho cultivares de aguacate Leaf lamina anatomy of eight avocado cultivars

    Directory of Open Access Journals (Sweden)

    Víctor Manuel González-Calderón

    2011-10-01

    increased CO2 assimilation rate and persea mite resistance. These features can be directly related to the leaf anatomy. It is important to know these features in current and new cultivars: 'Hass', 'Reed', 'Gwen', 'GEM', 'Lamb Hass', 'Harvest', BL667 ('Nobel' and BL516 ('Marvel'. During 2007 in Chapingo, Mexico, transverse sections of leaf blades were performed, evaluating anatomical features. There were found variables with no differences between cultivars, which may be because all genotypes used in this study except 'Reed', come from a common ancestor 'Hass'. The cultivars groupings are possible according to the anatomical characteristics of its leaf blade, where, there is a variation that can be interpreted from the physiological aspect and its likenesses by their ancestry. 'Gwen', 'Hass', 'Marvel' and 'GEM' had a wider cuticle and less wide palisade parenchyma cells, while 'Reed', 'Nobel' and 'Lamb Hass', had contrasting features, 'Harvest' had intermediate values. The 'Lamb Hass' cultivar presented a leaf blade anatomy with features that allow it to carry out photosynthesis more efficiently, due to the higher values of its palisade parenchyma I.

  6. Exploration of methods used to describe bacterial communities in silage of maize (Zea mays) cultivars.

    Science.gov (United States)

    Brusetti, Lorenzo; Borin, Sara; Rizzi, Aurora; Mora, Diego; Sorlini, Claudia; Daffonchio, Daniele

    2008-01-01

    Different techniques to assess bacterial community structure and diversity were evaluated in silages prepared with four different maize cultivars, three conventional and one transgenic (cv. Tundra, event Bt-176). Plants were cultivated in the greenhouse and harvested after 30 days of growth. Silage samples were collected at successive times during fermentation and analyzed for bacterial counts and by various DNA-based fingerprinting techniques. Bacterial counts were similar between cultivars for the total culturable bacteria, sporeforming, and mesophilic and thermophilic lactic acid bacteria (LAB). Further analysis of the species composition of 388 LAB strains by intergenic transcribed spacer (ITS) PCR followed by sequencing of 16S rRNA gene did not reveal differences between cultivars. In contrast, molecular fingerprinting methods targeting whole bacterial communities, such as automated ribosomal intergenic spacers analysis (ARISA) and 16S rRNA gene length heterogeneity-PCR (LH-PCR), indicated that different maize silage batches or cultivars hosted different bacterial communities. Thus, ARISA and LH-PCR fingerprinting techniques offer a fast and sensitive method to compare bacterial communities, and to detect differences in silage bacterial communities.

  7. Physiological analysis of common bean (Phaseolus vulgaris L.) cultivars uncovers characteristics related to terminal drought resistance.

    Science.gov (United States)

    Rosales, Miguel A; Ocampo, Edilia; Rodríguez-Valentín, Rocío; Olvera-Carrillo, Yadira; Acosta-Gallegos, Jorge; Covarrubias, Alejandra A

    2012-07-01

    Terminal drought is a major problem for common bean production because it occurs during the reproductive stage, importantly affecting seed yield. Diverse common bean cultivars with different drought susceptibility have been selected from different gene pools in several drought environments. To better understand the mechanisms associated with terminal drought resistance in a particular common bean race (Durango) and growth habit (type-III), we evaluated several metabolic and physiological parameters using two cultivars, Bayo Madero and Pinto Saltillo, with contrasting drought susceptibility. The common bean cultivars were submitted to moderate and severe terminal drought treatments under greenhouse conditions. We analyzed the following traits: relative growth rate, photosynthesis and transpiration rates, stomatal conductance, water-use efficiency, relative water content, proline accumulation, glycolate oxidase activity and their antioxidant response. Our results indicate that the competence of the drought-resistant cultivar (Pinto Saltillo) to maintain seed production upon terminal drought relies on an early response and fine-tuning of stomatal conductance, CO₂ diffusion and fixation, and by an increased water use and avoidance of ROS accumulation. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  8. Screening of Carnation Cultivars for Resistance to Meloidogyne incognita.

    Science.gov (United States)

    Cho, M R; Kim, J Y; Song, C; Ko, J Y; Na, S Y; Yiem, M S

    1996-12-01

    A total of 33 carnation cultivars cultured in Korea were screened for resistance to the southern root-knot nematode, Meloidogyne incognita. Carnations were tested by either inoculating with 5,000 eggs or by transplanting into a mixture of bedding medium and soil infested with an average of 435 second-stage juveniles/300 cm(3) soil. Cultivars, Desio, Castelaro, Kappa, Rara, Izu Pink, Target, and Antalia were highly resistant to M. incognita. Twelve cultivars were moderately resistant, and the remaining 14 cultivars were susceptible. These results were similar to those obtained when the cultivars were subjected to field populations of the condition on a carnation farm.

  9. Pollen limitation and Allee effect related to population size and sex ratio in the endangered Ottelia acuminata (Hydrocharitaceae): implications for conservation and reintroduction.

    Science.gov (United States)

    Xia, J; Lu, J; Wang, Z X; Hao, B B; Wang, H B; Liu, G H

    2013-03-01

    Small populations may suffer more severe pollen limitation and result in Allee effects. Sex ratio may also affect pollination and reproduction success in dioecious species, which is always overlooked when performing conservation and reintroduction tasks. In this study, we investigated whether and how population size and sex ratio affected pollen limitation and reproduction in the endangered Ottelia acuminata, a dioecious submerged species. We established experimental plots with increasing population size and male sex ratio. We observed insect visitation, estimated pollen limitation by hand-pollinations and counted fruit set and seed production per fruit. Fruit set and seed production decreased significantly in small populations due to pollinator scarcity and thus suffered more severe pollen limitation. Although frequently visited, female-biased larger populations also suffered severe pollen limitation due to few effective visits and insufficient pollen availability. Rising male ratio enhanced pollination service and hence reproduction. Unexpectedly, pollinator preferences did not cause reduced reproduction in male-biased populations because of high pollen availability. However, reproductive outputs showed more variability in severe male-biased populations. Our results revealed two component Allee effects in fruit set and seed production, mediated by pollen limitation in O. acuminata. Moreover, reproduction decreased significantly in larger female-biased populations, increasing the risk of an Allee effect.

  10. Microclimatic variation in UV perception and related disparity in tropane and quinolizidine alkaloid composition of Atropa acuminata, Lupinus polyphyllus and Hyoscyamus niger.

    Science.gov (United States)

    Jan, Sumira; Kamili, Azra N; Parray, Javid A; Bedi, Yashbir S; Ahmad, Parvaiz

    2016-08-01

    The aim of current research was to evaluate the physiological adjustment in three medicinal herbs viz., Atropa acuminata, Lupinus polyphyllus and Hyoscyamus niger to the winter period characterised by intense UV flux in Kashmir valley across the North Western Himalaya. Quinolizidine (QA) and tropane alkaloid (TA) concentrations were analysed in these herbs thriving at two different altitudes via GC-MS and correlated by PCA analysis. This study investigated the hypothesis that UV reflectance and absorbance at low temperatures are directly related to disparity in alkaloid accumulation. Among QAs in L. polyphyllus, ammodendrine and lupanine accumulated at higher concentration and exhibited significant variation of 186.36% and 95.91% in ammodendrine and lupanine respectively in both sites. Tetrahydrohombifoline displayed non-significant variation of about 9.60% irrespective of sites. Among tropane alkaloid (TA), hyoscyamine was recorded as the most abundant constituent irrespective of the plant and site while apotropine accumulated in lesser quantity in A. acuminata than H. niger. However, apotropine demonstrated significant variation of 175% among both sites. The final concentration of quinolizidine (QA) and tropane alkaloid (TA) reflects the interplay between reflectance and absorbance of UV radiation response field. These findings suggest that spectral response of UV light contributes directly to alkaloid biosynthesis.

  11. Composición química y actividad antibacteriana del aceite esencial de Peperomia acuminata de los Andes venezolanos

    Directory of Open Access Journals (Sweden)

    Flor D. Mora-Vivas

    2016-12-01

    Full Text Available El género Peperomia (Piperaceae, es bien conocido por sus especies ornamentales y usos etnomedicinales. En el presente trabajo se describe la caracterización química y la actividad antibacteriana del aceite esencial de Peperomia acuminata Ruiz & Pav. proveniente del Estado Mérida Venezuela. El aceite esencial se obtuvo por hidrodestilación de las hojas y la separación de los componentes se realizó por Cromatografía de gases-Espectrometría de Masas (CG/EM. Se logró la elucidación de ocho compuestos (96,7%, siendo el 2E-dodecenal el componente mayoritario (65% seguido de dodecanal (14,8% y tetradecanal (9,2%. Esta investigación muestra el potencial del aceite esencial de P. acuminata frente a bacterias Gram positivas (Staphylococcus aureus ATCC 25923 y Enterococcus faecalis 29212, con un valor de Concentración inhibitoria mínima de 1μL/mL. Este es el primer reporte sobre la composición química del aceite esencial de esta especie, por lo tanto una contribución importante al estudio del género Peperomia.

  12. Contributions of apoplasmic cadmium accumulation, antioxidative enzymes and induction of phytochelatins in cadmium tolerance of the cadmium-accumulating cultivar of black oat (Avena strigosa Schreb.).

    Science.gov (United States)

    Uraguchi, Shimpei; Kiyono, Masako; Sakamoto, Takuya; Watanabe, Izumi; Kuno, Katsuji

    2009-07-01

    The contributions of cadmium (Cd) accumulation in cell walls, antioxidative enzymes and induction of phytochelatins (PCs) to Cd tolerance were investigated in two distinctive genotypes of black oat (Avena strigosa Schreb.). One cultivar of black oat 'New oat' accumulated Cd in the leaves at the highest concentration compared to another black oat cultivar 'Soil saver' and other major graminaceous crops. The shoot:root Cd ratio also demonstrated that 'New oat' was the high Cd-accumulating cultivar, whereas 'Soil saver' was the low Cd-accumulating cultivar. Varied levels of Cd exposure demonstrated the strong Cd tolerance of 'New oat'. By contrast, low Cd-accumulating cultivar 'Soil saver' suffered Cd toxicity such as growth defects and increased lipid peroxidation, even though it accumulated less Cd in shoots than 'New oat'. Higher activities of ascorbate peroxidase (EC 1.11.1.11) and superoxide dismutase (EC 1. 15. 1. 1) were observed in the leaves of 'New oat' than in 'Soil saver'. No advantage of 'New oat' in PCs induction was observed in comparison to Cd-sensitive cultivar 'Soil saver', although Cd exposure increased the concentration of total PCs in both cultivars. Higher and increased Cd accumulation in cell wall fraction was observed in shoots of 'New oat'. On the other hand, in 'Soil saver', apoplasmic Cd accumulation showed saturation under higher Cd exposure. Overall, the present results suggest that cell wall Cd accumulation and antioxidative activities function in the tolerance against Cd stress possibly in combination with vacuolar Cd compartmentation.

  13. Textural properties of mango cultivars during ripening.

    Science.gov (United States)

    Jha, Shyam Narayan; Jaiswal, Pranita; Narsaiah, Kairam; Kaur, Poonam Preet; Singh, Ashish Kumar; Kumar, Ramesh

    2013-12-01

    Firmness and toughness of fruit, peel and pulp of seven different mango cultivars were studied over a ripening period of ten days to investigate the effects of harvesting stages (early, mid and late) on fruit quality. Parameters were measured at equatorial region of fruits using TA-Hdi Texture Analyzer. The textural characteristics showed a rapid decline in their behaviour until mangoes got ripened and thereafter, the decline became almost constant indicating the completion of ripening. However, the rate of decline in textural properties was found to be cultivar specific. In general, the changes in textural attributes were found to be significantly influenced by ripening period and stage of harvesting, but firmness attributes (peel, fruit and pulp) of early harvested mangoes did not differ significantly from mid harvested mangoes, while peel, fruit and pulp firmness of late harvested mangoes were found to be significantly lower than early and mid harvested mangoes.

  14. Characteristics of the microbial community in rhizosphere of Camptotheca acuminata cultured with exotic invasive plant Eupatorium adenophorum

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The traditional culture-dependent plate counting and culture-independent small-subunit-ribosomal RNA gene-targeted molecular techniques, Single-Strand Conformation Polymorphism (SSCP) and ter-minal Restriction Fragment Length Polymorphism (tRFLP) combined with 16S rDNA clone library were adopted to investigate the impacts of secretion from Camptotheca acuminata (abbreviated to Ca) roots on the quantities and structure of eukaryotic microbes and bacteria in the rhizosphere, and the possi-bility that Ca controls exotic invasive plant Eupatorium adenophorum (Ea). The counting results indi-cated that the number of bacteria increased in turn in rhizospheres of Ea, Ca-Ea mixed culture and Ca, while that of eukaryotic microbes decreased. PCR-SSCP profiles showed eukaryotic microbial bands (corresponding to biodiversity) in rhizosphere of Ea were more complex than those of Ca and CE. Meristolohmannia sp., Termitomyces sp. and Rhodophyllus sp. were the dominant populations in the rhizosphere of Ca. Bacterial terminal restriction fragments (TRFs) profiles showed no difference among three kinds of rhizospheres, and the sequences of the 16S rDNA clone library from Ca rhizospheres were distributed in 10 known phyla, in which phylum Proteobacteria were the absolute dominant group and accounted for 24.71% of the cloned sequences (δ-Proteobacteria accounted for up to 17.65%), and phyla Acidobacteria and Bacteroidetes accounted for 16.47% and 10.59% of the cloned sequences, respectively. In addition, high performance liquid chromatography detected a trace amount of camp-tothecin and hydroxycamptothecin in the rhizospheric soil of Ca and CE, but examined neither camp-tothecin nor hydroxycamptothecin in rhizospheric soil of Ea. Therefore, invasion and diffusion of Ea evidently depended on distinguishing the eukaryotic community structure, but not on that of the bac-terial pattern. Ca was able to alter the eukaryotic community structure of invasive Ea by secreting camptothecin and

  15. The effect of abiotic factors on the toxicity of cypermethrin against the snail Lymnaea acuminata in the control of fascioliasis.

    Science.gov (United States)

    Singh, V; Singh, D K

    2009-03-01

    Every month during the year 2006-2007, the 24, 48, 72 and 96 h LC50 values of a molluscicide, cypermethrin, were determined for a snail Lymnaea acuminata, with concomitant estimation of levels of temperature, pH, dissolved oxygen and carbon dioxide and electrical conductivity, both in control and test water. On the basis of a 24 h toxicity assay, it was noted that LC50 values of 10.39, 10.90 and 11.19 mg l- 1 during the months of May, June and July, respectively, were most effective in killing the snails, while the molluscicide was least effective in the month of January, when its 24 h LC50 was 65.84 mg l- 1.There was a significant positive correlation between LC50 of cypermethrin and levels of dissolved O2/pH of water in corresponding months. On the contrary, a negative correlation was observed between LC50 and dissolved CO2/temperature of test water in the same months. In order to ascertain that such a relationship between toxicity and abiotic factors is not coincidental, the nervous tissue of the snail was assayed for the activity of acetylcholinesterase (AChE), acid phosphatase (ACP) and alkaline phosphatase (ALP) to sublethal concentrations (40% and 80%) of 24 h LC50 during each of the 12 months of the same year. The findings confirmed that abiotic factors indeed influence toxicity of cypermethrin in the snail. A significant positive rank correlation between AChE, ACP and ALP activity did exist following exposure to the corresponding sublethal concentrations. Moreover, there was a maximum inhibition of 61.29 and 76.16% of AChE and ACP, respectively, in snails exposed to 80% of the 24 h LC50 in the month of May. A similar treatment caused a maximum inhibition of 70.53% of ALP activity in the month of June. This work shows conclusively that the best time to control the snail population with cypermethrin is during the months of May and June.

  16. Caracterización de harina y almidón de frutos de banano Gros Michel (Musa acuminata AAA

    Directory of Open Access Journals (Sweden)

    Jairo Montoya-López

    2015-01-01

    Full Text Available En el estudio se determinaron las características fisicoquímicas, térmicas y reológicas de la harina y el almidón de frutos de banano Gros Michel (Musa acuminata cosechado en fincas del departamento del Quindío, Colombia. En el análisis proximal, la harina presentó un contenido de fibra de 18.82% y el almidón presentó contenidos de proteína de 1.92%, grasa de 5.3% y fibra de 2.76%. La harina presentó la temperatura más alta de absorción de calor (68.88 °C y su entalpía de gelatinización fue de 2.17 J/g; mientras que para el almidón estos valores fueron de 48.36 °C y 44.62 J/g, respectivamente. El análisis termogravimétrico (TGA de la harina o temperaturas en las cuales se registra la descomposición de carbohidratos (componentes de bajo peso molecular y polisacáridos (componentes de alto peso molecular fueron, respectivamente, de 284.51 °C y 470.42 °C; y para el almidón fueron de 307.51 °C y 500.46 °C. Los gránulos de almidón de banano tienen forma elipsoidal con un tamaño longitudinal promedio de 39.39 µm y tamaño transversal promedio de 29.47 µm. Los difractogramas de rayos X mostraron patrones de difracción tipo B. Los viscoamilogramas mostraron que para la harina la temperatura de inicio de gelatinización (Tg es de 76.3 °C, la viscosidad máxima de 1120 cP, y para el almidón la Tg fue de 70.75 °C y la viscosidad máxima de 2087 cP.

  17. Relative competitiveness of soybean cultivars with barnyardgrass

    Directory of Open Access Journals (Sweden)

    Marlon Ouriques Bastiani

    Full Text Available ABSTRACT The aim of this work was to evaluate the competitiveness between soybean cultivars and barnyardgrass, based on morphological and physiological characteristics of species. The experiments were conducted in completely randomized experimental design, with 4 replications. In the first study, for both soybean and barnyardgrass, it was determined the population of plants in which shoot dry matter became constant and independent of the population (16 plants∙pot−1 or 400 plants∙m−2. In the second study, 2 experiments were conducted to evaluate the competitiveness of BMX Apolo RR and BMX Potência RR soybean cultivars with barnyardgrass plants, both carried out in replacement series under different proportions of plants∙pot−1 (100:0; 75:25; 50:50; 25:75 and 0:100 between the crop and the weed. The analysis of the species competitiveness was determined through diagrams applied to replacement series experiments and use of relative competitiveness indexes. At 44 days after the emergence of species, the physiological and morphological parameters of the crop and the weed were evaluated. The BMX Apolo RR and BMX Potência RR soybean cultivars show similar competitiveness when competing with the barnyardgrass; therefore, the ability of one species to interfere on another is equivalent. For plant height, barnyardgrass displays higher competitiveness compared to BMX Apolo RR, with early cycle and short height. The intraspecific competition is more important to barnyardgrass than interspecific competition with soybean cultivars, resulting in negative effects on the morphological and physiological characteristics of species.

  18. RB975952 – Early maturing sugarcane cultivar

    Directory of Open Access Journals (Sweden)

    Monalisa Sampaio Carneiro

    2015-08-01

    Full Text Available RB975952 is an early maturing sugarcane cultivar released for the South-Central region of Brazil. It should be harvested between April and May, and it is recommended for planting in environments with medium to high production potential. RB975952 has high resistance levels to the main diseases of the crop, it also has a good shoot development after mechanical harvesting, and high sucrose yields.

  19. Evaluation of garlic cultivars for polyphenolic content and antioxidant properties.

    Directory of Open Access Journals (Sweden)

    Shuxia Chen

    Full Text Available Two phenolic compound parameters (total phenolic and flavonoid contents and 5 antioxidant parameters (DPPH [2, 2-diphenyl-1-picrylhydrazyl] radical scavenging activity, HRSC (hydroxyl radical scavenging capacity, FRAP (ferric ion reducing antioxidant power, CUPRAC (cupric ion reducing antioxidant capacity, and MCA (metal chelating activity were measured in bulbs and bolts of 43 garlic cultivars. The bulbs of cultivar '74-x' had the highest phenolic content (total phenolic, flavonoids and the strongest antioxidant capacity (DPPH, FRAP, and CUPRAC, followed by bulbs of cultivar 'Hanzhong purple'; the bulbs of cultivar 'Gailiang' had the lowest phenolic content and antioxidant capacity (FRAP, CUPRAC, MCA. The bolts of 'Hanzhong purple' also had higher phenolic content. Principal components analysis (PCA separated the cultivars into 3 groups according to phenolic and flavonoid contents and strength of antioxidant activity. The first group had higher HRSC, FRAP, and flavonoid content; the second group had higher total phenolic content and MCA; some cultivars in the third group had higher HRSC and FRAP. All 8 test garlic bulb extracts successfully prevented Human Vascular Endothelial Cell death and significantly prevented reactive-oxygen species (ROS formation in oxidative stress model, in which cultivar '74-x' had highest protection capability, following by cultivar 'Hanzhong purple', and the bulbs of cultivar 'No. 105 from Korea' had the lower protection capability against cell death and ROS formation. The protection capability in vivo of these garlic cultivars was consistent with their phenolic content and antioxidant capacity.

  20. Evaluation of garlic cultivars for polyphenolic content and antioxidant properties.

    Science.gov (United States)

    Chen, Shuxia; Shen, Xiaoqing; Cheng, Siqiong; Li, Panpan; Du, Junna; Chang, Yanxia; Meng, Huanwen

    2013-01-01

    Two phenolic compound parameters (total phenolic and flavonoid contents) and 5 antioxidant parameters (DPPH [2, 2-diphenyl-1-picrylhydrazyl] radical scavenging activity, HRSC (hydroxyl radical scavenging capacity), FRAP (ferric ion reducing antioxidant power), CUPRAC (cupric ion reducing antioxidant capacity), and MCA (metal chelating activity) were measured in bulbs and bolts of 43 garlic cultivars. The bulbs of cultivar '74-x' had the highest phenolic content (total phenolic, flavonoids) and the strongest antioxidant capacity (DPPH, FRAP, and CUPRAC), followed by bulbs of cultivar 'Hanzhong purple'; the bulbs of cultivar 'Gailiang' had the lowest phenolic content and antioxidant capacity (FRAP, CUPRAC, MCA). The bolts of 'Hanzhong purple' also had higher phenolic content. Principal components analysis (PCA) separated the cultivars into 3 groups according to phenolic and flavonoid contents and strength of antioxidant activity. The first group had higher HRSC, FRAP, and flavonoid content; the second group had higher total phenolic content and MCA; some cultivars in the third group had higher HRSC and FRAP. All 8 test garlic bulb extracts successfully prevented Human Vascular Endothelial Cell death and significantly prevented reactive-oxygen species (ROS) formation in oxidative stress model, in which cultivar '74-x' had highest protection capability, following by cultivar 'Hanzhong purple', and the bulbs of cultivar 'No. 105 from Korea' had the lower protection capability against cell death and ROS formation. The protection capability in vivo of these garlic cultivars was consistent with their phenolic content and antioxidant capacity.

  1. Using simulation models to investigate the cumulative effects of sowing rate, sowing date and cultivar choice on weed competition.

    Science.gov (United States)

    Andrew, Izzadora K S; Storkey, Jonathan

    2017-05-01

    With the increasing pressure on crop production from the evolution of herbicide resistance, farmers are increasingly adopting Integrated Weed Management (IWM) strategies to augment their weed control. These include measures to increase the competitiveness of the crop canopy such as increased sowing rate and the use of more competitive cultivars. While there are data on the relative impact of these non-chemical weed control methods assessed in isolation, there is uncertainty about their combined contribution, which may be hindering their adoption. In this article, the INTERCOM simulation model of crop/weed competition was used to examine the combined impact of crop density, sowing date and cultivar choice on the outcomes of competition between wheat (Triticum aestivum) and Alopecurus myosuroides. Alopecurus myosuroides is a problematic weed of cereal crops in North-Western Europe and the primary target for IWM in the UK because it has evolved resistance to a range of herbicides. The model was parameterised for two cultivars with contrasting competitive ability, and simulations run across 10 years at different crop densities and two sowing dates. The results suggest that sowing date, sowing density and cultivar choice largely work in a complementary fashion, allowing enhanced competitive ability against weeds when used in combination. However, the relative benefit of choosing a more competitive cultivar decreases at later sowing dates and higher crop densities. Modeling approaches could be further employed to examine the effectiveness of IWM, reducing the need for more expensive and cumbersome long-term in situ experimentation.

  2. Distinct physiological and metabolic reprogramming by highbush blueberry (Vaccinium corymbosum) cultivars revealed during long-term UV-B radiation.

    Science.gov (United States)

    Luengo Escobar, Ana; Alberdi, Miren; Acevedo, Patricio; Machado, Mariana; Nunes-Nesi, Adriano; Inostroza-Blancheteau, Claudio; Reyes-Díaz, Marjorie

    2017-05-01

    Despite the Montreal protocol and the eventual recovery of the ozone layer over Antarctica, there are still concerns about increased levels of ultraviolet-B (UV-B) radiation in the Southern Hemisphere. UV-B induces physiological, biochemical and morphological stress responses in plants, which are species-specific and different even for closely related cultivars. In woody plant species, understanding of long-term mechanisms to cope with UV-B-induced stress is limited. Therefore, a greenhouse UV-B daily course simulation was performed for 21 days with two blueberry cultivars (Legacy and Bluegold) under UV-BBE irradiance doses of 0, 0.07 and 0.19 W m(-2) . Morphological changes, photosynthetic performance, antioxidants, lipid peroxidation and metabolic features were evaluated. We found that both cultivars behaved differently under UV-B exposure, with Legacy being a UV-B-resistant cultivar. Interestingly, Legacy used a combined strategy: initially, in the first week of exposure its photoprotective compounds increased, coping with the intake of UV-B radiation (avoidance strategy), and then, increasing its antioxidant capacity. These strategies proved to be UV-B radiation dose dependent. The avoidance strategy is triggered early under high UV-B radiation in Legacy. Moreover, the rapid metabolic reprogramming capacity of this cultivar, in contrast to Bluegold, seems to be the most relevant contribution to its UV-B stress-coping strategy. © 2016 Scandinavian Plant Physiology Society.

  3. Eating quality and health-promoting properties of two sweet cherry (Prunus avium L.) cultivars stored in passive modified atmosphere.

    Science.gov (United States)

    Lara, Isabel; Camats, Josep A; Comabella, Eva; Ortiz, Abel

    2015-03-01

    Two sweet cherry cultivars ('New Star' and 'Sweet Heart') were chosen to explore the impact of passive modified atmosphere packaging on the eating quality and health-promoting properties of fruit. Packaged and unpackaged fruits were stored at 0 ℃ for 15 or 30 days, followed by zero or three days at 20 ℃, after which the analyses were undertaken. In most cases, modified atmosphere packaging helped preserving higher firmness values and reducing the incidence of alterations and decay in both cultivars, but the effects on other physicochemical attributes were different for each cultivar. Partial least squares regression procedures were used to reveal relationships among the different variables assessed. Generally, fruits displaying higher antioxidant capacity were also characterised by higher values for firmness and titratable acidity, in turn related to better acceptability scores in both cultivars. However, the attributes contributing most to acceptability were different in each case. In 'New Star' fruit, acceptability was closely related to the perception of cherry flavour. In this cultivar, acetaldehyde content was related to the perception of off-flavours, while ethanol content was found to associate to soluble solids and to the perception of sweetness. In contrast, acceptability of 'Sweet Heart' fruit was related mainly to the perception of firmness and, to a lower extent, of sweetness.

  4. Extracción de nutrimentos en plantaciones de jaul (Alnus acuminata en la cuenca del río Virilla, Costa Rica

    Directory of Open Access Journals (Sweden)

    Manuel Segura

    2005-01-01

    Full Text Available El motivo del presente trabajo es ampliar el conocimiento sobre la extracción de nutrimentos de A. acuminata en plantaciones entre 2 y 7 años de edad, en suelos Typic Udivitrands (Landelina y Vista de Mar y Entic Udivitrands (Matinilla. Se encontró que la variación de la concentración de todos los elementos varía en función del tipo de tejido. Los contenidos de N, P, Mg y S de A. acuminata disminuyen en el orden: hojas>ramas secundarias>ramas principales>tallo. La concentración de K, Cu y Mn disminuyó en un orden similar al anterior, excepto para ramas principales y tallo, los cuales tenían una concentración similar. El B y el Ca tienen una mayor concentración en las hojas y ramas secundarias, entre las cuales no hay diferencias, mientras que se encontraron en menor cantidad en las ramas principales y el tallo. La concentración de Zn fue mayor en las ramas secundarias que en las hojas y disminuyó en el orden de ramas secundarias>hojas>ramas principales>tallo. El contenido de Fe en las hojas fue mayor que en las otras secciones comparadas de la biomasa aérea del árbol, entre las cuales no hubo diferencia. Indiferentemente del tejido estudiado y de la edad de la plantación, la concentración porcentual de los macronutrimentos en jaúl descendió en el orden: N>K>Ca>P≈Mg>S y la de los micronutrimentos en el orden: Fe>Zn>Mn>Cu>B. De los tejidos estudiados hasta los 2 años de edad, la copa y el tallo tienen biomasas comparables; a partir del cuarto año el tallo conforma la mayor parte de la biomasa aérea y por ende de los nutrimentos absorbidos, seguido por las ramas principales, las hojas y las ramas secundarias. La extracción total de nutrimentos en las plantaciones de A. acuminata se dio en el orden de N>K>Ca>P>Mg>S y de Fe>Zn>Mn>Cu>B.

  5. Arbuscular mycorrhizal colonization of Alnus acuminata Kunth in northwestern Argentina in relation to season and soil parameters Colonización micorrícico arbuscular de Alnus acuminata Kunth en el noroeste argentino en relación a la estacionalidad y a los parámetros edáficos

    Directory of Open Access Journals (Sweden)

    Alejandra Gabriela Becerra

    2007-07-01

    Full Text Available The objective of this study was to determine patterns of arbuscular mycorrhizal (AM colonization of Alnus acuminata Kunth at two natural forests in relation to soil parameters at two different seasons (autumn and spring. The soil parameters studied were field capacity, pH, electrical conductivity, available P, total N and organic matter. The percentage of AM colonization was estimated and correlated to soil properties and to two different seasons. The results indicate that the percentage of AM colonization varied among soil types and was higher in spring than autumn. A significant positive correlation was found between AM colonization and electrical conductivity, organic matter and total Nitrogen. Results of this study provide evidence that AM colonization of A. acuminata can be affected by some soil parameters and seasonality.El objetivo de este estudio fue determinar el patrón de colonización micorrícico arbuscular (MA de Alnus acuminata Kunth en dos bosques del Noroeste Argentino, en relación a los parámetros edáficos y en dos estaciones del año (otoño y primavera. Los parámetros edáficos estudiados fueron: capacidad de campo, pH, conductividad eléctrica, fósforo disponible, N total y materia orgánica. Se cuantificó el porcentaje de colonización MA y se lo correlacionó con las variables estudiadas (parámetros edáficos y estaciones. Los resultados indican que el porcentaje de colonización MA varió entre los dos tipos de suelo y las estaciones, siendo mayor en primavera. Se observó correlación positiva significativa entre el porcentaje de colonización MA y la conductividad eléctrica, materia orgánica y N total. Los resultados de este estudio indican que la colonización MA de A. acuminata puede ser afectada por algunos parámetros edáficos y la estacionalidad.

  6. Cadmium accumulation in different rice cultivars and screening for pollution-safe cultivars of rice

    Energy Technology Data Exchange (ETDEWEB)

    Yu Hui [State Key Laboratory for Biocontrol, also School of Life Sciences, Sun Yat-sen University, Guangzhou 510275 (China); Wang Junli [State Key Laboratory for Biocontrol, also School of Life Sciences, Sun Yat-sen University, Guangzhou 510275 (China); Fang Wei [Biology Department, Long Island University, Brooklyn, NY 11201 (United States); Yuan Jiangang [State Key Laboratory for Biocontrol, also School of Life Sciences, Sun Yat-sen University, Guangzhou 510275 (China); Yang Zhongyi [State Key Laboratory for Biocontrol, also School of Life Sciences, Sun Yat-sen University, Guangzhou 510275 (China)]. E-mail: adsyzy@mail.sysu.edu.cn

    2006-11-01

    Large areas of contaminated land are being used for agricultural production in some countries due to the high demand for food. To minimize the influx of pollutants to the human food chain through consumption of agricultural products, we propose the concept of pollution-safe cultivars (PSCs), i.e. cultivars whose edible parts accumulate a specific pollutant at a level low enough for safe consumption, even when grown in contaminated soil. We tested the feasibility of the PSC concept by growing 43 cultivars of paddy rice (Oryza sativa L., including 20 normal and 23 hybrid cultivars) under a high (75.69-77.55 mg kg{sup -1}) and a low (1.75-1.85 mg kg{sup -1}) cadmium (Cd) exposure. These pot experiments took place in the spring and summer of 2004. At the low level of Cd exposure, 30 out of the 43 tested cultivars were found to be Cd-PSCs. Grain Cd concentrations were highly correlated (p < 0.01) between the two experiments, suggesting that Cd accumulation in rice grain is genotype-dependent and that the selection of PSCs is possible, at least at a certain level of soil contamination. No Cd-PSCs were found under the high level of Cd exposure. Yield was enhanced in some cultivars and depressed in others in response to elevated soil Cd, indicating that farmers cannot rely on yield depression as an indicator of toxicity of the grains. It is therefore important and feasible to screen for PSCs and to establish PSC breeding programs to effectively and efficiently reduce the risk of human exposure to soil pollutants, such as Cd, through crop consumption.

  7. Characterization of oats (Avena sativa L.) cultivars using machine vision.

    Science.gov (United States)

    Sumathi, S; Balamurugan, P

    2013-10-15

    Machine vision or image analysis is an important tool in the study of morphology of any materials. This technique has been used successfully to differentiate the eleven oats cultivars based on morphological characters. The geometry of seeds was measured through image analyzer and the variation was observed and recorded. From the recorded data, the cluster analysis was carried out and it revealed that the cultivars could be grouped into two main clusters based on similarity in the measured parameters. Cultivar Sabzar, UPO 212, OL 9 and OL 88 formed one main cluster. The another main cluster includes cv. Kent, OS 6, UPO 94, HFO 114, OS 7, HJ 8 and JHO 822 with many sub clusters. Among the cultivars HJ 8 and JHO 822 has more similarity in all measured parameters than other cultivars. Thus morphological characterization through seed image analysis was found useful to discriminate the cultivars.

  8. Rooting of stem segments from fig tree cultivars

    OpenAIRE

    Rayane Barcelos Bisi; Guilherme Locatelli; Caio Morais de Alcântara Barbosa; Rafael Pio; Rodrigo Vieira Balbi

    2016-01-01

    ABSTRACT. Although Brazil is the largest fig (Ficus carica L.) producer in the Southern Hemisphere, it mainly uses only one cultivar, 'Roxo de Valinhos'. In addition, propagation is almost entirely through hardwood cuttings. Therefore, the aim of this study was to establish a propagation method that provides more successful rooting of stem segments of fig cultivars for the purpose of expanding the genetic base of the fig tree. The cultivars used were 'Brunswick', 'Calabacita', 'Negro de Bursa...

  9. Screening of Carnation Cultivars for Resistance to Meloidogyne incognita

    OpenAIRE

    Cho, M. R.; Kim, J. Y.; Song, C.; Ko, J.Y.; Na, S. Y.; Yiem, M. S.

    1996-01-01

    A total of 33 carnation cultivars cultured in Korea were screened for resistance to the southern root-knot nematode, Meloidogyne incognita. Carnations were tested by either inoculating with 5,000 eggs or by transplanting into a mixture of bedding medium and soil infested with an average of 435 second-stage juveniles/300 cm³ soil. Cultivars, Desio, Castelaro, Kappa, Rara, Izu Pink, Target, and Antalia were highly resistant to M. incognita. Twelve cultivars were moderately resistant, and the re...

  10. Cultivar identification in T. aestivum using highly polymorphic RFLP probes.

    Science.gov (United States)

    Vaccino, P; Accerbi, M; Corbellini, M

    1993-08-01

    Two probes, specific for HMW-glutenins and γ-gliadins have been used to identify 50 common wheat Italian cultivars, most of which are closely related, and four common wheat cultivars originating outside Italy. The probes revealed complex polymorphic patterns; three probe/enzyme combinations had the necessary sensitivity for the identification of all 54 cultivars. As already shown for potato and barley, the use of four-cutter restriction enzymes and polyacrylamide gels proved particularly useful for detecting polymorphism.

  11. Histology of Callogenesis in Diploid Bananas (Musa acuminata, AA Group �Kluai Sa� and �Kluai Leb Mu Nang�

    Directory of Open Access Journals (Sweden)

    Kamnoon KANCHANAPOOM

    2012-02-01

    Full Text Available Yellow compact calluses were induced from in vitro-grown shoot tips of diploid bananas (Musa acuminata, AA group �Kluai Sa� and �Kluai Leb Mu Nang� on a modified Murashige and Skoog (MS medium containing 100 mg/L malt extract, 50 mg/L proline, 50 mg/L cysteine, 100 mg/L glutamine, 1 mg/L biotin, 7 mg/L Dicamba and 2 mg/L TDZ. Green shoot buds were induced after transfer of the yellow compact calluses to the same MS medium but supplemented with 1 mg/L NAA and 3 mg/L BA and plant regeneration was achieved through organogenesis in callus cultures. Regenerated shoots were rooted on MS medium containing 0.2% activated charcoal but without plant growth regulators. Histological analysis revealed that calluses originated from small dense cells with well stained cytoplasm and nucleus typical of meristematic cells.

  12. Photosynthetic Diurnal Variation of Soybean Cultivars with High Photosynthetic Efficiency

    Institute of Scientific and Technical Information of China (English)

    MAN Wei-qun; DU Wei-guang; ZHANG Gui-ru; LUAN Xiao-yan; GE Qiao-ying; HAO Nai-bin; CHEN Yi

    2002-01-01

    The photosynthetic characters were investigated among soybean cultivars with high photosynthetic efficiency and high yield. The results indicated that: 1) There were significant differences in photosynthetic rate (Ph) and dark respiration rate (DR) under saturation light intensity and appropriate temperature.2) There were a little difference in light compensation point among them. Photo flux density (PFD) were mong the cultivars. Diurnal variation of Pn was shown a curve with two peaks. 4) The cultivars with high photosynthetic efficiency were subjected less to photoinhibition than that with high yield. Critical temperatures of photoinhibition in high photosynthetic efficiency cultivars were higher than that of high yield.

  13. Rational regional distribution of sugarcane cultivars in China.

    Science.gov (United States)

    Luo, Jun; Pan, Yong-Bao; Xu, Liping; Grisham, Michael Paul; Zhang, Hua; Que, Youxiong

    2015-10-26

    Knowing yield potential and yield stability of sugarcane cultivars is of significance in guiding sugarcane breeding and rationalising regional distribution of sugarcane cultivars. In the present study, a heritability-adjusted genotype main effect plus genotype × environment (HA-GGE) biplot program was used to analyze the cane and sucrose yields of 44 newly released sugarcane cultivars at eight pilot test sites. The cane and sucrose yields of nine cultivars were higher than those of the control cultivar ROC22. From the perspective of cane yield, cultivars FN 40 and YZ 06-407 were well adapted to a wider range of conditions and produced relatively high cane yields in several pilot sites. From the perspective of sucrose yield, cultivars LC 03-1137, FN 38, FN 41, MT 01-77 and LC 05-136 were well adapted to a wide range of conditions and produced relatively high sucrose yields. Based on these results, three high yielding and widely adapted cultivars, namely, FN 39, LC 05-136, and YZ 05-51 were recommended for production in three major Chinese sugarcane planting areas. The results will provide a theoretical basis for recommending the effective use and rational regional distribution of sugarcane cultivars in China.

  14. Consumer evaluation of scab-resistant apple cultivars in Sweden

    Directory of Open Access Journals (Sweden)

    Å. JÖNSSON

    2008-12-01

    Full Text Available The feasibility of using untrained consumers for sensory evaluation was investigated on Swedish-grown scab-resistant apple cultivars in 2002 (11 cultivars and 2003 (15 cultivars. The consumers evaluated five cultivars each, including the control cultivar ‘Aroma’. Each cultivar was scored for appearance, texture, juiciness, taste and overall impression by a minimum of 100 consumers in 2002 and by 200 in 2003. All quality attributes were positively correlated when calculations were performed across all consumer scores, with overall impression and taste having the strongest association. ‘Rubinola’ and K:1160 emerged as the best liked cultivars overall. Cultivar means were analysed for relationships with some previously scored or measured variables and with consumer profile data. Positive correlations with overall impression were obtained for amount of red colour in 2002, and for sugar levels in 2003. Among consumer profile variables, age had the largest influence on consumer scores, with some indications that older consumers preferred (or at least tolerated soft-fleshed cultivars better than did younger consumers. Minimum number of consumers needed to obtain reliable results was determined by computer simulations indicating that the error rate became stabilized already with 50 consumers.;

  15. Cell-specific expression of tryptophan decarboxylase and 10-hydroxygeraniol oxidoreductase, key genes involved in camptothecin biosynthesis in Camptotheca acuminata Decne (Nyssaceae

    Directory of Open Access Journals (Sweden)

    Santamaria Anna

    2010-04-01

    Full Text Available Abstract Background Camptotheca acuminata is a major natural source of the terpenoid indole alkaloid camptothecin (CPT. At present, little is known about the cellular distribution of the biosynthesis of CPT, which would be useful knowledge for developing new strategies and technologies for improving alkaloid production. Results The pattern of CPT accumulation was compared with the expression pattern of some genes involved in CPT biosynthesis in C. acuminata [i.e., Ca-TDC1 and Ca-TDC2 (encoding for tryptophan decarboxylase and Ca-HGO (encoding for 10-hydroxygeraniol oxidoreductase]. Both CPT accumulation and gene expression were investigated in plants at different degrees of development and in plantlets subjected to drought-stress. In all organs, CPT accumulation was detected in epidermal idioblasts, in some glandular trichomes, and in groups of idioblast cells localized in parenchyma tissues. Drought-stress caused an increase in CPT accumulation and in the number of glandular trichomes containing CPT, whereas no increase in epidermal or parenchymatous idioblasts was observed. In the leaf, Ca-TDC1 expression was detected in some epidermal cells and in groups of mesophyll cells but not in glandular trichomes; in the stem, it was observed in parenchyma cells of the vascular tissue; in the root, no expression was detected. Ca-TDC2 expression was observed exclusively in leaves of plantlets subjected to drought-stress, in the same sites described for Ca-TDC1. In the leaf, Ca-HGO was detected in all chlorenchyma cells; in the stem, it was observed in the same sites described for Ca-TDC1; in the root, no expression was detected. Conclusions The finding that the sites of CPT accumulation are not consistently the same as those in which the studied genes are expressed demonstrates an organ-to-organ and cell-to-cell translocation of CPT or its precursors.

  16. Condiloma acuminado anal com ovos de Schistosoma mansoni em paciente HIV-positivo Condilomata acuminata with Schistosoma eggs in HIV-positive patient

    Directory of Open Access Journals (Sweden)

    Fabiana Pirani Carneiro

    2007-06-01

    Full Text Available Condiloma acuminado e ovos de Schistosoma são freqüentemente encontrados na região anal, mas não há nenhum caso descrito de associação dessas doenças nessa região. No colo uterino a associação de infecção por HPV (vírus do papiloma humano e ovos de Schistosoma em paciente HIV (vírus da imunodeficiência humana-positivo já foi relatada e há evidências de que essa associação possa alterar a história natural dessas doenças. Assim como no colo uterino, é possível que essa interação também ocorra na região anal. Nosso objetivo, portanto, é relatar um caso de condiloma anal em paciente HIV-positivo, que foi submetido a ressecção cirúrgica e que apresentou no exame histopatológico numerosos ovos de Schistosoma mansoni.Condilomata acuminata and Schistosoma eggs are frequently found in the anal region, but there is no report about the association of these diseases in this region. The association of HPV infection and Schistosoma eggs in an HIV-positive patient was found in uterine cervix and there is evidence suggesting that this association can alters the natural history of these diseases. Like in the cervix, it is possible that this interaction also occurs in the anal region. So, we report a case of anal Condilomata acuminata, in an HIV-positive patient, that was ressected and contained on histopathologic examination, multiple Schistosoma eggs.

  17. Avaliação da competição intergenotipica em misturas de cultivares de soja Evaluation o f intergenotypic competition in soybean cultivars blends

    Directory of Open Access Journals (Sweden)

    Dilson Antonio Bisognin

    1995-01-01

    for the variable mean in pure stand. The blends yielded, in average, 3.8 % more than the mean yield of the components in pure stand. Two blends, IAS 5 + Bragg and BR 8-Pelotas + Bragg had an increment in yield, for the proportions studied. It was concluded that, the intergenotypic competition may be used in soybean breedmg programs to obtain cultivar blends with superior yield and performance. Differential responses to intergenotypic competition were observed in distinct blends and proportions; and proportion and contrasting charactenstics between the cultivars as branchung, height, maturity and flowering should be considered for the formation of superior blends.

  18. CULTIVAR RELEASE-BRS 217 Flora: Early-maturing soybean cultivar

    Directory of Open Access Journals (Sweden)

    Plínio Itamar de Mello de Souza

    2008-01-01

    Full Text Available The soybean (Glycine max L. Merr. cultivar BRS 217 Flora was developed by Embrapa and released forproduction in the states of Goiás, Minas Gerais, Bahia, Mato Grosso and the Distrito Federal, Brazil. It is resistant to stemcanker, frog-eye leaf spot, bacterial pustule, and partially resistant to powdery mildew.

  19. UEL 7: nova cultivar de Dendrobium UEL 7: a new Dendrobium cultivar

    Directory of Open Access Journals (Sweden)

    Ricardo Tadeu de Faria

    2011-09-01

    Full Text Available UEL 7 é uma cultivar de Dendrobium nobile desenvolvida no Departamento de Agronomia da Universidade Estadual de Londrina resultante do cruzamento das plantas matrizes D3 x D8 e selecionada pela coloração das flores amarelas e com largura e comprimento semelhantes (7,0 cm, formando praticamente um círculo. As plantas foram polinizadas artificialmente, e as sementes semeadas em meio de cultura in vitro. A cultivar apresenta flores de coloração amarela, labelo com o centro marrom escuro e o pseudobulbo apresenta em mé dia 11 flores. As flores têm durabilidade de aproximadamente 30 dias.UEL 7 is a Dendrobium nobile's cultivar developed at The Department of Agronomy of Universidade Estadual de Londrina and is the result of the crossing between D3 x D8 and selected for its yellow flowers and format with similar width and length (7.0 cm, almost forming a circle. The plants were pollinated artificially, and the seeds sowed in growth media in vitro. The cultivar presents flowers of yellow coloration, labelo with the center dark brown color and the pseudobulb presents 11 flowers on average. The flowers durability is about 30 days.

  20. CULTIVAR RELEASE - FAEM Carlasul: new white oat cultivar with high grain yield

    Directory of Open Access Journals (Sweden)

    Antônio Costa de Oliveira

    2012-01-01

    Full Text Available The white oat cultivar FAEM Carlasul was developed at the Plant Genomics and Breeding Center, Faculty of Agronomy Eliseu Maciel, Federal University of Pelotas, as a result of the cross between UFRGS 10 and 90SAT-28 (Coronado2/Cortez3/Pendek/ME 1563. It is characterized by high yield and grain quality.

  1. Storage performance of Taiwanese sweet potato cultivars

    OpenAIRE

    Huang, Che-Lun; Liao, Wayne C.; Chan, Chin-Feng; Lai, Yung-Chang

    2013-01-01

    Three sweet potato cultivars (TNG57, TNG66, and TNG73), provided by the Taiwanese Agricultural Research Institute (TARI), were stored at either 15 °C or under ambient conditions (23.8 ~ 28.4 °C and 77.1 ~ 81.0 % of relative humidity). Sweet potato roots were randomly chosen from each replicate and evaluated for measurement of weight loss, sugar content analysis, and sprouting after 0, 14, 24, 48, 56, 70, 84, and 98 days of storage. Fresh sweet potato roots were baked at 200 °C for 60 min then...

  2. Contribución al conocimiento de la biología y taxonomía de un hongo del género Phytium aislado del "aliso", Alnus acuminata HBK Contribución al conocimiento de la biología y taxonomía de un hongo del género Phytium aislado del "aliso", Alnus acuminata HBK

    Directory of Open Access Journals (Sweden)

    Cabrera Orlando

    1990-06-01

    Full Text Available

    Se estudio la biología de un hongo aislado de la parte externa de nódulos de raíces de aliso (Alnus acumi"ata HB K, el cual presento un alto poder de germinación a bajas temperaturas (entre QOC y 4QC, condición que le confiere gran agresividad para colonizar el suelo, de tal forma que se constituye en un factor importante en la ecofisiología de las poblaciones de aliso que crecen en los bosques secundarios del sub-paramo. A partir de cultivos puros se hicieron estudios para su identificación.

    Some biological aspects of an isolated fungus of Alnus acuminata roots were studied. It bas been found Tbat between OOC and 4°C tbe fungi grows fast. This condition can result in a important factor in the ecophysiology of 'Aliso' populations, that grows in secondary forests at sub-paramo, After a review of the taxonomic literature, we placed it in the Phytium genus, but not in a particular described species. We assume that it is a new species. We modificated the microculture technique that was simpler and safer and them we made direct observations about tbe fungus growtb and development. As for now it is nominated as Phytiun near Mammillatum Meurs. Palabras Claves: Phytium, bongos, A/nus acuminata HBK., "Aliso".

  3. Sensibilidade de cultivares de algodoeiro ao cloreto de mepiquat Sensibility of cotton cultivars to mepiquat chloride

    Directory of Open Access Journals (Sweden)

    Julio Cesar Bogiani

    2009-10-01

    Full Text Available O objetivo deste trabalho foi avaliar a sensibilidade de cultivares de algodoeiro ao cloreto de mepiquat e verificar se ela está relacionada ao ciclo ou à arquitetura da planta. Foi realizado um experimento em casa de vegetação com seis cultivares de algodoeiro - FiberMax 966, FiberMax 977, Delta Penta, Delta Opal, FMT 501 e FMT 701 - e quatro doses do regulador vegetal à base de cloreto de mepiquat - 0, 7,5, 15 e 22,5 g ha-1 de i.a. -, em delineamento de blocos ao acaso, com arranjo fatorial 6x4 e quatro repetições. As parcelas experimentais foram constituídas por vasos de 12 L com duas plantas em cada um. As doses do regulador vegetal foram aplicadas sem adjuvante, no estádio de aparecimento dos botões florais, aos 34 dias após a emergência das plântulas. Paralelamente ao experimento com doses, a retenção do regulador pelas folhas das cultivares foi quantificada. O crescimento em altura das plantas de algodoeiro é diminuído com a aplicação do regulador vegetal, e esse efeito se intensifica com o aumento da dosagem aplicada. Existe diferença entre as cultivares estudadas quanto à sensibilidade ao cloreto de mepiquat, sendo que as mais precoces são mais sensíveis. Além da sensibilidade diferenciada, a arquitetura das plantas pode possibilitar maior ou menor deposição do regulador sobre as folhas.The objective of this work was to assess the sensibility of cotton cultivars to mepiquat chloride and to verify if it is related to plant cycle or architecture. A green-house experiment was carried out with six cotton cultivars - FiberMax 966, FiberMax 977, Delta Penta, Delta Opal, FMT 501 e FMT 701 -, and four concentrations of mepiquat chloride plant growth regulator - 0, 7,5, 15 and 22,5 g ha-1 of the active ingredient - in complete block design with a 6x4 factorial arrangement and four replicates. The plots consisted of 12 L pots with two plants per pot. Regulator doses were applied without adjuvants at the beginning of

  4. Yield and quality of strawberry cultivars Produtividade e qualidade de cultivares de morangueiro

    Directory of Open Access Journals (Sweden)

    Luis Eduardo C Antunes

    2010-06-01

    Full Text Available The strawberry cultivation is an important economic activity in the Rio Grande do Sul State, Brazil, however the number of offered cultivars to the growers is reduced. The yield and quality of strawberry (Fragaria x ananassa Duch. cultivars Camarosa, Galexia, Earlibrite, Festival, Plarionfre and Sabrosa was evaluated under the climatic conditions of Pelotas, Rio Grande do Sul State. We determined the number, mass, total soluble solids (TSS ºBrix, total titratable acidity (TTA, antocianin level and fresh fruits produced in an experimental unit. We also determined the production of fruits per hectare and per plant. The statistical design used in the experiment was of completely randomized blocks with 6 treatments (cultivars and 4 replicates where the experimental unit was composed of 8 plants. The harvest began in the first half of August, extending to the second half of December, totalling 20 weeks. Plarionfre, Earlibrite and Festival cultivars showed higher production from the first half of October until the end of the first half of November. Camarosa reached higher productivity, mass of plants and fruit weight. There were no differences between the evaluated cultivars in the levels of TSS, antocianin, ATT and pH during the period of evaluation.No estado do Rio Grande do Sul o cultivo do morangueiro é uma atividade econômica importante, entretanto o número de cultivares disponíveis no mercado é bastante reduzido. Assim buscou-se com este trabalho avaliar a produtividade e a qualidade dos frutos de cultivares de morangueiro (Fragaria x ananassa Duch., Camarosa, Galexia, Earlibrite, Festival, Plarionfre e Sabrosa, cultivados nas condições climáticas e de solo do município de Pelotas, RS. Determinaram-se, o número, massa fresca e teor de sólidos solúveis totais (SST (expresso em ºBrix, acidez total titulável (ATT (expresso em % de ácido cítrico e teor de antocianinas, dos frutos produzidos por unidade experimental. Determinou

  5. Differentially Expressed Genes between Two Barley Cultivars Contrasting in Drought Tolerance

    Institute of Scientific and Technical Information of China (English)

    P.G. Guo; M. Baum; R.H. Li; S. Grando; R.K. Varshney; J. Valkoun; S. Ceccarelli; A. Grane

    2007-01-01

    @@ Drought tolerance is a key trait for increasing and stabilizing barley productivity in dry areas. A number of genes have been described that respond to drought at the transcriptional level (Seki et al., 2002; Cheong et al.,2003).

  6. Cut-rose production in response to planting density in two contrasting cultivars

    NARCIS (Netherlands)

    Burema, B.S.; Buck-Sorlin, G.H.; Damen, T.; Vos, J.; Heuvelink, E.; Marcelis, L.F.M.

    2010-01-01

    Growing in lower planting density, rose plants produce more assimilates, which can be used to produce more and/or heavier flowering shoots. The effect of planting density was investigated during a period including the first five flowering flushes of a young crop. In a heated greenhouse two cut-rose

  7. Cut-rose production in response to planting density in two contrasting cultivars

    NARCIS (Netherlands)

    Burema, B.S.; Buck-Sorlin, G.H.; Damen, T.; Vos, J.; Heuvelink, E.; Marcelis, L.F.M.

    2010-01-01

    Growing in lower planting density, rose plants produce more assimilates, which can be used to produce more and/or heavier flowering shoots. The effect of planting density was investigated during a period including the first five flowering flushes of a young crop. In a heated greenhouse two cut-rose

  8. Transcripts and MicroRNAs Responding to Salt Stress in Musa acuminata Colla (AAA Group cv. Berangan Roots.

    Directory of Open Access Journals (Sweden)

    Wan Sin Lee

    Full Text Available Physiological responses to stress are controlled by expression of a large number of genes, many of which are regulated by microRNAs. Since most banana cultivars are salt-sensitive, improved understanding of genetic regulation of salt induced stress responses in banana can support future crop management and improvement in the face of increasing soil salinity related to irrigation and climate change. In this study we focused on determining miRNA and their targets that respond to NaCl exposure and used transcriptome sequencing of RNA and small RNA from control and NaCl-treated banana roots to assemble a cultivar-specific reference transcriptome and identify orthologous and Musa-specific miRNA responding to salinity. We observed that, banana roots responded to salinity stress with changes in expression for a large number of genes (9.5% of 31,390 expressed unigenes and reduction in levels of many miRNA, including several novel miRNA and banana-specific miRNA-target pairs. Banana roots expressed a unique set of orthologous and Musa-specific miRNAs of which 59 respond to salt stress in a dose-dependent manner. Gene expression patterns of miRNA compared with those of their predicted mRNA targets indicated that a majority of the differentially expressed miRNAs were down-regulated in response to increased salinity, allowing increased expression of targets involved in diverse biological processes including stress signaling, stress defence, transport, cellular homeostasis, metabolism and other stress-related functions. This study may contribute to the understanding of gene regulation and abiotic stress response of roots and the high-throughput sequencing data sets generated may serve as important resources related to salt tolerance traits for functional genomic studies and genetic improvement in banana.

  9. Cultivar and row distance interactions in perennial ryegrass

    DEFF Research Database (Denmark)

    Deleuran, Lise C; Gislum, René; Boelt, Birte

    2009-01-01

    yield and seed weight (r=0.72***), whereas the correlation between seed yield and the number of reproductive tillers was negatively correlated (r= - 0.49***). This may reflect choice of cultivars in the experiment with the tetraploid forage cultivar 'Tivoli' having the lowest number of reproductive...

  10. Identifying nitrogen-efficient potato cultivars for organic farming

    NARCIS (Netherlands)

    Tiemens-Hulscher, M.; Lammerts Van Bueren, E.; Struik, P.C.

    2014-01-01

    In organic farming, nitrogen efficiency of potato might vary among cultivars, even within the same maturity type. We therefore analysed in depth the response to nitrogen of a diverse set of cultivars, grown at different locations (differing in soil type and management) and in four years (differing i

  11. Performance de six cultivars de tomates Lycopersicon esculentum ...

    African Journals Online (AJOL)

    ... de déterminer sur la parcelle après apport d\\'insecticides, les incidences du TYLCV ... others diseases: the yellow leaf curl, bacterial wilt and root knot nematodes. In order to identify performants cultivars, six improved cultivars of tomato were ...

  12. Performance of blueberry cultivars under mild winter conditions

    Directory of Open Access Journals (Sweden)

    José Gilberto Sousa Medeiros

    2017-08-01

    Full Text Available ABSTRACT: Evaluation of yield performance is important to find the most adapted blueberry cultivars in a particular region. This research aimed to evaluate the flowering and hasvesting periods, the production per plant, and fruit quality of eight rabbiteye blueberry cultivars (Aliceblue, Bluebelle, Bluegem, Briteblue, Climax, Delite, Powderblue, and Woodard and two highbush blueberries (Georgiagem and O’Neal, in mild winter conditions in Pinhais-PR. Flowering and harvesting periods, production, berry weight, size, pH, soluble solids, titratable acidity, ratio and color of the fruits were evaluated in the 2013/2014 and 2014/2015 growing seasons, when the plants had two and three years old, respectively. Cultivars flowered from August to September, and harvest was concentrated in November and December. Berry weight, size, pH, soluble solids and acidity varied among the cultivars. The average ratios of 14.97 and 13.39 for each crop proved that the cultivars have good fruit quality. There was little variation in fruit color in the two years evaluated. Blueberry cultivars showed the staining characteristics and physical and chemical attributes of quality compatible to blueberry from other traditional regions. Under mild winter conditions, young plants of rabbiteye blueberry cultivars, Climax, Delite, Bluegem and Powderblue, are the most productive, while the highbusch cultivars bear few fruits.

  13. Blueberry cultivars for the Pacific Northwest (PNW 656)

    Science.gov (United States)

    The bush habit, berry characteristics, yield potential, and suitability for commercial or homeowner production for 41 highbush, rabbiteye and ornamental blueberry cultivars are presented. This extension guide reviews many of the possible cultivars a commercial grower or homeowner might grow. Standar...

  14. Measurement of lipid transfer protein in 88 apple cultivars

    NARCIS (Netherlands)

    Sancho, A.I.; Ree, van R.; Leeuwen, van A.; Meulenbroek, E.J.; Weg, van de W.E.; Gilissen, L.J.W.J.; Puehringer, H.; Laimer, M.; Martinelli, A.; Zaccharini, M.; Vazquez-Cortes, S.; Fernandez-Rivas, M.; Hoffmann-Sommergruber, K.; Clare Mills, E.N.; Zuidmeer, L.

    2008-01-01

    Background: Fruits are a major cause of food allergy in adults. Lipid transfer proteins (LTP) are implicated in severe allergic reactions to fruits, but little is known about LTP content in different cultivars. Objective: Determination of the levels of LTP in a wide range of apple cultivars. Methods

  15. Evaluation of Wheat and Barley Cultivars Tolerance to Metribuzine Application

    Directory of Open Access Journals (Sweden)

    E Izadi Darbandi

    2013-08-01

    Full Text Available In order to study of barely and wheat cultivars tolerance to metribuzin, a factorial experiment was conducted as a completely randomized design, with three replications in Greenhouse of Agricultural Research at Ferdowsi University of Mashhad. Treatments included wheat cultivars (Backcross roshan, Cross Arvand, Bahar, Sepahan, Gascosion, Sayonez, Bam garmsiry, Garmsiri, Ghods, Pishtaz, Chamran and Shoori 6, barely cultivars (Macouyi, Karoon and Bahman and metribuzin application rates ( 0, 175, 350, 700, 1050, 1400 and 2100 gr. ai.ha-1. Metribuzine was applied at 3-4 leaf stage and 3 weeks after herbicide spraying, plants survival and their biomass were determined. Results showed that metribuzin application had a significant effect (p≤0.01 on barley and wheat dry weight. Based on results, mertibuzin application did not affect on barley cultivars up to 30 g.a.i.ha-1 but in wheat varieties lead to significant reduction in their biomass and survival. Increasing of metribuzin rates reduced wheat and barley cultivars biomass (p≤0.01. Barely varieties were less sensitive than wheat cultivars to metribuzine. The highest and the lowest ED50 in wheat cultivars were observed in cross arvand (940 and shoori (25 varieties, respectively. In barley cultivars the highest and lowest ED50 were observed in Macouyi (614 and Karoon (396, respectively.

  16. Effect of cultivar and year on phyllochron in winter barley

    Directory of Open Access Journals (Sweden)

    Pržulj Novo M.

    2013-01-01

    Full Text Available Development and growth of leaves in cereals significantly affects grain yield since dry matter accumulation depends on the leaf area that intercepts light. Phyllochron (PHY is defined as time interval between the emergences of successive leaves on the main stem. The aim of this study was to determine the effect of year and cultivar on phyllochron in winter barley. Twelve cultivars of winter barley differing in origin and time of anthesis were tested during six growing seasons (GS, from 2002/03 to 2007/08. The highest PHY across GSs was determined in the two-rowed cultivar Cordoba (81.6°Cd and the lowest in the two-rowed cultivar Novosadski 581 (71.0°Cd. The early cultivars had fast leaf development, the medium cultivars medium and the late cultivars slow development, 72.5°Cd, 75.6°Cd and 78.9°Cd, respectively. The tested cultivars showed significant variability in the PHY, which can be used for selecting most adaptable genotypes for specific growing conditions.

  17. New Kiwifruit Cultivar Carves a Firm Niche in European Market

    Institute of Scientific and Technical Information of China (English)

    2004-01-01

    @@ While enhancing the world kiwifruit production by developing new cultivars,CAS researchers are gaining a firm foothold in international kiwifruit market as they prolong their control over the propagation rights of a recently developed novel yellowfleshed cultivar, Jin Tao, in European countries.

  18. Micronucleus technology of microspore mother cells of Ottelia acuminata for monitoring water pollution of Dianchi Lake%海菜花花粉母细胞微核技术监测滇池水质污染状况

    Institute of Scientific and Technical Information of China (English)

    翟书华; 樊传章; 侯思名; 郭丽红; 王全坤

    2011-01-01

    以海菜花生长环境水(路南长湖水)处理作阴性对照,以滇池5个样点的水样处理作阳性对照,利用海菜花花粉母细胞微核技术监测评价滇池水质污染物致突变的情况,测定各采样点水样的海菜花花粉母细胞微核千分率及污染指数.结果表明:滇池5个样点的水样均使海菜花花粉母细胞微核千分率急剧增加,用海莱花水生植物建立的水体环境污染检验系统,可避免用陆生植物监测水体时因改变生长环境而造成的误差.%The micronucleus techniques of microspore mother cells of Ottelia acuminata was used to monitor the water pollution of Dianchi Lake when Ottelia acuminata was grown in the water samples of five sampling sites in the Dianchi lake. The micronucleus permillage and pollution index of the microspore mother cells of Ottelia acuminata in the water samples were determined. The results show that the water samples of the five sampling sites in the Dianchi Lake cause a sharp increase in the micronucleus of microspore mother cells of 0ttelia acuminate. The monitoring system of water environmental pollution established by Ottelia acuminata can avoid the error caused by the change of growth environment of land plants.

  19. Esterase polymorphism marking cultivars of Manihot esculenta, Crantz

    Directory of Open Access Journals (Sweden)

    Adriana Gazoli Resende

    2004-07-01

    Full Text Available Esterase isozymes were used to detected substrate-preference polymorphism in twenty cultivars of Manihot esculenta, and to show cultivar-specific variation of this species. A relatively complex extraction solution of proteins from leaves was needed to show a larger number of esterase isozymes. Similarity between cultivars from six groups ranged from 51 to 96%. The cultivars identified by the same name seemed to be biochemically different regarding esterase isozymes. Esterase isozyme electrophoretic patterns could, therefore, be used to discriminate the cultivars identified by the same name, and to monitor the vegetative propagation of cultivars maintained in the germplasm collection. In breeding strategies, isoesterase analysis could be used to avoid intercrossing between the similar genotypes.Isoenzimas esterases foram usadas no presente estudo, para detectar polimorfismos específicos para diferentes substratos em vinte cultivares de Manihot esculenta, e para mostrar variações específicas de cultivares nesta espécie. Os diferentes cultivares de M. esculenta tem sido mantidos na coleção de germoplasma do Departamento de Agronomia da Universidade Estadual de Maringá (Maringá, PR, e foram provenientes de cultivares tradicionais coletados nas regiões sudoeste e noroeste do Estado. Foi necessário a utilização de uma solução de extração de proteínas relativamente mais complexa, para evidenciar um maior número de isoenzimas esterases. A similaridade entre os cultivares variou de 51 a 96%. Cultivares identificados pelo mesmo nome parecem ser bioquimicamente diferentes para as isoenzimas esterases. Os padrões eletroforéticos das isoesterases podem, portanto, serem usados para discriminar os cultivares que são identificados pelo mesmo nome, e para monitorar a propagação vegetativa dos cultivares mantidos na coleção de germoplasma. A análise das isoesterases pode também ser usada para evitar cruzamentos entre genótipos mais

  20. Contrast-induced nephropathy

    Directory of Open Access Journals (Sweden)

    Ricardo A. García Hernández

    2016-06-01

    Full Text Available Contrast-induced nephropathy is an important complication associated with the use of contrast media. Favoring factors for the development of contrast-induced nephronpathy have been widely described, being diabetes mellitus and previous renal disease the greatest risk. The pathophysiology is a complex process where the medullary hypoxia represents the trigger element. Previous hydration and the use of low osmolality contrast are the most recommended measures to prevent its development.

  1. Metabolomics-driven nutraceutical evaluation of diverse green tea cultivars.

    Directory of Open Access Journals (Sweden)

    Yoshinori Fujimura

    Full Text Available BACKGROUND: Green tea has various health promotion effects. Although there are numerous tea cultivars, little is known about the differences in their nutraceutical properties. Metabolic profiling techniques can provide information on the relationship between the metabolome and factors such as phenotype or quality. Here, we performed metabolomic analyses to explore the relationship between the metabolome and health-promoting attributes (bioactivity of diverse Japanese green tea cultivars. METHODOLOGY/PRINCIPAL FINDINGS: We investigated the ability of leaf extracts from 43 Japanese green tea cultivars to inhibit thrombin-induced phosphorylation of myosin regulatory light chain (MRLC in human umbilical vein endothelial cells (HUVECs. This thrombin-induced phosphorylation is a potential hallmark of vascular endothelial dysfunction. Among the tested cultivars, Cha Chuukanbohon Nou-6 (Nou-6 and Sunrouge (SR strongly inhibited MRLC phosphorylation. To evaluate the bioactivity of green tea cultivars using a metabolomics approach, the metabolite profiles of all tea extracts were determined by high-performance liquid chromatography-mass spectrometry (LC-MS. Multivariate statistical analyses, principal component analysis (PCA and orthogonal partial least-squares-discriminant analysis (OPLS-DA, revealed differences among green tea cultivars with respect to their ability to inhibit MRLC phosphorylation. In the SR cultivar, polyphenols were associated with its unique metabolic profile and its bioactivity. In addition, using partial least-squares (PLS regression analysis, we succeeded in constructing a reliable bioactivity-prediction model to predict the inhibitory effect of tea cultivars based on their metabolome. This model was based on certain identified metabolites that were associated with bioactivity. When added to an extract from the non-bioactive cultivar Yabukita, several metabolites enriched in SR were able to transform the extract into a bioactive

  2. ANTIOXIDANT AND ANTIMUTAGENIC ACTIVITIES OF TAIF GRAPE (VITIS VINIFERA CULTIVARS

    Directory of Open Access Journals (Sweden)

    Abdelmegid Ibrahim Fahmi

    2013-01-01

    Full Text Available Extract of grape Vitis vinifera has been reported to exhibit antioxidant and antimutagenic activities and the phenolic compounds play a vital role in determining these activities. Therefore; the objective of the present study was to evaluate the antioxidant and anti-mutagenic activities as well as the phenolic composition of different grape cultivar extracts collected from Taif region. The grape cultivars namely; Italian, American, Lebanese, Taifyb and Taifye were collected at maturity stage to represent Taif region cultivars. The total concentrations of phenoles were determined for the five cultivar extracts and results indicated that the concentrations ranged from 115-960 mg L-1 Gallic Acid Equivalent (GAE. Also, HPLC analysis included was carried out of nine important phenolic compounds namely; Cyanidine chloride, Myricetin, Chrysin, Quercetin, Delphinidine chloride, Malvidine chloride, Naringenin, Galangin and Caffeic acid. Significant differences among cultivars were obtained for each compound. However, the highest cultivar for each compound differed from compound to another. At the same time, DPPH was used to estimate antioxidant activity and the data showed that different grape cultivar extracts were able to quench 47-60% of DPPH radical solution and to exhibited potent radical scavenging activity. Also, antimutagenic activity was measured as a decrease of chromosomal aberrations in bone marrow cells of mice treated with the mutagen Endoxan. Results showed that treatment of mice with grape cultivar extracts resulted in a significant decrease in all types of chromosomal aberrations induced by Endoxan. Also, the anticlastogenic effect was measured using micronulei test and results indicated that all grape cultivar extracts reduced significantly the effect of Endoxan on micronulei test. Finally, treatment of mice with grape cultivar extracts enhanced mitotic index of mice bone marrow cells reduced by Endoxan treatment. The relationship

  3. Compositional changes in cell wall polysaccharides from five sweet cherry (Prunus avium L.) cultivars during on-tree ripening.

    Science.gov (United States)

    Basanta, María F; Ponce, Nora M A; Salum, María L; Raffo, María D; Vicente, Ariel R; Erra-Balsells, Rosa; Stortz, Carlos A

    2014-12-24

    Excessive softening is a major cause of postharvest deterioration during transportation and storage of fresh cherries. In continuing our studies to identify the factors determining the textural differences between sweet cherry fruit genotypes, we evaluated the solubilization, depolymerization, and monosaccharide composition of pectin and hemicelluloses from five sweet cherry cultivars ('Chelan', 'Sumele', 'Brooks', 'Sunburst', and 'Regina') with contrasting firmness and cracking susceptibility at two developmental stages (immature and ripe). In contrast to what is usually shown in most fruits, cherry softening could occur is some cultivars without marked increases in water-soluble pectin. Although polyuronide and hemicellulose depolymerization was observed in the water-soluble and dilute-alkali-soluble fractions, only moderate association occurs between initial polymer size and cultivar firmness. In all the genotypes the Na2CO3-soluble polysaccharides (NSF) represented the most abundant and dynamic wall fraction during ripening. Firm cultivars showed upon ripening a lower neutral sugars/uronic acid ratio in the NSF, suggesting that they have a lower proportion of highly branched polyuronides. The similar molar ratios of arabinose plus galactose to rhamnose [(Ara+Gal)/Rha] suggest that the cultivars differed in their relative proportion of homogalacturonan (HG) and rhamnogalacturonan I (RG-I) rather than in the size of the RG side chains; with greater proportions of HG in firmer cherries. Ultraviolet matrix-assisted laser desorption/ionization time-of-flight mass spectrometry was useful to identify the depolymerization patterns of weakly bound pectins, but gave less accurate results on ionically bound pectins, and was unable to find any pattern on covalently bound pectins.

  4. Introgression Between Cultivars and Wild Populations of Momordica charantia L. (Cucurbitaceae in Taiwan

    Directory of Open Access Journals (Sweden)

    Yu-Chung Chiang

    2012-05-01

    Full Text Available The landrace strains of Momordica charantia are widely cultivated vegetables throughout the tropics and subtropics, but not in Taiwan, a continental island in Southeast Asia, until a few hundred years ago. In contrast, the related wild populations with smaller fruit sizes are native to Taiwan. Because of the introduction of cultivars for agricultural purposes, these two accessions currently exhibit a sympatric or parapatric distribution in Taiwan. In this study, the cultivars and wild samples from Taiwan, India, and Korea were collected for testing of their hybridization and evolutionary patterns. The cpDNA marker showed a clear distinction between accessions of cultivars and wild populations of Taiwan and a long divergence time. In contrast, an analysis of eight selectively neutral nuclear microsatellite loci did not reveal a difference between the genetic structures of these two accessions. A relatively short divergence time and frequent but asymmetric gene flows were estimated based on the isolation-with-migration model. Historical and current introgression from cultivars to wild populations of Taiwan was also inferred using MIGRATE-n and BayesAss analyses. Our results showed that these two accessions shared abundant common ancestral polymorphisms, and the timing of the divergence and colonization of the Taiwanese wild populations is consistent with the geohistory of the Taiwan Strait land bridge of the Last Glacial Maximum (LGM. Long-term and recurrent introgression between accessions indicated the asymmetric capacity to receive foreign genes from other accessions. The modern introduction of cultivars of M. charantia during the colonization of Taiwan by the Han Chinese ethnic group enhanced the rate of gene replacement in the native populations and resulted in the loss of native genes.

  5. Don't camp beside the river: structure and dynamics of Andean alder (Alnus acuminata forests affected by river floods, northwestern Argentina No acampe junto al río: estructura y dinámica de bosques de aliso (Alnus acuminata del noroeste argentino afectados por crecientes de río

    Directory of Open Access Journals (Sweden)

    TOMÁS A EASDALE

    2005-12-01

    Full Text Available Alnus acuminata (Betulaceae is a pioneer tree that dominates mountain riparian forests throughout the eastern Andes. Early studies associated these forests with particular microclimatic conditions along river beds, but they were later linked to the periodical disturbance regime of mountain rivers. To understand the dynamics of these forests, we analysed tree age and spatial arrangement in two plots along Potrero river and another plot along La Horqueta river, Tucumán Province, north west Argentina. Through intensive tree coring and age reconstruction we identified similar-aged tree cohorts with maximum age ranges of eight years. Tree mapping and Moran's I spatial autocorrelation analysis showed that tree cohorts were spatially clumped, and provided further evidence that coetaneous patches of A. acuminata arise from massive regeneration following catastrophic flooding events. We tested the association between cohort initiation dates and regional maximum river discharge records by means of a randomization procedure and found weak evidence that establishment occurs after devastating floods, which eliminate previous vegetation and create bare sites suitable for A. acuminata regeneration. Dates of tree floodscars sampled along Potrero river precede by one year the most recent cohort initiation date and provide further support of this association. Although previous studies found a positive correlation between El Niño events and mean annual precipitation in northwestern Argentina, we did not detect an association between El Niño and annual maximum stream flow for rivers in Tucumán Province. Therefore, factors driving devastating floods and A. acuminata stand initiation require further studyEl aliso (Alnus acuminata, Betulaceae es un árbol pionero que domina bosques riparios de montaña en los Andes orientales. Estudios iniciales atribuyeron la presencia de estos bosques a las típicas condiciones microclimáticas de cauces de ríos, pero luego

  6. Compatibilidade de enxertia de cultivares de marmeleiros com pereiras Compatibility of pear cultivars on quinces rootstocks

    Directory of Open Access Journals (Sweden)

    Zeni Fonseca Pinto Tomaz

    2009-12-01

    Full Text Available A insuficiência de estudos sobre compatibilidade de porta-enxertos é um dos fatores limitantes ao desenvolvimento da cultura da pereira (Pyrus sp. no Brasil. A utilização do marmeleiro (Cydonia oblonga como porta-enxerto para a cultura da pereira apresenta inúmeras vantagens, entre as quais a redução do vigor e a rápida entrada em produção; todavia, sua combinação com algumas cultivares copa apresenta problemas de incompatibilidade de enxertia, podendo ocasionar a ruptura do caule das plantas no pomar. Objetivou-se, neste trabalho, avaliar a compatibilidade de enxertia de algumas cultivares de marmeleiros ('Quince C' e 'Adams' com pereiras ('Packham's Triumph' e 'Kieffer'. As variáveis analisadas foram: diâmetro da secção do tronco no ponto de enxertia, 5 cm abaixo e 5 cm acima do ponto de enxertia, diferença do diâmetro entre porta-enxerto e copa, altura das plantas, volume e massa seca da copa e raízes. Além disso, efetuou-se a observação da conexão vascular no ponto de enxertia através da imersão da base das plantas (abaixo do ponto de enxertia, em solução corante de Ácido Fuccínico 0,08%. Concluiu-se que a cultivar 'Packham's Triumph'apresenta compatibilidade de enxertia com o marmeleiro cultivares 'Adams'e 'Quince C', enquanto o híbrido 'Kieffer' apresentou sintomas morfológicos de incompatibilidade de enxertia com o marmeleiro cultivares 'Quince C' e 'Adams'.The lack of studies on compatibility of pear cultivars and rootstocks is one of the limiting factors on the development of the pear crop in Brazil. The use of quinces as rootstocks for pear cultivars has several advantages, among them the reduction in vigor and earlier bearing trees, however, its combination with some scions cultivars results in problems of incompatibility , such as lost of trees of the orchard due to break of the graft union. The objective of this study was to determine the compatibility between pears cvs. Packham's Triumph and Kieffer

  7. CULTIVAR RELEASE - CD 120 – wheat cultivar, standard quality soft, for the Southern Region of Brazil

    Directory of Open Access Journals (Sweden)

    Ivan Schuster

    2011-01-01

    Full Text Available The cultivar CD 120, developed by the Cooperativa Central de Pesquisa Agrícola (COODETEC is suitable for cultivation in the VCU wheat-producing regions 1 and 2 of the states of Paraná, Santa Catarina and Rio Grande do Sul. It is tolerant to the major wheat diseases and pre-harvest germination and has soft wheat quality and a 6.5 % higher grain yield (3.678 kg ha-1 than the control.

  8. Breeding Potential in Danish Apple Cultivar

    DEFF Research Database (Denmark)

    Larsen, Bjarne

    understanding of the link between phenotypes and the underlying gene-tic background which is crucial in plant breeding. We found a considerable genetic diversity in the collection and no genetic structure. We exposed a high number of accessions in admix and revealed several putative cultivar parentages, never......The diversity in plant genetic resources is a prerequisite for genetic improvement of cultivated crop species. Lack of in-depth characterization and evaluation of gene bank accessions is a major obstacle for their potential utilization. The Danish apple (Malus domestica L.) gene bank collection...... be used directly for marker-assisted selection. In addition, we suggest a number of candidate genes involved in the control of several important fruit quality traits. Future studies and breeding attempts can therefore benefit from the results, including genetic fingerprints and pedigree reconstruction...

  9. Adaptability and stability of sweet sorghum cultivars

    Directory of Open Access Journals (Sweden)

    Vander Fillipe de Souza

    2013-06-01

    Full Text Available The objective of this study was to evaluate the phenotypic stability and adaptability of 25 sweet sorghum cultivars of EmbrapaMaize and Sorghum. The experiments were conducted in five Brazilian environments, three in the state of Minas Gerais, and theothers in Sinop, Mato Grosso and Pelotas, Rio Grande do Sul. Fresh biomass yield (FBY, and total soluble solids (TSS of the juicewere evaluated in a randomized complete block design with three replications. Analysis of variance showed significant genotype byenvironment interaction for both traits. According to the Annicchiarico methodology analysis, genotypes CMSXS634, BRS506, andCMSXS646 were the most stable and adapted for FBY and TSS concomitantly; CMSXS634 being more adapted to favorable environmentsand CMSXS646 being more adapted to unfavorable environments.

  10. Identification of SNPs in RNA-seq data of two cultivars of Glycine max (soybean differing in drought resistance

    Directory of Open Access Journals (Sweden)

    Ramon Oliveira Vidal

    2012-01-01

    Full Text Available The legume Glycine max (soybean plays an important economic role in the international commodities market, with a world production of almost 260 million tons for the 2009/2010 harvest. The increase in drought events in the last decade has caused production losses in recent harvests. This fact compels us to understand the drought tolerance mechanisms in soybean, taking into account its variability among commercial and developing cultivars. In order to identify single nucleotide polymorphisms (SNPs in genes up-regulated during drought stress, we evaluated suppression subtractive libraries (SSH from two contrasting cultivars upon water deprivation: sensitive (BR 16 and tolerant (Embrapa 48. A total of 2,222 soybean genes were up-regulated in both cultivars. Our method identified more than 6,000 SNPs in tolerant and sensitive Brazilian cultivars in those drought stress related genes. Among these SNPs, 165 (in 127 genes are positioned at soybean chromosome ends, including transcription factors (MYB, WRKY related to tolerance to abiotic stress.

  11. Identification of SNPs in RNA-seq data of two cultivars of Glycine max (soybean) differing in drought resistance.

    Science.gov (United States)

    Vidal, Ramon Oliveira; do Nascimento, Leandro Costa; Mondego, Jorge Maurício Costa; Pereira, Gonçalo Amarante Guimarães; Carazzolle, Marcelo Falsarella

    2012-06-01

    The legume Glycine max (soybean) plays an important economic role in the international commodities market, with a world production of almost 260 million tons for the 2009/2010 harvest. The increase in drought events in the last decade has caused production losses in recent harvests. This fact compels us to understand the drought tolerance mechanisms in soybean, taking into account its variability among commercial and developing cultivars. In order to identify single nucleotide polymorphisms (SNPs) in genes up-regulated during drought stress, we evaluated suppression subtractive libraries (SSH) from two contrasting cultivars upon water deprivation: sensitive (BR 16) and tolerant (Embrapa 48). A total of 2,222 soybean genes were up-regulated in both cultivars. Our method identified more than 6,000 SNPs in tolerant and sensitive Brazilian cultivars in those drought stress related genes. Among these SNPs, 165 (in 127 genes) are positioned at soybean chromosome ends, including transcription factors (MYB, WRKY) related to tolerance to abiotic stress.

  12. Initial growth and yield structure of selected cultivars of cranberry (Vaccinium macrocarpon Ait. cultivated on mineral soils

    Directory of Open Access Journals (Sweden)

    Szwonek Eugeniusz

    2016-06-01

    Full Text Available A study was conducted to evaluate the possibility of cranberry cultivation on mineral soils and to assess the influence of vegetative biomass development, generative growth and yield components on the yielding of three cranberry cultivars originating in the USA (Stevens, Pilgrim and Ben Lear at two locations in Poland. The key biometrical traits involved in yield formation were taken into account, and the soil and plant chemical conditions were evaluated. All of the measured biometrical characteristics were strongly influenced by the location and the year of cultivation, and varietal differences were also noted. The most important determinants that explained yield variation were: the number of uprights per square meter, floral induction and berry set. However, the participation of each component in yield variation was strongly affected by the location, age of plantation and to a minor extent by the cultivar. The study confirmed the possibility of cranberry cultivation on mineral soils with a low pH. The biggest average yield of the three years was collected from cv. Stevens as cultivated on sandy soil in contrast to the same cultivar grown on sandy loam soil. In the case of sandy loam soil after acidification, cv. Pilgrim appeared to be a relatively better yielding cultivar.

  13. Morphological diversity in fourteen cultivars Tiron village, Kediri, Indonesia

    Directory of Open Access Journals (Sweden)

    Nur Azis Fuad

    2016-01-01

    Full Text Available Tiron village, Kediri is one of central mangoes in Indonesia. Many cultivar of mangoes encountered at this location. This study aims to look at the diversity of mango cultivars in the Tiron Village, Kediri, Indonesia. Mangoes diversity is based on qualitative and quantitative character of each cultivar. The diversity among cultivar indicated by the standard deviation and variance in the eleven quantitative characters of mango. Mango cultivars categorized by phylogeny morphological characters. The method used for phylogeny analysis is an UPGMA method (unweighted pair group method with arithmetic mean. Phylogenic analysis is based by the qualitative character of the plant. The results showed there were fourteen cultivars of mango in the village of Tiron Kediri have high diversity. Fourteen mango cultivars were categorized four groups. Based on a qualitative character, there are four classes of mango. The first group is the Katul, Podang Urang, and Podang Lumut. The second group is the Gadung, Jaran, Madu, Endog, Pakel, Dodonilo, Ireng, Lanang and Cantek. Santok Kapur into groups to form groups of three and Kopyor fourth. The high diversity in the village mango Tiron Kediri potential for resource in situ germplasm.

  14. Studying on rooting ability of olive cultivars region of Tirana

    OpenAIRE

    KOZETA BREGU; FADIL THOMAJ; ANIDA MEMA

    2014-01-01

    The results brought in this study present the rooting ability of semi dendric olive pieces, including the five most important cultivars of the area which are used as oil cultivar ("olive white", “Kushan", "Karre" and "black olive from Ndroq Tirana") or as cultivar used for oil and salting (Boç and red olive). Anchoring (sample) material is taken from three age-old mother plants and with a good health and vegetation condition. Previously pieces are treated with IBA at 4000 ppm concentration. ...

  15. Phase contrast image synthesis

    DEFF Research Database (Denmark)

    Glückstad, J.

    1996-01-01

    A new method is presented for synthesizing arbitrary intensity patterns based on phase contrast imaging. The concept is grounded on an extension of the Zernike phase contrast method into the domain of full range [0; 2 pi] phase modulation. By controlling the average value of the input phase...... function and by choosing appropriate phase retardation at the phase contrast filter, a pure phase to intensity imaging is accomplished. The method presented is also directly applicable in dark field image synthesis....

  16. Contrast induced nephropathy

    DEFF Research Database (Denmark)

    Stacul, Fulvio; van der Molen, Aart J; Reimer, Peter

    2011-01-01

    measures used to reduce the incidence of CIN, and the management of patients receiving metformin. Key Points • Definition, risk factors and prevention of contrast medium induced nephropathy are reviewed. • CIN risk is lower with intravenous than intra-arterial iodinated contrast medium. • eGFR of 45 ml....../min/1.73 m (2) is CIN risk threshold for intravenous contrast medium. • Hydration with either saline or sodium bicarbonate reduces CIN incidence. • Patients with eGFR ≥ 60 ml/min/1.73 m (2) receiving contrast medium can continue metformin normally....

  17. Contrast induced nephropathy

    DEFF Research Database (Denmark)

    Stacul, Fulvio; van der Molen, Aart J; Reimer, Peter

    2011-01-01

    measures used to reduce the incidence of CIN, and the management of patients receiving metformin. Key Points • Definition, risk factors and prevention of contrast medium induced nephropathy are reviewed. • CIN risk is lower with intravenous than intra-arterial iodinated contrast medium. • eGFR of 45 ml....../min/1.73 m (2) is CIN risk threshold for intravenous contrast medium. • Hydration with either saline or sodium bicarbonate reduces CIN incidence. • Patients with eGFR = 60 ml/min/1.73 m (2) receiving contrast medium can continue metformin normally....

  18. BRS 137: cultivar de soja para cultivo no Sul do Brasil BRS 137: soybean cultivar for southern Brazil

    Directory of Open Access Journals (Sweden)

    Emídio Rizzo Bonato

    2001-05-01

    Full Text Available A liberação de cultivares de elevado potencial produtivo e com resistência a doenças é fundamental para continuar agregando rendimento na produção brasileira de soja. A cultivar BRS 137 é resultado do programa de melhoramento de soja desenvolvido pela Embrapa. A cultivar apresentou rendimento médio de grãos 2% superior ao da cultivar IAS 5, em 24 ambientes, no Rio Grande do Sul. É resistente à pústula-bacteriana (Xanthomonas axonopodis pv. glycines, ao cancro-da-haste (Diaporthe phaseolorum f. sp. meridionalis, à podridão-parda-da-haste (Phialophora gregata, à mancha-olho-de-rã (Cercospora sojina e ao oídio (Microsphaera diffusa. É indicada para cultivo no Rio Grande do Sul, em semeaduras realizadas a partir de meados de outubro até fim de novembro, com população máxima de 300.000 plantas/ha.The goals of the soybean breeding program for the release of a new cultivar include high yield potential and resistance to diseases in order to improve Brazilian production. The cultivar BRS 137 is a result of the soybean breeding program of Embrapa (Brazil. Prior to its release, the cultivar had shown a mean grain yield potential 2% higher than the cultivar IAS 5 in 24 environments in the State of Rio Grande do Sul, Brazil. Moreover, it is resistant to bacterial pustule (Xanthomonas axonopodis pv. glycines, soybean stem canker (Diaporthe phaseolorum f. sp. meridionalis, brown stem rot (Phialophora gregata, frogeye leaf spot (Cercospora sojina, and powdery mildew (Microsphaera diffusa. The cultivar is being indicated to be cropped in the Rio Grande do Sul state for sowing from mid October to the end of November with a maximum population of 300,000 plants/ha.

  19. Resposta diferencial das cultivares de algodoeiro a Alternaria macrospora Differential response of cotton cultivars to Alternaria macrospora

    Directory of Open Access Journals (Sweden)

    Yeshwant Ramchandra Mehta

    2006-06-01

    Full Text Available Estudou-se a resposta diferencial de 32 cultivares comerciais do algodoeiro a A. macrospora em casa de vegetação. A inoculação foi realizada em plântulas de 20-25 dias de idade com 25 repetições, utilizando-se o delineamento experimental de blocos ao acaso. As cultivares foram agrupadas através de análise de Scott & Knott. Resistência completa não foi encontrada, sendo que todas as cultivares foram suscetíveis. Houve diferença entre reação de plantas da mesma cultivar. Não obstante, quando algumas plantas das cvs. BRS Antares e Fibermax 986, que mostraram resistência, foram inoculadas com mistura de nove isolados escolhidos ao acaso, as mesmas mantiveram sua resistência a esta mistura. Trabalhos futuros deverão ser realizados para encontrar fontes de resistência a este patógeno em outras espécies de Gossypium.The differential response of 32 commercial cotton cultivars to A. macrospora was studied under greenhouse conditions. Twenty to twentyfive days old plants were inoculated in 25 repetitions in a randomized block design. The cultivars were grouped using the Scott & Knott analysis. Complete resistance was not found and all cultivars were susceptible to the pathogen. Differential reaction within the plants of the same cultivar was observed. However, when some resistant plants of cultivars BRS Antares and Fibermax 986 were inoculated using a mixture of nine randomly selected isolates of A. macrospora, the plants maintained their resistance. Further research is necessary to find sources of resistance to this pathogen in other species of Gossypium.

  20. Growth of Three Lettuce Cultivars in NASA's HDU PEM During the 2010 DRATS Test

    Science.gov (United States)

    Stutte, Gary W.; Newsham, Gerard; Wheeler, Raymond

    2011-01-01

    NASA's 2010 Desert Research and Technology Studies (DRATS) of the VEGGIE Food Production System in the Habitat Demonstration Unit (HDU) Pressurized Excursion Module (PEM) was the first operational evaluation of salad crop production technology in a NASA analog test. Rooting media and slow release fertilizers were evaluated for three lettuce cultivars that had shown promise as candidates for a surface based food production system. These tests involved comparing growth, color and quality of the lettuce cultivars grown under VEGGIE LED array (Orbitec, Madison, WI) or Biomass Production System for Education ((BSEe), Orbitec, Madison, WI) compact fluorescent lamps using a gravity feed water delivery system. Mission relevant conditions of CO2, temperature and RH were maintained using controlled environment chambers (EGC, Chagrin Falls, OH). Growth data was obtained for the two red leaf lettuce cultivars, Outredgeous and Firecracker, and the green Bibb lettuce cultivar, Flandria. Growth and quality was evaluated using different concentrations (7.5 g/L and 15 g/L) of commercial slow release fertilizer (Osmocote Plus 15-9-12, Scotts, Maryville, OH) and Nutricote 18-6-8 (Florikan, Sarasota, FL) in either a peat/vermiculite media (sunshine LP5 MiX, Sungro, Bellview, WA) or calcined montmorillonite clay [(arcillite,)Turface Proleague, Profile LLC, Buffalo Grove, IL]. The commercial peat/vermiculite mix generally resulted in larger plants than those grown in arcillite. Increasing the concentration of Osmocote from 7.5 to 15 g/L increased the height, dry mass, and leaf area of lettuce cultivars. In contrast, there was a decrease in growth parameters when concentration of Nutricote was increased from 7.5 to 15 g/L. The best growth was obtained with the 7.5 g/L Nutricote using a commercial peat/vermiculite mixture. This media was used for field testing VEGGIE plant system in the 2010 DRAT test. The VEGGIE nutrient delivery system worked well, was able to be maintained by multiple

  1. Response of Several Spring Barley Cultivars to UV-B Radiation and Ozone Treatment

    Directory of Open Access Journals (Sweden)

    Kristina DĖDELIENĖ

    2011-01-01

    Full Text Available Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} Experiments were conducted under controlled environmental conditions to assess the impact of UV-B radiation (8 kJ m-2 d-1 and ozone (240 μg m-3 on seven spring barley (Hordeum vulgare L. cultivars. It has been established that the impact of UV-B and ozone on various spring barley cultivars differs greatly and in most cases the cultivars which are tolerant to an impact of ozone are sensitive to UV-B and vice versa. The impact of both investigated stressors resulted in a more pronounced decrease in chlorophyll a than chlorophyll b content while the chlorophyll a/b ratio in the leaves of different spring barley cultivars has also decreased. The reaction of carotenoids differs greatly depending on a stressor. UV-B radiation causes a significant increase in the content of carotenoids which is most likely a defence reaction against high energy short-wave radiation. The impact of ozone, in contrast, resulted in a decrease in carotenoids in the leaves of different spring barley cultivars.

  2. Genetic variation of 12 rice cultivars grown in Brunei Darussalam ...

    African Journals Online (AJOL)

    Dell

    2015-03-25

    Mar 25, 2015 ... Genetic variations of 12 different rice cultivars in Brunei Darussalam were studied using 15 different. SSR markers ..... Principles of plant breeding: John Wiley & Sons Inc.,. New York .... and reproductive development of rice.

  3. introduction and evaluation of improved banana cultivars for ...

    African Journals Online (AJOL)

    jen

    Central and Eastern Provinces account for 26 %. The rest of the provinces ... from traditional cash crops, especially coffee. (Coffea arabica) ..... Impact Study of the Tissue Culture. Banana. Project in ... local cultivars. INIBAP Newsletter for Asia.

  4. Nonstructural carbohydrates and return bloom potential differ among cranberry cultivars

    Science.gov (United States)

    explain low fruit set and biennial bearing tendencies of cranberry (Vaccinium macrocarpon). Yet, comparisons of nonstructural carbohydrate concentrations during critical phenological stages across cultivars that differ in biennial bearing tendencies and return bloom potential are lacking, particular...

  5. RAPD-based genetic relationships in different Bougainvillea cultivars

    Directory of Open Access Journals (Sweden)

    Richa Srivastava

    2009-01-01

    Full Text Available The present study deals with authenticating existing knowledge about 21 Bougainvillea cultivars comprisingof 9 hybrids and their parents through RAPD analysis. The 19 degenerate primer sets generated 234 bands from which 158(67.5% were polymorphic. The UPGMA based dendrogram divided 21 cultivars into two major groups with Jaccard’ssimilarity coefficient ranging from 0.51 to 0.942. Group A had three cultivars namely Trinidad, Formosa and Dr. H. B. Singhin which Dr. H.B. Singh was confirmed as a hybrid of other two cultivars. Group B was sub divided into 8 clusters. Theparentages of 7 out of 8 hybirds have been confirmed based on clusters. The study concluded that the RAPD technique issuitable for confirmation of parent-hybrid relationship.

  6. Blueberry estimated harvest from seven new cultivars: fruit and anthocyanins.

    Science.gov (United States)

    Scalzo, Jessica; Stevenson, David; Hedderley, Duncan

    2013-08-15

    This study compares the yields, weights and anthocyanin contents of fruit from a group of seven new cultivars released from the New Zealand blueberry breeding programme and selected for the longest possible combined harvest season. The measured factors were primarily influenced by cultivar, and seasonal variations had relatively minor effects. The late-ripening cultivars 'Velluto Blue' and 'Centra Blue' had the highest fruit yields, anthocyanin contents and estimated total anthocyanin harvestable from a given area. 'Blue Moon' and 'Sky Blue' had the largest fruit sizes. The early-ripening cultivars 'Blue Bayou', 'Blue Moon' and 'Sunset Blue' had the lowest anthocyanin contents. The yield, fruit size and total anthocyanin content results obtained from any single year were highly correlated with the average of the three years, which makes pursuing the evaluation for these traits from a single year and at an early stage of plant development a practical proposition. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. YIELD AND YIELD COMPONENTS OF INVESTIGATED RAPESEED HYBRIDS AND CULTIVARS

    Directory of Open Access Journals (Sweden)

    Milan Pospišil

    2014-06-01

    Full Text Available To evaluate new winter rapeseed hybrids and cultivars, investigations were conducted at the experimental field of the Faculty of Agriculture, University of Zagreb, in the period 2009/10 - 2011/12. The trial involved 11 hybrids and 5 cultivars rapeseed of 5 seed producers selling seed in Croatia. The studied rapeseed hybrids and cultivars differed significantly in seed and oil yields, oil content and yield components (seed number per silique and 1000 seed weight. However, a number of hybrids rendered identical results, since the differences in the investigated properties were within statistically allowable deviation. Hybrids Traviata and CWH 119 can be singled out based on the achieved seed and oil yields, and the cultivar Ricco and hybrids CWH 119 and PR46W15 for their high oil content in seed. Hybrids with a larger silique number per plant also achieved a higher seed yield.

  8. development of hardy sorghum cultivars for the arid and

    African Journals Online (AJOL)

    DEVELOPMENT OF HARDY SORGHUM CULTIVARS FOR THE ARID AND. SEMI ARID REGIONS .... media and presence or absence ofin vitro selective agents (Amzallag et ...... diversity in India Mustard (Brassica Juncea) and its relationship ...

  9. Chemical desiccation for early harvest in soybean cultivars

    National Research Council Canada - National Science Library

    Tamara Pereira; Cileide Maria Medeiros Coelho; Clovis Arruda Souza; Analu Mantovani; Vanderléia Mathias

    2015-01-01

    .... The objective of this work was to assess the production performance and germination seeds in response to differents stages and desiccation chemicals products to early harvest of soybean cultivars...

  10. The use of cultivars of Raphanus sativus for cytokinin bioassay

    Directory of Open Access Journals (Sweden)

    Dorota Kubowicz

    2013-12-01

    Full Text Available Six cultivars of radish (Raphanus sativus were tested for their usefulness in radish cytokinin bioassay by the method of Letham (1971. The best cultivar was found to be 'Sopel Lodu' which responds well to both zeatin and 2iP over a wide range of concentrations. The fresh weight of cotyledons increased at most by 71.5% (if treated with zeatin or 101.0% (if treated with 2iP compared to untreated cotyledons. This cultivar is also sensitive to the partially purified cytokinin-like fraction isolated from the pine (Pinus silvestris cambial region. The cultivar 'Sopel Lodu' is therefore proposed to be a suitable plant for cytokinin bioassays.

  11. Integration of Information on Climate, Soil and Cultivar to Increase ...

    African Journals Online (AJOL)

    Cultivar to Increase Water Productivity of Maize in. Semi-arid ... 2Department of Soil and Crop Science, Texas A & M University, Texas USA. Abstract .... historical climate data into wet, normal and dry seasons (tercile probability) in particular.

  12. Respose of Phaseolus vulgaris L. cultivars to drought stress

    Directory of Open Access Journals (Sweden)

    Amalia Domínguez

    2014-01-01

    Full Text Available Tolerance to drought is a desired cultivars of Phaseolus vulgaris L. The present study aimed to determine the response of 22 cultivars of common bean during the early stages of vegetative development character. The plants were subjected to irrigation at 70% or 20% of field capacity (FC for seven days and the indicators were measured relative water content, stomatal opening, stomatal index, proline content and total phenols in leaves. The data obtained were processed using a principal component analysis and the variables studied were represented by a bivariate graph (biplot. It was possible to group the cultivars based on their response in tolerant, moderately tolerant and susceptible to water stress condition induced by irrigation at 20% FC. Stomatal opening and relative water content were recommended to be used as criteria for selecting cultivars tolerant to water stress indicators bean. Key words: PCA, Phaseolus vulgaris L., proline, water stress

  13. New hop (Humulus lupulus L. cultivars from Romania

    Directory of Open Access Journals (Sweden)

    Alexandru SALONTAI

    1985-08-01

    Full Text Available The research staff of the Agronomy Institute of Cluj-Napoca breeded the first Romanian hop cultivars officially approved in 1984 by the State Commission for the Testing and Approval of Plant Varieties. The new Humulus lupulus varieties are cv. "Napoca'l", cv. "Aroma" and cv. "Transilvania". The selection method, origin, biological characteristics, productivity and some technological qualities of the new cultivars are discussed in the paper.

  14. Androgenesis in anther culture of Lithuanian spring barley cultivars

    OpenAIRE

    Asakavičiūtė, Rita; Pašakinskienė, Izolda

    2006-01-01

    The method of anther culture was used for the production of doubled haploids in Lithuanian spring barley cultivars. Two methods, (i) regeneration from callus (Szarjeko’s method) and (ii) direct regeneration from embryoids (Caredda’s method) were applied to determine the androgenic potential according to the green regenerant yield and other morphogenetic factors. Green double haploid regenerants were obtained in four Lithuanian spring barley cultivars (‘Aura’, ‘Aidas’, ‘Alsa’ and ‘Auksiniai’) ...

  15. Chlorophyllin Bait Formulation and Exposure to Different Spectrum of Visible Light on the Reproduction of Infected/Uninfected Snail Lymnaea acuminata

    Directory of Open Access Journals (Sweden)

    Navneet Kumar

    2016-01-01

    Full Text Available Fasciolosis is a waterborne disease, caused by Fasciola species. Snail Lymnaea acuminata is an intermediate host of these flukes. Control of snail population is major tool in reducing the incidences. Variation in light intensity and wavelength caused significant changes in reproduction pattern of snails. Maximum fecundity was noted with bait containing carbohydrate (starch, 468 ± 0.10/20 snails or amino acid (serine, 319 ± 0.29/20 snails as attractant. Sublethal feeding of chlorophyllin bait with starch or serine attractant to infected and uninfected snails caused significant reduction in fecundity, hatchability, and survivability. These significant changes are observed in snails exposed to different spectral band of visible light and sunlight. Maximum fecundity of 536 ± 2.0 and minimum of 89.3 ± 0.4 were noted in snails not fed with bait and exposed to sunlight and red spectral band, respectively. There was complete arrest in the fecundity of infected and uninfected snails and no survivability of uninfected snails after 48 h feeding with bait containing chlorophyllin + attractant. Minimum hatchability (9.25 ± 0.5 was noted in red light exposed, chlorophyllin + starch fed infected snails and hatching period of bait fed snails was prolonged. Conclusively, chlorophyllin bait and red light reduce reproduction capacity in snails.

  16. Chlorophyllin Bait Formulation and Exposure to Different Spectrum of Visible Light on the Reproduction of Infected/Uninfected Snail Lymnaea acuminata.

    Science.gov (United States)

    Kumar, Navneet; Singh, D K; Singh, Vinay Kumar

    2016-01-01

    Fasciolosis is a waterborne disease, caused by Fasciola species. Snail Lymnaea acuminata is an intermediate host of these flukes. Control of snail population is major tool in reducing the incidences. Variation in light intensity and wavelength caused significant changes in reproduction pattern of snails. Maximum fecundity was noted with bait containing carbohydrate (starch, 468 ± 0.10/20 snails) or amino acid (serine, 319 ± 0.29/20 snails) as attractant. Sublethal feeding of chlorophyllin bait with starch or serine attractant to infected and uninfected snails caused significant reduction in fecundity, hatchability, and survivability. These significant changes are observed in snails exposed to different spectral band of visible light and sunlight. Maximum fecundity of 536 ± 2.0 and minimum of 89.3 ± 0.4 were noted in snails not fed with bait and exposed to sunlight and red spectral band, respectively. There was complete arrest in the fecundity of infected and uninfected snails and no survivability of uninfected snails after 48 h feeding with bait containing chlorophyllin + attractant. Minimum hatchability (9.25 ± 0.5) was noted in red light exposed, chlorophyllin + starch fed infected snails and hatching period of bait fed snails was prolonged. Conclusively, chlorophyllin bait and red light reduce reproduction capacity in snails.

  17. Chlorophyllin Bait Formulation and Exposure to Different Spectrum of Visible Light on the Reproduction of Infected/Uninfected Snail Lymnaea acuminata

    Science.gov (United States)

    Kumar, Navneet; Singh, D. K.; Singh, Vinay Kumar

    2016-01-01

    Fasciolosis is a waterborne disease, caused by Fasciola species. Snail Lymnaea acuminata is an intermediate host of these flukes. Control of snail population is major tool in reducing the incidences. Variation in light intensity and wavelength caused significant changes in reproduction pattern of snails. Maximum fecundity was noted with bait containing carbohydrate (starch, 468 ± 0.10/20 snails) or amino acid (serine, 319 ± 0.29/20 snails) as attractant. Sublethal feeding of chlorophyllin bait with starch or serine attractant to infected and uninfected snails caused significant reduction in fecundity, hatchability, and survivability. These significant changes are observed in snails exposed to different spectral band of visible light and sunlight. Maximum fecundity of 536 ± 2.0 and minimum of 89.3 ± 0.4 were noted in snails not fed with bait and exposed to sunlight and red spectral band, respectively. There was complete arrest in the fecundity of infected and uninfected snails and no survivability of uninfected snails after 48 h feeding with bait containing chlorophyllin + attractant. Minimum hatchability (9.25 ± 0.5) was noted in red light exposed, chlorophyllin + starch fed infected snails and hatching period of bait fed snails was prolonged. Conclusively, chlorophyllin bait and red light reduce reproduction capacity in snails. PMID:26925296

  18. Micromechanical properties of consecutive layers in specialized insect cuticle: the gula of Pachnoda marginata (Coleoptera, Scarabaeidae) and the infrared sensilla of Melanophila acuminata (Coleoptera, Buprestidae).

    Science.gov (United States)

    Müller, Martin; Olek, Maciej; Giersig, Michael; Schmitz, Helmut

    2008-08-01

    Insect cuticle is a highly adaptive material that fulfils a wide spectrum of different functions. Cuticle does not only build the exoskeleton with diverse moveable parts but is also an important component of a stunning variety of mechanosensory receptors. Therefore, the mechanical properties of these specialized cuticular systems are of crucial importance. We studied the different cuticular layers of the head part (gula) of the head-to-neck ball articulation of Pachnoda marginata and of the photomechanic infrared (IR) sensilla of Melanophila acuminata on the basis of cross sections. In our study, we combined histological methods (i.e. detection of the different types of cuticle by specific staining) with measurements of hardness (H) and reduced elastic modulus (E(r)) by nanoindentation technique. In the gula of Pachnoda we found an unusual aberrance from the well-known layering. Between the epi- and exocuticle, two meso- and one endocuticular layers are deposited which are softer and more elastic than the underlying exo- and mesocuticular layers. The hardest of all examined materials is the cuticle of the exocuticular shell of the internal sphere of the Melanophila IR sensillum with H=0.53GPa whereas the inner mesocuticular core of the sensillum represents the most elastic and softest layer with values of H=0.29GPa and E(r)=4.8GPa. Results are discussed with regard to the proposed functions.

  19. Expansion of banana (Musa acuminata) gene families involved in ethylene biosynthesis and signalling after lineage-specific whole-genome duplications.

    Science.gov (United States)

    Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila

    2014-05-01

    Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling.

  20. Processamento de tomate seco de diferentes cultivares Dried tomato processing of different cultivars

    Directory of Open Access Journals (Sweden)

    Dorivaldo da Silva Raupp

    2009-01-01

    Full Text Available O tomate seco apresenta um consumo crescente, principalmente como ingrediente de pizzas e lasanhas, e na forma de aperitivo. A pesquisa avaliou o processo de produção de tomate seco de quatro cultivares comerciais (Italiano, Débora Plus, Santa Cruz, Delícia e a qualidade dos produtos prontos. O tomate foi fatiado em quatro cortes longitudinais, sentido pedúnculo-ápice, e as fatias tiveram suas massas loculares removidas. O secador foi regulado nas primeiras três horas para 100ºC, seguido de 80ºC até completar a secagem do produto, o qual apresentou uma umidade residual em torno de 60%. A cv. Delícia produziu a maior perda de 39,8% durante o preparo das fatias frescas, sendo que as perdas para as demais cultivares variaram entre 32,7 a 34,3%. Os rendimentos dos tomates inteiros em produtos prontos foram iguais a: cv. Débora Plus 9,1%; cv. Santa Cruz 8,9%; cv. Delícia 8,6%; e cv. Italiano 8,3%. O maior tempo de secagem de 9 horas e 25 minutos foi para a cv. Delícia; as demais apresentaram um mínimo de 8 horas e 10 minutos (Italiano e um máximo de 8 horas e 35 minutos (Santa Cruz. Os tomates secos das cultivares Italiano e Débora Plus apresentaram-se levemente adocicados; o da cv. Santa Cruz foi ainda menos; e, esta característica foi de difícil percepção para o da cv. Delícia, que também teve uma mastigação não suave e mais prolongada. Apesar da diferença, os produtos tomates secos obtidos a partir dessas cultivares não diferiram significativamente quanto ao paladar quando degustados por provadores não treinados.Consumption of dried tomatoes has been increasing, mainly as an ingredient of pizzas and lasagnas, and also as an appetizer. This study evaluated the production process of four commercial varieties (Italiano, Débora Plus, Santa Cruz, Delícia and the quality of the finished products, which had a moisture content of around 60%. The tomatoes were sliced into four longitudinal cuts in the stalk-apex direction and

  1. Effect of MgCl2 stress on germination, plant growth, chlorophyll content, proline content and lipid peroxidation in sorghum cultivars

    Directory of Open Access Journals (Sweden)

    Khare T.

    2012-11-01

    Full Text Available Present report deals with the effect of increasing levels (0-300 mM of MgCl2 salt on sorghum cultivars, Phule Vasudha and Phule Revati. Although MgCl2 stress did not show considerable adverse effects on germination, however, at higher (>200 mM concentrations, the seedlings turned brown and did not showed any further growth, with comparably higher magnitude of negative effects on Phule Revati than Phule Vasudha. Overall, increasing MgCl2 stress reduced plant growth and biomass production significantly in both the cultivars, though with lesser extent in Phule Vsudha as compared to Phule Rvati. Contrasting behavior was evidenced in both the cultivars in terms of protein content under varying levels of MgCl2 concentration at vegetative growth level, where salinity induced reduction in protein content was higher in Phule Revati than Phule Vasudha. The genotype Phule Vasudha showed higher proline content under non-saline condition. MgCl2 stress-induced proline accumulation was observed in both the sorghum cultivars, however, interestingly, Phule Revati (439% of control plants showed comparably higher proline content than Phule Vasudha (324% of control plants at the highest (300 mM level of stress. Even though, malondialdehyde (MDA: lipid peroxidation indicator content was on higher side under non-saline conditions in cultivar Phule Vasudha as compared to cultivar Phule Revati, however the rate of increase in MDA with increasing salt stress was much higher in the latter cultivar, indicating the comparably higher level of lipid peroxidation under the influence of MgCl2 stress. The salt tolerance nature of Phule Vasudha was positively correlated with its better performance in terms of physiological and biochemical parameters.

  2. Comprehensive MS and Solid-State NMR Metabolomic Profiling Reveals Molecular Variations in Native Periderms from Four Solanum tuberosum Potato Cultivars.

    Science.gov (United States)

    Huang, Wenlin; Serra, Olga; Dastmalchi, Keyvan; Jin, Liqing; Yang, Lijia; Stark, Ruth E

    2017-03-15

    The potato (Solanum tuberosum L.) ranks third in worldwide consumption among food crops. Whereas disposal of potato peels poses significant challenges for the food industry, secondary metabolites in these tissues are also bioactive and essential to crop development. The diverse primary and secondary metabolites reported in whole tubers and wound-healing tissues prompted a comprehensive profiling study of native periderms from four cultivars with distinctive skin morphologies and commercial food uses. Polar and nonpolar soluble metabolites were extracted concurrently, analyzed chromatographically, and characterized with mass spectrometry; the corresponding solid interfacial polymeric residue was examined by solid-state (13)C NMR. In total, 112 secondary metabolites were found in the phellem tissues; multivariate analysis identified 10 polar and 30 nonpolar potential biomarkers that distinguish a single cultivar among Norkotah Russet, Atlantic, Chipeta, and Yukon Gold cultivars which have contrasting russeting features. Compositional trends are interpreted in the context of periderm protective function.

  3. De novo transcriptome assembly of a sour cherry cultivar, Schattenmorelle

    Directory of Open Access Journals (Sweden)

    Yeonhwa Jo

    2015-12-01

    Full Text Available Sour cherry (Prunus cerasus in the genus Prunus in the family Rosaceae is one of the most popular stone fruit trees worldwide. Of known sour cherry cultivars, the Schattenmorelle is a famous old sour cherry with a high amount of fruit production. The Schattenmorelle was selected before 1650 and described in the 1800s. This cultivar was named after gardens of the Chateau de Moreille in which the cultivar was initially found. In order to identify new genes and to develop genetic markers for sour cherry, we performed a transcriptome analysis of a sour cherry. We selected the cultivar Schattenmorelle, which is among commercially important cultivars in Europe and North America. We obtained 2.05 GB raw data from the Schattenmorelle (NCBI accession number: SRX1187170. De novo transcriptome assembly using Trinity identified 61,053 transcripts in which N50 was 611 bp. Next, we identified 25,585 protein coding sequences using TransDecoder. The identified proteins were blasted against NCBI's non-redundant database for annotation. Based on blast search, we taxonomically classified the obtained sequences. As a result, we provide the transcriptome of sour cherry cultivar Schattenmorelle using next generation sequencing.

  4. Adaptability of soybean cultivars in different crop years.

    Science.gov (United States)

    Soares, I O; Rezende, P M; Bruzi, A T; Zambiazzi, E V; Zuffo, A M; Silva, K B; Gwinner, R

    2015-08-07

    Soybean is one of the main sources of foreign exchange credits for Brazil in the agricultural sector. There is increasing interest in growing this leguminous crop, especially in the southern region of Minas Gerais, due to its importance as an alternative for crop rotation with maize. In this respect, the study of the adaptability of new cultivars to the region is indispensable so as to obtain high yields. Thus, the aim of this study was to evaluate the performance of 38 soybean cultivars for growing in the summer season in the municipality of Lavras, MG, Brazil, in the 2010/2011 and 2011/2012 crop years. The experiments were conducted in a randomized block design with 3 replications and the treatments consisted of 38 cultivars. At the time of harvest, the following assessments were made: grain yield (kg/ha), height of the lowest pod (cm), plant height (cm), and lodging. The data were subjected to individual and combined analysis of variance. The phenotypic mean values were clustered, adopting the Scott and Knott test. For simultaneous selection of multiple traits, the sum of rank index of Mulamba and Mock was adopted. The cultivar TMG 801 RR had the best yield performance; the cultivars Monsoy 8001, MGBR-46 (Conquista), and BRSMG 68 (Vencedora) also stood out. Considering simultaneous selection for grain yield, plant height, height of the lowest pod, and lodging, the cultivar TMG 801 RR is recommended for growing in the summer season in the southern region of Minas Gerais.

  5. Adaptability and stability of strawberry cultivars using a mixed model

    Directory of Open Access Journals (Sweden)

    Andréa Ferreira Costa

    2015-10-01

    Full Text Available Although strawberry crops have a strong socio-economic impact on the agricultural sector of Espírito Santo State, there are few studies on the performance of strawberry cultivars in different locations and years under a low tunnel management system (LT. Therefore, this study aimed to estimate the parameters of adaptability and stability of strawberry cultivars under LT-protected cultivation using the harmonic mean of the relative performance of genetically predicted values. Seven strawberry cultivars were assessed (‘Dover’, ‘Camino Real’, ‘Ventana’, ‘Camarosa’, ‘Seascape’, ‘Diamante’ and ‘Aromas’ in the agricultural years 2006/7, 2007/8 and 2008/9 in three locations in the mountainous region of Espírito Santo State. The experiment was arranged in a randomized block design, with 3 replications and 15 plants per plot. The analysis of deviance for the yield (ton. ha-1 demonstrated that only the effects of genotype and the triple interaction genotype x location x year were significant, which indicates the presence of genetic variability among the cultivars and the inconsistency of the position among the genotypes for combinations of year and location. Considering the selection for yield, adaptability and stability, in LT-protected cultivation, cultivars Camarosa and Aromas are highlighted for expressing average values that were 22% higher than the overall mean of the cultivars (24.55 ton. há-1 in the environments assessed.

  6. SSR Analysis of Genetic Diversity Among 192 Diploid Potato Cultivars

    Directory of Open Access Journals (Sweden)

    Xiaoyan Song

    2016-05-01

    Full Text Available In potato breeding, it is difficult to improve the traits of interest at the tetraploid level due to the tetrasomic inheritance. A promising alternative is diploid breeding. Thus it is necessary to assess the genetic diversity of diploid potato germplasm for efficient exploration and deployment of desirable traits. In this study, we used SSR markers to evaluate the genetic diversity of diploid potato cultivars. To screen polymorphic SSR markers, 55 pairs of SSR primers were employed to amplify 39 cultivars with relatively distant genetic relationships. Among them, 12 SSR markers with high polymorphism located at 12 chromosomes were chosen to evaluate the genetic diversity of 192 diploid potato cultivars. The primers produced 6 to 18 bands with an average of 8.2 bands per primer. In total, 98 bands were amplified from 192 cultivars, and 97 of them were polymorphic. Cluster analysis using UPGMA showed the genetic relationships of all accessions tested: 186 of the 192 accessions could be distinguished by only 12 pairs of SSR primers, and the 192 diploid cultivars were divided into 11 groups, and 83.3% constituted the first group. Clustering results showed relatively low genetic diversity among 192 diploid cultivars, with closer relationship at the molecular level. The results can provide molecular basis for diploid potato breeding.

  7. Growth Responses of Wheat Cultivars to Rock Phosphate in Hydroponics

    Institute of Scientific and Technical Information of China (English)

    M.ASHRAF; RAHMATULLAH; M.A.MAQSOOD; S.KANWAL; M.A.TAHIR; L.ALI

    2009-01-01

    Screening cultivars to grow under conditions of low phosphorus (P) availability and utilize P efficiently from compounds of low solubility in soils may be beneficial to overcome poor plant growth in P-deficient soils.The growth behavior and P utilization efficiency of seven wheat cultivars grown in hydroponics were studied,using rock phosphate as P source.The wheat cultivars grown for 30 days were significantly different in biomass accumulation,P uptake and P utilization efficiency.The dry matter production of all the cultivars was significantly correlated with P uptake,which in turn correlated to the drop in the root medium pH.The ranking of wheat cultivars on the basis of dry matter yield,P uptake and P utilization efficiency was Zamindar 80 > Yccora > C 271 > WL 711 > Barani 83 > PARI 73 > Rohtas.The cultivar Zamindar 80 appeared to possess the best growth potential in P-deficient soils.

  8. Avaliação de herbicidas para dois cultivares de mandioca Selectivity of herbicide alternatives for two cassava cultivars

    Directory of Open Access Journals (Sweden)

    D.F Biffe

    2010-12-01

    Full Text Available É importante avaliar a tolerância de variedade de mandioca a novas alternativas de controle químico, com o intuito de ampliar as opções disponíveis. Este trabalho teve como objetivo avaliar a seletividade de herbicidas aplicados em pré-emergência, para duas importantes variedades de mandioca cultivadas no Estado do Paraná. Os herbicidas e respectivas doses (g i.a. ha-1 avaliadas foram: diuron (400 e 800, metribuzin (360 e 720, isoxaflutole (60, atrazine (720, S-metolachlor (1.920 e as misturas ametryn + clomazone (1.350+1.900, ametryn+trifluralin (1.500+1.350, isoxaflutole+metribuzin (60+320, isoxaflutole+diuron (60+400, combinados com uso de uma testemunha dupla adjacente a cada tratamento. Os cultivares utilizados neste trabalho foram Fécula Branca e Fibra. Apenas o herbicida S-metolachlor, para ambos os cultivares, e metribuzin (360 g i.a. ha-1, para o cultivar Fibra, não provocaram injúrias. Atrazine provocou redução de estande para o cultivar Fécula Branca aos 60 DAP, mas não foi detectada redução na altura de plantas. Tanto atrazine (para os dois cultivares quanto diuron na dose de 800 g i.a. ha-1 (para o cultivar Fécula Branca afetaram a produtividade de raízes. Dessa forma, atrazine foi considerado não seletivo para ambos os cultivares, e a maior dose de diuron foi também considerada não seletiva para o cultivar Fécula Branca. Há diferenças de tolerância entre os cultivares, sendo o Fibra, de modo geral, mais tolerante aos herbicidas avaliados.It is important to evaluate the tolerance of cassava varieties under new weed chemical control alternatives. Thus, this study aimed to evaluate the selectivity of herbicides, applied at pre-emergence, for two important cassava varieties grown in the state of Paraná, Brazil. The herbicides and respective doses (g a.i. ha-1 were: diuron (400 and 800, metribuzin (360 and 720, isoxaflutole (60, atrazine (720, S-metolachlor (1,920 and mixtures ametryn+clomazone (1

  9. Growth of Verticillium longisporum in Xylem Sap of Brassica napus is Independent from Cultivar Resistance but Promoted by Plant Aging.

    Science.gov (United States)

    Lopisso, Daniel Teshome; Knüfer, Jessica; Koopmann, Birger; von Tiedemann, Andreas

    2017-09-01

    As Verticillium stem striping of oilseed rape (OSR), a vascular disease caused by Verticillium longisporum, is extending into new geographic regions and no control with fungicides exists, the demand for understanding mechanisms of quantitative resistance increases. Because V. longisporum is strictly limited to the xylem and resistance is expressed in the systemic stage post root invasion, we investigated a potential antifungal role of soluble constituents and nutritional conditions in xylem sap as determinants of cultivar resistance of OSR to V. longisporum. Assessment of biometric and molecular genetic parameters applied to describe V. longisporum resistance (net area under disease progress curve, stunting, stem thickness, plant biomass, and V. longisporum DNA content) showed consistent susceptibility of cultivar 'Falcon' in contrast to two resistant genotypes, 'SEM' and 'Aviso'. Spectrophotometric analysis revealed a consistently stronger in vitro growth of V. longisporum in xylem sap extracted from OSR compared with the water control. Further comparisons of fungal growth in xylem sap of different cultivars revealed the absence of constitutive or V. longisporum induced antifungal activity in the xylem sap of resistant versus susceptible genotypes. The similar growth of V. longisporum in xylem sap, irrespective of cultivar, infection with V. longisporum and xylem sap filtration, was correlated with about equal amounts of total soluble proteins in xylem sap from these treatments. Interestingly, compared with younger plants, xylem sap from older plants induced significantly stronger fungal growth. Growth enhancement of V. longisporum in xylem sap of aging plants was reflected by increased contents of carbohydrates, which was consistent in mock or V. longisporum-infected plants and independent from cultivar resistance. The improved nutritional conditions in the xylem of more mature plants may explain the late appearance of disease symptoms, which are observed only in

  10. Describing contrast across scales

    Science.gov (United States)

    Syed, Sohaib Ali; Iqbal, Muhammad Zafar; Riaz, Muhammad Mohsin

    2017-06-01

    Due to its sensitive nature against illumination and noise distributions, contrast is not widely used for image description. On the contrary, the human perception of contrast along different spatial frequency bandwidths provides a powerful discriminator function that can be modeled in a robust manner against local illumination. Based upon this observation, a dense local contrast descriptor is proposed and its potential in different applications of computer vision is discussed. Extensive experiments reveal that this simple yet effective description performs well in comparison with state of the art image descriptors. We also show the importance of this description in multiresolution pansharpening framework.

  11. Partially resistant Cucurbita pepo showed late onset of the Zucchini yellow mosaic virus infection due to rapid activation of defense mechanisms as compared to susceptible cultivar

    Directory of Open Access Journals (Sweden)

    Slavomira eNovakova

    2015-04-01

    Full Text Available Zucchini yellow mosaic virus (ZYMV is an emerging viral pathogen in cucurbit-growing areas wordwide. Infection causes significant yield losses in several species of the family Cucurbitaceae. To identify proteins potentially involved with resistance towards infection by the severe ZYMV-H isolate, two Cucurbita pepo cultivars (Zelena susceptible and Jaguar partially resistant were analyzed using a two-dimensional gel electrophoresis-based proteomic approach. Initial symptoms on leaves (clearing veins developed 6-7 days post inoculation (dpi in the susceptible C. pepo cv. Zelena. In contrast, similar symptoms appeared on the leaves of partially resistant C. pepo cv. Jaguar only after 15 dpi. This finding was confirmed by immune-blot analysis which showed higher levels of viral proteins at 6 dpi in the susceptible cultivar. Leaf proteome analyses revealed 28 and 31 spots differentially abundant between cultivars at 6 and 15 dpi, respectively. The variance early in infection can be attributed to a rapid activation of proteins involved with redox homeostasis in the partially resistant cultivar. Changes in the proteome of the susceptible cultivar are related to the cytoskeleton and photosynthesis.

  12. Partially resistant Cucurbita pepo showed late onset of the Zucchini yellow mosaic virus infection due to rapid activation of defense mechanisms as compared to susceptible cultivar.

    Science.gov (United States)

    Nováková, Slavomíra; Flores-Ramírez, Gabriela; Glasa, Miroslav; Danchenko, Maksym; Fiala, Roderik; Skultety, Ludovit

    2015-01-01

    Zucchini yellow mosaic virus (ZYMV) is an emerging viral pathogen in cucurbit-growing areas wordwide. Infection causes significant yield losses in several species of the family Cucurbitaceae. To identify proteins potentially involved with resistance toward infection by the severe ZYMV-H isolate, two Cucurbita pepo cultivars (Zelena susceptible and Jaguar partially resistant) were analyzed using a two-dimensional gel electrophoresis-based proteomic approach. Initial symptoms on leaves (clearing veins) developed 6-7 days post-inoculation (dpi) in the susceptible C. pepo cv. Zelena. In contrast, similar symptoms appeared on the leaves of partially resistant C. pepo cv. Jaguar only after 15 dpi. This finding was confirmed by immune-blot analysis which showed higher levels of viral proteins at 6 dpi in the susceptible cultivar. Leaf proteome analyses revealed 28 and 31 spots differentially abundant between cultivars at 6 and 15 dpi, respectively. The variance early in infection can be attributed to a rapid activation of proteins involved with redox homeostasis in the partially resistant cultivar. Changes in the proteome of the susceptible cultivar are related to the cytoskeleton and photosynthesis.

  13. Desempenho de cultivares de alface na região de Manaus Performance of lettuce cultivars in Manaus region

    Directory of Open Access Journals (Sweden)

    Isac N Rodrigues

    2008-12-01

    Full Text Available Na avaliação de cultivares de hortaliças, os rendimentos médios mais elevados nos ensaios de competição, associados a fatores de qualidade, são utilizados como critérios de recomendação para plantio. O presente trabalho teve como objetivo avaliar as cultivares de alface Frisella, Deisy, Tender Green, Lollo Bionda, Itapuã 401, Marisa, Verônica, Banchu New Red Fire e Hortência nas condições climáticas da região de Manaus, sob cultivo protegido e a campo. Foram avaliadas as características: massa fresca total, massa fresca comercial, diâmetro da cabeça e altura. As cultivares de alface Marisa, Itapuã 401 e Hortência são opções mais adequadas para o cultivo protegido e a campo na região, incluindo-se para o cultivo a campo a cultivar Verônica, a qual apresentou a melhor produção na avaliação realizada neste ambiente.In the evaluation of vegetable cultivars, the high average yield in the competition assays associated to quality factors are utilized as criteria to recommend cultivars. In the present work we evaluated the lettuce cultivars Frisella, Deisy, Tender Green, Lollo Bionda, Itapuã 401, Marisa, Verônica, Banchu New Red Fire and Hortência under the climatic conditions of the region of Manaus, under protected and conventional cultivation. The evaluated characteristics were: total and commercial weight, plant diameter and height. The lettuce cultivars Marisa, Itapuã 401 and Hortência presented higher production in both environments adding Verônica with best production under conventional cultivation.

  14. Influence of Prunus spp., peach cultivars, and bark damage on oviposition choices by the lesser peachtree borer (Lepidoptera: Sesiidae).

    Science.gov (United States)

    Cottrell, T E; Fuest, J; Horton, D L

    2008-12-01

    An examination of oviposition choices by the lesser peachtree borer, Synanthedon pictipes (Grote and Robinson) (Lepidoptera: Sesiidae), showed that wounded peach, Prunus persica (L.) Batsch, bark was attractive to females for oviposition. Females responded to bark that was injured mechanically (e.g., hammer blows, knife cuts, pruning wounds), infested by lesser peachtree borer larvae or injured by disease. In fact, there was no difference in female oviposition response to knife cut wounds and knife cut wounds infested with lesser peachtree borer larvae. Oviposition on wounded bark from three different high chill peach cultivars was similar and strongly suggests that the narrow genetic base of high chill peach cultivars grown in the southeastern United States has little inherent resistance to the lesser peachtree borer. In stark contrast, when provided different Prunus spp., i.e., exotic peach and the native species P. angustifolia and P. serotina, the exotic peach was highly preferred for oviposition by the native lesser peachtree borer.

  15. Generalized phase contrast:

    DEFF Research Database (Denmark)

    Glückstad, Jesper; Palima, Darwin

    Generalized Phase Contrast elevates the phase contrast technique not only to improve phase imaging but also to cross over and interface with diverse and seemingly disparate fields of contemporary optics and photonics. This book presents a comprehensive introduction to the Generalized Phase Contrast...... (GPC) method including an overview of the range of current and potential applications of GPC in wavefront sensing and phase imaging, structured laser illumination and image projection, optical trapping and manipulation, and optical encryption and decryption. The GPC method goes further than...... efficiency. Optimization can address practical issues, such as finding an optimal spatial filter for the chosen application, and can even enable a Reverse Phase Contrast mode where intensity patterns are converted into a phase modulation....

  16. Generalized Phase Contrast

    CERN Document Server

    Glückstad, Jesper

    2009-01-01

    Generalized Phase Contrast elevates the phase contrast technique not only to improve phase imaging but also to cross over and interface with diverse and seemingly disparate fields of contemporary optics and photonics. This book presents a comprehensive introduction to the Generalized Phase Contrast (GPC) method including an overview of the range of current and potential applications of GPC in wavefront sensing and phase imaging, structured laser illumination and image projection, optical trapping and manipulation, and optical encryption and decryption. The GPC method goes further than the restrictive assumptions of conventional Zernike phase contrast analysis and achieves an expanded range of validity beyond weak phase perturbations. The generalized analysis yields design criteria for tuning experimental parameters to achieve optimal performance in terms of accuracy, fidelity and light efficiency. Optimization can address practical issues, such as finding an optimal spatial filter for the chosen application, ...

  17. Generalized phase contrast:

    DEFF Research Database (Denmark)

    Glückstad, Jesper; Palima, Darwin

    Generalized Phase Contrast elevates the phase contrast technique not only to improve phase imaging but also to cross over and interface with diverse and seemingly disparate fields of contemporary optics and photonics. This book presents a comprehensive introduction to the Generalized Phase Contrast...... (GPC) method including an overview of the range of current and potential applications of GPC in wavefront sensing and phase imaging, structured laser illumination and image projection, optical trapping and manipulation, and optical encryption and decryption. The GPC method goes further than...... the restrictive assumptions of conventional Zernike phase contrast analysis and achieves an expanded range of validity beyond weak phase perturbations. The generalized analysis yields design criteria for tuning experimental parameters to achieve optimal performance in terms of accuracy, fidelity and light...

  18. Novo cultivar de mamona: IAC-226(Tarabay New castor bean cultivar IAC-226 (Tarabay

    Directory of Open Access Journals (Sweden)

    Angelo Savy Filho

    1990-01-01

    Full Text Available Este trabalho descreve um novo cultivar de mamona (Ricinus communis 1., IAC-226 (Tarabay originado de linhagem pura, obtida do cruzamento controlado entre o 'Pindorama' e o 'Campinas': trata-se de germoplasma adaptado às condições climáticas normais de cultura no Estado de São Paulo, material de porte alto (250-350cm, diâmetro de copa de 215cm e ciclo vegetativo médio (180 dias, a partir da emergência. A produção econômica é dada pelos racemos primários, secundários, terciários e quaternários, com 19, 30, 23 e 28% da produção total respectivamente, elevado potencial produtivo (2.681kg/ha de sementes e 1.233kg/ha de óleo, e frutos indeiscentes.The characteristics of a new castor bean (Ricinus communis L. cultivar, named IAC-226 (Tarabay, obtained by hybridization between 'Pindorama' and 'Campinas', and selected by the pedigree method, are reported. The origin, characteristics of the plant and fruits such as seed weight and yield are described. Remarkable traits are: tall height indehiscent fruits, adaptation and outstanding yield ability with mean value of 2,681kg of seeds/ha and 1,233kg of oil/ha.

  19. Microrganismos associados a frutos de diferentes cultivares de noz Pecan Microorganisms associated with fruits of different cultivars of Pecan nut

    Directory of Open Access Journals (Sweden)

    Nádia Izumi Terabe

    2008-04-01

    Full Text Available O conhecimento do comportamento natural da nogueira Pecan às principais doenças é de suma importância para o estabelecimento do planejamento da implantação da cultura. O controle fitossanitário e tratos culturais devem ser realizados de modo a não comprometerem a qualidade do produto final, as amêndoas. Foram avaliadas nozes produzidas na safra de 2005 e oriundas de Uraí-PR, pelas cultivares Burkett, Frotscher e Moneymaker, para identificar e quantificar os microrganismos associados à amêndoas e cascas dos frutos, bem como observar diferenças entre organismos colonizadores das cultivares. Os frutos foram avaliados na pós-colheita, aos trinta dias de armazenamento em ambiente, através da metodologia do papel de filtro, sendo submetidos ou não à assepsia superficial. O fungo Cladosporium caryigenum, promotor da rancificação das amêndoas foi observado, em amêndoas e cascas, nas cultivares Burkett, Frotscher e Moneymaker; Fusarium sp., foi encontrado em porcentuais elevados, tanto em amêndoas quanto em cascas das três cultivares estudadas; Cephalothecium roseum, causador do mofo róseo em amêndoas, na cultivar Frotscher. Aspergillus sp. e Penicillium sp., causadores de emboloramento e produtores de aflotoxinas foram observados em porcentuais representativos, em amêndoas da cultivar Frotscher e em amêndoas e cascas das cultivares Frotscher, Burkett e Moneymaker, respectivamente. Os maiores porcentuais de perda do rendimento foram observados na cultivar Burkett, por causa da incidência de Colletotrichum sp., causador da antracnose em amêndoas, que acarreta escurecimento e deterioração do produto final, levando-o ao descarte.The knowledgement of the natural behavior of the main diseases of Pecan nut is of utmost importance for the stablishment of an implantation plan for that culture. The phytosanitary control and cultural treatments should be performed in order not to change the quality of the final product. Nuts harvest

  20. Contribución al conocimiento de la relación biológica entre Pythium sp. y raíces y nódulos radicales de Alnus acuminata H.B.K

    Directory of Open Access Journals (Sweden)

    Moncada María Amelia

    1987-12-01

    Full Text Available En los alrededores del embalse del Neusa (Cundinamarcal, se encontró un hongo del género Pythium asociado frecuentemente a los nódulos radicales del Aliso (Alnus acuminata, especie nativa de gran importancia en programas de reforestación, protección de cuencas y sistemas silviculturales, debido a su rápido crecimiento y al efecto mejorado que ejerce sobre las caracter ísticas nutricionales del suelo. La presente investigación tuvo por objeto conocer algunos aspectos de la relación biológica de Pythium sp, asociado a las raíces y nódulos radicales de Alnus acuminata. Se utilizó un diseño experimental completamente al azar,
    con tres repeticiones. Para evaluar la relación se inocularon
    plántulas de Aliso con una combinación de cuatro dosis del hongo Pvthium y cuatro dosis del Actinornvcete. La respuesta a los tratamientos fue registrada a los 20, 30, 40 y 60 días de inoculadas, mediante la determinación de peso seco, altura, número de hojas e infección radical de Alnus acuminata.
    Los resultados mostraron que el hongo asociado a los nódulos de Pythium silveticum y que las dosis altas de este inóculo
    causaron la muerte de las plántulas y las dosis menores disminuyeron peso seco, altura y número de hojas por planta. En la interacción del Actinomycete y el hongo, la presencia del primero disminuyó el efecto patogénico de Pythium silvaticum.

  1. Genealogy of wine grape cultivars: "Pinot" is related to "Syrah".

    Science.gov (United States)

    Vouillamoz, J F; Grando, M S

    2006-08-01

    Since the domestication of wild grapes ca 6000 years ago, numerous cultivars have been generated by spontaneous or deliberate crosses, and up to 10 000 are still in existence today. Just as in human paternity analysis, DNA typing can reveal unexpected parentage of grape cultivars. In this study, we have analysed 89 grape cultivars with 60 microsatellite markers in order to accurately calculate the identity-by-descent (IBD) and relatedness (r) coefficients among six putatively related cultivars from France ("Pinot", "Syrah" and "Dureza") and northern Italy ("Teroldego", "Lagrein" and "Marzemino"). Using a recently developed likelihood-based approach to analyse kinship in grapes, we provide the first evidence of a genetic link between grapes across the Alps: "Dureza" and "Teroldego" turn out to be full-siblings (FS). For the first time in grapevine genetics we were able to detect FS without knowing one of the parents and identify unexpected second-degree relatives. We reconstructed the most likely pedigree that revealed a third-degree relationship between the worldwide-cultivated "Pinot" from Burgundy and "Syrah" from the Rhone Valley. Our finding was totally unsuspected by classical ampelography and it challenges the commonly assumed independent origins of these grape cultivars. Our results and this new approach in grape genetics will (a) help grape breeders to avoid choosing closely related varieties for new crosses, (b) provide pedigrees of cultivars in order to detect inheritance of disease-resistance genes and (c) open the way for future discoveries of first- and second-degree relationships between grape cultivars in order to better understand viticultural migrations.

  2. Storage performance of Taiwanese sweet potato cultivars.

    Science.gov (United States)

    Huang, Che-Lun; Liao, Wayne C; Chan, Chin-Feng; Lai, Yung-Chang

    2014-12-01

    Three sweet potato cultivars (TNG57, TNG66, and TNG73), provided by the Taiwanese Agricultural Research Institute (TARI), were stored at either 15 °C or under ambient conditions (23.8 ~ 28.4 °C and 77.1 ~ 81.0 % of relative humidity). Sweet potato roots were randomly chosen from each replicate and evaluated for measurement of weight loss, sugar content analysis, and sprouting after 0, 14, 24, 48, 56, 70, 84, and 98 days of storage. Fresh sweet potato roots were baked at 200 °C for 60 min then samples were taken for sugar analysis. After 14 days of ambient condition storage, the sprouting percentages for TNG57, TNG66, and TNG73 were 100, 85, and 95 % respectively. When sweet potatoes were stored at 15 °C, the weight loss became less and no sweet potato root sprouted after 14 days of storage. Because manufacturers can store sweet potatoes at 15 °C for almost 2 month without other treatments, the supply capacity shortage in July and September can be reduced. The total sugar content slowly increased along with increasing the storage time. After baking, the total sugar content of sweet potatoes significantly increased due to the formation of maltose. Maltose became the major sugar of baked sweet potatoes. Raw sweet potatoes stored at 15 °C had higher total sugar contents after baking than those stored under ambient conditions. Raw sweet potatoes were recommended to be stored at 15 °C before baking.

  3. Interferência de Raphanus sativus na produtividade de cultivares de soja Interference of Raphanus sativus in soybean cultivars' yield

    Directory of Open Access Journals (Sweden)

    M.A Bianchi

    2011-12-01

    Full Text Available A forte dependência de herbicidas para o controle de plantas daninhas em soja tem como consequência a seleção de espécies daninhas tolerantes e resistentes. O manejo integrado considera, além do uso de herbicidas, técnicas como a habilidade competitiva do cultivar para controlar plantas daninhas. Com os objetivos de avaliar a resposta de cultivares à competição com nabo (Raphanus sativus e identificar aqueles portadores de habilidade competitiva superior, foi conduzido experimento em campo, em Cruz Alta-RS, na safra 2000/01. Testaram-se duas condições de competição (ausência ou presença de nabo forrageiro durante a fase de desenvolvimento vegetativo da soja, combinadas com 11 cultivares da cultura. O efeito da competição com nabo é variável entre os cultivares, caracterizando variabilidade genética que permite selecionar genótipos portadores de habilidade competitiva superior. A competição com nabo reduz a estatura de planta, o comprimento médio dos ramos e a produtividade de grãos de soja. Entre os genótipos de soja utilizados, o cultivar MSoy 6101 destaca-se quanto à habilidade competitiva pela maior produtividade potencial de grãos na ausência de competição e pela capacidade de mantê-la diante da competição com nabo.The strong dependence on herbicides for weed control in soybean has led to the selection of tolerant and/or resistant weed plants. Besides the use of herbicides, integrated management includes techniques such as cultivar competitive ability to control weed plants. This work aimed to evaluate cultivar response to competition with forage turnip (Raphanus sativus and to identify carriers of superior competitive ability. The experiment was carried out under field conditions in Cruz Alta-RS, during the 2000/01 season. Two competition conditions (absence and presence of forage turnip during the soybean vegetative growth stage were tested in combination with 11 soybean cultivars. The effect of forage

  4. Analysis of phosphorus use efficiency traits in Coffea genotypes reveals Coffea arabica and Coffea canephora have contrasting phosphorus uptake and utilization efficiencies

    Directory of Open Access Journals (Sweden)

    Ana Paula Neto

    2016-03-01

    Full Text Available Background and Aims: Phosphate (Pi is one of the most limiting nutrients for agricultural production in Brazilian soils due to low soil Pi concentrations and rapid fixation of fertilizer Pi by adsorption to oxidic minerals and/or precipitation by iron and aluminum ions. The objectives of this study were to quantify phosphorus (P uptake and use efficiency in cultivars of the species Coffea arabica L. and Coffea canephora L., and group them in terms of efficiency and response to Pi availability.Methods: Plants of twenty-one cultivars of C. arabica and four cultivars of C. canephora were grown under contrasting soil Pi availabilities. Biomass accumulation, tissue P concentration and accumulation and efficiency indices for P use were measured. Key Results: Coffee plant growth was significantly reduced under low Pi availability, and P concentration was higher in cultivars of C. canephora. The young leaves accumulated more P than any other tissue. The cultivars of C. canephora had a higher root/shoot ratio and were significantly more efficient in P uptake, while the cultivars of C. arabica were more efficient in P utilization. Agronomic P use efficiency varied among coffee cultivars and E16 Shoa, E22 Sidamo, Iêmen and Acaiá cultivars were classified as the most efficient and responsive to Pi supply. A positive correlation between P uptake efficiency and root to shoot ratio was observed across all cultivars at low Pi supply. These data identify Coffea genotypes better adapted to low soil Pi availabilities, and the traits that contribute to improved P uptake and use efficiency. These data could be used to select current genotypes with improved P uptake or utilization efficiencies for use on soils with low Pi availability and also provide potential breeding material and targets for breeding new cultivars better adapted to the low Pi status of Brazilian soils. This could ultimately reduce the use of Pi fertilizers in tropical soils, and contribute to

  5. Relationships between phenotypic variation in osmotic adjustment, water-use efficiency, and drought tolerance of seven cultivars of Lotus corniculatus L.

    Directory of Open Access Journals (Sweden)

    Luis Inostroza

    2015-03-01

    Full Text Available Lotus corniculatus L. is a perennial forage legume species highly-adapted to growth under drought conditions. However, the genetic and physiological mechanisms involved in its adaptive capacity have not been elucidated. The role of osmotic adjustment (OA and water-use efficiency (WUE on the drought tolerance of L. corniculatus was studied in a greenhouse experiment. Seven cultivars of different origin were subjected to two contrasting treatments of available soil water: No water stress (NWS and with water stress (WWS. Xylem water potential (Ψx, osmotic potential (Ψπ, pressure potential (Ψp, relative water content (RWC, stomatal conductance (g s, shoot DM production, water transpiration (T, and WUE (shoot DM/T were measured. Water treatments significantly (P < 0.05 affected plant water status, which was reflected in reduced Ψx, RWC, g s, and transpiration rate in the WWS treatment compared with the NWS treatment. All cultivars showed a high capacity for OA under WWS treatment because Ψπ decreased by approximately 60% and Ψp increased by approximately 30%, compared with the NWS treatment. Cultivars with a higher solute accumulation (low Ψπ value had the lowest DM production under WWS treatment. In contrast, WUE varied greatly among cultivars and was positively associated (R² = 0.88; P < 0.01 with DM production under drought conditions.

  6. Consistência do padrão de agrupamento de cultivares de milho Clustering pattern consistency of corn cultivars

    Directory of Open Access Journals (Sweden)

    Alberto Cargnelutti Filho

    2011-09-01

    Full Text Available O objetivo deste trabalho foi avaliar a consistência do padrão de agrupamento obtido a partir da combinação de duas medidas de dissimilaridade e quatro métodos de agrupamento, em cenários formados por combinações de número de cultivares e número de variáveis, com dados reais de cultivares de milho (Zea mays L. e com dados simulados. Foram usados os dados reais de cinco variáveis mensuradas em 69 experimentos de competição de cultivares de milho, cujo número de cultivares avaliadas oscilou entre 9 e 40. A fim de investigar os resultados com maior número de cultivares e de variáveis, foram simulados, sob distribuição normal padrão, 1.000 experimentos para cada um dos 54 cenários formados pela combinação entre o número de cultivares (20, 30, 40, 50, 60, 70, 80, 90 e 100 e o número de variáveis (5, 6, 7, 8, 9 e 10. Foram realizadas análises de correlação, de diagnóstico de multicolinearidade e de agrupamento. A consistência do padrão de agrupamento foi avaliada por meio do coeficiente de correlação cofenética. Há decréscimo da consistência do padrão de agrupamento com o acréscimo do número de cultivares e de variáveis. A distância euclidiana proporciona maior consistência no padrão de agrupamento em relação à distância de Manhattan. A consistência do padrão de agrupamento entre os métodos aumenta na seguinte ordem: Ward, ligação completa, ligação simples e ligação média entre grupo.The objective of this research was to evaluate the clustering pattern consistency obtained from the combination of the two dissimilarity measures and four clustering methods, in scenarios consist of combinations number of cultivars and number of variables, with real data in corn cultivars (Zea mays L. and simulated data. We used real data from five variables measured in 69 trials involving corn cultivars, the number of cultivars ranged between 9 and 40. In order to investigate the results with more cultivars and

  7. Anisotropic Contrast Optical Microscope

    CERN Document Server

    Peev, D; Kananizadeh, N; Wimer, S; Rodenhausen, K B; Herzinger, C M; Kasputis, T; Pfaunmiller, E; Nguyen, A; Korlacki, R; Pannier, A; Li, Y; Schubert, E; Hage, D; Schubert, M

    2016-01-01

    An optical microscope is described that reveals contrast in the Mueller matrix images of a thin, transparent or semi-transparent specimen located within an anisotropic object plane (anisotropic filter). The specimen changes the anisotropy of the filter and thereby produces contrast within the Mueller matrix images. Here we use an anisotropic filter composed of a semi-transparent, nanostructured thin film with sub-wavelength thickness placed within the object plane. The sample is illuminated as in common optical microscopy but the light is modulated in its polarization using combinations of linear polarizers and phase plate (compensator) to control and analyze the state of polarization. Direct generalized ellipsometry data analysis approaches permit extraction of fundamental Mueller matrix object plane images dispensing with the need of Fourier expansion methods. Generalized ellipsometry model approaches are used for quantitative image analyses. We demonstrate the anisotropic contrast optical microscope by mea...

  8. Growth stage-based modulation in physiological and biochemical attributes of two genetically diverse wheat (Triticum aestivum L.) cultivars grown in salinized hydroponic culture.

    Science.gov (United States)

    Ashraf, Muhammad Arslan; Ashraf, Muhammad

    2016-04-01

    Hydroponic experiment was conducted to appraise variation in the salt tolerance potential of two wheat cultivars (salt tolerant, S-24, and moderately salt sensitive, MH-97) at different growth stages. These two wheat cultivars are not genetically related as evident from randomized polymorphic DNA analysis (random amplified polymorphic DNA (RAPD)) which revealed 28% genetic diversity. Salinity stress caused a marked reduction in grain yield of both wheat cultivars. However, cv. S-24 was superior to cv. MH-97 in maintaining grain yield under saline stress. Furthermore, salinity caused a significant variation in different physiological attributes measured at different growth stages. Salt stress caused considerable reduction in different water relation attributes of wheat plants. A significant reduction in leaf water, osmotic, and turgor potentials was recorded in both wheat cultivars at different growth stages. Maximal reduction in leaf water potential was recorded at the reproductive stage in both wheat cultivars. In contrast, maximal turgor potential was observed at the boot stage. Salt-induced adverse effects of salinity on different water relation attributes were more prominent in cv. MH-97 as compared to those in cv. S-24. Salt stress caused a substantial decrease in glycine betaine and alpha tocopherols. These biochemical attributes exhibited significant salt-induced variation at different growth stages in both wheat cultivars. For example, maximal accumulation of glycine betaine was evident at the early growth stages (vegetative and boot). However, cv. S-24 showed higher accumulation of this organic osmolyte, and this could be the reason for maintenance of higher turgor than that of cv. MH-97 under stress conditions. Salt stress significantly increased the endogenous levels of toxic ions (Na(+) and Cl(-)) and decreased essential cations (K(+) and Ca(2+)) in both wheat cultivars at different growth stages. Furthermore, K(+)/Na(+) and Ca(2+)/Na(+) ratios

  9. Hyperoside and anthocyanin content of ten different pomegranate cultivars.

    Science.gov (United States)

    Khanavi, M; Moghaddam, G; Oveisi, M R; Sadeghi, N; Jannat, B; Rostami, M; Saadat, M A; Hajimahmoodi, M

    2013-07-01

    Pomegranate (Punica granatum L.) is native to the Mediterranean region and has been used extensively as a medicine in many counties. Hyperoside is known as an important flavonoid with antioxidant activity and anti hypertension effect. Anthocyanins are the active component in several herbal medicines, thus accurate measurement of hyperoside and anthocyanins, along with their degradation indices, is very useful to food technologists and horticulturists. The aim of the current study was to determine the antioxidant capacity as hyperoside and anthocyanin content of ten different Iranian pomegranate cultivars. Spectroscopic analyses of the pomegranate showed Black peel cultivar had the highest hyperoside content (25.93 +/- 2.87, 620.41 +/- 30.32 mg/100 g) in its pulp and peel, respectively. Based on this study, the amounts of anthocyanin in pulp ranged between 1.56 +/- 0.05 and 3.89 +/- 0.07 mg g(-1) which related to Sweet white peel and Sweet alac cultivars, respectively. More over the highest and also the lowest peel anthocyanin contents related to these cultivars. The results revealed that the hyperoside and also anthocyanin peel content of each variety is higher than its pulp content. In addition the potency of black peel (Medicinal pomegranate) and Sweet alac cultivars for prevention of coronary heart disease and hypertension were presented.

  10. Analysis of pecan cultivars Mahan and Western in East China.

    Science.gov (United States)

    Luo, X; Li, Z; Sun, Z; Wan, X

    2016-09-16

    Pecan (Carya illinoensis) has been introduced to East China for over one hundred years, but its planting is still only occurring at a small scale. The key limiting factor is its low yield. To enhance the yield pecan in East China, two pecan cultivars, Mahan and Western, were examined. Twenty traits describing phasic development, yield, nut quality, and cultural practice were investigated. We found that pecan cultivar Mahan gives a higher yield and nut quality than cultivar Western. We recommend interplanting of cultivar Pawnee to act as a pollinator tree. Appropriate cultivation practices that can be implemented to enhance fruit yield of cultivars Mahan and Western include soil-applied paclobutrazol (PBZ) at certain concentrations, pinching, and supplementary pollination. For example, the addition of 1.25 g/m(2) of PBZ inhibits pecan branch growth and stimulates short bearing branches, which promotes fruit yield. We found that soil-applied PBZ reached optimal performance 82 days after application. A pinching length of 40 cm resulted in a fruit yield increase. In addition, grafting and transplantation may promote male flowering, but delays female flowering. These cultural practices may provide insights that can be used to improve pecan cultivation in East China.

  11. Chemical characteristics and volatile profile of genetically modified peanut cultivars.

    Science.gov (United States)

    Ng, Ee Chin; Dunford, Nurhan T; Chenault, Kelly

    2008-10-01

    Genetic engineering has been used to modify peanut cultivars for improving agronomic performance and pest resistance. Food products developed through genetic engineering have to be assessed for their safety before approval for human consumption. Preservation of desirable chemical, flavor and aroma attributes of the peanut cultivars during the genetic modifications is critical for acceptance of genetically modified peanuts (GMP) by the food industry. Hence, the main objective of this study is to examine chemical characteristics and volatile profile of GMP. The genetically modified peanut cultivars, 188, 540 and 654 were obtained from the USDA-ARS in Stillwater, Oklahoma. The peanut variety Okrun was examined as a control. The volatile analysis was performed using a gas chromatograph/mass spectrometer (GC/MS) equipped with an olfactory detector. The peanut samples were also analyzed for their moisture, ash, protein, sugar and oil compositions. Experimental results showed that the variations in nutritional composition of peanut lines examined in this study were within the values reported for existing cultivars. There were minor differences in volatile profile among the samples. The implication of this study is significant, since it shows that peanut cultivars with greater pest and fungal resistance were successfully developed without major changes in their chemical characteristics.

  12. Chemical Composition and Antioxidant Capacity of Three Plum Cultivars

    Directory of Open Access Journals (Sweden)

    Sandra Voća

    2009-12-01

    Full Text Available The aim of this study was to determine the chemical composition and antioxidants capacity of three plum cultivars, namely ‘Top’, ‘Elena’ and ‘Bistrica’. Fruits were harvested and following parameters were determined: dry matter, total acids (TA, total soluble solids (TSS, pH, vitamin C, total phenols, nonflavonoids and antioxidant capacity. Differences between cultivars for most of the chemical parameters were observed. The cultivar ‘Bistrica’ showed higher values of dry matter, TSS, vitamin C and pH value, while ‘Top’ had higher total acids value and lowest TSS, dry matter, vitamin C and pH. Total phenolics content varied from 157.70 mg in ‘Elena’ to 344.10 mg in ‘Bistrica’, expressed as gallic acid equivalents (GAE, on fresh weight basis. ‘Top’ contains the highest amount of non-flavonoids among cultivars studied. Therefore, ‘Bistrica’ and ‘Top’ show the highest antioxidant capacity, as well. There were significant differences between total phenolics and non-flavonoids content between ‘Elena’ and other two cultivars, while antioxidant capacity showed no significant difference (p ≤ 0.05. Total antioxidant capacity of fruits ranged from 3.10 mmol/kg in ‘Elena’ to 3.17 mmol/kg in ‘Top’ and ‘Bistrica’.

  13. Evaluation of Drought Tolerance in Some of Winter Canola Cultivars

    Directory of Open Access Journals (Sweden)

    J Rashidifar

    2012-10-01

    Full Text Available In order to evaluate terminal drought tolerance in different Canola cultivars based on drought tolerance indices, an experiment was conducted based on randomized complete block design (RCBD with three replications at experimental field of Seed and Plant Improvement Institute (SPII, Karaj in 2008-09. Results using stress tolerance index (STI, geometric mean productivity (GMP and mean productivity (MP indices revealed Zarfam, Talaye and GKH305, were as cultivars with highest yield in both optimum irrigation and terminal drought conditions. High and positive correlation between STI, GMP and MP indices with yield in optimum and drought conditions indicated that they were as the best indices for introduction and characterization of drought tolerant canola cultivars. Biplot graph showed that MP, GMP and STI indices had high correlation coefficient with each other, and tolerant genotypes were located near tolerance indices. Also results of three dimensional scatter plot indicated that cultivars Zarfam, GKH 305 and Tassilo were recognized as tolerant genotypes to drought stress, and cultivars ES Astrid, GK Helena, Modena and Okapi were identified as sensitive genotypes.

  14. Response mechanisms of Brachiaria brizantha cultivars to water deficit stress

    Directory of Open Access Journals (Sweden)

    Patricia Menezes Santos

    2013-11-01

    Full Text Available Two cultivars of Brachiaria brizantha (Hochst ex. A. Rich Stapf. (Syn. Urochloa were evaluated for their adaptation to water deficit and the stress response mechanisms in a greenhouse experiment. The experimental design was in completely randomized blocks with a 2 × 2 × 4 factorial arrangement. The Marandu and BRS Piatã cultivars were evaluated under two water availability conditions, with or without water restriction. The harvests were carried out 0, 7, 14 and 28 days after the start of water restriction. For both cultivars, the water deficit stress caused a reduction in shoot biomass and leaf area and an increase in the percentage of roots in the deeper soil layers. The B. brizantha cv. Marandu reached critical levels of leaf water potential in a shorter period of water restriction than did the B. brizantha cv. BRS Piatã. The osmoregulation and deepening of the root system are mechanisms of adaptation to water stress observed in both Marandu and BRS Piatã cultivars. Besides that, the Marandu cultivar also increases its leaf senescence and, consequentially, decreases its leaf area, as a response to water deficit.

  15. Morphological variation of 20 local rice cultivars of East Kalimantan

    Directory of Open Access Journals (Sweden)

    FITRI HANDAYANI

    2017-03-01

    Full Text Available Abstract. Handayani F, Sumarmiyati, Ahmadi NR. 2016. Morphological variation of 20 local rice cultivars of East Kalimantan. Pros Sem Nas Masy Biodiv Indon 3: 88-93. High diversity of local rice is very important in rice breeding program as a gene pool for valuable traits such as resistance to specific disease and tolerance against environmental stresses (Al, Fe, acidity, etc. East Kalimantan is a province which has so many local rice cultivars either lowland, upland or tidal swamp rice. Unfortunately, there is still limited scientific information about local rice genetic diversity in East Kalimantan, whereas it is an important basic information for rice breeding program. The aim of this research was to study the morphological variation of 20 local rice cultivars from some regions in East Kalimantan. The research was conducted at Lempake trial field, Samarinda in April-September 2016. The result showed that the cultivars had variability in morphological characters. Plant profile was medium to high while some tillers were little and very little. The color of lemma and palea was yellowish straw in 17 cultivars while the rest had brown lines in yellowish straw background. Seed length ranged between 7.3-9.6 mm, while seed width ranged between 1.9-3.3 mm, and seed thickness ranged between 1.5-2.1 mm. The shape of the rice grain varied between medium grain (length: width = 2.1-3.0 or long grain (length: width > 3.0.

  16. Compressive Phase Contrast Tomography

    CERN Document Server

    Maia, F R N C; Marchesini, S; Padmore, H A; Parkinson, D Y; Pien, J; Schirotzek, A; Yang, C; 10.1117/12.861946

    2010-01-01

    When x-rays penetrate soft matter, their phase changes more rapidly than their amplitude. In- terference effects visible with high brightness sources creates higher contrast, edge enhanced images. When the object is piecewise smooth (made of big blocks of a few components), such higher con- trast datasets have a sparse solution. We apply basis pursuit solvers to improve SNR, remove ring artifacts, reduce the number of views and radiation dose from phase contrast datasets collected at the Hard X-Ray Micro Tomography Beamline at the Advanced Light Source. We report a GPU code for the most computationally intensive task, the gridding and inverse gridding algorithm (non uniform sampled Fourier transform).

  17. Bioecological aspects of Hypocala andremona (Cramer (Lepidoptera: Noctuidae on persimmon cultivars = Aspectos bioecológicos de Hypocala andremona (Cramer (Lepidoptera: Noctuidae em cultivares de caquizeiro

    Directory of Open Access Journals (Sweden)

    Celso Luiz Hohmann

    2011-01-01

    Full Text Available The biology of Hypocala andremona (Cramer on persimmon (Diospyrus kaki L. leaves of the cultivars Atago and Giombo was studied in laboratory (27 ± 1ºC, 65 ± 10% RH, 14 hours photo period and egg distribution on plants of the cultivar Giombo in a commercial orchard, during the 2001/2002 crop season, in Londrina, Paraná state. The developmental period of larvae fed on ‘Giombo’ was longer (17.8 . 0.17 days in comparison to that of larvae fed on ‘Atago’ (15.8 . 0.27 days. In contrast, the duration of the pupal stage of insects raised on ‘Giombo’ was lower (12.0 . 0.29 days than that of insects reared on ‘Atago’ (13.3 . 0.17 days. The viabilities of larvae were 60.8 and 38.8% for insects reared on ‘Giombo’ and on ‘Atago’, respectively. Pupal viability was similar (ca. 93% between treatments. The duration of the preoviposition and incubation periods of larvae fed on ‘Atago’ were 4.0 days and 2.1 days, respectively, the fecundity 524.7 eggs, egg viability 77% and adult longevity 12.9 days. No eggs were obtained when H. andremona larvae were reared on ‘Giombo’ in laboratory. Adults preferred to lay their eggs on leaveslocated at the top of the persimmon tree canopy.A biologia de Hypocala andremona (Cramer (Lepidoptera: Noctuidae foi estudada em folhas das cultivares de caquizeiro (Diospyrus kakiL. Atago e Giombo em laboratório (27 ± 1ºC, 65 ± 10% UR, 14h fotofase e a distribuição de ovos em plantas da cultivar Giombo em pomar comercial, durante o período de 2001/2002, em Londrina, Estado do Paraná. O período de desenvolvimento das lagartas alimentadas com ‘Giombo’ foi maior (17,8 . 0,17 dias em relação às alimentadas com‘Atago’ (15,8 . 0,27 dias. Entretanto, a duração do estágio de pupa de insetos criados em ‘Giombo’ foi menor (12,0 . 0,29 dias do que as criadas em ‘Atago’ (13,3 . 0,17 dias. As viabilidades das lagartas foram 60,8 e 38,8% para insetos alimentados em ‘Giombo’ e

  18. Seasonal variation in abiotic factors and ferulic acid toxicity in snail-attractant pellets against the intermediate host snail Lymnaea acuminata.

    Science.gov (United States)

    Agrahari, P; Singh, D K

    2013-11-01

    Laboratory evaluation was made to access the seasonal variations in abiotic environmental factors temperature, pH, dissolved oxygen, carbon dioxide, electrical conductivity and ferulic acid toxicity in snail-attractant pellets (SAP) against the intermediate host snail Lymnaea acuminata in each month of the years 2010 and 2011. On the basis of a 24-h toxicity assay, it was noted that lethal concentration values of 4.03, 3.73% and 4.45% in SAP containing starch and 4.16, 4.23% and 4.29% in SAP containing proline during the months of May, June and September, respectively, were most effective in killing the snails, while SAP containing starch/proline + ferulic acid was least effective in the month of January/February (24-h lethal concentration value was 7.67%/7.63% in SAP). There was a significant positive correlation between lethal concentration value of ferulic acid containing SAP and levels of dissolved O2 /pH of water in corresponding months. On the contrary, a negative correlation was observed between lethal concentration value and dissolved CO2 /temperature of test water in the same months. To ascertain that such a relationship between toxicity and abiotic factors is not co-incidental, the nervous tissue of treated (40% and 80% of 24-h lethal concentration value) and control group of snails was assayed for the activity of acetylcholinesterase (AChE) in each of the 12 months of the same year. There was a maximum inhibition of 58.43% of AChE, in snails exposed to 80% of the 24-h lethal concentration value of ferulic acid + starch in the month of May. This work shows conclusively that the best time to control snail population with SAP containing ferulic acid is during the months of May, June and September.

  19. Effects of gamma irradiation followed by climatization on the quality of 'Prata' banana (Musa acuminata x Musa balbisiana, AAB)

    Energy Technology Data Exchange (ETDEWEB)

    Martineli, Maristella; Coneglian, Regina C.C.; Vasconcellos, Marco A.S.; Silva, Eduardo; Rocha, Janielio G.; Melo, Maruzanete P. [Universidade Federal Rural do Rio de Janeiro (UFRRJ), Seropedica, RJ. Inst. de Agronomia (Brazil)], e-mail: maristellamartineli@yahoo.com.br; Vital, Helio C. [Centro Tecnologico do Exercito (CTEx), Rio de Janeiro, RJ (Brazil). Secao de Defesa Nuclear], e-mail: vital@ctex.eb.br

    2009-07-01

    Banana is a highly perishable climacteric fruit. In order to ensure fast and homogeneous ripening that will make its processing and commercialization easier, it is usually treated by climatization. On the other hand, irradiation is an interesting physical process capable of delaying ripening and extending the shelf life of fruits. This work investigated the competing effects of irradiation followed by climatization on the quality of 'Prata' banana (Musa acuminata x Musa balbisiana, AAB). All fruits were harvested in the preclimacteric stage, rinsed and stored at 27 deg C after being submitted to five different treatments. After hygienization, four out of five samples were exposed to gamma-ray at doses of 0.25 and 0.50 kGy. The unirradiated fruits were left for control and half of the irradiated samples were then climatized by exposure to CaC{sub 2}. Measurements of fresh mass loss, total soluble solids, peel coloration and disease index were performed on five different dates for up to nine days in order to monitor quality and the degree of ripening. It was found that high temperatures prevailing during climatization and storage accelerated maturation in all fruits in spite of the use of irradiation, with the control becoming ripe in 3 days only. In addition, based on the consistent results from the experiments performed, it can be concluded that irradiation at the doses tested was unable to overcome the maturation effects produced by climatization. However, the sole use of irradiation with 0.25 kGy yielded the lowest figures for fresh mass loss and disease index in the samples, thus becoming the most attractive among the treatments tested. (author)

  20. Efecto del medio de soporte en la estabilidad biológica de dos cepas de Frankia aisladas de Alnus acuminata H. B. K.

    Directory of Open Access Journals (Sweden)

    Ana María Rey

    Full Text Available Alnus acuminata H. B. K. es una especie arbórea que puede ser incorporada en sistemas silvopastoriles, ya que tiene la capacidad de crecer en suelos marginados y contribuir a la conservación de la biodiversidad y al mejoramiento del suelo; lo cual se relaciona con la incorporación de hojarasca, el efecto de sombra, la retención de humedad, el reciclaje de nutrientes y la fijación de nitrógeno atmosférico, debido a su asociación simbiótica con el actinomiceto Frankia. La utilización de este como inoculante es una tecnología que requiere un profundo análisis de su comportamiento en condiciones controladas. Por otra parte, para la comercialización de los biofertilizantes es importante conservar su calidad el mayor tiempo posible, de lo cual depende la aceptación del producto en la cadena productiva. Por ello, se realizó una investigación con el objetivo de evaluar la estabilidad biológica de las cepas nativas de Frankia (Aan17 y Aac49 con diferentes proporciones sustrato:cepa, así como el efecto del alamacenamiento a 4 °C. Las cepas fueron tolerantes a los cambios del pH y al almacenamiento en condiciones de refrigeración. Se concluye que los inoculantes se deben almacenar a 4 °C durante 120 días, con una proporción de 80:20 (inoculante:sustrato en Aan17 y 60:40 en Aac49. En estos sustratos la proteína microbial se mantuvo por encima de 0,65 mg/mL en Aan17 y 0,7 mg/mL en Aac49.

  1. Volatile composition of four southern highbush blueberry cultivars and effect of growing location and harvest date.

    Science.gov (United States)

    Du, Xiaofen; Plotto, Anne; Song, Mei; Olmstead, James; Rouseff, Russell

    2011-08-10

    The volatile composition of four southern highbush blueberry cultivars ('Primadonna', 'Jewel', 'Snowchaser', and 'FL02-40') grown in two locations (Gainesville and Haines City, FL) and harvested multiple times was investigated. A total of 42 volatiles were identified, including 8 esters, 12 terpenoids, 11 aldehydes, 7 alcohols, and 4 ketones. Twelve of these volatiles are reported for the first time in highbush blueberries, with 10 being positively identified: (Z)-3-hexenal, (E,E)-2,4-hexadienal, (E,Z)-2,6-nonadienal, (E,E)-2,4-nonedienal, methyl 2-methylbutanoate, butyl acetate, 2-methylbutyl acetate, and geranyl acetate. The dominant volatiles were aldehydes followed by terpenoids and esters, with distinct varietal profiles. 'Primadonna' was characterized by a large amount of esters and C-6 aldehydes. In contrast, fewer than 4 esters were found in 'FL02-40' and 'Snowchaser', respectively, but they produced more terpenoids than 'Primadonna' and 'Jewel'. Location and/or harvest date affected the production of volatiles in 'Primadonna', but not so much in the other cultivars.

  2. Desempenho agronômico de quatro cultivares de almeirão Agronomic performance of four chicory cultivars

    Directory of Open Access Journals (Sweden)

    Franciele dos Santos

    2013-03-01

    Full Text Available Na literatura são escassas as informações sobre as principais cultivares de almeirão (Cichorium intybus cultivadas no Brasil. O objetivo do presente trabalho foi avaliar o desempenho agronômico de cultivares de almeirão na região de Campinas-SP. As cultivares avaliadas foram Catalonha, Folha Amarela, Folha Larga e Pão-de-Açúcar, em experimento realizado em canteiros no Centro Experimental Central do Instituto Agronômico, de dezembro de 2009 a janeiro de 2010 com mudas transplantadas. O delineamento experimental no campo foi inteiramente casualizado, com quatro repetições. Aos 50 dias após o transplante foram avaliadas cinco plantas de cada parcela quanto à altura, número de folhas, massa fresca e seca, e em duas dessas plantas avaliou-se a área foliar. Foi avaliado, também, o sabor, com e sem tempero, por seis provadores. As cultivares apresentaram diferenças significativas em relação à altura das plantas, área foliar e sabor. 'Pão-de-Açúcar' apresentou em magnitude maior rendimento agronômico (516,0 g planta-1, seguida pela 'Folha Amarela' (432,7 g planta-1. Esta constitui-se em uma alternativa para o mercado, uma vez que apresenta desempenho semelhante ao das principais cultivares de almeirão comercializadas no Estado de São Paulo.In the literature there is little information about the main chicory cultivars (Cichorium intybus grown in Brazil. The present paper aims to evaluate the agronomic performance of the chicory cultivars in the region of Campinas, São Paulo state, Brazil. Catalonha, Folha Amarela, Folha Larga and Pão-de-Açúcar cultivars were evaluated, in an experiment carried out in field conditions in the Experimental Center of the Instituto Agronômico, from December 2009 to January 2010. The experimental design was completely randomized, with 4 replications. At 50 days after transplanting five plants of each plot were evaluated for the height, leaf number, fresh and dry weight and two of these plants

  3. Annual variation in sensory characteristics of seventeen apple cultivars

    Directory of Open Access Journals (Sweden)

    Laila Seppä

    2016-11-01

    Full Text Available Sensory characteristics of 17 apple cultivars commonly grown in Finland were compared over three harvest years (2009–2011. Descriptive analysis with a trained panel (n = 11–14 comprised 17 attributes rated from 0 (‘not at all’ to 10 (‘very’: four appearance (green, red, area of red colour, skin waxiness, three odour (intense, grassy, fruity, five  texture (hard, crispy, mealy, juicy, tough peel, and five flavour (intense, sour, sweet, astringent, diverse attributes. Ratedintensities differed between the harvest years but their magnitude and direction of change varied according to the cultivar. Odour and flavour ratings tended to be higher in 2009 than in 2010 and 2011. The summer 2009 was fairly normal, while summer 2010 was hot and dry, and summer 2011  hot and humid. These climate may explain some of the differences between the first and the two subsequent years. Late season cultivars tended to be relatively stable against annual effects.

  4. Volatile components from mango (Mangifera indica L.) cultivars.

    Science.gov (United States)

    Pino, Jorge A; Mesa, Judith; Muñoz, Yamilie; Martí, M Pilar; Marbot, Rolando

    2005-03-23

    The volatile components of 20 mango cultivars were investigated by means of simultaneous distillation-extraction, GC, and GC-MS. Three hundred and seventy-two compounds were identified, of which 180 were found for the first time in mango fruit. The total concentration of volatiles was approximately 18-123 mg/kg of fresh fruit. Terpene hydrocarbons were the major volatiles of all cultivars, the dominant terpenes being delta-3-carene (cvs. Haden, Manga amarilla, Macho, Manga blanca, San Diego, Manzano, Smith, Florida, Keitt, and Kent), limonene (cvs. Delicioso, Super Haden, Ordonez, Filipino, and La Paz), both terpenes (cv. Delicia), terpinolene (cvs. Obispo, Corazon, and Huevo de toro), and alpha-phellandrene (cv. Minin). Other qualitative and quantitative differences among the cultivars could be demonstrated.

  5. Apple tree production in Italy: rootstocks, cultivars, fertilization, and irrigation

    Directory of Open Access Journals (Sweden)

    Giovambattista Sorrenti

    2012-11-01

    Full Text Available Italy is one of the main apple producers in Europe, primarily intended for fresh consumption, both in the domestic and foreign markets. Fruit yield and quality depends on the cultivar, rootstock, and management practices, such as the fertilization and irrigation adopted in the orchard. This review aims at reporting the main apple cultivars and rootstocks, the management of fertilization and irrigation, as well as their adaptation to apple tree orchards in Italy. The programs for genetic improvement carried out in this country involved the selection of apple tree cultivars and rootstocks which enable a high fruit yield and quality, in order to meet the requirements from the consumer market. In the fertilization and irrigation management, nutrients and water are supplied in amounts next to the actual need of the plants, providing an adequate nutrition, a satisfactory yield, and high quality fruits, besides preventing, whenever possible, nutrients and water losses in the environment.

  6. Comportamento de cultivares de cafeeiros C. Arabica L. enxertados sobre cultivar 'Apoatã IAC 2258' (Coffea canephora Performance of C. Arabica L. Coffee cultivars grafted on 'Apoatã IAC 2258' cultivar (Coffea canephora

    Directory of Open Access Journals (Sweden)

    Renato Fonseca de Paiva

    2012-07-01

    Full Text Available Objetivou-se no trabalho avaliar a influência da enxertia e do porta-enxerto 'Apoatã IAC 2258' no comportamento agronômico de sete cultivares de cafeeiro da espécie Coffea arabica cultivadas em solo isento de fitonematoides. O ensaio foi conduzido em delineamento experimental de blocos casualizados em esquema fatorial (7 x 3 com quatro repetições, sendo sete cultivares de Coffea arabica ('Obatã IAC 1669-20', 'Acauã', 'Oeiras MG 6851', 'Catucaí Amarelo 2SL', 'Topázio MG 1190', 'IBC Palma II' e 'Paraíso MG H 419-1' e três tipos de enxertia (muda enxertada, auto enxertada e pé franco. Foi avaliada a produtividade média de quatro anos, uniformidade de maturação, percentagem de frutos chochos e classificação do grão por tipo de peneira. As cultivares enxertadas estudadas apresentaram comportamento agronômico satisfatório em todas as características avaliadas e semelhante ao pé-franco. Em áreas isentas de fitonematoides, à exceção das cultivares 'IBC Palma II' e 'Paraíso MG H 419-1', as demais cultivares estudadas são adequadas opções de escolha para uso como copas. A técnica da enxertia com o uso do porta-enxerto 'Apoatã IAC 2258' em área isenta de fitonematoides não se justifica para incremento de produtividade.This research had the objective to evaluate the effect of grafting and 'Apoatã IAC 2258' cv. as rootstock on agronomic performance of seven Coffea arabica cvs. planted in area nematodes free. The experimental design was randomized blocks using a 7x3 factorial scheme with four repetitions. The treatments were 'Obatã IAC 1669-20', 'Acauã', 'Oeiras MG 6851', 'Catucaí Amarelo 2SL', 'Topázio MG 1190', 'IBC Palma II' and 'Paraíso MG H 419-1' coffee cultivars grafted on 'Apoatã IAC 2258', self grafted (meaning a cultivar was grafted on a rootstock of the same cultivar and no grafting. The characteristic evaluated was the average yield of beans between the first and the fourth year, the fruit maturation stage

  7. Six cultivars of Solanum macrocarpon (Solanaceae in Ghana

    Directory of Open Access Journals (Sweden)

    Z. R. Bukenya

    1987-12-01

    Full Text Available The  Solanum macrocarpon complex (the cultivated egg plant has been studied in Ghana using morphological and experimental methods. Six cultivars belonging to the S.  macrocarpon complex have been recognized and described. The cultivars are  S. macrocarpon ‘Gboma’,  S. macrocarpon ‘Mankessim’,  S. macrocarpon ‘Akwaseho’,  S. macrocarpon ‘Kade’,  S. macrocarpon ‘Sarpeiman’ and  S. macrocarpon ‘Bui’. The very spiny, hairy plant traditionally called S. dasyphyllum is regarded as the wild ancestor from which the cultivars have been derived through a process of crop evolution. The variation within S. macrocarpon complex is attributable to genotypic differences and environmental factors.

  8. Evaluation of fruit leather made from two cultivars of papaya

    Directory of Open Access Journals (Sweden)

    ZUHAIR RADHI ADDAI

    2016-03-01

    Full Text Available Two papaya cultivars were used to manufacture fruit leather. The objective of this study was to formulate papaya leather from locally grown papaya using natural ingredients like pectin, honey and citric acid. The fresh fruits were pureed and mix with natural ingredients, and dried in an oven at 60°C for 12 hours. The physicochemical properties and antioxidant activity were determined.The results showed that fruit leather made from Hongkong cultivar is significantly (P<0.05 higher in sensory parameters as well as physicochemical properties and antioxidant activity. The phenolics content and antioxidant activity increased by process of drying the fruit leather compared to fresh fruits in both papaya cultivars. Therefore, the consumer requirements for healthy and safe food products were respected.

  9. Identification of zygotic and nucellar seedlings in polyembryonic mango cultivars

    Directory of Open Access Journals (Sweden)

    Elisa del Carmen Martínez Ochoa

    2012-11-01

    Full Text Available The objective of this work was to evaluate the occurrence of polyembryony in the mango cultivars Manila and Ataulfo, and to determine whether seedlings cultured in vitro are zygotic or nucelar. Percentage of polyembryony was calculated and the number of embryos in 100 seeds of each cultivar was recorded. 'Manila' exhibited 97% polyembryony with 3.4 embryos per seed, while 'Ataulfo' had 95% polyembryony with 3.2 embryos per seed. Later, 20 seeds of each cultivar were established in vitro, and it was analyzed those in which all embryos germinated (12 seeds from 'Manila' and 7 from 'Ataulfo'. DNA was extracted from seedling leaf tissue, and its origin was identified with 14 RAPD primers. The polymorphic markers recognized the seedlings of sexual origin in seven of nine 'Manila' polyembryonic seeds, and in four of seven 'Ataulfo' ones. Also, in polyembryonic seeds not all zygotic seedlings were produced by small embryos located at the micropyle.

  10. Processing potential of jellies from subtropical loquat cultivars

    Directory of Open Access Journals (Sweden)

    Paula Nogueira CURI

    2016-01-01

    Full Text Available Abstract To increase the availability to consumers and add more value to loquat (Eriobotrya japonica Lindl., which is a very perishable and seasonal fruit, and in order to identify which cultivars grown in subtropical regions are more suitable for jelly processing, the objective of this study was to evaluate the influence of different loquat cultivars (Fukuhara, Kurisaki, Mizumo, Mizuho and Mizauto grown in subtropical regions of Brazil on the physicochemical characteristics, rheological properties and sensory acceptance of the resulting jelly. Based on sensory acceptance the most suitable loquat cultivars for jelly processing are Kurisaki and Mizuho. In this study it was found that the consumer prefers a more acidic, less sweet, less firm or softer loquat jelly, clearer with a more intense red color.

  11. Drought responses in six hazelnut (Corylus avellana L. cultivars

    Directory of Open Access Journals (Sweden)

    Ali Shahi-Gharahlar

    2016-11-01

    Full Text Available Drought is one of the major causes of reduction of crop yields worldwide, a problem that will increase in the next decades due to climate change. We describe here an initial attempt to define biochemical markers associated to water stress in several hazelnut cultivars, by measuring the levels of common osmolytes and the generation of secondary oxidative stress, in plants subjected to water stress, and after recovery from the stress treatment. Proline appears to be a reliable marker in this species, as its accumulation in leaves correlates well with the degree of stress affecting the plants. Differences between cultivars in relative Pro accumulation and oxidative stress suggested that some cultivars are more tolerant than others and could be selected for cultivation in drought-affected areas

  12. Identificação de cultivares de trigo pelo teste de fenol Cultivars identification of wheat by phenol test

    Directory of Open Access Journals (Sweden)

    Nilson Lemos de Menezes

    1995-01-01

    Full Text Available O teste de fenol é recomendado para a identificação de cultivares de trigo em laboratório e se baseia na reação de compostos presentes no pericarpo das sementes. Devido à reação constante para cada cultivar, o teste serve para caracterização rápida e fácil de materiais com reações diferentes. No presente trabalho, com o objetivo de facilitar a identificação varietal em trigo, determinou-se a reação ao fenol de 42 cultivares, que estiveram ou estão em recomendação no Brasil.The phenol test is recommended for wheat cultivar identification and is based on the reaction of compounds present in the seeds pericarp. Due to the constant reaction for each cultivar, the test may be used for a rapid and easy characterization of different reactions materiais. In this essay, the phenol reaction was determined in 42 brazilian wheat varieties aiming to facilitate its identification.

  13. Bagasse production potential from late sugar cane cultivars; Potencial produtivo de bagaco por cultivares tardios de cana-de-acucar

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Tulibio F. da; Silva Neto, Helio F. da; Tasso Junior, Luiz C.; Marques, Diogo; Marques, Marcos O. [Universidade Estadual Paulista (FCAV/UNESP), Jaboticabal, SP (Brazil). Fac. de Ciencias Agrarias e Veterinarias], E-mail: tulibio_fernandes@yahoo.com.br

    2010-07-01

    In order to diversify energy sources, the residue of sugarcane gathers attributes that qualify its use. Therefore, this study was to evaluate the potential of bagasse production in late cultivars of sugarcane. The experimental design was a randomized block design with 6 treatments (cultivars) and 3 replications. The experiment was carried out at FCAV/UNESP Jaboticabal. To calculate the productivity, it was counted the number of stems in a row linear meter, it was obtained the weight of stems. The percentage of fiber for each cultivar was determined by a calculation of estimated production and productivity of mulch. Using these values to estimate the number of people who would benefit from the energy generated from the combustion of bagasse in a process of cogeneration power. The results were submitted to analysis of variance by F test and averages compared by Tukey test at 5% probability. Cultivars RB867515, RB72454 and CTC6 showed the best performance, indicating its greater potential for power cogeneration. Cultivars CTC IAC94-2 and 2101 were lower when considering the results obtained. (author)

  14. Common bean cultivars and lines interactions with environments

    Directory of Open Access Journals (Sweden)

    Carbonell Sérgio Augusto Morais

    2004-01-01

    Full Text Available The performance of bean lines brought forth in breeding programs or of cultivars in use can be affected by environmental variability. The adaptability and stability of grain yield of 18 common bean cultivars and lines in 23 environments (combinations of seasons, years and locations were evaluated in the State of São Paulo, Brazil. 'IAC-Carioca' and 'IAC-Carioca Eté' were used as standard cultivars for the carioca grain type, while 'FT-Nobre' and 'IAC-Una' represented the standard for black grains. The experiment was set up in a randomized complete block design with four replications and plots consisting of two, two central five meters rows flanked by border rows. Stability parameters were estimated by the methods Maximum Yield Deviations (MYD and by the Additive Main Effects and Multiplicative Interaction Analysis (AMMI. For the identification of the most stable cultivars, the two methods led to consistent results, although by MYD the highest stability was always associated to the highest yield. 'MAC-733327' and 'LP 9637' were the most suitable cultivars and lines for the joint seasons, while 'LP 9637' and 'FT-Nobre' were the most suitable for the dry season. The MYD method combined a simple procedure, easiness of result interpretation, uniqueness of parameters, and association between stability and yield. On the other hand, the AMMI method simplified the identification of stable cultivars by visual inspection, also providing information on the environments. However, the complex nature which combines uni-and multivariate techniques hampers its widespread use in breeding programs.

  15. Soil covering in organic cultivation of onion cultivars

    Directory of Open Access Journals (Sweden)

    Leonardo Barreto Tavella

    2015-03-01

    Full Text Available The soil preparation in horticulture, including organic, is characterized by intense soil tillage, which increases energy costs and unbalanced the environment. The organic system in onion cultivation has shown satisfactory results, however the soil covering use tends to improve the cultivation environment and may result in higher yields. The objective of this work was to evaluate the performance of onion cultivars in organic cultivation under different soil coverages. The experiment was conducted in the period of April to October of 2009, under protected cropping, in the experimental area of the horticulture sector of the Universidade Federal do Acre (UFAC, in Rio Branco, Acre, Brazil. A randomized block design was adopted, in a split-plot arrangement, the plots being comprised of soil coverings: coffee bean husks, grass straw (Brachiaria decumbens; dessicated bamboo leaves (Bambusa spp. and uncovered soil (control treatment, and the subplots comprised of three onion cultivars (IPA 10, IPA 11 and IPA 12, with four repetitions. The variables analyzed were total bulb yield (t ha-1, marketable bulb yield (t ha-1, fresh mass of the bulb (g bulb-1, classification of the bulbs and loss of mass as a function of storage time. There was no interaction effect between the soil coverings and the cultivars. Cultivars IPA 10 and IPA 11 showed greater agronomic performance of the studied variables. The soil coverings did not affect the yield and average mass of the bulbs under organic cultivation. The three cultivars presented more than approximately 70% of the bulbs in class 2 and a maximum of 5% of unmarketable bulbs. The loss of mass after 49 days of storage was 10% independent of the cultivar or soil covering.

  16. The antioxidant activitives of mango peel among different cultivars

    Science.gov (United States)

    Liu, Yu-Ge; Zhang, Xiu-Mei; Ma, Fei-Yue; Fu, Qiong

    2017-04-01

    In this paper, the contents of total phenol and total flavonoid of 8 mango cultivars were determined. Their antioxidant abilities were also evaluated by 1,1-diphenyl-2-pireyhydrazyl (DPPH) radical scavenging, trolox equivalent antioxidant capacity (TEAC) and ferric reducing antioxidant power (FRAP). Correlations between total phenol, total flavonoid and FRAP as well as TEAC were also analyzed. Results showed that mango peels were rich in natural antioxidant compounds the antioxidant abilities were different among different cultivars. The correlations between total phenol, total flavonoid and FRAP indicated phenolics represent a major part of antioxidant capacity in mango peels. This was also useful in the utilization of mango processing waste.

  17. Bioactivity of sour cherry cultivars grown in Denmark

    DEFF Research Database (Denmark)

    Khoo, Gaik Ming; Clausen, Morten Rahr; Pedersen, Bjarne Hjelmsted;

    2012-01-01

    Thirty four varieties of sour cherries (Prunus cerasus) were investigated for their total antioxidant activity, Caco-2 cancer cell proliferation inhibitory activity and effect on prostaglandin E2 (PGE2) production. Total phenolic content, oxygen radical absorbance capacity (ORAC) and cancer cell...... proliferation inhibitory activity of sour cherries were closely correlated but not PGE2 production. The cultivars ‘BirgitteBöttermö’, ‘Fanal’ and ‘Tiki’ were the three cultivars with the highest ORAC values (180, 147 and 133mmol TE/g, respectively) and inhibition against Caco-2 cancer cell proliferation (74...

  18. Yield Potential of Hemp (Cannabis sativa L.) Cultivars in Denmark

    DEFF Research Database (Denmark)

    Deleuran, Lise Christina; Flengmark, Poul Kristiansen

    2005-01-01

    In order to determine the yield potential of fibre hemp in Denmark, defined as seed yield, biomass, stem and fibre production, five cultivars were evaluated in field trials at two sites during 1998-2000. The total dry matter yield, stem yield, fibre yield, fibre percent, plant height, and seed...... was approximately 500 kg ha-1. In general, fibre yields increased when seed rates of 16 kg ha-1 or more were used. At 32 kg seed ha-1 Futura gave higher fibre yields than at all other seed rates, and higher yields at 24 cm row distance than at 48 cm. Fasamo differed from the other cultivars by having a lower dry...

  19. Combined Effects of Ozone and Drought on the Physiology and Membrane Lipids of Two Cowpea (Vigna unguiculata (L.) Walp) Cultivars

    Science.gov (United States)

    Moura Rebouças, Deborah; Maia De Sousa, Yuri; Bagard, Matthieu; Costa, Jose Helio; Jolivet, Yves; Fernandes De Melo, Dirce; Repellin, Anne

    2017-01-01

    The interactive effects of drought and ozone on the physiology and leaf membrane lipid content, composition and metabolism of cowpea (Vigna unguiculata (L.) Walp.) were investigated in two cultivars (EPACE-1 and IT83-D) grown under controlled conditions. The drought treatment (three-week water deprivation) did not cause leaf injury but restricted growth through stomatal closure. In contrast, the short-term ozone treatment (130 ppb 12 h daily during 14 day) had a limited impact at the whole-plant level but caused leaf injury, hydrogen peroxide accumulation and galactolipid degradation. These effects were stronger in the IT83-D cultivar, which also showed specific ozone responses such as a higher digalactosyl-diacylglycerol (DGDG):monogalactosyl-diacylglycerol (MGDG) ratio and the coordinated up-regulation of DGDG synthase (VuDGD2) and ω-3 fatty acid desaturase 8 (VuFAD8) genes, suggesting that membrane remodeling occurred under ozone stress in the sensitive cultivar. When stresses were combined, ozone did not modify the stomatal response to drought and the observed effects on whole-plant physiology were essentially the same as when drought was applied alone. Conversely, the drought-induced stomatal closure appeared to alleviate ozone effects through the reduction of ozone uptake. PMID:28273829

  20. Effect of cultivar x ozone treatment interaction on the total polyphenols content and antioxidant activity of globe artichoke

    Directory of Open Access Journals (Sweden)

    Sara Lombardo

    2015-06-01

    Full Text Available Two globe artichoke cultivars (Violet de Provence and Apollo were harvested at an experimental field in Sicily, immediately washed with ozonised water and stored in: i normal atmosphere; ii ozone-enriched atmosphere for 3 days and for the last 4 days in normal atmosphere; iii ozone-enriched atmosphere for 7 days. A control (samples unwashed and stored at room temperature was also investigated. The effect of cultivar x ozone treatment interaction on water content losses, total polyphenols content and antioxidant activity was evaluated after 0, 3 and 7 days of storage. Washing with ozonised water and storage under O3- enriched atmosphere allowed higher water retention compared with the control, especially for Violet de Provence. After 3 days of storage in ozone-enriched atmosphere, on average of cultivars, the total polyphenols content and antioxidant activity increased by 11.7% and 5.5%, respectively. By contrast, after further 4 days of storage in ozonised atmosphere, Apollo and Violet de Provence displayed a significant reduction in their level of total polyphenols and aantioxidant activity. The exposure of globe artichoke heads to an ozone-enriched atmosphere should not exceed 3 days aimed at preserving their high nutritional value, with special emphasis on total polyphenols content.

  1. Combined Effects of Ozone and Drought on the Physiology and Membrane Lipids of Two Cowpea (Vigna unguiculata (L.) Walp) Cultivars.

    Science.gov (United States)

    Rebouças, Deborah Moura; De Sousa, Yuri Maia; Bagard, Matthieu; Costa, Jose Helio; Jolivet, Yves; De Melo, Dirce Fernandes; Repellin, Anne

    2017-03-03

    The interactive effects of drought and ozone on the physiology and leaf membrane lipid content, composition and metabolism of cowpea (Vigna unguiculata (L.) Walp.) were investigated in two cultivars (EPACE-1 and IT83-D) grown under controlled conditions. The drought treatment (three-week water deprivation) did not cause leaf injury but restricted growth through stomatal closure. In contrast, the short-term ozone treatment (130 ppb 12 h daily during 14 day) had a limited impact at the whole-plant level but caused leaf injury, hydrogen peroxide accumulation and galactolipid degradation. These effects were stronger in the IT83-D cultivar, which also showed specific ozone responses such as a higher digalactosyl-diacylglycerol (DGDG):monogalactosyldiacylglycerol (MGDG) ratio and the coordinated up-regulation of DGDG synthase (VuDGD2) and ω-3 fatty acid desaturase 8 (VuFAD8) genes, suggesting that membrane remodeling occurred under ozone stress in the sensitive cultivar. When stresses were combined, ozone did not modify the stomatal response to drought and the observed effects on whole-plant physiology were essentially the same as when drought was applied alone. Conversely, the drought-induced stomatal closure appeared to alleviate ozone effects through the reduction of ozone uptake.

  2. Combined Effects of Ozone and Drought on the Physiology and Membrane Lipids of Two Cowpea (Vigna unguiculata (L. Walp Cultivars

    Directory of Open Access Journals (Sweden)

    Deborah Moura Rebouças

    2017-03-01

    Full Text Available The interactive effects of drought and ozone on the physiology and leaf membrane lipid content, composition and metabolism of cowpea (Vigna unguiculata (L. Walp. were investigated in two cultivars (EPACE-1 and IT83-D grown under controlled conditions. The drought treatment (three-week water deprivation did not cause leaf injury but restricted growth through stomatal closure. In contrast, the short-term ozone treatment (130 ppb 12 h daily during 14 day had a limited impact at the whole-plant level but caused leaf injury, hydrogen peroxide accumulation and galactolipid degradation. These effects were stronger in the IT83-D cultivar, which also showed specific ozone responses such as a higher digalactosyl-diacylglycerol (DGDG:monogalactosyldiacylglycerol (MGDG ratio and the coordinated up-regulation of DGDG synthase (VuDGD2 and ω-3 fatty acid desaturase 8 (VuFAD8 genes, suggesting that membrane remodeling occurred under ozone stress in the sensitive cultivar. When stresses were combined, ozone did not modify the stomatal response to drought and the observed effects on whole-plant physiology were essentially the same as when drought was applied alone. Conversely, the drought-induced stomatal closure appeared to alleviate ozone effects through the reduction of ozone uptake.

  3. Biochemical and Physiological Changes of Three Watermelon Cultivars Infested with Fusarium oxysporum f. Sp.niveum

    Institute of Scientific and Technical Information of China (English)

    WANG Jian-ming; HAO Chi; GUO Chun-rong; ZHANG Zuo-gang; HE Yun-chun

    2002-01-01

    The dynamic changes in membrane permeability, activities of disease-related enzymes, and contents of pathogenesis-relevant chemical compounds and photosynthetic pigments in root cells of three watermelon cultivars were studied after inoculation with Fusarium oxysporum f. sp. niveum at seedling stage. The results showed that the capacity of self-regulating and returning to normal status of cultivar Kelunsheng (resistant) was greater than that of a susceptible cultivar, Zaohua, in terms of malonaldehyde (MDA) content, relative conductivity, and activity of superoxide dismutase (SOD) and catalase (CAT). The resistant cultivar maintained a higher activity of dehydrogenase, higher content of vitamin C(Vc), and relatively lower content of soluble sugar than the susceptible cultivar. The content of soluble protein was higher in the resistant cultivar than that in the susceptible one at day 1 after inoculation. The capacities of the resistant cultivar to inhibit chlorophyll deterioration and maintain a higher carotenoid content were significantly stronger than those of the susceptible cultivar.

  4. Synonyms and homonyms of Malvasia cultivars (Vitis vinifera L.) existing in Spain

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez Torres, I.; Ibanez, J.; Andres, M. T. de; Rubio, C.; Borrego, J.; Cabello, F.; Zerolo, J.; Munoz Organero, G.

    2009-07-01

    Malvasia is a common name for different grape cultivars that have long been grown in Spain. In many cases, these cultivars are noted as being aromatic, sweet, and similar to Muscat in flavour. However, not all grapes that share this name exhibit these characteristics. This study compares the Malvasia cultivars in the Spanish Denominations of Origin with those grape cultivars grown in the grapevine collection of El Encin (Alcala de Henares, Spain) using morphological, iso enzymatic, and micro satellite analysis as well as a large bibliographic search of the studied cultivars. Despite their Malvasia denomination, some cultivars have been identified as synonyms of Macabeo, Alarije, Dona Blanca, Chasselas, or Planta Nova, all included on the official Spanish list of commercial grape cultivars. Malvasia de Sitges and Malvasia de Lanzarote have the characteristic flavour of Malvasia grapes and no synonyms were found among the cultivars grown in Spain, whereas Malvasia Rosada resulted from a colour mutation in Malvasia de Sitges. (Author) 26 refs.

  5. Stability of partial resistance in potato cultivars exposed to aggressive strains of Phytophthora infestans

    NARCIS (Netherlands)

    Flier, W.G.; Bosch, van den G.B.M.; Turkensteen, L.J.

    2003-01-01

    Potato cultivars were evaluated for their resistance responses to aggressive strains of Phytophthora infestans in field and laboratory experiments. Analysis of variance revealed differential cultivar-by-isolate interactions for both foliar and tuber blight resistance. Differential responses occur as

  6. Polychromatic diffraction contrast tomography

    Energy Technology Data Exchange (ETDEWEB)

    King, A., E-mail: king@synchrotron-soleil.fr [Synchrotron SOLEIL, Gif-sur-Yvette 91192 (France); Reischig, P. [Xnovo Technology ApS, 4600 Køge (Denmark); Department of Materials Science and Engineering, Delft University of Technology, Delft 2628 CD (Netherlands); Adrien, J. [MATEIS, INSA de Lyon, Villeurbanne 69621 (France); Peetermans, S. [Paul Scherrer Institut, CH-5232 Villigen (Switzerland); Ludwig, W. [MATEIS, INSA de Lyon, Villeurbanne 69621 (France); European Synchrotron Radiation Facility, Grenoble 38043 (France)

    2014-11-15

    This tutorial review introduces the use of polychromatic radiation for 3D grain mapping using X-ray diffraction contrast tomography. The objective is to produce a 3D map of the grain shapes and orientations within a bulk, millimeter-sized polycrystalline sample. The use of polychromatic radiation enables the standard synchrotron X-ray technique to be applied in a wider range of contexts: 1) Using laboratory X-ray sources allows a much wider application of the diffraction contrast tomography technique. 2) Neutron sources allow large samples, or samples containing high Z elements to be studied. 3) Applied to synchrotron sources, smaller samples may be treated, or faster measurements may be possible. Challenges and particularities in the data acquisition and processing, and the limitations of the different variants, are discussed. - Highlights: • We present a tutorial review of polychromatic diffraction contrast tomography techniques. • The use of polychromatic radiation allows the standard synchrotron DCT technique to be extended to a range of other sources. • The characteristics and limitations of all variants of the techniques are derived, discussed and compared. • Examples using laboratory X-ray and cold neutron radiation are presented. • Suggestions for the future development of these techniques are presented.

  7. Contrastive topics decomposed

    Directory of Open Access Journals (Sweden)

    Michael Wagner

    2012-12-01

    Full Text Available The analysis of contrastive topics introduced in Büring 1997b and further developed in Büring 2003 relies on distinguishing two types of constituents that introduce alternatives: the sentence focus, which is marked by a FOC feature, and the contrastive topic, which is marked by a CT feature. A non-compositional rule of interpretation that refers to these features is used to derive a topic semantic value, a nested set of sets of propositions. This paper presents evidence for a correlation between the restrictive syntax of nested focus operators and the syntax of contrastive topics, a correlation which is unexpected under this analysis. A compositional analysis is proposed that only makes use of the flatter focus semantic values introduced by focus operators. The analysis aims at integrating insights from the original analysis while at the same time capturing the observed syntactic restrictions. http://dx.doi.org/10.3765/sp.5.8 BibTeX info

  8. Physicochemical and functional properties of two cowpea cultivars grown in temperate Indian climate

    OpenAIRE

    Saima Hamid; Sabeera Muzzafar; Idrees Ahmed Wani; Farooq Ahmad Masoodi

    2015-01-01

    Flours of two local cowpea cultivars namely Red cowpea and Black cowpea were analysed for proximate composition, pasting and functional properties. The crude protein and fat contents were higher for Black cultivar than the Red cultivar. The apparent amylose content was significantly higher for Red cowpea (25.54%) than Black cowpea (15.09%). Polyphenols were significantly higher for Red cowpea than Black cowpea. The pasting profile of two cultivars revealed significantly higher values of peak ...

  9. Estimation of resistance pear cultivars to Erwinia amylovora using artificial immature pear fruits method

    OpenAIRE

    Gavrilović, Veljko; Stanisavljević, Rade; Stošić, Stefan; Stevanović, Miloš; Aleksić, Goran; Stajić, Milica; Dolovac, Nenad

    2014-01-01

    Susceptibility of different pear cultivars to Erwinia amaylovora by artificial inoculated immature pear fruits are shown in this article. According obtained results significant differences among cultivars are confirmed and they could be divided in four groups. Most susceptibly cultivars were Santa Marija. Second group includes Williams, Morettini, Carmen, Hardenpont. As most resistant shown to be Magness, Turandot and two local varietyies Karamanka, as well as another unknown local cultivar. ...

  10. Ripening-Dependent Changes in Antioxidants, Color Attributes, and Antioxidant Activity of Seven Tomato (Solanum lycopersicum L.) Cultivars

    Science.gov (United States)

    2016-01-01

    To evaluate the ripening-dependent changes in phytonutrients, seven commercial cultivars (two general and five cherry) of tomatoes were cultivated under greenhouse conditions. Fruits were harvested at breaker, turning, pink, light red, and red stages of each cultivar, and antioxidant contents, color attributes, and antioxidant activities were measured. During ripening process, lycopene content increased from the breaker to red stage, while lutein displayed the reverse accumulation pattern, with higher values during the breaker stage. In contrast, β-carotene showed the highest levels of synthesis in pink and light red stages. Furthermore, flavonoids (quercetin, rutin, naringenin, and luteolin) also showed similar ripening-dependent changes, with higher quantities in pink and light red stages. Ascorbic acid showed continuously increasing patterns throughout ripening until the red stage, while the accumulation of total phenolics was cultivar-dependent. These results indicate that each antioxidant compound has a unique pattern of accumulation and degradation during the ripening process. “Unicon” exhibited highest total carotenoid (110.27 mg/100 g), total phenol (297.88 mg GAE/100 g) and total flavonoid content (273.33 mg/100 g), and consequently highest antioxidant activity (2552.4 μmol TE/100 g) compared to other cultivars. Throughout the ripening processes, total phenolics showed the highest correlation with antioxidant activity, followed by β-carotene and total flavonoids. In conclusion, ripening in tomatoes is accompanied by incremental increases in various antioxidant compounds to some extent, as well as by concomitant increases in antioxidant activity. PMID:27668121

  11. A Fixed-Precision Sequential Sampling Plan for the Potato Tuberworm Moth, Phthorimaea operculella Zeller (Lepidoptera: Gelechidae), on Potato Cultivars.

    Science.gov (United States)

    Shahbi, M; Rajabpour, A

    2017-02-15

    Phthorimaea operculella Zeller is an important pest of potato in Iran. Spatial distribution and fixed-precision sequential sampling for population estimation of the pest on two potato cultivars, Arinda(®) and Sante(®), were studied in two separate potato fields during two growing seasons (2013-2014 and 2014-2015). Spatial distribution was investigated by Taylor's power law and Iwao's patchiness. Results showed that the spatial distribution of eggs and larvae was random. In contrast to Iwao's patchiness, Taylor's power law provided a highly significant relationship between variance and mean density. Therefore, fixed-precision sequential sampling plan was developed by Green's model at two precision levels of 0.25 and 0.1. The optimum sample size on Arinda(®) and Sante(®) cultivars at precision level of 0.25 ranged from 151 to 813 and 149 to 802 leaves, respectively. At 0.1 precision level, the sample sizes varied from 5083 to 1054 and 5100 to 1050 leaves for Arinda(®) and Sante(®) cultivars, respectively. Therefore, the optimum sample sizes for the cultivars, with different resistance levels, were not significantly different. According to the calculated stop lines, the sampling must be continued until cumulative number of eggs + larvae reached to 15-16 or 96-101 individuals at precision levels of 0.25 or 0.1, respectively. The performance of the sampling plan was validated by resampling analysis using resampling for validation of sampling plans software. The sampling plant provided in this study can be used to obtain a rapid estimate of the pest density with minimal effort.

  12. Allelic variations in Glu-1 and Glu-3 loci of historical and modern Iranian bread wheat (Triticum aestivum L.) cultivars

    Indian Academy of Sciences (India)

    Ali Izadi-Darbandi; Bahman Yazdi-Samadi; Ali-Akbar Su-Boushehri; Mohsen Mohammadi

    2010-08-01

    Proline and glutamine-rich wheat seed endosperm proteins are collectively referred to as prolamins. They are comprised of HMW-GSs, LMW-GSs and gliadins. HMW-GSs are major determinants of gluten elasticity and LMW-GSs considerably affect dough extensibility and maximum dough resistance. The inheritance of glutenin subunits follows Mendelian genetics with multiple alleles in each locus. Identification of the banding patterns of glutenin subunits could be used as an estimate for screening high quality wheat germplasm. Here, by means of a two-step 1D-SDS-PAGE procedure, we identified the allelic variations in high and low-molecular-weight glutenin subunits in 65 hexaploid wheat (Triticum aestivum L.) cultivars representing a historical trend in the cultivars introduced or released in Iran from the years 1940 to 1990. Distinct alleles 17 and 19 were detected for Glu-1 and Glu-3 loci, respectively. The allelic frequencies at the Glu-1 loci demonstrated unimodal distributions. At Glu-A1, Glu-B1 and Glu-D1, we found that the most frequent alleles were the null, 7 + 8, 2 + 12 alleles, respectively, in Iranian wheat cultivars. In contrast, Glu-3 loci showed bimodal or trimodal distributions. At Glu-A3, the most frequent alleles were c and e. At Glu-B3 the most frequent alleles were a, b and c. At Glu-D3 locus, the alleles b and a, were the most and the second most frequent alleles in Iranian wheat cultivars. This led to a significantly higher Nei coefficient of genetic variations in Glu-3 loci (0.756) as compared to Glu-1 loci (0.547). At Glu-3 loci, we observed relatively high quality alleles in Glu-A3 and Glu-D3 loci and low quality alleles at Glu-B3 locus.

  13. Histology and Ultrastructure of Incompatible Combination Between Puccinia striiformis and Wheat Cultivars with Low Reaction Type Resistance

    Institute of Scientific and Technical Information of China (English)

    KANG Zhen-sheng; WANG Yao; HUANG Li-li; WEI Guo-rong; ZHAO Jie

    2003-01-01

    The incompatible combinations between races of Puccinia striiformis and wheat cuitivars withlow reaction type resistance were examined by means of fluorescent microscopy, differential interference con-trast microscopy and electron microscopy. The incompatible combinations consisted of wheat cultivar Niuzhuteplus CY28, Hybrid46 plus CY29 and Tianxuan882 plus CY29, while the compatible combination was wheatcultivar Huixianhong plus CY28. The observation revealed a striking difference in the fungal development andthe host responses between susceptible and resistant wheat cuitivars following infection by the pathogen. Themain histological manifestation of the pathogen development in the resistant wheat cultivars include inhibitionof hyphal growth, delay of hyphal branching and colony formation, decrease of formation of haustorial mothercells and haustoria, and occurrence of host cell necrosis. The observation by electron microscopy demonstratedthat a series of abnormal changes occurred in intercellular hyphae, haustorial mother cells and haustoria dur-ing pathogen development in the resistant wheat cultivars. The cytoplasm became more electron-dense and vac-uoles in the cytoplasm increased in number and size. The cell walls of hyphae, haustorial mother cells werethickened irregularly. The organeiles were disorderly distributed in the cytoplasm and the haustorial mothercells and haustoria lost their physiological function. In the final stage of the pathogen development, the inter-cellular hyphae, haustorial mother cells and haustoria became necrotic and collapsed. The structural defensereactions such as formation of cell wall apposition, collar and encasement of haustorium were essentially morepronounced in the infected wheat leaves of the resistant cultivars than in the susceptible one. In addition, therelationship between the host resistance expression and the histological and cytological features occurred in theincompatible combination was discussed in this paper.

  14. Ripening-Dependent Changes in Antioxidants, Color Attributes, and Antioxidant Activity of Seven Tomato (Solanum lycopersicum L. Cultivars

    Directory of Open Access Journals (Sweden)

    Shiva Ram Bhandari

    2016-01-01

    Full Text Available To evaluate the ripening-dependent changes in phytonutrients, seven commercial cultivars (two general and five cherry of tomatoes were cultivated under greenhouse conditions. Fruits were harvested at breaker, turning, pink, light red, and red stages of each cultivar, and antioxidant contents, color attributes, and antioxidant activities were measured. During ripening process, lycopene content increased from the breaker to red stage, while lutein displayed the reverse accumulation pattern, with higher values during the breaker stage. In contrast, β-carotene showed the highest levels of synthesis in pink and light red stages. Furthermore, flavonoids (quercetin, rutin, naringenin, and luteolin also showed similar ripening-dependent changes, with higher quantities in pink and light red stages. Ascorbic acid showed continuously increasing patterns throughout ripening until the red stage, while the accumulation of total phenolics was cultivar-dependent. These results indicate that each antioxidant compound has a unique pattern of accumulation and degradation during the ripening process. “Unicon” exhibited highest total carotenoid (110.27 mg/100 g, total phenol (297.88 mg GAE/100 g and total flavonoid content (273.33 mg/100 g, and consequently highest antioxidant activity (2552.4 μmol TE/100 g compared to other cultivars. Throughout the ripening processes, total phenolics showed the highest correlation with antioxidant activity, followed by β-carotene and total flavonoids. In conclusion, ripening in tomatoes is accompanied by incremental increases in various antioxidant compounds to some extent, as well as by concomitant increases in antioxidant activity.

  15. Contributions of cultivar shift, management practice and climate change to maize yield in North China Plain in 1981-2009

    Science.gov (United States)

    Xiao, Dengpan; Tao, Fulu

    2016-07-01

    The impact of climate change on crop yield is compounded by cultivar shifts and agronomic management practices. To determine the relative contributions of climate change, cultivar shift, and management practice to changes in maize ( Zea mays L.) yield in the past three decades, detailed field data for 1981-2009 from four representative experimental stations in North China Plain (NCP) were analyzed via model simulation. The four representative experimental stations are geographically and climatologically different, represent the typical cropping system in the study area, and have more complete weather/crop records for the period of 1981-2009. The results showed that while the shift from traditional to modern cultivar increased yield by 23.9-40.3 %, new fertilizer management increased yield by 3.3-8.6 %. However, the trends in climate variables for 1981-2009 reduced maize yield by 15-30 % in the study area. Among the main climate variables, solar radiation had the largest effect on maize yield, followed by temperature and then precipitation. While a significant decline in solar radiation in 1981-2009 (maybe due to air pollution) reduced yield by 12-24 %, a significant increase in temperature reduced yield by 3-9 %. In contrast, a non-significant increase in precipitation during the maize growth period increased yield by 0.9-3 % at three of the four investigated stations. However, a decline in precipitation reduced yield by 3 % in the remaining station. The study revealed that although the shift from traditional to modern cultivars and agronomic management practices contributed most to the increase in maize yield, the negative impact of climate change was large enough to offset 46-67 % of the trend in the observed yields in the past three decades in NCP. The reduction in solar radiation, especially in the most critical period of maize growth, limited the process of photosynthesis and thereby further reduced maize yield.

  16. Anisotropic contrast optical microscope

    Science.gov (United States)

    Peev, D.; Hofmann, T.; Kananizadeh, N.; Beeram, S.; Rodriguez, E.; Wimer, S.; Rodenhausen, K. B.; Herzinger, C. M.; Kasputis, T.; Pfaunmiller, E.; Nguyen, A.; Korlacki, R.; Pannier, A.; Li, Y.; Schubert, E.; Hage, D.; Schubert, M.

    2016-11-01

    An optical microscope is described that reveals contrast in the Mueller matrix images of a thin, transparent, or semi-transparent specimen located within an anisotropic object plane (anisotropic filter). The specimen changes the anisotropy of the filter and thereby produces contrast within the Mueller matrix images. Here we use an anisotropic filter composed of a semi-transparent, nanostructured thin film with sub-wavelength thickness placed within the object plane. The sample is illuminated as in common optical microscopy but the light is modulated in its polarization using combinations of linear polarizers and phase plate (compensator) to control and analyze the state of polarization. Direct generalized ellipsometry data analysis approaches permit extraction of fundamental Mueller matrix object plane images dispensing with the need of Fourier expansion methods. Generalized ellipsometry model approaches are used for quantitative image analyses. These images are obtained from sets of multiple images obtained under various polarizer, analyzer, and compensator settings. Up to 16 independent Mueller matrix images can be obtained, while our current setup is limited to 11 images normalized by the unpolarized intensity. We demonstrate the anisotropic contrast optical microscope by measuring lithographically defined micro-patterned anisotropic filters, and we quantify the adsorption of an organic self-assembled monolayer film onto the anisotropic filter. Comparison with an isotropic glass slide demonstrates the image enhancement obtained by our method over microscopy without the use of an anisotropic filter. In our current instrument, we estimate the limit of detection for organic volumetric mass within the object plane of ≈49 fg within ≈7 × 7 μm2 object surface area. Compared to a quartz crystal microbalance with dissipation instrumentation, where contemporary limits require a total load of ≈500 pg for detection, the instrumentation demonstrated here improves

  17. Growth and Spread of Blueberry Cultivars in a 15 Year-Old Collection

    Science.gov (United States)

    Blueberry cultivars with reduced plant height and non-spreading, upright growth habit would be useful for reducing pruning requirements and improving ease of hand and machine harvest. Twenty-one rabbiteye cultivars and six southern highbush cultivars and selections were planted on March 6,1985 in s...

  18. Evaluation of maize cultivars for their susceptibility towards mycotoxigenic fungi under storage conditions

    CSIR Research Space (South Africa)

    Dawlal, P

    2012-01-01

    Full Text Available was carried out where each maize cultivar was serially inoculated with each of the fungi. Results showed that four maize cultivars had a slower rate of infestation towards the field fungi while three cultivars had a slower rate of infestation towards...

  19. Resposta de cultivares de algodoeiro a subdoses de glyphosate Response of cotton cultivars to reduced rates of glyphosate

    Directory of Open Access Journals (Sweden)

    O.M. Yamashita

    2005-12-01

    Full Text Available Avaliou-se a resposta de nove cultivares de algodoeiro, de importância econômica no Estado do Mato Grosso, quanto à intoxicação causada por subdoses de glyphosate. Os cultivares de algodoeiro utilizados foram Fabrika, Makina, ITA-90, FM 986, FM 966, Delta Opal, BRS Facual, Antares e Coodetec 407. As plantas foram cultivadas em tubetes preenchidos com substrato de solo e mantidas em casa telada, tendo recebido a aplicação do glyphosate aos 20 dias após a emergência, época em que apresentavam quatro folhas verdadeiras. As subdoses de glyphosate, simulando deriva, foram de 270 e 540 g ha-1. Também foi utilizada testemunha, sem aplicação do herbicida, para efeito de comparação. Foram realizadas avaliações semanais até 42 dias após a aplicação dos tratamentos (DAA, período em que também foi tomada a altura das plantas. Os sintomas visuais de intoxicação iniciaram-se aos 3 DAA, caracterizados pelo amarelecimento das pontas das folhas mais novas, seguido de murchamento do ápice das plantas. Na dose de 270 g ha-1 esses sintomas foram de baixa intensidade, mas a 540 g ha-1 causaram, na maioria dos casos, toxidez "preocupante" a "muito alta". Os cultivares BRS Facual e FM 986 mostraram-se os mais suscetíveis. A altura das plantas foi mais afetada quando se aplicou a menor dose de glyphosate. Houve recuperação de todos os cultivares tratados com 270 g ha-1 de glyphosate até os 42 DAA. Quando tratados com 540 g ha-1 de glyphosate, os cultivares Fabrika, Coodetec 407, BRS-Facual e ITA-90 foram mais sensíveis, apresentando redução de altura entre 84 e 90% aos 42 DAA. Os cultivares menos sensíveis na dose de 270 g ha-1 de glyphosate não foram os mesmos para a dose de 540 g ha-1.The response of nine cotton cultivars economically important in the state of Mato Grosso was evaluated in relation to the toxicity caused by reduced rates of glyphosate. The cotton cultivars used were Fabrika, Makina, ITA-90, FM 986, FM 966, Delta Opal

  20. Resistance of squash cultivars to Aphis gossypii Resistência de cultivares de abobrinha italiana a Aphis gossypii

    Directory of Open Access Journals (Sweden)

    Edson LL Baldin

    2009-09-01

    Full Text Available The Cucurbitaceae plants are damaged by attack of a wide spectrum of insects and microorganisms. Among the sucker insects causing damages on squash Cucurbita pepo (L., the aphid Aphis gossypii (Glover (Hemiptera: Aphididae is pointed as one of the most important, once their nymphs and adults suck the sap of the leaves continuously, besides being potential vector of virus. The present research evaluated different cultivars, aiming to identify the resistance against this aphid. The cultivars Novita, Sandy, Caserta Cac Melhorada, Novita Plus, Samira, AF-2858 and Caserta TS were used in laboratory assays (T= 25±2ºC; RH= 70±10% and fotophase= 12 h. In the immature phase the duration of nymphal instars was evaluated, the total duration and their viability, confining individuals on leaf disks from cultivars. In the adult phase the duration of reproductive period, the fecundity and the biological cycle were observed. The cultivar 'Sandy' expressed high level of antibiosis and feeding non-preference against A. gossypii, increasing the nymphal stage and causing mortality near to 70%. Besides, this cultivar reduced the production of nymphs and the longevity of the insects. The 'Novita Plus' cultivar also induced significant nymphal mortality, however in lower levels than those verified in 'Sandy', indicating a moderate resistance.As plantas da família Cucurbitaceae são prejudicadas pelo ataque de um amplo espectro de insetos e microrganismos. Dentre os insetos sugadores que atacam a abobrinha Cucurbita pepo (L., o pulgão Aphis gossypii (Glover (Hemiptera: Aphididae merece destaque, uma vez que suas ninfas e adultos sugam a seiva das folhas constantemente, além de ser potencial vetor de vírus. A presente pesquisa foi realizada com o objetivo de avaliar diferetes cultivares de abobrinha italiana quanto à resistência a esse pulgão. Utilizaram-se as cultivares Novita, Sandy, Caserta Cac Melhorada, Novita Plus, Samira, AF-2858 e Caserta TS em ensaios

  1. Características do cultivar iarana de coffea arabica The iarana cultivar of coffea arabica

    Directory of Open Access Journals (Sweden)

    A. Carvalho

    1975-01-01

    Full Text Available Misturas mecânicas de sementes de cafeeiros selecionados portadores de alelos individuais SH1, SH2 , SH3 , SH4 responsáveis pela resistência de Coffea arabica a grupos de raças fisiológicas de Hemileia vastatrix foram distribuídas aos lavradores com as denominações de cultivar iarana-C 73 e iarana-C 74. As sementes foram misturadas nas proporções, em peso, de 2:12:3:1 e 2:8:2:1, para os genotipos SH1SH1, SH2SH2 , SH3,SH3, e SH4SH4 , para os anos de 1973 e 1974, respectivamente. Todos os cafeeiros devem ser portadores dos alelos SH5SH5. A mistura foi distribuida em 1973, a 987 lavradores e, em 1974, a 463 lavradores de todas as regiões cafeeiras do Brasil. O iarana deverá ser plantado isoladamente do resto do cafezal em cada propriedade, para observação e seleção das plantas mais adaptadas para produção de sementes. As hibridações naturais que ocorrem entre plantas de diferentes genotipos darão origem a novas combinações genéticas portadoras de vários dos fatores genéticos, com espectro mais amplo de resistência às raças fisiológicas de H. vastatrix.Mechanical mixtures of seeds of selected plants of Coffea arabica carrying the dominant alleles SH1, SH2, SH3, and SH4 conditioning resistance to different races of Hemileia vastatrix were released to the growers as Iarana C 73 and Iarana C 74 cultivars. The seeds were mixed in the proportion of 2:12:3:1 and 2:8:2:1 for the genotypes SH1SH1, SH2SH2, SH2SH3 and SH4SH4 for 1973 and 1974 crops, respectively. The mixed seeds were distributed to 987 farmers in 1973 and 463 coffee farmers in 1974 from most of the coffee regions in Brazil. Iarana is to be planted in isolated plots for observation and selection of the more adapted plants for seed production. Natural hybridization between plants of different genotypes will give rise to new combinations with broader spectrum of resistance to physiological races of H. vastratrix.

  2. A Multiplexed Microsatellite Fingerprinting Set for Hazelnut Cultivar Identification

    Science.gov (United States)

    The objective of this study was to develop a robust and cost-effective fingerprinting set for hazelnuts using microsatellite (SSR) markers. Twenty SSRs containing repeat motifs of = three nucleotides distributed throughout the hazelnut genome were screened on eight genetically diverse cultivars to a...

  3. Rooting of stem segments from fig tree cultivars

    Directory of Open Access Journals (Sweden)

    Rayane Barcelos Bisi

    2016-06-01

    Full Text Available Although Brazil is the largest fig (Ficus carica L. producer in the Southern Hemisphere, it mainly uses only one cultivar, ‘Roxo de Valinhos’. In addition, propagation is almost entirely through hardwood cuttings. Therefore, the aim of this study was to establish a propagation method that provides more successful rooting of stem segments of fig cultivars for the purpose of expanding the genetic base of the fig tree. The cultivars used were ‘Brunswick’, ‘Calabacita’, ‘Negro de Bursa’, ‘Mini Figo’, ‘Lampa Preta’, ‘Lemon’, ‘Troiano’,’ Nazaré’, ‘Três num Prato’, ‘Princesa’, ‘Colo de Dama’, ‘Montes’, ‘Bêbera Branca’, ‘Pingo de Mel’, and ‘Roxo de Valinhos’. The propagation methods used were layering, hardwood cuttings, nodal segments, herbaceous cuttings originating from the removal of sprouts, and herbaceous cuttings obtained during growth. We found that the propagation method influences the rooting of stem segments, and cultivars differ in their rooting potential.

  4. Rational regional distribution of sugarcane cultivars in China

    National Research Council Canada - National Science Library

    Luo, Jun; Pan, Yong-Bao; Xu, Liping; Grisham, Michael Paul; Zhang, Hua; Que, Youxiong

    2015-01-01

    .... In the present study, a heritability-adjusted genotype main effect plus genotype × environment (HA-GGE) biplot program was used to analyze the cane and sucrose yields of 44 newly released sugarcane cultivars at eight pilot test sites...

  5. Predicting Development of an Epidemics on Cultivar Mixtures

    DEFF Research Database (Denmark)

    Østergård, Hanne

    1983-01-01

    A mathematical model for the development of an epidemic on a plant cultivar mixture illustrates the influence of the infection efficiency, spore production rate, proportion of deposited spores, frequency of autodeposition, and composition of the mixture on the genetic composition of the pathogen...

  6. Variation in fruit chilling injury among mango cultivars

    NARCIS (Netherlands)

    Phakawatmongkol, W.; Ketsa, S.; Doorn, van W.G.

    2004-01-01

    Mango(Mangifera indica L.) fruit of six cultivars ('Kaew', 'Rad', 'Okrong', 'Tongdum', 'Nam Dok Mai' and 'Nungklangwun') were stored at 4, 8 and 12degreesC (85-90% RH) and randomly sampled every 5 days. Chilling injury was manifested initially as a gray to brown discoloration of the peel, followed b

  7. Two new promising cultivars of mango for Florida

    Science.gov (United States)

    Mango cultivars are mostly the result of random selections from open pollinated chance seedlings of indigenous or introduced germplasm. The National Germplasm Repository (genebank) at the Subtropical Horticulture Research Station (SHRS) in Miami, Florida is an important mango germplasm repository an...

  8. Irreversible commitment to flowering in two mango cultivars

    Science.gov (United States)

    In recent years, the state of Nayarit, Mexico has experienced variations in rainfall distribution and warmer temperatures during the autumn-winter season which have caused erratic flowering of mango. The early-flowering cultivars, such as ‘Ataulfo’, have been less affected than tardy ones such as ‘T...

  9. Nutritional composition of new peanut (Arachis hypogaea L.) cultivars

    Energy Technology Data Exchange (ETDEWEB)

    Campos-Mondragon, M. G.; Calderon de la Barca, A. M.; Duran-Prado, A.; Campos-Reyes, L. C.; Oliart-Ros, R. M.; Ortega-Garcia, J.; Medina-Juarez, L. A.; Angulo, O.

    2009-07-01

    Six peanut (Arachis hypogaea L.) cultivars (Col-24-Gro, Col-61-Gto, VA-81-B, Ranferi Diaz, NC-2 and Florunner) were studied for agricultural yield, chemical composition (protein, fat, carbohydrates, fiber and ash), amino acid profile, digestibility, fatty acid profile, tocopherol and sterol contents. Results indicated that Ranferi Diaz and Col-61-Gto presented the highest yield (6.3 Ton/ha). Protein content was from 23.5 to 26.6% and fat content ranged from 49.8-53.4%. Mean digestibility was 86%. Lysine and threonine levels in all cultivars were sufficient to meet human requirements. Total saturated fatty acids ranged from 15-18%. The oleic/linoleic ratio was estimated 1.3-1.4. Tocopherol levels varied from 390 to 706 ppm. The highest tocopherol levels corresponded to the cultivars with the lowest yield. The alpha tocopherol content was estimated at 90-150 ppm, while gamma tocopherol was 270-570 ppm. The main sterol present was A- sitosterol (approx. 65%). Ranferi Diaz variety presented the highest agronomic yield and the highest protein content but low oleic acid, low sterols and low total tocopherols. The differences among cultivars suggest differences in their applications. (Author) 40 refs.

  10. Sensitivity and growth of twelve Elatior begonia cultivars to ozone

    Energy Technology Data Exchange (ETDEWEB)

    Reinert, R.A.; Nelson, P.V.

    1979-12-01

    Twelve cultivars of Elatior begonia (Begonia X hiemalis Fotsch.) were exposed to O/sub 3/ at 25 and 50 pphM. The 'Schwabenland' group, 'Whisper 'O' Pink', and 'Improved Krefeld Orange' were the most sensitive, whereas 'Ballerina', 'Mikkell Limelight', and 'Turo' were the least sensitive. 'Rennaisance', 'Heirloom' 'Nixe', and 'Fantasy' were intermediate in sensitivity. The dry weight of foliage (stems plus leaves) of 9 cultivars exposed to O/sub 3/ was significantly less than that of control plants. Ozone at 25 and 50 pphM inhibited flower growth (including peduncles) and development in 4 and 8 of the 12 cultivars, respectively. Differences in flower weight ranged from 43 to 105% of the control at 25 pphM and from 25 to 98% of the control at 50 pphM, depending on cultivar. 1 table.

  11. WHEAT CULTIVARS: RESPONSE TO IRRIGATION AND SOWING DATES

    Directory of Open Access Journals (Sweden)

    Klar A.E.

    1996-01-01

    Full Text Available This study was carried out in an Alfisol-Oxisol transition sandy-clay texture, using six wheat cultivars (Triticum aestivum, L.: two tall and tolerant to soil aluminium toxicity (BH-1146, and IAC-18, and four semi-dwarf cultivars - Anahuac, IAC-162, IAC-24, and IAC-60 - of which only the first two are sensitive to soil aluminium toxicity. Two minimum soil water potentials (ys levels were used: 1. watered, when Ys reached about -0.05 MPa; 2. dry, when the water potential reached around -1.5 MPa. Two sowing dates, 05/22/92 and 06/11/92, were used. The results showed that Anahuac and IAC-60 are the most indicated cultivars for the studied region; when irrigated all cultivars presented similar yield level under no irrigation conditions; the irrigation was not sufficient to avoid yield differences between the two growing seasons; differences in rainfall were important for the crop in the dry treatment for both seasons.

  12. Susceptibility of highbush blueberry cultivars to Phytophthora root rot

    Science.gov (United States)

    Phytophthora cinnamomi Rands is a ubiquitous soilborne pathogen associated with root rot in many woody perennial plant species, including highbush blueberry (Vaccinium sp.). To identify genotypes with resistance to the pathogen, cultivars and advanced selections of highbush blueberry were grown in a...

  13. Quality Parameters of Six Cultivars of Blueberry Using Computer Vision

    Directory of Open Access Journals (Sweden)

    Silvia Matiacevich

    2013-01-01

    Full Text Available Background. Blueberries are considered an important source of health benefits. This work studied six blueberry cultivars: “Duke,” “Brigitta”, “Elliott”, “Centurion”, “Star,” and “Jewel”, measuring quality parameters such as °Brix, pH, moisture content using standard techniques and shape, color, and fungal presence obtained by computer vision. The storage conditions were time (0–21 days, temperature (4 and 15°C, and relative humidity (75 and 90%. Results. Significant differences (P<0.05 were detected between fresh cultivars in pH, °Brix, shape, and color. However, the main parameters which changed depending on storage conditions, increasing at higher temperature, were color (from blue to red and fungal presence (from 0 to 15%, both detected using computer vision, which is important to determine a shelf life of 14 days for all cultivars. Similar behavior during storage was obtained for all cultivars. Conclusion. Computer vision proved to be a reliable and simple method to objectively determine blueberry decay during storage that can be used as an alternative approach to currently used subjective measurements.

  14. Quality Parameters of Six Cultivars of Blueberry Using Computer Vision.

    Science.gov (United States)

    Matiacevich, Silvia; Celis Cofré, Daniela; Silva, Patricia; Enrione, Javier; Osorio, Fernando

    2013-01-01

    Background. Blueberries are considered an important source of health benefits. This work studied six blueberry cultivars: "Duke," "Brigitta", "Elliott", "Centurion", "Star," and "Jewel", measuring quality parameters such as °Brix, pH, moisture content using standard techniques and shape, color, and fungal presence obtained by computer vision. The storage conditions were time (0-21 days), temperature (4 and 15°C), and relative humidity (75 and 90%). Results. Significant differences (P cultivars in pH, °Brix, shape, and color. However, the main parameters which changed depending on storage conditions, increasing at higher temperature, were color (from blue to red) and fungal presence (from 0 to 15%), both detected using computer vision, which is important to determine a shelf life of 14 days for all cultivars. Similar behavior during storage was obtained for all cultivars. Conclusion. Computer vision proved to be a reliable and simple method to objectively determine blueberry decay during storage that can be used as an alternative approach to currently used subjective measurements.

  15. Register of new fruit and nut cultivars, list 48: strawberry

    Science.gov (United States)

    The Brooks and Olmo Registry of Fruit and Nut Varieties is a compilation of fruit and nut variety descriptions first published in 1952 and cataloging cultivars from 1920 through 1950. A second edition was published in 1972, and a third was published in 1997. Since then, fruit and nut variety descrip...

  16. Leaf gas exchange and yield of three upland rice cultivars

    Directory of Open Access Journals (Sweden)

    Rita de Cássia Félix Alvarez

    2015-03-01

    Full Text Available Studies of physiological parameters associated with crop performance and growth in different groups of upland rice (Oryza sativa L. may support plant breeding programs. We evaluated the role of gas exchange rates and dry matter accumulation (DMA as traits responsible for yields in a traditional (cv. ‘Caiapó’, intermediate (cv. ‘Primavera’ and modern (cv. ‘Maravilha’ upland rice cultivars. Leaf gas exchange rates, DMA, leaf area index (LAI, harvest indexes (HI and yield components were measured on these genotypes in the field, under sprinkler irrigation. Panicles per m2 and DMA at flowering (FL and heading, as well as CO2 assimilation rates (A were similar across these cultivars. The highest yield was found in ‘Primavera’, which may be explained by (i a two-fold higher HI compared to the other cultivars, (ii greater rates of DMA during spikelet formation and grain-filling, as well as (iii a slow natural decrease of A in this cultivar, at the end of the season (between FL and maturation.

  17. Sensory Profiles and Seasonal Variation of Black Walnut Cultivars.

    Science.gov (United States)

    Lynch, Catherine; Koppel, Kadri; Reid, William

    2016-03-01

    Black walnut (Juglans nigra L.) is a North American hardwood tree valued for producing nuts and wood. Black walnut cultivars were evaluated by a trained panel over 2 growing seasons to determine the seasonal variation in the sensory profile. Results showed that cultivars were significantly different on 3 appearance (skin color, nutmeat color, and kernel roughness), 1 aroma (black walnut ID), 5 flavor (black walnut ID, banana-like, piny, rancid, and overall nutty), and 2 texture attributes (surface roughness and hardness). These profiles were compared to results collected in 2011 to determine differences between growing seasons. Results showed 4 flavor attributes (black walnut ID, overall nutty, fruity-dark and rancid) had an interaction effect of year and cultivar, while 6 attributes (brown, caramelized, floral/fruity, piny, musty/dusty, and oily) showed a main effect of year. In general, flavor attributes had higher intensities in 2011 than in 2013. These results suggest that seasonal variation may influence flavor profile more than cultivar. Thus, using samples from only 1 growing season when testing agricultural products may not provide adequate information for the long term. © 2016 Institute of Food Technologists®

  18. RB962962, a sugarcane cultivar for late harvest

    Directory of Open Access Journals (Sweden)

    Luiz José Oliveira Tavares de Melo

    2014-07-01

    Full Text Available In the Northeast of Brazil, sugarcane cultivar RB962962 is harvested at the end of the cycle, between December and February, with a high sugar yield per area. Recommended for sandy soils of medium texture and fertility, it is resistant to the major diseases and fast-growing in plant and ratoon crops.

  19. Atividade antioxidante de frutos de quatro cultivares de pessegueiro

    Directory of Open Access Journals (Sweden)

    Cláudia Mendes dos Santos

    2013-06-01

    Full Text Available Esforços são empregados para identificar plantas com teores de antioxidantes que conferem benefícios à saúde. A capacidade antioxidante do pêssego deve-se aos compostos fenólicos, vitamina C e carotenoides. O objetivo deste trabalho foi caracterizar quatro cultivares de pessegueiro (Aurora, Biuti, Diamante e Douradão em relação à capacidade antioxidante, determinando o teor dos compostos antioxidantes relacionados a essa atividade. Os frutos foram separados em dois grupos: sem armazenamento e armazenados por cinco dias à temperatura ambiente. Foram determinados os teores de vitamina C, carotenoides, compostos fenólicos e a capacidade antioxidante, pelos métodos DPPH e β-caroteno/ácido linoleico. As quatro cultivares mostraram-se ricas em substâncias antioxidantes, porém a intensidade dessa ação foi diferenciada entre elas. A cultivar Biuti apresentou maior teor das substâncias analisadas e maior atividade antioxidante em relação às outras cultivares. Foi observado que o potencial antioxidante dos frutos de pêssego aumentou durante o período de armazenamento.

  20. Cultivar affects browning susceptibility of freshly cut star fruit slices

    Directory of Open Access Journals (Sweden)

    Teixeira Gustavo Henrique de Almeida

    2006-01-01

    Full Text Available Consumption of freshly-cut horticultural products has increased in the last few years. The principal restraint to using freshly-cut carambola is its susceptibility to tissue-browning, due to polyphenol oxidase-mediated oxidation of phenolic compounds present in the tissue. The current study investigated the susceptibility to browning of star fruit slices (Averrhoa carambola L. of seven genotypes (Hart, Golden Star, Taen-ma, Nota-10, Malásia, Arkin, and Fwang Tung. Cultivar susceptibility to browning as measured by luminosity (L* varied significantly among genotypes. Without catechol 0.05 M, little changes occurred on cut surface of any cultivars during 6 hour at 25degreesC, 67% RH. Addition of catechol led to rapid browning, which was more intense in cvs. Taen-ma, Fwang Tung, and Golden Star, with reduction in L* value of 28.60%, 27.68%, and 23.29%, respectively. Browning was more intense in the center of the slices, particularly when treated with catechol, indicating highest polyphenol oxidase (PPO concentration. Epidermal browning, even in absence of catechol, is a limitation to visual acceptability and indicates a necessity for its control during carambola processing. Care must be given to appropriate selection of cultivars for fresh-cut processing, since cultivar varied in browning susceptibility in the presence of catechol.

  1. GENETIC DIVERSITY OF WHEAT CULTIVARS ESTIMATED BY SSR MARKERS

    Directory of Open Access Journals (Sweden)

    K. Dvojković

    2008-09-01

    Full Text Available Presence and utilization of the genetic variability in the breeding programmes is prerequisite for their successfulness. Important factor for crop improvement is knowledge about the genetic diversity which providing a basis for the precise selection of parental combinations. Since beginning of 20th century, generation of wheat breeders and scientists in Croatia developed numerous advanced and successful wheat cultivars. Previous researches aimed to genetic diversity evaluation in Croatia were conducted by means of morphological traits, pedigree data (coefficients of parentage, proteins (glutenins and gliadins and RAPD DNA markers. DNA markers detect directly variation of DNA sequence for particular loci and they are not under influence of environment, epistatic and pleiotropic effects. Microsatellite markers (Simple Sequence Repeats; SSRs, as highly polymorphic, informative and codominant DNA marker system, have been extensively used for genetic diversity studies on wheat world wide. A set of 98 wheat cultivars released in Croatia during the period 1905-2007, and 24 foreign cultivar (included because of their ancestral significance or as standards, were screened by 45 microsatellite markers, covering all three wheat genomes. The objectives of this study were to evaluate the microsatellites-based genetic diversity with emphasize on cultivars created at the Agricultural Institute Osijek, as well as to investigate SSR application for selection of genetically the most distant parental pairs. Preliminary data obtained by means of SSR markers showed a satisfactory level of genetic diversity and usefulness of microsatellites for parental selection.

  2. (RR) soybean cultivars estimated by phenotypic characteristics and ...

    African Journals Online (AJOL)

    SAM

    2014-06-25

    Jun 25, 2014 ... phenotypic characteristics and microsatellite molecular markers (SSR). Ten agronomic traits ... genetic variations at the DNA, which are inherited genetically. ...... having been responsible for the development of RR. Villela et al. ..... soybean cultivars: evolution over time and breeding implications. Genet. Mol.

  3. susceptibility of some kersting's groundnut landrace cultivars to ...

    African Journals Online (AJOL)

    User

    The com- pletely randomized design was used to obtain data on the oviposition, developmental period, ... jung-black and Nakori-brown landrace cultivars consistently demonstrated high tolerance to the pest and .... Two hundred (200) sound seeds of each culti- var were ..... Ndlovu and Giga (1988) reported that the pat-.

  4. Properties of kenaf from various cultivars, growth and pulping conditions

    Science.gov (United States)

    James S. Han; Ernest S. Miyashita; Sara J. Spielvogel

    1999-01-01

    The physical properties of kenaf offer potential as an alternative raw material for the manufacture of paper. Investigations to date have not determined whether core and fiber should be pulped together or separately. Kenaf bast and core fibers of different cultivars were pulped under various kraft pulping conditions and physical properties: density, Canadian Standard...

  5. Impact of Molecular Genetic Research on Peanut Cultivar Development

    Directory of Open Access Journals (Sweden)

    Baozhu Guo

    2011-12-01

    Full Text Available Peanut (Arachis hypogaea L. has lagged other crops on use of molecular genetic technology for cultivar development in part due to lack of investment, but also because of low levels of molecular polymorphism among cultivated varieties. Recent advances in molecular genetic technology have allowed researchers to more precisely measure genetic polymorphism and enabled the development of low density genetic maps for A. hypogaea and the identification of molecular marker or QTL’s for several economically significant traits. Genomic research has also been used to enhance the amount of genetic diversity available for use in conventional breeding through the development of transgenic peanut, and the creation of TILLING populations and synthetic allotetraploids. Marker assisted selection (MAS is becoming more common in peanut cultivar development programs, and several cultivar releases are anticipated in the near future. There are also plans to sequence the peanut genome in the near future which should result in the development of additional molecular tools that will greatly advance peanut cultivar development.

  6. Variation of photosynthetic tolerance of rice cultivars (Oryza sativa L ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-03-01

    Mar 1, 2010 ... Institute of Food Crops, Jiangsu High Quality Rice R and D Center, ... temperature in the light at bud, seedling and booting stages and divided into three basic types; cultivars .... saturating photon pulse (4000 mol/m2 s).

  7. Reaction of peanut cultivars to late leafspot and rust

    Directory of Open Access Journals (Sweden)

    Nimitr Vorasoot

    2003-05-01

    Full Text Available Late leafspot caused by Phaeoisariopsis personata (Berk. & M.A. Curtis van Arx and rust caused by Puccinia arachidis Speg. are among the most serious diseases of peanut. Although fungicide application is effective in controlling the diseases, its high cost is considered uneconomical in many developing countries. In this situation, the use of resistant cultivars offers a better alternative. The objective of this study was to evaluate seven peanut cultivars for their resistances to late leafspot and rust. Peanut cultivars were planted in a randomized complete block design (RCBD with 4 replications at Khon Kaen University Experimental Farm. Natural infection of late leafspot and rust were allowed. Disease score, sporulation index and lesion number per 100 cm2 of leaf area were recorded as the resistance parameters of both diseases. Pod yield, seed yield, shelling percentage, pod number per plant and pod length were also measured. NC 17135 was the most resistant to late leafspot and moderately resistant to rust. NC 17090 was the most resistant to rust but susceptible to late leafspot. NC 17135 and NC 17090 should be recommended as sources of late leafspot and rust resistance, respectively. The two Thai released cultivars, Tainan 9 and Lampang were highly susceptible to both diseases.

  8. Variation in fruit chilling injury among mango cultivars

    NARCIS (Netherlands)

    Phakawatmongkol, W.; Ketsa, S.; Doorn, van W.G.

    2004-01-01

    Mango(Mangifera indica L.) fruit of six cultivars ('Kaew', 'Rad', 'Okrong', 'Tongdum', 'Nam Dok Mai' and 'Nungklangwun') were stored at 4, 8 and 12degreesC (85-90% RH) and randomly sampled every 5 days. Chilling injury was manifested initially as a gray to brown discoloration of the peel, followed b

  9. Selection and breeding of plant cultivars to minimize cadmium accumulation.

    Science.gov (United States)

    Grant, C A; Clarke, J M; Duguid, S; Chaney, R L

    2008-02-15

    Natural variation occurs in the uptake and distribution of essential and nonessential trace elements among crop species and among cultivars within species. Such variation can be responsible for trace element deficiencies and toxicities, which in turn can affect the quality of food. Plant breeding can be an important tool to both increase the concentration of desirable trace elements and reduce that of potentially harmful trace elements such as cadmium (Cd). Selection programs for a low-Cd content of various crops, including durum wheat, sunflower, rice and soybean have been established and low-Cd durum wheat cultivars and sunflower hybrids have been developed. In durum wheat (Triticum turgidum L. var durum), low-Cd concentration is controlled by a single dominant gene. The trait is highly heritable, and incorporation of the low-Cd allele can help to reduce the average grain Cd to levels below proposed international limits. The allele for low-Cd concentration does not appear to affect major economic traits and should not cause problems when incorporated into durum cultivars. The cost of Cd selection in a breeding program is initially large both in terms of Cd determination and reduced progress towards development of other economic traits, but declines as more breeding lines in the program carry the low-Cd trait and are utilized in new crosses. Production of low-Cd crop cultivars can be used as a tool to reduce the risk of movement of Cd into the human diet.

  10. Selection and breeding of plant cultivars to minimize cadmium accumulation

    Energy Technology Data Exchange (ETDEWEB)

    Grant, C.A. [AAFC Brandon Research Centre, Box 1000A, R.R. 3, Brandon, MB, R7A 5Y3 (Canada)], E-mail: cgrant@agr.gc.ca; Clarke, J.M. [AAFC Semiarid Prairie Agricultural Research Centre, Swift Current, SK, S9H 3X2 (Canada); Duguid, S. [AAFC Morden Research Station, Morden, MB, R6M 1Y5 (Canada); Chaney, R.L. [USDA, ARS, Animal Manure and Byproducts Laboratory, Room 013, Building 007, BARC-West, 10300 Baltimore Avenue, Beltsville, MD 20705-2350 (United States)

    2008-02-15

    Natural variation occurs in the uptake and distribution of essential and nonessential trace elements among crop species and among cultivars within species. Such variation can be responsible for trace element deficiencies and toxicities, which in turn can affect the quality of food. Plant breeding can be an important tool to both increase the concentration of desirable trace elements and reduce that of potentially harmful trace elements such as cadmium (Cd). Selection programs for a low-Cd content of various crops, including durum wheat, sunflower, rice and soybean have been established and low-Cd durum wheat cultivars and sunflower hybrids have been developed. In durum wheat (Triticum turgidum L. var durum), low-Cd concentration is controlled by a single dominant gene. The trait is highly heritable, and incorporation of the low-Cd allele can help to reduce the average grain Cd to levels below proposed international limits. The allele for low-Cd concentration does not appear to affect major economic traits and should not cause problems when incorporated into durum cultivars. The cost of Cd selection in a breeding program is initially large both in terms of Cd determination and reduced progress towards development of other economic traits, but declines as more breeding lines in the program carry the low-Cd trait and are utilized in new crosses. Production of low-Cd crop cultivars can be used as a tool to reduce the risk of movement of Cd into the human diet.

  11. BRS Centauro – oat cultivar for ground cover and grazing

    Directory of Open Access Journals (Sweden)

    Alfredo do Nascimento Junior

    2015-04-01

    Full Text Available Plants and seeds of oat cultivar BRS Centauro, of the species Avena brevis Roth., are highly uniform. The crop cycle is long, the suitability as fodder excellent, and leaf production particularly high, resulting in better quality forage than that of the black oat forage controls.

  12. Susceptibility of Geranium Cultivars (Pelargonium spp.) to Ralstonia solanacearum

    Science.gov (United States)

    Sixty-one cultivars of geraniums including zonal, regal, ivy, and scented were tested for susceptibility to three strains of Ralstonia solanacearum: a Race 1 Biovar 1 (R1B1) strain P597 isolated from tomato in Florida, a R1B1 strain P673 obtained from pothos originating in Costa Rica, and a Race 3 B...

  13. BRS Pampeira: new irrigated rice cultivar with high yield potential

    Directory of Open Access Journals (Sweden)

    Ariano Martins de Magalhães Júnior

    2016-12-01

    Full Text Available BRS Pampeira is a rice cultivar developed by Embrapa, recommended for irrigated cultivation in Brazil. It shows modern architecture, with high tillering and tolerance to lodging. It stands out for its high yield potential, medium cycle and good grain quality.

  14. 'Ramata': a new dwarf and variegated Hedychium J. Koenig cultivar

    Science.gov (United States)

    A new dwarf (~71 cm) variegated Hedychium cultivar, ‘Ramata’, was developed at the USDA-ARS Thad Cochran Southern Horticultural Laboratory (TCSHL), Poplarville. A potted ‘Ramata’ plant produces multiple pseudostems, originating from the rhizome, giving it a compact appearance. ‘Ramata’ originated fr...

  15. 'Suvetar' and 'Valotar' - new strawberry cultivars (Research Note

    Directory of Open Access Journals (Sweden)

    T. HIETARANTA

    2008-12-01

    Full Text Available The strawberry (Fragaria × ananassa cultivars ‘Suvetar’ and ‘Valotar’ have been released from the breeding programme of MTT Agrifood Research Finland. Both new cultivars overwintered as well as the control cultivars ‘Jonsok’ and ‘Polka’. ‘Suvetar’ overwintered even better than ‘Polka’. ‘Suvetar’ was produced from the cross ‘Polka’ × ‘Emily’. It scored better than the control cultivars for sensory assessed skin resistance. Measured fruit firmness of ‘Suvetar’ was not significantly different from that of ‘Polka’, but was better than ‘Jonsok’. ‘Valotar’ originates from a cross between ‘Jewel’ and ‘Senga Sengana’. Its measured fruit firmness was better than that of ‘Jonsok’ and ‘Polka’. Considering sensory assessments, the good firmness seems to be largely due to good skin resistance. The fresh flavour, yield, fruit size and fruit appearance of ‘Suvetar’ and ‘Valotar’, together with improved fruit firmness, make both the new varieties suitable for the fresh fruit market.;

  16. Performance de six cultivars de tomates Lycopersicon esculentum ...

    African Journals Online (AJOL)

    Administrateur

    Elle s'est déroulée sur deux cycles de production, l'un en saison sèche et ... respectively. The results obtained allowed us to make a hierarchical classification of the cultivars according to their ..... Plan directeur du développement agricole ...

  17. Cultivars of Codiaeum variegatum (L.) Blume (Euphorbiaceae) show ...

    African Journals Online (AJOL)

    SERVER

    2007-10-18

    Oct 18, 2007 ... times the leaf blade is interrupted along the midrib and become divided into an ... Two-month room temperature air-dried samples of six cultivars of ..... of garden horticulture and landscape design, De Lux ed, Garden City.

  18. Culture of the Tomato Micro-Tom Cultivar in Greenhouse.

    Science.gov (United States)

    Rothan, Christophe; Just, Daniel; Fernandez, Lucie; Atienza, Isabelle; Ballias, Patricia; Lemaire-Chamley, Martine

    2016-01-01

    Micro-Tom tomato cultivar is particularly adapted to the development of genomic approaches in tomato. Here, we describe the culture of this plant in greenhouse, including climate regulation, seed sowing and watering, vegetative development, plant maintenance, including treatment of phytosanitary problems, and reproductive development.

  19. High Contrast CRT.

    Science.gov (United States)

    1979-08-01

    r AD’ A076 235 WATKINS—JOHNSON Co SCOTYS VAL LEY CA F/S 9/5 N HIGH CONTRAST CRT.CU) AUG 79 6 A HOLNQUIST DAABO7—77—C—263 9 UNCLASSIFIED DEL.ET—TR—77...Air Force Systems Command A t t n : l) l . CA 2w) U I f iee ’ of \\ iva l Re ’~.ea r ch Andr ews AFI4 ( • ~~ii 4.~7 001 Washington , l ) .C. 20331

  20. Phenology, production and fruit quality of new Czech apricot cultivars in the Belgrade region

    Directory of Open Access Journals (Sweden)

    Milatović Dragan P.

    2013-01-01

    Full Text Available This study was aimed at evaluating of 14 new apricot cultivars created at the Faculty of Horticulture in Lednice in the Czech Republic in order to recommend the best of them for growing in the Belgrade region. The study was carried out at the Experimental station ‘Radmilovac’ of the Faculty of Agriculture in Belgrade over a period of five years (2009-2013. The experimental orchard was established in 2007, the rootstock was Myrobalan seedling, and tree spacing was 4.5 x 3 m. The control cultivar for comparison was the clone of ‘Velkopavlovická’ cultivar (type of ‘Hungarian Best’, LE-12/2. Flowering of introduced cultivars started from three days before to one day after the control cultivar, while the maturation time ranged from 19 days earlier in cultivar ‘Leskora’ to 12 days after the control in cultivar ‘Sophia’ (LE-2926. Compared with the control cultivar, significantly higher yield was achieved only in cultivar ‘Palava’, while significantly higher fruit weight was recorded in three cultivars: ‘Candela’ (LE-2927, ‘Sophia’ (LE-2926 and ‘Betinka’ (LE-3276. Cultivars ‘Sophia’ and ‘Betinka’ got the best scores for fruit appearance, while cultivars ‘Marlen’ and ‘Lebona’ ranked the highest for fruit taste. Among studied apricot cultivars, for the cultivation in the Belgrade region, the following cultivars can be recommended as promising: ‘Palava’ (early season, ‘Betinka’ (mid-season and ‘Sophia’ (late season. Regarding the large size and attractive appearance of fruits, these cultivars are more suitable for fresh consumption, but they can also be used for processing. [Projekat Ministarstva nauke Republike Srbije, br. TR-31063

  1. Does excess boron affect malondialdehyde levels of potato cultivars?

    Directory of Open Access Journals (Sweden)

    Murat Kemal Avci

    2013-07-01

    Full Text Available Background: Malondialdehyde (MDA is a product of lipid peroxidation and a sign of oxidative stress in plants. Therefore, determining the responses of plants to a particular type of stress at a particular time will shed a light on clarifying the stress status of the plants. In this study, we report how MDA levels in potato cultivars changed under toxic concentrations of boron, an essential plant micronutrient. Materials and Methods: Eight different potato (Solanum tuberosum cultivars (cv. Konsul, cv. Morene, cv. Slaney, cv. Mona Lisa, cv. Jaerla, cv. Poroventa, cv. Yayla Kizi, cv. Armada were used as study material. Excess boron was applied for seven weeks in three concentrations (0.5, 2.5 and 5 mM to plants that were grown from tubers. Plants were harvested and malondialdehyde content analyses were carried out in leaf tissues. Results: MDA levels under excess boron in cv. Mona Lisa and Yayla Kizi steadily increased rose with increasing concentrations in all groups, compared to control. In cv. Morene, MDA decreased in 0.5 mM Boron and increased in 2.5 and 5 mM Boron applications. In cv. Armada, cv. Slaney, cv. Konsul and cv. Poroventa, MDA levels fluctuated in different groups of each cultivar. In cv. Jaerla, MDA decreased in all groups with increasing boron, compared to control. Conclusions: MDA levels under excess boron showed increase, fluctuation and decrease in each group of the cultivars, compared to control. Therefore, MDA levels in potato plants under excess boron might not be a clear sign to determine the level of stress. This is the first report of MDA levels in eight different potato cultivars subjected to three different excess boron concentrations.

  2. The Processing of Turning Colour Olives of Oblica Cultivar

    Directory of Open Access Journals (Sweden)

    Tea Kulišić

    2004-12-01

    Full Text Available In this research the observation of the preservation process of turning colour olives of Oblica cultivar (an autochthonous Croatian cultivar processed according to the Californian type of processing has been carried out. Although the oblica cultivar is the most frequent cultivar in Croatian orchards, it is absolutely unexplored concerning the concentration of polyphenolic compounds (oleuropein and its derivatives as well as concerning the composition of natural microflora in the fruit. It has been very important to determine to what extent the choice of preserving technology is optimal for the cultivar’s particularities. The changes of fundamental physical and chemical features of brine (total acidity, pH value, the concentration of sodium chloride, the concentration of sugar, and brine temperature have been screened during the process of preservation. The appearance of the lactobacilli population has also been observed. The Lactobacillus plantarum species has been isolated and identified in this population on the seventh day after the fruit has been put in brine. The Lactobacillus plantarum species has been isolated and identified by means of the API 50 CHL (“bioMérieux”, France biochemical test and the APILAB PLUS (“bioMérieux”, France software. During further phases of the process, no appearance of the lactobacilli has been identified. On the basis of our physical and chemical examinations, we have concluded that the type of processing of turning colour olives of Oblica cultivar (which was applied without a complete knowledge of the Oblica’s particularities did not give optimal and expected values (low brine temperature, exceptionally high acidity of the medium. We have also concluded that it is necessary for further research to include the examinations of the portion of polyphenolic compounds in the fruit, as well as the examinations of the composition of naturally present microflora. Both examinations represent the

  3. Effect of Resin Ducts and Sap Content on Infestation and Development of Immature Stages of Anastrepha obliqua and Anastrepha ludens (Diptera: Tephritidae) in Four Mango (Sapindales: Anacardiaceae) Cultivars.

    Science.gov (United States)

    Guillén, Larissa; Adaime, Ricardo; Birke, Andrea; Velázquez, Olinda; Angeles, Guillermo; Ortega, Fernando; Ruíz, Eliel; Aluja, Martín

    2017-04-01

    We determined the influence of resin ducts, sap content, and fruit physicochemical features of four mango cultivars (Criollo, Manila, Ataulfo, and Tommy Atkins) on their susceptibility to the attack of the two most pestiferous fruit fly species infesting mangoes in Mexico: Anastrepha ludens (Loew) and Anastrepha obliqua (Macquart). We performed three studies: 1) analysis of resin ducts in mango fruit exocarp to determine the density and area occupied by resin ducts in each mango cultivar, 2) assessment of mango physicochemical features including fruit sap content, and 3) a forced infestation trial under field conditions using enclosed fruit-bearing branches to expose mangoes to gravid A. ludens or A. obliqua females. Infestation rates, development time from egg to prepupae and pupae, pupal weight, and percent of adult emergence, were assessed. 'Ataulfo' and 'Tommy Atkins' cultivars exhibited the highest resin duct density and sap content, the lowest infestation rate, and had a negative effect on immature development and pupal weight. In sharp contrast, 'Manila' and 'Criollo' cultivars, with the lowest resin duct density and sap content, were highly susceptible to A. ludens and A. obliqua attack. We conclude that sap content and the number, size, and distribution of resin ducts as well as firmness in mango fruit exocarp are all involved in the resistance of mango to A. ludens and A. obliqua attack. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. Influence of Soil Type, Cultivar and Verticillium dahliae on the Structure of the Root and Rhizosphere Soil Fungal Microbiome of Strawberry

    Science.gov (United States)

    Nallanchakravarthula, Srivathsa; Mahmood, Shahid; Alström, Sadhna; Finlay, Roger D.

    2014-01-01

    Sustainable management of crop productivity and health necessitates improved understanding of the ways in which rhizosphere microbial populations interact with each other, with plant roots and their abiotic environment. In this study we examined the effects of different soils and cultivars, and the presence of a soil-borne fungal pathogen, Verticillium dahliae, on the fungal microbiome of the rhizosphere soil and roots of strawberry plants, using high-throughput pyrosequencing. Fungal communities of the roots of two cultivars, Honeoye and Florence, were statistically distinct from those in the rhizosphere soil of the same plants, with little overlap. Roots of plants growing in two contrasting field soils had high relative abundance of Leptodontidium sp. C2 BESC 319 g whereas rhizosphere soil was characterised by high relative abundance of Trichosporon dulcitum or Cryptococcus terreus, depending upon the soil type. Differences between different cultivars were not as clear. Inoculation with the pathogen V. dahliae had a significant influence on community structure, generally decreasing the number of rhizosphere soil- and root-inhabiting fungi. Leptodontidium sp. C2 BESC 319 g was the dominant fungus responding positively to inoculation with V. dahliae. The results suggest that 1) plant roots select microorganisms from the wider rhizosphere pool, 2) that both rhizosphere soil and root inhabiting fungal communities are influenced by V. dahliae and 3) that soil type has a stronger influence on both of these communities than cultivar. PMID:25347069

  5. Influence of soil type, cultivar and Verticillium dahliae on the structure of the root and rhizosphere soil fungal microbiome of strawberry.

    Science.gov (United States)

    Nallanchakravarthula, Srivathsa; Mahmood, Shahid; Alström, Sadhna; Finlay, Roger D

    2014-01-01

    Sustainable management of crop productivity and health necessitates improved understanding of the ways in which rhizosphere microbial populations interact with each other, with plant roots and their abiotic environment. In this study we examined the effects of different soils and cultivars, and the presence of a soil-borne fungal pathogen, Verticillium dahliae, on the fungal microbiome of the rhizosphere soil and roots of strawberry plants, using high-throughput pyrosequencing. Fungal communities of the roots of two cultivars, Honeoye and Florence, were statistically distinct from those in the rhizosphere soil of the same plants, with little overlap. Roots of plants growing in two contrasting field soils had high relative abundance of Leptodontidium sp. C2 BESC 319 g whereas rhizosphere soil was characterised by high relative abundance of Trichosporon dulcitum or Cryptococcus terreus, depending upon the soil type. Differences between different cultivars were not as clear. Inoculation with the pathogen V. dahliae had a significant influence on community structure, generally decreasing the number of rhizosphere soil- and root-inhabiting fungi. Leptodontidium sp. C2 BESC 319 g was the dominant fungus responding positively to inoculation with V. dahliae. The results suggest that 1) plant roots select microorganisms from the wider rhizosphere pool, 2) that both rhizosphere soil and root inhabiting fungal communities are influenced by V. dahliae and 3) that soil type has a stronger influence on both of these communities than cultivar.

  6. Desempenho de cultivares de alface no Estado do Acre Performance of lettuce cultivars in the State of Acre, Brazil

    Directory of Open Access Journals (Sweden)

    Francisco J. da S. Lédo

    2000-11-01

    Full Text Available Devido às condições ambientais verificadas no estado do Acre, caracterizado pela ocorrência de temperaturas elevadas e alta precipitação, as cultivares tradicionalmente utilizadas pelos produtores apresentam baixo rendimento e qualidade. O objetivo do presente trabalho foi avaliar o comportamento das novas cultivares de alface disponíveis no mercado, em termos de características agronômicas e rendimento, nas condições edafoclimáticas de Rio Branco, Acre. Para isso foram realizados dois ensaios no campo experimental da Embrapa Acre, em um solo do tipo Argissolo Vermelho-Escuro, textura argilosa. O primeiro de maio a julho de 1996 (período seco e o segundo de dezembro de 1996 a fevereiro de 1997 (período chuvoso. Foram avaliadas as cultivares Babá de Verão, Brisa, Carolina AG-576, Elisa, Lucy Brown, Marisa AG-216, Piracicaba 65, Regina 71, Tainá, Simpson, Vanessa e Verônica, sendo que 'Regina 71' e 'Elisa' foram incluídas apenas no ensaio do período seco. O delineamento experimental foi o de blocos casualizados, com três repetições. No período seco, as cultivares Simpson, Lucy Brown e Regina 71 apresentaram os maiores pesos médios (373; 362 e 341 g, respectivamente e produções comerciais de 49,8; 48,3 e 45,5 t/ha, respectivamente. Em geral, as cultivares dos tipos lisa sem cabeça e lisa com cabeça apresentaram maior índice de ataque de nematóide (Meloidogyne javanica quando comparadas às do tipo crespa. No ensaio realizado no período chuvoso, as cultivares Marisa AG-216, Verônica, Lucy Brown, Brisa, Tainá e Piracicaba-65 apresentaram os maiores pesos médios e produções comerciais. Entretanto, as médias obtidas foram bem inferiores às verificadas no ensaio do período seco, variando de 164 a 198 g para o peso médio, e 21,9 a 25,9 t/ha para produção comercial. Dentre as cultivares avaliadas no período seco, Regina 71 (lisa, sem cabeça e Carolina AG-576 (lisa, com cabeça destacaram-se entre as do tipo

  7. Resistance and susceptibility of alfalfa (Medicago sativa L.) cultivars to the aphid Therioaphis maculata (Homoptera:Aphididae): insect biology and cultivar evaluation

    Institute of Scientific and Technical Information of China (English)

    ALEXANDRE DE ALMEIDA E SILVA; ELENICE MOURO VARANDA; JOS(E) RICARDO BAROSELA

    2006-01-01

    Biology of the aphid Therioaphis maculata was studied on alfalfa (Medicago sativa L.), including four resistant (Mesa-Sirsa, CUF101, Baker and Lahontan) and two susceptible (ARC and Caliverde) alfalfa cultivars, and one of the most cropped Brazilian cultivars, Crioula. Under controlled conditions, antibiosis (i.e., reduced longevity, fecundity and increased mortality of the aphid) was observed mainly on the resistant alfalfa cultivars,except on Lahontan. Crioula seemed to be tolerant to aphids. Present data support geographic limitation usage of cultivars, and we suggest Baker and Mesa-Sirsa as sources of antibiosis,and provide biological information of a tropical T. maculata biotype on alfalfa.

  8. Variantes somaclonais da cultivar de arroz Bluebelle resistentes à brusone Blast resistant somaclonal variants of rice cultivar Bluebelle

    Directory of Open Access Journals (Sweden)

    Leila Garcês de Araújo

    2001-05-01

    Full Text Available A brusone, causada por Pyricularia grisea, constitui fator limitante da produtividade do arroz irrigado, principalmente no Estado do Tocantins. A detecção de variabilidade genética quanto à resistência à brusone em cultivares suscetíveis, como a Bluebelle, considerada uma das cultivares-padrões quanto à qualidade dos grãos, foi o principal objetivo deste trabalho. O procedimento adotado incluiu a indução de calos provenientes de panículas imaturas, regeneração, avaliação e seleção das plantas R2 resistentes à doença. O mesmo procedimento foi utilizado para nova indução de calos e regeneração de plantas a partir de três plantas R2 selecionadas. Foi realizada a avaliação e a seleção de plantas resistentes nas gerações R2 e R4 em viveiro de brusone. Nos testes realizados em casa de vegetação com três isolados coletados da cultivar Metica1, pertencentes aos patótipos IB41 e IB45 de P. grisea, todos os 47 somaclones R6 foram resistentes. Por outro lado, os somaclones apresentaram reações diferenciais frente a cinco isolados provenientes de somaclones da cultivar Bluebelle, e resistência a um isolado proveniente da cultivar Bluebelle, enquanto a cultivar Bluebelle foi suscetível a todos os isolados. Estes resultados indicaram variação genética no que diz respeito à resistência à brusone, na segunda fase de indução de calos e na regeneração de plantas. Dos 47 somaclones R6, 22 apresentaram alto grau de resistência vertical nos testes conduzidos nos viveiros de brusone em quatro locais, e poderão ser utilizados como novas fontes de resistência.Rice blast, caused by Pyricularia grisea, is the major yield constraint in irrigated rice mainly in the State of Tocantins. The detection of genetic variability for blast resistance in susceptible cultivars such as Bluebelle, considered as a standard for superior grain quality, was the main objective of the present investigation. The adopted procedure included

  9. LEAF MINERAL CONCENTRATION OF FIVE OLIVE CULTIVARS GROWN ON CALCAREOUS SOIL

    Directory of Open Access Journals (Sweden)

    Igor Pasković

    2013-12-01

    Full Text Available There are limited numbers of scientific publication regarding genotypic differences which exist among olive cultivars concerning nutrient uptake and translocation. For that purpose, the object of our study was to determine possible differences between leaf mineral content of five selected olive cultivars since leaf nutrient analysis is consider being the best method for diagnosing olive tree nutritional status. Plant material was obtained from an olive collection, grown on calcareous soil maintained at Institute of Adriatic Crops and Karst Reclamation, Split, Croatia. The study was conducted with two Croatian autochthonous olive cultivars (“Istarska bjelica”, “Lastovka”, two Italian cultivars (“Pendolino”, “Leccino” and one Spanish cultivar (“Hojiblanca”. Completely randomized design was applied. This study has shown questionably low Mg concentration in all olive cultivars with exception for “Hojiblanca” cultivar. Also, only Croatian cultivars “Istarska bjelica” and “Lastovka” as well as Spanish cultivar “Hojiblanca” recorded sufficient levels of iron leaf mineral content. Regarding other elements studied (P, K, Ca, Zn, Mn, Cu all cultivars were above literature cited thresholds for possible deficiencies. Selected olive cultivars in our experiment demonstrated different nutrient leaf concentration, which is of particular importance for fertilization requirements and fertilization practice in Croatian orchards grown on calcareous soil.

  10. Characterization and quantification of fruit phenolic compounds of European and Tunisian pear cultivars.

    Science.gov (United States)

    Brahem, Marwa; Renard, Catherine M G C; Eder, Severin; Loonis, Michèle; Ouni, Rim; Mars, Messaoud; Le Bourvellec, Carine

    2017-05-01

    The flesh and peel of 19 pear cultivars (8 Tunisian dessert cultivars, 8 European dessert cultivars and 3 French perry pear cultivars) were studied for their phenolic composition. Phenolic compounds were identified by HPLC/ESI-MS(2) and individually quantified by HPLC-DAD. Five classes of polyphenols were present: flavan-3-ols, phenolic acids, flavonols, anthocyanins and simple phenolics (hydroquinones). The total phenolic content ranged between 0.1g/kg Fresh Weight (FW) ('Conference' cultivar) and 8.6g/kg FW ('Plant De Blanc' cultivar) in the flesh and between 1.6g/kg FW ('William vert' cultivar) and 40.4g/kg FW ('Arbi Chiheb' cultivar) in the peel. Procyanidins, analyzed after thioacidolysis, were the main phenolic compounds in all pear cultivars either in the pulp or the peel, their constitutive units being essentially (-)-epicatechin. Tunisian dessert pears and French perry pears are richer in procyanidins with very high degree of polymerization (>100) for Tunisian pears. Peel procyanidins were less polymerized (from 4 to 20). Pear peel phenolic profile was more complex especially for Tunisian cultivars, with flavonols and in some cultivars anthocyanins. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Assessment of inter- and intra-cultivar variations in olive using SSR markers

    Directory of Open Access Journals (Sweden)

    Ahmet Ipek

    2012-10-01

    Full Text Available Olive (Olea europaea L. production in the world has been made by using many cultivars, and the genetic uniformity of commercial cultivars is important for standard olive oil and table olive production. The genetic variation among and within commonly cultivated olive cultivars in Turkey was analyzed using SSR markers. A total of 135 leaf samples were collected from 11 commonly cultivated olive cultivars from 11 provinces in four geographical regions of Turkey. Seven SSR primer pairs generated 46 SSR markers, and the number of SSR markers per primer pair ranged from 4 (UDO-14 to 9 (GAPU-89 with an average of 6.57. This high level of SSR polymorphism suggests that olive production in Turkey has been made using genetically diverse olive cultivars and this high level of genetic variation is probably due to the location of Turkey in the center of the origin of olive. The UPGMA dendrogram, developed to visualize the estimated genetic relationships among the 135 samples, demonstrated that the clustering of olive cultivars was not based on geographical regions of cultivation. Presence of genetic variation was detected within a nationwide grown Turkish olive cultivar, called 'Gemlik'. Olive growers successfully discriminated olive cultivars with distinct morphological and pomological characters. However, there was some confusion about the identification of cultivars with similar phenotypic traits. To prevent misidentification of olive cultivars and to minimize intra-cultivar variation, certified propagation materials which were characterized using DNA based molecular markers should be used during the establishment of new olive orchards.

  12. Comparative of Qualitative and Quantitative Characteristics of Four Commercial Mandarin Cultivars on 'Flying Dragon' Rootstock

    Directory of Open Access Journals (Sweden)

    E. Abedi Gheshlaghi

    2016-02-01

    Full Text Available 'Flying dragon' is one of the citrus rootstocks that are considered to be a promised dwarfing rootstock in the world. This experiment was conducted in the Astara research station for study of qualitative and quantitative characteristics of 4 mandarin cultivars (Unshiu, Clementine, Page, and Yunesi budded on 'Flying dragon'. This experiment was carried out with four cultivars in randomized complete bloke design (RCBD with three replications. Qualitative and quantitative characteristics of fruits, as well as vegetative traits were recorded and analyzed for 3, 6 and 1 years, respectively. The highest yield was observed on Yunesi cultivar in the final year of experiments and the lowest yield was on Unshiu cultivar in the fifth year. TSS/TA and means of fruit weight were affected by interaction of year and cultivar. The highest means of fruit weight was on Yunesi in the years of 85 and the highest TSS/TA was in years of 88 on Clementine cultivar. The highest alternate bearing index obtained in years of 88 on the Unshiu cultivar and the lowest that was on the Page cultivar. The highest yield efficiency, cumulative yield and plant height were observed on Yunesi cultivar, and the highest width and canopy of tree were on Unshiu cultivar. The lowest yield and tree size were on Page cultivar.

  13. Phase Contrast Imaging

    DEFF Research Database (Denmark)

    1996-01-01

    with a simple one-to-one mapping between resolution elements of a spatial phase modulator and resolution elements of the generated intensity pattern is provided. According to the invention a method is provided for synthesizing an intensity pattern with low loss of electromagnetic energy, comprising spatial...... modulation of electromagnetic radiation with a spatial phase mask for modulation of the phase of the incident eletromagnetic radiation by phasor values of individual resolution elements of the spatial phase mask, each phasor value being determined in such a way that the values of the Fourier transformed......The invention relates to a method and a system for synthesizing a prescribed intensity pattern based on phase contrast imaging that is not based on the assumption of prior art methods that the pahase shift phi is less than 1 radian. An improved method based on a simple imaging operation...

  14. 波叶海菜花种子储存条件与萌发初步研究%Preliminary Studies on Characteristics of Seed Germination and Storage Condition of Ottelia acuminata var.crispa

    Institute of Scientific and Technical Information of China (English)

    王斌

    2011-01-01

    研究了储藏条件和萌发温度对波叶海菜花种子萌发的影响.将波叶海菜花新鲜和风干种子分别在0、4、10℃及15℃下贮藏120 d,在25℃下进行萌发试验.结果表明,风干的种子全部不萌发.新鲜种子在10℃及4℃储藏,种子萌发率高,没有显著差异;而在0℃下储藏的种子萌发率显著降低.并在15、20、25、30℃下对波叶海菜花进行萌发试验,发现种子在所有温度条件下均有较高的萌发率(>90%);温度越高萌发时滞越短,萌发持续时间越短.基质对种子萌发没有显著影响.%The effects of storage condition and germination temperature of Ottelia acuminata var. Crispaseeds were studied in order to find suitable store ways and germination condition. The author examined the germination after 120 days of dry and miost storage under 0 ℃,4 ℃, 10 ℃ and 15 ℃ respectively. The result showed that germination of O. Acuminata var. Crispa was affected by storage conditions remarkably and the optimal range was 10 ℃ to 4℃ , while the germination percentage of seeds was lower under 0 ℃. The seeds did not germinate when the duration of storage was dry. At the same time,the author tested the germination of seeds of Otteliaacuminata under 15 ℃ ,20 ℃ ,25 ℃ and 30℃. The germination could germinate in an abroad range of temperature. Seeds of O. Acuminata var. Crispa showed higher germination under 15 ℃ to 30 ℃ regions. The germination speed increased gradually with rising of temperature. Substance had no significant effect on percentage germination.

  15. Caracterização morfológica, produtividade e rendimento comercial de cultivares de alho Morphological characterization, commercial yield and productivity of garlic cultivars

    Directory of Open Access Journals (Sweden)

    Juliano Tadeu V de Resende

    2013-03-01

    Full Text Available O Brasil tem condições de elevar a produção de alho a ponto de suprir a demanda interna. Para alcançar tal êxito, é necessário avaliar o maior número possível de cultivares visando estabelecer as melhores para cada região. Sendo assim, esse trabalho objetivou avaliar o rendimento econômico e a qualidade de bulbos de 20 cultivares de alho na região Centro-Sul do Paraná. O experimento foi conduzido entre os meses de março e setembro de 2009, no município de Guarapuava-PR. O delineamento experimental foi em blocos casualizados, com três repetições. Os tratamentos constituíram-se em doze cultivares de alho seminobre e oito cultivares de alho nobre. Foram realizadas as avaliações de produtividade total (PT, produção comercial (PC e classificação comercial dos bulbos; superbrotamento; e seis caracteres relacionados à morfologia da planta: diâmetro do pseudocaule, comprimento e largura da folha, comprimento, largura e número de bulbilhos. As cultivares do grupo nobre apresentaram PT superior às cultivares do grupo seminobre, porém, não houve diferença com relação à PC. Entre as cultivares do grupo nobre, a São Valentim apresentou a maior PC de bulbos, com 8,9 t ha-1. As cultivares do grupo nobre apresentaram maior porcentagem de bulbos nas classes 6 e 7, com destaque para as cultivares Chonan, com 40,3% dos bulbos na classe 7 e a cultivar Ito, com 75% dos bulbos nas classes 6 e 7. O oposto foi observado no grupo seminobre, pois a maioria dos bulbos encontra-se nas classes 3, 4 e 5. Dentre as cultivares avaliadas, a cultivar São Valentim se adaptou melhor às condições edafoclimáticas da região, apresentando elevado potencial produtivo.Brazil could increase garlic production up to the point of supplying the internal demand. To achieve this success, it is necessary to evaluate the maximum number of cultivars to establish the best ones for each region. Therefore, we aimed to evaluate economic yield and quality of

  16. Avaliação de cultivares de berinjela em armazenamento refrigerado Post-harvest quality of eggplant cultivars in cold storage

    Directory of Open Access Journals (Sweden)

    Ricardo Alfredo Kluge

    1999-01-01

    Full Text Available Frutos de diferentes cultivares de berinjela foram armazenados a 11 + 0,5ºC e 90 + 5% UR, por períodos de 7, 14 e 21 dias (+ 2 dias a 24-25ºC e 70-75% UR, com o objetivo de verificar o comportamento pós-colheita destes frutos. As cultivares estudadas foram Diamante Negro, Kiko, Piracicaba F-100, Flórida Market, Super F-100, F-2000, Suzuki, Nápoli e Ciça. Verificaram-se diferenças nas respostas das diferentes cultivares em relação à perda de peso, pressão de turgescência e qualidade global durante o armazenamento refrigerado. A frigoconservação dos frutos foi viável até 7 dias para todos as cultivares. O armazenamento por período superior a 7 dias dependeu da cultivar. A cultivar Super F-100 foi a que apresentou a maior capacidade de armazenamento (21 dias.Our objective was to evaluate the post-harvest behavior of nine eggplant cultivars. Fruits were stored at 11 + 0,5ºC e 90 + 5% RH, for periods of 7, 14 and 21 days (including 2 days of simulated commercialization at 24-25ºC and 70-75% RH. The cultivars studies were Diamante Negro, Kiko, Piracicaba F-100, Flórida Market, Super F-100, F-2000, Suzuki, Nápoli and Ciça. We measured changes in weight loss, turgor pressure and visual quality during the cold storage period. Low temperature storage of the fruits was acceptable up to 7 days for all cultivars. Storage above 7 days was dependent of the cultivar. The cultivar Super F-100 presented the largest storage capacity.

  17. Determination of Genetic Polymorphism Among Soybean (Glycine max. L. Merrill Cultivars Developed in Recent Years through RAPD Markers

    Directory of Open Access Journals (Sweden)

    Mine PAKYÜREK

    2015-01-01

    Full Text Available Genotype or cultivar identification is the first step to ensure plant breeder’s rights. If registered cultivars or germplasms were not distinguished by any mechanism, then seed production or novel varieties could not be controlled. The RAPD markers are chosen to distinguish seven soybean ( Glycine max. L. Merrill cultivars from each other  and to assign the polymorphisms among of them in this study. Eight primers were used and DNA fingerprinting of all cultivars were determined with that primers. According to that fingerprinting all cultivars were distingusihed from each other in DNA banding pattern. Using these markers results, similarity index in between soybean cultivars were calculated. Dwight and Maverick were the most similar cultivars ( These two cultivars were similar at 0,70 point to each other. In addition that Maverick and Defiance cultivars have shown the highest polymorphism rate ( These two cultivars were similar at 0,39 point each other. .

  18. Intergenic spacer length variants in Old Portuguese bread wheat cultivars

    Indian Academy of Sciences (India)

    Ana Carvalho; Henrique Guedes-Pinto; José Lima-Brito

    2011-08-01

    The intergenic spacer of the ribosomal DNA is highly variable, but is location specific in the nucleolar organizer region of the chromosomes. This study provides an event of high level of polymorphism / size variation and occurrence of 14 unique phenotypes in 48 landraces of Portuguese bread wheat cultivars for IGS-amplified products obtained by PCR-RFLP technique performed with TaqI. The attendant IGS polymorphism has been used to deduce affinities between landraces. Some of the high molecular weight IGS allelic variants were also probed for their chromosomal localization by sequential silver nitrate staining and fluorescence in situ hybridization. However, only the intergenic spacer allelic variant of 3.1 kb could be successfully hybridized, and was observed to be physically located on the chromosome pair 1B in the NOR loci of the cultivar ‘Magueija’.

  19. Free hydroxycinnamic acids, lycopene, and color parameters in tomato cultivars.

    Science.gov (United States)

    Hernández, Marcos; Rodríguez, Elena; Díaz, Carlos

    2007-10-17

    Concentrations of antioxidant compounds (total phenolic compounds, free hydroxycinnamic acids, and lycopene) and color parameters ( a*, b*, and L*) were determined in 167 tomato samples belonging to five cultivars (Dorothy, Boludo, Dunkan, Dominique, and Thomas) produced on the island of Tenerife. Chlorogenic, caffeic, p-coumaric, and ferulic acids were identified and quantified in the tomato samples. Chlorogenic acid had the highest mean concentration, whereas the p-coumaric was not detected in almost half of the tomato samples. The cultivar, cultivation method, and production region had little influence on the concentration of analyzed parameters. Considerable seasonal variations in the levels of these parameters were observed. Many correlations were observed between the antioxidant compounds and color parameters. The tomato samples tended to be differentiated according to the sampling period when discriminant analysis was applied.

  20. Sensory quality of scab-resistant apple cultivars

    OpenAIRE

    2001-01-01

    Twenty-two scab-resistant apple cultivars were harvested in autumn 1999 and evaluated for sensory quality the following October, November and December. Multivariate analysis was effective in describing the comblex relationships and variabillity among the numerous attributes used to characterise apple quality. Crispness, mealiness, skin toughness, apple flavour, sweetness, unripe flavour and overripe flavour were informative attributes describing the variation in the sensory quality. Texture a...

  1. Nodule senescence and biomass components in common bean cultivars

    OpenAIRE

    Fabián Fernández Luqueño; David Espinosa Victoria; Antonio Munive; Langen Corlay Chee; Luis M. Serrano Covarrubias

    2008-01-01

    Most legumes establish mutualistic symbiotic relationships with atmospheric nitrogen-fixing bacteria (rhizobia), giving origin to nodules. Nodules exhibit natural or induced aging which coincides with the drop in nitrogenase activity at the flowering period or at the pod filling stage. In this research, the onset of nodule senescence (NS) was evaluated under greenhouse conditions in five common bean (Phaseolus vulgaris L.) cultivars of two growth habits, determined (Type I) and indeterminate ...

  2. BRS 331 – Early cycle double-haploid wheat cultivar

    Directory of Open Access Journals (Sweden)

    Pedro Luiz Scheeren

    2016-12-01

    Full Text Available The wheat cultivar ‘BRS 331’ was developed by Embrapa. It results from an interspecific cross between wheat and maize by double-hapolid method. ‘BRS 331’ shows solid stem in the base of the plant, short leaves and super-early cycle to maturity. It is classified as bread wheat in all of the regions that is recommended in the States of Rio Grande do Sul, Paraná and Santa Catarina, Brazil.

  3. A new red -fleshed kiwifruit cultivar ‘Chuhong’

    Institute of Scientific and Technical Information of China (English)

    WangZhongyan; ZhongCaihong; BuFanwen

    2004-01-01

    ‘Chuhong’ is a red-fleshed kiwifruit cultivar selected from Actinidia chinensis var. rufopulpa grown in the wild.The fruit has beautiful red flesh color around the central core. It also has high soluble solids content and good taste. The plantsgrow well in both high and low altitude conditions, and are precocious and productive. The fruit matures in early September, and has reasonably good storage quality. There is a very positive response from customers according to preliminary marketing tests.

  4. The Impact of Switchgrass Cultivar Diversity on Nitrogen Use Efficiency

    Science.gov (United States)

    Johns, A. C.; Jastrow, J. D.; SIX, J. W. U. A.; Morris, G.; De Graaff, M. A.

    2015-12-01

    The search for new sources of sustainable energy has cast attention on switchgrass (Panicum virgatum L.) as a potential biofuel crop. However, growing switchgrass in a high-input, low-diversity cropping system can have negative environmental consequences, such as enhanced nitrate (NO3) leaching and nitrous oxide (N2O) emissions. Increasing plant diversity has been shown to promote plant production by increasing nitrogen (N) use efficiency (NUE), which may lower fertilizer requirements in cropping systems. With this study we asked how increasing cultivar diversity of switchgrass impacts NUE. The study took place at Fermilab National Environmental Research Park in Batavia, IL. In 2013, we applied a 15N tracer label to switchgrass planted in monocultures and mixtures of 2-types, 4-types, and 6-types of cultivars. We harvested the aboveground biomass and collected soil cores after one growing season. Preliminary data showed that cultivars differed significantly in yield and in the total 15N content in aboveground biomass, but there are no differences in tissue 15N concentration. In addition, there appears to be no effect of diversity level on 15N contents or concentrations. We intend to use this aboveground and soil 15N data to calculate NUE. These results could suggest that choosing the cultivar that most efficiently takes up N and produces the most yield may be more important than increasing diversity to promote the efficacy of biofuel feedstock production. However, increasing diversity can have other positive ecological consequences and does not appear to have negative impacts on yield or the N cycle.

  5. Evaluation of Tunisian olive oils from different cultivars

    OpenAIRE

    Slim, Souihli; Rodrigues, Nuno; Dias, Luís G.; Veloso, Ana C. A.; Pereira, José A.; Oueslati, Souheib; António M. Peres

    2016-01-01

    [Excerpt] Olive oil is a highly appreciated food product due to sensory and healthy attributes, being quite prone to frauds. So, physicochemical evaluation of olive oils is legally required. In this study, 43 olive oil samples produced in Tunisia from different olive cultivars (groups: Sahli cv – 11 samples; Chetoui cv- 26 samples; and, Other cvs – 4 samples including Leguim cv and Arbequina cv) were physicochemically evaluated taking into account: (i) free acidity (FA), K232 and K270 extinct...

  6. Soil covering in organic cultivation of onion cultivars

    OpenAIRE

    Leonardo Barreto Tavella; Regina Lúcia Felix Ferreira; Sebastião Elviro de Araújo Neto; Antônio Jussie da Silva Solino; Eliana Mara Napoli Corrêa de Paula da Silva; Maísa Pinto Bravin

    2015-01-01

    The soil preparation in horticulture, including organic, is characterized by intense soil tillage, which increases energy costs and unbalanced the environment. The organic system in onion cultivation has shown satisfactory results, however the soil covering use tends to improve the cultivation environment and may result in higher yields. The objective of this work was to evaluate the performance of onion cultivars in organic cultivation under different soil coverages. The experiment was co...

  7. CALLUS INDUCTION FROM 15 CARNATION (DIANTHUS CARYOPHYLLUS L.) CULTIVARS

    OpenAIRE

    Teixeira da Silva, Jaime A.

    2014-01-01

    Plant growth regulators (PGRs) were used to induce callus in 15 carnation (Dianthus caryophyllus L.; Caryophyllaceae) cultivars: Orange Sherbert, Avalanche, Magenta, La France, Stripe Red, Marie, Concerto PVP, Snap, Lucky Pierot, Cinnamon Tea, White Love, Siberia, Magesta, Spark Bruno, and Honono no Estejo. Seeds were initially sown on autoclaved moistened filter paper and internodes of surface-sterilized seedlings were used as explants. Most callus was induced in the presence of 0.5 mg/L α-n...

  8. CULTIVARES DE MILHO E DE GRAMÍNEAS FORRAGEIRAS SOB MONOCULTIVO E CONSORCIAÇÃO MAIZE AND FORAGE GRASS CULTIVARS UNDER MONOCROPPING AND INTERCROPPING SYSTEMS

    National Research Council Canada - National Science Library

    Lindomar Pereira Simões; Emerson Alexandrino; Thales Augusto Duarte Daniel; Adriano Jakelaitis; Kennedy Vidal Souza; Josia Ludtke

    2010-01-01

    ...) e o segundo por quatro cultivares forrageiras (Marandu e Xaraés, de B. brizantha , e Tanzânia e Mombaça, de P. maximum ). Os sete tratamentos adicionais corresponderam aos respectivos monocultivos das cultivares testadas...

  9. Eficiência hospedeira de oito cultivares de bananeira a fitonematóides Host reaction of eight banana cultivars to plant parasitic nematodes

    Directory of Open Access Journals (Sweden)

    Leila Lucí Dinardo-Miranda

    1996-01-01

    Full Text Available Os cultivares de bananeira (Musa spp. Grande Naine, Nanicão Jangada, Nanicão (Grupo AAA, Enxerto, Prata, Prata Zulu, Maçã e Mysore (Grupo AAB foram plantados em campo e avaliados quanto à eficiência hospedeira a nematóides. Todos eles apresentaram elevadas populações de Meloidogyne arenaria raça 1, sendo considerados, portanto, hospedeiros favoráveis dessa espécie. Os cultivares do grupo AAA e Mysore foram também hospedeiros favoráveis de Radopholus similis, enquanto os demais do grupo AAB se comportaram como hospedeiros pouco favoráveis. Helicotylenchus dihystera foi detectado em baixas populações, em raízes e no solo da rizosfera de todos os cultivares.The host reaction of eight banana cultivars (Musa spp. to nematodes was assessed in a field experiment. Three cultivars evaluated were members of AAA Group (Grande Naine, Nanicão and Nanicão Jangada and five belonged to AAB Group (Prata, Enxerto, Prata Zulu, Maçã and Mysore. All cultivars were infested by Meloidogyne arenaria race 1, rated as efficient hosts. The AAA Group cultivars and Mysore were also efficient hosts to Radopholus similis, whereas Prata, Enxerto and Maçã were not. Helicotylenchus dihystera was detected at low density populations in soil and root samples of all cultivars.

  10. Dissecting the Genetic Basis of Extremely Large Grain Shape in Rice Cultivar ‘JZ1560'

    Institute of Scientific and Technical Information of China (English)

    Jie-Zheng Ying; Ji-Ping Gao; Jun-Xiang Shan; Mei-Zhen Zhu; Min Shi; Hong-Xuan Lin

    2012-01-01

    Rice grain shape,grain length (GL),width (GW),thickness (GT) and length-to-width ratio (LWR),are usually controlled by multiple quantitative trait locus (QTL).To elucidate the genetic basis of extremely large grain shape,QTL analysis was performed using an F2 population derived from a cross between a japonica cultivar ‘JZ1560' (extremely large grain) and a contrasting indica cultivar ‘FAZ1' (small grain).A total number of 24 QTLs were detected on seven different chromosomes.QTLs for GL,GW,GT and LWR explained 11.6%,95.62%,91.5% and 89.9% of total phenotypic variation,respectively.Many QTLs pleiotropically controlled different grain traits,contributing complex traits correlation.GW2 and qSW5/GW5,which have been cloned previously to control GW,showed similar chromosomal locations with qGW2-1/qGT2-1/qLWR2-2 and qGW5-2/qLWR5-1 and should be the right candidate genes.Plants pyramiding GW2 and qSW5/GW5 showed a significant increase in GW compared with those carrying one of the two major QTLs.Furthermore,no significant QTL interaction was observed between GW2 and qSW5/GW5.These results suggested that GW2 and qSW5/GW5 might work in independent pathways to regulate grain traits.‘JZ1560' alleles underlying all QTLs contributed an increase in GW and GT and the accumulation of additive effects generates the extremely large grain shape in ‘JZ1560'.

  11. Descriptive analysis of flavor characteristics for black walnut cultivars.

    Science.gov (United States)

    Miller, Ashley E; Chambers, Delores H

    2013-06-01

    Seven black walnut cultivars, Brown Nugget, Davidson, Emma K, Football, Sparks 127, Sparrow, and Tomboy, were evaluated by descriptive sensory analysis. Seven trained panelists developed a lexicon for the black walnuts and scored the intensities of the samples for 22 flavor attributes. Results showed that the 7 samples differed significantly (P ≤ 0.05) on 13 of the attributes. For the majority of the attributes, only Emma K differed from the rest of the cultivars by being characterized with lower scores for black walnut ID, overall nutty, nutty-grain-like, nutty-buttery, floral/fruity, oily, and overall sweet. That sample also was higher in acrid, burnt, fruity-dark, musty/earthy, rancid, and bitter attributes. The remaining 6 cultivars showed few differences in individual attribute ratings, but did show some differences when mapped using multivariate techniques. Future studies should include descriptive analysis of other black walnut varieties, both wild and commercial, that could be grown and harvested for production. © 2013 Institute of Food Technologists®

  12. Near-infrared spectroscopy is feasible to discriminate hazelnut cultivars

    Directory of Open Access Journals (Sweden)

    Elisabetta Stella

    2013-09-01

    Full Text Available The study demonstrated the feasibility of the near infrared (NIR spectroscopy use for hazelnut-cultivar sorting. Hazelnut spectra were acquired from 600 fruit for each cultivar sample, two diffuse reflectance spectra were acquired from opposite sides of the same hazelnut. Spectral data were transformed into absorbance before the computations. A different variety of spectral pretreatments were applied to extract characteristics for the classification. An iterative Linear Discriminant Analysis (LDA algorithm was used to select a relatively small set of variables to correctly classify samples. The optimal group of features selected for each test was analyzed using Partial Least Squares Discriminant Analysis (PLS-DA. The spectral region most frequently chosen was the 1980-2060 nm range, which corresponds to best differentiation performance for a total minimum error rate lower than 1.00%. This wavelength range is generally associated with stretching and bending of the N-H functional group of amino acids and proteins. The feasibility of using NIR Spectroscopy to distinguish different hazelnut cultivars was demonstrated.

  13. In vitro starch digestion in sorghum flour from Algerian cultivars.

    Science.gov (United States)

    Souilah, Rachid; Djabali, Djaffar; Belhadi, Badreddine; Mokrane, Hind; Boudries, Nadia; Nadjemi, Boubekeur

    2014-05-01

    This work aims to evaluate starch digestion in whole sorghum grains. Nine sorghum cultivars were sampled from the Sahara of Algeria. The structural characteristics of sorghum grains were measured. Total starch (TS) varied between 67.67% and 74.82%, digestible starch (DS) between 64.34% and 69.70%, and resistant starch (RS) ranged from 2.55% to 7.98%. The kinetic of starch digestion displayed first-order model. For all sorghum cultivars, starch were digested with different extents, DS at infinite time (D ∞) ranged from 52.58 to 102.13 g/100 g dry starch, while the hydrolysis index (HI) ranged from 41.55% to 76.93% and high average glycemic index (GIavg) ranged from 65.97 to 94.14. The results showed that there are differences in grain quality of Algerian sorghum cultivars. The starch fractions have acceptable nutritional value with good in vitro digestibility characteristics suitable for human health and nutrition.

  14. Emergy assessment method for wheat cultivar efficiency and environmental sustainability

    Directory of Open Access Journals (Sweden)

    Janusz Jankowiak

    2009-01-01

    Full Text Available The method based on emergy was applied to quantify the fluxes of the energy, matter and monetary investment use (water, seeds, work, fertilizer and plant protecting agents, fuel, goods and services, productivity, environmental services and sustainability in typical wheat cultivar conducted in Wielkopolska. In order to convert all the flows mentioned into common base (seJ a conversion factors (solar transformities were used. In this way it was possible to consider also such flows that are free and generally neglected in the traditional balances. Generally only 52% emergy inflow is delivered by financial investment, while the remaining part, delivered in the form of the environmental services, is free. The Emergy Yield Ratio EYR = 1.14 indicate a low level of output per emergy investment unit. The values of Environmental Loading Ratio ELR = 11 and Emergy Sustainability Index ESI = 0.1 indicate an environmental stress and low level of cultivar sustainability, respectively. The final cultivar product (wheat has the emergy density 4.35 E12 seJ/kg and transformity 26.3 E4 seJ/J.

  15. Characterization of volatile aroma compounds in different brewing barley cultivars.

    Science.gov (United States)

    Dong, Liang; Hou, Yingmin; Li, Feng; Piao, Yongzhe; Zhang, Xiao; Zhang, Xiaoyu; Li, Cheng; Zhao, Changxin

    2015-03-30

    Beer is a popular alcoholic malt beverage resulting from fermentation of the aqueous extract of malted barley with hops. The aroma of brewing barley impacts the flavor of beer indirectly, because some flavor compounds or their precursors in beer come from the barley. The objectives of this research were to study volatile profiles and to characterize odor-active compounds of brewing barley in order to determine the variability of the aroma composition among different brewing barley cultivars. Forty-one volatiles comprising aldehydes, ketones, alcohols, organic acids, aromatic compounds and furans were identified using solid phase microextraction combined with gas chromatography/mass spectrometry, among which aldehydes, alcohols and ketones were quantitatively in greatest abundance. Quantitative measurements performed by means of solvent extraction and calculation of odor activity values revealed that acetaldehyde, 2-methylpropanal, 3-methylbutanal, 2-methylbutanal, hexanal, heptanal, octanal, nonanal, 3-methyl-1-butanol, cyclopentanol, 2,3-butanedione, 2,3-pentanedione, 2-heptanone, acetic acid, ethyl acetate, 2-pentylfuran and benzeneacetaldehyde, whose concentrations exceeded their odor thresholds, could be considered as odor-active compounds of brewing barley. Principal component analysis was employed to evaluate the differences among cultivars. The results demonstrated that the volatile profile based on the concentrations of aroma compounds enabled good differentiation of most barley cultivars. © 2014 Society of Chemical Industry.

  16. Response of carnation (Dianthus caryophyllus) cultivars to different postharvest preservatives.

    Science.gov (United States)

    Adugna, Biniam; Belew, Derbew; Kassa, Negussie

    2013-10-01

    Experiments were conducted to assess the effect of selected pulsing solutions on the days to flower bud shrinkage, leaf wilting and petal edge drying occurrence of carnation cultivars (Green-Go and Galy). The pulsing solutions used for this investigation were Silver Thiosulfate (STS) (0.2, 0.6, 1 mM) and also ethanol (6, 8, 10%), both received equal amount of sucrose (10%). Besides, to simulate the actual practice of the farm (0.4 mM Silver Thiosulfate (STS) plus 0.3 mM T.O.G) was used as a standard control. Senescence symptoms such as flower bud shrinkage, petal edge drying and leaf wilting were monitored. The results obtained showed that 1 mM STS plus 25 g sucrose achieved rapid petal edge drying for Green-Go cultivar. On the other hand, positive effects were also observed in days to flower bud shrinkage extended by 6 mM Silver Thiosulfate (STS) plus 25 g sucrose and being in par with 8% ethanol plus 25 g sucrose for Green-Go cultivar. Subsequently, the standard control, 0.6 mM Silver Thiosulfate (STS) plus 25 g sucrose and 8% ethanol plus 25 g sucrose attended comparable increment on the days to leaf wilting occurrences.

  17. Chemical characterization and genetic relationships among Ocimum basilicum L. cultivars.

    Science.gov (United States)

    Liber, Zlatko; Carović-Stanko, Klaudija; Politeo, Olivera; Strikić, Frane; Kolak, Ivan; Milos, Mladen; Satovic, Zlatko

    2011-11-01

    Twenty-seven Ocimum basilicum cultivars were subjected to a chemical characterization of essential oil components by gas chromatography/mass spectrometry (GC/MS) and a genetic characterization using the amplified fragment-length polymorphism (AFLP) technique. Since the same 27 accessions had previously been classified into six morphotypes, these analyses allowed us to make detailed comparisons of chemistry, genetics, and morphology. The chemical composition and morphology of the studied cultivars appeared to have a strong genetic component. The AFLP analysis revealed a distinction between the green and purple morphotypes. The green morphotypes predominantly utilized the terpene biosynthetic pathway, while most purple morphotypes primarily utilized the phenylpropene biosynthetic pathway. The GC/MS analysis led to identification of 87 volatiles. Among the 27 cultivars, five chemotypes were identified. A detailed characterization of the essential oil constituents indicated the existence of both specific combinations of compounds and 'private' compounds with the potential to be used in many aspects of human life. The established relationship between a genetic profile, chemical composition, and morphology represents an important step in future breeding programs and in the cultivation of this species.

  18. Polyphenol and glycoalkaloid contents in potato cultivars grown in Luxembourg.

    Science.gov (United States)

    Deusser, Hannah; Guignard, Cédric; Hoffmann, Lucien; Evers, Danièle

    2012-12-15

    The polyphenol (phenolic acids, flavanols and flavonols) and glycoalkaloid (α-chaconine and α-solanine) contents of potato tubers grown in Luxembourg were analyzed by UPLC-DAD and HPLC-MS/MS separately in peel (approx. 2mm), outer (approx. 1cm) and inner flesh. Polyphenol contents decreased from the peel via the outer to the inner flesh and differed among the cultivars. The cultivars Vitelotte and Luminella had the highest polyphenol contents (5202 and 572 μg/g dry weight (DW) in the outer flesh), whereas Charlotte and Bintje had the lowest contents (19.5 and 48.0 μg/g DW). Chlorogenic acid and its isomers (neo- and cryptochlorogenic acid) were the major polyphenols. Glycoalkaloid contents were highest in the peel and lowest in the inner flesh, values in the flesh were below guideline limits in all cultivars. In conclusion, potatoes contribute to the daily intake of polyphenols and their consumption, thereby, may have positive effects on health.

  19. Screening of Amaranth Cultivars (Amaranthus mangostanus L.) for Cadmium Hyperaccumulation

    Institute of Scientific and Technical Information of China (English)

    FAN Hong-li; ZHOU Wei

    2009-01-01

    The potential harm of soil cadmium pollution to ecological environment and human health has been increasingly widely concerned. Phytoremediation, as a kind of new and effective technology, has become an important method for cleaning up cadmium in contaminated sites. The amaranth (Amaranthus mangostanus L.) is widely distributed and has abundant varieties in China, its rapid growth and large biomass can be served as candidate for cadmium hyperaccumulators for phytoremediation. To obtain cadmium hyper-accumulator, Cd uptake in 23 amaranth euitivars from different ecological region was investigated under hydroponic culture condition. Meanwhile, pot experiment was established to probe phytoremediation potentiality of Cd contaminated soil by amaranth. Three treatment (Cd 5, 10, and 25 mg kg-1) were imposed to red soil, yellow brown soil, and vegetable soil. The results showed that under hydroponic culture with Cd 3 mg L-1, the cadmium concentration in the shoots of the cultivar Tianxingmi reached 260 mg kg-1, and its total cadmium uptake was the highest among various cultivars. In the treatment Cd 25 mg kg-1, the cadmium concentration in the shoots of the cultivar Tianxingmi reached 212 mg kg-1, while bioaccumulation factor and shoot purification rate reached 8.50 and 3.8%, respectively. Further, the total biomass and shoot biomass were not decreased significantly under Cd exposure.These results suggested that eultivar Tianxingmi is a typical Cd hyperaccumulator, and can be expected to be used in phytoremediation of Cd contaminated soil.

  20. Phosphorus Uptake from Rhizosphere Soilby Two Wheat Cultivars

    Institute of Scientific and Technical Information of China (English)

    MAJIAN; T.S.GAHOONIA; 等

    1998-01-01

    Inorganic soil phosphorus extractable with sodium bicarbonate(NaHCO3-Pi),soil pH and root hairs length and density in the rhizosphere of two winter wheat cultivars (Tritium aestivum L.cv.Shichum,Sleipner)grown on a high pH Chinese silt loam(52.7 mg NaHCO3-Pikg-1) and a Danish sandy loam(43.4mg NaHCO3-Pi kg-1)wer studied to assess how these wheat cultivars differed in phosphorus uptake.The rhizosphere soil pH of two wheat cultivars grown on the two soils were fairly unchanged with increasing distrance from the roo surface.However the root hairs of Shichun were 2.1 times longer than those of Sleipner,Root surface area(RSA) of Shichun increased by 192% due to root hairs whereas root hairs of Sleipner increased RSA by 68% only.Hence the root system of Shichun was in contact with more soil than that of Sleipner,even though Sleipner had a longer root,Grown at the lower pH and level of NaHCO3-Pi in the Danish soil Shichun absorbed more inorganic phosphorus than Sleipner whereas at the higher pH and level of NaHCO3-Pi in the Chinese soil there was no phosphorus uptake difference between the two wheat culivars.