WorldWideScience

Sample records for activity promotes dna

  1. Prediction of fine-tuned promoter activity from DNA sequence.

    Science.gov (United States)

    Siwo, Geoffrey; Rider, Andrew; Tan, Asako; Pinapati, Richard; Emrich, Scott; Chawla, Nitesh; Ferdig, Michael

    2016-01-01

    The quantitative prediction of transcriptional activity of genes using promoter sequence is fundamental to the engineering of biological systems for industrial purposes and understanding the natural variation in gene expression. To catalyze the development of new algorithms for this purpose, the Dialogue on Reverse Engineering Assessment and Methods (DREAM) organized a community challenge seeking predictive models of promoter activity given normalized promoter activity data for 90 ribosomal protein promoters driving expression of a fluorescent reporter gene. By developing an unbiased modeling approach that performs an iterative search for predictive DNA sequence features using the frequencies of various k-mers, inferred DNA mechanical properties and spatial positions of promoter sequences, we achieved the best performer status in this challenge. The specific predictive features used in the model included the frequency of the nucleotide G, the length of polymeric tracts of T and TA, the frequencies of 6 distinct trinucleotides and 12 tetranucleotides, and the predicted protein deformability of the DNA sequence. Our method accurately predicted the activity of 20 natural variants of ribosomal protein promoters (Spearman correlation r = 0.73) as compared to 33 laboratory-mutated variants of the promoters (r = 0.57) in a test set that was hidden from participants. Notably, our model differed substantially from the rest in 2 main ways: i) it did not explicitly utilize transcription factor binding information implying that subtle DNA sequence features are highly associated with gene expression, and ii) it was entirely based on features extracted exclusively from the 100 bp region upstream from the translational start site demonstrating that this region encodes much of the overall promoter activity. The findings from this study have important implications for the engineering of predictable gene expression systems and the evolution of gene expression in naturally occurring

  2. Regularities in the E.coli promoters composition in connection with the DNA strands interaction and promoter activity

    Institute of Scientific and Technical Information of China (English)

    BEREZHNOY Andrey Yu; SHCKORBATOV Yuriy G.; HISANORI Kiryu

    2006-01-01

    The energy of interaction between DNA strands in promoters is of great functional importance. Visualization of the energy of DNA strands distribution in promoter sequences was achieved. The separation of promoters in groups by their energetic properties enables evaluation of the dependence of promoter strength on the energetic properties. The analysis of groups (clusters)of promoters distributed by the energy of DNA strands interaction in -55, -35, -10 and +6 sequences indicates their connection with the transcriptional activity.

  3. nifH Promoter Activity Is Regulated by DNA Supercoiling in Sinorhizobium meliloti

    Institute of Scientific and Technical Information of China (English)

    Yan-Jie LIU; Biao HU; Jia-Bi ZHU; Shan-Jiong SHEN; Guan-Qiao YU

    2005-01-01

    In prokaryotes, DNA supercoiling regulates the expression of many genes; for example, the expression of Klebsiella pneumoniae nifLA operon depends on DNA negative supercoiling in anaerobically grown cells, which indicates that DNA supercoiling might play a role in gene regulation of the anaerobic response. Since the expression of the nifH promoter in Sinorhizobium meliloti is not repressed by oxygen, it is proposed that the status of DNA supercoiling may not affect the expression of the nifH promoter. We tested this hypothesis by analyzing nifH promoter activity in wild-type and gyr- Escherichia coli in the presence and absence of DNA gyrase inhibitors. Our results show that gene expression driven by the S.meliloti nifH promoter requires the presence of active DNA gyrase. Because DNA gyrase increases the number of negative superhelical turns in DNA in the presence of ATP, our data indicate that negative supercoiling is also important for nifH promoter activity. Our study also shows that the DNA supercoilingdependent S. meliloti nifH promoter activity is related to the trans-acting factors NtrC and NifA that activate it. DNA supercoiling appeared to have a stronger effect on NtrC-activated nifH promoter activity than on NifA-activated promoter activity. Collectively, these results from the S. meliloti nifH promoter model system seem to indicate that, in addition to regulating gene expression during anaerobic signaling, DNA supercoiling may also provide a favorable topology for trans-acting factor binding and promoter activation regardless of oxygen status.

  4. Anthracyclines induce double-strand DNA breaks at active gene promoters.

    Science.gov (United States)

    Yang, Fan; Kemp, Christopher J; Henikoff, Steven

    2015-03-01

    Doxorubicin is a widely used chemotherapeutic drug that intercalates between DNA base-pairs and poisons Topoisomerase II, although the mechanistic basis for cell killing remains speculative. Doxorubicin and related anthracycline compounds have been shown to increase nucleosome turnover and/or eviction around promoters, which suggests that the resulting enhanced exposure of DNA might underlie cell killing. Previously, we showed that low doses of anthracyclines increase nucleosome turnover around active gene promoters, which suggests that loss of nucleosomes might contribute to cancer cell killing. Here we apply a genome-wide method to precisely map DNA double-strand breaks (DSBs) in cancer cells. We find that spontaneous DSBs occur preferentially around promoters of active genes, and that both anthracyclines and etoposide, a Topoisomerase II poison, increase DSBs around promoters, although CpG islands are conspicuously protected from DSBs. We propose that torsion-based enhancement of nucleosome turnover by anthracyclines exposes promoter DNA, ultimately causing DSBs around promoters.

  5. Lamin A Is an Endogenous SIRT6 Activator and Promotes SIRT6-Mediated DNA Repair

    Directory of Open Access Journals (Sweden)

    Shrestha Ghosh

    2015-11-01

    Full Text Available The nuclear lamins are essential for various molecular events in the nucleus, such as chromatin organization, DNA replication, and provision of mechanical support. A specific point mutation in the LMNA gene creates a truncated prelamin A termed progerin, causing Hutchinson-Gilford progeria syndrome (HGPS. SIRT6 deficiency leads to defective genomic maintenance and accelerated aging similar to HGPS, suggesting a potential link between lamin A and SIRT6. Here, we report that lamin A is an endogenous activator of SIRT6 and facilitates chromatin localization of SIRT6 upon DNA damage. Lamin A promotes SIRT6-dependent DNA-PKcs (DNA-PK catalytic subunit recruitment to chromatin, CtIP deacetylation, and PARP1 mono-ADP ribosylation in response to DNA damage. The presence of progerin jeopardizes SIRT6 activation and compromises SIRT6-mediated molecular events in response to DNA damage. These data reveal a critical role for lamin A in regulating SIRT6 activities, suggesting that defects in SIRT6 functions contribute to impaired DNA repair and accelerated aging in HGPS.

  6. DNA Topoisomerases maintain promoters in a state competent for transcriptional activation in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Jakob Madsen Pedersen

    Full Text Available To investigate the role of DNA topoisomerases in transcription, we have studied global gene expression in Saccharomyces cerevisiae cells deficient for topoisomerases I and II and performed single-gene analyses to support our findings. The genome-wide studies show a general transcriptional down-regulation upon lack of the enzymes, which correlates with gene activity but not gene length. Furthermore, our data reveal a distinct subclass of genes with a strong requirement for topoisomerases. These genes are characterized by high transcriptional plasticity, chromatin regulation, TATA box presence, and enrichment of a nucleosome at a critical position in the promoter region, in line with a repressible/inducible mode of regulation. Single-gene studies with a range of genes belonging to this group demonstrate that topoisomerases play an important role during activation of these genes. Subsequent in-depth analysis of the inducible PHO5 gene reveals that topoisomerases are essential for binding of the Pho4p transcription factor to the PHO5 promoter, which is required for promoter nucleosome removal during activation. In contrast, topoisomerases are dispensable for constitutive transcription initiation and elongation of PHO5, as well as the nuclear entrance of Pho4p. Finally, we provide evidence that topoisomerases are required to maintain the PHO5 promoter in a superhelical state, which is competent for proper activation. In conclusion, our results reveal a hitherto unknown function of topoisomerases during transcriptional activation of genes with a repressible/inducible mode of regulation.

  7. Isolation, cDNA cloning, and growth promoting activity of rabbitfish (Siganus guttatus) growth hormone.

    Science.gov (United States)

    Ayson, F G; de Jesus, E G; Amemiya, Y; Moriyama, S; Hirano, T; Kawauchi, H

    2000-02-01

    We report the isolation, cDNA cloning, and growth promoting activity of rabbitfish (Siganus guttatus; Teleostei; Perciformes; Siganidae) growth hormone (GH). Rabbitfish GH was extracted from pituitary glands under alkaline conditions, fractionated by gel filtration chromatography on Sephadex G-100, and purified by high-performance liquid chromatography. The fractions containing GH were identified by immunoblotting with bonito GH antiserum. Under nonreducing conditions, the molecular weight of rabbitfish GH is about 19 kDa as estimated by SDS-PAGE. The purified hormone was potent in promoting growth in rabbitfish fry. Weekly intraperitoneal injections of the hormone significantly accelerated growth. This was evident 3 weeks after the start of the treatment, and its effect was still significant 2 weeks after the treatment was terminated. Rabbitfish GH cDNA was cloned to determine its nucleotide sequence. Excluding the poly (A) tail, rabbitfish GH cDNA is 860 base pairs (bp) long. It contained untranslated regions of 94 and 175 bp in the 5' and 3' ends, respectively. It has an open reading frame of 588 bp coding for a signal peptide of 18 amino acids and a mature protein of 178 amino acid residues. Rabbitfish GH has 4 cysteine residues. On the amino acid level, rabbitfish GH shows high identity (71-74%) with GHs of other perciforms, such as tuna, sea bass, yellow tail, bonito, and tilapia, and less (47-49%) identity with salmonid and carp GHs.

  8. Prophage spontaneous activation promotes DNA release enhancing biofilm formation in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Margarida Carrolo

    Full Text Available Streptococcus pneumoniae (pneumococcus is able to form biofilms in vivo and previous studies propose that pneumococcal biofilms play a relevant role both in colonization and infection. Additionally, pneumococci recovered from human infections are characterized by a high prevalence of lysogenic bacteriophages (phages residing quiescently in their host chromosome. We investigated a possible link between lysogeny and biofilm formation. Considering that extracellular DNA (eDNA is a key factor in the biofilm matrix, we reasoned that prophage spontaneous activation with the consequent bacterial host lysis could provide a source of eDNA, enhancing pneumococcal biofilm development. Monitoring biofilm growth of lysogenic and non-lysogenic pneumococcal strains indicated that phage-infected bacteria are more proficient at forming biofilms, that is their biofilms are characterized by a higher biomass and cell viability. The presence of phage particles throughout the lysogenic strains biofilm development implicated prophage spontaneous induction in this effect. Analysis of lysogens deficient for phage lysin and the bacterial major autolysin revealed that the absence of either lytic activity impaired biofilm development and the addition of DNA restored the ability of mutant strains to form robust biofilms. These findings establish that limited phage-mediated host lysis of a fraction of the bacterial population, due to spontaneous phage induction, constitutes an important source of eDNA for the S. pneumoniae biofilm matrix and that this localized release of eDNA favors biofilm formation by the remaining bacterial population.

  9. Characterization and isolation of a T-DNA tagged banana promoter active during in vitro culture and low temperature stress

    Directory of Open Access Journals (Sweden)

    Windelinckx Saskia

    2009-06-01

    Full Text Available Abstract Background Next-generation transgenic plants will require a more precise regulation of transgene expression, preferably under the control of native promoters. A genome-wide T-DNA tagging strategy was therefore performed for the identification and characterization of novel banana promoters. Embryogenic cell suspensions of a plantain-type banana were transformed with a promoterless, codon-optimized luciferase (luc+ gene and low temperature-responsive luciferase activation was monitored in real time. Results Around 16,000 transgenic cell colonies were screened for baseline luciferase activity at room temperature 2 months after transformation. After discarding positive colonies, cultures were re-screened in real-time at 26°C followed by a gradual decrease to 8°C. The baseline activation frequency was 0.98%, while the frequency of low temperature-responsive luciferase activity was 0.61% in the same population of cell cultures. Transgenic colonies with luciferase activity responsive to low temperature were regenerated to plantlets and luciferase expression patterns monitored during different regeneration stages. Twenty four banana DNA sequences flanking the right T-DNA borders in seven independent lines were cloned via PCR walking. RT-PCR analysis in one line containing five inserts allowed the identification of the sequence that had activated luciferase expression under low temperature stress in a developmentally regulated manner. This activating sequence was fused to the uidA reporter gene and back-transformed into a commercial dessert banana cultivar, in which its original expression pattern was confirmed. Conclusion This promoter tagging and real-time screening platform proved valuable for the identification of novel promoters and genes in banana and for monitoring expression patterns throughout in vitro development and low temperature treatment. Combination of PCR walking techniques was efficient for the isolation of candidate

  10. Construction of recombinant adenovirus with Egr-1 promoter and Smad7 cDNA and study of the Egr-1 promoter's biological activity

    International Nuclear Information System (INIS)

    Objective: To construct a recombinant replication-defective adenovirus containing Egr-1 promoter and Smad7 cDNA, then to evaluate the biological activity of Egr-1 promoter. Methods: Based on Adeno- XTM expression system, CMV promoter of the pShuttle vector was replaced by Egr-1 promoter, and the Smad7 cDNA was subcloned into the MCS(multiple cloning site) of pShuttle. The recombinant pShuttle was then sub-cloned into the Adeno-XTM genome, which was transformed into E. coli to get recombinant Adeno-XTM plasmid DNA. The recombinant adenovirus was packaged and amplified in the transfected HEK293 cells before it was purified and tested for viral titer. The fibroblasts (3T6 cells) infected by the recombinant adenovirus were irradiated , and the activity of Egr-1 promoter was quantitively determined by the amount of Smad7 protein expressed in the 3T6 cells using Western blot. Results: Identified by restriction endonuclease analysis and PCR, the recombinant adenovirus containing Egr-1 promoter and Smad7 cDNA was constructed successfully, with a viral titer of 1.0 x 1011 TCID50/ml. The expressed amount of Smad7 protein varied at different dose levels and different time points post-irradiation in the 3T6 cells infected with the recombinant adenovirus. The amount of Smad7 protein increased along with the rising of the irradiation dose, and remained at a high expression level from 8 Gy to 15 Gy. The amount of Smad7 protein started to increase at 2 hours post-irradiation, and maintained a relatively high level for the next 5 hours before it descended, which was not observed in the control 3T6 cells. Conclusions: With the aid of Adeno-XTM expression system and molecular cloning techniques, construction of recombinant adenovirus could be quick and efficient. The recombined Egr-1 promoter has the activity of regulating the expression of downstream Smad7 cDNA. The increase in Smad7 expression under control of Egr-1 promoter induced by ionizing radiation is time- and dose

  11. DNA Topoisomerases Maintain Promoters in a State Competent for Transcriptional Activation in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Pedersen, Jakob Madsen; Fredsøe, Jacob Christian; Rødgaard, Morten Terpager;

    2012-01-01

    To investigate the role of DNA topoisomerases in transcription, we have studied global gene expression in Saccharomyces cerevisiae cells deficient for topoisomerases I and II and performed single-gene analyses to support our findings. The genome-wide studies show a general transcriptional down-re...... transcriptional activation of genes with a repressible/inducible mode of regulation....

  12. Genomically amplified Akt3 activates DNA repair pathway and promotes glioma progression.

    Science.gov (United States)

    Turner, Kristen M; Sun, Youting; Ji, Ping; Granberg, Kirsi J; Bernard, Brady; Hu, Limei; Cogdell, David E; Zhou, Xinhui; Yli-Harja, Olli; Nykter, Matti; Shmulevich, Ilya; Yung, W K Alfred; Fuller, Gregory N; Zhang, Wei

    2015-03-17

    Akt is a robust oncogene that plays key roles in the development and progression of many cancers, including glioma. We evaluated the differential propensities of the Akt isoforms toward progression in the well-characterized RCAS/Ntv-a mouse model of PDGFB-driven low grade glioma. A constitutively active myristoylated form of Akt1 did not induce high-grade glioma (HGG). In stark contrast, Akt2 and Akt3 showed strong progression potential with 78% and 97% of tumors diagnosed as HGG, respectively. We further revealed that significant variations in polarity and hydropathy values among the Akt isoforms in both the pleckstrin homology domain (P domain) and regulatory domain (R domain) were critical in mediating glioma progression. Gene expression profiles from representative Akt-derived tumors indicated dominant and distinct roles for Akt3, consisting primarily of DNA repair pathways. TCGA data from human GBM closely reflected the DNA repair function, as Akt3 was significantly correlated with a 76-gene signature DNA repair panel. Consistently, compared with Akt1 and Akt2 overexpression models, Akt3-expressing human GBM cells had enhanced activation of DNA repair proteins, leading to increased DNA repair and subsequent resistance to radiation and temozolomide. Given the wide range of Akt3-amplified cancers, Akt3 may represent a key resistance factor.

  13. Long-term pancreatic beta cell exposure to high levels of glucose but not palmitate induces DNA methylation within the insulin gene promoter and represses transcriptional activity.

    Directory of Open Access Journals (Sweden)

    Kota Ishikawa

    Full Text Available Recent studies have implicated epigenetics in the pathophysiology of diabetes. Furthermore, DNA methylation, which irreversibly deactivates gene transcription, of the insulin promoter, particularly the cAMP response element, is increased in diabetes patients. However, the underlying mechanism remains unclear. We aimed to investigate insulin promoter DNA methylation in an over-nutrition state. INS-1 cells, the rat pancreatic beta cell line, were cultured under normal-culture-glucose (11.2 mmol/l or experimental-high-glucose (22.4 mmol/l conditions for 14 days, with or without 0.4 mmol/l palmitate. DNA methylation of the rat insulin 1 gene (Ins1 promoter was investigated using bisulfite sequencing and pyrosequencing analysis. Experimental-high-glucose conditions significantly suppressed insulin mRNA and increased DNA methylation at all five CpG sites within the Ins1 promoter, including the cAMP response element, in a time-dependent and glucose concentration-dependent manner. DNA methylation under experimental-high-glucose conditions was unique to the Ins1 promoter; however, palmitate did not affect DNA methylation. Artificial methylation of Ins1 promoter significantly suppressed promoter-driven luciferase activity, and a DNA methylation inhibitor significantly improved insulin mRNA suppression by experimental-high-glucose conditions. Experimental-high-glucose conditions significantly increased DNA methyltransferase activity and decreased ten-eleven-translocation methylcytosine dioxygenase activity. Oxidative stress and endoplasmic reticulum stress did not affect DNA methylation of the Ins1 promoter. High glucose but not palmitate increased ectopic triacylglycerol accumulation parallel to DNA methylation. Metformin upregulated insulin gene expression and suppressed DNA methylation and ectopic triacylglycerol accumulation. Finally, DNA methylation of the Ins1 promoter increased in isolated islets from Zucker diabetic fatty rats. This study helps to

  14. Long-term pancreatic beta cell exposure to high levels of glucose but not palmitate induces DNA methylation within the insulin gene promoter and represses transcriptional activity.

    Science.gov (United States)

    Ishikawa, Kota; Tsunekawa, Shin; Ikeniwa, Makoto; Izumoto, Takako; Iida, Atsushi; Ogata, Hidetada; Uenishi, Eita; Seino, Yusuke; Ozaki, Nobuaki; Sugimura, Yoshihisa; Hamada, Yoji; Kuroda, Akio; Shinjo, Keiko; Kondo, Yutaka; Oiso, Yutaka

    2015-01-01

    Recent studies have implicated epigenetics in the pathophysiology of diabetes. Furthermore, DNA methylation, which irreversibly deactivates gene transcription, of the insulin promoter, particularly the cAMP response element, is increased in diabetes patients. However, the underlying mechanism remains unclear. We aimed to investigate insulin promoter DNA methylation in an over-nutrition state. INS-1 cells, the rat pancreatic beta cell line, were cultured under normal-culture-glucose (11.2 mmol/l) or experimental-high-glucose (22.4 mmol/l) conditions for 14 days, with or without 0.4 mmol/l palmitate. DNA methylation of the rat insulin 1 gene (Ins1) promoter was investigated using bisulfite sequencing and pyrosequencing analysis. Experimental-high-glucose conditions significantly suppressed insulin mRNA and increased DNA methylation at all five CpG sites within the Ins1 promoter, including the cAMP response element, in a time-dependent and glucose concentration-dependent manner. DNA methylation under experimental-high-glucose conditions was unique to the Ins1 promoter; however, palmitate did not affect DNA methylation. Artificial methylation of Ins1 promoter significantly suppressed promoter-driven luciferase activity, and a DNA methylation inhibitor significantly improved insulin mRNA suppression by experimental-high-glucose conditions. Experimental-high-glucose conditions significantly increased DNA methyltransferase activity and decreased ten-eleven-translocation methylcytosine dioxygenase activity. Oxidative stress and endoplasmic reticulum stress did not affect DNA methylation of the Ins1 promoter. High glucose but not palmitate increased ectopic triacylglycerol accumulation parallel to DNA methylation. Metformin upregulated insulin gene expression and suppressed DNA methylation and ectopic triacylglycerol accumulation. Finally, DNA methylation of the Ins1 promoter increased in isolated islets from Zucker diabetic fatty rats. This study helps to clarify the

  15. Activation of the Pleiotropic Drug Resistance Pathway Can Promote Mitochondrial DNA Retention by Fusion-Defective Mitochondria in Saccharomyces cerevisiae

    OpenAIRE

    Dunn, Cory, D.; Mutlu, Nebibe; Garipler, Gorkem; Akdogan, Emel

    2014-01-01

    1 Activation of the pleiotropic drug resistance pathway can promote mitochondrial DNA retention by fusion-defective mitochondria in Saccharomyces cerevisiae Nebibe Mutlu1, Görkem Garipler, Emel Akdoğan and Cory D. Dunn Department of Molecular Biology and Genetics Koç University Sarıyer, İstanbul, 34450 Turkey 1 Present address: Department of Molecular, Cellular, and Developmental Biology, University of Michigan, Ann Arbor, Michigan, 48109, U.S.A. NCBI Sequence...

  16. Sirtuin 7 promotes cellular survival following genomic stress by attenuation of DNA damage, SAPK activation and p53 response

    International Nuclear Information System (INIS)

    Maintaining the genomic integrity is a constant challenge in proliferating cells. Amongst various proteins involved in this process, Sirtuins play a key role in DNA damage repair mechanisms in yeast as well as mammals. In the present work we report the role of one of the least explored Sirtuin viz., SIRT7, under conditions of genomic stress when treated with doxorubicin. Knockdown of SIRT7 sensitized osteosarcoma (U2OS) cells to DNA damage induced cell death by doxorubicin. SIRT7 overexpression in NIH3T3 delayed cell cycle progression by causing delay in G1 to S transition. SIRT7 overexpressing cells when treated with low dose of doxorubicin (0.25 µM) showed delayed onset of senescence, lesser accumulation of DNA damage marker γH2AX and lowered levels of growth arrest markers viz., p53 and p21 when compared to doxorubicin treated control GFP expressing cells. Resistance to DNA damage following SIRT7 overexpression was also evident by EdU incorporation studies where cellular growth arrest was significantly delayed. When treated with higher dose of doxorubicin (>1 µM), SIRT7 conferred resistance to apoptosis by attenuating stress activated kinases (SAPK viz., p38 and JNK) and p53 response thereby shifting the cellular fate towards senescence. Interestingly, relocalization of SIRT7 from nucleolus to nucleoplasm together with its co-localization with SAPK was an important feature associated with DNA damage. SIRT7 mediated resistance to doxorubicin induced apoptosis and senescence was lost when p53 level was restored by nutlin treatment. Overall, we propose SIRT7 attenuates DNA damage, SAPK activation and p53 response thereby promoting cellular survival under conditions of genomic stress. - Highlights: • Knockdown of SIRT7 sensitized cells to DNA damage induced apoptosis. • SIRT7 delayed onset of premature senescence by attenuating DNA damage response. • Overexpression of SIRT7 delayed cell cycle progression by delaying G1/S transition. • Upon DNA damage SIRT

  17. Sirtuin 7 promotes cellular survival following genomic stress by attenuation of DNA damage, SAPK activation and p53 response

    Energy Technology Data Exchange (ETDEWEB)

    Kiran, Shashi; Oddi, Vineesha [Laboratory of Cancer Biology, Centre for DNA Fingerprinting and Diagnostics, Hyderabad, Telangana, 500001 (India); Ramakrishna, Gayatri, E-mail: gayatrirama1@gmail.com [Laboratory of Cancer Biology, Centre for DNA Fingerprinting and Diagnostics, Hyderabad, Telangana, 500001 (India); Laboratory of Cancer Cell Biology, Department of Research, Institute of Liver and Biliary Sciences, Delhi 110070 (India)

    2015-02-01

    Maintaining the genomic integrity is a constant challenge in proliferating cells. Amongst various proteins involved in this process, Sirtuins play a key role in DNA damage repair mechanisms in yeast as well as mammals. In the present work we report the role of one of the least explored Sirtuin viz., SIRT7, under conditions of genomic stress when treated with doxorubicin. Knockdown of SIRT7 sensitized osteosarcoma (U2OS) cells to DNA damage induced cell death by doxorubicin. SIRT7 overexpression in NIH3T3 delayed cell cycle progression by causing delay in G1 to S transition. SIRT7 overexpressing cells when treated with low dose of doxorubicin (0.25 µM) showed delayed onset of senescence, lesser accumulation of DNA damage marker γH2AX and lowered levels of growth arrest markers viz., p53 and p21 when compared to doxorubicin treated control GFP expressing cells. Resistance to DNA damage following SIRT7 overexpression was also evident by EdU incorporation studies where cellular growth arrest was significantly delayed. When treated with higher dose of doxorubicin (>1 µM), SIRT7 conferred resistance to apoptosis by attenuating stress activated kinases (SAPK viz., p38 and JNK) and p53 response thereby shifting the cellular fate towards senescence. Interestingly, relocalization of SIRT7 from nucleolus to nucleoplasm together with its co-localization with SAPK was an important feature associated with DNA damage. SIRT7 mediated resistance to doxorubicin induced apoptosis and senescence was lost when p53 level was restored by nutlin treatment. Overall, we propose SIRT7 attenuates DNA damage, SAPK activation and p53 response thereby promoting cellular survival under conditions of genomic stress. - Highlights: • Knockdown of SIRT7 sensitized cells to DNA damage induced apoptosis. • SIRT7 delayed onset of premature senescence by attenuating DNA damage response. • Overexpression of SIRT7 delayed cell cycle progression by delaying G1/S transition. • Upon DNA damage SIRT

  18. Cdc6 ATPase activity disengages Cdc6 from the pre-replicative complex to promote DNA replication.

    Science.gov (United States)

    Chang, FuJung; Riera, Alberto; Evrin, Cecile; Sun, Jingchuan; Li, Huilin; Speck, Christian; Weinreich, Michael

    2015-08-25

    To initiate DNA replication, cells first load an MCM helicase double hexamer at origins in a reaction requiring ORC, Cdc6, and Cdt1, also called pre-replicative complex (pre-RC) assembly. The essential mechanistic role of Cdc6 ATP hydrolysis in this reaction is still incompletely understood. Here, we show that although Cdc6 ATP hydrolysis is essential to initiate DNA replication, it is not essential for MCM loading. Using purified proteins, an ATPase-defective Cdc6 mutant 'Cdc6-E224Q' promoted MCM loading on DNA. Cdc6-E224Q also promoted MCM binding at origins in vivo but cells remained blocked in G1-phase. If after loading MCM, Cdc6-E224Q was degraded, cells entered an apparently normal S-phase and replicated DNA, a phenotype seen with two additional Cdc6 ATPase-defective mutants. Cdc6 ATP hydrolysis is therefore required for Cdc6 disengagement from the pre-RC after helicase loading to advance subsequent steps in helicase activation in vivo.

  19. In Vitro and In Vivo Plant Growth Promoting Activities and DNA Fingerprinting of Antagonistic Endophytic Actinomycetes Associates with Medicinal Plants.

    Science.gov (United States)

    Passari, Ajit Kumar; Mishra, Vineet Kumar; Gupta, Vijai Kumar; Yadav, Mukesh Kumar; Saikia, Ratul; Singh, Bhim Pratap

    2015-01-01

    Endophytic actinomycetes have shown unique plant growth promoting as well as antagonistic activity against fungal phytopathogens. In the present study forty-two endophytic actinomycetes recovered from medicinal plants were evaluated for their antagonistic potential and plant growth-promoting abilities. Twenty-two isolates which showed the inhibitory activity against at least one pathogen were subsequently tested for their plant-growth promoting activities and were compared genotypically using DNA based fingerprinting, including enterobacterial repetitive intergenic consensus (ERIC) and BOX repetitive elements. Genetic relatedness based on both ERIC and BOX-PCR generates specific patterns corresponding to particular genotypes. Exponentially grown antagonistic isolates were used to evaluate phosphate solubilization, siderophores, HCN, ammonia, chitinase, indole-3-acetic acid production, as well as antifungal activities. Out of 22 isolates, the amount of indole-3-acetic acid (IAA) ranging between 10-32 μg/ml was produced by 20 isolates and all isolates were positive for ammonia production ranging between 5.2 to 54 mg/ml. Among 22 isolates tested, the amount of hydroxamate-type siderophores were produced by 16 isolates ranging between 5.2 to 36.4 μg/ml, while catechols-type siderophores produced by 5 isolates ranging from 3.2 to 5.4 μg/ml. Fourteen isolates showed the solubilisation of inorganic phosphorous ranging from 3.2 to 32.6 mg/100ml. Chitinase and HCN production was shown by 19 and 15 different isolates, respectively. In addition, genes of indole acetic acid (iaaM) and chitinase (chiC) were successively amplified from 20 and 19 isolates respectively. The two potential strains Streptomyces sp. (BPSAC34) and Leifsonia xyli (BPSAC24) were tested in vivo and improved a range of growth parameters in chilli (Capsicum annuum L.) under greenhouse conditions. This study is the first published report that actinomycetes can be isolated as endophytes from within these

  20. In Vitro and In Vivo Plant Growth Promoting Activities and DNA Fingerprinting of Antagonistic Endophytic Actinomycetes Associates with Medicinal Plants.

    Directory of Open Access Journals (Sweden)

    Ajit Kumar Passari

    Full Text Available Endophytic actinomycetes have shown unique plant growth promoting as well as antagonistic activity against fungal phytopathogens. In the present study forty-two endophytic actinomycetes recovered from medicinal plants were evaluated for their antagonistic potential and plant growth-promoting abilities. Twenty-two isolates which showed the inhibitory activity against at least one pathogen were subsequently tested for their plant-growth promoting activities and were compared genotypically using DNA based fingerprinting, including enterobacterial repetitive intergenic consensus (ERIC and BOX repetitive elements. Genetic relatedness based on both ERIC and BOX-PCR generates specific patterns corresponding to particular genotypes. Exponentially grown antagonistic isolates were used to evaluate phosphate solubilization, siderophores, HCN, ammonia, chitinase, indole-3-acetic acid production, as well as antifungal activities. Out of 22 isolates, the amount of indole-3-acetic acid (IAA ranging between 10-32 μg/ml was produced by 20 isolates and all isolates were positive for ammonia production ranging between 5.2 to 54 mg/ml. Among 22 isolates tested, the amount of hydroxamate-type siderophores were produced by 16 isolates ranging between 5.2 to 36.4 μg/ml, while catechols-type siderophores produced by 5 isolates ranging from 3.2 to 5.4 μg/ml. Fourteen isolates showed the solubilisation of inorganic phosphorous ranging from 3.2 to 32.6 mg/100ml. Chitinase and HCN production was shown by 19 and 15 different isolates, respectively. In addition, genes of indole acetic acid (iaaM and chitinase (chiC were successively amplified from 20 and 19 isolates respectively. The two potential strains Streptomyces sp. (BPSAC34 and Leifsonia xyli (BPSAC24 were tested in vivo and improved a range of growth parameters in chilli (Capsicum annuum L. under greenhouse conditions. This study is the first published report that actinomycetes can be isolated as endophytes from

  1. Conjugative DNA transfer induces the bacterial SOS response and promotes antibiotic resistance development through integron activation.

    Directory of Open Access Journals (Sweden)

    Zeynep Baharoglu

    2010-10-01

    Full Text Available Conjugation is one mechanism for intra- and inter-species horizontal gene transfer among bacteria. Conjugative elements have been instrumental in many bacterial species to face the threat of antibiotics, by allowing them to evolve and adapt to these hostile conditions. Conjugative plasmids are transferred to plasmidless recipient cells as single-stranded DNA. We used lacZ and gfp fusions to address whether conjugation induces the SOS response and the integron integrase. The SOS response controls a series of genes responsible for DNA damage repair, which can lead to recombination and mutagenesis. In this manuscript, we show that conjugative transfer of ssDNA induces the bacterial SOS stress response, unless an anti-SOS factor is present to alleviate this response. We also show that integron integrases are up-regulated during this process, resulting in increased cassette rearrangements. Moreover, the data we obtained using broad and narrow host range plasmids strongly suggests that plasmid transfer, even abortive, can trigger chromosomal gene rearrangements and transcriptional switches in the recipient cell. Our results highlight the importance of environments concentrating disparate bacterial communities as reactors for extensive genetic adaptation of bacteria.

  2. Computational analysis of promoters and DNA-protein interactions

    OpenAIRE

    Tomovic, Andrija

    2009-01-01

    The investigation of promoter activity and DNA-protein interactions is very important for understanding many crucial cellular processes, including transcription, recombination and replication. Promoter activity and DNA-protein interactions can be studied in the lab (in vitro or in vivo) or using computational methods (in silico). Computational approaches for analysing promoters and DNA-protein interactions have become more powerful as more and more complete genome sequences, 3D...

  3. Solvent-exposed serines in the Gal4 DNA-binding domain are required for promoter occupancy and transcriptional activation in vivo.

    Science.gov (United States)

    Jeličić, Branka; Nemet, Josipa; Traven, Ana; Sopta, Mary

    2014-03-01

    The yeast transcriptional activator Gal4 has long been the prototype for studies of eukaryotic transcription. Gal4 is phosphorylated in the DNA-binding domain (DBD); however, the molecular details and functional significance of this remain unknown. We mutagenized seven potential phosphoserines that lie on the solvent-exposed face of the DBD structure and assessed them for transcriptional activity and DNA binding in vivo. Serine to alanine mutants at positions 22, 47, and 85 show the greatest reduction in promoter occupancy and transcriptional activity at the MEL1 promoter containing a single UASGAL . Substitutions with the phosphomimetic aspartate restored DNA-binding and transcriptional activity at serines 22 and 85, suggesting that they are potential sites of Gal4 phosphorylation in vivo. In contrast, the serine to alanine mutants, except serine 22, were fully proficient for binding to the GAL1-10 promoter, containing multiple UASGAL sites, although they had a reduced ability to activate transcription. Collectively, these data show that at the GAL1-10 promoter, functions of the DBD in transcriptional activation can be uncoupled from roles in promoter binding. We suggest that the serines in the DBD mediate protein-protein contacts with the transcription machinery, leading to stabilization of Gal4 at promoters.

  4. In Vitro and In Vivo Plant Growth Promoting Activities and DNA Fingerprinting of Antagonistic Endophytic Actinomycetes Associates with Medicinal Plants

    OpenAIRE

    Ajit Kumar Passari; Vineet Kumar Mishra; Vijai Kumar Gupta; Mukesh Kumar Yadav; Ratul Saikia; Bhim Pratap Singh

    2015-01-01

    Endophytic actinomycetes have shown unique plant growth promoting as well as antagonistic activity against fungal phytopathogens. In the present study forty-two endophytic actinomycetes recovered from medicinal plants were evaluated for their antagonistic potential and plant growth-promoting abilities. Twenty-two isolates which showed the inhibitory activity against at least one pathogen were subsequently tested for their plant-growth promoting activities and were compared genotypically using...

  5. O6-methylguanine-DNA methyltransferase activity is associated with response to alkylating agent therapy and with MGMT promoter methylation in glioblastoma and anaplastic glioma

    Science.gov (United States)

    Bobola, Michael S.; Alnoor, Mohammad; Chen, John Y.-S.; Kolstoe, Douglas D.; Silbergeld, Daniel L.; Rostomily, Robert C.; Blank, A.; Chamberlain, Marc C.; Silber, John R.

    2014-01-01

    Background CpG methylation in the O6-methylguanine-DNA methyltransferase (MGMT) promoter is associated with better outcome following alkylating agent chemotherapy in glioblastoma (GBM) and anaplastic glioma (AG). To what extent improved response reflects low or absent MGMT activity in glioma tissue has not been unequivocally assessed. This information is central to developing anti-resistance therapies. Methods We examined the relationship of MGMT activity in 91 GBMs and 84 AGs with progression-free survival (PFS) following alkylator therapy and with promoter methylation status determined by methylation-specific PCR (MSP). Results Cox regression analysis revealed that GBMs with high activity had a significantly greater risk for progression in dichotomous (P ≤ 0.001) and continuous (P ≤ 0.003) models, an association observed for different alkylator regimens, including concurrent chemo-radiation with temozolomide. Analysis of MGMT promoter methylation status in 47 of the GBMs revealed that methylated tumors had significantly lower activity (P ≤ 0.005) and longer PFS (P ≤ 0.036) compared to unmethylated tumors, despite overlapping activities. PFS was also significantly greater in methylated vs. unmethylated GBMs with comparable activity (P ≤ 0.005), and among unmethylated tumors with less than median activity (P ≤ 0.026), suggesting that mechanisms in addition to MGMT promote alkylator resistance. Similar associations of MGMT activity with PFS and promoter methylation status were observed for AGs. Conclusions Our results provide strong support for the hypotheses that MGMT activity promotes alkylator resistance and reflects promoter methylation status in malignant gliomas. General significance MGMT activity is an attractive target for anti-resistance therapy regardless of methylation status. PMID:25558448

  6. Transcription Factor ZBED6 Mediates IGF2 Gene Expression by Regulating Promoter Activity and DNA Methylation in Myoblasts

    Science.gov (United States)

    Huang, Yong-Zhen; Zhang, Liang-Zhi; Lai, Xin-Sheng; Li, Ming-Xun; Sun, Yu-Jia; Li, Cong-Jun; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Zhao, Xin; Chen, Hong

    2014-04-01

    Zinc finger, BED-type containing 6 (ZBED6) is an important transcription factor in placental mammals, affecting development, cell proliferation and growth. In this study, we found that the expression of the ZBED6 and IGF2 were upregulated during C2C12 differentiation. The IGF2 expression levels were negatively associated with the methylation status in beef cattle (P assay for the IGF2 intron 3 and P3 promoter showed that the mutant-type 439 A-SNP-pGL3 in driving reporter gene transcription is significantly higher than that of the wild-type 439 G-SNP-pGL3 construct (P assay revealed that ZBED6 regulate IGF2 expression and promote myoblast differentiation. Furthermore, knockdown of ZBED6 led to IGF2 expression change in vitro. Taken together, these results suggest that ZBED6 inhibits IGF2 activity and expression via a G to A transition disrupts the interaction. Thus, we propose that ZBED6 plays a critical role in myogenic differentiation.

  7. A point mutation in the DNA-binding domain of HPV-2 E2 protein increases its DNA-binding capacity and reverses its transcriptional regulatory activity on the viral early promoter

    Directory of Open Access Journals (Sweden)

    Gao Chen

    2012-02-01

    Full Text Available Abstract Background The human papillomavirus (HPV E2 protein is a multifunctional DNA-binding protein. The transcriptional activity of HPV E2 is mediated by binding to its specific binding sites in the upstream regulatory region of the HPV genomes. Previously we reported a HPV-2 variant from a verrucae vulgaris patient with huge extensive clustered cutaneous, which have five point mutations in its E2 ORF, L118S, S235P, Y287H, S293R and A338V. Under the control of HPV-2 LCR, co-expression of the mutated HPV E2 induced an increased activity on the viral early promoter. In the present study, a series of mammalian expression plasmids encoding E2 proteins with one to five amino acid (aa substitutions for these mutations were constructed and transfected into HeLa, C33A and SiHa cells. Results CAT expression assays indicated that the enhanced promoter activity was due to the co-expressions of the E2 constructs containing A338V mutation within the DNA-binding domain. Western blots analysis demonstrated that the transiently transfected E2 expressing plasmids, regardless of prototype or the A338V mutant, were continuously expressed in the cells. To study the effect of E2 mutations on its DNA-binding activity, a serial of recombinant E2 proteins with various lengths were expressed and purified. Electrophoresis mobility shift assays (EMSA showed that the binding affinity of E2 protein with A338V mutation to both an artificial probe with two E2 binding sites or HPV-2 and HPV-16 promoter-proximal LCR sequences were significantly stronger than that of the HPV-2 prototype E2. Furthermore, co-expression of the construct containing A338V mutant exhibited increased activities on heterologous HPV-16 early promoter P97 than that of prototype E2. Conclusions These results suggest that the mutation from Ala to Val at aa 338 is critical for E2 DNA-binding and its transcriptional regulation.

  8. A milk protein gene promoter directs the expression of human tissue plasminogen activator cDNA to the mammary gland in transgenic mice

    Energy Technology Data Exchange (ETDEWEB)

    Pittius, C.W.; Hennighausen, L.; Lee, E.; Westphal, H.; Nicols, E.; Vitale, J.; Gordon, K. (National Institutes of Health, Bethesda, MD (USA))

    1988-08-01

    Whey acidic protein (WAP) is a major whey protein in mouse milk. Its gene is expressed in the lactating mammary gland and is inducible by steroid and peptide hormones. A series of transgenic mice containing a hybrid gene in which human tissue plasminogen activator (tPA) cDNA is under the control of the murine WAP gene promoter had previously been generated. In this study, 21 tissues from lactating and virgin transgenic female mice containing the WAP-tPA hybrid gene were screened for the distribution of murine WAP and human tPA transcripts. Like the endogenous WAP RNA, WAP-tPA RNA was expressed predominantly in mammary gland tissue and appeared to be inducible by lactation. Whereas WAP transcripts were not detected in 22 tissues of virgin mice, low levels of WAP-tPA RNA, which were not modulated during lactation, were found in tongue, kidney, and sublingual gland. These studies demonstrate that the WAP gene promoter can target the expression of a transgene to the mammary gland and that this expression is inducible during lactation.

  9. A milk protein gene promoter directs the expression of human tissue plasminogen activator cDNA to the mammary gland in transgenic mice

    International Nuclear Information System (INIS)

    Whey acidic protein (WAP) is a major whey protein in mouse milk. Its gene is expressed in the lactating mammary gland and is inducible by steroid and peptide hormones. A series of transgenic mice containing a hybrid gene in which human tissue plasminogen activator (tPA) cDNA is under the control of the murine WAP gene promoter had previously been generated. In this study, 21 tissues from lactating and virgin transgenic female mice containing the WAP-tPA hybrid gene were screened for the distribution of murine WAP and human tPA transcripts. Like the endogenous WAP RNA, WAP-tPA RNA was expressed predominantly in mammary gland tissue and appeared to be inducible by lactation. Whereas WAP transcripts were not detected in 22 tissues of virgin mice, low levels of WAP-tPA RNA, which were not modulated during lactation, were found in tongue, kidney, and sublingual gland. These studies demonstrate that the WAP gene promoter can target the expression of a transgene to the mammary gland and that this expression is inducible during lactation

  10. Transcription Factor ZBED6 Mediates IGF2 Gene Expression by Regulating Promoter Activity and DNA Methylation in Myoblasts

    OpenAIRE

    Huang, Yong-Zhen; Liang-zhi ZHANG; Lai, Xin-Sheng; Li, Ming-xun; Sun, Yu-Jia; Li, Cong-jun; Lan, Xian-yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Zhao, Xin; Chen, Hong

    2014-01-01

    Zinc finger, BED-type containing 6 (ZBED6) is an important transcription factor in placental mammals, affecting development, cell proliferation and growth. In this study, we found that the expression of the ZBED6 and IGF2 were upregulated during C2C12 differentiation. The IGF2 expression levels were negatively associated with the methylation status in beef cattle (P < 0.05). A luciferase assay for the IGF2 intron 3 and P3 promoter showed that the mutant-type 439 A-SNP-pGL3 in driving reporter...

  11. Rad52-mediated DNA annealing after Rad51-mediated DNA strand exchange promotes second ssDNA capture.

    Science.gov (United States)

    Sugiyama, Tomohiko; Kantake, Noriko; Wu, Yun; Kowalczykowski, Stephen C

    2006-11-29

    Rad51, Rad52, and RPA play central roles in homologous DNA recombination. Rad51 mediates DNA strand exchange, a key reaction in DNA recombination. Rad52 has two distinct activities: to recruit Rad51 onto single-strand (ss)DNA that is complexed with the ssDNA-binding protein, RPA, and to anneal complementary ssDNA complexed with RPA. Here, we report that Rad52 promotes annealing of the ssDNA strand that is displaced by DNA strand exchange by Rad51 and RPA, to a second ssDNA strand. An RPA that is recombination-deficient (RPA(rfa1-t11)) failed to support annealing, explaining its in vivo phenotype. Escherichia coli RecO and SSB proteins, which are functional homologues of Rad52 and RPA, also facilitated the same reaction, demonstrating its conserved nature. We also demonstrate that the two activities of Rad52, recruiting Rad51 and annealing DNA, are coordinated in DNA strand exchange and second ssDNA capture. PMID:17093500

  12. DNA demethylation in the PTEN gene promoter induced by 5-azacytidine activates PTEN expression in the MG-63 human osteosarcoma cell line.

    Science.gov (United States)

    Song, Deye; Ni, Jiangdong; Xie, Hongming; Ding, Muliang; Wang, Jun

    2014-05-01

    This study used the MG-63 osteosarcoma cell line to investigate the demethylation of the phosphate and tension homolog (PTEN) gene promoter and the change in PTEN gene expression levels, which are caused by the methylation inhibitor 5-azacytidine (5-Zac), and the association between the two. Different concentrations of 5-Zac (0, 5 and 10 μmol/l) were added into the MG-63 cell culture medium and the cells were cultured for 72 h. The following techniques were performed on the cells: Western blot analysis to detect the PTEN protein; reverse transcription-polymerase chain reaction (PCR) to detect the mRNA transcription levels of the PTEN gene; flow cytometry to detect the cell apoptotic rate; and sodium bisulfate to deal with the DNA of each group. The genes of the PTEN promoter and the transcription factors specificity protein 1 (Sp1) and Myc were PCR amplified and transformed into Escherichia coli, then a number of clones were selected for sequencing and the methylation status of the amplified PTEN promoter fragment was detected. Following culture of the MG-63 cells with 5-Zac at concentrations of 0, 5 and 10 μmol/l for 72 h, the expression levels of PTEN protein in each group were gradually increased, presenting a concentration-dependent effect: Group 0 μmol/l compared with groups 5 and 10 μmol/l, P<0.05; and group 5 μmol/l compared with group 10 μmol/l, P=0.007. The mRNA expression levels of the PTEN gene significantly increased. The apoptotic rates of groups 0, 5 and 10 μmol/l were 0.69±0.42, 2.50±0.30 and 6.59±0.62%, and significant differences (P<0.01) were observed between every two groups. The bisulfate DNA sequencing results of three groups showed that, following the treatment with 5-Zac, the binding of the CG site to transcription factors was affected by demethylation. The average rate of demethylation indicated a statistical difference among the three groups. In conclusion, the methylation inhibitor 5-Zac leads to a significant increase in the

  13. DNA demethylation in the PTEN gene promoter induced by 5-azacytidine activates PTEN expression in the MG-63 human osteosarcoma cell line

    Science.gov (United States)

    SONG, DEYE; NI, JIANGDONG; XIE, HONGMING; DING, MULIANG; WANG, JUN

    2014-01-01

    This study used the MG-63 osteosarcoma cell line to investigate the demethylation of the phosphate and tension homolog (PTEN) gene promoter and the change in PTEN gene expression levels, which are caused by the methylation inhibitor 5-azacytidine (5-Zac), and the association between the two. Different concentrations of 5-Zac (0, 5 and 10 μmol/l) were added into the MG-63 cell culture medium and the cells were cultured for 72 h. The following techniques were performed on the cells: Western blot analysis to detect the PTEN protein; reverse transcription-polymerase chain reaction (PCR) to detect the mRNA transcription levels of the PTEN gene; flow cytometry to detect the cell apoptotic rate; and sodium bisulfate to deal with the DNA of each group. The genes of the PTEN promoter and the transcription factors specificity protein 1 (Sp1) and Myc were PCR amplified and transformed into Escherichia coli, then a number of clones were selected for sequencing and the methylation status of the amplified PTEN promoter fragment was detected. Following culture of the MG-63 cells with 5-Zac at concentrations of 0, 5 and 10 μmol/l for 72 h, the expression levels of PTEN protein in each group were gradually increased, presenting a concentration-dependent effect: Group 0 μmol/l compared with groups 5 and 10 μmol/l, P<0.05; and group 5 μmol/l compared with group 10 μmol/l, P=0.007. The mRNA expression levels of the PTEN gene significantly increased. The apoptotic rates of groups 0, 5 and 10 μmol/l were 0.69±0.42, 2.50±0.30 and 6.59±0.62%, and significant differences (P<0.01) were observed between every two groups. The bisulfate DNA sequencing results of three groups showed that, following the treatment with 5-Zac, the binding of the CG site to transcription factors was affected by demethylation. The average rate of demethylation indicated a statistical difference among the three groups. In conclusion, the methylation inhibitor 5-Zac leads to a significant increase in the

  14. Estrogen receptors bind to and activate the HOXC4/HoxC4 promoter to potentiate HoxC4-mediated activation-induced cytosine deaminase induction, immunoglobulin class switch DNA recombination, and somatic hypermutation.

    Science.gov (United States)

    Mai, Thach; Zan, Hong; Zhang, Jinsong; Hawkins, J Seth; Xu, Zhenming; Casali, Paolo

    2010-11-26

    Estrogen enhances antibody and autoantibody responses through yet to be defined mechanisms. It has been suggested that estrogen up-regulates the expression of activation-induced cytosine deaminase (AID), which is critical for antibody class switch DNA recombination (CSR) and somatic hypermutation (SHM), through direct activation of this gene. AID, as we have shown, is induced by the HoxC4 homeodomain transcription factor, which binds to a conserved HoxC4/Oct site in the AICDA/Aicda promoter. Here we show that estrogen-estrogen receptor (ER) complexes do not directly activate the AID gene promoter in B cells undergoing CSR. Rather, they bind to three evolutionarily conserved and cooperative estrogen response elements (EREs) we identified in the HOXC4/HoxC4 promoter. By binding to these EREs, ERs synergized with CD154 or LPS and IL-4 signaling to up-regulate HoxC4 expression, thereby inducing AID and CSR without affecting B cell proliferation or plasmacytoid differentiation. Estrogen administration in vivo significantly potentiated CSR and SHM in the specific antibody response to the 4-hydroxy-3-nitrophenylacetyl hapten conjugated with chicken γ-globulin. Ablation of HoxC4 (HoxC4(-/-)) abrogated the estrogen-mediated enhancement of AID gene expression and decreased CSR and SHM. Thus, estrogen enhances AID expression by activating the HOXC4/HoxC4 promoter and inducing the critical AID gene activator, HoxC4.

  15. DNA binding and antigene activity of a daunomycin-conjugated triplex-forming oligonucleotide targeting the P2 promoter of the human c-myc gene

    OpenAIRE

    Giuseppina M. Carbone; McGuffie, Eileen; Napoli, Sara; Flanagan, Courtney E.; Dembech, Chiara; Negri, Umberto; Arcamone, Federico; Capobianco, Massimo L.; Catapano, Carlo V

    2004-01-01

    Triplex-forming oligonucleotides (TFO) that bind DNA in a sequence-specific manner might be used as selective repressors of gene expression and gene-targeted therapeutics. However, many factors, including instability of triple helical complexes in cells, limit the efficacy of this approach. In the present study, we tested whether covalent linkage of a TFO to daunomycin, which is a potent DNA-intercalating agent and anticancer drug, could increase stability of the triple helix and activity of ...

  16. Ten1p promotes the telomeric DNA-binding activity of Cdc13p: implication for its function in telomere length regulation

    Institute of Scientific and Technical Information of China (English)

    Wei Qian; Jianyong Wang; Na-Na Jin; Xiao-Hong Fu; Yi-Chien Lin; Jing-Jer Lin; Jin-Qiu Zhou

    2009-01-01

    In Saccharomyces cerevisiae, the essential gene CDC13 encodes a telomeric single-stranded DNA-binding protein that interacts with Stnlp and Tenlp genetically and physically, and is required for telomere end protection and te-Iomere length control. The molecular mechanism by which Ten1 participates in telomere length regulation and chro-mosome end protection remains elusive. In this work, we observed a weak interaction of Cdc13p and Tenlp in a gel-filtration analysis using purified recombinant Cdc13p and Ten lp. Ten 1p itself exhibits a weak DNA-binding activity, but enhances the telomeric TG1-3 DNA-binding ability of Cdc13p. Cdc13p is co-immunoprecipitated with Ten1p. In the mutant ten1-55 or ten1-66 cells, the impaired interaction between Ten1p and Cdc13p results in much longer telomeres, as well as a decreased association of Cdc13p with telomeric DNA. Consistently, the Ten1-55 and Ten1-66 mutant proteins fail to stimulate the telomeric DNA-binding activity of Cdc13p in vitro. These results suggest that Ten1p enhances the telomeric DNA-binding activity of Cdc13p to negatively regulate telomere length.

  17. UV Damage in DNA Promotes Nucleosome Unwrapping*

    OpenAIRE

    Duan, Ming-Rui; Smerdon, Michael J.

    2010-01-01

    The association of DNA with histones in chromatin impedes DNA repair enzymes from accessing DNA lesions. Nucleosomes exist in a dynamic equilibrium in which portions of the DNA molecule spontaneously unwrap, transiently exposing buried DNA sites. Thus, nucleosome dynamics in certain regions of chromatin may provide the exposure time and space needed for efficient repair of buried DNA lesions. We have used FRET and restriction enzyme accessibility to study nucleosome dynamics following DNA dam...

  18. DNA element downstream of the κB site in the Lcn2 promoter is required for transcriptional activation by IκBζ and NF-κB p50.

    Science.gov (United States)

    Kohda, Akira; Yamazaki, Soh; Sumimoto, Hideki

    2014-08-01

    The nuclear protein IκBζ activates transcription of a subset of NF-κB-dependent innate immune genes such as Lcn2 encoding the antibacterial protein lipocalin-2. IκBζ functions as a coactivator via its interaction with NF-κB p50, which contains a DNA-binding Rel-homology domain but lacks a transcriptional activation domain. However cis-regulatory elements involved in IκBζ function have remained unknown. Here, we show that, although IκBζ by itself is unable to associate with the Lcn2 promoter, IκBζ interacts with the promoter via p50 binding to the NF-κB-binding site (κB site) and the interaction also requires the pyrimidine-rich site (CCCCTC) that localizes seven bases downstream of the κB site. The pyrimidine-rich site is also essential for IκBζ-mediated activation of the Lcn2 gene. Introduction of both sites into an IκBζ-independent gene culminates in IκBζ-p50-DNA complex formation and transcriptional activation. Furthermore, spacing between the two sites is crucial for both IκBζ-DNA interaction and IκBζ-mediated gene activation. Thus, the pyrimidine-rich IκBζ-responsive site plays an essential role in productive interaction of IκBζ with the p50-DNA complex.

  19. Cdk5 promotes DNA replication stress checkpoint activation through RPA-32 phosphorylation, and impacts on metastasis free survival in breast cancer patients.

    Science.gov (United States)

    Chiker, Sara; Pennaneach, Vincent; Loew, Damarys; Dingli, Florent; Biard, Denis; Cordelières, Fabrice P; Gemble, Simon; Vacher, Sophie; Bieche, Ivan; Hall, Janet; Fernet, Marie

    2015-01-01

    Cyclin dependent kinase 5 (Cdk5) is a determinant of PARP inhibitor and ionizing radiation (IR) sensitivity. Here we show that Cdk5-depleted (Cdk5-shRNA) HeLa cells show higher sensitivity to S-phase irradiation, chronic hydroxyurea exposure, and 5-fluorouracil and 6-thioguanine treatment, with hydroxyurea and IR sensitivity also seen in Cdk5-depleted U2OS cells. As Cdk5 is not directly implicated in DNA strand break repair we investigated in detail its proposed role in the intra-S checkpoint activation. While Cdk5-shRNA HeLa cells showed altered basal S-phase dynamics with slower replication velocity and fewer active origins per DNA megabase, checkpoint activation was impaired after a hydroxyurea block. Cdk5 depletion was associated with reduced priming phosphorylations of RPA32 serines 29 and 33 and SMC1-Serine 966 phosphorylation, lower levels of RPA serine 4 and 8 phosphorylation and DNA damage measured using the alkaline Comet assay, gamma-H2AX signal intensity, RPA and Rad51 foci, and sister chromatid exchanges resulting in impaired intra-S checkpoint activation and subsequently higher numbers of chromatin bridges. In vitro kinase assays coupled with mass spectrometry demonstrated that Cdk5 can carry out the RPA32 priming phosphorylations on serines 23, 29, and 33 necessary for this checkpoint activation. In addition we found an association between lower Cdk5 levels and longer metastasis free survival in breast cancer patients and survival in Cdk5-depleted breast tumor cells after treatment with IR and a PARP inhibitor. Taken together, these results show that Cdk5 is necessary for basal replication and replication stress checkpoint activation and highlight clinical opportunities to enhance tumor cell killing. PMID:26237679

  20. miRNA gene promoters are frequent targets of aberrant DNA methylation in human breast cancer.

    Science.gov (United States)

    Vrba, Lukas; Muñoz-Rodríguez, José L; Stampfer, Martha R; Futscher, Bernard W

    2013-01-01

    miRNAs are important regulators of gene expression that are frequently deregulated in cancer, with aberrant DNA methylation being an epigenetic mechanism involved in this process. We previously identified miRNA promoter regions active in normal mammary cell types and here we analyzed which of these promoters are targets of aberrant DNA methylation in human breast cancer cell lines and breast tumor specimens. Using 5-methylcytosine immunoprecipitation coupled to miRNA tiling microarray hybridization, we performed comprehensive evaluation of DNA methylation of miRNA gene promoters in breast cancer. We found almost one third (55/167) of miRNA promoters were targets for aberrant methylation in breast cancer cell lines. Breast tumor specimens displayed DNA methylation of majority of these miRNA promoters, indicating that these changes in DNA methylation might be clinically relevant. Aberrantly methylated miRNA promoters were, similar to protein coding genes, enriched for promoters targeted by polycomb in normal cells. Detailed analysis of selected miRNA promoters revealed decreased expression of miRNA linked to increased promoter methylation for mir-31, mir-130a, let-7a-3/let-7b, mir-155, mir-137 and mir-34b/mir-34c genes. The proportion of miRNA promoters we found aberrantly methylated in breast cancer is several fold larger than that observed for protein coding genes, indicating an important role of DNA methylation in miRNA deregulation in cancer.

  1. Methylated DNA binding domain protein 2 (MBD2 coordinately silences gene expression through activation of the microRNA hsa-mir-496 promoter in breast cancer cell line.

    Directory of Open Access Journals (Sweden)

    Sebastian Alvarado

    Full Text Available Methylated DNA binding protein 2 (MBD2 binds methylated promoters and suppresses transcription in cis through recruitment of a chromatin modification repressor complex. We show here a new mechanism of action for MBD2: suppression of gene expression indirectly through activation of microRNA hsa-mir-496. Overexpression of MBD2 in breast epithelial cell line MCF-10A results in induced expression and demethylation of hsa-mir-496 while depletion of MBD2 in a human breast cancer cell lines MCF-7 and MDA-MB231 results in suppression of hsa-mir-496. Activation of hsa-mir-496 by MBD2 is associated with silencing of several of its target genes while depletion of MBD2 leads to induction of hsa-mir-496 target genes. Depletion of hsa-mir-496 by locked nucleic acid (LNA antisense oligonucleotide leads to activation of these target genes in MBD2 overexpressing cells supporting that hsa-mir-496 is mediating in part the effects of MBD2 on gene expression. We demonstrate that MBD2 binds the promoter of hsa-mir-496 in MCF-10A, MCF-7 and MDA-MB-231 cells and that it activates an in vitro methylated hsa-mir-496 promoter driving a CG-less luciferase reporter in a transient transfection assay. The activation of hsa-mir-496 is associated with reduced methylation of the promoter. Taken together these results describe a novel cascade for gene regulation by DNA methylation whereby activation of a methylated microRNA by MBD2 that is associated with loss of methylation triggers repression of downstream targets.

  2. DNA methylation directly silences genes with non-CpG island promoters and establishes a nucleosome occupied promoter.

    Science.gov (United States)

    Han, Han; Cortez, Connie C; Yang, Xiaojing; Nichols, Peter W; Jones, Peter A; Liang, Gangning

    2011-11-15

    Despite the fact that 45% of all human gene promoters do not contain CpG islands, the role of DNA methylation in control of non-CpG island promoters is controversial and its relevance in normal and pathological processes is poorly understood. Among the few studies which investigate the correlation between DNA methylation and expression of genes with non-CpG island promoters, the majority do not support the view that DNA methylation directly leads to transcription silencing of these genes. Our reporter assays and gene reactivation by 5-aza-2'-deoxycytidine, a DNA demethylating agent, show that DNA methylation occurring at CpG poor LAMB3 promoter and RUNX3 promoter 1(RUNX3 P1) can directly lead to transcriptional silencing in cells competent to express these genes in vitro. Using Nucleosome Occupancy Methylome- Sequencing, NOMe-Seq, a single-molecule, high-resolution nucleosome positioning assay, we demonstrate that active, but not inactive, non-CpG island promoters display a nucleosome-depleted region (NDR) immediately upstream of the transcription start site (TSS). Furthermore, using NOMe-Seq and clonal analysis, we show that in RUNX3 expressing 623 melanoma cells, RUNX3 P1 has two distinct chromatin configurations: one is unmethylated with an NDR upstream of the TSS; another is methylated and nucleosome occupied, indicating that RUNX3 P1 is monoallelically methylated. Together, these results demonstrate that the epigenetic signatures comprising DNA methylation, histone marks and nucleosome occupancy of non-CpG island promoters are almost identical to CpG island promoters, suggesting that aberrant methylation patterns of non-CpG island promoters may also contribute to tumorigenesis and should therefore be included in analyses of cancer epigenetics.

  3. RECQL4 Promotes DNA End Resection in Repair of DNA Double-Strand Breaks.

    Science.gov (United States)

    Lu, Huiming; Shamanna, Raghavendra A; Keijzers, Guido; Anand, Roopesh; Rasmussen, Lene Juel; Cejka, Petr; Croteau, Deborah L; Bohr, Vilhelm A

    2016-06-28

    The RecQ helicase RECQL4, mutated in Rothmund-Thomson syndrome, regulates genome stability, aging, and cancer. Here, we identify a crucial role for RECQL4 in DNA end resection, which is the initial and an essential step of homologous recombination (HR)-dependent DNA double-strand break repair (DSBR). Depletion of RECQL4 severely reduces HR-mediated repair and 5' end resection in vivo. RECQL4 physically interacts with MRE11-RAD50-NBS1 (MRN), which senses DSBs and initiates DNA end resection with CtIP. The MRE11 exonuclease regulates the retention of RECQL4 at laser-induced DSBs. RECQL4 also directly interacts with CtIP via its N-terminal domain and promotes CtIP recruitment to the MRN complex at DSBs. Moreover, inactivation of RECQL4's helicase activity impairs DNA end processing and HR-dependent DSBR without affecting its interaction with MRE11 and CtIP, suggesting an important role for RECQL4's unwinding activity in the process. Thus, we report that RECQL4 is an important participant in HR-dependent DSBR.

  4. DNA甲基化对Ki-67启动子转录活性的影响%Identification of the effect of DNA methylation on Ki-67 promoter activity

    Institute of Scientific and Technical Information of China (English)

    李望; 郑骏年; 钱国伟; 徐为; 田卉; 李连涛; 刘俊杰; 陈菲菲; 李慧中; 章龙珍

    2011-01-01

    目的 观察DNA甲基化对Ki-67启动子转录活性的影响.方法 使用S-腺苷甲硫氨酸作为甲基供体,使用甲基化酶(M.SssI、M.HpaII、M.HhaI)诱导Ki-67启动子DNA片段发生不同程度的甲基化,将甲基化的启动子片段插入pGL3-Basic载体得到甲基化Ki-67启动子荧光素酶报告质粒,并以非甲基化Ki-67启动子荧光素酶报告质粒作为对照,分别转染正常细胞(HL-7702、HUVEC)和肿瘤细胞(A549、EJ、Kert-3、Hela和SGC-7901),使用双荧光素酶报告基因检测系统测定甲基化的Ki-67启动子在这些细胞中的转录活性.结果 甲基化Ki-67启动子的转录活性均有不同程度的下降,其下降幅度依次为M.SssI处理组>M.HhaI处理组>M.HpsII处理组,其中M.SssI处理组启动子的转录活性几乎完全消失.结论 Ki-67启动子的甲基化抑制了其转录活性,抑制程度与DNA甲基化程度和甲基化位置有关.%Objective To investigate the effect of DNA methylation on Ki-67 promoter activity.Methods Ki-67 promoter fragments were in vitro methylated using M. Hpall, M. HhaI or M. SssI methylases respectively in the presence of S-adenosyl methionine. Methylated promoter fragments were then cloned into the firefly luciferase reporter vector pGL3-Basic, these methylated promoter luciferase reporter constructs and unmethylated Ki-67 promoter constructs were used to transfect normal cell lines ( HL-7702,HUVEC) and cancer cell lines ( A549,EJ, Hela, Kert-3,SGC-7901 ). Promoter activities were determined by Dual Luciferase Reporter Assay System. Results Transient transfection of cultured cell lines with these methylated promoter reporter plasmids showed that dense methylation with M. SssI methylase abolished the promoter activity whereas methylation with HpaII and HhaI methylase resulted in partial reduction of the basal activity of the promoter compared to the unmethylated controls. The rank according to promoter activity reduction from high to low was M. Sss

  5. Osmotic pressure: resisting or promoting DNA ejection from phage

    CERN Document Server

    Jeembaeva, Meerim; Larsson, Frida; Evilevitch, Alex

    2008-01-01

    Recent in vitro experiments have shown that DNA ejection from bacteriophage can be partially stopped by surrounding osmotic pressure when ejected DNA is digested by DNase I on the course of ejection. We argue in this work by combination of experimental techniques (osmotic suppression without DNaseI monitored by UV absorbance, pulse-field electrophoresis, and cryo-EM visualization) and simple scaling modeling that intact genome (i.e. undigested) ejection in a crowded environment is, on the contrary, enhanced or eventually complete with the help of a pulling force resulting from DNA condensation induced by the osmotic stress itself. This demonstrates that in vivo, the osmotically stressed cell cytoplasm will promote phage DNA ejection rather than resisting it. The further addition of DNA-binding proteins under crowding conditions is shown to enhance the extent of ejection. We also found some optimal crowding conditions for which DNA content remaining in the capsid upon ejection is maximum, which correlates well...

  6. Bayesian classification for promoter prediction in human DNA sequences

    Science.gov (United States)

    Bercher, J.-F.; Jardin, P.; Duriez, B.

    2006-11-01

    Many Computational methods are yet available for data retrieval and analysis of genomic sequences, but some functional sites are difficult to characterize. In this work, we examine the problem of promoter localization in human DNA sequences. Promoters are regulatory regions that governs the expression of genes, and their prediction is reputed difficult, so that this issue is still open. We present the Chaos Game representation (CGR) of DNA sequences which has many interesting properties, and the notion of `genomic signature' that proved relevant in phylogeny applications. Based on this notion, we develop a (naïve) bayesian classifier, evaluate its performances, and show that its adaptive implementation enable to reveal or assess core-promoter positions along a DNA sequence.

  7. PARP activation promotes nuclear AID accumulation in lymphoma cells.

    Science.gov (United States)

    Tepper, Sandra; Jeschke, Julia; Böttcher, Katrin; Schmidt, Angelika; Davari, Kathrin; Müller, Peter; Kremmer, Elisabeth; Hemmerich, Peter; Pfeil, Ines; Jungnickel, Berit

    2016-03-15

    Activation-induced cytidine deaminase (AID) initiates immunoglobulin diversification in germinal center B cells by targeted introduction of DNA damage. As aberrant nuclear AID action contributes to the generation of B cell lymphoma, the protein's activity is tightly regulated, e.g. by nuclear/cytoplasmic shuttling and nuclear degradation. In the present study, we asked whether DNA damage may affect regulation of the AID protein. We show that exogenous DNA damage that mainly activates base excision repair leads to prevention of proteasomal degradation of AID and hence its nuclear accumulation. Inhibitor as well as knockout studies indicate that activation of poly (ADP-ribose) polymerase (PARP) by DNA damaging agents promotes both phenomena. These findings suggest that PARP inhibitors influence DNA damage dependent AID regulation, with interesting implications for the regulation of AID function and chemotherapy of lymphoma.

  8. Human neuronal tau promoting the melting temperature of DNA

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The hyperchromic effect of ultraviolet spectroscopy shows that adding recombinant human neuronal tau to the solution of calf thymus DNA will promote the melting temperature (Tm) from 67℃ to 81℃. Similar result has been detected when adding tau to plasmid pBluescript-Ⅱ SK, by raising Tm from 75℃ to 85℃. The kinetics of thermal denaturation of DNA with tau is much slower than that of control. It suggests that tau may stabilize the double helix conformation of DNA.

  9. International energy-promotion-activities

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-09-01

    Comprehensive promotion of energy and environmental measures are demanded in order to realize improvement in energy demand/supply structures in developing countries where increase in energy demand is anticipated. To achieve this goal, technical transfer related to energy saving technologies and clean coal as well as international energy promotion activities are implemented in China and Indonesia since fiscal 1993. In the field of energy saving, model operations are performed to improve efficiency in such energy consuming fields as steel making, power generation, and oil refining, in addition to cooperation in structuring databases and establishing master plans. In the clean coal field, model operations are conducted to reduce environmental load in coal utilizing areas, in addition to cooperation in establishing master plans for coal utilization. This paper describes feasibility studies on environmentally harmonious coal utilization systems in developing countries, assistance to introduction thereof, and joint verification operations. To rationalize international energy usage, basic surveys on energy utilization efficiency improvement and model operations are carried out mainly in the Asia-Pacific countries.

  10. Active DNA demethylation by DNA repair: Facts and uncertainties.

    Science.gov (United States)

    Schuermann, David; Weber, Alain R; Schär, Primo

    2016-08-01

    Pathways that control and modulate DNA methylation patterning in mammalian cells were poorly understood for a long time, although their importance in establishing and maintaining cell type-specific gene expression was well recognized. The discovery of proteins capable of converting 5-methylcytosine (5mC) to putative substrates for DNA repair introduced a novel and exciting conceptual framework for the investigation and ultimate discovery of molecular mechanisms of DNA demethylation. Against the prevailing notion that DNA methylation is a static epigenetic mark, it turned out to be dynamic and distinct mechanisms appear to have evolved to effect global and locus-specific DNA demethylation. There is compelling evidence that DNA repair, in particular base excision repair, contributes significantly to the turnover of 5mC in cells. By actively demethylating DNA, DNA repair supports the developmental establishment as well as the maintenance of DNA methylation landscapes and gene expression patterns. Yet, while the biochemical pathways are relatively well-established and reviewed, the biological context, function and regulation of DNA repair-mediated active DNA demethylation remains uncertain. In this review, we will thus summarize and critically discuss the evidence that associates active DNA demethylation by DNA repair with specific functional contexts including the DNA methylation erasure in the early embryo, the control of pluripotency and cellular differentiation, the maintenance of cell identity, and the nuclear reprogramming. PMID:27247237

  11. Replication of cloned DNA containing the Alu family sequence during cell extract-promoting simian virus 40 DNA synthesis.

    OpenAIRE

    Ariga, H

    1984-01-01

    The replicating activity of several cloned DNAs containing putative origin sequences was examined in a cell-free extract that absolutely depends on simian virus 40 (SV40) T antigen promoting initiation of SV40 DNA replication in vitro. Of the three DNAs containing the human Alu family sequence (BLUR8), the origin of (Saccharomyces cerevisiae plasmid 2 micron DNA (pJD29), and the yeast autonomous replicating sequence (YRp7), only BLUR8 was active as a template. Replication in a reaction mixtur...

  12. Impaired DNA replication within progenitor cell pools promotes leukemogenesis.

    Directory of Open Access Journals (Sweden)

    Ganna Bilousova

    2005-12-01

    Full Text Available Impaired cell cycle progression can be paradoxically associated with increased rates of malignancies. Using retroviral transduction of bone marrow progenitors followed by transplantation into mice, we demonstrate that inhibition of hematopoietic progenitor cell proliferation impairs competition, promoting the expansion of progenitors that acquire oncogenic mutations which restore cell cycle progression. Conditions that impair DNA replication dramatically enhance the proliferative advantage provided by the expression of Bcr-Abl or mutant p53, which provide no apparent competitive advantage under conditions of healthy replication. Furthermore, for the Bcr-Abl oncogene the competitive advantage in contexts of impaired DNA replication dramatically increases leukemogenesis. Impaired replication within hematopoietic progenitor cell pools can select for oncogenic events and thereby promote leukemia, demonstrating the importance of replicative competence in the prevention of tumorigenesis. The demonstration that replication-impaired, poorly competitive progenitor cell pools can promote tumorigenesis provides a new rationale for links between tumorigenesis and common human conditions of impaired DNA replication such as dietary folate deficiency, chemotherapeutics targeting dNTP synthesis, and polymorphisms in genes important for DNA metabolism.

  13. The Bacillus subtilis DnaD and DnaB Proteins Exhibit Different DNA Remodelling Activities

    OpenAIRE

    Zhang, Wenke; Carneiro, Maria J. V. M.; Turner, Ian J.; ALLEN, Stephanie; Roberts, Clive J.; Soultanas, Panos

    2005-01-01

    Primosomal protein cascades load the replicative helicase onto DNA. In Bacillus subtilis a putative primosomal cascade involving the DnaD-DnaB-DnaI proteins has been suggested to participate in both the DnaA and PriA-dependent loading of the replicative helicase DnaC onto the DNA. Recently we discovered that DnaD has a global remodelling DNA activity suggesting a more widespread role in bacterial nucleoid architecture. Here, we show that DnaB forms a “square-like” tetramer with a hole in the ...

  14. Promoter DNA hypermethylation and gene repression in undifferentiated Arabidopsis cells.

    Directory of Open Access Journals (Sweden)

    María Berdasco

    Full Text Available Maintaining and acquiring the pluripotent cell state in plants is critical to tissue regeneration and vegetative multiplication. Histone-based epigenetic mechanisms are important for regulating this undifferentiated state. Here we report the use of genetic and pharmacological experimental approaches to show that Arabidopsis cell suspensions and calluses specifically repress some genes as a result of promoter DNA hypermethylation. We found that promoters of the MAPK12, GSTU10 and BXL1 genes become hypermethylated in callus cells and that hypermethylation also affects the TTG1, GSTF5, SUVH8, fimbrin and CCD7 genes in cell suspensions. Promoter hypermethylation in undifferentiated cells was associated with histone hypoacetylation and primarily occurred at CpG sites. Accordingly, we found that the process specifically depends on MET1 and DRM2 methyltransferases, as demonstrated with DNA methyltransferase mutants. Our results suggest that promoter DNA methylation may be another important epigenetic mechanism for the establishment and/or maintenance of the undifferentiated state in plant cells.

  15. Cdk5 promotes DNA replication stress checkpoint activation through RPA-32 phosphorylation, and impacts on metastasis free survival in breast cancer patients

    OpenAIRE

    Chiker, Sara; Pennaneach, Vincent; Loew, Damarys; Dingli, Florent; Biard, Denis; Cordelières, Fabrice P; Gemble, Simon; Vacher, Sophie; Bieche, Ivan; Hall, Janet; Fernet, Marie

    2015-01-01

    Cyclin dependent kinase 5 (Cdk5) is a determinant of PARP inhibitor and ionizing radiation (IR) sensitivity. Here we show that Cdk5-depleted (Cdk5-shRNA) HeLa cells show higher sensitivity to S-phase irradiation, chronic hydroxyurea exposure, and 5-fluorouracil and 6-thioguanine treatment, with hydroxyurea and IR sensitivity also seen in Cdk5-depleted U2OS cells. As Cdk5 is not directly implicated in DNA strand break repair we investigated in detail its proposed role in the intra-S checkpoint...

  16. Local chromatin microenvironment determines DNMT activity : from DNA methyltransferase to DNA demethylase or DNA dehydroxymethylase

    NARCIS (Netherlands)

    van der Wijst, Monique G. P.; Venkiteswaran, Muralidhar; Chen, Hui; Xu, Guo-Liang; Plosch, Torsten; Rots, Marianne G.

    2015-01-01

    Insights on active DNA demethylation disproved the original assumption that DNA methylation is a stable epigenetic modification. Interestingly, mammalian DNA methyltransferases 3A and 3B (DNMT-3A and -3B) have also been reported to induce active DNA demethylation, in addition to their well-known fun

  17. Promoting 21st-Century Skills in the Science Classroom by Adapting Cookbook Lab Activities: The Case of DNA Extraction of Wheat Germ

    Science.gov (United States)

    Alozie, Nonye M.; Grueber, David J.; Dereski, Mary O.

    2012-01-01

    How can science instruction engage students in 21st-century skills and inquiry-based learning, even when doing simple labs in the classroom? We collaborated with teachers in professional development workshops to transform "cookbook" activities into engaging laboratory experiences. We show how to change the common classroom activity of DNA…

  18. Rep provides a second motor at the replisome to promote duplication of protein-bound DNA.

    Science.gov (United States)

    Guy, Colin P; Atkinson, John; Gupta, Milind K; Mahdi, Akeel A; Gwynn, Emma J; Rudolph, Christian J; Moon, Peter B; van Knippenberg, Ingeborg C; Cadman, Chris J; Dillingham, Mark S; Lloyd, Robert G; McGlynn, Peter

    2009-11-25

    Nucleoprotein complexes present challenges to genome stability by acting as potent blocks to replication. One attractive model of how such conflicts are resolved is direct targeting of blocked forks by helicases with the ability to displace the blocking protein-DNA complex. We show that Rep and UvrD each promote movement of E. coli replisomes blocked by nucleoprotein complexes in vitro, that such an activity is required to clear protein blocks (primarily transcription complexes) in vivo, and that a polarity of translocation opposite that of the replicative helicase is critical for this activity. However, these two helicases are not equivalent. Rep but not UvrD interacts physically and functionally with the replicative helicase. In contrast, UvrD likely provides a general means of protein-DNA complex turnover during replication, repair, and recombination. Rep and UvrD therefore provide two contrasting solutions as to how organisms may promote replication of protein-bound DNA. PMID:19941825

  19. Analysis of promoter activity in transgenic plants by normalizing expression with a reference gene: anomalies due to the influence of the test promoter on the reference promoter

    Indian Academy of Sciences (India)

    Simran Bhullar; Suma Chakravarthy; Deepak Pental; Pradeep Kumar Burma

    2009-12-01

    Variations in transgene expression due to position effect and copy number are normalized when analysing and comparing the strengths of different promoters. In such experiments, the promoter to be tested is placed upstream to a reporter gene and a second expression cassette is introduced in a linked fashion in the same transfer DNA (T-DNA). Normalization in the activity of the test promoter is carried out by calculating the ratio of activities of the test and reference promoters. When an appropriate number of independent transgenic events are analysed, normalization facilitates assessment of the relative strengths of the test promoters being compared. In this study, using different modified versions of the Cauliflower Mosaic Virus (CaMV) 35S promoter expressing the reporter gene -glucuronidase (gus) (test cassette) linked to a chloramphenicol acetyl transferase (cat) gene under the wild-type 35S promoter (reference cassette) in transgenic tobacco lines, we observed that cat gene expression varied depending upon the strength of the modified 35S promoter expressing the gus gene. The 35S promoter in the reference cassette was found to have been upregulated in cases where the modified 35S promoter was weaker than the wild-type 35S promoter. Many studies have been carried out in different organisms to study the phenomenon of transcriptional interference, which refers to the reduced expression of the downstream promoter by a closely linked upstream promoter. However, we observed a positive interaction wherein the weakened activity of a promoter led to upregulation of a contiguous promoter. These observations suggest that, in situations where the promoters of the test and reference gene share the same transcription factors, the activity of the test promoter can influence the activity of the reference promoter in a way that the test promoter’s strength is underestimated when normalized by the reference promoter.

  20. Promoting and avoiding recombination: contrasting activities of the Escherichia coli RuvABC Holliday junction resolvase and RecG DNA translocase.

    Science.gov (United States)

    Zhang, Jing; Mahdi, Akeel A; Briggs, Geoffrey S; Lloyd, Robert G

    2010-05-01

    RuvABC and RecG are thought to provide alternative pathways for the late stages of recombination in Escherichia coli. Inactivation of both blocks the recovery of recombinants in genetic crosses. RuvABC resolves Holliday junctions, with RuvAB driving branch migration and RuvC catalyzing junction cleavage. RecG also drives branch migration, but no nuclease has been identified that might act with RecG to cleave junctions, apart from RusA, which is not normally expressed. We searched for an alternative nuclease using a synthetic lethality assay to screen for mutations causing inviability in the absence of RuvC, on the premise that a strain without any ability to cut junctions might be inviable. All the mutations identified mapped to polA, dam, or uvrD. None of these genes encodes a nuclease that cleaves Holliday junctions. Probing the reason for the inviability using the RusA Holliday junction resolvase provided strong evidence in each case that the RecG pathway is very ineffective at removing junctions and indicated that a nuclease component most probably does not exist. It also revealed new suppressors of recG, which were located to the ssb gene. Taken together with the results from the synthetic lethality assays, the properties of the mutant SSB proteins provide evidence that, rather than promoting recombination, a major function of RecG is to curb potentially pathological replication initiated via PriA protein at sites remote from oriC. PMID:20157002

  1. Libraries of Synthetic TALE-Activated Promoters: Methods and Applications.

    Science.gov (United States)

    Schreiber, T; Tissier, A

    2016-01-01

    The discovery of proteins with programmable DNA-binding specificities triggered a whole array of applications in synthetic biology, including genome editing, regulation of transcription, and epigenetic modifications. Among those, transcription activator-like effectors (TALEs) due to their natural function as transcription regulators, are especially well-suited for the development of orthogonal systems for the control of gene expression. We describe here the construction and testing of libraries of synthetic TALE-activated promoters which are under the control of a single TALE with a given DNA-binding specificity. These libraries consist of a fixed DNA-binding element for the TALE, a TATA box, and variable sequences of 19 bases upstream and 43 bases downstream of the DNA-binding element. These libraries were cloned using a Golden Gate cloning strategy making them usable as standard parts in a modular cloning system. The broad range of promoter activities detected and the versatility of these promoter libraries make them valuable tools for applications in the fine-tuning of expression in metabolic engineering projects or in the design and implementation of regulatory circuits. PMID:27480693

  2. Libraries of Synthetic TALE-Activated Promoters: Methods and Applications.

    Science.gov (United States)

    Schreiber, T; Tissier, A

    2016-01-01

    The discovery of proteins with programmable DNA-binding specificities triggered a whole array of applications in synthetic biology, including genome editing, regulation of transcription, and epigenetic modifications. Among those, transcription activator-like effectors (TALEs) due to their natural function as transcription regulators, are especially well-suited for the development of orthogonal systems for the control of gene expression. We describe here the construction and testing of libraries of synthetic TALE-activated promoters which are under the control of a single TALE with a given DNA-binding specificity. These libraries consist of a fixed DNA-binding element for the TALE, a TATA box, and variable sequences of 19 bases upstream and 43 bases downstream of the DNA-binding element. These libraries were cloned using a Golden Gate cloning strategy making them usable as standard parts in a modular cloning system. The broad range of promoter activities detected and the versatility of these promoter libraries make them valuable tools for applications in the fine-tuning of expression in metabolic engineering projects or in the design and implementation of regulatory circuits.

  3. Promotion marketing activities in universities

    OpenAIRE

    Guseva I.B.; Ledentcova E.A.

    2014-01-01

    The article discusses the need for promotion of educational services through such means of marketing communications as advertising and personal selling , able to satisfy user requests. The results of market research - questioning school graduates of Perm, which was carried out in order to create an effective advertising campaign to attract entrants. Experience can be used in the advertising campaign universities in Russia , in particular , Perm State National Research University.

  4. Human DNA2 possesses a cryptic DNA unwinding activity that functionally integrates with BLM or WRN helicases

    Science.gov (United States)

    Pinto, Cosimo; Kasaciunaite, Kristina; Seidel, Ralf; Cejka, Petr

    2016-01-01

    Human DNA2 (hDNA2) contains both a helicase and a nuclease domain within the same polypeptide. The nuclease of hDNA2 is involved in a variety of DNA metabolic processes. Little is known about the role of the hDNA2 helicase. Using bulk and single-molecule approaches, we show that hDNA2 is a processive helicase capable of unwinding kilobases of dsDNA in length. The nuclease activity prevents the engagement of the helicase by competing for the same substrate, hence prominent DNA unwinding by hDNA2 alone can only be observed using the nuclease-deficient variant. We show that the helicase of hDNA2 functionally integrates with BLM or WRN helicases to promote dsDNA degradation by forming a heterodimeric molecular machine. This collectively suggests that the hDNA2 motor promotes the enzyme's capacity to degrade dsDNA in conjunction with BLM or WRN and thus promote the repair of broken DNA. DOI: http://dx.doi.org/10.7554/eLife.18574.001 PMID:27612385

  5. FBH1 promotes DNA double-strand breakage and apoptosis in response to DNA replication stress.

    Science.gov (United States)

    Jeong, Yeon-Tae; Rossi, Mario; Cermak, Lukas; Saraf, Anita; Florens, Laurence; Washburn, Michael P; Sung, Patrick; Schildkraut, Carl L; Schildkraut, Carl; Pagano, Michele

    2013-01-21

    Proper resolution of stalled replication forks is essential for genome stability. Purification of FBH1, a UvrD DNA helicase, identified a physical interaction with replication protein A (RPA), the major cellular single-stranded DNA (ssDNA)-binding protein complex. Compared with control cells, FBH1-depleted cells responded to replication stress with considerably fewer double-strand breaks (DSBs), a dramatic reduction in the activation of ATM and DNA-PK and phosphorylation of RPA2 and p53, and a significantly increased rate of survival. A minor decrease in ssDNA levels was also observed. All these phenotypes were rescued by wild-type FBH1, but not a FBH1 mutant lacking helicase activity. FBH1 depletion had no effect on other forms of genotoxic stress in which DSBs form by means that do not require ssDNA intermediates. In response to catastrophic genotoxic stress, apoptosis prevents the persistence and propagation of DNA lesions. Our findings show that FBH1 helicase activity is required for the efficient induction of DSBs and apoptosis specifically in response to DNA replication stress. PMID:23319600

  6. DNA structure in human RNA polymerase II promoters

    DEFF Research Database (Denmark)

    Pedersen, Anders Gorm; Baldi, Pierre; Chauvin, Yves;

    1998-01-01

    protein in a manner reminiscent of DNA in a nucleosome. This notion is further supported by the finding that the periodic bendability is caused mainly by the complementary triplet pairs CAG/CTG and GGC/GCC, which previously have been found to correlate with nucleosome positioning. We present models where...... the high-bendability regions position nucleosomes at the downstream end of the transcriptional start point, and consider the possibility of interaction between histone-like TAFs and this area. We also propose the use of this structural signature in computational promoter-finding algorithms....

  7. Distribution, silencing potential and evolutionary impact of promoter DNA methylation in the human genome.

    Science.gov (United States)

    Weber, Michael; Hellmann, Ines; Stadler, Michael B; Ramos, Liliana; Pääbo, Svante; Rebhan, Michael; Schübeler, Dirk

    2007-04-01

    To gain insight into the function of DNA methylation at cis-regulatory regions and its impact on gene expression, we measured methylation, RNA polymerase occupancy and histone modifications at 16,000 promoters in primary human somatic and germline cells. We find CpG-poor promoters hypermethylated in somatic cells, which does not preclude their activity. This methylation is present in male gametes and results in evolutionary loss of CpG dinucleotides, as measured by divergence between humans and primates. In contrast, strong CpG island promoters are mostly unmethylated, even when inactive. Weak CpG island promoters are distinct, as they are preferential targets for de novo methylation in somatic cells. Notably, most germline-specific genes are methylated in somatic cells, suggesting additional functional selection. These results show that promoter sequence and gene function are major predictors of promoter methylation states. Moreover, we observe that inactive unmethylated CpG island promoters show elevated levels of dimethylation of Lys4 of histone H3, suggesting that this chromatin mark may protect DNA from methylation. PMID:17334365

  8. THE PROMOTIONAL ACTIVITY IN THE TOURISTIC SECTOR

    Directory of Open Access Journals (Sweden)

    Costel Iliuta Negricea

    2008-05-01

    Full Text Available The promotion as one of the components of the marketing mix, laying stress, în this regard,on its role în the deployment of the tourism companies’ activity, the structure of the promotional activity în thetouristic sector as well as the use of the promotional strategies în the attainment of the development targets ofthe tourism companies.So, în the paper there have been mentioned the three levels at which it is made the touristic promotionîn Romania, respectively nationally, by the Ministry of the Tourism, under whose subordination it is theTourism National Authority, the second level is the regional/local one, concerning the activity carried out bythe Centers/Offices of Touristic Information from a series of localities, and the last level refers to the microone, respectively at the level of the tourism companies, which promote their offer individually (the most often.The important role of the promotion în the deployment of the activity of the tourism companies isbeing highlighted by the fact that this makes the connection between the activity of an organization and itscustomers (effective or potential, and, în the touristic field, the content of the promotional activity is stronglystressed by the features of this type of services and of the system of creation and delivery, as well as of thepurchasing behaviour.

  9. Public Relations as Promotional Activity

    Directory of Open Access Journals (Sweden)

    Almira CURRI-MEMETI

    2011-11-01

    Full Text Available Public relations give opportunity to the organization to present its image and personality to its own “public”- users, supporters, sponsors, donors, local community and other public.It is about transferring the message to the public, but that is a twoway street. You must communicate with your public, but at the same time you must give opportunity to the public to communicate easier with you. The real public relations include dialog – you should listen to the others, to see things through their perspective. This elaborate is made with the purpose to be useful for every organization, not for the sensational promotion of its achievements, but to become more critical towards its work. Seeing the organization in the way that the other see it, you can become better and sure that you are giving to your users the best service possible.

  10. Evaluation of Results from Sales Promotion Activities

    OpenAIRE

    Olimpia Ban

    2007-01-01

    An essential element of the sales promotion strategy and not only is the evaluation of the results obtained from the activities performed. Due to their nature and applicability, the evaluation of the sales promotion is much easier to be achieved, but it raises some problems. Using a hypothetical example, we have tried to develop a "classic" evaluation model of the specialty literature.

  11. Promoting physical activity in socially vulnerable groups

    NARCIS (Netherlands)

    Herens, M.C.

    2016-01-01

    Background:  In the Netherlands, inequalities in physical activity behaviour go hand in hand with socioeconomic inequalities in health. To promote physical activity effectively and equitably, participatory community-based physical activity interventions seem promising and are s

  12. Rep Provides a Second Motor at the Replisome to Promote Duplication of Protein-Bound DNA

    OpenAIRE

    Guy, Colin P.; Atkinson, John; Gupta, Milind K.; Mahdi, Akeel A.; Gwynn, Emma J.; Rudolph, Christian J.; Moon, Peter B.; van Knippenberg, Ingeborg C.; Cadman, Chris J.; Dillingham, Mark S.; Lloyd, Robert G.; McGlynn, Peter

    2009-01-01

    Summary Nucleoprotein complexes present challenges to genome stability by acting as potent blocks to replication. One attractive model of how such conflicts are resolved is direct targeting of blocked forks by helicases with the ability to displace the blocking protein-DNA complex. We show that Rep and UvrD each promote movement of E. coli replisomes blocked by nucleoprotein complexes in vitro, that such an activity is required to clear protein blocks (primarily transcription complexes) in vi...

  13. Regulation of ALF promoter activity in Xenopus oocytes.

    Directory of Open Access Journals (Sweden)

    Dan Li

    Full Text Available BACKGROUND: In this report we evaluate the use of Xenopus laevis oocytes as a matched germ cell system for characterizing the organization and transcriptional activity of a germ cell-specific X. laevis promoter. PRINCIPAL FINDINGS: The promoter from the ALF transcription factor gene was cloned from X. laevis genomic DNA using a PCR-based genomic walking approach. The endogenous ALF gene was characterized by RACE and RT-PCR for transcription start site usage, and by sodium bisulfite sequencing to determine its methylation status in somatic and oocyte tissues. Homology between the X. laevis ALF promoter sequence and those from human, chimpanzee, macaque, mouse, rat, cow, pig, horse, dog, chicken and X. tropicalis was relatively low, making it difficult to use such comparisons to identify putative regulatory elements. However, microinjected promoter constructs were very active in oocytes and the minimal promoter could be narrowed by PCR-mediated deletion to a region as short as 63 base pairs. Additional experiments using a series of site-specific promoter mutants identified two cis-elements within the 63 base pair minimal promoter that were critical for activity. Both elements (A and B were specifically recognized by proteins present in crude oocyte extracts based on oligonucleotide competition assays. The activity of promoter constructs in oocytes and in transfected somatic Xenopus XLK-WG kidney epithelial cells was quite different, indicating that the two cell types are not functionally equivalent and are not interchangeable as assay systems. CONCLUSIONS: Overall the results provide the first detailed characterization of the organization of a germ cell-specific Xenopus promoter and demonstrate the feasibility of using immature frog oocytes as an assay system for dissecting the biochemistry of germ cell gene regulation.

  14. Promoting Physical Activity among Underserved Populations.

    Science.gov (United States)

    Mendoza-Vasconez, Andrea S; Linke, Sarah; Muñoz, Mario; Pekmezi, Dori; Ainsworth, Cole; Cano, Mayra; Williams, Victoria; Marcus, Bess H; Larsen, Britta A

    2016-01-01

    Underserved populations, including racial/ethnic minorities, individuals with low socioeconomic status, and individuals with physical disabilities, are less likely to engage in sufficient moderate to vigorous physical activity (MVPA) and are thus at increased risk of morbidity and mortality. These populations face unique challenges to engaging in MVPA. Learning how to overcome these challenges is a necessary first step in achieving health equity through health promotion research. In this review of the literature, we discuss issues and strategies that have been used to promote MVPA among individuals from underserved populations, focusing on recruitment, intervention delivery, and the use of technology in interventions. Physical activity promotion research among these vulnerable populations is scarce. Nevertheless, there is preliminary evidence of efficacy in the use of certain recruitment and intervention strategies including tailoring, cultural adaptation, incorporation of new technologies, and multilevel and community-based approaches for physical activity promotion among different underserved populations. PMID:27399827

  15. Promoting physical activity in socially vulnerable groups

    OpenAIRE

    Herens, M.C.

    2016-01-01

    Background:  In the Netherlands, inequalities in physical activity behaviour go hand in hand with socioeconomic inequalities in health. To promote physical activity effectively and equitably, participatory community-based physical activity interventions seem promising and are supported by the Dutch government’s policy. Although many strategies have been developed to increase physical activity levels in general and in socially vulnerable groups in particular, most evaluations show o...

  16. INTRANUCLEAR MATRIX METALLOPROTEINASES PROMOTE DNA DAMAGE AND APOPTOSIS INDUCED BY OXYGEN–GLUCOSE DEPRIVATION IN NEURONS

    Science.gov (United States)

    HILL, J. W.; PODDAR, R.; THOMPSON, J. F.; ROSENBERG, G. A.; YANG, Y.

    2016-01-01

    Degradation of the extracellular matrix by elevated matrix metalloproteinase (MMP) activity following ischemia/reperfusion is implicated in blood–brain barrier disruption and neuronal death. In contrast to their characterized extracellular roles, we previously reported that elevated intranuclear MMP-2 and -9 (gelatinase) activity degrades nuclear DNA repair proteins and promotes accumulation of oxidative DNA damage in neurons in rat brain at 3-h reperfusion after ischemic stroke. Here, we report that treatment with a broad-spectrum MMP inhibitor significantly reduced neuronal apoptosis in rat ischemic hemispheres at 48-h reperfusion after a 90-min middle cerebral artery occlusion (MCAO). Since extracellular gelatinases in brain tissue are known to be neurotoxic during acute stroke, the contribution of intranuclear MMP-2 and -9 activities in neurons to neuronal apoptosis has been unclear. To confirm and extend our in vivo observations, oxygen–glucose deprivation (OGD), an in vitro model of ischemia/reperfusion, was employed. Primary cortical neurons were subjected to 2-h OGD with reoxygenation. Increased intranuclear gelatinase activity was detected immediately after reoxygenation onset and was maximal at 24 h, while extracellular gelatinase levels remained unchanged. We detected elevated levels of both MMP-2 and -9 in neuronal nuclear extracts and gelatinase activity in neurons co-localized primarily with MMP-2. We found a marked decrease in PARP1, XRCC1, and OGG1, and decreased PARP1 activity. Pretreatment of neurons with selective MMP-2/9 inhibitor II significantly decreased gelatinase activity and downregulation of DNA repair enzymes, decreased accumulation of oxidative DNA damage, and promoted neuronal survival after OGD. Our results confirm the nuclear localization of gelatinases and their nuclear substrates observed in an animal stroke model, further supporting a novel role for intranuclear gelatinase activity in an intrinsic apoptotic pathway in neurons

  17. A 5-methylcytosine DNA glycosylase/lyase demethylates the retrotransposon Tos17 and promotes its transposition in rice

    KAUST Repository

    La, Honggui

    2011-09-06

    DNA 5-methylcytosine (5-meC) is an important epigenetic mark for transcriptional gene silencing in many eukaryotes. In Arabidopsis, 5-meC DNA glycosylase/lyases actively remove 5-meC to counter-act transcriptional gene silencing in a locus-specific manner, and have been suggested to maintain the expression of transposons. However, it is unclear whether plant DNA demethylases can promote the transposition of transposons. Here we report the functional characterization of the DNA glycosylase/lyase DNG701 in rice. DNG701 encodes a large (1,812 amino acid residues) DNA glycosylase domain protein. Recombinant DNG701 protein showed 5-meC DNA glycosylase and lyase activities in vitro. Knockout or knockdown of DNG701 in rice plants led to DNA hypermethylation and reduced expression of the retrotransposon Tos17. Tos17 showed less transposition in calli derived from dng701 knockout mutant seeds compared with that in wild-type calli. Overexpression of DNG701 in both rice calli and transgenic plants substantially reduced DNA methylation levels of Tos17 and enhanced its expression. The overexpression also led to more frequent transposition of Tos17 in calli. Our results demonstrate that rice DNG701 is a 5-meC DNA glycosylase/lyase responsible for the demethylation of Tos17 and this DNA demethylase plays a critical role in promoting Tos17 transposition in rice calli.

  18. Characterization of a stable, major DNA polymerase alpha species devoid of DNA primase activity.

    OpenAIRE

    Kaiserman, H B; Benbow, R. M.

    1987-01-01

    We have purified from Xenopus laevis ovaries a major DNA polymerase alpha species that lacked DNA primase activity. This primase-devoid DNA polymerase alpha species exhibited the same sensitivity as the DNA polymerase DNA primase alpha to BuAdATP and BuPdGTP, nucleotide analogs capable of distinguishing between DNA polymerase delta and DNA polymerase DNA primase alpha. The primase-devoid DNA polymerase alpha species also lacked significant nuclease activity indicative of the alpha-like (rathe...

  19. Evaluation of Results from Sales Promotion Activities

    Directory of Open Access Journals (Sweden)

    Olimpia Ban

    2007-02-01

    Full Text Available An essential element of the sales promotion strategy and not only is the evaluation of the results obtained from the activities performed. Due to their nature and applicability, the evaluation of the sales promotion is much easier to be achieved, but it raises some problems. Using a hypothetical example, we have tried to develop a "classic" evaluation model of the specialty literature.

  20. TH17 cells promote microbial killing and innate immune sensing of DNA via interleukin 26

    Science.gov (United States)

    Meller, Stephan; Domizio, Jeremy Di; Voo, Kui S; Friedrich, Heike C; Chamilos, Georgios; Ganguly, Dipyaman; Conrad, Curdin; Gregorio, Josh; Roy, Didier Le; Roger, Thierry; Ladbury, John E; Homey, Bernhard; Watowich, Stanley; Modlin, Robert L; Kontoyiannis, Dimitrios P; Liu, Yong-Jun; Arold, Stefan T; Gilliet, Michel

    2016-01-01

    Interleukin 17–producing helper T cells (TH17 cells) have a major role in protection against infections and in mediating autoimmune diseases, yet the mechanisms involved are incompletely understood. We found that interleukin 26 (IL-26), a human TH17 cell–derived cytokine, is a cationic amphipathic protein that kills extracellular bacteria via membrane-pore formation. Furthermore, TH17 cell–derived IL-26 formed complexes with bacterial DNA and self-DNA released by dying bacteria and host cells. The resulting IL-26–DNA complexes triggered the production of type I interferon by plasmacytoid dendritic cells via activation of Toll-like receptor 9, but independently of the IL-26 receptor. These findings provide insights into the potent antimicrobial and proinflammatory function of TH17 cells by showing that IL-26 is a natural human antimicrobial that promotes immune sensing of bacterial and host cell death. PMID:26168081

  1. NLRP3 Activation Was Regulated by DNA Methylation Modification during Mycobacterium tuberculosis Infection

    Science.gov (United States)

    Wei, Meili; Wang, Lu; Wu, Tao; Xi, Jun; Han, Yuze; Yang, Xingxiang; Zhang, Ding; Fang, Qiang

    2016-01-01

    Mycobacterium tuberculosis (Mtb) infection activates the NLRP3 inflammasome in macrophages and dendritic cells. Much attention has been paid to the mechanisms for regulation of NLRP3 against Mtb. However, whether epigenetic mechanisms participated in NLRP3 activation is still little known. Here we showed that NLRP3 activation was regulated by DNA methylation modification. Mtb infection promoted NLRP3 activation and inflammatory cytokines expression. NLRP3 promoter was cloned and subsequently identified by Dual-Luciferase Reporter System. The results showed that NLRP3 promoter activity was decreased after methylation by DNA methylase Sss I in vitro. Meanwhile, DNA methyltransferases inhibitor DAC could upregulate the expression of NLRP3. Furthermore, promoter region of NLRP3 gene was demethylated after Mtb H37Rv strain infection. These data revealed that DNA methylation was involved in NLRP3 inflammasome activation during Mtb infection and provided a new insight into the relationship between host and pathogens. PMID:27366746

  2. Modulation of UvrD Helicase Activity by Covalent DNA-Protein Cross-links*

    OpenAIRE

    Kumari, Anuradha; Minko, Irina G.; Smith, Rebecca L.; Lloyd, R. Stephen; McCullough, Amanda K.

    2010-01-01

    UvrD (DNA helicase II) has been implicated in DNA replication, DNA recombination, nucleotide excision repair, and methyl-directed mismatch repair. The enzymatic function of UvrD is to translocate along a DNA strand in a 3′ to 5′ direction and unwind duplex DNA utilizing a DNA-dependent ATPase activity. In addition, UvrD interacts with many other proteins involved in the above processes and is hypothesized to facilitate protein turnover, thus promoting further DNA processing. Although UvrD int...

  3. Osteoponin Promoter Controlled by DNA Methylation: Aberrant Methylation in Cloned Porcine Genome

    Directory of Open Access Journals (Sweden)

    Chih-Jie Shen

    2014-01-01

    Full Text Available Cloned animals usually exhibited many defects in physical characteristics or aberrant epigenetic reprogramming, especially in some important organ development. Osteoponin (OPN is an extracellular-matrix protein involved in heart and bone development and diseases. In this study, we investigated the correlation between OPN mRNA and its promoter methylation changes by the 5-aza-dc treatment in fibroblast cell and promoter assay. Aberrant methylation of porcine OPN was frequently found in different tissues of somatic nuclear transferred cloning pigs, and bisulfite sequence data suggested that the OPN promoter region −2615 to −2239 nucleotides (nt may be a crucial regulation DNA element. In pig ear fibroblast cell culture study, the demethylation of OPN promoter was found in dose-dependent response of 5-aza-dc treatment and followed the OPN mRNA reexpression. In cloned pig study, discrepant expression pattern was identified in several cloned pig tissues, especially in brain, heart, and ear. Promoter assay data revealed that four methylated CpG sites presenting in the −2615 to −2239 nt region cause significant downregulation of OPN promoter activity. These data suggested that methylation in the OPN promoter plays a crucial role in the regulation of OPN expression that we found in cloned pigs genome.

  4. Vitamin and antioxidant rich diet increases MLH1 promoter DNA methylation in DMT2 subjects

    Directory of Open Access Journals (Sweden)

    Switzeny Olivier J

    2012-10-01

    Full Text Available Abstract Background Oxidative stress may lead to an increased level of unrepaired cellular DNA damage, which is discussed as one risk for tumor initiation. Mismatch repair (MMR enzymes act as proofreading complexes that maintain the genomic integrity and MMR-deficient cells show an increased mutation rate. One important gene in the MMR complex is the MutL homolog 1 (MLH1 gene. Since a diet rich in antioxidants has the potential to counteract harmful effects by reactive oxygen species (ROS, we investigated the impact of an antioxidant, folate, and vitamin rich diet on the epigenetic pattern of MLH1. These effects were analyzed in individuals with non-insulin depended diabetes mellitus type 2 (NIDDM2 and impaired fasting glucose (IFG. Methods In this post-hoc analysis of a randomized trial we analyzed DNA methylation of MLH1, MSH2, and MGMT at baseline and after 8 weeks of intervention, consisting of 300 g vegetables and 25 ml plant oil rich in polyunsaturated fatty acids per day. DNA methylation was quantified using combined bisulfite restriction enzyme analysis (COBRA and pyrosequencing. MLH1 and DNMT1 mRNA expression were investigated by qRT-PCR. DNA damage was assessed by COMET assay. Student’s two-tailed paired t test and one-way ANOVA with Scheffé corrected Post hoc test was used to determine significant methylation and expression differences. Two-tailed Pearson test was used to determine correlations between methylation level, gene expression, and DNA strand break amount. Results The intervention resulted in significantly higher CpG methylation in two particular MLH1 promoter regions and the MGMT promoter. DNA strand breaks and methylation levels correlated significantly. The expression of MLH1, DNMT1, and the promoter methylation of MSH2 remained stable. CpG methylation levels and gene expression did not correlate. Conclusion This vitamin and antioxidant rich diet affected the CpG methylation of MLH1. The higher methylation might be a

  5. Molecular Mechanisms of DNA Replication Checkpoint Activation

    Directory of Open Access Journals (Sweden)

    Bénédicte Recolin

    2014-03-01

    Full Text Available The major challenge of the cell cycle is to deliver an intact, and fully duplicated, genetic material to the daughter cells. To this end, progression of DNA synthesis is monitored by a feedback mechanism known as replication checkpoint that is untimely linked to DNA replication. This signaling pathway ensures coordination of DNA synthesis with cell cycle progression. Failure to activate this checkpoint in response to perturbation of DNA synthesis (replication stress results in forced cell division leading to chromosome fragmentation, aneuploidy, and genomic instability. In this review, we will describe current knowledge of the molecular determinants of the DNA replication checkpoint in eukaryotic cells and discuss a model of activation of this signaling pathway crucial for maintenance of genomic stability.

  6. Identification of procollagen promoter DNA-binding proteins: effects of dexamethasone

    International Nuclear Information System (INIS)

    Glucocorticoids selectively decrease procollagen synthesis by decreasing procollagen mRNA transcription. Dexamethasone coordinately decreased total cellular type I and type III procollagen mRNAs in mouse embryonic skin fibroblasts. Since sequence specific DNA-binding proteins are known to modulate eukaryotic gene expression the authors identified in mouse fibroblasts nuclear proteins which bind to types I and III procollagen promoter DNAs. Nuclear proteins were electrophoresed, blotted onto nitrocellulose and probed with 32P-end-labeled type I and type III procollagen promoter DNAs in the presence of equimolar amounts of 32P-end-labeled vector DNA. Differences in total DNA binding were noted by the densitometric scans of the nuclear proteins. Dexamethasone treatment enhanced total DNA binding. Increasing the NaCl concentration decreased the number of promoter DNA-binding proteins without altering the relative specificity for the promoter DNAs. Promoter DNA binding to nuclear proteins was also inhibited by increasing concentrations of E. coli DNA. The number of DNA-binding proteins was greater for type III procollagen promoter DNA. The effect of dexamethasone treatment on promoter DNA binding to nuclear proteins was determined

  7. Distinct structural features of TFAM drive mitochondrial DNA packaging versus transcriptional activation.

    Science.gov (United States)

    Ngo, Huu B; Lovely, Geoffrey A; Phillips, Rob; Chan, David C

    2014-01-01

    TFAM (transcription factor A, mitochondrial) is a DNA-binding protein that activates transcription at the two major promoters of mitochondrial DNA (mtDNA)--the light strand promoter (LSP) and the heavy strand promoter 1 (HSP1). Equally important, it coats and packages the mitochondrial genome. TFAM has been shown to impose a U-turn on LSP DNA; however, whether this distortion is relevant at other sites is unknown. Here we present crystal structures of TFAM bound to HSP1 and to nonspecific DNA. In both, TFAM similarly distorts the DNA into a U-turn. Yet, TFAM binds to HSP1 in the opposite orientation from LSP explaining why transcription from LSP requires DNA bending, whereas transcription at HSP1 does not. Moreover, the crystal structures reveal dimerization of DNA-bound TFAM. This dimerization is dispensable for DNA bending and transcriptional activation but is important in DNA compaction. We propose that TFAM dimerization enhances mitochondrial DNA compaction by promoting looping of the DNA.

  8. cis Determinants of Promoter Threshold and Activation Timescale

    Directory of Open Access Journals (Sweden)

    Anders S. Hansen

    2015-08-01

    Full Text Available Although the relationship between DNA cis-regulatory sequences and gene expression has been extensively studied at steady state, how cis-regulatory sequences affect the dynamics of gene induction is not known. The dynamics of gene induction can be described by the promoter activation timescale (AcTime and amplitude threshold (AmpThr. Combining high-throughput microfluidics with quantitative time-lapse microscopy, we control the activation dynamics of the budding yeast transcription factor, Msn2, and reveal how cis-regulatory motifs in 20 promoter variants of the Msn2-target-gene SIP18 affect AcTime and AmpThr. By modulating Msn2 binding sites, we can decouple AmpThr from AcTime and switch the SIP18 promoter class from high AmpThr and slow AcTime to low AmpThr and either fast or slow AcTime. We present a model that quantitatively explains gene-induction dynamics on the basis of the Msn2-binding-site number, TATA box location, and promoter nucleosome organization. Overall, we elucidate the cis-regulatory logic underlying promoter decoding of TF dynamics.

  9. Transcriptional template activity of covalently modified DNA.

    Science.gov (United States)

    Tolwińska-Stańczyk, Z; Wilmańska, D; Studzian, K; Gniazdowski, M

    1997-03-01

    The transcriptional template activity of covalent modified DNA is compared. 8-Methoxypsoralen (MOP), 3,4'dimethyl-8-methoxypsoralen (DMMOP) and benzopsoralen (BP) forming with DNA covalent complexes upon UV irradiation and exhibiting preference to pyrimidines, mostly thymines, differ in their cross-linking potency. MOP and DMMOP form both monoadducts and diadducts while no cross-links are formed by BP. Nitracrine (NC) forms covalent complexes with DNA upon reductive activation with dithiothreitol exhibiting a preference to purines and low cross-linking potency. Semilogarithmic plots of the relative template activity against the number of the drugs molecules covalently bound per 10(3) DNA nucleotides fit to regression lines corresponding to one-hit inactivation characteristics. The number of drug molecules decreasing RNA synthesis to 37% differ from 0.25 to 1.26 depending on the template used and the base preference but no dependence on the cross-linking potency was found. PMID:9067423

  10. Effects of DNA strand breaks on transcription by RNA polymerase III: insights into the role of TFIIIB and the polarity of promoter opening

    OpenAIRE

    Kassavetis, George A.; Grove, Anne; Geiduschek, E.Peter

    2002-01-01

    Certain deletion mutants of the Brf1 and Bdp1 subunits of transcription factor (TF) IIIB retain the ability to recruit RNA polymerase (pol) III to its promoters, but fail to support promoter opening: deletions within an internal Bdp1 segment interfere with initiation of DNA strand separation, and an N-terminal Brf1 deletion blocks propagation of promoter opening past the transcriptional start site. The ability of DNA strand breaks to restore pol III transcription activity to these defective T...

  11. Protein found to promote DNA repair, prevent cancer

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    @@ An abundant chromosomal protein that binds to damaged DNA prevents cancer development by enhancing DNA repair, researchers at University of Texas reported on-line in the Proceedings of the National Academies of Science.

  12. Nuclear interferon-inducible protein 16 promotes silencing of herpesviral and transfected DNA

    OpenAIRE

    Orzalli, Megan H.; Conwell, Sara E.; Berrios, Christian; DeCaprio, James A.; Knipe, David M.

    2013-01-01

    Cells have evolved mechanisms to silence foreign DNA to prevent the expression of foreign genes within them. In mammalian cells, this involves the assembly of heterochromatin on foreign DNAs such as viral or transfected DNA. Herpesviruses have evolved strategies to counteract these host mechanisms to express their own genes. Herein we demonstrate that the nuclear DNA sensor IFN-inducible protein 16 (IFI16) is involved in the host silencing response to foreign DNA. IFI16 promotes the assembly ...

  13. Interaction of Individual Structural Domains of hnRNP LL with the BCL2 Promoter i-Motif DNA.

    Science.gov (United States)

    Roy, Basab; Talukder, Poulami; Kang, Hyun-Jin; Tsuen, Shujian S; Alam, Mohammad P; Hurley, Laurence H; Hecht, Sidney M

    2016-08-31

    The recently discovered role of the BCL2 (B-cell lymphoma 2 gene) promoter i-motif DNA in modulation of gene expression via interaction with the ribonucleoprotein hnRNP L-like (hnRNP LL) has prompted a more detailed study of the nature of this protein-DNA interaction. The RNA recognition motifs (RRMs) of hnRNP LL were expressed individually, and both RRM1 and RRM2 were found to bind efficiently to the BCL2 i-motif DNA, as well as being critical for transcriptional activation, whereas RRM3-4 bound only weakly to this DNA. Binding was followed by unfolding of the DNA as monitored by changes in the CD spectrum. Mutational analysis of the i-motif DNA revealed that binding involved primarily the lateral loops of the i-motif. The kinetics of binding of the DNA with RRM1 was explored by recording CD spectra at predetermined times following admixture of the protein and DNA. The change in molar ellipticity was readily apparent after 30 s and largely complete within 1 min. A more detailed view of protein-DNA interaction was obtained by introducing the fluorescence donor 6-CNTrp in RRM1 at position 137, and the acceptor 4-aminobenzo[g]quinazoline-2-one (Cf) in lieu of cytidine22 in the i-motif DNA. The course of binding of the two species was monitored by FRET, which reflected a steady increase in energy transfer over a period of several minutes. The FRET signal could be diminished by the further addition of (unlabeled) RRM2, no doubt reflecting competition for binding to the i-motif DNA. These experiments using the individual RRM domains from hnRNP LL confirm the role of this transcription factor in activation of BCL2 transcription via the i-motif in the promoter element. PMID:27483029

  14. Inhibition of SIRT1 reactivates silenced cancer genes without loss of promoter DNA hypermethylation.

    Directory of Open Access Journals (Sweden)

    Kevin Pruitt

    2006-03-01

    Full Text Available The class III histone deactylase (HDAC, SIRT1, has cancer relevance because it regulates lifespan in multiple organisms, down-regulates p53 function through deacetylation, and is linked to polycomb gene silencing in Drosophila. However, it has not been reported to mediate heterochromatin formation or heritable silencing for endogenous mammalian genes. Herein, we show that SIRT1 localizes to promoters of several aberrantly silenced tumor suppressor genes (TSGs in which 5' CpG islands are densely hypermethylated, but not to these same promoters in cell lines in which the promoters are not hypermethylated and the genes are expressed. Heretofore, only type I and II HDACs, through deactylation of lysines 9 and 14 of histone H3 (H3-K9 and H3-K14, respectively, had been tied to the above TSG silencing. However, inhibition of these enzymes alone fails to re-activate the genes unless DNA methylation is first inhibited. In contrast, inhibition of SIRT1 by pharmacologic, dominant negative, and siRNA (small interfering RNA-mediated inhibition in breast and colon cancer cells causes increased H4-K16 and H3-K9 acetylation at endogenous promoters and gene re-expression despite full retention of promoter DNA hypermethylation. Furthermore, SIRT1 inhibition affects key phenotypic aspects of cancer cells. We thus have identified a new component of epigenetic TSG silencing that may potentially link some epigenetic changes associated with aging with those found in cancer, and provide new directions for therapeutically targeting these important genes for re-expression.

  15. THE CONTROL AND EVALUATION OF PROMOTIONAL ACTIVITIES

    Directory of Open Access Journals (Sweden)

    Felicia Sabou

    2012-01-01

    Full Text Available The paper focused on importance and benefits of control and evaluation of marketing activities. The control of efficiency review the assessment of the resources for marketing activity, checking also the efficiency of the human resources, advertising, promotion activities and distribution activities. In the analyse of human resources the most important ratio are: the average of costumers visits on a day, the number of custom order received from 100 visits, the number of new customers from a period, the number of lost customers from a period, the marketing human expenditures from all the sales.The strategic control is made to check if the objectives and the company strategy are adapted to the marketing environment.

  16. Lyn tyrosine kinase promotes silencing of ATM-dependent checkpoint signaling during recovery from DNA double-strand breaks

    Energy Technology Data Exchange (ETDEWEB)

    Fukumoto, Yasunori, E-mail: fukumoto@faculty.chiba-u.jp; Kuki, Kazumasa; Morii, Mariko; Miura, Takahito; Honda, Takuya; Ishibashi, Kenichi; Hasegawa, Hitomi; Kubota, Sho; Ide, Yudai; Yamaguchi, Noritaka; Nakayama, Yuji; Yamaguchi, Naoto, E-mail: nyama@faculty.chiba-u.jp

    2014-09-26

    Highlights: • Inhibition of Src family kinases decreased γ-H2AX signal. • Inhibition of Src family increased ATM-dependent phosphorylation of Chk2 and Kap1. • shRNA-mediated knockdown of Lyn increased phosphorylation of Kap1 by ATM. • Ectopic expression of Src family kinase suppressed ATM-mediated Kap1 phosphorylation. • Src is involved in upstream signaling for inactivation of ATM signaling. - Abstract: DNA damage activates the DNA damage checkpoint and the DNA repair machinery. After initial activation of DNA damage responses, cells recover to their original states through completion of DNA repair and termination of checkpoint signaling. Currently, little is known about the process by which cells recover from the DNA damage checkpoint, a process called checkpoint recovery. Here, we show that Src family kinases promote inactivation of ataxia telangiectasia mutated (ATM)-dependent checkpoint signaling during recovery from DNA double-strand breaks. Inhibition of Src activity increased ATM-dependent phosphorylation of Chk2 and Kap1. Src inhibition increased ATM signaling both in G2 phase and during asynchronous growth. shRNA knockdown of Lyn increased ATM signaling. Src-dependent nuclear tyrosine phosphorylation suppressed ATM-mediated Kap1 phosphorylation. These results suggest that Src family kinases are involved in upstream signaling that leads to inactivation of the ATM-dependent DNA damage checkpoint.

  17. Replication stress activates DNA repair synthesis in mitosis.

    Science.gov (United States)

    Minocherhomji, Sheroy; Ying, Songmin; Bjerregaard, Victoria A; Bursomanno, Sara; Aleliunaite, Aiste; Wu, Wei; Mankouri, Hocine W; Shen, Huahao; Liu, Ying; Hickson, Ian D

    2015-12-10

    Oncogene-induced DNA replication stress has been implicated as a driver of tumorigenesis. Many chromosomal rearrangements characteristic of human cancers originate from specific regions of the genome called common fragile sites (CFSs). CFSs are difficult-to-replicate loci that manifest as gaps or breaks on metaphase chromosomes (termed CFS 'expression'), particularly when cells have been exposed to replicative stress. The MUS81-EME1 structure-specific endonuclease promotes the appearance of chromosome gaps or breaks at CFSs following replicative stress. Here we show that entry of cells into mitotic prophase triggers the recruitment of MUS81 to CFSs. The nuclease activity of MUS81 then promotes POLD3-dependent DNA synthesis at CFSs, which serves to minimize chromosome mis-segregation and non-disjunction. We propose that the attempted condensation of incompletely duplicated loci in early mitosis serves as the trigger for completion of DNA replication at CFS loci in human cells. Given that this POLD3-dependent mitotic DNA synthesis is enhanced in aneuploid cancer cells that exhibit intrinsically high levels of chromosomal instability (CIN(+)) and replicative stress, we suggest that targeting this pathway could represent a new therapeutic approach.

  18. Macrophage activation induced by Brucella DNA suppresses bacterial intracellular replication via enhancing NO production.

    Science.gov (United States)

    Liu, Ning; Wang, Lin; Sun, Changjiang; Yang, Li; Tang, Bin; Sun, Wanchun; Peng, Qisheng

    2015-12-01

    Brucella DNA can be sensed by TLR9 on endosomal membrane and by cytosolic AIM2-inflammasome to induce proinflammatory cytokine production that contributes to partially activate innate immunity. Additionally, Brucella DNA has been identified to be able to act as a major bacterial component to induce type I IFN. However, the role of Brucella DNA in Brucella intracellular growth remains unknown. Here, we showed that stimulation with Brucella DNA promote macrophage activation in TLR9-dependent manner. Activated macrophages can suppresses wild type Brucella intracellular replication at early stage of infection via enhancing NO production. We also reported that activated macrophage promotes bactericidal function of macrophages infected with VirB-deficient Brucella at the early or late stage of infection. This study uncovers a novel function of Brucella DNA, which can help us further elucidate the mechanism of Brucella intracellular survival.

  19. Regulation of the activity of the dual-function DnaA protein in Caulobacter crescentus.

    Directory of Open Access Journals (Sweden)

    Carmen Fernandez-Fernandez

    Full Text Available DnaA is a conserved essential bacterial protein that acts as the initiator of chromosomal replication as well as a master transcriptional regulator in Caulobacter crescentus. Thus, the intracellular levels of active DnaA need to be tightly regulated during the cell cycle. Our previous work suggested that DnaA may be regulated at the level of its activity by the replisome-associated protein HdaA. Here, we describe the construction of a mutant DnaA protein [DnaA(R357A]. The R357 residue in the AAA+ domain of the C. crescentus DnaA protein is equivalent to the R334 residue of the E. coli DnaA protein, which is required for the Regulatory Inactivation of DnaA (RIDA. We found that the expression of the DnaA(R357A mutant protein in C. crescentus, but not the expression of the wild-type DnaA protein at similar levels, causes a severe phenotype of over-initiation of chromosomal replication and that it blocks cell division. Thus, the mutant DnaA(R357A protein is hyper-active to promote the initiation of DNA replication, compared to the wild-type DnaA protein. DnaA(R357A could not replace DnaA in vivo, indicating that the switch in DnaA activity once chromosomal replication has started may be an essential process in C. crescentus. We propose that the inactivation of DnaA is the main mechanism ensuring that chromosomal replication starts only once per cell cycle. We further observed that the R357A substitution in DnaA does not promote the activity of DnaA as a direct transcriptional activator of four important genes, encoding HdaA, the GcrA master cell cycle regulator, the FtsZ cell division protein and the MipZ spatial regulator of cell division. Thus, the AAA+ domain of DnaA may play a role in temporally regulating the bifunctionality of DnaA by reallocating DnaA molecules from initiating DNA replication to transcribing genes within the unique DnaA regulon of C. crescentus.

  20. Regulation of the activity of the dual-function DnaA protein in Caulobacter crescentus.

    Science.gov (United States)

    Fernandez-Fernandez, Carmen; Gonzalez, Diego; Collier, Justine

    2011-01-01

    DnaA is a conserved essential bacterial protein that acts as the initiator of chromosomal replication as well as a master transcriptional regulator in Caulobacter crescentus. Thus, the intracellular levels of active DnaA need to be tightly regulated during the cell cycle. Our previous work suggested that DnaA may be regulated at the level of its activity by the replisome-associated protein HdaA. Here, we describe the construction of a mutant DnaA protein [DnaA(R357A)]. The R357 residue in the AAA+ domain of the C. crescentus DnaA protein is equivalent to the R334 residue of the E. coli DnaA protein, which is required for the Regulatory Inactivation of DnaA (RIDA). We found that the expression of the DnaA(R357A) mutant protein in C. crescentus, but not the expression of the wild-type DnaA protein at similar levels, causes a severe phenotype of over-initiation of chromosomal replication and that it blocks cell division. Thus, the mutant DnaA(R357A) protein is hyper-active to promote the initiation of DNA replication, compared to the wild-type DnaA protein. DnaA(R357A) could not replace DnaA in vivo, indicating that the switch in DnaA activity once chromosomal replication has started may be an essential process in C. crescentus. We propose that the inactivation of DnaA is the main mechanism ensuring that chromosomal replication starts only once per cell cycle. We further observed that the R357A substitution in DnaA does not promote the activity of DnaA as a direct transcriptional activator of four important genes, encoding HdaA, the GcrA master cell cycle regulator, the FtsZ cell division protein and the MipZ spatial regulator of cell division. Thus, the AAA+ domain of DnaA may play a role in temporally regulating the bifunctionality of DnaA by reallocating DnaA molecules from initiating DNA replication to transcribing genes within the unique DnaA regulon of C. crescentus.

  1. Loyalty Card Promotional Activity in Budget Hotel

    OpenAIRE

    Teng, Fei

    2010-01-01

    Loyalty card is one of the most commonly used promotional activities in business. Thus far, there are some research has been done on luxury hotel, but very few researches are on budget hotel. So, the purpose of the thesis is finding out the Swedish customers’ attitude and behavior towards budget hotel’s loyalty card; getting to know what factors influence Swedish customers’ response towards the loyalty card and budget hotels. In the thesis, the main research problem is “How do Swedish custome...

  2. MAPK15 upregulation promotes cell proliferation and prevents DNA damage in male germ cell tumors

    Science.gov (United States)

    Ilardi, Gennaro; Acunzo, Mario; Nigita, Giovanni; Sasdelli, Federica; Celetti, Angela; Strambi, Angela; Staibano, Stefania; Croce, Carlo Maria; Chiariello, Mario

    2016-01-01

    Germ cell tumors (GCT) are the most common malignancies in males between 15 and 35 years of age. Despite the high cure rate, achieved through chemotherapy and/or surgery, the molecular basis of GCT etiology is still largely obscure. Here, we show a positive correlation between MAPK15 (ERK8; ERK7) expression and specific GCT subtypes, with the highest levels found in the aggressive embryonal carcinomas (EC). Indeed, in corresponding cellular models for EC, MAPK15 enhanced tumorigenicity in vivo and promoted cell proliferation in vitro, supporting a role for this kinase in human GCT. At molecular level, we demonstrated that endogenous MAPK15 is necessary to sustain cell cycle progression of EC cells, by limiting p53 activation and preventing the triggering of p53-dependent mechanisms resulting in cell cycle arrest. To understand MAPK15-dependent mechanisms impinging on p53 activation, we demonstrate that this kinase efficiently protects cells from DNA damage. Moreover, we show that the ability of MAPK15 to control the autophagic process is necessary for basal management of DNA damage and for tumor formation controlled by the kinase. In conclusion, our findings suggest that MAPK15 overexpression may contribute to the malignant transformation of germ cells by controlling a “stress support” autophagic pathway, able to prevent DNA damage and the consequent activation of the p53 tumor suppressor. Moreover, in light of these results, MAPK15-specific inhibitors might represent new tools to enhance the therapeutic index of cytotoxic therapy in GCT treatment, and to increase the sensitivity to DNA-damaging drugs in other chemotherapy-resistant human tumors. PMID:26988910

  3. DNA-based control of protein activity.

    Science.gov (United States)

    Engelen, W; Janssen, B M G; Merkx, M

    2016-03-01

    DNA has emerged as a highly versatile construction material for nanometer-sized structures and sophisticated molecular machines and circuits. The successful application of nucleic acid based systems greatly relies on their ability to autonomously sense and act on their environment. In this feature article, the development of DNA-based strategies to dynamically control protein activity via oligonucleotide triggers is discussed. Depending on the desired application, protein activity can be controlled by directly conjugating them to an oligonucleotide handle, or expressing them as a fusion protein with DNA binding motifs. To control proteins without modifying them chemically or genetically, multivalent ligands and aptamers that reversibly inhibit their function provide valuable tools to regulate proteins in a noncovalent manner. The goal of this feature article is to give an overview of strategies developed to control protein activity via oligonucleotide-based triggers, as well as hurdles yet to be taken to obtain fully autonomous systems that interrogate, process and act on their environments by means of DNA-based protein control. PMID:26812623

  4. Human SIRT6 promotes DNA end resection through CtIP deacetylation

    DEFF Research Database (Denmark)

    Kaidi, Abderrahmane; Weinert, Brian T; Choudhary, Chunaram;

    2010-01-01

    SIRT6 belongs to the sirtuin family of protein lysine deacetylases, which regulate aging and genome stability. We found that human SIRT6 has a role in promoting DNA end resection, a crucial step in DNA double-strand break (DSB) repair by homologous recombination. SIRT6 depletion impaired the accu...

  5. PROMOTION OF ACTIVE MEASURES AND EMPLOYMENT STIMULATION

    Directory of Open Access Journals (Sweden)

    LAVINIA ELISABETA POPP

    2012-01-01

    Full Text Available Researches in the field of the labour market has allowed the identification of certain specific mechanisms for employment promotion; at present, on the Romanian labour market we find passive policies, concretised in financial aids paid to the unemployed, along with active policies, constituting the most efficient social protection activity addressed to the unemployed (they aim at counterbalancing the inefficiencies determined by the granting of financial allowances, help population to find a job by actions of information, professional training and contributing to the encouragement of the labour force mobility. The paper refers to some theoretical considerations related to the influence factors of employment stimulation, as well as to the unemployment – correlated adequate measures synapse. The applied research comprises the analysis of statistic documents; the method used is the case study, i.e. the activity of employment stimulation carried on by the County Agency for Employment Caraş-Severin, in the period 2004-2012. The conclusions highlight the impact of the activity of the institutions involved in the system of social protection and security within the labour market.

  6. TH17 cells promote microbial killing and innate immune sensing of DNA via interleukin 26

    KAUST Repository

    Meller, Stephan

    2015-07-13

    Interleukin 17-producing helper T cells (TH 17 cells) have a major role in protection against infections and in mediating autoimmune diseases, yet the mechanisms involved are incompletely understood. We found that interleukin 26 (IL-26), a human TH17 cell-derived cytokine, is a cationic amphipathic protein that kills extracellular bacteria via membrane-pore formation. Furthermore, TH17 cell-derived IL-26 formed complexes with bacterial DNA and self-DNA released by dying bacteria and host cells. The resulting IL-26-DNA complexes triggered the production of type I interferon by plasmacytoid dendritic cells via activation of Toll-like receptor 9, but independently of the IL-26 receptor. These findings provide insights into the potent antimicrobial and proinflammatory function of TH17 cells by showing that IL-26 is a natural human antimicrobial that promotes immune sensing of bacterial and host cell death. © 2015 Nature America, Inc.

  7. EBV-LMP1 suppresses the DNA damage response through DNA-PK/AMPK signaling to promote radioresistance in nasopharyngeal carcinoma.

    Science.gov (United States)

    Lu, Jingchen; Tang, Min; Li, Hongde; Xu, Zhijie; Weng, Xinxian; Li, Jiangjiang; Yu, Xinfang; Zhao, Luqing; Liu, Hongwei; Hu, Yongbin; Tan, Zheqiong; Yang, Lifang; Zhong, Meizuo; Zhou, Jian; Fan, Jia; Bode, Ann M; Yi, Wei; Gao, Jinghe; Sun, Lunquan; Cao, Ya

    2016-09-28

    We conducted this research to explore the role of latent membrane protein 1 (LMP1) encoded by the Epstein-Barr virus (EBV) in modulating the DNA damage response (DDR) and its regulatory mechanisms in radioresistance. Our results revealed that LMP1 repressed the repair of DNA double strand breaks (DSBs) by inhibiting DNA-dependent protein kinase (DNA-PK) phosphorylation and activity. Moreover, LMP1 reduced the phosphorylation of AMP-activated protein kinase (AMPK) and changed its subcellular location after irradiation, which appeared to occur through a disruption of the physical interaction between AMPK and DNA-PK. The decrease in AMPK activity was associated with LMP1-mediated glycolysis and resistance to apoptosis induced by irradiation. The reactivation of AMPK significantly promoted radiosensitivity both in vivo and in vitro. The AMPKα (Thr172) reduction was associated with a poorer clinical outcome of radiation therapy in NPC patients. Our data revealed a new mechanism of LMP1-mediated radioresistance and provided a mechanistic rationale in support of the use of AMPK activators for facilitating NPC radiotherapy. PMID:27255972

  8. Distribution, silencing potential and evolutionary impact of promoter DNA methylation in the human genome.

    NARCIS (Netherlands)

    Weber, M.; Hellmann, I.; Stadler, M.B.; Ramos, L.; Paabo, S.; Rebhan, M.; Schubeler, D.

    2007-01-01

    To gain insight into the function of DNA methylation at cis-regulatory regions and its impact on gene expression, we measured methylation, RNA polymerase occupancy and histone modifications at 16,000 promoters in primary human somatic and germline cells. We find CpG-poor promoters hypermethylated in

  9. Protein–DNA charge transport: Redox activation of a DNA repair protein by guanine radical

    OpenAIRE

    Yavin, Eylon; Boal, Amie K.; Stemp, Eric D. A.; Boon, Elizabeth M; Livingston, Alison L.; O'Shea, Valerie L.; David, Sheila S.; Barton, Jacqueline K.

    2005-01-01

    DNA charge transport (CT) chemistry provides a route to carry out oxidative DNA damage from a distance in a reaction that is sensitive to DNA mismatches and lesions. Here, DNA-mediated CT also leads to oxidation of a DNA-bound base excision repair enzyme, MutY. DNA-bound Ru(III), generated through a flash/quench technique, is found to promote oxidation of the [4Fe-4S](2+) cluster of MutY to [4Fe-4S](3+) and its decomposition product [3Fe-4S](1+). Flash/quench experiments monitored by EPR spec...

  10. Substrate-induced DNA polymerase β activation.

    Science.gov (United States)

    Beard, William A; Shock, David D; Batra, Vinod K; Prasad, Rajendra; Wilson, Samuel H

    2014-11-01

    DNA polymerases and substrates undergo conformational changes upon forming protein-ligand complexes. These conformational adjustments can hasten or deter DNA synthesis and influence substrate discrimination. From structural comparison of binary DNA and ternary DNA-dNTP complexes of DNA polymerase β, several side chains have been implicated in facilitating formation of an active ternary complex poised for chemistry. Site-directed mutagenesis of these highly conserved residues (Asp-192, Arg-258, Phe-272, Glu-295, and Tyr-296) and kinetic characterization provides insight into the role these residues play during correct and incorrect insertion as well as their role in conformational activation. The catalytic efficiencies for correct nucleotide insertion for alanine mutants were wild type ∼ R258A > F272A ∼ Y296A > E295A > D192A. Because the efficiencies for incorrect insertion were affected to about the same extent for each mutant, the effects on fidelity were modest (chain generates a population of non-productive ternary complexes. Structures of binary and ternary substrate complexes of the R258A mutant and a mutant associated with gastric carcinomas, E295K, provide molecular insight into intermediate structural conformations not appreciated previously. Although the R258A mutant crystal structures were similar to wild-type enzyme, the open ternary complex structure of E295K indicates that Arg-258 stabilizes a non-productive conformation of the primer terminus that would decrease catalysis. Significantly, the open E295K ternary complex binds two metal ions indicating that metal binding cannot overcome the modified interactions that have interrupted the closure of the N-subdomain. PMID:25261471

  11. Mutations in BALB mitochondrial DNA induce CCL20 up-regulation promoting tumorigenic phenotypes

    Energy Technology Data Exchange (ETDEWEB)

    Sligh, James [Department of Medicine—Dermatology Division, University of Arizona, Tucson, AZ 857 24 (United States); University of Arizona Cancer Center, Tucson, AZ 85724 (United States); Janda, Jaroslav [University of Arizona Cancer Center, Tucson, AZ 85724 (United States); Jandova, Jana, E-mail: jjandova@email.arizona.edu [Department of Medicine—Dermatology Division, University of Arizona, Tucson, AZ 857 24 (United States); University of Arizona Cancer Center, Tucson, AZ 85724 (United States)

    2014-11-15

    -κB activation inhibited CCL20 expression in mtBALB cybrids and decreased their migratory capabilities. Thus, acquired mtDNA mutations may promote tumorigenic phenotypes through up-regulation of chemokine CCL20.

  12. Association between DNA Methylation of the BDNF Promoter Region and Clinical Presentation in Alzheimer's Disease

    Directory of Open Access Journals (Sweden)

    Tomoyuki Nagata

    2015-03-01

    Full Text Available Background/Aims: In the present study, we examined whether DNA methylation of the brain-derived neurotrophic factor (BDNF promoter is associated with the manifestation and clinical presentation of Alzheimer's disease (AD. Methods: Of 20 patients with AD and 20 age-matched normal controls (NCs, the DNA methylation of the BDNF promoter (measured using peripheral blood samples was completely analyzed in 12 patients with AD and 6 NCs. The resulting methylation levels were compared statistically. Next, we investigated the correlation between the DNA methylation levels and the clinical presentation of AD. Results: The total methylation ratio (in % of the 20 CpG sites was significantly higher in the AD patients (5.08 ± 5.52% than in the NCs (2.09 ± 0.81%; p Conclusion: These results suggest that the DNA methylation of the BDNF promoter may significantly influence the manifestation of AD and might be associated with its neurocognitive presentation.

  13. Novel and functional DNA sequence variants within the GATA5 gene promoter in ventricular septal defects

    Institute of Scientific and Technical Information of China (English)

    Ji-Ping Shan; Xiao-Li Wang; Yuan-Gang Qiao; Hong-Xin Wan Yan; Wen-Hui Huang; Shu-Chao Pang; Bo Yan

    2014-01-01

    Background: Congenital heart disease (CHD) is the most common human birth defect. Genetic causes for CHD remain largely unknown. GATA transcription factor 5 (GATA 5) is an essential regulator for the heart development. Mutations in the GATA5 gene have been reported in patients with a variety of CHD. Since misregulation of gene expression have been associated with human diseases, we speculated that changed levels of cardiac transcription factors, GATA5, may mediate the development of CHD. Methods: In this study, GATA5 gene promoter was genetically and functionally analyzed in large cohorts of patients with ventricular septal defect (VSD) (n=343) and ethnic-matched healthy controls (n=348). Results: Two novel and heterozygous DNA sequence variants (DSVs), g.61051165A>G and g.61051463delC, were identified in three VSD patients, but not in the controls. In cultured cardiomyocytes, GATA5 gene promoter activities were significantly decreased by DSV g.61051165A>G and increased by DSV g.61051463delC. Moreover, fathers of the VSD patients carrying the same DSVs had reduced diastolic function of left ventricles. Three SNPs, g.61051279C>T (rs77067995), g.61051327A>C (rs145936691) and g.61051373G>A (rs80197101), and one novel heterozygous DSV, g.61051227C>T, were found in both VSD patients and controls with similar frequencies. Conclusion: Our data suggested that the DSVs in the GATA5 gene promoter may increase the susceptibility to the development of VSD as a risk factor.

  14. Screening of promoters from rhizosphere metagenomic DNA using a promoter-trap vector and flow cytometric cell sorting.

    Science.gov (United States)

    Lee, Se Hee; Kim, Jeong Myeong; Lee, Hyo Jung; Jeon, Che Ok

    2011-02-01

    We constructed a facilitative and efficient promoter-trap vector, pCM-EGFP, for capturing and analyzing functional promoters from environmental DNA. The pCM-EGFP vector showed good chloramphenicol sensitivity and no enhanced green fluorescent protein (EGFP) gene expression. Promoter libraries were constructed for screening promoters responding to naringenin, a key molecule released from plant roots. After electroporation, E. coli transformants were incubated in LB broth containing chloramphenicol (10 μg/ml) to select against transformants with no cloned promoter. E. coli cells were sorted using flow cytometry without naringenin, and then sorted again with high fluorescence after incubation in LB broth with naringenin (1 mM) at 28 °C for 12 h. The inducible properties of approximately 400 sorted cells were evaluated, with most cells showing only strong EGFP gene expression without inducible properties. Two clones (5-4E and 15-3D) displayed naringenin inducibility, and both contained a promoter bounded by a TetR-family regulator. The regulator knock-out mutant of the 5-4E clone lost its ability to be induced by naringenin. In conclusion, the pCM-EGFP vector may be used as an efficient promoter-trap vector and a combination of the vector with flow cytometric cell sorting was demonstrated to be an useful method for screening promoters responding to specific conditions or inducers. PMID:21259288

  15. RNA Pol II promotes transcription of centromeric satellite DNA in beetles.

    Directory of Open Access Journals (Sweden)

    Zeljka Pezer

    Full Text Available Transcripts of centromeric satellite DNAs are known to play a role in heterochromatin formation as well as in establishment of the kinetochore. However, little is known about basic mechanisms of satellite DNA expression within constitutive heterochromatin and its regulation. Here we present comprehensive analysis of transcription of abundant centromeric satellite DNA, PRAT from beetle Palorus ratzeburgii (Coleoptera. This satellite is characterized by preservation and extreme sequence conservation among evolutionarily distant insect species. PRAT is expressed in all three developmental stages: larvae, pupae and adults at similar level. Transcripts are abundant comprising 0.033% of total RNA and are heterogeneous in size ranging from 0.5 kb up to more than 5 kb. Transcription proceeds from both strands but with 10 fold different expression intensity and transcripts are not processed into siRNAs. Most of the transcripts (80% are not polyadenylated and remain in the nucleus while a small portion is exported to the cytoplasm. Multiple, irregularly distributed transcription initiation sites as well as termination sites have been mapped within the PRAT sequence using primer extension and RLM-RACE. The presence of cap structure as well as poly(A tails in a portion of the transcripts indicate RNA polymerase II-dependent transcription and a putative polymerase II promoter site overlaps the most conserved part of the PRAT sequence. The treatment of larvae with alpha-amanitin decreases the level of PRAT transcripts at concentrations that selectively inhibit pol II activity. In conclusion, stable, RNA polymerase II dependant transcripts of abundant centromeric satellite DNA, not regulated by RNAi, have been identified and characterized. This study offers a basic understanding of expression of highly abundant heterochromatic DNA which in beetle species constitutes up to 50% of the genome.

  16. AMP-activated protein kinase-regulated activation of the PGC-1alpha promoter in skeletal muscle cells.

    Directory of Open Access Journals (Sweden)

    Isabella Irrcher

    Full Text Available The mechanisms by which PGC-1alpha gene expression is controlled in skeletal muscle remains largely undefined. Thus, we sought to investigate the transcriptional regulation of PGC-1alpha using AICAR, an activator of AMPK, that is known to increase PGC-1alpha expression. A 2.2 kb fragment of the human PGC-1alpha promoter was cloned and sequence analysis revealed that this TATA-less sequence houses putative consensus sites including a GC-box, a CRE, several IRSs, a SRE, binding sites for GATA, MEF2, p 53, NF-kappaB, and EBox binding proteins. AMPK activation for 24 hours increased PGC-1alpha promoter activity with concomitant increases in mRNA expression. The effect of AICAR on transcriptional activation was mediated by an overlapping GATA/EBox binding site at -495 within the PGC-1alpha promoter based on gel shift analyses that revealed increases in GATA/EBox DNA binding. Mutation of the EBox within the GATA/EBox binding site in the promoter reduced basal promoter activity and completely abolished the AICAR effect. Supershift analyses identified USF-1 as a DNA binding transcription factor potentially involved in regulating PGC-1alpha promoter activity, which was confirmed in vivo by ChIP. Overexpression of either GATA-4 or USF-1 alone increased the p851 PGC-1alpha promoter activity by 1.7- and 2.0-fold respectively, while co-expression of GATA-4 and USF-1 led to an additive increase in PGC-1alpha promoter activity. The USF-1-mediated increase in PGC-1alpha promoter activation led to similar increases at the mRNA level. Our data identify a novel AMPK-mediated regulatory pathway that regulates PGC-1alpha gene expression. This could represent a potential therapeutic target to control PGC-1alpha expression in skeletal muscle.

  17. Hiwi Promotes the Proliferation of Colorectal Cancer Cells via Upregulating Global DNA Methylation

    Directory of Open Access Journals (Sweden)

    Lin Yang

    2015-01-01

    Full Text Available Hiwi is well known for its role in stem cell renewal, maintaining the resting stage, and downregulating cell cycle of stem cells via RNA silencing. And Hiwi overexpression has been recognized in several types of cancers. In the present study, we examined the Hiwi expression in colorectal cancer (CRC specimens in both mRNA and protein levels via real-time quantitative PCR, western blot assay, and immunohistochemical staining. Then we explored the role of Hiwi in the cancer cell proliferation and in the DNA methylation in human CRC Caro-2 and HT-29 cell lines. Results demonstrated that both mRNA and protein levels of Hiwi were significantly higher in 38 CRC tissues than in 38 peritumor tissues. Moreover, the Hiwi overexpression with an adenovirus vector significantly promoted the proliferation of Caro-2 and HT-29 cells, associated with significant increase in the global DNA methylation levels. And the chemical inhibition of DNA methylation significantly restrained such proliferation promotion. In summary, we confirmed that Hiwi was overexpressed in CRC tissues and that the forced Hiwi overexpression promoted the proliferation and global DNA methylation of CRC cell lines. Our results imply for the first time that Hiwi promotes the proliferation of CRC cells via promoting global DNA methylation.

  18. Arsenic Biotransformation as a Cancer Promoting Factor by Inducing DNA Damage and Disruption of Repair Mechanisms

    Directory of Open Access Journals (Sweden)

    Victor D. Martinez

    2011-01-01

    Full Text Available Chronic exposure to arsenic in drinking water poses a major global health concern. Populations exposed to high concentrations of arsenic-contaminated drinking water suffer serious health consequences, including alarming cancer incidence and death rates. Arsenic is biotransformed through sequential addition of methyl groups, acquired from s-adenosylmethionine (SAM. Metabolism of arsenic generates a variety of genotoxic and cytotoxic species, damaging DNA directly and indirectly, through the generation of reactive oxidative species and induction of DNA adducts, strand breaks and cross links, and inhibition of the DNA repair process itself. Since SAM is the methyl group donor used by DNA methyltransferases to maintain normal epigenetic patterns in all human cells, arsenic is also postulated to affect maintenance of normal DNA methylation patterns, chromatin structure, and genomic stability. The biological processes underlying the cancer promoting factors of arsenic metabolism, related to DNA damage and repair, will be discussed here.

  19. Effect of alternative temozolomide schedules on glioblastoma O 6-methylguanine-DNA methyltransferase activity and survival

    OpenAIRE

    Robinson, C G; Palomo, J M; Rahmathulla, G; McGraw, M; Donze, J; L. Liu; Vogelbaum, M A

    2010-01-01

    Background: O 6-methylguanine-DNA methyltransferase (MGMT) expression in glioblastoma correlates with temozolomide resistance. Dose-intense temozolomide schedules deplete MGMT activity in peripheral blood mononuclear cells; however, no published data exist evaluating the effect of temozolomide schedules on intracranial tumour MGMT activity. Methods: Human glioblastoma cells (GBM43) with an unmethylated MGMT promoter were implanted intracranially in immunodeficient rodents. Three weeks later, ...

  20. Eukaryotic and archaeal TBP and TFB/TF(II)B follow different promoter DNA bending pathways.

    Science.gov (United States)

    Gietl, Andreas; Holzmeister, Phil; Blombach, Fabian; Schulz, Sarah; von Voithenberg, Lena Voith; Lamb, Don C; Werner, Finn; Tinnefeld, Philip; Grohmann, Dina

    2014-06-01

    During transcription initiation, the promoter DNA is recognized and bent by the basal transcription factor TATA-binding protein (TBP). Subsequent association of transcription factor B (TFB) with the TBP-DNA complex is followed by the recruitment of the ribonucleic acid polymerase resulting in the formation of the pre-initiation complex. TBP and TFB/TF(II)B are highly conserved in structure and function among the eukaryotic-archaeal domain but intriguingly have to operate under vastly different conditions. Employing single-pair fluorescence resonance energy transfer, we monitored DNA bending by eukaryotic and archaeal TBPs in the absence and presence of TFB in real-time. We observed that the lifetime of the TBP-DNA interaction differs significantly between the archaeal and eukaryotic system. We show that the eukaryotic DNA-TBP interaction is characterized by a linear, stepwise bending mechanism with an intermediate state distinguished by a distinct bending angle. TF(II)B specifically stabilizes the fully bent TBP-promoter DNA complex and we identify this step as a regulatory checkpoint. In contrast, the archaeal TBP-DNA interaction is extremely dynamic and TBP from the archaeal organism Sulfolobus acidocaldarius strictly requires TFB for DNA bending. Thus, we demonstrate that transcription initiation follows diverse pathways on the way to the formation of the pre-initiation complex. PMID:24744242

  1. PERK promotes cancer cell proliferation and tumor growth by limiting oxidative DNA damage

    Science.gov (United States)

    Bobrovnikova-Marjon, Ekaterina; Grigoriadou, Christina; Pytel, Dariusz; Zhang, Fang; Ye, Jiangbin; Koumenis, Constantinos; Cavener, Douglas; Diehl, J. Alan

    2010-01-01

    In order to proliferate and expand in an environment with limited nutrients, cancer cells co-opt cellular regulatory pathways that facilitate adaptation and thereby maintain tumor growth and survival potential. The endoplasmic reticulum (ER) is uniquely positioned to sense nutrient deprivation stress and subsequently engage signaling pathways that promote adaptive strategies. As such, components of the ER stress-signaling pathway represent potential anti-neoplastic targets. However, recent investigations into the role of the ER resident protein kinase PERK have paradoxically suggested both pro- and anti-tumorigenic properties. We have utilized animal models of mammary carcinoma to interrogate PERK contribution in the neoplastic process. The ablation of PERK in tumor cells resulted in impaired regeneration of intracellular antioxidants and accumulation of reactive oxygen species triggering oxidative DNA damage. Ultimately, PERK deficiency impeded progression through the cell cycle due to the activation of the DNA damage checkpoint. Our data reveal that PERK-dependent signaling is utilized during both tumor initiation and expansion to maintain redox homeostasis and thereby facilitates tumor growth. PMID:20453876

  2. PERK promotes cancer cell proliferation and tumor growth by limiting oxidative DNA damage.

    Science.gov (United States)

    Bobrovnikova-Marjon, E; Grigoriadou, C; Pytel, D; Zhang, F; Ye, J; Koumenis, C; Cavener, D; Diehl, J A

    2010-07-01

    To proliferate and expand in an environment with limited nutrients, cancer cells co-opt cellular regulatory pathways that facilitate adaptation and thereby maintain tumor growth and survival potential. The endoplasmic reticulum (ER) is uniquely positioned to sense nutrient deprivation stress and subsequently engage signaling pathways that promote adaptive strategies. As such, components of the ER stress-signaling pathway represent potential antineoplastic targets. However, recent investigations into the role of the ER resident protein kinase, RNA-dependent protein kinase (PKR)-like ER kinase (PERK) have paradoxically suggested both pro- and anti-tumorigenic properties. We have used animal models of mammary carcinoma to interrogate the contribution of PERK in the neoplastic process. The ablation of PERK in tumor cells resulted in impaired regeneration of intracellular antioxidants and accumulation of reactive oxygen species triggering oxidative DNA damage. Ultimately, PERK deficiency impeded progression through the cell cycle because of the activation of the DNA damage checkpoint. Our data reveal that PERK-dependent signaling is used during both tumor initiation and expansion to maintain redox homeostasis, thereby facilitating tumor growth.

  3. Eukaryotic and archaeal TBP and TFB/TF(II)B follow different promoter DNA bending pathways

    OpenAIRE

    Gietl, Andreas; Holzmeister, Phil; Blombach, Fabian; Schulz, Sarah; von Voithenberg, Lena Voith; Lamb, Don C; Werner, Finn; Tinnefeld, Philip; Grohmann, Dina

    2014-01-01

    During transcription initiation, the promoter DNA is recognized and bent by the basal transcription factor TATA-binding protein (TBP). Subsequent association of transcription factor B (TFB) with the TBP–DNA complex is followed by the recruitment of the ribonucleic acid polymerase resulting in the formation of the pre-initiation complex. TBP and TFB/TF(II)B are highly conserved in structure and function among the eukaryotic-archaeal domain but intriguingly have to operate under vastly differen...

  4. Transient gene expression control: effects of transfected DNA stability and trans-activation by viral early proteins.

    Science.gov (United States)

    Alwine, J C

    1985-05-01

    The effects of trans-acting factors and transfected DNA stability on promoter activity were examined with chloramphenicol acetyl transferase (CAT) transient expression analysis. With cotransfection into CV-1P and HeLa cells, simian virus 40 T antigen, adenovirus E1a, and herpes-virus IE proteins were compared for their ability to trans-activate a variety of eucaryotic promoters constructed into CAT plasmids. T antigen and the IE protein were promiscuous activators of all the promoters tested [the simian virus 40 late promoter, the adenovirus E3 promoter, the alpha 2(I) collagen promoter, and the promoter of the Rous sarcoma virus long terminal repeat]. Conversely the E1a protein was specific, activating only the adenovirus E3 promoter and suppressing the basal activity of the other promoters. This specificity of activation by E1a contrasted with the high activity generated by all of the promoter-CAT plasmids when transfected into 293 cells, which endogenously produce E1a protein. Examination of transfected 293 cells determined that they stabilized much greater amounts of plasmid DNA than any other cells tested (CV-1P, COS, NIH-3T3, KB). Thus the high activity of nonadenovirus promoter-CAT plasmids in 293 cells results from the cumulative effect of basal promoter activity from a very large number of gene copies, not from E1a activation. This conclusion was supported by similar transfection analysis of KB cell lines which endogenously produce E1a protein. These cells stabilize plasmid DNA at a level comparable to that of CV-1P cells and, in agreement with the CV-1P cotransfection results, did not activate a nonadenovirus promoter-CAT plasmid. These results indicate that the stability of plasmid DNA must be considered when transient gene expression is being compared between cell lines. The use of relative plasmid copy numbers for the standardization of transient expression results is discussed. PMID:2987671

  5. Stress-mediated p38 activation promotes somatic cell reprogramming

    Institute of Scientific and Technical Information of China (English)

    Xinxiu Xu; Quan Wang; Yuan Long; Ru Zhang; Xiaoyuan Wei; Mingzhe Xing; Haifeng Gu

    2013-01-01

    Environmental stress-mediated adaptation plays essential roles in the evolution of life.Cellular adaptation mechanisms usually involve the regulation of chromatin structure,transcription,mRNA stability and translation,which eventually lead to efficient changes in gene expression.Global epigenetic change is also involved in the reprogramming of somatic cells into induced pluripotent stem (iPS) cells by defined factors.Here we report that environmental stress such as hyperosmosis not only facilitates four factor-mediated reprogramming,but also enhances two or one factor-induced iPS cell generation.Hyperosmosis-induced p38 activation plays a critical role in this process.Constitutive active p38 mimics the positive effect of hyperosmosis,while dominant negative p38 and p38 inhibitor block the effect of hyperosmosis.Further study indicates stress-mediated p38 activation may promote reprogramming by reducing the global DNA methylation level and enhancing the expression of pluripotency genes.Our results demonstrate how simple environmental stress like hyperosmosis helps to alter the fate of cells via intracellular signaling and epigenetic modulation.

  6. The role of CopG mediated DNA bending on the regulation of the σ54-dependent promoters in E. coli

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    In order to investigate the role of DNA bending on the regulation of σ54-dependent promoters, we introduced the CopG binding site between the enhancer-like element and the core promoter of glnAp2, nifLp and glnHp2, without changing the distance in between. The expression activities of these homologous promoters were either activated or repressed by the CopG-induced DNA bending in E. coli. In this case, similar regulatory pattern (either activated or repressed) could be observed, when the bending centers from CopG are in integral DNA helixes interval, while opposite regulatory pattern could be observed, when the bending centers from CopG are in integral plus a half DNA helixes interval. These results suggested that CopG-induced DNA bending can exert regulatory effects on the transcription of σ54-dependent promoters probably by altering the relative DNA helix phase of 54 RNA polymerase and NtrC.

  7. Modulation of UvrD helicase activity by covalent DNA-protein cross-links.

    Science.gov (United States)

    Kumari, Anuradha; Minko, Irina G; Smith, Rebecca L; Lloyd, R Stephen; McCullough, Amanda K

    2010-07-01

    UvrD (DNA helicase II) has been implicated in DNA replication, DNA recombination, nucleotide excision repair, and methyl-directed mismatch repair. The enzymatic function of UvrD is to translocate along a DNA strand in a 3' to 5' direction and unwind duplex DNA utilizing a DNA-dependent ATPase activity. In addition, UvrD interacts with many other proteins involved in the above processes and is hypothesized to facilitate protein turnover, thus promoting further DNA processing. Although UvrD interactions with proteins bound to DNA have significant biological implications, the effects of covalent DNA-protein cross-links on UvrD helicase activity have not been characterized. Herein, we demonstrate that UvrD-catalyzed strand separation was inhibited on a DNA strand to which a 16-kDa protein was covalently bound. Our sequestration studies suggest that the inhibition of UvrD activity is most likely due to a translocation block and not helicase sequestration on the cross-link-containing DNA substrate. In contrast, no inhibition of UvrD-catalyzed strand separation was apparent when the protein was linked to the complementary strand. The latter result is surprising given the earlier observations that the DNA in this covalent complex is severely bent ( approximately 70 degrees ), with both DNA strands making multiple contacts with the cross-linked protein. In addition, UvrD was shown to be required for replication of plasmid DNAs containing covalent DNA-protein complexes. Combined, these data suggest a critical role for UvrD in the processing of DNA-protein cross-links. PMID:20444702

  8. Optimization of reporter gene assay: several factors influencing detection of promoter activity

    Institute of Scientific and Technical Information of China (English)

    XUE Li-xiang; WENG Mo; ZHANG Zong-yu; TONG Tan-jun

    2007-01-01

    Background Promoter analysis is currently applied to detect the expression of the targeted gene in studies of signal transduction and transcriptional regulation. As a reporter gene, luciferase plays an important role and has been used widely in the promoter assay.Methods Human embryonic lung fibroblast cells (2BS), HeLa cells and MCF-7 cells were transfected with various genes embedded by lipofectamine. This study determined various factors that affect promoter activity determination,such as the selection of the reporter genes and internal references, the dose and the type of the vectors carrying the transcription factors, the host cells and the instruments.Results The sensitivity of the luciferase assay was much higher than that of enhanced green fluorescence protein (EGFP). Moreover, promoter activity is increased in a dose-related manner only in certain ranges outside of which the results may be reversed and the promoter activity is related to the expression vector which is carrying the cDNA.Otherwise, the length of the promoter, internal references and the host cell can also influence the promoter activity.Conclusions To detect the promoter activity accurately, a few factors including dose, vector, length and host cell which influence reporter gene assay aforementioned should be considered.

  9. Laser controlled singlet oxygen generation in mitochondria to promote mitochondrial DNA replication in vitro.

    Science.gov (United States)

    Zhou, Xin; Wang, Yupei; Si, Jing; Zhou, Rong; Gan, Lu; Di, Cuixia; Xie, Yi; Zhang, Hong

    2015-11-18

    Reports have shown that a certain level of reactive oxygen species (ROS) can promote mitochondrial DNA (mtDNA) replication. However, it is unclear whether it is the mitochondrial ROS that stimulate mtDNA replication and this requires further investigation. Here we employed a photodynamic system to achieve controlled mitochondrial singlet oxygen ((1)O2) generation. HeLa cells incubated with 5-aminolevulinic acid (ALA) were exposed to laser irradiation to induce (1)O2 generation within mitochondria. Increased mtDNA copy number was detected after low doses of 630 nm laser light in ALA-treated cells. The stimulated mtDNA replication was directly linked to mitochondrial (1)O2 generation, as verified using specific ROS scavengers. The stimulated mtDNA replication was regulated by mitochondrial transcription factor A (TFAM) and mtDNA polymerase γ. MtDNA control region modifications were induced by (1)O2 generation in mitochondria. A marked increase in 8-Oxoguanine (8-oxoG) level was detected in ALA-treated cells after irradiation. HeLa cell growth stimulation and G1-S cell cycle transition were also observed after laser irradiation in ALA-treated cells. These cellular responses could be due to a second wave of ROS generation detected in mitochondria. In summary, we describe a controllable method of inducing mtDNA replication in vitro.

  10. Mesoscopic model and free energy landscape for protein-DNA binding sites: analysis of cyanobacterial promoters.

    Directory of Open Access Journals (Sweden)

    Rafael Tapia-Rojo

    2014-10-01

    Full Text Available The identification of protein binding sites in promoter sequences is a key problem to understand and control regulation in biochemistry and biotechnological processes. We use a computational method to analyze promoters from a given genome. Our approach is based on a physical model at the mesoscopic level of protein-DNA interaction based on the influence of DNA local conformation on the dynamics of a general particle along the chain. Following the proposed model, the joined dynamics of the protein particle and the DNA portion of interest, only characterized by its base pair sequence, is simulated. The simulation output is analyzed by generating and analyzing the Free Energy Landscape of the system. In order to prove the capacity of prediction of our computational method we have analyzed nine promoters of Anabaena PCC 7120. We are able to identify the transcription starting site of each of the promoters as the most populated macrostate in the dynamics. The developed procedure allows also to characterize promoter macrostates in terms of thermo-statistical magnitudes (free energy and entropy, with valuable biological implications. Our results agree with independent previous experimental results. Thus, our methods appear as a powerful complementary tool for identifying protein binding sites in promoter sequences.

  11. RCC1-dependent activation of Ran accelerates cell cycle and DNA repair, inhibiting DNA damage-induced cell senescence.

    Science.gov (United States)

    Cekan, Pavol; Hasegawa, Keisuke; Pan, Yu; Tubman, Emily; Odde, David; Chen, Jin-Qiu; Herrmann, Michelle A; Kumar, Sheetal; Kalab, Petr

    2016-04-15

    The coordination of cell cycle progression with the repair of DNA damage supports the genomic integrity of dividing cells. The function of many factors involved in DNA damage response (DDR) and the cell cycle depends on their Ran GTPase-regulated nuclear-cytoplasmic transport (NCT). The loading of Ran with GTP, which is mediated by RCC1, the guanine nucleotide exchange factor for Ran, is critical for NCT activity. However, the role of RCC1 or Ran⋅GTP in promoting cell proliferation or DDR is not clear. We show that RCC1 overexpression in normal cells increased cellular Ran⋅GTP levels and accelerated the cell cycle and DNA damage repair. As a result, normal cells overexpressing RCC1 evaded DNA damage-induced cell cycle arrest and senescence, mimicking colorectal carcinoma cells with high endogenous RCC1 levels. The RCC1-induced inhibition of senescence required Ran and exportin 1 and involved the activation of importin β-dependent nuclear import of 53BP1, a large NCT cargo. Our results indicate that changes in the activity of the Ran⋅GTP-regulated NCT modulate the rate of the cell cycle and the efficiency of DNA repair. Through the essential role of RCC1 in regulation of cellular Ran⋅GTP levels and NCT, RCC1 expression enables the proliferation of cells that sustain DNA damage. PMID:26864624

  12. Genetic variation in the proximal promoter of ABC and SLC superfamilies: liver and kidney specific expression and promoter activity predict variation.

    Directory of Open Access Journals (Sweden)

    Stephanie E Hesselson

    Full Text Available Membrane transporters play crucial roles in the cellular uptake and efflux of an array of small molecules including nutrients, environmental toxins, and many clinically used drugs. We hypothesized that common genetic variation in the proximal promoter regions of transporter genes contribute to observed variation in drug response. A total of 579 polymorphisms were identified in the proximal promoters (-250 to +50 bp and flanking 5' sequence of 107 transporters in the ATP Binding Cassette (ABC and Solute Carrier (SLC superfamilies in 272 DNA samples from ethnically diverse populations. Many transporter promoters contained multiple common polymorphisms. Using a sliding window analysis, we observed that, on average, nucleotide diversity (pi was lowest at approximately 300 bp upstream of the transcription start site, suggesting that this region may harbor important functional elements. The proximal promoters of transporters that were highly expressed in the liver had greater nucleotide diversity than those that were highly expressed in the kidney consistent with greater negative selective pressure on the promoters of kidney transporters. Twenty-one promoters were evaluated for activity using reporter assays. Greater nucleotide diversity was observed in promoters with strong activity compared to promoters with weak activity, suggesting that weak promoters are under more negative selective pressure than promoters with high activity. Collectively, these results suggest that the proximal promoter region of membrane transporters is rich in variation and that variants in these regions may play a role in interindividual variation in drug disposition and response.

  13. Mrc1 is a replication fork component whose phosphorylation in response to DNA replication stress activates Rad53

    OpenAIRE

    Osborn, Alexander J.; Elledge, Stephen J.

    2003-01-01

    When DNA replication is stalled, a signal transduction pathway is activated that promotes the stability of stalled forks and resumption of DNA synthesis. In budding yeast, this pathway includes the kinases Mec1 and Rad53. Here we report that the Mediator protein Mrc1, which is required for normal DNA replication and for activation of Rad53, is present at replication forks. Mrc1 initially binds early-replicating sequences and moves along chromatin with the replication f...

  14. DNA Evidence Uncompromised by Active Oxygen

    Directory of Open Access Journals (Sweden)

    Ana Castelló

    2010-01-01

    Full Text Available Currently, forensic sciences can make use of the potential of instrumental analysis techniques to obtain information from the smallest, even invisible, samples. However, as laboratory techniques improve, so too should the procedures applied in the search for and initial testing of clues in order to be equally effective. This requires continuous revision so that those procedures may resolve the problems that samples present. As far as bloodstains are concerned, there are methods available that are recognized as being both highly sensitive and effective. Nevertheless, the marketing of new cleaning products, those that contain active oxygen, has raised doubts about the ability of those procedures to detect blood. It has been shown that stains washed with these detergents (and still visible invalidated both the presumptive test (reduced phenolphthalein, luminol, and Bluestar® and that applied for determining human hemoglobin. These findings have caused considerable concern both within the forensic and scientific community, and among the general public, so obliging us to seek solutions. In this work, the effect of these new cleaning products on DNA analyses is studied. The results, encouraging ones, show that these detergents, despite invalidating all other tests, do not hinder the extraction, or the subsequent analysis, of DNA.

  15. Nuclear interferon-inducible protein 16 promotes silencing of herpesviral and transfected DNA

    Science.gov (United States)

    Orzalli, Megan H.; Conwell, Sara E.; Berrios, Christian; DeCaprio, James A.; Knipe, David M.

    2013-01-01

    Mammalian cells have evolved mechanisms to silence foreign DNA introduced by viruses or by transfection. Upon herpesviral infection of cells, the viral genome is chromatinized in an attempt by the host cell to restrict expression of the viral genome. HSV ICP0 acts to counter host-intrinsic and innate responses to viral infection. We have found that nuclear interferon (IFN)-inducible protein 16 (IFI16) acts as a restriction factor against ICP0-null herpes simplex virus 1 (HSV-1) to limit viral replication and immediate–early gene expression. IFI16 promoted the addition of heterochromatin marks and the reduction of euchromatin marks on viral chromatin. IFI16 also restricted the expression of plasmid DNAs introduced by transfection but did not restrict SV40 DNA introduced into the cellular nucleus in the form of nucleosomal chromatin by viral infection. These results argue that IFI16 restricts unchromatinized DNA when it enters the cell nucleus by promoting the loading of nucleosomes and the addition of heterochromatin marks. Furthermore, these results indicate that IFI16 provides a broad surveillance role against viral and transfected DNA by promoting restriction of gene expression from the exogenous DNA and inducing innate immune responses. PMID:24198334

  16. Nuclear interferon-inducible protein 16 promotes silencing of herpesviral and transfected DNA.

    Science.gov (United States)

    Orzalli, Megan H; Conwell, Sara E; Berrios, Christian; DeCaprio, James A; Knipe, David M

    2013-11-19

    Mammalian cells have evolved mechanisms to silence foreign DNA introduced by viruses or by transfection. Upon herpesviral infection of cells, the viral genome is chromatinized in an attempt by the host cell to restrict expression of the viral genome. HSV ICP0 acts to counter host-intrinsic and innate responses to viral infection. We have found that nuclear interferon (IFN)-inducible protein 16 (IFI16) acts as a restriction factor against ICP0-null herpes simplex virus 1 (HSV-1) to limit viral replication and immediate-early gene expression. IFI16 promoted the addition of heterochromatin marks and the reduction of euchromatin marks on viral chromatin. IFI16 also restricted the expression of plasmid DNAs introduced by transfection but did not restrict SV40 DNA introduced into the cellular nucleus in the form of nucleosomal chromatin by viral infection. These results argue that IFI16 restricts unchromatinized DNA when it enters the cell nucleus by promoting the loading of nucleosomes and the addition of heterochromatin marks. Furthermore, these results indicate that IFI16 provides a broad surveillance role against viral and transfected DNA by promoting restriction of gene expression from the exogenous DNA and inducing innate immune responses. PMID:24198334

  17. Increased anticoagulant activity of thrombin-binding DNA aptamers by nanoscale organization on DNA nanostructures

    OpenAIRE

    Rangnekar, Abhijit; Zhang, Alex M.; Shiyuan Li, Susan; M. Bompiani, Kristin; Hansen, Majken Nørgaard; Gothelf, Kurt Vesterager; Sullenger, Bruce A; LaBean, Thomas H.

    2012-01-01

    Control over thrombin activity is much desired to regulate blood clotting in surgical and therapeutic situations. Thrombin-binding RNA and DNA aptamers have been used to inhibit thrombin activity and thus the coagulation cascade. Soluble DNA aptamers, as well as two different aptamers tethered by a flexible single-strand linker, have been shown to possess anticoagulant activity. Here, we link multiple aptamers at programmed positions on DNA nanostructures to optimize spacing and orientation o...

  18. Epigenetic features in the oyster Crassostrea gigas suggestive of functionally relevant promoter DNA methylation in invertebrates.

    Directory of Open Access Journals (Sweden)

    Guillaume eRiviere

    2014-04-01

    Full Text Available DNA methylation is evolutionarily conserved. Vertebrates exhibit high, widespread DNA methylation whereas invertebrate genomes are less methylated, predominantly within gene bodies. DNA methylation in invertebrates is associated with transcription level, alternative splicing and genome evolution, but functional outcomes of DNA methylation remain poorly described in lophotrochozoans. Recent genome-wide approaches improve understanding in distant taxa such as molluscs, where the phylogenetic position and life traits of Crassostrea gigas make this bivalve an ideal model to study the physiological and evolutionary implications of DNA methylation. We review the literature about DNA methylation in invertebrates and focus on DNA methylation features in the oyster. Indeed, though our MeDIP-seq results confirm predominant intragenic methylation, the profiles depend on the oyster’s developmental and reproductive stage. We discuss the perspective that oyster DNA methylation could be biased toward the 5’-end of some genes, depending on physiological status, suggesting important functional outcomes of putative promoter methylation from cell differentiation during early development to sustained adaptation of the species to the environment.

  19. Introgression of mitochondrial DNA promoted by natural selection in the Japanese pipistrelle bat (Pipistrellus abramus).

    Science.gov (United States)

    Dong, Ji; Mao, Xiuguang; Sun, Haijian; Irwin, David M; Zhang, Shuyi; Hua, Panyu

    2014-12-01

    Introgression of mitochondrial DNA (mtDNA) between closely related taxa can be promoted by either neutral processes or natural selection. Since mitochondrial gene-encoded proteins play critical roles in oxidative metabolism, mtDNA genes are commonly considered to experience strong selective constraint. However, metabolic requirements vary across climatic and ecological gradients, thus modifying potential selective pressures acting on mtDNA genes. Here we conducted tests to detect adaptive evolution occurring in two mtDNA genes (Cytb and ND5) in individuals of Japanese pipistrelle bat (Pipistrellus abramus) across the mainland of China and Hainan Island. Nuclear DNA markers identified two clades in both the mainland and Hainan Island populations, whereas each of these regions had a specific mtDNA clade. This cyto-nuclear discordance is most likely caused by introgression of the mtDNA by ruling out two other alternative scenarios (incomplete lineage sorting and sex-biased gene flow). Although population-based analyses revealed purifying selection acting on Cytb and neutrality in ND5, multiple nonsynonymous substitutions in both Cytb and ND5 were suggested to have been caused by positive selection by a divergence-based analysis. Our study supports the view that molecular adaptation can occur at genes under strong purifying selection if nonsynonymous substitutions cause radical changes in the physicochemical properties of amino acids.

  20. Promoting physical activity in persons with subacute spinal cord injury

    NARCIS (Netherlands)

    C.F.J. Nooijen (Carla)

    2015-01-01

    markdownabstractAbstract Introduction: After discharge from inpatient rehabilitation, physical activity levels in persons with spinal cord injury (SCI) are known to decline. Primary objective: To evaluate the added value of a behavioral intervention promoting an active lifestyle after discharge

  1. Gastric cancer associated variant of DNA polymerase beta (Leu22Pro) promotes DNA replication associated double strand breaks.

    Science.gov (United States)

    Rozacky, Jenna; Nemec, Antoni A; Sweasy, Joann B; Kidane, Dawit

    2015-09-15

    DNA polymerase beta (Pol β) is a key enzyme for the protection against oxidative DNA lesions via its role in base excision repair (BER). Approximately 1/3 of tumors studied to date express Pol β variant proteins, and several tumors overexpress Pol β. Pol β possesses DNA polymerase and dRP lyase activities, both of which are known to be important for efficient BER. The dRP lyase activity resides within the 8kDa amino terminal domain of Pol β, is responsible for removal of the 5' phosphate group (5'-dRP). The DNA polymerase subsequently fills the gaps. Previously, we demonstrated that the human gastric cancer-associated variant of Pol β (Leu22Pro (L22P)) lacks dRP lyase function in vitro. Here, we report that L22P-expressing cells harbor significantly increased replication associated DNA double strand breaks (DSBs) and defective maintenance of the nascent DNA strand (NDS) during replication stress. Moreover, L22P-expressing cells are sensitive to PARP1 inhibitors, which suggests trapped PARP1 binds to the 5'-dRP group and blocks replications forks, resulting in fork collapse and DSBs. Our data suggest that the normal function of the dRP lyase is critical to maintain replication fork integrity and prevent replication fork collapse to DSBs and cellular transformation. PMID:26090616

  2. Purification of total DNA extracted from activated sludge

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Purification of the total DNA extracted from activated sludge samples was studied. The effects of extraction buffers and lysis treatments (lysozyme, sodium dodecyl sulfate (SDS), sonication, mechanical mill and thermal shock) on yield and purity of the total DNA extracted from activated sludge were investigated. It was found that SDS and mechanical mill were the most effective ways for cell lysis, and both gave the highest DNA yields, while by SDS and thermal shock, the purest DNA extract could be obtained. The combination of SDS with other lysis treatment, such as sonication and thermal shock, could apparently increase the DNA yields but also result in severe shearing. For the purification of the crude DNA extract, polyvinyl polypyrrolidone was used for the removal of humic contaminants. Cetyltrimethyl ammonium bromide, potassium acetate and phenol/chloroform were used to remove proteins and polysaccharides from crude DNA. Crude DNA was further purified by isopropanol precipitation. Thus, a suitable protocol was proposed for DNA extraction, yielding about 49.9 mg (DNA)/g volatile suspended solids, and the DNA extracts were successfully used in PCR amplifications for 16S rDNA and 16S rDNA V3 region. The PCR products of 16S rDNA V3 region allowed the DGGE analysis (denatured gradient gel electrophoresis) to be possible.

  3. A novel DNA joining activity catalyzed by T4 DNA ligase.

    OpenAIRE

    Western, L M; Rose, S. J.

    1991-01-01

    The use of T4 and E. coli DNA ligases in genetic engineering technology is usually associated with nick-closing activity in double stranded DNA or ligation of 'sticky-ends' to produce recombinant DNA molecules. We describe in this communication the ability of T4 DNA ligase to catalyze intramolecular loop formation between annealed oligodeoxyribonucleotides wherein Watson-Crick base pairing is absent on one side of the ligation site. Enzyme concentration, loop size, substrate specificity, and ...

  4. Integrity and Biological Activity of DNA after UV Exposure

    Science.gov (United States)

    Lyon, Delina Y.; Monier, Jean-Michel; Dupraz, Sébastien; Freissinet, Caroline; Simonet, Pascal; Vogel, Timothy M.

    2010-04-01

    The field of astrobiology lacks a universal marker with which to indicate the presence of life. This study supports the proposal to use nucleic acids, specifically DNA, as a signature of life (biosignature). In addition to its specificity to living organisms, DNA is a functional molecule that can confer new activities and characteristics to other organisms, following the molecular biology dogma, that is, DNA is transcribed to RNA, which is translated into proteins. Previous criticisms of the use of DNA as a biosignature have asserted that DNA molecules would be destroyed by UV radiation in space. To address this concern, DNA in plasmid form was deposited onto different surfaces and exposed to UVC radiation. The surviving DNA was quantified via the quantitative polymerase chain reaction (qPCR). Results demonstrate increased survivability of DNA attached to surfaces versus non-adsorbed DNA. The DNA was also tested for biological activity via transformation into the bacterium Acinetobacter sp. and assaying for antibiotic resistance conferred by genes encoded by the plasmid. The success of these methods to detect DNA and its gene products after UV exposure (254 nm, 3.5 J/m2s) not only supports the use of the DNA molecule as a biosignature on mineral surfaces but also demonstrates that the DNA retained biological activity.

  5. Development and functional analysis of novel genetic promoters using DNA shuffling, hybridization and a combination thereof.

    Directory of Open Access Journals (Sweden)

    Rajiv Ranjan

    Full Text Available BACKGROUND: Development of novel synthetic promoters with enhanced regulatory activity is of great value for a diverse range of plant biotechnology applications. METHODOLOGY: Using the Figwort mosaic virus full-length transcript promoter (F and the sub-genomic transcript promoter (FS sequences, we generated two single shuffled promoter libraries (LssF and LssFS, two multiple shuffled promoter libraries (LmsFS-F and LmsF-FS, two hybrid promoters (FuasFScp and FSuasFcp and two hybrid-shuffled promoter libraries (LhsFuasFScp and LhsFSuasFcp. Transient expression activities of approximately 50 shuffled promoter clones from each of these libraries were assayed in tobacco (Nicotiana tabacum cv. Xanthi protoplasts. It was observed that most of the shuffled promoters showed reduced activity compared to the two parent promoters (F and FS and the CaMV35S promoter. In silico studies (computer simulated analyses revealed that the reduced promoter activities of the shuffled promoters could be due to their higher helical stability. On the contrary, the hybrid promoters FuasFScp and FSuasFcp showed enhanced activities compared to F, FS and CaMV 35S in both transient and transgenic Nicotiana tabacum and Arabidopsis plants. Northern-blot and qRT-PCR data revealed a positive correlation between transcription and enzymatic activity in transgenic tobacco plants expressing hybrid promoters. Histochemical/X-gluc staining of whole transgenic seedlings/tissue-sections and fluorescence images of ImaGene Green™ treated roots and stems expressing the GUS reporter gene under the control of the FuasFScp and FSuasFcp promoters also support the above findings. Furthermore, protein extracts made from protoplasts expressing the human defensin (HNP-1 gene driven by hybrid promoters showed enhanced antibacterial activity compared to the CaMV35S promoter. SIGNIFICANCE/CONCLUSION: Both shuffled and hybrid promoters developed in the present study can be used as molecular tools to

  6. Microcalorimetric Studies on Gene Promoter Function of Cloned DNA Fragements from Halobacterium halobium J7 Plasmid pHH205 in Escherichia coli TG1

    Institute of Scientific and Technical Information of China (English)

    LEI,Ke-Lin; HOU,Han-Na; LIU,Yi; YE,Xue-Cheng; SHEN,Ping

    2007-01-01

    Halobacterium halobium is a typical kind of extremely halophilic bacterium. Combined with the antibiotic resistance assay, the microcalorimetric method was used to study the promoter function of the cloned DNA fragments from Halobacterium halobium J7 plasmid pHH205 in Escherichia coli TG1. The promoter probe vector, plasmid pKK232-8, was used to form the recombinants. The DNA fragment, which is the promoter for the chloramphenicol acetyl transferase (CAT) gene in plasmid pKK232-8, is about 800 bp, and the chloramphenicol resistance level presented by IC50 is about 200 μg·mL-1, which suggests a high promoter activity. The conclusions show that there probably exist double-function or trinary-function gene promoters in Halobacterium halobium, and Archaea may contain rich genetic resources.

  7. Escherichia coli DnaE Polymerase Couples Pyrophosphatase Activity to DNA Replication.

    Directory of Open Access Journals (Sweden)

    Fabio Lapenta

    Full Text Available DNA Polymerases generate pyrophosphate every time they catalyze a step of DNA elongation. This elongation reaction is generally believed as thermodynamically favoured by the hydrolysis of pyrophosphate, catalyzed by inorganic pyrophosphatases. However, the specific action of inorganic pyrophosphatases coupled to DNA replication in vivo was never demonstrated. Here we show that the Polymerase-Histidinol-Phosphatase (PHP domain of Escherichia coli DNA Polymerase III α subunit features pyrophosphatase activity. We also show that this activity is inhibited by fluoride, as commonly observed for inorganic pyrophosphatases, and we identified 3 amino acids of the PHP active site. Remarkably, E. coli cells expressing variants of these catalytic residues of α subunit feature aberrant phenotypes, poor viability, and are subject to high mutation frequencies. Our findings indicate that DNA Polymerases can couple DNA elongation and pyrophosphate hydrolysis, providing a mechanism for the control of DNA extension rate, and suggest a promising target for novel antibiotics.

  8. Active DNA demethylation by oxidation and repair

    Institute of Scientific and Technical Information of China (English)

    Zhizhong Gong; Jian-Kang Zhu

    2011-01-01

    DNA methylation and demethylation are increasingly recognized as important epigenetic factors in both plants and animals.DNA methylation,which is catalyzed by DNA methyltransferases (DNMTs),is a relatively stable and heritable modification that controls gene expression,cellular differentiation,genomic imprinting,paramutation,transposon movement,X-inactivation,and embryogenesis [1].The methylation of cytosine to 5-methylcytosine (5mC) is an important example of DNA modification in animals and plants.This highlight concerns DNA demethylation mechanisms in mammals and whether they are similar to that in plants.

  9. Spi-1/PU.1 oncogene accelerates DNA replication fork elongation and promotes genetic instability in the absence of DNA breakage.

    Science.gov (United States)

    Rimmelé, Pauline; Komatsu, Jun; Hupé, Philippe; Roulin, Christophe; Barillot, Emmanuel; Dutreix, Marie; Conseiller, Emmanuel; Bensimon, Aaron; Moreau-Gachelin, Françoise; Guillouf, Christel

    2010-09-01

    The multistage process of cancer formation is driven by the progressive acquisition of somatic mutations. Replication stress creates genomic instability in mammals. Using a well-defined multistep leukemia model driven by Spi-1/PU.1 overexpression in the mouse and Spi-1/PU.1-overexpressing human leukemic cells, we investigated the relationship between DNA replication and cancer progression. Here, using DNA molecular combing and flow cytometry methods, we show that Spi-1 increases the speed of replication by acting specifically on elongation rather than enhancing origin firing. This shortens the S-phase duration. Combining data from Spi-1 knockdown in murine cells with Spi-1 overexpression in human cells, we provide evidence that inappropriate Spi-1 expression is directly responsible for the replication alteration observed. Importantly, the acceleration of replication progression coincides with an increase in the frequency of genomic mutations without inducing DNA breakage. Thus, we propose that the hitherto unsuspected role for spi-1 oncogene in promoting replication elongation and genomic mutation promotes blastic progression during leukemic development.

  10. Neuritin: a gene induced by neural activity and neurotrophins that promotes neuritogenesis.

    Science.gov (United States)

    Naeve, G S; Ramakrishnan, M; Kramer, R; Hevroni, D; Citri, Y; Theill, L E

    1997-03-18

    Neural activity and neurotrophins induce synaptic remodeling in part by altering gene expression. A cDNA encoding a glycosylphoshatidylinositol-anchored protein was identified by screening for hippocampal genes that are induced by neural activity. This molecule, named neuritin, is expressed in postmitotic-differentiating neurons of the developing nervous system and neuronal structures associated with plasticity in the adult. Neuritin message is induced by neuronal activity and by the activity-regulated neurotrophins BDNF and NT-3. Purified recombinant neuritin promotes neurite outgrowth and arborization in primary embryonic hippocampal and cortical cultures. These data implicate neuritin as a downstream effector of activity-induced neurite outgrowth. PMID:9122250

  11. Activity-promoting gaming systems in exercise and rehabilitation.

    Science.gov (United States)

    Taylor, Matthew J D; McCormick, Darren; Shawis, Teshk; Impson, Rebecca; Griffin, Murray

    2011-01-01

    Commercial activity-promoting gaming systems provide a potentially attractive means to facilitate exercise and rehabilitation. The Nintendo Wii, Sony EyeToy, Dance Dance Revolution, and Xbox Kinect are examples of gaming systems that use the movement of the player to control gameplay. Activity-promoting gaming systems can be used as a tool to increase activity levels in otherwise sedentary gamers and also be an effective tool to aid rehabilitation in clinical settings. Therefore, the aim of this current work is to review the growing area of activity-promoting gaming in the context of exercise, injury, and rehabilitation.

  12. Activity-promoting gaming systems in exercise and rehabilitation

    Directory of Open Access Journals (Sweden)

    Matthew J. D. Taylor, PhD

    2011-12-01

    Full Text Available Commercial activity-promoting gaming systems provide a potentially attractive means to facilitate exercise and rehabilitation. The Nintendo Wii, Sony EyeToy, Dance Dance Revolution, and Xbox Kinect are examples of gaming systems that use the movement of the player to control gameplay. Activity-promoting gaming systems can be used as a tool to increase activity levels in otherwise sedentary gamers and also be an effective tool to aid rehabilitation in clinical settings. Therefore, the aim of this current work is to review the growing area of activity-promoting gaming in the context of exercise, injury, and rehabilitatio

  13. The artificial zinc finger coding gene 'Jazz' binds the utrophin promoter and activates transcription.

    Science.gov (United States)

    Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C

    2000-06-01

    Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.

  14. Invariant distribution of promoter activities in Escherichia coli.

    Science.gov (United States)

    Zaslaver, Alon; Kaplan, Shai; Bren, Anat; Jinich, Adrian; Mayo, Avi; Dekel, Erez; Alon, Uri; Itzkovitz, Shalev

    2009-10-01

    Cells need to allocate their limited resources to express a wide range of genes. To understand how Escherichia coli partitions its transcriptional resources between its different promoters, we employ a robotic assay using a comprehensive reporter strain library for E. coli to measure promoter activity on a genomic scale at high-temporal resolution and accuracy. This allows continuous tracking of promoter activity as cells change their growth rate from exponential to stationary phase in different media. We find a heavy-tailed distribution of promoter activities, with promoter activities spanning several orders of magnitude. While the shape of the distribution is almost completely independent of the growth conditions, the identity of the promoters expressed at different levels does depend on them. Translation machinery genes, however, keep the same relative expression levels in the distribution across conditions, and their fractional promoter activity tracks growth rate tightly. We present a simple optimization model for resource allocation which suggests that the observed invariant distributions might maximize growth rate. These invariant features of the distribution of promoter activities may suggest design constraints that shape the allocation of transcriptional resources.

  15. Invariant distribution of promoter activities in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Alon Zaslaver

    2009-10-01

    Full Text Available Cells need to allocate their limited resources to express a wide range of genes. To understand how Escherichia coli partitions its transcriptional resources between its different promoters, we employ a robotic assay using a comprehensive reporter strain library for E. coli to measure promoter activity on a genomic scale at high-temporal resolution and accuracy. This allows continuous tracking of promoter activity as cells change their growth rate from exponential to stationary phase in different media. We find a heavy-tailed distribution of promoter activities, with promoter activities spanning several orders of magnitude. While the shape of the distribution is almost completely independent of the growth conditions, the identity of the promoters expressed at different levels does depend on them. Translation machinery genes, however, keep the same relative expression levels in the distribution across conditions, and their fractional promoter activity tracks growth rate tightly. We present a simple optimization model for resource allocation which suggests that the observed invariant distributions might maximize growth rate. These invariant features of the distribution of promoter activities may suggest design constraints that shape the allocation of transcriptional resources.

  16. A mechanism for DNA-PK activation requiring unique contributions from each strand of a DNA terminus and implications for microhomology-mediated nonhomologous DNA end joining

    OpenAIRE

    Pawelczak, Katherine S; Turchi, John J.

    2008-01-01

    DNA-dependent protein kinase (DNA-PK) is an essential component of the nonhomologous end joining pathway (NHEJ), responsible for the repair of DNA double-strand breaks. Ku binds a DSB and recruits the catalytic subunit, DNA-PKcs, where it is activated once the kinase is bound to the DSB. The precise mechanism by which DNA activates DNA-PK remains unknown. We have investigated the effect of DNA structure on DNA-PK activation and results demonstrate that in Ku-dependent DNA-PKcs reactions, DNA-...

  17. The DNA cytosine deaminase APOBEC3B promotes tamoxifen resistance in ER-positive breast cancer

    Science.gov (United States)

    Law, Emily K.; Sieuwerts, Anieta M.; LaPara, Kelly; Leonard, Brandon; Starrett, Gabriel J.; Molan, Amy M.; Temiz, Nuri A.; Vogel, Rachel Isaksson; Meijer-van Gelder, Marion E.; Sweep, Fred C. G. J.; Span, Paul N.; Foekens, John A.; Martens, John W. M.; Yee, Douglas; Harris, Reuben S.

    2016-01-01

    Breast tumors often display extreme genetic heterogeneity characterized by hundreds of gross chromosomal aberrations and tens of thousands of somatic mutations. Tumor evolution is thought to be ongoing and driven by multiple mutagenic processes. A major outstanding question is whether primary tumors have preexisting mutations for therapy resistance or whether additional DNA damage and mutagenesis are necessary. Drug resistance is a key measure of tumor evolvability. If a resistance mutation preexists at the time of primary tumor presentation, then the intended therapy is likely to fail. However, if resistance does not preexist, then ongoing mutational processes still have the potential to undermine therapeutic efficacy. The antiviral enzyme APOBEC3B (apolipoprotein B mRNA-editing enzyme, catalytic polypeptide-like 3B) preferentially deaminates DNA C-to-U, which results in signature C-to-T and C-to-G mutations commonly observed in breast tumors. We use clinical data and xenograft experiments to ask whether APOBEC3B contributes to ongoing breast tumor evolution and resistance to the selective estrogen receptor modulator, tamoxifen. First, APOBEC3B levels in primary estrogen receptor–positive (ER+) breast tumors inversely correlate with the clinical benefit of tamoxifen in the treatment of metastatic ER+ disease. Second, APOBEC3B depletion in an ER+ breast cancer cell line results in prolonged tamoxifen responses in murine xenograft experiments. Third, APOBEC3B overexpression accelerates the development of tamoxifen resistance in murine xenograft experiments by a mechanism that requires the enzyme’s catalytic activity. These studies combine to indicate that APOBEC3B promotes drug resistance in breast cancer and that inhibiting APOBEC3B-dependent tumor evolvability may be an effective strategy to improve efficacies of targeted cancer therapies. PMID:27730215

  18. Activity-promoting gaming systems in exercise and rehabilitation

    OpenAIRE

    Matthew J. D. Taylor, PhD; Darren McCormick, BSc; Teshk Shawis, MBChB, FRCP; Rebecca Impson, MSc; Murray Griffin, PhD

    2011-01-01

    Commercial activity-promoting gaming systems provide a potentially attractive means to facilitate exercise and rehabilitation. The Nintendo Wii, Sony EyeToy, Dance Dance Revolution, and Xbox Kinect are examples of gaming systems that use the movement of the player to control gameplay. Activity-promoting gaming systems can be used as a tool to increase activity levels in otherwise sedentary gamers and also be an effective tool to aid rehabilitation in clinical settings. Therefore, the aim of t...

  19. Condensin promotes the juxtaposition of DNA flanking its loading site in Bacillus subtilis.

    Science.gov (United States)

    Wang, Xindan; Le, Tung B K; Lajoie, Bryan R; Dekker, Job; Laub, Michael T; Rudner, David Z

    2015-08-01

    SMC condensin complexes play a central role in compacting and resolving replicated chromosomes in virtually all organisms, yet how they accomplish this remains elusive. In Bacillus subtilis, condensin is loaded at centromeric parS sites, where it encircles DNA and individualizes newly replicated origins. Using chromosome conformation capture and cytological assays, we show that condensin recruitment to origin-proximal parS sites is required for the juxtaposition of the two chromosome arms. Recruitment to ectopic parS sites promotes alignment of large tracks of DNA flanking these sites. Importantly, insertion of parS sites on opposing arms indicates that these "zip-up" interactions only occur between adjacent DNA segments. Collectively, our data suggest that condensin resolves replicated origins by promoting the juxtaposition of DNA flanking parS sites, drawing sister origins in on themselves and away from each other. These results are consistent with a model in which condensin encircles the DNA flanking its loading site and then slides down, tethering the two arms together. Lengthwise condensation via loop extrusion could provide a generalizable mechanism by which condensin complexes act dynamically to individualize origins in B. subtilis and, when loaded along eukaryotic chromosomes, resolve them during mitosis. PMID:26253537

  20. Increased anticoagulant activity of thrombin-binding DNA aptamers by nanoscale organization on DNA nanostructures

    DEFF Research Database (Denmark)

    Rangnekar, Abhijit; Zhang, Alex M.; Shiyuan Li, Susan;

    2012-01-01

    Control over thrombin activity is much desired to regulate blood clotting in surgical and therapeutic situations. Thrombin-binding RNA and DNA aptamers have been used to inhibit thrombin activity and thus the coagulation cascade. Soluble DNA aptamers, as well as two different aptamers tethered by...

  1. Effect of γ-irradiated DNA on the activity of DNA polymerase

    International Nuclear Information System (INIS)

    A cell-free assay was developed to measure the effect of γ-irradiated DNA template on the ability of DNA polymerase to copy unirradiated template. Doses as low as 1 krad were able to decrease (approx. 15%) the activity of both bacterial and mammalian DNA polymerases in the assay. The percentage of polymerase activity decreased as the dose received by the template increased. The reduction in DNA polymerase activity was shown to be due to an inhibition of the enzyme by the irradiated DNA. Irradiated poly(dA-dT) was more effective in reducing polymerase activity than calf thymus DNA. Thus the polymerase-inhibition site(s) appears to be associated with base damage, specifically adenine or thymine. Using a free-radical scavenger, OH radicals were found to be involved in producing the damage sites. The interaction between irradiated DNA and DNA polymerase was found to be specific for the enzyme and not for other proteins present in the assay. The inhibition of DNA polymerase occurred prior to or during the initiation of DNA synthesis rather than after initiation of synthesis, i.e., during elongation

  2. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Directory of Open Access Journals (Sweden)

    Fauteux François

    2009-10-01

    Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination

  3. Engagement of membrane immunoglobulin enhances Id3 promoter activity in WEHI-231 B lymphoma cells

    Institute of Scientific and Technical Information of China (English)

    Xiao-jun LI; Kikumi HATA; Junichiro MIZUGUCHI

    2005-01-01

    Aim: We have recently shown that engagement of membrane immunoglobulin (mIg) induced upregulation of inhibitor of differentiation 3 (Id3) mRNA, resulting in growth arrest at G1 phase in WEHI-231 cells. In the present study, we examined whether engagement of mIg will affect promoter activity of the Id3 gene in WEHI231 cells. Methods: DNA fragments corresponding to the 5′-flanking region of mId3 gene were amplified by polymerase chain reaction (PCR) using genomic DNA as the template. Three DNA fragments upstream of the transcription start site (+ 1) of the mId3 gene were subcloned into the luciferase reporter vector PGVB2. The recombinant constructs were transiently transfected into WEHI-231 cells by an electroporation method. After incubation for 24 h, WEHI-231 cells were stimulated with 10 mg/L anti-IgM or irradiated CD40L-expressing NIH3T3 cells or control NIH3T3 cells for further 24 h, followed by assay for luciferase activity. Results: The luciferase analysis demonstrated that basal promoter activity of the Id3 gene was found in the region between -200 and +54. The Id3 promoter activity was increased 2-fold following stimulation with anti-IgM, but not CD40L, compared with medium alone. Conclusion: The mIg-mediated upregulation of Id3 expression is controlled, at least in part, through transcriptional regulation, as assessed by luciferase assay.

  4. Promoting Physical Activity during Early Childhood

    Science.gov (United States)

    Vidoni, Carla; Ignico, Arlene

    2011-01-01

    The prevalence of obesity in children and adolescents from low-income families in the USA has become a significant concern over the last 20 years. One of the major contributors to this problem is the lack of physical activity. The purpose of this paper is to describe initiatives designed to: (1) engage young children in physical activity during…

  5. DNA replication origin activation in space and time.

    Science.gov (United States)

    Fragkos, Michalis; Ganier, Olivier; Coulombe, Philippe; Méchali, Marcel

    2015-06-01

    DNA replication begins with the assembly of pre-replication complexes (pre-RCs) at thousands of DNA replication origins during the G1 phase of the cell cycle. At the G1-S-phase transition, pre-RCs are converted into pre-initiation complexes, in which the replicative helicase is activated, leading to DNA unwinding and initiation of DNA synthesis. However, only a subset of origins are activated during any S phase. Recent insights into the mechanisms underlying this choice reveal how flexibility in origin usage and temporal activation are linked to chromosome structure and organization, cell growth and differentiation, and replication stress.

  6. Transcription from the P1 promoters of Micromonospora echinospora in the absence of native upstream DNA sequences.

    OpenAIRE

    Baum, E Z; Buttner, M J; Lin, L S; Rothstein, D. M.

    1989-01-01

    We demonstrated previously that the 0.4-kilobase DNA fragment from Micromonospora echinospora contains multiple tandem promoters, P1a, P1b, P1c, and P2, which are also functional when cloned into Streptomyces lividans. We now show by in vitro transcription with Streptomyces RNA polymerase that each of these promoters is an authentic initiation site, rather than a processing site for transcripts which initiate further upstream. The DNA sequence requirements for the closely spaced promoters P1a...

  7. Cyclin F suppresses B-Myb activity to promote cell cycle checkpoint control

    DEFF Research Database (Denmark)

    Klein, Ditte Kjærsgaard; Hoffmann, Saskia; Ahlskog, Johanna K;

    2015-01-01

    Cells respond to DNA damage by activating cell cycle checkpoints to delay proliferation and facilitate DNA repair. Here, to uncover new checkpoint regulators, we perform RNA interference screening targeting genes involved in ubiquitylation processes. We show that the F-box protein cyclin F plays...... an important role in checkpoint control following ionizing radiation. Cyclin F-depleted cells initiate checkpoint signalling after ionizing radiation, but fail to maintain G2 phase arrest and progress into mitosis prematurely. Importantly, cyclin F suppresses the B-Myb-driven transcriptional programme...... that promotes accumulation of crucial mitosis-promoting proteins. Cyclin F interacts with B-Myb via the cyclin box domain. This interaction is important to suppress cyclin A-mediated phosphorylation of B-Myb, a key step in B-Myb activation. In summary, we uncover a regulatory mechanism linking the F-box protein...

  8. Physical Activity Promotion in Call Centres: Employers' Perspectives

    Science.gov (United States)

    Renton, Sheila J.; Lightfoot, Nancy E.; Maar, Marion A.

    2011-01-01

    This study followed a predominantly qualitative approach to explore the perspectives of employers in Sudbury, Ontario, Canada, call centres (CCs) regarding physical activity (PA) promotion in workplaces, by identifying current practices and employers' motivation to promote PA, as well as perceived facilitators and barriers. In-depth interviews…

  9. miR-29 Represses the Activities of DNA Methyltransferases and DNA Demethylases

    Directory of Open Access Journals (Sweden)

    Izuho Hatada

    2013-07-01

    Full Text Available Members of the microRNA-29 (miR-29 family directly target the DNA methyltransferases, DNMT3A and DNMT3B. Disturbances in the expression levels of miR-29 have been linked to tumorigenesis and tumor aggressiveness. Members of the miR-29 family are currently thought to repress DNA methylation and suppress tumorigenesis by protecting against de novo methylation. Here, we report that members of the miR-29 family repress the activities of DNA methyltransferases and DNA demethylases, which have opposing roles in control of DNA methylation status. Members of the miR-29 family directly inhibited DNA methyltransferases and two major factors involved in DNA demethylation, namely tet methylcytosine dioxygenase 1 (TET1 and thymine DNA glycosylase (TDG. Overexpression of miR-29 upregulated the global DNA methylation level in some cancer cells and downregulated DNA methylation in other cancer cells, suggesting that miR-29 suppresses tumorigenesis by protecting against changes in the existing DNA methylation status rather than by preventing de novo methylation of DNA.

  10. Inactivation of nuclear GSK3β by Ser(389) phosphorylation promotes lymphocyte fitness during DNA double-strand break response.

    Science.gov (United States)

    Thornton, Tina M; Delgado, Pilar; Chen, Liang; Salas, Beatriz; Krementsov, Dimitry; Fernandez, Miriam; Vernia, Santiago; Davis, Roger J; Heimann, Ruth; Teuscher, Cory; Krangel, Michael S; Ramiro, Almudena R; Rincón, Mercedes

    2016-01-01

    Variable, diversity and joining (V(D)J) recombination and immunoglobulin class switch recombination (CSR) are key processes in adaptive immune responses that naturally generate DNA double-strand breaks (DSBs) and trigger a DNA repair response. It is unclear whether this response is associated with distinct survival signals that protect T and B cells. Glycogen synthase kinase 3β (GSK3β) is a constitutively active kinase known to promote cell death. Here we show that phosphorylation of GSK3β on Ser(389) by p38 MAPK (mitogen-activated protein kinase) is induced selectively by DSBs through ATM (ataxia telangiectasia mutated) as a unique mechanism to attenuate the activity of nuclear GSK3β and promote survival of cells undergoing DSBs. Inability to inactivate GSK3β through Ser(389) phosphorylation in Ser(389)Ala knockin mice causes a decrease in the fitness of cells undergoing V(D)J recombination and CSR. Preselection-Tcrβ repertoire is impaired and antigen-specific IgG antibody responses following immunization are blunted in Ser(389)GSK3β knockin mice. Thus, GSK3β emerges as an important modulator of the adaptive immune response. PMID:26822034

  11. Improving health through policies that promote active travel

    DEFF Research Database (Denmark)

    de Nazelle, Audrey; Nieuwenhuijsen, Mark J; Antó, Josep M;

    2011-01-01

    Substantial policy changes to control obesity, limit chronic disease, and reduce air pollution emissions, including greenhouse gasses, have been recommended. Transportation and planning policies that promote active travel by walking and cycling can contribute to these goals, potentially yielding...

  12. Selective DNA Methylation of BDNF Promoter in Bipolar Disorder: Differences Among Patients with BDI and BDII

    OpenAIRE

    D'Addario, Claudio; Dell'Osso, Bernardo; Palazzo, Maria Carlotta; Benatti, Beatrice; Lietti, Licia; Cattaneo, Elisabetta; Galimberti, Daniela; Fenoglio, Chiara; Cortini, Francesca; Scarpini, Elio; Arosio, Beatrice; Di Francesco, Andrea; Di Benedetto, Manuela; Romualdi, Patrizia; Candeletti, Sanzio

    2012-01-01

    The etiology of bipolar disorder (BD) is still poorly understood, involving genetic and epigenetic mechanisms as well as environmental contributions. This study aimed to investigate the degree of DNA methylation at the promoter region of the brain-derived neurotrophic factor (BDNF) gene, as one of the candidate genes associated with major psychoses, in peripheral blood mononuclear cells isolated from 94 patients with BD (BD I=49, BD II=45) and 52 healthy controls. A significant BDNF gene expr...

  13. Tumor suppressor protein C53 antagonizes checkpoint kinases to promote cyclin-dependent kinase 1 activation

    Institute of Scientific and Technical Information of China (English)

    Hai Jiang; Jianchun Wu; Chen He; Wending Yang; Honglin Li

    2009-01-01

    Cyclin-dependent kinase 1 (Cdk1)/cyclin B1 complex is the driving force for mitotic entry, and its activation is tightly regulated by the G2/M checkpoint. We originally reported that a novel protein C53 (also known as Cdk5rap3 and LZAP) potentiates DNA damage-induced cell death by modulating the G2/M checkpoint. More recently, Wang et al. (2007) found that C53/LZAP may function as a tumor suppressor by way of inhibiting NF-kB signaling. We report here the identification of C53 protein as a novel regulator of Cdk1 activation. We found that knockdown of C53 protein causes delayed Cdkl activation and mitotic entry. During DNA damage response, activation of checkpoint kinase 1 and 2 (Chk1 and Chk2) is partially inhibited by C53 overexpression. Intriguingly, we found that C53 interacts with Chkl and antagonizes its function. Moreover, a portion of C53 protein is localized at the centrosome, and centrosome-targeting C53 potently promotes local Cdk1 activation. Taken together, our results strongly suggest that C53 is a novel negative regulator of checkpoint response. By counteracting Chk1, C53 promotes Cdk1 activation and mitotic entry in both unperturbed cell-cycle progression and DNA damage response.

  14. DNA methylation dynamics in the rat EGF gene promoter after partial hepatectomy

    Directory of Open Access Journals (Sweden)

    Deming Li

    2014-06-01

    Full Text Available Epidermal growth factor (EGF, a multifunctional growth factor, is a regulator in a wide variety of physiological processes. EGF plays an important role in the regulation of liver regeneration. This study was aimed at investigating the methylation level of EGF gene throughout liver regeneration. DNA of liver tissue from control rats and partial hepatectomy (PH rats at 10 time points was extracted and a 354 bp fragment including 10 CpG sites from the transcription start was amplified after DNA was modified by sodium bisulfate. The result of sequencing suggested that methylation ratio of four CpG sites was found to be significantly changed when PH group was compared to control group, in particular two of them were extremely striking. mRNA expression of EGF was down-regulated in total during liver regeneration. We think that the rat EGF promoter region is regulated by variation in DNA methylation during liver regeneration.

  15. Promoter proximal polyadenylation sites reduce transcription activity

    DEFF Research Database (Denmark)

    Andersen, Pia Kjølhede; Lykke-Andersen, Søren; Jensen, Torben Heick

    2012-01-01

    Gene expression relies on the functional communication between mRNA processing and transcription. We previously described the negative impact of a point-mutated splice donor (SD) site on transcription. Here we demonstrate that this mutation activates an upstream cryptic polyadenylation (CpA) site...

  16. Promoting Physical Activity through Goal Setting Strategies

    Science.gov (United States)

    Martinez, Ray

    2004-01-01

    Physical educators are used to setting specific goals for students within a given unit. Here, the author emphasizes that they should also encourage students to set their own goals. Goal setting engages students in the learning process and allows them to develop the skills that support an active lifestyle. The author presents goal setting…

  17. Rescue of Newcastle disease virus from cloned cDNA using an RNA polymerase II promoter.

    Science.gov (United States)

    Li, Bao-Yu; Li, Xue-Rui; Lan, Xi; Yin, Xiang-Pin; Li, Zhi-Yong; Yang, Bin; Liu, Ji-Xing

    2011-06-01

    A new system was developed to improve the efficiency and simplify the procedure of recovery of Newcastle disease virus (NDV) from cloned cDNA. A full-length cDNA clone of mesogenic NDV vaccine strain Mukteswar was assembled from five subgenomic cDNA fragments and cloned into a plasmid allowing transcription driven by cellular RNA polymerase II. The full-length viral cDNA was flanked by hammerhead ribozyme (HamRz) and hepatitis delta virus ribozyme (HdvRz) sequences, resulted in the synthesis of antigenomic RNA with exact termini. Without supplying T7 RNA polymerase, infectious NDV could be generated efficiently in some eukaryotic cell lines by simultaneous transcription of antigenomic RNA from the full-length plasmid and expression of NP, P and L proteins from helper plasmids introduced by cotransfection. The efficiency of recovery with the conventional T7 promoter system based on BRS-T7 cells and the cytomegalovirus (CMV) promoter system was compared, and the results demonstrate that the new system facilitates the generation of recombinant NDV and more efficient than the T7 rescue system using BRS-T7. PMID:21327786

  18. Extraction DNA from Activated Sludge-Comparing with Soil Sample

    Institute of Scientific and Technical Information of China (English)

    谢冰; 奚旦立; 陈季华

    2003-01-01

    DNA directly extraction from activated sludge and soil sample with enzyme lyses methods was investigated in this paper. DNA yield from activated sludge was 3.0 mg/g. VLSS, and 28.2-43.8 μg/g soil respectively. The resulting DNA is suitable for PCR.By studied methods, higher quality and quantity of sludge DNA could be obtained rapidly and inexpensively from large number of samples, and the PCR product obtained from this protocol was not affected by contaminated higher concentration of heavy metals.

  19. RAGE is a nucleic acid receptor that promotes inflammatory responses to DNA

    OpenAIRE

    Sirois, Cherilyn M.; Jin, Tengchuan; Miller, Allison L.; Bertheloot, Damien; Nakamura, Hirotaka; Horvath, Gabor L.; Mian, Abubakar; Jiang, Jiansheng; Schrum, Jacob; Bossaller, Lukas; Pelka, Karin; Garbi, Natalio; Brewah, Yambasu; Tian, Jane; Chang, ChewShun

    2013-01-01

    Recognition of DNA and RNA molecules derived from pathogens or self-antigen is one way the mammalian immune system senses infection and tissue damage. Activation of immune signaling receptors by nucleic acids is controlled by limiting the access of DNA and RNA to intracellular receptors, but the mechanisms by which endosome-resident receptors encounter nucleic acids from the extracellular space are largely undefined. In this study, we show that the receptor for advanced glycation end-products...

  20. Achaete-scute complex homolog-1 promotes DNA repair in the lung carcinogenesis through matrix metalloproteinase-7 and O(6-methylguanine-DNA methyltransferase.

    Directory of Open Access Journals (Sweden)

    Xiao-Yang Wang

    Full Text Available Lung cancer is the leading cause of cancer-related deaths in the world. Achaete-scute complex homolog-1 (Ascl1 is a member of the basic helix-loop-helix (bHLH transcription factor family that has multiple functions in the normal and neoplastic lung such as the regulation of neuroendocrine differentiation, prevention of apoptosis and promotion of tumor-initiating cells. We now show that Ascl1 directly regulates matrix metalloproteinase-7 (MMP-7 and O(6-methylguanine-DNA methyltransferase (MGMT. Loss- and gain-of-function experiments in human bronchial epithelial and lung carcinoma cell lines revealed that Ascl1, MMP-7 and MGMT are able to protect cells from the tobacco-specific nitrosamine NNK-induced DNA damage and the alkylating agent cisplatin-induced apoptosis. We also examined the role of Ascl1 in NNK-induced lung tumorigenesis in vivo. Using transgenic mice which constitutively expressed human Ascl1 in airway lining cells, we found that there was a delay in lung tumorigenesis. We conclude that Ascl1 potentially enhances DNA repair through activation of MMP-7 and MGMT which may impact lung carcinogenesis and chemoresistance. The study has uncovered a novel and unexpected function of Ascl1 which will contribute to better understanding of lung carcinogenesis and the broad implications of transcription factors in tobacco-related carcinogenesis.

  1. Honey, I Shrunk the DNA : DNA Length as a Probe for Nucleic-Acid Enzyme Activity

    NARCIS (Netherlands)

    Oijen, Antoine M. van

    2007-01-01

    The replication, recombination, and repair of DNA are processes essential for the maintenance of genomic information and require the activity of numerous enzymes that catalyze the polymerization or digestion of DNA. This review will discuss how differences in elastic properties between single- and d

  2. Activation and Regulation of DNA-Driven Immune Responses

    OpenAIRE

    Paludan, Søren R

    2015-01-01

    The innate immune system provides early defense against infections and also plays a key role in monitoring alterations of homeostasis in the body. DNA is highly immunostimulatory, and recent advances in this field have led to the identification of the innate immune sensors responsible for the recognition of DNA as well as the downstream pathways that are activated. Moreover, information on how cells regulate DNA-driven immune responses to avoid excessive inflammation is now emerging. Finally,...

  3. Development of transcriptional fusions to assess Leptospira interrogans promoter activity.

    Directory of Open Access Journals (Sweden)

    Gustavo M Cerqueira

    Full Text Available BACKGROUND: Leptospirosis is a zoonotic infectious disease that affects both humans and animals. The existing genetic tools for Leptospira spp. have improved our understanding of the biology of this spirochete as well as the interaction of pathogenic leptospires with the mammalian host. However, new tools are necessary to provide novel and useful information to the field. METHODOLOGY AND PRINCIPAL FINDINGS: A series of promoter-probe vectors carrying a reporter gene encoding green fluorescent protein (GFP were constructed for use in L. biflexa. They were tested by constructing transcriptional fusions between the lipL41, Leptospiral Immunoglobulin-like A (ligA and Sphingomyelinase 2 (sph2 promoters from L. interrogans and the reporter gene. ligA and sph2 promoters were the most active, in comparison to the lipL41 promoter and the non-induced controls. The results obtained are in agreement with LigA expression from the L. interrogans Fiocruz L1-130 strain. CONCLUSIONS: The novel vectors facilitated the in vitro evaluation of L. interrogans promoter activity under defined growth conditions which simulate the mammalian host environment. The fluorescence and rt-PCR data obtained closely reflected transcriptional regulation of the promoters, thus demonstrating the suitability of these vectors for assessing promoter activity in L. biflexa.

  4. Purification and biochemical characterization of DnaK and its transcriptional activator RpoH from Neisseria gonorrhoeae.

    Science.gov (United States)

    Narayanan, Shalini; Beckham, Simone A; Davies, John K; Roujeinikova, Anna

    2014-12-01

    DnaK plays a central role in stress response in the important human pathogen Neisseria gonorrhoeae. The genes encoding the DnaK chaperone machine (DnaK/DnaJ/GrpE) in N. gonorrhoeae are transcribed from RpoH (σ(32))-dependent promoters. In this study, we cloned, purified and biochemically characterised N. gonorrhoeae DnaK (NgDnaK) and RpoH. The NgDnaK and RpoH sequences are 73 and 50 % identical to the sequences of their respective E. coli counterparts. Similar to EcDnaK, nucleotide-free NgDnaK exists as a mix of monomers, dimers and higher oligomeric species in solution, and dissociates into monomers on addition of ATP. Like E. coli σ(32), RpoH of N. gonorrhoeae is monomeric in solution. Kinetic analysis of the basal ATPase activity of purified NgDnaK revealed a V max of 193 pmol phosphate released per minute per microgram DnaK (which is significantly higher than reported basal ATPase activity of EcDnaK), and the turnover number against ATP was 0.4 min(-1) under our assay conditions. Nucleotide-free NgDnaK bound a short model substrate, NR-peptide, with micromolar affinity close to that reported for EcDnaK. Our analysis showed that interaction between N. gonorrhoeae RpoH and DnaK appears to be ATP-dependent and non-specific, in stark contrast to the E. coli DnaK system where σ(32) and DnaK interact as monomers even in the absence of ATP. Sequence comparison showed that the DnaK-binding site of σ(32) is not conserved in RpoH. Our findings suggest that the mechanism of DnaK/RpoH recognition in N. gonorrhoeae is different from that in E. coli. PMID:25156536

  5. Yeast homologous recombination-based promoter engineering for the activation of silent natural product biosynthetic gene clusters.

    Science.gov (United States)

    Montiel, Daniel; Kang, Hahk-Soo; Chang, Fang-Yuan; Charlop-Powers, Zachary; Brady, Sean F

    2015-07-21

    Large-scale sequencing of prokaryotic (meta)genomic DNA suggests that most bacterial natural product gene clusters are not expressed under common laboratory culture conditions. Silent gene clusters represent a promising resource for natural product discovery and the development of a new generation of therapeutics. Unfortunately, the characterization of molecules encoded by these clusters is hampered owing to our inability to express these gene clusters in the laboratory. To address this bottleneck, we have developed a promoter-engineering platform to transcriptionally activate silent gene clusters in a model heterologous host. Our approach uses yeast homologous recombination, an auxotrophy complementation-based yeast selection system and sequence orthogonal promoter cassettes to exchange all native promoters in silent gene clusters with constitutively active promoters. As part of this platform, we constructed and validated a set of bidirectional promoter cassettes consisting of orthogonal promoter sequences, Streptomyces ribosome binding sites, and yeast selectable marker genes. Using these tools we demonstrate the ability to simultaneously insert multiple promoter cassettes into a gene cluster, thereby expediting the reengineering process. We apply this method to model active and silent gene clusters (rebeccamycin and tetarimycin) and to the silent, cryptic pseudogene-containing, environmental DNA-derived Lzr gene cluster. Complete promoter refactoring and targeted gene exchange in this "dead" cluster led to the discovery of potent indolotryptoline antiproliferative agents, lazarimides A and B. This potentially scalable and cost-effective promoter reengineering platform should streamline the discovery of natural products from silent natural product biosynthetic gene clusters.

  6. Archaeal promoter architecture and mechanism of gene activation

    DEFF Research Database (Denmark)

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang;

    2011-01-01

    Sulfolobus solfataricus and Sulfolobus islandicus contain several genes exhibiting D-arabinose-inducible expression and these systems are ideal for studying mechanisms of archaeal gene expression. At sequence level, only two highly conserved cis elements are present on the promoters: a regulatory...... element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked...... mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression....

  7. Archaeal promoter architecture and mechanism of gene activation.

    Science.gov (United States)

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang; She, Qunxin

    2011-01-01

    Sulfolobus solfataricus and Sulfolobus islandicus contain several genes exhibiting D-arabinose-inducible expression and these systems are ideal for studying mechanisms of archaeal gene expression. At sequence level, only two highly conserved cis elements are present on the promoters: a regulatory element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression. PMID:21265754

  8. Promotion of nutrition and physical activity in Dutch general practice

    NARCIS (Netherlands)

    Dillen, van S.; Hiddink, G.J.; Woerkum, van C.M.J.

    2011-01-01

    Introduction: Promotion of nutrition and physical activity is important to slow down the increase of overweight. General practitioners (GPs) are in an unique position to communicate with their patients about nutrition and physical activity, because of the high referral score, high perceived expertis

  9. A DNA enzyme with N-glycosylase activity

    OpenAIRE

    Sheppard, Terry L.; Ordoukhanian, Phillip; Joyce, Gerald F.

    2000-01-01

    In vitro evolution was used to develop a DNA enzyme that catalyzes the site-specific depurination of DNA with a catalytic rate enhancement of about 106-fold. The reaction involves hydrolysis of the N-glycosidic bond of a particular deoxyguanosine residue, leading to DNA strand scission at the apurinic site. The DNA enzyme contains 93 nucleotides and is structurally complex. It has an absolute requirement for a divalent metal cation and exhibits optimal activity at about pH 5. The mechanism of...

  10. Promoting Physical Activity Among Overweight Young African American Women

    Centers for Disease Control (CDC) Podcasts

    2014-01-15

    This podcast is an interview with Nefertiti Durant, MD, MPH, from the University of Alabama at Birmingham about promoting physical activity among overweight and obese young African American Women using Internet-based tools.  Created: 1/15/2014 by Preventing Chronic Disease (PCD), National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 1/15/2014.

  11. Promotion as a Tool in Sustaining the Destination Marketing Activities

    OpenAIRE

    Ivo Mulec

    2010-01-01

    Promoting the tourism destination in the right and best possible way is today one of vital marketing activities of all Destination Management Organizations. Only successful promotion can entice and attract potential travelers to visit the destination. The number of new destinations is increasing every year and some of them are quite similar. Market segmentation is one of the starting points for devising marketing strategy. Only by presenting the destination to the right segment of potential c...

  12. Evaluation of hair growth promoting activity of Phyllanthus niruri

    OpenAIRE

    Satish Patel; Vikas Sharma; Nagendra Chauhan; Mayank Thakur; Vinod Dixit

    2015-01-01

    Objective: This study was designed to investigate the potential Phyllanthus niruri (P. niruri ) extracts in promotion of hair growth. Materials and Methods: Here, we studied the hair growth promoting activity of petroleum ether extract of P. niruri following its topical administration. Alopecia was induced in albino rats by subcutaneous administration of testosterone for 21 days. Evaluation of hair loss inhibition was done by concurrent administration of extract and monitoring parameters like...

  13. Stimulation of DNA Glycosylase Activities by XPC Protein Complex: Roles of Protein-Protein Interactions

    Directory of Open Access Journals (Sweden)

    Yuichiro Shimizu

    2010-01-01

    Full Text Available We showed that XPC complex, which is a DNA damage detector for nucleotide excision repair, stimulates activity of thymine DNA glycosylase (TDG that initiates base excision repair. XPC appeared to facilitate the enzymatic turnover of TDG by promoting displacement from its own product abasic site, although the precise mechanism underlying this stimulation has not been clarified. Here we show that XPC has only marginal effects on the activity of E. coli TDG homolog (EcMUG, which remains bound to the abasic site like human TDG but does not significantly interacts with XPC. On the contrary, XPC significantly stimulates the activities of sumoylated TDG and SMUG1, both of which exhibit quite different enzymatic kinetics from unmodified TDG but interact with XPC. These results point to importance of physical interactions for stimulation of DNA glycosylases by XPC and have implications in the molecular mechanisms underlying mutagenesis and carcinogenesis in XP-C patients.

  14. Rarity of DNA sequence alterations in the promoter region of the human androgen receptor gene

    Directory of Open Access Journals (Sweden)

    D.F. Cabral

    2004-12-01

    Full Text Available The human androgen receptor (AR gene promoter lies in a GC-rich region containing two principal sites of transcription initiation and a putative Sp1 protein-binding site, without typical "TATA" and "CAAT" boxes. It has been suggested that mutations within the 5'untranslated region (5'UTR may contribute to the development of prostate cancer by changing the rates of gene transcription and/or translation. In order to investigate this question, the aim of the present study was to search for the presence of mutations or polymorphisms at the AR-5'UTR in 92 prostate cancer patients, where histological diagnosis of adenocarcinoma was established in specimens obtained from transurethral resection or after prostatectomy. The AR-5'UTR was amplified by PCR from genomic DNA samples of the patients and of 100 healthy male blood donors, included as controls. Conformation-sensitive gel electrophoresis was used for DNA sequence alteration screening. Only one band shift was detected in one individual from the blood donor group. Sequencing revealed a new single nucleotide deletion (T in the most conserved portion of the promoter region at position +36 downstream from the transcription initiation site I. Although the effect of this specific mutation remains unknown, its rarity reveals the high degree of sequence conservation of the human androgen promoter region. Moreover, the absence of detectable variation within the critical 5'UTR in prostate cancer patients indicates a low probability of its involvement in prostate cancer etiology.

  15. Hair Growth Promotion Activity and Its Mechanism of Polygonum multiflorum

    Directory of Open Access Journals (Sweden)

    Yunfei Li

    2015-01-01

    Full Text Available Polygonum multiflorum Radix (PMR has long history in hair growth promotion and hair coloring in clinical applications. However, several crucial problems in its clinic usage and mechanisms are still unsolved or lack scientific evidences. In this research, C57BL/6J mice were used to investigate hair growth promotion activity and possible mechanism of PMR and Polygonum multiflorum Radix Preparata (PMRP. Hair growth promotion activities were investigated by hair length, hair covered skin ratio, the number of follicles, and hair color. Regulation effects of several cytokines involved in the hair growth procedure were tested, such as fibroblast growth factor (FGF-7, Sonic Hedgehog (SHH, β-catenin, insulin-like growth factor-1 (IGF-1, and hepatocyte growth factor (HGF. Oral PMR groups had higher hair covered skin ratio (100 ± 0.00% than oral PMRP groups (48%~88%. However, topical usage of PMRP had about 90% hair covered skin ratio. Both oral administration of PMR and topically given PMRP showed hair growth promotion activities. PMR was considered to be more suitable for oral administration, while PMRP showed greater effects in external use. The hair growth promotion effect of oral PMR was most probably mediated by the expression of FGF-7, while topical PMRP promoted hair growth by the stimulation of SHH expression.

  16. Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone

    Science.gov (United States)

    Schwarz, Megan C.; Sourisseau, Marion; Espino, Michael M.; Gray, Essanna S.; Chambers, Matthew T.; Tortorella, Domenico

    2016-01-01

    ABSTRACT The recent Zika virus (ZIKV) outbreak has been linked to severe pathogenesis. Here, we report the construction of a plasmid carrying a cytomegalovirus (CMV) promoter-expressed prototype 1947 Uganda MR766 ZIKV cDNA that can initiate infection following direct plasmid DNA transfection of mammalian cells. Incorporation of a synthetic intron in the nonstructural protein 1 (NS1) region of the ZIKV polyprotein reduced viral cDNA-associated toxicity in bacteria. High levels of infectious virus were produced following transfection of the plasmid bearing the wild-type MR766 ZIKV genome, but not one with a disruption to the viral nonstructural protein 5 (NS5) polymerase active site. Multicycle growth curve and plaque assay experiments indicated that the MR766 virus resulting from plasmid transfection exhibited growth characteristics that were more similar to its parental isolate than previously published 2010 Cambodia and 2015 Brazil cDNA-rescued ZIKV. This ZIKV infectious clone will be useful for investigating the genetic determinants of ZIKV infection and pathogenesis and should be amenable to construction of diverse infectious clones expressing reporter proteins and representing a range of ZIKV isolates. IMPORTANCE The study of ZIKV, which has become increasingly important with the recent association of this virus with microcephaly and Guillain-Barré syndrome, would benefit from an efficient strategy to genetically manipulate the virus. This work describes a model system to produce infectious virus in cell culture. We created a plasmid carrying the prototype 1947 Uganda MR766 ZIKV genome that both was stable in bacteria and could produce high levels of infectious virus in mammalian cells through direct delivery of this DNA. Furthermore, growth properties of this rescued virus closely resembled those of the viral isolate from which it was derived. This model system will provide a simple and effective means to study how ZIKV genetics impact viral replication and

  17. Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone

    Science.gov (United States)

    Schwarz, Megan C.; Sourisseau, Marion; Espino, Michael M.; Gray, Essanna S.; Chambers, Matthew T.; Tortorella, Domenico

    2016-01-01

    ABSTRACT The recent Zika virus (ZIKV) outbreak has been linked to severe pathogenesis. Here, we report the construction of a plasmid carrying a cytomegalovirus (CMV) promoter-expressed prototype 1947 Uganda MR766 ZIKV cDNA that can initiate infection following direct plasmid DNA transfection of mammalian cells. Incorporation of a synthetic intron in the nonstructural protein 1 (NS1) region of the ZIKV polyprotein reduced viral cDNA-associated toxicity in bacteria. High levels of infectious virus were produced following transfection of the plasmid bearing the wild-type MR766 ZIKV genome, but not one with a disruption to the viral nonstructural protein 5 (NS5) polymerase active site. Multicycle growth curve and plaque assay experiments indicated that the MR766 virus resulting from plasmid transfection exhibited growth characteristics that were more similar to its parental isolate than previously published 2010 Cambodia and 2015 Brazil cDNA-rescued ZIKV. This ZIKV infectious clone will be useful for investigating the genetic determinants of ZIKV infection and pathogenesis and should be amenable to construction of diverse infectious clones expressing reporter proteins and representing a range of ZIKV isolates. IMPORTANCE The study of ZIKV, which has become increasingly important with the recent association of this virus with microcephaly and Guillain-Barré syndrome, would benefit from an efficient strategy to genetically manipulate the virus. This work describes a model system to produce infectious virus in cell culture. We created a plasmid carrying the prototype 1947 Uganda MR766 ZIKV genome that both was stable in bacteria and could produce high levels of infectious virus in mammalian cells through direct delivery of this DNA. Furthermore, growth properties of this rescued virus closely resembled those of the viral isolate from which it was derived. This model system will provide a simple and effective means to study how ZIKV genetics impact viral replication and

  18. Neuronal Activity Promotes Glioma Growth through Neuroligin-3 Secretion.

    Science.gov (United States)

    Venkatesh, Humsa S; Johung, Tessa B; Caretti, Viola; Noll, Alyssa; Tang, Yujie; Nagaraja, Surya; Gibson, Erin M; Mount, Christopher W; Polepalli, Jai; Mitra, Siddhartha S; Woo, Pamelyn J; Malenka, Robert C; Vogel, Hannes; Bredel, Markus; Mallick, Parag; Monje, Michelle

    2015-05-01

    Active neurons exert a mitogenic effect on normal neural precursor and oligodendroglial precursor cells, the putative cellular origins of high-grade glioma (HGG). By using optogenetic control of cortical neuronal activity in a patient-derived pediatric glioblastoma xenograft model, we demonstrate that active neurons similarly promote HGG proliferation and growth in vivo. Conditioned medium from optogenetically stimulated cortical slices promoted proliferation of pediatric and adult patient-derived HGG cultures, indicating secretion of activity-regulated mitogen(s). The synaptic protein neuroligin-3 (NLGN3) was identified as the leading candidate mitogen, and soluble NLGN3 was sufficient and necessary to promote robust HGG cell proliferation. NLGN3 induced PI3K-mTOR pathway activity and feedforward expression of NLGN3 in glioma cells. NLGN3 expression levels in human HGG negatively correlated with patient overall survival. These findings indicate the important role of active neurons in the brain tumor microenvironment and identify secreted NLGN3 as an unexpected mechanism promoting neuronal activity-regulated cancer growth.

  19. Commercial activities and the promotion of health in schools.

    Science.gov (United States)

    Raine, Gary

    2013-11-01

    Many companies nowadays consider schools to be an important setting for marketing to children. However, important concerns can be raised from a health promotion perspective about the potential negative impact of commercial activities on the health and well-being of pupils. As this discussion paper will demonstrate, some commercial activities raise concerns in relation to physical health and obesity, not only by potentially undermining formal curriculum messages, but also through the active promotion of specific products, particularly those high in fat, sugar or salt. Nonetheless, the issues raised by commercial activities are not solely limited to effects on physical health. By allowing commercial activities, schools risk instilling in pupils consumer-orientated values. This is significant as such values have been linked to the development of poor health and well-being. Furthermore, the presence in schools of commercial activities will also militate against informed decision-making and be disempowering. There is also evidence that business-sponsored teaching materials can contain biased and misleading information. The potential negative impacts of commercial activities are inconsistent with goals in relation to the promotion of health and the principles of health-promoting schools.

  20. Commercial activities and the promotion of health in schools.

    Science.gov (United States)

    Raine, Gary

    2013-11-01

    Many companies nowadays consider schools to be an important setting for marketing to children. However, important concerns can be raised from a health promotion perspective about the potential negative impact of commercial activities on the health and well-being of pupils. As this discussion paper will demonstrate, some commercial activities raise concerns in relation to physical health and obesity, not only by potentially undermining formal curriculum messages, but also through the active promotion of specific products, particularly those high in fat, sugar or salt. Nonetheless, the issues raised by commercial activities are not solely limited to effects on physical health. By allowing commercial activities, schools risk instilling in pupils consumer-orientated values. This is significant as such values have been linked to the development of poor health and well-being. Furthermore, the presence in schools of commercial activities will also militate against informed decision-making and be disempowering. There is also evidence that business-sponsored teaching materials can contain biased and misleading information. The potential negative impacts of commercial activities are inconsistent with goals in relation to the promotion of health and the principles of health-promoting schools. PMID:23135869

  1. O-methylguanine-DNA methyltransferase (MGMT mRNA expression predicts outcome in malignant glioma independent of MGMT promoter methylation.

    Directory of Open Access Journals (Sweden)

    Simone Kreth

    Full Text Available BACKGROUND: We analyzed prospectively whether MGMT (O(6-methylguanine-DNA methyltransferase mRNA expression gains prognostic/predictive impact independent of MGMT promoter methylation in malignant glioma patients undergoing radiotherapy with concomitant and adjuvant temozolomide or temozolomide alone. As DNA-methyltransferases (DNMTs are the enzymes responsible for setting up and maintaining DNA methylation patterns in eukaryotic cells, we analyzed further, whether MGMT promoter methylation is associated with upregulation of DNMT expression. METHODOLOGY/PRINCIPAL FINDINGS: ADULT PATIENTS WITH A HISTOLOGICALLY PROVEN MALIGNANT ASTROCYTOMA (GLIOBLASTOMA: N = 53, anaplastic astrocytoma: N = 10 were included. MGMT promoter methylation was determined by methylation-specific PCR (MSP and sequencing analysis. Expression of MGMT and DNMTs mRNA were analysed by real-time qPCR. Prognostic factors were obtained from proportional hazards models. Correlation between MGMT mRNA expression and MGMT methylation status was validated using data from the Cancer Genome Atlas (TCGA database (N = 229 glioblastomas. Low MGMT mRNA expression was strongly predictive for prolonged time to progression, treatment response, and length of survival in univariate and multivariate models (p<0.0001; the degree of MGMT mRNA expression was highly correlated with the MGMT promoter methylation status (p<0.0001; however, discordant findings were seen in 12 glioblastoma patients: Patients with methylated tumors with high MGMT mRNA expression (N = 6 did significantly worse than those with low transcriptional activity (p<0.01. Conversely, unmethylated tumors with low MGMT mRNA expression (N = 6 did better than their counterparts. A nearly identical frequency of concordant and discordant findings was obtained by analyzing the TCGA database (p<0.0001. Expression of DNMT1 and DNMT3b was strongly upregulated in tumor tissue, but not correlated with MGMT promoter methylation and MGMT m

  2. Different human TFIIIB activities direct RNA polymerase III transcription from TATA-containing and TATA-less promoters

    OpenAIRE

    Schramm, Laura; Pendergrast, P. Shannon; Sun, Yuling; Hernandez, Nouria

    2000-01-01

    Transcription initiation at RNA polymerase III promoters requires transcription factor IIIB (TFIIIB), an activity that binds to RNA polymerase III promoters, generally through protein–protein contacts with DNA binding factors, and directly recruits RNA polymerase III. Saccharomyces cerevisiae TFIIIB is a complex of three subunits, TBP, the TFIIB-related factor BRF, and the more loosely associated polypeptide β″. Although human homologs for two of the TFIIIB subunits, the TATA box–binding prot...

  3. Global genome nucleotide excision repair is organized into domains that promote efficient DNA repair in chromatin

    Science.gov (United States)

    Yu, Shirong; Evans, Katie; Bennett, Mark; Webster, Richard M.; Leadbitter, Matthew; Teng, Yumin; Waters, Raymond

    2016-01-01

    The rates at which lesions are removed by DNA repair can vary widely throughout the genome, with important implications for genomic stability. To study this, we measured the distribution of nucleotide excision repair (NER) rates for UV-induced lesions throughout the budding yeast genome. By plotting these repair rates in relation to genes and their associated flanking sequences, we reveal that, in normal cells, genomic repair rates display a distinctive pattern, suggesting that DNA repair is highly organized within the genome. Furthermore, by comparing genome-wide DNA repair rates in wild-type cells and cells defective in the global genome–NER (GG-NER) subpathway, we establish how this alters the distribution of NER rates throughout the genome. We also examined the genomic locations of GG-NER factor binding to chromatin before and after UV irradiation, revealing that GG-NER is organized and initiated from specific genomic locations. At these sites, chromatin occupancy of the histone acetyl-transferase Gcn5 is controlled by the GG-NER complex, which regulates histone H3 acetylation and chromatin structure, thereby promoting efficient DNA repair of UV-induced lesions. Chromatin remodeling during the GG-NER process is therefore organized into these genomic domains. Importantly, loss of Gcn5 significantly alters the genomic distribution of NER rates; this has implications for the effects of chromatin modifiers on the distribution of mutations that arise throughout the genome. PMID:27470111

  4. Cigarette Smoking, BPDE-DNA Adducts, and Aberrant Promoter Methylations of Tumor Suppressor Genes (TSGs) in NSCLC from Chinese Population.

    Science.gov (United States)

    Jin, Yongtang; Xu, Peiwei; Liu, Xinneng; Zhang, Chunye; Tan, Cong; Chen, Chunmei; Sun, Xiaoyu; Xu, Yingchun

    2016-01-01

    Non-small cell lung cancer (NSCLC) is related to the genetic and epigenetic factors. The goal of this study was to determine association of cigarette smoking and BPDE-DNA adducts with promoter methylations of several genes in NSCLC. Methylation of the promoters of p16, RARβ, DAPK, MGMT, and TIMP-3 genes of tumor tissues from 199 lung cancer patients was analyzed with methylation-specific PCR (MSP), and BPDE-DNA adduct level in lung cancer tissue was obtained by ELISA. Level of BPDE-DNA adduct increased significantly in males, aged people (over 60 years), and smokers; however, no significant difference was found while comparing the BPDE-DNA adduct levels among different tumor types, locations, and stages. Cigarette smoking was also associated with increased BPDE-DNA adducts level (OR = 2.43, p > .05) and increased methylation level in at least 1 gene (OR = 5.22, p smoking also significantly increase the risk of p16 or DAPK methylation (OR = 3.02, p smoking for more than 40 pack-years (OR = 4.21, p smoking is significantly associated with the increase of BPDE-DNA adduct level, promoter hypermethylation of p16 and DAPK genes, while BPDE-DNA adduct was not significantly related to abnormal promoter hypermethylation in TSGs, suggesting that BPDE-DNA adducts and TSGs methylations play independent roles in NSCLC.

  5. DNA Cleavage Promoted by Cu2+ Complex of N,N'-Bis(2-aminoethyl)-2,6-pyridinedicarboxamide

    Institute of Scientific and Technical Information of China (English)

    LI, Ying; SHENG, Xin; SHAO, Ying; LU, Guo-Yuan

    2007-01-01

    The interaction of Cu2+ complex of N,N'-bis(2-aminoethyl)-2,6-pyridinedicarboxamide (BAP) with DNA was studied by agarose gel electrophoresis analysis. The results indicate that the BAP-Cu2+ complex can promote the cleavage of phosphodiester bond of supercoiled DNA at physiological condition, which is 3.2×106 times higher than DNA natural degradation. A hydrolytic cleaving mechanism through the cooperation of copper ions and functional amino groups was proposed.

  6. Mechanisms of transcriptional activation of the mouse claudin-5 promoter by estrogen receptor alpha and beta.

    Science.gov (United States)

    Burek, Malgorzata; Steinberg, Katrin; Förster, Carola Y

    2014-07-01

    Claudin-5 is an integral membrane protein and a critical component of endothelial tight junctions that control paracellular permeability. Claudin-5 is expressed at high levels in the brain vascular endothelium. Estrogens have multiple effects on vascular physiology and function. The biological actions of estrogens are mediated by two different estrogen receptor (ER) subtypes, ER alpha and ER beta. Estrogens have beneficial effects in several vascular disorders. Recently we have cloned and characterized a murine claudin-5 promoter and demonstrated 17beta-estradiol (E2)-mediated regulation of claudin-5 in brain and heart microvascular endothelium on promoter, mRNA and protein level. Sequence analysis revealed a putative estrogen response element (ERE) and a putative Sp1 transcription factor binding site in the claudin-5 promoter. The aim of the present study was to further characterize the estrogen-responsive elements of claudin-5 promoter. First, we introduced point mutations in ERE or Sp1 site in -500/+111 or in Sp1 site of -268/+111 claudin-5 promoter construct, respectively. Basal and E2-mediated transcriptional activation of mutated constructs was abrogated in the luciferase reporter gene assay. Next, we examined whether estrogen receptor subtypes bind to the claudin-5 promoter region. For this purpose we performed chromatin immunoprecipitation assays using anti-estrogen receptor antibodies and cellular lysates of E2-treated endothelial cells followed by quantitative PCR analysis. We show enrichment of claudin-5 promoter fragments containing the ERE- and Sp1-binding site in immunoprecipitates after E2 treatment. Finally, in a gel mobility shift assay, we demonstrated DNA-protein interaction of both ER subtypes at ERE. In summary, this study provides evidence that both a non-consensus ERE and a Sp1 site in the claudin-5 promoter are functional and necessary for the basal and E2-mediated activation of the promoter.

  7. Rapid restriction enzyme free detection of DNA methyltransferase activity based on DNA-templated silver nanoclusters.

    Science.gov (United States)

    Kermani, Hanie Ahmadzade; Hosseini, Morteza; Dadmehr, Mehdi; Ganjali, Mohammad Reza

    2016-06-01

    DNA methylation has significant roles in gene regulation. DNA methyltransferase (MTase) enzyme characterizes DNA methylation and also induces an aberrant methylation pattern that is related to many diseases, especially cancers. Thus, it is required to develop a method to detect the DNA MTase activity. In this study, we developed a new sensitive and reliable method for methyltransferase activity assay by employing DNA-templated silver nanoclusters (DNA/Ag NCs) without using restriction enzymes. The Ag NCs have been utilized for the determination of M.SssI MTase activity and its inhibition. We designed an oligonucleotide probe which contained an inserted six-cytosine loop as Ag NCs formation template. The changes in fluorescence intensity were monitored to quantify the M.SssI activity. The fluorescence spectra showed a linear decrease in the range of 0.4 to 20 U/ml with a detection limit of 0.1 U/ml, which was significant compared with previous reports. The proposed method was applied successfully for demonstrating the Gentamicin effect as MTase inhibitor. The proposed method showed convenient reproducibility and sensitivity indicating its potential for the determination of methyltransferase activity. PMID:27052776

  8. A Conserved DNA Repeat Promotes Selection of a Diverse Repertoire of Trypanosoma brucei Surface Antigens from the Genomic Archive.

    Directory of Open Access Journals (Sweden)

    Galadriel Hovel-Miner

    2016-05-01

    Full Text Available African trypanosomes are mammalian pathogens that must regularly change their protein coat to survive in the host bloodstream. Chronic trypanosome infections are potentiated by their ability to access a deep genomic repertoire of Variant Surface Glycoprotein (VSG genes and switch from the expression of one VSG to another. Switching VSG expression is largely based in DNA recombination events that result in chromosome translocations between an acceptor site, which houses the actively transcribed VSG, and a donor gene, drawn from an archive of more than 2,000 silent VSGs. One element implicated in these duplicative gene conversion events is a DNA repeat of approximately 70 bp that is found in long regions within each BES and short iterations proximal to VSGs within the silent archive. Early observations showing that 70-bp repeats can be recombination boundaries during VSG switching led to the prediction that VSG-proximal 70-bp repeats provide recombinatorial homology. Yet, this long held assumption had not been tested and no specific function for the conserved 70-bp repeats had been demonstrated. In the present study, the 70-bp repeats were genetically manipulated under conditions that induce gene conversion. In this manner, we demonstrated that 70-bp repeats promote access to archival VSGs. Synthetic repeat DNA sequences were then employed to identify the length, sequence, and directionality of repeat regions required for this activity. In addition, manipulation of the 70-bp repeats allowed us to observe a link between VSG switching and the cell cycle that had not been appreciated. Together these data provide definitive support for the long-standing hypothesis that 70-bp repeats provide recombinatorial homology during switching. Yet, the fact that silent archival VSGs are selected under these conditions suggests the 70-bp repeats also direct DNA pairing and recombination machinery away from the closest homologs (silent BESs and toward the rest of

  9. THE ACTIVITY OF ARABIDOSPIS DLL PROMOTER IN TRANSGENIC TOBACCO PLANTS UNDER WATER STRESS CONDITIONS

    Directory of Open Access Journals (Sweden)

    Zuzana Polóniová

    2014-02-01

    Full Text Available In this work we used the Cre/loxP recombination system to study the activity of the Arabidopsis DLL promoter under water stress treatment. For this, the T-DNA containing the Cre/loxP self-excision recombination cassette was introduced into tobacco genome via A. tumefaciens LBA 4404. The expression of the cre gene was regulated by the DLL promoter. On activity of the DLL the Cre recombinase was expected to remove Cre/loxP cassette. Transgenic nature of regenerated transgenic T0 tobacco plantlets was proved by GUS and PCR analyses. The selected 10 transgenic T0 plants were subjected to the water stress analyses under in vitro as well as under in vivo conditions. The osmotic stress experiments were performed with 10 % PEG and 100 mmol.l-1 mannitol (individually. The activity of the DLL was evaluated after 24 hours. For drought stress experiments, the watering was withheld for 10 days. The activity of the DLL was monitored using PCR approach. Under given abiotic stress conditions, no activity of the DLL was observed. The DLL promoter remained stable. It points out the DLL as the promoter with precise control of the gene expression with wide usability in plant biotechnology.

  10. PML induces compaction, TRF2 depletion and DNA damage signaling at telomeres and promotes their alternative lengthening.

    Science.gov (United States)

    Osterwald, Sarah; Deeg, Katharina I; Chung, Inn; Parisotto, Daniel; Wörz, Stefan; Rohr, Karl; Erfle, Holger; Rippe, Karsten

    2015-05-15

    The alternative lengthening of telomeres (ALT) mechanism allows cancer cells to escape senescence and apoptosis in the absence of active telomerase. A characteristic feature of this pathway is the assembly of ALT-associated promyelocytic leukemia (PML) nuclear bodies (APBs) at telomeres. Here, we dissected the role of APBs in a human ALT cell line by performing an RNA interference screen using an automated 3D fluorescence microscopy platform and advanced 3D image analysis. We identified 29 proteins that affected APB formation, which included proteins involved in telomere and chromatin organization, protein sumoylation and DNA repair. By integrating and extending these findings, we found that APB formation induced clustering of telomere repeats, telomere compaction and concomitant depletion of the shelterin protein TRF2 (also known as TERF2). These APB-dependent changes correlated with the induction of a DNA damage response at telomeres in APBs as evident by a strong enrichment of the phosphorylated form of the ataxia telangiectasia mutated (ATM) kinase. Accordingly, we propose that APBs promote telomere maintenance by inducing a DNA damage response in ALT-positive tumor cells through changing the telomeric chromatin state to trigger ATM phosphorylation. PMID:25908860

  11. First functional polymorphism in CFTR promoter that results in decreased transcriptional activity and Sp1/USF binding

    International Nuclear Information System (INIS)

    Growing evidences show that functionally relevant polymorphisms in various promoters alter both transcriptional activity and affinities of existing protein-DNA interactions, and thus influence disease progression in humans. We previously reported the -94G>T CFTR promoter variant in a female CF patient in whom any known disease-causing mutation has been detected. To investigate whether the -94G>T could be a regulatory variant, we have proceeded to in silico analyses and functional studies including EMSA and reporter gene assays. Our data indicate that the promoter variant decreases basal CFTR transcriptional activity in different epithelial cells and alters binding affinities of both Sp1 and USF nuclear proteins to the CFTR promoter. The present report provides evidence for the first functional polymorphism that negatively affects the CFTR transcriptional activity and demonstrates a cooperative role of Sp1 and USF transcription factors in transactivation of the CFTR gene promoter

  12. A point mutation in a silencer module reduces the promoter activity for the human mercaptopyruvate sulfurtransferase.

    Science.gov (United States)

    Nagahara, Noriyuki; Sreeja, V G; Li, Qing; Shimizu, Takako; Tsuchiya, Terumasa; Fujii-Kuriyama, Yoshiaki

    2004-11-01

    A promoter region of human mercaptopyruvate sulfurtransferase (MST) [EC 2.8.1.2] is G+C-rich and TATA-less, showing features of a house-keeping gene. In the core promoter, a GC box (-284:GGGGCGTGGC:-275) and an initiator (-219:TTATATG:-225) are found. A cap site hunting analysis for human liver cDNA revealed four possible transcriptional start sites, nucleotides -223, -159, -35 and -25. Point mutagenesis and deletion studies suggest that a module of the silencer element is -394:GCTG:-391. A replacement of -391G to C lost the silencer function; on the other hand, a replacement of -394G to T or C, -393C to T or -392T to G markedly reduced the promoter activity. PMID:15507321

  13. The Dynamic Character of the BCL2 Promoter i-Motif Provides a Mechanism for Modulation of Gene Expression by Compounds That Bind Selectively to the Alternative DNA Hairpin Structure

    OpenAIRE

    Kendrick, Samantha; Kang, Hyun-Jin; Alam, Mohammad P.; Madathil, Manikandadas M.; Agrawal, Prashansa; Gokhale, Vijay; Yang, Danzhou; Hecht, Sidney M.; Hurley, Laurence H

    2014-01-01

    It is generally accepted that DNA predominantly exists in duplex form in cells. However, under torsional stress imposed by active transcription, DNA can assume nonduplex structures. The BCL2 promoter region forms two different secondary DNA structures on opposite strands called the G-quadruplex and the i-motif. The i-motif is a highly dynamic structure that exists in equilibrium with a flexible hairpin species. Here we identify a pregnanol derivative and a class of piperidine derivatives that...

  14. Bifidobacteria DNA Induces Murine Macrophages Activation in vitro

    Institute of Scientific and Technical Information of China (English)

    Yalin Li; Xun Qu; Hua Yang; Li Kang; Yingping Xu; Bo Bai; Wengang Song

    2005-01-01

    Previous studies have shown that oligodeoxynucleotides containing unmethylated CpG motifs were used as adjuvants for immunoregulation and immune response. This study was to explore the activation effects of Bifidobacteria DNA containing unmethylated CpG motifs (CpG DNA) on murine macrophage J774A.1 cells. The genomic DNA of Bifidobacteria was extracted and purified, and the methylation degree of CpG motifs was tested.The phagocytic ability of the macrophages was detected by flow cytometry. The cytokines (IL-1β, IL-6, IL-12p40 and TNF-α) levels in the culture supernatants of Bifidobacteria DNA treated J774A.1 cells were assayed by ELISA. The content of nitric oxide (NO) was detected by Griess reagent. After treated with Bifidobacteria DNA for 24h,Nile Red stain increased in J774A.1 macrophage, which suggested that the lipid metabolism increased in the macrophages. The phagocytic ability and levels of NO and cytokines of IL-1β, IL-6, IL-12p40 and TNF-α were significantly higher than PBS group and CT DNA group. The results indicated that Bifidobacteria DNA could activate murine macrophages J774A.1, which could provide scientific basis for the research and application of microorganism DNA preparation.

  15. DNA sequence and structure properties analysis reveals similarities and differences to promoters of stress responsive genes in Arabidopsis thaliana.

    Science.gov (United States)

    Zhu, Pan; Zhou, Yanhong; Zhang, Libin; Ma, Chuang

    2015-01-01

    Understanding regulatory mechanisms of stress response in plants has important biological and agricultural significances. In this study, we firstly compiled a set of genes responsive to different stresses in Arabidopsis thaliana and then comparatively analysed their promoters at both the DNA sequence and three-dimensional structure levels. Amazingly, the comparison revealed that the profiles of several sequence and structure properties vary distinctly in different regions of promoters. Moreover, the content of nucleotide T and the profile of B-DNA twist are distinct in promoters from different stress groups, suggesting Arabidopsis genes might exploit different regulatory mechanisms in response to various stresses. Finally, we evaluated the performance of two representative promoter predictors including EP3 and PromPred. The evaluation results revealed their strengths and weakness for identifying stress-related promoters, providing valuable guidelines to accelerate the discovery of novel stress-related promoters and genes in plants.

  16. Promoter DNA methylation of farnesoid X receptor and pregnane X receptor modulates the intrahepatic cholestasis of pregnancy phenotype.

    Directory of Open Access Journals (Sweden)

    Romina Cabrerizo

    Full Text Available The intrahepatic cholestasis of pregnancy (ICP is a multifactorial liver disorder which pathogenesis involves the interplay among abnormal bile acid (BA levels, sex hormones, environmental factors, and genetic susceptibility. The dynamic nature of ICP that usually resolves soon after delivery suggests the possibility that its pathobiology is under epigenetic modulation. We explored the status of white blood peripheral cells-DNA methylation of CpG-enriched sites at the promoter of targeted genes (FXR/NR1H4, PXR/NR1I2, NR1I3, ESR1, and ABCC2 in a sample of 88 ICP patients and 173 healthy pregnant women in the third trimester of their pregnancies. CpG dinucleotides at the gene promoter of nuclear receptors subfamily 1 members and ABCC2 transporter were highly methylated during healthy pregnancy. We observed significant differences at the distal (-1890 and proximal promoter (-358 CpG sites of the FXR/NR1H4 and at the distal PXR/NR1I2 (-1224 promoter, which were consistently less methylated in ICP cases when compared with controls. In addition, we observed that methylation at FXR/NR1H4-1890 and PXR/NR1I2-1224 promoter sites was highly and positively correlated with BA profiling, particularly, conjugated BAs. Conversely, methylation level at the proximal FXR/NR1H4-358 CpG site was significantly and negatively correlated with the primary cholic and secondary deoxycholic acid. In vitro exploration showed that epiallopregnanolone sulfate, a reported FXR inhibitor, regulates the transcriptional activity of FXR/NR1H4 but seems to be not involved in the methylation changes. In conclusion, the identification of epigenetic marks in target genes provides a basis for the understanding of adverse liver-related pregnancy outcomes, including ICP.

  17. Structure-function analysis indicates that sumoylation modulates DNA-binding activity of STAT1

    Directory of Open Access Journals (Sweden)

    Grönholm Juha

    2012-10-01

    Full Text Available Abstract Background STAT1 is an essential transcription factor for interferon-γ-mediated gene responses. A distinct sumoylation consensus site (ψKxE 702IKTE705 is localized in the C-terminal region of STAT1, where Lys703 is a target for PIAS-induced SUMO modification. Several studies indicate that sumoylation has an inhibitory role on STAT1-mediated gene expression but the molecular mechanisms are not fully understood. Results Here, we have performed a structural and functional analysis of sumoylation in STAT1. We show that deconjugation of SUMO by SENP1 enhances the transcriptional activity of STAT1, confirming a negative regulatory effect of sumoylation on STAT1 activity. Inspection of molecular model indicated that consensus site is well exposed to SUMO-conjugation in STAT1 homodimer and that the conjugated SUMO moiety is directed towards DNA, thus able to form a sterical hindrance affecting promoter binding of dimeric STAT1. In addition, oligoprecipitation experiments indicated that sumoylation deficient STAT1 E705Q mutant has higher DNA-binding activity on STAT1 responsive gene promoters than wild-type STAT1. Furthermore, sumoylation deficient STAT1 E705Q mutant displayed enhanced histone H4 acetylation on interferon-γ-responsive promoter compared to wild-type STAT1. Conclusions Our results suggest that sumoylation participates in regulation of STAT1 responses by modulating DNA-binding properties of STAT1.

  18. In vitro incubation of human spermatozoa promotes reactive oxygen species generation and DNA fragmentation.

    Science.gov (United States)

    Cicaré, J; Caille, A; Zumoffen, C; Ghersevich, S; Bahamondes, L; Munuce, M J

    2015-10-01

    The aim of this study was to investigate the oxidative process associated with sperm capacitation and its impact on DNA fragmentation and sperm function. Redox activity and lipid peroxidation were analysed in human spermatozoa after 3, 6 and 22 h of incubation in Ham's F10 medium plus bovine albumin at 37° and 5% CO2 for capacitation. DNA status, tyrosine phosphorylation pattern and induced acrosome reaction were evaluated after capacitating conditions. At 22 h of incubation, there was a significant (P < 0.05) increase in oxygen-free radicals and lipid peroxidation, with no effect on sperm viability. There also was a significant (P < 0.001) increase in fragmented DNA in capacitated spermatozoa compared to semen values with higher rates being found after the occurrence of the induced acrosome reaction. Protein tyrosine phosphorylation pattern confirms that capacitation took place in parallel with the occurrence of DNA fragmentation. These results indicate that when spermatozoa are incubated for several hours (22 h), a common practice in assisted reproductive techniques, an increase in oxidative sperm metabolism and in the proportion of fragmented DNA should be expected. However, there was no effect on any of the other functional parameters associated with sperm fertilising capacity. PMID:25233794

  19. Conserved hypothetical BB0462 protein enhances the transcription activity of oppAV promoter

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Borrelia burgdorferi BB0462 ORF encodes an unknown functional protein with 110 amino acids.A BLAST search in protein databases and the secondary structure being predicted by the program JUFO showed that the conserved hypothetical BB0462 protein was similar to the members of the YbaB protein family in both amino acid composition and protein structure.The co-transformation of BB0462 ORF and oppA upstream regulation DNA into E.coli host cells and β-galactosidase activity assay demonstrated that the BB0462 protein enhanced the transcriptional activity of the oppAV promoter,but does not affect those of oppAⅠ,Ⅱ,Ⅲ and Ⅳ promoters.Analysis of DNA retardation and competitive repression also confirmed that the BB0462 protein bound to the 409 bp upstream regulation DNA fragment close to the initiation codon of the oppAV gene.All data in our study suggested that the BB0462 protein was involved in the transcriptional regulation of the oppAV gene

  20. Internet as a Medium of Pharmaceutical Companies Promotional Activities

    OpenAIRE

    Darko Pantelic

    2009-01-01

    Pharmaceuticals market is highly regulated, and it can be stated that prescription (legal or ethical) drugs have a status of substances in controlled circulation. Promotional activities are also under strict legislation, further burdened with ethical consideration and public scrutiny. Internet as liberal and hard to control medium brings entirely new sets of solutions and/or problems to pharmaceuticals market(ers).

  1. Health Promotion Guidance Activity of Youth Sports Clubs

    Science.gov (United States)

    Kokko, Sami; Kannas, Lasse; Villberg, Jari; Ormshaw, Michael

    2011-01-01

    Purpose: This paper aims to clarify the extent to which youth sports clubs guide their coaches to recognise health promotion as a part of the coaching practice. The guidance activity of clubs is seen parallel to internal organisational communication. Design/methodology/approach: A survey of 93 (from 120, 78 per cent) youth sports clubs in Finland…

  2. How do general practitioners in Denmark promote physical activity?

    DEFF Research Database (Denmark)

    Jørgensen, Tanja K; Nordentoft, Merete; Krogh, Jesper

    2012-01-01

    The primary objective of this study was to quantify the frequency of advice given on type, frequency, duration, and intensity of exercise during physical activity (PA) promoting sessions by general practitioners. Second, to find GP characteristics associated with high quality of PA counselling....

  3. Healthy and Active Ageing: Social Capital in Health Promotion

    Science.gov (United States)

    Koutsogeorgou, Eleni; Davies, John Kenneth; Aranda, Kay; Zissi, Anastasia; Chatzikou, Maria; Cerniauskaite, Milda; Quintas, Rui; Raggi, Alberto; Leonardi, Matilde

    2014-01-01

    Objectives: This paper examines the context of health promotion actions that are focused on/contributing to strengthening social capital by increasing community participation, reciprocal trust and support as the means to achieve better health and more active ageing. Method: The methodology employed was a literature review/research synthesis, and a…

  4. It Takes a Virtual Community: Promoting Collaboration through Student Activities

    Science.gov (United States)

    Battista, Ludmila; Forrey, Carol; Stevenson, Carolyn

    2008-01-01

    Distance education provides many nontraditional students with the opportunity to pursue a college education not possible through traditional brick and mortar education. Although not meeting face-to-face, student activities help promote a stronger connection between the classroom and university community. This paper will discuss strategies for…

  5. Promoting Educational Equity through School Libraries: Equity Activity Book.

    Science.gov (United States)

    Arizona State Univ., Tempe.

    The activities suggested in this workbook for participants in a continuing education program for inservice school media specialists are designed to develop the trainee's skills in identifying instances of sexism and sex stereotyping in education, and in promoting sex fairness in the library. Exercises and tests on the first module are concerned…

  6. The Role of Values in Promoting Physical Activity

    Science.gov (United States)

    Kosma, Maria; Buchanan, David R.; Hondzinski, Jan

    2015-01-01

    Despite the proliferation of theory-based behavior-change programs to promote physical activity, obesity and diabetes rates continue to rise. Given the notable ineffective interventions, it is important to examine why these efforts have been largely unsuccessful and to consider potential alternatives. The purpose of this article is to consider the…

  7. Gain of DNA methylation is enhanced in the absence of CTCF at the human retinoblastoma gene promoter

    Directory of Open Access Journals (Sweden)

    Recillas-Targa Félix

    2011-06-01

    Full Text Available Abstract Background Long-term gene silencing throughout cell division is generally achieved by DNA methylation and other epigenetic processes. Aberrant DNA methylation is now widely recognized to be associated with cancer and other human diseases. Here we addressed the contribution of the multifunctional nuclear factor CTCF to the epigenetic regulation of the human retinoblastoma (Rb gene promoter in different tumoral cell lines. Methods To assess the DNA methylation status of the Rb promoter, genomic DNA from stably transfected human erythroleukemic K562 cells expressing a GFP reporter transgene was transformed with sodium bisulfite, and then PCR-amplified with modified primers and sequenced. Single- and multi-copy integrants with the CTCF binding site mutated were isolated and characterized by Southern blotting. Silenced transgenes were reactivated using 5-aza-2'-deoxycytidine and Trichostatin-A, and their expression was monitored by fluorescent cytometry. Rb gene expression and protein abundance were assessed by RT-PCR and Western blotting in three different glioma cell lines, and DNA methylation of the promoter region was determined by sodium bisulfite sequencing, together with CTCF dissociation and methyl-CpG-binding protein incorporation by chromatin immunoprecipitation assays. Results We found that the inability of CTCF to bind to the Rb promoter causes a dramatic loss of gene expression and a progressive gain of DNA methylation. Conclusions This study indicates that CTCF plays an important role in maintaining the Rb promoter in an optimal chromatin configuration. The absence of CTCF induces a rapid epigenetic silencing through a progressive gain of DNA methylation. Consequently, CTCF can now be seen as one of the epigenetic components that allows the proper configuration of tumor suppressor gene promoters. Its aberrant dissociation can then predispose key genes in cancer cells to acquire DNA methylation and epigenetic silencing.

  8. Reversible supramolecular assembly at specific DNA sites: nickel-promoted bivalent DNA binding with designed peptide and bipyridyl-bis(benzamidine) components.

    Science.gov (United States)

    Sánchez, Mateo I; Mosquera, Jesús; Vázquez, M Eugenio; Mascareñas, José L

    2014-09-01

    At specific DNA sites, nickel(II) salts promote the assembly of designed components, namely a bis(histidine)-modified peptide that is derived from a bZIP transcription factor and a bis(benzamidine) unit that is equipped with a bipyridine. This programmed supramolecular system with emergent properties reproduces some key characteristics of naturally occurring DNA-binding proteins, such as bivalence, selectivity, responsiveness to external agents, and reversibility.

  9. Invariant distribution of promoter activities in Escherichia coli.

    OpenAIRE

    Alon Zaslaver; Shai Kaplan; Anat Bren; Adrian Jinich; Avi Mayo; Erez Dekel; Uri Alon; Shalev Itzkovitz

    2009-01-01

    Author Summary Cells respond to a changing environment by regulating the activity of genes. Here, we sought to understand how E. coli cells distribute their limited transcriptional resources among their target genes, and how this allocation varies with growth rate and growth conditions. To achieve this, we assayed the expression of a comprehensive library of transcriptional reporter strains under different conditions. High-temporal resolution measurements of promoter activities were obtained ...

  10. Technology to promote and increase physical activity in heart failure.

    Science.gov (United States)

    Franklin, Nina C

    2015-01-01

    Regular physical activity is firmly recommended as part of a multifaceted approach to heart failure (HF) self-management. Unfortunately, research indicates that most patients are less likely to engage in and adhere to such activities. The widespread use of information and communication technology tools and resources offers an innovative and potentially beneficial avenue for increasing physical activity levels in HF patients. This article presents specific ways in which advances in information and communication technologies, including Internet- and mobile-based communications, social media platforms, and self-monitoring health devices, can serve as a means to broadly promote increasing levels of physical activity to improve health outcomes in the HF population.

  11. TALE factors poise promoters for activation by Hox proteins.

    Science.gov (United States)

    Choe, Seong-Kyu; Ladam, Franck; Sagerström, Charles G

    2014-01-27

    Hox proteins form complexes with TALE cofactors from the Pbx and Prep/Meis families to control transcription, but it remains unclear how Hox:TALE complexes function. Examining a Hoxb1b:TALE complex that regulates zebrafish hoxb1a transcription, we find maternally deposited TALE proteins at the hoxb1a promoter already during blastula stages. These TALE factors recruit histone-modifying enzymes to promote an active chromatin profile at the hoxb1a promoter and also recruit RNA polymerase II (RNAPII) and P-TEFb. However, in the presence of TALE factors, RNAPII remains phosphorylated on serine 5 and hoxb1a transcription is inefficient. By gastrula stages, Hoxb1b binds together with TALE factors to the hoxb1a promoter. This triggers P-TEFb-mediated transitioning of RNAPII to the serine 2-phosphorylated form and efficient hoxb1a transcription. We conclude that TALE factors access promoters during early embryogenesis to poise them for activation but that Hox proteins are required to trigger efficient transcription.

  12. HyCCAPP as a tool to characterize promoter DNA-protein interactions in Saccharomyces cerevisiae.

    Science.gov (United States)

    Guillen-Ahlers, Hector; Rao, Prahlad K; Levenstein, Mark E; Kennedy-Darling, Julia; Perumalla, Danu S; Jadhav, Avinash Y L; Glenn, Jeremy P; Ludwig-Kubinski, Amy; Drigalenko, Eugene; Montoya, Maria J; Göring, Harald H; Anderson, Corianna D; Scalf, Mark; Gildersleeve, Heidi I S; Cole, Regina; Greene, Alexandra M; Oduro, Akua K; Lazarova, Katarina; Cesnik, Anthony J; Barfknecht, Jared; Cirillo, Lisa A; Gasch, Audrey P; Shortreed, Michael R; Smith, Lloyd M; Olivier, Michael

    2016-06-01

    Currently available methods for interrogating DNA-protein interactions at individual genomic loci have significant limitations, and make it difficult to work with unmodified cells or examine single-copy regions without specific antibodies. In this study, we describe a physiological application of the Hybridization Capture of Chromatin-Associated Proteins for Proteomics (HyCCAPP) methodology we have developed. Both novel and known locus-specific DNA-protein interactions were identified at the ENO2 and GAL1 promoter regions of Saccharomyces cerevisiae, and revealed subgroups of proteins present in significantly different levels at the loci in cells grown on glucose versus galactose as the carbon source. Results were validated using chromatin immunoprecipitation. Overall, our analysis demonstrates that HyCCAPP is an effective and flexible technology that does not require specific antibodies nor prior knowledge of locally occurring DNA-protein interactions and can now be used to identify changes in protein interactions at target regions in the genome in response to physiological challenges.

  13. HyCCAPP as a tool to characterize promoter DNA-protein interactions in Saccharomyces cerevisiae.

    Science.gov (United States)

    Guillen-Ahlers, Hector; Rao, Prahlad K; Levenstein, Mark E; Kennedy-Darling, Julia; Perumalla, Danu S; Jadhav, Avinash Y L; Glenn, Jeremy P; Ludwig-Kubinski, Amy; Drigalenko, Eugene; Montoya, Maria J; Göring, Harald H; Anderson, Corianna D; Scalf, Mark; Gildersleeve, Heidi I S; Cole, Regina; Greene, Alexandra M; Oduro, Akua K; Lazarova, Katarina; Cesnik, Anthony J; Barfknecht, Jared; Cirillo, Lisa A; Gasch, Audrey P; Shortreed, Michael R; Smith, Lloyd M; Olivier, Michael

    2016-06-01

    Currently available methods for interrogating DNA-protein interactions at individual genomic loci have significant limitations, and make it difficult to work with unmodified cells or examine single-copy regions without specific antibodies. In this study, we describe a physiological application of the Hybridization Capture of Chromatin-Associated Proteins for Proteomics (HyCCAPP) methodology we have developed. Both novel and known locus-specific DNA-protein interactions were identified at the ENO2 and GAL1 promoter regions of Saccharomyces cerevisiae, and revealed subgroups of proteins present in significantly different levels at the loci in cells grown on glucose versus galactose as the carbon source. Results were validated using chromatin immunoprecipitation. Overall, our analysis demonstrates that HyCCAPP is an effective and flexible technology that does not require specific antibodies nor prior knowledge of locally occurring DNA-protein interactions and can now be used to identify changes in protein interactions at target regions in the genome in response to physiological challenges. PMID:27184763

  14. Inhibition of DNA methylation promotes breast tumor sensitivity to netrin-1 interference.

    Science.gov (United States)

    Grandin, Mélodie; Mathot, Pauline; Devailly, Guillaume; Bidet, Yannick; Ghantous, Akram; Favrot, Clementine; Gibert, Benjamin; Gadot, Nicolas; Puisieux, Isabelle; Herceg, Zdenko; Delcros, Jean-Guy; Bernet, Agnès; Mehlen, Patrick; Dante, Robert

    2016-01-01

    In a number of human cancers, NTN1 upregulation inhibits apoptosis induced by its so-called dependence receptors DCC and UNC5H, thus promoting tumor progression. In other cancers however, the selective inhibition of this dependence receptor death pathway relies on the silencing of pro-apoptotic effector proteins. We show here that a substantial fraction of human breast tumors exhibits simultaneous DNA methylation-dependent loss of expression of NTN1 and of DAPK1, a serine threonine kinase known to transduce the netrin-1 dependence receptor pro-apoptotic pathway. The inhibition of DNA methylation by drugs such as decitabine restores the expression of both NTN1 and DAPK1 in netrin-1-low cancer cells. Furthermore, a combination of decitabine with NTN1 silencing strategies or with an anti-netrin-1 neutralizing antibody potentiates tumor cell death and efficiently blocks tumor growth in different animal models. Thus, combining DNA methylation inhibitors with netrin-1 neutralizing agents may be a valuable strategy for combating cancer. PMID:27378792

  15. Analysis of Significance of Unite Examination of AFP and DNA Polymorphism of P3 Promoter of IGF-ⅡGene

    Institute of Scientific and Technical Information of China (English)

    LUO Su; ZHANG Feng-chun; SUN Chang-jiang; LIU Cheng-bai; ZHUANG Jiang-xing; ZHANG Jin

    2004-01-01

    The DNA of P3 promoter region of IGF-Ⅱ gene was obtained by means of PCR technique. The examination of DNA polymorphism by restriction endonuclease BstE Ⅱ and the examination of AFP by bioluminescence immunoassay technique were carried out. The results have a significant difference(P<0.005). But the positive rate of AFP is higher than that of DNA polymorphism. The experimental result shows that the change of the DNA polymorphism of IGF-Ⅱis not the only carcinogenic factor. The suggested unite examination is the best method for the diagnosis of the primary hepatocellular carcinoma.

  16. Propionate induces the bovine cytosolic phosphoenolpyruvate carboxykinase promoter activity.

    Science.gov (United States)

    Zhang, Qian; Koser, Stephanie L; Donkin, Shawn S

    2016-08-01

    Cytosolic phosphoenolpyruvate carboxykinase (PCK1) is a critical enzyme within the metabolic networks for gluconeogenesis, hepatic energy metabolism, and tricarboxylic acid cycle function, and is controlled by several transcription factors including hepatic nuclear factor 4α (HNF4α). The primary objective of the present study was to determine whether propionate regulates bovine PCK1 transcription. The second objective was to determine the action of cyclic AMP (cAMP), glucocorticoids, and insulin, hormonal cues known to modulate glucose metabolism, on bovine PCK1 transcriptional activity. The proximal promoter of the bovine PCK1 gene was ligated to a Firefly luciferase reporter and transfected into H4IIE hepatoma cells. Cells were exposed to treatments for 23 h and luciferase activity was determined in cell lysates. Activity of the PCK1 promoter was linearly induced by propionate, and maximally increased 7-fold with 2.5 mM propionate, which was not muted by 100 nM insulin. Activity of the PCK1 promoter was increased 1-fold by either 1.0 mM cAMP or 5.0µM dexamethasone, and 2.2-fold by their combination. Induction by cAMP and dexamethasone was repressed 50% by 100 nM insulin. Propionate, cAMP, and dexamethasone acted synergistically to induce the PCK1 promoter activity. Propionate-responsive regions, identified by 5' deletion analysis, were located between -1,238 and -409 bp and between -85 and +221 bp. Deletions of the core sequences of the 2 putative HNF4α sites decreased the responsiveness to propionate by approximately 40%. These data indicate that propionate regulates its own metabolism through transcriptional stimulation of the bovine PCK1 gene. This induction is mediated, in part, by the 2 putative HNF4α binding sites in the bovine PCK1 promoter. PMID:27289145

  17. Synthesis, DNA interaction and antimicrobial activities of three rimantadine analogues

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Bing-Mi; Zhang, Jun [Department of Pharmacy, Liaoning University, Shenyang 110036 (China); Wang, Xin, E-mail: wangxinlnu@163.com [Department of Pharmacy, Liaoning University, Shenyang 110036 (China); Zhang, Li-Ping; Liu, Yang [Department of Pharmacy, Liaoning University, Shenyang 110036 (China); Niu, Hua-Ying [Jinan Dachpharm Development Co., Ltd., Jinan 250100 (China); Liu, Bin, E-mail: liubinzehao@163.com [Department of Pharmacy, Liaoning University, Shenyang 110036 (China)

    2015-03-15

    The interactions of three rimantadine analogues (RAs) with calf thymus deoxyribonucleic acid (ct-DNA) in buffer solution (pH 7.4) were investigated using berberine (BR) as a probe by various methods. Fluorescence studies revealed that the RAs interacted with DNA in vitro and the quenchings were all static. Furthermore, the binding modes of these compounds to DNA were disclosed as groove binding supported by absorption spectroscopy, viscosity measurement and denatured DNA experiment. The antimicrobial activities of the RAs were also evaluated in Staphylococcus aureus and Escherichia coli, and they all exhibited good bacteriostasic effects. The results might provide an important reference for investigation of the molecular mechanism associated with the DNA binding of the RAs. - Highlights: • Three rimantadine analogues were synthesized. • The RAs effectively quenched the intrinsic fluorescence of DNA via a static combination. • These analogues can bind to DNA via groove binding mode. • The antimicrobial activities of three analogues were also evaluated by the disk diffusion method.

  18. NCOA4 transcriptional coactivator inhibits activation of DNA replication origins.

    Science.gov (United States)

    Bellelli, Roberto; Castellone, Maria Domenica; Guida, Teresa; Limongello, Roberto; Dathan, Nina Alayne; Merolla, Francesco; Cirafici, Anna Maria; Affuso, Andrea; Masai, Hisao; Costanzo, Vincenzo; Grieco, Domenico; Fusco, Alfredo; Santoro, Massimo; Carlomagno, Francesca

    2014-07-01

    NCOA4 is a transcriptional coactivator of nuclear hormone receptors that undergoes gene rearrangement in human cancer. By combining studies in Xenopus laevis egg extracts and mouse embryonic fibroblasts (MEFs), we show here that NCOA4 is a minichromosome maintenance 7 (MCM7)-interacting protein that is able to control DNA replication. Depletion-reconstitution experiments in Xenopus laevis egg extracts indicate that NCOA4 acts as an inhibitor of DNA replication origin activation by regulating CMG (CDC45/MCM2-7/GINS) helicase. NCOA4(-/-) MEFs display unscheduled origin activation and reduced interorigin distance; this results in replication stress, as shown by the presence of fork stalling, reduction of fork speed, and premature senescence. Together, our findings indicate that NCOA4 acts as a regulator of DNA replication origins that helps prevent inappropriate DNA synthesis and replication stress.

  19. Testing promoter activity in the trypanosome genome: isolation of a metacyclic-type VSG promoter, and unexpected insights into RNA polymerase II transcription.

    Science.gov (United States)

    McAndrew, M; Graham, S; Hartmann, C; Clayton, C

    1998-09-01

    In trypanosomes, most genes are arranged in polycistronic transcription units. Individual mRNAs are generated by 5'-trans splicing and 3' polyadenylation. Remarkably, no regulation of RNA polymerase II transcription has been detected although many RNAs are differentially expressed during kinetoplastid life cycles. Demonstration of specific class II promoters is complicated by the difficulty in distinguishing between genuine promoter activity and stimulation of trans splicing. Using vectors that were designed to allow the detection of low promoter activities in a transcriptionally silent chromosomal context, we isolated a novel trypanosome RNA polymerase I promoter. We were however unable to detect class II promoter activity in any tested DNA fragment. We also integrated genes which were preceded by a T3 promoter into the genome of cells expressing bacteriophage T3 polymerase: surprisingly, transcription was alpha-amanitin sensitive. One possible interpretation of these results is that in trypanosomes, RNA polymerase II initiation is favored by genomic accessibility and double-strand melting. PMID:9709032

  20. An upstream activation element exerting differential transcriptional activation on an archaeal promoter

    DEFF Research Database (Denmark)

    Peng, Nan; Xia, Qiu; Chen, Zhengjun;

    2009-01-01

    (UAS) ara-box activated the basal promoter by recruiting transcription factor B to its BRE. While this UAS ensured a general expression from an inactive or weak basal promoter in the presence of other tested carbon resources, it exhibited a strong arabinose-responsive transcriptional activation. To our...

  1. The HMG-box mitochondrial transcription factor xl-mtTFA binds DNA as a tetramer to activate bidirectional transcription.

    OpenAIRE

    Antoshechkin, I; Bogenhagen, D F; Mastrangelo, I A

    1997-01-01

    The mitochondrial HMG-box transcription factor xl-mtTFA activates bidirectional transcription by binding to a site separating two core promoters in Xenopus laevis mitochondrial DNA (mtDNA). Three independent approaches were used to study the higher order structure of xl-mtTFA binding to this site. First, co-immunoprecipitation of differentially tagged recombinant mtTFA derivatives established that the protein exists as a multimer. Second, in vitro chemical cross-linking experiments provided e...

  2. Promoter Hypermethylation of DNA Repair Gene MGMT in Laryngeal Squamous Cell Carcinoma

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    The relationship between hypermethylation of CpG islands in the promoter regions of O6methylguanine DNA methyltransferase (MGMT)genes and laryngeal squamous cell carcinoma was explored. Methylation-specific PCR and semi-quantitative RT-PCR were used to study the promoter methylation and mRNA expression of the MGMT gene in laryngeal carcinoma tissues, t issues adjacent to the tumor and normal laryngeal tissues. Hypermethylation of MGMT gene was detected in 16 samples of 46 (34.8 %) laryngeal squamous cell carcinoma samples. However, the MGMT hypermethylation was not detected in all tissues adjacent to the tumors and normal tissues. No significant difference in MGMT gene hypermethylation was found in samples with different histological grades (x2= 3. 130, P=0. 077) or in samples from patients with different TNM status (x2=3. 957, P=0. 138). No expression of MGMT mRNA was detected in all hypermethylated laryngeal carcinoma tissues. The expression of MGMT mRNA was detected in all unmethylated laryngeal carcinoma tissues, tissues adjacent to the tumors and normal tissues. It suggests that MGMT gene promoter hypermethylation is associated with MGMT gene transcription loss in laryngeal carcinoma tissues and possibly plays an important role in carcinogenesis of laryngeal tissues.

  3. Using DNA devices to track anticancer drug activity.

    Science.gov (United States)

    Kahanda, Dimithree; Chakrabarti, Gaurab; Mcwilliams, Marc A; Boothman, David A; Slinker, Jason D

    2016-06-15

    It is beneficial to develop systems that reproduce complex reactions of biological systems while maintaining control over specific factors involved in such processes. We demonstrated a DNA device for following the repair of DNA damage produced by a redox-cycling anticancer drug, beta-lapachone (β-lap). These chips supported ß-lap-induced biological redox cycle and tracked subsequent DNA damage repair activity with redox-modified DNA monolayers on gold. We observed drug-specific changes in square wave voltammetry from these chips at therapeutic ß-lap concentrations of high statistical significance over drug-free control. We also demonstrated a high correlation of this change with the specific ß-lap-induced redox cycle using rational controls. The concentration dependence of ß-lap revealed significant signal changes at levels of high clinical significance as well as sensitivity to sub-lethal levels of ß-lap. Catalase, an enzyme decomposing peroxide, was found to suppress DNA damage at a NQO1/catalase ratio found in healthy cells, but was clearly overcome at a higher NQO1/catalase ratio consistent with cancer cells. We found that it was necessary to reproduce key features of the cellular environment to observe this activity. Thus, this chip-based platform enabled tracking of ß-lap-induced DNA damage repair when biological criteria were met, providing a unique synthetic platform for uncovering activity normally confined to inside cells. PMID:26901461

  4. Alterations in HIV-1 LTR promoter activity during AIDS progression

    International Nuclear Information System (INIS)

    HIV-1 variants evolving in AIDS patients frequently show increased replicative capacity compared to those present during early asymptomatic infection. It is known that late stage HIV-1 variants often show an expanded coreceptor tropism and altered Nef function. In the present study we investigated whether enhanced HIV-1 LTR promoter activity might also evolve during disease progression. Our results demonstrate increased LTR promoter activity after AIDS progression in 3 of 12 HIV-1-infected individuals studied. Further analysis revealed that multiple alterations in the U3 core-enhancer and in the transactivation-response (TAR) region seem to be responsible for the enhanced functional activity. Our findings show that in a subset of HIV-1-infected individuals enhanced LTR transcription contributes to the increased replicative potential of late stage virus isolates and might accelerate disease progression

  5. DNA ligase III promotes alternative nonhomologous end-joining during chromosomal translocation formation.

    Directory of Open Access Journals (Sweden)

    Deniz Simsek

    2011-06-01

    Full Text Available Nonhomologous end-joining (NHEJ is the primary DNA repair pathway thought to underlie chromosomal translocations and other genomic rearrangements in somatic cells. The canonical NHEJ pathway, including DNA ligase IV (Lig4, suppresses genomic instability and chromosomal translocations, leading to the notion that a poorly defined, alternative NHEJ (alt-NHEJ pathway generates these rearrangements. Here, we investigate the DNA ligase requirement of chromosomal translocation formation in mouse cells. Mammals have two other DNA ligases, Lig1 and Lig3, in addition to Lig4. As deletion of Lig3 results in cellular lethality due to its requirement in mitochondria, we used recently developed cell lines deficient in nuclear Lig3 but rescued for mitochondrial DNA ligase activity. Further, zinc finger endonucleases were used to generate DNA breaks at endogenous loci to induce translocations. Unlike with Lig4 deficiency, which causes an increase in translocation frequency, translocations are reduced in frequency in the absence of Lig3. Residual translocations in Lig3-deficient cells do not show a bias toward use of pre-existing microhomology at the breakpoint junctions, unlike either wild-type or Lig4-deficient cells, consistent with the notion that alt-NHEJ is impaired with Lig3 loss. By contrast, Lig1 depletion in otherwise wild-type cells does not reduce translocations or affect microhomology use. However, translocations are further reduced in Lig3-deficient cells upon Lig1 knockdown, suggesting the existence of two alt-NHEJ pathways, one that is biased toward microhomology use and requires Lig3 and a back-up pathway which does not depend on microhomology and utilizes Lig1.

  6. Protein kinase C controls activation of the DNA integrity checkpoint

    Science.gov (United States)

    Soriano-Carot, María; Quilis, Inma; Bañó, M. Carmen; Igual, J. Carlos

    2014-01-01

    The protein kinase C (PKC) superfamily plays key regulatory roles in numerous cellular processes. Saccharomyces cerevisiae contains a single PKC, Pkc1, whose main function is cell wall integrity maintenance. In this work, we connect the Pkc1 protein to the maintenance of genome integrity in response to genotoxic stresses. Pkc1 and its kinase activity are necessary for the phosphorylation of checkpoint kinase Rad53, histone H2A and Xrs2 protein after deoxyribonucleic acid (DNA) damage, indicating that Pkc1 is required for activation of checkpoint kinases Mec1 and Tel1. Furthermore, Pkc1 electrophoretic mobility is delayed after inducing DNA damage, which reflects that Pkc1 is post-translationally modified. This modification is a phosphorylation event mediated by Tel1. The expression of different mammalian PKC isoforms at the endogenous level in yeast pkc1 mutant cells revealed that PKCδ is able to activate the DNA integrity checkpoint. Finally, downregulation of PKCδ activity in HeLa cells caused a defective activation of checkpoint kinase Chk2 when DNA damage was induced. Our results indicate that the control of the DNA integrity checkpoint by PKC is a mechanism conserved from yeast to humans. PMID:24792164

  7. Chromatin inactivation precedes de novo dna methylation during the progressive epigenetic silencing of the rassf1a promoter

    Energy Technology Data Exchange (ETDEWEB)

    Strunnikova Maria; Schagdarsurengin, Undraga; Kehlen, Astrid; Garbe, James C.; Stampfer, Martha R.; Dammann, Reinhard

    2005-02-23

    Epigenetic inactivation of the RASSF1A tumor suppressor by CpG island methylation was frequently detected in cancer. However, the mechanisms of this aberrant DNA methylation are unknown. In the RASSF1A promoter, we characterized four Sp1 sites, which are frequently methylated in cancer. We examined the functional relationship between DNA methylation, histone modification, Sp1 binding, and RASSF1A expression in proliferating human mammary epithelial cells. With increasing passages, the transcription of RASSF1A was dramatically silenced. This inactivation was associated with deacetylation and lysine 9 trimethylation of histone H3 and an impaired binding of Sp1 at the RASSF1A promoter. In mammary epithelial cells that had overcome a stress-associated senescence barrier, a spreading of DNA methylation in the CpG island promoter was observed. When the RASSF1A-silenced cells were treated with inhibitors of DNA methyltransferase and histone deacetylase, binding of Sp1 and expression of RASSF1 A reoccurred. In summary, we observed that histone H3 deacetylation and H3 lysine 9 trimethylation occur in the same time window as gene inactivation and precede DNA methylation. Our data suggest that in epithelial cells, histone inactivation may trigger de novo DNA methylation of the RASSF1A promoter and this system may serve as a model for CpG island inactivation of tumor suppressor genes.

  8. Relationship between Expression of the Human Alpha-Fetoprotein Gene and DNA Methylation Status of the Promoter Region

    Institute of Scientific and Technical Information of China (English)

    Lijun Chen; Wei Wang; Qiuyue Jin; Ruimin Wang; Wenliang Hu

    2006-01-01

    OBJECTIVE DNA methylation has been regarded as an important epigenetic signature reflecting the transcription state of DNA in cells. This study was to conducted to assess the relationship between human alpha-fetoprotein (AFP) gene expression and the DNA methylation status of the promoter region in three different cells, namely two human hepatocellular carcinoma (HCC) cell lines and normal human fibroblasts.METHODS Transcription of the AFP gene was verified by RT-PCR. After bisulphate treatment of DNA, the methods of MSP and BSP were used to analyze the methylation density and status within single DNA strands of two closely spaced CpG dinucleotides of the promoter region in the different cells.RESULTS RT-PCR analysis indicated that the expression of the AFP gene in HepG2 cells was significantly higher than in SMMC-7721 cells,and that the AFP gene was not expressed in normal human fibroblasts.By MSP and BSP we observed that the promoter region was demethylated in the AFP-high-expressing cell lines, and that the sites of -2,494 bp and -2,431 bp in the AFP genomic sequence can be used as detection sites for early tumorous diagnosis.CONCLUSION These results indicate that the DNA methylation state of the promoter region has a negative correlation with AFP gene expression.

  9. Promotion as a Tool in Sustaining the Destination Marketing Activities

    Directory of Open Access Journals (Sweden)

    Ivo Mulec

    2010-01-01

    Full Text Available Promoting the tourism destination in the right and best possible way is today one of vital marketing activities of all Destination Management Organizations. Only successful promotion can entice and attract potential travelers to visit the destination. The number of new destinations is increasing every year and some of them are quite similar. Market segmentation is one of the starting points for devising marketing strategy. Only by presenting the destination to the right segment of potential clients in the right way will a destination maximize the effectiveness of its marketing and promotion. Tourism destination marketers will continue to face considerable challenges in the future: they will have to take account of the needs, wants and expectations of more mature and knowledgeable customers, and the corresponding need for more up-to-date and reliable information upon which to base decision-making. In the future only marketing which includes collaborative dimensions will meet its objectives fully.

  10. DNA polymerase-α regulates type I interferon activation through cytosolic RNA:DNA synthesis

    Science.gov (United States)

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J.; Xing, Chao; Wang, Richard C.; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K.; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R.; Burstein, Ezra

    2016-01-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations disrupting nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts expression of POLA1, the gene encoding the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency results in increased type I interferon production. This enzyme is necessary for RNA:DNA primer synthesis during DNA replication and strikingly, POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Altogether, this work identified POLA1 as a critical regulator of the type I interferon response. PMID:27019227

  11. H. pylori-Induced DNA Strand Breaks Are Introduced by Nucleotide Excision Repair Endonucleases and Promote NF-κB Target Gene Expression

    Directory of Open Access Journals (Sweden)

    Mara L. Hartung

    2015-10-01

    Full Text Available The human bacterial pathogen Helicobacter pylori exhibits genotoxic properties that promote gastric carcinogenesis. H. pylori introduces DNA double strand breaks (DSBs in epithelial cells that trigger host cell DNA repair efforts. Here, we show that H. pylori-induced DSBs are repaired via error-prone, potentially mutagenic non-homologous end-joining. A genome-wide screen for factors contributing to DSB induction revealed a critical role for the H. pylori type IV secretion system (T4SS. Inhibition of transcription, as well as NF-κB/RelA-specific RNAi, abrogates DSB formation. DSB induction further requires β1-integrin signaling. DSBs are introduced by the nucleotide excision repair endonucleases XPF and XPG, which, together with RelA, are recruited to chromatin in a highly coordinated, T4SS-dependent manner. Interestingly, XPF/XPG-mediated DNA DSBs promote NF-κB target gene transactivation and host cell survival. In summary, H. pylori induces XPF/XPG-mediated DNA damage through activation of the T4SS/β1-integrin signaling axis, which promotes NF-κB target gene expression and host cell survival.

  12. Checkpoint Kinase ATR Promotes Nucleotide Excision Repair of UV-induced DNA Damage via Physical Interaction with Xeroderma Pigmentosum Group A*

    Science.gov (United States)

    Shell, Steven M.; Li, Zhengke; Shkriabai, Nikolozi; Kvaratskhelia, Mamuka; Brosey, Chris; Serrano, Moises A.; Chazin, Walter J.; Musich, Phillip R.; Zou, Yue

    2009-01-01

    In response to DNA damage, eukaryotic cells activate a series of DNA damage-dependent pathways that serve to arrest cell cycle progression and remove DNA damage. Coordination of cell cycle arrest and damage repair is critical for maintenance of genomic stability. However, this process is still poorly understood. Nucleotide excision repair (NER) and the ATR-dependent cell cycle checkpoint are the major pathways responsible for repair of UV-induced DNA damage. Here we show that ATR physically interacts with the NER factor Xeroderma pigmentosum group A (XPA). Using a mass spectrometry-based protein footprinting method, we found that ATR interacts with a helix-turn-helix motif in the minimal DNA-binding domain of XPA where an ATR phosphorylation site (serine 196) is located. XPA-deficient cells complemented with XPA containing a point mutation of S196A displayed a reduced repair efficiency of cyclobutane pyrimidine dimers as compared with cells complemented with wild-type XPA, although no effect was observed for repair of (6-4) photoproducts. This suggests that the ATR-dependent phosphorylation of XPA may promote NER repair of persistent DNA damage. In addition, a K188A point mutation of XPA that disrupts the ATR-XPA interaction inhibits the nuclear import of XPA after UV irradiation and, thus, significantly reduced DNA repair efficiency. By contrast, the S196A mutation has no effect on XPA nuclear translocation. Taken together, our results suggest that the ATR-XPA interaction mediated by the helix-turn-helix motif of XPA plays an important role in DNA-damage responses to promote cell survival and genomic stability after UV irradiation. PMID:19586908

  13. Plasma-activated air mediates plasmid DNA delivery in vivo.

    Science.gov (United States)

    Edelblute, Chelsea M; Heller, Loree C; Malik, Muhammad A; Bulysheva, Anna; Heller, Richard

    2016-01-01

    Plasma-activated air (PAA) provides a noncontact DNA transfer platform. In the current study, PAA was used for the delivery of plasmid DNA in a 3D human skin model, as well as in vivo. Delivery of plasmid DNA encoding luciferase to recellularized dermal constructs was enhanced, resulting in a fourfold increase in luciferase expression over 120 hours compared to injection only (P plasmid DNA encoding green fluorescent protein (GFP) was confirmed in the epidermal layers of the construct. In vivo experiments were performed in BALB/c mice, with skin as the delivery target. PAA exposure significantly enhanced luciferase expression levels 460-fold in exposed sites compared to levels obtained from the injection of plasmid DNA alone (P plasmid DNA encoding GFP to mouse skin was confirmed by immunostaining, where a 3-minute exposure at a 10 mm distance displayed delivery distribution deep within the dermal layers compared to an exposure at 3 mm where GFP expression was localized within the epidermis. Our findings suggest PAA-mediated delivery warrants further exploration as an alternative approach for DNA transfer for skin targets. PMID:27110584

  14. Gene activation regresses atherosclerosis, promotes health, and enhances longevity

    Directory of Open Access Journals (Sweden)

    Luoma Pauli V

    2010-07-01

    Full Text Available Abstract Background Lifestyle factors and pharmacological compounds activate genetic mechanisms that influence the development of atherosclerotic and other diseases. This article reviews studies on natural and pharmacological gene activation that promotes health and enhances longevity. Results Living habits including healthy diet and regular physical activity, and pharmacotherapy, upregulate genes encoding enzymes and apolipoprotein and ATP-binding cassette transporters, acting in metabolic processes that promote health and increase survival. Cytochrome P450-enzymes, physiological factors in maintaining cholesterol homeostasis, generate oxysterols for the elimination of surplus cholesterol. Hepatic CTP:phosphocholine cytidylyltransferase-α is an important regulator of plasma HDL-C level. Gene-activators produce plasma lipoprotein profile, high HDL-C, HDL2-C and HDL-C/cholesterol ratio, which is typical of low risk of atherosclerotic disease, and also of exceptional longevity together with reduced prevalence of cardiovascular, metabolic and other diseases. High HDL contributes to protection against inflammation, oxidation and thrombosis, and associates with good cognitive function in very old people. Avoiding unhealthy stress and managing it properly promotes health and increases life expectancy. Conclusions Healthy living habits and gene-activating xenobiotics upregulate mechanisms that produce lipoprotein pattern typical of very old people and enhance longevity. Lipoprotein metabolism and large HDL2 associate with the process of living a very long life. Major future goals for health promotion are the improving of commitment to both wise lifestyle choices and drug therapy, and further the developing of new and more effective and well tolerated drugs and treatments.

  15. DNA fragments binding CTCF in vitro and in vivo are capable of blocking enhancer activity

    Directory of Open Access Journals (Sweden)

    Didych Dmitry A

    2012-04-01

    Full Text Available Abstract Background Earlier we identified ten 100-300-bp long CTCF-binding DNA fragments selected earlier from a 1-Mb human chromosome 19 region. Here the positive-negative selection technique was used to check the ability of CTCF-binding human genomic fragments to block enhancer-promoter interaction when inserted into the genome. Results Ten CTCF-binding DNA fragments were inserted between the CMV enhancer and CMV minimal promoter driving the herpes simplex virus thymidine kinase (HSV-tk gene in a vector expressing also the neoR gene under a separate promoter. The constructs were then integrated into the genome of CHO cells, and the cells resistant to neomycin and ganciclovir (positive-negative selection were picked up, and their DNAs were PCR analyzed to confirm the presence of the fragments between the enhancer and promoter in both orientations. Conclusions We demonstrated that all sequences identified by their CTCF binding both in vitro and in vivo had enhancer-blocking activity when inserted between the CMV minimal promoter and enhancer in stably transfected CHO cells.

  16. Transcriptional activation via DNA-looping: visualization of intermediates in the activation pathway of E. coli RNA polymerase x sigma 54 holoenzyme by scanning force microscopy.

    Science.gov (United States)

    Rippe, K; Guthold, M; von Hippel, P H; Bustamante, C

    1997-07-11

    Scanning force microscopy (SFM) has been used to study transcriptional activation of Escherichia coli RNA polymerase x sigma 54 (RNAP x sigma 54) at the glnA promoter by the constitutive mutant NtrC(D54E,S160F) of the NtrC Protein (nitrogen regulatory protein C). DNA-protein complexes were deposited on mica and images were recorded in air. The DNA template was a 726 bp linear fragment with two NtrC binding sites located at the end and about 460 bp away from the RNAP x sigma 54 glnA promoter. By choosing appropriate conditions the structure of various intermediates in the transcription process could be visualized and analyzed: (1) different multimeric complexes of NtrC(D54E,S160F) dimers bound to the DNA template; (2) the closed complex of RNAP x sigma 54 at the glnA promoter; (3) association between DNA bound RNAP x sigma 54 and NtrC(D54E,S160F) with the intervening DNA looped out; and (4) the activated open promoter complex of RNAP x sigma 54. Measurements of the DNA bending angle of RNAP x sigma 54 closed promoter complexes yielded an apparent bending angle of 49(+/-24) degrees. Under conditions that allowed the formation of the open promoter complex, the distribution of bending angles displayed two peaks at 50(+/-24) degrees and 114(+/-18) degrees, suggesting that the transition from the RNAP x sigma 54 closed complex to the open complex is accompanied by an increase of the DNA bending angle.

  17. Cryptic single-stranded-DNA binding activities of the phage λ P and Escherichia coli DnaC replication initiation proteins facilitate the transfer of E. coli DnaB helicase onto DNA

    OpenAIRE

    Learn, Brian A.; Um, Soo-Jong; Huang, Li; McMacken, Roger

    1997-01-01

    The bacteriophage λ P and Escherichia coli DnaC proteins are known to recruit the bacterial DnaB replicative helicase to initiator complexes assembled at the phage and bacterial origins, respectively. These specialized nucleoprotein assemblies facilitate the transfer of one or more molecules of DnaB helicase onto the chromosome; the transferred DnaB, in turn, promotes establishment of a processive replication fork apparatus. To learn more about the mechanism of the DnaB transfer reaction, we ...

  18. Amino acid 1-209 is essential for PDX-1-mediated repression of human CMV IE promoter activity

    Institute of Scientific and Technical Information of China (English)

    Jing CHEN; Lei CHEN; Ge LI; Lu CHENG; Yin HUANG; Jia-xin ZHANG; Wei-wei FAN; Da-ru LU

    2006-01-01

    Aim: To explore the different roles of pancreatic duodenal homeobox factors-1 (PDX-1) domains in PDX-1 mediated repression of human cytomegalovirus immediately early (CMV IE) promoter. Methods: A series of truncated PDX-1 mutants were constructed. The binding of PDX-1 and CMV IE promoter was identified by electrophoretic mobility shift assay (EMSA). The dual-reporter assay was applied to examine the repression activities of PDX-1 mutants on CMV IE promoter. In addition, RNAi technology was used to specifically knock down the endogenous PDX-1 expression. Results: The reporter assay indicated that compared to the mock controls (pEGFP-N2), overexpression of PDX-1 resulted in a 41% decrease of CMV IE promoter activity in the 293 cells (P<0.05) and 43% decrease in HeLa cells (P<0.05), and the repression levels of various truncated mutants played on CMV IE promoter were different. Specific knock down of the endogenous PDX-1 expression significantly restored the activity of CMV IE promoter. EMS A demonstrated that domain 3 is necessary for nuclear localization and DNA binding activity of PDX-1. However, binding of PDX-1 alone to CMV IE promoter was not sufficient to inhibit its transcriptional activity, and other domains of PDX-1 presented were also required. Conclusion: Our data suggested that the DNA binding activity of PDX-1 domain 3 and the cooperative binding of PDX-1 domain 1/2 with other proteins were required for PDX-1 mediated repression of CMV IE promoter.

  19. Synthesis and biological activity of benzamide DNA minor groove binders.

    Science.gov (United States)

    Khan, Gul Shahzada; Pilkington, Lisa I; Barker, David

    2016-02-01

    A range of di- and triaryl benzamides were synthesised to investigate the effect of the presence and nature of a polar sidechain, bonding and substitution patterns and functionalisation of benzylic substituents. These compounds were tested for their antiproliferative activity as well as their DNA binding activity. The most active compounds in all assays were unsymmetrical triaryl benzamides with a bulky or alkylating benzylic substituent and a polar amino sidechain.

  20. The DNA methylation profile of activated human natural killer cells.

    Science.gov (United States)

    Wiencke, John K; Butler, Rondi; Hsuang, George; Eliot, Melissa; Kim, Stephanie; Sepulveda, Manuel A; Siegel, Derick; Houseman, E Andres; Kelsey, Karl T

    2016-05-01

    Natural killer (NK) cells are now recognized to exhibit characteristics akin to cells of the adaptive immune system. The generation of adaptive memory is linked to epigenetic reprogramming including alterations in DNA methylation. The study herein found reproducible genome wide DNA methylation changes associated with human NK cell activation. Activation led predominately to CpG hypomethylation (81% of significant loci). Bioinformatics analysis confirmed that non-coding and gene-associated differentially methylated sites (DMS) are enriched for immune related functions (i.e., immune cell activation). Known DNA methylation-regulated immune loci were also identified in activated NK cells (e.g., TNFA, LTA, IL13, CSF2). Twenty-one loci were designated high priority and further investigated as potential markers of NK activation. BHLHE40 was identified as a viable candidate for which a droplet digital PCR assay for demethylation was developed. The assay revealed high demethylation in activated NK cells and low demethylation in naïve NK, T- and B-cells. We conclude the NK cell methylome is plastic with potential for remodeling. The differentially methylated region signature of activated NKs revealed similarities with T cell activation, but also provided unique biomarker candidates of NK activation, which could be useful in epigenome-wide association studies to interrogate the role of NK subtypes in global methylation changes associated with exposures and/or disease states. PMID:26967308

  1. Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

    International Nuclear Information System (INIS)

    Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n = 51) and cancer free controls (n = 88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [32P]-based oligonucleotide cleavage assay (MPG substrate 5′-CCGCTεAGCGGGTACCGAGCTCGAAT; εA = ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21 ± 1.67 fmol/μg DNA/h vs 3.47 ± 1.35 fmol/μg DNA/h, p = 0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16–7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

  2. Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

    Energy Technology Data Exchange (ETDEWEB)

    Crosbie, Philip A.J. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); North West Lung Centre, University Hospital of South Manchester, Manchester (United Kingdom); Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom); Watson, Amanda J. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); Agius, Raymond [Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom); Barber, Philip V. [North West Lung Centre, University Hospital of South Manchester, Manchester (United Kingdom); Margison, Geoffrey P. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); Povey, Andrew C., E-mail: apovey@manchester.ac.uk [Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom)

    2012-04-01

    Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n = 51) and cancer free controls (n = 88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [{sup 32}P]-based oligonucleotide cleavage assay (MPG substrate 5 Prime -CCGCT{epsilon}AGCGGGTACCGAGCTCGAAT; {epsilon}A = ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21 {+-} 1.67 fmol/{mu}g DNA/h vs 3.47 {+-} 1.35 fmol/{mu}g DNA/h, p = 0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16-7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

  3. Study of the activity of DNA polymerases β and λ using 5-formyluridine containing DNA substrates

    Directory of Open Access Journals (Sweden)

    Lavrik O. I.

    2012-06-01

    Full Text Available Aim. To investigate the TLS-activity of human DNA polymerases β and λ (pols β and λ using 5-formyluridine (5-foU containing DNA duplexes which are imitating the intermediates during replication of the leading DNA strand, and to study the influence of replication factors hRPA and hPCNA on this activity. Methods. The EMSA and the methods of enzyme’s kinetics were used. Results. The capability of pols β and λ to catalyze DNA synthesis across 5-foU was investigated and the kinetic characteristics of this process in the presence and in the absence of protein factors hRPA and hPCNA were evaluated. Conclusions. It was shown that: (i both proteins are able to catalyze TLS on used DNA substrates regardless of the reaction conditions, however, pol λ was more accurate enzyme; (ii hRPA can stimulate the efficacy of the nonmutagenic TLS catalyzed by pol at the nucleotide incorporation directly opposite of 5-foU, at the same time it doesn’t influence the incorporation efficacy if the damage displaced into the duplex; (iii hPCNA doesn’t influence the efficacy of TLS catalyzed by both enzymes.

  4. Loss of TET2 in hematopoietic cells leads to DNA hypermethylation of active enhancers and induction of leukemogenesis

    DEFF Research Database (Denmark)

    Rasmussen, Kasper D; Jia, Guangshuai; Johansen, Jens V;

    2015-01-01

    DNA methylation is tightly regulated throughout mammalian development, and altered DNA methylation patterns are a general hallmark of cancer. The methylcytosine dioxygenase TET2 is frequently mutated in hematological disorders, including acute myeloid leukemia (AML), and has been suggested to...... protect CG dinucleotide (CpG) islands and promoters from aberrant DNA methylation. In this study, we present a novel Tet2-dependent leukemia mouse model that closely recapitulates gene expression profiles and hallmarks of human AML1-ETO-induced AML. Using this model, we show that the primary effect of Tet......2 loss in preleukemic hematopoietic cells is progressive and widespread DNA hypermethylation affecting up to 25% of active enhancer elements. In contrast, CpG island and promoter methylation does not change in a Tet2-dependent manner but increases relative to population doublings. We confirmed this...

  5. Promoter prediction and annotation of microbial genomes based on DNA sequence and structural responses to superhelical stress

    Directory of Open Access Journals (Sweden)

    Benham Craig J

    2006-05-01

    Full Text Available Abstract Background In our previous studies, we found that the sites in prokaryotic genomes which are most susceptible to duplex destabilization under the negative superhelical stresses that occur in vivo are statistically highly significantly associated with intergenic regions that are known or inferred to contain promoters. In this report we investigate how this structural property, either alone or together with other structural and sequence attributes, may be used to search prokaryotic genomes for promoters. Results We show that the propensity for stress-induced DNA duplex destabilization (SIDD is closely associated with specific promoter regions. The extent of destabilization in promoter-containing regions is found to be bimodally distributed. When compared with DNA curvature, deformability, thermostability or sequence motif scores within the -10 region, SIDD is found to be the most informative DNA property regarding promoter locations in the E. coli K12 genome. SIDD properties alone perform better at detecting promoter regions than other programs trained on this genome. Because this approach has a very low false positive rate, it can be used to predict with high confidence the subset of promoters that are strongly destabilized. When SIDD properties are combined with -10 motif scores in a linear classification function, they predict promoter regions with better than 80% accuracy. When these methods were tested with promoter and non-promoter sequences from Bacillus subtilis, they achieved similar or higher accuracies. We also present a strictly SIDD-based predictor for annotating promoter sequences in complete microbial genomes. Conclusion In this report we show that the propensity to undergo stress-induced duplex destabilization (SIDD is a distinctive structural attribute of many prokaryotic promoter sequences. We have developed methods to identify promoter sequences in prokaryotic genomes that use SIDD either as a sole predictor or in

  6. Genome-wide study predicts promoter-G4 DNA motifs regulate selective functions in bacteria: radioresistance of D. radiodurans involves G4 DNA-mediated regulation.

    Science.gov (United States)

    Beaume, Nicolas; Pathak, Rajiv; Yadav, Vinod Kumar; Kota, Swathi; Misra, Hari S; Gautam, Hemant K; Chowdhury, Shantanu

    2013-01-01

    A remarkable number of guanine-rich sequences with potential to adopt non-canonical secondary structures called G-quadruplexes (or G4 DNA) are found within gene promoters. Despite growing interest, regulatory role of quadruplex DNA motifs in intrinsic cellular function remains poorly understood. Herein, we asked whether occurrence of potential G4 (PG4) DNA in promoters is associated with specific function(s) in bacteria. Using a normalized promoter-PG4-content (PG4(P)) index we analysed >60,000 promoters in 19 well-annotated species for (a) function class(es) and (b) gene(s) with enriched PG4(P). Unexpectedly, PG4-associated functional classes were organism specific, suggesting that PG4 motifs may impart specific function to organisms. As a case study, we analysed radioresistance. Interestingly, unsupervised clustering using PG4(P) of 21 genes, crucial for radioresistance, grouped three radioresistant microorganisms including Deinococcus radiodurans. Based on these predictions we tested and found that in presence of nanomolar amounts of the intracellular quadruplex-binding ligand N-methyl mesoporphyrin (NMM), radioresistance of D. radiodurans was attenuated by ~60%. In addition, important components of the RecF recombinational repair pathway recA, recF, recO, recR and recQ genes were found to harbour promoter-PG4 motifs and were also down-regulated in presence of NMM. Together these results provide first evidence that radioresistance may involve G4 DNA-mediated regulation and support the rationale that promoter-PG4s influence selective functions. PMID:23161683

  7. Isolation and characterization of active promoters from Gluconacetobacter diazotrophicus strain PAL5 using a promoter-trapping plasmid.

    Science.gov (United States)

    Schwab, Stefan; Pessoa, Cristiane Alves; de Lima Bergami, Amanda Aparecida; de Azevedo Figueiredo, Nathália Lima; Dos Santos Teixeira, Kátia Regina; Baldani, José Ivo

    2016-07-01

    Gluconacetobacter diazotrophicus is a nitrogen-fixing, endophytic bacterium that has the potential to promote plant growth and increase yield. Genetically modified strains might get more benefits to host plants, including through expression of useful proteins, such as Cry toxins from B. thuringiensis, or enzymes involved in phytohormone production, proteins with antagonistic activity for phytopathogens, or that improve nutrient utilization by the plant. For that, expression systems for G. diazotrophicus are needed, which requires active promoters fused to foreign (or innate) genes. This article describes the construction of a G. diazotrophicus PAL5 promoter library using a promoter-less lacZ-bearing vector, and the identification of six active promoters through β-galactosidase activity assays, sequencing and localization in the bacterial genome. The characterized promoters, which are located on distinct regions of the bacterial genome and encoding either sense or antisense transcripts, present variable expression strengths and might be used in the future for expressing useful proteins. PMID:26914247

  8. The metabolic activator FOXO1 binds hepatitis B virus DNA and activates its transcription

    Energy Technology Data Exchange (ETDEWEB)

    Shlomai, Amir, E-mail: amirsh@tasmc.health.gov.il [Department of Molecular Genetics, Weizmann Institute of Science, Rehovot 76100 (Israel); Institute for Gastroenterology and Liver disease, Tel-Aviv Sourasky Medical Center, 6 Weizmann street, Tel-Aviv (Israel); Shaul, Yosef [Department of Molecular Genetics, Weizmann Institute of Science, Rehovot 76100 (Israel)

    2009-04-17

    Hepatitis B virus (HBV) is a small DNA virus that targets the liver and infects humans worldwide. Recently we have shown that the metabolic regulator PGC-1{alpha} coactivates HBV transcription thereby rendering the virus susceptible to fluctuations in the nutritional status of the liver. PGC-1{alpha} coactivation of HBV is mediated through the liver-enriched nuclear receptor HNF4{alpha} and through another yet unknown transcription factor(s). Here we show that the forkhead transcription factor FOXO1, a known target for PGC-1{alpha} coactivation and a central mediator of glucose metabolism in the liver, binds HBV core promoter and activates its transcription. This activation is further enhanced in the presence of PGC-1{alpha}, implying that FOXO1 is a target for PGC-1{alpha} coactivation of HBV transcription. Thus, our results identify another key metabolic regulator as an activator of HBV transcription, thereby supporting the principle that HBV gene expression is regulated in a similar way to key hepatic metabolic genes.

  9. An ATF/CREB site is the major regulatory element in the human herpesvirus 6 DNA polymerase promoter.

    OpenAIRE

    Agulnick, A D; Thompson, J R; Ricciardi, R P

    1994-01-01

    Human herpesvirus 6 (HHV-6) is a recently described T-cell pathogen whose medical relevance and molecular biology are just beginning to be addressed. As a first look at the regulation of viral genes, control of the HHV-6 DNA polymerase promoter was examined. Polymerase gene transcription in HHV-6-infected cells was found to initiate from a single site located 115 bases upstream of the translation start codon. A polymerase promoter-chloramphenicol acetyltransferase reporter gene construct fail...

  10. Electrostatic map of T7 DNA. Comparative analysis of functional and electrostatic properties of T7 RNA polymerase specific promoters

    OpenAIRE

    Kamzolova, S. G.; Beskaravainy, P. M.; Osypov, A. A.; Dzhelyadin, T. R.; Temlyakova, E. A.; Sorokin, A. A.

    2013-01-01

    The entire T7 bacteriophage genome contains 39937 base pairs (Database NCBI RefSeq N1001604). Here, electrostatic potential distribution around double helical T7 DNA was calculated by Coulomb method using the computer program of Sorokin A.A. Electrostatic profiles of 17 promoters recognized by T7 phage specific RNA polymerase were analyzed. It was shown that electrostatic profiles of all T7 RNA polymerase specific promoters can be characterized by distinctive motifs which are specific for eac...

  11. DNA methylation by CcrM activates the transcription of two genes required for the division of Caulobacter crescentus.

    Science.gov (United States)

    Gonzalez, Diego; Collier, Justine

    2013-04-01

    DNA methylation regulates many processes, including gene expression, by superimposing secondary information on DNA sequences. The conserved CcrM enzyme, which methylates adenines in GANTC sequences, is essential to the viability of several Alphaproteobacteria. In this study, we find that Caulobacter crescentus cells lacking the CcrM enzyme accumulate low levels of the two conserved FtsZ and MipZ proteins, leading to a severe defect in cell division. This defect can be compensated by the expression of the ftsZ gene from an inducible promoter or by spontaneous suppressor mutations that promote FtsZ accumulation. We show that CcrM promotes the transcription of the ftsZ and mipZ genes and that the ftsZ and mipZ promoter regions contain a conserved CGACTC motif that is critical to their activities and to their regulation by CcrM. In addition, our results suggest that the ftsZ promoter has the lowest activity when the CGACTC motif is non-methylated, an intermediate activity when it is hemi-methylated and the highest activity when it is fully methylated. The regulation of ftsZ expression by DNA methylation may explain why CcrM is essential in a subset of Alphaproteobacteria.

  12. Rad18 is required for functional interactions between FANCD2, BRCA2, and Rad51 to repair DNA topoisomerase 1-poisons induced lesions and promote fork recovery

    Science.gov (United States)

    Tripathi, Kaushlendra; Mani, Chinnadurai; Clark, David W; Palle, Komaraiah

    2016-01-01

    Camptothecin (CPT) and its analogues are chemotherapeutic agents that covalently and reversibly link DNA Topoisomerase I to its nicked DNA intermediate eliciting the formation of DNA double strand breaks (DSB) during replication. The repair of these DSB involves multiple DNA damage response and repair proteins. Here we demonstrate that CPT-induced DNA damage promotes functional interactions between BRCA2, FANCD2, Rad18, and Rad51 to repair the replication-associated DSB through homologous recombination (HR). Loss of any of these proteins leads to equal disruption of HR repair, causes chromosomal aberrations and sensitizes cells to CPT. Rad18 appears to function upstream in this repair pathway as its downregulation prevents activation of FANCD2, diminishes BRCA2 and Rad51 protein levels, formation of nuclear foci of all three proteins and recovery of stalled or collapsed replication forks in response to CPT. Taken together this work further elucidates the complex interplay of DNA repair proteins in the repair of replication-associated DSB. PMID:26871286

  13. Hypothermia activates adipose tissue to promote malignant lung cancer progression.

    Directory of Open Access Journals (Sweden)

    Gangjun Du

    Full Text Available Microenvironment has been increasingly recognized as a critical regulator of cancer progression. In this study, we identified early changes in the microenvironment that contribute to malignant progression. Exposure of human bronchial epithelial cells (BEAS-2B to methylnitrosourea (MNU caused a reduction in cell toxicity and an increase in clonogenic capacity when the temperature was lowered from 37°C to 28°C. Hypothermia-incubated adipocyte media promoted proliferation in A549 cells. Although a hypothermic environment could increase urethane-induced tumor counts and Lewis lung cancer (LLC metastasis in lungs of three breeds of mice, an increase in tumor size could be discerned only in obese mice housed in hypothermia. Similarly, coinjections using differentiated adipocytes and A549 cells promoted tumor development in athymic nude mice when adipocytes were cultured at 28°C. Conversely, fat removal suppressed tumor growth in obese C57BL/6 mice inoculated with LLC cells. Further studies show hypothermia promotes a MNU-induced epithelial-mesenchymal transition (EMT and protects the tumor cell against immune control by TGF-β1 upregulation. We also found that activated adipocytes trigger tumor cell proliferation by increasing either TNF-α or VEGF levels. These results suggest that hypothermia activates adipocytes to stimulate tumor boost and play critical determinant roles in malignant progression.

  14. Dexamethasone down-regulates, the activity of promoter from human al (Ⅱ) procollagen gene

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Objective To investigate the effects of dexamethasone on the promoter activity of human al(1) procollagen gene.Methods Fibroblasts from human skin were primary cultured and subcultured. (1) The effects of dexamethasone on the human skin fibroblasts were determined by BrdU incorporation into DNA of fibroblasts. (2) Three plasmids containing various engths of 5' flanksequence of human al(1) procollagen gene and CAT as reporter gene were constructed, and were transfected into the human skin fi-broblasts by FuGENE Transfecfion Reagent. The effects of dexamethasone on 3 plasmids were determined by CAT - ELlSA. Results (1)After 24h of treatment on the fibroblasts with 110-9 ~110-4mol/L examethasone in DMEM containing 2% or 10% FCS, BrdU in-corporation into DNA showed no difference ( P > 0.05) . (2) the 3 plasmids were transfected into fibroblasts and then treated with 110-5mol/L and 110-6mol/L dexamethasones for 24h, relative CAT values were different belwent dexamethasone and control,higher dexamethasone(110 -5mol/L} and lower examethasone(110 -6mol/L) ( P <0. 05) . ConcluSion Dexamethasone has noeffects on the proliferation of human skin fibroblasts, and it has negative effect on the promoter activity of human al(1) procollagengene, which is dose- dependent.

  15. RSC facilitates Rad59-dependent homologous recombination between sister chromatids by promoting cohesin loading at DNA double-strand breaks.

    Science.gov (United States)

    Oum, Ji-Hyun; Seong, Changhyun; Kwon, Youngho; Ji, Jae-Hoon; Sid, Amy; Ramakrishnan, Sreejith; Ira, Grzegorz; Malkova, Anna; Sung, Patrick; Lee, Sang Eun; Shim, Eun Yong

    2011-10-01

    Homologous recombination repairs DNA double-strand breaks by searching for, invading, and copying information from a homologous template, typically the homologous chromosome or sister chromatid. Tight wrapping of DNA around histone octamers, however, impedes access of repair proteins to DNA damage. To facilitate DNA repair, modifications of histones and energy-dependent remodeling of chromatin are required, but the precise mechanisms by which chromatin modification and remodeling enzymes contribute to homologous DNA repair are unknown. Here we have systematically assessed the role of budding yeast RSC (remodel structure of chromatin), an abundant, ATP-dependent chromatin-remodeling complex, in the cellular response to spontaneous and induced DNA damage. RSC physically interacts with the recombination protein Rad59 and functions in homologous recombination. Multiple recombination assays revealed that RSC is uniquely required for recombination between sister chromatids by virtue of its ability to recruit cohesin at DNA breaks and thereby promoting sister chromatid cohesion. This study provides molecular insights into how chromatin remodeling contributes to DNA repair and maintenance of chromatin fidelity in the face of DNA damage.

  16. Monitoring DNA triplex formation using multicolor fluorescence and application to insulin-like growth factor I promoter downregulation.

    Science.gov (United States)

    Hégarat, Nadia; Novopashina, Darya; Fokina, Alesya A; Boutorine, Alexandre S; Venyaminova, Alya G; Praseuth, Danièle; François, Jean-Christophe

    2014-03-01

    Inhibition of insulin-like growth factor I (IGF-I) signaling is a promising antitumor strategy and nucleic acid-based approaches have been investigated to target genes in the pathway. Here, we sought to modulate IGF-I transcriptional activity using triple helix formation. The IGF-I P1 promoter contains a purine/pyrimidine (R/Y) sequence that is pivotal for transcription as determined by deletion analysis and can be targeted with a triplex-forming oligonucleotide (TFO). We designed modified purine- and pyrimidine-rich TFOs to bind to the R/Y sequence. To monitor TFO binding, we developed a fluorescence-based gel-retardation assay that allowed independent detection of each strand in three-stranded complexes using end-labeling with Alexa 488, cyanine (Cy)3 and Cy5 fluorochromes. We characterized TFOs for their ability to inhibit restriction enzyme activity, compete with DNA-binding proteins and inhibit IGF-I transcription in reporter assays. TFOs containing modified nucleobases, 5-methyl-2'-deoxycytidine and 5-propynyl-2'-deoxyuridine, specifically inhibited restriction enzyme cleavage and formed triplexes on the P1 promoter fragment. In cells, deletion of the R/Y-rich sequence led to 48% transcriptional inhibition of a reporter gene. Transfection with TFOs inhibited reporter gene activity to a similar extent, whereas transcription from a mutant construct with an interrupted R/Y region was unaffected, strongly suggesting the involvement of triplex formation in the inhibitory mechanisms. Our results indicate that nuclease-resistant TFOs will likely inhibit endogenous IGF-I gene function in cells. PMID:24423253

  17. DNA Recombinase Proteins, their Function and Structure in the Active Form, a Computational Study

    Science.gov (United States)

    Carra, Claudio; Cucinotta, Francis A.

    2007-01-01

    Homologous recombination is a crucial sequence of reactions in all cells for the repair of double strand DNA (dsDNA) breaks. While it was traditionally considered as a means for generating genetic diversity, it is now known to be essential for restart of collapsed replication forks that have met a lesion on the DNA template (Cox et al., 2000). The central stage of this process requires the presence of the DNA recombinase protein, RecA in bacteria, RadA in archaea, or Rad51 in eukaryotes, which leads to an ATP-mediated DNA strand-exchange process. Despite many years of intense study, some aspects of the biochemical mechanism, and structure of the active form of recombinase proteins are not well understood. Our theoretical study is an attempt to shed light on the main structural and mechanistic issues encountered on the RecA of the e-coli, the RecA of the extremely radio resistant Deinococcus Radiodurans (promoting an inverse DNA strand-exchange repair), and the homolog human Rad51. The conformational changes are analyzed for the naked enzymes, and when they are linked to ATP and ADP. The average structures are determined over 2ns time scale of Langevian dynamics using a collision frequency of 1.0 ps(sup -1). The systems are inserted in an octahedron periodic box with a 10 Angstrom buffer of water molecules explicitly described by the TIP3P model. The corresponding binding free energies are calculated in an implicit solvent using the Poisson-Boltzmann solvent accessible surface area, MM-PBSA model. The role of the ATP is not only in stabilizing the interaction RecA-DNA, but its hydrolysis is required to allow the DNA strand-exchange to proceed. Furthermore, we extended our study, using the hybrid QM/MM method, on the mechanism of this chemical process. All the calculations were performed using the commercial code Amber 9.

  18. Inflammatory cytokines promote inducible nitric oxide synthase-mediated DNA damage in hamster gallbladder epithelial cells

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    AIM: To investigate the link between chronic biliary inflammation and carcinogenesis using hamster gallbladder epithelial cells.METHODS: Gallbladder epithelial cells were isolated from hamsters and cultured with a mixture of inflammatory cytokines including interleukin-1β, interferon-γ, and tumor necrosis factor-α. Inducible nitric oxide synthase (iNOS) expression, nitric oxide (NO) generation, and DNA damage were evaluated.RESULTS: NO generation was increased significantly following cytokine stimulation, and suppressed by an iNOS inhibitor. iNOS mRNA expression was demonstrated in the gallbladder epithelial cells during exposure to inflammatory cytokines. Furthermore, NO-dependent DNA damage, estimated by the comet assay, was significantly increased by cytokines, and decreased to control levels by an iNOS inhibitor.CONCLUSION: Cytokine stimulation induced iNOS expression and NO generation in normal hamster gallbladder epithelial cells, which was sufficient to cause DNA damage. These results indicate that NO-mediated genotoxicity induced by inflammatory cytokines through activation of iNOS may be involved in the process of biliary carcinogenesis in response to chronic inflammation of the biliary tree.

  19. Regulation of Mutagenic DNA Polymerase V Activation in Space and Time.

    Science.gov (United States)

    Robinson, Andrew; McDonald, John P; Caldas, Victor E A; Patel, Meghna; Wood, Elizabeth A; Punter, Christiaan M; Ghodke, Harshad; Cox, Michael M; Woodgate, Roger; Goodman, Myron F; van Oijen, Antoine M

    2015-08-01

    Spatial regulation is often encountered as a component of multi-tiered regulatory systems in eukaryotes, where processes are readily segregated by organelle boundaries. Well-characterized examples of spatial regulation are less common in bacteria. Low-fidelity DNA polymerase V (UmuD'2C) is produced in Escherichia coli as part of the bacterial SOS response to DNA damage. Due to the mutagenic potential of this enzyme, pol V activity is controlled by means of an elaborate regulatory system at transcriptional and posttranslational levels. Using single-molecule fluorescence microscopy to visualize UmuC inside living cells in space and time, we now show that pol V is also subject to a novel form of spatial regulation. After an initial delay (~ 45 min) post UV irradiation, UmuC is synthesized, but is not immediately activated. Instead, it is sequestered at the inner cell membrane. The release of UmuC into the cytosol requires the RecA* nucleoprotein filament-mediated cleavage of UmuD→UmuD'. Classic SOS damage response mutants either block [umuD(K97A)] or constitutively stimulate [recA(E38K)] UmuC release from the membrane. Foci of mutagenically active pol V Mut (UmuD'2C-RecA-ATP) formed in the cytosol after UV irradiation do not co-localize with pol III replisomes, suggesting a capacity to promote translesion DNA synthesis at lesions skipped over by DNA polymerase III. In effect, at least three molecular mechanisms limit the amount of time that pol V has to access DNA: (1) transcriptional and posttranslational regulation that initially keep the intracellular levels of pol V to a minimum; (2) spatial regulation via transient sequestration of UmuC at the membrane, which further delays pol V activation; and (3) the hydrolytic activity of a recently discovered pol V Mut ATPase function that limits active polymerase time on the chromosomal template.

  20. Presentation and exhibition activities for promoting theexportof transport services

    Directory of Open Access Journals (Sweden)

    Darya Vladimirovna Nesterova

    2012-03-01

    Full Text Available Development of presentation and exhibition activities is considered as an important factor in providing new competitive advantages at the strategic markets for exporting of transportation services. A specific role for exhibition activities as a factor to overcome market failures arose from imperfect information and incomplete markets is displayed. Exhibitions are considered as a true reflection of most market parameters, as a means to get correct information concerning market capacity and its borders, as an instrument to access to new markets. At the firm level presentation and branding activities should be considered as a modern technology (especially it concerns Russian companies which provide to hold up already existed markets and to conquer new ones. Presentation and branding activities are an effective technology to promote company trade-mark, competitive advantages for market demand increasing. Comparative analysis of the main exhibitions on transport and logistics issues is fulfilled on the data basecollected by authors. Data observes geographical distribution of transport exhibition and exhibition facilities development at several regions for the last years. The analyses allow to revealing a geographical structure of the exhibitions and its distribution by type of transport. The most promising and economically favorable exhibition areas for the promotion of Russian transport services are shown.

  1. Evaluation of hair growth promoting activity of Phyllanthus niruri

    Directory of Open Access Journals (Sweden)

    Satish Patel

    2015-10-01

    Full Text Available Objectives: This study was designed to investigate the potential Phyllanthus niruri extracts in promotion of hair growth. Materials and Methods: Here, we studied the hair growth promoting activity of petroleum ether extract of P. niruri following its topical administration. Alopecia was induced in albino rats by subcutaneous administration of testosterone for 21 days. Evaluation of hair loss inhibition was done by concurrent administration of extract and monitoring parameters like follicular density,  anagen/telogen (A/T ratio and histological observation of animal skin sections. Finasteride solution was applied topically as standard. In vitro experiments were also performed to study the effect of extract on the activity of 5α-reductase enzyme Results: Groups treated with petroleum ether extract of plant showed hair re-growth as reflected by follicular density, A/T ratio and skin sections. Histopathology and morphologic observations of hair re-growth at shaved sites showed active follicular proliferation. In vitro experiments results showed inhibitory activity of petroleum  ether extract on type-2 5α-reductase enzyme and an increase in the amount of testosterone with increasing concentrations.  Conclusion: It could be concluded that petroleum ether extracts of P. niruri might be useful in the treatment of testosterone-induced alopecia in the experimental animal by inhibiting 5α-reductase enzyme.

  2. DNA hairpins promote temperature controlled cargo encapsulation in a truncated octahedral nanocage structure family

    Science.gov (United States)

    Franch, Oskar; Iacovelli, Federico; Falconi, Mattia; Juul, Sissel; Ottaviani, Alessio; Benvenuti, Claudia; Biocca, Silvia; Ho, Yi-Ping; Knudsen, Birgitta R.; Desideri, Alessandro

    2016-07-01

    In the present study we investigate the mechanism behind temperature controlled cargo uptake using a truncated octahedral DNA cage scaffold functionalized with one, two, three or four hairpin forming DNA strands inserted in one corner of the structure. This investigation was inspired by our previous demonstration of temperature controlled reversible encapsulation of the cargo enzyme, horseradish peroxidase, in the cage with four hairpin forming strands. However, in this previous study the mechanism of cargo uptake was not directly addressed (Juul, et al., Temperature-Controlled Encapsulation and Release of an Active Enzyme in the Cavity of a Self-Assembled DNA Nanocage, ACS Nano, 2013, 7, 9724-9734). In the present study we use a combination of molecular dynamics simulations and in vitro analyses to unravel the mechanism of cargo uptake in hairpin containing DNA cages. We find that two hairpin forming strands are necessary and sufficient to facilitate efficient cargo uptake, which argues against a full opening-closing of one corner of the structure being responsible for encapsulation. Molecular dynamics simulations were carried out to evaluate the atomistic motions responsible for encapsulation and showed that the two hairpin forming strands facilitated extension of at least one of the face surfaces of the cage scaffold, allowing entrance of the cargo protein into the cavity of the structure. Hence, the presented data demonstrate that cargo uptake does not involve a full opening of the structure. Rather, the uptake mechanism represents a feature of increased flexibility integrated in this nanocage structure upon the addition of at least two hairpin-forming strands.In the present study we investigate the mechanism behind temperature controlled cargo uptake using a truncated octahedral DNA cage scaffold functionalized with one, two, three or four hairpin forming DNA strands inserted in one corner of the structure. This investigation was inspired by our previous

  3. Genetic variants in ABCA1 promoter affect transcription activity and plasma HDL level in pigs.

    Science.gov (United States)

    Dang, Xiao-yong; Chu, Wei-wei; Shi, Heng-chuan; Yu, Shi-gang; Han, Hai-yin; Gu, Shu-Hua; Chen, Jie

    2015-01-25

    Excess accumulation of cholesterol in plasma may result in coronary artery disease. Numerous studies have demonstrated that ATP-binding cassette protein A1 (ABCA1) mediates the efflux of cholesterol and phospholipids to apolipoproteins, a process necessary for plasma high density lipoprotein (HDL) formation. Higher plasma levels of HDL are associated with lower risk for cardiovascular disease. Studies of human disease and animal models had shown that an increased hepatic ABCA1 activity relates to an enhanced plasma HDL level. In this study, we hypothesized that functional mutations in the ABCA1 promoter in pigs may affect gene transcription activity, and consequently the HDL level in plasma. The promoter region of ABCA1 was comparatively scanned by direct sequencing with pool DNA of high- and low-HDL groups (n=30 for each group). Two polymorphisms, c. - 608A>G and c. - 418T>A, were revealed with reverse allele distribution in the two groups. The two polymorphisms were completely linked and formed only G-A or A-T haplotypes when genotyped in a larger population (n=526). Furthermore, we found that the G-A/G-A genotype was associated with higher HDL and ABCA1 mRNA level than A-T/A-T genotype. Luciferase assay also revealed that G-A haplotype promoter had higher activity than A-T haplotype. Single-nucleotide mutant assay showed that c.-418T>A was the causal mutation for ABCA1 transcription activity alteration. Conclusively, we identified two completely linked SNPs in porcine ABCA1 promoter region which have influence on the plasma HDL level by altering ABCA1 gene transcriptional activity.

  4. Nuclear factor Y regulates ancient budgerigar hepadnavirus core promoter activity.

    Science.gov (United States)

    Shen, Zhongliang; Liu, Yanfeng; Luo, Mengjun; Wang, Wei; Liu, Jing; Liu, Wei; Pan, Shaokun; Xie, Youhua

    2016-09-16

    Endogenous viral elements (EVE) in animal genomes are the fossil records of ancient viruses and provide invaluable information on the origin and evolution of extant viruses. Extant hepadnaviruses include avihepadnaviruses of birds and orthohepadnaviruses of mammals. The core promoter (Cp) of hepadnaviruses is vital for viral gene expression and replication. We previously identified in the budgerigar genome two EVEs that contain the full-length genome of an ancient budgerigar hepadnavirus (eBHBV1 and eBHBV2). Here, we found eBHBV1 Cp and eBHBV2 Cp were active in several human and chicken cell lines. A region from nt -85 to -11 in eBHBV1 Cp was critical for the promoter activity. Bioinformatic analysis revealed a putative binding site of nuclear factor Y (NF-Y), a ubiquitous transcription factor, at nt -64 to -50 in eBHBV1 Cp. The NF-Y core binding site (ATTGG, nt -58 to -54) was essential for eBHBV1 Cp activity. The same results were obtained with eBHBV2 Cp and duck hepatitis B virus Cp. The subunit A of NF-Y (NF-YA) was recruited via the NF-Y core binding site to eBHBV1 Cp and upregulated the promoter activity. Finally, the NF-Y core binding site is conserved in the Cps of all the extant avihepadnaviruses but not of orthohepadnaviruses. Interestingly, a putative and functionally important NF-Y core binding site is located at nt -21 to -17 in the Cp of human hepatitis B virus. In conclusion, our findings have pinpointed an evolutionary conserved and functionally critical NF-Y binding element in the Cps of avihepadnaviruses.

  5. ATPase activity measurement of DNA replicative helicase from Bacillus stearothermophilus by malachite green method.

    Science.gov (United States)

    Yang, Mu; Wang, Ganggang

    2016-09-15

    The DnaB helicase from Bacillus stearothermophilus (DnaBBst) was a model protein for studying the bacterial DNA replication. In this work, a non-radioactive method for measuring ATPase activity of DnaBBst helicase was described. The working parameters and conditions were optimized. Furthermore, this method was applied to investigate effects of DnaG primase, ssDNA and helicase loader protein (DnaI) on ATPase activity of DnaBBst. Our results showed this method was sensitive and efficient. Moreover, it is suitable for the investigation of functional interaction between DnaB and related factors. PMID:27372608

  6. Human geminin promotes pre-RC formation and DNA replication by stabilizing CDT1 in mitosis

    DEFF Research Database (Denmark)

    Ballabeni, Andrea; Melixetian, Marina; Zamponi, Raffaella;

    2004-01-01

    -mediated degradation by inhibiting its ubiquitination. In particular, Geminin ensures basal levels of CDT1 during S phase and its accumulation during mitosis. Consistently, inhibition of Geminin synthesis during M phase leads to impairment of pre-RC formation and DNA replication during the following cell cycle....... Moreover, we show that inhibition of CDK1 during mitosis, and not Geminin depletion, is sufficient for premature formation of pre-RCs, indicating that CDK activity is the major mitotic inhibitor of licensing in human cells. Taken together with recent data from our laboratory, our results demonstrate...

  7. A PHF8 homolog in C. elegans promotes DNA repair via homologous recombination.

    Directory of Open Access Journals (Sweden)

    Changrim Lee

    Full Text Available PHF8 is a JmjC domain-containing histone demethylase, defects in which are associated with X-linked mental retardation. In this study, we examined the roles of two PHF8 homologs, JMJD-1.1 and JMJD-1.2, in the model organism C. elegans in response to DNA damage. A deletion mutation in either of the genes led to hypersensitivity to interstrand DNA crosslinks (ICLs, while only mutation of jmjd-1.1 resulted in hypersensitivity to double-strand DNA breaks (DSBs. In response to ICLs, JMJD-1.1 did not affect the focus formation of FCD-2, a homolog of FANCD2, a key protein in the Fanconi anemia pathway. However, the dynamic behavior of RPA-1 and RAD-51 was affected by the mutation: the accumulations of both proteins at ICLs appeared normal, but their subsequent disappearance was retarded, suggesting that later steps of homologous recombination were defective. Similar changes in the dynamic behavior of RPA-1 and RAD-51 were seen in response to DSBs, supporting a role of JMJD-1.1 in homologous recombination. Such a role was also supported by our finding that the hypersensitivity of jmjd-1.1 worms to ICLs was rescued by knockdown of lig-4, a homolog of Ligase 4 active in nonhomologous end-joining. The hypersensitivity of jmjd-1.1 worms to ICLs was increased by rad-54 knockdown, suggesting that JMJD-1.1 acts in parallel with RAD-54 in modulating chromatin structure. Indeed, the level of histone H3 Lys9 tri-methylation, a marker of heterochromatin, was higher in jmjd-1.1 cells than in wild-type cells. We conclude that the histone demethylase JMJD-1.1 influences homologous recombination either by relaxing heterochromatin structure or by indirectly regulating the expression of multiple genes affecting DNA repair.

  8. 75 FR 42114 - Office of Biotechnology Activities; Recombinant DNA Research: Proposed Action Under the NIH...

    Science.gov (United States)

    2010-07-20

    ... HUMAN SERVICES National Institutes of Health Office of Biotechnology Activities; Recombinant DNA Research: Proposed Action Under the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH... transgenic rodents by recombinant DNA technology must be registered with the Institutional...

  9. Promotion

    OpenAIRE

    Alam, Hasan B.

    2013-01-01

    This article gives an overview of the promotion process in an academic medical center. A description of different promotional tracks, tenure and endowed chairs, and the process of submitting an application is provided. Finally, some practical advice about developing skills and attributes that can help with academic growth and promotion is dispensed.

  10. Cockayne syndrome group B protein promotes mitochondrial DNA stability by supporting the DNA repair association with the mitochondrial membrane

    DEFF Research Database (Denmark)

    Aamann, Maria Diget; Sorensen, Martin M; Hvitby, Christina Poulsen;

    2010-01-01

    Cockayne syndrome (CS) is a human premature aging disorder associated with severe developmental deficiencies and neurodegeneration, and phenotypically it resembles some mitochondrial DNA (mtDNA) diseases. Most patients belong to complementation group B, and the CS group B (CSB) protein plays a role...

  11. Domain movements of the enhancer-dependent sigma factor drive DNA delivery into the RNA polymerase active site: insights from single molecule studies.

    Science.gov (United States)

    Sharma, Amit; Leach, Robert N; Gell, Christopher; Zhang, Nan; Burrows, Patricia C; Shepherd, Dale A; Wigneshweraraj, Sivaramesh; Smith, David Alastair; Zhang, Xiaodong; Buck, Martin; Stockley, Peter G; Tuma, Roman

    2014-04-01

    Recognition of bacterial promoters is regulated by two distinct classes of sequence-specific sigma factors, σ(70) or σ(54), that differ both in their primary sequence and in the requirement of the latter for activation via enhancer-bound upstream activators. The σ(54) version controls gene expression in response to stress, often mediating pathogenicity. Its activator proteins are members of the AAA+ superfamily and use adenosine triphosphate (ATP) hydrolysis to remodel initially auto-inhibited holoenzyme promoter complexes. We have mapped this remodeling using single-molecule fluorescence spectroscopy. Initial remodeling is nucleotide-independent and driven by binding both ssDNA during promoter melting and activator. However, DNA loading into the RNA polymerase active site depends on co-operative ATP hydrolysis by the activator. Although the coupled promoter recognition and melting steps may be conserved between σ(70) and σ(54), the domain movements of the latter have evolved to require an activator ATPase.

  12. Glycine Receptor α2 Subunit Activation Promotes Cortical Interneuron Migration

    Directory of Open Access Journals (Sweden)

    Ariel Avila

    2013-08-01

    Full Text Available Glycine receptors (GlyRs are detected in the developing CNS before synaptogenesis, but their function remains elusive. This study demonstrates that functional GlyRs are expressed by embryonic cortical interneurons in vivo. Furthermore, genetic disruption of these receptors leads to interneuron migration defects. We discovered that extrasynaptic activation of GlyRs containing the α2 subunit in cortical interneurons by endogenous glycine activates voltage-gated calcium channels and promotes calcium influx, which further modulates actomyosin contractility to fine-tune nuclear translocation during migration. Taken together, our data highlight the molecular events triggered by GlyR α2 activation that control cortical tangential migration during embryogenesis.

  13. The DNA damage checkpoint pathway promotes extensive resection and nucleotide synthesis to facilitate homologous recombination repair and genome stability in fission yeast.

    Science.gov (United States)

    Blaikley, Elizabeth J; Tinline-Purvis, Helen; Kasparek, Torben R; Marguerat, Samuel; Sarkar, Sovan; Hulme, Lydia; Hussey, Sharon; Wee, Boon-Yu; Deegan, Rachel S; Walker, Carol A; Pai, Chen-Chun; Bähler, Jürg; Nakagawa, Takuro; Humphrey, Timothy C

    2014-05-01

    DNA double-strand breaks (DSBs) can cause chromosomal rearrangements and extensive loss of heterozygosity (LOH), hallmarks of cancer cells. Yet, how such events are normally suppressed is unclear. Here we identify roles for the DNA damage checkpoint pathway in facilitating homologous recombination (HR) repair and suppressing extensive LOH and chromosomal rearrangements in response to a DSB. Accordingly, deletion of Rad3(ATR), Rad26ATRIP, Crb2(53BP1) or Cdc25 overexpression leads to reduced HR and increased break-induced chromosome loss and rearrangements. We find the DNA damage checkpoint pathway facilitates HR, in part, by promoting break-induced Cdt2-dependent nucleotide synthesis. We also identify additional roles for Rad17, the 9-1-1 complex and Chk1 activation in facilitating break-induced extensive resection and chromosome loss, thereby suppressing extensive LOH. Loss of Rad17 or the 9-1-1 complex results in a striking increase in break-induced isochromosome formation and very low levels of chromosome loss, suggesting the 9-1-1 complex acts as a nuclease processivity factor to facilitate extensive resection. Further, our data suggest redundant roles for Rad3ATR and Exo1 in facilitating extensive resection. We propose that the DNA damage checkpoint pathway coordinates resection and nucleotide synthesis, thereby promoting efficient HR repair and genome stability. PMID:24623809

  14. A novel type of DNA-binding protein interacts with a conserved sequence in an early nodulin ENOD12 promoter

    DEFF Research Database (Denmark)

    Christiansen, H; Hansen, A C; Vijn, I;

    1996-01-01

    in the nodule parenchyma and meristem. The presence of three small overlapping ORFs in the 5'-untranslated region of the ENBP1 cDNA indicates that ENBP1 expression might be regulated at the translational level. The interaction of ENBP1 with a conserved AT-rich element within the ENOD12 promoter and...

  15. Human mediator subunit MED15 promotes transcriptional activation.

    Science.gov (United States)

    Nakatsubo, Takuya; Nishitani, Saori; Kikuchi, Yuko; Iida, Satoshi; Yamada, Kana; Tanaka, Aki; Ohkuma, Yoshiaki

    2014-10-01

    In eukaryotes, the Mediator complex is an essential transcriptional cofactor of RNA polymerase II (Pol II). In humans, it contains up to 30 subunits and consists of four modules: head, middle, tail, and CDK/Cyclin. One of the subunits, MED15, is located in the tail module, and was initially identified as Gal11 in budding yeast, where it plays an essential role in the transcriptional regulation of galactose metabolism with the potent transcriptional activator Gal4. For this reason, we investigated the function of the human MED15 subunit (hMED15) in transcriptional activation. First, we measured the effect of hMED15 knockdown on cell growth in HeLa cells. The growth rate was greatly reduced. By immunostaining, we observed the colocalization of hMED15 with the general transcription factors TFIIE and TFIIH in the nucleus. We measured the effects of siRNA-mediated knockdown of hMED15 on transcriptional activation using two different transcriptional activators, VP16 and SREBP1a. Treatment with siRNAs reduced transcriptional activation, and this reduction could be rescued by overexpression of HA/Flag-tagged, wild-type hMED15. To investigate hMED15 localization, we treated human MCF-7 cells with the MDM2 inhibitor Nutlin-3, thus inducing p21 transcription. We found that hMED15 localized to both the p53 binding site and the p21 promoter region, along with TFIIE and TFIIH. These results indicate that hMED15 promotes transcriptional activation.

  16. ESR1 gene promoter region methylation in free circulating DNA and its correlation with estrogen receptor protein expression in tumor tissue in breast cancer patients

    International Nuclear Information System (INIS)

    Tumor expression of estrogen receptor (ER) is an important marker of prognosis, and is predictive of response to endocrine therapy in breast cancer. Several studies have observed that epigenetic events, such methylation of cytosines and deacetylation of histones, are involved in the complex mechanisms that regulate promoter transcription. However, the exact interplay of these factors in transcription activity is not well understood. In this study, we explored the relationship between ER expression status in tumor tissue samples and the methylation of the 5′ CpG promoter region of the estrogen receptor gene (ESR1) isolated from free circulating DNA (fcDNA) in plasma samples from breast cancer patients. Patients (n = 110) with non-metastatic breast cancer had analyses performed of ER expression (luminal phenotype in tumor tissue, by immunohistochemistry method), and the ESR1-DNA methylation status (fcDNA in plasma, by quantitative methylation specific PCR technique). Our results showed a significant association between presence of methylated ESR1 in patients with breast cancer and ER negative status in the tumor tissue (p = 0.0179). There was a trend towards a higher probability of ESR1-methylation in those phenotypes with poor prognosis i.e. 80% of triple negative patients, 60% of HER2 patients, compared to 28% and 5.9% of patients with better prognosis such as luminal A and luminal B, respectively. Silencing, by methylation, of the promoter region of the ESR1 affects the expression of the estrogen receptor protein in tumors of breast cancer patients; high methylation of ESR1-DNA is associated with estrogen receptor negative status which, in turn, may be implicated in the patient’s resistance to hormonal treatment in breast cancer. As such, epigenetic markers in plasma may be of interest as new targets for anticancer therapy, especially with respect to endocrine treatment

  17. Cationic Nanocylinders Promote Angiogenic Activities of Endothelial Cells

    Directory of Open Access Journals (Sweden)

    Jung Bok Lee

    2016-01-01

    Full Text Available Polymers have been used extensively taking forms as scaffolds, patterned surface and nanoparticle for regenerative medicine applications. Angiogenesis is an essential process for successful tissue regeneration, and endothelial cell–cell interaction plays a pivotal role in regulating their tight junction formation, a hallmark of angiogenesis. Though continuous progress has been made, strategies to promote angiogenesis still rely on small molecule delivery or nuanced scaffold fabrication. As such, the recent paradigm shift from top-down to bottom-up approaches in tissue engineering necessitates development of polymer-based modular engineering tools to control angiogenesis. Here, we developed cationic nanocylinders (NCs as inducers of cell–cell interaction and investigated their effect on angiogenic activities of human umbilical vein endothelial cells (HUVECs in vitro. Electrospun poly (l-lactic acid (PLLA fibers were aminolyzed to generate positively charged NCs. The aninolyzation time was changed to produce two different aspect ratios of NCs. When HUVECs were treated with NCs, the electrostatic interaction of cationic NCs with negatively charged plasma membranes promoted migration, permeability and tubulogenesis of HUVECs compared to no treatment. This effect was more profound when the higher aspect ratio NC was used. The results indicate these NCs can be used as a new tool for the bottom-up approach to promote angiogenesis.

  18. Hemi-methylated DNA regulates DNA methylation inheritance through allosteric activation of H3 ubiquitylation by UHRF1

    Science.gov (United States)

    Harrison, Joseph S; Cornett, Evan M; Goldfarb, Dennis; DaRosa, Paul A; Li, Zimeng M; Yan, Feng; Dickson, Bradley M; Guo, Angela H; Cantu, Daniel V; Kaustov, Lilia; Brown, Peter J; Arrowsmith, Cheryl H; Erie, Dorothy A; Major, Michael B; Klevit, Rachel E; Krajewski, Krzysztof; Kuhlman, Brian; Strahl, Brian D; Rothbart, Scott B

    2016-01-01

    The epigenetic inheritance of DNA methylation requires UHRF1, a histone- and DNA-binding RING E3 ubiquitin ligase that recruits DNMT1 to sites of newly replicated DNA through ubiquitylation of histone H3. UHRF1 binds DNA with selectivity towards hemi-methylated CpGs (HeDNA); however, the contribution of HeDNA sensing to UHRF1 function remains elusive. Here, we reveal that the interaction of UHRF1 with HeDNA is required for DNA methylation but is dispensable for chromatin interaction, which is governed by reciprocal positive cooperativity between the UHRF1 histone- and DNA-binding domains. HeDNA recognition activates UHRF1 ubiquitylation towards multiple lysines on the H3 tail adjacent to the UHRF1 histone-binding site. Collectively, our studies are the first demonstrations of a DNA-protein interaction and an epigenetic modification directly regulating E3 ubiquitin ligase activity. They also define an orchestrated epigenetic control mechanism involving modifications both to histones and DNA that facilitate UHRF1 chromatin targeting, H3 ubiquitylation, and DNA methylation inheritance. DOI: http://dx.doi.org/10.7554/eLife.17101.001 PMID:27595565

  19. Human transcriptional coactivator PC4 stimulates DNA end joining and activates DSB repair activity.

    Science.gov (United States)

    Batta, Kiran; Yokokawa, Masatoshi; Takeyasu, Kunio; Kundu, Tapas K

    2009-01-23

    Human transcriptional coactivator PC4 is a highly abundant nuclear protein that is involved in diverse cellular processes ranging from transcription to chromatin organization. Earlier, we have shown that PC4, a positive activator of p53, overexpresses upon genotoxic insult in a p53-dependent manner. In the present study, we show that PC4 stimulates ligase-mediated DNA end joining irrespective of the source of DNA ligase. Pull-down assays reveal that PC4 helps in the association of DNA ends through its C-terminal domain. In vitro nonhomologous end-joining assays with cell-free extracts show that PC4 enhances the joining of noncomplementary DNA ends. Interestingly, we found that PC4 activates double-strand break (DSB) repair activity through stimulation of DSB rejoining in vivo. Together, these findings demonstrate PC4 as an activator of nonhomologous end joining and DSB repair activity.

  20. Bacterial lipopolysaccharide promotes profibrotic activation of intestinal fibroblasts.

    LENUS (Irish Health Repository)

    Burke, J P

    2012-02-01

    BACKGROUND: Fibroblasts play a critical role in intestinal wound healing. Lipopolysaccharide (LPS) is a cell wall component of commensal gut bacteria. The effects of LPS on intestinal fibroblast activation were characterized. METHODS: Expression of the LPS receptor, toll-like receptor (TLR) 4, was assessed in cultured primary human intestinal fibroblasts using flow cytometry and confocal microscopy. Fibroblasts were treated with LPS and\\/or transforming growth factor (TGF) beta1. Nuclear factor kappaB (NFkappaB) pathway activation was assessed by inhibitory kappaBalpha (IkappaBalpha) degradation and NFkappaB promoter activity. Fibroblast contractility was measured using a fibroblast-populated collagen lattice. Smad-7, a negative regulator of TGF-beta1 signalling, and connective tissue growth factor (CTGF) expression were assessed using reverse transcriptase-polymerase chain reaction and western blot. The NFkappaB pathway was inhibited by IkappaBalpha transfection. RESULTS: TLR-4 was present on the surface of intestinal fibroblasts. LPS treatment of fibroblasts induced IkappaBalpha degradation, enhanced NFkappaB promoter activity and increased collagen contraction. Pretreatment with LPS (before TGF-beta1) significantly increased CTGF production relative to treatment with TGF-beta1 alone. LPS reduced whereas TGF-beta1 increased smad-7 expression. Transfection with an IkappaBalpha plasmid enhanced basal smad-7 expression. CONCLUSION: Intestinal fibroblasts express TLR-4 and respond to LPS by activating NFkappaB and inducing collagen contraction. LPS acts in concert with TGF-beta1 to induce CTGF. LPS reduces the expression of the TGF-beta1 inhibitor, smad-7.

  1. Photon-induced cell migration and integrin expression promoted by DNA integration of HPV16 genome

    International Nuclear Information System (INIS)

    Persistent human papilloma virus 16 (HPV16) infections are a major cause of cervical cancer. The integration of the viral DNA into the host genome causes E2 gene disruption which prevents apoptosis and increases host cell motility. In cervical cancer patients, survival is limited by local infiltration and systemic dissemination. Surgical control rates are poor in cases of parametrial infiltration. In these patients, radiotherapy (RT) is administered to enhance local control. However, photon irradiation itself has been reported to increase cell motility. In cases of E2-disrupted cervical cancers, this phenomenon would impose an additional risk of enhanced tumor cell motility. Here, we analyze mechanisms underlying photon-increased migration in keratinocytes with differential E2 gene status. Isogenic W12 (intact E2 gene status) and S12 (disrupted E2 gene status) keratinocytes were analyzed in fibronectin-based and serum-stimulated migration experiments following single photon doses of 0, 2, and 10 Gy. Quantitative FACS analyses of integrin expression were performed. Migration and adhesion are increased in E2 gene-disrupted keratinocytes. E2 gene disruption promotes attractability by serum components, therefore, effectuating the risk of local infiltration and systemic dissemination. In S12 cells, migration is further increased by photon RT which leads to enhanced expression of fibronectin receptor integrins. HPV16-associated E2 gene disruption is a main predictor of treatment-refractory cancer virulence. E2 gene disruption promotes cell motility. Following photon RT, E2-disrupted tumors bear the risk of integrin-related infiltration and dissemination. (orig.)

  2. Activation of the ATM-Snail pathway promotes breast cancer metastasis

    Science.gov (United States)

    Sun, Mianen; Guo, Xiaojing; Qian, Xiaolong; Wang, Haibo; Yang, Chunying; Brinkman, Kathryn L.; Serrano-Gonzalez, Monica; Jope, Richard S.; Zhou, Binhua; Engler, David A.; Zhan, Ming; Wong, Stephen T.C.; Fu, Li; Xu, Bo

    2012-01-01

    The DNA damage response (DDR) is critical for the maintenance of genetic stability and serves as an anti-cancer barrier during early tumorigenesis. However, the role of the DDR in tumor progression and metastasis is less known. Here, we demonstrate that the ATM kinase, one of the critical DDR elements, is hyperactive in late stage breast tumor tissues with lymph-node metastasis and this hyperactivity correlates with elevated expression of the epithelial–mesenchymal transition marker, Snail. At the molecular level, we demonstrate that ATM regulates Snail stabilization by phosphorylation on Serine-100. Using mass spectrometry, we identified HSP90 as a critical binding protein of Snail in response to DNA damage. HSP90 binds to and stabilizes phosphorylated Snail. We further provide in vitro and in vivo evidence that activation of ATM-mediated Snail phosphorylation promotes tumor invasion and metastasis. Finally, we demonstrate that Snail Serine-100 phosphorylation is elevated in breast cancer tissues with lymph-node metastasis, indicating clinical significance of the ATM-Snail pathway. Together, our findings provide strong evidence that the ATM-Snail pathway promotes tumor metastasis, highlighting a previously undescribed role of the DDR in tumor invasion and metastasis. PMID:22923499

  3. Activation of the ATM-Snail pathway promotes breast cancer metastasis

    Institute of Scientific and Technical Information of China (English)

    Mianen Sun; David A. Engler; Ming Zhan; Stephen T.C. Wong; Li Fu; Bo Xu; Xiaojing Guo; Xiaolong Qian; Haibo Wang; Chunying Yang; Kathryn L. Brinkman; Monica Serrano-Gonzalez; Richard S. Jope; Binhua Zhou

    2012-01-01

    The DNA damage response (DDR) is critical for the maintenance of genetic stability and serves as an anti-cancer barrier during early tumorigenesis.However,the role of the DDR in tumor progression and metastasis is less known.Here,we demonstrate that the ATM kinase,one of the critical DDR elements,is hyperactive in late stage breast tumor tissues with lymph-node metastasis and this hyperactivity correlates with elevated expression of the epitheliai-mesenchymal transition marker,Snail.At the molecular level,we demonstrate that ATM regulates Snail stabilization by phosphorylation on Serine-100.Using mass spectrometry,we identified HSP90 as a critical binding protein of Snail in response to DNA damage.HsP9o binds to and stabilizes phosphorylated Snail.We further provide in vitro and in vivo evidence that activation of ATM-mediated Snail phosphorylation promotes tumor invasion and metastasis.Finally,we demonstrate that Snail Serine-100 phosphorylation is elevated in breast cancer tissues with lymph-node metastasis,indicating clinical significance of the ATM-Snail pathway.Together,our findings provide strong evidence that the ATM-Snail pathway promotes tumor metastasis,highlighting a previously undescribed role of the DDR in tumor invasion and metastasis.

  4. GPS2/KDM4A Pioneering Activity Regulates Promoter-Specific Recruitment of PPARγ

    Directory of Open Access Journals (Sweden)

    M. Dafne Cardamone

    2014-07-01

    Full Text Available Timely and selective recruitment of transcription factors to their appropriate DNA-binding sites represents a critical step in regulating gene activation; however, the regulatory strategies underlying each factor’s effective recruitment to specific promoter and/or enhancer regions are not fully understood. Here, we identify an unexpected regulatory mechanism by which promoter-specific binding, and therefore function, of peroxisome proliferator-activator receptor γ (PPARγ in adipocytes requires G protein suppressor 2 (GPS2 to prime the local chromatin environment via inhibition of the ubiquitin ligase RNF8 and stabilization of the H3K9 histone demethylase KDM4A/JMJD2. Integration of genome-wide profiling data indicates that the pioneering activity of GPS2/KDM4A is required for PPARγ-mediated regulation of a specific transcriptional program, including the lipolytic enzymes adipose triglyceride lipase (ATGL and hormone-sensitive lipase (HSL. Hence, our findings reveal that GPS2 exerts a biologically important function in adipose tissue lipid mobilization by directly regulating ubiquitin signaling and indirectly modulating chromatin remodeling to prime selected genes for activation.

  5. A conserved TATA-less proximal promoter drives basal transcription from the urokinase-type plasminogen activator receptor gene

    DEFF Research Database (Denmark)

    Soravia, E; Grebe, A; De Luca, P;

    1995-01-01

    have cloned an uPAR DNA segment containing upstream regulatory sequences from both the human and murine genomes. We report that a proximal promoter, contained within 180 bp from the major transcription start sites of the human uPAR gene, drives basal transcription. This region lacks TATA and CAAT boxes...... and contains relatively GC-rich proximal sequences. A subregion of this sequence, highly conserved between human and murine genes, contains most of the promoter activity and is specifically bound by HeLa nuclear proteins, one of which belongs to the SP1 class....

  6. Differential Roles of Cell Death-inducing DNA Fragmentation Factor-α-like Effector (CIDE) Proteins in Promoting Lipid Droplet Fusion and Growth in Subpopulations of Hepatocytes.

    Science.gov (United States)

    Xu, Wenyi; Wu, Lizhen; Yu, Miao; Chen, Feng-Jung; Arshad, Muhammad; Xia, Xiayu; Ren, Hao; Yu, Jinhai; Xu, Li; Xu, Dijin; Li, John Zhong; Li, Peng; Zhou, Linkang

    2016-02-26

    Lipid droplets (LDs) are dynamic subcellular organelles whose growth is closely linked to obesity and hepatic steatosis. Cell death-inducing DNA fragmentation factor-α-like effector (CIDE) proteins, including Cidea, Cideb, and Cidec (also called Fsp27), play important roles in lipid metabolism. Cidea and Cidec are LD-associated proteins that promote atypical LD fusion in adipocytes. Here, we find that CIDE proteins are all localized to LD-LD contact sites (LDCSs) and promote lipid transfer, LD fusion, and growth in hepatocytes. We have identified two types of hepatocytes, one with small LDs (small LD-containing hepatocytes, SLHs) and one with large LDs (large LD-containing hepatocytes, LLHs) in the liver. Cideb is localized to LDCSs and promotes lipid exchange and LD fusion in both SLHs and LLHs, whereas Cidea and Cidec are specifically localized to the LDCSs and promote lipid exchange and LD fusion in LLHs. Cideb-deficient SLHs have reduced LD sizes and lower lipid exchange activities. Fasting dramatically induces the expression of Cidea/Cidec and increases the percentage of LLHs in the liver. The majority of the hepatocytes from the liver of obese mice are Cidea/Cidec-positive LLHs. Knocking down Cidea or Cidec significantly reduced lipid storage in the livers of obese animals. Our data reveal that CIDE proteins play differential roles in promoting LD fusion and lipid storage; Cideb promotes lipid storage under normal diet conditions, whereas Cidea and Cidec are responsible for liver steatosis under fasting and obese conditions.

  7. Active Fantasy Sports: Rationale and Feasibility of Leveraging Online Fantasy Sports to Promote Physical Activity

    Science.gov (United States)

    Majewski, Sara; Standish, Melanie; Agarwal, Pooja; Podowski, Aleksandra; Carson, Rebecca; Eyesus, Biruk; Shah, Aakash; Schneider, Kristin L

    2014-01-01

    Background The popularity of active video games (AVGs) has skyrocketed over the last decade. However, research suggests that the most popular AVGs, which rely on synchronous integration between players’ activity and game features, fail to promote physical activity outside of the game or for extended periods of engagement. This limitation has led researchers to consider AVGs that involve asynchronous integration of players’ ongoing physical activity with game features. Rather than build an AVG de novo, we selected an established sedentary video game uniquely well suited for the incorporation of asynchronous activity: online fantasy sports. Objective The primary aim of this study was to explore the feasibility of a new asynchronous AVG—active fantasy sports—designed to promote physical activity. Methods We conducted two pilot studies of an active fantasy sports game designed to promote physical activity. Participants wore a low cost triaxial accelerometer and participated in an online fantasy baseball (Study 1, n=9, 13-weeks) or fantasy basketball (Study 2, n=10, 17-weeks) league. Privileges within the game were made contingent on meeting weekly physical activity goals (eg, averaging 10,000 steps/day). Results Across the two studies, the feasibility of integrating physical activity contingent features and privileges into online fantasy sports games was supported. Participants found the active fantasy sports game enjoyable, as or more enjoyable than traditional (sedentary) online fantasy sports (Study 1: t 8=4.43, P<.01; Study 2: t 9=2.09, P=.07). Participants in Study 1 increased their average steps/day, t 8=2.63, P<.05, while participants in Study 2 maintained (ie, did not change) their activity, t 9=1.57, P=.15). In postassessment interviews, social support within the game was cited as a key motivating factor for increasing physical activity. Conclusions Preliminary evidence supports potential for the active fantasy sports system as a sustainable and

  8. Expressing activity of promoter elements of large intergenic region from cotton leaf curl virus in host plant*

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Cotton leaf curl virus (CLCuV) is a type of single-stranded DNAvirus, belonging to geminivirus of subgroup III. In order to determine the function of CLCuV large intergenic region (LIR), total DNA of CLCuV-infected cotton leaves was used as template, and fragment of LIR was obtained by PCR and inserted into clone vector. The fragment of LIR was fused with gus reporter gene and nos terminator in the orientation of transcription of virion sense and complementary sense respectively, and the plant expression vectors were constructed. GUS activity of Agrobacterium-mediated transgenic tobacco was measured. The result indicated that LIR showed strong promoter activity in complementary sense gene orientation. Average GUS activity of the complementary sense promoter was 5-6 times that of CaMV 35S promoter, and the highest GUS activity of individual plant was ten times of that of CaMV 35S promoter. Histochemical localization confirmed its activity in both mesophyll and vascular tissues. Activity of virion sense of LIR was rather low. Thus LIR isolated from CLCuV could be used as a novel strong promoter in plant genetic manipulation.

  9. Damage-induced DNA replication stalling relies on MAPK-activated protein kinase 2 activity

    DEFF Research Database (Denmark)

    Köpper, Frederik; Bierwirth, Cathrin; Schön, Margarete;

    2013-01-01

    knockdown of the MAP kinase-activated protein kinase 2 (MK2), a kinase currently implicated in p38 stress signaling and G2 arrest. Depletion or inhibition of MK2 also protected cells from DNA damage-induced cell death, and mice deficient for MK2 displayed decreased apoptosis in the skin upon UV irradiation......DNA damage can obstruct replication forks, resulting in replicative stress. By siRNA screening, we identified kinases involved in the accumulation of phosphohistone 2AX (γH2AX) upon UV irradiation-induced replication stress. Surprisingly, the strongest reduction of phosphohistone 2AX followed....... Moreover, MK2 activity was required for damage response, accumulation of ssDNA, and decreased survival when cells were treated with the nucleoside analogue gemcitabine or when the checkpoint kinase Chk1 was antagonized. By using DNA fiber assays, we found that MK2 inhibition or knockdown rescued DNA...

  10. Active Aging Promotion: Results from the Vital Aging Program

    Directory of Open Access Journals (Sweden)

    Mariagiovanna Caprara

    2013-01-01

    Full Text Available Active aging is one of the terms in the semantic network of aging well, together with others such as successful, productive, competent aging. All allude to the new paradigm in gerontology, whereby aging is considered from a positive perspective. Most authors in the field agree active aging is a multidimensional concept, embracing health, physical and cognitive fitness, positive affect and control, social relationships and engagement. This paper describes Vital Aging, an individual active aging promotion program implemented through three modalities: Life, Multimedia, and e-Learning. The program was developed on the basis of extensive evidence about individual determinants of active aging. The different versions of Vital Aging are described, and four evaluation studies (both formative and summative are reported. Formative evaluation reflected participants’ satisfaction and expected changes; summative evaluations yielded some quite encouraging results using quasi-experimental designs: those who took part in the programs increased their physical exercise, significantly improved their diet, reported better memory, had better emotional balance, and enjoyed more cultural, intellectual, affective, and social activities than they did before the course, thus increasing their social relationships. These results are discussed in the context of the common literature within the field and, also, taking into account the limitations of the evaluations accomplished.

  11. Molecular mechanism by which AMP-activated protein kinase activation promotes glycogen accumulation in muscle

    DEFF Research Database (Denmark)

    Hunter, Roger W; Treebak, Jonas Thue; Wojtaszewski, Jørgen;

    2011-01-01

    OBJECTIVE During energy stress, AMP-activated protein kinase (AMPK) promotes glucose transport and glycolysis for ATP production, while it is thought to inhibit anabolic glycogen synthesis by suppressing the activity of glycogen synthase (GS) to maintain the energy balance in muscle. Paradoxicall...... and subsequent rise in cellular [G6P]....

  12. The nuclear protein Artemis promotes AMPK activation by stabilizing the LKB1–AMPK complex

    International Nuclear Information System (INIS)

    Highlights: ► The nuclear protein Artemis physically interacts with AMPKα2. ► Artemis co-localizes with AMPKα2 in the nucleus. ► Artemis promotes phosphorylation and activation of AMPK. ► The interaction between AMPKα2 and LKB1 is stabilized by Artemis. -- Abstract: AMP-activated protein kinase (AMPK) is a hetero-trimeric Ser/Thr kinase composed of a catalytic α subunit and regulatory β and γ subunits; it functions as an energy sensor that controls cellular energy homeostasis. In response to an increased cellular AMP/ATP ratio, AMPK is activated by phosphorylation at Thr172 in the α-subunit by upstream AMPK kinases (AMPKKs), including tumor suppressor liver kinase B1 (LKB1). To elucidate more precise molecular mechanisms of AMPK activation, we performed yeast two-hybrid screening and isolated the complementary DNA (cDNA) encoding the nuclear protein Artemis/DNA cross-link repair 1C (DCLRE1C) as an AMPKα2-binding protein. Artemis was found to co-immunoprecipitate with AMPKα2, and the co-localization of Artemis with AMPKα2 in the nucleus was confirmed by immunofluorescence staining in U2OS cells. Moreover, over-expression of Artemis enhanced the phosphorylation of AMPKα2 and the AMPK substrate acetyl-CoA carboxylase (ACC). Conversely, RNAi-mediated knockdown of Artemis reduced AMPK and ACC phosphorylation. In addition, Artemis markedly increased the physical association between AMPKα2 and LKB1. Taken together, these results suggest that Artemis functions as a positive regulator of AMPK signaling by stabilizing the LKB1–AMPK complex.

  13. The nuclear protein Artemis promotes AMPK activation by stabilizing the LKB1-AMPK complex

    Energy Technology Data Exchange (ETDEWEB)

    Nakagawa, Koji, E-mail: k_nakagawa@pharm.hokudai.ac.jp [Department of Pathophysiology and Therapeutics, Division of Pharmascience, Faculty of Pharmaceutical Sciences, Hokkaido University, N12 W6, Kita-ku, Sapporo, Hokkaido 060-0812 (Japan); Uehata, Yasuko; Natsuizaka, Mitsuteru; Kohara, Toshihisa; Darmanin, Stephanie [Department of Gastroenterology and Hematology, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Asaka, Masahiro [Department of Gastroenterology and Hematology, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Department of Cancer Preventive Medicine, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Takeda, Hiroshi [Department of Pathophysiology and Therapeutics, Division of Pharmascience, Faculty of Pharmaceutical Sciences, Hokkaido University, N12 W6, Kita-ku, Sapporo, Hokkaido 060-0812 (Japan); Department of Gastroenterology and Hematology, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Kobayashi, Masanobu [Department of Cancer Preventive Medicine, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); School of Nursing and Social Services, Health Sciences University of Hokkaido, Ishikari-Toubetsu, Hokkaido 061-0293 (Japan)

    2012-11-02

    Highlights: Black-Right-Pointing-Pointer The nuclear protein Artemis physically interacts with AMPK{alpha}2. Black-Right-Pointing-Pointer Artemis co-localizes with AMPK{alpha}2 in the nucleus. Black-Right-Pointing-Pointer Artemis promotes phosphorylation and activation of AMPK. Black-Right-Pointing-Pointer The interaction between AMPK{alpha}2 and LKB1 is stabilized by Artemis. -- Abstract: AMP-activated protein kinase (AMPK) is a hetero-trimeric Ser/Thr kinase composed of a catalytic {alpha} subunit and regulatory {beta} and {gamma} subunits; it functions as an energy sensor that controls cellular energy homeostasis. In response to an increased cellular AMP/ATP ratio, AMPK is activated by phosphorylation at Thr172 in the {alpha}-subunit by upstream AMPK kinases (AMPKKs), including tumor suppressor liver kinase B1 (LKB1). To elucidate more precise molecular mechanisms of AMPK activation, we performed yeast two-hybrid screening and isolated the complementary DNA (cDNA) encoding the nuclear protein Artemis/DNA cross-link repair 1C (DCLRE1C) as an AMPK{alpha}2-binding protein. Artemis was found to co-immunoprecipitate with AMPK{alpha}2, and the co-localization of Artemis with AMPK{alpha}2 in the nucleus was confirmed by immunofluorescence staining in U2OS cells. Moreover, over-expression of Artemis enhanced the phosphorylation of AMPK{alpha}2 and the AMPK substrate acetyl-CoA carboxylase (ACC). Conversely, RNAi-mediated knockdown of Artemis reduced AMPK and ACC phosphorylation. In addition, Artemis markedly increased the physical association between AMPK{alpha}2 and LKB1. Taken together, these results suggest that Artemis functions as a positive regulator of AMPK signaling by stabilizing the LKB1-AMPK complex.

  14. Identification of a Cryptic Bacterial Promoter in Mouse (mdr1a P-Glycoprotein cDNA.

    Directory of Open Access Journals (Sweden)

    Kristen M Pluchino

    Full Text Available The efflux transporter P-glycoprotein (P-gp is an important mediator of various pharmacokinetic parameters, being expressed at numerous physiological barriers and also in multidrug-resistant cancer cells. Molecular cloning of homologous cDNAs is an important tool for the characterization of functional differences in P-gp between species. However, plasmids containing mouse mdr1a cDNA display significant genetic instability during cloning in bacteria, indicating that mdr1a cDNA may be somehow toxic to bacteria, allowing only clones containing mutations that abrogate this toxicity to survive transformation. We demonstrate here the presence of a cryptic promoter in mouse mdr1a cDNA that causes mouse P-gp expression in bacteria. This expression may account for the observed toxicity of mdr1a DNA to bacteria. Sigma 70 binding site analysis and GFP reporter plasmids were used to identify sequences in the first 321 bps of mdr1a cDNA capable of initiating bacterial protein expression. An mdr1a M107L cDNA containing a single residue mutation at the proposed translational start site was shown to allow sub-cloning of mdr1a in E. coli while retaining transport properties similar to wild-type P-gp. This mutant mdr1a cDNA may prove useful for efficient cloning of mdr1a in E. coli.

  15. Targeted DNA demethylation and activation of endogenous genes using programmable TALE-TET1 fusion proteins.

    Science.gov (United States)

    Maeder, Morgan L; Angstman, James F; Richardson, Marcy E; Linder, Samantha J; Cascio, Vincent M; Tsai, Shengdar Q; Ho, Quan H; Sander, Jeffry D; Reyon, Deepak; Bernstein, Bradley E; Costello, Joseph F; Wilkinson, Miles F; Joung, J Keith

    2013-12-01

    Genome-wide studies have defined cell type-specific patterns of DNA methylation that are important for regulating gene expression in both normal development and disease. However, determining the functional significance of specific methylation events remains challenging, owing to the lack of methods for removing such modifications in a targeted manner. Here we describe an approach for efficient targeted demethylation of specific CpGs in human cells using fusions of engineered transcription activator-like effector (TALE) repeat arrays and the TET1 hydroxylase catalytic domain. Using these TALE-TET1 fusions, we demonstrate that modification of critical methylated promoter CpG positions can lead to substantial increases in the expression of endogenous human genes. Our results delineate a strategy for understanding the functional significance of specific CpG methylation marks in the context of endogenous gene loci and validate programmable DNA demethylation reagents with potential utility for research and therapeutic applications.

  16. Z-DNA-forming sites identified by ChIP-Seq are associated with actively transcribed regions in the human genome

    Science.gov (United States)

    Shin, So-I.; Ham, Seokjin; Park, Jihwan; Seo, Seong Hye; Lim, Chae Hyun; Jeon, Hyeongrin; Huh, Jounghyun; Roh, Tae-Young

    2016-01-01

    Z-DNA, a left-handed double helical DNA is structurally different from the most abundant B-DNA. Z-DNA has been known to play a significant role in transcription and genome stability but the biological meaning and positions of Z-DNA-forming sites (ZFSs) in the human genome has not been fully explored. To obtain genome-wide map of ZFSs, Zaa with two Z-DNA-binding domains was used for ChIP-Seq analysis. A total of 391 ZFSs were found and their functions were examined in vivo. A large portion of ZFSs was enriched in the promoter regions and contain sequences with high potential to form Z-DNA. Genes containing ZFSs were occupied by RNA polymerase II at the promoters and showed high levels of expression. Moreover, ZFSs were significantly related to active histone marks such as H3K4me3 and H3K9ac. The association of Z-DNA with active transcription was confirmed by the reporter assay system. Overall, our results suggest that Z-DNA formation depends on chromatin structure as well as sequence composition, and is associated with active transcription in human cells. The global information about ZFSs positioning will provide a useful resource for further understanding of DNA structure-dependent transcriptional regulation. PMID:27374614

  17. Physical activity and health promotion in Italian university students

    Directory of Open Access Journals (Sweden)

    Adele Anna Teleman

    2015-06-01

    Full Text Available INTRODUCTION: Physical activity, diet plans, the mantainment of a certain Body Mass Index (BMI and the use of various types of supplementation are common elements in the search for disease prevention, health promotion and well-being. MATERIALS AND METHODS: We analyzed the data regarding Italian university students' BMI, dieting behaviour, personal body perception, exercise habits, and use of dietary supplements and of doping substances. RESULTS: 13.7% resulted being underweight, 75.1% was in the normal range, 9.8% was overweight, and 1.4% was obese. 11.0% were on a diet. 25.8% of the students reported never doing any type of physical activity. 0.9% admitted consuming doping substances. The percentage of overweight/obese students increases from 8.8% of the 18-21 year olds to 18.1% of the 25-30 year olds. Similarly, the prevalence of overweight/obesity was 18.5% among male population and 7.5% among the female one. DISCUSSION: The data deriving from this questionnaire showed that while the majority of university students has a BMI in the normal range, 11.2% of the study population is overweight/obese. Males present a higher risk of being overweight or obese. An important part of the population showed to be sedentary even though data coming from our study are aligned to further evidence. CONCLUSION: The most important concern arising from the questionnaire is represented by physical inactivity. Indeed, it is necessary to encourage and plan initiatives aimed at promoting physical activity in university students.

  18. Prognostic Significance of Promoter DNA Hypermethylation of cysteine dioxygenase 1 (CDO1 Gene in Primary Breast Cancer.

    Directory of Open Access Journals (Sweden)

    Naoko Minatani

    Full Text Available Using pharmacological unmasking microarray, we identified promoter DNA methylation of cysteine dioxygenase 1 (CDO1 gene in human cancer. In this study, we assessed the clinicopathological significance of CDO1 methylation in primary breast cancer (BC with no prior chemotherapy. The CDO1 DNA methylation was quantified by TaqMan methylation specific PCR (Q-MSP in 7 BC cell lines and 172 primary BC patients with no prior chemotherapy. Promoter DNA of the CDO1 gene was hypermethylated in 6 BC cell lines except SK-BR3, and CDO1 gene expression was all silenced at mRNA level in the 7 BC cell lines. Quantification of CDO1 methylation was developed using Q-MSP, and assessed in primary BC. Among the clinicopathologic factors, CDO1 methylation level was not statistically significantly associated with any prognostic factors. The log-rank plot analysis elucidated that the higher methylation the tumors harbored, the poorer prognosis the patients exhibited. Using the median value of 58.0 as a cut-off one, disease specific survival in BC patients with CDO1 hypermethylation showed significantly poorer prognosis than those with hypomethylation (p = 0.004. Multivariate Cox proportional hazards model identified that CDO1 hypermethylation was prognostic factor as well as Ki-67 and hormone receptor status. The most intriguingly, CDO1 hypermethylation was of robust prognostic relevance in triple negative BC (p = 0.007. Promoter DNA methylation of CDO1 gene was robust prognostic indicator in primary BC patients with no prior chemotherapy. Prognostic relevance of the CDO1 promoter DNA methylation is worthy of being paid attention in triple negative BC cancer.

  19. O6-Methylguanine-DNA Methyltransferase (MGMT) mRNA Expression Predicts Outcome in Malignant Glioma Independent of MGMT Promoter Methylation

    OpenAIRE

    Simone Kreth; Niklas Thon; Sabina Eigenbrod; Juergen Lutz; Carola Ledderose; Rupert Egensperger; Tonn, Joerg C.; Kretzschmar, Hans A.; Ludwig C Hinske; Kreth, Friedrich W.

    2011-01-01

    Background: We analyzed prospectively whether MGMT (O(6)-methylguanine-DNA methyltransferase) mRNA expression gains prognostic/predictive impact independent of MGMT promoter methylation in malignant glioma patients undergoing radiotherapy with concomitant and adjuvant temozolomide or temozolomide alone. As DNA-methyltransferases (DNMTs) are the enzymes responsible for setting up and maintaining DNA methylation patterns in eukaryotic cells, we analyzed further, whether MGMT promoter methylatio...

  20. Promoting moderate-vigorous physical activity in overweight minority girls.

    Science.gov (United States)

    Olvera, Norma; Graham, Marilynn; McLeod, Jessica; Kellam, Stephanie F; Butte, Nancy F

    2010-01-01

    There is limited research on the types of activities that are most effective for promoting MVPA in children. Purpose. To assess which types of activities elicit MVPA in overweight minority girls. Methods. Sample consisted of 31 overweight (BMI >/= 85th percentile) Latina and African-American girls (mean age 10.3 +/- 1.2 years). Participants wore an Actical accelerometer each day for 8 hours for 15 days to assess engagement in MVPA during their participation in a three-week activity intervention that included traditional fitness, sport skills, games, dancing, and flexibility sessions. Results. On average 62% of participants met the MVPA recommended guidelines (60 min/5d/wk) with an average of 68.5 +/- 14 minutes of MVPA across the three weeks. Traditional fitness sessions elicited the highest percent of MVPA (mean time spent in MVPA = 32%), followed by dancing and games (mean time spent in MVPA = 21%), sports skills (mean time spent in MVPA = 18%), and flexibility (mean time spent in MVPA = 7%). Step aerobics and rumba fitness elicited the highest proportions of MVPA. Conclusion. Traditional fitness activities were identified as the most successful in eliciting MVPA in overweight Latina and African American girls.

  1. Promoting Moderate-Vigorous Physical Activity in Overweight Minority Girls

    Directory of Open Access Journals (Sweden)

    Norma Olvera

    2010-01-01

    Full Text Available There is limited research on the types of activities that are most effective for promoting MVPA in children. Purpose. To assess which types of activities elicit MVPA in overweight minority girls. Methods. Sample consisted of 31 overweight (BMI≥85th percentile Latina and African-American girls (mean age 10.3±1.2 years. Participants wore an Actical accelerometer each day for 8 hours for 15 days to assess engagement in MVPA during their participation in a three-week activity intervention that included traditional fitness, sport skills, games, dancing, and flexibility sessions. Results. On average 62% of participants met the MVPA recommended guidelines (60 min/5d/wk with an average of 68.5±14 minutes of MVPA across the three weeks. Traditional fitness sessions elicited the highest percent of MVPA (mean time spent in MVPA=32%, followed by dancing and games (mean time spent in MVPA=21%, sports skills (mean time spent in MVPA=18%, and flexibility (mean time spent in MVPA=7%. Step aerobics and rumba fitness elicited the highest proportions of MVPA. Conclusion. Traditional fitness activities were identified as the most successful in eliciting MVPA in overweight Latina and African American girls.

  2. Synthesis, characterization, DNA binding, DNA cleavage, protein binding and cytotoxic activities of Ru(II) complexes.

    Science.gov (United States)

    Thota, Sreekanth; Vallala, Srujana; Yerra, Rajeshwar; Rodrigues, Daniel Alencar; Raghavendra, Nulgumnalli Manjunathaiah; Barreiro, Eliezer J

    2016-01-01

    We report on the synthesis of novel Ru(II) compounds (Ru-1 to Ru-8) bearing R-pdc, 4-Cl-pbinh ligands (where R=4-CF3, 4-F, 4-OH pdc=3-phenyl-5-(1H-pyrrol-2-yl)-4,5-dihydro-1H-pyrazole-1-carbothioamide, pbinh=phenoxybenzylidene isonicotinyl hydrazides) and their in vitro antitumor activity toward the cell lines murine leukemia L1210, human lymphocyte CEM, human epithelial cervical carcinoma HeLa, BEL-7402 and Molt4/C8. Some of the complexes exhibited more potent antiproliferative activity against cell lines than the standard drug cisplatin. Ruthenium complex Ru-2 displayed potent cytotoxicity with than that of cisplatin. DNA-binding, DNA cleavage and protein binding properties of ruthenium complexes with these ligands are reported. Interactions of these ruthenium complexes with DNA revealed an intercalative mode of binding between them. Synchronous fluorescence spectra proved that the interaction of ruthenium complexes with bovine serum albumin (BSA) resulted in a conformational change of the latter.

  3. Powdered Activated Carbon: An Alternative Approach to Genomic DNA Purification.

    Science.gov (United States)

    Barbarić, Lucija; Bačić, Ivana; Grubić, Zorana

    2015-07-01

    Forensic evidence samples are routinely found as stains on various substrates, which may contain substances known to inhibit polymerase chain reaction (PCR). The goal of this study was to evaluate post-Chelex(®) 100 purification using powdered activated carbon (PAC). Mock crime scene DNA extracts were analyzed using quantitative PCR and short tandem repeat (STR) profiling to test the DNA recovery and inhibitor removal using PAC with those of the Amicon(®) Ultra 100K. For extracted bloodstains on soil and wood substrates, PAC and Amicon(®) Ultra 100K generated similar DNA yield and quality. Moreover, the two methods significantly decreased the concentration of humic substances and tannins compared to nonpurified extracts (p < 0.001). In instances where extracts contained indigo dye (bloodstains on denim), Amicon(®) Ultra 100K performed better than PAC due to improved amplifiability. Efficient adsorption of humic substances and tannins, which are common inhibitors, indicates PAC's potential application in the purification of high-template DNA extracts. PMID:25929735

  4. IL-21 promotes the production of anti-DNA IgG but is dispensable for kidney damage in lyn-/- mice.

    Science.gov (United States)

    Gutierrez, Toni; Mayeux, Jessica M; Ortega, Sterling B; Karandikar, Nitin J; Li, Quan-Zhen; Rakheja, Dinesh; Zhou, Xin J; Satterthwaite, Anne B

    2013-02-01

    The autoimmune disease systemic lupus erythematosus is characterized by loss of tolerance to nuclear Ags and a heightened inflammatory environment, which together result in end organ damage. Lyn-deficient mice, a model of systemic lupus erythematosus, lack an inhibitor of B-cell and myeloid cell activation. This results in B-cell hyper-responsiveness, plasma cell accumulation, autoantibodies, and glomerulonephritis (GN). IL-21 is associated with autoimmunity in mice and humans and promotes B-cell differentiation and class switching. Here, we explore the role of IL-21 in the autoimmune phenotypes of lyn(-/-) mice. We find that IL-21 mRNA is reduced in the spleens of lyn(-/-) IL-6(-/-) and lyn(-/-) Btk(lo) mice, neither of which produce pathogenic autoantibodies or develop significant GN. While IL-21 is dispensable for plasma cell accumulation and IgM autoantibodies in lyn(-/-) mice, it is required for anti-DNA IgG antibodies and some aspects of T-cell activation. Surprisingly, GN still develops in lyn(-/-) IL-21(-/-) mice. This likely results from the presence of IgG autoantibodies against a limited set of non-DNA Ags. These studies identify a specific role for IL-21 in the class switching of anti-DNA B cells and demonstrate that neither IL-21 nor anti-DNA IgG is required for kidney damage in lyn(-/-) mice.

  5. Cdt2-mediated XPG degradation promotes gap-filling DNA synthesis in nucleotide excision repair

    OpenAIRE

    Han, Chunhua; Wani, Gulzar; Zhao, Ran; Qian, Jiang; Sharma, Nidhi; He, Jinshan; Zhu, Qianzheng; Wang, Qi-En; Wani, Altaf A.

    2014-01-01

    Xeroderma pigmentosum group G (XPG) protein is a structure-specific repair endonuclease, which cleaves DNA strands on the 3′ side of the DNA damage during nucleotide excision repair (NER). XPG also plays a crucial role in initiating DNA repair synthesis through recruitment of PCNA to the repair sites. However, the fate of XPG protein subsequent to the excision of DNA damage has remained unresolved. Here, we show that XPG, following its action on bulky lesions resulting from exposures to UV ir...

  6. Unbiased identification of signal-activated transcription factors by barcoded synthetic tandem repeat promoter screening (BC-STAR-PROM).

    Science.gov (United States)

    Gosselin, Pauline; Rando, Gianpaolo; Fleury-Olela, Fabienne; Schibler, Ueli

    2016-08-15

    The discovery of transcription factors (TFs) controlling pathways in health and disease is of paramount interest. We designed a widely applicable method, dubbed barcorded synthetic tandem repeat promoter screening (BC-STAR-PROM), to identify signal-activated TFs without any a priori knowledge about their properties. The BC-STAR-PROM library consists of ∼3000 luciferase expression vectors, each harboring a promoter (composed of six tandem repeats of synthetic random DNA) and an associated barcode of 20 base pairs (bp) within the 3' untranslated mRNA region. Together, the promoter sequences encompass >400,000 bp of random DNA, a sequence complexity sufficient to capture most TFs. Cells transfected with the library are exposed to a signal, and the mRNAs that it encodes are counted by next-generation sequencing of the barcodes. This allows the simultaneous activity tracking of each of the ∼3000 synthetic promoters in a single experiment. Here we establish proof of concept for BC-STAR-PROM by applying it to the identification of TFs induced by drugs affecting actin and tubulin cytoskeleton dynamics. BC-STAR-PROM revealed that serum response factor (SRF) is the only immediate early TF induced by both actin polymerization and microtubule depolymerization. Such changes in cytoskeleton dynamics are known to occur during the cell division cycle, and real-time bioluminescence microscopy indeed revealed cell-autonomous SRF-myocardin-related TF (MRTF) activity bouts in proliferating cells.

  7. Unbiased identification of signal-activated transcription factors by barcoded synthetic tandem repeat promoter screening (BC-STAR-PROM).

    Science.gov (United States)

    Gosselin, Pauline; Rando, Gianpaolo; Fleury-Olela, Fabienne; Schibler, Ueli

    2016-08-15

    The discovery of transcription factors (TFs) controlling pathways in health and disease is of paramount interest. We designed a widely applicable method, dubbed barcorded synthetic tandem repeat promoter screening (BC-STAR-PROM), to identify signal-activated TFs without any a priori knowledge about their properties. The BC-STAR-PROM library consists of ∼3000 luciferase expression vectors, each harboring a promoter (composed of six tandem repeats of synthetic random DNA) and an associated barcode of 20 base pairs (bp) within the 3' untranslated mRNA region. Together, the promoter sequences encompass >400,000 bp of random DNA, a sequence complexity sufficient to capture most TFs. Cells transfected with the library are exposed to a signal, and the mRNAs that it encodes are counted by next-generation sequencing of the barcodes. This allows the simultaneous activity tracking of each of the ∼3000 synthetic promoters in a single experiment. Here we establish proof of concept for BC-STAR-PROM by applying it to the identification of TFs induced by drugs affecting actin and tubulin cytoskeleton dynamics. BC-STAR-PROM revealed that serum response factor (SRF) is the only immediate early TF induced by both actin polymerization and microtubule depolymerization. Such changes in cytoskeleton dynamics are known to occur during the cell division cycle, and real-time bioluminescence microscopy indeed revealed cell-autonomous SRF-myocardin-related TF (MRTF) activity bouts in proliferating cells. PMID:27601530

  8. Promoter-distal RNA polymerase II binding discriminates active from inactive CCAAT/ enhancer-binding protein beta binding sites

    Science.gov (United States)

    Savic, Daniel; Roberts, Brian S.; Carleton, Julia B.; Partridge, E. Christopher; White, Michael A.; Cohen, Barak A.; Cooper, Gregory M.; Gertz, Jason; Myers, Richard M.

    2015-01-01

    Transcription factors (TFs) bind to thousands of DNA sequences in mammalian genomes, but most of these binding events appear to have no direct effect on gene expression. It is unclear why only a subset of TF bound sites are actively involved in transcriptional regulation. Moreover, the key genomic features that accurately discriminate between active and inactive TF binding events remain ambiguous. Recent studies have identified promoter-distal RNA polymerase II (RNAP2) binding at enhancer elements, suggesting that these interactions may serve as a marker for active regulatory sequences. Despite these correlative analyses, a thorough functional validation of these genomic co-occupancies is still lacking. To characterize the gene regulatory activity of DNA sequences underlying promoter-distal TF binding events that co-occur with RNAP2 and TF sites devoid of RNAP2 occupancy using a functional reporter assay, we performed cis-regulatory element sequencing (CRE-seq). We tested more than 1000 promoter-distal CCAAT/enhancer-binding protein beta (CEBPB)-bound sites in HepG2 and K562 cells, and found that CEBPB-bound sites co-occurring with RNAP2 were more likely to exhibit enhancer activity. CEBPB-bound sites further maintained substantial cell-type specificity, indicating that local DNA sequence can accurately convey cell-type–specific regulatory information. By comparing our CRE-seq results to a comprehensive set of genome annotations, we identified a variety of genomic features that are strong predictors of regulatory element activity and cell-type–specific activity. Collectively, our functional assay results indicate that RNAP2 occupancy can be used as a key genomic marker that can distinguish active from inactive TF bound sites. PMID:26486725

  9. Chk2 Activation Dependence on Nbs1 after DNA Damage

    OpenAIRE

    Buscemi, Giacomo; Savio, Camilla; Zannini, Laura; Miccichè, Francesca; Masnada, Debora; Nakanishi, Makoto; Tauchi, Hiroshi; Komatsu, Kenshi; Mizutani, Shuki; Khanna, KumKum; Chen, Phil; Concannon, Patrick; Chessa, Luciana; Delia, Domenico

    2001-01-01

    The checkpoint kinase Chk2 has a key role in delaying cell cycle progression in response to DNA damage. Upon activation by low-dose ionizing radiation (IR), which occurs in an ataxia telangiectasia mutated (ATM)-dependent manner, Chk2 can phosphorylate the mitosis-inducing phosphatase Cdc25C on an inhibitory site, blocking entry into mitosis, and p53 on a regulatory site, causing G1 arrest. Here we show that the ATM-dependent activation of Chk2 by γ- radiation requires Nbs1, the gene product ...

  10. Gene cloning, structural gene and promoter identification, and active assay of the phosphatidylcholine synthase of Pseudomonas sp. strain 593.

    Science.gov (United States)

    He, Huoguang; Wu, Bin; Xiong, Min; Li, Yang; Wu, Wenhua; Wang, Xingguo

    2011-10-01

    Pseudomonas sp. strain 593, a soil bacterium, is able to use exogenous choline to synthesize phosphatidylcholine via phosphatidylcholine synthase (Pcs). A 2020 bp DNA fragment that hybridized to a Pcs probe was cloned. This fragment contained a large open reading frame (ORF) with two potential ATG start sites that would encode for 293 and 231 amino acid proteins. Fragments containing the two ORFs encoded Pcs when they were inserted into the expression vector pET23a and expressed under the control of the T7 promoter in Escherichia coli BL21(DE3) pLysS. However, when the two ORFs were inserted into the cloning vector pMD18-T and expressed without control of the plasmid promoter in E. coli DH5α, only the larger clone exhibited Pcs activity. This suggested that the larger fragment contained a native promoter driving expression of the smaller ORF. A promoter activity assay, in which DNA fragments were inserted into the promoter-probe plasmid pCB182 and β-galactosidase activity of E. coli transformants was tested, demonstrated that a promoter is indeed present in the DNA region. All results together indicate that the 696 bp ORF, not the larger 897 bp ORF, encodes the Pcs in Pseudomonas sp. strain 593 and carries a promoter in front of its 5' terminus. PMID:21939372

  11. MBD3 localizes at promoters, gene bodies and enhancers of active genes.

    Science.gov (United States)

    Shimbo, Takashi; Du, Ying; Grimm, Sara A; Dhasarathy, Archana; Mav, Deepak; Shah, Ruchir R; Shi, Huidong; Wade, Paul A

    2013-01-01

    The Mi-2/nucleosome remodeling and histone deacetylase (NuRD) complex is a multiprotein machine proposed to regulate chromatin structure by nucleosome remodeling and histone deacetylation activities. Recent reports describing localization of NuRD provide new insights that question previous models on NuRD action, but are not in complete agreement. Here, we provide location analysis of endogenous MBD3, a component of NuRD complex, in two human breast cancer cell lines (MCF-7 and MDA-MB-231) using two independent genomic techniques: DNA adenine methyltransferase identification (DamID) and ChIP-seq. We observed concordance of the resulting genomic localization, suggesting that these studies are converging on a robust map for NuRD in the cancer cell genome. MBD3 preferentially associated with CpG rich promoters marked by H3K4me3 and showed cell-type specific localization across gene bodies, peaking around the transcription start site. A subset of sites bound by MBD3 was enriched in H3K27ac and was in physical proximity to promoters in three-dimensional space, suggesting function as enhancers. MBD3 enrichment was also noted at promoters modified by H3K27me3. Functional analysis of chromatin indicated that MBD3 regulates nucleosome occupancy near promoters and in gene bodies. These data suggest that MBD3, and by extension the NuRD complex, may have multiple roles in fine tuning expression for both active and silent genes, representing an important step in defining regulatory mechanisms by which NuRD complex controls chromatin structure and modification status.

  12. Promoting direct interspecies electron transfer with activated carbon

    DEFF Research Database (Denmark)

    Liu, Fanghua; Rotaru, Amelia-Elena; Shrestha, Pravin M.;

    2012-01-01

    Granular activated carbon (GAC) is added to methanogenic digesters to enhance conversion of wastes to methane, but the mechanism(s) for GAC’s stimulatory effect are poorly understood. GAC has high electrical conductivity and thus it was hypothesized that one mechanism for GAC stimulation...... were attached to GAC, but did not aggregate as they do when making biological electrical connections between cells. Studies with a series of gene deletion mutants eliminated the possibility that GAC promoted electron exchange via interspecies hydrogen or formate transfer and demonstrated that DIET...... of methanogenesis might be to facilitate direct interspecies electron transfer (DIET) between bacteria and methanogens. Metabolism was substantially accelerated when GAC was added to co-cultures of Geobacter metallireducens and Geobacter sulfurreducens grown under conditions previously shown to require DIET. Cells...

  13. Activating STAT3 Alpha for Promoting Healing of Neurons

    Science.gov (United States)

    Conway, Greg

    2008-01-01

    A method of promoting healing of injured or diseased neurons involves pharmacological activation of the STAT3 alpha protein. Usually, injured or diseased neurons heal incompletely or not at all for two reasons: (1) they are susceptible to apoptosis (cell death); and (2) they fail to engage in axogenesis that is, they fail to re-extend their axons to their original targets (e.g., muscles or other neurons) because of insufficiency of compounds, denoted neurotrophic factors, needed to stimulate such extension. The present method (see figure) of treatment takes advantage of prior research findings to the effect that the STAT3 alpha protein has anti-apoptotic and pro-axogenic properties.

  14. 5-azacytidine promotes microspore embryogenesis initiation by decreasing global DNA methylation, but prevents subsequent embryo development in rapeseed and barley

    Science.gov (United States)

    Solís, María-Teresa; El-Tantawy, Ahmed-Abdalla; Cano, Vanesa; Risueño, María C.; Testillano, Pilar S.

    2015-01-01

    Microspores are reprogrammed by stress in vitro toward embryogenesis. This process is an important tool in breeding to obtain double-haploid plants. DNA methylation is a major epigenetic modification that changes in differentiation and proliferation. We have shown changes in global DNA methylation during microspore reprogramming. 5-Azacytidine (AzaC) cannot be methylated and leads to DNA hypomethylation. AzaC is a useful demethylating agent to study DNA dynamics, with a potential application in microspore embryogenesis. This work analyzes the effects of short and long AzaC treatments on microspore embryogenesis initiation and progression in two species, the dicot Brassica napus and the monocot Hordeum vulgare. This involved the quantitative analyses of proembryo and embryo production, the quantification of DNA methylation, 5-methyl-deoxy-cytidine (5mdC) immunofluorescence and confocal microscopy, and the analysis of chromatin organization (condensation/decondensation) by light and electron microscopy. Four days of AzaC treatments (2.5 μM) increased embryo induction, response associated with a decrease of DNA methylation, modified 5mdC, and heterochromatin patterns compared to untreated embryos. By contrast, longer AzaC treatments diminished embryo production. Similar effects were found in both species, indicating that DNA demethylation promotes microspore reprogramming, totipotency acquisition, and embryogenesis initiation, while embryo differentiation requires de novo DNA methylation and is prevented by AzaC. This suggests a role for DNA methylation in the repression of microspore reprogramming and possibly totipotency acquisition. Results provide new insights into the role of epigenetic modifications in microspore embryogenesis and suggest a potential benefit of inhibitors, such as AzaC, to improve the process efficiency in biotechnology and breeding programs. PMID:26161085

  15. 5-azacytidine promotes microspore embryogenesis initiation by decreasing global DNA methylation, but prevents subsequent embryo development in rapeseed and barley.

    Science.gov (United States)

    Solís, María-Teresa; El-Tantawy, Ahmed-Abdalla; Cano, Vanesa; Risueño, María C; Testillano, Pilar S

    2015-01-01

    Microspores are reprogrammed by stress in vitro toward embryogenesis. This process is an important tool in breeding to obtain double-haploid plants. DNA methylation is a major epigenetic modification that changes in differentiation and proliferation. We have shown changes in global DNA methylation during microspore reprogramming. 5-Azacytidine (AzaC) cannot be methylated and leads to DNA hypomethylation. AzaC is a useful demethylating agent to study DNA dynamics, with a potential application in microspore embryogenesis. This work analyzes the effects of short and long AzaC treatments on microspore embryogenesis initiation and progression in two species, the dicot Brassica napus and the monocot Hordeum vulgare. This involved the quantitative analyses of proembryo and embryo production, the quantification of DNA methylation, 5-methyl-deoxy-cytidine (5mdC) immunofluorescence and confocal microscopy, and the analysis of chromatin organization (condensation/decondensation) by light and electron microscopy. Four days of AzaC treatments (2.5 μM) increased embryo induction, response associated with a decrease of DNA methylation, modified 5mdC, and heterochromatin patterns compared to untreated embryos. By contrast, longer AzaC treatments diminished embryo production. Similar effects were found in both species, indicating that DNA demethylation promotes microspore reprogramming, totipotency acquisition, and embryogenesis initiation, while embryo differentiation requires de novo DNA methylation and is prevented by AzaC. This suggests a role for DNA methylation in the repression of microspore reprogramming and possibly totipotency acquisition. Results provide new insights into the role of epigenetic modifications in microspore embryogenesis and suggest a potential benefit of inhibitors, such as AzaC, to improve the process efficiency in biotechnology and breeding programs. PMID:26161085

  16. 5-azacytidine promotes microspore embryogenesis initiation by decreasing global DNA methylation, but prevents subsequent embryo development in rapeseed and barley

    Directory of Open Access Journals (Sweden)

    María-Teresa eSolís

    2015-06-01

    Full Text Available Microspores are reprogrammed by stress in vitro towards embryogenesis. This process is an important tool in breeding to obtain double-haploid plants. DNA methylation is a major epigenetic modification that changes in differentiation and proliferation. We have shown changes in global DNA methylation during microspore reprogramming. 5-Azacytidine (AzaC cannot be methylated and leads to DNA hypomethylation. AzaC is a useful demethylating agent to study DNA dynamics, with a potential application in microspore embryogenesis. This work analyzes the effects of short and long AzaC treatments on microspore embryogenesis initiation and progression in two species, the dicot Brassica napus and the monocot Hordeum vulgare. This involved the quantitative analyses of proembryo and embryo production, the quantification of DNA methylation, 5mdC immunofluorescence and confocal microscopy, and the analysis of chromatin organization (condensation/ decondensation by light and electron microscopy. Four days of AzaC treatments (2.5 µM increased embryo induction, response associated with a decrease of DNA methylation, modified 5mdC and heterochromatin patterns compared to untreated embryos. By contrast, longer AzaC treatments diminished embryo production. Similar effects were found in both species, indicating that DNA demethylation promotes microspore reprogramming, totipotency acquisition and embryogenesis initiation, while embryo differentiation requires de novo DNA methylation and is prevented by AzaC. This suggests a role for DNA methylation in the repression of microspore reprogramming and possibly totipotency acquisition.Results provide new insights into the role of epigenetic modifications in microspore embryogenesis and suggest a potential benefit of inhibitors, such as AzaC, to improve the process efficiency in biotechnology and breeding programs.

  17. Detailed analysis of the promoter activity of an attenuated lentivirus.

    Science.gov (United States)

    Blatti-Cardinaux, Laure; Sanjosé, Leticia; Zahno, Marie-Luise; Zanoni, Reto; Reina, Ramses; Bertoni, Giuseppe

    2016-07-01

    In spite of an eradication campaign that eliminated clinical cases of caprine arthritis encephalitis virus-induced arthritis in the Swiss goat population, seroconversions are still observed. In the affected flocks, viruses belonging mainly to the small ruminant lentivirus A4 subtype are regularly isolated. These viruses are considered attenuated, except in the mammary gland, where high viral loads and histopathological lesions have been observed. We previously characterized and sequenced such field isolates, detecting several potentially attenuating mutations in their LTR. Here we present a detailed analysis of the promoter activity of these genetic elements, which was comparable to those of virulent isolates. An AP-1 binding site was shown to be crucial for promoter activity in reporter gene assays and also in the context of a replicating molecular clone. Other sites, such as AML(vis) and a conserved E-box, appeared to be less crucial. Analysis of a unique AP-4 site showed a clear discrepancy between results obtained with reporter gene assays and those with mutated viruses. Within the limits of this in vitro study, we did not find evidence pointing to the LTR as the genetic correlate of attenuation for these viruses. Finally, the limited replication of SRLV A4 in mammary cell culture could not explain the suggested mammary tropism. In contrast, and in view of the abundance of macrophages in the mammary gland, it is the striking replication capacity of SRLV A4 in these cells, unaffected by all LTR mutations tested, which may explain the apparent mammary tropism of these viruses. PMID:27114068

  18. Ratite oils promote keratinocyte cell growth and inhibit leukocyte activation

    Science.gov (United States)

    Bennett, Darin C.; Leung, Gigi; Wang, Eddy; Ma, Sam; Lo, Blanche K. K.; McElwee, Kevin J.; Cheng, Kimberly M.

    2015-01-01

    Traditionally, native Australian aborigines have used emu oil for the treatment of inflammation and to accelerate wound healing. Studies on mice suggest that topically applied emu oil may have anti-inflammatory properties and may promote wound healing. We investigated the effects of ratite oils (6 emu, 3 ostrich, 1 rhea) on immortalized human keratinocytes (HaCaT cells) in vitro by culturing the cells in media with oil concentrations of 0%, 0.5%, and 1.0%. Peking duck, tea tree, and olive oils were used as comparative controls. The same oils at 0.5% concentration were evaluated for their influence on peripheral blood mononuclear cell (PBMC) survival over 48 hr and their ability to inhibit IFNγ production in PBMCs activated by phytohemagglutinin (PHA) in ELISpot assays. Compared to no oil control, significantly shorter population doubling time durations were observed for HaCaT cells cultured in emu oil (1.51 × faster), ostrich oil (1.46 × faster), and rhea oil (1.64 × faster). Tea tree oil demonstrated significant antiproliferative activity and olive oil significantly prolonged (1.35 × slower) cell population doubling time. In contrast, almost all oils, particularly tea tree oil, significantly reduced PBMC viability. Different oils had different levels of inhibitory effect on IFNγ production with individual emu, ostrich, rhea, and duck oil samples conferring full inhibition. This preliminary investigation suggests that emu oil might promote wound healing by accelerating the growth rate of keratinocytes. Combined with anti-inflammatory properties, ratite oil may serve as a useful component in bandages and ointments for the treatment of wounds and inflammatory skin conditions. PMID:26217022

  19. Status of O 6 -methylguanine-DNA methyltransferase [MGMT] gene promoter methylation among patients with glioblastomas from India

    Directory of Open Access Journals (Sweden)

    Gopal Arun Nehru

    2012-01-01

    Full Text Available Background: O 6 -methylguanine DNA methyltransferase [MGMT] gene promoter methylation has emerged as a promising marker in determining resistance to temozolomide, used in the treatment of patients with glioblastomas. Aim: To determine the frequency of MGMT promoter methylation among patients with glioblastomas using methylation-specific polymerase chain reaction (MSP and compare it to the results obtained by bisulfite sequencing of a subset of samples. Materials and Methods: DNA obtained from the frozen tissue of 27 samples of glioblastomas and three other gliomas, were analyzed for MGMT promoter methylation using a nested MSP assay. Sixteen samples were also subjected to bisulfite sequencing to determine the methylation status of 27 CpG sites within the sequenced region of the MGMT promoter. Data with respect to radiation, chemotherapy and survival outcome was also collected. Results: MGMT promoter methylation was seen in 67% of the cases included in the study using frozen tissues by MSP analysis, while 62% were methylated among glioblastomas alone. There was a 100% concordance between the results obtained by MSP analysis and bisulfite sequencing. Clinical outcome was known among 67% of cases and methylation was higher among those patients who had no recurrence, though it was not statistically significant [P=0.44]. Conclusion: The frequency of methylation seen in this study concurs with that reported earlier from the country. MSP was easy to perform and interpret. However, the utility of this testing system in a routine diagnostic setting is still being debated.

  20. Promoting Uranium Immobilization by the Activities of Microbial Phosphatases

    International Nuclear Information System (INIS)

    The overall objective of this project is to examine the activity of nonspecific phosphohydrolases present in naturally occurring subsurface microorganisms for the purpose of promoting the immobilization of radionuclides through the production of uranium U(VI) phosphate precipitates. Specifically, we hypothesize that the precipitation of U(VI) phosphate minerals may be promoted through the microbial release and/or accumulation of PO43- as a means to detoxify radionuclides and heavy metals. An experimental approach was designed to determine the extent of phosphatase activity in bacteria previously isolated from contaminated subsurface soils collected at the ERSP Field Research Center (FRC) in Oak Ridge, TN. Screening of 135 metal resistant isolates for phosphatase activity indicated the majority (75 of 135) exhibited a phosphatase-positive phenotype. During this phase of the project, a PCR based approach has also been designed to assay FRC isolates for the presence of one or more classes of the characterized non-specific acid phophastase (NSAP) genes likely to be involved in promoting U(VI) precipitation. Testing of a subset of Pb resistant (Pbr) Arthrobacter, Bacillus and Rahnella strains indicated 4 of the 9 Pbr isolates exhibited phosphatase phenotypes suggestive of the ability to bioprecipitate U(VI). Two FRC strains, a Rahnella sp. strain Y9602 and a Bacillus sp. strain Y9-2, were further characterized. The Rahnella sp. exhibited enhanced phosphatase activity relative to the Bacillus sp. Whole-cell enzyme assays identified a pH optimum of 5.5, and inorganic phosphate accumulated in pH 5.5 synthetic groundwater (designed to mimic FRC conditions) incubations of both strains in the presence of a model organophosphorus substrate provided as the sole C and P source. Kinetic experiments showed that these two organisms can grow in the presence of 200 (micro)M dissolved uranium and that Rahnella is much more efficient in precipitating U(VI) than Bacillus sp. The

  1. Promoting Uranium Immobilization by the Activities of Microbial Phosphatases

    Energy Technology Data Exchange (ETDEWEB)

    Robert J. Martinez; Melanie J. Beazley; Samuel M. Webb; Martial Taillefert (co-PI); and Patricia A. Sobecky

    2007-04-19

    The overall objective of this project is to examine the activity of nonspecific phosphohydrolases present in naturally occurring subsurface microorganisms for the purpose of promoting the immobilization of radionuclides through the production of uranium [U(VI)] phosphate precipitates. Specifically, we hypothesize that the precipitation of U(VI) phosphate minerals may be promoted through the microbial release and/or accumulation of PO4 3- as a means to detoxify radionuclides and heavy metals. An experimental approach was designed to determine the extent of phosphatase activity in bacteria previously isolated from contaminated subsurface soils collected at the ERSP Field Research Center (FRC) in Oak Ridge, TN. Screening of 135 metal resistant isolates for phosphatase activity indicated the majority (75 of 135) exhibited a phosphatase-positive phenotype. During this phase of the project, a PCR based approach has also been designed to assay FRC isolates for the presence of one or more classes of the characterized non-specific acid phophastase (NSAP) genes likely to be involved in promoting U(VI) precipitation. Testing of a subset of Pb resistant (Pbr) Arthrobacter, Bacillus and Rahnella strains indicated 4 of the 9 Pbr isolates exhibited phosphatase phenotypes suggestive of the ability to bioprecipitate U(VI). Two FRC strains, a Rahnella sp. strain Y9602 and a Bacillus sp. strain Y9-2, were further characterized. The Rahnella sp. exhibited enhanced phosphatase activity relative to the Bacillus sp. Whole-cell enzyme assays identified a pH optimum of 5.5, and inorganic phosphate accumulated in pH 5.5 synthetic groundwater (designed to mimic FRC conditions) incubations of both strains in the presence of a model organophosphorus substrate provided as the sole C and P source. Kinetic experiments showed that these two organisms can grow in the presence of 200 μM dissolved uranium and that Rahnella is much more efficient in precipitating U(VI) than Bacillus sp. The

  2. O 6 -methylguanine DNA methyltransferase gene promoter methylation in high-grade gliomas: A review of current status

    Directory of Open Access Journals (Sweden)

    Vaishali Suri

    2011-01-01

    Full Text Available Assessment of promoter methylation of the O 6 -methylguanine DNA methyltransferase (MGMT gene has recently gained importance in molecular profiling of high-grade gliomas. It has emerged not only as an important prognostic marker but also as a predictive marker for response to temozolomide in patients with newly diagnosed glioblastoma. Further, recent studies indicate that MGMT promoter methylation has strong prognostic relevance even in anaplastic (grade III gliomas, irrespective of therapy (chemotherapy or radiotherapy. This article provides an overview of its use as a predictive and prognostic biomarker, as well as the methods employed for its assessment and use in therapeutic decision making.

  3. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  4. DNA Methyltransferase 3B Gene Promoter and Interleukin-1 Receptor Antagonist Polymorphisms in Childhood Immune Thrombocytopenia

    Directory of Open Access Journals (Sweden)

    Margarita Pesmatzoglou

    2012-01-01

    Full Text Available Primary immune thrombocytopenia (ITP is one of the most common blood diseases as well as the commonest acquired bleeding disorder in childhood. Although the etiology of ITP is unclear, in the pathogenesis of the disease, both environmental and genetic factors including polymorphisms of TNF-a, IL-10, and IL-4 genes have been suggested to be involved. In this study, we investigated the rs2424913 single-nucleotide polymorphism (SNP (C46359T in DNA methyltransferase 3B (DNMT3B gene promoter and the VNTR polymorphism of IL-1 receptor antagonist (IL-1 Ra intron-2 in 32 children (17 boys with the diagnosis of ITP and 64 healthy individuals. No significant differences were found in the genotype distribution of DNMT3B polymorphism between the children with ITP and the control group, whereas the frequency of allele T appeared significantly increased in children with ITP (P = 0.03, OR = 2, 95% CI: 1.06–3.94. In case of IL-1 Ra polymorphism, children with ITP had a significantly higher frequency of genotype I/II, compared to control group (P = 0.043, OR = 2.60, 95% CI: 1.02–6.50. Moreover, genotype I/I as well as allele I was overrepresented in the control group, suggesting that allele I may have a decreased risk for development of ITP. Our findings suggest that rs2424913 DNMT3B SNP as well as IL-1 Ra VNTR polymorphism may contribute to the susceptibility to ITP.

  5. Phylogenomics of caspase-activated DNA fragmentation factor

    International Nuclear Information System (INIS)

    The degradation of nuclear DNA by DNA fragmentation factor (DFF) is a key step in apoptosis of mammalian cells. Using comparative genomics, we have here determined the evolutionary history of the genes encoding the two DFF subunits, DFFA (also known as ICAD) and DFFB (CAD). Orthologs of DFFA and DFFB were identified in Nematostella vectensis, a representative of the primitive metazoan clade cnidarians, and in various vertebrates and insects, but not in representatives of urochordates, echinoderms, and nematodes. The domains mediating the interaction of DFFA and DFFB, a caspase cleavage site in DFFA, and the amino acid residues critical for endonuclease activity of DFFB were conserved in Nematostella. These findings suggest that DFF has been a part of the primordial apoptosis system of the eumetazoan common ancestor and that the ancient cell death machinery has degenerated in several evolutionary lineages, including the one leading to the prototypical apoptosis model, Caenorhabditis elegans

  6. Metabolites and DNA adduct formation from flavoenzyme-activated porfiromycin.

    Science.gov (United States)

    Pan, S S; Iracki, T

    1988-08-01

    Porfiromycin was reductively metabolized by NADPH cytochrome P-450 reductase and xanthine oxidase under anaerobic conditions. The production of metabolites varied with the pH and the contents of the reaction buffer. In Tris buffer, two major metabolites were produced at pH 7.5 and above, whereas one major metabolite was produced at pH 6.5. The three major metabolites were separated and isolated by HPLC. Identification by californium-252 plasma desorption mass spectrometry showed that the two major metabolites from pH 7.5 were (trans) and (cis)-forms of 7-amino-1-hydroxyl-2-methylaminomitosene and the major metabolite from pH 6.5 was 7-amino-2-methylaminomitosene. All three major metabolites showed substitutions at the C-1 position. DNA was alkylated readily by enzyme-activated porfiromycin. Digestion of porfiromycin-alkylated DNA by DNase, snake venom phosphodiesterase, and alkaline phosphatase resulted in an insoluble nuclease-resistant fraction and a soluble fraction. The nuclease-resistant fraction reflected a high content of cross-linked adducts. Upon HPLC analysis, the solubilized fraction contained two monofunctionally linked porfiromycin adducts and a possibly cross-linked dinucleotide. The major adduct was isolated by HPLC and identified by NMR, as N2-(2'-deoxyguanosyl)-7-amino-2-methylaminomitosene. The N2 position of deoxyguanosine appeared as the major monofunctional alkylating site for DNA alkylation by porfiromycin. Thus, mitomycin C and porfiromycin (which differs from mitomycin C only by the addition of a methyl group to the aziridine nitrogen) share the same enzymatic activating mechanism that leads to the formation of the same types of metabolites and the same specificity of DNA alkylation. PMID:3412325

  7. Rev1 promotes replication through UV lesions in conjunction with DNA polymerases η, ι, and κ but not DNA polymerase ζ.

    Science.gov (United States)

    Yoon, Jung-Hoon; Park, Jeseong; Conde, Juan; Wakamiya, Maki; Prakash, Louise; Prakash, Satya

    2015-12-15

    Translesion synthesis (TLS) DNA polymerases (Pols) promote replication through DNA lesions; however, little is known about the protein factors that affect their function in human cells. In yeast, Rev1 plays a noncatalytic role as an indispensable component of Polζ, and Polζ together with Rev1 mediates a highly mutagenic mode of TLS. However, how Rev1 functions in TLS and mutagenesis in human cells has remained unclear. Here we determined the role of Rev1 in TLS opposite UV lesions in human and mouse fibroblasts and showed that Rev1 is indispensable for TLS mediated by Polη, Polι, and Polκ but is not required for TLS by Polζ. In contrast to its role in mutagenic TLS in yeast, Rev1 promotes predominantly error-free TLS opposite UV lesions in humans. The identification of Rev1 as an indispensable scaffolding component for Polη, Polι, and Polκ, which function in TLS in highly specialized ways opposite a diverse array of DNA lesions and act in a predominantly error-free manner, implicates a crucial role for Rev1 in the maintenance of genome stability in humans. PMID:26680302

  8. Inlfuence of DNA methyltransferase 3b on FHIT expression and DNA methylation of the FHIT promoter region in hepatoma SMMC-7721 cells

    Institute of Scientific and Technical Information of China (English)

    Jia-Xiang Wang; Yong-Gan Zhang; Long-Shuan Zhao

    2009-01-01

    BACKGROUND: Alterations in DNA methylation occur during the pathogenesis of human tumors. In this study, we investigated the inlfuence of DNA methyltransferase 3b (DNMT3b) on fragile histidine trial (FHIT) expression and on DNA methylation of the FHIT promoter region in the hepatoma cell line SMMC-7721. METHODS: DNMT3b siRNA was used to down-regulate DNMT3b expression. DNMT3b and FHIT proteins were determined by Western blotting. Methylation-speciifc PCR was used to analyze the methylation status of the FHIT gene. RESULTS: After DNMT3b siRNA transfection, the expression of DNMT3b was inhibited in SMMC-7721 cells, and the expression of FHIT was signiifcantly higher than that in the control group. There was no signiifcant difference in methylation status between the DNMT3b siRNA transfected cells and control cells. CONCLUSION: DNMT3b may play an important role in regulation of FHIT expression in hepatoma SMMC-7721 cells, but not through methylation of the FHIT promoter.

  9. Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

    Science.gov (United States)

    D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

    2002-01-01

    Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

  10. Bacterial community analysis of activated sludge: an evaluation of four commonly used DNA extraction methods

    NARCIS (Netherlands)

    Vanysacker, L.; Declerck, S.A.J.; Hellemans, B.; De Meester, L.; Vankelecom, I.; Declerck, P.

    2010-01-01

    The effectiveness of three commercially available direct DNA isolation kits (Mobio, Fast, Qiagen) and one published direct DNA extraction protocol (Bead) for extracting bacterial DNA from different types of activated sludge was investigated and mutually compared. The DNA quantity and purity were det

  11. International Association for Promoting Geoethics (IAPG): an update on activities

    Science.gov (United States)

    Di Capua, Giuseppe; Bobrowsky, Peter; Kieffer, Susan; Peppoloni, Silvia; Tinti, Stefano

    2016-04-01

    The International Association for Promoting Geoethics (IAPG: http://www.geoethics.org) was founded on August 2012 to unite global geoscientists to raise the awareness of the scientific community regarding the importance of the ethical, social and cultural implications of geoscience research, education, and practice. IAPG is an international, multidisciplinary and scientific platform for discussion on ethical problems and dilemmas in Earth Sciences, promoting geoethical themes through scientific publications and conferences, strengthening the research base on geoethics, and focusing on case-studies as models for the development of effective and operative strategies. IAPG is legally recognized as a not-for-profit organization. It is a non-governmental, non-political, non-party institution, at all times free from racial, gender, religious or national prejudices. Its network continues to grow with more than 900 members in 103 countries, including 20 national sections. IAPG operates exclusively through donations and personal funds of its members. The results achieved since inception have been recognized by numerous international organizations. In particular, IAPG has obtained the status of affiliated organization by the International Union of Geological Sciences (IUGS), American Geosciences Institute (AGI), Geological Society of America (GSA), and the Geological Society of London (GSL). IAPG has enlarged its official relationships also through agreements on collaboration with other organizations, such as the American Geophysical Union (AGU), EuroGeoSurveys (EGS), European Federation of Geologists (EFG), Association of Environmental & Engineering Geologists (AEG), International Geoscience Education Organisation (IGEO), African Association of Women in Geosciences (AAWG), and others. IAPG considers publications as an indispensable activity to strengthen geoethics from a scientific point of view, so members are active in the publication of articles and editing of books on

  12. [Methylation of FHIT gene promoter region in DNA from plasma of patients with myelodysplastic syndromes and demethylating effect of decitabine].

    Science.gov (United States)

    Deng, Yin-Fen; Zhang, Lei; Zhang, Xiu-Qun; Hu, Ming-Qiu; Dai, Dan; Zhang, Xue-Zhong; Xu, Yan-Li

    2012-10-01

    This study was aimed to detect the methylation status of FHIT gene promoter region in the DNA from plasma of patients with myelodysplastic syndrome (MDS), and to investigate the demethylating effect of decitabine. Methylation-specific PCR method was used to detect the methylation status of FHIT gene promoter region in the DNA from plasma of 4 patients with MDS before and after treatment with decitabine plus semis CAG therapy (among them, 1 case of newly diagnosed MDS, 3 cases progressed into acute leukemia). The results indicated that 3 cases were found to have an increased methylation in the promoter region. After treatment with decitabine plus semis CAG, increased methylation was reversed in 2 cases. In 4 cases, 2 cases displayed clinical response. It is concluded that FHIT gene hypermethylation is associated with MDS pathogenesis. Decitabine has demethylating effect on the FHIT gene hypermethylation of plasma from MDS patients. Detecting the methylation status of FHIT gene in DNA from plasma may play a role in MDS auxiliary diagnosis or prognosis.

  13. Sonic Hedgehog Promotes Cementoblastic Differentiation via Activating the BMP Pathways.

    Science.gov (United States)

    Bae, Won-Jung; Auh, Q-Schick; Lim, Hyun-Chang; Kim, Gyu-Tae; Kim, Hyun-Soo; Kim, Eun-Cheol

    2016-10-01

    Although sonic hedgehog (SHH), an essential molecule in embryogenesis and organogenesis, stimulates proliferation of human periodontal ligament (PDL) stem cells, the effects of recombinant human SHH (rh-SHH) on osteoblastic differentiation are unclear. To reveal the role of SHH in periodontal regeneration, expression of SHH in mouse periodontal tissues and its effects on the osteoblastic/cementoblastic differentiation in human cementoblasts were investigated. SHH is immunolocalized to differentiating cementoblasts, PDL cells, and osteoblasts of the developing mouse periodontium. Addition of rh-SHH increased cell growth, ALP activity, and mineralization nodule formation, and upregulated mRNA expression of osteoblastic and cementoblastic markers. The osteoblastic/cementoblastic differentiation of rh-SHH was abolished by the SHH inhibitor cyclopamine (Cy) and the BMP antagonist noggin. rh-SHH increased the expression of BMP-2 and -4 mRNA, as well as levels of phosphorylated Akt, ERK, p38, and JNK, and of MAPK and NF-κB activation, which were reversed by noggin, Cy, and BMP-2 siRNA. Collectively, this study is the first to demonstrate that SHH can promote cell growth and cell osteoblastic/cementoblastic differentiation via BMP pathway. Thus, SHH plays important roles in the development of periodontal tissue, and might represent a new therapeutic target for periodontitis and periodontal regeneration. PMID:27289556

  14. Chk2 Activation Dependence on Nbs1 after DNA Damage

    Science.gov (United States)

    Buscemi, Giacomo; Savio, Camilla; Zannini, Laura; Miccichè, Francesca; Masnada, Debora; Nakanishi, Makoto; Tauchi, Hiroshi; Komatsu, Kenshi; Mizutani, Shuki; Khanna, KumKum; Chen, Phil; Concannon, Patrick; Chessa, Luciana; Delia, Domenico

    2001-01-01

    The checkpoint kinase Chk2 has a key role in delaying cell cycle progression in response to DNA damage. Upon activation by low-dose ionizing radiation (IR), which occurs in an ataxia telangiectasia mutated (ATM)-dependent manner, Chk2 can phosphorylate the mitosis-inducing phosphatase Cdc25C on an inhibitory site, blocking entry into mitosis, and p53 on a regulatory site, causing G1 arrest. Here we show that the ATM-dependent activation of Chk2 by γ- radiation requires Nbs1, the gene product involved in the Nijmegen breakage syndrome (NBS), a disorder that shares with AT a variety of phenotypic defects including chromosome fragility, radiosensitivity, and radioresistant DNA synthesis. Thus, whereas in normal cells Chk2 undergoes a time-dependent increased phosphorylation and induction of catalytic activity against Cdc25C, in NBS cells null for Nbs1 protein, Chk2 phosphorylation and activation are both defective. Importantly, these defects in NBS cells can be complemented by reintroduction of wild-type Nbs1, but neither by a carboxy-terminal deletion mutant of Nbs1 at amino acid 590, unable to form a complex with and to transport Mre11 and Rad50 in the nucleus, nor by an Nbs1 mutated at Ser343 (S343A), the ATM phosphorylation site. Chk2 nuclear expression is unaffected in NBS cells, hence excluding a mislocalization as the cause of failed Chk2 activation in Nbs1-null cells. Interestingly, the impaired Chk2 function in NBS cells correlates with the inability, unlike normal cells, to stop entry into mitosis immediately after irradiation, a checkpoint abnormality that can be corrected by introduction of the wild-type but not the S343A mutant form of Nbs1. Altogether, these findings underscore the crucial role of a functional Nbs1 complex in Chk2 activation and suggest that checkpoint defects in NBS cells may result from the inability to activate Chk2. PMID:11438675

  15. Cernunnos/XLF promotes the ligation of mismatched and noncohesive DNA ends

    OpenAIRE

    Tsai, Chun J.; Kim, Sunny A.; Chu, Gilbert

    2007-01-01

    Nonhomologous end-joining (NHEJ) repairs DNA double-strand breaks created by ionizing radiation or V(D)J recombination of the immunoglobulin genes. The breaks often leave mismatched or nonligatable ends, and NHEJ must repair the breaks with high efficiency and minimal nucleotide loss. Here, the NHEJ proteins Ku, DNA-dependent protein kinase catalytic subunit, XRCC4/Ligase IV, and Cernunnos/XRCC4-like factor joined mismatched and noncohesive DNA ends in the absence of processing factors. Depen...

  16. DNA ligase III promotes alternative nonhomologous end-joining during chromosomal translocation formation.

    OpenAIRE

    Deniz Simsek; Erika Brunet; Sunnie Yan-Wai Wong; Sachin Katyal; Yankun Gao; McKinnon, Peter J.; Jacqueline Lou; Lei Zhang; James Li; Rebar, Edward J; Gregory, Philip D.; Michael C. Holmes; Maria Jasin

    2011-01-01

    International audience Nonhomologous end-joining (NHEJ) is the primary DNA repair pathway thought to underlie chromosomal translocations and other genomic rearrangements in somatic cells. The canonical NHEJ pathway, including DNA ligase IV (Lig4), suppresses genomic instability and chromosomal translocations, leading to the notion that a poorly defined, alternative NHEJ (alt-NHEJ) pathway generates these rearrangements. Here, we investigate the DNA ligase requirement of chromosomal translo...

  17. Antagonism of the STING Pathway via Activation of the AIM2 Inflammasome by Intracellular DNA.

    Science.gov (United States)

    Corrales, Leticia; Woo, Seng-Ryong; Williams, Jason B; McWhirter, Sarah M; Dubensky, Thomas W; Gajewski, Thomas F

    2016-04-01

    Recent evidence has indicated that innate immune sensing of cytosolic DNA in dendritic cells via the host STING pathway is a major mechanism leading to spontaneous T cell responses against tumors. However, the impact of the other major pathway triggered by intracellular DNA, the absent in melanoma 2 (AIM2) inflammasome, on the functional output from the stimulator of IFN genes (STING) pathway is poorly understood. We found that dendritic cells and macrophages deficient in AIM2, apoptosis-associated specklike protein, or caspase-1 produced markedly higher IFN-β in response to DNA. Biochemical analyses showed enhanced generation of cyclic GMP-AMP, STING aggregation, and TANK-binding kinase 1 and IFN regulatory factor 3 phosphorylation in inflammasome-deficient cells. Induction of pyroptosis by the AIM2 inflammasome was a major component of this effect, and inhibition of caspase-1 reduced cell death, augmenting phosphorylation of TANK-binding kinase 1/IFN regulatory factor 3 and production of IFN-β. Our data suggest that in vitro activation of the AIM2 inflammasome in murine macrophages and dendritic cells leads to reduced activation of the STING pathway, in part through promoting caspase-1-dependent cell death.

  18. DNA methylation of specific CpG sites in the promoter region regulates the transcription of the mouse oxytocin receptor.

    Directory of Open Access Journals (Sweden)

    Shimrat Mamrut

    Full Text Available Oxytocin is a peptide hormone, well known for its role in labor and suckling, and most recently for its involvement in mammalian social behavior. All central and peripheral actions of oxytocin are mediated through the oxytocin receptor, which is the product of a single gene. Transcription of the oxytocin receptor is subject to regulation by gonadal steroid hormones, and is profoundly elevated in the uterus and mammary glands during parturition. DNA methylation is a major epigenetic mechanism that regulates gene transcription, and has been linked to reduced expression of the oxytocin receptor in individuals with autism. Here, we hypothesized that transcription of the mouse oxytocin receptor is regulated by DNA methylation of specific sites in its promoter, in a tissue-specific manner. Hypothalamus-derived GT1-7, and mammary-derived 4T1 murine cell lines displayed negative correlations between oxytocin receptor transcription and methylation of the gene promoter, and demethylation caused a significant enhancement of oxytocin receptor transcription in 4T1 cells. Using a reporter gene assay, we showed that methylation of specific sites in the gene promoter, including an estrogen response element, significantly inhibits transcription. Furthermore, methylation of the oxytocin receptor promoter was found to be differentially correlated with oxytocin receptor expression in mammary glands and the uterus of virgin and post-partum mice, suggesting that it plays a distinct role in oxytocin receptor transcription among tissues and under different physiological conditions. Together, these results support the hypothesis that the expression of the mouse oxytocin receptor gene is epigenetically regulated by DNA methylation of its promoter.

  19. UV-induced DNA damage promotes resistance to the biotrophic pathogen Hyaloperonospora parasitica in Arabidopsis.

    Science.gov (United States)

    Kunz, Bernard A; Dando, Paige K; Grice, Desma M; Mohr, Peter G; Schenk, Peer M; Cahill, David M

    2008-10-01

    Plant innate immunity to pathogenic microorganisms is activated in response to recognition of extracellular or intracellular pathogen molecules by transmembrane receptors or resistance proteins, respectively. The defense signaling pathways share components with those involved in plant responses to UV radiation, which can induce expression of plant genes important for pathogen resistance. Such intriguing links suggest that UV treatment might activate resistance to pathogens in normally susceptible host plants. Here, we demonstrate that pre-inoculative UV (254 nm) irradiation of Arabidopsis (Arabidopsis thaliana) susceptible to infection by the biotrophic oomycete Hyaloperonospora parasitica, the causative agent of downy mildew, induces dose- and time-dependent resistance to the pathogen detectable up to 7 d after UV exposure. Limiting repair of UV photoproducts by postirradiation incubation in the dark, or mutational inactivation of cyclobutane pyrimidine dimer photolyase, (6-4) photoproduct photolyase, or nucleotide excision repair increased the magnitude of UV-induced pathogen resistance. In the absence of treatment with 254-nm UV, plant nucleotide excision repair mutants also defective for cyclobutane pyrimidine dimer or (6-4) photoproduct photolyase displayed resistance to H. parasitica, partially attributable to short wavelength UV-B (280-320 nm) radiation emitted by incubator lights. These results indicate UV irradiation can initiate the development of resistance to H. parasitica in plants normally susceptible to the pathogen and point to a key role for UV-induced DNA damage. They also suggest UV treatment can circumvent the requirement for recognition of H. parasitica molecules by Arabidopsis proteins to activate an immune response.

  20. Antioxidant activity, cytotoxicity, and DNA information of Glossogyne tenuifolia.

    Science.gov (United States)

    Hsu, Hsia-Fen; Houng, Jer-Yiing; Chang, Chao-Lin; Wu, Chin-Chung; Chang, Fang-Rong; Wu, Yang-Chang

    2005-07-27

    This study investigates the antioxidant activity and cytotoxicity of Glossogyne tenuifolia extract on various cancer cell lines. The 5.8s DNA of G. tenuifolia was isolated, and the species of this plant was confirmed by NCBI's DNA database. G. tenuifolia was then extracted with ethanol and separated into several fractions using the partition procedure with water, n-butanol, and ethyl acetate (EA). Among these, the EA fraction most significantly affected the activity of DPPH(*) and superoxide anion scavenging. Additionally, only the EA fraction exhibited cytotoxicity on breast cancer cells (MCF-7 and MDA-MB-231) and liver cancer cells (Hep G2 and Hep 3B). Next, the EA fraction was further separated by column chromatography, and 15 fractions were obtained. Three effective components were isolated and identified separately from the active fractions: oleanolic acid (OA) from fraction 6, luteolin from fractions 8-10, and luteolin-7-glucoside from fraction 12. The test of these three compounds on scavenging activity of DPPH(*) and superoxide anion indicates that luteolin had the highest antioxidant activity, whereas the effect of OA was negligible. Additionally, a synergistic effect between luteolin and luteolin-7-glucoside was observed. Kick-out experiments showed that the activities were vanished or decreased. Especially on MDA-MB-231 and MCF-7 cells, the cytotoxicity completely disappeared when luteolin was eliminated from fractions 8-10. These findings demonstrate that luteolin plays a crucial role in the inhibition of the growth of hepatoma cancer cell lines. Fraction 3, which did not contain luteolin, luteolin-7-glucoside, and oleanolic acid, had cytotoxicity on MDA-MB-231, MCF-7, Hep G2, Hep 3B, and A549, which implies that this fraction contained some other effective ingredients and requires further study. The investigation is currently underway in our laboratory. PMID:16029005

  1. Microfluidic DNA microarrays in PMMA chips: streamlined fabrication via simultaneous DNA immobilization and bonding activation by brief UV exposure

    DEFF Research Database (Denmark)

    Sabourin, David; Petersen, J; Snakenborg, Detlef;

    2010-01-01

    This report presents and describes a simple and scalable method for producing functional DNA microarrays within enclosed polymeric, PMMA, microfluidic devices. Brief (30 s) exposure to UV simultaneously immobilized poly(T)poly(C)-tagged DNA probes to the surface of unmodified PMMA and activated t...

  2. Epidermal growth factor activates telomerase activity by direct binding of Ets-2 to hTERT promoter in lung cancer cells.

    Science.gov (United States)

    Hsu, Chung-Ping; Lee, Li-Wen; Tang, Sheau-Chung; Hsin, I-Lun; Lin, Yu-Wen; Ko, Jiunn-Liang

    2015-07-01

    Growth signals are directly or indirectly involved in telomerase regulation. In this study, we investigated molecular mechanisms of the effect of EGF (epidermal growth factor) on regulating hTERT (human telomerase reverse transcriptase) expression. To elucidate specific transcription factors involved in EGF-stimulated hTERT transcription in A549 and H1299 lung cancer cells, transcription factors drives hTERT promoter activity, such as Myc, Mad, and Ets-2, was evaluated on luciferase reporter assay. The upregulation of hTERT promoter by Ets-2 and Myc were abolished by Mad. Using DAPA (DNA affinity precipitation assay), Ets-2 binding to SNP (T) was stronger than Ets-2 binding to SNP (C) at -245 bp upstream of the transcription start site within the core promoter of hTERT. Ets-2 silence by siRNA decreased hTERT expression at mRNA and protein levels. The regulation of hTERT promoter by EGF/Ets-2 was diminished via the EGFR kinase signal pathway-specific inhibitors AG1478 and Iressa. Inhibitors of Erk and Akt inhibited Ets-2-activated hTERT promoter activity. These data suggested that Ets-2, a genuine cancer-specific transcription factor, is actively involved in EGFR kinase-induced hTERT overexpression pathway in lung cancer cells. Blockage of this pathway may contribute to targeted gene therapy in lung cancer.

  3. O6-methylguanine-DNA methyltransferase (MGMT) Promoter methylation is a rare event in soft tissue sarcoma

    International Nuclear Information System (INIS)

    Gene silencing of O6-methylguanine–DNA methyltransferase (MGMT) by promoter methylation improves the outcome of glioblastoma patients after combined therapy of alkylating chemotherapeutic agents and radiation. The purpose of this study was to assess the frequency of MGMT promoter methylation in soft tissue sarcoma to identify patients eligible for alkylating agent chemotherapy such as temozolomide. Paraffin tumor blocks of 75 patients with representative STS subtypes were evaluated. The methylation status of the MGMT promoter was assessed by methylation-specific polymerase-chain-reaction analysis (PCR). Furthermore, immunohistochemistry was applied to verify expression of MGMT. MGMT gene silencing was assumed if MGMT promoter methylation was present and the fraction of tumor cells expressing MGMT was 20% or less. Methylation specific PCR detected methylated MGMT promoter in 10/75 cases. Immunohistochemical staining of nuclear MGMT was negative in 15/75 cases. 6/75 tumor samples showed MGMT promoter methylation and negative immunohistochemical nuclear staining of MGMT. In none of the tested STS subtypes we found a fraction of tumors with MGMT silencing exceeding 22%. MGMT gene silencing is a rare event in soft tissue sarcoma and cannot be recommended as a selection criterion for the therapy of STS patients with alkylating agents such as temozolomide

  4. O6-methylguanine-DNA methyltransferase (MGMT Promoter methylation is a rare event in soft tissue sarcoma

    Directory of Open Access Journals (Sweden)

    Jakob Jens

    2012-10-01

    Full Text Available Abstract Background Gene silencing of O6-methylguanine–DNA methyltransferase (MGMT by promoter methylation improves the outcome of glioblastoma patients after combined therapy of alkylating chemotherapeutic agents and radiation. The purpose of this study was to assess the frequency of MGMT promoter methylation in soft tissue sarcoma to identify patients eligible for alkylating agent chemotherapy such as temozolomide. Findings Paraffin tumor blocks of 75 patients with representative STS subtypes were evaluated. The methylation status of the MGMT promoter was assessed by methylation-specific polymerase-chain-reaction analysis (PCR. Furthermore, immunohistochemistry was applied to verify expression of MGMT. MGMT gene silencing was assumed if MGMT promoter methylation was present and the fraction of tumor cells expressing MGMT was 20% or less. Methylation specific PCR detected methylated MGMT promoter in 10/75 cases. Immunohistochemical staining of nuclear MGMT was negative in 15/75 cases. 6/75 tumor samples showed MGMT promoter methylation and negative immunohistochemical nuclear staining of MGMT. In none of the tested STS subtypes we found a fraction of tumors with MGMT silencing exceeding 22%. Conclusion MGMT gene silencing is a rare event in soft tissue sarcoma and cannot be recommended as a selection criterion for the therapy of STS patients with alkylating agents such as temozolomide.

  5. Tousled-like kinases phosphorylate Asf1 to promote histone supply during DNA replication

    DEFF Research Database (Denmark)

    Kamalyukova, Ilnaz M; Young, Clifford; Strømme, Caroline B;

    2014-01-01

    During DNA replication, nucleosomes are rapidly assembled on newly synthesized DNA to restore chromatin organization. Asf1, a key histone H3-H4 chaperone required for this process, is phosphorylated by Tousled-like kinases (TLKs). Here, we identify TLK phosphorylation sites by mass spectrometry...

  6. The Hierarchy of Transcriptional Activation: From Enhancer to Promoter.

    Science.gov (United States)

    Vernimmen, Douglas; Bickmore, Wendy A

    2015-12-01

    Regulatory elements (enhancers) that are remote from promoters play a critical role in the spatial, temporal, and physiological control of gene expression. Studies on specific loci, together with genome-wide approaches, suggest that there may be many common mechanisms involved in enhancer-promoter communication. Here, we discuss the multiprotein complexes that are recruited to enhancers and the hierarchy of events taking place between regulatory elements and promoters.

  7. Cloning, sequencing and expression analysis of the NAR promoter activated during hyphal stage of Magnaporthe grisea

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The promoter of N4R gene in Magnaporthe grisea was isolated and sequenced. The promoter sequences contained the "TATA" box, the "CAAT" box, and binding sites for fungal regulatory proteins. Programs that predict promoter sequences indicated that promoter sequence lies between locations 430 and 857 of the NAR promoter fragment. GFP expression under the NAR promoter and NAR transcript analysis revealed that this promoter is activated primarily at the mycelial stage in the rice blast fungus and could be used to express native or extrinsic genes in the mycelia of the rice blast fungus.

  8. Photon-induced cell migration and integrin expression promoted by DNA integration of HPV16 genome

    Energy Technology Data Exchange (ETDEWEB)

    Rieken, Stefan; Simon, Florian; Habermehl, Daniel; Dittmar, Jan Oliver; Combs, Stephanie E.; Weber, Klaus; Debus, Juergen; Lindel, Katja [University Hospital of Heidelberg, Department of Radiation Therapy and Radiation Oncology, Heidelberg (Germany)

    2014-10-15

    Persistent human papilloma virus 16 (HPV16) infections are a major cause of cervical cancer. The integration of the viral DNA into the host genome causes E2 gene disruption which prevents apoptosis and increases host cell motility. In cervical cancer patients, survival is limited by local infiltration and systemic dissemination. Surgical control rates are poor in cases of parametrial infiltration. In these patients, radiotherapy (RT) is administered to enhance local control. However, photon irradiation itself has been reported to increase cell motility. In cases of E2-disrupted cervical cancers, this phenomenon would impose an additional risk of enhanced tumor cell motility. Here, we analyze mechanisms underlying photon-increased migration in keratinocytes with differential E2 gene status. Isogenic W12 (intact E2 gene status) and S12 (disrupted E2 gene status) keratinocytes were analyzed in fibronectin-based and serum-stimulated migration experiments following single photon doses of 0, 2, and 10 Gy. Quantitative FACS analyses of integrin expression were performed. Migration and adhesion are increased in E2 gene-disrupted keratinocytes. E2 gene disruption promotes attractability by serum components, therefore, effectuating the risk of local infiltration and systemic dissemination. In S12 cells, migration is further increased by photon RT which leads to enhanced expression of fibronectin receptor integrins. HPV16-associated E2 gene disruption is a main predictor of treatment-refractory cancer virulence. E2 gene disruption promotes cell motility. Following photon RT, E2-disrupted tumors bear the risk of integrin-related infiltration and dissemination. (orig.) [German] Persistierende Infektionen mit humanen Papillomaviren 16 (HPV16) sind ein Hauptausloeser des Zervixkarzinoms. Die Integration der viralen DNS in das Wirtszellgenom fuehrt zum Integritaetsverlust des E2-Gens, wodurch in der Wirtszelle Apoptose verhindert und Motilitaet gesteigert werden. In

  9. Allele-specific DNA methylation reinforces PEAR1 enhancer activity.

    Science.gov (United States)

    Izzi, Benedetta; Pistoni, Mariaelena; Cludts, Katrien; Akkor, Pinar; Lambrechts, Diether; Verfaillie, Catherine; Verhamme, Peter; Freson, Kathleen; Hoylaerts, Marc F

    2016-08-18

    Genetic variation in the PEAR1 locus is linked to platelet reactivity and cardiovascular disease. The major G allele of rs12041331, an intronic cytosine guanine dinucleotide-single-nucleotide polymorphism (CpG-SNP), is associated with higher PEAR1 expression in platelets and endothelial cells than the minor A allele. The molecular mechanism underlying this difference remains elusive. We have characterized the histone modification profiles of the intronic region surrounding rs12041331 and identified H3K4Me1 enhancer-specific enrichment for the region that covers the CpG-SNP. Interestingly, methylation studies revealed that the CpG site is fully methylated in leukocytes of GG carriers. Nuclear protein extracts from megakaryocytes, endothelial cells, vs control HEK-293 cells show a 3-fold higher affinity for the methylated G allele compared with nonmethylated G or A alleles in a gel electrophoretic mobility shift assay. To understand the positive relationship between methylation and gene expression, we studied DNA methylation at 4 different loci of PEAR1 during in vitro megakaryopoiesis. During differentiation, the CpG-SNP remained fully methylated, while we observed rapid methylation increases at the CpG-island overlapping the first 5'-untranslated region exon, paralleling the increased PEAR1 expression. In the same region, A-allele carriers of rs12041331 showed significantly lower DNA methylation at CGI1 compared with GG homozygote. This CpG-island contains binding sites for the methylation-sensitive transcription factor CTCF, whose binding is known to play a role in enhancer activation and/or repression. In conclusion, we report the molecular characterization of the first platelet function-related CpG-SNP, a genetic predisposition that reinforces PEAR1 enhancer activity through allele-specific DNA methylation. PMID:27313330

  10. Parent participation plays an important part in promoting physical activity

    Directory of Open Access Journals (Sweden)

    Anna-Karin Lindqvist

    2015-08-01

    Full Text Available Although physical activity (PA is an important and modifiable determinant of health, in Sweden only 15% of boys and 10% of girls aged 15 years old achieve the recommended levels of PA 7 days per week. Adolescents’ PA levels are associated with social influence exerted by parents, friends, and teachers. The purpose of this study was to describe parents’ experiences of being a part of their adolescents’ empowerment-inspired PA intervention. A qualitative interview study was performed at a school in the northern part of Sweden. A total of 10 parents were interviewed, and the collected data were analyzed with qualitative content analysis. Three subthemes were combined into one main theme, demonstrating that parents are one important part of a successful PA intervention. The life of an adolescent has many options and demands that make it difficult to prioritize PA. Although parents felt that they were important in supporting their adolescent, a successful PA intervention must have multiple components. Moreover, the parents noted that the intervention had a positive effect upon not only their adolescents’, but also their own PA. Interventions aimed at promoting PA among adolescents should include measures to stimulate parent participation, have an empowerment approach, and preferably be school-based.

  11. Promoting physical activity: fertile ground for rehabilitation psychology.

    Science.gov (United States)

    Uswatte, Gitendra

    2013-02-01

    Comments on the article by Schmacher et al. (see record 2013-06066-009). Readers of Rehabilitation Psychology might be surprised, or maybe even alarmed, to find an article on promoting physical activity in able-bodied people between the covers of their latest issue. This commentary contends that this area of research and practice might be one into which rehabilitation psychologists want to venture. Schumacher and coworkers describe a field test (N = 216) of a token system for reinforcing stair taking. The setting was an eight-story office building housing a single company in a midsized city in the southeastern United States. Schumacher et al. report an increase from 39 stair transactions per day by all study participants in the 6 months before implementation of the intervention to 301 transactions in the 6 months after the implementation of the intervention, which represents a 600% increase. The cost of the intervention was only $17 per person. Although replication of these results in a study with additional sources of control would increase confidence in the validity of the findings, the size of the gains in stair taking, the number of participants in the study, the length of the baseline and implementation periods, and the objective measurement of outcome warrant attention. PMID:23438004

  12. Precore/basal core promoter mutants and hepatitis B viral DNA levels as predictors for liver deaths and hepatocellular carcinoma

    Institute of Scientific and Technical Information of China (English)

    Myron J Tong; Lawrence M Blatt; Jia-Horng Kao; Jason Tzuying Cheng; William G Corey

    2006-01-01

    AIM: To conduct a retrospective study in 400 chronic hepatitis B patients in order to identify hepatitis B viral factors associated with complications of liver disease or development of hepatocellular carcinoma.METHODS: The mean follow-up time was 83.6 ± 39.6mo. Alpha-fetoprotein test and abdominal ultrasound were used for cancer surveillance. Hepatitis B basal core promoter mutants, precore mutants, genotypes,hepatitis B viral DNA (HBV DNA) level and hepatitis B e antigen (HBeAg) were measured. Univariate analysis and logistic regression were used to assess odds ratios for viral factors related to liver deaths and hepatocellular carcinoma development.RESULTS: During follow-up, 38 patients had liver deaths not related to hepatocellular carcinoma. On multivariate analysis, older age [odds ratio: 95.74 (12.13-891.31);P < 0.0001], male sex [odds ratio: 7.61 (2.20-47.95);P = 0.006], and higher log10 HBV DNA [odds ratio:4.69 (1.16-20.43); P < 0.0001] were independently predictive for these liver related deaths. Also, 31 patients developed hepatocellular carcinoma. Multivariate analysis showed that older age [odds ratio: 26.51 (2.36-381.47);P = 0.007], presence of precore mutants [odds ratio:4.23 (1.53-19.58); P = 0.02] and presence of basal core promoter mutants [odds ratio: 2.93 (1.24-7.57); P =0.02] were independent predictors for progression to hepatocellular carcinoma.CONCLUSION: Our results show that high levels of baseline serum HBV DNA are associated with nonhepatocellular carcinoma-related deaths of liver failure,while genetic mutations in the basal core promoter and precore regions are predictive for development of hepatocellular carcinoma.

  13. Photodynamic activation as a molecular switch to promote osteoblast cell differentiation via AP-1 activation.

    Science.gov (United States)

    Kushibiki, Toshihiro; Tu, Yupeng; Abu-Yousif, Adnan O; Hasan, Tayyaba

    2015-01-01

    In photodynamic therapy (PDT), cells are impregnated with a photosensitizing agent that is activated by light irradiation, thereby photochemically generating reactive oxygen species (ROS). The amounts of ROS produced depends on the PDT dose and the nature of the photosensitizer. Although high levels of ROS are cytotoxic, at physiological levels they play a key role as second messengers in cellular signaling pathways, pluripotency, and differentiation of stem cells. To investigate further the use of photochemically triggered manipulation of such pathways, we exposed mouse osteoblast precursor cells and rat primary mesenchymal stromal cells to low-dose PDT. Our results demonstrate that low-dose PDT can promote osteoblast differentiation via the activation of activator protein-1 (AP-1). Although PDT has been used primarily as an anti-cancer therapy, the use of light as a photochemical "molecular switch" to promote differentiation should expand the utility of this method in basic research and clinical applications. PMID:26279470

  14. Constitutive NF-κB activation and tumor-growth promotion by Romo1-mediated reactive oxygen species production

    International Nuclear Information System (INIS)

    Highlights: • Romo1 expression is required for constitutive nuclear DNA-binding activity of NF-κB. • Romo1 depletion suppresses tumor growth in vivo. • Romo1 presents a potential therapeutic target for diseases. - Abstract: Deregulation of nuclear factor-κB (NF-κB) and related pathways contribute to tumor cell proliferation and invasion. Mechanisms for constitutive NF-κB activation are not fully explained; however, the underlying defects appear to generate and maintain pro-oxidative conditions. In hepatocellular carcinoma (HCC) tissues, up-regulation of reactive oxygen species modulator 1 (Romo1) correlates positively with tumor size. In the present study, we showed that Romo1 expression is required to maintain constitutive nuclear DNA-binding activity of NF-κB and transcriptional activity through constitutive IκBα phosphorylation. Overexpression of Romo1 promoted p65 nuclear translocation and DNA-binding activity. We also show that Romo1 depletion suppressed anchorage-independent colony formation by HCC cells and suppressed tumor growth in vivo. Based on these findings, Romo1 may be a principal regulatory factor in the maintenance of constitutive NF-κB activation in tumor cells. In the interest of anti-proliferative treatments for cancer, Romo1 may also present a productive target for drug development

  15. DNA Fingerprinting Using PCR: A Practical Forensic Science Activity

    Science.gov (United States)

    Choi, Hyun-Jung; Ahn, Jung Hoon; Ko, Minsu

    2008-01-01

    This paper describes a forensic science simulation programme applicable for use in colleges. Students were asked to find a putative suspect by DNA fingerprinting using a simple protocol developed in this study. DNA samples were obtained from a hair root and a drop of blood, common sources of DNA in forensic science. The DNA fingerprinting protocol…

  16. Primary characterization and basal promoter activity of two hexamerin genes of Musca domestica

    Directory of Open Access Journals (Sweden)

    C.K. Moreira

    2004-02-01

    Full Text Available Hexamerins are high molecular-weight proteins found in the hemolymph of insects and have been proposed to function as storage proteins. In previous studies, two Musca domestica hexamerins, designated Hex-L and Hex-F were characterized. Hex-L is synthesized exclusively by the larval fat bodies, is secreted into the hemolymph and likely provides a source of amino acids and energy during metamorphosis. Hex-F synthesis is induced by a proteinaceous meal and occurs only in the adult insect fat bodies. Hex-F also is secreted into the hemolymph and it has been suggested that in females it may be an amino acid reservoir to be used during the final stages of egg formation. Genomic clones containing full-length copies of the genes MdHexL1 and MdHexF1, encoding subunits of the larval and the adult female hexamerin, respectively, were isolated. Complete nucleotide sequences, including the 5'-end untranscribed regions, were determined and analyzed for each of the genes. Comparisons of the conceptual translation products of the cloned genes indicated that MdHexL1 and MdHexF1 are related to the larval serum proteins (LSP 1 and 2 of Calliphora vicina and Drosophila melanogaster. DNA fragments containing the putative promoters of the two hexamerin genes were compared and cloned into a plasmid vector so as to drive the expression of the GFP reporter gene. The constructs were assayed in vitro in transfected S2 Drosophila melanogaster cells demonstrating that the cloned M. domestica DNA fragments exhibit promoter activity.

  17. Evaluation of INK4A promoter methylation using pyrosequencing and circulating cell-free DNA from patients with hepatocellular carcinoma

    Science.gov (United States)

    Kirk, Jason L.; Merwat, Shehzad N.; Ju, Hyunsu; Soloway, Roger D.; Wieck, Lucas R.; Li, Albert; Okorodudu, Anthony O.; Petersen, John R.; Abdulla, Nihal E.; Duchini, Andrea; Cicalese, Luca; Rastellini, Cristiana; Hu, Peter C.; Dong, Jianli

    2015-01-01

    Background Hyper-methylation of CpG dinucleotides in the promoter region of inhibitor of cyclin-dependent kinase 4A (INK4A) has been reported in 60%–80% of hepatocellular carcinoma (HCC). As INK4A promoter hypermethylation event occurs early in HCC progression, the quantification of INK4A promoter methylation in blood sample may represent a useful biomarker for non-invasive diagnosis and prediction of response to therapy. Methods We examined INK4A promoter methylation using circulating cell-free DNA (ccfDNA) in a total of 109 serum specimens, including 66 HCC and 43 benign chronic liver diseases. Methylation of the individual seven CpG sites was examined using pyrosequencing. Results Our results showed that there were significantly higher levels of methylated INK4A in HCC specimens than controls and that the seven CpG sites had different levels of methylation and might exist in different PCR amplicons. The area under receiver operating characteristic (ROC) curve was 0.82, with 65.3% sensitivity and 87.2% specificity at 5% (LOD), 39.0% sensitivity and 96.5% specificity at 7% LOD, and 20.3% sensitivity and 98.8% specificity at 10% LOD, respectively. Conclusions Our results support additional studies incorporating INK4A methylation testing of ccfDNA to further validate the diagnostic, predictive, and prognostic characteristics of this biomarker in HCC patients. The knowledge of the existence of epi-alleles should help improve assay design to maximize detection. PMID:24406287

  18. Leaf extracts from Moricandia arvensis promote antiproliferation of human cancer cells, induce apoptosis, and enhance antioxidant activity.

    Science.gov (United States)

    Skandrani, Ines; Boubaker, Jihed; Bhouri, Wissem; Limem, Ilef; Kilani, Soumaya; Ben Sghaier, Mohamed; Neffati, Aicha; Bouhlel, Ines; Ghedira, Kamel; Chekir-Ghedira, Leila

    2010-01-01

    The in vitro antiproliferative, apoptotic, and antioxidant activities from leaf extracts of Moricandia arvensis, which are used in traditional cooking and medicines, were investigated. The MTT assay revealed that only TOF (total oligomer flavonoids), ethyl acetate (EA), chloroform (Chl), and petroleum ether (PE) extracts inhibited the proliferation of K562 cells. Apoptosis plays a very important role in the treatment of cancer by promoting the apoptosis of cancer cells and limiting the concurrent death of normal cells. Thus, the possible effects of M. arvensis extracts on the induction of apoptosis in human leukemic cells (K562 cells) were investigated. The electrophoretic analysis of DNA fragmentation confirms that TOF, Chl, PE, and EA extracts provoke DNA fragmentation. Using the lipid peroxidation inhibitory assay, the antioxidant capacity of M. arvensis extracts was evaluated by the ability of each extract to inhibit malondialdehyde formation. It was revealed that EA and TOF extracts are the most active in scavenging the hydroxyl radicals. PMID:19995267

  19. Combining Health Promotion Classroom Lessons with Health Fair Activities

    Science.gov (United States)

    Cooper, Leslie; Eliason, Kathy; True, Alexandra

    2004-01-01

    This article focuses on the important role of the school nurse in promoting healthy lifestyle choices through networking, resource identification, and working with community partners. "Everyone Is Healthy at Northeast" was a health promotion program designed and presented in two ways: classroom lessons and a health fair. There were interactive…

  20. Cdt2-mediated XPG degradation promotes gap-filling DNA synthesis in nucleotide excision repair.

    Science.gov (United States)

    Han, Chunhua; Wani, Gulzar; Zhao, Ran; Qian, Jiang; Sharma, Nidhi; He, Jinshan; Zhu, Qianzheng; Wang, Qi-En; Wani, Altaf A

    2015-01-01

    Xeroderma pigmentosum group G (XPG) protein is a structure-specific repair endonuclease, which cleaves DNA strands on the 3' side of the DNA damage during nucleotide excision repair (NER). XPG also plays a crucial role in initiating DNA repair synthesis through recruitment of PCNA to the repair sites. However, the fate of XPG protein subsequent to the excision of DNA damage has remained unresolved. Here, we show that XPG, following its action on bulky lesions resulting from exposures to UV irradiation and cisplatin, is subjected to proteasome-mediated proteolytic degradation. Productive NER processing is required for XPG degradation as both UV and cisplatin treatment-induced XPG degradation is compromised in NER-deficient XP-A, XP-B, XP-C, and XP-F cells. In addition, the NER-related XPG degradation requires Cdt2, a component of an E3 ubiquitin ligase, CRL4(Cdt2). Micropore local UV irradiation and in situ Proximity Ligation assays demonstrated that Cdt2 is recruited to the UV-damage sites and interacts with XPG in the presence of PCNA. Importantly, Cdt2-mediated XPG degradation is crucial to the subsequent recruitment of DNA polymerase δ and DNA repair synthesis. Collectively, our data support the idea of PCNA recruitment to damage sites which occurs in conjunction with XPG, recognition of the PCNA-bound XPG by CRL4(Cdt2) for specific ubiquitylation and finally the protein degradation. In essence, XPG elimination from DNA damage sites clears the chromatin space needed for the subsequent recruitment of DNA polymerase δ to the damage site and completion of gap-filling DNA synthesis during the final stage of NER. PMID:25483071

  1. Identification and annotation of promoter regions in microbial genome sequences on the basis of DNA stability

    Indian Academy of Sciences (India)

    Vetriselvi Rangannan; Manju Bansal

    2007-08-01

    Analysis of various predicted structural properties of promoter regions in prokaryotic as well as eukaryotic genomes had earlier indicated that they have several common features, such as lower stability, higher curvature and less bendability, when compared with their neighboring regions. Based on the difference in stability between neighboring upstream and downstream regions in the vicinity of experimentally determined transcription start sites, a promoter prediction algorithm has been developed to identify prokaryotic promoter sequences in whole genomes. The average free energy (E) over known promoter sequences and the difference (D) between E and the average free energy over the entire genome (G) are used to search for promoters in the genomic sequences. Using these cutoff values to predict promoter regions across entire Escherichia coli genome, we achieved a reliability of 70% when the predicted promoters were cross verified against the 960 transcription start sites (TSSs) listed in the Ecocyc database. Annotation of the whole E. coli genome for promoter region could be carried out with 49% accuracy. The method is quite general and it can be used to annotate the promoter regions of other prokaryotic genomes.

  2. cis-active elements from mouse chromosomal DNA suppress simian virus 40 DNA replication.

    OpenAIRE

    Hartl, M.; Willnow, T; Fanning, E

    1990-01-01

    Simian virus 40 (SV40)-containing DNA was rescued after the fusion of SV40-transformed VLM cells with permissive COS1 monkey cells and cloned, and prototype plasmid clones were characterized. A 2-kilobase mouse DNA fragment fused with the rescued SV40 DNA, and derived from mouse DNA flanking the single insert of SV40 DNA in VLM cells, was sequenced. Insertion of the intact rescued mouse sequence, or two nonoverlapping fragments of it, into wild-type SV40 plasmid DNA suppressed replication of ...

  3. Embryonic turkey liver: activities of biotransformation enzymes and activation of DNA-reactive carcinogens

    Energy Technology Data Exchange (ETDEWEB)

    Perrone, Carmen E.; Duan, Jian Dong; Jeffrey, Alan M.; Williams, Gary M. [New York Medical College, Department of Pathology, Valhalla (United States); Ahr, Hans-Juergen; Schmidt, Ulrich [Bayer AG, Institute of Toxicology, Wuppertal (Germany); Enzmann, Harald H. [Federal Institute for Drugs and Medical Devices, Bonn (Germany)

    2004-10-01

    Avian embryos are a potential alternative model for chemical toxicity and carcinogenicity research. Because the toxic and carcinogenic effects of some chemicals depend on bioactivation, activities of biotransformation enzymes and formation of DNA adducts in embryonic turkey liver were examined. Biochemical analyses of 22-day in ovoturkey liver post-mitochondrial fractions revealed activities of the biotransformation enzymes 7-ethoxycoumarin de-ethylase (ECOD), 7-ethoxyresorufin de-ethylase (EROD), aldrin epoxidase (ALD), epoxide hydrolase (EH), glutathione S-transferase (GST), and UDP-glucuronyltransferase (GLUT). Following the administration of phenobarbital (24 mg/egg) on day 21, enzyme activities of ECOD, EROD, ALD, EH and GLUT, but not of GST, were increased by two-fold or higher levels by day 22. In contrast, acute administration of 3-methylcholanthrene (5 mg/egg) induced only ECOD and EROD activities. Bioactivation of structurally diverse pro-carcinogens was also examined using {sup 32}P-postlabeling for DNA adducts. In ovoexposure of turkey embryos on day 20 of gestation to 2-acetylaminofluorene (AAF), 4,4'-methylenebis(2-chloroaniline) (MOCA), benzo[a]pyrene (BaP), and 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx) resulted in the formation of DNA adducts in livers collected by day 21. Some of the DNA adducts had {sup 32}P-postlabeling chromatographic migration patterns similar to DNA adducts found in livers from Fischer F344 rats exposed to the same pro-carcinogens. We conclude that 21-day embryonic turkey liver is capable of chemical biotransformation and activation of genotoxic carcinogens to form DNA adducts. Thus, turkey embryos could be utilized to investigate potential chemical toxicity and carcinogenicity. (orig.)

  4. Activity-based in vitro selection of T4 DNA ligase

    International Nuclear Information System (INIS)

    Recent in vitro methodologies for selection and directed evolution of proteins have concentrated not only on proteins with affinity such as single-chain antibody but also on enzymes. We developed a display technology for selection of T4 DNA ligase on ribosome because an in vitro selection method for DNA ligase had never been developed. The 3' end of mRNA encoding the gene of active or inactive T4 DNA ligase-spacer peptide fusion protein was hybridized to dsDNA fragments with cohesive ends, the substrate of T4 DNA ligase. After in vitro translation of the mRNA-dsDNA complex in a rabbit reticulocyte system, a mRNA-dsDNA-ribosome-ligase complex was produced. T4 DNA ligase enzyme displayed on a ribosome, through addition of a spacer peptide, is able to react with dsDNA in the complex. The complex expressing active ligase was biotinylated by ligation with another biotinylated dsDNA probe and selected with streptavidin-coated magnetic beads. We effectively selected active T4 DNA ligase from a small amount of protein. The gene of the active T4 DNA ligase was enriched 40 times from a mixture of active and inactive genes using this selection strategy. This ribosomal display strategy may have high potential to be useful for selection of other enzymes associated with DNA

  5. Rad52 promotes second-end DNA capture in double-stranded break repair to form complement-stabilized joint molecules.

    Science.gov (United States)

    Nimonkar, Amitabh V; Sica, R Alejandro; Kowalczykowski, Stephen C

    2009-03-01

    Saccharomyces cerevisiae Rad52 performs multiple functions during the recombinational repair of double-stranded DNA (dsDNA) breaks (DSBs). It mediates assembly of Rad51 onto single-stranded DNA (ssDNA) that is complexed with replication protein A (RPA); the resulting nucleoprotein filament pairs with homologous dsDNA to form joint molecules. Rad52 also catalyzes the annealing of complementary strands of ssDNA, even when they are complexed with RPA. Both Rad51 and Rad52 can be envisioned to promote "second-end capture," a step that pairs the ssDNA generated by processing of the second end of a DSB to the joint molecule formed by invasion of the target dsDNA by the first processed end. Here, we show that Rad52 promotes annealing of complementary ssDNA that is complexed with RPA to the displaced strand of a joint molecule, to form a complement-stabilized joint molecule. RecO, a prokaryotic homolog of Rad52, cannot form complement-stabilized joint molecules with RPA-ssDNA complexes, nor can Rad52 promote second-end capture when the ssDNA is bound with either human RPA or the prokaryotic ssDNA-binding protein, SSB, indicating a species-specific process. We conclude that Rad52 participates in second-end capture by annealing a resected DNA break, complexed with RPA, to the joint molecule product of single-end invasion event. These studies support a role for Rad52-promoted annealing in the formation of Holliday junctions in DSB repair. PMID:19204284

  6. PLCz functional haplotypes modulating promoter transcriptional activity are associated with semen quality traits in Chinese Holstein bulls.

    Directory of Open Access Journals (Sweden)

    Qing Pan

    Full Text Available The sperm-specific phospholipase C zeta (PLCz is a candidate sperm-borne oocyte-activating factor that triggers a characteristic series of physiological stimuli via cytoplasmic Ca(2+ oscillations during fertilization. The molecular mechanisms involved in the regulation of PLCz gene expression remain largely unknown. To explore the genetic variations in the 5'-flanking region of the PLCz gene and their common haplotypes in Chinese Holstein bulls, as well as to determine whether these variations affect bovine semen quality traits and transcriptional activity, DNA samples were collected from Chinese Holstein bulls and sequenced for the identification of genetic variants in the 5'-flanking region of PLCz. Two genetic variants were identified, and their haplotypic profiles were constructed. The two novel genetic variations (g. -456 G>A and g. +65 T>C were genotyped in 424 normal Chinese Holstein bulls. Bioinformatics analysis revealed that both loci are in transcription factor binding sites of the core promoter region. The association studies revealed that the two genetic variations and their haplotype combinations significantly affected semen quality traits. Using serially truncated constructs of the bovine PLCz promoters and the luciferase reporter, we found that a 726 bp (-641 nt to +112 nt fragment constitutes the core promoter region. Furthermore, four haplotypes, H1H1 (GTGT, H2H2 (GCGC, H3H3 (ATAT, and H4H4 (ACAC, were significantly associated with semen quality traits and successfully transfected into MLTC-1 cell lines. The luciferase reporter assay showed that the different haplotypes exhibited distinct promoter activities. Maximal promoter activity was demonstrated by the H2H2 haplotypes, as compared with the other haplotypes. To the best of our knowledge, this study is the first report on genetic variants and their respective haplotypes in the 5'-flanking region of PLCz gene that can influence the semen quality of Chinese Holstein bulls as

  7. AZD1775 sensitizes T cell acute lymphoblastic leukemia cells to cytarabine by promoting apoptosis over DNA repair.

    Science.gov (United States)

    Ford, James B; Baturin, Dmitry; Burleson, Tamara M; Van Linden, Annemie A; Kim, Yong-Mi; Porter, Christopher C

    2015-09-29

    While some children with acute lymphoblastic leukemia (ALL) have excellent prognoses, the prognosis for adults and children with T cell ALL is more guarded. Treatment for T-ALL is heavily dependent upon antimetabolite chemotherapeutics, including cytarabine. Targeted inhibition of WEE1 with AZD1775 has emerged as a strategy to sensitize cancer cells to cytarabine and other chemotherapeutics. We sought to determine if this strategy would be effective for T-ALL with clinically relevant anti-leukemia agents. We found that AZD1775 sensitizes T-ALL cells to several traditional anti-leukemia agents, acting synergistically with cytarabine by enhancing DNA damage and apoptosis. In addition to increased phosphorylation of H2AX at serine 139 (γH2AX), AZD1775 led to increased phosphorylation of H2AX at tyrosine 142, a signaling event associated with promotion of apoptosis over DNA repair. In a xenograft model of T-ALL, the addition of AZD1775 to cytarabine slowed leukemia progression and prolonged survival. Inhibition of WEE1 with AZD1775 sensitizes T-ALL to several anti-leukemia agents, particularly cytarabine and that mechanistically, AZD1775 promotes apoptosis over DNA repair in cells treated with cytarabine. These data support the development of clinical trials including AZD1775 in combination with conventional chemotherapy for acute leukemia. PMID:26334102

  8. Surface-promoted aggregation of amphiphilic quadruplex ligands drives their selectivity for alternative DNA structures.

    Science.gov (United States)

    Laguerre, Aurélien; Chang, Yi; Pirrotta, Marc; Desbois, Nicolas; Gros, Claude P; Lesniewska, Eric; Monchaud, David

    2015-07-01

    Scientists are currently truly committed to enhance the specificity of chemotherapeutics that target DNA. To this end, sequence-specific drugs have progressively given way to structure-specific therapeutics. However, while numerous strategies have been implemented to design high-affinity candidates, strategies devoted to the design of high-selectivity ligands are still rare. Here we report on such an approach via the study of an amphiphilic compound, TEGPy, that self-assembles at a liquid/solid interface to provide nanosized objects that are stable in water. The resulting aggregates, identified through atomic force microscopy measurements, were found to disassemble upon interaction with DNA in a structure-specific manner (quadruplex- versus duplex-DNA). Our results provide a fertile ground for devising new strategies aiming at concomitantly enhancing DNA structural specificity and the water-solubility of aggregation-prone ligands. PMID:26040925

  9. The enhancement effect of pp38 gene product on the activity of its upstream bi-directional promoter in Marek's disease virus

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    There was a bi-directional promoter between gene 38 kd phosphorylated protein (pp38) gene and 1.8-kb mRNA transcript gene family in the genome of Marek's disease virus (MDV). In this study, enhanced green fluorescence protein (EGFP) reporter plamids, pP(pp38)-EGFP and pP(1.8- kb)-EGFP, were constructed under this bi-directional promoter in two directions. The two plasmids were transfected into uninfected chicken embryo fibroblast (CEF), MDV clone rMd5 infected CEF (rMd5-CEF) and pp38-deleted derivative rMd5Δpp38 infected CEF (rMd5Δpp38-CEF) respectively. Transfection analysis showed that EGFP was only expressed in rMd5-CEF, and no EGFP could be detected in uninfected CEF or rMd5Δpp38-CEF, implying that pp38 was a factor influencing the activity of the promoter. The pp38-expressing recombinant plasmid pcDNA-pp38 was constructed to co- transfect CEF or rMd5Δpp38-CEF with pP(pp38)-EGFP or pP(1.8-kb)-EGFP. In this case, EGFP could be detected only in rMd5Δpp38-CEF but still not in uninfected CEF, implying that pp38 needs other protein(s) to work together for the complete trans-acting activity. Another MDV gene, 24 kd phosphorylated protein pp24 gene was cloned into pcDNA3.1 as a pp24-expressing recombinant plasmid pcDNA-pp24. When uninfected CEF was co-transfected with pcDNA-pp38, pcDNA-pp24 and EGFP expressing plasmids pP(pp38)-EGFP or pP(1.8-kb)-EGFP, the EGFP could be detected. These results indicated that pp38 and pp24 could enhance the activity of the promoter when they worked together. DNA mobility shift assay showed that pp38 would bind to the bi-directional promoter with the co-existing of pp24, although neither of them alone influenced mobility of the promoter DNA. All the above suggested that MDV pp38 could transactivate the bi-directional promoter when combined with pp24. The results also indicated that the activity of the promoter in the direction of 1.8-kb mRNA was significantly stronger than that of pp38 direction.

  10. Rad54 and Mus81 cooperation promotes DNA damage repair and restrains chromosome missegregation

    DEFF Research Database (Denmark)

    Ghamrasni, S El; Cardoso, R; Li, L;

    2016-01-01

    -damaging agents, defects on both the homologous recombination and non-homologous DNA end joining repair pathways and reduced fertility. We also observed that while Mus81 deficiency diminished the cleavage of common fragile sites, very strikingly, Rad54 loss impaired this cleavage to even a greater extent...... the importance of the cooperation between Rad54 and Mus81 for mediating DNA DSB repair and restraining chromosome missegregation....

  11. Analysis of the essential DNA region for OsEBP-89 promoter in response to methyl jasmonic acid

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    In rice, the characterization of OsEBP-89 is inducible by various stress- or hormone-stimuli, including ethylene, abscisic acid (ABA), jasmonate acid (JA), drought and cold. Here, we report the investigation of essential DNA region within OsEBP-89 promoter for methyl jasmonic acid (MeJA) induction. PLACE analysis indicates that this promoter sequence contains multiple potential elements in response to various stimuli. First, we fused this promoter with GUS gene and analyzed its expression under MeJA treatment through Agrobacterium infiltration mediating transient expression in tobacco leaves. Our results revealed that this chimeric gene could be inducible by MeJA in tobacco leaves. To further de- termine the crucial sequences responsible for MeJA induction, we generated a series of deletion pro- moters which were fused with GUS reporter gene respectively. The results of transient expression of GUS gene driven by these mutant promoters show that the essential region for MeJA induction is po- sitioned in the region between -1200 and -800 in OsEBP-89 promoter containing a G-box (?1127), which is distinct from the essential region containing ERE (?562) for ACC induction. In all, our finding is helpful in understanding the molecular mechanism of OsEBP-89 expression under different stimuli.

  12. [Comparative analysis of activity of different promoters for NIS gene expression in melanoma cells].

    Science.gov (United States)

    Kuz'mich, A I; Kopantsev, E P; Vinogradova, T V; Sverdlov, E D

    2014-01-01

    Development of targeted drug delivery system is key problem of cancer gene therapy. To ensure specific delivery of these therapeutic compounds to the tumor it is preferable for therapeutic gene expression to occur predominantly in cancer cells. Therefore, when testing drug in vivo, it is necessary to study distribution of therapeutic gene expression products in different tissues of the organism. Sodium iodide symporter (NIS) is attractive reporter because its tissue level is easily quantitatively detected by noninvasive imaging methods. Different promoters are used to direct expression of therapeutic genes in tumor cells: strong nonspecific, moderate tissue-specific and tumor-specific. Tumor-specific promoters function in wide range of tumor cells, however they are relatively weak. Relationship between promoter and sodium iodide symporter activity is unclear to date. In this report we examined activity of different promoters in two melanoma cell lines, functional activity of NIS driven by these promoters, also we compared promoter strength and NIS activity. We demonstrated that in spite of strong differences in promoter activity functional activity of NIS directed by these promoters varies weakly. Relatively weak melanoma-specific promoter directs high NIS activity in melanoma cell, however weaker cancer-specific promoters drive high NIS activity only in certain melanoma cell line.

  13. Human cytomegalovirus gene UL76 induces IL-8 expression through activation of the DNA damage response.

    Directory of Open Access Journals (Sweden)

    Helena Costa

    2013-09-01

    Full Text Available Human cytomegalovirus (HCMV, a β-herpesvirus, has evolved many strategies to subvert both innate and adaptive host immunity in order to ensure its survival and propagation within the host. Induction of IL-8 is particularly important during HCMV infection as neutrophils, primarily attracted by IL-8, play a key role in virus dissemination. Moreover, IL-8 has a positive effect in the replication of HCMV. This work has identified an HCMV gene (UL76, with the relevant property of inducing IL-8 expression at both transcriptional and protein levels. Up-regulation of IL-8 by UL76 results from activation of the NF-kB pathway as inhibition of both IKK-β activity or degradation of Ikβα abolishes the IL-8 induction and, concomitantly, expression of UL76 is associated with the translocation of p65 to the nucleus where it binds to the IL-8 promoter. Furthermore, the UL76-mediated induction of IL-8 requires ATM and is correlated with the phosphorylation of NEMO on serine 85, indicating that UL76 activates NF-kB pathway by the DNA Damage response, similar to the impact of genotoxic drugs. More importantly, a UL76 deletion mutant virus was significantly less efficient in stimulating IL-8 production than the wild type virus. In addition, there was a significant reduction of IL-8 secretion when ATM -/- cells were infected with wild type HCMV, thus, indicating that ATM is also involved in the induction of IL-8 by HCMV. In conclusion, we demonstrate that expression of UL76 gene induces IL-8 expression as a result of the DNA damage response and that both UL76 and ATM have a role in the mechanism of IL-8 induction during HCMV infection. Hence, this work characterizes a new role of the activation of DNA Damage response in the context of host-pathogen interactions.

  14. Detecting the movement and spawning activity of bigheaded carps with environmental DNA.

    Science.gov (United States)

    Erickson, Richard A; Rees, Christopher B; Coulter, Alison A; Merkes, Christopher M; McCalla, Sunnie G; Touzinsky, Katherine F; Walleser, Liza; Goforth, Reuben R; Amberg, Jon J

    2016-07-01

    Bigheaded carps are invasive fishes threatening to invade the Great Lakes basin and establish spawning populations, and have been monitored using environmental DNA (eDNA). Not only does eDNA hold potential for detecting the presence of species, but may also allow for quantitative comparisons like relative abundance of species across time or space. We examined the relationships among bigheaded carp movement, hydrography, spawning and eDNA on the Wabash River, IN, USA. We found positive relationships between eDNA and movement and eDNA and hydrography. We did not find a relationship between eDNA and spawning activity in the form of drifting eggs. Our first finding demonstrates how eDNA may be used to monitor species abundance, whereas our second finding illustrates the need for additional research into eDNA methodologies. Current applications of eDNA are widespread, but the relatively new technology requires further refinement. PMID:27087387

  15. Detecting the movement and spawning activity of bigheaded carps with environmental DNA

    Science.gov (United States)

    Erickson, Richard A.; Rees, Christopher B.; Coulter, Alison A.; Merkes, Christopher; McCalla, Sunnie; Touzinsky, Katherine F; Walleser, Liza R.; Goforth, Reuben R.; Amberg, Jon

    2016-01-01

    Bigheaded carps are invasive fishes threatening to invade the Great Lakes basin and establish spawning populations, and have been monitored using environmental DNA (eDNA). Not only does eDNA hold potential for detecting the presence of species, but may also allow for quantitative comparisons like relative abundance of species across time or space. We examined the relationships among bigheaded carp movement, hydrography, spawning and eDNA on the Wabash River, IN, USA. We found positive relationships between eDNA and movement and eDNA and hydrography. We did not find a relationship between eDNA and spawning activity in the form of drifting eggs. Our first finding demonstrates how eDNA may be used to monitor species abundance, whereas our second finding illustrates the need for additional research into eDNA methodologies. Current applications of eDNA are widespread, but the relatively new technology requires further refinement.

  16. HDAC Activity Is Required for Efficient Core Promoter Function at the Mouse Mammary Tumor Virus Promoter

    Directory of Open Access Journals (Sweden)

    Sang C. Lee

    2011-01-01

    Full Text Available Histone deacetylases (HDACs have been shown to be required for basal or inducible transcription at a variety of genes by poorly understood mechanisms. We demonstrated previously that HDAC inhibition rapidly repressed transcription from the mouse mammary tumor virus (MMTV promoter by a mechanism that does not require the binding of upstream transcription factors. In the current study, we find that HDACs work through the core promoter sequences of MMTV as well as those of several cellular genes to facilitate transcriptional initiation through deacetylation of nonhistone proteins.

  17. A designer bleomycin with significantly improved DNA cleavage activity.

    Science.gov (United States)

    Huang, Sheng-Xiong; Feng, Zhiyang; Wang, Liyan; Galm, Ute; Wendt-Pienkowski, Evelyn; Yang, Dong; Tao, Meifeng; Coughlin, Jane M; Duan, Yanwen; Shen, Ben

    2012-08-15

    The bleomycins (BLMs) are used clinically in combination with a number of other agents for the treatment of several types of tumors, and the BLM, etoposide, and cisplatin treatment regimen cures 90-95% of metastatic testicular cancer patients. BLM-induced pneumonitis is the most feared, dose-limiting side effect of BLM in chemotherapy, which can progress into lung fibrosis and affect up to 46% of the total patient population. There have been continued efforts to develop new BLM analogues in the search for anticancer drugs with better clinical efficacy and lower lung toxicity. We have previously cloned and characterized the biosynthetic gene clusters for BLMs from Streptomyces verticillus ATCC15003, tallysomycins from Streptoalloteichus hindustanus E465-94 ATCC31158, and zorbamycin (ZBM) from Streptomyces flavoviridis SB9001. Comparative analysis of the three biosynthetic machineries provided the molecular basis for the formulation of hypotheses to engineer novel analogues. We now report engineered production of three new analogues, 6'-hydroxy-ZBM, BLM Z, and 6'-deoxy-BLM Z and the evaluation of their DNA cleavage activities as a measurement for their potential anticancer activity. Our findings unveiled: (i) the disaccharide moiety plays an important role in the DNA cleavage activity of BLMs and ZBMs, (ii) the ZBM disaccharide significantly enhances the potency of BLM, and (iii) 6'-deoxy-BLM Z represents the most potent BLM analogue known to date. The fact that 6'-deoxy-BLM Z can be produced in reasonable quantities by microbial fermentation should greatly facilitate follow-up mechanistic and preclinical studies to potentially advance this analogue into a clinical drug.

  18. Xeroderma Pigmentosum Group A Promotes Autophagy to Facilitate Cisplatin Resistance in Melanoma Cells through the Activation of PARP1.

    Science.gov (United States)

    Ge, Rui; Liu, Lin; Dai, Wei; Zhang, Weigang; Yang, Yuqi; Wang, Huina; Shi, Qiong; Guo, Sen; Yi, Xiuli; Wang, Gang; Gao, Tianwen; Luan, Qi; Li, Chunying

    2016-06-01

    Xeroderma pigmentosum group A (XPA), a key protein in the nucleotide excision repair pathway, has been shown to promote the resistance of tumor cells to chemotherapeutic drugs by facilitating the DNA repair process. However, the role of XPA in the resistance of melanoma to platinum-based drugs like cisplatin is largely unknown. In this study, we initially found that XPA was expressed at higher levels in cisplatin-resistant melanoma cells than in cisplatin-sensitive ones. Furthermore, the knockdown of XPA not only increased cellular apoptosis but also inhibited cisplatin-induced autophagy, which rendered the melanoma cells more sensitive to cisplatin. Moreover, we discovered that the increased XPA in resistant melanoma cells promoted poly(adenosine diphosphate-ribose) polymerase 1 (PARP1) activation and that the inhibition of PARP1 could attenuate the cisplatin-induced autophagy. Finally, we proved that the inhibition of PARP1 and the autophagy process made resistant melanoma cells more susceptible to cisplatin treatment. Our study shows that XPA can promote cell-protective autophagy in a DNA repair-independent manner by enhancing the activation of PARP1 in melanoma cells resistant to cisplatin and that the XPA-PARP1-mediated autophagy process can be targeted to overcome cisplatin resistance in melanoma chemotherapy. PMID:26880244

  19. Cyclical DNA Methylation and Histone Changes Are Induced by LPS to Activate COX-2 in Human Intestinal Epithelial Cells

    Science.gov (United States)

    Brancaccio, Mariarita; Coretti, Lorena; Florio, Ermanno; Pezone, Antonio; Calabrò, Viola; Falco, Geppino; Keller, Simona; Lembo, Francesca; Avvedimento, Vittorio Enrico; Chiariotti, Lorenzo

    2016-01-01

    Bacterial lipopolysaccharide (LPS) induces release of inflammatory mediators both in immune and epithelial cells. We investigated whether changes of epigenetic marks, including selected histone modification and DNA methylation, may drive or accompany the activation of COX-2 gene in HT-29 human intestinal epithelial cells upon exposure to LPS. Here we describe cyclical histone acetylation (H3), methylation (H3K4, H3K9, H3K27) and DNA methylation changes occurring at COX-2 gene promoter overtime after LPS stimulation. Histone K27 methylation changes are carried out by the H3 demethylase JMJD3 and are essential for COX-2 induction by LPS. The changes of the histone code are associated with cyclical methylation signatures at the promoter and gene body of COX-2 gene. PMID:27253528

  20. Prevalence of human cell material: DNA and RNA profiling of public and private objects and after activity scenarios.

    Science.gov (United States)

    van den Berge, M; Ozcanhan, G; Zijlstra, S; Lindenbergh, A; Sijen, T

    2016-03-01

    Especially when minute evidentiary traces are analysed, background cell material unrelated to the crime may contribute to detectable levels in the genetic analyses. To gain understanding on the composition of human cell material residing on surfaces contributing to background traces, we performed DNA and mRNA profiling on samplings of various items. Samples were selected by considering events contributing to cell material deposits in exemplary activities (e.g. dragging a person by the trouser ankles), and can be grouped as public objects, private samples, transfer-related samples and washing machine experiments. Results show that high DNA yields do not necessarily relate to an increased number of contributors or to the detection of other cell types than skin. Background cellular material may be found on any type of public or private item. When a major contributor can be deduced in DNA profiles from private items, this can be a different person than the owner of the item. Also when a specific activity is performed and the areas of physical contact are analysed, the "perpetrator" does not necessarily represent the major contributor in the STR profile. Washing machine experiments show that transfer and persistence during laundry is limited for DNA and cell type dependent for RNA. Skin conditions such as the presence of sebum or sweat can promote DNA transfer. Results of this study, which encompasses 549 samples, increase our understanding regarding the prevalence of human cell material in background and activity scenarios. PMID:26736139

  1. Determination of polyphenolic content, HPLC analyses and DNA cleavage activity of Malaysian Averrhoa carambola L. fruit extracts

    Directory of Open Access Journals (Sweden)

    Zakia Khanam

    2015-10-01

    Full Text Available In developing countries, the increasing gap between population growth and food supply has created renewed interest in finding reliable and cheap natural resources of nutraceutical value and health promoting properties. Therefore, the present study deals with the phytochemical analyses and DNA cleavage activity of Averrhoa carambola L. fruit (starfruit extracts. The phytochemical studies involve colour tests and quantification of phenolics and flavonoids of the prepared ethanolic and aqueous extracts. Identification of phenolic acids and flavonoids present in the extracts were conducted by high performance liquid chromatography (HPLC equipped with diode array detector (DAD. DNA cleavage activity of the extracts was evaluated through gel electrophoresis against plasmid Escherichia coli DNA at different concentrations (0.125–0.60 μg/μl. The results of the study exhibited that the starfruit is a rich source of polyphenols and all the extracts exhibited a dose dependent DNA cleavage activity, whereas ethanolic extract induced more cleavage as compared to the aqueous extract. In conclusion, the present study provides preliminary evidence with regard to nutraceutical value of the fruit. So, further extensive study is a prerequisite to exploit DNA cleaving properties of the fruit extracts for therapeutic application.

  2. 78 FR 24393 - Agency Information Collection Activities; Comment Request; Promoting Student Success in Algebra I...

    Science.gov (United States)

    2013-04-25

    ... Agency Information Collection Activities; Comment Request; Promoting Student Success in Algebra I Project... notice will be considered public records. Title of Collection: Promoting Student Success in Algebra I... Estimated Number of Annual Burden Hours: 208. Abstract: The Promoting Student Success in Algebra I...

  3. DNA-recognition by a σ54 transcriptional activator from Aquifex aeolicus

    OpenAIRE

    Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; Lamers, Meindert; Huo, Yixin; Pelton, Jeffrey G.; Ton, Jimmy; Gralla, Jay; Berger, James; Wemmer, David E.

    2014-01-01

    Transcription initiation by bacterial σ54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) f...

  4. Zinc promotes proliferation and activation of myogenic cells via the PI3K/Akt and ERK signaling cascade

    Energy Technology Data Exchange (ETDEWEB)

    Ohashi, Kazuya, E-mail: asuno10k@yahoo.co.jp [Department of Life Sciences, Graduate School of Arts and Sciences, The University of Tokyo (Japan); Nagata, Yosuke, E-mail: cynagata@mail.ecc.u-tokyo.ac.jp [Department of Life Sciences, Graduate School of Arts and Sciences, The University of Tokyo (Japan); Wada, Eiji, E-mail: gacchu1@yahoo.co.jp [Department of Life Sciences, Graduate School of Arts and Sciences, The University of Tokyo (Japan); Zammit, Peter S., E-mail: peter.zammit@kcl.ac.uk [Randall Division of Cell and Molecular Biophysics, King' s College London, London SE1 1UL (United Kingdom); Shiozuka, Masataka, E-mail: cmuscle@mail.ecc.u-tokyo.ac.jp [Department of Life Sciences, Graduate School of Arts and Sciences, The University of Tokyo (Japan); Matsuda, Ryoichi, E-mail: cmatsuda@mail.ecc.u-tokyo.ac.jp [Department of Life Sciences, Graduate School of Arts and Sciences, The University of Tokyo (Japan)

    2015-05-01

    Skeletal muscle stem cells named muscle satellite cells are normally quiescent but are activated in response to various stimuli, such as injury and overload. Activated satellite cells enter the cell cycle and proliferate to produce a large number of myogenic progenitor cells, and these cells then differentiate and fuse to form myofibers. Zinc is one of the essential elements in the human body, and has multiple roles, including cell growth and DNA synthesis. However, the role of zinc in myogenic cells is not well understood, and is the focus of this study. We first examined the effects of zinc on differentiation of murine C2C12 myoblasts and found that zinc promoted proliferation, with an increased number of cells incorporating EdU, but inhibited differentiation with reduced myogenin expression and myotube formation. Furthermore, we used the C2C12 reserve cell model of myogenic quiescence to investigate the role of zinc on activation of myogenic cells. The number of reserve cells incorporating BrdU was increased by zinc in a dose dependent manner, with the number dramatically further increased using a combination of zinc and insulin. Akt and extracellular signal-regulated kinase (ERK) are downstream of insulin signaling, and both were phosphorylated after zinc treatment. The zinc/insulin combination-induced activation involved the phosphoinositide 3-kinase (PI3K)/Akt and ERK cascade. We conclude that zinc promotes activation and proliferation of myogenic cells, and this activation requires phosphorylation of PI3K/Akt and ERK as part of the signaling cascade. - Highlights: • Zinc has roles for promoting proliferation and inhibition differentiation of C2C12. • Zinc promotes activation of reserve cells. • Insulin and zinc synergize activation of reserve cells. • PI3K/Akt and ERK cascade affect zinc/insulin-mediated activation of reserve cells.

  5. Zinc promotes proliferation and activation of myogenic cells via the PI3K/Akt and ERK signaling cascade

    International Nuclear Information System (INIS)

    Skeletal muscle stem cells named muscle satellite cells are normally quiescent but are activated in response to various stimuli, such as injury and overload. Activated satellite cells enter the cell cycle and proliferate to produce a large number of myogenic progenitor cells, and these cells then differentiate and fuse to form myofibers. Zinc is one of the essential elements in the human body, and has multiple roles, including cell growth and DNA synthesis. However, the role of zinc in myogenic cells is not well understood, and is the focus of this study. We first examined the effects of zinc on differentiation of murine C2C12 myoblasts and found that zinc promoted proliferation, with an increased number of cells incorporating EdU, but inhibited differentiation with reduced myogenin expression and myotube formation. Furthermore, we used the C2C12 reserve cell model of myogenic quiescence to investigate the role of zinc on activation of myogenic cells. The number of reserve cells incorporating BrdU was increased by zinc in a dose dependent manner, with the number dramatically further increased using a combination of zinc and insulin. Akt and extracellular signal-regulated kinase (ERK) are downstream of insulin signaling, and both were phosphorylated after zinc treatment. The zinc/insulin combination-induced activation involved the phosphoinositide 3-kinase (PI3K)/Akt and ERK cascade. We conclude that zinc promotes activation and proliferation of myogenic cells, and this activation requires phosphorylation of PI3K/Akt and ERK as part of the signaling cascade. - Highlights: • Zinc has roles for promoting proliferation and inhibition differentiation of C2C12. • Zinc promotes activation of reserve cells. • Insulin and zinc synergize activation of reserve cells. • PI3K/Akt and ERK cascade affect zinc/insulin-mediated activation of reserve cells

  6. Molecular and functional characterization of the promoter region of the mouse LDH/C gene: enhancer-assisted, Sp1-mediated transcriptional activation.

    OpenAIRE

    Yang, J; THOMAS, K.

    1997-01-01

    Molecular and functional studies of the LDH/C 5' upstream promoter elements were undertaken to elucidate the molecular mechanisms involved in temporal activation of LDH/C gene expression in differentiating germ cells. Ligation mediated-PCR (LM-PCR) gene walking techniques were exploited to isolate a 2.1 kb fragment of the mouse LDH/C 5' promoter region. DNA sequence analysis of this isolated genomic fragment indicated that the mouse LDH/C promoter contained TATA and CCAT boxes as well as a GC...

  7. Histone chaperone Anp32e removes H2A.Z from DNA double-strand breaks and promotes nucleosome reorganization and DNA repair.

    Science.gov (United States)

    Gursoy-Yuzugullu, Ozge; Ayrapetov, Marina K; Price, Brendan D

    2015-06-16

    The repair of DNA double-strand breaks (DSBs) requires open, flexible chromatin domains. The NuA4-Tip60 complex creates these flexible chromatin structures by exchanging histone H2A.Z onto nucleosomes and promoting acetylation of histone H4. Here, we demonstrate that the accumulation of H2A.Z on nucleosomes at DSBs is transient, and that rapid eviction of H2A.Z is required for DSB repair. Anp32e, an H2A.Z chaperone that interacts with the C-terminal docking domain of H2A.Z, is rapidly recruited to DSBs. Anp32e functions to remove H2A.Z from nucleosomes, so that H2A.Z levels return to basal within 10 min of DNA damage. Further, H2A.Z removal by Anp32e disrupts inhibitory interactions between the histone H4 tail and the nucleosome surface, facilitating increased acetylation of histone H4 following DNA damage. When H2A.Z removal by Anp32e is blocked, nucleosomes at DSBs retain elevated levels of H2A.Z, and assume a more stable, hypoacetylated conformation. Further, loss of Anp32e leads to increased CtIP-dependent end resection, accumulation of single-stranded DNA, and an increase in repair by the alternative nonhomologous end joining pathway. Exchange of H2A.Z onto the chromatin and subsequent rapid removal by Anp32e are therefore critical for creating open, acetylated nucleosome structures and for controlling end resection by CtIP. Dynamic modulation of H2A.Z exchange and removal by Anp32e reveals the importance of the nucleosome surface and nucleosome dynamics in processing the damaged chromatin template during DSB repair.

  8. The MSHA strain of Pseudomonas aeruginosa activated TLR pathway and enhanced HIV-1 DNA vaccine immunoreactivity.

    Directory of Open Access Journals (Sweden)

    Jue Hou

    Full Text Available The mannose-sensitive hemagglutination pilus strain of Pseudomonas aeruginosa (PA-MSHA has been shown to trigger naïve immune responses through the activation of monocytes, macrophages, natural killer cells (NK cells and antigen presenting cells (APCs. Based on the hypothesis that PA-MSHA activates natural immunity through the Toll-like receptor (TLR pathway, we scanned several critical TLR pathway molecules in mouse splenocytes using high-throughput real-time QRT-PCR and co-stimulatory molecule in bone marrow-derived dendritic cells (BMDCs following in vitro stimulation by PA-MSHA. PA-MSHA enabled activation of the TLR pathway mediated by NF-κB and JNK signaling in splenocytes, and the co-stimulatory molecule CD86 was up-regulated in BMDCs. We then assessed the adjuvant effect of PA-MSHA for HIV-1 DNA vaccines. In comparison to DNA inoculation alone, co-inoculation with low dosage of PA-MSHA enhanced specific immunoreactivity against HIV-1 Env in both cellular and humoral responses, and promoted antibody avidity maturation. However, high doses of adjuvant resulted in an immunosuppressive effect; a two- or three-inoculation regimen yielded low antibody responses and the two-inoculation regimen exhibited only a slight cellular immunity response. To our knowledge, this is the first report demonstrating the utility of PA-MSHA as an adjuvant to a DNA vaccine. Further research is needed to investigate the exact mechanisms through which PA-MSHA achieves its adjuvant effects on innate immune responses, especially on dendritic cells.

  9. ATRX loss promotes tumor growth and impairs nonhomologous end joining DNA repair in glioma.

    Science.gov (United States)

    Koschmann, Carl; Calinescu, Anda-Alexandra; Nunez, Felipe J; Mackay, Alan; Fazal-Salom, Janet; Thomas, Daniel; Mendez, Flor; Kamran, Neha; Dzaman, Marta; Mulpuri, Lakshman; Krasinkiewicz, Johnathon; Doherty, Robert; Lemons, Rosemary; Brosnan-Cashman, Jacqueline A; Li, Youping; Roh, Soyeon; Zhao, Lili; Appelman, Henry; Ferguson, David; Gorbunova, Vera; Meeker, Alan; Jones, Chris; Lowenstein, Pedro R; Castro, Maria G

    2016-03-01

    Recent work in human glioblastoma (GBM) has documented recurrent mutations in the histone chaperone protein ATRX. We developed an animal model of ATRX-deficient GBM and showed that loss of ATRX reduces median survival and increases genetic instability. Further, analysis of genome-wide data for human gliomas showed that ATRX mutation is associated with increased mutation rate at the single-nucleotide variant (SNV) level. In mouse tumors, ATRX deficiency impairs nonhomologous end joining and increases sensitivity to DNA-damaging agents that induce double-stranded DNA breaks. We propose that ATRX loss results in a genetically unstable tumor, which is more aggressive when left untreated but is more responsive to double-stranded DNA-damaging agents, resulting in improved overall survival. PMID:26936505

  10. Crystal Structure of a Bacterial Type IB DNA Topoisomerase Reveals a Preassembled Active Site in the Absence of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Patel, Asmita; Shuman, Stewart; Mondragon, Alfonso (NWU); (SKI)

    2010-03-08

    Type IB DNA topoisomerases are found in all eukarya, two families of eukaryotic viruses (poxviruses and mimivirus), and many genera of bacteria. They alter DNA topology by cleaving and resealing one strand of duplex DNA via a covalent DNA-(3-phosphotyrosyl)-enzyme intermediate. Bacterial type IB enzymes were discovered recently and are described as poxvirus-like with respect to their small size, primary structures, and bipartite domain organization. Here we report the 1.75-{angstrom} crystal structure of Deinococcus radiodurans topoisomerase IB (DraTopIB), a prototype of the bacterial clade. DraTopIB consists of an amino-terminal (N) {beta}-sheet domain (amino acids 1-90) and a predominantly {alpha}-helical carboxyl-terminal (C) domain (amino acids 91-346) that closely resemble the corresponding domains of vaccinia virus topoisomerase IB. The five amino acids of DraTopIB that comprise the catalytic pentad (Arg-137, Lys-174, Arg-239, Asn-280, and Tyr-289) are preassembled into the active site in the absence of DNA in a manner nearly identical to the pentad configuration in human topoisomerase I bound to DNA. This contrasts with the apoenzyme of vaccinia topoisomerase, in which three of the active site constituents are either displaced or disordered. The N and C domains of DraTopIB are splayed apart in an 'open' conformation, in which the surface of the catalytic domain containing the active site is exposed for DNA binding. A comparison with the human topoisomerase I-DNA cocrystal structure suggests how viral and bacterial topoisomerase IB enzymes might bind DNA circumferentially via movement of the N domain into the major groove and clamping of a disordered loop of the C domain around the helix.

  11. Repetitive elements and enforced transcriptional repression co-operate to enhance DNA methylation spreading into a promoter CpG-island

    Science.gov (United States)

    Repression of many tumor suppressor genes in cancer is concurrent with aberrantly increased DNA methylation levels at promoter CpG islands (CGIs). About one-fourth of empirically defined human promoters are surrounded by or contain clustered repetitive elements. It was previously observed that a sha...

  12. Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

    Science.gov (United States)

    Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

    2016-03-01

    We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

  13. 75 FR 28811 - Office of Biotechnology Activities; Recombinant DNA Research: Proposed Actions Under the NIH...

    Science.gov (United States)

    2010-05-24

    ... HUMAN SERVICES National Institutes of Health Office of Biotechnology Activities; Recombinant DNA Research: Proposed Actions Under the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH... DNA Advisory Committee and approved by the NIH Director (Section III-A-1). Such research involves...

  14. Metastasis suppressor NM23-H1 promotes repair of UV-induced DNA damage and suppresses UV-induced melanomagenesis

    OpenAIRE

    Jarrett, Stuart G; Novak, Marian; Dabernat, Sandrine; Daniel, Jean-Yves; Mellon, Isabel; Zhang, Qingbei; Harris, Nathan; Ciesielski, Michael J.; Fenstermaker, Robert A.; Kovacic, Diane; Slominski, Andrzej; Kaetzel, David M.

    2011-01-01

    Reduced expression of the metastasis suppressor NM23-H1 is associated with aggressive forms of multiple cancers. Here, we establish that NM23-H1 (termed H1 isoform in human, M1 in mouse) and two of its attendant enzymatic activities, the 3′-5′ exonuclease and nucleoside diphosphate kinase, are novel participants in the cellular response to UV radiation (UVR)-induced DNA damage. NM23-H1 deficiency compromised the kinetics of repair for total DNA polymerase-blocking lesions and nucleotide excis...

  15. Delivery of a survivin promoter-driven antisense survivin-expressing plasmid DNA as a cancer therapeutic: a proof-of-concept study

    Directory of Open Access Journals (Sweden)

    Lin KY

    2016-05-01

    Full Text Available Kun-Yuan Lin,1 Siao Muk Cheng,2 Shing-Ling Tsai,2 Ju-Ya Tsai,1 Chun-Hui Lin,1 Chun Hei Antonio Cheung1,2 1Department of Pharmacology, College of Medicine, National Cheng Kung University, Tainan, Taiwan, ROC; 2Institute of Basic Medical Sciences, College of Medicine, National Cheng Kung University, Tainan, Taiwan, ROC Abstract: Survivin is a member of the inhibitor-of-apoptosis proteins family. It is overexpressed in many different cancer types but not in the differentiated normal tissue. In addition, overexpression of survivin promotes cancer cell survival and induces chemotherapeutic drug resistance, making it an attractive target for new anticancer interventions. Despite survivin being a promising molecular target for anticancer treatment, it is widely accepted that survivin is only a “semi-druggable” target. Therefore, it is important to develop a new strategy to target survivin for anticancer treatment. In this study, we constructed a novel survivin promoter-driven full-length antisense survivin (pSur/AS-Sur expression plasmid DNA. Promoter activity assay revealed that the activity of the survivin promoter of pSur/AS-Sur correlated with the endogenous expression of survivin at the transcriptional level in the transfected A549, MDA-MB-231, and PANC-1 cancer cells. Western blot analysis showed that liposomal delivery of pSur/AS-Sur successfully downregulated the expression of survivin in A549, MBA-MB-231, and PANC-1 cells in vitro. In addition, delivery of pSur/AS-Sur induced autophagy, caspase-dependent apoptosis, and caspase-independent apoptosis as indicated by the increased LC3B-II conversion, autophagosome formation, caspase-9/-3 and poly(ADP-ribose polymerase-1 cleavage, and apoptosis-inducing factor nuclear translocation in A549, MBA-MB-231, and PANC-1 cells. Importantly, liposomal delivery of pSur/AS-Sur was also capable of decreasing the proliferation of the survivin/MDR1 coexpressing multidrug-resistant KB-TAX50 cancer cells and

  16. All-trans retinoic acid promotes TGF-β-induced Tregs via histone modification but not DNA demethylation on Foxp3 gene locus.

    Directory of Open Access Journals (Sweden)

    Ling Lu

    Full Text Available BACKGROUND: It has been documented all-trans retinoic acid (atRA promotes the development of TGF-β-induced CD4(+Foxp3(+ regulatory T cells (iTreg that play a vital role in the prevention of autoimmune responses, however, molecular mechanisms involved remain elusive. Our objective, therefore, was to determine how atRA promotes the differentiation of iTregs. METHODOLOGY/PRINCIPAL FINDINGS: Addition of atRA to naïve CD4(+CD25(- cells stimulated with anti-CD3/CD28 antibodies in the presence of TGF-β not only increased Foxp3(+ iTreg differentiation, but maintained Foxp3 expression through apoptosis inhibition. atRA/TGF-β-treated CD4(+ cells developed complete anergy and displayed increased suppressive activity. Infusion of atRA/TGF-β-treated CD4(+ cells resulted in the greater effects on suppressing symptoms and protecting the survival of chronic GVHD mice with typical lupus-like syndromes than did CD4(+ cells treated with TGF-β alone. atRA did not significantly affect the phosphorylation levels of Smad2/3 and still promoted iTreg differentiation in CD4(+ cells isolated from Smad3 KO and Smad2 conditional KO mice. Conversely, atRA markedly increased ERK1/2 activation, and blockade of ERK1/2 signaling completely abolished the enhanced effects of atRA on Foxp3 expression. Moreover, atRA significantly increased histone methylation and acetylation within the promoter and conserved non-coding DNA sequence (CNS elements at the Foxp3 gene locus and the recruitment of phosphor-RNA polymerase II, while DNA methylation in the CNS3 was not significantly altered. CONCLUSIONS/SIGNIFICANCE: We have identified the cellular and molecular mechanism(s by which atRA promotes the development and maintenance of iTregs. These results will help to enhance the quantity and quality of development of iTregs and may provide novel insights into clinical cell therapy for patients with autoimmune diseases and those needing organ transplantation.

  17. Sulfolobus Replication Factor C stimulates the activity of DNA Polymerase B1

    DEFF Research Database (Denmark)

    Xing, Xuanxuan; Zhang, Likui; Guo, Li;

    2014-01-01

    Replication factor C (RFC) is known to function in loading proliferating cell nuclear antigen (PCNA) onto primed DNA, allowing PCNA to tether DNA polymerase for highly processive DNA synthesis in eukaryotic and archaeal replication. In this report, we show that an RFC complex from the...... with the ability of RFC to facilitate DNA binding by PolB1 through protein-protein interaction. These results suggest that Sulfolobus RFC may play a role in recruiting DNA polymerase for efficient primer extension, in addition to clamp loading, during DNA replication....... hyperthermophilic archaea of the genus Sulfolobus physically interacts with DNA polymerase B1 (PolB1) and enhances both the polymerase and 3'-5' exonuclease activities of PolB1 in an ATP-independent manner. Stimulation of the PolB1 activity by RFC is independent of the ability of RFC to bind DNA but is consistent...

  18. Competition between the DNA unwinding and strand pairing activities of the Werner and Bloom syndrome proteins

    Directory of Open Access Journals (Sweden)

    Orren David K

    2006-01-01

    Full Text Available Abstract Background The premature aging and cancer-prone Werner and Bloom syndromes are caused by defects in the RecQ helicase enzymes WRN and BLM, respectively. Recently, both WRN and BLM (as well as several other RecQ members have been shown to possess a strand annealing activity in addition to the requisite DNA unwinding activity. Since an annealing function would appear to directly oppose the action of a helicase, we have examined in this study the dynamic equilibrium between unwinding and annealing mediated by either WRN or BLM. Results Our investigation into the competition between annealing and unwinding demonstrates that, under standard reaction conditions, WRN- or BLM-mediated annealing can partially or completely mask unwinding as measured in standard helicase assays. Several strategies were employed to suppress the annealing activity so that the actual strength of WRN- or BLM-dependent unwinding could be more accurately assessed. Interestingly, if a DNA oligomer complementary to one strand of the DNA substrate to be unwound is added during the helicase reaction, both WRN and BLM unwinding is enhanced, presumably by preventing protein-mediated re-annealing. This strategy allowed measurement of WRN-catalyzed unwinding of long (80 base pair duplex regions and fully complementary, blunt-ended duplexes, both of which were otherwise quite refractory to the helicase activity of WRN. Similarly, the addition of trap strand stimulated the ability of BLM to unwind long and blunt-ended duplexes. The stimulatory effect of the human replication protein A (hRPA, the eukaryotic single-stranded DNA binding protein on both WRN- and BLM-dependent unwinding was also re-examined in light of its possible role in preventing re-annealing. Our results show that hRPA influences the outcome of WRN and BLM helicase assays by both inhibiting re-annealing and directly promoting unwinding, with the larger contribution from the latter mechanism. Conclusion These

  19. Ligands of Peroxisome Proliferator-activated Receptor Inhibit Homocysteineinduced DNA Methylation of Inducible Nitric Oxide Synthase Gene

    Institute of Scientific and Technical Information of China (English)

    Yideng JIANG; Jianzhong ZHANG; Jiantuan XIONG; Jun CAO; Guizhong LI; Shuren WANG

    2007-01-01

    Homocysteine (Hcy) is a risk factor for atherosclerosis. It is generally accepted that inducible nitric oxide synthase (iNOS) is a key enzyme in the regulation of vascular disease. The aim of the present study is to investigate the effects of peroxisome proliferator-activated receptor ligands on iNOS in the presence of Hcy in human monocytes. Foam cells, induced by oxidize low density lipoprotein (ox-LDL) and phorbol myristate acetate (PMA) in the presence of different concentrations of Hcy, clofibrate and pioglitazone in human monocytes for 4 d, were examined by oil red O staining. The activity of iNOS was detected by real-time quantitative reverse transcription-polymerase chain reaction and Western blot analysis. The capability of DNA methylation was measured by assaying endogenous C5 DNA methyltransferase (C5MTase)activity, and the iNOS promoter methylation level was determined by quantitative MethyLight assays. The results indicated that Hcy increased the activity of C5MTase and the level of iNOS gene DNA methylation,resulting in a decrease of iNOS expression. Clofibrate and pioglitazone could antagonize the Hcy effect on iNOS expression through DNA methylation, resulting in attenuation of iNOS transcription. These findings suggested that Hcy decreased the expression of iNOS by elevating iNOS DNA methylation levels, which can repress the transcription of some genes. Peroxisome proliferator-activated receptor α/γ ligands can down-regulate iNOS DNA methylation, and could be useful for preventing Hcy-induced atherosclerosis by repressing iNOS expression.

  20. Activity of heat shock genes' promoters in thermally contrasting animal species.

    Science.gov (United States)

    Astakhova, Lyubov N; Zatsepina, Olga G; Funikov, Sergei Yu; Zelentsova, Elena S; Schostak, Natalia G; Orishchenko, Konstantin E; Evgen'ev, Michael B; Garbuz, David G

    2015-01-01

    Heat shock gene promoters represent a highly conserved and universal system for the rapid induction of transcription after various stressful stimuli. We chose pairs of mammalian and insect species that significantly differ in their thermoresistance and constitutive levels of Hsp70 to compare hsp promoter strength under normal conditions and after heat shock (HS). The first pair includes the HSPA1 gene promoter of camel (Camelus dromedarius) and humans. It was demonstrated that the camel HSPA1A and HSPA1L promoters function normally in vitro in human cell cultures and exceed the strength of orthologous human promoters under basal conditions. We used the same in vitro assay for Drosophila melanogaster Schneider-2 (S2) cells to compare the activity of the hsp70 and hsp83 promoters of the second species pair represented by Diptera, i.e., Stratiomys singularior and D. melanogaster, which dramatically differ in thermoresistance and the pattern of Hsp70 accumulation. Promoter strength was also monitored in vivo in D. melanogaster strains transformed with constructs containing the S. singularior hsp70 ORF driven either by its own promoter or an orthologous promoter from the D. melanogaster hsp70Aa gene. Analysis revealed low S. singularior hsp70 promoter activity in vitro and in vivo under basal conditions and after HS in comparison with the endogenous promoter in D. melanogaster cells, which correlates with the absence of canonical GAGA elements in the promoters of the former species. Indeed, the insertion of GAGA elements into the S. singularior hsp70 regulatory region resulted in a dramatic increase in promoter activity in vitro but only modestly enhanced the promoter strength in the larvae of the transformed strains. In contrast with hsp70 promoters, hsp83 promoters from both of the studied Diptera species demonstrated high conservation and universality.

  1. Cdk1 Phosphorylates SPAT-1/Bora to Promote Plk1 Activation in C. elegans and Human Cells

    Directory of Open Access Journals (Sweden)

    Yann Thomas

    2016-04-01

    Full Text Available The conserved Bora protein is a Plk1 activator, essential for checkpoint recovery after DNA damage in human cells. Here, we show that Bora interacts with Cyclin B and is phosphorylated by Cyclin B/Cdk1 at several sites. The first 225 amino acids of Bora, which contain two Cyclin binding sites and three conserved phosphorylated residues, are sufficient to promote Plk1 phosphorylation by Aurora A in vitro. Mutating the Cyclin binding sites or the three conserved phosphorylation sites abrogates the ability of the N terminus of Bora to promote Plk1 activation. In human cells, Bora-carrying mutations of the three conserved phosphorylation sites cannot sustain mitotic entry after DNA damage. In C. elegans embryos, mutation of the three conserved phosphorylation sites in SPAT-1, the Bora ortholog, results in a severe mitotic entry delay. Our results reveal a crucial and conserved role of phosphorylation of the N terminus of Bora for Plk1 activation and mitotic entry.

  2. Miz-1 activates gene expression via a novel consensus DNA binding motif.

    Science.gov (United States)

    Barrilleaux, Bonnie L; Burow, Dana; Lockwood, Sarah H; Yu, Abigail; Segal, David J; Knoepfler, Paul S

    2014-01-01

    The transcription factor Miz-1 can either activate or repress gene expression in concert with binding partners including the Myc oncoprotein. The genomic binding of Miz-1 includes both core promoters and more distal sites, but the preferred DNA binding motif of Miz-1 has been unclear. We used a high-throughput in vitro technique, Bind-n-Seq, to identify two Miz-1 consensus DNA binding motif sequences--ATCGGTAATC and ATCGAT (Mizm1 and Mizm2)--bound by full-length Miz-1 and its zinc finger domain, respectively. We validated these sequences directly as high affinity Miz-1 binding motifs. Competition assays using mutant probes indicated that the binding affinity of Miz-1 for Mizm1 and Mizm2 is highly sequence-specific. Miz-1 strongly activates gene expression through the motifs in a Myc-independent manner. MEME-ChIP analysis of Miz-1 ChIP-seq data in two different cell types reveals a long motif with a central core sequence highly similar to the Mizm1 motif identified by Bind-n-Seq, validating the in vivo relevance of the findings. Miz-1 ChIP-seq peaks containing the long motif are predominantly located outside of proximal promoter regions, in contrast to peaks without the motif, which are highly concentrated within 1.5 kb of the nearest transcription start site. Overall, our results indicate that Miz-1 may be directed in vivo to the novel motif sequences we have identified, where it can recruit its specific binding partners to control gene expression and ultimately regulate cell fate. PMID:24983942

  3. Miz-1 activates gene expression via a novel consensus DNA binding motif.

    Directory of Open Access Journals (Sweden)

    Bonnie L Barrilleaux

    Full Text Available The transcription factor Miz-1 can either activate or repress gene expression in concert with binding partners including the Myc oncoprotein. The genomic binding of Miz-1 includes both core promoters and more distal sites, but the preferred DNA binding motif of Miz-1 has been unclear. We used a high-throughput in vitro technique, Bind-n-Seq, to identify two Miz-1 consensus DNA binding motif sequences--ATCGGTAATC and ATCGAT (Mizm1 and Mizm2--bound by full-length Miz-1 and its zinc finger domain, respectively. We validated these sequences directly as high affinity Miz-1 binding motifs. Competition assays using mutant probes indicated that the binding affinity of Miz-1 for Mizm1 and Mizm2 is highly sequence-specific. Miz-1 strongly activates gene expression through the motifs in a Myc-independent manner. MEME-ChIP analysis of Miz-1 ChIP-seq data in two different cell types reveals a long motif with a central core sequence highly similar to the Mizm1 motif identified by Bind-n-Seq, validating the in vivo relevance of the findings. Miz-1 ChIP-seq peaks containing the long motif are predominantly located outside of proximal promoter regions, in contrast to peaks without the motif, which are highly concentrated within 1.5 kb of the nearest transcription start site. Overall, our results indicate that Miz-1 may be directed in vivo to the novel motif sequences we have identified, where it can recruit its specific binding partners to control gene expression and ultimately regulate cell fate.

  4. E2A Antagonizes PU.1 Activity through Inhibition of DNA Binding.

    Science.gov (United States)

    Rogers, Jason H; Owens, Kristin S; Kurkewich, Jeffrey; Klopfenstein, Nathan; Iyer, Sangeeta R; Simon, M Celeste; Dahl, Richard

    2016-01-01

    Antagonistic interactions between transcription factors contribute to cell fate decisions made by multipotent hematopoietic progenitor cells. Concentration of the transcription factor PU.1 affects myeloid/lymphoid development with high levels of PU.1 directing myeloid cell fate acquisition at the expense of B cell differentiation. High levels of PU.1 may be required for myelopoiesis in order to overcome inhibition of its activity by transcription factors that promote B cell development. The B cell transcription factors, E2A and EBF, are necessary for commitment of multipotential progenitors and lymphoid primed multipotential progenitors to lymphocytes. In this report we hypothesized that factors required for early B cell commitment would bind to PU.1 and antagonize its ability to induce myeloid differentiation. We investigated whether E2A and/or EBF associate with PU.1. We observed that the E2A component, E47, but not EBF, directly binds to PU.1. Additionally E47 represses PU.1-dependent transactivation of the MCSFR promoter through antagonizing PU.1's ability to bind to DNA. Exogenous E47 expression in hematopoietic cells inhibits myeloid differentiation. Our data suggest that E2A antagonism of PU.1 activity contributes to its ability to commit multipotential hematopoietic progenitors to the lymphoid lineages.

  5. Inactivation of the WNT5A Alternative Promoter B Is Associated with DNA Methylation and Histone Modification in Osteosarcoma Cell Lines U2OS and SaOS-2.

    Directory of Open Access Journals (Sweden)

    Himani Vaidya

    Full Text Available WNT5A is a secreted ligand involved in Wnt pathway signaling and has a role in cell movement and differentiation. Altered WNT5A expression is associated with various cancers, although in most studies the focus has been on only one of the known WNT5A isoforms. In this study, we analyzed expression from two of the major WNT5A promoters, termed promoter A and promoter B, in normal human osteoblasts, SaOS-2 and U2OS osteosarcoma cell lines, and osteosarcoma tumor tissue. We found that both promoters A and B are active in normal osteoblasts with nearly 11-fold more promoter B than A transcripts. Promoter B but not promoter A transcripts are decreased or nearly undetectable in the SaOS-2 and U2OS cell lines and osteosarcoma tumor tissues. Transient transfection of promoter A and promoter B reporter constructs confirmed that SaOS-2 cells have the necessary factors to transcribe both promoters. Bisulfite sequencing analysis revealed that three CpG enriched regions upstream of the promoter B exon 1βare highly methylated in both SaOS-2 and U2OS cells. The CpG island sub-region R6 located in promoter B exon 1β was approximately 51% methylated in SaOS-2 and 25% methylated in U2OS. Region 3 was approximately 28% methylated in normal osteoblasts, whereas the others were unmethylated. Promoter B was re-activated by treatment of SaOS-2 cells with 1 μM 5-azacytidine, which was associated with only a small insignificant change in methylation of sub-region R6. ChIP analysis of U2OS and SaOS-2 cells indicated that the promoter B region is less enriched in the active histone mark H3K4me3, in comparison to promoter A and that there is increased enrichment of the repressive mark H3K27me3 in association with the promoter B genomic region in the cell line SaOS-2. These findings show that epigenetic inactivation of the WNT5A promoter B involves both DNA methylation and histone modifications and suggest that differential expression of the WNT5A alternative promoters A

  6. Inactivation of the WNT5A Alternative Promoter B Is Associated with DNA Methylation and Histone Modification in Osteosarcoma Cell Lines U2OS and SaOS-2.

    Science.gov (United States)

    Vaidya, Himani; Rumph, Candie; Katula, Karen S

    2016-01-01

    WNT5A is a secreted ligand involved in Wnt pathway signaling and has a role in cell movement and differentiation. Altered WNT5A expression is associated with various cancers, although in most studies the focus has been on only one of the known WNT5A isoforms. In this study, we analyzed expression from two of the major WNT5A promoters, termed promoter A and promoter B, in normal human osteoblasts, SaOS-2 and U2OS osteosarcoma cell lines, and osteosarcoma tumor tissue. We found that both promoters A and B are active in normal osteoblasts with nearly 11-fold more promoter B than A transcripts. Promoter B but not promoter A transcripts are decreased or nearly undetectable in the SaOS-2 and U2OS cell lines and osteosarcoma tumor tissues. Transient transfection of promoter A and promoter B reporter constructs confirmed that SaOS-2 cells have the necessary factors to transcribe both promoters. Bisulfite sequencing analysis revealed that three CpG enriched regions upstream of the promoter B exon 1βare highly methylated in both SaOS-2 and U2OS cells. The CpG island sub-region R6 located in promoter B exon 1β was approximately 51% methylated in SaOS-2 and 25% methylated in U2OS. Region 3 was approximately 28% methylated in normal osteoblasts, whereas the others were unmethylated. Promoter B was re-activated by treatment of SaOS-2 cells with 1 μM 5-azacytidine, which was associated with only a small insignificant change in methylation of sub-region R6. ChIP analysis of U2OS and SaOS-2 cells indicated that the promoter B region is less enriched in the active histone mark H3K4me3, in comparison to promoter A and that there is increased enrichment of the repressive mark H3K27me3 in association with the promoter B genomic region in the cell line SaOS-2. These findings show that epigenetic inactivation of the WNT5A promoter B involves both DNA methylation and histone modifications and suggest that differential expression of the WNT5A alternative promoters A and B is a

  7. The Role of Physical Educators in Helping Classroom Teachers to Promote Physical Activity

    Science.gov (United States)

    Russ, Laura

    2015-01-01

    Elementary classroom teachers are an increasingly important constituency in school-based physical activity promotion. This article situates the need for classroom teacher physical-activity promotion at the intersection of what we know about teacher actions, what informs those actions, and what recent research has uncovered. Recommendations are…

  8. Functional relevance of DNA polymorphisms within the promoter region of the prion protein gene and their association to BSE infection.

    Science.gov (United States)

    Kashkevich, Kseniya; Humeny, Andreas; Ziegler, Ute; Groschup, Martin H; Nicken, Petra; Leeb, Tosso; Fischer, Christine; Becker, Cord-Michael; Schiebel, Katrin

    2007-05-01

    Transmissible spongiform encephalopathies (TSEs) are a group of neurodegenerative diseases that can occur spontaneously or can be caused by infection or mutations within the prion protein gene PRNP. Nonsynonymous DNA polymorphisms within the PRNP gene have been shown to influence susceptibility/resistance to infection in sheep and humans. Analysis of DNA polymorphisms within the core promoter region of the PRNP gene in four major German bovine breeds resulted in the identification of both SNPs and insertion/deletion (indel) polymorphisms. Comparative genotyping of both controls and animals that tested positive for bovine spongiform encephalopathy (BSE) revealed a significantly different distribution of two indel polymorphisms and two SNPs within Braunvieh animals, suggesting an association of these polymorphisms with BSE susceptibility. The functional relevance of these polymorphisms was analyzed using reporter gene constructs in neuronal cells. A specific haplotype near exon 1 was identified that exhibited a significantly lower expression level. Genotyping of nine polymorphisms within the promoter region and haplotype calculation revealed that the haplotype associated with the lowest expression level was underrepresented in the BSE group of all breeds compared to control animals, indicating a correlation of reduced PRNP expression and increased resistance to BSE.

  9. Vitamin D-mediated modifications in protein-DNA interactions at two promoter elements of the osterocalcin gene

    International Nuclear Information System (INIS)

    By the combined use of DNase I footprinting, electrophoretic mobility-shift assay, and methylation interference analysis, the authors have identified a series of sequence-specific protein-DNA interactions in the 5' flanking region of the rat osteocalcin gene. Stimulation of osteocalcin gene expression by 1,25-dihydroxyvitamin D3, a physiologic mediator of this bone-specific gene in vitro and in vivo, is associated with modifications in the binding of ROS 17/2.8 cell nuclear factors to two promoter segments that up-regulate transcription. One segment located between -462 and -437 exhibits a vitamin D-dependent increase in sequence-specific binding of nuclear factors. This element (CTGGGTGAATGAGGACATTACT-GACC), identified at single nucleotide resolution, contains a region of hyphenated dyad symmetry and shares sequence homology with consensus steroid-responsive elements and with the sequence that has been identified as the vitamin D receptor binding site in the human osteocalcin gene. They have also observed that vitamin D stimulation of osteocalcin gene expression results in a 5-fold increase in protein binding to the region of the osteocalcin box, a 24-nucleotide segment in the proximal promoter with a CCAAT motif as the central core. The results demonstrate protein-DNA interactions in a vitamin D-responsive element and in a second sequence, the osteocalcin box, both of which are involved in the physiologic regulation of the osteocalcin gene in response to 1,25-dihydroxyvitamin D3

  10. A Comparative Study of G-Quadruplex Unfolding and DNA Reeling Activities of Human RECQ5 Helicase.

    Science.gov (United States)

    Budhathoki, Jagat B; Maleki, Parastoo; Roy, William A; Janscak, Pavel; Yodh, Jaya G; Balci, Hamza

    2016-06-21

    RECQ5 is one of five members of the RecQ family of helicases in humans, which include RECQ1, Bloom (BLM), Werner (WRN), RECQ4, and RECQ5. Both WRN and BLM have been shown to resolve G-quadruplex (GQ) structures. Deficiencies in unfolding GQ are known to result in DNA breaks and genomic instability, which are prominent in Werner and Bloom syndromes. RECQ5 is significant in suppressing sister chromatid exchanges during homologous recombination but its GQ unfolding activity are not known. We performed single-molecule studies under different salt (50-150 mM KCl or NaCl) and ATP concentrations on different GQ constructs including human telomeric GQ (with different overhangs and polarities) and GQ formed by thrombin-binding aptamer to investigate this activity. These studies demonstrated a RECQ5-mediated GQ unfolding activity that was an order of magnitude weaker than BLM and WRN. On the other hand, BLM and RECQ5 demonstrated similar single-stranded DNA (ssDNA) reeling activities that were not coupled to GQ unfolding. These results demonstrate overlap in function between these RecQ helicases; however, the relatively weak GQ destabilization activity of RECQ5 compared to BLM and WRN suggests that RECQ5 is not primarily associated with GQ destabilization, but could substitute for the more efficient helicases under conditions where their activity is compromised. In addition, these results implicate a more general role for helicase-promoted ssDNA reeling activity such as removal of proteins at the replication fork, whereas the association of ssDNA reeling with GQ destabilization is more helicase-specific. PMID:27332117

  11. c-Jun represses the human insulin promoter activity that depends on multiple cAMP response elements

    Energy Technology Data Exchange (ETDEWEB)

    Inagaki, Nobuya; Seino, Yutaka; Imura, Hiroo (Kyoto Univ. (Japan)); Maekawa, Toshio; Sudo, Tatsuhiko; Ishii, Shunsuke (Inst. of Physical and Chemical Research (RIKEN), Tsukuba (Japan))

    1992-02-01

    Glucose is known to increase the cAMP concentration in pancreatic {beta} cells. To determine the mechanism by which cAMP augments insulin gene expression, the authors first identified the cAMP response elements (CREs) of human insulin gene. In DNase I footprint analysis, the bacterially synthesized CRE-binding protein, CRE-BP1, protected four sites: two sites in the region upstream from the insulin core promoter, one site in the first exon, and one site in the first intron. To examine the roles of those four sites, they constructed a series of DNA plasmids in which the wild-type and mutant insulin promoters were linked to the chloramphenicol acetyltransferase gene. Studies of the transcriptional activity of these plasmids after transfection into hamster insulinoma (HIT) cells showed that these four sites contributed additively to the cAMP inducibility of the insulin promoter. Surprisingly, the c-jun protooncogene product (c-Jun) repressed the cAMP-induced activity of the insulin promoter in a cotransfection assay with the c-Jun expression plasmic. Northern blot analysis demonstrated that the level of c-jun mRNA was dramatically increased by glucose deprivation in HIT cells. These results suggest that glucose deprivation in HIT cells. These results suggest that glucose may regulate expression of the human insulin gene through multiple CREs and c-Jun.

  12. Tankyrases Promote Homologous Recombination and Check Point Activation in Response to DSBs.

    Directory of Open Access Journals (Sweden)

    Zita Nagy

    2016-02-01

    Full Text Available DNA lesions are sensed by a network of proteins that trigger the DNA damage response (DDR, a signaling cascade that acts to delay cell cycle progression and initiate DNA repair. The Mediator of DNA damage Checkpoint protein 1 (MDC1 is essential for spreading of the DDR signaling on chromatin surrounding Double Strand Breaks (DSBs by acting as a scaffold for PI3K kinases and for ubiquitin ligases. MDC1 also plays a role both in Non-Homologous End Joining (NHEJ and Homologous Recombination (HR repair pathways. Here we identify two novel binding partners of MDC1, the poly (ADP-ribose Polymerases (PARPs TNKS1 and 2. We find that TNKSs are recruited to DNA lesions by MDC1 and regulate DNA end resection and BRCA1A complex stabilization at lesions leading to efficient DSB repair by HR and proper checkpoint activation.

  13. Tankyrases Promote Homologous Recombination and Check Point Activation in Response to DSBs.

    Science.gov (United States)

    Nagy, Zita; Kalousi, Alkmini; Furst, Audrey; Koch, Marc; Fischer, Benoit; Soutoglou, Evi

    2016-02-01

    DNA lesions are sensed by a network of proteins that trigger the DNA damage response (DDR), a signaling cascade that acts to delay cell cycle progression and initiate DNA repair. The Mediator of DNA damage Checkpoint protein 1 (MDC1) is essential for spreading of the DDR signaling on chromatin surrounding Double Strand Breaks (DSBs) by acting as a scaffold for PI3K kinases and for ubiquitin ligases. MDC1 also plays a role both in Non-Homologous End Joining (NHEJ) and Homologous Recombination (HR) repair pathways. Here we identify two novel binding partners of MDC1, the poly (ADP-ribose) Polymerases (PARPs) TNKS1 and 2. We find that TNKSs are recruited to DNA lesions by MDC1 and regulate DNA end resection and BRCA1A complex stabilization at lesions leading to efficient DSB repair by HR and proper checkpoint activation. PMID:26845027

  14. Tankyrases Promote Homologous Recombination and Check Point Activation in Response to DSBs

    Science.gov (United States)

    Furst, Audrey; Koch, Marc; Fischer, Benoit; Soutoglou, Evi

    2016-01-01

    DNA lesions are sensed by a network of proteins that trigger the DNA damage response (DDR), a signaling cascade that acts to delay cell cycle progression and initiate DNA repair. The Mediator of DNA damage Checkpoint protein 1 (MDC1) is essential for spreading of the DDR signaling on chromatin surrounding Double Strand Breaks (DSBs) by acting as a scaffold for PI3K kinases and for ubiquitin ligases. MDC1 also plays a role both in Non-Homologous End Joining (NHEJ) and Homologous Recombination (HR) repair pathways. Here we identify two novel binding partners of MDC1, the poly (ADP-ribose) Polymerases (PARPs) TNKS1 and 2. We find that TNKSs are recruited to DNA lesions by MDC1 and regulate DNA end resection and BRCA1A complex stabilization at lesions leading to efficient DSB repair by HR and proper checkpoint activation. PMID:26845027

  15. Differential control of Bradyrhizobium japonicum iron stimulon genes through variable affinity of the iron response regulator (Irr) for target gene promoters and selective loss of activator function.

    Science.gov (United States)

    Jaggavarapu, Siddharth; O'Brian, Mark R

    2014-05-01

    Bradyrhizobium japonicum Irr is a conditionally stable transcriptional activator and repressor that accumulates in cells under iron-limited, manganese-replete conditions, but degrades in a haem-dependent manner under high iron conditions, manganese limitation or upon exposure to H2 O2 . Here, we identified Irr-regulated genes that were relatively unresponsive to factors that promote Irr degradation. The promoters of those genes bound Irr with at least 200-fold greater affinity than promoters of the responsive genes, resulting in maintenance of promoter occupancy over a wide cellular Irr concentration range. For Irr-repressible genes, promoter occupancy correlated with transcriptional repression, resulting in differential levels of expression based on Irr affinity for target promoters. However, inactivation of positively controlled genes required neither promoter vacancy nor loss of DNA-binding activity by Irr. Thus, activation and repression functions of Irr may be uncoupled from each other under certain conditions. Abrogation of Irr activation function was haem-dependent, thus haem has two functionally separable roles in modulating Irr activity. The findings imply a greater complexity of control by Irr than can be achieved by conditional stability alone. We suggest that these regulatory mechanisms accommodate the differing needs for Irr regulon genes in response to the prevailing metabolic state of the cell.

  16. CBF mediates adenovirus Ela trans-activation by interaction at the C-terminal promoter targeting domain of conserved region 3.

    Science.gov (United States)

    Agoff, S N; Wu, B

    1994-12-01

    Genetic and biochemical evidence suggest that conserved region 3 (CR3) of the adenovirus Ela polypeptide can provide two distinct and separable functions: an N-terminal transcriptional activation region and a C-terminal promoter targeting region. It is thought that the promoter targeting region of Ela CR3 interacts with promoter-specific transcription factors, thereby bringing the activation region of Ela CR3 in proximity of the promoter. Here we report that CBF, a CCAAT-box-binding factor that regulates hsp70 gene expression and mediates Ela trans-activation in vivo, interacts with the promoter targeting region of Ela CR3 in vitro. Point mutations in Ela CR3 that are defective in stimulating transcription from the hsp70 promoter are also defective in stimulating transcription directed by a synthetic activator, GAL-CBF, composed of the DNA-binding domain of yeast GAL4 fused to CBF. These mutations fall into two classes with respect to their abilities to interact with CBF in vitro. Mutations in the transcriptional activation region of Ela CR3 do not affect binding to CBF, but mutation of the promoter targeting region of Ela CR3 prevents association with CBF in vitro.

  17. Active Kids Active Minds: A Physical Activity Intervention to Promote Learning?

    Science.gov (United States)

    lisahunter; Abbott, Rebecca; Macdonald, Doune; Ziviani, Jennifer; Cuskelly, Monica

    2014-01-01

    This study assessed the feasibility and impact of introducing a programme of an additional 30 minutes per day of moderate physical activity within curriculum time on learning and readiness to learn in a large elementary school in south-east Queensland, Australia. The programme, Active Kids Active Minds (AKAM), involved Year 5 students (n = 107),…

  18. An analysis of the positional distribution of DNA motifs in promoter regions and its biological relevance

    OpenAIRE

    Vinga Susana; Casimiro Ana C; Freitas Ana T; Oliveira Arlindo L

    2008-01-01

    Abstract Background Motif finding algorithms have developed in their ability to use computationally efficient methods to detect patterns in biological sequences. However the posterior classification of the output still suffers from some limitations, which makes it difficult to assess the biological significance of the motifs found. Previous work has highlighted the existence of positional bias of motifs in the DNA sequences, which might indicate not only that the pattern is important, but als...

  19. The human DNA-activated protein kinase, DNA-PK: Substrate specificity

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, C.W.; Connelly, M.A.; Zhang, H.; Sipley, J.A. [Brookhaven National Lab., Upton, NY (United States). Biology Dept.; Lees-Miller, S.P.; Lintott, L.G. [Univ. of Calgary, Alberta (Canada). Dept. of Biological Sciences; Sakaguchi, Kazuyasu; Appella, E. [National Institutes of Health, Bethesda, MD (United States). Lab. of Cell Biology

    1994-11-05

    Although much has been learned about the structure and function of p53 and the probable sequence of subsequent events that lead to cell cycle arrest, little is known about how DNA damage is detected and the nature of the signal that is generated by DNA damage. Circumstantial evidence suggests that protein kinases may be involved. In vitro, human DNA-PK phosphorylates a variety of nuclear DNA-binding, regulatory proteins including the tumor suppressor protein p53, the single-stranded DNA binding protein RPA, the heat shock protein hsp90, the large tumor antigen (TAg) of simian virus 40, a variety of transcription factors including Fos, Jun, serum response factor (SRF), Myc, Sp1, Oct-1, TFIID, E2F, the estrogen receptor, and the large subunit of RNA polymerase II (reviewed in Anderson, 1993; Jackson et al., 1993). However, for most of these proteins, the sites that are phosphorylated by DNA-PK are not known. To determine if the sites that were phosphorylated in vitro also were phosphorylated in vivo and if DNA-PK recognized a preferred protein sequence, the authors identified the sites phosphorylated by DNA-PK in several substrates by direct protein sequence analysis. Each phosphorylated serine or threonine is followed immediately by glutamine in the polypeptide chain; at no other positions are the amino acid residues obviously constrained.

  20. Self-Assembled Tetrahedral DNA Nanostructures Promote Adipose-Derived Stem Cell Migration via lncRNA XLOC 010623 and RHOA/ROCK2 Signal Pathway.

    Science.gov (United States)

    Shi, Sirong; Peng, Qiang; Shao, Xiaoru; Xie, Jing; Lin, Shiyu; Zhang, Tao; Li, Qianshun; Li, Xiaolong; Lin, Yunfeng

    2016-08-01

    Self-assembled tetrahedral DNA nanostructures (TDNs) with precise sizes have been extensively applied in various fields owing to their exceptional mechanical rigidity, structural stability, and modification versatility. In addition, TDNs can be internalized by mammalian cells and remain mainly intact within the cytoplasm by escaping degradation by nucleases. Here, we studied the effects of TDNs on cell migration and the underlying molecular mechanisms. TDNs remarkably enhanced the migration of rat adipose-derived stem cells and down-regulated the long noncoding RNA (lncRNA) XLOC 010623 to activate the mRNA expression of Tiam1 and Rac1. Furthermore, TDNs highly up-regulated the mRNA and protein expression of RHOA, ROCK2, and VCL. These results indicate that TDNs suppressed the transcription of lncRNA XLOC 010623 and activated the TIAM1/RAC1 and RHOA/ROCK2 signaling pathways to promote cell migration. On the basis of these findings, TDNs show a high potential for application in tissue repair and regenerative medicine as a functional three-dimensional DNA nanomaterial. PMID:27403707

  1. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.

    2004-02-01

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  2. Do Topological Charge Solitons Participate in DNA Activity?

    CERN Document Server

    Hermon, Z; Ben-Jacob, E; Hermon, Ziv; Caspi, Shay; Ben-Jacob, Eshel

    1997-01-01

    We present a novel electromagnetic model of DNA molecules, in which the P-bonds act as tunnel junctions and the H-bonds as capacitors. Excess charge in the model gives rise to two coupled modified sine-Gordon equations, which admit topological solitonic excitations. We study the dynamics of the solitons, their effect on the DNA transport properties, and comment about their role in the DNA functioning. We propose specific experiments in order to test our predictions.

  3. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

    Directory of Open Access Journals (Sweden)

    Tatsuya eKon

    2014-11-01

    Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.

  4. Merkel cell polyomavirus large T antigen has growth-promoting and inhibitory activities.

    Science.gov (United States)

    Cheng, Jingwei; Rozenblatt-Rosen, Orit; Paulson, Kelly G; Nghiem, Paul; DeCaprio, James A

    2013-06-01

    Merkel cell carcinoma (MCC) is a rare and aggressive form of skin cancer. In at least 80% of all MCC, Merkel cell polyomavirus (MCPyV) DNA has undergone clonal integration into the host cell genome, and most tumors express the MCPyV large and small T antigens. In all cases of MCC reported to date, the integrated MCPyV genome has undergone mutations in the large T antigen. These mutations result in expression of a truncated large T antigen that retains the Rb binding or LXCXE motif but deletes the DNA binding and helicase domains. However, the transforming functions of full-length and truncated MCPyV large T antigen are unknown. We compared the transforming activities of full-length, truncated, and alternatively spliced 57kT forms of MCPyV large T antigen. MCPyV large T antigen could bind to Rb but was unable to bind to p53. Furthermore, MCPyV-truncated large T antigen was more effective than full-length and 57kT large T antigen in promoting the growth of human and mouse fibroblasts. In contrast, expression of the MCPyV large T antigen C-terminal 100 residues could inhibit the growth of several different cell types. These data imply that the deletion of the C terminus of MCPyV large T antigen found in MCC serves not only to disrupt viral replication but also results in the loss of a distinct growth-inhibitory function intrinsic to this region. PMID:23514892

  5. Cyclin A2 promotes DNA repair in the brain during both development and aging.

    Science.gov (United States)

    Gygli, Patrick E; Chang, Joshua C; Gokozan, Hamza N; Catacutan, Fay P; Schmidt, Theresa A; Kaya, Behiye; Goksel, Mustafa; Baig, Faisal S; Chen, Shannon; Griveau, Amelie; Michowski, Wojciech; Wong, Michael; Palanichamy, Kamalakannan; Sicinski, Piotr; Nelson, Randy J; Czeisler, Catherine; Otero, José J

    2016-07-01

    Various stem cell niches of the brain have differential requirements for Cyclin A2. Cyclin A2 loss results in marked cerebellar dysmorphia, whereas forebrain growth is retarded during early embryonic development yet achieves normal size at birth. To understand the differential requirements of distinct brain regions for Cyclin A2, we utilized neuroanatomical, transgenic mouse, and mathematical modeling techniques to generate testable hypotheses that provide insight into how Cyclin A2 loss results in compensatory forebrain growth during late embryonic development. Using unbiased measurements of the forebrain stem cell niche, we parameterized a mathematical model whereby logistic growth instructs progenitor cells as to the cell-types of their progeny. Our data was consistent with prior findings that progenitors proliferate along an auto-inhibitory growth curve. The growth retardation inCCNA2-null brains corresponded to cell cycle lengthening, imposing a developmental delay. We hypothesized that Cyclin A2 regulates DNA repair and that CCNA2-null progenitors thus experienced lengthened cell cycle. We demonstrate that CCNA2-null progenitors suffer abnormal DNA repair, and implicate Cyclin A2 in double-strand break repair. Cyclin A2's DNA repair functions are conserved among cell lines, neural progenitors, and hippocampal neurons. We further demonstrate that neuronal CCNA2 ablation results in learning and memory deficits in aged mice. PMID:27425845

  6. JAB1 regulates unphosphorylated STAT3 DNA-binding activity through protein–protein interaction in human colon cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Nishimoto, Arata, E-mail: anishimo@yamaguchi-u.ac.jp [Department of Surgery and Clinical Science, Yamaguchi University Graduate School of Medicine, 1-1-1 Minami-Kogushi, Ube, Yamaguchi 755-8505 (Japan); Kugimiya, Naruji; Hosoyama, Toru; Enoki, Tadahiko [Department of Surgery and Clinical Science, Yamaguchi University Graduate School of Medicine, 1-1-1 Minami-Kogushi, Ube, Yamaguchi 755-8505 (Japan); Li, Tao-Sheng [Department of Stem Cell Biology, Nagasaki University Graduate School of Biomedical Sciences, 1-12-4 Sakamoto, Nagasaki 852-8523 (Japan); Hamano, Kimikazu [Department of Surgery and Clinical Science, Yamaguchi University Graduate School of Medicine, 1-1-1 Minami-Kogushi, Ube, Yamaguchi 755-8505 (Japan)

    2013-08-30

    Highlights: •JAB1 interacted with unphosphorylated STAT3 in the nucleus. •JAB1 knockdown tended to increase nuclear STAT3 expression. •JAB1 knockdown significantly decreased unphosphorylated STAT3 DNA-binding activity. •JAB1 knockdown significantly decreased MDR1, NANOG, and VEGF expressions. •Nuclear JAB1, but not nuclear STAT3, correlated with STAT3 DNA-binding activity. -- Abstract: Recent studies have revealed that unphosphorylated STAT3 forms a dimer, translocates to the nucleus, binds to the STAT3 binding site, and activates the transcription of STAT3 target genes, thereby playing an important role in oncogenesis in addition to phosphorylated STAT3. Among signaling steps of unphosphorylated STAT3, nuclear translocation and target DNA-binding are the critical steps for its activation. Therefore, elucidating the regulatory mechanism of these signaling steps of unphosphorylated STAT3 is a potential step in the discovery of a novel cancer drug. However, the mechanism of unphosphorylated STAT3 binding to the promoter of target genes remains unclear. In this study, we focused on Jun activation domain-binding protein 1 (JAB1) as a candidate protein that regulates unphosphorylated STAT3 DNA-binding activity. Initially, we observed that both unphosphorylated STAT3 and JAB1 existed in the nucleus of human colon cancer cell line COLO205 at the basal state (no cytokine stimulation). On the other hand, phosphorylated STAT3 did not exist in the nucleus of COLO205 cells at the basal state. Immunoprecipitation using nuclear extract of COLO205 cells revealed that JAB1 interacted with unphosphorylated STAT3. To investigate the effect of JAB1 on unphosphorylated STAT3 activity, RNAi studies were performed. Although JAB1 knockdown tended to increase nuclear STAT3 expression, it significantly decreased unphosphorylated STAT3 DNA-binding activity. Subsequently, JAB1 knockdown significantly decreased the expression levels of MDR1, NANOG, and VEGF, which are STAT3 target

  7. Sulforaphane inhibits CYP1A1 activity and promotes genotoxicity induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Fangxing, E-mail: fxyang@zju.edu.cn [MOE Key Laboratory of Environmental Remediation and Ecosystem Health, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou, 310058 (China); Zhuang, Shulin [MOE Key Laboratory of Environmental Remediation and Ecosystem Health, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou, 310058 (China); Zhang, Chao; Dai, Heping [State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, 430072 (China); Liu, Weiping, E-mail: wliu@zju.edu.cn [MOE Key Laboratory of Environmental Remediation and Ecosystem Health, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou, 310058 (China)

    2013-06-15

    Increasing environmental pollution by carcinogens such as some of persistent organic pollutants (POPs) has prompted growing interest in searching for chemopreventive compounds which are readily obtainable. Sulforaphane (SFN) is isolated from cruciferous vegetables and has the potentials to reduce carcinogenesis through various pathways. In this study, we studied the effects of SFN on CYP1A1 activity and genotoxicity induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). The results showed that SFN inhibited TCDD-induced CYP1A1 activity in H4IIE cells by directly inhibiting CYP1A1 activity, probably through binding to aryl hydrocarbon receptor and/or CYP1A1 revealed by molecular docking. However, SFN promoted TCDD-induced DNA damage in yeast cells and reduced the viability of initiated yeast cells. Besides, it is surprising that SFN also failed to reduce genotoxicity induced by other genotoxic reagents which possess different mechanisms to lead to DNA damage. Currently, it is difficult to predict whether SFN has the potentials to reduce the risk of TCDD based on the conflicting observations in the study. Therefore, further studies should be urgent to reveal the function and mechanism of SFN in the stress of such POPs on human health. - Highlights: • Sulforaphane inhibited TCDD-induced CYP1A1 activity in H4IIE cells. • Sulforaphane may bind to aryl hydrocarbon receptor and/or CYP1A1. • Sulforaphane promoted TCDD-induced DNA damage in yeast cells. • Sulforaphane may promote DNA damage by DNA strand breaks or DNA alkylation.

  8. The cell-free fetal DNA fraction in maternal blood decreases after physical activity

    DEFF Research Database (Denmark)

    Schlütter, Jacob Mørup; Hatt, Lotte; Bach, Cathrine;

    2014-01-01

    OBJECTIVE: If noninvasive prenatal testing using next generation sequencing is to be effective for pregnant women, a cell-free fetal DNA (cffDNA) fraction above 4% is essential unless the depth of sequencing is increased. This study's objective is to determine whether physical activity has an eff...... prenatal diagnosis based on the fetal fraction, physical activity prior to sampling should be avoided.......OBJECTIVE: If noninvasive prenatal testing using next generation sequencing is to be effective for pregnant women, a cell-free fetal DNA (cffDNA) fraction above 4% is essential unless the depth of sequencing is increased. This study's objective is to determine whether physical activity has...... of cycling with a pulse-rate of 150 beats per minute. The concentrations of cffDNA (DYS14) and cfDNA (RASSF1A) were assessed using quantitative real-time polymerase chain reaction. RESULTS: The fetal fraction decreased significantly in all participants after physical activity (p 

  9. DNA polymerase-α regulates the activation of type I interferons through cytosolic RNA:DNA synthesis.

    Science.gov (United States)

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J; Xing, Chao; Wang, Richard C; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R; Burstein, Ezra

    2016-05-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations that disrupt nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts the expression of POLA1, which encodes the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency resulted in increased production of type I interferons. This enzyme is necessary for the synthesis of RNA:DNA primers during DNA replication and, strikingly, we found that POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Together this work identifies POLA1 as a critical regulator of the type I interferon response.

  10. The cytosolic sensor cGAS detects Mycobacterium tuberculosis DNA to induce type I interferons and activate autophagy

    Science.gov (United States)

    MacDuff, Donna A.; Kimmey, Jacqueline M.; Diner, Elie J.; Olivas, Joanna; Vance, Russell E.; Stallings, Christina L.; Virgin, Herbert W.; Cox, Jeffery S.

    2015-01-01

    Summary Type I interferons (IFNs) are critical mediators of antiviral defense, but their elicitation by bacterial pathogens can be detrimental to hosts. Many intracellular bacterial pathogens, including Mycobacterium tuberculosis, induce type I IFNs following phagosomal membrane perturbations. Cytosolic M. tuberculosis DNA has been implicated as a trigger for IFN production, but the mechanisms remain obscure. We report that the cytosolic DNA sensor, cyclic GMP-AMP synthase (cGAS), is required for activating IFN production via the STING/TBK1/IRF3 pathway during M. tuberculosis and L. pneumophila infection of macrophages, whereas L. monocytogenes short-circuits this pathway by producing the STING agonist, c-di-AMP. Upon sensing cytosolicDNA, cGAS also activates cell-intrinsic antibacterial defenses, promoting autophagic targeting of M. tuberculosis. Importantly, we show that cGAS binds M. tuberculosis DNA during infection, providing direct evidence that this unique host-pathogen interaction occurs in vivo. These data uncover a mechanism by which IFN is likely elicited during active human infections. PMID:26048136

  11. The cAMP signaling system inhibits the repair of γ-ray-induced DNA damage by promoting Epac1-mediated proteasomal degradation of XRCC1 protein in human lung cancer cells

    International Nuclear Information System (INIS)

    Highlights: ► cAMP signaling system inhibits repair of γ-ray-induced DNA damage. ► cAMP signaling system inhibits DNA damage repair by decreasing XRCC1 expression. ► cAMP signaling system decreases XRCC1 expression by promoting its proteasomal degradation. ► The promotion of XRCC1 degradation by cAMP signaling system is mediated by Epac1. -- Abstract: Cyclic AMP is involved in the regulation of metabolism, gene expression, cellular growth and proliferation. Recently, the cAMP signaling system was found to modulate DNA-damaging agent-induced apoptosis by regulating the expression of Bcl-2 family proteins and inhibitors of apoptosis. Thus, we hypothesized that the cAMP signaling may modulate DNA repair activity, and we investigated the effects of the cAMP signaling system on γ-ray-induced DNA damage repair in lung cancer cells. Transient expression of a constitutively active mutant of stimulatory G protein (GαsQL) or treatment with forskolin, an adenylyl cyclase activator, augmented radiation-induced DNA damage and inhibited repair of the damage in H1299 lung cancer cells. Expression of GαsQL or treatment with forskolin or isoproterenol inhibited the radiation-induced expression of the XRCC1 protein, and exogenous expression of XRCC1 abolished the DNA repair-inhibiting effect of forskolin. Forskolin treatment promoted the ubiquitin and proteasome-dependent degradation of the XRCC1 protein, resulting in a significant decrease in the half-life of the protein after γ-ray irradiation. The effect of forskolin on XRCC1 expression was not inhibited by PKA inhibitor, but 8-pCPT-2′-O-Me-cAMP, an Epac-selective cAMP analog, increased ubiquitination of XRCC1 protein and decreased XRCC1 expression. Knockdown of Epac1 abolished the effect of 8-pCPT-2′-O-Me-cAMP and restored XRCC1 protein level following γ-ray irradiation. From these results, we conclude that the cAMP signaling system inhibits the repair of γ-ray-induced DNA damage by promoting the ubiquitin

  12. The cAMP signaling system inhibits the repair of {gamma}-ray-induced DNA damage by promoting Epac1-mediated proteasomal degradation of XRCC1 protein in human lung cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Eun-Ah [Department of Biochemistry and Molecular Biology, Cancer Research Center, Seoul National University College of Medicine, Seoul 110-799 (Korea, Republic of); Juhnn, Yong-Sung, E-mail: juhnn@snu.ac.kr [Department of Biochemistry and Molecular Biology, Cancer Research Center, Seoul National University College of Medicine, Seoul 110-799 (Korea, Republic of)

    2012-06-01

    Highlights: Black-Right-Pointing-Pointer cAMP signaling system inhibits repair of {gamma}-ray-induced DNA damage. Black-Right-Pointing-Pointer cAMP signaling system inhibits DNA damage repair by decreasing XRCC1 expression. Black-Right-Pointing-Pointer cAMP signaling system decreases XRCC1 expression by promoting its proteasomal degradation. Black-Right-Pointing-Pointer The promotion of XRCC1 degradation by cAMP signaling system is mediated by Epac1. -- Abstract: Cyclic AMP is involved in the regulation of metabolism, gene expression, cellular growth and proliferation. Recently, the cAMP signaling system was found to modulate DNA-damaging agent-induced apoptosis by regulating the expression of Bcl-2 family proteins and inhibitors of apoptosis. Thus, we hypothesized that the cAMP signaling may modulate DNA repair activity, and we investigated the effects of the cAMP signaling system on {gamma}-ray-induced DNA damage repair in lung cancer cells. Transient expression of a constitutively active mutant of stimulatory G protein (G{alpha}sQL) or treatment with forskolin, an adenylyl cyclase activator, augmented radiation-induced DNA damage and inhibited repair of the damage in H1299 lung cancer cells. Expression of G{alpha}sQL or treatment with forskolin or isoproterenol inhibited the radiation-induced expression of the XRCC1 protein, and exogenous expression of XRCC1 abolished the DNA repair-inhibiting effect of forskolin. Forskolin treatment promoted the ubiquitin and proteasome-dependent degradation of the XRCC1 protein, resulting in a significant decrease in the half-life of the protein after {gamma}-ray irradiation. The effect of forskolin on XRCC1 expression was not inhibited by PKA inhibitor, but 8-pCPT-2 Prime -O-Me-cAMP, an Epac-selective cAMP analog, increased ubiquitination of XRCC1 protein and decreased XRCC1 expression. Knockdown of Epac1 abolished the effect of 8-pCPT-2 Prime -O-Me-cAMP and restored XRCC1 protein level following {gamma}-ray irradiation. From

  13. The physical therapist's role in physical activity promotion

    NARCIS (Netherlands)

    Verhagen, E.; Engbers, L.

    2009-01-01

    Clinicians are increasingly confronted with the diseases of physical inactivity. Paradoxically, a promising strategy to motivate sedentary individuals to become more active is the opportunity to encourage physical activity related behavioural change when individuals encounter health professionals. A

  14. INVESTIGATION INTO CONSUMER RESPONSE TO SALES PROMOTIONAL ACTIVITIES: THE CASE OF UNILEVER GHANA LIMITED

    Directory of Open Access Journals (Sweden)

    Martin Owusu Ansah

    2013-10-01

    Full Text Available The promotional activities have become more sophisticated and an increasing number of companies are using them to ensure their survival in today’s competitive market. Essentially, the study analyzed the nature of sales promotional activities of Unilever Ghana Limited; determined factors that influence the consumption of Unilever products in Kumasi and finally examined the relationship between sales promotions and the consumption of Unilever products. Primary and secondary data sources were used to select 220 consumers of Unilever in Kumasi and an in-depth interview with the Managers of the companies in Kumasi. Convenient sampling technique was employed in the study. Cross tabulation was done on the demographics whilst a regression model was used to establish the relationship between sales promotions and consumption of products. The findings revealed that Personalities in promotions, Prices in promotions, Messages in promotions and Promotional tools have strong influence on consumption but the Medium in promotion did not have influence on consumption during promotions. It was therefore recommended for celebrities to be used in the company’s promotions.

  15. Promoting physical activity in patients with rheumatoid arthritis

    NARCIS (Netherlands)

    Berg, Machteld Heleen van den

    2007-01-01

    The aim of the thesis was to study: 1. The engagement of patients with RA in various forms of physical activity and their preferences regarding the delivery of physical activity interventions; 2. The evidence regarding the effectiveness of physical activity interventions delivered by means of the I

  16. Promoting Physical Activity: Addressing Barriers and Moving Forward

    Science.gov (United States)

    Beighle, Aaron; Morrow, James R.

    2014-01-01

    The barriers that keep individuals from adopting and maintaining active lifestyles are very complex. Strategies for overcoming these barriers and to incentivize and assist inactive individuals to benefit from physical activity are necessary. In addition, it is important to examine the impact of public policy on active living. As youth physical…

  17. Strategies for Physical Activity Promotion beyond the Physical Education Classroom

    Science.gov (United States)

    Faber, Larry; Kulinna, Pamela Hodges; Darst, Paul

    2007-01-01

    The current need for physical activity has extended beyond the limited time given to students in physical education classes. In order for students to receive appropriate levels of physical activity (i.e., at least 60 minutes per day), it is necessary for physical educators to incorporate physical activity opportunities outside the traditional…

  18. Replication stress activates DNA repair synthesis in mitosis

    DEFF Research Database (Denmark)

    Minocherhomji, Sheroy; Ying, Songmin; Bjerregaard, Victoria A;

    2015-01-01

    mitosis serves as the trigger for completion of DNA replication at CFS loci in human cells. Given that this POLD3-dependent mitotic DNA synthesis is enhanced in aneuploid cancer cells that exhibit intrinsically high levels of chromosomal instability (CIN(+)) and replicative stress, we suggest...

  19. Brusatol Enhances the Radiosensitivity of A549 Cells by Promoting ROS Production and Enhancing DNA Damage

    Directory of Open Access Journals (Sweden)

    Xiaohui Sun

    2016-06-01

    Full Text Available NF-E2-related factor 2 (Nrf2 has been identified as a master regulatory factor in the protection of cells from oxidative and electrophilic stress. However, overexpression of Nrf2 in lung cancer may cause chemoresistance, as well as radioresistance. In this study, we examined the relationship between radioresistance and Nrf2 protein levels in H1299, A549, and H460 cells, and finally chose the A549 cell line to continue with due to its strong radioresistance and high Nrf2 protein levels. We found that the Nrf2 inhibitor, brusatol, could prevent the increase and accumulation of Nrf2 after exposure to irradiation. Additionally, following treatment with 80 nM brusatol, A549 cells became sensitive to irradiation, suffering severe DNA damage. Combination treatment with brusatol and ionizing radiation (IR can distinctly increase the level of reactive oxygen species in A549 cells, causing a 1.8-fold increase compared with the control, and a 1.4-fold increase compared with IR alone. In fact, in the treatment with both brusatol and IR, lung cancer cell proliferation is halted, gradually leading to cell death. Because Nrf2 is closely linked to DNA damage repair, inhibiting the function of Nrf2, as in brusatol treatment, may increase the DNA damage caused by radiotherapy or chemotherapy, possibly enhancing the efficacy of chemotherapeutic drugs. Our study is the first to demonstrate brusatol’s ability to enhance the responsiveness of lung cancer cells to irradiation, and its potential application as a natural sensitizer in radiotherapy.

  20. Brusatol Enhances the Radiosensitivity of A549 Cells by Promoting ROS Production and Enhancing DNA Damage.

    Science.gov (United States)

    Sun, Xiaohui; Wang, Qin; Wang, Yan; Du, Liqing; Xu, Chang; Liu, Qiang

    2016-01-01

    NF-E2-related factor 2 (Nrf2) has been identified as a master regulatory factor in the protection of cells from oxidative and electrophilic stress. However, overexpression of Nrf2 in lung cancer may cause chemoresistance, as well as radioresistance. In this study, we examined the relationship between radioresistance and Nrf2 protein levels in H1299, A549, and H460 cells, and finally chose the A549 cell line to continue with due to its strong radioresistance and high Nrf2 protein levels. We found that the Nrf2 inhibitor, brusatol, could prevent the increase and accumulation of Nrf2 after exposure to irradiation. Additionally, following treatment with 80 nM brusatol, A549 cells became sensitive to irradiation, suffering severe DNA damage. Combination treatment with brusatol and ionizing radiation (IR) can distinctly increase the level of reactive oxygen species in A549 cells, causing a 1.8-fold increase compared with the control, and a 1.4-fold increase compared with IR alone. In fact, in the treatment with both brusatol and IR, lung cancer cell proliferation is halted, gradually leading to cell death. Because Nrf2 is closely linked to DNA damage repair, inhibiting the function of Nrf2, as in brusatol treatment, may increase the DNA damage caused by radiotherapy or chemotherapy, possibly enhancing the efficacy of chemotherapeutic drugs. Our study is the first to demonstrate brusatol's ability to enhance the responsiveness of lung cancer cells to irradiation, and its potential application as a natural sensitizer in radiotherapy. PMID:27347930

  1. Chinese tobacco industry promotional activity on the microblog Weibo.

    Directory of Open Access Journals (Sweden)

    Fan Wang

    Full Text Available BACKGROUND: Although China ratified the WHO Framework Convention on Tobacco Control [FCTC] in 2005, the partial ban on tobacco advertising does not cover the internet. Weibo is one of the most important social media channels in China, using a format similar to its global counterpart, Twitter. The Weibo homepage is a platform to present products, brands and corporate culture. There is great potential for the tobacco industry to exploit Weibo to promote products. METHODS: Seven tobacco industry Weibo accounts that each had more than 5000 fans were selected to examine the content of Weibos established by tobacco companies or their advertising agents. RESULTS: Of the 12073 posts found on the seven accounts, 92.3% (11143 could be classified into six main themes: traditional culture, popular culture, social and business affairs, advertisement, public relations and tobacco culture. Posts under the theme of popular culture accounted for about half of total posts (49%, followed by 'advertisement' and 'tobacco culture' (both at 12%, 'traditional culture' and 'public relations' (both at 11%, and finally 'social and business affairs' (5%. 33% of posts included the words 'cigarette' or 'smoking' and 53% of posts included the tobacco brand name, indicating that tobacco companies carefully construct the topic and content of posts. CONCLUSIONS: Weibo is an important new online marketing tool for the Chinese tobacco industry. Tobacco industry use of Weibo to promote brands and normalize smoking subverts China's ratification of the WHO FCTC. Policy to control tobacco promotion needs reforming to address this widespread circumvention of China's tobacco advertising ban.

  2. Tousled kinase activator, gallic acid, promotes homologous recombinational repair and suppresses radiation cytotoxicity in salivary gland cells.

    Science.gov (United States)

    Timiri Shanmugam, Prakash Srinivasan; Nair, Renjith Parameshwaran; De Benedetti, Arrigo; Caldito, Gloria; Abreo, Fleurette; Sunavala-Dossabhoy, Gulshan

    2016-04-01

    Accidental or medical radiation exposure of the salivary glands can gravely impact oral health. Previous studies have shown the importance of Tousled-like kinase 1 (TLK1) and its alternate start variant TLK1B in cell survival against genotoxic stresses. Through a high-throughput library screening of natural compounds, the phenolic phytochemical, gallic acid (GA), was identified as a modulator of TLK1/1B. This small molecule possesses anti-oxidant and free radical scavenging properties, but in this study, we report that in vitro it promotes survival of human salivary acinar cells, NS-SV-AC, through repair of ionizing radiation damage. Irradiated cells treated with GA show improved clonogenic survival compared to untreated controls. And, analyses of DNA repair kinetics by alkaline single-cell gel electrophoresis and γ-H2AX foci immunofluorescence indicate rapid resolution of DNA breaks in drug-treated cells. Study of DR-GFP transgene repair indicates GA facilitates homologous recombinational repair to establish a functional GFP gene. In contrast, inactivation of TLK1 or its shRNA knockdown suppressed resolution of radiation-induced DNA tails in NS-SV-AC, and homology directed repair in DR-GFP cells. Consistent with our results in culture, animals treated with GA after exposure to fractionated radiation showed better preservation of salivary function compared to saline-treated animals. Our results suggest that GA-mediated transient modulation of TLK1 activity promotes DNA repair and suppresses radiation cytoxicity in salivary gland cells.

  3. Influence of exogenous DNA on macrophage functional activity in experimental radiotherapy

    International Nuclear Information System (INIS)

    A study was made of peritoneal macrophage functional activity in C57BL/6 mice witb transplantable Lewis carcinoma during administration of exogenous DNA and use of local radiotherapy. The results show that the use of exogenous DNA in radiotherapy incroases peritoneal macrophage functional activity in mice with transplantable tumors

  4. Staff's perceptions of the use of evidence-based physical activity promotion strategies for promoting girls' physical activity at afterschool programs: a qualitative study.

    Science.gov (United States)

    Dinkel, Danae; Huberty, Jennifer; Beets, Michael; Tibbits, Melissa

    2014-08-01

    There is a need to improve girls' physical activity (PA) in afterschool programs as girls' PA levels are consistently lower than boys'. An evidence-based professional development framework, the 5 Ms, has been effective in helping staff to improve PA in both girls and boys but further improvements in girls' PA are needed. Little is known about staff's perceptions of using PA promotion strategies to promote girls' PA. Therefore, the purpose of this study was to explore staff perceptions of the use of evidence-based PA promotion strategies for promoting PA in girls. Semi-structured interviews were conducted with staff from three community-based afterschool programs located within a school setting (n=18). Data were analyzed using the process of immersion/crystallization. A majority of staff had some knowledge of PA promotion strategies but few staff consistently utilized these strategies and a majority felt several strategies were unnecessary (i.e., having a PA policy). Newer staff reported depending on senior staff to promote PA in girls. Overall, findings suggest that staff's perceptions may impact their use of PA promotions strategies. The results of this study will contribute to the enhancement of an existing staff training framework (the 5 Ms) to improve girls' PA in afterschool programs.

  5. Structure, function, and tethering of DNA-binding domains in σ⁵⁴ transcriptional activators.

    Science.gov (United States)

    Vidangos, Natasha; Maris, Ann E; Young, Anisa; Hong, Eunmi; Pelton, Jeffrey G; Batchelor, Joseph D; Wemmer, David E

    2013-12-01

    We compare the structure, activity, and linkage of DNA-binding domains (DBDs) from σ(54) transcriptional activators and discuss how the properties of the DBDs and the linker to the neighboring domain are affected by the overall properties and requirements of the full proteins. These transcriptional activators bind upstream of specific promoters that utilize σ(54)-polymerase. Upon receiving a signal the activators assemble into hexamers, which then, through adenosine triphosphate (ATP) hydrolysis, drive a conformational change in polymerase that enables transcription initiation. We present structures of the DBDs of activators nitrogen regulatory protein C 1 (NtrC1) and Nif-like homolog 2 (Nlh2) from the thermophile Aquifex aeolicus. The structures of these domains and their relationship to other parts of the activators are discussed. These structures are compared with previously determined structures of the DBDs of NtrC4, NtrC, ZraR, and factor for inversion stimulation. The N-terminal linkers that connect the DBDs to the central domains in NtrC1 and Nlh2 were studied and found to be unstructured. Additionally, a crystal structure of full-length NtrC1 was solved, but density of the DBDs was extremely weak, further indicating that the linker between ATPase and DBDs functions as a flexible tether. Flexible linking of ATPase and DBDs is likely necessary to allow assembly of the active hexameric ATPase ring. The comparison of this set of activators also shows clearly that strong dimerization of the DBD only occurs when other domains do not dimerize strongly. PMID:23818155

  6. Pseudomonas aeruginosa phage PaP1 DNA polymerase is an A-family DNA polymerase demonstrating ssDNA and dsDNA 3'-5' exonuclease activity.

    Science.gov (United States)

    Liu, Binyan; Gu, Shiling; Liang, Nengsong; Xiong, Mei; Xue, Qizhen; Lu, Shuguang; Hu, Fuquan; Zhang, Huidong

    2016-08-01

    Most phages contain DNA polymerases, which are essential for DNA replication and propagation in infected host bacteria. However, our knowledge on phage-encoded DNA polymerases remains limited. This study investigated the function of a novel DNA polymerase of PaP1, which is the lytic phage of Pseudomonas aeruginosa. PaP1 encodes its sole DNA polymerase called Gp90 that was predicted as an A-family DNA polymerase with polymerase and 3'-5' exonuclease activities. The sequence of Gp90 is homologous but not identical to that of other A-family DNA polymerases, such as T7 DNA polymerases (Pol) and DNA Pol I. The purified Gp90 demonstrated a polymerase activity. The processivity of Gp90 in DNA replication and its efficiency in single-dNTP incorporation are similar to those of T7 Pol with processive thioredoxin (T7 Pol/trx). Gp90 can degrade ssDNA and dsDNA in 3'-5' direction at a similar rate, which is considerably lower than that of T7 Pol/trx. The optimized conditions for polymerization were a temperature of 37 °C and a buffer consisting of 40 mM Tris-HCl (pH 8.0), 30 mM MgCl2, and 200 mM NaCl. These studies on DNA polymerase encoded by PaP1 help advance our knowledge on phage-encoded DNA polymerases and elucidate PaP1 propagation in infected P. aeruginosa. PMID:27052734

  7. Production of anti-double-stranded DNA antibodies in activated lymphocyte derived DNA induced lupus model was dependent on CD4+ T cells.

    Science.gov (United States)

    Wen, Z; Xu, L; Xu, W; Xiong, S

    2012-04-01

    Our previous study demonstrated that activated lymphocyte derived DNA (ALD-DNA) could function as an autoantigen to induce production of anti-double-stranded DNA (anti-dsDNA) antibodies in syngeneic BALB/c mice. Here we carefully evaluated the potential role of T cells in the induction of anti-dsDNA antibody. We demonstrated that ALD-DNA could effectively induce production of anti-dsDNA antibodies in vivo and in vitro. In contrast, ALD-DNA could not induce the generation of anti-dsDNA antibodies in nude mice. We further showed that in vivo depletion of CD3(+) T cells blocked the induction of anti-dsDNA antibodies in BALB/c mice. Notably, we demonstrated that CD4(+) but not CD8(+) T cells conferred ALD-DNA to induce anti-dsDNA antibodies. Finally, we demonstrated that adoptive transfer of CD4(+) T cells could rescue ALD-DNA induced anti-dsDNA antibodies in nude mice. Our results suggested that T helper cells were required for ALD-DNA to induce anti-dsDNA antibodies. These findings could further our understanding about the immunogenic properties of DNA and throw new light on SLE pathogenesis.

  8. Promoting Female Students' Learning Motivation towards Science by Exercising Hands-On Activities

    Science.gov (United States)

    Wen-jin, Kuo; Chia-ju, Liu; Shi-an, Leou

    2012-01-01

    The purpose of this study is to design different hands-on science activities and investigate which activities could better promote female students' learning motivation towards science. This study conducted three types of science activities which contains nine hands-on activities, an experience scale and a learning motivation scale for data…

  9. Linking active DNA demethylation by Thymine DNA Glycosylase with epigenetic regulation of gene expression

    OpenAIRE

    Wirz, Annika

    2014-01-01

    The correct regulation of epigenetic modifications is crucial for cell plasticity and the establishment of cell identity. The underlying molecular mechanisms are not clear, but a role for DNA repair proteins has been implicated in this context, the investigation of which was the overall aim of my PhD thesis. The Thymine DNA Glycosylase (TDG) was described to excise the deamination products of cytosine (C) and 5-methylcytosine (5-mC), thereby initiating base excision repair (BER; Nedderman...

  10. Effect of single-nucleotide polymorphisms -705T/C and -603T/A in P1 promoter region of human insulin-like growth factor-I gene on promoter activity

    Directory of Open Access Journals (Sweden)

    Wei HUANG

    2012-01-01

    Full Text Available Objective  To investigate the effect of single-nucleotide polymorphisms (SNP -705T>C and -603T>A in the P1 promoter region of human insulin-like growth factor I (IGF-I gene on promoter activity. Methods  A total of 152 healthy volunteers were recruited for the present study. The peripheral blood samples were obtained through venipuncture. The total genomic DNA of each blood sample was extracted using the genomic DNA extraction kit. Genotyping of SNP -705T>C and -603T>A in each volunteer was performed based on restriction fragment length polymorphism (RFLP analysis, and the frequencies of each genotype were statistically analyzed. P1 promoter haplotypes and their frequencies were analyzed by PHASE v2.1 software. Luciferase reporter gene assays were adopted to determine the difference in activity between different promoter haplotypes. Results  The total genomic DNA of each volunteer was successfully extracted. Genotyping of SNP -705T>C and -603T>A was also carried out. The genotype frequencies of -705T/T, -705T/C, and -705C/C were the same as those of -603T/T, -603T/ A, and -603A/A, which were 43.4%, 45.4%, and 11.2%, respectively. The frequencies of allelic gene -705T and -705C were the same as those of -603T and -603A, which were 66.1% and 33.9%, respectively. A complete linkage disequilibrium between SNP -705T>C and -603T>A was observed. Moreover, these two SNPs only comprised two types of promoter haplotypes, including -705T/-603T (66.1% and -705C/-603A (33.9%. The results of reporter gene assays showed that the activity of -705C/-603A P1 promoter haplotype was significantly higher than that of -705T/-603T haplotype. Conclusion  SNP -705T>C and -603T>A in the P1 promoter field of human IGF-I gene can affect the activity of the P1 promoter.

  11. Considerations on the promotional activity on the DIY market in Romania

    OpenAIRE

    Mihai FÎNARU; Ioana Bianca CHIŢU

    2015-01-01

    Communication is a component of the marketing mix of great importance for the success of companies on the market. Currently the promotional activity of companies is experiencing a variety of manifestations, the manufacturers and the distributors are always interested in finding ways to promote themselves differently, moreover to draw the attention of consumers and to produce the desired behavior among them. DIY market is a highly competitive market and the promotional technique...

  12. An empirical analysis of the roles, activities and performance of commercial diplomats in promoting international business

    OpenAIRE

    Naray, Olivier; Bezençon, Valéry; Kostecki, Michel

    2015-01-01

    Background Governments seek to promote – beyond the support for individual businesses – increased exports but also the intangible elements, such as nation branding and country positioning for inward foreign direct investment (FDI) and other economic benefits. In this context, commercial diplomats work as State representatives with diplomatic status conducting trade and business promotion activities between a home and a host country supporting directly individual business firms or promoting t...

  13. Videogames to Promote Physical Activity in Older Adults with Schizophrenia.

    Science.gov (United States)

    Leutwyler, Heather; Hubbard, Erin M; Vinogradov, Sophia; Dowling, Glenna A

    2012-10-01

    Older adults with schizophrenia need physical activity interventions to improve their physical health. The purpose of this report is to describe the preliminary acceptability of a videogame-based physical activity program using the Kinect™ for Xbox 360 game system (Microsoft, Redmond, WA) in older adults with schizophrenia.

  14. Green care farms promote activity among elderly people with dementia

    NARCIS (Netherlands)

    Bruin, S.R. de; Oosting, S.J.; Kuin, Y.; Hoefnagels, E.C.M.; Blauw, Y.H.; Groot, C.P.G.M. de; Schols, J.M.G.A.

    2009-01-01

    In the Netherlands, an increasing number of green care farms are providing day care to community-dwelling elderly people with dementia. Currently, it is unknown whether activities, activity participation, and facility use of elderly people with dementia at green care farms differ from those at regul

  15. Use of SPARK to Promote After-School Physical Activity

    Science.gov (United States)

    Herrick, Heidi; Thompson, Hannah; Kinder, Jennifer; Madsen, Kristine A.

    2012-01-01

    Background: The after-school period is potentially an important venue for increasing physical activity for youth. We sought to assess the effectiveness of the Sports, Play, and Recreation for Youth (SPARK) program to increase physical activity and improve cardiorespiratory fitness and weight status among elementary students after school. Methods:…

  16. Measuring the activity of BioBrick promoters using an in vivo reference standard

    Directory of Open Access Journals (Sweden)

    Kelly Jason R

    2009-03-01

    Full Text Available Abstract Background The engineering of many-component, synthetic biological systems is being made easier by the development of collections of reusable, standard biological parts. However, the complexity of biology makes it difficult to predict the extent to which such efforts will succeed. As a first practical example, the Registry of Standard Biological Parts started at MIT now maintains and distributes thousands of BioBrick™ standard biological parts. However, BioBrick parts are only standardized in terms of how individual parts are physically assembled into multi-component systems, and most parts remain uncharacterized. Standardized tools, techniques, and units of measurement are needed to facilitate the characterization and reuse of parts by independent researchers across many laboratories. Results We found that the absolute activity of BioBrick promoters varies across experimental conditions and measurement instruments. We choose one promoter (BBa_J23101 to serve as an in vivo reference standard for promoter activity. We demonstrated that, by measuring the activity of promoters relative to BBa_J23101, we could reduce variation in reported promoter activity due to differences in test conditions and measurement instruments by ~50%. We defined a Relative Promoter Unit (RPU in order to report promoter characterization data in compatible units and developed a measurement kit so that researchers might more easily adopt RPU as a standard unit for reporting promoter activity. We distributed a set of test promoters to multiple labs and found good agreement in the reported relative activities of promoters so measured. We also characterized the relative activities of a reference collection of BioBrick promoters in order to further support adoption of RPU-based measurement standards. Conclusion Relative activity measurements based on an in vivoreference standard enables improved measurement of promoter activity given variation in measurement

  17. Dynamical analysis on gene activity in the presence of repressors and an interfering promoter.

    Science.gov (United States)

    Nakanishi, Hiizu; Mitarai, Namiko; Sneppen, Kim

    2008-11-01

    Transcription is regulated through interplay among transcription factors, an RNA polymerase (RNAP), and a promoter. Even for a simple repressive transcription factor that disturbs promoter activity at initial binding of RNAP, its repression level is not determined solely by the dissociation constant of transcription factor but is sensitive to timescales of processes in RNAP. We first analyze the promoter activity under strong repression by a slow binding repressor, in which case transcription events occur in bursts, followed by long quiescent periods while a repressor binds to the operator; the number of transcription events, bursting, and quiescent times are estimated by reaction rates. We then examine interference effect from an opposing promoter, using the correlation function of initiation events for a single promoter. The interference is shown to de-repress the promoter because RNAPs from the opposing promoter most likely encounter the repressor and remove it in case of strong repression. This de-repression mechanism should be especially prominent for the promoters that facilitate fast formation of open complex with the repressor whose binding rate is slower than approximately 1/s. Finally, we discuss possibility of this mechanism for high activity of promoter PR in the hyp-mutant of lambda-phage. PMID:18658208

  18. Spatio-Temporal Imaging of Promoter Activity in Intact Plant Tissues.

    Science.gov (United States)

    Xiong, Tou Cheu; Sanchez, Frédéric; Briat, Jean-François; Gaymard, Frédéric; Dubos, Christian

    2016-01-01

    Localization and quantification of expression levels of genes help to determine their function. Localization of gene expression is often achieved through the study of their promoter activity. Three main reporter genes β-glucuronidase (GUS), green fluorescent protein (GFP), and luciferase (LUC) have been intensively used to characterize promoter activities, each having its own specificities and advantages. Among them, the LUC reporter gene is best suitable for the analysis of the promoter activity of genes in intact living plants. Here, we describe a LUC-based method that allows to precisely localize and quantify promoter activity at the whole plant level, and to study the mechanisms that are involved in long-distance regulation of gene expression in Arabidopsis thaliana. Imaging LUC signals with a low-light CCD camera allows monitoring promoter activity in time and space in the transgenic plant harboring the promoter fused with the LUC gene. In addition, it allows quantifying change of promoter activities in plant during several hours. PMID:27557763

  19. Dithiocarbamate/piperazine bridged pyrrolobenzodiazepines as DNA-minor groove binders: synthesis, DNA-binding affinity and cytotoxic activity.

    Science.gov (United States)

    Kamal, Ahmed; Sreekanth, Kokkonda; Shankaraiah, Nagula; Sathish, Manda; Nekkanti, Shalini; Srinivasulu, Vunnam

    2015-04-01

    A new series of C8-linked dithiocarbamate/piperazine bridged pyrrolo[2,1-c][1,4]benzodiazepine conjugates (5a-c, 6a,b) have been synthesized and evaluated for their cytotoxic potential and DNA-binding ability. The representative conjugates 5a and 5b have been screened for their cytotoxicity against a panel of 60 human cancer cell lines. Compound 5a has shown promising cytotoxic activity on selected cancer cell lines that display melanoma, leukemia, CNS, ovarian, breast and renal cancer phenotypes. The consequence of further replacement of the 3-cyano-3,3-diphenylpropyl 1-piperazinecarbodithioate in 5b and 5c with 4-methylpiperazine-1-carbodithioate yielded new conjugates 6a and 6b respectively. In addition, the compounds 5c and 6a,b have been evaluated for their in vitro cytotoxicity on some of the selected human cancer cell lines and these conjugates have exhibited significant cytotoxic activity. Further, the DNA-binding ability of these new conjugates has been evaluated by using thermal denaturation (ΔTm) studies. The correlation between structure and DNA-binding ability has been investigated by molecular modeling studies which predicted that 6b exhibits superior DNA-binding ability and these are in agreement with the experimental DNA-binding studies. PMID:25665519

  20. The Myc Transactivation Domain Promotes Global Phosphorylation of the RNA Polymerase II Carboxy-Terminal Domain Independently of Direct DNA Binding▿ †

    Science.gov (United States)

    Cowling, Victoria H.; Cole, Michael D.

    2007-01-01

    Myc is a transcription factor which is dependent on its DNA binding domain for transcriptional regulation of target genes. Here, we report the surprising finding that Myc mutants devoid of direct DNA binding activity and Myc target gene regulation can rescue a substantial fraction of the growth defect in myc−/− fibroblasts. Expression of the Myc transactivation domain alone induces a transcription-independent elevation of the RNA polymerase II (Pol II) C-terminal domain (CTD) kinases cyclin-dependent kinase 7 (CDK7) and CDK9 and a global increase in CTD phosphorylation. The Myc transactivation domain binds to the transcription initiation sites of these promoters and stimulates TFIIH binding in an MBII-dependent manner. Expression of the Myc transactivation domain increases CDK mRNA cap methylation, polysome loading, and the rate of translation. We find that some traditional Myc transcriptional target genes are also regulated by this Myc-driven translation mechanism. We propose that Myc transactivation domain-driven RNA Pol II CTD phosphorylation has broad effects on both transcription and mRNA metabolism. PMID:17242204

  1. Acute dosing and p53-deficiency promote cellular sensitivity to DNA methylating agents.

    Science.gov (United States)

    Chapman, Katherine E; Doak, Shareen H; Jenkins, Gareth J S

    2015-04-01

    Risk assessment of human exposure to chemicals is crucial for understanding whether such agents can cause cancer. The current emphasis on avoidance of animal testing has placed greater importance on in vitro tests for the identification of genotoxicants. Selection of an appropriate in vitro dosing regime is imperative in determining the genotoxic effects of test chemicals. Here, the issue of dosing approaches was addressed by comparing acute and chronic dosing, uniquely using low-dose experiments. Acute 24 h exposures were compared with equivalent dosing every 24 h over 5-day, fractionated treatment periods. The in vitro micronucleus assay was used to measure clastogenicity induced by methyl methanesulfonate (MMS) and N-methyl-N-nitrosourea (MNU) in human lymphoblastoid cell line, TK6. Quantitative real-time (qRT) PCR was used to measure mRNA level induction of DNA repair enzymes. Lowest observed genotoxic effect levels (LOGELs) for MMS were obtained at 0.7 µg/ml for the acute study and 1.0 µg/ml for the chronic study. For acute MNU dosing, a LOGEL was observed at 0.46 µg/ml, yet genotoxicity was completely removed following the chronic study. Interestingly, acute MNU dosing demonstrated a statistically significant decrease at 0.009 µg/ml. Levels of selected DNA repair enzymes did not change significantly following doses tested. However, p53 deficiency (using the TK6-isogenic cell line, NH32) increased sensitivity to MMS during chronic dosing, causing this LOGEL to equate to the acute treatment LOGEL. In the context of the present data for 2 alkylating agents, chronic dosing could be a valuable in vitro supplement to acute dosing and could contribute to reduction of unnecessary in vivo follow-up tests. PMID:25595616

  2. The BPV-1 E2 DNA-contact helix cysteine is required for transcriptional activation but not replication in mammalian cells.

    Science.gov (United States)

    Grossel, M J; Barsoum, J; Prakash, S S; Androphy, E J

    1996-03-01

    The papillomavirus E2 protein contains an amino-terminal region thought necessary and sufficient to support transcriptional activation and a carboxy-terminal region shown to direct sequence-specific DNA binding and dimerization. A cysteine residue in the center of the E2 DNA recognition helix is highly conserved among papillomavirus E2 proteins. Mutations of this cysteine in bovine papillomavirus type 1 E2 to serine and glycine resulted in proteins which failed to activate E2-dependent promoters in mammalian cells. These E2 mutants were DNA-binding competent, dimeric, and nuclear. When fused to the VP16 transactivation domain, C-terminal regions of E2 containing the mutations at 340 supported transcriptional activation, indicating that the heterologous trans-activation domain did not require cysteine in the DNA-binding helix as did the full-length E2 transactivating protein. Although cysteine-340 was required for transcriptional activation it was not required for DNA replication in vivo. Together, these results suggest that the E2 DNA-binding domain may directly contribute to functions of transcriptional activation previously thought limited to the N-terminal domain. PMID:8599215

  3. Targeting and timing promotional activities : An agent-based model for the takeoff of new products

    NARCIS (Netherlands)

    Delre, S. A.; Jager, W.; Bijmolt, T. H. A.; Janssen, M. A.

    2007-01-01

    Many marketing efforts focus on promotional activities that support the launch of new products. Promotional strategies may play a crucial role in the early stages of the product life cycle, and determine to a large extent the diffusion of a new product. This paper proposes an agent-based model to si

  4. Investigating message-framing effects in the context of a tailored intervention promoting physical activity.

    NARCIS (Netherlands)

    Riet, van 't J.P.; Ruiter, R.A.C.; Werrij, M.Q.; Vries, de H.

    2010-01-01

    Health-promoting messages can be framed in terms of the gains associated with healthy behaviour or the losses associated with unhealthy behaviour. It has been argued that gain-framed messages promoting physical activity (PA) are more effective than loss-framed messages, but empirical findings are in

  5. Biological Activity of the Alternative Promoters of the Dictyostelium discoideum Adenylyl Cyclase A Gene.

    Science.gov (United States)

    Rodriguez-Centeno, Javier; Sastre, Leandro

    2016-01-01

    Amoebae of the Dictyostelium discoideum species form multicellular fruiting bodies upon starvation. Cyclic adenosine monophosphate (cAMP) is used as intercellular signalling molecule in cell-aggregation, cell differentiation and morphogenesis. This molecule is synthesized by three adenylyl cyclases, one of which, ACA, is required for cell aggregation. The gene coding for ACA (acaA) is transcribed from three different promoters that are active at different developmental stages. Promoter 1 is active during cell-aggregation, promoters 2 and 3 are active in prespore and prestalk tip cells at subsequent developmental stages. The biological relevance of acaA expression from each of the promoters has been studied in this article. The acaA gene was expressed in acaA-mutant cells, that do not aggregate, under control of each of the three acaA promoters. acaA expression under promoter 1 control induced cell aggregation although subsequent development was delayed, very small fruiting bodies were formed and cell differentiation genes were expressed at very low levels. Promoter 2-driven acaA expression induced the formation of small aggregates and small fruiting bodies were formed at the same time as in wild-type strains and differentiation genes were also expressed at lower levels. Expression of acaA from promoter 3 induced aggregates and fruiting bodies formation and their size and the expression of differentiation genes were more similar to that of wild-type cells. Expression of acaA from promoters 1 and 2 in AX4 cells also produced smaller structures. In conclusion, the expression of acaA under control of the aggregation-specific Promoter 1 is able to induce cell aggregation in acaA-mutant strains. Expression from promoters 2 and 3 also recovered aggregation and development although promoter 3 induced a more complete recovery of fruiting body formation.

  6. Complement activation promotes muscle inflammation during modified muscle use

    Science.gov (United States)

    Frenette, J.; Cai, B.; Tidball, J. G.

    2000-01-01

    Modified muscle use can result in muscle inflammation that is triggered by unidentified events. In the present investigation, we tested whether the activation of the complement system is a component of muscle inflammation that results from changes in muscle loading. Modified rat hindlimb muscle loading was achieved by removing weight-bearing from the hindlimbs for 10 days followed by reloading through normal ambulation. Experimental animals were injected with the recombinant, soluble complement receptor sCR1 to inhibit complement activation. Assays for complement C4 or factor B in sera showed that sCR1 produced large reductions in the capacity for activation of the complement system through both the classical and alternative pathways. Analysis of complement C4 concentration in serum in untreated animals showed that the classical pathway was activated during the first 2 hours of reloading. Analysis of factor B concentration in untreated animals showed activation of the alternative pathway at 6 hours of reloading. Administration of sCR1 significantly attenuated the invasion of neutrophils (-49%) and ED1(+) macrophages (-52%) that occurred in nontreated animals after 6 hours of reloading. The presence of sCR1 also reduced significantly the degree of edema by 22% as compared to untreated animals. Together, these data show that increased muscle loading activated the complement system which then briefly contributes to the early recruitment of inflammatory cells during modified muscle loading.

  7. Altered DNA methylation patterns of the H19 differentially methylated region and the DAZL gene promoter are associated with defective human sperm.

    Directory of Open Access Journals (Sweden)

    Bo Li

    Full Text Available DNA methylation disturbance is associated with defective human sperm. However, oligozoospermia (OZ and asthenozoospermia (AZ usually present together, and the relationship between the single-phenotype defects in human sperm and DNA methylation is poorly understood. In this study, 20 infertile OZ patients and 20 infertile AZ patients were compared with 20 fertile normozoospermic men. Bisulfate-specific PCR was used to analyze DNA methylation of the H19-DMR and the DAZL promoter in these subjects. A similar DNA methylation pattern of the H19-DMR was detected in AZ and NZ(control, with only complete methylation and mild hypomethylation(0.05. However, the methylation pattern of severe hypomethylation (>50% unmethylated CpGs and complete unmethylation was only detected in 5 OZ patients, and the occurrence of these two methylation patterns was 8.54±10.86% and 9±6.06%, respectively. Loss of DNA methylation of the H19-DMR in the OZ patients was found to mainly occur in CTCF-binding site 6, with occurrence of 18.15±14.71%, which was much higher than that in patients with NZ (0.84±2.05% and AZ (0.58±1.77% (P20% methylated clones in the DAZL promoter only in infertile patients, there was no significant difference between the AZ and OZ patients in the proportion of moderately-to-severely hypermethylated clones (p>0.05. In all cases, global sperm genome methylation analyses, using LINE1 transposon as the indicator, showed that dysregulation of DNA methylation is specifically associated with the H19-DMR and DAZL promoter. Therefore, abnormal DNA methylation status of H19-DMR, especially at the CTCF-binding site 6, is closely associated with OZ. Abnormal DNA methylation of the DAZL promoter might represent an epigenetic marker of male infertility.

  8. Helicobacter pylori AddAB helicase-nuclease and RecA promote recombination-related DNA repair and survival during stomach colonization

    OpenAIRE

    Amundsen, Susan K.; Fero, Jutta; Hansen, Lori M.; Cromie, Gareth A.; Solnick, Jay V.; Smith, Gerald R.; Salama, Nina R.

    2008-01-01

    Helicobacter pylori colonization of the human stomach is characterized by profound disease-causing inflammation. Bacterial proteins that detoxify reactive oxygen species or recognize damaged DNA adducts promote infection, suggesting that H. pylori requires DNA damage-repair for successful in vivo colonization. The molecular mechanisms of repair remain unknown. We identified homologs of the AddAB class of helicase-nuclease enzymes, related to the Escherichia coli RecBCD enzyme, which, with Rec...

  9. Construction and use of lambda PL promoter vectors for direct cloning and high level expression of PCR amplified DNA coding sequences.

    OpenAIRE

    Cheng, X.; Patterson, T A

    1992-01-01

    A set of plasmid vectors which allow single-step cloning and expression of PCR-amplified DNA coding sequences has been constructed. The vectors contain the phage lambda PL promoter, a synthetic translation initiation region (TIR), and convenient cloning sites. The cloning sites provide all or part of an AUG translation initiation codon and facilitate the precise fusion of target DNA sequences to vector transcriptional and translational signals. The vectors were constructed with synthetic TIRs...

  10. Synthesis, DNA Binding, and Antiproliferative Activity of Novel Acridine-Thiosemicarbazone Derivatives.

    Science.gov (United States)

    de Almeida, Sinara Mônica Vitalino; Lafayette, Elizabeth Almeida; da Silva, Lúcia Patrícia Bezerra Gomes; Amorim, Cézar Augusto da Cruz; de Oliveira, Tiago Bento; Ruiz, Ana Lucia Tasca Gois; de Carvalho, João Ernesto; de Moura, Ricardo Olímpio; Beltrão, Eduardo Isidoro Carneiro; de Lima, Maria do Carmo Alves; de Carvalho Júnior, Luiz Bezerra

    2015-01-01

    In this work, the acridine nucleus was used as a lead-compound for structural modification by adding different substituted thiosemicarbazide moieties. Eight new (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide derivatives (3a-h) were synthesized, their antiproliferative activities were evaluated, and DNA binding properties were performed with calf thymus DNA (ctDNA) by electronic absorption and fluorescence spectroscopies. Both hyperchromic and hypochromic effects, as well as red or blue shifts were demonstrated by addition of ctDNA to the derivatives. The calculated binding constants ranged from 1.74 × 10(4) to 1.0 × 10(6) M(-1) and quenching constants from -0.2 × 10(4) to 2.18 × 10(4) M(-1) indicating high affinity to ctDNA base pairs. The most efficient compound in binding to ctDNA in vitro was (Z)-2-(acridin-9-ylmethylene)-N- (4-chlorophenyl) hydrazinecarbothioamide (3f), while the most active compound in antiproliferative assay was (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide (3a). There was no correlation between DNA-binding and in vitro antiproliferative activity, but the results suggest that DNA binding can be involved in the biological activity mechanism. This study may guide the choice of the size and shape of the intercalating part of the ligand and the strategic selection of substituents that increase DNA-binding or antiproliferative properties. PMID:26068233

  11. Synthesis, DNA Binding, and Antiproliferative Activity of Novel Acridine-Thiosemicarbazone Derivatives

    Directory of Open Access Journals (Sweden)

    Sinara Mônica Vitalino de Almeida

    2015-06-01

    Full Text Available In this work, the acridine nucleus was used as a lead-compound for structural modification by adding different substituted thiosemicarbazide moieties. Eight new (Z-2-(acridin-9-ylmethylene-N-phenylhydrazinecarbothioamide derivatives (3a–h were synthesized, their antiproliferative activities were evaluated, and DNA binding properties were performed with calf thymus DNA (ctDNA by electronic absorption and fluorescence spectroscopies. Both hyperchromic and hypochromic effects, as well as red or blue shifts were demonstrated by addition of ctDNA to the derivatives. The calculated binding constants ranged from 1.74 × 104 to 1.0 × 106 M−1 and quenching constants from −0.2 × 104 to 2.18 × 104 M−1 indicating high affinity to ctDNA base pairs. The most efficient compound in binding to ctDNA in vitro was (Z-2-(acridin-9-ylmethylene-N- (4-chlorophenyl hydrazinecarbothioamide (3f, while the most active compound in antiproliferative assay was (Z-2-(acridin-9-ylmethylene-N-phenylhydrazinecarbothioamide (3a. There was no correlation between