WorldWideScience

Sample records for active tuberculosis tb

  1. Tuberculosis (TB): Treatment

    Science.gov (United States)

    ... Education & Training Home Conditions Tuberculosis (TB) Tuberculosis: Treatment Tuberculosis: Treatment Make an Appointment Refer a Patient Ask ... or bones is treated longer. NEXT: Preventive Treatment Tuberculosis: Diagnosis Tuberculosis: History Clinical Trials For more than ...

  2. Tuberculosis (TB)

    Science.gov (United States)

    ... with facebook share with twitter share with linkedin Tuberculosis Go to Information for Researchers ► Credit: NIAID Scanning ... are drug resistant. Why Is the Study of Tuberculosis a Priority for NIAID? Tuberculosis is one of ...

  3. Tuberculosis Facts - Exposure to TB

    Science.gov (United States)

    Tuberculosis (TB) Facts Exposure to TB What is TB? “TB” is short for a disease called tuberculosis. TB is spread through the air from one ... Viral Hepatitis, STD, and TB Prevention Division of Tuberculosis Elimination

  4. Tuberculosis Facts - Testing for TB

    Science.gov (United States)

    Tuberculosis (TB) Facts Testing for TB What is TB? “TB” is short for a disease called tuberculosis. TB is spread through the air from one ... Viral Hepatitis, STD, and TB Prevention Division of Tuberculosis Elimination

  5. HIV and Tuberculosis (TB)

    Science.gov (United States)

    ... AIDS Drugs Clinical Trials Apps skip to content HIV and Opportunistic Infections, Coinfections, and Conditions Home Understanding ... 4 p.m. ET) Send us an email HIV and Tuberculosis (TB) Last Reviewed: June 14, 2018 ...

  6. Tuberculosis Facts - TB and HIV/AIDS

    Science.gov (United States)

    Tuberculosis (TB) Facts TB and HIV/AIDS What is TB? “TB” is short for a disease called tuberculosis. TB is spread through the air from one ... Viral Hepatitis, STD, and TB Prevention Division of Tuberculosis Elimination

  7. Tuberculosis Facts - You Can Prevent TB

    Science.gov (United States)

    Tuberculosis (TB) Facts You Can Prevent TB What is TB? “TB” is short for a disease called tuberculosis. TB is spread through the air from one ... Viral Hepatitis, STD, and TB Prevention Division of Tuberculosis Elimination TB Facts: You Can Prevent TB What ...

  8. Tuberculosis Facts - TB Can Be Treated

    Science.gov (United States)

    Tuberculosis (TB) Facts TB Can Be Treated What is TB? “TB” is short for a disease called tuberculosis. TB is spread through the air from one ... Viral Hepatitis, STD, and TB Prevention Division of Tuberculosis Elimination Page 1 of 2 TB Facts: TB ...

  9. The risk factor of false-negative and false-positive for T-SPOT.TB in active tuberculosis.

    Science.gov (United States)

    Di, Li; Li, Yan

    2018-02-01

    T-SPOT.TB is a promising diagnosis tool to identify both pulmonary tuberculosis and extrapulmonary tuberculosis, as well as latent tuberculosis; however, the factors that affect the results of T-SPOT.TB remains unclear. In this study, we aim to figure out the risk factor of T-SPOT.TB for active TB. A total of 349 patients were recruited between January 1st, 2016 and January 22st, 2017 at Renmin Hospital of Wuhan University, including 98 subjects with TB and 251 subjects with non-TB disease, and received T-SPOT.TB (Oxford Immunotec Ltd). Statistics were analyzed by SPSS 19.0 using logistic regression. The overall specificity and sensitivity of the T-SPOT.TB was 92.83% (233/251; 95%CI 0.8872-0.9557) and 83.67% (82/98; 95%CI 0.7454-0.9010), respectively. Patients with tuberculous meningitis were more likely to have false-negative results (OR 17.4, 95%CI 3.068-98.671; P.05). Tuberculous meningitis was a risk factor of false-negative for T-SPOT.TB, while cured TB was a risk factor of false-positive. © 2017 Wiley Periodicals, Inc.

  10. Pulmonary Immune-Compartment-Specific Interferon Gamma Responses in HIV-Infected Individuals with Active Tuberculosis (TB in an Area of High TB Prevalence

    Directory of Open Access Journals (Sweden)

    S. Buldeo

    2012-01-01

    Full Text Available There is a paucity of data on the pulmonary immune-compartment interferon gamma (IFNγ response to M. tuberculosis, particularly in settings of high tuberculosis (TB prevalence and in HIV-coinfected individuals. This data is necessary to understand the diagnostic potential of commercially available interferon gamma release assays (IGRAs in both the pulmonary immune-compartment and peripheral blood. We used intracellular cytokine staining by flow cytometry to assess the IFNγ response to purified protein derivative (PPD and early secretory antigen 6 (ESAT6 in induced sputa (ISp and blood samples from HIV-infected, smear-negative, TB suspects. We found that individuals with active TB disease produced significantly less IFNγ in response to PPD in their induced sputa samples than individuals with non-active TB (control group. This difference was not reflected in the peripheral blood, even within the CD27− CD4+ memory T lymphocyte population. These findings suggest that progression to active TB disease may be associated with the loss of IFNγ secretion at the site of primary infection. Our findings highlight the importance of studying pulmonary immune-compartment M. tuberculosis specific responses to elucidate IFNγ secretion across the spectrum of TB disease.

  11. QuantiFERON®-TB gold in-tube performance for diagnosing active tuberculosis in children and adults in a high burden setting

    DEFF Research Database (Denmark)

    Rose, Michala Vaaben; Kimaro, Godfather; Nissen, Thomas N

    2012-01-01

    To determine whether QuantiFERON®-TB Gold In-Tube (QFT) can contribute to the diagnosis of active tuberculosis (TB) in children in a high-burden setting and to assess the performance of QFT and tuberculin skin test (TST) in a prospective cohort of TB suspect children compared to adults with confi......To determine whether QuantiFERON®-TB Gold In-Tube (QFT) can contribute to the diagnosis of active tuberculosis (TB) in children in a high-burden setting and to assess the performance of QFT and tuberculin skin test (TST) in a prospective cohort of TB suspect children compared to adults...

  12. Analysis of Factors Influencing Diagnostic Accuracy of T-SPOT.TB for Active Tuberculosis in Clinical Practice.

    Science.gov (United States)

    Zhang, Lifan; Shi, Xiaochun; Zhang, Yueqiu; Zhang, Yao; Huo, Feifei; Zhou, Baotong; Deng, Guohua; Liu, Xiaoqing

    2017-08-10

    T-SPOT.TB didn't perform a perfect diagnosis for active tuberculosis (ATB), and some factors may influence the results. We did this study to evaluate possible factors associated with the sensitivity and specificity of T-SPOT.TB, and the diagnostic parameters under varied conditions. Patients with suspected ATB were enrolled prospectively. Influencing factors of the sensitivity and specificity of T-SPOT.TB were evaluated using logistic regression models. Sensitivity, specificity, predictive values (PV), and likelihood ratios (LR) were calculated with consideration of relevant factors. Of the 865 participants, 205 (23.7%) had ATB, including 58 (28.3%) microbiologically confirmed TB and 147 (71.7%) clinically diagnosed TB. 615 (71.7%) were non-TB. 45 (5.2%) cases were clinically indeterminate and excluded from the final analysis. In multivariate analysis, serous effusion was the only independent risk factor related to lower sensitivity (OR = 0.39, 95% CI: 0.18-0.81) among patients with ATB. Among non-TB patients, age, TB history, immunosuppressive agents/glucocorticoid treatment and lymphocyte count were the independent risk factors related to specificity of T-SPOT.TB. Sensitivity, specificity, PV+, PV-, LR+ and LR- of T-SPOT.TB for diagnosis of ATB were 78.5%, 74.1%, 50.3%, 91.2%, 3.0 and 0.3, respectively. This study suggests that influencing factors of sensitivity and specificity of T-SPOT.TB should be considered for interpretation of T-SPOT.TB results.

  13. Comparison of sensitivity of quantiferon-tb gold test and tuberculin skin test in active pulmonary tuberculosis

    International Nuclear Information System (INIS)

    Khalil, K.F.; Ambreen, A.; Butt, T.

    2013-01-01

    Objective: To compare the sensitivity of tuberculin skin test (TST) and quantiFERON-TB gold test (QFT-G) in active pulmonary tuberculosis. Study Design: Analytical study. Place and Duration of Study: Department of Pulmonology, Fauji Foundation Hospital, Rawalpindi, from July 2011 to January 2012. Methodology: QuantiFERON-TB gold test (QFT-G) was evaluated and compared it with tuberculin skin test (TST) in 50 cases of active pulmonary tuberculosis, in whom tuberculous infection was suspected on clinical, radiological and microbiological grounds. Sensitivity was determined against positive growth for Mycobacterium tuberculosis. Results: Out of 50 cases, 43 were females and 7 were males. The mean age was 41.84 A+- 19.03 years. Sensitivity of QFT-G was 80% while that of TST was 28%. Conclusion: QFT-G has much higher sensitivity than TST for active pulmonary tuberculosis. It is unaffected by prior BCG administration and prior exposure to atypical mycobacteria. A positive QFT-G result can be an adjunct to diagnosis in patients having clinical and radiological data compatible with pulmonary tuberculosis. (author)

  14. Sensitivity and specificity of QuantiFERON-TB Gold Plus compared with QuantiFERON-TB Gold In-Tube and T-SPOT.TB on active tuberculosis in Japan.

    Science.gov (United States)

    Takasaki, Jin; Manabe, Toshie; Morino, Eriko; Muto, Yoshikazu; Hashimoto, Masao; Iikura, Motoyasu; Izumi, Shinyu; Sugiyama, Haruhito; Kudo, Koichiro

    2018-03-01

    The QuantiFERON-TB Gold Plus (QFT-Plus) was introduced in 2015 as a new generation of interferon-gamma release assays (IGRAs) designed to detect Mycobacterium tuberculosis infection (TB). Examination of its diagnostic accuracy is crucial before it is launched in Japan. We examined 99 patients with laboratory-confirmed active TB (patients) and 117 healthy volunteers with no risk of TB infection (controls) at a medical center in Tokyo, Japan. Blood samples were collected from both the patients and controls and tested using three types of IGRAs: the QFT-Plus, the QuantiFERON-TB Gold In-Tube (QFT-GIT), and the T-SPOT.TB (T-SPOT). The sensitivity and specificity of each IGRA were examined and compared. The sensitivity of the QFT-Plus was 98.9% (95% confidence interval [CI], 0.934-0.998) and similar to that of the QFT-GIT (97.9%; 95% CI, 0.929-0.998) and T-SPOT (96.9%; 95% CI, 0.914-0.994). The specificity of the QFT-Plus was the same as that of the QFT-GIT and T-SPOT (98.1%; 95% CI, 0.934-0.998). One patient with uncontrolled diabetes mellitus showed negative results on all three IGRAs. The QFT-Plus showed a high degree of agreement with the QFT-GIT and T-SPOT, with high sensitivity and specificity. Severe diabetes mellitus may influence the results of IGRAs. Larger studies are needed to validate the accuracy of the GFT-Plus and determine whether it can contribute as adjunctive method for the early diagnosis of active TB in Japan. Copyright © 2017 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  15. Survey on medicinal plants traditionally used in Senegal for the treatment of tuberculosis (TB) and assessment of their antimycobacterial activity.

    Science.gov (United States)

    Diop, ElHadji Assane; Queiroz, Emerson Ferreira; Kicka, Sébastien; Rudaz, Serge; Diop, Tahir; Soldati, Thierry; Wolfender, Jean-Luc

    2018-04-24

    In West Africa, populations are used to taking traditional medicine as a first aid against common health problems. In this aspect, many plants are claimed to be effective in the treatment of Tuberculosis (TB), which according to the World Health Organization (WHO) remains one of the world's deadliest communicable diseases. The main aim of this study was to identify plants used to treat TB-symptoms by the population of Senegal and to evaluate their possible concomitant use with clinically approved TB-drugs. This approach allowed the selection of plants effectively used in traditional medicine. In order to verify if the usage of some of these plants can be rationalized, the activity of their traditional preparations was assessed with both an intracellular and extracellular antimycobacterial host-pathogen assays. An ethnopharmacological survey conducted on 117 TB-patients and 30 healers in Senegal from March to May 2014. The questionnaires were focused on the use of medicinal plants to treat common TB -symptoms (cough longer than 2 weeks, fever, night sweats, weight loss and bloody sputum). Local plant names, utilized organs (herbal drugs) and traditional formulations of the plants were recorded. Extracts were prepared by mimicking the traditional decoction in boiling water and screened for their antimycobacterial activity using Mycobacterium marinum, as a validated TB surrogate, and an Acanthamoeba castellanii - M. marinum whole-cell based host-pathogen assay, to detect anti-infective activities. By the end of the survey, nearly 30 plants were cited and the 12 most cited herbal drugs were collected and their usage documented by extensive literature search. Extracts of the chosen herbs were screened with the described assays; with a main focus on traditional formulas (mainly herbal decoctions). Two of the water extracts from Combretum aculeatum and Guiera senegalensis showed significant antimycobacterial activities when compared to the positive control drug (rifampin

  16. Tuberculosis: Learn the Signs and Symptoms of TB Disease

    Science.gov (United States)

    ... this? Submit What's this? Submit Button Past Emails Tuberculosis (TB) Disease: Symptoms and Risk Factors Language: English ( ... Español (Spanish) Recommend on Facebook Tweet Share Compartir Tuberculosis (TB) is a disease caused by bacteria that ...

  17. QuantiFERON®-TB gold in-tube performance for diagnosing active tuberculosis in children and adults in a high burden setting.

    Directory of Open Access Journals (Sweden)

    Michala V Rose

    Full Text Available AIM: To determine whether QuantiFERON®-TB Gold In-Tube (QFT can contribute to the diagnosis of active tuberculosis (TB in children in a high-burden setting and to assess the performance of QFT and tuberculin skin test (TST in a prospective cohort of TB suspect children compared to adults with confirmed TB in Tanzania. METHODS: Sensitivity and specificity of QFT and TST for diagnosing active TB as well as indeterminate QFT rates and IFN-γ levels were assessed in 211 TB suspect children in a Tanzanian district hospital and contrasted in 90 adults with confirmed pulmonary TB. RESULTS: Sensitivity of QFT and TST in children with confirmed TB was 19% (5/27 and 6% (2/31 respectively. In adults sensitivity of QFT and TST was 84% (73/87 and 85% (63/74. The QFT indeterminate rate in children and adults was 27% and 3%. Median levels of IFN-γ were lower in children than adults, particularly children <2 years and HIV infected. An indeterminate result was associated with age <2 years but not malnutrition or HIV status. Overall childhood mortality was 19% and associated with an indeterminate QFT result at baseline. CONCLUSION: QFT and TST showed poor performance and a surprisingly low sensitivity in children. In contrast the performance in Tanzanian adults was good and comparable to performance in high-income countries. Indeterminate results in children were associated with young age and increased mortality. Neither test can be recommended for diagnosing active TB in children with immature or impaired immunity in a high-burden setting.

  18. [CLINICAL UTILITY OF T-SPOT.TB ASSAY WITH T-Cell Xtend REAGENT FOR ACTIVE TUBERCULOSIS DIAGNOSIS IN THE FIELD TEST AT OUR HOSPITAL].

    Science.gov (United States)

    Nemoto, Kenji; Oh-ishi, Shuji; Taguchi, Masato; Hyodo, Kentaro; Kanazawa, Jun; Miura, Yukiko; Takaku, Takio; Usui, Shingo; Hayashihara, Kenji; Saito, Takefumi

    2016-04-01

    T-SPOT.TB (T-SPOT), an interferon-gamma release assay, has shown promise as a diagnostic tool for active tuberculosis (TB), and its use is expanding. Addition of the T-Cell Xtend (TCX) reagent may allow delayed processing, and this characteristic is important for using this test in the field. However, limited data is available on the usefulness of T-SPOT with TCX as a field test for diagnosing active TB. To investigate the clinical utility of T-SPOT with TCX and the risk factors for a false-negative result in patients with active TB. A total of 57 patients with active TB who underwent the T-SPOT test with TCX prior to treatment were enrolled between May 2013 and May 2015. One patient with an indeterminate result for T-SPOT was excluded; therefore, the data of 56 patients were eventually included in the final analysis. The basic characteristics and clinical findings were compared between the true-positive and false-negative T-SPOT groups. Of the 56 patients, 40 (71.4%), 13 (23.2%), 3 (5.4%) had true-positive, false-negative, and borderline T-SPOT results, respectively. This study did not reveal any significant risk factors for a false-negative T-SPOT result. In this clinical study, the proportion of patients with a false-negative result for T-SPOT with TCX for active TB was higher than that reported previously. Therefore, careful interpretation of a negative result for T-SPOT with TCX is necessary, regardless of the patient's background.

  19. Prevalence of pulmonary TB and spoligotype pattern of Mycobacterium tuberculosis among TB suspects in a rural community in Southwest Ethiopia

    Directory of Open Access Journals (Sweden)

    Deribew Amare

    2012-03-01

    Full Text Available Abstract Background In Ethiopia where there is no strong surveillance system and state of the art diagnostic facilities are limited, the real burden of tuberculosis (TB is not well known. We conducted a community based survey to estimate the prevalence of pulmonary TB and spoligotype pattern of the Mycobacterium tuberculosis isolates in Southwest Ethiopia. Methods A total of 30040 adults in 10882 households were screened for pulmonary TB in Gilgel Gibe field research centre in Southwest Ethiopia. A total of 482 TB suspects were identified and smear microscopy and culture was done for 428 TB suspects. Counseling and testing for HIV/AIDS was done for all TB suspects. Spoligotyping was done to characterize the Mycobacterium tuberculosis isolates. Results Majority of the TB suspects were females (60.7% and non-literates (83.6%. Using smear microscopy, a total of 5 new and 4 old cases of pulmonary TB cases were identified making the prevalence of TB 30 per 100,000. However, using the culture method, we identified 17 new cases with a prevalence of 76.1 per 100,000. There were 4.3 undiagnosed pulmonary TB cases for every TB case who was diagnosed through the passive case detection mechanism in the health facility. Eleven isolates (64.7% belonged to the six previously known spoligotypes: T, Haarlem and Central-Asian (CAS. Six new spoligotype patterns of Mycobacterium tuberculosis, not present in the international database (SpolDB4 were identified. None of the rural residents was HIV infected and only 5 (5.5% of the urban TB suspects were positive for HIV. Conclusion The prevalence of TB in the rural community of Southwest Ethiopia is low. There are large numbers of undiagnosed TB cases in the community. However, the number of sputum smear-positive cases was very low and therefore the risk of transmitting the infection to others may be limited. Active case finding through health extension workers in the community can improve the low case detection rate

  20. Oxidative Stress Markers in Tuberculosis and HIV/TB Co-Infection.

    Science.gov (United States)

    Rajopadhye, Shreewardhan Haribhau; Mukherjee, Sandeepan R; Chowdhary, Abhay S; Dandekar, Sucheta P

    2017-08-01

    Dysfunction of redox homeostasis has been implicated in many pathological conditions. An imbalance of pro- and anti-oxidants have been observed in Tuberculosis (TB) and its co-morbidities especially HIV/AIDS. The pro inflammatory milieu in either condition aggravates the physiological balance of the redox mechanisms. The present study therefore focuses on assessing the redox status of patients suffering from TB and HIV-TB co-infection. To assess the oxidative stress markers in the HIV-TB and TB study cohort. The current prospective study was conducted in Haffkine Institute, Parel, Maharashtra, India, during January 2013 to December 2015. Blood samples from 50 patients each suffering from active TB and HIV-TB co-infection were collected from Seth G.S.Medical College and KEM Hospital Mumbai and Group of Tuberculosis Hospital, Sewree Mumbai. Samples were processed and the experiments were carried out at the Department of Biochemistry, Haffkine Institute. Samples from 50 healthy volunteers were used as controls. Serum was assessed for pro-oxidant markers such as Nitric Oxide (NO), Thiobarbituric Acid Reactive Species (TBARS), C-Reactive Protein (CRP), superoxide anion. Antioxidant markers such as catalase and Superoxide Dismutase (SOD) were assessed. Total serum protein, was also assessed. Among the pro-oxidants, serum NO levels were decreased in TB group while no change was seen in HIV-TB group. TBARS and CRP levels showed significant increase in both groups; superoxide anion increased significantly in HIV-TB group. Catalase levels showed decreased activities in TB group. SOD activity significantly increased in HIV-TB but not in TB group. The total serum proteins were significantly increased in HIV-TB and TB groups. The values of Control cohort were with the normal reference ranges. In the present study, we found the presence of oxidative stress to be profound in the TB and HIV-TB co-infection population.

  1. The social determinants of tuberculosis and their association with TB ...

    African Journals Online (AJOL)

    Progress made in TB control through the implementation of the DOTS strategy, has been retarded by factors such as poverty, the HIV pandemic and the advent of multidrug resistant tuberculosis. There is currently an increasing shift in TB control ...

  2. FEATURES OF ADOLESCENTS TUBERCULOSIS AT A REFERRAL TB'S HOSPITAL IN TEHRAN, IRAN

    Directory of Open Access Journals (Sweden)

    Ferial Lotfian

    2016-01-01

    Full Text Available Abstract OBJECTIVE: To identify the pattern of the clinical, radiological, diagnostic procedures and loss to follow -up of the diagnosed cases of active tuberculosis (TB adolescents. METHODS: This study was a retrospective analysis of the medical records of 143 adolescents aged 10 to 18 years with tuberculosis who were admitted TB wards of National Research Institute of Tuberculosis and Lung Disease (NRITLD in Tehran, Iran, between March 2006 and March2011. RESULTS: Of the 143 patients identified, 62.9% were females. Median age of the patients was 16 years. The contact source was identified in 47.5%.The most common presenting symptom was cough (86%.Isolated pulmonary TB (PTB was detected in 113 patients (79%, 21 patients (14.7% had extrapulmonary TB(EPTB, and 9 patients (6.3% had PTB and EP TB .The most common site of  EPTB was pleural (14% .The most common radiographic finding was infiltration (61%.Positive acid fast smears were seen in 67.8%.Positive cultures for Mycobacterium tuberculosis(M. TB were seen in 31.6%. Positive PCR results were seen in 60%.The adolescents aged 15 to 18 years were more likely to lose weight (p=0.001, smear positive (p=0.002and have positive PCR results (p=0.009. The type of TB (p=0.017 was a significant factor influencing loss to follow-up. CONCLUSIONS: Adolescents with the high rate of positive sputum smear results and the high treatment default rate are more likely to increase risk for TB transmission to the community. The TB control programs should pay more attention to prevention and treatment of TB in adolescents.     Key words: adolescents, tuberculosis, Lost to follow-up, prevention

  3. The effect of HIV coinfection, HAART and TB treatment on cytokine/chemokine responses to Mycobacterium tuberculosis (Mtb) antigens in active TB patients and latently Mtb infected individuals

    NARCIS (Netherlands)

    Kassa, Desta; de Jager, Wilco; Gebremichael, Gebremedhin; Alemayehu, Yodit; Ran, Leonie; Fransen, Justin; Wolday, Dawit; Messele, Tsehaynesh; Tegbaru, Belete; Ottenhoff, Tom H M; van Baarle, Debbie

    2016-01-01

    Identification of Mtb specific induced cytokine/chemokine host biomarkers could assist in developing novel diagnostic, prognostic and therapeutic tools for TB. Levels of IFN-γ, IL-2, IL-17, IL-10, IP-10 and MIP-1α were measured in supernatants of whole blood stimulated with Mtb specific fusion

  4. Technology and tuberculosis control: the OUT-TB Web experience.

    Science.gov (United States)

    Guthrie, Jennifer L; Alexander, David C; Marchand-Austin, Alex; Lam, Karen; Whelan, Michael; Lee, Brenda; Furness, Colin; Rea, Elizabeth; Stuart, Rebecca; Lechner, Julia; Varia, Monali; McLean, Jennifer; Jamieson, Frances B

    2017-04-01

    Develop a tool to disseminate integrated laboratory, clinical, and demographic case data necessary for improved contact tracing and outbreak detection of tuberculosis (TB). In 2007, the Public Health Ontario Laboratories implemented a universal genotyping program to monitor the spread of TB strains within Ontario. Ontario Universal Typing of TB (OUT-TB) Web utilizes geographic information system (GIS) technology with a relational database platform, allowing TB control staff to visualize genotyping matches and microbiological data within the context of relevant epidemiological and demographic data. OUT-TB Web is currently available to the 8 health units responsible for >85% of Ontario's TB cases and is a valuable tool for TB case investigation. Users identified key features to implement for application enhancements, including an e-mail alert function, customizable heat maps for visualizing TB and drug-resistant cases, socioeconomic map layers, a dashboard providing TB surveillance metrics, and a feature for animating the geographic spread of strains over time. OUT-TB Web has proven to be an award-winning application and a useful tool. Developed and enhanced using regular user feedback, future versions will include additional data sources, enhanced map and line-list filter capabilities, and development of a mobile app. © The Author 2016. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  5. Utility of QuantiFERON-TB Gold In-Tube assay in adult, pulmonary and extrapulmonary, active tuberculosis diagnosis

    Directory of Open Access Journals (Sweden)

    Mohammed Azghay

    2016-03-01

    Conclusion: On its own, QFT-GIT is an insufficient tool to confirm the diagnosis of TB disease. However, it may form part of an ensemble of tools in combination with clinical, biological, and radiological assessments.

  6. Active Sputum Monitoring Detects Substantial Rate of Multi-Drug Resistant Tuberculosis (MDR-TB) in an HIV-Infected Population in South Africa

    Science.gov (United States)

    Hassim, Shaheen; Shaw, Pamela A.; Sangweni, Phumelele; Malan, Lizette; Ntshani, Ella; Mathibedi, Monkwe Jethro; Stubbs, Nomso; Metcalf, Julia A; Eckes, Risa; Masur, Henry; Komati, Stephanus

    2010-01-01

    Background Tuberculosis (TB) co-infection with HIV is a substantial problem in South Africa. There has been a presumption that drug resistant strains of TB are common in South Africa, but few studies have documented this impression. Methods In Phidisa, a joint observational and randomized HIV treatment study for South African National Defence Force members and dependents, an initiative obtained microbiologic TB testing in subjects who appeared to be at high risk. We report results for HIV-infected subjects. Results TB was identified by culture in 116/584 (19.9%) of patients selected for sputum examination on the basis of suggestive symptoms. Smear was an insensitive technique for confirming the diagnosis: only 33% of culture-positive patients were identified by smear, with a 0.2% false positive rate. Of the 107 culture-positive individuals with susceptibility testing, 22 (20.6%) were identified to be MDR and 4 (3.7%) became extremely drug resistant tuberculosis (XDR) while under observation. Culture-positive cases with a history of TB treatment had more than twice the rate of MDR than those without, 27.1% vs. 11.9% (p=0.05). Conclusions TB is common in this cohort of HIV-infected patients. Smear was not a sensitive technique for identifying culture-positive cases in this health system. Drug susceptibility testing is essential to proper patient management because MDR was present in 20.6% of culture-positive patients. Better management strategies are needed to reduce the development of MDR-TB since so many such patients had received prior antituberculous therapy that was presumably not curative. PMID:20196651

  7. Extensively Drug-Resistant Tuberculosis (XDR TB)

    Science.gov (United States)

    ... TB Reference Laboratory Network, the National TB Surveillance System in the United States, the national reference laboratory of South Korea, and ... capacity in the U.S. and abroad; and Developing education, risk, and media communications ... – United States, 1993–2006 CDC. CDC’s Role in Preventing XDR ...

  8. Application Values of T-SPOT.TB in Clinical Rapid Diagnosis of Tuberculosis.

    Science.gov (United States)

    Zhu, Feng; Ou, Qinfang; Zheng, Jian

    2018-01-01

    This paper aims to explore the application value of tuberculosis-specific enzyme-linked immunospot assay (T-SPOT.TB) in the diagnosis of tuberculosis. Fifty one patients with tuberculosis (TB) admitted to Wuxi No.5 People's Hospital, Wuxi, China from June 2015 to June 2017 were selected as the TB group, and 40 patients without tuberculosis admitted in the same period were randomly selected as the non-TB group. Patients in the two groups received T-SPOT.TB, TB antibody (TB-Ab) test and mycobacterium TB deoxyribonucleic acid (TB-DNA) test, and the results were compared. Comparisons of the sensitivity of the three methods showed that the sensitivity of T-SPOT.TB was the highest, followed by TB-DNA from sputum samples, and that of TB-Ab was the lowest. The specificity of TB-Ab was the highest, followed by T-SPOT.TB, and that of TB-DNA from sputum samples was the lowest. In the receiver operating characteristic (ROC) curve analysis, the area under curve (AUC) of T-SPOT.TB (0.896) was the highest, followed by TB-DNA from sputum samples (0.772), and that of sputum smears (0.698) was the lowest. T-SPOT.TB can quickly and accurately determine the presence of tuberculosis infection, and it is a non-invasive examination, which can further assist in the diagnosis and guide the treatment.

  9. Tuberculosis and Diabetes

    Science.gov (United States)

    TUBERCULOSIS www.who.int/tb & DIABETES THE DUAL EPIDEMIC OF TB AND DIABETES DEADLY LINKAGES  People with ... higher risk of progressing from latent to active tuberculosis.  Diabetes triples a person’s risk of developing TB. ...

  10. Host markers in Quantiferon supernatants differentiate active TB from latent TB infection: preliminary report

    Directory of Open Access Journals (Sweden)

    Walzl Gerhard

    2009-05-01

    Full Text Available Abstract Background Interferon gamma release assays, including the QuantiFERON® TB Gold In Tube (QFT have been shown to be accurate in diagnosing Mycobacterium tuberculosis infection. These assays however, do not discriminate between latent TB infection (LTBI and active TB disease. Methods We recruited twenty-three pulmonary TB patients and 34 household contacts from Cape Town, South Africa and performed the QFT test. To investigate the ability of new host markers to differentiate between LTBI and active TB, levels of 29 biomarkers in QFT supernatants were evaluated using a Luminex multiplex cytokine assay. Results Eight out of 29 biomarkers distinguished active TB from LTBI in a pilot study. Baseline levels of epidermal growth factor (EGF soluble CD40 ligand (sCD40L, antigen stimulated levels of EGF, and the background corrected antigen stimulated levels of EGF and macrophage inflammatory protein (MIP-1β were the most informative single markers for differentiation between TB disease and LTBI, with AUCs of 0.88, 0.84, 0.87, 0.90 and 0.79 respectively. The combination of EGF and MIP-1β predicted 96% of active TB cases and 92% of LTBIs. Combinations between EGF, sCD40L, VEGF, TGF-α and IL-1α also showed potential to differentiate between TB infection states. EGF, VEGF, TGF-α and sCD40L levels were higher in TB patients. Conclusion These preliminary data suggest that active TB may be accurately differentiated from LTBI utilizing adaptations of the commercial QFT test that includes measurement of EGF, sCD40L, MIP-1β, VEGF, TGF-α or IL-1α in supernatants from QFT assays. This approach holds promise for development as a rapid diagnostic test for active TB.

  11. The Ontario Universal Typing of Tuberculosis (OUT-TB Surveillance Program – What It Means to You

    Directory of Open Access Journals (Sweden)

    Shelly Bolotin

    2010-01-01

    Full Text Available BACKGROUND: Tuberculosis (TB is a serious disease that is transmitted primarily by the airborne route. Effective disease control and outbreak management requires the timely diagnosis, isolation and treatment of infected individuals with active disease; contact tracing to identify secondary cases likely to benefit from treatment of latent infection; and laboratory identification or confirmation of epidemiologically linked cases. TB genotyping enables the comparison of Mycobacterium tuberculosis complex (MTBC strains and the identification of cases that may or may not be linked. The increased availability of molecular methods for genotyping has allowed for greater discrimination of MTBC strains and greatly enhanced understanding of TB transmission patterns.

  12. PolyTB: A genomic variation map for Mycobacterium tuberculosis

    KAUST Repository

    Coll, Francesc

    2014-02-15

    Tuberculosis (TB) caused by Mycobacterium tuberculosis (Mtb) is the second major cause of death from an infectious disease worldwide. Recent advances in DNA sequencing are leading to the ability to generate whole genome information in clinical isolates of M. tuberculosis complex (MTBC). The identification of informative genetic variants such as phylogenetic markers and those associated with drug resistance or virulence will help barcode Mtb in the context of epidemiological, diagnostic and clinical studies. Mtb genomic datasets are increasingly available as raw sequences, which are potentially difficult and computer intensive to process, and compare across studies. Here we have processed the raw sequence data (>1500 isolates, eight studies) to compile a catalogue of SNPs (n = 74,039, 63% non-synonymous, 51.1% in more than one isolate, i.e. non-private), small indels (n = 4810) and larger structural variants (n = 800). We have developed the PolyTB web-based tool (http://pathogenseq.lshtm.ac.uk/polytb) to visualise the resulting variation and important meta-data (e.g. in silico inferred strain-types, location) within geographical map and phylogenetic views. This resource will allow researchers to identify polymorphisms within candidate genes of interest, as well as examine the genomic diversity and distribution of strains. PolyTB source code is freely available to researchers wishing to develop similar tools for their pathogen of interest. 2014 Elsevier Ltd. All rights reserved.

  13. TIME Impact - a new user-friendly tuberculosis (TB) model to inform TB policy decisions.

    Science.gov (United States)

    Houben, R M G J; Lalli, M; Sumner, T; Hamilton, M; Pedrazzoli, D; Bonsu, F; Hippner, P; Pillay, Y; Kimerling, M; Ahmedov, S; Pretorius, C; White, R G

    2016-03-24

    Tuberculosis (TB) is the leading cause of death from infectious disease worldwide, predominantly affecting low- and middle-income countries (LMICs), where resources are limited. As such, countries need to be able to choose the most efficient interventions for their respective setting. Mathematical models can be valuable tools to inform rational policy decisions and improve resource allocation, but are often unavailable or inaccessible for LMICs, particularly in TB. We developed TIME Impact, a user-friendly TB model that enables local capacity building and strengthens country-specific policy discussions to inform support funding applications at the (sub-)national level (e.g. Ministry of Finance) or to international donors (e.g. the Global Fund to Fight AIDS, Tuberculosis and Malaria).TIME Impact is an epidemiological transmission model nested in TIME, a set of TB modelling tools available for free download within the widely-used Spectrum software. The TIME Impact model reflects key aspects of the natural history of TB, with additional structure for HIV/ART, drug resistance, treatment history and age. TIME Impact enables national TB programmes (NTPs) and other TB policymakers to better understand their own TB epidemic, plan their response, apply for funding and evaluate the implementation of the response.The explicit aim of TIME Impact's user-friendly interface is to enable training of local and international TB experts towards independent use. During application of TIME Impact, close involvement of the NTPs and other local partners also builds critical understanding of the modelling methods, assumptions and limitations inherent to modelling. This is essential to generate broad country-level ownership of the modelling data inputs and results. In turn, it stimulates discussions and a review of the current evidence and assumptions, strengthening the decision-making process in general.TIME Impact has been effectively applied in a variety of settings. In South Africa, it

  14. A tuberculosis biomarker database: the key to novel TB diagnostics

    Directory of Open Access Journals (Sweden)

    Seda Yerlikaya

    2017-03-01

    Full Text Available New diagnostic innovations for tuberculosis (TB, including point-of-care solutions, are critical to reach the goals of the End TB Strategy. However, despite decades of research, numerous reports on new biomarker candidates, and significant investment, no well-performing, simple and rapid TB diagnostic test is yet available on the market, and the search for accurate, non-DNA biomarkers remains a priority. To help overcome this ‘biomarker pipeline problem’, FIND and partners are working on the development of a well-curated and user-friendly TB biomarker database. The web-based database will enable the dynamic tracking of evidence surrounding biomarker candidates in relation to target product profiles (TPPs for needed TB diagnostics. It will be able to accommodate raw datasets and facilitate the verification of promising biomarker candidates and the identification of novel biomarker combinations. As such, the database will simplify data and knowledge sharing, empower collaboration, help in the coordination of efforts and allocation of resources, streamline the verification and validation of biomarker candidates, and ultimately lead to an accelerated translation into clinically useful tools.

  15. Antiretroviral Treatment Scale-Up and Tuberculosis Mortality in High TB/HIV Burden Countries: An Econometric Analysis.

    Science.gov (United States)

    Yan, Isabel; Bendavid, Eran; Korenromp, Eline L

    2016-01-01

    Antiretroviral therapy (ART) reduces mortality in patients with active tuberculosis (TB), but the population-level relationship between ART coverage and TB mortality is untested. We estimated the reduction in population-level TB mortality that can be attributed to increasing ART coverage across 41 high HIV-TB burden countries. We compiled TB mortality trends between 1996 and 2011 from two sources: (1) national program-reported TB death notifications, adjusted for annual TB case detection rates, and (2) WHO TB mortality estimates. National coverage with ART, as proportion of HIV-infected people in need, was obtained from UNAIDS. We applied panel linear regressions controlling for HIV prevalence (5-year lagged), coverage of TB interventions (estimated by WHO and UNAIDS), gross domestic product per capita, health spending from domestic sources, urbanization, and country fixed effects. Models suggest that that increasing ART coverage was followed by reduced TB mortality, across multiple specifications. For death notifications at 2 to 5 years following a given ART scale-up, a 1% increase in ART coverage predicted 0.95% faster mortality rate decline (p = 0.002); resulting in 27% fewer TB deaths in 2011 alone than would have occurred without ART. Based on WHO death estimates, a 1% increase in ART predicted a 1.0% reduced TB death rate (peconometric analysis supports a substantial impact of ART on population-level TB mortality realized already within the first decade of ART scale-up, that is apparent despite variable-quality mortality data.

  16. Variation in C - reactive protein response according to host and mycobacterial characteristics in active tuberculosis

    OpenAIRE

    Brown, James; Clark, Kristina; Smith, Colette; Hopwood, Jennifer; Lynard, Oliver; Toolan, Michael; Creer, Dean; Barker, Jack; Breen, Ronan; Brown, Tim; Cropley, Ian; Lipman, Marc

    2016-01-01

    Background The C - reactive protein (CRP) response is often measured in patients with active tuberculosis (TB) yet little is known about its relationship to clinical features in TB, or whether responses differ between ethnic groups or with different Mycobacterium tuberculosis (M.tb) strain types. We report the relationship between baseline serum CRP prior to treatment and disease characteristics in a metropolitan population with TB resident in a low TB incidence region. Methods People treated...

  17. Evaluation of the performance of two tuberculosis interferon gamma release assays (IGRA-ELISA and T-SPOT.TB) for diagnosing Mycobacterium tuberculosis infection.

    Science.gov (United States)

    Wang, Linchuan; Tian, Xu-Dong; Yu, Yan; Chen, Wei

    2018-04-01

    The IGRA-ELISA and T-SPOT.TB are widely used in China. The aim of the study was to evaluate the performance of the two assays in diagnosis Mycobacterium tuberculosis infection. Of the 3727 patients in the study, 204 underwent testing using both the T-SPOT.TB and IGRA-ELISA, 1794 were tested using the T-SPOT.TB only, and 1729 were tested using the IGRA-ELISA only. The positive rate and consistency of the two assays were analyzed, and their sensitivity and specificity for diagnosing active tuberculosis were compared. There were no significant differences in the positive rate between the T-SPOT.TB test (25.8%) and IGRA-ELISA (28.6%), p = .065. The two assays were highly consistent, with a kappa value of 0.852 (p SPOT.TB test were 82.9% (107/129) and 78.6% (1309/1665), respectively, and those of IGRA-ELISA were 81.7% (94/115) and 75.2% (1214/1614), respectively. There were no significant differences in sensitivity (p > .05), but the specificity of the T-SPOT.TB test was slightly higher than that of IGRA-ELISA (p = .023). Both in terms of diagnosing M. tuberculosis infection and ruling out active tuberculosis, the performance of the IGRA-ELISA-a simple, almost labor-free assay that allows simultaneous processing of a very large number of samples-was well-matched with that of T-SPOT.TB test. However, IGRAs cannot be used as the only test to diagnose active tuberculosis. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. The Risk of Depressive Disorder Among Contacts of Tuberculosis Patients in a TB-endemic Area

    Science.gov (United States)

    Pan, Sheng-Wei; Yen, Yung-Feng; Feng, Jia-Yih; Su, Vincent Yi-Fong; Kou, Yu Ru; Su, Wei-Juin

    2015-01-01

    Abstract Tuberculosis (TB) disease may be transmitted to close contacts of index cases, causing physical illness. No studies have investigated the risk of developing depressive disorder among TB contacts in a TB-endemic area. Adult participants with a new diagnosis of TB contact (ICD-9-CM codes V01.1 plus chest radiographic order) since January 1, 2008, were identified from the National Health Insurance Research Database in Taiwan. A control cohort matched for age (±5 y), sex, enrolled years, and income level was selected. These 2 cohorts were followed until December 31, 2012, and observed for the development of depressive disorder. The Kaplan-Meier method and the log-rank test were used to examine the difference in cumulative incidences of depressive disorder between groups. Cox proportional-hazard models were used to calculate adjusted hazard ratios (aHRs) for depressive disorder. The TB contact cohort consisted of 9046 patients and matched controls of 36,184 ones. The mean age of TB contacts was 44.7 years, and 56.0% of them were women. During a mean follow-up period of 2.5 years, 127 (1.40%) TB contacts and 521 (1.44%) matched controls developed depressive disorder. TB exposure was found to be an independent risk factor of depressive disorder in women (aHR 1.34, 95% confidence interval [CI] 1.07–1.68), but not in men (aHR 0.71, 95% CI 0.48–1.06) after adjusting for age, comorbidities, and income levels. The risk of depression was significantly higher for female TB contacts than for matched controls in the first and second years (aHR 1.49, 95% CI 1.03–2.14; and aHR 1.53, 95% CI 1.05–2.23, respectively), but not thereafter. Of note, 67 (0.74%) TB contacts and 88 (0.24%) matched controls developed active TB, but none of them had subsequent depressive disorder during follow-up periods. Female TB contacts had an increased risk of depression within the first 2 years after exposure. Clinicians should consider conducting depression evaluations in addition to

  19. Index-TB Guidelines: Guidelines on extrapulmonary tuberculosis for India

    Science.gov (United States)

    Sharma, Surendra K.; Ryan, H.; Khaparde, Sunil; Sachdeva, K. S.; Singh, Achintya D.; Mohan, Alladi; Sarin, Rohit; Paramasivan, C N; Kumar, Prahlad; Nischal, Neeraj; Khatiwada, Saurav; Garner, Paul; Tharyan, Prathap

    2017-01-01

    Extrapulmonary tuberculosis (EPTB) is frequently a diagnostic and therapeutic challenge. It is a common opportunistic infection in people living with HIV/AIDS and other immunocompromised states such as diabetes mellitus and malnutrition. There is a paucity of data from clinical trials in EPTB and most of the information regarding diagnosis and management is extrapolated from pulmonary TB. Further, there are no formal national or international guidelines on EPTB. To address these concerns, Indian EPTB guidelines were developed under the auspices of Central TB Division and Directorate of Health Services, Ministry of Health and Family Welfare, Government of India. The objective was to provide guidance on uniform, evidence-informed practices for suspecting, diagnosing and managing EPTB at all levels of healthcare delivery. The guidelines describe agreed principles relevant to 10 key areas of EPTB which are complementary to the existing country standards of TB care and technical operational guidelines for pulmonary TB. These guidelines provide recommendations on three priority areas for EPTB: (i) use of Xpert MTB/RIF in diagnosis, (ii) use of adjunct corticosteroids in treatment, and (iii) duration of treatment. The guidelines were developed using the Grading of Recommendations Assessment, Development and Evaluation (GRADE) criteria, which were evidence based, and due consideration was given to various healthcare settings across India. Further, for those forms of EPTB in which evidence regarding best practice was lacking, clinical practice points were developed by consensus on accumulated knowledge and experience of specialists who participated in the working groups. This would also reflect the needs of healthcare providers and develop a platform for future research. PMID:28862176

  20. Index-TB guidelines: Guidelines on extrapulmonary tuberculosis for India

    Directory of Open Access Journals (Sweden)

    Surendra K Sharma

    2017-01-01

    Full Text Available Extrapulmonary tuberculosis (EPTB is frequently a diagnostic and therapeutic challenge. It is a common opportunistic infection in people living with HIV/AIDS and other immunocompromised states such as diabetes mellitus and malnutrition. There is a paucity of data from clinical trials in EPTB and most of the information regarding diagnosis and management is extrapolated from pulmonary TB. Further, there are no formal national or international guidelines on EPTB. To address these concerns, Indian EPTB guidelines were developed under the auspices of Central TB Division and Directorate of Health Services, Ministry of Health and Family Welfare, Government of India. The objective was to provide guidance on uniform, evidence-informed practices for suspecting, diagnosing and managing EPTB at all levels of healthcare delivery. The guidelines describe agreed principles relevant to 10 key areas of EPTB which are complementary to the existing country standards of TB care and technical operational guidelines for pulmonary TB. These guidelines provide recommendations on three priority areas for EPTB: (i use of Xpert MTB/RIF in diagnosis, (ii use of adjunct corticosteroids in treatment, and (iii duration of treatment. The guidelines were developed using the Grading of Recommendations Assessment, Development and Evaluation (GRADE criteria, which were evidence based, and due consideration was given to various healthcare settings across India. Further, for those forms of EPTB in which evidence regarding best practice was lacking, clinical practice points were developed by consensus on accumulated knowledge and experience of specialists who participated in the working groups. This would also reflect the needs of healthcare providers and develop a platform for future research.

  1. Mathematical Modeling of Tuberculosis Granuloma Activation

    Directory of Open Access Journals (Sweden)

    Steve M. Ruggiero

    2017-12-01

    Full Text Available Tuberculosis (TB is one of the most common infectious diseases worldwide. It is estimated that one-third of the world’s population is infected with TB. Most have the latent stage of the disease that can later transition to active TB disease. TB is spread by aerosol droplets containing Mycobacterium tuberculosis (Mtb. Mtb bacteria enter through the respiratory system and are attacked by the immune system in the lungs. The bacteria are clustered and contained by macrophages into cellular aggregates called granulomas. These granulomas can hold the bacteria dormant for long periods of time in latent TB. The bacteria can be perturbed from latency to active TB disease in a process called granuloma activation when the granulomas are compromised by other immune response events in a host, such as HIV, cancer, or aging. Dysregulation of matrix metalloproteinase 1 (MMP-1 has been recently implicated in granuloma activation through experimental studies, but the mechanism is not well understood. Animal and human studies currently cannot probe the dynamics of activation, so a computational model is developed to fill this gap. This dynamic mathematical model focuses specifically on the latent to active transition after the initial immune response has successfully formed a granuloma. Bacterial leakage from latent granulomas is successfully simulated in response to the MMP-1 dynamics under several scenarios for granuloma activation.

  2. Patient reported delays in seeking treatment for Tuberculosis (TB among adult and pediatric TB patients and TB patients co-infected with HIV in Lima, Peru: a qualitative study

    Directory of Open Access Journals (Sweden)

    Valerie A Paz-Soldan

    2014-12-01

    Full Text Available Abstract: Tuberculosis (TB remains a significant public health challenge worldwide, and particularly in Peru with one of the highest incidence rates in Latin America. TB patient behavior has a direct influence on whether a patient will receive timely diagnosis and successful treatment of their illness. Objectives: The objective was to understand the complex factors that can impact TB patient health seeking behavior. Methods: In-depth interviews were conducted with adult and parents of pediatric patients receiving TB treatment (n=43, within that group a sub-group was also co-infected with HIV (n=11. Results: Almost all of the study participants recognized delays in seeking either their child’s or their own diagnosis of their TB symptoms. The principal reasons for treatment-seeking delays were lack of knowledge and confusion of tuberculosis symptoms, fear and embarrassment of receiving a TB diagnosis, and a patient tendency to self-medicate prior to seeking formal medical attention.Conclusions: Health promotion activities that target patient delays have the potential to improve individual patient outcomes and mitigate the spread of TB at a community level.

  3. Comparison of TST and IGRA in Diagnosis of Latent Tuberculosis Infection in a High TB-Burden Setting.

    Science.gov (United States)

    Sharma, Surendra K; Vashishtha, Richa; Chauhan, L S; Sreenivas, V; Seth, Divya

    2017-01-01

    There are currently two tests for diagnosing latent tuberculosis infection (LTBI); TST and IGRA. However, it is still unclear that which one of these tests performs better in high TB-burden settings. 1511 household contacts of pulmonary TB patients were enrolled to compare the performance of TST and IGRA for LTBI. At baseline all participant underwent testing for IGRA [QuantiFERON-TB® Gold In-tube (QFT-GIT) assay] and TST [2 tuberculin unit (TU), purified protein derivative (PPD), RT23, Staten Serum Institute (SSI), Copenhagen, Denmark]. All the household contacts were followed-up for two years for incident TB cases. Active TB was diagnosed in 76 household contacts at an incidence rate of 2.14 per 1000 person-years. Both, TST [Hazard Ratio (HR): 1.14, 95% confidence interval (CI): 0.72-1.79, p = 0.57], as well as QFT-GIT assay (HR: 1.66, 95% CI: 0.97-2.84, p = 0.06) results at baseline were not significantly associated with subsequent development of active TB among household contacts of pulmonary TB patients. Neither TST nor IGRA predicted subsequent development of active TB among household contacts of pulmonary TB patients during follow-up. However, keeping in view the cost, and other logistics, TST remains the most preferred method for LTBI diagnosis in resource-limited, high TB-burden settings.

  4. Are intestinal helminths risk factors for developing active tuberculosis?

    DEFF Research Database (Denmark)

    Elias, Daniel; Mengistu, Getahun; Akuffo, Hannah

    2006-01-01

    OBJECTIVES: To determine the prevalence of intestinal helminth infections in active tuberculosis patients and their healthy household contacts and to assess its association with active TB in an area endemic for both types of infections. METHODS: Smear-positive pulmonary TB patients and healthy...

  5. State of affairs of tuberculosis in prison facilities: a systematic review of screening practices and recommendations for best TB control

    NARCIS (Netherlands)

    Vinkeles Melchers, Natalie V. S.; van Elsland, Sabine L.; Lange, Joep M. A.; Borgdorff, Martien W.; van den Hombergh, Jan

    2013-01-01

    Prisoners are at high risk of developing tuberculosis (TB), causing morbidity and mortality. Prison facilities encounter many challenges in TB screening procedures and TB control. This review explores screening practices for detection of TB and describes limitations of TB control in prison

  6. TB treatment initiation and adherence in a South African community influenced more by perceptions than by knowledge of tuberculosis

    Directory of Open Access Journals (Sweden)

    Møller Valerie

    2010-02-01

    Full Text Available Abstract Background Tuberculosis (TB is a global health concern. Inadequate case finding and case holding has been cited as major barrier to the control of TB. The TB literature is written almost entirely from a biomedical perspective, while recent studies show that it is imperative to understand lay perception to determine why people seek treatment and may stop taking treatment. The Eastern Cape is known as a province with high TB incidence, prevalence and with one of the worst cure rates of South Africa. Its inhabitants can be considered lay experts when it comes to TB. Therefore, we investigated knowledge, perceptions of (access to TB treatment and adherence to treatment among an Eastern Cape population. Methods An area-stratified sampling design was applied. A total of 1020 households were selected randomly in proportion to the total number of households in each neighbourhood. Results TB knowledge can be considered fairly good among this community. Respondents' perceptions suggest that stigma may influence TB patients' decision in health seeking behavior and adherence to TB treatment. A full 95% of those interviewed believe people with TB tend to hide their TB status out of fear of what others may say. Regression analyses revealed that in this population young and old, men and women and the lower and higher educated share the same attitudes and perceptions. Our findings are therefore likely to reflect the actual situation of TB patients in this population. Conclusions The lay experts' perceptions suggests that stigma appears to effect case holding and case finding. Future interventions should be directed at improving attitudes and perceptions to potentially reduce stigma. This requires a patient-centered approach to empower TB patients and active involvement in the development and implementation of stigma reduction programs.

  7. QuantiFERON® TB GOLD’ s applications in the tuberculosis disease

    Directory of Open Access Journals (Sweden)

    Maria Saladino

    2014-06-01

    Full Text Available Background. Tuberculosis is the most frequent cause of death from a single infectious agent in humans and remains a serious global health problem. The latent tuberculosis (LTBI treatment can prevent progression to active disease. People infected with LTBI are a dangerous reservoir, since any immunosuppressive factor can cause a reactivation of Mycobacterium leading to overt disease. Recent production and introduction into the healthcare system, on the other hand, are the IGRAs (Interferon-Gamma Release Assay. Materials and Methods. The QuantiFERON-TB Gold test is an ELISA assay of IFN-γ produced by sensitized lymphocytes that allows to overcome some limitations of Mantoux test, being an in vitro test with specific antigens for M. tuberculosis. In the present study we examined a population of 150 patients tested with the Mantoux test and the QuantiFERON-TB Gold test. The patients were divided into categories (contacts of the case, immigrants, health care personnel, and immunocompromised subjects in biological therapy. Results. The analysis of the obtained results from the comparison of the two tests showed a good concordance rate (47.3% in the case of double positivity and detected the highest percentage of discrepancy in the profile QuantiFERON negative/Mantoux positive. Conclusions. Our results allow to state that remains valid and effective use of the QuantiFERON test, provided it is flanked by the Mantoux test and a medical history of patients.

  8. HGV&TB: a comprehensive online resource on human genes and genetic variants associated with tuberculosis

    OpenAIRE

    Sahajpal, Ruchika; Kandoi, Gaurav; Dhiman, Heena; Raj, Sweety; Scaria, Vinod; Bhartiya, Deeksha; Hasija, Yasha

    2014-01-01

    Abstract Tuberculosis (TB) is an infectious disease caused by fastidious pathogen Mycobacterium tuberculosis. TB has emerged as one of the major causes of mortality in the developing world. Role of host genetic factors that modulate disease susceptibility have not been studied widely. Recent studies have reported few genetic loci that provide impetus to this area of research. The availability of tools has enabled genome-wide scans for disease susceptibility loci associated with infectious dis...

  9. Risk factors for bovine tuberculosis (bTB) in cattle in Ethiopia

    NARCIS (Netherlands)

    Dejene, Sintayehu W.; Heitkonig, Ignas; Prins, Herbert H.T.; Lemma, Fitsum A.; Mekonnen, Daniel A.; Alemu, Zelalem E.; Kelkay, Tessema Z.; Boer, de Fred

    2016-01-01

    Bovine tuberculosis (bTB) infection is generally correlated with individual cattle's age, sex, body condition, and with husbandry practices such as herd composition, cattle movement, herd size, production system and proximity to wildlife - including bTB maintenance hosts. We tested the

  10. The Transcriptional Signature of Active Tuberculosis Reflects Symptom Status in Extra-Pulmonary and Pulmonary Tuberculosis.

    Directory of Open Access Journals (Sweden)

    Simon Blankley

    Full Text Available Mycobacterium tuberculosis infection is a leading cause of infectious death worldwide. Gene-expression microarray studies profiling the blood transcriptional response of tuberculosis (TB patients have been undertaken in order to better understand the host immune response as well as to identify potential biomarkers of disease. To date most of these studies have focused on pulmonary TB patients with gene-expression profiles of extra-pulmonary TB patients yet to be compared to those of patients with pulmonary TB or sarcoidosis.A novel cohort of patients with extra-pulmonary TB and sarcoidosis was recruited and the transcriptional response of these patients compared to those with pulmonary TB using a variety of transcriptomic approaches including testing a previously defined 380 gene meta-signature of active TB.The 380 meta-signature broadly differentiated active TB from healthy controls in this new dataset consisting of pulmonary and extra-pulmonary TB. The top 15 genes from this meta-signature had a lower sensitivity for differentiating extra-pulmonary TB from healthy controls as compared to pulmonary TB. We found the blood transcriptional responses in pulmonary and extra-pulmonary TB to be heterogeneous and to reflect the extent of symptoms of disease.The transcriptional signature in extra-pulmonary TB demonstrated heterogeneity of gene expression reflective of symptom status, while the signature of pulmonary TB was distinct, based on a higher proportion of symptomatic individuals. These findings are of importance for the rational design and implementation of mRNA based TB diagnostics.

  11. "The Impact of Mycobacterium tuberculosis Immune Evasion on Protective Immunity: Implications for TB Vaccine Design" - Meeting report.

    Science.gov (United States)

    Boggiano, Cesar; Eichelberg, Katrin; Ramachandra, Lakshmi; Shea, Jaqueline; Ramakrishnan, Lalita; Behar, Samuel; Ernst, Joel D; Porcelli, Steven A; Maeurer, Markus; Kornfeld, Hardy

    2017-06-14

    Tuberculosis (TB) is the major cause of death from infectious diseases around the world, particularly in HIV infected individuals. TB vaccine design and development have been focused on improving Bacille Calmette-Guérin (BCG) and evaluating recombinant and viral vector expressed Mycobacterium tuberculosis (Mtb) proteins, for boosting BCG-primed immunity, but these approaches have not yet yielded significant improvements over the modest effects of BCG in protecting against infection or disease. On March 7-8, 2016, the National Institute of Allergy and Infectious Diseases (NIAID) convened a workshop on "The Impact of Mtb Immune Evasion on Protective Immunity: Implications for TB Vaccine Design" with the goal of defining immune mechanisms that could be targeted through novel research approaches, to inform vaccine design and immune therapeutic interventions for prevention of TB. The workshop addressed early infection events, the impact of Mtb evolution on the development and maintenance of an adaptive immune response, and the factors that influence protection against and progression to active disease. Scientific gaps and areas of study to revitalize and accelerate TB vaccine design were discussed and prioritized. These included a comprehensive evaluation of innate and Mtb-specific adaptive immune responses in the lung at different stages of disease; determining the role of B cells and antibodies (Abs) during Mtb infection; development of better assays to measure Mtb burden following exposure, infection, during latency and after treatment, and approaches to improving current animal models to study Mtb immunogenicity, TB disease and transmission. Copyright © 2017.

  12. Genome sequencing and annotation of multidrug resistant Mycobacterium tuberculosis (MDR-TB PR10 strain

    Directory of Open Access Journals (Sweden)

    Mohd Zakihalani A. Halim

    2016-03-01

    Full Text Available Here, we report the draft genome sequence and annotation of a multidrug resistant Mycobacterium tuberculosis strain PR10 (MDR-TB PR10 isolated from a patient diagnosed with tuberculosis. The size of the draft genome MDR-TB PR10 is 4.34 Mbp with 65.6% of G + C content and consists of 4637 predicted genes. The determinants were categorized by RAST into 400 subsystems with 4286 coding sequences and 50 RNAs. The whole genome shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession number CP010968. Keywords: Mycobacterium tuberculosis, Genome, MDR, Extrapulmonary

  13. Use of bactec 460 TB system in the diagnosis of tuberculosis

    Directory of Open Access Journals (Sweden)

    Rodrigues C

    2007-01-01

    Full Text Available Purpose : To evaluate, the efficacy of BACTEC 460 TB system for the diagnosis of tuberculosis in a tertiary care hospital in Mumbai, India. Methods : We compared 12,726 clinical specimens using BACTEC 460 TB system and conventional method for detection of Mycobacterium tuberculosis over a period of six years. Result: The overall recovery rate was 39% by BACTEC technique and 29% using Lowenstein-Jensen (LJ medium. An average detection time for B actec0 460 TB system was found to be 13.3 days and 15.3 days as against 31.2 days and 35.3 days by LJ method for respiratory and nonrespiratory specimens respectively. The average reporting time for drug susceptibility results ranged from 6-10 days for the BACTEC 460 TB system. Conclusions: The BACTEC system is a good system for level II laboratories, especially in the diagnosis of extrapulmonary and smear negative tuberculosis.

  14. Association between passive smoking and Mycobacterium tuberculosis infection in children with household TB contact

    Directory of Open Access Journals (Sweden)

    Novaily Zuliartha

    2015-03-01

    Full Text Available Background Tuberculosis (TB and cigarette consumption are relatively high in Indonesia. Passive smoking may increase the risk of infection and disease in adults and children exposed to TB. An association between passive smoking and Mycobacterium tuberculosis infection in children has not been well documented. Objective To assess for an association between passive smoking and M. tuberculosis infection in children who had household contact with a TB patient. Methods This cross-sectional study was conducted in February and March 2011. Children aged 5 to 18 years who had household contact with a TB patient underwent tuberculin testing for M. tuberculosis infection. Subjects were divided into two groups: those exposed to passive smoke and those not exposed to passive smoke. Chi-square test was used to assess for an association between passive smoking and M. tuberculosis infection. Results There were 140 children enrolled in this study, with 70 exposed to passive smoke and 70 not exposed to passive smoke. Prevalence of M. tuberculosis infection was significantly higher in the passive smoking group than in those not exposed to passive smoke [81.4% and 52.9%, respectively, (P= 0.0001]. In the passive smoking group there were significant associations between nutritional state, paternal and maternal education, and M. tuberculosis infection. But no associations were found between M. tuberculosis infection and familial income or BCG vaccination. Conclusion Among children who had household contact with a TB patient, they who exposed to passive smoke are more likely to have M. tuberculosis infection compared to they who not exposed to passive smoke.

  15. Treatment Outcomes of Patients with Multidrug-Resistant Tuberculosis (MDR- TB) Compared with Non-MDR-TB Infections in Peninsular Malaysia.

    Science.gov (United States)

    Elmi, Omar Salad; Hasan, Habsah; Abdullah, Sarimah; Mat Jeab, Mat Zuki; Ba, Zilfalil; Naing, Nyi Nyi

    2016-07-01

    Treating patients with multidrug-resistant tuberculosis (MDR-TB) strains is more complicated, complex, toxic, expensive, than treating patients with susceptible TB strains. This study aims to compare the treatment outcomes and potential factors associated between patients with MDR-TB and non MDR TB infections in peninsular Malaysia. This study was a retrospective cohort study. Data were collected from the medical records of all registered MDR-TB patients and Non-MDR-TB patients at five TB hospitals in peninsular Malaysia from January 2010 to January 2014. A total of 314 subjects were studied, including 105 MDR-TB cases and 209 non-MDR-TB. After TB treatment, 24.8% of the MDR-TB patients and 17.7% of non MDR TB relapsed; 17.1% of the MDR-TB patients and 16.3% of non MDR TB defaulted from TB treatment. A significant difference seen in treatment success rate 17.1% for MDR-TB; 63.1% for non MDR TB (P history of TB treatment, and presence of HIV infection.

  16. The relationship between chitotriosidase activity and tuberculosis.

    Science.gov (United States)

    Chen, M; Deng, J; Li, W; Su, C; Xia, Y; Wang, M; Li, X; Abuaku, B K; Tan, H; Wen, S W

    2015-11-01

    Chitotriosidase, secreted by activated macrophages, is a biomarker of activated macrophages. In this study, we explored whether chitotriosidase could be adopted as a biomarker to evaluate the curative effect on tuberculosis (TB). Five counties were randomly selected out of 122 counties/cities/districts in Hunan Province, China. Our cases were all TB patients who were newly diagnosed or had been receiving treatment at the Centers for Disease Control (CDCs) of these five counties between April and August in 2009. Healthy controls were selected from a community health facility in the Kaifu district of Changsha City after frequency-matching of gender and age with the cases. Chitotriosidase activity was evaluated by a fluorometric assay. Categorical variables were analysed with the χ 2 test. Measurement data in multiple groups were tested with analysis of variance and least significant difference (LSD). Correlation between chitotriosidase activity and the degree of radiological extent (DRE) was examined by Spearman's rank correlation test. The average chitotriosidase activity levels of new TB cases, TB cases with different periods of treatment (6 months) and the control group were 54·47, 34·77, 21·54, 12·73 and 10·53 nmol/h.ml, respectively. Chitotriosidase activity in TB patients declined along with the continuity of treatment. The chitotriosidase activity of both smear-positive and the smear-negative pulmonary TB patients decreased after 6 months' treatment to normal levels (P activity was positively correlated with DRE (r = 0·607, P < 0·001). Our results indicate that chitotriosidase might be a marker of TB treatment effects. However, further follow-up study of TB patients is needed in the future.

  17. Tuberculosis: The Connection between TB and HIV (the AIDS Virus)

    Science.gov (United States)

    ... Regimen for Latent TB Infection-Patient Education Brochure Posters Mantoux Tuberculin Skin Test Wall Chart World TB ... site? Adobe PDF file Microsoft PowerPoint file Microsoft Word file Microsoft Excel file Audio/Video file Apple ...

  18. Molecular detection of multi drug resistant tuberculosis (mdr-tb) in mdr-tb patients' attendant in north western pakistan

    International Nuclear Information System (INIS)

    Shah, T.; Hayat, A.; Shah, Z.; Hayat, A.; Khan, S.B.

    2017-01-01

    Objective: To determine the drugs susceptibility pattern of mycobacterium tuberculosis (M.TB) in multi-drug resistant tuberculosis (MDR-TB) patients' attendants in North Western, Pakistan. Study Design: Cross sectional study. Place and Duration of Study: This study was conducted at Peshawar Tuberculosis Research Laboratory (PTRL), Provincial TB Control Program Hayatabad Medical Complex Peshawar, (KP) from August 2013 to March 2014. Material and Methods: A cross sectional study in which four hundred and eighty sputum samples from MDR-TB patients' attendants were processed for the detection of M.TB through Ziehl-Neelsen staining, Lowenstein-Jensen, BACTEC MGIT-960 culture and line probe assay. Results: Out of 480 samples, 06 (2.1%) were found positive for M.TB through Ziehl-Neelsen staining while 10 (2.8%) were positive through LJ and BACTEC MGIT-960 culture. The 10 positive samples were further subjected to drugs susceptibility testing and line probes assay test to find out rifampicin, isoniazid, streptomycin and ethambutol resistant and it was found that 6 M.TB isolates were resistant while 4 were sensitive to rifampicin and isoniazid. Among the 6 resistant M.TB strains, 4 showed mutation in rpoB gene at 531, 516 and 526 codons. Conclusion: Majority of MDR-TB patients' attendants had drug-resistant tuberculosis and the rate of drug susceptible TB was low. (author)

  19. Arginine as an adjuvant to chemotherapy improves clinical outcome in active tuberculosis

    DEFF Research Database (Denmark)

    Schön, T; Elias, D; Moges, F

    2003-01-01

    Nitric oxide (NO) is involved in the host defence against tuberculosis (TB). Patients with TB exhibit increased catabolism and reduced energy intake. Thus the hypothesis for this study was that restoring a relative deficiency in the amino acid arginine, the substrate for mycobactericidal NO produ......Nitric oxide (NO) is involved in the host defence against tuberculosis (TB). Patients with TB exhibit increased catabolism and reduced energy intake. Thus the hypothesis for this study was that restoring a relative deficiency in the amino acid arginine, the substrate for mycobactericidal...... virus-negative patients with active tuberculosis, most likely mediated by increased production of nitric oxide....

  20. Prevalence of post-traumatic stress symptoms and associated factors in tuberculosis (TB), TB retreatment and/or TB-HIV co-infected primary public health-care patients in three districts in South Africa.

    Science.gov (United States)

    Peltzer, Karl; Naidoo, Pamela; Matseke, Gladys; Louw, Julia; McHunu, Gugu; Tutshana, Bomkazi

    2013-01-01

    High rates of tuberculosis (TB) and TB/HIV co-infection is often linked with mental health issues such as post-traumatic stress disorder (PTSD) symptoms, which is further associated with poor health outcomes. In a country such as South Africa where rates of these infectious diseases are high, it is concerning that there is limited/no data on prevalence rates of mental disorders such as PTSD and its associated factors. Therefore, the aim of this study was to establish the prevalence of PTSD symptoms and associated factors in TB, TB retreatment and/or TB-HIV co-infected primary public health-care patients in three districts in South Africa. Brief screening self-report tools were used to measure: PTSD symptoms, psychological distress (anxiety and depression) and alcohol misuse. Other relevant measures, such as adherence to medication, stressful life events and sexual risk-taking behaviours, were obtained through structured questions. A total of 4900 public primary care adult patients from clinics in high TB burden districts from three provinces in South Africa participated. All the patients screened positive for TB (either new or retreatment cases). The prevalence of PTSD symptoms was 29.6%. Patients who screened positive for PTSD symptoms and psychological distress were more likely to be on antidepressant medication. Factors that predicted PTSD symptoms were poverty, residing in an urban area, psychological distress, suicide attempt, alcohol and/or drug use before sex, unprotected sex, TB-HIV co-infected and the number of other chronic conditions. Health-care systems should be strengthened to improve delivery of mental health care, by focusing on existing programmes and activities, such as those which address the prevention and treatment of TB and HIV.

  1. Evaluation of coexistence of cancer and active tuberculosis; 16 case series

    Directory of Open Access Journals (Sweden)

    Beyhan Çakar

    Full Text Available Introduction: Tuberculosis is an important risk factor for cancer. Pulmonary TB and lung cancer(LC may mimic each other especially in the aspect of the clinical and radiological features. The aim of the study was to evaluate the features and risk factors of cases with coexistence cancer and active TB. Methodology: We retrospectively reviewed the medical records of patients with coexisting TB and cancer a period from 2009 to 2014. We evaluated demographic data, the ways diagnosis of TB cases, the location of TB and cancer, TB treatment results of the cases. Results: We recorded 374 TB cases in our dyspensary at this study period. In 16 (4% of these cases, a coexistence of cancer and TB was detected. The male/female ratio was 12/4. The mean age was 62,12 ± 15,13 years. There were TST results except three cases. There were ten pulmonary TB and six extra-pulmonary TB (four peripheral lymphadenopathy TB, one abdominal TB lymphadenopathy and one salivary gland TB. Cancer types were as follows; eight lung cancer, two breast cancer, one base of tongue, one endometrium cancer, one hypopharyngeal cancer, one stomach cancer, one bladder cancer and one maxillary cancer. Diagnosis of all cases was confirmed by bacteriologic and/or histopathological examination. Squamous cell carcinoma was the most common type of cancers. This rate was 9/16. All TB cases were new. There were risk factors out of two case in the cases. Five cases were died during TB treatment. Others completed TB treatment without any complication. Conclusions: In our study, the coexistence of LC and pulmonary TB was more common. The local immunity is deteriorated in cancer cases. If there is pulmonary infiltrates in lung or peripheral lymphadenopathy, we must search tuberculosis too out of metastatic lesion and other infectious diseases. We should not make delay in the diagnosis of active TB in cancer cases. Keywords: Coexistent, Cancer, Tuberculosis, Tuberculosis treatment

  2. Mortality among MDR-TB cases: comparison with drug-susceptible tuberculosis and associated factors.

    Directory of Open Access Journals (Sweden)

    Kocfa Chung-Delgado

    Full Text Available An increase in multidrug-resistant tuberculosis (MDR-TB cases is evident worldwide. Its management implies a complex treatment, high costs, more toxic anti-tuberculosis drug use, longer treatment time and increased treatment failure and mortality. The aims of this study were to compare mortality between MDR and drug-susceptible cases of tuberculosis, and to determine risk factors associated with mortality among MDR-TB cases.A retrospective cohort study was performed using data from clinical records of the National Strategy for Prevention and Control of Tuberculosis in Lima, Peru. In the first objective, MDR-TB, compared to drug-susceptible cases, was the main exposure variable and time to death, censored at 180 days, the outcome of interest. For the second objective, different variables obtained from clinical records were assessed as potential risk factors for death among MDR-TB cases. Cox regression analysis was used to determine hazard ratios (HR and 95% confidence intervals (95%CI. A total of 1,232 patients were analyzed: mean age 30.9 ±14.0 years, 60.0% were males. 61 patients (5.0% died during treatment, whereas the MDR-TB prevalence was 19.2%. MDR-TB increased the risk of death during treatment (HR = 7.5; IC95%: 4.1-13.4 when compared to presumed drug-susceptible cases after controlling for potential confounders. Education level (p = 0.01, previous TB episodes (p<0.001, diabetes history (p<0.001 and HIV infection (p = 0.04 were factors associated with mortality among MDR-TB cases.MDR-TB is associated with an increased risk of death during treatment. Lower education, greater number of previous TB episodes, diabetes history, and HIV infection were independently associated with mortality among MDR-TB cases. New strategies for appropriate MDR-TB detection and management should be implemented, including drug sensitivity tests, diabetes and HIV screening, as well as guarantee for a complete adherence to therapy.

  3. Resistance to first-line anti-TB drugs is associated with reduced nitric oxide susceptibility in Mycobacterium tuberculosis

    DEFF Research Database (Denmark)

    Idh, Jonna; Mekonnen, Mekidim; Abate, Ebba

    2012-01-01

    The relative contribution of nitric oxide (NO) to the killing of Mycobacterium tuberculosis in human tuberculosis (TB) is controversial, although this has been firmly established in rodents. Studies have demonstrated that clinical strains of M. tuberculosis differ in susceptibility to NO, but how...

  4. Vitamin D enhances IL-1β secretion and restricts growth of Mycobacterium tuberculosis in macrophages from TB patients

    Directory of Open Access Journals (Sweden)

    Daniel Eklund

    2013-01-01

    Full Text Available The emergence of multidrug-resistant strains of Mycobacterium tuberculosis (MTB, the bacterium responsible for tuberculosis (TB, has rekindled the interest in the role of nutritional supplementation of micronutrients, such as vitamin D, as adjuvant treatment. Here, the growth of virulent MTB in macrophages obtained from the peripheral blood of patients with and without TB was studied. The H37Rv strain genetically modified to express Vibrio harveyi luciferase was used to determine the growth of MTB by luminometry in the human monocyte-derived macrophages (hMDMs from study subjects. Determination of cytokine levels in culture supernatants was performed using a flow cytometry-based bead array technique. No differences in intracellular growth of MTB were observed between the different study groups. However, stimulation with 100nM 1,25-dihydroxyvitamin D significantly enhanced the capacity of hMDMs isolated from TB patients to control the infection. This effect was not observed in hMDMs from the other groups. The interleukin (IL-1β and IL-10 release by hMDMs was clearly increased upon stimulation with 1,25-dihydroxyvitamin D. Furthermore, the 1,25-dihydroxyvitamin D stimulation also led to elevated levels of TNF-α (tumor necrosis factor-alpha and IL-12p40. It was concluded that vitamin D triggers an inflammatory response in human macrophages with enhanced secretion of cytokines, as well as enhancing the capacity of hMDMs from patients with active TB to restrict mycobacterial growth.

  5. Systematic Expression Profiling Analysis Identifies Specific MicroRNA-Gene Interactions that May Differentiate between Active and Latent Tuberculosis Infection

    OpenAIRE

    Wu, Lawrence Shih-Hsin; Lee, Shih-Wei; Huang, Kai-Yao; Lee, Tzong-Yi; Hsu, Paul Wei-Che; Weng, Julia Tzu-Ya

    2014-01-01

    Tuberculosis (TB) is the second most common cause of death from infectious diseases. About 90% of those infected are asymptomatic—the so-called latent TB infections (LTBI), with a 10% lifetime chance of progressing to active TB. To further understand the molecular pathogenesis of TB, several molecular studies have attempted to compare the expression profiles between healthy controls and active TB or LTBI patients. However, the results vary due to diverse genetic backgrounds and study designs ...

  6. Difference in TB10.4 T-cell epitope recognition following immunization with recombinant TB10.4, BCG or infection with Mycobacterium tuberculosis

    DEFF Research Database (Denmark)

    Billeskov, Rolf; Grandal, Michael V; Poulsen, Christian

    2010-01-01

    vaccine Ag, TB10.4, in a recombinant form, or when expressed by the pathogen Mycobacterium tuberculosis (M.tb), or by the current anti-tuberculosis vaccine, Mycobacterium bovis BCG. We showed that BCG and M.tb induced a similar CD4(+) T-cell specific TB10.4 epitope-pattern, which differed completely from...... that induced by recombinant TB10.4. This difference was not due to post-translational modifications of TB10.4 or because TB10.4 is secreted from BCG and M.tb as a complex with Rv0287. In addition, BCG and TB10.4/CAF01 were both taken up by DC and macrophages in vivo, and in vitro uptake experiments revealed...... that both TB10.4 and BCG were transported to Lamp(+)-compartments. BCG and TB10.4 however, were directed to different types of Lamp(+)-compartments in the same APC, which may lead to different epitope recognition patterns. In conclusion, we show that different vectors can induce completely different...

  7. Diagnosis of tuberculosis in a high TB-HIV environment using ...

    African Journals Online (AJOL)

    There is growing concern about the high transmission of tuberculosis (TB) in prisons posing a risk to the outside community. There are high levels of overcrowding in the Uganda Prisons Service (UPS) with some prisons accommodating 4 times above their designed capacities. Our objective was to determine the prevalence ...

  8. diagnosis of tuberculosis in a high tb-hiv environment using ...

    African Journals Online (AJOL)

    PUBLICATIONS1

    ABSTRACT. There is growing concern about the high transmission of tuberculosis (TB) in prisons posing a risk to the outside community. There are high levels of overcrowding in the Uganda Prisons Ser- vice (UPS) with some prisons accommodating 4 times above their designed capacities. Our ob- jective was to determine ...

  9. Eco-epidemiology of Bovine Tuberculosis (bTB) in an African savanna

    NARCIS (Netherlands)

    Dejene, Sintayehu Workeneh

    2017-01-01

    Bovine tuberculosis (bTB) is a zoonotic disease, and remains a cause of concern for livestock, wildlife and human health, especially in Ethiopia. It is a contagious disease, so close contact between animals or sharing of feed between infected and non-infected animals are major risk factors for

  10. Prevalence of Pulmonary Tuberculosis among Household Contacts in Hyderabad, Sindh: Active Contact Tracing in Children with Tuberculosis

    International Nuclear Information System (INIS)

    Sheikh, M.A.; Shah, S.A.A.

    2017-01-01

    Background: Tuberculosis (TB) in children is clearly linked to TB in adults therefore active household contact tracing is an important method of early diagnosis and treatment particularly in high-TB-burden countries. Objectives: To estimate the prevalence of TB among household contacts of children suffering from tuberculosis using active contact tracing and linking them to TB program for treatment. Subjects and Methods: A total of 125 children suffering from active tuberculosis (index cases)aged 12 years or less were randomly selected from the outpatient department of a tertiary care hospital of Hyderabad. Using their home address, all house hold members of the index cases (sharing one kitchen) were identified. The households were visited by a team including a doctor and the supported staff and were screened for TB using history, physical examination, sputum for AFB and X-ray of chest. Clinical suspects were divided in to two populations, equal to or less than 12 years of age and greater than this age. All suspected cases were brought to outpatient's department of the hospital where children were examined and diagnosed by pediatrician and adults were examined by the pulmonologist. Results: There were 125 children and 1365 household members. Prevalence of active TB in adult household contacts was 8.1 percent and among children was 5.7 percent. Mother, father, grand parents or siblings were the source of disease spread in children. Family history of TB was present in 95 percent (pulmonary 78 percent, extra-pulmonary 22 percent). Conclusion: Tuberculosis in children is mostly spreading from household member hence deeply required to undertake active contact tracing in each new case that is diagnosed or being treated. Policy message: National and Provincial TB programs should advocate and undertake active screening of all household contacts of all TB cases. (author)

  11. Risk factors associated with multidrug-resistant tuberculosis (MDR-TB) in a tertiary armed force referral and teaching hospital, Ethiopia.

    Science.gov (United States)

    Demile, Biresaw; Zenebu, Amare; Shewaye, Haile; Xia, Siqing; Guadie, Awoke

    2018-05-31

    Ethiopia is one of the world health organization defined higher tuberculosis (TB) burden countries where the disease remains a massive public health threat. This study aimed to identify the prevalence and associated factors of multidrug-resistant tuberculosis (MDR-TB) using all armed force and civilian TB attendants in a tertiary level armed force hospital, where data for MDR-TB are previously unpublished. Cross-sectional study was conducted from September 2014 to August 2015 in a tertiary level Armed Force Referral and Teaching Hospital (AFRTH), Ethiopia. Armed force members (n = 251) and civilians (n = 130) which has been undergone TB diagnosis at AFRTH were included. All the specimens collected were subjected to microscopic smear observation, culture growth and drug susceptibility testing. Data were analyzed using statistical package for social sciences following binary logistic regression and Chi-square. P-values < 0.05 were considered statistically significant. Among 381 TB patients, 355 (93.2%) new and 26 (6.8%) retreatment cases were identified. Culture and smear positive TB cases were identified in 297 (77.9%) and 252 (66.1%) patients, respectively. The overall prevalence of MDR-TB in AFRTH was found 1.8% (1.3% for armed force members and 0.5% for civilian patients) all of which were previously TB treated cases. The entire treatment success rates were 92.6% achieved highest in the armed force (active and pension) than the civilian patients. The failure and dead cases were also found 2.5 and 4.6%, respectively. Using bivariate analysis, category of attendants and TB contact history were strong predictors of MDR-TB in armed force and civilian patients. Moreover, human immunodeficiency virus (HIV) infection also identified a significant (OR = 14.6; 95% CI = 2.3-92.1; p = 0.004) predicting factor for MDR-TB in armed force members. However, sex, age and body mass index were not associated factor for MDR-TB. In AFRTH, lower prevalence of

  12. The association between alcohol use, alcohol use disorders and tuberculosis (TB. A systematic review

    Directory of Open Access Journals (Sweden)

    Room Robin

    2009-12-01

    Full Text Available Abstract Background In 2004, tuberculosis (TB was responsible for 2.5% of global mortality (among men 3.1%; among women 1.8% and 2.2% of global burden of disease (men 2.7%; women 1.7%. The present work portrays accumulated evidence on the association between alcohol consumption and TB with the aim to clarify the nature of the relationship. Methods A systematic review of existing scientific data on the association between alcohol consumption and TB, and on studies relevant for clarification of causality was undertaken. Results There is a strong association between heavy alcohol use/alcohol use disorders (AUD and TB. A meta-analysis on the risk of TB for these factors yielded a pooled relative risk of 2.94 (95% CI: 1.89-4.59. Numerous studies show pathogenic impact of alcohol on the immune system causing susceptibility to TB among heavy drinkers. In addition, there are potential social pathways linking AUD and TB. Heavy alcohol use strongly influences both the incidence and the outcome of the disease and was found to be linked to altered pharmacokinetics of medicines used in treatment of TB, social marginalization and drift, higher rate of re-infection, higher rate of treatment defaults and development of drug-resistant forms of TB. Based on the available data, about 10% of the TB cases globally were estimated to be attributable to alcohol. Conclusion The epidemiological and other evidence presented indicates that heavy alcohol use/AUD constitute a risk factor for incidence and re-infection of TB. Consequences for prevention and clinical interventions are discussed.

  13. Evaluation of Active Case Finding (ACF of Tuberculosis in Slums Population in North of Iran

    Directory of Open Access Journals (Sweden)

    Reza Hoseinpoor

    2017-05-01

    Full Text Available Background At present of the limitation of the current case finding strategies and the global urgency to improve tuberculosis (TB case finding, a renewed interest in active case finding (ACF has risen. World Health Organization (WHO calls for research on TB screening among low-income countries because of the limitation of the passive case finding strategies. We aimed to evaluated Active Case Finding strategy for TB among the slums population in North of Iran (Gorgan city and comprise this procedure to Passive Case Finding. Materials and Methods We conducted a house-to-house survey from April 2016 to July 2016 by trained health volunteers for TB in ten urban slums of Gorgan. Individuals with TB symptoms were identified through targeted screening using a standardized questionnaire and investigated further for TB. Descriptive analyses were performed using Stata-12. Results During study period, of 22,741 individuals screened for TB, 112 (0.49% were identified as TB suspects; 95 suspects were evaluated for TB. TB was diagnosed in four individuals, representing 4.2% of those evaluated for TB as suspected cases. The incidence rate of tuberculosis was 17.5 in 100.000 people in slums population of Gorgan. Of the four detected cases, three individuals had pulmonary TB that among them two cases had new smear-positive TB. Conclusion ACF could supplement current strategies to yield additional TB cases, lead to early diagnosis and better treatment.

  14. Drug Susceptibility of Mycobacterium tuberculosis Beijing Genotype and Association with MDR TB

    Science.gov (United States)

    ten Kate, Marian T.; de Knegt, Gerjo J.; Kremer, Kristin; Aarnoutse, Rob E.; Boeree, Martin J.; Verbrugh, Henri A.; van Soolingen, Dick; Bakker-Woudenberg, Irma A.J.M.

    2012-01-01

    To determine differences in the ability of Mycobacterium tuberculosis strains to withstand antituberculosis drug treatment, we compared the activity of antituberculosis drugs against susceptible Beijing and East-African/Indian genotype M. tuberculosis strains. Beijing genotype strains showed high rates of mutation within a wide range of drug concentrations, possibly explaining this genotype’s association with multidrug-resistant tuberculosis. PMID:22469099

  15. PhyTB: Phylogenetic tree visualisation and sample positioning for M. tuberculosis

    KAUST Repository

    Benavente, Ernest D

    2015-05-13

    Background Phylogenetic-based classification of M. tuberculosis and other bacterial genomes is a core analysis for studying evolutionary hypotheses, disease outbreaks and transmission events. Whole genome sequencing is providing new insights into the genomic variation underlying intra- and inter-strain diversity, thereby assisting with the classification and molecular barcoding of the bacteria. One roadblock to strain investigation is the lack of user-interactive solutions to interrogate and visualise variation within a phylogenetic tree setting. Results We have developed a web-based tool called PhyTB (http://pathogenseq.lshtm.ac.uk/phytblive/index.php webcite) to assist phylogenetic tree visualisation and identification of M. tuberculosis clade-informative polymorphism. Variant Call Format files can be uploaded to determine a sample position within the tree. A map view summarises the geographical distribution of alleles and strain-types. The utility of the PhyTB is demonstrated on sequence data from 1,601 M. tuberculosis isolates. Conclusion PhyTB contextualises M. tuberculosis genomic variation within epidemiological, geographical and phylogenic settings. Further tool utility is possible by incorporating large variants and phenotypic data (e.g. drug-resistance profiles), and an assessment of genotype-phenotype associations. Source code is available to develop similar websites for other organisms (http://sourceforge.net/projects/phylotrack webcite).

  16. EDITORIAL Multi-drug-resistant tuberculosis (MDR-TB): Current ...

    African Journals Online (AJOL)

    A South African Health Systems Trust report indicated that despite a global ... less financial resources performed better. ... Healthcare providers need to be better trained at our various nursing colleges and medical schools on how to manage TB, with regular and intense follow-up in-service training sessions. In addition ...

  17. Prospective evaluation of a whole-blood test using Mycobacterium tuberculosis-specific antigens ESAT-6 and CFP-10 for diagnosis of active tuberculosis

    DEFF Research Database (Denmark)

    Ravn, Pernille; Munk, Martin E; Andersen, Ase B

    2005-01-01

    A new immunodiagnostic test based on the Mycobacterium tuberculosis-specific antigens CFP-10/ESAT-6(QFT-RD1) has been launched as an aid in the diagnosis of latent tuberculosis (TB) infection (LTBI). The aim of this study was to evaluate this test for the diagnosis of active TB. Eighty-two patients...... with suspicion of TB and 39 healthy BCG-vaccinated persons were enrolled. Forty-eight had active TB, 25 did not, and 9 were excluded. Sensitivity and specificity of the test for active TB were evaluated in a prospective blinded manner in patients suspected of TB. The sensitivity of the QFT-RD1 was 85% (40......% (5/12) by culture (P test, sensitivity increased to 96% (CI, 90 to 102). Ten of 25 (40%) non-TB patients were QFT-RD1 positive, resulting...

  18. Pulmonary tuberculosis

    Science.gov (United States)

    TB; Tuberculosis - pulmonary; Mycobacterium - pulmonary ... Pulmonary TB is caused by the bacterium Mycobacterium tuberculosis (M tuberculosis) . TB is contagious. This means the bacteria is easily spread from an infected person ...

  19. Definition of drug resistance of Mycobacterium tuberculosis to antituberculosis drugs in patients with multidrugresistant tuberculosis and TB with extremely drug resistant depending on the case of the disease

    Directory of Open Access Journals (Sweden)

    Kryzhanovsky D.G.

    2014-11-01

    Full Text Available There was studied the profile of drug resistance to the main (I line and reserve (II line antituberculosis drugs in patients with MDR and XDR tuberculosis, depending of the case of the disease. According to the randomized retrospective research 200 patients with MDR and XDR tuberculosis, who received treatment in the clinic of hospital Municipal institution «Dnipropetrovsk rigional clinical association «Phthisiology» Dnipropetrovsk regional Council» during the period 2010 – 2012 were involved. Data about patients contained the data on a case of the disease and the results of the test of drug sensitivity to MBT. XDR – TB was revealed in 7.5% of patients with MDR tuberculosis. In patients with MDR tuberculosis as compared with patients with XDR tuberculosis «new cases» were diagnosed in 19.5% against 18.5% (p <0.05. In patients with MDR tuberculosis and with XDR tuberculosis resistance to the antituberculosis drug more commonly developed to S - 88.5%, E - 55% and Z - 24%. The presence of MDR-TB and XDR-TB prevails in patients, who underwent previous courses of treatment with anti-TB drugs in case history as compared with patients with «new cases» of treatment. The development of resistance to anti-TB drugs depends on the availability of these drugs in the previous treatment regimens.

  20. Factors influencing quality of life in patients with active tuberculosis.

    Science.gov (United States)

    Marra, Carlo A; Marra, Fawziah; Cox, Victoria C; Palepu, Anita; Fitzgerald, J Mark

    2004-10-20

    With effective treatment strategies, the focus of tuberculosis (TB) management has shifted from the prevention of mortality to the avoidance of morbidity. As such, there should be an increased focus on quality of life (QoL) experienced by individuals being treated for TB. The objective of our study was to identify areas of QoL that are affected by active TB using focus groups and individual interviews. English, Cantonese, and Punjabi-speaking subjects with active TB who were receiving treatment were eligible for recruitment into the study. Gender-based focus group sessions were conducted for the inner city participants but individual interviews were conducted for those who came to the main TB clinic or were hospitalized. Facilitators used open-ended questions and participants were asked to discuss their experiences of being diagnosed with tuberculosis, what impact it had on their lives, issues around adherence to anti-TB medications and information pertaining to their experience with side effects to these medications. All data were audio-recorded, transcribed verbatim, and analyzed using constant comparative analysis. 39 patients with active TB participated. The mean age was 46.2 years (SD 18.4) and 62% were male. Most were Canadian-born being either Caucasian or Aboriginal. Four themes emerged from the focus groups and interviews. The first describes issues related to the diagnosis of tuberculosis and sub-themes were identified as 'symptoms', 'health care provision', and 'emotional impact'. The second theme discusses TB medication factors and the sub-themes identified were 'adverse effects', 'ease of administration', and 'adherence'. The third theme describes social support and functioning issues for the individuals with TB. The fourth theme describes health behavior issues for the individuals with TB and the identified sub-themes were "behavior modification" and "TB knowledge." Despite the ability to cure TB, there remains a significant impact on QOL. Since much

  1. Factors influencing quality of life in patients with active tuberculosis

    Directory of Open Access Journals (Sweden)

    Cox Victoria C

    2004-10-01

    Full Text Available Abstract Background With effective treatment strategies, the focus of tuberculosis (TB management has shifted from the prevention of mortality to the avoidance of morbidity. As such, there should be an increased focus on quality of life (QoL experienced by individuals being treated for TB. The objective of our study was to identify areas of QoL that are affected by active TB using focus groups and individual interviews. Methods English, Cantonese, and Punjabi-speaking subjects with active TB who were receiving treatment were eligible for recruitment into the study. Gender-based focus group sessions were conducted for the inner city participants but individual interviews were conducted for those who came to the main TB clinic or were hospitalized. Facilitators used open-ended questions and participants were asked to discuss their experiences of being diagnosed with tuberculosis, what impact it had on their lives, issues around adherence to anti-TB medications and information pertaining to their experience with side effects to these medications. All data were audio-recorded, transcribed verbatim, and analyzed using constant comparative analysis. Results 39 patients with active TB participated. The mean age was 46.2 years (SD 18.4 and 62% were male. Most were Canadian-born being either Caucasian or Aboriginal. Four themes emerged from the focus groups and interviews. The first describes issues related to the diagnosis of tuberculosis and sub-themes were identified as 'symptoms', 'health care provision', and 'emotional impact'. The second theme discusses TB medication factors and the sub-themes identified were 'adverse effects', 'ease of administration', and 'adherence'. The third theme describes social support and functioning issues for the individuals with TB. The fourth theme describes health behavior issues for the individuals with TB and the identified sub-themes were "behavior modification" and "TB knowledge." Conclusion Despite the ability to

  2. Diagnosis of active TB using aptamers

    CSIR Research Space (South Africa)

    Khati, M

    2013-08-01

    Full Text Available of the disease. We have shown in a proof-of-concept case-controlled study that the aptamer-based diagnostic tool was able to accurately detect all cases of active TB from sputum samples of patients, including smear-negative culture positive and samples from...

  3. Mycobacterium tuberculosis lipolytic enzymes as potential biomarkers for the diagnosis of active tuberculosis.

    Directory of Open Access Journals (Sweden)

    Belinda Brust

    Full Text Available BACKGROUND: New diagnosis tests are urgently needed to address the global tuberculosis (TB burden and to improve control programs especially in resource-limited settings. An effective in vitro diagnostic of TB based on serological methods would be regarded as an attractive progress because immunoassays are simple, rapid, inexpensive, and may offer the possibility to detect cases missed by standard sputum smear microscopy. However, currently available serology tests for TB are highly variable in sensitivity and specificity. Lipolytic enzymes have recently emerged as key factors in lipid metabolization during dormancy and/or exit of the non-replicating growth phase, a prerequisite step of TB reactivation. The focus of this study was to analyze and compare the potential of four Mycobacterium tuberculosis lipolytic enzymes (LipY, Rv0183, Rv1984c and Rv3452 as new markers in the serodiagnosis of active TB. METHODS: Recombinant proteins were produced and used in optimized ELISA aimed to detect IgG and IgM serum antibodies against the four lipolytic enzymes. The capacity of the assays to identify infection was evaluated in patients with either active TB or latent TB and compared with two distinct control groups consisting of BCG-vaccinated blood donors and hospitalized non-TB individuals. RESULTS: A robust humoral response was detected in patients with active TB whereas antibodies against lipolytic enzymes were infrequently detected in either uninfected groups or in subjects with latent infection. High specifity levels, ranging from 93.9% to 97.5%, were obtained for all four antigens with sensitivity values ranging from 73.4% to 90.5%, with Rv3452 displaying the highest performances. Patients with active TB usually exhibited strong IgG responses but poor IgM responses. CONCLUSION: These results clearly indicate that the lipolytic enzymes tested are strongly immunogenic allowing to distinguish active from latent TB infections. They appear as potent

  4. Tuberculosis Screening on a Health Science Campus: Use of QuantiFERON-TB Gold Test for Students and Employees

    Science.gov (United States)

    Veeser, Peggy Ingram; Smith, Phillip Karl; Handy, Barry; Martin, Sharon R.

    2007-01-01

    Detecting and managing "Mycobacterium tuberculosis" (TB) infection in a health-science center population is a clinical dilemma. Tuberculin skin tests are still the preferred method for detecting present or past infection of TB. The authors discuss the performance of whole blood interferon gamma release assay test commercially known as…

  5. Viral hepatitis and HIV-associated tuberculosis: Risk factors and TB treatment outcomes in Thailand

    Directory of Open Access Journals (Sweden)

    Likanonsakul Sirirat

    2008-07-01

    Full Text Available Abstract Background The occurrence of tuberculosis (TB, human immunodeficiency virus (HIV, and viral hepatitis infections in the same patient poses unique clinical and public health challenges, because medications to treat TB and HIV are hepatotoxic. We conducted an observational study to evaluate risk factors for HBsAg and/or anti-HCV reactivity and to assess differences in adverse events and TB treatment outcomes among HIV-infected TB patients. Methods Patients were evaluated at the beginning, during, and at the end of TB treatment. Blood samples were tested for aspartate aminotransferase (AST, alanine aminotransferase (ALT, total bilirubin (BR, complete blood count, and CD4+ T lymphocyte cell count. TB treatment outcomes were assessed at the end of TB treatment according to international guidelines. Results Of 769 enrolled patients, 752 (98% had serologic testing performed for viral hepatitis: 70 (9% were reactive for HBsAg, 237 (31% for anti-HCV, and 472 (63% non-reactive for both markers. At the beginning of TB treatment, 18 (26% patients with HBsAg reactivity had elevated liver function tests compared with 69 (15% patients non-reactive to any viral marker (p = 0.02. At the end of TB treatment, 493 (64% were successfully treated. Factors independently associated with HBsAg reactivity included being a man who had sex with men (adjusted odds ratio [AOR], 2.1; 95% confidence interval [CI], 1.1–4.3 and having low TB knowledge (AOR, 1.8; CI, 1.0–3.0. Factors most strongly associated with anti-HCV reactivity were having injection drug use history (AOR, 12.8; CI, 7.0–23.2 and living in Bangkok (AOR, 15.8; CI, 9.4–26.5. The rate of clinical hepatitis and death during TB treatment was similar in patients HBsAg reactive, anti-HCV reactive, both HBsAg and anti-HCV reactive, and non-reactive to any viral marker. Conclusion Among HIV-infected TB patients living in Thailand, markers of viral hepatitis infection, particularly hepatitis C virus

  6. Detection of circulating Mycobacterium tuberculosis-specific DNA by droplet digital PCR for vaccine evaluation in challenged monkeys and TB diagnosis.

    Science.gov (United States)

    Song, Neng; Tan, Yang; Zhang, Lingyun; Luo, Wei; Guan, Qing; Yan, Ming-Zhe; Zuo, Ruiqi; Liu, Weixiang; Luo, Feng-Ling; Zhang, Xiao-Lian

    2018-04-24

    Mycobacterium tuberculosis (M. tb) is emerging as a more serious pathogen due to the increased multidrug-resistant TB and co-infection of human immunodeficiency virus (HIV). The development of an effective and sensitive detection method is urgently needed for bacterial load evaluation in vaccine development, early TB diagnosis, and TB treatment. Droplet digital polymerase chain reaction (ddPCR) is a newly developed sensitive PCR method for the absolute quantification of nucleic acid concentrations. Here, we used ddPCR to quantify the circulating virulent M. tb-specific CFP10 (10-kDa culture filtrate protein, Rv3874) and Rv1768 DNA copy numbers in the blood samples from Bacille Calmette-Guerin (BCG)-vaccinated and/or virulent M. tb H37Rv-challenged rhesus monkeys. We found that ddPCR was more sensitive compared to real-time fluorescence quantitative PCR (qPCR), as the detection limits of CFP10 were 1.2 copies/μl for ddPCR, but 15.8 copies/μl for qPCR. We demonstrated that ddPCR could detect CFP10 and Rv1768 DNA after 3 weeks of infection and at least two weeks earlier than qPCR in M.tb H37Rv-challenged rhesus monkey models. DdPCR could also successfully quantify CFP10 and Rv1768 DNA copy numbers in clinical TB patients' blood samples (active pulmonary TB, extrapulmonary TB (EPTB), and infant TB). To our knowledge, this study is the first to demonstrate that ddPCR is an effective and sensitive method of measuring the circulating CFP10 and Rv1768 DNA for vaccine development, bacterial load evaluation in vivo, and early TB (including EPTB and infant TB) diagnosis as well.

  7. TB epidemiology: where are the young women? Know your tuberculosis epidemic, know your response.

    Science.gov (United States)

    Perumal, Rubeshan; Naidoo, Kogieleum; Padayatchi, Nesri

    2018-03-27

    The global predominance of tuberculosis in men has received significant attention. However, epidemiological studies now demonstrate that there is an increased representation of young women with tuberculosis, especially in high HIV burden settings where young women bear a disproportionate burden of HIV. The role of the HIV epidemic, as well as changes in behavioural, biological, and structural risk factors are explored as potential explanations for the increasing burden of tuberculosis in young women. As young women are particularly vulnerable to HIV infection in sub-Saharan Africa, it is unsurprising that the TB epidemic in this setting has become increasingly feminised. This age-sex trend of TB in South Africa is similar to WHO estimates for other countries with a high HIV prevalence where there are more female than male cases notified up to the age of 25 years. The high prevalence of anaemia of chronic disease in young women with HIV is an additional potential reason for their increased TB risk. The widespread use of injectable medroxyprogesterone acetate contraception, which has been shown to possess selective glucocorticoid effect and oestrogen suppression, in young women may be an important emerging biological risk factor for tuberculosis in young women. Behavioural factors such as alcohol use and tobacco smoking patterns are further factors which may be responsible for the narrowing of the sex gap in TB epidemiology. In comparison to the significantly higher alcohol consumption rates in men globally, there is a narrowing gap in alcohol consumption between the sexes in South Africa with alarming rates of alcohol abuse in young women. There is a similar narrowing of the tobacco smoking gap between the sexes in South Africa, with increasing smoking prevalence in young women. With nearly 70% of all TB patients being co-infected with HIV in our setting, it is not surprising that the age and sex distribution of TB is increasingly resembling the distribution of HIV

  8. Clinical implications of molecular drug resistance testing for Mycobacterium tuberculosis: a TBNET/RESIST-TB consensus statement

    NARCIS (Netherlands)

    Domínguez, J.; Boettger, E. C.; Cirillo, D.; Cobelens, F.; Eisenach, K. D.; Gagneux, S.; Hillemann, D.; Horsburgh, R.; Molina-Moya, B.; Niemann, S.; Tortoli, E.; Whitelaw, A.; Lange, C.

    2016-01-01

    The emergence of drug-resistant strains of Mycobacterium tuberculosis is a challenge to global tuberculosis (TB) control. Although culture-based methods have been regarded as the gold standard for drug susceptibility testing (DST), molecular methods provide rapid information on mutations in the M.

  9. Association between smoking, tuberculosis and diabetes-TB: an analysis on Indian TB patients

    Directory of Open Access Journals (Sweden)

    Ashok Bhardwaj

    2018-03-01

    400 (100 P value Non Smoker 20 (10.5 170 (89.5 190 (100 0.03 Current 17 (12.5 119 (87.5 136 (100 Ex -Smoker 17 (33.0 57 (77.0 74 (100 Median duration of smoking (IQR in years 20 (30 0.5 (25 3 (65 0.03 [Prevalence of Smoking with TB DM

  10. A Data-Driven Evaluation of the Stop TB Global Partnership Strategy of Targeting Key Populations at Greater Risk for Tuberculosis.

    Science.gov (United States)

    McLaren, Zoë M; Schnippel, Kathryn; Sharp, Alana

    2016-01-01

    Identifying those infected with tuberculosis (TB) is an important component of any strategy for reducing TB transmission and population prevalence. The Stop TB Global Partnership recently launched an initiative with a focus on key populations at greater risk for TB infection or poor clinical outcomes, due to housing and working conditions, incarceration, low household income, malnutrition, co-morbidities, exposure to tobacco and silica dust, or barriers to accessing medical care. To achieve operational targets, the global health community needs effective, low cost, and large-scale strategies for identifying key populations. Using South Africa as a test case, we assess the feasibility and effectiveness of targeting active case finding to populations with TB risk factors identified from regularly collected sources of data. Our approach is applicable to all countries with TB testing and census data. It allows countries to tailor their outreach activities to the particular risk factors of greatest significance in their national context. We use a national database of TB test results to estimate municipality-level TB infection prevalence, and link it to Census data to measure population risk factors for TB including rates of urban households, informal settlements, household income, unemployment, and mobile phone ownership. To examine the relationship between TB prevalence and risk factors, we perform linear regression analysis and plot the set of population characteristics against TB prevalence and TB testing rate by municipality. We overlay lines of best fit and smoothed curves of best fit from locally weighted scatter plot smoothing. Higher TB prevalence is statistically significantly associated with more urban municipalities (slope coefficient β1 = 0.129, p informal settlement households (β1 = 0.021, p = 0.136, R2 = 0.014). These analyses reveal that the set of characteristics identified by the Global Plan as defining key populations do not adequately predict

  11. Dihydrolipoamide dehydrogenase-Lpd (Rv0462)-specific T cell recall responses are higher in healthy household contacts of TB: a novel immunodominant antigen from M. tuberculosis.

    Science.gov (United States)

    Devasundaram, Santhi; Raja, Alamelu

    2017-07-01

    The partial effectiveness against pulmonary tuberculosis (PTB), displayed by the existing tuberculosis (TB) vaccine, bacillus Calmette-Guérin (BCG), highlights the need for novel vaccines to replace or improve BCG. In TB immunology, antigen-specific cellular immune response is frequently considered indispensable. Latency-associated antigens are intriguing as targets for TB vaccine development. The mycobacterial protein, dihydrolipoamide dehydrogenase (Lpd; Rv0462), the third enzyme of the pyruvate dehydrogenase (PDH) complex, facilitates Mycobacterium tuberculosis to resist host reactive nitrogen intermediates. Multicolor flow cytometry analysis of whole-blood cultures showed higher Lpd-specific Th1 recall response (IFN-γ, TNF-α, and IL-2; P = 0.0006) and memory CD4 + and CD8 + T cells (CCR7 + CD45RA - and CCR7 - CD45RA - ) in healthy household contacts (HHC) of TB ( P < 0.0001), which is comparable with or higher than the standard antigens, ESAT-6 and CFP-10. The frequency of Lpd-specific multifunctional T cells was higher in HHC compared with PTB patients. However, there is no significant statistical correlation. Regulatory T cell (T reg ) analysis of HHCs and active TB patients demonstrated very low Lpd-specific CD4 + T regs relative to ESAT-6 and CFP-10. Our study demonstrates that the Lpd antigen induces a strong cellular immune response in healthy mycobacteria-infected individuals. In consideration of this population having demonstrated immunologic protection against active TB disease development, our data are encouraging about the possible use of Lpd as a target for further TB subunit vaccine development. © Society for Leukocyte Biology.

  12. Psychiatric disorders in patients with multidrug resistant tuberculosis (MDR-TB in Sardjito Hospital, Yogyakarta, Indonesia

    Directory of Open Access Journals (Sweden)

    Irwan Supriyanto

    2017-08-01

    Full Text Available Introduction: Tuberculosis has become a chronic debilitating disease in developing countries, particularly after the emergence of multidrug resistant tuberculosis (MDR-TB. Second line treatments for the disease which were subsequently developed were associated with psychiatric disorders among patients. Psychiatric disorder can either be induced by treatment regiments or psychosocial factors. Cycloserine administration is frequently reported to be associated with psychiatric disorders. In this study, we examined the prevalence and characteristics of psychiatric disorders among MDR-TB patients in Sardjito Hospital, Yogyakarta, Indonesia. Methods: In this descriptive study, we studied medical records of MDR-TB patients admitted for MDR-TB treatments to Sardjito Hospital from January 2014 to July 2016 and screened for psychiatric disorders. Results: We found that 32.8% of the patients had psychiatric disorders, some of which had multiple psychiatric diagnoses (14.1%. The diagnoses were medication induced delirium, substance/medication induced psychotic disorder, substance/medication use depressive disorder, depressive type schizoaffective disorder, bipolar I disorder current episode severe manic with psychotic features, mild depression, moderate depression, major depression without psychotic features, major depression with psychotic features, adjustment disorders with mixed anxiety and depressed mood, adjustment disorder with anxiety, acute stress disorder, and insomnia. Psychiatric disorders were significantly associated with cycloserine dose and sex. Psychotic symptoms were significantly associated with sex and level of education. Conclusion: The presence of psychiatric disorders might disturb MDR-TB treatment resulting in poor outcomes. Precaution and prompt managements are required for psychiatric disorders in patients receiving MDR-TB treatment regiments.

  13. Vitamin D enhances IL-1β secretion and restricts growth of Mycobacterium tuberculosis in macrophages from TB patients.

    Science.gov (United States)

    Eklund, Daniel; Persson, Hans Lennart; Larsson, Marie; Welin, Amanda; Idh, Jonna; Paues, Jakob; Fransson, Sven-Göran; Stendahl, Olle; Schön, Thomas; Lerm, Maria

    2013-03-01

    The emergence of multidrug-resistant strains of Mycobacterium tuberculosis (MTB), the bacterium responsible for tuberculosis (TB), has rekindled the interest in the role of nutritional supplementation of micronutrients, such as vitamin D, as adjuvant treatment. Here, the growth of virulent MTB in macrophages obtained from the peripheral blood of patients with and without TB was studied. The H37Rv strain genetically modified to express Vibrio harveyi luciferase was used to determine the growth of MTB by luminometry in the human monocyte-derived macrophages (hMDMs) from study subjects. Determination of cytokine levels in culture supernatants was performed using a flow cytometry-based bead array technique. No differences in intracellular growth of MTB were observed between the different study groups. However, stimulation with 100nM 1,25-dihydroxyvitamin D significantly enhanced the capacity of hMDMs isolated from TB patients to control the infection. This effect was not observed in hMDMs from the other groups. The interleukin (IL)-1β and IL-10 release by hMDMs was clearly increased upon stimulation with 1,25-dihydroxyvitamin D. Furthermore, the 1,25-dihydroxyvitamin D stimulation also led to elevated levels of TNF-α (tumor necrosis factor-alpha) and IL-12p40. It was concluded that vitamin D triggers an inflammatory response in human macrophages with enhanced secretion of cytokines, as well as enhancing the capacity of hMDMs from patients with active TB to restrict mycobacterial growth. Copyright © 2013 Asian-African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

  14. Utility of urine lipoarabinomannan (LAM) in diagnosing tuberculosis and predicting mortality with and without HIV: prospective TB cohort from the Thailand Big City TB Research Network.

    Science.gov (United States)

    Suwanpimolkul, Gompol; Kawkitinarong, Kamon; Manosuthi, Weerawat; Sophonphan, Jiratchaya; Gatechompol, Sivaporn; Ohata, Pirapon June; Ubolyam, Sasiwimol; Iampornsin, Thatri; Katerattanakul, Pairaj; Avihingsanon, Anchalee; Ruxrungtham, Kiat

    2017-06-01

    To evaluate the applicability and accuracy of the urine lipoarabinomannan (LAM) test in tuberculosis (TB)/HIV co-infected patients and HIV-negative patients with disseminated TB. Frozen urine samples obtained at baseline from patients in the TB research cohort with proven culture-positive TB were selected for blinded urine LAM testing. One hundred and nine patients were categorized into four groups: (1) HIV-positive patients with TB; (2) HIV-negative patients with disseminated TB; (3) HIV-negative immunocompromised patients with TB; and (4) patients with diseases other than TB. The sensitivity of urine LAM testing for culture-positive TB, specificity of urine LAM testing for patients without TB, positive predictive value (PPV), and negative predictive value (NPV) were assessed. The sensitivity of the urine LAM test in group 1 patients with a CD4 T-cell count of >100, ≤100, and ≤50 cells/mm 3 was 38.5%, 40.6%, and 45%, respectively. The specificity and PPV of the urine LAM test were >80%. The sensitivity of the test was 20% in group 2 and 12.5% in group 3, and the specificity and PPV were 100% for both groups. A positive urine LAM test result was significantly associated with death. This promising diagnostic tool could increase the yield of TB diagnosis and may predict the mortality rate of TB infection, particularly in TB/HIV co-infected patients. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  15. Risk Factors for Bovine Tuberculosis (bTB in Cattle in Ethiopia.

    Directory of Open Access Journals (Sweden)

    Sintayehu W Dejene

    Full Text Available Bovine tuberculosis (bTB infection is generally correlated with individual cattle's age, sex, body condition, and with husbandry practices such as herd composition, cattle movement, herd size, production system and proximity to wildlife-including bTB maintenance hosts. We tested the correlation between those factors and the prevalence of bTB, which is endemic in Ethiopia's highland cattle, in the Afar Region and Awash National Park between November 2013 and April 2015. A total of 2550 cattle from 102 herds were tested for bTB presence using the comparative intradermal tuberculin test (CITT. Data on herd structure, herd movement, management and production system, livestock transfer, and contact with wildlife were collected using semi-structured interviews with cattle herders and herd owners. The individual overall prevalence of cattle bTB was 5.5%, with a herd prevalence of 46%. Generalized Linear Mixed Models with a random herd-effect were used to analyse risk factors of cattle reactors within each herd. The older the age of the cattle and the lower the body condition the higher the chance of a positive bTB test result, but sex, lactation status and reproductive status were not correlated with bTB status. At herd level, General Linear Models showed that pastoral production systems with transhumant herds had a higher bTB prevalence than sedentary herds. A model averaging analysis identified herd size, contact with wildlife, and the interaction of herd size and contact with wildlife as significant risk factors for bTB prevalence in cattle. A subsequent Structural Equation Model showed that the probability of contact with wildlife was influenced by herd size, through herd movement. Larger herds moved more and grazed in larger areas, hence the probability of grazing in an area with wildlife and contact with either infected cattle or infected wildlife hosts increased, enhancing the chances for bTB infection. Therefore, future bTB control strategies

  16. Toward a Generation Free of Tuberculosis: TB Disease and Infection in Individuals of College Age in the United States

    Science.gov (United States)

    Shah, N. S.; Flood-Bryzman, A.; Jeffries, C.; Scott, J.

    2018-01-01

    Objectives: To assess the magnitude of active TB disease and latent TB infection (LTBI) in young adults of college age. Participants: Individuals who were aged 18-24 years in 2011 were used as a proxy for college students. Methods: Active TB cases reported to the 2011 US National TB Surveillance System (NTSS) were included. LTBI prevalence was…

  17. Rapid Screening of MDR-TB in Cases of Extra Pulmonary Tuberculosis Using Geno Type MTBDRplus.

    Directory of Open Access Journals (Sweden)

    Richa Kumari

    Full Text Available Drug resistance in tuberculosis is a major public health challenge in developing countries. The limited data available on drug resistance in extra pulmonary tuberculosis stimulated us to design our study on anti-tuberculosis drug resistance pattern in cases of extra pulmonary tuberculosis in a tertiary referral hospital of North India. We performed Geno Type MTBDRplus assay in comparison with conventional drug susceptibility testing by proportion method to study the mutation patterns in rpoB, katG and inhA genes.A total of 510 extra pulmonary samples were included in this study. After the smear microscopy, all the specimens were subjected for culture on Lowenstein Jensen (LJ media. Phenotypic drug susceptibility testing (DST was performed on LJ media for all the MTB isolates and compared with the results of Geno Type MTBDRplus assay which was performed with the DNA isolated from the culture by conventional method.Of 510 specimens cultured, the total culture positivity obtained was 11.8% (60 encompassing 54 (10.6% Mycobacterium tuberculosis and 6 (1.2% non-tubercular mycobacteria (NTM. DST results by Geno Type MTBDRplus assay and solid culture methods were compared in 51 MTB isolates excluding the two Rif indeterminate and one invalid test. Geno Type MTBDRplus accurately identified 13 of 14 rifampicin-resistant strains, 14 of 15 isoniazid-resistant strains and 13 of 14 as multi drug resistant tuberculosis (MDR-TB in comparison with conventional method. Sensitivity and specificity were 92.86% and 97.30% respectively for detection of RIF resistance, 93.33% and 94.44% respectively for detection of INH resistance, 92.86% and 97.30% respectively for detection of MDR-TB, while the overall concordance of Geno Type MTBDRplus assay with conventional DST was 94.11%. The turn-around time for performing Geno Type MTBDRplus assay test was 48 hours.The problem of MDR in extra pulmonary tuberculosis (EPTB cannot be overlooked and due attention on patients

  18. Initiation and adherence to TB treatment in a Pakistani community influenced more by perceptions than by knowledge of tuberculosis

    Directory of Open Access Journals (Sweden)

    Mubashir Zafar

    2013-01-01

    Full Text Available Background: The tuberculosis (TB literature is written almost entirely from a biomedical perspective, while recent studies show that it is imperative to understand lay perception to determine why people seek treatment and may stop taking treatment. Aims: To investigate knowledge about TB, perceptions of (access to TB treatment, and adherence to treatment among a Pakistani population. Setting and Design: Descriptive cross-sectional study. Materials and Methods: A total of 175 participants were selected nonrandomly, 100 were TB patient and 75 were non-TB patient in proportion to the total number of participants in each ward of hospital. Statistical Analysis: Analysis of attitudes and perceptions toward TB, adherence to TB treatment, health seeking behavior, and TB treatment types done by frequency counts and percentages. Regression analysis and logistic regression analysis were performed to test whether differences in age, gender, and education level led to different knowledge scores and different attitudes and preferences toward TB, adherence to TB treatment, health seeking behavior, and TB treatment types. All statistical analyses were performed using Statistical Package for Social Sciences (SPSS 16.0. Result: TB knowledge can be considered fairly well among this community. Respondents′ perceptions suggest that stigma may influence TB patients′ decision in health seeking behavior and adherence to TB treatment. A full 95% of those interviewed believe people with TB tend to hide their TB status out of fear of what others may say. Conclusion: Most of the subjects were unaware of TB that seems to be due to their illiteracy and those who knew had got the knowledge from media, but the majority of the patients who were on directly observed treatment, short-course (DOTS were found to be satisfied.

  19. Treating tuberculosis with high doses of anti-TB drugs: mechanisms and outcomes.

    Science.gov (United States)

    Xu, Yuhui; Wu, Jianan; Liao, Sha; Sun, Zhaogang

    2017-10-03

    Tuberculosis (TB) is considered as one of the most serious threats to public health in many parts of the world. The threat is even more severe in the developing countries where there is a lack of advanced medical amenities and contemporary anti-TB drugs. In such situations, dosage optimization of existing medication regimens seems to be the only viable option. Therapeutic drug monitoring study results suggest that high-dose treatment regimens can compensate the low serum concentration of anti-TB drugs and shorten the therapy duration. The article presents a critical review on the possible changes that occur in the host and the pathogen upon the administration of standard and high-dose regimens. Some of the most common factors that are responsible for low anti-TB drug concentrations in the serum are differences in hosts' body weight, metabolic processing of the drug, malabsorption and/or drug-drug interaction. Furthermore, failure to reach the cavitary pulmonary and extrapulmonary tissues also contributes to the therapeutic inefficiency of the drugs. In such conditions, administration of higher doses can help in compensating the pathogenic outcomes of enhancement of the pathogen's physical barriers, efflux pumps and genetic mutations. The present article also presents a summary of the recorded treatment outcomes of clinical trials that were conducted to test the efficacy of administration of high dose of anti-tuberculosis drugs. This review will help physicians across the globe to understand the underlying pathophysiological changes (including side effects) that dictate the clinical outcomes in patients administered with standard and/or high dose anti-TB drugs.

  20. Circulating microRNAs in patients with active pulmonary tuberculosis.

    Science.gov (United States)

    Fu, Yurong; Yi, Zhengjun; Wu, Xiaoyan; Li, Jianhua; Xu, Fuliang

    2011-12-01

    Emerging evidence shows that microRNAs (miRNAs) play an important role in pathogen-host interactions. Circulating miRNAs have been repeatedly and stably detected in blood and hold promise to serve as molecular markers for diverse physiological and pathological conditions. To date, the relationship between circulating miRNAs and active pulmonary tuberculosis (TB) has not been reported. Using microarray-based expression profiling followed by real-time quantitative PCR validation, the levels of circulating miRNAs were compared between patients with active pulmonary tuberculosis and matched healthy controls. The receiver operating characteristic curve was used to evaluate the diagnostic effect of selected miRNA. Bioinformatic analysis was used to explore the potential roles of these circulating miRNAs in active pulmonary tuberculosis infection. Among 92 miRNAs significantly detected, 59 miRNAs were downregulated and 33 miRNAs were upregulated in the TB serum compared to their levels in the control serum. Interestingly, only two differentially expressed miRNAs were increased not only in the serum but also in the sputum of patients with active pulmonary tuberculosis compared to the levels for the healthy controls. Upregulated miR-29a could discriminate TB patients from healthy controls with reasonable sensitivity and specificity. A number of significantly enriched pathways regulated by these circulating miRNAs were predicted, and most of them were involved in acute-phase response, inflammatory response, and the regulation of the cytoskeleton. In all, for the first time our results revealed that a number of miRNAs were differentially expressed during active pulmonary tuberculosis infection, and circulating miR-29a has great potential to serve as a marker for the detection of active pulmonary tuberculosis infection.

  1. Tuberculosis

    NARCIS (Netherlands)

    Ankrah, Alfred O; Glaudemans, Andor W J M; Maes, Alex; Van de Wiele, Christophe; Dierckx, Rudi A J O; Vorster, Mariza; Sathekge, Mike M

    Tuberculosis (TB) is currently the world's leading cause of infectious mortality. Imaging plays an important role in the management of this disease. The complex immune response of the human body to Mycobacterium tuberculosis results in a wide array of clinical manifestations, making clinical and

  2. Tuberculosis: General Information

    Science.gov (United States)

    TB Elimination Tuberculosis: General Information What is TB? Tuberculosis (TB) is a disease caused by germs that are spread from person ... Viral Hepatitis, STD, and TB Prevention Division of Tuberculosis Elimination CS227840_A What Does a Positive Test ...

  3. Arginine Adjunctive Therapy in Active Tuberculosis

    Directory of Open Access Journals (Sweden)

    Aliasghar Farazi

    2015-01-01

    Full Text Available Background. Dietary supplementation has been used as a mechanism to augment the immune system. Adjunctive therapy with L-arginine has the potential to improve outcomes in active tuberculosis. Methods. In a randomized clinical trial 63 participants with smear-positive pulmonary tuberculosis in Markazi Province of Iran were given arginine or placebo for 4 weeks in addition to conventional chemotherapy. The final treatment success, sputum conversion, weight gain, and clinical symptoms after one and two months were considered as primary outcomes and secondary outcomes were ESR, CRP, and Hg. Data were collected and analyzed with SPSS software (ver. 18. Results. Arginine supplementation reduced constitutional symptoms (P=0.032 in patients with smear-positive TB at the end of the first month of treatment. Arginine treated patients had significantly increased BMI at the end of the first and second months of treatment (P=0.032 and P=0.04 and a reduced CRP at the end of the first month of treatment (P=0.03 versus placebo group. Conclusion. Arginine is useful as an adjunctive therapy in patients with active tuberculosis, in which the effects are more likely mediated by the increased production of nitric oxide and improved constitutional symptoms and weight gain. This trial is registered with Clinical Trials Registry of Iran: IRCT201211179855N2.

  4. User experience analysis of e-TB Manager, a nationwide electronic tuberculosis recording and reporting system in Ukraine

    Directory of Open Access Journals (Sweden)

    Niranjan Konduri

    2017-05-01

    Full Text Available Ukraine has successfully implemented e-TB Manager nationwide as its mandatory national tuberculosis registry after first introducing it in 2009. Our objective was to perform an end-of-programme evaluation after formal handover of the registry administration to Ukraine's Centre for Disease Control in 2015. We conducted a nationwide, cross-sectional, anonymous, 18-point user experience survey, and stratified the registry's transaction statistics to demonstrate usability. Contrary to initial implementation experience, older users (aged >50 years, often with limited or no computer proficiency prior to using the registry, had significantly better user experience scores for at least six of the 12 measures compared to younger users (aged 18–29 years. Using the registry for >3 years was associated with significantly higher scores for having capacity, adequacy of training received and satisfaction with the registry. Of the 5.9 million transactions over a 4-year period, nine out of 24 oblasts (regions and Kiev city accounted for 62.5% of all transactions, and corresponded to 59% of Ukraine's tuberculosis burden. There were 437 unique active users in 486 rayons (districts of Ukraine, demonstrating extensive reach. Our key findings complement the World Health Organization and European Respiratory Society's agenda for action on digital health to help implement the End TB Strategy.

  5. Primary lung cancer coexisting with active pulmonary tuberculosis.

    Science.gov (United States)

    Varol, Y; Varol, U; Unlu, M; Kayaalp, I; Ayranci, A; Dereli, M S; Guclu, S Z

    2014-09-01

    Lung cancer and pulmonary tuberculosis (TB) comorbidity is a clinical problem that presents a challenge for the diagnosis and treatment of both diseases. To clarify the clinical and survival characteristics of cases with both lung cancer and active pulmonary TB. From 2008 to 2013, 3350 TB patients admitted to the TB Department of the Chest Diseases Hospital of Izmir, Turkey, were evaluated. In 38 (1.1%) male patients, lung cancer and TB were found to coexist. Almost all of the patients were diagnosed at Stage III (n = 14, 36.8%) or IV (n = 17, 44.7%) lung cancer, whereas four (10.6%) had Stage II and three (7.9%) had Stage I disease. Squamous cell lung cancer was the predominant histology (n = 23, 60.7%). The median overall survival among patients was 13.4 months (95%CI 8.09-18.8). One-year survival rates for patients with Stages I, II, III and IV were respectively 100%, 75%, 57% and 40%. The present study demonstrates that lung cancer combined with active pulmonary TB most frequently presents as squamous cell carcinoma, with a male predominance. The overall survival of lung cancer patients did not change even with concomitant active TB.

  6. Increased complement C1q level marks active disease in human tuberculosis.

    Directory of Open Access Journals (Sweden)

    Yi Cai

    Full Text Available BACKGROUND: Complement functions as an important host defense system and complement C5 and C7 have been implicated in immunopathology of tuberculosis. However, little is known about the role of other complement components in tuberculosis. METHODS: Complement gene expression in peripheral blood mononuclear cells of tuberculosis patients and controls were determined using whole genome transcriptional microarray assays. The mRNA and protein levels of three C1q components, C1qA, C1qB, and C1qC, were further validated by qRT-PCR and enzyme-linked immunosorbent assay, respectively. The percentages of C1q expression in CD14 positive cells were determined by flow cytometry. Finally, C1qC protein level was quantified in the pleural fluid of tuberculosis and non-tuberculosis pleurisy. RESULTS: C1q expression increases significantly in the peripheral blood of patients with active tuberculosis compared to healthy controls and individuals with latent TB infection. The percentage of C1q-expressing CD14 positive cells is significantly increased in active TB patients. C1q expression in the peripheral blood correlates with sputum smear positivity in tuberculosis patients and is reduced after anti-tuberculosis chemotherapy. Notably, receiver operating characteristic analysis showed that C1qC mRNA levels in peripheral blood efficiently discriminate active from latent tuberculosis infection and healthy controls. Additionally, C1qC protein level in pleural effusion shows improved power in discriminating tuberculosis from non-tuberculosis pleurisy when compared to other inflammatory markers, such as IL-6 and TNF-α. CONCLUSIONS: C1q expression correlates with active disease in human tuberculosis. C1q could be a potential diagnostic marker to discriminate active tuberculosis from latent tuberculosis infection as well as tuberculosis pleurisy from non-tuberculosis pleurisy.

  7. Mycobacterium tuberculosis strains potentially involved in the TB epidemic in Sweden a century ago.

    Directory of Open Access Journals (Sweden)

    Ramona Groenheit

    Full Text Available UNLABELLED: A hundred years ago the prevalence of tuberculosis (TB in Sweden was one of the highest in the world. In this study we conducted a population-based search for distinct strains of Mycobacterium tuberculosis complex isolated from patients born in Sweden before 1945. Many of these isolates represent the M. tuberculosis complex population that fueled the TB epidemic in Sweden during the first half of the 20(th century. METHODS: Genetic relationships between strains that caused the epidemic and present day strains were studied by spoligotyping and restriction fragment length polymorphism. RESULTS: The majority of the isolates from the elderly population were evolutionary recent Principal Genetic Group (PGG2/3 strains (363/409 or 88.8%, and only a low proportion were ancient PGG1 strains (24/409 or 5.9%. Twenty-two were undefined. The isolates demonstrated a population where the Euro-American superlineage dominated; in particular with Haarlem (41.1% and T (37.7% spoligotypes and only 21.2% belonged to other spoligotype families. Isolates from the elderly population clustered much less frequently than did isolates from a young control group population. CONCLUSIONS: A closely knit pool of PGG2/3 strains restricted to Sweden and its immediate neighbours appears to have played a role in the epidemic, while PGG1 strains are usually linked to migrants in todaýs Sweden. Further studies of these outbreak strains may give indications of why the epidemic waned.

  8. Diagnostic value of pleural fluid adenosine deaminase activity in tuberculosis pleurisy

    Directory of Open Access Journals (Sweden)

    Abbas ali Niazi

    2009-09-01

    Full Text Available Background: Diagnosis of tuberculosis pleurisies is difficult because of its nonspecific clinical presentation and insufficient traditional diagnostic methods. We investigated the use of adenosine deaminase (ADA activity in tuberculosis pleurisies. Methods: A number of 85 patients were analyzed with exudative pleural effusions. Using the ROC curve, we determined the optimal cutoff for TB pleurisy. Results: A number of 58 exudative samples were nontuberculous (non-TB and 27 were tuberculosis (TB. There was statistically significant difference (p<0.0001 between the means of pleural fluid ADA levels among the TB and non-TB populations. The prevalence of TB pleurisy in the studied population was 31%. Using the cutoff point equal to 35 for diagnosing TB effusions the sensitivity and specificity 70.3% and 91.3%, respectively. The positive predictive value (PPV was 79.1% and the negative predictive value (NPV was 86.8%. A pleural fluid ADA value <19 IU/L suggests that a tuberculosis effusion is highly unlikely. Conclusion: Pleural fluid total ADA assay is a sensitive and specific test suitable for rapid diagnosis of TB pleurisy.

  9. Antibacterial Activity of Medicinal Aqueous Plant Extracts against Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Muna Mohammed Buzayan

    2012-09-01

    Full Text Available Tuberculosis (TB remains a serious health problem in many regions of the world, and the development of resistance to antibiotics by this microbe created the need for new drugs to replace those which have lost effectiveness. This study assesses the medicinal anti-Mycobacterium tuberculosis properties of natural products obtained from plants collected from Eastern Libya. In this study aqueous extracts of nine different plants were assayed for their Mycobacterium tuberculosis inhibitory activity using the BACTEC MGIT960 susceptibility test method. The aqueous extracts of Ceratonia siliqua L, Helichrysum stoechas (L. Moench and Thymus algeriensis did not show any activity against M. tuberculosis in different concentrations. The aqueous extract of Marrubium vulgare L. from Syria showed high activity against M. tuberculosis. Marrubium alysson L., Marrubium vulgare L., Pistacia lentiscus L, Quercus coccifera L, Thymus capitatus (L. Hoffm. & Link, showed varying degrees of activity against M. tuberculosis. The results of this study show that aqueous extracts from six different medicinal plants have different effects against M. tuberculosis in vitro.

  10. Using giant African pouched rats to detect human tuberculosis

    African Journals Online (AJOL)

    ebutamanya

    2015-08-31

    Aug 31, 2015 ... Tuberculosis is an infectious disease caused by Mycobacterium tuberculosis. About one-third of Earth's population has latent TB, which means that they have been exposed to M. tuberculosis but not become ill. About 10% of people with latent TB develop active. TB, that is, they become ill with the disease, ...

  11. Molecular approaches for detection of the multi-drug resistant tuberculosis (MDR-TB in Bangladesh.

    Directory of Open Access Journals (Sweden)

    Tafsina Haque Aurin

    Full Text Available The principal obstacles in the treatment of tuberculosis (TB are delayed and inaccurate diagnosis which often leads to the onset of the drug resistant TB cases. To avail the appropriate treatment of the patients and to hinder the transmission of drug-resistant TB, accurate and rapid detection of resistant isolates is critical. Present study was designed to demonstrate the efficacy of molecular techniques inclusive of line probe assay (LPA and GeneXpert MTB/RIF methods for the detection of multi-drug resistant (MDR TB. Sputum samples from 300 different categories of treated and new TB cases were tested for the detection of possible mutation in the resistance specific genes (rpoB, inhA and katG through Genotype MTBDRplus assay or LPA and GeneXpert MTB/RIF tests. Culture based conventional drug susceptibility test (DST was also carried out to measure the efficacy of the molecular methods employed. Among 300 samples, 191 (63.7% and 193 (64.3% cases were found to be resistant against rifampicin in LPA and GeneXpert methods, respectively; while 189 (63% cases of rifampicin resistance were detected by conventional DST methods. On the other hand, 196 (65.3% and 191 (63.7% isolates showed isoniazid resistance as detected by LPA and conventional drug susceptibility test (DST, respectively. Among the drug resistant isolates (collectively 198 in LPA and 193 in conventional DST, 189 (95.6% and 187 (96.9% were considered to be MDR as examined by LPA and conventional DST, respectively. Category-II and -IV patients encountered higher frequency of drug resistance compared to those from category-I and new cases. Considering the higher sensitivity, specificity and accuracy along with the required time to results significantly shorter, our study supports the adoption of LPA and GeneXpert assay as efficient tools in detecting drug resistant TB in Bangladesh.

  12. [Analysis of tuberculosis infection among foreigners using QuantiFeron TB-2G test].

    Science.gov (United States)

    Higuchi, Kazue; Harada, Nobuyuki; Nagasaka, Yuji; Mori, Toru

    2007-06-01

    The purpose of this study was to investigate contacts of a tuberculosis patient among foreigners using QuantiFERON TB-2G (QFT-2G) test. Three index cases in this study were all foreigners. Contacts, who were mostly foreigners and some Japanese, were investigated by a chest X-ray examination, tuberculin skin test (TST) and QFT-2G, and all data were compared. Among 48 subjects (30 Vietnamese and 18 Japanese) in case 1, 8 Vietnamese and 2 Japanese were QFT-2G positive. One contacts among 3 most close contacts who lived in the same room with the index case was QFT-2G positive. In case 2, three Chinese among 22 contacts were QFT-2G positive, and a very close contact who lived in the next door to the index case was QFT-2G negative. Seven QFT-2G positive Chinese were identified among 24 contacts in case 3. However, four very close contacts among them were QFT-2G negative. Although it was unclear whether QFT-2G positives in cases 1 and 2 were infected with M. tuberculosis through the index cases, it is possible to speculate that these QFT-2G positives were already infected with M. tuberculosis while they live in their own country based on the prevalence of TB in their countries and the fact that many very close contacts were QFT-2G negative. Also, it was suggested that QFT-2G positives in case 3 may not be infected through the index case, but infected in their country, since all close contacts were QFT-2G negative. The results of this study suggested that using the QFT-2G test for foreigners prior to or soon after their entry to Japan and recommending chemoprophylaxis for those who are QFT-2G positive would be a very efficient control measures against immigrant foreigners with TB infection.

  13. CD4 cell levels during treatment for tuberculosis (TB in Ethiopian adults and clinical markers associated with CD4 lymphocytopenia.

    Directory of Open Access Journals (Sweden)

    Sten Skogmar

    Full Text Available BACKGROUND: The clinical correlations and significance of subnormal CD4 levels in HIV-negative patients with TB are unclear. We have determined CD4 cell levels longitudinally during anti-tuberculosis treatment (ATT in patients, with and without HIV co-infection, and their associations with clinical variables. METHOD: Adults diagnosed with TB (maximum duration of ATT for 2 weeks, and with no history of antiretroviral therapy (ART in HIV-positive subjects were included consecutively in eight out-patient clinics in Ethiopia. Healthy individuals were recruited for comparison at one of the study health centers. Data on patient characteristics and physical findings were collected by trained nurses following a structured questionnaire at inclusion and on follow-up visits at 2 and 6 months. In parallel, peripheral blood CD4 cell levels were determined. The evolution of CD4 cell levels during ATT was assessed, and the association between clinical characteristics and low CD4 cell levels at baseline was investigated using regression analysis. RESULTS: In total, 1116 TB patients were included (307 HIV-infected. Among 809 HIV-negative patients, 200 (25% had subnormal CD4 cell counts (<500 cells/mm(3, with <350 cells/mm(3 in 82 (10% individuals. CD4 cell levels increased significantly during the course of ATT in both HIV+ and HIV- TB-patients, but did not reach the levels in healthy subjects (median 896 cells/mm(3. Sputum smear status, signs of wasting (low mid upper arm circumference (MUAC, and bedridden state were significantly associated with low CD4 cell counts. CONCLUSION: A high proportion of Ethiopian TB patients have subnormal CD4 cell counts before starting treatment. Low CD4 cell levels are associated with smear positive disease and signs of wasting. The continuous increase of CD4 cell counts during the course of ATT suggest a reversible impact of active TB on CD4 cell homeostasis, which may be considered in interpretation of CD4 cell counts in HIV/TB

  14. Respiratory symptoms and active tuberculosis in a prison in Southern Brazil: associated epidemiologic variables

    Directory of Open Access Journals (Sweden)

    Jeane Zanini Rocha

    2013-10-01

    Full Text Available Backgound and Objectives: This study is justified by the high TB prevalence in prisons, which constitutes a public health problem and aims to estimate the prevalence of active tuberculosis (TB and determine the variables associated with respiratory symptoms in a prison in Brazil. Methods: This is a descriptive study of 262 inmates divided into respiratory symptomatic and asymptomatic groups. Samples were evaluated by microscopy following the cultivation of the sputum from symptomatic individuals. Associated epidemiological variables were also evaluated. Results: Among the 262 inmates included, 178 (68% were considered symptomatic, and of these, 25 (14% were diagnosed with active TB. The contribution of culturing in the detection of TB cases was 48%. The prevalence of active TB was 9,542/100.000. Low educational level, use of drugs and alcohol, prison recidivism, and previous TB and HIV-positive status were associated with the presence of respiratory symptoms. Being male, single, black, a prison recidivist, an alcoholic and HIV-seropositive was associated with the development of TB. The rate of TB/HIV co infection was 60%. The outcome was death in 12% of patients. Drug therapy interruption was reported by 96% of patients. Conclusions: The studied population showed a high prevalence of TB and TB/HIV co-infection. In addition, the rates of drug therapy interruption and mortality were alarmingly elevated. KEYWORDS: Epidemiology. Tuberculosis. Coinfections. HIV infection. Prisons.

  15. TB or not TB?’ Problems of differential diagnosis of cutaneous mycobacteriosis and tuberculosis – A Case Study and interdisciplinary discussion

    Directory of Open Access Journals (Sweden)

    Katarzyna Szmygin-Milanowska

    2015-12-01

    Full Text Available The diagnosis of cutaneous tuberculosis poses a serious challenge due to many skin diseases of different etiology resembling the lesions caused by the TB (tuberculosis bacillus, and difficulties in confirming the disease. The presented case concerns skin lesions in a hobby aquarist stung in the finger of the left hand by a fish. The resulting inflammatory infiltration was to be cutaneous tuberculosis or mycobacteriosis caused by MOTT (Mycobacterium other than tuberculosis. Laboratory, pathomorphologic, genetic and microbiologic tests of samples obtained from the patient, fish and water in the aquarium gave ambiguous results. A multidisciplinary discussion is presented on the difficulties in the differential diagnosis, problems with a clear interpretation of the results of various conducted tests, and possible ways of transmission of the infection, relevant to the described example.

  16. Re-activation of bovine tuberculosis in a patient treated with infliximab

    DEFF Research Database (Denmark)

    Larsen, Mette Vang; Thomsen, V Ø; Sørensen, Inge Juul

    2008-01-01

    Treatment with tumour necrosis factor-alpha inhibitors increases the risk of tuberculosis (TB). Screening for latent TB infection (LTBI) and prophylactic treatment has become mandatory. A 79-yr-old female with a history of severe erosive sero-positive rheumatoid arthritis was screened for LTBI......-infected cattle. Re-activation of bovine tuberculosis is a risk in people with recent or previous exposure to unpasteurised dairy products. The QuantiFERON-TB test has the potential to detect Mycobacterium bovis infection. Indeterminate test results reflect either anergy, due to poor immunity, or technical...... problems and should be cautiously interpreted and as a minimum be repeated. Studies are ongoing to determine the role of QuantiFERON-TB testing in the screening for latent tuberculosis infection....

  17. Living with Tuberculosis

    Science.gov (United States)

    ... Diseases > Lung Disease Lookup > Tuberculosis (TB) Living With Tuberculosis What to Expect You will need regular checkups ... XML file."); } }); } } --> Blank Section Header Lung Disease Lookup Tuberculosis (TB) Learn About Tuberculosis Tuberculosis Symptoms, Causes & Risk ...

  18. Molecular epidemiology of TB – Its impact on multidrug-resistant tuberculosis control in China☆

    Directory of Open Access Journals (Sweden)

    Biao Xu

    2015-01-01

    Results: In total, 238 bacteriologic confirmed pulmonary TB patients from DQ and 393 from GY diagnosed between 2008 and 2011 were recruited in the study. Of the 631 isolates, 220 (34.9% were resistant to at least one anti-TB drug, including 95 (15.1% simultaneously resistant to isoniazid and rifampicin or MDR, albeit with the similar distribution between DQ and GY (32/238 vs. 63/393; p, 0.378. The MIRU-VNTR genotyping revealed 35 isolates from DQ and 86 from GY exhibited 15 and 32 clustering patterns with four patterns shared between two counties. Compared with GY county, DQ had a significantly lower clustering proportion in MTB isolates susceptible to first-line drugs (25/167 vs. 46/198; p, 0.047 and total drug resistant TB isolates (12/71 vs. 44/149; p, 0.044, but a similar clustering proportion in MDR-TB isolates (8/32 vs. 18/63; p, 0.712. A significant higher clustering proportion was observed in the previously treated patients in both counties, but in the sputum smear-positive patients with cavitaries only in GY. Comparing the previously treated patients between the two counties, the proportion of MDR-TB and clustering proportion exhibited a similar distribution, while the average age of previously treated patients in DQ is significantly older than that in GY. Conclusions: A lower proportion of recent transmissions was observed in the county with long-term DOTS implementation. However, DOTS itself might not have worked enough on blocking the recent transmission of MDR-TB. This observation suggests the urgent needs of implementing the Stop-TB strategies; in particular, accelerating the use of rapid molecularbasedTBdiagnosisand drug susceptibility testing, providing active case findings in a high risk population of MDR-TB and enhancing infection control in high MDR-TB burden countries.

  19. Safety and efficacy of the C-Tb skin test to diagnose Mycobacterium tuberculosis infection, compared with an interferon γ release assay and the tuberculin skin test: a phase 3, double-blind, randomised, controlled trial.

    Science.gov (United States)

    Ruhwald, Morten; Aggerbeck, Henrik; Gallardo, Rafael Vázquez; Hoff, Søren T; Villate, José I; Borregaard, Bettine; Martinez, José A; Kromann, Ingrid; Penas, Antón; Anibarro, Luis L; de Souza-Galvão, Maria Luiza; Sánchez, Francisca; Rodrigo-Pendás, Jose Ángel; Noguera-Julian, Antoni; Martínez-Lacasa, Xavier; Tuñez, Maria Victoria; Fernández, Virginia Leiro; Millet, Joan P; Moreno, Antonio; Cobos, Nazaret; Miró, José M; Roldan, Llanos; Orcau, Angels; Andersen, Peter; Caylá, Joan A

    2017-04-01

    Targeted screening and treatment of Mycobacterium tuberculosis infection substantially reduces the risk of developing active tuberculosis. C-Tb (Statens Serum Institute, Copenhagen, Denmark) is a novel specific skin test based on ESAT-6 and CFP10 antigens. We investigated the safety and diagnostic potential of C-Tb compared with established tests in the contact-tracing setting. Negative controls, close contacts, occasional contacts, and patients with active pulmonary tuberculosis were enrolled at 13 centres in Spain. We compared C-Tb with the QuantiFERON-TB Gold In-Tube ([QFT] Qiagen, Hilden, Germany) interferon γ release assay (IGRA) and the purified protein derivative (PPD) RT 23 tuberculin skin test ([TST] Statens Serum Institute). All participants older than 5 years were tested with QFT. Some participants in the negative control group received C-Tb without the TST to test for potential interactions between C-Tb and PPD RT 23. The rest were randomly assigned in blocks of ten and tested with both C-Tb and TST, with five in each block receiving injection of C-Tb in the right arm and the TST in the left arm and five vice versa. The primary and safety analyses were done in all participants randomly assigned to a group who received any test. This trial is registered with ClinicalTrials.gov, number NCT01631266, and with EudraCT, number 2011-005617-36. From July 24, 2012, to Oct 2, 2014, 979 participants were enrolled, of whom 263 were negative controls, 299 were occasional contacts, 316 were close contacts, and 101 were patients with tuberculosis. 970 (99%) participants completed the trial. Induration sizes were similar for C-Tb and TST, but TST positivity was affected by BCG vaccination status. We found a strong positive trend towards C-Tb test positivity with increasing risk of infection, from 3% in negative controls to 16% in occasional contacts, to 43% in close contacts. C-Tb and QFT results were concordant in 785 (94%) of 834 participants aged 5 years and older

  20. The Risk of Depressive Disorder Among Contacts of Tuberculosis Patients in a TB-endemic Area: A Population-based Cohort Study.

    Science.gov (United States)

    Pan, Sheng-Wei; Yen, Yung-Feng; Feng, Jia-Yih; Su, Vincent Yi-Fong; Kou, Yu Ru; Su, Wei-Juin

    2015-10-01

    Tuberculosis (TB) disease may be transmitted to close contacts of index cases, causing physical illness. No studies have investigated the risk of developing depressive disorder among TB contacts in a TB-endemic area.Adult participants with a new diagnosis of TB contact (ICD-9-CM codes V01.1 plus chest radiographic order) since January 1, 2008, were identified from the National Health Insurance Research Database in Taiwan. A control cohort matched for age (±5 y), sex, enrolled years, and income level was selected. These 2 cohorts were followed until December 31, 2012, and observed for the development of depressive disorder. The Kaplan-Meier method and the log-rank test were used to examine the difference in cumulative incidences of depressive disorder between groups. Cox proportional-hazard models were used to calculate adjusted hazard ratios (aHRs) for depressive disorder.The TB contact cohort consisted of 9046 patients and matched controls of 36,184 ones. The mean age of TB contacts was 44.7 years, and 56.0% of them were women. During a mean follow-up period of 2.5 years, 127 (1.40%) TB contacts and 521 (1.44%) matched controls developed depressive disorder. TB exposure was found to be an independent risk factor of depressive disorder in women (aHR 1.34, 95% confidence interval [CI] 1.07-1.68), but not in men (aHR 0.71, 95% CI 0.48-1.06) after adjusting for age, comorbidities, and income levels. The risk of depression was significantly higher for female TB contacts than for matched controls in the first and second years (aHR 1.49, 95% CI 1.03-2.14; and aHR 1.53, 95% CI 1.05-2.23, respectively), but not thereafter. Of note, 67 (0.74%) TB contacts and 88 (0.24%) matched controls developed active TB, but none of them had subsequent depressive disorder during follow-up periods.Female TB contacts had an increased risk of depression within the first 2 years after exposure. Clinicians should consider conducting depression evaluations in addition to routine TB contact

  1. Alto a la tuberculosis en mi generación: Un llamado a un mundo libre de tuberculosis. Podcast del Día Mundial de la Tuberculosis del 2013 (Stop TB in My Lifetime: A Call for a World Free of TB World TB Day 2013)

    Centers for Disease Control (CDC) Podcasts

    2012-03-12

    En este podcast el doctor Kenneth Castro, Director de la División de Eliminación de la Tuberculosis, habla sobre el Día Mundial de la Tuberculosis, así como del tema y eslogan de este año.  Created: 3/12/2012 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 3/13/2012.

  2. Performance of QuantiFERON TB Gold test in detecting latent tuberculosis infection in brain-dead organ donors in Iran: a brief report.

    Science.gov (United States)

    Tabarsi, Payam; Yousefzadeh, Amir; Najafizadeh, Katayoun; Droudinia, Atousa; Bayati, Rouzbeh; Marjani, Majid; Shafaghi, Shadi; Farokhzad, Banafsheh; Javanmard, Pedram; Velayati, Ali Akbar

    2014-11-01

    With regard to the significant morbidity and mortality due to tuberculosis in lung transplant recipients, the identification of brain-dead organ donors with latent tuberculosis by use of the QuantiFERON TB Gold (QFT-G) test may be of help to reduce the risk of TB reactivation and mortality in lung recipients. This study was conducted in the National Research Institute of Tuber-culosis and Lung Diseases (NRITLD) in Iran, from January to March 2013. A total of 38 conse-cutive brain-dead donors, not currently infected with active tuberculosis, were recruited. The medi-cal records of all the study enrollees were reviewed. A whole-blood IFN- release assay (IGRA) in reaction to early secreted antigenic target 6 (ESAT-6), culture filtrate protein 10 (CFP-10), and TB7.7 antigens, was performed and the released Interferon- was measured via enzyme-linked immunosorbent assay (ELISA). The data was analyzed with QFT-G software which was provided by the company. The demographic, characteristics and other variables were entered into SPSS version 11.5. The QFT-G test results of three donors (7.9%) turned out to be positive, negative for 24 donors (63.1%), and indeterminate for 11 cases (28.9%). Our study revealed the potential advantages of QFT-G in lowering the incidence of donor-derived post-transplant tuberculosis among lung recipients. However, a high rate of indeterminate results restricted the performance of QFT-G in this study.

  3. Performance of QuantiFERON TB Gold test in detecting latent tuberculosis infection in brain-dead organ donors in Iran: A brief report

    Directory of Open Access Journals (Sweden)

    Payam Tabarsi

    2014-01-01

    Full Text Available With regard to the significant morbidity and mortality due to tuberculosis in lung transplant recipients, the identification of brain-dead organ donors with latent tuberculosis by use of the QuantiFERON TB Gold (QFT-G test may be of help to reduce the risk of TB reactivation and mortality in lung recipients. This study was conducted in the National Research Institute of Tuber-culosis and Lung Diseases (NRITLD in Iran, from January to March 2013. A total of 38 conse-cutive brain-dead donors, not currently infected with active tuberculosis, were recruited. The medi-cal records of all the study enrollees were reviewed. A whole-blood IFN- release assay (IGRA in reaction to early secreted antigenic target 6 (ESAT-6, culture filtrate protein 10 (CFP-10, and TB7.7 antigens, was performed and the released Interferon- was measured via enzyme-linked immunosorbent assay (ELISA. The data was analyzed with QFT-G software which was provided by the company. The demographic, characteristics and other variables were entered into SPSS version 11.5. The QFT-G test results of three donors (7.9% turned out to be positive, negative for 24 donors (63.1%, and indeterminate for 11 cases (28.9%. Our study revealed the potential advantages of QFT-G in lowering the incidence of donor-derived post-transplant tuberculosis among lung recipients. However, a high rate of indeterminate results restricted the performance of QFT-G in this study.

  4. The high burden of tuberculosis (TB) and human immunodeficiency virus (HIV) in a large Zambian prison: a public health alert.

    Science.gov (United States)

    Henostroza, German; Topp, Stephanie M; Hatwiinda, Sisa; Maggard, Katie R; Phiri, Winifreda; Harris, Jennifer B; Krüüner, Annika; Kapata, Nathan; Ayles, Helen; Chileshe, Chisela; Reid, Stewart E

    2013-01-01

    Tuberculosis (TB) and human immunodeficiency virus (HIV) represent two of the greatest health threats in African prisons. In 2010, collaboration between the Centre for Infectious Disease Research in Zambia, the Zambia Prisons Service, and the National TB Program established a TB and HIV screening program in six Zambian prisons. We report data on the prevalence of TB and HIV in one of the largest facilities: Lusaka Central Prison. Between November 2010 and April 2011, we assessed the prevalence of TB and HIV amongst inmates entering, residing, and exiting the prison, as well as in the surrounding community. The screening protocol included complete history and physical exam, digital radiography, opt-out HIV counseling and testing, sputum smear and culture. A TB case was defined as either bacteriologically confirmed or clinically diagnosed. A total of 2323 participants completed screening. A majority (88%) were male, median age 31 years and body mass index 21.9. TB symptoms were found in 1430 (62%). TB was diagnosed in 176 (7.6%) individuals and 52 people were already on TB treatment at time of screening. TB was bacteriologically confirmed in 88 cases (3.8%) and clinically diagnosed in 88 cases (3.8%). Confirmed TB at entry and exit interventions were 4.6% and 5.3% respectively. Smear was positive in only 25% (n = 22) of bacteriologically confirmed cases. HIV prevalence among inmates currently residing in prison was 27.4%. Ineffective TB and HIV screening programs deter successful disease control strategies in prison facilities and their surrounding communities. We found rates of TB and HIV in Lusaka Central Prison that are substantially higher than the Zambian average, with a trend towards concentration and potential transmission of both diseases within the facility and to the general population. Investment in institutional and criminal justice reform as well as prison-specific health systems is urgently required.

  5. State of affairs of tuberculosis in prison facilities: a systematic review of screening practices and recommendations for best TB control.

    Directory of Open Access Journals (Sweden)

    Natalie V S Vinkeles Melchers

    Full Text Available BACKGROUND: Prisoners are at high risk of developing tuberculosis (TB, causing morbidity and mortality. Prison facilities encounter many challenges in TB screening procedures and TB control. This review explores screening practices for detection of TB and describes limitations of TB control in prison facilities worldwide. METHODS: A systematic search of online databases (e.g., PubMed and Embase and conference abstracts was carried out. Research papers describing screening and diagnostic practices among prisoners were included. A total of 52 articles met the inclusion criteria. A meta-analysis of TB prevalence in prison facilities by screening and diagnostic tools was performed. RESULTS: The most common screening tool was symptom questionnaires (63·5%, mostly reporting presence of cough. Microscopy of sputum with Ziehl-Neelsen staining and solid culture were the most frequently combined diagnostic methods (21·2%. Chest X-ray and tuberculin skin tests were used by 73·1% and 50%, respectively, as either a screening and/or diagnostic tool. Median TB prevalence among prisoners of all included studies was 1,913 cases of TB per 100,000 prisoners (interquartile range [IQR]: 332-3,517. The overall annual median TB incidence was 7·0 cases per 1000 person-years (IQR: 2·7-30·0. Major limitations for successful TB control were inaccuracy of diagnostic algorithms and the lack of adequate laboratory facilities reported by 61·5% of studies. The most frequent recommendation for improving TB control and case detection was to increase screening frequency (73·1%. DISCUSSION: TB screening algorithms differ by income area and should be adapted to local contexts. In order to control TB, prison facilities must improve laboratory capacity and frequent use of effective screening and diagnostic tools. Sustainable political will and funding are critical to achieve this.

  6. The High Burden of Tuberculosis (TB) and Human Immunodeficiency Virus (HIV) in a Large Zambian Prison: A Public Health Alert

    Science.gov (United States)

    Henostroza, German; Topp, Stephanie M.; Hatwiinda, Sisa; Maggard, Katie R.; Phiri, Winifreda; Harris, Jennifer B.; Krüüner, Annika; Kapata, Nathan; Ayles, Helen; Chileshe, Chisela; Reid, Stewart E.

    2013-01-01

    Background Tuberculosis (TB) and human immunodeficiency virus (HIV) represent two of the greatest health threats in African prisons. In 2010, collaboration between the Centre for Infectious Disease Research in Zambia, the Zambia Prisons Service, and the National TB Program established a TB and HIV screening program in six Zambian prisons. We report data on the prevalence of TB and HIV in one of the largest facilities: Lusaka Central Prison. Methods Between November 2010 and April 2011, we assessed the prevalence of TB and HIV amongst inmates entering, residing, and exiting the prison, as well as in the surrounding community. The screening protocol included complete history and physical exam, digital radiography, opt-out HIV counseling and testing, sputum smear and culture. A TB case was defined as either bacteriologically confirmed or clinically diagnosed. Results A total of 2323 participants completed screening. A majority (88%) were male, median age 31 years and body mass index 21.9. TB symptoms were found in 1430 (62%). TB was diagnosed in 176 (7.6%) individuals and 52 people were already on TB treatment at time of screening. TB was bacteriologically confirmed in 88 cases (3.8%) and clinically diagnosed in 88 cases (3.8%). Confirmed TB at entry and exit interventions were 4.6% and 5.3% respectively. Smear was positive in only 25% (n = 22) of bacteriologically confirmed cases. HIV prevalence among inmates currently residing in prison was 27.4%. Conclusion Ineffective TB and HIV screening programs deter successful disease control strategies in prison facilities and their surrounding communities. We found rates of TB and HIV in Lusaka Central Prison that are substantially higher than the Zambian average, with a trend towards concentration and potential transmission of both diseases within the facility and to the general population. Investment in institutional and criminal justice reform as well as prison-specific health systems is urgently required. PMID

  7. Assessment of the influence of direct tobacco smoke on infection and active TB management.

    Directory of Open Access Journals (Sweden)

    Neus Altet

    Full Text Available Smoking is a risk factor for tuberculosis (TB infection and disease progression. Tobacco smoking increases susceptibility to TB in a variety of ways, one of which is due to a reduction of the IFN-γ response. Consequently, an impaired immune response could affect performance of IFN-γ Release Assays (IGRAs.In the present study, we assess the impact of direct tobacco smoking on radiological manifestations, sputum conversion and immune response to Mycobacterium tuberculosis, analyzing IFN-γ secretion by IGRAs.A total of 525 participants were studied: (i 175 active pulmonary TB patients and (ii 350 individuals coming from contact tracing studies, 41 of whom were secondary TB cases. Clinical, radiological and microbiological data were collected. T-SPOT.TB and QFN-G-IT were processed according manufacturer's instructions.In smoking patients with active TB, QFN-G-IT (34.4% and T-SPOT.TB (19.5% had high frequencies of negative results. In addition, by means of an unconditional logistic regression, smoking was a main factor associated with IGRAs' false-negative results (aOR: 3.35; 95%CI:1.47-7.61; p<0.05. Smoking patients with active TB presented a high probability of having cavitary lesions (aOR: 1.88; 95%CI:1.02-3.46;p<0.05. Mean culture negativization (months ± standard deviation (SD was higher in smokers than in non-smokers (2.47±1.3 versus 1.69±1.4. Latent TB infection (LTBI was favored in smoking contacts, being a risk factor associated with infection (aOR: 11.57; 95%CI:5.97-22.41; p<0.00005. The IFN-γ response was significantly higher in non-smokers than in smokers. Smoking quantity and IFN-γ response analyzed by IGRAs were dose-dependent related.Smoking had a negative effect on radiological manifestations, delaying time of sputum conversion. Our data establish a link between tobacco smoking and TB due to a weakened IFN-γ response caused by direct tobacco smoke.

  8. Inflammasome genetics contributes to the development and control of active pulmonary tuberculosis.

    Science.gov (United States)

    Souza de Lima, D; Ogusku, M M; Sadahiro, A; Pontillo, A

    2016-07-01

    Tuberculosis (TB) continues to be a major public health problem. An estimated one-third of the world's population is infected with Mycobacterium tuberculosis (Mtb) but remains asymptomatic (latent TB) and only 5% to 10% of these latent individuals will develop active pulmonary TB. Factors affecting the balance between latent and active TB are mostly unknown, even if host genome has been shown to contribute to the outcome of Mtb response. Acute inflammation and Th1 response are important in the early clearance of the bacteria as it was emphasized by the association between immune genes (i.e.: HLA, IFNG, TNF, NRPAM1, IL10) variants and the development of active pulmonary TB. Recently, the role of the inflammasome in experimental TB has been demonstrated, however, to our knowledge, no data still exist about the contribution of inflammasome genetics to Mtb susceptibility and/or to the development of active TB. For this reason, selected polymorphisms in inflammasome genes were analysed in a case/control cohort of individuals with active pulmonary TB from an endemic area of Brazil Amazon. Our data evidence the novel association between polymorphisms in NLRP3-inflammasome encoding genes and active pulmonary TB, and replicated the association between P2X7 and TB observed in other populations. These results emphasize the role of NLRP3-inflammasome also in human TB, and contribute to our knowledge about pathways involved in the development of active TB, even if deeper investigation are needed to fully elucidate the role of the complex in Mtb infection. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Anti-tuberculosis activities of the crude methanolic extract and ...

    African Journals Online (AJOL)

    Summary: Tuberculosis (TB) is of great public health burden globally especially in developing countries of Africa and Asia . Current TB regimen involves multiple therapies and of long duration leading to poor patient adherence. There is also the challenge of multidrug resistant TB. Hence, there is a need for discovery of new ...

  10. Limitations of the QuantiFERON-TB Gold test in detecting Mycobacterium tuberculosis infection in immunocompromised patients

    DEFF Research Database (Denmark)

    Hornum, M.; Mortensen, K.L.; Kamper, Anne-Lise

    2008-01-01

    Four cases are presented, immunosuppressed by at least three different mechanisms: one HIV-positive patient with a CD4 count of 0.29 x 10(6)/ml, one malnourished patient, and two kidney-transplanted patients. All patients had a negative interferon (IFN)-gamma test for suspected tuberculosis (TB),...

  11. Limitations of the QuantiFERON-TB Gold test in detecting Mycobacterium tuberculosis infection in immunocompromised patients

    DEFF Research Database (Denmark)

    Hornum, Mads; Mortensen, Klaus Leth; Kamper, Anne-Lise

    2008-01-01

    Four cases are presented, immunosuppressed by at least three different mechanisms: one HIV-positive patient with a CD4 count of 0.29 x 10(6)/ml, one malnourished patient, and two kidney-transplanted patients. All patients had a negative interferon (IFN)-gamma test for suspected tuberculosis (TB...

  12. A Data-Driven Evaluation of the Stop TB Global Partnership Strategy of Targeting Key Populations at Greater Risk for Tuberculosis.

    Directory of Open Access Journals (Sweden)

    Zoë M McLaren

    Full Text Available Identifying those infected with tuberculosis (TB is an important component of any strategy for reducing TB transmission and population prevalence. The Stop TB Global Partnership recently launched an initiative with a focus on key populations at greater risk for TB infection or poor clinical outcomes, due to housing and working conditions, incarceration, low household income, malnutrition, co-morbidities, exposure to tobacco and silica dust, or barriers to accessing medical care. To achieve operational targets, the global health community needs effective, low cost, and large-scale strategies for identifying key populations. Using South Africa as a test case, we assess the feasibility and effectiveness of targeting active case finding to populations with TB risk factors identified from regularly collected sources of data. Our approach is applicable to all countries with TB testing and census data. It allows countries to tailor their outreach activities to the particular risk factors of greatest significance in their national context.We use a national database of TB test results to estimate municipality-level TB infection prevalence, and link it to Census data to measure population risk factors for TB including rates of urban households, informal settlements, household income, unemployment, and mobile phone ownership. To examine the relationship between TB prevalence and risk factors, we perform linear regression analysis and plot the set of population characteristics against TB prevalence and TB testing rate by municipality. We overlay lines of best fit and smoothed curves of best fit from locally weighted scatter plot smoothing.Higher TB prevalence is statistically significantly associated with more urban municipalities (slope coefficient β1 = 0.129, p < 0.0001, R2 = 0.133, lower mobile phone access (β1 = -0.053, p < 0.001, R2 = 0.089, lower unemployment rates (β1 = -0.020, p = 0.003, R2 = 0.048, and a lower proportion of low-income households

  13. Comparison of PPD test in household contacts of smear-positive and -negative tuberculosis (TB

    Directory of Open Access Journals (Sweden)

    Zohreh Azarkar

    2015-01-01

    Conclusions: The most important way to prevent TB is omission of the disease transmission sources (TB patients by anti-TB treatment. Extensive studies are needed to ensure that contacts of patients with pulmonary TB are identified and appropriately screened.

  14. Use of anti-retroviral therapy in tuberculosis patients on second-line anti-TB regimens: a systematic review.

    Directory of Open Access Journals (Sweden)

    Matthew Arentz

    Full Text Available Use of antiretroviral therapy (ART during treatment of drug susceptible tuberculosis (TB improves survival. However, data from HIV infected individuals with drug resistant TB are lacking. Second line TB drugs when combined with ART may increase drug interactions and lead to higher rates of toxicity and greater noncompliance. This systematic review sought to determine the benefit of ART in the setting of second line drug therapy for drug resistant TB.We included individual patient data from studies that evaluated treatment of drug-resistant tuberculosis in HIV-1 infected individuals published between January 1980 and December of 2009. We evaluated the effect of ART on treatment outcomes, time to smear and culture conversion, and adverse events.Ten observational studies, including data from 217 subjects, were analyzed. Patients using ART during TB treatment had increased likelihood of cure (hazard ratio (HR 3.4, 95% CI 1.6-7.4 and decreased likelihood of death (HR 0.4, 95% CI 0.3-0.6 during treatment for drug resistant TB. These associations remained significant in patients with a CD4 less than 200 cells/mm(3 and less than 50 cells/mm(3, and when correcting for drug resistance pattern.We identified only observational studies from which individual patient data could be drawn. Limitations in study design, and heterogeneity in a number of the outcomes of interest had the potential to introduce bias.While there are insufficient data to determine if ART use increases adverse drug interactions when used with second line TB drugs, ART use during treatment of drug resistant TB appears to improve cure rates and decrease risk of death. All individuals with HIV appear to benefit from ART use during treatment for TB.

  15. Comparison of fastsure tb dna and mgit 960 for the detection of mycobacterium tuberculosis complex in clinical specimens

    International Nuclear Information System (INIS)

    Hussain, A.; Mirza, I.A.; Abbasi, S.A.; Ali, S.; Zia, F.; Ahmed, Z.

    2013-01-01

    Objective: To compare the efficacy of Fastsure TB DNA with fully automated MGIT 960 method for detection of Mycobacterium tuberculosis complex (MTB) in clinical specimens. Study Design: Comparative cross sectional study. Methodology: After decontamination procedure, the clinical specimens were subjected to DNA extraction and amplification. Extracted DNA was separated in a separate tube provided with fastsure TB DNA kit and was then inserted into the cartridge provided and results were observed within 30 minutes. For Processing in MGIT 960, OADC and PANTA were added to the clinical specimens after decontamination and then the tubes were processed in MGIT 960. Results: A total of 80 specimens were tested by both MGIT 960 and fastsure TB DNA. On MGIT 960 system, 57 specimens showed growth of MTB while 23 were negative. On Fastsure TB DNA, 47 Specimens were tested as positive and 33 specimens showed negative result. Sensitivity and specificity of Fastsure TB DNA method was calculated to be 82.45 % and 100 % respectively, while positive and negative predictive values were 100 % and 69.69 % respectively. Conclusion: Fast sure TB DNA is a rapid and accurate method for the detection of Mycobacterium tuberculosis complex (MTB) from clinical specimens. (author)

  16. Alveolar Epithelial Cells in Mycobacterium tuberculosis Infection: Active Players or Innocent Bystanders?

    Science.gov (United States)

    Scordo, Julia M; Knoell, Daren L; Torrelles, Jordi B

    2016-01-01

    Tuberculosis (TB) is a disease that kills one person every 18 s. TB remains a global threat due to the emergence of drug-resistant Mycobacterium tuberculosis (M.tb) strains and the lack of an efficient vaccine. The ability of M.tb to persist in latency, evade recognition following seroconversion, and establish resistance in vulnerable populations warrants closer examination. Past and current research has primarily focused on examination of the role of alveolar macrophages and dendritic cells during M.tb infection, which are critical in the establishment of the host response during infection. However, emerging evidence indicates that the alveolar epithelium is a harbor for M.tb and critical during progression to active disease. Here we evaluate the relatively unexplored role of the alveolar epithelium as a reservoir and also its capacity to secrete soluble mediators upon M.tb exposure, which influence the extent of infection. We further discuss how the M.tb-alveolar epithelium interaction instigates cell-to-cell crosstalk that regulates the immune balance between a proinflammatory and an immunoregulatory state, thereby prohibiting or allowing the establishment of infection. We propose that consideration of alveolar epithelia provides a more comprehensive understanding of the lung environment in vivo in the context of host defense against M.tb. © 2015 S. Karger AG, Basel.

  17. Alveolar epithelial cells in Mycobacterium tuberculosis infection: Active Players or Innocent Bystanders

    Science.gov (United States)

    Scordo, Julia M.; Knoell, Daren L.; Torrelles, Jordi B.

    2015-01-01

    Tuberculosis (TB) is a disease that kills one person every 18 seconds. TB remains a global threat due to the emergence of drug resistance Mycobacterium tuberculosis (M.tb) strains and the lack of an efficient vaccine. The ability of M.tb to persist in latency, evade recognition following sero-conversion and establish resistance in vulnerable populations warrants closer examination. Past and current research has primarily focused on examination of the role of alveolar macrophages and dendritic cells during M.tb infection, which are critical in the establishment of the host response during infection. However, emerging evidence indicates that the alveolar epithelium is a harbor for M.tb and critical during progression to active disease. Here we evaluate the relatively unexplored role of the alveolar epithelium as a reservoir and also its capacity to secrete soluble mediators upon M.tb exposure that influence the extent of infection. We further discuss how the M.tb-alveolar epithelia interaction instigate cell to cell crosstalk that regulates immune balance between a pro-inflammatory or immunoregulatory state thereby prohibiting or allowing the establishment of infection. We propose that consideration of the alveolar epithelia provides a more comprehensive understanding of the lung environment in vivo in the context of host defense against M.tb. PMID:26384325

  18. [Tuberculosis screening program for undocumented immigrant teenagers using the QuantiFERON(®)-TB Gold In-Tube test].

    Science.gov (United States)

    Salinas, Carlos; Ballaz, Aitor; Díez, Rosa; Aguirre, Urko; Antón, Ane; Altube, Lander

    2015-07-06

    The aim of this study was to determine the prevalence of tuberculosis infection in undocumented immigrant teenagers using a tuberculin skin test (TST) for initial screening and QuantiFERON(®)-TB Gold In-Tube (QFT-GIT) as a confirmatory test. From 2007 to 2012, under 19 year-old immigrant teenagers from 2 accommodation centers of the Basque Country (Spain) were included in the study. The TST was done in all of them and the QFT-GIT was done in selected patients with a TST≥5mm. Eight hundred and forty-five immigrants were included, most of them from Africa (99.5%). Fifty-one percent of immigrants with TST ≥ 5 mm has a positive QFT-GIT. We found 2 cases of active tuberculosis (2/845: 0.24%). The concordance between TST (≥ 10 mm) and QFT-GIT was 63%, with 57% of positive concordance cases and 96% of negative concordances. There were 246 cases with TST ≥ 10 mm (29%), with significant differences between Magrebis (21.5%) and Subsaharians (67%) (Ptuberculosis infection in Subsaharian immigrants, we recommend implementing screening programs in this population. Using QFT-GIT, the number of candidates for chemoprophylaxis was reduced to 43% compared with TST alone (≥ 10 mm). Copyright © 2013 Elsevier España, S.L.U. All rights reserved.

  19. Abandono do tratamento de tuberculose em co-infectados TB/HIV Abandono del tratamiento de la tuberculosis en coinfectados TB/HIV Abandonment of tuberculosis treatment among patinets co-infected with TB/HIV

    Directory of Open Access Journals (Sweden)

    Ivaneide Leal Ataide Rodrigues

    2010-06-01

    ísica, organización del proceso de trabajo y acceso mostraron relevancia para la no adhesión. Los resultados apuntan a la necesidad de alterar las prácticas desarrolladas en los Servicios.This study aimed at analyzing the reasons that patients co-infected with tuberculosis and HIV leave the treatment of tuberculosis and to know the conduct of the health team toward that abandonment. The study, using a qualitative approach, performed semi-structured interviews on 45 professionals working at a referral health center in Pará state. Two units emerged based on the thematic analysis: patient-associated factors that make TB treatment adherence difficult; and service-associated factors that contribute to treatment abandonment. It was found that, in terms of the patients, that their low socioeconomic condition was the most common factor that led to abandonment. Other factors that led to this outcome included the adverse drug effects, the use of illegal drugs, and poor personal motivation. Regarding the service, issues related to the physical structure, working process organization and accessibility were also relevant to their non-adherence. Results show there is a need to change the practices performed at the health care services.

  20. Optimization of TB/HIV co-treatment in Ethiopian patients

    OpenAIRE

    Degu, Wondwossen Amogne

    2015-01-01

    Tuberculosis (TB) and HIV infection act with deadly synergy. HIV is the most important risk factor for latent TB reactivation and active TB progression following exposure or reinfection while TB accelerates HIV progression. TB is the most frequent cause of morbidity and mortality in HIV infection. Anti-TB therapy (ATT) must precede initiation of combination Antiretroviral Therapy (cART), TB being the most immediate threat. Undoubtedly cART benefits; however, important clinical ...

  1. Listening to Those at the Frontline: Patient and Healthcare Personnel Perspectives on Tuberculosis Treatment Barriers and Facilitators in High TB Burden Regions of Argentina

    Directory of Open Access Journals (Sweden)

    Sarah J. Iribarren

    2014-01-01

    Full Text Available Purpose. In Argentina, tuberculosis (TB control measures have not achieved key treatment targets. The purpose of this study was to identify modes of treatment delivery and explore patient and healthcare personnel perceptions of barriers and facilitators to treatment success. Methods. We used semistructured group and individual interviews for this descriptive qualitative study. Eight high burden municipalities were purposively selected. Patients in treatment for active TB (n=16, multidisciplinary TB team members (n=26, and TB program directors (n=12 at local, municipal, regional, and national levels were interviewed. Interviews were recorded, transcribed verbatim, and analyzed using thematic analysis. Results. Modes of treatment delivery varied across municipalities and types of healthcare facility and were highly negotiated with patients. Self-administration of treatment was common in hospital-based and some community clinics. Barriers to TB treatment success were concentrated at the system level. This level relied heavily on individual personal commitment, and many system facilitators were operating in isolation or in limited settings. Conclusions. We outline experiences and perspectives of the facilitating and challenging factors at the individual, structural, social, and organizational levels. Establishing strong patient-healthcare personnel relationships, responding to patient needs, capitalizing on community resources, and maximizing established decentralized system could mitigate some of the barriers.

  2. Enhancing the role of private practitioners in tuberculosis prevention and care activities in India

    Directory of Open Access Journals (Sweden)

    Tanu Anand

    2017-01-01

    Full Text Available India accounts for the highest number of incident tuberculosis (TB cases globally. Hence, to impact the TB incidence world over, there is an urgent need to address and accelerate TB control activities in the country. Nearly, half of the TB patients first seek TB care in private sector. However, the participation of private practitioners (PPs has been patchy in TB prevention and care and distrust exists between public and private sector. PPs usually have varied diagnostic and treatment practices that are inadequate and amplify the risk of drug resistance. Hence, their regulation and involvement as key stakeholders are important in TB prevention and care in India if we are to achieve TB control at global level. However, there remain certain barriers and gaps, which are preventing their upscaling. The current paper aims to discuss the status of private sector involvement in TB prevention and care in India. The paper also discusses the strategies and initiatives taken by the government in this regard as evidence shows that the involvement of private sector in co-opting directly observed treatment short-course (DOTS helps to enhance case finding and treatment outcomes; it improves the accessibility of quality TB care with greater geographic coverage. Besides public-private mix, DOTS has been found more cost-effective and reduces financial burden of patients. The paper also offers to present some more solutions both at policy and program level for upscaling the engagement of PPs in the national TB control program.

  3. Analysis of host responses to Mycobacterium tuberculosis antigens in a multi-site study of subjects with different TB and HIV infection states in sub-Saharan Africa.

    Directory of Open Access Journals (Sweden)

    Jayne S Sutherland

    Full Text Available Tuberculosis (TB remains a global health threat with 9 million new cases and 1.4 million deaths per year. In order to develop a protective vaccine, we need to define the antigens expressed by Mycobacterium tuberculosis (Mtb, which are relevant to protective immunity in high-endemic areas.We analysed responses to 23 Mtb antigens in a total of 1247 subjects with different HIV and TB status across 5 geographically diverse sites in Africa (South Africa, The Gambia, Ethiopia, Malawi and Uganda. We used a 7-day whole blood assay followed by IFN-γ ELISA on the supernatants. Antigens included PPD, ESAT-6 and Ag85B (dominant antigens together with novel resuscitation-promoting factors (rpf, reactivation proteins, latency (Mtb DosR regulon-encoded antigens, starvation-induced antigens and secreted antigens.There was variation between sites in responses to the antigens, presumably due to underlying genetic and environmental differences. When results from all sites were combined, HIV- subjects with active TB showed significantly lower responses compared to both TST(- and TST(+ contacts to latency antigens (Rv0569, Rv1733, Rv1735, Rv1737 and the rpf Rv0867; whilst responses to ESAT-6/CFP-10 fusion protein (EC, PPD, Rv2029, TB10.3, and TB10.4 were significantly higher in TST(+ contacts (LTBI compared to TB and TST(- contacts fewer differences were seen in subjects with HIV co-infection, with responses to the mitogen PHA significantly lower in subjects with active TB compared to those with LTBI and no difference with any antigen.Our multi-site study design for testing novel Mtb antigens revealed promising antigens for future vaccine development. The IFN-γ ELISA is a cheap and useful tool for screening potential antigenicity in subjects with different ethnic backgrounds and across a spectrum of TB and HIV infection states. Analysis of cytokines other than IFN-γ is currently on-going to determine correlates of protection, which may be useful for vaccine

  4. Tuberculosis Treatment and Pregnancy

    Science.gov (United States)

    ... Search Form Controls Cancel Submit Search The CDC Tuberculosis (TB) Note: Javascript is disabled or is not ... message, please visit this page: About CDC.gov . Tuberculosis Basic TB Facts How TB Spreads Latent TB ...

  5. Liver toxicity associated with tuberculosis chemotherapy in the REMoxTB study.

    Science.gov (United States)

    Tweed, Conor Duncan; Wills, Genevieve Helen; Crook, Angela M; Dawson, Rodney; Diacon, Andreas H; Louw, Cheryl E; McHugh, Timothy D; Mendel, Carl; Meredith, Sarah; Mohapi, Lerato; Murphy, Michael E; Murray, Stephen; Murthy, Sara; Nunn, Andrew J; Phillips, Patrick P J; Singh, Kasha; Spigelman, M; Gillespie, S H

    2018-03-28

    Drug-induced liver injury (DILI) is a common complication of tuberculosis treatment. We utilised data from the REMoxTB clinical trial to describe the incidence of predisposing factors and the natural history in patients with liver enzyme levels elevated in response to tuberculosis treatment. Patients received either standard tuberculosis treatment (2EHRZ/4HR), or a 4-month regimen in which moxifloxacin replaced either ethambutol (isoniazid arm, 2MHRZ/2MHR) or isoniazid (ethambutol arm, 2EMRZ/2MR). Hepatic enzymes were measured at 0, 2, 4, 8, 12 and 17 weeks and as clinically indicated during reported adverse events. Patients included were those receiving at least one dose of drug and with two or more hepatic enzyme measurements. A total of 1928 patients were included (639 2EHRZ/4HR, 654 2MHRZ/2MHR and 635 2EMRZ/2MR). DILI was defined as peak alanine aminotransferase (ALT) ≥ 5 times the upper limit of normal (5 × ULN) or ALT ≥ 3 × ULN with total bilirubin > 2 × ULN. DILI was identified in 58 of the 1928 (3.0%) patients at a median time of 28 days (interquartile range IQR 14-56). Of 639 (6.4%) patients taking standard tuberculosis therapy, 41 experienced clinically significant enzyme elevations (peak ALT ≥ 3 × ULN). On standard therapy, 21.1% of patients aged >55 years developed a peak ALT/aspartate aminotransferase (AST) ≥ 3 × ULN (p = 0.01) and 15% of HIV-positive patients experienced a peak ALT/AST ≥ 3 × ULN compared to 9% of HIV-negative patients (p = 0.160). The median peak ALT/AST was higher in isoniazid-containing regimens vs no-isoniazid regimens (p tuberculosis patients on standard treatment. Older patients on standard therapy, HIV-positive patients, Asian patients and those receiving isoniazid were at higher risk of elevated enzyme levels. Monitoring hepatic enzymes during the first 2 months of standard therapy detected approximately 75% of patients with a peak enzyme elevation ≥3 × ULN, suggesting this should be a standard of care. These

  6. Pathway to care for drug resistant tuberculosis cases identified during a retrospective study conducted in high TB burden wards in Mumbai.

    Science.gov (United States)

    Lobo, Eunice; Shah, Shimoni; Rangan, Sheela; Dholakia, Yatin; Mistry, Nerges

    2018-05-10

    Background: Mumbai is witnessing a rising incidence of all forms of drug resistant tuberculosis (DR-TB). Methods: A population-based, retrospective study was conducted between April and July 2014, in 15 high TB burden wards in Mumbai, to capture the patient pathways to TB care. A total of 23 DR-TB patients were identified and their pathways to access DR-TB care were recorded using semi-structured interviews. Results: The total DR-TB pathway time of new patients (who did not report any past episode of TB) (180 days; IQR 123,346) was found to be more than twice that of retreatment patients (who reported a past episode of TB) (69 days; IQR 42,128). Conclusions: The unacceptable delay for diagnosis and treatment of DR-TB in Mumbai advocates for consistent implementation of early screening of patients using rapid gene-based technologies.

  7. [Evaluation of T-SPOT.TB assay in the diagnosis of pulmonary tuberculosis within different age groups].

    Science.gov (United States)

    Pan, Liping; Jia, Hongyan; Liu, Fei; Gao, Mengqiu; Sun, Huishan; Du, Boping; Sun, Qi; Xing, Aiying; Wei, Rongrong; Zhang, Zongde

    2015-12-01

    To evaluate the value of T-SPOT.TB assay in the diagnosis of pulmonary tuberculosis within different age groups. We analyzed 1 518 suspected pulmonary tuberculosis (PTB) patients who were admitted to the Beijing Chest Hospital from November 2012 to February 2014 and had valid T-SPOT.TB tests before anti-tuberculosis therapy. The 599 microbiologically and/or histopathologically-confirmed PTB patients (16-89 years old, 388 males and 211 females) and 235 non-TB patients (14-85 years old, 144 males and 91 females) were enrolled for the analysis of diagnostic performance of T-SPOT.TB, while patients with uncertain diagnosis or diagnosis based on clinical impression (n=684) were excluded from the analysis. The sensitivity, specificity, positive predictive value, negative predictive value, positive likelihood ratio, and negative likelihood ratio of the T-SPOT.TB were analyzed according to the final diagnosis. Furthermore, the diagnostic performance of T-SPOT.TB assay in the younger patients (14-59 years old) and elderly patients (60-89 years old) were also analyzed respectively. Categorical variables were compared by Pearson's Chi-square test, while continuous variables were compared by the Mann-Whitney U-test. The sensitivity, specificity, positive predictive value, negative predictive value, positive likelihood ratio, and negative likelihood ratio of the T-SPOT.TB in diagnosis of PTB were 90.1% (540/599), 65.5% (154/235), 86.9% (540/621), 72.3% (154/213), 2.61, and 0.15, respectively. The sensitivity and specificity of T-SPOT.TB assay were 92.6% (375/405) and 75.6% (99/131), respectively in the younger patients, and 85.0% (165/194), 52.9% (55/104) respectively in the elderly patients. The sensitivity and specificity of T-SPOT.TB assay in the younger patients were significantly higher than those in the elderly patients (Pspot forming cells in the younger PTB patients were significantly higher than in the elderly PTB patients [300 (126, 666)/10(6) PBMCs vs. 258 (79, 621

  8. Learn About Tuberculosis

    Science.gov (United States)

    ... Diseases > Lung Disease Lookup > Tuberculosis (TB) Learn About Tuberculosis Tuberculosis (TB) is an airborne bacterial infection caused by the organism Mycobacterium tuberculosis that primarily affects the lungs, although other organs ...

  9. Mycobacterium tuberculosis: Active disease and latent infection in a renal transplant cohort.

    Science.gov (United States)

    Rafiei, Nastaran; Williams, Jackie; Mulley, William R; Trauer, James M; Jenkin, Grant A; Rogers, Benjamin A

    2018-04-16

    Tuberculosis (TB) is a serious opportunistic infection in renal transplant recipients associated with high mortality. Screening and treatment of latent Mycobacterium tuberculosis infection (LTBI) offers an opportunity to prevent subsequent active disease. We retrospectively reviewed the records of all adult patients who underwent renal transplantation at our centre from 2005 to 2014 to assess current screening practices, the risks for and burden of active TB. A total of 660 individuals underwent renal transplantation during this period, totalling 3647 person years of follow up. Three patients were diagnosed with active TB after renal transplant, resulting in an incidence of 82 per 100,000 person-years. Of 656 transplant recipients, 102 (15.5%) were born in high TB incidence countries and 89 (13.5%) had an interferon gamma release assay (IGRA) at any point. Individuals born in high TB risk countries had a much higher incidence of active TB (530 per 100,000 person-years). Ten individuals had positive IGRA tests, of whom two were treated for active TB, two received chemoprophylaxis and six were not treated. In the absence of formal guidelines, IGRA-based screening for LTBI was infrequently performed. Our data suggests that screening and treatment of renal transplant recipients born in high incidence countries is an important preventive measure. This article is protected by copyright. All rights reserved.

  10. Tuberculosis Screening and Active Tuberculosis among HIV-Infected Persons in a Canadian Tertiary Care Centre

    Directory of Open Access Journals (Sweden)

    Paul Brassard

    2009-01-01

    Full Text Available RATIONALE: HIV infection increases the risk of reactivation of latent tuberculosis (TB. The present study evaluates how latent TB is detected and treated to determine the effectiveness of screening in HIV-infected patients with diverse risk profiles.

  11. Mycobacteria-specific cytokine responses as correlates of treatment response in active and latent tuberculosis.

    Science.gov (United States)

    Clifford, Vanessa; Tebruegge, Marc; Zufferey, Christel; Germano, Susie; Forbes, Ben; Cosentino, Lucy; McBryde, Emma; Eisen, Damon; Robins-Browne, Roy; Street, Alan; Denholm, Justin; Curtis, Nigel

    2017-08-01

    A biomarker indicating successful tuberculosis (TB) therapy would assist in determining appropriate length of treatment. This study aimed to determine changes in mycobacteria-specific antigen-induced cytokine biomarkers in patients receiving therapy for latent or active TB, to identify biomarkers potentially correlating with treatment success. A total of 33 adults with active TB and 36 with latent TB were followed longitudinally over therapy. Whole blood stimulation assays using mycobacteria-specific antigens (CFP-10, ESAT-6, PPD) were done on samples obtained at 0, 1, 3, 6 and 9 months. Cytokine responses (IFN-γ, IL-1ra, IL-2, IL-10, IL-13, IP-10, MIP-1β, and TNF-α) in supernatants were measured by Luminex xMAP immunoassay. In active TB cases, median IL-1ra (with CFP-10 and with PPD stimulation), IP-10 (CFP-10, ESAT-6), MIP-1β (ESAT-6, PPD), and TNF-α (ESAT-6) responses declined significantly over the course of therapy. In latent TB cases, median IL-1ra (CFP-10, ESAT-6, PPD), IL-2 (CFP-10, ESAT-6), and IP-10 (CFP-10, ESAT-6) responses declined significantly. Mycobacteria-specific cytokine responses change significantly over the course of therapy, and their kinetics in active TB differ from those observed in latent TB. In particular, mycobacteria-specific IL-1ra responses are potential correlates of successful therapy in both active and latent TB. Copyright © 2017 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  12. Analysis of multi drug resistant tuberculosis (MDR-TB) financial protection policy: MDR-TB health insurance schemes, in Chhattisgarh state, India.

    Science.gov (United States)

    Kundu, Debashish; Sharma, Nandini; Chadha, Sarabjit; Laokri, Samia; Awungafac, George; Jiang, Lai; Asaria, Miqdad

    2018-01-27

    There are significant financial barriers to access treatment for multi drug resistant tuberculosis (MDR-TB) in India. To address these challenges, Chhattisgarh state in India has established a MDR-TB financial protection policy by creating MDR-TB benefit packages as part of the universal health insurance scheme that the state has rolled out in their effort towards attaining Universal Health Coverage for all its residents. In these schemes the state purchases health insurance against set packages of services from third party health insurance agencies on behalf of all its residents. Provider payment reform by strategic purchasing through output based payments (lump sum fee is reimbursed as per the MDR-TB benefit package rates) to the providers - both public and private health facilities empanelled under the insurance scheme was the key intervention. To understand the implementation gap between policy and practice of the benefit packages with respect to equity in utilization of package claims by the poor patients in public and private sector. Data from primary health insurance claims from January 2013 to December 2015, were analysed using an extension of 'Kingdon's multiple streams for policy implementation framework' to explain the implementation gap between policy and practice of the MDR-TB benefit packages. The total number of claims for MDR-TB benefit packages increased over the study period mainly from poor patients treated in public facilities, particularly for the pre-treatment evaluation and hospital stay packages. Variations and inequities in utilizing the packages were observed between poor and non-poor beneficiaries in public and private sector. Private providers participation in the new MDR-TB financial protection mechanism through the universal health insurance scheme was observed to be much lower than might be expected given their share of healthcare provision overall in India. Our findings suggest that there may be an implementation gap due to weak

  13. Deregulated microRNAs in CD4+ T cells from individuals with latent tuberculosis versus active tuberculosis.

    Science.gov (United States)

    Fu, Yurong; Yi, Zhengjun; Li, Jianhua; Li, Ruifang

    2014-03-01

    The mechanisms of latent tuberculosis (TB) infection remain elusive. Roles of microRNA (miRNA) have been highlighted in pathogen-host interactions recently. To identify miRNAs involved in the immune response to TB, expression profiles of miRNAs in CD4(+) T cells from patients with latent TB, active TB and healthy controls were investigated by microarray assay and validated by RT-qPCR. Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were used to analyse the significant functions and involvement in signalling pathways of the differentially expressed miRNAs. To identify potential target genes for miR-29, interferon-γ (IFN-γ) mRNA expression was measured by RT-qPCR. Our results showed that 27 miRNAs were deregulated among the three groups. RT-qPCR results were generally consistent with the microarray data. We observed an inverse correlation between miR-29 level and IFN-γ mRNA expression in CD4(+) T cells. GO and KEGG pathway analysis showed that the possible target genes of deregulated miRNAs were significantly enriched in mitogen-activated protein kinase signalling pathway, focal adhesion and extracellular matrix receptor interaction, which might be involved in the transition from latent to active TB. In all, for the first time, our study revealed that some miRNAs in CD4(+) T cells were altered in latent and active TB. Function and pathway analysis highlighted the possible involvement of miRNA-deregulated mRNAs in TB. The study might help to improve understanding of the relationship between miRNAs in CD4(+) T cells and TB, and laid an important foundation for further identification of the underlying mechanisms of latent TB infection and its reactivation. © 2013 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  14. Analysis of the Phenotype of Mycobacterium tuberculosis-Specific CD4+ T Cells to Discriminate Latent from Active Tuberculosis in HIV-Uninfected and HIV-Infected Individuals

    Directory of Open Access Journals (Sweden)

    Catherine Riou

    2017-08-01

    Full Text Available Several immune-based assays have been suggested to differentiate latent from active tuberculosis (TB. However, their relative performance as well as their efficacy in HIV-infected persons, a highly at-risk population, remains unclear. In a study of 81 individuals, divided into four groups based on their HIV-1 status and TB disease activity, we compared the differentiation (CD27 and KLRG1, activation (HLA-DR, homing potential (CCR4, CCR6, CXCR3, and CD161 and functional profiles (IFNγ, IL-2, and TNFα of Mycobacterium tuberculosis (Mtb-specific CD4+ T cells using flow cytometry. Active TB disease induced major changes within the Mtb-responding CD4+ T cell population, promoting memory maturation, elevated activation and increased inflammatory potential when compared to individuals with latent TB infection. Moreover, the functional profile of Mtb-specific CD4+ T cells appeared to be inherently related to their degree of differentiation. While these specific cell features were all capable of discriminating latent from active TB, irrespective of HIV status, HLA-DR expression showed the best performance for TB diagnosis [area-under-the-curve (AUC = 0.92, 95% CI: 0.82–1.01, specificity: 82%, sensitivity: 84% for HIV− and AUC = 0.99, 95% CI: 0.98–1.01, specificity: 94%, sensitivity: 93% for HIV+]. In conclusion, these data support the idea that analysis of T cell phenotype can be diagnostically useful in TB.

  15. Impaired IFN-α-mediated signal in dendritic cells differentiates active from latent tuberculosis.

    Directory of Open Access Journals (Sweden)

    Stefania Parlato

    Full Text Available Individuals exposed to Mycobacterium tuberculosis (Mtb may be infected and remain for the entire life in this condition defined as latent tuberculosis infection (LTBI or develop active tuberculosis (TB. Among the multiple factors governing the outcome of the infection, dendritic cells (DCs play a major role in dictating antibacterial immunity. However, current knowledge on the role of the diverse components of human DCs in shaping specific T-cell response during Mtb infection is limited. In this study, we performed a comparative evaluation of peripheral blood circulating DC subsets as well as of monocyte-derived Interferon-α DCs (IFN-DCs from patients with active TB, subjects with LTBI and healthy donors (HD. The proportion of circulating myeloid BDCA3+ DCs (mDC2 and plasmacytoid CD123+ DCs (pDCs declined significantly in active TB patients compared to HD, whereas the same subsets displayed a remarkable activation in LTBI subjects. Simultaneously, the differentiation of IFN-DCs from active TB patients resulted profoundly impaired compared to those from LTBI and HD individuals. Importantly, the altered developmental trait of IFN-DCs from active TB patients was associated with down-modulation of IFN-linked genes, marked changes in molecular signaling conveying antigen (Ag presentation and full inability to induce Ag-specific T cell response. Thus, these data reveal an important role of IFN-α in determining the induction of Mtb-specific immunity.

  16. Interferon-gamma response to the treatment of active pulmonary and extra-pulmonary tuberculosis.

    Science.gov (United States)

    Liang, L; Shi, R; Liu, X; Yuan, X; Zheng, S; Zhang, G; Wang, W; Wang, J; England, K; Via, L E; Cai, Y; Goldfeder, L C; Dodd, L E; Barry, C E; Chen, R Y

    2017-10-01

    Interferon-gamma (IFN-γ) release assays (IGRAs) are used to diagnose tuberculosis (TB) but not to measure treatment response. To measure IFN-γ response to active anti-tuberculosis treatment. Patients from the Henan Provincial Chest Hospital, Henan, China, with TB symptoms and/or signs were enrolled into this prospective, observational cohort study and followed for 6 months of treatment, with blood and sputum samples collected at 0, 2, 4, 6, 8, 16 and 24 weeks. The QuantiFERON® TB-Gold assay was run on collected blood samples. Participants received a follow-up telephone call at 24 months to determine relapse status. Of the 152 TB patients enrolled, 135 were eligible for this analysis: 118 pulmonary (PTB) and 17 extra-pulmonary TB (EPTB) patients. IFN-γ levels declined significantly over time among all patients (P = 0.002), with this decline driven by PTB patients (P = 0.001), largely during the initial 8 weeks of treatment (P = 0.019). IFN-γ levels did not change among EPTB patients over time or against baseline culture or drug resistance status. After 6 months of effective anti-tuberculosis treatment, IFN-γ levels decreased significantly in PTB patients, largely over the initial 8 weeks of treatment. IFN-γ concentrations may offer some value for monitoring anti-tuberculosis treatment response among PTB patients.

  17. Prevalence, risk factors and social context of active pulmonary tuberculosis among prison inmates in Tajikistan.

    Directory of Open Access Journals (Sweden)

    Daniel E Winetsky

    Full Text Available SETTING: Tuberculosis (TB is highly prevalent in prisons of the former Soviet Union. OBJECTIVE: To understand the behavioral, demographic and biological factors placing inmates in Tajikistan at risk for active TB. DESIGN: We administered a behavioral and demographic survey to 1317 inmates in two prison facilities in Sughd province, Tajikistan along with radiographic screening for pulmonary TB. Suspected cases were confirmed bacteriologically. Inmates undergoing TB treatment were also surveyed. In-depth interviews were conducted with former prisoners to elicit relevant social and behavioral characteristics. RESULTS: We identified 59 cases of active pulmonary TB (prevalence 4.5%. Factors independently associated with increased prevalence of active TB were: HIV-infection by self-report (PR 7.88; 95%CI 3.40-18.28, history of previous TB (PR 10.21; 95%CI 6.27-16.63 and infrequent supplemental nutrition beyond scheduled meals (PR 3.00; 95%CI 1.67-5.62. Access to supplemental nutrition was associated with frequency of visits from friends and family and ability to rely on other inmates for help. CONCLUSION: In prison facilities of Tajikistan, HIV-infection, injection drug use and low access to supplemental nutrition were associated with prevalent cases of active pulmonary TB. Policies that reduce HIV transmission among injection drug users and improve the nutritional status of socially isolated inmates may alleviate the TB burden in Tajikistan's prisons.

  18. Urgent Living-Donor Liver Transplantation in a Patient With Concurrent Active Tuberculosis: A Case Report.

    Science.gov (United States)

    Jung, B-H; Park, J-I; Lee, S-G

    2018-04-01

    Although active tuberculosis (TB) is considered a contraindication for liver transplantation (LT), this is the only treatment in patients with liver failure and concurrent active TB. We report a case with successful urgent living-donor LT for irreversible liver failure in the presence of active TB. A 48-year-old man, with a history of decompensated alcoholic liver cirrhosis, was presented with stupor. At admission, his consciousness had deteriorated to semi-coma, and his renal function also rapidly deteriorated to hepatorenal syndrome. A preoperative computed tomography scan of the chest revealed several small cavitary lesions in both upper lobes, and acid-fast bacillus stain from his sputum was graded 2+. Adenosine deaminase levels from ascites were elevated, suggesting TB peritonitis. A first-line anti-TB drug regimen was started immediately (rifampin, isoniazid, levofloxacin, and amikacin). An urgent living-donor LT was performed 2 days later. After LT, the regimen was changed to second-line anti-TB drugs (amikacin, levofloxacin, cycloserine, and pyridoxine). The sputum acid-fast bacillus stain tested negative on postoperative day 10. His liver function remained well preserved, even after the reversion to first-line anti-TB treatment. The patient recovered without any anti-TB medication-related complications and was discharged. LT can be prudently performed as a life-saving option, particularly for patients with liver failure and concurrent active TB. Copyright © 2018 Elsevier Inc. All rights reserved.

  19. Essential and toxic metals in serum of individuals with active pulmonary tuberculosis in an endemic region

    Directory of Open Access Journals (Sweden)

    Zahra Sepehri

    2017-01-01

    Full Text Available Trace elements play an important role in tuberculosis infection because their deficiencies can be associated with impaired immunity. Blood samples were collected from a total of 320 active pulmonary tuberculosis patients and healthy individuals. The serum concentrations of Zinc, Iron, Copper, Calcium, lead, Arsenic and Selenium were analyzed by atomic absorption spectrometry. The levels of trace elements were measured after 2, 4 and 6 months of anti-TB treatment initiation in TB infected groups. Compared to the control group, the concentrations of Zinc, Selenium, and Iron were significantly lower (P< 0.001 in tuberculosis patients; however, that of Arsenic, Lead, and copper was significantly higher (P< 0.001 in the serum of patients. Cu/Zn and Cu/Se ratios were also significantly higher (P< 0.001 in TB patients compared to the control group. In addition, serum concentration calcium was similar in both TB patients and healthy controls. Our results indicated that trace elements concentrations in tuberculosis patients are related to each element role in immune system. Wherever the element is essential for the pathogenesis of bacteria, its concentration will remain low; and contrariwise, when the element is toxic for the bacteria, its level will be regulated up to provide a perfect condition for bacterial growth. Keywords: Trace elements, Blood, Atomic absorption spectroscopy, Sistan, Pulmonary tuberculosis, Trace elements, Graphite furnace atomic absorption spectrometry, Sistan

  20. Soluble Urokinase Plasminogen Activator Receptor Levels in Tuberculosis Patients at High Risk for Multidrug Resistance

    Directory of Open Access Journals (Sweden)

    Tri Yudani Mardining Raras

    2012-01-01

    Full Text Available The soluble urokinase plasminogen activator receptor (suPAR has been shown to be a strong prognostic biomarker for tuberculosis (TB. In the present study, the profiles of plasma suPAR levels in pulmonary TB patients at high risk for multidrug resistance were analyzed and compared with those in multidrug resistant (MDR-TB patients. Forty patients were prospectively included, consisting of 10 MDR-TB patients and 30 TB patients at high risk for MDR, underwent clinical assesment. Plasma suPAR levels were measured using ELISA (SUPARnostic, Denmark and bacterial cultures were performed in addition to drug susceptibility tests. All patients of suspected MDR-TB group demonstrated significantly higher suPAR levels compared with the healthy TB-negative group (1.79 ng/mL. Among the three groups at high risk for MDR-TB, only the relapse group (7.87 ng/mL demonstrated suPAR levels comparable with those of MDR-TB patients (7.67 ng/mL. suPAR levels in the two-month negative acid-fast bacilli conversion group (9.29 ng/mL were higher than positive control, whereas levels in the group consisting of therapy failure patients (5.32 ng/mL were lower. Our results strongly suggest that suPAR levels enable rapid screening of suspected MDR-TB patients, but cannot differentiate between groups.

  1. Dextran solution optical activity in Tb (III) ion presence

    International Nuclear Information System (INIS)

    Vasconcellos, Sandra S.; Rodrigues, J.F.; Faljoni-Alario, A.

    1984-01-01

    Optical activity studies of aqueous solutions of dextrana in presence of Tb (III) or without it shows the complex with the hidroxyl groups of C 2 and C 3 of monomeric unit participation is formed. (L.M.J.) [pt

  2. Infection control, genetic assessment of drug resistance and drug susceptibility testing in the current management of multidrug/extensively-resistant tuberculosis (M/XDR-TB) in Europe

    DEFF Research Database (Denmark)

    Bothamley, Graham H.; Lange, Christoph; Albrecht, Dirk

    2017-01-01

    AIM: Europe has the highest documented caseload and greatest increase in multidrug and extensively drug-resistant tuberculosis (M/XDR-TB) of all World Health Organization (WHO) regions. This survey examines how recommendations for M/XDR-TB management are being implemented. METHODS: TBNET is a pan...

  3. Diagnostic accuracy of the rapid urine lipoarabinomannan test for pulmonary tuberculosis among HIV-infected adults in Ghana-findings from the DETECT HIV-TB study

    DEFF Research Database (Denmark)

    Bjerrum, Stephanie; Kenu, Ernest; Lartey, Margaret

    2015-01-01

    BACKGROUND: Rapid diagnostic tests are urgently needed to mitigate HIV-associated tuberculosis (TB) mortality. We evaluated diagnostic accuracy of the rapid urine lipoarabinomannan (LAM) test for pulmonary TB and assessed the effect of a two-sample strategy. METHODS: HIV-infected adults eligible...

  4. Challenges of TB diagnosis and treatment in South Africa | Wood ...

    African Journals Online (AJOL)

    It is estimated that 2 billion of the world\\'s population are latently infected with Mycobacterium tuberculosis (Mtb) with a resultant 8 - 9 million cases of active tuberculosis (TB) and 1.6 million deaths annually.1 The tools used for diagnosis of TB have remained largely unchanged since the 1880s when sputum microscopy, Mtb ...

  5. QuantiFERON-TB Gold In-Tube as a Confirmatory Test for Tuberculin Skin Test in Tuberculosis Contact Tracing: A Noninferiority Clinical Trial.

    Science.gov (United States)

    Muñoz, Laura; Santin, Miguel; Alcaide, Fernando; Ruíz-Serrano, Maria Jesús; Gijón, Paloma; Bermúdez, Elena; Domínguez-Castellano, Angel; Navarro, María Dolores; Ramírez, Encarnación; Pérez-Escolano, Elvira; López-Prieto, María Dolores; Gutiérrez-Rodriguez, José; Anibarro, Luis; Calviño, Laura; Trigo, Matilde; Cifuentes, Carmen; García-Gasalla, Mercedes; Payeras, Antoni; Gasch, Oriol; Espasa, Mateu; Agüero, Ramon; Ferrer, Diego; Casas, Xavier; González-Cuevas, Araceli; García-Zamalloa, Alberto; Bikuña, Edurne; Lecuona, María; Galindo, Rosa; Ramírez-Lapausa, Marta; Carrillo, Raquel

    2018-01-18

    Screening strategies based on interferon-γ release assays in tuberculosis contact tracing may reduce the need for preventive therapy without increasing subsequent active disease. We conducted an open-label, randomized trial to test the noninferiority of a 2-step strategy with the tuberculin skin test (TST) followed by QuantiFERON-TB Gold In-Tube (QFT-GIT) as a confirmatory test (the TST/QFT arm) to the standard TST-alone strategy (TST arm) for targeting preventive therapy in household contacts of patients with tuberculosis. Participants were followed for 24 months after randomization. The primary endpoint was the development of tuberculosis, with a noninferiority margin of 1.5 percentage points. A total of 871 contacts were randomized. Four contacts in the TST arm and 2 in the TST/QFT arm developed tuberculosis. In the modified intention-to-treat analysis, this accounted for 0.99% in the TST arm and 0.51% in the TST/QFT arm (-0.48% difference; 97.5% confidence interval [CI], -1.86% to 0.90%); in the per-protocol analysis, the corresponding rates were 1.67% and 0.82% in the TST and TST/QFT arms, respectively (-0.85% difference; 97.5% CI, -3.14% to 1.43%). Of the 792 contacts analyzed, 65.3% in the TST arm and 42.2% in the TST/QFT arm were diagnosed with tuberculosis infection (23.1% difference; 95% CI, 16.4% to 30.0%). In low-incidence settings, screening household contacts with the TST and using QFT-GIT as a confirmatory test is not inferior to TST-alone for preventing active tuberculosis, allowing a safe reduction of preventive treatments. NCT01223534. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  6. Evaluation of the Sensititre MycoTB plate for susceptibility testing of the Mycobacterium tuberculosis complex against first- and second-line agents.

    Science.gov (United States)

    Hall, Leslie; Jude, Kurt P; Clark, Shirley L; Dionne, Kim; Merson, Ryan; Boyer, Ana; Parrish, Nicole M; Wengenack, Nancy L

    2012-11-01

    The Sensititre MycoTB plate (TREK Diagnostic Systems, Cleveland, OH) uses a microtiter plate MIC format for susceptibility testing of Mycobacterium tuberculosis complex isolates against first- and second-line antituberculosis agents. Categorical agreement versus the agar proportion method for 122 M. tuberculosis complex isolates was 94% to 100%.

  7. Demographic predictors of active tuberculosis in people migrating to British Columbia, Canada: a retrospective cohort study.

    Science.gov (United States)

    Ronald, Lisa A; Campbell, Jonathon R; Balshaw, Robert F; Romanowski, Kamila; Roth, David Z; Marra, Fawziah; Cook, Victoria J; Johnston, James C

    2018-02-26

    Canadian tuberculosis (TB) guidelines recommend targeting postlanding screening for and treatment of latent tuberculosis infection (LTBI) in people migrating to Canada who are at increased risk for TB reactivation. Our objectives were to calculate robust longitudinal estimates of TB incidence in a cohort of people migrating to British Columbia, Canada, over a 29-year period, and to identify groups at highest risk of developing TB based on demographic characteristics at time of landing. We included all individuals ( n = 1 080 908) who became permanent residents of Canada between Jan. 1, 1985, and Dec. 31, 2012, and were resident in BC at any time between 1985 and 2013. Multiple administrative databases were linked to the provincial TB registry. We used recursive partitioning models to identify populations with high TB yield. Active TB was diagnosed in 2814 individuals (incidence rate 24.2/100 000 person-years). Demographic factors (live-in caregiver, family, refugee immigration classes; higher TB incidence in country of birth; and older age) were strong predictors of TB incidence in BC, with elevated rates continuing many years after entry into the cohort. Recursive partitioning identified refugees 18-64 years of age from countries with a TB incidence greater than 224/100 000 population as a high-yield group, with 1% developing TB within the first 10 years. These findings support recommendations in Canadian guidelines to target postlanding screening for and treatment of LTBI in adult refugees from high-incidence countries. Because high-yield populations can be identified at entry via demographic data, screening at this point may be practical and high-impact, particularly if the LTBI care cascade can be optimized. © 2018 Joule Inc. or its licensors.

  8. Tuberculose ativa entre profissionais de saúde em Portugal Active tuberculosis among health care workers in Portugal

    Directory of Open Access Journals (Sweden)

    José Castela Torres da Costa

    2011-10-01

    Full Text Available OBJETIVO: Determinar a incidência de tuberculose (TB ativa em uma coorte de profissionais de saúde (PS. MÉTODOS: Estudo descritivo dos casos de TB ativa identificados entre 2005 e 2010 no rastreio de medicina do trabalho efetuado em 6.112 PS. Casos de TB ativa foram definidos como aqueles com identificação de Mycobacterium tuberculosis por microscopia direta ou cultura; aqueles com sintomas ou sinais clínicos de TB e granuloma necrotizante, detectado por histologia; e aqueles com achados radiológicos consistentes com TB ativa. RESULTADOS: Dos 6.112 PS avaliados, houve 62 casos de TB ativa (TB pulmonar, em 43; TB pleural, em 15; TB ganglionar, em 2; TB do pericárdio, em 1; TB cutânea, em 1. Sete PS estavam assintomáticos no momento do diagnóstico. Dos 62 casos de TB ativa, a doença ocorreu nos primeiros 10 anos de exposição ocupacional em 48 e nos primeiros 5 anos em 36. A maioria dos casos verificou-se em médicos e enfermeiros (22 e 21, respectivamente. CONCLUSÕES: O impacto da TB em PS em Portugal é elevado. Os médicos e enfermeiros são os PS com o maior risco de desenvolver TB ativa. Tal como relatado em estudos prévios, parece haver um risco mais elevado de desenvolver essa doença nos primeiros anos de exposição. Em países de elevada incidência, o rastreio de TB nos PS é importante no controle da transmissão dessa doença.OBJECTIVE: To determine the incidence of active tuberculosis (TB in a cohort of health care workers (HCWs. METHODS: Descriptive study of active TB cases identified in an occupational health screening of 6,112 HCWs between 2005 and 2010. Cases of active TB were defined as those in which Mycobacterium tuberculosis was identified by direct microscopy or culture; those in which there were symptoms or clinical signs of TB and necrotizing granuloma, as detected by histology; and those in which the radiological findings were consistent with active TB. RESULTS: Among the 6,112 HCWs evaluated, we identified

  9. Diagnosis of Latent Tuberculosis in Patients with Systemic Lupus Erythematosus: T.SPOT.TB versus Tuberculin Skin Test

    Directory of Open Access Journals (Sweden)

    Maria Del Mar Arenas Miras

    2014-01-01

    Full Text Available Early studies in patients with systemic lupus erythematosus (SLE reported increased incidence of tuberculosis. The tuberculin skin test (TST is the technique of choice to detect latent tuberculosis infection (LTBI but has several limitations. Objectives. We compared TST and the newer T.SPOT.TB test to diagnose LTBI in SLE patients. Methods. In this observational cohort study conducted between August 2009 and February 2012, we recruited 92 patients from those attending the SLE clinic of our university hospital. Data recorded were epidemiological and sociodemographic characteristics. Laboratory analyses included TST and T.SPOT.TB tests. Results. Of the patients studied, 92% were women with an average age of 42.7 years. Overall, the degree of correlation between the two tests was low (Kappa index = 0.324 but was better in patients not receiving corticosteroids (CTC/immunosuppressive (IS therapy (Kappa = 0.436 and in those receiving hydroxychloroquine (Kappa = 0.473. While TST results were adversely affected by those receiving CTC and/or IS drugs (P=0.021, the T.SPOT.TB results were not. Conclusion. Although the TST test remains a useful tool for diagnosing LTBI in SLE patients, the T.SPOT.TB test is perhaps better employed when the patient is receiving CTC and/or IS drugs.

  10. Risk factors for inadequate TB case finding in Rural Western Kenya: a comparison of actively and passively identified TB patients.

    Directory of Open Access Journals (Sweden)

    Anna H Van't Hoog

    Full Text Available The findings of a prevalence survey conducted in western Kenya, in a population with 14.9% HIV prevalence suggested inadequate case finding. We found a high burden of infectious and largely undiagnosed pulmonary tuberculosis (PTB, that a quarter of the prevalent cases had not yet sought care, and a low case detection rate.We aimed to identify factors associated with inadequate case finding among adults with PTB in this population by comparing characteristics of 194 PTB patients diagnosed in a health facility after self-report, i.e., through passive case detection, with 88 patients identified through active case detection during the prevalence survey. We examined associations between method of case detection and patient characteristics, including HIV-status, socio-demographic variables and disease severity in univariable and multivariable logistic regression analyses.HIV-infection was associated with faster passive case detection in univariable analysis (crude OR 3.5, 95% confidence interval (CI 2.0-5.9, but in multivariable logistic regression this was largely explained by the presence of cough, illness and clinically diagnosed smear-negative TB (adjusted OR (aOR HIV 1.8, 95% CI 0.85-3.7. Among the HIV-uninfected passive case detection was less successful in older patients aOR 0.76, 95%CI 0.60-0.97 per 10 years increase, and women (aOR 0.27, 95%CI 0.10-0.73. Reported current or past alcohol use reduced passive case detection in both groups (0.42, 95% CI 0.23-0.79. Among smear-positive patients median durations of cough were 4.0 and 6.9 months in HIV-infected and uninfected patients, respectively.HIV-uninfected patients with infectious TB who were older, female, relatively less ill, or had a cough of a shorter duration were less likely found through passive case detection. In addition to intensified case finding in HIV-infected persons, increasing the suspicion of TB among HIV-uninfected women and the elderly are needed to improve TB case

  11. Treatment of Latent Tuberculosis Infection

    OpenAIRE

    Tang, Patrick; Johnston, James

    2017-01-01

    Opinion statement The treatment of latent tuberculosis infection (LTBI) is an essential component of tuberculosis (TB) elimination in regions that have a low incidence of TB. However, the decision to treat individuals with LTBI must consider the limitations of current diagnostic tests for LTBI, the risk of developing active TB disease, the potential adverse effects from chemoprophylactic therapy, and the importance of treatment adherence. When an individual has been diagnosed with LTBI and ac...

  12. [Active tuberculosis in a cohort of HIV-infected inmates in a prison in Mexico City: clinical and epidemiological characteristics].

    Science.gov (United States)

    Hernández-León, Christian; Badial-Hernández, Florentino; Ponce-de-León, Alfredo; Sierra-Madero, Juan G; Martínez-Gamboa, Areli; Crabtree-Ramírez, Brenda; Bautista-Arredondo, Sergio; González-Aguirre, Adrián; Guerrero-Almeida, María de Lourdes; del Valle, J Miriam Bobadilla; González-Rodríguez, Andrea; Sifuentes-Osornio, José

    2012-01-01

    To determine the clinical and epidemiological characteristics of prison inmates with active tuberculosis in HIV-positive prison populations. We conducted a cohort study in HIV-infected subjects in a prison in Mexico City, with the aim of determining clinical and epidemiological characteristics of cases with active TB. We detected 172 HIV infected inmates and TB in 28 of them (16.3%) - 21 (12.2) with pulmonary TB--with an incidence rate of 7.7/100 persons/year for active TB and 4.7/100 persons/year for pulmonary TB. No drug resistance was found. Two clusters (4 and 2 subjects) were observed after RFLP-typing of 18 isolates, with a transmission rate of 11% by molecular and clinical analysis. The prevalence of active TB was found to be a thousand times greater than in the general population. Evidence of transmission inside the prison was also found.

  13. The effectiveness and cost-effectiveness of screening for active tuberculosis among migrants in the EU/EEA

    DEFF Research Database (Denmark)

    Greenaway, Christina; Pareek, Manish; Abou Chakra, Claire-Nour

    2018-01-01

    BACKGROUND: The foreign-born population make up an increasing and large proportion of tuberculosis (TB) cases in European Union/European Economic Area (EU/EEA) low-incidence countries and challenge TB elimination efforts. Methods: We conducted a systematic review to determine effectiveness (yield...... and performance of chest radiography (CXR) to detect active TB, treatment outcomes and acceptance of screening) and a second systematic review on cost-effectiveness of screening for active TB among migrants living in the EU/EEA. Results: We identified six systematic reviews, one report and three individual...... studies that addressed our aims. CXR was highly sensitive (98%) but only moderately specific (75%). The yield of detecting active TB with CXR screening among migrants was 350 per 100,000 population overall but ranged widely by host country (110-2,340), migrant type (170-1,192), TB incidence in source...

  14. Prevalence of Tuberculosis among Household Contacts in Pondicherry: Active Case Finding Among New Smear Positive Cases

    Directory of Open Access Journals (Sweden)

    Kumar VA

    2016-05-01

    Full Text Available Introduction: The risk of transmission from the index case to its contacts is more in case of smear positive Pulmonary Tuberculosis cases. Any delay in diagnosis and treatment increases the risk of disease transmission to their contacts. Contact screening is important for early detection of transmission of infection. Thus, active case finding of TB is needed to identify the case yield among household contacts. This study will yield the burden of Tuberculosis among the household contact. Objective: To identify the TB suspect and estimate the prevalence of TB among household contacts. Material and Methods: A two stage cross study was done in 472 households of 157 ‘Index cases’ registered in the State Tuberculosis Unit, Puducherry. The study duration was one year and eight months. Data was entered and analyzed by using Epi_Info (Version 3.4.3 software package. Results: A total of 96 (20.3% symptomatic was found from the 472 households contacts who participated in this study. Out of 90 symptomatics, 70 (72.9% were symptomatic within two months of visit and 26 (27.1% were found to have symptoms after eight months. The overall prevalence of tuberculosis in symptomatic household contacts was 4.3% and all tuberculosis confirmed cases were found at the end of in second month only. Conclusion: Considering the prevalence tuberculosis among the symptomatic of household contact to be 4.3%, their investigation to rule out TB in earlier stages is a need. It may help prevent further spread of M. tuberculosis infection in the local community.

  15. Differential cellular recognition pattern to M. tuberculosis targets defined by IFN-γ and IL-17 production in blood from TB + patients from Honduras as compared to health care workers: TB and immune responses in patients from Honduras.

    Science.gov (United States)

    Alvarez-Corrales, Nancy; Ahmed, Raija K; Rodriguez, Carol A; Balaji, Kithiganahalli N; Rivera, Rebeca; Sompallae, Ramakrishna; Vudattu, Nalini K; Hoffner, Sven E; Zumla, Alimuddin; Pineda-Garcia, Lelany; Maeurer, Markus

    2013-03-06

    A better understanding of the quality of cellular immune responses directed against molecularly defined targets will guide the development of TB diagnostics and identification of molecularly defined, clinically relevant M.tb vaccine candidates. Recombinant proteins (n = 8) and peptide pools (n = 14) from M. tuberculosis (M.tb) targets were used to compare cellular immune responses defined by IFN-γ and IL-17 production using a Whole Blood Assay (WBA) in a cohort of 148 individuals, i.e. patients with TB + (n = 38), TB- individuals with other pulmonary diseases (n = 81) and individuals exposed to TB without evidence of clinical TB (health care workers, n = 29). M.tb antigens Rv2958c (glycosyltransferase), Rv2962c (mycolyltransferase), Rv1886c (Ag85B), Rv3804c (Ag85A), and the PPE family member Rv3347c were frequently recognized, defined by IFN-γ production, in blood from healthy individuals exposed to M.tb (health care workers). A different recognition pattern was found for IL-17 production in blood from M.tb exposed individuals responding to TB10.4 (Rv0288), Ag85B (Rv1886c) and the PPE family members Rv0978c and Rv1917c. The pattern of immune target recognition is different in regard to IFN-γ and IL-17 production to defined molecular M.tb targets in PBMCs from individuals frequently exposed to M.tb. The data represent the first mapping of cellular immune responses against M.tb targets in TB patients from Honduras.

  16. Usefulness of the mycobacterium tuberculosis direct assay in early diagnosis of extrapulmonary TB

    Directory of Open Access Journals (Sweden)

    Zhang Hui-Zhang

    2014-01-01

    Full Text Available The aim of this study was to evaluate the in situ detection of living mycobacterium TB rRNA by the mycobacterium TB direct assay (MTD and its clinical significance in the early diagnosis of extrapulmonary TB. Eighty-six patients were recruited from the Shanghai Public Health Clinical Center from June to November in 2010, having been diagnosed with extrapulmonary TB, including tuberculous peritonitis (n=22, lymphatic TB (n=21, tuberculous meningitis (n=15, HIV-associated TB (n=13, nephroTB (n=9, spinal TB (n=2, cutaneous TB (n=13, parotid TB (n=1, chest wall TB (n=1, intestinal TB (n=1. One hundred and five extrapulmonary specimens, including CSF, puncture fluid, drainage, pleural fluid, urine, secretion, ascites, lymphatic tissue and marrow were collected from the patients. The samples were examined using acid-fast stain, solid culture, liquid culture and MTD in parallel. In MTD, the target segments of MTB rRNA in either cultures or clinical specimens were amplified prior to being qualitatively detected with the hybridization protection assay (HPA. The sensitivities of MTD and acid-fast staining in liquid and solid cultures were 48.6%, 41.9%, 20.0% and 14.3%, respectively. MTD sensitivity was higher than that of the others and its specificity was 100%. We concluded that MTD rRNA detection is an effective, rapid, convenient, sensitive and reliable method for the early diagnosis of extrapulmonary TB.

  17. The mass miniature chest radiography programme in Cape Town, South Africa, 1948-1994: The impact of active tuberculosis case finding

    NARCIS (Netherlands)

    Hermans, S. M.; Andrews, J. R.; Bekker, L.-G.; Wood, R.

    2016-01-01

    Tuberculosis (TB) control programmes rely mainly on passive detection of symptomatic individuals. The resurgence of TB has rekindled interest in active case finding. Cape Town (South Africa) had a mass miniature radiography (MMR) screening programme from 1948 to 1994. To evaluate screening coverage,

  18. Altered microRNA signatures in sputum of patients with active pulmonary tuberculosis.

    Directory of Open Access Journals (Sweden)

    Zhengjun Yi

    Full Text Available Role of microRNA (miRNA has been highlighted in pathogen-host interactions recently. At present, their role in active pulmonary tuberculosis is unknown. The aim of the study was to delineate miRNA expression in sputum supernatant of patients with active pulmonary tuberculosis. Expression of miRNAs was evaluated by microarray analysis and differentially expressed miRNAs were validated by RT-qPCR. Secreted cytokines TNF-α and IL-6 were measured by ELISA. We found that 95 miRNAs were differentially expressed between tuberculosis group and controls. More miRNAs (52 out of 95 miRNAs were underexpressed than overexpressed during tuberculosis infection. Overexpression of miR-3179, miR-147 and underexpression of miR-19b-2* in TB group compared with controls were confirmed in the validation cohort. TNF-α and IL-6 levels were not significantly altered between TB group and controls. For the first time, differential expression of miRNAs in sputum was found in active pulmonary tuberculosis. The study provides rationale for identifying the role of miRNAs in the pathogenesis of pulmonary tuberculosis and indicates potential for miRNA-based therapeutic strategies.

  19. Altered microRNA signatures in sputum of patients with active pulmonary tuberculosis.

    Science.gov (United States)

    Yi, Zhengjun; Fu, Yurong; Ji, Rui; Li, Ruifang; Guan, Zhiyu

    2012-01-01

    Role of microRNA (miRNA) has been highlighted in pathogen-host interactions recently. At present, their role in active pulmonary tuberculosis is unknown. The aim of the study was to delineate miRNA expression in sputum supernatant of patients with active pulmonary tuberculosis. Expression of miRNAs was evaluated by microarray analysis and differentially expressed miRNAs were validated by RT-qPCR. Secreted cytokines TNF-α and IL-6 were measured by ELISA. We found that 95 miRNAs were differentially expressed between tuberculosis group and controls. More miRNAs (52 out of 95 miRNAs) were underexpressed than overexpressed during tuberculosis infection. Overexpression of miR-3179, miR-147 and underexpression of miR-19b-2* in TB group compared with controls were confirmed in the validation cohort. TNF-α and IL-6 levels were not significantly altered between TB group and controls. For the first time, differential expression of miRNAs in sputum was found in active pulmonary tuberculosis. The study provides rationale for identifying the role of miRNAs in the pathogenesis of pulmonary tuberculosis and indicates potential for miRNA-based therapeutic strategies.

  20. Detection of Tuberculosis Infection Hotspots Using Activity Spaces Based Spatial Approach in an Urban Tokyo, from 2003 to 2011.

    Directory of Open Access Journals (Sweden)

    Kiyohiko Izumi

    Full Text Available Identifying ongoing tuberculosis infection sites is crucial for breaking chains of transmission in tuberculosis-prevalent urban areas. Previous studies have pointed out that detection of local accumulation of tuberculosis patients based on their residential addresses may be limited by a lack of matching between residences and tuberculosis infection sites. This study aimed to identify possible tuberculosis hotspots using TB genotype clustering statuses and a concept of "activity space", a place where patients spend most of their waking hours. We further compared the spatial distribution by different residential statuses and describe urban environmental features of the detected hotspots.Culture-positive tuberculosis patients notified to Shinjuku city from 2003 to 2011 were enrolled in this case-based cross-sectional study, and their demographic and clinical information, TB genotype clustering statuses, and activity space were collected. Spatial statistics (Global Moran's I and Getis-Ord Gi* statistics identified significant hotspots in 152 census tracts, and urban environmental features and tuberculosis patients' characteristics in these hotspots were assessed.Of the enrolled 643 culture-positive tuberculosis patients, 416 (64.2% were general inhabitants, 42 (6.5% were foreign-born people, and 184 were homeless people (28.6%. The percentage of overall genotype clustering was 43.7%. Genotype-clustered general inhabitants and homeless people formed significant hotspots around a major railway station, whereas the non-clustered general inhabitants formed no hotspots. This suggested the detected hotspots of activity spaces may reflect ongoing tuberculosis transmission sites and were characterized by smaller residential floor size and a higher proportion of non-working households.Activity space-based spatial analysis suggested possible TB transmission sites around the major railway station and it can assist in further comprehension of TB transmission

  1. Detection of Tuberculosis Infection Hotspots Using Activity Spaces Based Spatial Approach in an Urban Tokyo, from 2003 to 2011.

    Science.gov (United States)

    Izumi, Kiyohiko; Ohkado, Akihiro; Uchimura, Kazuhiro; Murase, Yoshiro; Tatsumi, Yuriko; Kayebeta, Aya; Watanabe, Yu; Ishikawa, Nobukatsu

    2015-01-01

    Identifying ongoing tuberculosis infection sites is crucial for breaking chains of transmission in tuberculosis-prevalent urban areas. Previous studies have pointed out that detection of local accumulation of tuberculosis patients based on their residential addresses may be limited by a lack of matching between residences and tuberculosis infection sites. This study aimed to identify possible tuberculosis hotspots using TB genotype clustering statuses and a concept of "activity space", a place where patients spend most of their waking hours. We further compared the spatial distribution by different residential statuses and describe urban environmental features of the detected hotspots. Culture-positive tuberculosis patients notified to Shinjuku city from 2003 to 2011 were enrolled in this case-based cross-sectional study, and their demographic and clinical information, TB genotype clustering statuses, and activity space were collected. Spatial statistics (Global Moran's I and Getis-Ord Gi* statistics) identified significant hotspots in 152 census tracts, and urban environmental features and tuberculosis patients' characteristics in these hotspots were assessed. Of the enrolled 643 culture-positive tuberculosis patients, 416 (64.2%) were general inhabitants, 42 (6.5%) were foreign-born people, and 184 were homeless people (28.6%). The percentage of overall genotype clustering was 43.7%. Genotype-clustered general inhabitants and homeless people formed significant hotspots around a major railway station, whereas the non-clustered general inhabitants formed no hotspots. This suggested the detected hotspots of activity spaces may reflect ongoing tuberculosis transmission sites and were characterized by smaller residential floor size and a higher proportion of non-working households. Activity space-based spatial analysis suggested possible TB transmission sites around the major railway station and it can assist in further comprehension of TB transmission dynamics in an

  2. TB truths : Patients’ experience with tuberculosis and healthcare in sub-Saharan Africa

    NARCIS (Netherlands)

    Cremers, A.L.

    2018-01-01

    TB remains one of the most alarming global health threats of this age. Despite the often available TB medication for free, rates are not being significantly reduced or in some areas even going up. TB epidemiology have become more complex, due to the HIV epidemic and development of drug-resistance.

  3. One of the possible mechanisms for the inhibition effect of Tb(III) on peroxidase activity in horseradish (Armoracia rusticana) treated with Tb(III).

    Science.gov (United States)

    Guo, Shaofen; Cao, Rui; Lu, Aihua; Zhou, Qing; Lu, Tianhong; Ding, Xiaolan; Li, Chaojun; Huang, Xiaohua

    2008-05-01

    One of the possible mechanisms for the inhibition effect of Tb(III) on peroxidase activity in horseradish (Armoracia rusticana) treated with Tb(III) was investigated using some biophysical and biochemical methods. Firstly, it was found that a large amount of Tb(III) can be distributed on the cell wall, that some Tb(III) can enter into the horseradish cell, indicating that peroxidase was mainly distributed on cell wall, and thus that Tb(III) would interact with horseradish peroxidase (HRP) in the plant. In addition, peroxidase bioactivity was decreased in the presence of Tb(III). Secondly, a new peroxidase-containing Tb(III) complex (Tb-HRP) was obtained from horseradish after treatment with Tb(III); the molecular mass of Tb-HRP is near 44 kDa and the pI is about 8.80. Thirdly, the electrocatalytic activity of Tb-HRP is much lower than that of HRP obtained from horseradish without treatment with Tb(III). The decrease in the activity of Tb-HRP is due to the destruction (unfolding) of the conformation in Tb-HRP. The planarity of the heme active center in the Tb-HRP molecule was increased and the extent of exposure of Fe(III) in heme was decreased, leading to inhibition of the electron transfer. The microstructure change in Tb-HRP might be the result of the inhibition effect of Tb(III) on peroxidase activity in horseradish.

  4. Impaired CXCR1-dependent oxidative defence in active tuberculosis patients.

    Science.gov (United States)

    Alaridah, Nader; Winqvist, Niclas; Håkansson, Gisela; Tenland, Erik; Rönnholm, Anna; Sturegård, Erik; Björkman, Per; Godaly, Gabriela

    2015-12-01

    Much of the pronounced host inflammatory response that occurs in tuberculosis (TB) is related to failed immunity against the invading pathogen. The G-protein coupled receptors CXCR1 and CXCR2 are implicated in important signal transduction pathways in lung inflammatory responses. We investigated the expression and function of these receptors in a simple whole blood model from 24 patients with pulmonary TB and in subjects with latent TB infection (LTBI). Healthy controls were recruited from close contacts to the pulmonary index patients. We found that pulmonary TB patients had significantly increased CXCR1 expression on blood cells compared to LTBI subjects and controls (p microRNA-223 was increased in pulmonary TB patients compared to LTBI (p tuberculosis (Mtb). Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  5. Antigen induced production of υ-interferon ex vivo, in the peripheral blood of patients with active pulmonary tuberculosis

    Directory of Open Access Journals (Sweden)

    Z. M. Zagdyn

    2013-01-01

    Full Text Available Tuberculosis (TB is one of the most significant problems in the Russian Health Care. Russia remains on the list of the 22 countries with a high TB incidence and on the third place in the world with a high prevalence of Drug Resistant TB [1]. It is urgently needed to develop new TB diagnostic methods as well as effective measures of the specific TB prevention, including a development of the novel vaccines, so we have to know better about the most immunogenic antigens of Mycobacterium Tuberculosis. We studied the Interferon-Q production in the whole blood after stimulating immune response with different proteins of Mycobacterium Tuberculosis in patients with active TB. The study results permitted us to evaluate the immunogenicity of the previously known proteins (Ag85a и ESAT-6 in comparison to the recently identified ones (Rv2957, Rv2958c и Rv0447, analyzing simultaneously their relation to tuberculin, as well as to antigens of the different viruses (Human Immunodeficiency Virus, Cytomegalovirus, Epstein-Barr Virus, Influenza Virus. Protein Rv2958c, unlike protein ESAT-6, showed the high immunogenicity in comparison to tuberculin. The expressed immunogenicity of protein Rv2958c might be indicated a possible greatest specificity of immune response to this antigen in TB patients. Meanwhile, bacillary tuberculosis was strongly associated with low immune response to this protein. Also we were found statistical differences in immune responses of patients to the different Mycobacterium Tuberculosis antigens depending on the drug sensitivity. In addition it was interesting to know about a significantly low immune response of patients with Drug Resistant TB to protein pp65 CMV.

  6. Global Tuberculosis Report 2016

    Science.gov (United States)

    ... Alt+0 Navigation Alt+1 Content Alt+2 Tuberculosis (TB) Menu Tuberculosis Data and statistics Regional Framework Resources Meetings and events Global tuberculosis report 2017 WHO has published a global TB ...

  7. Sputum is a surrogate for bronchoalveolar lavage for monitoring Mycobacterium tuberculosis transcriptional profiles in TB patients.

    Science.gov (United States)

    Garcia, Benjamin J; Loxton, Andre G; Dolganov, Gregory M; Van, Tran T; Davis, J Lucian; de Jong, Bouke C; Voskuil, Martin I; Leach, Sonia M; Schoolnik, Gary K; Walzl, Gerhard; Strong, Michael; Walter, Nicholas D

    2016-09-01

    Pathogen-targeted transcriptional profiling in human sputum may elucidate the physiologic state of Mycobacterium tuberculosis (M. tuberculosis) during infection and treatment. However, whether M. tuberculosis transcription in sputum recapitulates transcription in the lung is uncertain. We therefore compared M. tuberculosis transcription in human sputum and bronchoalveolar lavage (BAL) samples from 11 HIV-negative South African patients with pulmonary tuberculosis. We additionally compared these clinical samples with in vitro log phase aerobic growth and hypoxic non-replicating persistence (NRP-2). Of 2179 M. tuberculosis transcripts assayed in sputum and BAL via multiplex RT-PCR, 194 (8.9%) had a p-value <0.05, but none were significant after correction for multiple testing. Categorical enrichment analysis indicated that expression of the hypoxia-responsive DosR regulon was higher in BAL than in sputum. M. tuberculosis transcription in BAL and sputum was distinct from both aerobic growth and NRP-2, with a range of 396-1020 transcripts significantly differentially expressed after multiple testing correction. Collectively, our results indicate that M. tuberculosis transcription in sputum approximates M. tuberculosis transcription in the lung. Minor differences between M. tuberculosis transcription in BAL and sputum suggested lower oxygen concentrations or higher nitric oxide concentrations in BAL. M. tuberculosis-targeted transcriptional profiling of sputa may be a powerful tool for understanding M. tuberculosis pathogenesis and monitoring treatment responses in vivo. Published by Elsevier Ltd.

  8. Evaluation of a tuberculosis active case finding project in peri-urban areas, Myanmar: 2014-2016.

    Science.gov (United States)

    Aye, Sandar; Majumdar, Suman S; Oo, Myo Minn; Tripathy, Jaya Prasad; Satyanarayana, S; Kyaw, Nang Thu Thu; Kyaw, Khine Wut Yee; Oo, Nay Lynn; Thein, Saw; Thu, Myat Kyaw; Soe, Kyaw Thu; Aung, Si Thu

    2018-05-01

    We assessed the effect of an active case finding (ACF) project on tuberculosis (TB) case notification and the yields from a household and neigbourhood intervention (screening contacts of historical index TB patients diagnosed >24months ago) and a community intervention (screening attendants of health education sessions/mobile clinics). Cross-sectional analysis of project records, township TB registers and annual TB reports. In the household and neigbourhood intervention, of 56,709 people screened, 1,076 were presumptive TB and 74 patients were treated for active TB with a screening yield of 0.1% and a yield from presumptive cases of 6.9%. In the community intervention, of 162,881 people screened, 4,497 were presumptive TB and 984 were treated for active TB with a screening yield of 0.6% and yield from presumptive cases of 21.9%. Of active TB cases, 94% were new, 89% were pulmonary, 44% were bacteriologically-confirmed and 5% had HIV. Case notification rates per 100,000 in project townships increased from 142 during baseline (2011-2013) to 148 during intervention (2014-2016) periods. The yield from household and neigbourhood intervention was lower than community intervention. This finding highlights reconsidering the strategy of screening of contacts from historical index cases. Strategies to reach high-risk groups should be explored for future ACF interventions to increase yield of TB. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  9. Epidemia de tuberculosis multidrogo resistente y extensivamente resistente a drogas (TB MDR/XDR en el Perú: situación y propuestas para su control

    Directory of Open Access Journals (Sweden)

    Hernán Del Castillo

    2009-07-01

    Full Text Available En este artículo se describe el estado actual de las epidemias de tuberculosis multidrogo resitente (TB MDR y tuberculosis extensivamente resistente a drogas (TB XDR en el Perú. Se realiza un análisis de nuestra situación con respecto al resto de Latinoamérica, y de la distribución temporo espacial de los casos de TB XDR en Lima. También presentamos nuestra reflexión de lo que está pasando y debe cambiar; lo que se resume en darle la importancia debida a un problema que nos está rebasando y anteponer a nuestros propios intereses, los intereses de la humanidad; por consiguiente no podemos callar, y debemos declarar a la tuberculosis como emergencia sanitaria nacional. Eso constituye una respuesta, esperamos, aún viable para el Perú.

  10. Economic support to patients in HIV and TB grants in rounds 7 and 10 from the global fund to fight AIDS, tuberculosis and malaria.

    Directory of Open Access Journals (Sweden)

    Linda M Richter

    Full Text Available People with TB and/or HIV frequently experience severe economic barriers to health care, including out-of-pocket expenses related to diagnosis and treatment, as well as indirect costs due to loss of income. These barriers can both aggravate economic hardship and prevent or delay diagnosis, treatment and successful outcome, leading to increased transmission, morbidity and mortality. WHO, UNAIDS and the ILO argue that economic support of various kinds is essential to enable vulnerable people to protect themselves from infection, avoid delayed diagnosis and treatment, overcome barriers to adherence, and avert destitution. This paper analyses successful country proposals to the Global Fund to Fight AIDS, Tuberculosis and Malaria that include economic support in Rounds 7 and 10; 36 and 20 HIV and TB grants in Round 7 and 32 and 26, respectively, in Round 10. Of these, up to 84 percent included direct or indirect economic support for beneficiaries, although the amount constituted a very small proportion of the total grant. In TB grants, the objectives of economic support were generally clearly stated, and focused on mechanisms to improve treatment uptake and adherence, and the case was most clearly made for MDR-TB patients. In HIV grants, the objectives were much broader in scope, including mitigation of adverse economic and social effects of HIV and its treatment on both patients and families. The analysis shows that economic support is on the radar for countries developing Global Fund proposals, and a wide range of economic support activities are in place. In order to move forward in this area, the wealth of country experience that exists needs to be collated, assessed and disseminated. In addition to trials, operational research and programme evaluations, more precise guidance to countries is needed to inform evidence-based decision about activities that are cost-effective, affordable and feasible.

  11. miR-30c is specifically repressed in patients with active pulmonary tuberculosis.

    Science.gov (United States)

    Spinelli, Silvana V; Fernández, Rocío Del V; Zoff, Luciana; Bongiovanni, Bettina; Díaz, Ariana; D'Attilio, Luciano; Santucci, Natalia; Alvarez, Tomás; Marchesini, Marcela M; Bogue, Cristina; Bay, Maria L; Bottasso, Oscar A

    2017-07-01

    Tuberculous pleurisy (PLTB) is a common form of extrapulmonary tuberculosis. It often resolves without chemotherapy being hence considered a rather benign manifestation of the disease. Patients with PLTB mount an effective anti-mycobacterial response, unlike those with active pulmonary TB (pTB) that were shown to present an imbalance in plasma immune and endocrine mediators. In this work, we explored whether expression of the active isoform of the glucocorticoid receptor (hGRα) in the context of the inflammatory-anti-inflammatory responses of TB patients may be associated to microRNA levels. As expected, the inflammatory response triggered in patients coexists with increased circulating cortisol and altered hGRα levels in the peripheral blood mononuclear cells. However, while hGRα expression is significantly downregulated in PLTB, its levels in pTB patients are higher within the control values. These results point out to the existence of an additional mechanism tending to preserve hGRα levels probably to deal with the chronic inflammation observed in pTB. In this regard, we found that miR-30c is strongly downregulated in mononuclear cells of pTB patients compared to PLTB cases, showing an expression profile opposite to that seen with hGRα. Interestingly, low levels of miR-30c are specific for this active form of TB, as its expression is not altered in mononuclear cells from either healthy controls or patients with tuberculous or non-tuberculous pleurisy. Moreover, miR-30c and hGRα also showed an inverse expression pattern in M. tuberculosis-stimulated THP-1 macrophage cultures. In sum, our studies identify miR-30c as a specific correlate of pulmonary manifestations of TB, potentially involved in the altered glucocorticoid sensitivity observed in these patients. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Transmission of Mycobacterium tuberculosis from patients who are nucleic acid amplification test- negative.

    Science.gov (United States)

    Xie, Yingda L; Cronin, Wendy A; Proschan, Michael; Oatis, Richard; Cohn, Silvia; Curry, Scott R; Golub, Jonathan E; Barry Iii, Clifton E; Dorman, Susan E

    2018-04-24

    Among adults with signs and symptoms of pulmonary tuberculosis (TB), recognition of transmissible TB has implications for airborne infection isolation and public health activities. Sputum smear-negative TB patients account for around one-fifth of tuberculosis transmission. The tuberculosis transmission risk of TB patients with negative results on nucleic acid amplification (NAA) testing of respiratory specimens has not been established. We sought to estimate the tuberculosis transmission risk of NAA test-negative TB patients. We retrospectively reviewed Maryland TB program data from 2004 to 2009 during which NAA testing by the Mycobacterium Tuberculosis Direct Test (MTD) was performed routinely. Patients with sputum Mycobacterium tuberculosis (M.tb) isolates having matching genotypes were assigned to clusters. Transmission sequence was approximated by collection order of individuals' first culture-positive specimens. Minimum transmission risks of NAA (MTD)-negative TB patients and of smear-negative TB patients were estimated based on individuals' positions within clusters. Among 809 patients with culture-confirmed TB, M.tb genotypes were available for 782 (96.7%). For NAA-negative TB patients the minimum transmission risk estimate was 5.1% (95% CI 0-11.4). For smear-negative TB patients the minimum transmission risk estimate was 11.2% (95% CI 7.2-15.3). Minimum transmission risk of NAA-negative TB patients was lower than that of smear-negative TB patients. However, transmission risk of NAA-negative TB patients appears to not be negligible.

  13. 'Team up against TB': promoting involvement in Thibela TB, a trial of community-wide tuberculosis preventive therapy.

    Science.gov (United States)

    Grant, Alison D; Coetzee, Leonie; Fielding, Katherine L; Lewis, James J; Ntshele, Smanga; Luttig, Mariëtha M; Mngadi, Kathryn T; Muller, Dorothy; Popane, Flora; Mdluli, John; Mngadi, Nkosinathi; Sefuthi, Clement; Clark, David A; Churchyard, Gavin

    2010-11-01

    To describe a programme of community education and mobilization to promote uptake in a cluster-randomized trial of tuberculosis preventive therapy offered to all members of intervention clusters. Gold mines in South Africa, where tuberculosis incidence is extremely high, despite conventional control measures. All employees in intervention clusters (mine shaft and associated hostel) were invited to enrol. Cumulative enrolment in the study in intervention clusters. Key steps in communicating information relevant to the study included extensive consultation with key stakeholders; working with a communication company to develop a project 'brand'; developing a communication strategy tailored to each intervention site; and involving actors from a popular television comedy series to help inform communities about the study. One-to-one communications used peer educators along with study staff, and participant advisory groups facilitated two-way communication between study staff and participants. By contrast, treatment 'buddies' and text messaging to promote adherence proved less successful. Mean cumulative enrolment in the first four intervention clusters was 61.9%, increasing to 83.0% in the final four clusters. A tailored communication strategy can facilitate a high level of enrolment in a community health intervention.

  14. Purity-activity relationships of natural products: the case of anti-TB active ursolic acid.

    Science.gov (United States)

    Jaki, Birgit U; Franzblau, Scott G; Chadwick, Lucas R; Lankin, David C; Zhang, Fangqiu; Wang, Yuehong; Pauli, Guido F

    2008-10-01

    The present study explores the variability of biological responses from the perspective of sample purity and introduces the concept of purity-activity relationships (PARs) in natural product research. The abundant plant triterpene ursolic acid (1) was selected as an exemplary natural product due to the overwhelming number yet inconsistent nature of its approximate 120 reported biological activities, which include anti-TB potential. Nine different samples of ursolic acid with purity certifications were obtained, and their purity was independently assessed by means of quantitative 1H NMR (qHNMR). Biological evaluation consisted of determining MICs against two strains of virulent Mycobacterium tuberculosis and IC50 values in Vero cells. Ab initio structure elucidation provided unequivocal structural confirmation and included an extensive 1H NMR spin system analysis, determination of nearly all J couplings and the complete NOE pattern, and led to the revision of earlier reports. As a net result, a sigmoid PAR profile of 1 was obtained, demonstrating the inverse correlation of purity and anti-TB bioactivity. The results imply that synergistic effects of 1 and its varying impurities are the likely cause of previously reported antimycobacterial potential. Generating PARs is a powerful extension of the routinely performed quantitative correlation of structure and activity ([Q]SAR). Advanced by the use of primary analytical methods such as qHNMR, PARs enable the elucidation of cases like 1 when increasing purity voids biological activity. This underlines the potential of PARs as a tool in drug discovery and synergy research and accentuates the need to routinely combine biological testing with purity assessment.

  15. Evaluation of immune responses in HIV infected patients with pleural tuberculosis by the QuantiFERON® TB-Gold interferon-gamma assay

    Directory of Open Access Journals (Sweden)

    Lekabe Jacob M

    2008-03-01

    Full Text Available Abstract Background Diagnosis of tuberculous (TB pleuritis is difficult and better diagnostic tools are needed. New blood based interferon-gamma (IFN-γ tests are promising, but sensitivity could be low in HIV positive patients. The IFN-γ tests have not yet been validated for use in pleural fluid, a compartment with higher level of immune activation than in blood. Methods The QuantiFERON TB®-Gold (QFT-TB test was analysed in blood and pleural fluid from 34 patients presenting with clinically suspected pleural TB. Clinical data, HIV status and CD4 cell counts were recorded. Adenosine deaminase activity (ADA analysis and TB culture were performed on pleural fluid. Results The patients were categorised as 'confirmed TB' (n = 12, 'probable TB' (n = 16 and 'non-TB' pleuritis (n = 6 based on TB culture results and clinical and biochemical criteria. The majority of the TB patients were HIV infected (82%. The QFT-TB in pleural fluid was positive in 27% and 56% of the 'confirmed TB' and 'probable TB' cases, respectively, whereas the corresponding sensitivities in blood were 58% and 83%. Indeterminate results in blood (25% were caused by low phytohemagglutinin (PHA = positive control IFN-γ responses, significantly lower in the TB patients as compared to the 'non-TB' cases (p = 0.02. Blood PHA responses correlated with CD4 cell count (r = 0.600, p = 0.028. In contrast, in pleural fluid indeterminate results (52% were caused by high Nil (negative control IFN-γ responses in both TB groups. Still, the Nil IFN-γ responses were lower than the TB antigen responses (p Conclusion The QFT-TB test in blood could contribute to the diagnosis of TB pleuritis in the HIV positive population. Still, the number of inconclusive results is too high to recommend the commercial QFT-TB test for routine use in pleural fluid in a TB/HIV endemic resource-limited setting.

  16. Genome-Based In Silico Identification of New Mycobacterium tuberculosis Antigens Activating Polyfunctional CD8+ T Cells in Human Tuberculosis

    DEFF Research Database (Denmark)

    Tang, Sheila Tuyet; van Meijgaarden, Krista E.; Caccamo, Nadia

    2011-01-01

    8(+) T cell proliferation assays (CFSE dilution) in 41 M. tuberculosis-responsive donors identified 70 new M. tuberculosis epitopes. Using HLA/peptide tetramers for the 18 most prominently recognized HLA-A*0201-binding M. tuberculosis peptides, recognition by cured TB patients' CD8(+) T cells......-epitope/Ag repertoire for human CD8(+) T cells is much broader than hitherto suspected, and the newly identified M. tuberculosis Ags are recognized by (poly) functional CD8(+) T cells during control of infection. These results impact on TB-vaccine design and biomarker identification. The Journal of Immunology, 2011...

  17. Clonal expansion across the seas as seen through CPLP-TB database: A joint effort in cataloguing Mycobacterium tuberculosis genetic diversity in Portuguese-speaking countries

    KAUST Repository

    Perdigão, João

    2018-03-18

    Tuberculosis (TB) remains a major health problem within the Community of Portuguese Language Speaking Countries (CPLP). Despite the marked variation in TB incidence across its member-states and continued human migratory flux between countries, a considerable gap in the knowledge on the Mycobacterium tuberculosis population structure and strain circulation between the countries still exists. To address this, we have assembled and analysed the largest CPLP M. tuberculosis molecular and drug susceptibility dataset, comprised by a total of 1447 clinical isolates, including 423 multidrug-resistant isolates, from five CPLP countries. The data herein presented reinforces Latin American and Mediterranean (LAM) strains as the hallmark of M. tuberculosis populational structure in the CPLP coupled with country-specific differential prevalence of minor clades. Moreover, using high-resolution typing by 24-loci MIRU-VNTR, six cross-border genetic clusters were detected, thus supporting recent clonal expansion across the Lusophone space.To make this data available to the scientific community and public health authorities we developed CPLP-TB (available at http://cplp-tb.ff.ulisboa.pt), an online database coupled with web-based tools for exploratory data analysis. As a public health tool, it is expected to contribute to improved knowledge on the M. tuberculosis population structure and strain circulation within the CPLP, thus supporting the risk assessment of strain-specific trends.

  18. Clonal expansion across the seas as seen through CPLP-TB database: A joint effort in cataloguing Mycobacterium tuberculosis genetic diversity in Portuguese-speaking countries

    KAUST Repository

    Perdigã o, Joã o; Silva, Carla; Diniz, Jaciara; Pereira, Catarina; Machado, Diana; Ramos, Jorge; Silva, Hugo; Abilleira, Fernanda; Brum, Clarice; Reis, Ana J.; Macedo, Maí ra; Scaini, Joã o L.; Silva, Ana B.; Esteves, Leonardo; Macedo, Rita; Maltez, Fernando; Clemente, Sofia; Coelho, Elizabeth; Viegas, Sofia; Rabna, Paulo; Rodrigues, Amabé lia; Taveira, Nuno; Jordao, Luí sa; Kritski, Afrâ nio; e Silva, José Lapa; Mokrousov, Igor; Couvin, David; Rastogi, Nalin; Couto, Isabel; Pain, Arnab; McNerney, Ruth; Clark, Taane G.; von Groll, Andrea; Dalla-Costa, Elis R.; Rossetti, Maria Lú cia; da Silva, Pedro E.A.; Viveiros, Miguel; Portugal, Isabel

    2018-01-01

    Tuberculosis (TB) remains a major health problem within the Community of Portuguese Language Speaking Countries (CPLP). Despite the marked variation in TB incidence across its member-states and continued human migratory flux between countries, a considerable gap in the knowledge on the Mycobacterium tuberculosis population structure and strain circulation between the countries still exists. To address this, we have assembled and analysed the largest CPLP M. tuberculosis molecular and drug susceptibility dataset, comprised by a total of 1447 clinical isolates, including 423 multidrug-resistant isolates, from five CPLP countries. The data herein presented reinforces Latin American and Mediterranean (LAM) strains as the hallmark of M. tuberculosis populational structure in the CPLP coupled with country-specific differential prevalence of minor clades. Moreover, using high-resolution typing by 24-loci MIRU-VNTR, six cross-border genetic clusters were detected, thus supporting recent clonal expansion across the Lusophone space.To make this data available to the scientific community and public health authorities we developed CPLP-TB (available at http://cplp-tb.ff.ulisboa.pt), an online database coupled with web-based tools for exploratory data analysis. As a public health tool, it is expected to contribute to improved knowledge on the M. tuberculosis population structure and strain circulation within the CPLP, thus supporting the risk assessment of strain-specific trends.

  19. Chronic destructive pulmonary tuberculosis: assessment of disease activity by computed tomography

    Energy Technology Data Exchange (ETDEWEB)

    Nam, Kyung Jin; Jeong, Yeon Joo [Dept. of Radiology, Pusan National Univ. Hospital, Pusan National Univ. School of Medicine and Medical Research Inst., Pusan (Korea, Republic of)], E-mail: jeongyj@pusan.ac.kr; Kim, Yeong Dae; I, Hoseok [Thoracic and Cardiovascular Surgery, Pusan National Univ. Hospital, Pusan National Univ. School of Medicine and Medical Research Inst., Pusan (Korea, Republic of); Kim, Kun-Il; Lee, Jun Woo [Dept. of Radiology, Pusan National Univ. Yangsan Hospital, Pusan National Univ. School of Medicine, Pusan (Korea, Republic of); Park, Hye Kyung [Internal Medicine, and Pusan National Univ. Hospital, Pusan National Univ. School of Medicine and Medical Research Inst., Pusan (Korea, Republic of)

    2012-11-15

    Background Determination of disease activity of chronic destructive pulmonary tuberculosis (TB) on imaging studies can be difficult because several imaging findings due to disease chronicity such as a residual cavity can be misinterpreted as an active disease. Purpose To evaluate computed tomography (CT) findings to predict active disease in patients with chronic destructive pulmonary TB. Material and Methods CT findings of 36 patients with chronic active destructive pulmonary TB and 78 patients with chronic inactive destructive pulmonary TB were reviewed and their patterns of lung lesions were compared. Statistical comparisons were performed using chi-square and Student's T tests for univariate analyses, and a stepwise logistic regression method was used for multivariate analysis. Results Based on univariate analyses, cavitary destruction (P = 0.015), non-branching centrilobular nodules (P < 0.001), tree-in-bud pattern (P < 0.001), airspace nodules (P < 0.001), and cavities in other lobes (P = 0.001) were more frequently seen in chronic active destructive pulmonary TB. A stepwise logistic regression analysis demonstrated that tree-in-bud pattern (odds ratio, 52.3; 95% confidence interval, 6.2-437.2; P < 0.001) were significant CT findings associated with active disease. Conclusion Tree-in-bud pattern were the most characteristic CT findings to predict active disease in patients with chronic destructive pulmonary TB.

  20. Current integration of tuberculosis (TB and HIV services in South Africa, 2011.

    Directory of Open Access Journals (Sweden)

    Joel C Chehab

    Full Text Available SETTING: Public Health Facilities in South Africa. OBJECTIVE: To assess the current integration of TB and HIV services in South Africa, 2011. DESIGN: Cross-sectional study of 49 randomly selected health facilities in South Africa. Trained interviewers administered a standardized questionnaire to one staff member responsible for TB and HIV in each facility on aspects of TB/HIV policy, integration and recording and reporting. We calculated and compared descriptive statistics by province and facility type. RESULTS: Of the 49 health facilities 35 (71% provided isoniazid preventive therapy (IPT and 35 (71% offered antiretroviral therapy (ART. Among assessed sites in February 2011, 2,512 patients were newly diagnosed with HIV infection, of whom 1,913 (76% were screened for TB symptoms, and 616 of 1,332 (46% of those screened negative for TB were initiated on IPT. Of 1,072 patients newly registered with TB in February 2011, 144 (13% were already on ART prior to Tb clinical diagnosis, and 451 (42% were newly diagnosed with HIV infection. Of those, 84 (19% were initiated on ART. Primary health clinics were less likely to offer ART compared to district hospitals or community health centers (p<0.001. CONCLUSION: As of February 2011, integration of TB and HIV services is taking place in public medical facilities in South Africa. Among these services, IPT in people living with HIV and ART in TB patients are the least available.

  1. Predictors of tuberculosis (TB) and antiretroviral (ARV) medication non-adherence in public primary care patients in South Africa: a cross sectional study.

    Science.gov (United States)

    Naidoo, Pamela; Peltzer, Karl; Louw, Julia; Matseke, Gladys; McHunu, Gugu; Tutshana, Bomkazi

    2013-04-26

    Despite the downward trend in the absolute number of tuberculosis (TB) cases since 2006 and the fall in the incidence rates since 2001, the burden of disease caused by TB remains a global health challenge. The co-infection between TB and HIV adds to this disease burden. TB is completely curable through the intake of a strict anti-TB drug treatment regimen which requires an extremely high and consistent level of adherence.The aim of this study was to investigate factors associated with adherence to anti-TB and HIV treatment drugs. A cross-sectional survey method was used. Three study districts (14 primary health care facilities in each) were selected on the basis of the highest TB caseload per clinic. All new TB and new TB retreatment patients were consecutively screened within one month of anti-tuberculosis treatment. The sample comprised of 3107 TB patients who had been on treatment for at least three weeks and a sub-sample of the total sample were on both anti-TB treatment and anti-retro-viral therapy(ART) (N = 757). Data collection tools included: a Socio-Demographic Questionnaire; a Post-Traumatic-Stress-Disorder (PTSD) Screen; a Psychological Distress Scale; the Alcohol Use Disorder Identification Test (AUDIT); and self-report measures of tobacco use, perceived health status and adherence to anti-TB drugs and ART. The majority of the participants (N = 3107) were new TB cases with a 55.9% HIV co-infection rate in this adult male and female sample 18 years and older. Significant predictors of non-adherence common to both anti-TB drugs and to dual therapy (ART and anti-TB drugs) included poverty, having one or more co-morbid health condition, being a high risk for alcohol mis-use and a partner who is HIV positive. An additional predictor for non-adherence to anti-TB drugs was tobacco use. A comprehensive treatment programme addressing poverty, alcohol mis-use, tobacco use and psycho-social counseling is indicated for TB patients (with and without HIV

  2. Plants and Fungal Products with Activity Against Tuberculosis

    Directory of Open Access Journals (Sweden)

    Marcus Vinicius Nora De Souza

    2005-01-01

    Full Text Available Tuberculosis (TB is becoming an ever more serious worldwide problem. This contagious disease kills four people every minute somewhere in the world and accounts for more than 2 million deaths per year. Due to the rapid spread of TB strains resistant to all the major anti-TB drugs on the market, and the association of TB with human immunodeficiency virus (HIV infection in AIDS, we urgently need to develop new drugs to fight against TB. In this context, due to the importance of nature in the development of new drugs, the aim of the present review is to highlight a series of new and promising anti-TB agents derived from plants and fungi discovered between 2001 and 2005.

  3. Factors Associated with Prevalent Tuberculosis Among Patients ...

    African Journals Online (AJOL)

    Background: Tuberculosis (TB) causes significant morbidity/mortality among human immunodeficiency virus‑infected individuals in Africa. Reducing TB burden in the era of highly active antiretroviral therapy (HAART) is a public health priority. Aim: We determined the factors associated with prevalent TB among patients ...

  4. Active tuberculosis among homeless persons, Toronto, Ontario, Canada, 1998-2007.

    Science.gov (United States)

    Khan, Kamran; Rea, Elizabeth; McDermaid, Cameron; Stuart, Rebecca; Chambers, Catharine; Wang, Jun; Chan, Angie; Gardam, Michael; Jamieson, Frances; Yang, Jae; Hwang, Stephen W

    2011-03-01

    While tuberculosis (TB) in Canadian cities is increasingly affecting foreign-born persons, homeless persons remain at high risk. To assess trends in TB, we studied all homeless persons in Toronto who had a diagnosis of active TB during 1998-2007. We compared Canada-born and foreign-born homeless persons and assessed changes over time. We identified 91 homeless persons with active TB; they typically had highly contagious, advanced disease, and 19% died within 12 months of diagnosis. The proportion of homeless persons who were foreign-born increased from 24% in 1998-2002 to 39% in 2003-2007. Among foreign-born homeless persons with TB, 56% of infections were caused by strains not known to circulate among homeless persons in Toronto. Only 2% of infections were resistant to first-line TB medications. The rise in foreign-born homeless persons with TB strains likely acquired overseas suggests that the risk for drug-resistant strains entering the homeless shelter system may be escalating.

  5. Cloning and expression of pab gene of M. tuberculosis isolated from pulmonary TB patient in E.coli DH5α

    Directory of Open Access Journals (Sweden)

    Tri Y. M. Raras

    2011-11-01

    Full Text Available Background: Mycobacterium tuberculosis antigen38 is a potent serodiagnostic agent containing two M. tuberculosisspecific B-cell epitopes. The high price of imported diagnostic agents hinders realization of fast clinical TB diagnosis in developing countries. Therefore, we produced recombinant antigen38 (recAg38M from M. tuberculosis local strain, which might be used to produce economical tuberculosis serodiagnostic kit.Methods: Pab gene that was isolated from pulmonary TB patient in Malang was cloned into a plasmid vector (pGEMTeasy to construct pMB38. The E.coli DH5α clone carrying pMb38 was selected on X-gal medium. The expression of pab was mediated using pPRoExHTc under the control of Trc promoter and E.coli DH5α as host.Results: Alignment of the pab sequence from the white E.coli DH5α clones with that of M. tuberculosis H37Rv showed 98% homology. The recombinant protein in which the signal peptide has been deleted to prevent the protein being secreted into medium was found in the cytoplasm.Conclusion: pab gene of M. tuberculosis isolated from a TB patient could be expressed in heterologous system in E.coliDH5α. (Med J Indones 2011; 20:247-54Keywords: Mycobacterium tuberculosis, Pab gene expression, recombinant antigen38

  6. High utility of active tuberculosis case finding in an Ethiopian prison.

    Science.gov (United States)

    Merid, Y; Woldeamanuel, Y; Abebe, M; Datiko, D G; Hailu, T; Habtamu, G; Assefa, G; Kempker, R R; Blumberg, H M; Aseffa, A

    2018-05-01

    Hawassa Prison, Southern Region of Ethiopia. To determine the burden of pulmonary tuberculosis (TB) using active case finding among prisoners. In this cross-sectional study, prisoners were screened for TB using a symptom screen. Those with cough of 2 weeks had spot and morning sputum samples collected for acid-fast bacilli (AFB) smear microscopy and molecular diagnostic testing (Xpert® MTB/RIF). Among 2068 prisoners, 372 (18%) had a positive cough screen. The median age of these 372 persons was 23 years, 97% were male and 63% were from urban areas. Among those with a positive symptom screen, 8 (2%) were AFB sputum smear-positive and 31 (8%) were Xpert-positive. The point prevalence of pulmonary TB at the prison was 1748 per 100 000 persons. In multivariate analysis, persons with cough >4 weeks were more likely to have TB (OR 3.34, 95%CI 1.54-7.23). A high prevalence of TB was detected among inmates at a large Ethiopian prison. Active case finding using a cough symptom screen in combination with Xpert had high utility, and has the potential to interrupt transmission of Mycobacterium tuberculosis in correctional facilities in low- and middle-income, high-burden countries.

  7. Over-expression of thymosin β4 in granulomatous lung tissue with active pulmonary tuberculosis.

    Science.gov (United States)

    Kang, Yun-Jeong; Jo, Jin-Ok; Ock, Mee Sun; Yoo, Young-Bin; Chun, Bong-Kwon; Oak, Chul-Ho; Cha, Hee-Jae

    2014-05-01

    Recent studies have shown that thymosin β4 (Tβ4) stimulates angiogenesis by inducing vascular endothelial growth factor (VEGF) expression and stabilizing hypoxia inducible factor-1α (HIF-1α) protein. Pulmonary tuberculosis (TB), a type of granulomatous disease, is accompanied by intense angiogenesis and VEGF levels have been reported to be elevated in serum or tissue inflamed by pulmonary tuberculosis. We investigated the expression of Tβ4 in granulomatous lung tissues at various stages of active pulmonary tuberculosis, and we also examined the expression patterns of VEGF and HIF-1α to compare their Tβ4 expression patterns in patients' tissues and in the tissue microarray of TB patients. Tβ4 was highly expressed in both granulomas and surrounding lymphocytes in nascent granulomatous lung tissue, but was expressed only surrounding tissues of necrotic or caseous necrotic regions. The expression pattern of HIF-1α was similar to that of Tβ4. VEGF was expressed in both granulomas and blood vessels surrounding granulomas. The expression pattern of VEGF co-localized with CD31 (platelet endothelial cell adhesion molecule, PECAM-1), a blood endothelial cell marker, and partially co-localized with Tβ4. However, the expression of Tβ4 did not co-localize with alveolar macrophages. Stained alveolar macrophages were present surrounding regions of granuloma highly expressing Tβ4. We also analyzed mRNA expression in the sputum of 10 normal and 19 pulmonary TB patients. Expression of Tβ4 was significantly higher in patients with pulmonary tuberculosis than in normal controls. These data suggest that Tβ4 is highly expressed in granulomatous lung tissue with active pulmonary TB and is associated with HIF-1α- and VEGF-mediated inflammation and angiogenesis. Furthermore, the expression of Tβ4 in the sputum of pulmonary tuberculosis patients can be used as a potential marker for diagnosis. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. [Clinical evaluation on causes of death in patients with active pulmonary tuberculosis].

    Science.gov (United States)

    Kuba, M; Nakasone, K; Miyagi, S; Kyan, K; Shinzato, T; Kohagura, N; Futenma, M; Genka, K

    1996-04-01

    Seventy one patients with active pulmonary tuberculosis who died during the past 5 years (1989 to 1993) were evaluated on their causes of death. Twenty two patients (31%) died directly of tuberculosis, and among them, 18 patients (81%) of 22 patients who died of tuberculosis) had very advanced tuberculosis. The majority of them (64%) were old age over 70 years and were bedridden due mostly to cerebrovascular injuries. The serum level of albumin was low in all 17 patients in whom it was measured. Establishment of diagnosis of tuberculosis was delayed over one month after the onset of symptoms in 59% of patients who died of severe disease. Sixty one percent (11/18) of patients died within the first month after the initiation of chemotherapy and about 90% (16/18) died within 3 months. Two patients died from massive hemoptysis and other patients died of either respiratory failure or tuberculosis meningitis. From these observations it was found that very advanced tuberculosis was the major cause of death in patients who died of tuberculosis and that the advanced disease was chiefly caused by the delay on the establishment of diagnosis, and it was most important to detect tuberculosis as early as possible, with regular check up of chest X-ray and frequent examination for AFB (acid-fast bacilli) for tuberculosis suspected patients. On the other hand, the majority of patients (49/71) died of complicating medical problem unrelated to tuberculosis. Seventeen patients died from malignancy (seven lung cancer, four lymphoma, two laryngeal cancer, etc). Ten deaths were the result of bacterial superinfection. Other patients died from respiratory failure due to COPD, arteiosclerotic heart disease, or cerebrovascular injuries, etc. Two patients of old age died of hepatic failure possibly caused by adverse reaction of TB chemotherapy. It was found that diseases unrelated to tuberculosis were the cause of death in approximately 70% of patients with active tuberculosis, and it should

  9. Involvement of CD244 in regulating CD4+ T cell immunity in patients with active tuberculosis.

    Directory of Open Access Journals (Sweden)

    Bingfen Yang

    Full Text Available CD244 (2B4 is a member of the signaling lymphocyte activation molecule (SLAM family of immune cell receptors and it plays an important role in modulating NK cell and CD8(+ T cell immunity. In this study, we investigated the expression and function of CD244/2B4 on CD4(+ T cells from active TB patients and latent infection individuals. Active TB patients had significantly elevated CD244/2B4 expression on M. tuberculosis antigen-specific CD4(+ T cells compared with latent infection individuals. The frequencies of CD244/2B4-expressing antigen-specific CD4(+ T cells were significantly higher in retreatment active TB patients than in new active TB patients. Compared with CD244/2B4-dull and -middle CD4(+ T cells, CD244/2B4-bright CD4(+ T cell subset had significantly reduced expression of IFN-γ, suggesting that CD244/2B4 expression may modulate IFN-γ production in M. tuberculosis antigen-responsive CD4(+ T cells. Activation of CD244/2B4 signaling by cross-linking led to significantly decreased production of IFN-γ. Blockage of CD244/2B4 signaling pathway of T cells from patients with active TB resulted in significantly increased production of IFN-γ, compared with isotype antibody control. In conclusion, CD244/2B4 signaling pathway has an inhibitory role on M. tuberculosis antigen-specific CD4(+ T cell function.

  10. Clinical presentation, demographics and outcome of Tuberculosis (TB in a low incidence area: a 4-year study in Geneva, Switzerland

    Directory of Open Access Journals (Sweden)

    Rochat Thierry

    2009-12-01

    Full Text Available Abstract Background The incidence of tuberculosis (TB in developed countries has decreased since the 1990s, reflecting worldwide efforts to identify and treat TB according to WHO recommendations. However TB remains an important public health problem in industrialized countries with a high proportion of cases occurring among subjects originating from high prevalence countries. The aim of this study was to describe clinical and social characteristics of patients with TB and their outcome in a low incidence area with a high immigration rate. Methods Four-year retrospective study based on a computerized database and subsequent review of medical records of all patients with TB followed at the outpatient section of the Division of Pulmonary Diseases, Geneva University Hospital, Switzerland. Results 252 patients (84% foreigners, 25% asylum seekers aged 38 ± 19 yrs were studied (11% co-infected with HIV. TB was intrapulmonary (TBP in 158 cases (63%, extrapulmonary (TBE in 137 (54%, and both in 43 cases (17%. TBP was smear (S+/culture (C+ in 59%, S-/C+ in 37%, S-/C- in 4%. Smoking was significantly associated with cavitary disease. Time from onset of symptoms to diagnosis was 2.1 ± 3.1 months. Initially, 10% were asymptomatic; 35% had no general symptoms. Despite systematic sputum analysis (induced or spontaneous, TBP was confirmed only by bronchoscopy in 38 subjects (24% of TBP. Side effects requiring changes in treatment occurred in 38 cases (11%. Treatment was completed in 210 (83% patients. In 42 cases, follow up was unsuccessful; causes were: failure (n = 2; 0.8%, defaulters (n = 8; 3%, transfer out (n = 28; 11% and death (n = 4; 1.6%. Relapse rate was 0.24 per 100 patient-years. Considering S+ TBP only, success rate was 87%. Conclusion TB in our area is predominantly a disease of young foreign-born subjects. Smoking appears as a possible risk factor for cavitary TBP. Time to diagnosis remains long. Compliance to treatment is satisfactory. Success

  11. Stereochemical Analysis of Leubethanol, an Anti-TB Active Serrulatane, from Leucophyllum frutescens

    Science.gov (United States)

    Molina-Salinas, Gloria M.; Rivas-Galindo, Verónica M.; Said-Fernández, Salvador; Lankin, David C.; Muñoz, Marcelo A.; Joseph-Nathan, Pedro; Pauli, Guido F.; Waksman, Noemí

    2013-01-01

    Bioactivity-guided fractionation of the methanolic root bark extract of Leucophyllum frutescens (Berl.) I.M. Johnst. led to the identification of leubethanol (1), a new serrulatane-type diterpene with activity against both multi drug-resistant and drug-sensitive strains of virulent Mycobacterium tuberculosis. Leubethanol (1) was identified by 1D/2D NMR data, as a serrulatane closely related to erogorgiane (2), and exhibited anti-TB activity with minimum inhibitory concentrations in the range 6.25–12.50 µg/mL. Stereochemical evidence for 1 was gleaned from 1D and 2D NOE experiments, 1H-NMR full spin analysis, as well as by comparison of the experimental vibrational circular dichroism (VCD) spectrum to density functional theory calculated VCD spectra of two diastereomers. PMID:21859082

  12. Investigation of Susceptibility of Mycobacterium tuberculosis Complex Strains Isolated from Clinical Samples Against the First and Second-Line Anti-tuberculosis Drugs by the Sensititre MycoTB Plate Method

    Directory of Open Access Journals (Sweden)

    Figen KAYSERİLİ ORHAN

    2018-03-01

    Full Text Available Introduction: Phenotypic methods for drug susceptibility testing of Mycobacterium tuberculosis complex (MTC to second-line drugs are not yet standardized. The Sensititre MycoTB Plate is a microtiter plate containing lyophilized antibiotics and configured for determination of MIC to first and second-line anti-tuberculosis drugs. The purpose of this study is to detect the susceptibility rates of MTC strains isolated from patients’ specimens for first and second-line anti-tuberculosis drugs. Materials and Methods: This study included 50 MTC strains isolated from various clinical specimens. Out of the 50 strains, 38 were isolated from sputum, three from cerebrospinal fluid, three from bronchoalveolar lavage, and six from other samples in this study. The susceptibility of strains to anti-tuberculosis drugs were determined by the Sensititre MycoTB Plate Method. Thawed isolates were subcultured, and dilutions were inoculated into MycoTB wells. The results were read at days 7, 14 and 21. Results: At the end of study, out of 50 MTC isolates, 7 (14% showed resistance to Isoniazid (INH, 5 (10% to streptomycin (SM, 4 (8% to ethambutol (EMB, 4 (8% to ethionamide (ETH, 3 (6% to rifampicin (RIF, 3 (6% to rifabutin (RFB, 2 (4% to kanamycin (KAN, 2 (4% to ofloxacin (OFL, 2 (4% to P-aminosalicyclic acid (PAS, 1 (2% to moxiflocacin (MOX, and 1 (2% to cycloserine (CYC. All strains were found sensitive to amikacin while 2 strains (4% were identified as multidrug-resistant tuberculosis (MDR-TB. Thirty-five strains (70% were sensitive to all drugs. Extensively drug resistant tuberculosis (XDR-TB was not determined in this study. Conclusion: This is the first study that tests second line anti-tuberculosis drugs in our location and provides us valuable data regarding MDR-TB and XDR-TB rates. The Sensititre MycoTB Plate Method is a fast, reliable and practical method and can be used to determine the susceptibility of first and second-line anti-tuberculosis drugs.

  13. Tracking and Treating Mobile Populations. The TB Net System. Migrant Clinicians Network Monograph Series. = El Sistema de Red para la TB.

    Science.gov (United States)

    Migrant Clinicians Network, Inc., Austin, TX.

    A comprehensive tracking and referral network that helps provide continuity of care for mobile populations with active tuberculosis (TB) or TB infection is considered essential for effective treatment of TB. However, the interstate referral system that exists between state health departments has been highly inefficient for serving migrant…

  14. Surveillance, Evaluation of Programmatic Management of Drug Resistant Tuberculosis (PMDT at DR-TB Centre, NITRD, New Delhi

    Directory of Open Access Journals (Sweden)

    Preeti Padda

    2018-03-01

    Full Text Available Background: PMDT was launched in 2007 in our country but drug resistant TB remains to be a public health problem. Effective surveillance is the backbone for success of any programme and true stands for PMDT. Aim & Objectives: To identify the strengths and constraints of the surveillance evaluation system. Material & Methods: A cross sectional study was conducted in January 2015 at DR-TB Centre of NITRD, New Delhi which caters to a population of 29 lacs. PMDT surveillance system was evaluated using attributes like simplicity, data quality, acceptability, positive predictive value, representativeness and timeliness defined by CDC, USA guidelines. Relevant information was collected using data abstraction form and interview with stakeholders. Data was analysed using EpiInfo 07 version. Results: Nodal officer and District TB officer are responsible for surveillance system activities of PMDT at DR-TB centre and district level, respectively. All the reports (100% were submitted on time and all the districts were reporting to DR-TB centre. 75% of TB-HIV coordinators found reporting formats to be simple but all the quarterly reports were found to be complete. Data quality was not found to be optimal. Conclusion: Private sector needs to be taken on board as they have no to minimal involvement in PMDT. For data quality improvement time to time training of medical officers and health workers should be organized.

  15. The endothelial protein C receptor and activated protein C play a limited role in host defense during experimental tuberculosis

    NARCIS (Netherlands)

    Kager, Liesbeth M.; Roelofs, Joris J. T. H.; de Vos, Alex F.; Wieland, Catharina W.; Schouten, Marcel; Meijers, Joost C. M.; Isermann, Berend; van't Veer, Cornelis; Esmon, Charles T.; van der Poll, Tom

    2013-01-01

    The protein C (PC) system is an important regulator of both coagulation and inflammation. Activated PC (APC), together with its receptor the endothelial protein C receptor (EPCR), has anticoagulant and anti-inflammatory properties. During tuberculosis (TB), a devastating chronic pulmonary disease

  16. Short Report: Worsening and unmasking of tuberculosis in HIV-1 ...

    African Journals Online (AJOL)

    Objectives: To determine the proportion of patients developing active tuberculosis (TB) versus that of patients who experience worsening of TB, after initiating highly active anti retroviral therapy (HAART). Methods: Charts of HAART naïve patients with or without clinically active TB who consecutively commenced HAART at ...

  17. Specificity of the Tuberculin Skin Test and the T-SPOT."TB" Assay among Students in a Low-Tuberculosis Incidence Setting

    Science.gov (United States)

    Talbot, Elizabeth A.; Harland, Dawn; Wieland-Alter, Wendy; Burrer, Sherry; Adams, Lisa V.

    2012-01-01

    Objective: Interferon-[gamma] release assays (IGRAs) are an important tool for detecting latent "Mycobacterium tuberculosis" infection (LTBI). Insufficient data exist about IGRA specificity in college health centers, most of which screen students for LTBI using the tuberculin skin test (TST). Participants: Students at a low-TB incidence college…

  18. Tuberculin-Specific T Cells Are Reduced in Active Pulmonary Tuberculosis Compared to LTBI or Status Post BCG Vaccination

    Science.gov (United States)

    Streitz, Mathias; Fuhrmann, Stephan; Powell, Fiona; Quassem, Ali; Nomura, Laurel; Maecker, Holden; Martus, Peter; Volk, Hans-Dieter

    2011-01-01

    Functional characteristics of tuberculosis (TB)–specific CD4 T cells were studied in clinically active pulmonary TB (n = 21) and high TB exposure including LTBI (n = 17). Following tuberculin stimulation, activated CD4 T cells were identified by flow-cytometry (CD154 up-regulation, degranulation, interferon γ [IFN-γ], tumor necrosis factor α [TNF-α], and interleukin 2 [IL-2\\ production). Interestingly, CD154 up-regulation accounted for ∼80% of activated CD4 T cells in the active TB group but just 40% in the controls, whereas IFN-γ accounted for only ∼50% of activated cells in each group. The frequencies of CD4 T cells displaying at least 1 activation marker discriminated better between the groups than those displaying degranulation or IFN-γ production alone. PMID:21186260

  19. [Morphological signs of inflammatory activity in different clinical forms of drug-resistant pulmonary tuberculosis].

    Science.gov (United States)

    Elipashev, A A; Nikolsky, V O; Shprykov, A S

    to determine whether the activity of tuberculous inflammation is associated with different clinical forms of drug-resistant pulmonary tuberculosis. The material taken from 310 patients operated on in 2010-2015 were retrospectively examined. The patients underwent economical lung resections of limited extent (typical and atypical ones of up to 3 segments) for circumscribed forms of tuberculosis with bacterial excretion. A study group consisted of 161 (51.9%) patients with drug-resistant variants of pulmonary tuberculosis. A control group included 149 (48.1%) patients with preserved susceptibility of Mycobacterium tuberculosis to anti-TB drugs. The activity of specific changes in tuberculosis was morphologically evaluated in accordance with the classification proposed by B.M. Ariel in 1998. The highest activity of fourth-to-fifth degree specific inflammation, including that outside the primary involvement focus, was obtained in the drug-resistant pulmonary tuberculosis group due to the predominance of patients with cavernous and fibrous-cavernous tuberculosis versus those in whom the susceptibility to chemotherapeutic agents was preserved. A macroscopic study showed that the primary lesion focus had a median size in one-half of the all the examinees; but large tuberculomas, caverns, and fibrous caverns over 4 cm in diameter were multiple and detected in the drug-resistant pulmonary tuberculosis group. Multidrug resistance was observed in more than 60% of the patients with fibrous-cavernous pulmonary tuberculosis, extensive drug resistance was seen in those with cavernous tuberculosis, which is an aggravating factor. The data obtained from the morphological study of the intraoperative material can specify the clinical form of tuberculosis and evaluate the efficiency of preoperative specific therapy. The highest activity of specific inflammation was observed in patients with multiple drug-resistant pulmonary tuberculosis, the prevalence of third-to-fourth degree

  20. Reverse translation in tuberculosis: neutrophils as clues for development of active disease

    Directory of Open Access Journals (Sweden)

    Anca eDorhoi

    2014-02-01

    Full Text Available Tuberculosis (TB is a major health issue globally. Although typically the disease can be cured by chemotherapy and prevented – at least in part, in newborn by vaccination, general consensus exists that development of novel intervention measures requires better understanding of disease mechanisms. Human TB is characterized by polarity between host resistance as seen in 2 billion individuals with latent TB infection and susceptibility occurring in 9 million individuals who develop active TB disease every year. Experimental animal models often do not reflect this polarity adequately, calling for a reverse translational approach. Gene expression profiling has allowed identification of biomarkers that discriminate between latent infection and active disease. Functional analysis of most relevant markers in experimental animal models can help to better understand mechanisms driving disease progression. We have embarked on in-depth characterization of candidate markers of pathology and protection hereby harnessing mouse mutants with defined gene deficiencies. Analysis of mutants deficient in miR223 expression and CXCL5 production allowed elucidation of relevant pathogenic mechanisms. Intriguingly, these deficiencies were linked to aberrant neutrophil activities. Our findings point to a detrimental potential of neutrophils in TB. Reciprocally, measures that control neutrophils should be leveraged for amelioration of TB in adjunct to chemotherapy.

  1. Updates on antibody functions in Mycobacterium tuberculosis infection and their relevance for developing a vaccine against tuberculosis.

    Science.gov (United States)

    Achkar, Jacqueline M; Prados-Rosales, Rafael

    2018-04-12

    A more effective vaccine to control tuberculosis (TB), a major global public health problem, is urgently needed. Current vaccine candidates focus predominantly on eliciting cell-mediated immunity but other arms of the immune system also contribute to protection against TB. We review here recent studies that enhance our current knowledge of antibody-mediated functions against Mycobacterium tuberculosis. These findings, which contribute to the increasing evidence that antibodies have a protective role against TB, include demonstrations that firstly distinct human antibody Fc glycosylation patterns, found in latent M. tuberculosis infection but not in active TB, influence the efficacy of the host to control M. tuberculosis infection, secondly antibody isotype influences human antibody functions, and thirdly that antibodies targeting M. tuberculosis surface antigens are protective. We discuss these findings in the context of TB vaccine development and highlight the need for further research on antibody-mediated immunity in M. tuberculosis infection. Copyright © 2018 Elsevier Ltd. All rights reserved.

  2. Development of a Patient-Centred, Psychosocial Support Intervention for Multi-Drug-Resistant Tuberculosis (MDR-TB Care in Nepal.

    Directory of Open Access Journals (Sweden)

    Sudeepa Khanal

    Full Text Available Multi-drug-resistant tuberculosis (MDR-TB poses a major threat to public health worldwide, particularly in low-income countries. The current long (20 month and arduous treatment regime uses powerful drugs with side-effects that include mental ill-health. It has a high loss-to-follow-up (25% and higher case fatality and lower cure-rates than those with drug sensitive tuberculosis (TB. While some national TB programmes provide small financial allowances to patients, other aspects of psychosocial ill-health, including iatrogenic ones, are not routinely assessed or addressed. We aimed to develop an intervention to improve psycho-social well-being for MDR-TB patients in Nepal. To do this we conducted qualitative work with MDR-TB patients, health professionals and the National TB programme (NTP in Nepal. We conducted semi-structured interviews (SSIs with 15 patients (10 men and 5 women, aged 21 to 68, four family members and three frontline health workers. In addition, three focus groups were held with MDR-TB patients and three with their family members. We conducted a series of meetings and workshops with key stakeholders to design the intervention, working closely with the NTP to enable government ownership. Our findings highlight the negative impacts of MDR-TB treatment on mental health, with greater impacts felt among those with limited social and financial support, predominantly married women. Michie et al's (2011 framework for behaviour change proved helpful in identifying corresponding practice- and policy-level changes. The findings from this study emphasise the need for tailored psycho-social support. Recent work on simple psychological support packages for the general population can usefully be adapted for use with people with MDR-TB.

  3. PhyTB: Phylogenetic tree visualisation and sample positioning for M. tuberculosis

    KAUST Repository

    Benavente, Ernest D; Coll, Francesc; Furnham, Nick; McNerney, Ruth; Glynn, Judith R; Campino, Susana; Pain, Arnab; Mohareb, Fady R; Clark, Taane G

    2015-01-01

    Phylogenetic-based classification of M. tuberculosis and other bacterial genomes is a core analysis for studying evolutionary hypotheses, disease outbreaks and transmission events. Whole genome sequencing is providing new insights

  4. Patho-TB test for the rapid diagnosis of pulmonary tuberculosis

    Directory of Open Access Journals (Sweden)

    Roya Alavi-Naini

    2009-09-01

    Full Text Available

    • BACKGROUND: Despite recent technologic improvements in identifying mycobacterium tuberculosis, we are still facing problems in rapid diagnosis of tuberculosis. The objective of this study is to determine the diagnostic value of a new rapid screening test (Patho-TB™ for diagnosis of pulmonary tuberculosis.
    • METHODS: Between September 2006 to August 2007, 178 patients were enrolled in the study who were finally classified into two groups; a group of documented pulmonary tuberculosis (n = 67 and a group of non-tuberculous pulmonary infection (n = 111. Patho-TB™ test, Ziehl-Neelsen staining and culture were done on all specimens.
    • RESULTS: Of all, 43 patients with pulmonary tuberculosis were sputum smear positive for acid fast bacilli and the rest were smear negative. Mean age of the patients was 59.8 ± 16.1 years and 44% of them were men. The results of Patho- TB™ test were positive in 40 of smear positive and 20 of smear negative tuberculous patients and 33 cases of nontuberculous control group. The sensitivity, specificity, positive and negative predictive values and accuracy of Patho- TB™ test were estimated 89.5%, 70.2%, 64.5%, 91.7% and 77.5%, respectively.
    • CONCLUSIONS: According to the present study it would be suggested that Patho-TB™ test could be a rapid and inexpensive method for diagnosis of pulmonary tuberculosis, given by its high sensitivity and negative predictive value. Concerning the high number of false positive results, using a confirmatory diagnostic procedure is mandatory.
    • KEYWORDS: Pulmonary Tuberculosis, Rapid Diagnosis, Mycobacterium Tuberculosis Antigens, Iran

  5. Challenges with diagnosing and investigating suspected active tuberculosis disease in military trainees.

    Science.gov (United States)

    Chang, David; Webber, Bryant J; Hetrick, Steven M; Owen, Jerry B; Blasi, Audra A; Steele, Bernadette M; Yun, Heather C

    2017-08-01

    Between 1 January 2010 and 31 December 2016, a total of 14 U.S. and international military personnel in training at Joint Base San Antonio-Lackland, TX, were hospitalized due to suspected pulmonary tuberculosis (TB); of these, five personnel were diagnosed with active TB disease. Only one TB case had pulmonary symptoms, but these symptoms were not suggestive of TB. The incidence rate in the training population was 1.89 per 100,000 population (95% CI: 0.81, 4.42), with a higher rate when restricted to international military students attending the Defense Language Institute English Language Center. No instances of TB transmission were identified. The variety of atypical presentations and their resulting diagnostic and public health challenges prompted this retrospective review of all hospitalized cases. This case series highlights both the importance of a high index of clinical suspicion when TB is being considered in close congregate settings as well as the risk of overreliance on acid-fast bacilli staining and nucleic acid amplification testing for ruling out active pulmonary disease in young, otherwise healthy trainees. Practical solutions are suggested.

  6. Management of latent Mycobacterium tuberculosis infection: WHO guidelines for low tuberculosis burden countries

    NARCIS (Netherlands)

    Getahun, Haileyesus; Matteelli, Alberto; Abubakar, Ibrahim; Aziz, Mohamed Abdel; Baddeley, Annabel; Barreira, Draurio; den Boon, Saskia; Borroto Gutierrez, Susana Marta; Bruchfeld, Judith; Burhan, Erlina; Cavalcante, Solange; Cedillos, Rolando; Chaisson, Richard; Chee, Cynthia Bin-Eng; Chesire, Lucy; Corbett, Elizabeth; Dara, Masoud; Denholm, Justin; de Vries, Gerard; Falzon, Dennis; Ford, Nathan; Gale-Rowe, Margaret; Gilpin, Chris; Girardi, Enrico; Go, Un-Yeong; Govindasamy, Darshini; D Grant, Alison; Grzemska, Malgorzata; Harris, Ross; Horsburgh, C. Robert; Ismayilov, Asker; Jaramillo, Ernesto; Kik, Sandra; Kranzer, Katharina; Lienhardt, Christian; LoBue, Philip; Lönnroth, Knut; Marks, Guy; Menzies, Dick; Migliori, Giovanni Battista; Mosca, Davide; Mukadi, Ya Diul; Mwinga, Alwyn; Nelson, Lisa; Nishikiori, Nobuyuki; Oordt-Speets, Anouk; Rangaka, Molebogeng Xheedha; Reis, Andreas; Rotz, Lisa; Sandgren, Andreas; Sañé Schepisi, Monica; Schünemann, Holger J.; Sharma, Surender Kumar; Sotgiu, Giovanni; Stagg, Helen R.; Sterling, Timothy R.; Tayeb, Tamara; Uplekar, Mukund; van der Werf, Marieke J.; Vandevelde, Wim; van Kessel, Femke; van't Hoog, Anna; Varma, Jay K.; Vezhnina, Natalia; Voniatis, Constantia; Vonk Noordegraaf-Schouten, Marije; Weil, Diana; Weyer, Karin; Wilkinson, Robert John; Yoshiyama, Takashi; Zellweger, Jean Pierre; Raviglione, Mario

    2015-01-01

    Latent tuberculosis infection (LTBI) is characterised by the presence of immune responses to previously acquired Mycobacterium tuberculosis infection without clinical evidence of active tuberculosis (TB). Here we report evidence-based guidelines from the World Health Organization for a public health

  7. Potential of DosR and Rpf antigens from Mycobacterium tuberculosis to discriminate between latent and active tuberculosis in a tuberculosis endemic population of Medellin Colombia.

    Science.gov (United States)

    Arroyo, Leonar; Marín, Diana; Franken, Kees L M C; Ottenhoff, Tom H M; Barrera, Luis F

    2018-01-08

    Tuberculosis (TB) remains one of the most deadly infectious diseases. One-third to one-fourth of the human population is estimated to be infected with Mycobacterium tuberculosis (Mtb) without showing clinical symptoms, a condition called latent TB infection (LTBI). Diagnosis of Mtb infection is based on the immune response to a mixture of mycobacterial antigens (PPD) or to Mtb specific ESAT-6/CFP10 antigens (IGRA), highly expressed during the initial phase of infection. However, the immune response to PPD and IGRA antigens has a low power to discriminate between LTBI and PTB. The T-cell response to a group of so-called latency (DosR-regulon-encoded) and Resuscitation Promoting (Rpf) antigens of Mtb has been proved to be significantly higher in LTBI compared to active TB across many populations, suggesting their potential use as biomarkers to differentiate latent from active TB. PBMCs from a group LTBI (n = 20) and pulmonary TB patients (PTB, n = 21) from an endemic community for TB of the city of Medellín, Colombia, were in vitro stimulated for 7 days with DosR- (Rv1737c, Rv2029c, and Rv2628), Rpf- (Rv0867c and Rv2389c), the recombinant fusion protein ESAT-6-CFP10 (E6-C10)-, or PPD-antigen. The induced IFNγ levels detectable in the supernatants of the antigen-stimulated cells were then used to calculate specificity and sensitivity in discriminating LTBI from PTB, using different statistical approaches. IFNγ production in response to DosR and Rpf antigens was significantly higher in LTBI compared to PTB. ROC curve analyses of IFNγ production allowed differentiation of LTBI from PTB with areas under the curve higher than 0.70. Furthermore, Multiple Correspondence Analysis (MCA) revealed that LTBI is associated with higher levels of IFNγ in response to the different antigens compared to PTB. Analysis based on decision trees showed that the IFNγ levels produced in response to Rv2029c was the leading variable that best-classified disease status. Finally

  8. Tuberculosis.

    Science.gov (United States)

    Tabbara, Khalid F

    2007-11-01

    The purpose of this report is to present an update on the manifestations and management of ocular tuberculosis. Tuberculosis affects one-third of the world's population. The incidence of tuberculosis has increased with the increase in the HIV infected population. Following a resurgence of the disease in the US, the incidence has recently declined. Patients may develop scleritis that can be focal, nodular or diffuse with or without keratitis. Anterior granulomatous uveitis may occur. The posterior segment reveals vitritis, choroiditis, and can mimic serpiginous choroiditis and other entities. Patients who are immunosuppressed or HIV infected may develop active mycobacterial disease in the eye leading to rapid destruction of the ocular structures. The diagnosis of ocular tuberculosis is made by isolation of Mycobacterium tuberculosis on Löwestein-Jensen medium or by PCR. The diagnosis is supported by the clinical findings, imaging techniques including optical coherence tomography, fluorescein angiography, indocyanine green and ultrasonography. Tuberculin skin test helps to confirm the diagnosis. Ocular tuberculosis may occur in the absence of pulmonary disease. Patients present with a spectrum of clinical signs. The disease may mimic several clinical entities. Early diagnosis and prompt treatment of ocular tuberculosis may prevent ocular morbidity and blindness.

  9. Health systems in the Republic of Congo: challenges and opportunities for implementing tuberculosis and HIV collaborative service, research, and training activities.

    Science.gov (United States)

    Linguissi, Laure Stella Ghoma; Gwom, Luc Christian; Nkenfou, Celine Nguefeu; Bates, Matthew; Petersen, Eskild; Zumla, Alimuddin; Ntoumi, Francine

    2017-03-01

    The Republic of Congo is on the World Health Organization (WHO) list of 'high burden' countries for tuberculosis (TB) and HIV. TB is the leading cause of death among HIV-infected patients in the Republic of Congo. In this viewpoint, the available data on TB and HIV in the Republic of Congo are reviewed, and the gaps and bottlenecks that the National TB Control Program (NTCP) faces are discussed. Furthermore, priority requirements for developing and implementing TB and HIV collaborative service activities are identified. HIV and TB control programs operate as distinct entities with separate case management plans. The implementation of collaborative TB/HIV activities to evaluate and monitor the management of TB/HIV co-infected individuals remains inefficient in most regions, and these activities are sometimes non-existent. This reveals major challenges that require definition in order to improve the delivery of healthcare. The NTCP lacks adequate resources for optimal implementation of control measures of TB and HIV compliance and outcomes. The importance of aligning and integrating TB and HIV treatment services (including follow-up) and adherence support services through coordinated and collaborative efforts between individual TB and HIV programs is discussed. Aligning and integrating TB and HIV treatment services through coordinated and collaborative efforts between individual TB and HIV programs is required. However, the WHO recommendations are generic, and health services in the Republic of Congo need to tailor their TB and HIV programs according to the availability of resources and operational feasibility. This will also open opportunities for synergizing collaborative TB/HIV research and training activities, which should be prioritized by the donors supporting the TB/HIV programs. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  10. Health systems in the Republic of Congo: challenges and opportunities for implementing tuberculosis and HIV collaborative service, research, and training activities

    Directory of Open Access Journals (Sweden)

    Laure Stella Ghoma Linguissi

    2017-03-01

    Full Text Available The Republic of Congo is on the World Health Organization (WHO list of ‘high burden’ countries for tuberculosis (TB and HIV. TB is the leading cause of death among HIV-infected patients in the Republic of Congo. In this viewpoint, the available data on TB and HIV in the Republic of Congo are reviewed, and the gaps and bottlenecks that the National TB Control Program (NTCP faces are discussed. Furthermore, priority requirements for developing and implementing TB and HIV collaborative service activities are identified. HIV and TB control programs operate as distinct entities with separate case management plans. The implementation of collaborative TB/HIV activities to evaluate and monitor the management of TB/HIV co-infected individuals remains inefficient in most regions, and these activities are sometimes non-existent. This reveals major challenges that require definition in order to improve the delivery of healthcare. The NTCP lacks adequate resources for optimal implementation of control measures of TB and HIV compliance and outcomes. The importance of aligning and integrating TB and HIV treatment services (including follow-up and adherence support services through coordinated and collaborative efforts between individual TB and HIV programs is discussed. Aligning and integrating TB and HIV treatment services through coordinated and collaborative efforts between individual TB and HIV programs is required. However, the WHO recommendations are generic, and health services in the Republic of Congo need to tailor their TB and HIV programs according to the availability of resources and operational feasibility. This will also open opportunities for synergizing collaborative TB/HIV research and training activities, which should be prioritized by the donors supporting the TB/HIV programs.

  11. Addison's Disease Caused by Tuberculosis with Atypical Hyperpigmentation and Active Pulmonary Tuberculosis.

    Science.gov (United States)

    Namikawa, Hiroki; Takemoto, Yasuhiko; Kainuma, Shigeto; Umeda, Sakurako; Makuuchi, Ayako; Fukumoto, Kazuo; Kobayashi, Masanori; Kinuhata, Shigeki; Isaka, Yoshihiro; Toyoda, Hiromitsu; Kamata, Noriko; Tochino, Yoshihiro; Hiura, Yoshikazu; Morimura, Mina; Shuto, Taichi

    2017-01-01

    We herein report a case of Addison's disease caused by tuberculosis characterized by atypical hyperpigmentation, noted as exacerbation of the pigmentation of freckles and the occurrence of new freckles, that was diagnosed in the presence of active pulmonary tuberculosis. The clinical condition of the patient was markedly ameliorated by the administration of hydrocortisone and anti-tuberculosis agents. When exacerbation of the pigmentation of the freckles and/or the occurrence of new freckles are noted, Addison's disease should be considered as part of the differential diagnosis. In addition, the presence of active tuberculosis needs to be assumed whenever we treat patients with Addison's disease caused by tuberculosis, despite its rarity.

  12. Outbreak of pulmonary tuberculosis in which tuberculosis developed from QuantiFERON-TB second generation (QFT-2G) test negative persons

    International Nuclear Information System (INIS)

    Yamaguchi, Junichi; Ooba, Yuko; Kaneda, Mie; Uchida, Kiyomi; Ishikawa, Yo; Suzuki, Kiminori; Yagi, Takenori; Sasaki, Yuka; Yamagishi, Fumio

    2007-01-01

    The purpose of this study was to clarify the points to be considered when QuantiFERON-TB second generation (QFT-2G) tests are used in the contacts examination by public health center. We analyzed the results of contacts examination on 43 workplace colleagues (39 y/o and younger) of a pulmonary tuberculosis patient (bII2, Gaffky 9, cough for 1.5 months). After two months of the last contact with the index case, tuberculin skin tests, QFT-2G tests and chest X-rays were undertaken. After 6 months, chest X-rays were taken, and after 9 months, QFT-2G tests and chest CT scans were also undertaken. The tuberculin skin tests after two months showed a bimodal distribution, and 10 were QFT-2G positive and 2 showed doubtful reaction. The latter 12 persons underwent chemoprophylaxis. After 6 months, however, out of 31 QFT-2G negative persons, 2 developed pulmonary tuberculosis. Moreover, after 9 months, chest CT scans revealed 5 pulmonary tuberculosis patients. Three out of 7 new patients showed positive or doubtful reactions in QFT-2G tests undertaken after 9 months. The sensitivity of QFT-2G tests is reported to be 80 to 90%, and the possibility of false negative is not negligible. We propose measures for public health center to conduct the contacts examination as follows; In case of high QFT-2G positive (including doubtful reaction) rate and/or a bimodal distribution of tuberculin skin test result, many infected persons are likely to be included in the group; and the following measures are recommended; Necessity of chemoprophylaxis should be judged considering both tuberculin skin test results and the situation of contact with the index case, and not only by QFT-2G test results. QFT-2G negative persons also need to be followed with chest X-rays. (author)

  13. Rationale and design of a randomized controlled trial of the effect of retinol and vitamin D supplementation on treatment in active pulmonary tuberculosis patients with diabetes

    DEFF Research Database (Denmark)

    Wang, Qiuzhen; Ma, Aiguo; Bygbjerg, Ib Christian

    2013-01-01

    The association between pulmonary tuberculosis (PTB) and diabetes mellitus (DM) has been previously attracted much attention. Diabetes alters immunity to tuberculosis, leading to more frequent treatment failure in TB patients with DM. Moreover, TB and DM often coincide with micronutrients...

  14. Protective activity of Lentinan in experimental tuberculosis.

    Science.gov (United States)

    Markova, Nadya; Kussovski, Vesselin; Drandarska, Ivanka; Nikolaeva, Sascha; Georgieva, Neli; Radoucheva, Tatyana

    2003-10-01

    Protective effects of Lentinan (Ajinomoto, Japan) against Mycobacterium tuberculosis infection were studied by in vitro and in vivo mouse models. The effectiveness of Lentinan administrated intraperitoneally (i.p.) before infection at a dose of 1 mg/kg three times at 2-day intervals was monitored in vivo by several parameters (body temperature; spleen weight; CFU counts of M. tuberculosis in spleen, liver and lung; and histomorphological observations). Peritoneal macrophages obtained from animals treated with Lentinan were greatly stimulated, as assayed by establishing their number, acid phosphatase activity, H2O2 production and killing ability against M. tuberculosis in vitro. The in vivo model demonstrated that administration of Lentinan before infection can mobilize host defense potential and reduce mycobacterial infection.

  15. Activity of moxifloxacin and linezolid against Mycobacterium tuberculosis in combination with potentiator drugs verapamil, timcodar, colistin and SQ109.

    Science.gov (United States)

    de Knegt, Gerjo J; van der Meijden, Aart; de Vogel, Corné P; Aarnoutse, Rob E; de Steenwinkel, Jurriaan E M

    2017-03-01

    Current treatment for tuberculosis (TB) is complicated by the emergence of multidrug resistant TB (MDR-TB). As a result, there is an urgent need for new powerful anti-TB regimens and novel strategies. In this study, we aimed to potentiate a moxifloxacin + linezolid backbone as treatment for MDR-TB with the efflux pump inhibitors verapamil and timcodar as well as with drugs that act on mycobacterial cell wall stability such as colistin and SQ109. Using a time-kill kinetics assay, the activities of moxifloxacin, linezolid, verapamil, timcodar, colistin and SQ109 as single drugs against Mycobacterium tuberculosis were evaluated. In addition, the activity of the moxifloxacin + linezolid backbone in combination with one of the potentiator drugs was assessed. As little as 0.125 mg/L moxifloxacin achieved 99% killing of M. tuberculosis after 6 days of exposure. Linezolid showed moderate killing but 99% killing was not achieved. Verapamil, timcodar and colistin only resulted in killing with the highest concentrations tested but 99% killing was not achieved. SQ109 resulted in complete elimination after 1 day of exposure to 256 mg/L and in 99% elimination after 6 days of exposure to 1 mg/L. Furthermore, colistin added to the moxifloxacin + linezolid backbone resulted in increased elimination, whereas verapamil, timcodar and SQ109 showed no added value to the backbone. This finding that colistin potentiates the activity of the moxifloxacin + linezolid backbone against M. tuberculosis suggests its potential role in further studies on the applicability of a moxifloxacin + linezolid treatment of MDR-TB. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

  16. Exploring the iron metabolism in multidrug resistant tuberculosis ...

    African Journals Online (AJOL)

    The iron metabolism plays a key role in the progression of active Tuberculosis. Several studies have shown a link between iron metabolism disorders an active tuberculosis. The aim of this study was to explore the iron metabolism of 100 patients with multidrug-resistant tuberculosis. (MDR-TB) treated with second ...

  17. Exploring the iron metabolism in multidrug resistant tuberculosis ...

    African Journals Online (AJOL)

    The iron metabolism plays a key role in the progression of active Tuberculosis. Several studies have shown a link between iron metabolism disorders an active tuberculosis. The aim of this study was to explore the iron metabolism of 100 patients with multidrug-resistant tuberculosis (MDR-TB) treated with second generation ...

  18. IL-10 dependent suppression of type 1, type 2 and type 17 cytokines in active pulmonary tuberculosis.

    Directory of Open Access Journals (Sweden)

    Nathella Pavan Kumar

    Full Text Available Although Type 1 cytokine responses are considered protective in pulmonary tuberculosis (PTB, their role as well as those of Type 2, 17 and immunoregulatory cytokines in tuberculous lymphadenitis (TBL and latent tuberculosis (LTB have not been well studied.To identify cytokine responses associated with pulmonary tuberculosis (TB, TB lymphadenitits and latent TB, we examined mycobacterial antigen-specific immune responses of PTB, TBL and LTB individuals. More specifically, we examined ESAT-6 and CFP-10 induced Type 1, Type 2 and Type 17 cytokine production and their regulation using multiplex ELISA.PTB individuals exhibited a significantly lower baseline as well as antigen-specific production of Type 1 (IFNγ, TNFα and IL-2; Type 2 (IL-4 and Type 17 (IL-17A and IL-17F cytokines in comparison to both TBL and LTB individuals. TBL individuals exhibited significantly lower antigen-specific IFNγ responses alone in comparison to LTB individuals. Although, IL-10 levels were not significantly higher, neutralization of IL-10 during antigen stimulation resulted in significantly enhanced production of IFNγ, IL-4 and IL-17A in PTB individuals, indicating that IL-10 mediates (at least partially the suppression of cytokine responses in PTB.Pulmonary TB is characterized by an IL-10 dependent antigen-specific suppression of Type 1, Type 2 and Type 17 cytokines, reflecting an important association of these cytokines in the pathogenesis of active TB.

  19. Tuberculosis genotyping information management system: enhancing tuberculosis surveillance in the United States.

    Science.gov (United States)

    Ghosh, Smita; Moonan, Patrick K; Cowan, Lauren; Grant, Juliana; Kammerer, Steve; Navin, Thomas R

    2012-06-01

    Molecular characterization of Mycobacterium tuberculosis complex isolates (genotyping) can be used by public health programs to more readily identify tuberculosis (TB) transmission. The Centers for Disease Control and Prevention's National Tuberculosis Genotyping Service has offered M. tuberculosis genotyping for every culture-confirmed case in the United States since 2004. The TB Genotyping Information Management System (TB GIMS), launched in March 2010, is a secure online database containing genotype results linked with case characteristics from the national TB registry for state and local TB programs to access, manage and analyze these data. As of September 2011, TB GIMS contains genotype results for 89% of all culture-positive TB cases for 2010. Over 400 users can generate local and national reports and maps using TB GIMS. Automated alerts on geospatially concentrated cases with matching genotypes that may represent outbreaks are also generated by TB GIMS. TB genotyping results are available to enhance national TB surveillance and apply genotyping results to conduct TB control activities in the United States. Published by Elsevier B.V.

  20. Systematic review on tuberculosis transmission on aircraft and update of the European Centre for Disease Prevention and Control risk assessment guidelines for tuberculosis transmitted on aircraft (RAGIDA-TB).

    Science.gov (United States)

    Kotila, Saara M; Payne Hallström, Lara; Jansen, Niesje; Helbling, Peter; Abubakar, Ibrahim

    2016-01-01

    As a setting for potential tuberculosis (TB) transmission and contact tracing, aircraft pose specific challenges. Evidence-based guidelines are needed to support the related-risk assessment and contact-tracing efforts. In this study evidence of TB transmission on aircraft was identified to update the Risk Assessment Guidelines for TB Transmitted on Aircraft (RAGIDA-TB) of the European Centre for Disease Prevention and Control (ECDC). Electronic searches were undertaken from Medline (Pubmed), Embase and Cochrane Library until 19 July 2013. Eligible records were identified by a two-stage screening process and data on flight and index case characteristics as well as contact tracing strategies extracted. The systematic literature review retrieved 21 records. Ten of these records were available only after the previous version of the RAGIDA guidelines (2009) and World Health Organization guidelines on TB and air travel (2008) were published. Seven of the 21 records presented some evidence of possible in-flight transmission, but only one record provided substantial evidence of TB transmission on an aircraft. The data indicate that overall risk of TB transmission on aircraft is very low. The updated ECDC guidelines for TB transmission on aircraft have global implications due to inevitable need for international collaboration in contract tracing and risk assessment.

  1. Concomitant active tuberculosis prolongs survival in non-small cell lung cancer: a study in a tuberculosis-endemic country.

    Directory of Open Access Journals (Sweden)

    Chih-Hsi Kuo

    Full Text Available BACKGROUND: Adjuvant tumor cell vaccine with chemotherapy against non-small cell lung cancer (NSCLC shows limited clinical response. Whether it provokes effective cellular immunity in tumor microenvironment is questionable. Concomitant active tuberculosis in NSCLC (TBLC resembles locoregional immunotherapy of tumor cell vaccine; thus, maximally enriches effective anti-tumor immunity. This study compares the survival and immunological cell profile in TBLC over NSCLC alone. METHODS: Retrospective review of NSCLC patients within 1-year-period of 2007 and follow-up till 2010. RESULTS: A total 276 NSCLC patients were included. The median survival of TBLC is longer than those of NSCLC alone (11.6 vs. 8.8 month, p<0.01. Active tuberculosis is an independent predictor of better survival with HR of 0.68 (95% CI, 0.48 ~ 0.97. Squamous cell carcinoma (SCC (55.8 vs. 31.7%, p<0.01 is a significant risk factor for NSCLC with active TB. The median survival of SCC with active tuberculosis is significantly longer than adenocarcinoma or undetermined NSCLC with TB (14.2 vs. 6.6 and 2.8 months, p<0.05. Active tuberculosis in SCC increases the expression of CD3 (46.4 ± 24.8 vs. 24.0 ± 16.0, p<0.05, CXCR3 (35.1 ± 16.4 vs. 19.2 ± 13.3, p<0.01 and IP-10 (63.5 ± 21.9 vs. 35.5 ± 21.0, p<0.01, while expression of FOXP3 is decreased (3.5 ± 0.5 vs. 13.3 ± 3.7 p<0.05, p<0.05. Survival of SCC with high expression of CD3 (12.1 vs. 3.6 month, p<0.05 and CXCR3 (12.1 vs. 4.4 month, p<0.05 is longer than that with low expression. CONCLUSIONS: Active tuberculosis in NSCLC shows better survival outcome. The effective T lymphocyte infiltration in tumor possibly underlies the mechanism. Locoregional immunotherapy of tumor cell vaccine may deserve further researches.

  2. Systematic Expression Profiling Analysis Identifies Specific MicroRNA-Gene Interactions that May Differentiate between Active and Latent Tuberculosis Infection

    Directory of Open Access Journals (Sweden)

    Lawrence Shih-Hsin Wu

    2014-01-01

    Full Text Available Tuberculosis (TB is the second most common cause of death from infectious diseases. About 90% of those infected are asymptomatic—the so-called latent TB infections (LTBI, with a 10% lifetime chance of progressing to active TB. To further understand the molecular pathogenesis of TB, several molecular studies have attempted to compare the expression profiles between healthy controls and active TB or LTBI patients. However, the results vary due to diverse genetic backgrounds and study designs and the inherent complexity of the disease process. Thus, developing a sensitive and efficient method for the detection of LTBI is both crucial and challenging. For the present study, we performed a systematic analysis of the gene and microRNA profiles of healthy individuals versus those affected with TB or LTBI. Combined with a series of in silico analysis utilizing publicly available microRNA knowledge bases and published literature data, we have uncovered several microRNA-gene interactions that specifically target both the blood and lungs. Some of these molecular interactions are novel and may serve as potential biomarkers of TB and LTBI, facilitating the development for a more sensitive, efficient, and cost-effective diagnostic assay for TB and LTBI for the Taiwanese population.

  3. Systematic expression profiling analysis identifies specific microRNA-gene interactions that may differentiate between active and latent tuberculosis infection.

    Science.gov (United States)

    Wu, Lawrence Shih-Hsin; Lee, Shih-Wei; Huang, Kai-Yao; Lee, Tzong-Yi; Hsu, Paul Wei-Che; Weng, Julia Tzu-Ya

    2014-01-01

    Tuberculosis (TB) is the second most common cause of death from infectious diseases. About 90% of those infected are asymptomatic--the so-called latent TB infections (LTBI), with a 10% lifetime chance of progressing to active TB. To further understand the molecular pathogenesis of TB, several molecular studies have attempted to compare the expression profiles between healthy controls and active TB or LTBI patients. However, the results vary due to diverse genetic backgrounds and study designs and the inherent complexity of the disease process. Thus, developing a sensitive and efficient method for the detection of LTBI is both crucial and challenging. For the present study, we performed a systematic analysis of the gene and microRNA profiles of healthy individuals versus those affected with TB or LTBI. Combined with a series of in silico analysis utilizing publicly available microRNA knowledge bases and published literature data, we have uncovered several microRNA-gene interactions that specifically target both the blood and lungs. Some of these molecular interactions are novel and may serve as potential biomarkers of TB and LTBI, facilitating the development for a more sensitive, efficient, and cost-effective diagnostic assay for TB and LTBI for the Taiwanese population.

  4. Prospective use of soluble urokinase plasminogen activator receptor to screen TB co-infected with HIV patient among TB patient

    Directory of Open Access Journals (Sweden)

    Tri Yudani Mardining Raras

    2017-10-01

    Conclusion: Plasma suPAR level of TB patients co-infected with HIV showed significantly difference from that of TB-AFB(+ patients suggested its potential to screen the TB/HIV among pulmonary TB-AFB(+ patients.

  5. Illness perceptions and quality of life among tuberculosis patients in ...

    African Journals Online (AJOL)

    Conclusion: The illness perceptions of the TB patients might influence their adherence to treatment. The poor quality of life of the TB patients in the different areas of quality of life such as daily activities and work, calls for programmes to strengthen TB information, education and counselling. Key words: Tuberculosis, patients, ...

  6. Challenges of loss to follow-up in tuberculosis research

    DEFF Research Database (Denmark)

    Nissen, Thomas N; Rose, Michala V; Kimaro, Godfather

    2012-01-01

    In studies evaluating methods for diagnosing tuberculosis (TB), follow-up to verify the presence or absence of active TB is crucial and high dropout rates may significantly affect the validity of the results. In a study assessing the diagnostic performance of the QuantiFERON®-TB Gold In-Tube test...

  7. A Serum Circulating miRNA Signature for Short-Term Risk of Progression to Active Tuberculosis Among Household Contacts

    Directory of Open Access Journals (Sweden)

    Fergal J. Duffy

    2018-04-01

    Full Text Available Biomarkers that predict who among recently Mycobacterium tuberculosis (MTB-exposed individuals will progress to active tuberculosis are urgently needed. Intracellular microRNAs (miRNAs regulate the host response to MTB and circulating miRNAs (c-miRNAs have been developed as biomarkers for other diseases. We performed machine-learning analysis of c-miRNA measurements in the serum of adult household contacts (HHCs of TB index cases from South Africa and Uganda and developed a c-miRNA-based signature of risk for progression to active TB. This c-miRNA-based signature significantly discriminated HHCs within 6 months of progression to active disease from HHCs that remained healthy in an independent test set [ROC area under the ROC curve (AUC 0.74, progressors < 6 Mo to active TB and ROC AUC 0.66, up to 24 Mo to active TB], and complements the predictions of a previous cellular mRNA-based signature of TB risk.

  8. A Serum Circulating miRNA Signature for Short-Term Risk of Progression to Active Tuberculosis Among Household Contacts.

    Science.gov (United States)

    Duffy, Fergal J; Thompson, Ethan; Downing, Katrina; Suliman, Sara; Mayanja-Kizza, Harriet; Boom, W Henry; Thiel, Bonnie; Weiner Iii, January; Kaufmann, Stefan H E; Dover, Drew; Tabb, David L; Dockrell, Hazel M; Ottenhoff, Tom H M; Tromp, Gerard; Scriba, Thomas J; Zak, Daniel E; Walzl, Gerhard

    2018-01-01

    Biomarkers that predict who among recently Mycobacterium tuberculosis (MTB)-exposed individuals will progress to active tuberculosis are urgently needed. Intracellular microRNAs (miRNAs) regulate the host response to MTB and circulating miRNAs (c-miRNAs) have been developed as biomarkers for other diseases. We performed machine-learning analysis of c-miRNA measurements in the serum of adult household contacts (HHCs) of TB index cases from South Africa and Uganda and developed a c-miRNA-based signature of risk for progression to active TB. This c-miRNA-based signature significantly discriminated HHCs within 6 months of progression to active disease from HHCs that remained healthy in an independent test set [ROC area under the ROC curve (AUC) 0.74, progressors < 6 Mo to active TB and ROC AUC 0.66, up to 24 Mo to active TB], and complements the predictions of a previous cellular mRNA-based signature of TB risk.

  9. THE EFFECT OF DIFFERENT TB DRUGS AND ANTIMICROBIAL AGENTS ON THE EFFICIENCY OF TREATMENT OF TUBERCULOSIS PATIENTS WITH MULTIPLE DRUG RESISTANCE

    Directory of Open Access Journals (Sweden)

    I. A. Vasilyeva

    2017-01-01

    Full Text Available Objective of the study: to study the effect of specific TB drugs and antimicrobial agents constituting chemotherapy regimens on the efficiency of treatment of tuberculosis patients with various patterns of multiple drug resistance.Subjects and Methods. 412 pulmonary tuberculosis patients with bacillary excretion and various patterns of multiple drug resistance were enrolled into the study (117 patients with MDR TB (non pre-XDR and non-XDR; 120 patients with pre-XDR TB and 175 with XDR TB. Patients in the subgroups were compatible regarding sex and age. The patients were prescribed regimens including 5-6 drugs in accordance with their drug resistance pattern. The time of sputum conversion (by culture versus the year of treatment was selected as a surrogate endpoint. The effect of specific TB drugs and antimicrobial agents on treatment efficiency was assessed through calculation of odds ratio (OR of achieving a surrogate endpoint in the patients receiving and not receiving a certain drug.Results. In the subgroup of pre-XDR TB, the following drugs demonstrated the valid increase of odds of sputum conversion: ethambutol (OR 11.8, pyrazinamide (OR 10.2, moxifloxacin (OR 7.8, capreomicin (OR 4.41. Sputum conversion was achieved in all 11 patients treated with bedaquiline.In the subgroup of XDR TB, the following drugs provided a positive effect on the achievement of sputum conversion: bedaquiline (OR 9.62, linezolid (OR 8.15, cycloserine (OR 7.88, pyrazinamide (OR 7.29, moxifloxacin (OR 7.08, and ethambutol (OR 6.69. Ofloxacin demonstrated a confident negative effect on achieving sputum conversion (95% CI 0.06-0.32. 

  10. Prophylactic effect of a therapeutic vaccine against TB based on fragments of Mycobacterium tuberculosis.

    Science.gov (United States)

    Vilaplana, Cristina; Gil, Olga; Cáceres, Neus; Pinto, Sergio; Díaz, Jorge; Cardona, Pere-Joan

    2011-01-01

    The prophylactic capacity of the RUTI® vaccine, based on fragmented cells of Mycobacterium tuberculosis, has been evaluated in respect to aerosol challenge with virulent bacilli. Subcutaneous vaccination significantly reduced viable bacterial counts in both lungs and spleens of C57Bl mice, when challenged 4 weeks after vaccination. RUTI® protected the spleen less than BCG. Following a 9 month vaccination-challenge interval, protection was observed for the lungs, but not for the spleen. Survival of infected guinea pigs was prolonged by vaccination given 5 weeks before challenge. Inoculations of RUTI® shortly after infection significantly reduced the viable bacterial counts in the lungs, when compared with infected control mice. Thus, vaccination by RUTI® has potential for both the prophylaxis and immunotherapy of tuberculosis.

  11. Achievements in and Challenges of Tuberculosis Control in South Korea.

    Science.gov (United States)

    Kim, Ji Han; Yim, Jae-Joon

    2015-11-01

    After the Korean War (1950-1953), nearly 6.5% of South Korea's population had active tuberculosis (TB). In response, South Korea implemented the National Tuberculosis Program in 1962. From 1965 to 1995, the prevalence of bacteriologically confirmed pulmonary TB in South Korea decreased from 940 to 219 cases per 100,000 population. Astounding economic growth might have contributed to this result; however, TB incidence in South Korea remains the highest among high-income countries. The rate of decrease in TB incidence seems to have slowed over the past 15 years. A demographic shift toward an older population, many of whom have latent TB and various concurrent conditions, is challenging TB control efforts in South Korea. The increasing number of immigrants also plays a part in the prolonged battle against TB. A historical review of TB in South Korea provides an opportunity to understand national TB control efforts that are applicable to other parts of the world.

  12. Multidrug-resistant tuberculosis

    Directory of Open Access Journals (Sweden)

    McNerney Ruth

    2008-01-01

    Full Text Available Abstract Background With almost 9 million new cases each year, tuberculosis remains one of the most feared diseases on the planet. Led by the STOP-TB Partnership and WHO, recent efforts to combat the disease have made considerable progress in a number of countries. However, the emergence of mutated strains of Mycobacterium tuberculosis that are resistant to the major anti-tuberculosis drugs poses a deadly threat to control efforts. Multidrug-resistant tuberculosis (MDR-TB has been reported in all regions of the world. More recently, extensively drug resistant-tuberculosis (XDR-TB that is also resistant to second line drugs has emerged in a number of countries. To ensure that adequate resources are allocated to prevent the emergence and spread of drug resistance it is important to understand the scale of the problem. In this article we propose that current methods of describing the epidemiology of drug resistant tuberculosis are not adequate for this purpose and argue for the inclusion of population based statistics in global surveillance data. Discussion Whereas the prevalence of tuberculosis is presented as the proportion of individuals within a defined population having disease, the prevalence of drug resistant tuberculosis is usually presented as the proportion of tuberculosis cases exhibiting resistance to anti-tuberculosis drugs. Global surveillance activities have identified countries in Eastern Europe, the former Soviet Union and regions of China as having a high proportion of MDR-TB cases and international commentary has focused primarily on the urgent need to improve control in these settings. Other regions, such as sub-Saharan Africa have been observed as having a low proportion of drug resistant cases. However, if one considers the incidence of new tuberculosis cases with drug resistant disease in terms of the population then countries of sub-Saharan Africa have amongst the highest rates of transmitted MDR-TB in the world. We propose

  13. Information needs of rural health professionals: A case study of the tuberculosis and leprosy referral center (tb/l), Eku, Delta State

    OpenAIRE

    Esoswo Francisca Ogbomo

    2012-01-01

    In developing countries, many rural health professionals have little or no access to basic practical information. The "information poverty" of health professionals in rural area is exacerbating what is clearly a public health emergency on a massive scale. It is against this background that the researcher is investigating the information needs of rural health professionals in the tuberculosis and leprosy referral centre (TB/L), Eku, Nigeria. The study employed the ex-post facto research metho...

  14. Characteristics and outcomes of end-stage renal disease patients with active tuberculosis followed in intensive care units

    International Nuclear Information System (INIS)

    Ulasli, Sevinc Sarinc; Ulubay, Gaye; Arslan, Nevra Gullu; Akcay, Sule; Eyuboglu, Fusun Oner; Sezer, Siren; Haberal, Mehmet

    2009-01-01

    Tuberculosis (TB) remains a common problem in patients with chronic renal failure. In intensive care units, misdiagnosis or delayed diagnosis of TB is common. Therefore, a description of characteristics of active TB in patients with renal failure followed in intensive care units is important to reduce mortality and transmission of the disease. This study was performed to describe the characteristics of patients with renal failure admitted to the intensive care units and having active TB and evaluate predictive factors for in hospital mortality. The hospital records of 24 patients (11 women, 13 men) having ESRD and TB between 2001-2006 were reviewed. Clinical, radiological, and laboratory data on admission were recorded. Possible parameters contributing to in-hospital mortality were obtained from the medical records. In-hospital mortality rate was 66.6%. Factors associated with mortality were decreased partial pressure of oxygen and malnutrition. Fever was reported in 8 patients and hemoptysis was reported in 3 patients. Eight patients had consolidation on chest radiograph, while 4 had normal findings Seventeen patients had pulmonary involvement, and 11 had extra pulmonary involvement. The mortality rate in TB patients followed in intensive care units is high, with 3 factors contributing to in-hospital mortality. Clinicians should consider active TB in renal failure patients being followed in the intensive care unit, even when results of a chest radiograph are normal especially in patients with unexplained poor general health or respiratory failure. (author)

  15. Find TB. Treat TB. Working together to eliminate TB.

    Centers for Disease Control (CDC) Podcasts

    2014-02-26

    In this podcast, Dr. Sundari Mase, Medical Team Lead in the Field Services and Evaluation Branch in the Division of Tuberculosis Elimination, discusses World TB Day and the 2014 theme.  Created: 2/26/2014 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 2/26/2014.

  16. Conjugation of the CRM197-inulin conjugate significantly increases the immunogenicity of Mycobacterium tuberculosis CFP10-TB10.4 fusion protein.

    Science.gov (United States)

    Hu, Shun; Yu, Weili; Hu, Chunyang; Wei, Dong; Shen, Lijuan; Hu, Tao; Yi, Youjin

    2017-11-01

    Mycobacterium tuberculosis (Mtb) is a serious fatal pathogen that causes tuberculosis (TB). Effective vaccination is urgently needed to deal with the serious threat from TB. Mtb-secreted protein antigens are important virulence determinants of Mtb with poor immunogenicity. Adjuvants and antigen delivery systems are thus highly desired to improve the immunogenicity of protein antigens. Inulin is a biocompatible polysaccharide (PS) adjuvant that can stimulate a strong cellular and humoral immunity. Bacterial capsular PS and haptens have been conjugated with cross-reacting material 197 (CRM 197 ) to improve their immunogenicity. CFP10 and TB10.4 were two Mtb-secreted immunodominant protein antigens. A CFP10-TB10.4 fusion protein (CT) was used as the antigen for covalent conjugation with the CRM 197 -inulin conjugate (CRM-inu). The resultant conjugate (CT-CRM-inu) elicited high CT-specific IgG titers, stimulated splenocyte proliferation and provoked the secretion of Th1-type and Th2-type cytokines. Conjugation with CRM-inu significantly prolonged the systemic circulation of CT and exposure to the immune system. Moreover, CT-CRM-inu showed no apparent toxicity to cardiac, hepatic and renal functions. Thus, conjugation of CT with CRM-inu provided an effective strategy for development of protein-based vaccines against Mtb infection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. A pivotal registration phase III, multicenter, randomized tuberculosis controlled trial: design issues and lessons learnt from the Gatifloxacin for TB (OFLOTUB project

    Directory of Open Access Journals (Sweden)

    Merle Corinne SC

    2012-05-01

    Full Text Available Abstract Background There have been no major advances in tuberculosis (TB drug development since the first East African/British Medical Research Council short course chemotherapy trial 35 years ago. Since then, the landscape for conducting TB clinical trials has profoundly changed with the emergence of HIV infection, the spread of resistant TB bacilli strains, recent advances in mycobacteriological capacity, and drug discovery. As a consequence questions have arisen on the most appropriate approach to design and conduct current TB trials. To highlight key issues discussed: Is a superiority, equivalence, or non-inferiority design most appropriate? What should be the primary efficacy outcome? How to consider re-infections in the definition of the outcome? What is the optimal length of patient follow-up? Is blinding appropriate when treatment duration in test arm is shorter? What are the appropriate assumptions for sample size calculation? Methods Various drugs are currently in the development pipeline. We are presenting in this paper the design of the most recently completed phase III TB trial, the OFLOTUB project, which is the pivotal trial of a registration portfolio for a gatifloxacin-containing TB regimen. It is a randomized, open-label, multicenter, controlled trial aiming to evaluate the efficacy and safety of a gatifloxacin-containing 4-month regimen (trial registration: ClinicalTrial.gov database: NCT00216385. Results In the light of the recent scientific and regulatory discussions, we discuss some of the design issues in TB clinical trials and more specifically the reasons that guided our choices, in order to best answer the trial objectives, while at the same time satisfying regulatory authority requirements. Conclusion When shortening TB treatment, we are advocating for a non-inferiority, non-blinded design, with a composite unfavorable endpoint assessed 12 months post treatment completion, and added trial procedures specifically

  18. Active pulmonary tuberculosis case detection and treatment among floating population in China: an effective pilot.

    Science.gov (United States)

    Li, Xinxu; Zhang, Hui; Jiang, Shiwen; Wang, Jia; Liu, Xiaoqiu; Li, Weibin; Yao, Hongyan; Wang, Lixia

    2010-12-01

    China has more and more floating population because of reform and opening-up. As one of the high burden countries in tuberculosis (TB) control in the world, China has to face more challenges about the TB case detection and treatment among floating population in China. Aim to evaluate the effect of case detection and treatment of the Floating Population TB Control Pilot Project from Global Fund Round Five (GFR5) TB Control Program in China. During October 2006 to September 2008, the pilot project was implemented gradually in 60 counties in Tianjin, Shanghai, Jiangsu, Zhejiang, Fujian, Shandong and Guangdong. All quarterly reports of the pilot project were collected, and these materials were summarized and analyzed. In seven coastal provinces, 19,584 active pulmonary TB (PTB) cases were registered among floating population in 2 years. Among the active PTB cases, 87.2% were 15-45 years old, and 62.8% were male. In second year, 15,629 active PTB cases were registered, and the overall registration rate was 68 per 100,000 people. DOT treatments were provided for 18,125 active PTB cases in 2 years, and overall DOT treatment rate was 92.6%. There were 3,955 active PTB cases registered in first year, and the overall cure rate was 86.0%. Through the implementation of the pilot project, the TB case detection and treatment among floating population have been enhanced in pilot areas of China. The useful experience and results from the pilot project have been being gradually generalized nationally.

  19. Status of nosocomial tuberculosis transmission prevention in hospitals in Thailand.

    Science.gov (United States)

    Unahalekhaka, Akeau; Lueang-a-papong, Suchada; Chitreecheur, Jittaporn

    2014-03-01

    A national survey was conducted during July to September 2009 to determine tuberculosis (TB) prevention activities, problems, and support needed of Thai hospitals. Ninety-seven percent of hospitals established TB isolation policy, 96.3% provided guidelines for caring of TB patients, 95% and 91.8% provided prevention of TB transmission and environmental management guideline, and 92.6% established screening system for TB in the outpatient department (OPD). A half of hospitals had problems with isolation rooms and difficulties in screening TB cases in the OPD. Support needed included consultation on structure and ventilation systems, personnel training, national TB prevention, and TB screening guideline. Strengthening TB prevention activities, providing expert consultation, and national guidelines may help hospitals improve their TB prevention activities. Copyright © 2014 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Mosby, Inc. All rights reserved.

  20. Prevalence of Pulmonary Tuberculosis among Prison Inmates in Ethiopia, a Cross-Sectional Study.

    Science.gov (United States)

    Ali, Solomon; Haileamlak, Abraham; Wieser, Andreas; Pritsch, Michael; Heinrich, Norbert; Loscher, Thomas; Hoelscher, Michael; Rachow, Andrea

    2015-01-01

    Tuberculosis (TB) is one of the major health problems in prisons. This study was done to assess the prevalence and determinants of active tuberculosis in Ethiopian prisons. A cross-sectional study was conducted from January 2013 to December 2013 in 13 zonal prisons. All incarcerated inmates underwent TB symptom screening according to WHO criteria. From identified TB-suspects two sputum samples were analyzed using smear microscopy and solid culture. A standardized questionnaire assessing TB risk factors was completed for each TB suspect. 765 (4.9%) TB suspects were identified among 15,495 inmates. 51 suspects were already on anti-TB treatment (6.67%) and 20 (2.8%) new culture-confirmed TB cases were identified in the study, resulting in an overall TB prevalence of 458.1/100,000 (95%CI: 350-560/100,000). Risk factors for active TB were alcohol consumption, contact with a TB case before incarceration and no window in prison cell. HIV prevalence was not different between TB suspects and active TB cases. Further, the TB burden in prisons increased with advancing distance from the capital Addis Ababa. The overall TB prevalence in Ethiopian prisons was high and extremely variable among different prisons. TB risk factors related to conditions of prison facilities and the impact of implemented TB control measures need to be further studied in order to improve TB control among inmates.

  1. Matrix Degradation in Human Immunodeficiency Virus Type 1-Associated Tuberculosis and Tuberculosis Immune Reconstitution Inflammatory Syndrome: A Prospective Observational Study.

    Science.gov (United States)

    Walker, Naomi F; Wilkinson, Katalin A; Meintjes, Graeme; Tezera, Liku B; Goliath, Rene; Peyper, Janique M; Tadokera, Rebecca; Opondo, Charles; Coussens, Anna K; Wilkinson, Robert J; Friedland, Jon S; Elkington, Paul T

    2017-07-01

    Extensive immunopathology occurs in human immunodeficiency virus (HIV)/tuberculosis (TB) coinfection, but the underlying molecular mechanisms are not well-defined. Excessive matrix metalloproteinase (MMP) activity is emerging as a key process but has not been systematically studied in HIV-associated TB. We performed a cross-sectional study of matrix turnover in HIV type 1 (HIV-1)-infected and -uninfected TB patients and controls, and a prospective cohort study of HIV-1-infected TB patients at risk of TB immune reconstitution inflammatory syndrome (TB-IRIS), in Cape Town, South Africa. Sputum and plasma MMP concentrations were quantified by Luminex, plasma procollagen III N-terminal propeptide (PIIINP) by enzyme-linked immunosorbent assay, and urinary lipoarabinomannan (LAM) by Alere Determine TB LAM assay. Peripheral blood mononuclear cells from healthy donors were cultured with Mycobacterium tuberculosis and extracellular matrix in a 3D model of TB granuloma formation. MMP activity differed between HIV-1-infected and -uninfected TB patients and corresponded with specific TB clinical phenotypes. HIV-1-infected TB patients had reduced pulmonary MMP concentrations, associated with reduced cavitation, but increased plasma PIIINP, compared to HIV-1-uninfected TB patients. Elevated extrapulmonary extracellular matrix turnover was associated with TB-IRIS, both before and during TB-IRIS onset. The predominant collagenase was MMP-8, which was likely neutrophil derived and M. tuberculosis-antigen driven. Mycobacterium tuberculosis-induced matrix degradation was suppressed by the MMP inhibitor doxycycline in vitro. MMP activity in TB differs by HIV-1 status and compartment, and releases matrix degradation products. Matrix turnover in HIV-1-infected patients is increased before and during TB-IRIS, informing novel diagnostic strategies. MMP inhibition is a potential host-directed therapy strategy for prevention and treatment of TB-IRIS. © The Author 2017. Published by Oxford

  2. Latent Tuberculosis Infection in an Urban Cohort: Screening and Treatment for Latent TB in an Urban Setting

    Science.gov (United States)

    Morano, Jamie P.; Walton, Mary R.; Zelenev, Alexei; Bruce, R. Douglas; Altice, Frederick L.

    2013-01-01

    Background Despite its benefit for treating active tuberculosis, directly observed therapy (DOT) for latent tuberculosis infection (LTBI) has been largely understudied among challenging inner city populations. Methods Utilizing questionnaire data from a comprehensive mobile healthcare clinic in New Haven, CT from 2003 to July 2011, a total of 2523 completed tuberculin skin tests (TST’s) resulted in 357 new LTBIs. Multivariate logistic regression correlated covariates of the two outcomes 1) initiation of isoniazid preventative therapy (IPT) and 2) completion of 9-months IPT. Results Of 357 new LTBIs, 86.3% (n=308) completed screening CXRs: 90.3% (n=278) were normal and 0.3% (n=1) with active tuberculosis. Of those completing CXR screening, 44.0% (n=135) agreed to IPT: 69.6% (n=94) selected DOT, and 30.4% (n=41) selected SAT. Initiating IPT was correlated with undocumented status (AOR=3.43; pmodels for LTBI treatment resulted in similar outcomes, yet outcomes were hampered by differential measurement bias between DOT and SAT participants. PMID:23728822

  3. A comparison of interferon-γ and IP-10 for the diagnosis of tuberculosis

    DEFF Research Database (Denmark)

    Holm, Line Lindebo; Rose, Michala Vaaben; Kimaro, Godfather

    2014-01-01

    OBJECTIVE: Interferon-γ and IP-10 release assays are diagnostic tests for tuberculosis infection. We have compared the accuracy of IP-10 and QuantiFERON-TB Gold In-tube [QFT-IT] in Tanzanian children suspected of having active tuberculosis (TB). METHODS: Hospitalized Tanzanian children...

  4. Assessing the effect of TB-HIV collaborative activities on knowledge ...

    African Journals Online (AJOL)

    Assessing the effect of TB-HIV collaborative activities on knowledge and perception of TB patients ... Tanzania Journal of Health Research ... which requires to be corrected as soon as possible so as to enable patients to undertake active steps ...

  5. Tuberculosis

    International Nuclear Information System (INIS)

    Aleksandrova, A.V.

    1983-01-01

    Classification of clinical forms of tuberculosis of respiratory organs is m ade. It is shown, that diagnosis, determination of the clinical form of pulmona ry tuberculosis, extent and phase of the process are mainly based on the data of roentgenologic studies and in certain cases tomography is preferable. Roentgenologic picture of primary tuberculosis, tuberculosis of intrathoracis l ymp nodes, dissemenated tuberculosis, focal and infiltrative tuberculosis of lungs, tuberculomas of lungs, cavernous and fibrocavernous form of pulmonary tub erculosis, cirrhotic tuberculosis of lungs, tuberculosis of upper respiratory tracks, tuberculous pleurite and tuberculosis of respiratory organs, combined wi th dust occupational diseases, has been described

  6. Discovery and Validation of a Six-Marker Serum Protein Signature for the Diagnosis of Active Pulmonary Tuberculosis.

    Science.gov (United States)

    De Groote, Mary A; Sterling, David G; Hraha, Thomas; Russell, Theresa M; Green, Louis S; Wall, Kirsten; Kraemer, Stephan; Ostroff, Rachel; Janjic, Nebojsa; Ochsner, Urs A

    2017-10-01

    New non-sputum biomarker tests for active tuberculosis (TB) diagnostics are of the highest priority for global TB control. We performed in-depth proteomic analysis using the 4,000-plex SOMAscan assay on 1,470 serum samples from seven countries where TB is endemic. All samples were from patients with symptoms and signs suggestive of active pulmonary TB that were systematically confirmed or ruled out for TB by culture and clinical follow-up. HIV coinfection was present in 34% of samples, and 25% were sputum smear negative. Serum protein biomarkers were identified by stability selection using L1-regularized logistic regression and by Kolmogorov-Smirnov (KS) statistics. A naive Bayes classifier using six host response markers (HR6 model), including SYWC, kallistatin, complement C9, gelsolin, testican-2, and aldolase C, performed well in a training set (area under the sensitivity-specificity curve [AUC] of 0.94) and in a blinded verification set (AUC of 0.92) to distinguish TB and non-TB samples. Differential expression was also highly significant ( P CA6 (carbonic anhydrase 6). Target product profiles (TPPs) for a non-sputum biomarker test to diagnose active TB for treatment initiation (TPP#1) and for a community-based triage or referral test (TPP#2) have been published by the WHO. With 90% sensitivity and 80% specificity, the HR6 model fell short of TPP#1 but reached TPP#2 performance criteria. In conclusion, we identified and validated a six-marker signature for active TB that warrants diagnostic development on a patient-near platform. Copyright © 2017 De Groote et al.

  7. Accelerating TB notification from the private health sector in Delhi, India.

    Science.gov (United States)

    Kundu, Debashish; Chopra, Kamal; Khanna, Ashwani; Babbar, Neeti; Padmini, T J

    2016-01-01

    In India, almost half of all patients with tuberculosis (TB) seek care in the private sector as the first point of care. The national programme is unable to support such TB patients and facilitate effective treatment, as there is no information on TB and Multi or Extensively Drug Resistant TB (M/XDR-TB) diagnosis and treatment in private sector. To improve this situation, Government of India declared TB a notifiable disease for establishing TB surveillance system, to extend supportive mechanism for TB treatment adherence and standardised practices in the private sector. But TB notification from the private sector is a challenge and still a lot needs to be done to accelerate TB notification. Delhi State TB Control Programme had taken initiatives for improving notification of TB cases from the private sector in 2014. Key steps taken were to constitute a state level TB notification committee to oversee the progress of TB notification efforts in the state and direct 'one to one' sensitisation of private practitioners (PPs) (in single PP's clinic, corporate hospitals and laboratories) by the state notification teams with the help of available tools for sensitising the PP on TB notification - TB Notification Government Order, Guidance Tool for TB Notification and Standards of TB Care in India. As a result of focussed state level interventions, without much external support, there was an accelerated notification of TB cases from the private sector. TB notification cases from the private sector rose from 341 (in 2013) to 4049 (by the end of March 2015). Active state level initiatives have led to increase in TB case notification. Copyright © 2016 Tuberculosis Association of India. Published by Elsevier B.V. All rights reserved.

  8. Anti-tuberculosis activity of -lactam antibiotics: prospects for the ...

    African Journals Online (AJOL)

    This review is prepared to show results on the anti-TB activity of -lactam antibiotics. -Lactams are among the oldest drugs with little or no side effects. Both in vitro studies and clinical data indicate that -lactams have a promising activity for use in the management of MDR-TB. More studies are required to define the interaction ...

  9. Asymptomatic Helminth Infection in Active Tuberculosis Is Associated with Increased Regulatory and Th-2 Responses and a Lower Sputum Smear Positivity

    DEFF Research Database (Denmark)

    Abate, E; Belayneh, M; Idh, J

    2015-01-01

    BACKGROUND: The impact of intestinal helminth infection on the clinical presentation and immune response during active tuberculosis (TB) infection is not well characterized. Our aim was to investigate whether asymptomatic intestinal helminth infection alters the clinical signs and symptoms as wel...

  10. A field evaluation of the Hardy TB MODS Kit™ for the rapid phenotypic diagnosis of tuberculosis and multi-drug resistant tuberculosis.

    Directory of Open Access Journals (Sweden)

    Laura Martin

    Full Text Available Even though the WHO-endorsed, non-commercial MODS assay offers rapid, reliable TB liquid culture and phenotypic drug susceptibility testing (DST at lower cost than any other diagnostic, uptake has been patchy. In part this reflects misperceptions about in-house assay quality assurance, but user convenience of one-stop procurement is also important. A commercial MODS kit was developed by Hardy Diagnostics (Santa Maria, CA, USA with PATH (Seattle, WA, USA to facilitate procurement, simplify procedures through readymade media, and enhance safety with a sealing silicone plate lid. Here we report the results from a large-scale field evaluation of the MODS kit in a government service laboratory.2446 sputum samples were cultured in parallel in Lowenstein-Jensen (LJ, conventional MODS and in the MODS kit. MODS kit DST was compared with conventional MODS (direct DST and proportion method (indirect DST. 778 samples (31.8% were Mycobacterium tuberculosis culture-positive. Compared to conventional MODS the sensitivity, specificity, positive, and negative predictive values (95% confidence intervals of the MODS Kit were 99.3% (98.3-99.8%, 98.3% (97.5-98.8%, 95.8% (94.0-97.1%, and 99.7% (99.3-99.9%. Median (interquartile ranges time to culture-positivity (and rifampicin and isoniazid DST was 10 (9-13 days for conventional MODS and 8.5 (7-11 for MODS Kit (p<0.01. Direct rifampicin and isoniazid DST in MODS kit was almost universally concordant with conventional MODS (97.9% agreement, 665/679 evaluable samples and reference indirect DST (97.9% agreement, 687/702 evaluable samples.MODS kit delivers performance indistinguishable from conventional MODS and offers a convenient, affordable alternative with enhanced safety from the sealing silicone lid. The availability in the marketplace of this platform, which conforms to European standards (CE-marked, readily repurposed for second-line DST in the near future, provides a fresh opportunity for improving equity of

  11. Active case finding of tuberculosis in Europe: a Tuberculosis Network European Trials Group (TBNET) survey

    DEFF Research Database (Denmark)

    Bothamley, G H; Ditiu, L; Migliori, G B

    2008-01-01

    Tuberculosis control depends on successful case finding and treatment of individuals infected with Mycobacterium tuberculosis. Passive case finding is widely practised: the present study aims to ascertain the consensus and possible improvements in active case finding across Europe. Recommendations...... from national guidelines were collected from 50 countries of the World Health Organization European region using a standard questionnaire. Contacts are universally screened for active tuberculosis and latent tuberculosis infection (LTBI). Most countries (>70%) screen those with HIV infection, prisoners...... and in-patient contacts. Screening of immigrants is related to their contribution to national rates of tuberculosis. Only 25 (50%) out of 50 advise a request for symptoms in their guidelines. A total of 36 (72%) out of 50 countries recommend sputum examination for those with a persistent cough; 13...

  12. Tomographic Aspects of Advanced Active Pulmonary Tuberculosis and Evaluation of Sequelae following Treatment

    Directory of Open Access Journals (Sweden)

    Rafael Barcelos Capone

    2017-01-01

    Full Text Available Objectives. To evaluate tomographic changes in pulmonary tuberculosis (TB, degree of agreement among three radiologists regarding tomographic diagnoses, and sequelae following treatment. Methods. Cross-sectional and descriptive study of 74 TB patients confirmed by sputum culture and chest computed tomography before (CT1 and 6 months after (CT2 drug therapy. Results were performed by three radiologists blinded to clinical and laboratory results. Results. Main findings in CT1 included nodules indicating the presence of a tree-in-bud pattern in 93% of cases, ill-defined nodules in 84% of cases, consolidation in 77% of cases, architectural distortion in 71% of cases, cavitary lesions in 62% of cases, and ground glass opacities in 37% of cases. Airway involvement, characterized by increased thickness and dilatation of the bronchial walls, occurred in 93% of cases. Pleural involvement occurred in 54%. There was an agreement on active TB among the three radiologists in 85% of cases. The results in CT2 indicated the presence of architectural distortion in 91% of cases and cylindrical bronchiectasis in 86%. Conclusions. The study established a tomographic pattern for diagnosis of active TB characterized by the presence of airway nodules, consolidation, architectural distortion, and cavitary lesions, and an almost complete degree of agreement (Kappa was observed among the radiologists (0.85. CT after treatment assists in defining the cure.

  13. Tuberculosis active case finding in Cambodia: a pragmatic, cost-effectiveness comparison of three implementation models.

    Science.gov (United States)

    James, Richard; Khim, Keovathanak; Boudarene, Lydia; Yoong, Joanne; Phalla, Chea; Saint, Saly; Koeut, Pichenda; Mao, Tan Eang; Coker, Richard; Khan, Mishal Sameer

    2017-08-22

    Globally, almost 40% of tuberculosis (TB) patients remain undiagnosed, and those that are diagnosed often experience prolonged delays before initiating correct treatment, leading to ongoing transmission. While there is a push for active case finding (ACF) to improve early detection and treatment of TB, there is extremely limited evidence about the relative cost-effectiveness of different ACF implementation models. Cambodia presents a unique opportunity for addressing this gap in evidence as ACF has been implemented using different models, but no comparisons have been conducted. The objective of our study is to contribute to knowledge and methodology on comparing cost-effectiveness of alternative ACF implementation models from the health service perspective, using programmatic data, in order to inform national policy and practice. We retrospectively compared three distinct ACF implementation models - door to door symptom screening in urban slums, checking contacts of TB patients, and door to door symptom screening focusing on rural populations aged above 55 - in terms of the number of new bacteriologically-positive pulmonary TB cases diagnosed and the cost of implementation assuming activities are conducted by the national TB program of Cambodia. We calculated the cost per additional case detected using the alternative ACF models. Our analysis, which is the first of its kind for TB, revealed that the ACF model based on door to door screening in poor urban areas of Phnom Penh was the most cost-effective (249 USD per case detected, 737 cases diagnosed), followed by the model based on testing contacts of TB patients (308 USD per case detected, 807 cases diagnosed), and symptomatic screening of older rural populations (316 USD per case detected, 397 cases diagnosed). Our study provides new evidence on the relative effectiveness and economics of three implementation models for enhanced TB case finding, in line with calls for data from 'routine conditions' to be included

  14. Tuberculosis Treatment

    African Journals Online (AJOL)

    Tuberculosis Treatment, Lusaka, Zambia. 1. 2. 2. 3. 3 ... TB treatment has contributed to the steady rise of TB incidence in ... respondents (89.4%) had positive attitude towards TB treatment ..... respondents described feelings of depression, anger and apathy .... Journal of Personality and Social Psychology,. 1979, 37:1-11.

  15. Radiological and clinical pattern of pulmonary Tuberculosis in selected TB clinics in Khartoum

    Energy Technology Data Exchange (ETDEWEB)

    Dongola, Nagwa Ali Mohammad [Faculty of Medicine, University of Khartoum, Khartoum (Sudan)

    1998-12-31

    160 adult tuberculous patients were selected randomly from Al shaab and Abu Anja hospital, to (1) study the clino-radiological pattern of the disease, (2) to determine the percentage of radiologically-positive patients and (3) to study the frequency of the initial presenting symptoms and to correlate them with their x-ray findings. A flow-sheet was filled and proper clinical examination was conducted for each patient. Tuberclin test, 3 sputa examinations, ESR and chest x-ray were done for every patient. Three quarters of the patients were males in the young age group and most of the patients were of low socioeconomic status. The main presenting symptoms were productive cough, chest pain, dysnoea, fever, weight loss and malaise. Patients presented rather late, with a mean period of four months. 57 % of patients were sputum positive, 80% Tuberclin-positive and 98% had a high erythrocyte sedimentation rate (ESR). 15% of patients had radiological features of primary diseases of which hilar lymph-adenopathy was the commonest, while consolidation was the commonest parenchymal lesion. In post-primary disease fibrocavitory type was the commonest and together with exudative lesions constituted 98% of parenchymal lesions. 90% of patients had typical upper or middle zone infiltrates and 10% had lower lung field tuberculosis. 14% of patients had pleural effusion. 60% of patients had moderate disease extent in the chest, 30% far-advanced and 10% minimal lesions in their chest x-ray.(Author) 134 ref. , 17 tabs. , 23 fig.

  16. Radiological and clinical pattern of pulmonary Tuberculosis in selected TB clinics in Khartoum

    International Nuclear Information System (INIS)

    Dongola, Nagwa Ali Mohammad

    1997-01-01

    160 adult tuberculous patients were selected randomly from Al shaab and Abu Anja hospital, to (1) study the clino-radiological pattern of the disease, (2) to determine the percentage of radiologically-positive patients and (3) to study the frequency of the initial presenting symptoms and to correlate them with their x-ray findings. A flow-sheet was filled and proper clinical examination was conducted for each patient. Tuberclin test, 3 sputa examinations, ESR and chest x-ray were done for every patient. Three quarters of the patients were males in the young age group and most of the patients were of low socioeconomic status. The main presenting symptoms were productive cough, chest pain, dysnoea, fever, weight loss and malaise. Patients presented rather late, with a mean period of four months. 57 % of patients were sputum positive, 80% Tuberclin-positive and 98% had a high erythrocyte sedimentation rate (ESR). 15% of patients had radiological features of primary diseases of which hilar lymph-adenopathy was the commonest, while consolidation was the commonest parenchymal lesion. In post-primary disease fibrocavitory type was the commonest and together with exudative lesions constituted 98% of parenchymal lesions. 90% of patients had typical upper or middle zone infiltrates and 10% had lower lung field tuberculosis. 14% of patients had pleural effusion. 60% of patients had moderate disease extent in the chest, 30% far-advanced and 10% minimal lesions in their chest x-ray.(Author)

  17. Reaching the underserved: Active tuberculosis case finding in urban slums in southeastern Nigeria

    Directory of Open Access Journals (Sweden)

    Chidubem L Ogbudebe

    2015-01-01

    Conclusions: There is high prevalence of TB in Nigeria slum population. Targeted screening of out-patients, TB contacts, and HIV-infected patients should be optimized for active TB case finding in Nigeria.

  18. Community referral for presumptive TB in Nigeria: a comparison of four models of active case finding

    Directory of Open Access Journals (Sweden)

    A. O. Adejumo

    2016-02-01

    Full Text Available Abstract Background Engagement of communities and civil society organizations is a critical part of the Post-2015 End TB Strategy. Since 2007, many models of community referral have been implemented to boost TB case detection in Nigeria. Yet clear insights into the comparative TB yield from particular approaches have been limited. Methods We compared four models of active case finding in three Nigerian states. Data on presumptive TB case referral by community workers (CWs, TB diagnoses among referred clients, active case finding model characteristics, and CWs compensation details for 2012 were obtained from implementers and CWs via interviews and log book review. Self-reported performance data were triangulated against routine surveillance data to assess concordance. Analysis focused on assessing the predictors of presumptive TB referral. Results CWs referred 4–22 % of presumptive TB clients tested, and 4–24 % of the total TB cases detected. The annual median referral per CW ranged widely among the models from 1 to 48 clients, with an overall average of 13.4 referrals per CW. The highest median referrals (48 per CW/yr and mean TB diagnoses (7.1/yr per CW (H =70.850, p < 0.001 was obtained by the model with training supervision, and $80/quarterly payments (Comprehensive Quotas-Oriented model. The model with irregularly supervised, trained, and compensated CWs contributed the least to TB case detection with a median of 13 referrals per CW/yr and mean of 0.53 TB diagnoses per CW/yr. Hours spent weekly on presumptive TB referral made the strongest unique contribution (Beta = 0.514, p < 0.001 to explaining presumptive TB referral after controlling for other variables. Conclusion All community based TB case-finding projects studied referred a relative low number of symptomatic individuals. The study shows that incentivized referral, appropriate selection of CWs, supportive supervision, leveraged treatment support roles, and a

  19. risk factors of active tuberculosis in people living with hiv/aids in ...

    African Journals Online (AJOL)

    Abrham

    2011-07-02

    Jul 2, 2011 ... R, Lisse I, Samb B et al: Tuberculosis in. Bissau: incidence and risk factors in an urban community in sub-Saharan Africa. Int J. Epidemiol 2004;33(1):163-172. 10. MOH: TB, leprosy and TB/HIV prevention and control program manual. Addis Ababa,. Ethiopia. 2008. 11. Fugnudo Mbeki AG, Kuwala Lube: ...

  20. The use of combined heart rate response and accelerometry to assess the level and predictors of physical activity in tuberculosis patients in Tanzania

    DEFF Research Database (Denmark)

    Faurholt-Jepsen, Maria; Faurholt-Jepsen, Daniel; Range, N

    2014-01-01

    , HIV and physical activity estimates were assessed in multivariable linear regression models adjusted for age, sex, haemoglobin and alpha-1-acid glycoprotein (AGP). Sputum-positive [eB 0·43, 95% confidence interval (CI) 0·29-0·64] and sputum-negative (eB 0·67, 95% CI 0·47-0·94) TB as well as HIV......SUMMARY: We assessed the role of tuberculosis (TB) disease and HIV infection on the level of physical activity. A combined heart rate and movement sensor was used to assess habitual physical activity in TB patients and non-TB controls. The association between sputum-negative TB, sputum-positive TB...... infection (eB 0·59, 95% CI 0·46-0·75) were associated with reduced activity compared to controls. Anaemia accounted for a substantial part of the effects of HIV, while elevated AGP primarily mediated the TB effect. The level of physical activity is highly influenced by TB and HIV, and mainly mediated...

  1. Symptom screening rules to identify active pulmonary tuberculosis: Findings from the Zambian South African Tuberculosis and HIV/AIDS Reduction (ZAMSTAR trial prevalence surveys.

    Directory of Open Access Journals (Sweden)

    M M Claassens

    Full Text Available High tuberculosis (TB burden countries should consider systematic screening among adults in the general population. We identified symptom screening rules to be used in addition to cough ≥2 weeks, in a context where X-ray screening is not feasible, aiming to increase the sensitivity of screening while achieving a specificity of ≥85%.We used 2010 Zambia South Africa Tuberculosis and HIV/AIDS Reduction (ZAMSTAR survey data: a South African (SA training dataset, a SA testing dataset for internal validation and a Zambian dataset for external validation. Regression analyses investigated relationships between symptoms or combinations of symptoms and active disease. Sensitivity and specificity were calculated for candidate rules.Among all participants, the sensitivity of using only cough ≥2 weeks as a screening rule was less than 25% in both SA and Zambia. The addition of any three of six TB symptoms (cough <2 weeks, night sweats, weight loss, fever, chest pain, shortness of breath, or 2 or more of cough <2 weeks, night sweats, and weight loss, increased the sensitivity to ~38%, while reducing specificity from ~95% to ~85% in SA and ~97% to ~92% in Zambia. Among HIV-negative adults, findings were similar in SA, whereas in Zambia the increase in sensitivity was relatively small (15% to 22%.High TB burden countries should investigate cost-effective strategies for systematic screening: one such strategy could be to use our rule in addition to cough ≥2 weeks.

  2. Congenital tuberculosis

    African Journals Online (AJOL)

    Prof Ezechukwu

    2012-06-20

    Jun 20, 2012 ... Key words: Congenital tuberculo- sis, case report, miliary tuberculosis. Introduction. Congenital tuberculosis defines tuberculosis in infants of .... tary TB and otitis media, resulting in seizures, deafness, and death. It is therefore not surprising that the index case who presented at twelve weeks of age, had ...

  3. Bovine tuberculosis

    Science.gov (United States)

    Tuberculosis (TB) in animals and humans may result from exposure to bacilli within the Mycobacterium tuberculosis complex (i.e., M. tuberculosis, M. bovis, M. africanum, M. pinnipedii, M. microti, M. caprae, or M. canetti) . Mycobacterium bovis is the species most often isolated from tuberculous cat...

  4. ASSESSMENT OF EFFECT OF MDR - TB/TB ON SOCIAL, FUNCTIONAL AND ECONOMIC WELL BEING OF PATIENTS – A CROSS SECTIONAL STUDY

    Directory of Open Access Journals (Sweden)

    Shiv Kumar

    2015-06-01

    Full Text Available CONTEXT : Tuberculosis is a contagious disease with social stigma attached to it. Various problems which are social and economic in nature are faced by TB patient. Therefore , it is essential to explore the overall effect of MDR - TB/TB on health and patients perception of Well - being. AIMS : To Document the effect of MDR - TB/TB on social , functional and economic well - being of patients. SETTINGS AND DESIGN : A Cross - sectional study , Conveniently Recruited 68 MDR - TB Patients and 136 non - MDR - TB Patients (from Rural as well as urban Area of Surat District diagnosed by CBNAAT were interviewed for investigating the effect of Tuberculosis. METHODS AND MATERIAL : A pre - tested standardized semi - structured questionnaire was used. Data was collected about socio - demographic profile of patients and interpreted in table. Data about effect of MDR - TB/TB was collected on Likert Scale and Frequency was calculated and Data wa s plotted on multiple bar charts. RESULTS : As compared to healthy status in the past , 93% MDR - TB and 82% TB patients have decreased ability to do work , about half of MDR - TB Patients and TB Patients have detiorated relations with family members , 67% of stud y participants have developed disharmonious relations with neighbor’s , 55% of Study participants have decreased income , 88% of study participants have decreased performance in day to day activities and 78% of study participants have faced discordial and di srespectful behavior from co - workers. CONCLUSION : Working ability more detiorated in MDR - TB patients while rest of the effect on social , functional and economic well - being is same in both TB and Multi Drug Resistant TB patients. This study emphasizes very clearly that social stigma still persist in community about Tuberculosis which needs to be eliminated in community by behavior change communication by health workers at all levels of health care.

  5. Translating childhood tuberculosis case management research into operational policies.

    Science.gov (United States)

    Safdar, N; Hinderaker, S G; Baloch, N A; Enarson, D A; Khan, M A; Morkve, O

    2011-08-01

    The control of childhood tuberculosis (TB) has been of low priority in TB programmes in high-burden settings. The objective of this paper was to describe the development and testing of tools for the management of childhood TB. The Pakistan National TB Control Programme embarked on a number of activities, including the establishment of policy guidelines for the management of childhood TB and later a guidance document, 'Case Management Desk Guide and Structured Monitoring', to demonstrate the implementation of childhood TB interventions in a programme context. Initial results showed improved case finding and treatment outcome in implementation sites compared with control districts. However, further programme attention is required to improve quality.

  6. Tuberculosis among drug users and homeless persons: impact of voluntary X-ray investigation on active case finding.

    Science.gov (United States)

    Goetsch, U; Bellinger, O K; Buettel, K-L; Gottschalk, R

    2012-08-01

    Illicit drug use and homelessness are major contributors to the incidence of tuberculosis (TB) among inhabitants of major cities. The primary objective of this study was to establish a sustainable low-threshold chest X-ray screening programme for pulmonary TB among illicit drug users and homeless persons and to integrate this into the existing public health programme for active case finding. A secondary objective was to estimate the coverage of the programme, assess other risk factors and determine TB rates and treatment outcome in these two groups. Illicit drug users and homeless persons were asked to voluntarily participate in an X-ray screening programme. The coverage of the intervention, total number and characteristics of cases and the follow-up of treatment were assessed. A total of 4,529 chest radiographs were made from 3,477 persons, of whom 66% were homeless and 34% were illicit drug users, between May 2002 and April 2007. Coverage for screening once every 2 years ranged between 18 and 26%. Thirty-nine TB cases (14 drug users, 25 homeless persons) were identified, representing 8.7% of the total case load of 448 notified cases of pulmonary TB in Frankfurt during this period. Among the drug users, human immunodeficiency virus coinfection (10/14) seemed to play a key role in the development of TB. The case-finding rate of 861/100,000 radiographs (1,122/100,000 persons) is as high as that in routine contact investigations (1,078/100,000). Among all individuals with TB, 76% completed treatment. A novel targeted TB screening approach with voluntary radiographic examination of illicit drug users and homeless persons can be integrated into the existing public TB prevention programme and provides a high case-finding rate.

  7. THE ANTI-TB DRUG SENSITIVITY OF MYCOBACTERIUM TUBERCULOSIS FROM CEREBROSPINAL FLUID AND BONE TISSUE BIOPSY SPECIMENS OF PATIENTS SUSPECTED TUBERCULOUS MENINGITIS AND SPINAL TB IN DR SOETOMO HOSPITAL INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Made Mertaniasih

    2014-09-01

    Full Text Available Tuberculous meningitis (TBM is an infection of meningens which potentially life threatening with significant morbidity and mortality. Spinal TB has the same problem with TBM, infection in bone and joint, the delayed diagnosis worsens the prognosis. The rapid and accurate diagnosis plus promt adequate treatment is essential for the good outcome. The aim of this research is to study the first line drug sensitivity of Mycobacterium tuberculosis isolated from specimens of cerebrospinal fluid from suspected tuberculous meningitis patients and bone tissue biopsy from suspected spinal TB patients. The method of this research is TB Laboratory examination in Department of Clinical Microbiology – Dr. Soetomo General Hospital, Indonesia, using the gold standard liquid culture method MGIT 960 System (Becton Dickinson and solid culture method with Lowenstein-Jensen medium. The specimens CSF from 50 TBM patients at January 2013 until May 2014. Positive isolate detection of Mycobacterium tuberculosis complex were 11 isolates (22%, which sensitivity 100% (11/11 isolates to Rifampin (R, Pyrazinamide (Z, Ethambutol (E, and Streptomycin (S; one isolate resistant to Isoniazid, sensitivity to Isoniazid 90,90% (10/11; and received 21 specimens of bone tissue biopsy which positive 5 isolates (23%, all isolates sensitive 100% (5/5 isolates to Rifampin and Pyrazinamide, and 1 isolates resistant to Isoniazid, Ethambutol, and Streptomycin, in which sensitivity 80% (4/5 isolates to Isoniazid, Ethambutol, and Streptomycin. The conclusion of this research is positivity detection 22% of CSF specimens, and 23% of bone tissue biopsy were low. All isolates sensitive 100% to Rifampin and Pyrazinamide, and 80-90% sensitive to Isoniazid.

  8. Tuberculosis screening at a diabetes clinic in the Republic of the Marshall Islands

    Directory of Open Access Journals (Sweden)

    R.M. Trinidad

    2016-12-01

    Full Text Available Setting: Tuberculosis (TB and diabetes mellitus (DM are prominent public health problems in the Republic of the Marshall Islands, a small island nation with high rates of tuberculosis and diabetes. Objective: Evaluate the rate of active and latent TB in a Pacific Island DM clinic. Design: In one DM clinic on the island of Ebeye, 213 adult patients aged 27–86 years completed tuberculin skin testing and TB work-up between April 2010 and March 2012. Results: Screening for TB led to the diagnosis of 77 patients with TB infection and 11 patients with TB disease. From these data, the prevalence of TB disease among DM patients in the clinic exceeded 5% (95% CI 2.2%–8.1%. All patients who completed TB screening were at high risk of TB disease, and those with DM aged ≤50 years had a higher risk of TB disease than those with DM over age 50 (RR 3.1, C.I. 1.0–9.7, p= 0.05. Conclusion: The experience at the Ebeye Diabetes Clinic demonstrates that screening DM patients for TB can identify significant rates of TB infection and TB disease, and should be considered for other settings with a high background TB incidence. Further assessment of TB risks should explore age, gender, and level of diabetes control. Keywords: Tuberculosis, Diabetes, Pacific Islands, Bi-directional screening

  9. Bactericidal activity of an imidazo[1, 2-a]pyridine using a mouse M. tuberculosis infection model.

    Directory of Open Access Journals (Sweden)

    Yong Cheng

    Full Text Available Tuberculosis remains a global threat due in part to the long treatment regimen and the increased prevalence of drug resistant M. tuberculosis strains. Therefore, new drug regimens are urgently required to combat this deadly disease. We previously synthesized and evaluated a series of new anti-tuberculosis compounds which belong to the family of imidazo[1,2-a]pyridines. This family of compounds showed low nM MIC (minimal inhibitory concentration values against M. tuberculosis in vitro. In this study, a derivative of imidazo[1,2-a]pyridines, (N-(4-(4-chlorophenoxybenzyl-2,7-dimethylimidazo[1,2-a]pyridine-3-carboxamide (ND-09759, was selected as a promising lead compound to determine its protective efficacy using a mouse infection model. Pharmacokinetic analysis of ND-09759 determined that at a dosage of 30 mg/kg mouse body weight (PO gave a maximum serum drug concentration (Cmax of 2.9 µg/ml and a half-life of 20.1 h. M. tuberculosis burden in the lungs and spleens was significantly decreased in mice treated once daily 6 days per week for 4-weeks with ND-09759 compared to untreated mice and this antibiotic activity was equivalent to isoniazid (INH and rifampicin (RMP, two first-line anti-TB drugs. We observed slightly higher efficacy when using a combination of ND-09759 with either INH or RMP. Finally, the histopathological analysis revealed that infected mice treated with ND-09759 had significantly reduced inflammation relative to untreated mice. In conclusion, our findings indicate ND-09759 might be a potent candidate for the treatment of active TB in combination with current standard anti-TB drugs.

  10. MicroRNA-223 Is Upregulated in Active Tuberculosis Patients and Inhibits Apoptosis of Macrophages by Targeting FOXO3.

    Science.gov (United States)

    Xi, Xiue; Zhang, Chunxiao; Han, Wei; Zhao, Huayang; Zhang, Huiqiang; Jiao, Junhua

    2015-12-01

    Macrophage apoptosis is a host innate defense mechanism against tuberculosis (TB). In this study, we aimed to investigate the role of microRNA-223 (miR-223) in macrophage apoptosis of TB. We analyzed apoptosis in peripheral blood macrophages of active TB patients, infected human macrophages (TDMs and MDMs) with the Mycobacterium tuberculosis (Mtb) strain H37Rv, and observed the expression of miR-223 to investigate the relationship between miR-223 and macrophage apoptosis induced by Mtb. The apoptosis rate of peripheral blood macrophages decreased in active TB patients compared with healthy controls, and miR-223 expression increased significantly in macrophages after H37Rv infection. Transfection of human macrophages (TDMs and MDMs) with miR-223 inhibited macrophage apoptosis. We also demonstrated that miR-223 directly suppressed forkhead box O3 (FOXO3), and FOXO3 played a critical role as a mediator of the biological effects of miR-223 in macrophage apoptosis. The overexpression of FOXO3 remarkably reversed the apoptosis inhibitory effect of miR-223. Our data provide new clues for the essential role of miR-223 in the regulation of anti-Mtb-directed immune responses, which relies on the regulation of FOXO3 expression.

  11. 2-Thiophenecarboxylic acid hydrazide Derivatives: Synthesis and Anti-Tuberculosis Studies

    Science.gov (United States)

    Fahmi, M. R. G.; Khumaidah, L.; Ilmiah, T. K.; Fadlan, A.; Santoso, M.

    2018-04-01

    One of the most frequent and widespread infectious diseases especially in developing countries is tuberculosis (TB). The number of TB drug resistant tend to increase, and there has been no new TB drug introduce since the 1960s. Six 2-Thiophenecarboxylic acid hydrazide derivatives were synthesized in 90-97% yields, and 2-thiophenecarbonylhydrazone-5, 7-dibromoisatin showed the highest activity in inhibiting M. tuberculosis H37Rv.

  12. An ancestral human genetic variant linked to an ancient disease: A novel association of FMO2 polymorphisms with tuberculosis (TB in Ethiopian populations provides new insight into the differential ethno-geographic distribution of FMO2*1.

    Directory of Open Access Journals (Sweden)

    Ephrem Mekonnen

    Full Text Available The human FMO2 (flavin-containing monooxygenase 2 gene has been shown to be involved in innate immunity against microbial infections, including tuberculosis (TB, via the modulation of oxidative stress levels. It has also been found to possess a curious loss-of-function mutation (FMO2*1/FMO2*2 that demonstrates a distinctive differentiation in expression, function and ethno-geographic distribution. However, despite evidences of ethnic-specific genetic associations in the inflammatory profile of TB, no studies were done to investigate whether these patterns of variations correlate with evidences for the involvement of FMO2 in antimicrobial immune responses and ethnic differences in the distribution of FMO2 polymorphisms except for some pharmacogenetic data that suggest a potentially deleterious role for the functional variant (FMO2*1. This genetic epidemiological study was designed to investigate whether there is an association between FMO2 polymorphisms and TB, an ancient malady that remains a modern global health concern, in a sub-Saharan Africa setting where there is not only a relatively high co-prevalence of the disease and the ancestral FMO2*1 variant but also where both Mycobcaterium and Homo sapiens are considered to have originated and co-evolved. Blood samples and TB related clinical data were collected from ascertained TB cases and unrelated household controls (n = 292 from 3 different ethnic groups in Ethiopia. Latent Mtb infection was determined using Quantiferon to develop reliable TB progression phenotypes. We sequenced exonic regions of FMO2.We identified for the first time an association between FMO2 and TB both at the SNP and haplotype level. Two novel SNPs achieved a study-wide significance [chr1:171181877(A, p = 3.15E-07, OR = 4.644 and chr1:171165749(T, p = 3.32E-06, OR = 6.825] while multiple SNPs (22 showed nominal signals. The pattern of association suggested a protective effect of FMO2 against both active and latent TB

  13. Socio-demographic and AIDS-related factors associated with tuberculosis stigma in southern Thailand: a quantitative, cross-sectional study of stigma among patients with TB and healthy community members

    Directory of Open Access Journals (Sweden)

    Strauss Ronald P

    2011-08-01

    Full Text Available Abstract Background Tuberculosis (TB remains one of the most important infectious diseases worldwide. A comprehensive approach towards disease control that addresses social factors including stigma is now advocated. Patients with TB report fears of isolation and rejection that may lead to delays in seeking care and could affect treatment adherence. Qualitative studies have identified socio-demographic, TB knowledge, and clinical determinants of TB stigma, but only one prior study has quantified these associations using formally developed and validated stigma scales. The purpose of this study was to measure TB stigma and identify factors associated with TB stigma among patients and healthy community members. Methods A cross-sectional study was performed in southern Thailand among two different groups of participants: 480 patients with TB and 300 healthy community members. Data were collected on socio-demographic characteristics, TB knowledge, and clinical factors. Scales measuring perceived TB stigma, experienced/felt TB stigma, and perceived AIDS stigma were administered to patients with TB. Community members responded to a community TB stigma and community AIDS stigma scale, which contained the same items as the perceived stigma scales given to patients. Stigma scores could range from zero to 30, 33, or 36 depending on the scale. Three separate multivariable linear regressions were performed among patients with TB (perceived and experience/felt stigma and community members (community stigma to determine which factors were associated with higher mean TB stigma scores. Results Only low level of education, belief that TB increases the chance of getting AIDS, and AIDS stigma were associated with higher TB stigma scores in all three analyses. Co-infection with HIV was associated with higher TB stigma among patients. All differences in mean stigma scores between index and referent levels of each factor were less than two points, except for

  14. Direct Application of the INNO-LiPA Rif.TB Line-Probe Assay for Rapid Identification of Mycobacterium tuberculosis Complex Strains and Detection of Rifampin Resistance in 360 Smear-Positive Respiratory Specimens from an Area of High Incidence of Multidrug-Resistant Tuberculosis

    Science.gov (United States)

    Viveiros, Miguel; Leandro, Clara; Rodrigues, Liliana; Almeida, Josefina; Bettencourt, Rosário; Couto, Isabel; Carrilho, Lurdes; Diogo, José; Fonseca, Ana; Lito, Luís; Lopes, João; Pacheco, Teresa; Pessanha, Mariana; Quirim, Judite; Sancho, Luísa; Salfinger, Max; Amaral, Leonard

    2005-01-01

    The INNO-LiPA Rif.TB assay for the identification of Mycobacterium tuberculosis complex strains and the detection of rifampin (RIF) resistance has been evaluated with 360 smear-positive respiratory specimens from an area of high incidence of multidrug-resistant tuberculosis (MDR-TB). The sensitivity when compared to conventional identification/culture methods was 82.2%, and the specificity was 66.7%; the sensitivity and specificity were 100.0% and 96.9%, respectively, for the detection of RIF resistance. This assay has the potential to provide rapid information that is essential for the effective management of MDR-TB. PMID:16145166

  15. Optimal treatment interruptions control of TB transmission model

    Science.gov (United States)

    Nainggolan, Jonner; Suparwati, Titik; Kawuwung, Westy B.

    2018-03-01

    A tuberculosis model which incorporates treatment interruptions of infectives is established. Optimal control of individuals infected with active TB is given in the model. It is obtained that the control reproduction numbers is smaller than the reproduction number, this means treatment controls could optimize the decrease in the spread of active TB. For this model, controls on treatment of infection individuals to reduce the actively infected individual populations, by application the Pontryagins Maximum Principle for optimal control. The result further emphasized the importance of controlling disease relapse in reducing the number of actively infected and treatment interruptions individuals with tuberculosis.

  16. Active case finding of tuberculosis in Europe: a Tuberculosis Network European Trials Group (TBNET) survey

    DEFF Research Database (Denmark)

    Bothamley, G.H.; Ditiu, L.; Migliori, G.B.

    2008-01-01

    countries do not, even if the chest radiograph suggests tuberculosis. Nearly all countries (49 out of 50) use tuberculin skin testing (TST); 27 (54%) out of 50 countries also perform chest radiography irrespective of the TST result. Interpretation of the TST varies widely. All countries use 6-9 months...... of isoniazid for treatment of LTBI, with an estimated median (range) uptake of 55% (5-92.5%). Symptoms and sputum examination could be used more widely when screening for active tuberculosis. Treatment of latent tuberculosis infection might be better focused by targeted use of interferon-gamma release assays...

  17. Collaborative activities and treatment outcomes in patients with HIV-associated tuberculosis in Viet Nam.

    Science.gov (United States)

    Huyen, T T T; Nhung, N V; Shewade, H D; Hoa, N B; Harries, A D

    2016-03-21

    The National Tuberculosis (TB) Programme in Viet Nam and Ho Chi Minh City (HCMC). To determine 1) at national level between 2011 and 2013, the relationship between human immunodeficiency virus (HIV) testing, uptake of TB-HIV interventions and adverse treatment outcomes among TB-HIV patients; and 2) in HCMC in 2013, patient characteristics associated with adverse outcomes. An ecological study reviewing aggregate nationwide data and a retrospective cohort review in HCMC. Nationwide, from 2011 to 2013, HIV testing increased in TB patients from 58% to 68% and antiretroviral therapy (ART) increased in TB-HIV patients from 54% to 63%. Adverse treatment outcomes in TB-HIV patients increased from 24% to 27%, largely due to transfer out (5-9% increase) and death. The Northern and Highland regions showed poor uptake of TB-HIV interventions. In HCMC, 303 (27%) of 1110 TB-HIV patients had adverse outcomes, with higher risks observed in those with previously treated TB, those diagnosed as HIV-positive before TB onset and those never placed on cotrimoxazole or ART. Despite improving HIV testing rates and TB-HIV interventions, adverse outcomes in TB-HIV patients remain at about 26%. Characteristics predicting higher risk of adverse outcomes must be addressed if Viet Nam wishes to end the TB epidemic by 2030.

  18. Healthcare Worker Preferences for Active Tuberculosis Case Finding Programs in South Africa: A Best-Worst Scaling Choice Experiment.

    Directory of Open Access Journals (Sweden)

    Nathan N O'Hara

    Full Text Available Healthcare workers (HCWs in South Africa are at a high risk of developing active tuberculosis (TB due to their occupational exposures. This study aimed to systematically quantify and compare the preferred attributes of an active TB case finding program for HCWs in South Africa.A Best-Worst Scaling choice experiment estimated HCW's preferences using a random-effects conditional logit model. Latent class analysis (LCA was used to explore heterogeneity in preferences."No cost", "the assurance of confidentiality", "no wait" and testing at the occupational health unit at one's hospital were the most preferred attributes. LCA identified a four class model with consistent differences in preference strength. Sex, occupation, and the time since a previous TB test were statistically significant predictors of class membership.The findings support the strengthening of occupational health units in South Africa to offer free and confidential active TB case finding programs for HCWs with minimal wait times. There is considerable variation in active TB case finding preferences amongst HCWs of different gender, occupation, and testing history. Attention to heterogeneity in preferences should optimize screening utilization of target HCW populations.

  19. The effectiveness and cost-effectiveness of screening for active tuberculosis among migrants in the EU/EEA: a systematic review

    Science.gov (United States)

    Greenaway, Christina; Pareek, Manish; Abou Chakra, Claire-Nour; Walji, Moneeza; Makarenko, Iuliia; Alabdulkarim, Balqis; Hogan, Catherine; McConnell, Ted; Scarfo, Brittany; Christensen, Robin; Tran, Anh; Rowbotham, Nick; Noori, Teymur; van der Werf, Marieke J; Pottie, Kevin; Matteelli, Alberto; Zenner, Dominik; Morton, Rachael L

    2018-01-01

    Background : The foreign-born population make up an increasing and large proportion of tuberculosis (TB) cases in European Union/European Economic Area (EU/EEA) low-incidence countries and challenge TB elimination efforts. Methods : We conducted a systematic review to determine effectiveness (yield and performance of chest radiography (CXR) to detect active TB, treatment outcomes and acceptance of screening) and a second systematic review on cost-effectiveness of screening for active TB among migrants living in the EU/EEA. Results : We identified six systematic reviews, one report and three individual studies that addressed our aims. CXR was highly sensitive (98%) but only moderately specific (75%). The yield of detecting active TB with CXR screening among migrants was 350 per 100,000 population overall but ranged widely by host country (110–2,340), migrant type (170–1,192), TB incidence in source country (19–336) and screening setting (220–1,720). The CXR yield was lower (19.6 vs 336/100,000) and the numbers needed to screen were higher (5,076 vs 298) among migrants from source countries with lower TB incidence (≤ 50 compared with ≥ 350/100,000). Cost-effectiveness was highest among migrants originating from high (> 120/100,000) TB incidence countries. The foreign-born had similar or better TB treatment outcomes than those born in the EU/EEA. Acceptance of CXR screening was high (85%) among migrants. Discussion: Screening programmes for active TB are most efficient when targeting migrants from higher TB incidence countries. The limited number of studies identified and the heterogeneous evidence highlight the need for further data to inform screening programmes for migrants in the EU/EEA. PMID:29637888

  20. The effectiveness and cost-effectiveness of screening for active tuberculosis among migrants in the EU/EEA: a systematic review.

    Science.gov (United States)

    Greenaway, Christina; Pareek, Manish; Abou Chakra, Claire-Nour; Walji, Moneeza; Makarenko, Iuliia; Alabdulkarim, Balqis; Hogan, Catherine; McConnell, Ted; Scarfo, Brittany; Christensen, Robin; Tran, Anh; Rowbotham, Nick; Noori, Teymur; van der Werf, Marieke J; Pottie, Kevin; Matteelli, Alberto; Zenner, Dominik; Morton, Rachael L

    2018-04-01

    The foreign-born population make up an increasing and large proportion of tuberculosis (TB) cases in European Union/European Economic Area (EU/EEA) low-incidence countries and challenge TB elimination efforts. Methods : We conducted a systematic review to determine effectiveness (yield and performance of chest radiography (CXR) to detect active TB, treatment outcomes and acceptance of screening) and a second systematic review on cost-effectiveness of screening for active TB among migrants living in the EU/EEA. Results : We identified six systematic reviews, one report and three individual studies that addressed our aims. CXR was highly sensitive (98%) but only moderately specific (75%). The yield of detecting active TB with CXR screening among migrants was 350 per 100,000 population overall but ranged widely by host country (110-2,340), migrant type (170-1,192), TB incidence in source country (19-336) and screening setting (220-1,720). The CXR yield was lower (19.6 vs 336/100,000) and the numbers needed to screen were higher (5,076 vs 298) among migrants from source countries with lower TB incidence (≤ 50 compared with ≥ 350/100,000). Cost-effectiveness was highest among migrants originating from high (> 120/100,000) TB incidence countries. The foreign-born had similar or better TB treatment outcomes than those born in the EU/EEA. Acceptance of CXR screening was high (85%) among migrants. Discussion : Screening programmes for active TB are most efficient when targeting migrants from higher TB incidence countries. The limited number of studies identified and the heterogeneous evidence highlight the need for further data to inform screening programmes for migrants in the EU/EEA.

  1. Prejudice and misconceptions about tuberculosis and HIV in rural and urban communities in Ethiopia: a challenge for the TB/HIV control program

    Science.gov (United States)

    2010-01-01

    Background In Ethiopia, where HIV and tuberculosis (TB) are very common, little is known about the prejudice and misconceptions of rural communities towards People living with HIV/AIDS (PLHA) and TB. Methods We conducted a cross sectional study in Gilgel Gibe Field Research area (GGFRA) in southwest Ethiopia to assess the prejudice and misconceptions of rural and urban communities towards PLHA and TB. The study population consisted of 862 randomly selected adults in GGFRA. Data were collected by trained personnel using a pretested structured questionnaire. To triangulate the findings, 8 focus group discussions among women and men were done. Results Of the 862 selected study participants, 750(87%) accepted to be interviewed. The mean age of the respondents was 31.2 (SD ± 11.0). Of the total interviewed individuals, 58% of them were females. More than half of the respondents did not know the possibility of transmission of HIV from a mother to a child or by breast feeding. For fear of contagion of HIV, most people do not want to eat, drink, and share utensils or clothes with a person living with HIV/AIDS. A higher proportion of females [OR = 1.5, (95% CI: 1.0, 2.2)], non-literate individuals [OR = 2.3, (95%CI: 1.4, 3.6)], rural residents [OR = 3.8, (95%CI: 2.2, 6.6)], and individuals who had poor knowledge of HIV/AIDS [OR = 2.8, (95%CI: 1.8, 2.2)] were more likely to have high prejudice towards PLHA than respectively males, literates, urban residents and individuals with good knowledge. Exposure to cold air was implicated as a major cause of TB. Literates had a much better knowledge about the cause and methods of transmission and prevention of TB than non-literates. More than half of the individuals (56%) had high prejudice towards a patient with TB. A larger proportion of females [OR = 1.3, (95% CI: 1.0, 1.9)] and non-literate individuals [OR = 1.4, (95% CI: 1.1, 2.0)] had high prejudice towards patients with TB than males and literate individuals. Conclusion TB

  2. Tuberculosis: looking beyond BCG vaccines.

    Directory of Open Access Journals (Sweden)

    Mustafa Abu S

    2003-01-01

    Full Text Available Tuberculosis (TB is an infectious disease of international importance and ranks among the top 10 causes of death in the World. About one-third of the world′s population is infected with Mycobacterium tuberculosis. Every year, approximately eight million people develop active disease and two million die of TB. The currently used BCG vaccines have shown variable protective efficacies against TB in different parts of the world. Moreover, being a live vaccine, BCG can be pathogenic in immunocompromised recipients. Therefore, there is an urgent need to develop new vaccines against TB. The comparative genome analysis has revealed the existence of several M. tuberculosis-specific regions that are deleted in BCG. The work carried out to determine the immunological reactivity of proteins encoded by genes located in these regions revealed several major antigens of M. tuberculosis, including the 6 kDa early secreted antigen target (ESAT6. Immunization with ESAT6 and its peptide (aa51-70 protects mice challenged with M. tuberculosis. The protective efficacy of immunization further improves when ESAT6 is recombinantly fused with M. tuberculosis antigen 85B. In addition, ESAT6 delivered as a DNA vaccine is also protective in mice. Whether these vaccines would be safe or not cannot be speculated. The answer regarding the safety and efficacy of these vaccines has to await human trials in different parts of the world.

  3. Symptom-based screening tool in ruling out active tuberculosis among HIV-infected patients eligible for isoniazid preventive therapy in Tanzania.

    Science.gov (United States)

    Shayo, Grace A; Minja, Lilian T; Egwaga, Said; Bakari, Muhammad; Mugusi, Ferdinand M

    2014-06-01

    We assessed the usefulness of the National TB and Leprosy Control Program (NTLP) symptom-based tuberculosis (TB) screening tool in identifying HIV-infected patients eligible for isoniazid preventive therapy in Muhimbili National Hospital, Dar es Salaam Tanzania. Descriptive cross-sectional study. Data collected included socio-demographic and clinical data. Chest X-ray, sputum for acid-fast bacilli (AFB) microscopy, mycobacterial culture, CD4 + count and complete blood count were performed. Patients were considered not having active TB if they presented with no symptom in the screening tool, which comprised these symptoms: cough, fever and excessive night sweats for ≥2 weeks; weight loss of ≥3 kg in 4 weeks and haemoptysis of any duration. The reference standard was a negative culture for Mycobacterium tuberculosis. We enroled 373 patients, of whom 72.1% were females. Active pulmonary TB was found in 4.1% (14/338) of the participants as defined by a positive culture. The sensitivity and specificity of the NTLP screening tool were 71.4% (10/14) and 75.9% (246/324), respectively. False-negative rate was 28.6% (4/10). Cough, fever for ≥2 weeks and weight loss were independent predictors of NTLP-defined TB. Cough ≥2 weeks predicted TB when a positive culture was used to define TB. The screening tool had fairly good sensitivity and specificity for TB screening; however, there is a possibility that about 29% of the screened population will be given IPT while they are supposed to receive a full course of TB treatment. © 2014 John Wiley & Sons Ltd.

  4. Differential cellular recognition pattern to M. tuberculosis targets defined by IFN-γ and IL-17 production in blood from TB + patients from Honduras as compared to health care workers: TB and immune responses in patients from Honduras

    Science.gov (United States)

    2013-01-01

    Background A better understanding of the quality of cellular immune responses directed against molecularly defined targets will guide the development of TB diagnostics and identification of molecularly defined, clinically relevant M.tb vaccine candidates. Methods Recombinant proteins (n = 8) and peptide pools (n = 14) from M. tuberculosis (M.tb) targets were used to compare cellular immune responses defined by IFN-γ and IL-17 production using a Whole Blood Assay (WBA) in a cohort of 148 individuals, i.e. patients with TB + (n = 38), TB- individuals with other pulmonary diseases (n = 81) and individuals exposed to TB without evidence of clinical TB (health care workers, n = 29). Results M.tb antigens Rv2958c (glycosyltransferase), Rv2962c (mycolyltransferase), Rv1886c (Ag85B), Rv3804c (Ag85A), and the PPE family member Rv3347c were frequently recognized, defined by IFN-γ production, in blood from healthy individuals exposed to M.tb (health care workers). A different recognition pattern was found for IL-17 production in blood from M.tb exposed individuals responding to TB10.4 (Rv0288), Ag85B (Rv1886c) and the PPE family members Rv0978c and Rv1917c. Conclusions The pattern of immune target recognition is different in regard to IFN-γ and IL-17 production to defined molecular M.tb targets in PBMCs from individuals frequently exposed to M.tb. The data represent the first mapping of cellular immune responses against M.tb targets in TB patients from Honduras. PMID:23497342

  5. Active tuberculosis is associated with worse clinical outcomes in HIV-infected African patients on antiretroviral therapy.

    Directory of Open Access Journals (Sweden)

    Abraham M Siika

    Full Text Available This cohort study utilized data from a large HIV treatment program in western Kenya to describe the impact of active tuberculosis (TB on clinical outcomes among African patients on antiretroviral therapy (ART.We included all patients initiating ART between March 2004 and November 2007. Clinical (signs and symptoms, radiological (chest radiographs and laboratory (mycobacterial smears, culture and tissue histology criteria were used to record the diagnosis of TB disease in the program's electronic medical record system.We assessed the impact of TB disease on mortality, loss to follow-up (LTFU and incident AIDS-defining events (ADEs through Cox models and CD4 cell and weight response to ART by non-linear mixed models.We studied 21,242 patients initiating ART-5,186 (24% with TB; 62% female; median age 37 years. There were proportionately more men in the active TB (46% than in the non-TB (35% group. Adjusting for baseline HIV-disease severity, TB patients were more likely to die (hazard ratio--HR = 1.32, 95% CI 1.18-1.47 or have incident ADEs (HR = 1.31, 95% CI: 1.19-1.45. They had lower median CD4 cell counts (77 versus 109, weight (52.5 versus 55.0 kg and higher ADE risk at baseline (CD4-adjusted odds ratio = 1.55, 95% CI: 1.31-1.85. ART adherence was similarly good in both groups. Adjusting for gender and baseline CD4 cell count, TB patients experienced virtually identical rise in CD4 counts after ART initiation as those without. However, the overall CD4 count at one year was lower among patients with TB (251 versus 269 cells/µl.Clinically detected TB disease is associated with greater mortality and morbidity despite salutary response to ART. Data suggest that identifying HIV patients co-infected with TB earlier in the HIV-disease trajectory may not fully address TB-related morbidity and mortality.

  6. Clinical characteristics, drug resistance, and treatment outcomes among tuberculosis patients with diabetes in Peru.

    Science.gov (United States)

    Magee, M J; Bloss, E; Shin, S S; Contreras, C; Huaman, H Arbanil; Ticona, J Calderon; Bayona, J; Bonilla, C; Yagui, M; Jave, O; Cegielski, J P

    2013-06-01

    Diabetes is a risk factor for active tuberculosis (TB). Data are limited regarding the association between diabetes and TB drug resistance and treatment outcomes. We examined characteristics of TB patients with and without diabetes in a Peruvian cohort at high risk for drug-resistant TB. Among TB patients with diabetes (TB-DM), we studied the association between diabetes clinical/management characteristics and TB drug resistance and treatment outcomes. During 2005-2008, adults with suspected TB with respiratory symptoms in Lima, Peru, who received rapid drug susceptibility testing (DST), were prospectively enrolled and followed during treatment. Bivariate and Kaplan-Meier analyses were used to examine the relationships of diabetes characteristics with drug-resistant TB and TB outcomes. Of 1671 adult TB patients enrolled, 186 (11.1%) had diabetes. TB-DM patients were significantly more likely than TB patients without diabetes to be older, have had no previous TB treatment, and to have a body mass index (BMI) >18.5 kg/m(2) (pdiabetes, and 12% and 28%, respectively, among TB-DM patients. Among 149 TB-DM patients with DST results, 104 (69.8%) had drug-susceptible TB and 45 (30.2%) had drug-resistant TB, of whom 29 had multidrug-resistant TB. There was no association between diabetes characteristics and drug-resistant TB. Of 136 TB-DM patients with outcome information, 107 (78.7%) had a favorable TB outcome; active diabetes management was associated with a favorable outcome. Diabetes was common in a cohort of TB patients at high risk for drug-resistant TB. Despite prevalent multidrug-resistant TB among TB-DM patients, the majority had a favorable TB treatment outcome. Copyright © 2013 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  7. Target prioritization and strategy selection for active case-finding of pulmonary tuberculosis: a tool to support country-level project planning.

    Science.gov (United States)

    Nishikiori, Nobuyuki; Van Weezenbeek, Catharina

    2013-02-02

    Despite the progress made in the past decade, tuberculosis (TB) control still faces significant challenges. In many countries with declining TB incidence, the disease tends to concentrate in vulnerable populations that often have limited access to health care. In light of the limitations of the current case-finding approach and the global urgency to improve case detection, active case-finding (ACF) has been suggested as an important complementary strategy to accelerate tuberculosis control especially among high-risk populations. The present exercise aims to develop a model that can be used for county-level project planning. A simple deterministic model was developed to calculate the number of estimated TB cases diagnosed and the associated costs of diagnosis. The model was designed to compare cost-effectiveness parameters, such as the cost per case detected, for different diagnostic algorithms when they are applied to different risk populations. The model was transformed into a web-based tool that can support national TB programmes and civil society partners in designing ACF activities. According to the model output, tuberculosis active case-finding can be a costly endeavor, depending on the target population and the diagnostic strategy. The analysis suggests the following: (1) Active case-finding activities are cost-effective only if the tuberculosis prevalence among the target population is high. (2) Extensive diagnostic methods (e.g. X-ray screening for the entire group, use of sputum culture or molecular diagnostics) can be applied only to very high-risk groups such as TB contacts, prisoners or people living with human immunodeficiency virus (HIV) infection. (3) Basic diagnostic approaches such as TB symptom screening are always applicable although the diagnostic yield is very limited. The cost-effectiveness parameter was sensitive to local diagnostic costs and the tuberculosis prevalence of target populations. The prioritization of appropriate target

  8. Mycobactericidal activity of sutezolid (PNU-100480 in sputum (EBA and blood (WBA of patients with pulmonary tuberculosis.

    Directory of Open Access Journals (Sweden)

    Robert S Wallis

    Full Text Available Sutezolid (PNU-100480 is a linezolid analog with superior bactericidal activity against Mycobacterium tuberculosis in the hollow fiber, whole blood and mouse models. Like linezolid, it is unaffected by mutations conferring resistance to standard TB drugs. This study of sutezolid is its first in tuberculosis patients.Sputum smear positive tuberculosis patients were randomly assigned to sutezolid 600 mg BID (N = 25 or 1200 mg QD (N = 25, or standard 4-drug therapy (N = 9 for the first 14 days of treatment. Effects on mycobacterial burden in sputum (early bactericidal activity or EBA were monitored as colony counts on agar and time to positivity in automated liquid culture. Bactericidal activity was also measured in ex vivo whole blood cultures (whole blood bactericidal activity or WBA inoculated with M. tuberculosis H37Rv.All patients completed assigned treatments and began subsequent standard TB treatment according to protocol. The 90% confidence intervals (CI for bactericidal activity in sputum over the 14 day interval excluded zero for all treatments and both monitoring methods, as did those for cumulative WBA. There were no treatment-related serious adverse events, premature discontinuations, or dose reductions due to laboratory abnormalities. There was no effect on the QT interval. Seven sutezolid-treated patients (14% had transient, asymptomatic ALT elevations to 173±34 U/L on day 14 that subsequently normalized promptly; none met Hy's criteria for serious liver injury.The mycobactericidal activity of sutezolid 600 mg BID or 1200 mg QD was readily detected in sputum and blood. Both schedules were generally safe and well tolerated. Further studies of sutezolid in tuberculosis treatment are warranted.ClinicalTrials.gov NCT01225640.

  9. Comparative Tuberculosis (TB) Prevention Effectiveness in Children of Bacillus Calmette-Guérin (BCG) Vaccines from Different Sources, Kazakhstan

    Science.gov (United States)

    Favorov, Michael; Ali, Mohammad; Tursunbayeva, Aigul; Aitmagambetova, Indira; Kilgore, Paul; Ismailov, Shakhimurat; Chorba, Terence

    2012-01-01

    Background Except during a 1-year period when BCG vaccine was not routinely administered, annual coverage of infants with Bacillus Calmette-Guérin (BCG) in Kazakhstan since 2002 has exceeded 95%. BCG preparations from different sources (Japan, Serbia, and Russia) or none were used exclusively in comparable 7-month time-frames, September through March, in 4 successive years beginning in 2002. Our objective was to assess relative effectiveness of BCG immunization. Methods/Findings We compared outcomes of birth cohorts from the 4 time-frames retrospectively. Three cohorts received vaccine from one of three manufacturers exclusively, and one cohort was not vaccinated. Cohorts were followed for 3 years for notifications of clinical TB and of culture-confirmed TB, and for 21 months for TB meningitis notifications. Prevention effectiveness based on relative risk of TB incidence was calculated for each vaccinated cohort compared to the non-vaccinated cohort. Although there were differences in prevention effectiveness observed among the three BCG vaccines, all were protective. The Japanese vaccine (currently used in Kazakhstan), the Serbian vaccine, and the Russian vaccine respectively were 69%, 43%, and 22% effective with respect to clinical TB notifications, and 92%, 82%, and 51% effective with respect to culture confirmed TB. All three vaccines were >70% effective with respect to TB meningitis. Limitations Potential limitations included considerations that 1) the methodology used was retrospective, 2) multiple risk factors could have varied between cohorts and affected prevention effectiveness measures, 3) most cases were clinically diagnosed, and TB culture-positive case numbers and TB meningitis case numbers were sparse, and 4) small variations in reported population TB burden could have affected relative risk of exposure for cohorts. Conclusions/Significance All three BCG vaccines evaluated were protective against TB, and prevention effectiveness varied by

  10. Comparative tuberculosis (TB prevention effectiveness in children of Bacillus Calmette-Guérin (BCG vaccines from different sources, Kazakhstan.

    Directory of Open Access Journals (Sweden)

    Michael Favorov

    Full Text Available BACKGROUND: Except during a 1-year period when BCG vaccine was not routinely administered, annual coverage of infants with Bacillus Calmette-Guérin (BCG in Kazakhstan since 2002 has exceeded 95%. BCG preparations from different sources (Japan, Serbia, and Russia or none were used exclusively in comparable 7-month time-frames, September through March, in 4 successive years beginning in 2002. Our objective was to assess relative effectiveness of BCG immunization. METHODS/FINDINGS: We compared outcomes of birth cohorts from the 4 time-frames retrospectively. Three cohorts received vaccine from one of three manufacturers exclusively, and one cohort was not vaccinated. Cohorts were followed for 3 years for notifications of clinical TB and of culture-confirmed TB, and for 21 months for TB meningitis notifications. Prevention effectiveness based on relative risk of TB incidence was calculated for each vaccinated cohort compared to the non-vaccinated cohort. Although there were differences in prevention effectiveness observed among the three BCG vaccines, all were protective. The Japanese vaccine (currently used in Kazakhstan, the Serbian vaccine, and the Russian vaccine respectively were 69%, 43%, and 22% effective with respect to clinical TB notifications, and 92%, 82%, and 51% effective with respect to culture confirmed TB. All three vaccines were >70% effective with respect to TB meningitis. LIMITATIONS: Potential limitations included considerations that 1 the methodology used was retrospective, 2 multiple risk factors could have varied between cohorts and affected prevention effectiveness measures, 3 most cases were clinically diagnosed, and TB culture-positive case numbers and TB meningitis case numbers were sparse, and 4 small variations in reported population TB burden could have affected relative risk of exposure for cohorts. CONCLUSIONS/SIGNIFICANCE: All three BCG vaccines evaluated were protective against TB, and prevention effectiveness

  11. Comparative tuberculosis (TB) prevention effectiveness in children of Bacillus Calmette-Guérin (BCG) vaccines from different sources, Kazakhstan.

    Science.gov (United States)

    Favorov, Michael; Ali, Mohammad; Tursunbayeva, Aigul; Aitmagambetova, Indira; Kilgore, Paul; Ismailov, Shakhimurat; Chorba, Terence

    2012-01-01

    Except during a 1-year period when BCG vaccine was not routinely administered, annual coverage of infants with Bacillus Calmette-Guérin (BCG) in Kazakhstan since 2002 has exceeded 95%. BCG preparations from different sources (Japan, Serbia, and Russia) or none were used exclusively in comparable 7-month time-frames, September through March, in 4 successive years beginning in 2002. Our objective was to assess relative effectiveness of BCG immunization. We compared outcomes of birth cohorts from the 4 time-frames retrospectively. Three cohorts received vaccine from one of three manufacturers exclusively, and one cohort was not vaccinated. Cohorts were followed for 3 years for notifications of clinical TB and of culture-confirmed TB, and for 21 months for TB meningitis notifications. Prevention effectiveness based on relative risk of TB incidence was calculated for each vaccinated cohort compared to the non-vaccinated cohort. Although there were differences in prevention effectiveness observed among the three BCG vaccines, all were protective. The Japanese vaccine (currently used in Kazakhstan), the Serbian vaccine, and the Russian vaccine respectively were 69%, 43%, and 22% effective with respect to clinical TB notifications, and 92%, 82%, and 51% effective with respect to culture confirmed TB. All three vaccines were >70% effective with respect to TB meningitis. Potential limitations included considerations that 1) the methodology used was retrospective, 2) multiple risk factors could have varied between cohorts and affected prevention effectiveness measures, 3) most cases were clinically diagnosed, and TB culture-positive case numbers and TB meningitis case numbers were sparse, and 4) small variations in reported population TB burden could have affected relative risk of exposure for cohorts. All three BCG vaccines evaluated were protective against TB, and prevention effectiveness varied by manufacturer. When setting national immunization policy, consideration

  12. Clinical application of T-spot test of Mycobacterium tuberculosis infection for diagnosis of suspected pulmonary tuberculosis patients

    Directory of Open Access Journals (Sweden)

    Xue-ping SHI

    2017-11-01

    Full Text Available Objective To explore the application value of T-spot test of Mycobacterium tuberculosis infection (T-SPOT.TB on diagnosis and differential diagnosis of pulmonary tuberculosis. Methods From Apr. 2014 to Dec. 2016, 700 patients with suspected pulmonary tuberculosis were collected, venous blood (5ml was drawn off and sputum was collected from each patient separately for T-SPOT.TB and pathogens identification (including TB. Chest CT, bronchoscopy brush or biopsy histopathological examination were followed up, cultivation of My. tuberculosis and of common bacteria with sputum or lavage fluid when needed. T-SPOT.TB test was performed according to the kit instruction operation. 2.5×105 peripheral blood mononuclear cells (PBMCs were added into the pre- coated anti- human γ- interferon antibody, and co-incubated separately with two specific My. tuberculosis antigens, namely early secretory targeting 6 (ESAT-6 and culture filtration protein 10 (CFP-10, and then the spot forming cells (SFCs were counted. The gold standard for present study were set as follows: 1 My. tuberculosis smear positive or culture positive; 2 Clinical diagnosis (meet any one is positive. The efficacy of T-SPOT.TB on diagnosing active TB was observed, and then the optimal critical value for diagnosing active TB was determined. Patients diagnosed as active TB were divided into 4 subgroups: initial treatment group, retreatment group, smear or culture positive group, and smear or culture negative group. T-SPOT.TB was carried out to detect A and B antigen, and the difference of formed SFCs was then compared. The present study was approved by the Ethics Committee of Xinjiang Uygur Autonomous Region Chest Hospital. Results Of 700 cases suspected of pulmonary tuberculosis enrolled in present study, 528 out of 624 definite cases (84.6% were finally diagnosed as active tuberculosis (active TB group and 96 cases (15.4% were as without TB infection (non-TB group. Positive results of T-SPOT.TB

  13. Tuberculosis

    OpenAIRE

    C. Robert Horsburgh, Jr

    2014-01-01

    This article reviews the published literature on tuberculosis from September 2012 to August 2013 and describes important advances in tuberculosis epidemiology, microbiology, pathology, clinical pharmacology, genetics, treatment and prevention.

  14. Gamma delta T cell responses associated with the development of tuberculosis in health care workers.

    Science.gov (United States)

    Ordway, Diane J; Pinto, Luisa; Costa, Leonor; Martins, Marta; Leandro, Clara; Viveiros, Miguel; Amaral, Leonard; Arroz, Maria J; Ventura, Fernando A; Dockrell, Hazel M

    2005-03-01

    This study evaluated T cell immune responses to purified protein derivative (PPD) and Mycobacterium tuberculosis (Mtb) in health care workers who remained free of active tuberculosis (HCWs w/o TB), health care workers who went on to develop active TB (HCWs w/TB), non-health care workers who were TB free (Non-HCWs) and tuberculosis patients presenting with minimal (Min TB) or advanced (Adv TB) disease. Peripheral blood mononuclear cells (PBMC) were stimulated with Mtb and PPD and the expression of T cell activation markers CD25+ and HLA-DR+, intracellular IL-4 and IFN-gamma production and cytotoxic responses were evaluated. PBMC from HCWs who developed TB showed decreased percentages of cells expressing CD8+CD25+ in comparison to HCWs who remained healthy. HCWs who developed TB showed increased gammadelta TCR+ cell cytotoxicity and decreased CD3+gammadelta TCR- cell cytotoxicity in comparison to HCWs who remained healthy. PBMC from TB patients with advanced disease showed decreased percentages of CD25+CD4+ and CD25+CD8+ T cells that were associated with increased IL-4 production in CD8+ and gammadelta TCR+ phenotypes, in comparison with TB patients presenting minimal disease. TB patients with advanced disease showed increased gammadelta TCR+ cytotoxicity and reduced CD3+gammadelta TCR- cell cytotoxicity. Our results suggest that HCWs who developed TB show an early compensatory mechanism involving an increase in lytic responses of gammadelta TCR+ cells which did not prevent TB.

  15. Pediatric Tuberculosis in Italian Children: Epidemiological and Clinical Data from the Italian Register of Pediatric Tuberculosis

    Directory of Open Access Journals (Sweden)

    Luisa Galli

    2016-06-01

    Full Text Available Tuberculosis (TB is one of the leading causes of death worldwide. Over the last decades, TB has also emerged in the pediatric population. Epidemiologic data of childhood TB are still limited and there is an urgent need of more data on very large cohorts. A multicenter study was conducted in 27 pediatric hospitals, pediatric wards, and public health centers in Italy using a standardized form, covering the period of time between 1 January 2010 and 31 December 2012. Children with active TB, latent TB, and those recently exposed to TB or recently adopted/immigrated from a high TB incidence country were enrolled. Overall, 4234 children were included; 554 (13.1% children had active TB, 594 (14.0% latent TB and 3086 (72.9% were uninfected. Among children with active TB, 481 (86.8% patients had pulmonary TB. The treatment of active TB cases was known for 96.4% (n = 534 of the cases. Overall, 210 (39.3% out of these 534 children were treated with three and 216 (40.4% with four first-line drugs. Second-line drugs where used in 87 (16.3% children with active TB. Drug-resistant strains of Mycobacterium tuberculosis were reported in 39 (7% children. Improving the surveillance of childhood TB is important for public health care workers and pediatricians. A non-negligible proportion of children had drug-resistant TB and was treated with second-line drugs, most of which are off-label in the pediatric age. Future efforts should concentrate on improving active surveillance, diagnostic tools, and the availability of antitubercular pediatric formulations, also in low-endemic countries.

  16. Tuberculosis

    OpenAIRE

    Mochammad, Hatta

    2008-01-01

    This book chapter for medical students and researcher Tuberculosis is still one of the leading causes of death by infectious diseases with 2 million deaths per year and 9.2 million new cases of tuberculosis disease annually [1-3]. Besides, more than 2 milliard people are infected with latent tuberculosis infection (LTBI) [1-3]. Despite continuous effort in the prevention, monitoring and treatment of tuberculosis, the disease remains a major health problem in many countries [4-6...

  17. Factors associated with negative T-SPOT.TB results among smear-negative tuberculosis patients in China.

    Science.gov (United States)

    Kang, Wanli; Wu, Meiying; Yang, Kunyun; Ertai, A; Wu, Shucai; Geng, Shujun; Li, Zhihui; Li, Mingwu; Pang, Yu; Tang, Shenjie

    2018-03-09

    We compared the positive rates of T-SPOT.TB and bacterial culture in the smear-negative PTB, and analyzed the factors affecting the results of negative T-SPOT.TB and bacterial culture. Retrospective evaluation of data from smear-negative PTB patients who underwent T-SPOT.TB and bacterial culture were done. The agreement and concordance were analyzed between T-SPOT.TB and bacterial culture. Multivariable logistic regression analysis was used to explore the factors associated with positive results of T-SPOT.TB and bacterial culture in smear-negative PTB. 858 eligible smear-negative PTB patients were included in the study. The agreement rate was 25.6% (22.7~28.5%) between T-SPOT.TB and bacterial culture in smear- negative PTB patients. The positive rate of T-SPOT.TB was higher than that of bacterial culture in smear-negative PTB patients (p SPOT.TB and bacterial culture (p > 0.05). Using multivariable logistic regression analysis we found that older age ≥ 60 years (OR = 0.469, 95% CI: 0.287-0.768) and decreased albumin (OR = 0.614, 95% CI: 0.380-0.992) were associated with negative diagnostic results of T-SPOT.TB in smear-negative PTB patients. Female (OR = 0.654, 95% CI: 0.431-0.992) were associated with negative diagnostic results of bacteria culture in smear-negative PTB patients. Our results indicated that the older age and decreased albumin were independently associated with negative T-SPOT.TB responses.

  18. Anti-Tuberculosis Activity of Extract Ethyl Acetate Kenikir Leaves (Cosmos caudatus H.B.K and Sendok Leaves (Plantago Major L. By In Vitro Test

    Directory of Open Access Journals (Sweden)

    Tatang Irianti

    2018-04-01

    Full Text Available The increasing therapy problem including multidrug-resistant tuberculosis (TB has made it important to discover a new anti-TB drug candidate. The aim of this study was to acknowledge the activity of ethyl acetate extracts of kenikir (Cosmos caudatus H.B.K and sendok (Plantago major L. leaves against Mycobacterium tuberculosis (M. tuberculosis H37Rv. This research used Middlebrook (MB 7H9 media and observed the growth of M. tuberculosis using Lowenstein Jensen (LJ media. The concentration of extracts were 0.25 mg/ml, 0.50 mg/ml, and 1.00 mg/ml. The result of this study showed that ethyl acetate extracts exhibited anti-TB activity in 1000 µg/ml of both extracts. The active compound group was detected by thin layer chromatography (TLC and the separation of compounds was shown by retardation factor (Rf and the color of the spots. Based on TLC chromatograms, it is known that there are types of compounds, such as ortho-dihydroxy compounds, phenolic compounds, and compound leads to terpenoids for both extracts.

  19. Role of digital tomosynthesis and dual energy subtraction digital radiography in detection of parenchymal lesions in active pulmonary tuberculosis

    International Nuclear Information System (INIS)

    Sharma, Madhurima; Sandhu, Manavjit Singh; Gorsi, Ujjwal; Gupta, Dheeraj; Khandelwal, Niranjan

    2015-01-01

    Highlights: • Digital tomosynthesis and dual energy subtraction digital radiography are modifications of digital radiography. • These modalities perform better than digital radiography in detection of parenchymal lesions in active pulmonary tuberculosis. • Digital tomosynthesis has a sensitivity of 100% in detection of cavities. • Centrilobular nodules seen on CT in active pulmonary tuberculosis, were also demonstrated on digital tomosynthesis in our study. • Digital tomosynthesis can be used for diagnosis and follow up of patients in pulmonary tuberculosis, thereby reducing the number of CT examinations. - Abstract: Objective: To assess the role of digital tomosynthesis (DTS) and dual energy subtraction digital radiography (DES-DR) in detection of parenchymal lesions in active pulmonary tuberculosis (TB) and to compare them with digital radiography (DR). Materials and methods: This prospective study was approved by our institutional review committee. DTS and DES-DR were performed in 62 patients with active pulmonary TB within one week of multidetector computed tomography (MDCT) study. Findings of active pulmonary TB, that is consolidation, cavitation and nodules were noted on digital radiography (DR), DTS and DES-DR in all patients. Sensitivity, specificity, positive and negative predictive values of all 3 modalities was calculated with MDCT as reference standard. In addition presence of centrilobular nodules was also noted on DTS. Results: Our study comprised of 62 patients (33 males, 29 females with age range 18–82 years). Sensitivity and specificity of DTS for detection of nodules and cavitation was better than DR and DES-DR. Sensitivity and specificity of DTS for detection of consolidation was comparable to DR and DES-DR. DES-DR performed better than DR in detection of nodules and cavitation. DTS was also able to detect centrilobular nodules with sensitivity and specificity of 57.4% and 86.5% respectively. Conclusion: DTS and DES-DR perform better

  20. Role of digital tomosynthesis and dual energy subtraction digital radiography in detection of parenchymal lesions in active pulmonary tuberculosis

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Madhurima, E-mail: madhurimashrm88@gmail.com [Department of Radiodiagnosis and Imaging, PGIMER, Chandigarh 160012 (India); Sandhu, Manavjit Singh, E-mail: manavjitsandhu@yahoo.com [Department of Radiodiagnosis and Imaging, PGIMER, Chandigarh 160012 (India); Gorsi, Ujjwal, E-mail: ujjwalgorsi@gmail.com [Department of Radiodiagnosis and Imaging, PGIMER, Chandigarh 160012 (India); Gupta, Dheeraj, E-mail: dheeraj1910@gmail.com [Department of Pulmonary Medicine, PGIMER, Chandigarh 160012 (India); Khandelwal, Niranjan, E-mail: khandelwaln@hotmail.com [Department of Radiodiagnosis and Imaging, PGIMER, Chandigarh 160012 (India)

    2015-09-15

    Highlights: • Digital tomosynthesis and dual energy subtraction digital radiography are modifications of digital radiography. • These modalities perform better than digital radiography in detection of parenchymal lesions in active pulmonary tuberculosis. • Digital tomosynthesis has a sensitivity of 100% in detection of cavities. • Centrilobular nodules seen on CT in active pulmonary tuberculosis, were also demonstrated on digital tomosynthesis in our study. • Digital tomosynthesis can be used for diagnosis and follow up of patients in pulmonary tuberculosis, thereby reducing the number of CT examinations. - Abstract: Objective: To assess the role of digital tomosynthesis (DTS) and dual energy subtraction digital radiography (DES-DR) in detection of parenchymal lesions in active pulmonary tuberculosis (TB) and to compare them with digital radiography (DR). Materials and methods: This prospective study was approved by our institutional review committee. DTS and DES-DR were performed in 62 patients with active pulmonary TB within one week of multidetector computed tomography (MDCT) study. Findings of active pulmonary TB, that is consolidation, cavitation and nodules were noted on digital radiography (DR), DTS and DES-DR in all patients. Sensitivity, specificity, positive and negative predictive values of all 3 modalities was calculated with MDCT as reference standard. In addition presence of centrilobular nodules was also noted on DTS. Results: Our study comprised of 62 patients (33 males, 29 females with age range 18–82 years). Sensitivity and specificity of DTS for detection of nodules and cavitation was better than DR and DES-DR. Sensitivity and specificity of DTS for detection of consolidation was comparable to DR and DES-DR. DES-DR performed better than DR in detection of nodules and cavitation. DTS was also able to detect centrilobular nodules with sensitivity and specificity of 57.4% and 86.5% respectively. Conclusion: DTS and DES-DR perform better

  1. Design, syntheses, and anti-tuberculosis activities of conjugates of piperazino-1,3-benzothiazin-4-ones (pBTZs) with 2,7-dimethylimidazo [1,2-a]pyridine-3-carboxylic acids and 7-phenylacetyl cephalosporins.

    Science.gov (United States)

    Majewski, Mark W; Tiwari, Rohit; Miller, Patricia A; Cho, Sanghyun; Franzblau, Scott G; Miller, Marvin J

    2016-04-15

    Tuberculosis (TB) remains one of the most threatening diseases in the world and the need for development of new therapies is dire. Herein we describe the rationale for the design and subsequent syntheses and studies of conjugates between pBTZ and both the imidazopyridine and cephalosporin scaffolds. Overall some compounds exhibited notable anti-TB activity in the range of 2-0.2 μM in the Microplate Alamar Blue (MABA) Assay. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Accuracy of the QuantiFERON-TB Gold in Tube for diagnosing tuberculosis in a young pediatric population previously vaccinated with Bacille Calmette-Guerin

    Directory of Open Access Journals (Sweden)

    Marcelo Genofre Vallada

    2014-03-01

    Full Text Available Objective: To evaluate the accuracy of an interferongamma release assay (QuantiFERON-TB Gold in Tube for diagnosing Mycobacterium tuberculosis infection in a young pediatric population. Methods: 195 children previously vaccinated with BCG were evaluated, being 184 healthy individuals with no clinical or epidemiological evidence of mycobacterial infection, and 11 with Mycobacterium tuberculosis infection, according to clinical, radiological, and laboratory parameters. A blood sample was obtained from each child and processed according to the manufacturer's instructions. The assay performance was evaluated by a Receiver Operating Characteristic (ROC curve. Results: In the group of 184 non-infected children, 130 (70.6% were under the age of four years (mean age of 35 months. In this group, 177 children (96.2% had negative test results, six (3.2% had indeterminate results, and one (0.5% had a positive result. In the group of 11 infected children, the mean age was 58.5 months, and two of them (18% had negative results. The ROC curve had an area under the curve of 0.88 (95%CI 0.82-0.92; p<0.001, disclosing a predictive positive value of 81.8% for the test (95%CI 46.3-97.4. The assay sensitivity was 81.8% (95%CI 48.2-97.2 and the specificity was 98.8% (95%CI 96-99.8. Conclusions: In the present study, the QuantiFERON-TB Gold in Tube performance for diagnosing M. tuberculosis infection was appropriate in a young pediatric population.

  3. First reported case of fulminant TB with progression of infection from lungs to the genitourinary region

    Directory of Open Access Journals (Sweden)

    Tatjana Adzic-Vukicevic

    Full Text Available ABSTRACT Although tuberculosis (TB is a curable disease, it continues to be one of the leading infections associated with death in the world. Extra-pulmonary TB (EPTB occurs in approximately 10% of the total cases, presenting with lymph nodes, pleura, bone and genitourinary tract as the most common locations. Genitourinary tuberculosis, the second most common EPTB, is very difficult to diagnose unless there is a high index of suspicion. Isolated TB orchitis or prostatitis without clinical evidence of renal involvement is a rare entity among genitourinary tuberculosis. We presented the first reported case of TB prostatitis and orchitis associated with pulmonary TB and the presence of an acute massive caseous pneumonia in an immunocompetent man. Despite the anti-TB therapy, the patient presented a rapid progression of disease and deterioration of general conditions taking to death, which occurred four days after TB treatment had started. Disseminated TB is a relatively uncommon cause of acute massive caseous pneumonia; however, there should always be suspicion of the disease, since it is a potentially treatable cause. This rare case supports the assertion that TB should be considered as an important differential diagnosis of genitourinary tumors irrespective of evidence of active TB elsewhere in the body.

  4. Tuberculosis

    International Nuclear Information System (INIS)

    Latorre Tortello, Pablo

    1998-01-01

    The tuberculosis is an infection bacterial chronicle of world distribution. Three organisms of the family of the mycobacterium, the m. tuberculosis, the m. bovis and m. africanum, phenotypic and genetically similar, produce it, but only the m. tuberculosis has importance; the others rarely produce illness in the human. By definition, the lung tuberculosis is the localization of the m. tuberculosis in the breathing tract, the most common and main form in the affection and the only able to contaminate to other people. The koch bacillus, transmits the illness directly person to person. The paper Includes topics like pathogenesis, natural history, epidemiology, diagnose, symptomatology and treatment

  5. Comparative evaluation of low-molecular-mass proteins from Mycobacterium tuberculosis identifies members of the ESAT-6 family as immunodominant T-cell antigens

    DEFF Research Database (Denmark)

    Skjøt, R L; Oettinger, T; Rosenkrands, I

    2000-01-01

    Culture filtrate from Mycobacterium tuberculosis contains protective antigens of relevance for the generation of a new antituberculosis vaccine. We have identified two previously uncharacterized M. tuberculosis proteins (TB7.3 and TB10.4) from the highly active low-mass fraction of culture filtra...

  6. A Clinical Algorithm to Identify HIV Patients at High Risk for Incident Active Tuberculosis: A Prospective 5-Year Cohort Study.

    Directory of Open Access Journals (Sweden)

    Susan Shin-Jung Lee

    Full Text Available Predicting the risk of tuberculosis (TB in people living with HIV (PLHIV using a single test is currently not possible. We aimed to develop and validate a clinical algorithm, using baseline CD4 cell counts, HIV viral load (pVL, and interferon-gamma release assay (IGRA, to identify PLHIV who are at high risk for incident active TB in low-to-moderate TB burden settings where highly active antiretroviral therapy (HAART is routinely provided.A prospective, 5-year, cohort study of adult PLHIV was conducted from 2006 to 2012 in two hospitals in Taiwan. HAART was initiated based on contemporary guidelines (CD4 count < = 350/μL. Cox regression was used to identify the predictors of active TB and to construct the algorithm. The validation cohorts included 1455 HIV-infected individuals from previous published studies. Area under the receiver operating characteristic (ROC curve was calculated.Seventeen of 772 participants developed active TB during a median follow-up period of 5.21 years. Baseline CD4 < 350/μL or pVL ≥ 100,000/mL was a predictor of active TB (adjusted HR 4.87, 95% CI 1.49-15.90, P = 0.009. A positive baseline IGRA predicted TB in patients with baseline CD4 ≥ 350/μL and pVL < 100,000/mL (adjusted HR 6.09, 95% CI 1.52-24.40, P = 0.01. Compared with an IGRA-alone strategy, the algorithm improved the sensitivity from 37.5% to 76.5%, the negative predictive value from 98.5% to 99.2%. Compared with an untargeted strategy, the algorithm spared 468 (60.6% from unnecessary TB preventive treatment. Area under the ROC curve was 0.692 (95% CI: 0.587-0.798 for the study cohort and 0.792 (95% CI: 0.776-0.808 and 0.766 in the 2 validation cohorts.A validated algorithm incorporating the baseline CD4 cell count, HIV viral load, and IGRA status can be used to guide targeted TB preventive treatment in PLHIV in low-to-moderate TB burden settings where HAART is routinely provided to all PLHIV. The implementation of this algorithm will avoid unnecessary

  7. Active tuberculosis patients have high levels of IgA anti-alpha-crystallin and isocitrate lyase proteins.

    Science.gov (United States)

    Talavera-Paulín, M; García-Morales, L; Ruíz-Sánchez, B P; Caamal-Ley, Á D; Hernández-Solis, A; Ramírez-Casanova, E; Cicero-Sabido, R; Espitia, C; Helguera-Repetto, C; González-Y-Merchand, J A; Flores-Mejía, R; Estrada-Parra, S; Estrada-García, I; Chacón-Salinas, R; Wong-Baeza, I; Serafín-López, J

    2016-12-01

    Mexico City, Mexico. To identify proteins synthetised by Mycobacterium tuberculosis in hypoxic culture, which resemble more closely a granuloma environment than aerobic culture, and to determine if they are recognised by antibodies from patients with active pulmonary tuberculosis (PTB). Soluble extracts from M. tuberculosis H37Rv cultured under aerobic or hypoxic conditions were analysed using two-dimensional polyacrylamide gel electrophoresis, and proteins over-expressed under hypoxia were identified by mass spectrometry. The presence of immunoglobulin (Ig) G, IgA and IgM antibodies against these proteins was determined in the serum of 42 patients with active PTB and 42 healthy controls. We selected three M. tuberculosis H37Rv proteins (alpha-crystallin protein [Acr, Rv2031c], universal stress protein Rv2623 and isocitrate lyase [ICL, RV0467]) that were over-expressed under hypoxia. Titres of anti-Acr and anti-ICL IgA antibodies were higher in patients than in healthy controls, with an area under the receiver operating characteristic curve of 0.71 for anti-ICL IgA antibodies. ICL could be used in combination with other M. tuberculosis antigens to improve the sensitivity and specificity of current serological TB diagnostic methods.

  8. Increased Interleukin-4 production by CD8 and gammadelta T cells in health-care workers is associated with the subsequent development of active tuberculosis.

    Science.gov (United States)

    Ordway, Diane J; Costa, Leonor; Martins, Marta; Silveira, Henrique; Amaral, Leonard; Arroz, Maria J; Ventura, Fernando A; Dockrell, Hazel M

    2004-08-15

    We evaluated immune responses to Mycobacterium tuberculosis in 10 health-care workers (HCWs) and 10 non-HCWs and correlated their immune status with the development of active tuberculosis (TB). Twenty individuals were randomly recruited, tested, and monitored longitudinally for TB presentation. Peripheral blood mononuclear cells (PBMCs) from donors were stimulated with M. tuberculosis and tested for cell proliferation and the production of interferon (IFN)- gamma, interleukin (IL)-5, and IL-4, by use of enzyme-linked immunosorbent or flow-cytometric assays. HCWs had higher levels of cell proliferation (24,258 cpm) and IFN- gamma (6373 pg/mL) to M. tuberculosis than did non-HCWs (cell proliferation, 11,462 cpm; IFN- gamma, 3228 pg/mL). Six of 10 HCWs showed increased median percentages of CD8+IL-4+ (4.7%) and gammadelta +IL-4+ (2.3%) T cells and progressed to active TB. HCWs who remained healthy showed increased median percentages of CD8+IFN- gamma+ (25.0%) and gammadelta +IFN- gamma+ (8.0%) and lower percentages of CD8+IL-4+ (0.05%) and gammadelta +IL-4+ (0.03%) T cells.

  9. Oral vaccination with heat inactivated Mycobacterium bovis activates the complement system to protect against tuberculosis.

    Directory of Open Access Journals (Sweden)

    Beatriz Beltrán-Beck

    Full Text Available Tuberculosis (TB remains a pandemic affecting billions of people worldwide, thus stressing the need for new vaccines. Defining the correlates of vaccine protection is essential to achieve this goal. In this study, we used the wild boar model for mycobacterial infection and TB to characterize the protective mechanisms elicited by a new heat inactivated Mycobacterium bovis vaccine (IV. Oral vaccination with the IV resulted in significantly lower culture and lesion scores, particularly in the thorax, suggesting that the IV might provide a novel vaccine for TB control with special impact on the prevention of pulmonary disease, which is one of the limitations of current vaccines. Oral vaccination with the IV induced an adaptive antibody response and activation of the innate immune response including the complement component C3 and inflammasome. Mycobacterial DNA/RNA was not involved in inflammasome activation but increased C3 production by a still unknown mechanism. The results also suggested a protective mechanism mediated by the activation of IFN-γ producing CD8+ T cells by MHC I antigen presenting dendritic cells (DCs in response to vaccination with the IV, without a clear role for Th1 CD4+ T cells. These results support a role for DCs in triggering the immune response to the IV through a mechanism similar to the phagocyte response to PAMPs with a central role for C3 in protection against mycobacterial infection. Higher C3 levels may allow increased opsonophagocytosis and effective bacterial clearance, while interfering with CR3-mediated opsonic and nonopsonic phagocytosis of mycobacteria, a process that could be enhanced by specific antibodies against mycobacterial proteins induced by vaccination with the IV. These results suggest that the IV acts through novel mechanisms to protect against TB in wild boar.

  10. Serial interferon-gamma release assays during treatment of active tuberculosis in young adults

    Directory of Open Access Journals (Sweden)

    Lee Choon-Taek

    2010-10-01

    Full Text Available Abstract Background The role of interferon-γ release assay (IGRA in monitoring responses to anti-tuberculosis (TB treatment is not clear. We evaluated the results of the QuantiFERON-TB Gold In-tube (QFT-GIT assay over time during the anti-TB treatment of adults with no underlying disease. Methods We enrolled soldiers who were newly diagnosed with active TB and admitted to the central referral military hospital in South Korea between May 1, 2008 and September 30, 2009. For each participant, we preformed QFT-GIT assay before treatment (baseline and at 1, 3, and 6 months after initiating anti-TB medication. Results Of 67 eligible patients, 59 (88.1% completed the study protocol. All participants were males who were human immunodeficiency virus (HIV-negative and had no chronic diseases. Their median age was 21 years (range, 20-48. Initially, 57 (96.6% patients had positive QFT-GIT results, and 53 (89.8%, 42 (71.2%, and 39 (66.1% had positive QFT-GIT results at 1, 3, and 6 months, respectively. The IFN-γ level at baseline was 5.31 ± 5.34 IU/ml, and the levels at 1, 3, and 6 months were 3.95 ± 4.30, 1.82 ± 2.14, and 1.50 ± 2.12 IU/ml, respectively. All patients had clinical and radiologic improvements after treatment and were cured. A lower IFN-γ level, C-reactive protein ≥ 3 mg/dl, and the presence of fever (≥ 38.3°C at diagnosis were associated with negative reversion of the QFT-GIT assay. Conclusion Although the IFN-γ level measured by QFT-GIT assay decreased after successful anti-TB treatment in most participants, less than half of them exhibited QFT-GIT reversion. Thus, the reversion to negativity of the QFT-GIT assay may not be a good surrogate for treatment response in otherwise healthy young patients with TB.

  11. Dietary Intake of Antioxidant Vitamins and Carotenoids and Risk of Developing Active Tuberculosis in a Prospective Population-Based Cohort Study.

    Science.gov (United States)

    Soh, Avril Z; Chee, Cynthia B E; Wang, Yee-Tang; Yuan, Jian-Min; Koh, Woon-Puay

    2017-08-15

    Antioxidants may protect against oxidative stress, which is associated with tuberculosis (TB) disease. However, direct evidence for a protective association between dietary antioxidants and TB incidence in humans has been lacking. The relationship between intake of antioxidant vitamins (vitamins A, C, D, and E) and individual carotenoids (α-carotene, β-carotene, β-cryptoxanthin, lycopene, and lutein) and TB incidence was examined in the Singapore Chinese Health Study, a prospective cohort study of 63,257 adults aged 45-74 years enrolled during 1993-1998. Baseline intake of these antioxidants was estimated using a validated semiquantitative food frequency questionnaire including questions on use of dietary supplements. After an average of 16.9 years of follow-up, 1,186 incident active TB cases were identified among cohort participants. Compared with the lowest quartile, reduced risk of active TB was observed for the highest quartile of vitamin A intake (hazard ratio = 0.71, 95% confidence interval: 0.59, 0.85; P-trend carotenoids were not associated with TB risk. These results suggest that vitamin C may reduce TB risk among current smokers by ameliorating oxidative stress, while vitamin A and β-carotene may have additional antimycobacterial properties. © The Author(s) 2017. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Determination of circulating Mycobacterium tuberculosis strains and transmission patterns among TB patients in Iran, using 15 loci MIRU-VNTR

    Directory of Open Access Journals (Sweden)

    S Zamani

    2015-01-01

    Conclusions: MIRU-VNTR typing showed a high genetic diversity and suggests the possibility of transmission from Sistan–Baluchestan to other provinces of Iran. This method could be considered a suitable tool for studying the transmission routes of TB and leading to more appropriate measures for TB control. MIRU-VNTR typing leads to a much better understanding of the bacterial population structure and phylogenetic relationships between strains of MTB in different regions of Iran.

  13. Adenovirus type 35-vectored tuberculosis vaccine has an acceptable safety and tolerability profile in healthy, BCG-vaccinated, QuantiFERON(®)-TB Gold (+) Kenyan adults without evidence of tuberculosis.

    Science.gov (United States)

    Walsh, Douglas S; Owira, Victorine; Polhemus, Mark; Otieno, Lucas; Andagalu, Ben; Ogutu, Bernhards; Waitumbi, John; Hawkridge, Anthony; Shepherd, Barbara; Pau, Maria Grazia; Sadoff, Jerald; Douoguih, Macaya; McClain, J Bruce

    2016-05-05

    In a Phase 1 trial, we evaluated the safety of AERAS-402, an adenovirus 35-vectored TB vaccine candidate expressing 3 Mycobacterium tuberculosis (Mtb) immunodominant antigens, in subjects with and without latent Mtb infection. HIV-negative, BCG-vaccinated Kenyan adults without evidence of tuberculosis, 10 QuantiFERON(®)-TB Gold In-Tube test (QFT-G)(-) and 10 QFT-G(+), were randomized 4:1 to receive AERAS-402 or placebo as two doses, on Days 0 and 56, with follow up to Day 182. There were no deaths, serious adverse events or withdrawals. For 1 AERAS-402 QFT-G(-) and 1 AERAS-402 QFT-G(+) subject, there were 3 self-limiting severe AEs of injection site pain: 1 after the first vaccination and 1 after each vaccination, respectively. Two additional severe AEs considered vaccine-related were reported after the first vaccination in AERAS-402 QFT-G(+) subjects: elevated blood creatine phosphokinase and neutropenia, the latter slowly improving but remaining abnormal until study end. AERAS-402 was not detected in urine or throat cultures for any subject. In intracellular cytokine staining studies, curtailed by technical issues, we saw modest CD4+ and CD8+ T cell responses to Mtb Ag85A/b peptide pools among both QFT-G(-) and (+) subjects, with trends in the CD4+ T cells suggestive of boosting after the second vaccine dose, slightly more so in QFT-G(+) subjects. CD4+ and CD8+ responses to Mtb antigen TB10.4 were minimal. Increases in Adenovirus 35 neutralizing antibodies from screening to end of study, seen in 50% of AERAS-402 recipients, were mostly minimal. This small study confirms acceptable safety and tolerability profiles for AERAS-402, in line with other Phase 1 studies of AERAS-402, now to include QFT-G(+) subjects. Published by Elsevier Ltd.

  14. Active case finding and treatment adherence in risk groups in the tuberculosis pre-elimination era.

    Science.gov (United States)

    Gupta, R K; Lipman, M; Story, A; Hayward, A; de Vries, G; van Hest, R; Erkens, C; Rangaka, M X; Abubakar, I

    2018-05-01

    Vulnerable populations, including homeless persons, high-risk drug and alcohol users, prison inmates and other marginalised populations, contribute a disproportionate burden of tuberculosis (TB) cases in low-incidence settings. Drivers of this disease burden include an increased risk of both TB transmission in congregate settings, and progression from infection to active disease. Late diagnosis and poor treatment completion further propagate the epidemic and fuel the acquisition of drug resistance. These groups are therefore a major priority for TB control programmes in low-incidence settings. Targeted strategies include active case finding (ACF) initiatives and interventions to improve treatment completion, both of which should be tailored to local populations. ACF usually deploys mobile X-ray unit screening, which allows sensitive, high-throughput screening with immediate availability of results. Such initiatives have been found to be effective and cost-effective, and associated with reductions in proxy measures of transmission in hard-to-reach groups. The addition of point-of-care molecular diagnostics and automated X-ray readers may further streamline the screening pathway. There is little evidence to support interventions to improve adherence among these risk groups. Such approaches include enhanced case management and directly observed treatment, while video-observed therapy (currently under evaluation) appears to be a promising tool for the future. Integrating outreach services to include both case detection and case-management interventions that share a resource infrastructure may allow cost-effectiveness to be maximised. Integrating screening and treatment for other diseases that are prevalent among targeted risk groups into TB outreach interventions may further improve cost-effectiveness. This article reviews the existing literature, and highlights priorities for further research.

  15. Tuberculosis infection and disease in children living in households of Filipino patients with tuberculosis: a preliminary report.

    Science.gov (United States)

    Salazar-Vergara, R M L; Sia, I G; Tupasi, T E; Alcañeses, M R; Orillaza, R B; Co, V; Quelapio, M I D; Beltran, G; Legaspi, J D; Rostrata, M P C; Tecson, M E B; Corpuz, M L S B

    2003-12-01

    DOTS Clinic with a DOTS-Plus pilot project for the management of multidrug-resistant tuberculosis (MDR-TB) in a high burden country. To determine the prevalence of tuberculosis (TB) infection and disease among pediatric household contacts of patients with pulmonary TB (PTB). Cross-sectional study. One hundred and fifty-three children aged 0-15 years in the households of 62 bacteriologically confirmed PTB patients, including 44 with MDR-TB, were studied. BCG scars were noted, and tuberculin skin test (TST), screening chest radiography, and sputum or gastric aspirate smear and culture for Mycobacterium tuberculosis in those with radiographic findings suggestive of PTB were done. For children in this study, the prevalences of latent TB infection (LTBI), radiographically diagnosed pulmonary TB, and bacillary pulmonary TB were 69.2%, 3.3%, and 0.65%, respectively. Only age > or = 5 years was found to be a significant predictor of LTBI (OR 3.17, 95%CI 1.43-7.01). Contact investigation for active case-finding and early treatment of TB in children from households of patients with active PTB is essential for TB control. Further study on a more precise definition of TB infection and strategies for control in this population will be pursued.

  16. Mycobacterium tuberculosis lipomannan blocks TNF biosynthesis by regulating macrophage MAPK-activated protein kinase 2 (MK2) and microRNA miR-125b.

    Science.gov (United States)

    Rajaram, Murugesan V S; Ni, Bin; Morris, Jessica D; Brooks, Michelle N; Carlson, Tracy K; Bakthavachalu, Baskar; Schoenberg, Daniel R; Torrelles, Jordi B; Schlesinger, Larry S

    2011-10-18

    Contact of Mycobacterium tuberculosis (M.tb) with the immune system requires interactions between microbial surface molecules and host pattern recognition receptors. Major M.tb-exposed cell envelope molecules, such as lipomannan (LM), contain subtle structural variations that affect the nature of the immune response. Here we show that LM from virulent M.tb (TB-LM), but not from avirulent Myocobacterium smegmatis (SmegLM), is a potent inhibitor of TNF biosynthesis in human macrophages. This difference in response is not because of variation in Toll-like receptor 2-dependent activation of the signaling kinase MAPK p38. Rather, TB-LM stimulation leads to destabilization of TNF mRNA transcripts and subsequent failure to produce TNF protein. In contrast, SmegLM enhances MAPK-activated protein kinase 2 phosphorylation, which is critical for maintaining TNF mRNA stability in part by contributing microRNAs (miRNAs). In this context, human miRNA miR-125b binds to the 3' UTR region of TNF mRNA and destabilizes the transcript, whereas miR-155 enhances TNF production by increasing TNF mRNA half-life and limiting expression of SHIP1, a negative regulator of the PI3K/Akt pathway. We show that macrophages incubated with TB-LM and live M.tb induce high miR-125b expression and low miR-155 expression with correspondingly low TNF production. In contrast, SmegLM and live M. smegmatis induce high miR-155 expression and low miR-125b expression with high TNF production. Thus, we identify a unique cellular mechanism underlying the ability of a major M.tb cell wall component, TB-LM, to block TNF biosynthesis in human macrophages, thereby allowing M.tb to subvert host immunity and potentially increase its virulence.

  17. TUBERCULOSIS

    OpenAIRE

    Tarik Bajrović; Mahmud Nurkić; Šukrija Zvizdić

    2013-01-01

    Tuberculosis, known as the "White Plague" in the early 19th century, is the infectious disease, which is being researched today even in some of the most developed countries in the world. Epidemiological- epizootiological research points to the importance of pasteurizing milk as well as the transmission in aerosolized droplets in humans and animals. Mycobacterium tuberculosis (Mtb), M. bovis, M. africanum and M. microti are the mycobacteria that cause tuberculosis. Other mycobacteria cause dis...

  18. Spatial distribution of extensively drug-resistant tuberculosis (XDR TB patients in KwaZulu-Natal, South Africa.

    Directory of Open Access Journals (Sweden)

    Thandi Kapwata

    Full Text Available KwaZulu-Natal province, South Africa, has among the highest burden of XDR TB worldwide with the majority of cases occurring due to transmission. Poor access to health facilities can be a barrier to timely diagnosis and treatment of TB, which can contribute to ongoing transmission. We sought to determine the geographic distribution of XDR TB patients and proximity to health facilities in KwaZulu-Natal.We recruited adults and children with XDR TB diagnosed in KwaZulu-Natal. We calculated distance and time from participants' home to the closest hospital or clinic, as well as to the actual facility that diagnosed XDR TB, using tools within ArcGIS Network analyst. Speed of travel was assigned to road classes based on Department of Transport regulations. Results were compared to guidelines for the provision of social facilities in South Africa: 5km to a clinic and 30km to a hospital.During 2011-2014, 1027 new XDR TB cases were diagnosed throughout all 11 districts of KwaZulu-Natal, of whom 404 (39% were enrolled and had geospatial data collected. Participants would have had to travel a mean distance of 2.9 km (CI 95%: 1.8-4.1 to the nearest clinic and 17.6 km (CI 95%: 11.4-23.8 to the nearest hospital. Actual distances that participants travelled to the health facility that diagnosed XDR TB ranged from 50 km (n = 109, 27%, with a mean of 69 km. The majority (77% of participants travelled farther than the recommended distance to a clinic (5 km and 39% travelled farther than the recommended distance to a hospital (30 km. Nearly half (46% of participants were diagnosed at a health facility in eThekwini district, of whom, 36% resided outside the Durban metropolitan area.XDR TB cases are widely distributed throughout KwaZulu-Natal province with a denser focus in eThekwini district. Patients travelled long distances to the health facility where they were diagnosed with XDR TB, suggesting a potential role for migration or transportation in the XDR TB

  19. Incidence, risk factors and mortality of tuberculosis in Danish HIV patients 1995-2007

    DEFF Research Database (Denmark)

    Taarnhøj, Gry A.; Engsig, Frederik N; Ravn, Pernille

    2011-01-01

    Human Immunodeficiency Virus (HIV) infection predisposes to tuberculosis (TB). We described incidence, risk factors and prognosis of TB in HIV-1 infected patients during pre (1995-1996), early (1997-1999), and late Highly Active Antiretroviral Therapy (HAART) (2000-2007) periods.......Human Immunodeficiency Virus (HIV) infection predisposes to tuberculosis (TB). We described incidence, risk factors and prognosis of TB in HIV-1 infected patients during pre (1995-1996), early (1997-1999), and late Highly Active Antiretroviral Therapy (HAART) (2000-2007) periods....

  20. HIV-associated TB syndemic: A growing clinical challenge worldwide

    Directory of Open Access Journals (Sweden)

    Maria Theresa Montales

    2015-12-01

    Full Text Available The association of tuberculosis (TB with human immunodeficiency virus (HIV infection and acquired immune deficiency syndrome (AIDS over the past several years has become an emerging syndemic. Approximately 10% of people living with HIV (PLHIV with latent TB infection will develop active TB disease each year. In this review, we highlight that this phenomenon is not limited to high endemic regions like Afro-Asian nations, but globalization/migration is causing increased case detection even in developed nations such as the United States (US. Active screening should be performed for tuberculosis in PLHIV. A high degree of clinical suspicion for tuberculosis is warranted in PLHIV presenting with fever, cough and unintentional weight loss. HIV-Mycobacterium tuberculosis (MTB coinfection is often paucibacillary, precluding diagnosis by conventional diagnostics and/or smear-microscopy/culture. Improved detection of pulmonary and extrapulmonary tuberculosis is now possible by incorporation of the GeneXPERT MTB/RIF assay (Cepheid Inc, Sunnyvale, USA. The World Health Organization (WHO recommends instituting immediate therapy for Mycobacterium tuberculosis, in conjunction with ongoing or newly introduced antiretroviral therapy (ART. Vigilance is required to detect drug-induced organ injuries, and early-treatment induced immune reconstitution inflammatory syndrome (IRIS. Collaborating MTB and HIV activities in concentrated HIV epidemic settings should become a high public health priority.

  1. Increasing the Structural Coverage of Tuberculosis Drug Targets

    OpenAIRE

    Baugh, Loren; Phan, Isabelle; Begley, Darren W.; Clifton, Matthew C.; Armour, Brianna; Dranow, David M.; Taylor, Brandy M.; Muruthi, Marvin M.; Abendroth, Jan; Fairman, James W.; Fox, David; Dieterich, Shellie H.; Staker, Bart L.; Gardberg, Anna S.; Choi, Ryan

    2014-01-01

    High-resolution three-dimensional structures of essential Mycobacterium tuberculosis (Mtb) proteins provide templates for TB drug design, but are available for only a small fraction of the Mtb proteome. Here we evaluate an intra-genus “homolog-rescue” strategy to increase the structural information available for TB drug discovery by using mycobacterial homologs with conserved active sites. Of 179 potential TB drug targets selected for x-ray structure determination, only 16 yielded a crystal s...

  2. Serological testing versus other strategies for diagnosis of active tuberculosis in India: a cost-effectiveness analysis.

    Directory of Open Access Journals (Sweden)

    David W Dowdy

    2011-08-01

    Full Text Available Undiagnosed and misdiagnosed tuberculosis (TB drives the epidemic in India. Serological (antibody detection TB tests are not recommended by any agency, but widely used in many countries, including the Indian private sector. The cost and impact of using serology compared with other diagnostic techniques is unknown.Taking a patient cohort conservatively equal to the annual number of serological tests done in India (1.5 million adults suspected of having active TB, we used decision analysis to estimate costs and effectiveness of sputum smear microscopy (US$3.62 for two smears, microscopy plus automated liquid culture (mycobacterium growth indicator tube [MGIT], US$20/test, and serological testing (anda-tb ELISA, US$20/test. Data on test accuracy and costs were obtained from published literature. We adopted the perspective of the Indian TB control sector and an analysis frame of 1 year. Our primary outcome was the incremental cost per disability-adjusted life year (DALY averted. We performed one-way sensitivity analysis on all model parameters, with multiway sensitivity analysis on variables to which the model was most sensitive. If used instead of sputum microscopy, serology generated an estimated 14,000 more TB diagnoses, but also 121,000 more false-positive diagnoses, 102,000 fewer DALYs averted, and 32,000 more secondary TB cases than microscopy, at approximately four times the incremental cost (US$47.5 million versus US$11.9 million. When added to high-quality sputum smears, MGIT culture was estimated to avert 130,000 incremental DALYs at an incremental cost of US$213 per DALY averted. Serology was dominated by (i.e., more costly and less effective than MGIT culture and remained less economically favorable than sputum smear or TB culture in one-way and multiway sensitivity analyses.In India, sputum smear microscopy remains the most cost-effective diagnostic test available for active TB; efforts to increase access to quality-assured microscopy

  3. T Cell Reactivity against Mycolyl Transferase Antigen 85 of M. tuberculosis in HIV-TB Coinfected Subjects and in AIDS Patients Suffering from Tuberculosis and Nontuberculous Mycobacterial Infections

    Directory of Open Access Journals (Sweden)

    Pascal Launois

    2011-01-01

    Full Text Available The mycolyl transferase antigen 85 complex is a major secreted protein family from mycobacterial culture filtrate, demonstrating powerful T cell stimulatory properties in most HIV-negative, tuberculin-positive volunteers with latent M.tuberculosis infection and only weak responses in HIV-negative tuberculosis patients. Here, we have analyzed T cell reactivity against PPD and Ag85 in HIV-infected individuals, without or with clinical symptoms of tuberculosis, and in AIDS patients with disease caused by nontuberculous mycobacteria. Whereas responses to PPD were not significantly different in HIV-negative and HIV-positive tuberculin-positive volunteers, responses to Ag85 were significantly decreased in the HIV-positive (CDC-A and CDC-B group. Tuberculosis patients demonstrated low T cell reactivity against Ag85, irrespective of HIV infection, and finally AIDS patients suffering from NTM infections were completely nonreactive to Ag85. A one-year follow-up of twelve HIV-positive tuberculin-positive individuals indicated a decreased reactivity against Ag85 in patients developing clinical tuberculosis, highlighting the protective potential of this antigen.

  4. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  5. Importance of Therapeutic Drug Monitoring in the Treatment of Active Tuberculosis - A Retrospective Study of 4 Cases

    Directory of Open Access Journals (Sweden)

    Sanaa HAMMI

    2016-06-01

    Full Text Available Background: In the treatment of active tuberculosis, therapeutic drug monitoring (TDM is used to optimize dosing that maximizes therapeutic benefit while minimizing toxicity. In Morocco, TDM is not routinely used, yet low levels of anti-TB drugs can be associated with poorer treatment outcomes.Methods: We retrospectively checked our archives for patients with active TB for whom TDM was performed during 2014. Medical records were reviewed to abstract demographic, clinical, radiographic and microbiological data including time until smear and culture conversion. Then, we looked for cases with delay of TB conversion.Results: In total, 24 patients were identified, for whom TDM was performed, they all had low serum drug levels. Among them, 4 patients showed delayed bacteriological conversion.Conclusions: Our study cases are showing the benefit of serum dosage in the follow-up of the patients showing a delay of sputum examination conversion, both direct and culture, during their evolutions. TDM is potentially useful for the treatment of active TB, but is currently underused in Morocco.

  6. Tuberculosis risk factors among tuberculosis patients in Kampala, Uganda: implications for tuberculosis control

    NARCIS (Netherlands)

    Kirenga, Bruce J.; Ssengooba, Willy; Muwonge, Catherine; Nakiyingi, Lydia; Kyaligonza, Stephen; Kasozi, Samuel; Mugabe, Frank; Boeree, Martin; Joloba, Moses; Okwera, Alphonse

    2015-01-01

    Slow decline in the incidence of tuberculosis (TB) has been observed in most high TB burden countries. Knowledge of the prevalence of different TB risk factors can help expand TB control strategies. However with the exception of Human Immunodeficiency Virus (HIV) the prevalence of the other TB risk

  7. Tuberculosis

    Science.gov (United States)

    Friend, Milton

    1999-01-01

    Avian tuberculosis is usually caused by the bacterium Mycobacterium avium. At least 20 different types of M. avium have been identified, only three of which are known to cause disease in birds. Other types of Mycobacterium rarely cause tuberculosis in most avian species; however, parrots, macaws, and other large perching birds are susceptible to human and bovine types of tuberculosis bacilli. Avian tuberculosis generally is transmitted by direct contact with infected birds, ingestion of contaminated feed and water, or contact with a contaminated environment. Inhalation of the bacterium can cause respiratory tract infections. Wild bird studies in the Netherlands disclosed tuberculosis-infected puncture-type injuries in birds of prey that fight at the nest site (kestrels) or on the ground (buteo-type buzzards), but tuberculosisinfected injuries were not found in accipiters (falco

  8. Multidrug-resistant tuberculosis in Europe, 2010-2011

    DEFF Research Database (Denmark)

    Günther, Gunar; van Leth, Frank; Alexandru, Sofia

    2015-01-01

    Drug-resistant Mycobacterium tuberculosis is challenging elimination of tuberculosis (TB). We evaluated risk factors for TB and levels of second-line drug resistance in M. tuberculosis in patients in Europe with multidrug-resistant (MDR) TB. A total of 380 patients with MDR TB and 376 patients...... with non-MDR TB were enrolled at 23 centers in 16 countries in Europe during 2010-2011. A total of 52.4% of MDR TB patients had never been treated for TB, which suggests primary transmission of MDR M. tuberculosis. At initiation of treatment for MDR TB, 59.7% of M. tuberculosis strains tested were...

  9. Tuberculosis case finding in first-degree relative contacts not living with index tuberculosis cases in Kampala, Uganda

    Directory of Open Access Journals (Sweden)

    Chheng P

    2015-10-01

    Full Text Available Phalkun Chheng,1,2 Mary Nsereko,2 LaShaunda L Malone,2 Brenda Okware,2 Sarah Zalwango,2 Moses Joloba,2,3 W Henry Boom,2 Ezekiel Mupere,1,2,4 Catherine M Stein1,2 On behalf of the Tuberculosis Research Unit 1Department of Epidemiology and Biostatistics, Case Western Reserve University, Cleveland, OH, USA; 2Uganda-Case Western Reserve University Research Collaboration, 3Department of Medical Microbiology, College of Health Sciences, Makerere University, Kampala, Uganda; 4Department of Pediatrics and Child Health, College of Health Sciences, Makerere University, Kampala, Uganda Purpose: To assess the prevalence of pulmonary tuberculosis among first-degree relative (FDR contacts not living with tuberculosis (TB cases. Methods: A cross-sectional analysis of household contacts living with an index TB case and FDR contacts living outside of households in Kampala, Uganda, is presented. Results: A total of 177 contacts (52 FDRs and 125 index household contacts of 31 TB cases were examined. Compared with index household contacts, FDR contacts were older, more likely to be TB symptomatic (50% vs 33%, had a higher percentage of abnormal chest X-rays (19% vs 11%, sputum smear positive (15% vs 5%, and many similar epidemiologic risk factors, including HIV infection (13% vs 10%. Contact groups had similar pulmonary tuberculosis prevalence: 9.6% in FDR vs 10.4% in index household contacts and similar Mycobacterium tuberculosis infection: 62% in FDR vs 61% in index households. Conclusion: TB is common among FDR contacts. High TB prevalence justifies targeting FDRs during household contact investigations. Combining TB active-case finding among FDR contacts with household contact investigation in low-income setting is feasible. This should be part of national TB control program strategies for increasing TB case-detection rates and reducing community TB transmission and death. Keywords: prevalence of pulmonary tuberculosis, limited resource setting, contact tracing

  10. Risk for latent and active tuberculosis in Germany.

    Science.gov (United States)

    Herzmann, Christian; Sotgiu, Giovanni; Bellinger, Oswald; Diel, Roland; Gerdes, Silke; Goetsch, Udo; Heykes-Uden, Helga; Schaberg, Tom; Lange, Christoph

    2017-06-01

    Few individuals that are latently infected with M. tuberculosis latent tuberculosis infection(LTBI) progress to active disease. We investigated risk factors for LTBI and active pulmonary tuberculosis (PTB) in Germany. Healthy household contacts (HHCs), health care workers (HCWs) exposed to M. tuberculosis and PTB patients were recruited at 18 German centres. Interferon-γ release assay (IGRA) testing was performed. LTBI risk factors were evaluated by comparing IGRA-positive with IGRA-negative contacts. Risk factors for tuberculosis were evaluated by comparing PTB patients with HHCs. From 2008-2014, 603 HHCs, 295 HCWs and 856 PTBs were recruited. LTBI was found in 34.5% of HHCs and in 38.9% of HCWs. In HCWs, care for coughing patients (p = 0.02) and longstanding nursing occupation (p = 0.04) were associated with LTBI. In HHCs, predictors for LTBI were a diseased partner (odds ratio 4.39), sexual contact to a diseased partner and substance dependency (all p < 0.001). PTB was associated with male sex, low body weight (p < 0.0001), alcoholism (15.0 vs 5.9%; p < 0.0001), glucocorticoid therapy (7.2 vs 2.0%; p = 0.004) and diabetes (7.8 vs. 4.0%; p = 0.04). No contact developed active tuberculosis within 2 years follow-up. Positive IGRA responses are frequent among exposed HHCs and HCWs in Germany and are poor predictors for the development of active tuberculosis.

  11. Dendritic Cells Activate and Mature after Infection with Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Mamo Gezahagne

    2011-07-01

    Full Text Available Abstract Background Dendritic cells (DCs can take up an array of different antigens, including microorganisms which they can process and present more effectively than any other antigen presenting cell. However, whether the interaction between the human DC and Mycobacterium tuberculosis represents a defense mechanism by the invaded host, or helping the invader to evade the defense mechanism of the host is still not clearly understood. Findings To analyze the interactions between M. tuberculosis and immune cells, human peripheral blood monocyte-derived immature DCs were infected with M. tuberculosis H37Rv wild type strain and flow cytometry was used to analyse cell surface expression markers. The ability of the M. tuberculosis infected DC to induce T cell proliferation using 5 and 6-carboxyfluorescein diacetate succinimidyl ester (CFSE dilution technique was also investigated. DCs were found to internalize the mycobacteria and show dose dependent infection and necrosis with different multiplicity of infection. Flow cytometry analysis of cell surface expression markers CD40, CD54, CD80, CD83, CD86 and HLA DR in infected DC revealed significant (p M. tuberculosis in comparison to immature DC with no stimulation. Lipopolysaccharide (LPS from Salmonella abortus equi, a known DC maturation agent, was used as a positive control and showed a comparable up regulation of cell surface markers as observed with M. tuberculosis infected DC. It was revealed that the M. tuberculosis infected DC induced T cell proliferation. Conclusion These data clearly demonstrate that M. tuberculosis induces activation and maturation of human monocyte-derived immature DC as well as induces T cell proliferation in vitro.

  12. Local Inflammation, Dissemination and Coalescence of Lesions Are Key for the Progression toward Active Tuberculosis: The Bubble Model.

    Science.gov (United States)

    Prats, Clara; Vilaplana, Cristina; Valls, Joaquim; Marzo, Elena; Cardona, Pere-Joan; López, Daniel

    2016-01-01

    The evolution of a tuberculosis (TB) infection toward active disease is driven by a combination of factors mostly related to the host response. The equilibrium between control of the bacillary load and the pathology generated is crucial as regards preventing the growth and proliferation of TB lesions. In addition, some experimental evidence suggests an important role of both local endogenous reinfection and the coalescence of neighboring lesions. Herein we propose a mathematical model that captures the essence of these factors by defining three hypotheses: (i) lesions grow logistically due to the inflammatory reaction; (ii) new lesions can appear as a result of extracellular bacilli or infected macrophages that escape from older lesions; and (iii) lesions can merge when they are close enough. This model was implemented in Matlab to simulate the dynamics of several lesions in a 3D space. It was also fitted to available microscopy data from infected C3HeB/FeJ mice, an animal model of active TB that reacts against Mycobacterium tuberculosis with an exaggerated inflammatory response. The results of the simulations show the dynamics observed experimentally, namely an initial increase in the number of lesions followed by fluctuations, and an exponential increase in the mean area of the lesions. In addition, further analysis of experimental and simulation results show a strong coincidence of the area distributions of lesions at day 21, thereby highlighting the consistency of the model. Three simulation series removing each one of the hypothesis corroborate their essential role in the dynamics observed. These results demonstrate that three local factors, namely an exaggerated inflammatory response, an endogenous reinfection, and a coalescence of lesions, are needed in order to progress toward active TB. The failure of one of these factors stops induction of the disease. This mathematical model may be used as a basis for developing strategies to stop the progression of

  13. Local inflammation, dissemination and coalescence of lesions are key for the progression towards active tuberculosis: the bubble model

    Directory of Open Access Journals (Sweden)

    Clara ePrats

    2016-02-01

    Full Text Available The evolution of a tuberculosis (TB infection towards active disease is driven by a combination of factors mostly related to the host response. The equilibrium between control of the bacillary load and the pathology generated is crucial as regards preventing the growth and proliferation of TB lesions. In addition, some experimental evidence suggests an important role of both local endogenous reinfection and the coalescence of neighboring lesions.Herein we propose a mathematical model that captures the essence of these factors by defining three hypotheses: (i lesions grow logistically due to the inflammatory reaction; (ii new lesions can appear as a result of extracellular bacilli or infected macrophages that escape from older lesions; and (iii lesions can merge when they are close enough. This model was implemented in Matlab to simulate the dynamics of several lesions in a 3D space. It was also fitted to available microscopy data from infected C3HeB/FeJ mice, an animal model of active TB that reacts against Mycobacterium tuberculosis with an exaggerated inflammatory response.The results of the simulations show the dynamics observed experimentally, namely an initial increase in the number of lesions followed by oscillations, and an exponential increase in the mean area of the lesions. In addition, further analysis of experimental and simulation results show a strong coincidence of the area distributions of lesions at day 21, thereby highlighting the consistency of the model. Three simulation series removing each one of the hypothesis corroborate their essential role in the dynamics observed.These results demonstrate that three local factors, namely an exaggerated inflammatory response, an endogenous reinfection and a coalescence of lesions, are needed in order to progress towards active TB. The failure of one of these factors stops induction of the disease. This mathematical model may be used as a basis for developing strategies to stop the

  14. Tobacco use prevalence, knowledge, and attitudes among newly diagnosed tuberculosis patients in Penang State and Wilayah Persekutuan Kuala Lumpur, Malaysia

    OpenAIRE

    Awaisu, Ahmed; Nik Mohamed, Mohamad Haniki; Abd Aziz, Noorizan; Syed Sulaiman, Syed Azhar; Mohamad Noordin, Noorliza; Muttalif, Abdul Razak; Ahmad Mahayiddin, Aziah

    2010-01-01

    Abstract Background There is sufficient evidence to conclude that tobacco smoking is strongly linked to tuberculosis (TB) and a large proportion of TB patients may be active smokers. In addition, a previous analysis has suggested that a considerable proportion of the global burden of TB may be attributable to smoking. However, there is paucity of information on the prevalence of tobacco smoking among TB patients in Malaysia. Moreover, the tobacco-related knowledge, attitudes, and behaviors of...

  15. miR-582-5p is upregulated in patients with active tuberculosis and inhibits apoptosis of monocytes by targeting FOXO1.

    Science.gov (United States)

    Liu, Yanhua; Jiang, Jing; Wang, Xinjing; Zhai, Fei; Cheng, Xiaoxing

    2013-01-01

    Macrophage apoptosis is a host innate defense mechanism against tuberculosis (TB). In this study, we found that percentage of apoptotic cells in peripheral blood monocytes from patients with active TB was lower than that from healthy controls (pmicroRNAs can modulate apoptosis of monocytes, we investigated differentially expressed microRNAs in patients with active TB. miR-582-5p was mainly expressed in monocytes and was upregulated in patients with active TB. The apoptotic percentage of THP-1 cells transfected with miR-582-5p mimics was significantly lower than those transfected with negative control of microRNA mimics (pmicroRNA mimics were transfected into THP-1 cells. RT-PCR and western blot analysis showed that the miR-582-5p could suppress both FOXO1 mRNA and protein expression. Co-transfection of miR-582-5p and FOXO1 3'UTR-luciferase reporter vector into cells demonstrated that significant decrease in luciferase activity was only found in reporter vector that contained a wild type sequence of FOXO1 3'UTR, suggesting that miR-582-5p could directly target FOXO1. In conclusion, miR-582-5p inhibited apoptosis of monocytes by down-regulating FOXO1 expression and might play an important role in regulating anti-M. tuberculosis directed immune responses.

  16. Modifiable factors associated with active pulmonary tuberculosis in a Kenyan prison.

    Science.gov (United States)

    Amwayi, A S; Kikuvi, G M; Muchiri, E M

    2010-02-01

    To establish modifiable factors associated with active pulmonary tuberculosis (PTB) among prisoners. Retrospective matched case-control study. Nakuru GK prison in Kenya. A total of 144 subjects (48 cases and 96 controls) were recruited into the study. Cases were adult prisoners who had at least two initial sputum specimens being Acid Fast Bacilli-positive (AFB+) on direct smear microscopy and hence recruited to PTB WHO DOTS Programme. Controls were adults with no chronic cough and not on PTB treatment six months prior to the study. Independent factors significantly associated with active PTB disease were: self reported HIV+ status (OR=11; 95% CI = 2.42-47.77), evidence of BCG vaccination (OR = 0.20; 95% CI = 0.05-0.60), contact with PTB case (OR = 7.0; 95% CI = 1.17-38.23), unemployment (OR = 9.0; 95% CI = 1.84-43.97) and sharing linen (OR = 4.32; 95%CI = 1.08-17.29). Modifiable factors associated with active PTB in Nakuru G.K prison are: HIV status, BCG vaccination, PTB case contact, poverty and poor personal hygiene. We recommend HIV counselling and testing of all PTB patients, screening for TB upon prison entry and TB contact investigation and improving personal hygiene of prisoners.

  17. Evaluation of the efficacy of valproic acid and suberoylanilide hydroxamic acid (vorinostat in enhancing the effects of first-line tuberculosis drugs against intracellular Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Martin Rao

    2018-04-01

    Full Text Available Background: New tuberculosis (TB drug treatment regimens are urgently needed. This study evaluated the potential of the histone deacetylase inhibitors (HDIs valproic acid (VPA and suberoylanilide hydroxamic acid (SAHA to enhance the effects of first-line anti-TB drugs against intracellular Mycobacterium tuberculosis. Methods: M. tuberculosis H37Rv cultures were exposed to VPA or SAHA over 6 days, in the presence or absence of isoniazid (INH and rifampicin (RIF. The efficacy of VPA and SAHA against intracellular M. tuberculosis with and without INH or RIF was tested by treating infected macrophages. Bactericidal activity was assessed by counting mycobacterial colony-forming units (CFU. Results: VPA treatment exhibited superior bactericidal activity to SAHA (2-log CFU reduction, while both HDIs moderately improved the activity of RIF against extracellular M. tuberculosis. The bactericidal effect of VPA against intracellular M. tuberculosis was greater than that of SAHA (1-log CFU reduction and equalled that of INH (1.5-log CFU reduction. INH/RIF and VPA/SAHA combination treatment inhibited intracellular M. tuberculosis survival in a shorter time span than monotherapy (3 days vs. 6 days. Conclusions: VPA and SAHA have adjunctive potential to World Health Organization-recommended TB treatment regimens. Clinical evaluation of the two drugs with regard to reducing the treatment duration and improving treatment outcomes in TB is warranted. Keywords: Mycobacterium tuberculosis, Adjunct host-directed therapy, Tuberculosis, Histone deacetylase inhibitors, Repurposed drugs

  18. How many sputum culture results do we need to monitor multidrug-resistant-tuberculosis (MDR-TB) patients during treatment?

    NARCIS (Netherlands)

    Janssen, Saskia; Padanilam, Xavier; Louw, Rianna; Mahanyele, Russel; Coetzee, Gerrit; Hänscheid, Thomas; Leenstra, Tjalling; Grobusch, Martin P.

    2013-01-01

    Discharge of a hospital patient after a single negative sputum culture may save money when treating multidrug-resistant tuberculosis. However, after initial sputum conversion in 336 South Africans, 11.6% and 5.4% reconverted after 1 and 2 months, respectively. These findings endorse the WHO

  19. Adrenocortical function in hospitalised patients with active ...

    African Journals Online (AJOL)

    2006-05-17

    May 17, 2006 ... Tuberculosis (TB) is a major cause of morbidity and mortality in sub-Sah aran Africa, ... To assess whether adrenocortical function was compromised in patients with active tuberculosis. (TB) during the first 5 days of ..... Hernandez-Pando R, de la Luz Streber M, Orozco H, et al. Emergent immunoregulatory.

  20. Chest radiography and thoracic computed tomography findings in children who have family members with active pulmonary tuberculosis

    International Nuclear Information System (INIS)

    Uzum, Kazim; Karahan, Okkes I.; Dogan, Sukru; Coskun, Abdulhakim; Topcu, Faik

    2003-01-01

    Objective: The chest radiography and TCT findings in children who had contacted with adult family members with active pulmonary tuberculosis were compared. The contributions of thoracic computed tomography to the diagnosis of tuberculosis were investigated. Methods and material: The children who were 0-16 years old (n=173) and children of families with an adult member which was diagnosed as pulmonary tuberculosis were evaluated. The children were considered in two groups based on the absence (n=125) or presence (n=48) of complaints and/or ambiguous symptoms such as lack of appetite, mild cough, sweating, history of lung infection, low body weight and those with suspicious chest radiography findings (12 cases) were included in this study. Asymptomatic patients (n=125) did not undergo TCT. Patients who had positive PPD skin tests only received isoniazid. If the TCT demonstrated enlarged lymph nodes or parenchymal lesions, minimally active pulmonary tuberculosis was diagnosed and antituberculous treatment was given. Results and discussions: TCT revealed lymph node enlargement or parenchymal lesions in 39 children (81.2%). Of the 12 children whose CXRs revealed suspicious lymph node enlargement and/or infiltration, five had normal findings in TCT whereas the initial findings were confirmed in the remaining seven. These data suggest that there is a correlation between the presence of ambiguous symptoms in exposed children and TCT findings; chest radiography and TCT findings do not yield parallel findings. All the patients who received anti-TB treatment were resolved in the control examinations. Conclusion: In this study there is a correlation between presence of ambiguous symptoms and TCT findings, but the chest radiography and TCT findings do not yield harmony in exposed children with ambiguous symptoms (suspicious tuberculosis cases). These observations should be considered in children with symptoms similar to those of exposed children, but with no definite history of

  1. Persistent Latent Tuberculosis Reactivation Risk in United States Immigrants

    Science.gov (United States)

    Painter, John; Parker, Matthew; Lowenthal, Phillip; Flood, Jennifer; Fu, Yunxin; Asis, Redentor; Reves, Randall

    2014-01-01

    Rationale: Current guidelines limit latent tuberculosis infection (LTBI) evaluation to persons in the United States less than or equal to 5 years based on the assumption that high TB rates among recent entrants are attributable to high LTBI reactivation risk, which declines over time. We hypothesized that high postarrival TB rates may instead be caused by imported active TB. Objectives: Estimate reactivation and imported TB in an immigrant cohort. Methods: We linked preimmigration records from a cohort of California-bound Filipino immigrants during 2001–2010 with subsequent TB reports. TB was likely LTBI reactivation if the immigrant had no evidence of active TB at preimmigration examination, likely imported if preimmigration radiograph was abnormal and TB was reported less than or equal to 6 months after arrival, and likely reactivation of inactive TB if radiograph was abnormal but TB was reported more than 6 months after arrival. Measurements and Main Results: Among 123,114 immigrants, 793 TB cases were reported. Within 1 year of preimmigration examination, 85% of TB was imported; 6 and 9% were reactivation of LTBI and inactive TB, respectively. Conversely, during Years 2–9 after U.S. entry, 76 and 24% were reactivation of LTBI and inactive TB, respectively. The rate of LTBI reactivation (32 per 100,000) did not decline during Years 1–9. Conclusions: High postarrival TB rates were caused by detection of imported TB through active postarrival surveillance. Among immigrants without active TB at baseline, reported TB did not decline over 9 years, indicating sustained high risk of LTBI reactivation. Revised guidelines should support LTBI screening and treatment more than 5 years after U.S. arrival. PMID:24308495

  2. TUBERCULOSIS

    Directory of Open Access Journals (Sweden)

    Tarik Bajrović

    2013-10-01

    Full Text Available Tuberculosis, known as the "White Plague" in the early 19th century, is the infectious disease, which is being researched today even in some of the most developed countries in the world. Epidemiological- epizootiological research points to the importance of pasteurizing milk as well as the transmission in aerosolized droplets in humans and animals. Mycobacterium tuberculosis (Mtb, M. bovis, M. africanum and M. microti are the mycobacteria that cause tuberculosis. Other mycobacteria cause diseases commonly known as mycobacteriosae. Pathogenesis of tuberculosis includes both host- related and mycobacterium-related factors (virulence. Mtb acts through the expression of various genes and their proteins that are detectable in the serums of the diseased only, proving these proteins are formed in the course of the disease. In humans, a diagnosis is established by the detection of antigens (and antibodies, and in animals, with the allergy tests. As far as the bovine tuberculosis is concerned, the combination of skin tuberculin and blood gamma interferon test is recommended. Sequential genome (Mtb analysis has given the basis for further research of the new vaccines.Key words: Tuberculosis, pathogenesis, immunity

  3. 38 CFR 3.374 - Effect of diagnosis of active tuberculosis.

    Science.gov (United States)

    2010-07-01

    ... active tuberculosis. 3.374 Section 3.374 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS... Considerations Relative to Specific Diseases § 3.374 Effect of diagnosis of active tuberculosis. (a) Service diagnosis. Service department diagnosis of active pulmonary tuberculosis will be accepted unless a board of...

  4. Tuberculosis prevention and care in Korea: Evolution of policy and practice

    Directory of Open Access Journals (Sweden)

    Unyeong Go

    2018-05-01

    Full Text Available Tuberculosis (TB in Korea remains a serious health problem with an estimated 77 per 100,000 incidence rate for 2016. This makes Korea as the only OECD country with high incidence of TB. The government has increased budgets and strengthened patient management policies since 2011. The management of latent tuberculosis was added to the response with strengthened and extensive contact investigations in the five-year tuberculosis control plan (2013–2017 and implementation was established in 2013. Due to these efforts Korea has achieved an average 5.2% reduction annually in tuberculosis incidence rate between 2011 and 2016. To further expedite the reduction of the TB burden the government has introduced additional measures including mandatory screening of latent tuberculosis infection for community workers in congregate settings including daycare centers for children, kindergarten, and teachers in schools and health care workers in clinics and hospitals to solve the problems identified through contact investigations in 2017.Providing high quality free diagnosis and treatment of active TB including for multidrug resistant TB combined with active contact investigations is the mainstay of the current programmatic response in Korea. However, the limitation of existing tools for LTBI pose challenge including absence of best mechanism for effective communication with professionals and the public, the need for at least 3 months of treatment and the risk of side effects. Developing effective tools will help to overcome these challenges. Keywords: Tuberculosis, Latent tuberculosis infection, End TB, Contact investigations, Epidemiology

  5. Common features of tuberculosis and sarcoidosis

    Directory of Open Access Journals (Sweden)

    Esmaeil Mortaz

    2016-01-01

    Full Text Available Tuberculosis (TB is a disease caused by Mycobacterium tuberculosis. Despite the availability of novel therapeutic approaches, TB is considered as one of the leading causes of death due to infectious diseases worldwide. Alveolar macrophages are the first line of defense against M. tuberculosis; they ingest and sequester the bacilli within granulomatous structures. Control and resolution of the infection requires activated T lymphocytes as well as Th1 cytokines. There are two forms of TB: active TB and latent TB. Latent TB is a state in which M. tuberculosis survives in the body without causing overt signs and symptoms. People with latent TB are noncontagious. However, M. tuberculosis can become active in the body, multiply, and cause overt TB. Sarcoidosis, on the other hand, is an autoimmune disease of unknown etiology which can affect multiple systems of the body. Nonspecific constitutional symptoms, such as fever, fatigue, malaise, and weight loss, are present in approximately one-third of patients. Chest X-ray usually shows hilar and mediastinal lymphadenopathy. Although the lungs are the most common sites of inflammation, sarcoidosis can also involve other organs, such as the eyes (intraocular and adnexal, skin, lymph nodes, salivary glands, heart, spleen, liver, and the nervous system. Recent investigations have provided further insights into the genetic basis of sarcoidosis and the way genotype determines the clinical presentation and phenotype of patients. Histopathologic features are usually insufficient for diagnosis of sarcoidosis. Diagnosis of sarcoidosis in endemic areas for TB can become a great challenge. Both TB and sarcoidosis are granulomatous diseases; TB is characterized by caseating granulomas, whereas sarcoidosis is characterized by noncaseating granulomas. New cases of sarcoidosis are increasingly being diagnosed in areas endemic for TB due to increased orientation of physicians and availability of diagnostic modalities

  6. Tuberculosis

    Directory of Open Access Journals (Sweden)

    Elena Morán López

    2001-04-01

    Full Text Available En la actualidad la incidencia de la tuberculosis ha aumentado. El Mycobacterium tuberculosis infecta frecuentemente a las personas con SIDA, debido a que en estos pacientes hay una reducción de la resistencia mediada por células T, lo que propicia que este bacilo pueda desarrollar la enfermedad con una frecuencia superior a la de las personas sanas. La transmisión de la enfermedad puede ser por vía directa, de un individuo afectado a otro, fundamentalmente por las gotitas de saliva que contengan a este microorganismo, o por vía indirecta por la inhalación del bacilo que se puede encontrar por meses en los objetos de uso diario, debido a su gran resistencia. Las micobacterias que producen tuberculosis en el hombre inmunocompetente son la Mycobacterium tuberculosis y la bovis, otros tipos pueden provocar tuberculosis en individuos inmunocomprometidos. La patogenicidad de este bacilo está relacionada con su capacidad para escapar de la destrucción inducida por los macrófagos y para provocar hipersensibilidad de tipo retardado. Esta enfermedad tiene muy pocas manifestaciones bucales, lo que se observa generalmente es una úlcera que toma como asiento fundamental el dorso de la lengua. La tuberculosis amenaza con convertirse en una enfermedad incurable por la deficiente administración de los programas contra ésta, por lo que la OMS plantea para su detección y tratamiento el DOTS (tratamiento observado directamente, de corta duración que comienza a tener resultados satisfactorios, aunque en el último quinquenio, el 88 % de los pacientes que se estimaban como infectados por tuberculosis no recibieron DOTS.At present, the incidence of tuberculosis is on the rise. Mycobacterium tuberculosis often infests AIDS patients due to the fact that these persons´T-cell mediated resistance is reduced, which favors the development of the disease at a higher rate than in healthy people. The disease can be transmitted directly, that is , from an

  7. CXCL10/IP10 is a novel potential in vitro marker of TB infection

    Directory of Open Access Journals (Sweden)

    Ilaria Sauzullo

    2009-06-01

    Full Text Available Introduction IFN-γ is a pivotal cytokine in the immune response to Myc. tuberculosis, infact this is the key cytokine produced in response to antigens specific following tuberculosis exposure causing either active or latent tuberculosis (TB and this observation forms the basis of interferon gamma release assay (IGRA, but there are alternative or additional cytokines and chemokines that could be used to improve detection of Myc. tuberculosis infection.The aim of this study was to evaluate the diagnostic utility of chemokine CXCL10/IP-10 as biomarker of active TB and to compare the results with classical QuantiFERON-Gold assay . Methods CXCL10/IP-10 and IFN-γ responses to stimulation with ESAT-6 and CFP-10 were evaluated in 21 patients with active tuberculosis and in 6 healthy unexposed subjects with no history of TB or TB contact were used as controls healthy controls. QuantiFERON-TB Gold (QFT-G, Cellestis was used for the measurement of IFN-γ levels; CXCL10/IP-10 was detected by ELISA (R&D Systems . Results Of the 21 TB patients included, 11 had a QFT-G positive and 10 had negative QFT-G results.All QFT-G positive patients had increased levels of CXCL10/IP-10 (median, pg/ml in both ESAT-6 and CFP-10 stimulated samples patients compared to healthy controls (1807 and 1111 vs 251 and 188 of controls, respectively (p<0.001 for both. The patients with active TB and QFT-G negative exhibited higher concentrations of CXCL10/IP-10 following antigen stimulation (837 pg/ml for ESAT-6;1674 pg/ml for CFP-10 (p<0.001. Conclusion Our study showed that in all patients with active TB, the CXCL10/IP-10 is expressed in higher amounts than IFN-γ following Myc. tuberculosis antigen-specific stimulation, and CXCL10/IP-10 appeared to be even more sensitive than QuantiFERON TB-Gold in TB patients with negative IFN-γ response. The measurement of chemokine CXCL10/IP-10, although not specific for tuberculosis, may have potential as an alternative or additional marker

  8. Multifunctional Analysis of CD4+ T-Cell Response as Immune-Based Model for Tuberculosis Detection

    Directory of Open Access Journals (Sweden)

    Miriam Lichtner

    2015-01-01

    Full Text Available Mono- and multifunctional specific CD4+ and CD8+ T-cell responses were evaluated to improve the immune-based detection of active tuberculosis (TB and latent infection (LTBI. We applied flow cytometry to investigate cytokines profile (IFN-γ, TNF-α, and IL-2 of T cells after stimulation with TB antigens in 28 TB-infected subjects (18 active TB and 10 LTBI and 10 uninfected controls. Cytokines production by CD4+ T cells at single-cell levels was higher in TB-infected subjects than uninfected controls P0.45%, it was possible to differentiate TB-infected (>0.45% by uninfected subjects (0.182%. The magnitude of CD8+ T-cell responses showed no differences between active TB and LTBI. Multifunctional CD4+ T-cell responses could have the potential to identify at single time point subjects without TB infection and patients having active or latent TB.

  9. Modeling of novel diagnostic strategies for active tuberculosis - a systematic review: current practices and recommendations.

    Directory of Open Access Journals (Sweden)

    Alice Zwerling

    Full Text Available The field of diagnostics for active tuberculosis (TB is rapidly developing. TB diagnostic modeling can help to inform policy makers and support complicated decisions on diagnostic strategy, with important budgetary implications. Demand for TB diagnostic modeling is likely to increase, and an evaluation of current practice is important. We aimed to systematically review all studies employing mathematical modeling to evaluate cost-effectiveness or epidemiological impact of novel diagnostic strategies for active TB.Pubmed, personal libraries and reference lists were searched to identify eligible papers. We extracted data on a wide variety of model structure, parameter choices, sensitivity analyses and study conclusions, which were discussed during a meeting of content experts.From 5619 records a total of 36 papers were included in the analysis. Sixteen papers included population impact/transmission modeling, 5 were health systems models, and 24 included estimates of cost-effectiveness. Transmission and health systems models included specific structure to explore the importance of the diagnostic pathway (n = 4, key determinants of diagnostic delay (n = 5, operational context (n = 5, and the pre-diagnostic infectious period (n = 1. The majority of models implemented sensitivity analysis, although only 18 studies described multi-way sensitivity analysis of more than 2 parameters simultaneously. Among the models used to make cost-effectiveness estimates, most frequent diagnostic assays studied included Xpert MTB/RIF (n = 7, and alternative nucleic acid amplification tests (NAATs (n = 4. Most (n = 16 of the cost-effectiveness models compared new assays to an existing baseline and generated an incremental cost-effectiveness ratio (ICER.Although models have addressed a small number of important issues, many decisions regarding implementation of TB diagnostics are being made without the full benefits of insight from mathematical

  10. Directly observed therapy for treating tuberculosis

    OpenAIRE

    Karumbi, Jamlick; Garner, Paul

    2015-01-01

    Background Tuberculosis (TB) requires at least six months of treatment. If treatment is incomplete, patients may not be cured and drug resistance may develop. Directly Observed Therapy (DOT) is a specific strategy, endorsed by the World Health Organization, to improve adherence by requiring health workers, community volunteers or family members to observe and record patients taking each dose. Objectives To evaluate DOT compared to self-administered therapy in people on treatment for active TB...

  11. Anti-mycobacterium tuberculosis activity of polyherbal medicines used for the treatment of tuberculosis in Eastern Cape, South Africa.

    Science.gov (United States)

    Famewo, Elizabeth B; Clarke, Anna M; Wiid, Ian; Ngwane, Andile; van Helden, Paul; Afolayan, Anthony J

    2017-09-01

    The emergence of drug-resistant strains of Mycobacterium tuberculosis has become a global public health problem. Polyherbal medicines offer great hope for developing alternative drugs for the treatment of tuberculosis. To evaluate the anti-tubercular activity of polyherbal medicines used for the treatment of tuberculosis. The remedies were screened against Mycobacterium tuberculosis H37Rv using Middlebrook 7H9 media and MGIT BACTEC 960 system. They were liquid preparations from King Williams Town site A (KWTa), King Williams Town site B (KWTb), King Williams Town site C (KWTc), Hogsback first site (HBfs), Hogsback second site (HBss), Hogsback third site (HBts), East London (EL), Alice (AL) and Fort Beaufort (FB). The susceptibility testing revealed that all the remedies contain anti-tubercular activity with KWTa, KWTb, KWTc, HBfs, HBts, AL and FB exhibiting more activity at a concentration below 25 µl/ml. Furthermore, MIC values exhibited inhibitory activity with the most active remedies from KWTa, HBfs and HBts at 1.562 µg/ml. However, isoniazid showed more inhibitory activity against M. tuberculosis at 0.05 µg/ml when compare to the polyherbal remedies. This study has indicated that these remedies could be potential sources of new anti-mycobacterial agents against M. tuberculosis . However, the activity of these preparations and their active principles still require in vivo study in order to assess their future as new anti-tuberculosis agents.

  12. Spinal tuberculosis.

    Science.gov (United States)

    Dunn, R N; Ben Husien, M

    2018-04-01

    Tuberculosis (TB) remains endemic in many parts of the developing world and is increasingly seen in the developed world due to migration. A total of 1.3 million people die annually from the disease. Spinal TB is the most common musculoskeletal manifestation, affecting about 1 to 2% of all cases of TB. The coexistence of HIV, which is endemic in some regions, adds to the burden and the complexity of management. This review discusses the epidemiology, clinical presentation, diagnosis, impact of HIV and both the medical and surgical options in the management of spinal TB. Cite this article: Bone Joint J 2018;100-B:425-31.

  13. Convergence of a diabetes mellitus, protein energy malnutrition, and TB epidemic: the neglected elderly population.

    Science.gov (United States)

    Menon, Sonia; Rossi, Rodolfo; Nshimyumukiza, Leon; Wusiman, Aibibula; Zdraveska, Natasha; Eldin, Manal Shams

    2016-07-26

    On a global scale, nearly two billion persons are infected with Mycobacterium tuberculosis. From this vast reservoir of latent tuberculosis (TB) infection, a substantial number will develop active TB during their lifetime, with some being able to transmit TB or Multi-drug- resistant (MDR) TB to others. There is clinical evidence pointing to a higher prevalence of infectious diseases including TB among individuals with Diabetes Mellitus (DM). Furthermore, ageing and diabetes mellitus may further aggravate protein-energy malnutrition (PEM), which in turn impairs T-lymphocyte mediated immunologic defenses, thereby increasing the risk of developing active TB and compromising TB treatment. This article aims to a) highlight synergistic mechanisms associated with immunosenescence, DM and PEM in relation to the development of active TB and b) identify nutritional, clinical and epidemiological research gaps. To explore the synergistic relationship between ageing, DM, tuberculosis and PEM, a comprehensive review was undertaken. The MEDLINE and the Google Scholar databases were searched for articles published from 1990 to March 2015, using different MESH keywords in various combinations. Ageing and DM act synergistically to reduce levels of interferon gamma (IFN- γ), thereby increasing susceptibility to TB, for which cell mediated immunity (CMI) plays an instrumental role. These processes can set in motion a vicious nutritional cycle which can predispose to PEM, further impairing the CMI and consequently limiting host defenses. This ultimately transforms the latent TB infection into active disease. A clinical diagnostic algorithm and clinical guidelines need to be established for this population. Given the increase in ageing population with DM and PEM, especially in resource-poor settings, these synergistic tripartite interactions must be examined if a burgeoning TB epidemic is to be averted. Implementation of a comprehensive, all-encompassing approach to curb transmission

  14. Nutritional supplements for people being treated for active tuberculosis

    Science.gov (United States)

    Grobler, Liesl; Nagpal, Sukrti; Sudarsanam, Thambu D; Sinclair, David

    2016-01-01

    Background Tuberculosis and malnutrition are linked in a complex relationship. Tuberculosis may cause undernutrition through increased metabolic demands and decreased intake, and nutritional deficiencies may worsen the disease, or delay recovery by depressing important immune functions. At present, there is no evidence-based nutritional guidance for adults and children being treated for tuberculosis. Objectives To assess the effects of oral nutritional supplements in people being treated with antituberculous drug therapy for active tuberculosis. Search methods We searched the Cochrane Infectious Disease Group Specialized Register, Cochrane Central Register of Controlled Trials (CENTRAL; Issue 1, 2016), MEDLINE (from 1946 to 4 February 2016), EMBASE (from 1980 to 4 February 2016), LILACS (from 1982 to 4 February 2016), the metaRegister of Controlled Trials (mRCT), the World Health Organization (WHO) International Clinical Trials Registry Platform (ICTRP), and the Indian Journal of Tuberculosis up to 4 February 2016, and checked the reference lists of all included studies. Selection criteria Randomized controlled trials that compared any oral nutritional supplement given for at least four weeks with no nutritional intervention, placebo, or dietary advice only for people being treated for active tuberculosis. The primary outcomes of interest were all-cause death, and cure at six and 12 months. Data collection and analysis Two review authors independently selected trials for inclusion, and extracted data and assessed the risk of bias in the included trials. We presented the results as risk ratios (RR) for dichotomous variables, and mean differences (MD) for continuous variables, with 95% confidence intervals (CIs). Where appropriate, we pooled data from trials with similar interventions and outcomes. We assessed the quality of the evidence using the Grading of Recommendation Assessment, Development and Evaluation (GRADE) approach. Main results Thirty-five trials

  15. Revisiting the natural history of tuberculosis. The inclusion of constant reinfection, host tolerance, and damage-response frameworks leads to a better understanding of latent infection and its evolution towards active disease.

    Science.gov (United States)

    Cardona, Pere-Joan

    2010-02-01

    Once Mycobacterium tuberculosis infects a person it can persist for a long time in a process called latent tuberculosis infection (LTBI). LTBI has traditionally been considered to involve the bacilli remaining in a non-replicating state (dormant) in old lesions but still retaining their ability to induce reactivation and cause active tuberculosis (TB) once a disruption of the immune response takes place. The present review aims to challenge these concepts by including recent experimental data supporting LTBI as a constant endogenous reinfection process as well as the recently introduced concepts of damage-response and tolerance frameworks to explain TB induction. These frameworks highlight the key role of an exaggerated and intolerant host response against M. tuberculosis bacilli which induces the classical TB cavity in immunocompetent adults once the constant endogenous reinfection process has resulted in the presence of bacilli in the upper lobes, where they can grow faster and the immune response is delayed. This essay intends to provide new clues to understanding the induction of TB in non-immunosuppressed patients.

  16. Interferon-gamma release assay and Rifampicin therapy for household contacts of tuberculosis.

    Science.gov (United States)

    Wang, Jann-Yuan; Shu, Chin-Chung; Lee, Chih-Hsin; Yu, Chong-Jen; Lee, Li-Na; Yang, Pan-Chyr

    2012-03-01

    Longitudinal studies in household contacts to identify subgroups at risk of active tuberculosis are lacking. Household contacts of pulmonary tuberculosis patients were prospectively enrolled to receive chest radiography, sputum studies, and T-SPOT.TB assay at initial visit. Repeat examinations every 6 months for 3 years, and 4-month rifampin preventive therapy for T-SPOT.TB-positive contacts were provided. We investigated factors predicting T-SPOT.TB-positivity and active pulmonary tuberculosis. 583 contacts were enrolled with a follow-up duration of 20.7 ± 9.4 months. 176 (30.2%) were T-SPOT.TB-positive initially and 32 (18.2%) of them received preventive therapy. Old age, living in the same room/house with the index case, the index case having a high smear grade (3+ ∼ 4+) and pulmonary cavitation were associated with T-SPOT.TB-positivity. Active tuberculosis developed in 9 T-SPOT.TB-positive contacts; risk factors included T-SPOT.TB-positivity without preventive therapy, living in the same room, and the index case being ≤50 years or female. 108 (61.4%) T-SPOT.TB-positive contacts had repeat examinations. Forty-five had T-SPOT.TB reversion and none of them developed active tuberculosis. Household contacts who are T-SPOT.TB-positive and live in the same room as the index case are at risk of active tuberculosis and require preventive therapy and close follow-up. Copyright © 2011 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  17. Impact of tuberculosis treatment on CD4 cell count, HIV RNA, and p24 antigen in patients with HIV and tuberculosis

    DEFF Research Database (Denmark)

    Wejse, Christian; Furtado, A.; Camara, C.

    2013-01-01

    To describe HIV RNA levels during tuberculosis (TB) infection in patients co-infected with TB and HIV. Moreover, to examine the p24 antigen profile during TB treatment.......To describe HIV RNA levels during tuberculosis (TB) infection in patients co-infected with TB and HIV. Moreover, to examine the p24 antigen profile during TB treatment....

  18. Delayed culture conversion due to cigarette smoking in active pulmonary tuberculosis patients

    NARCIS (Netherlands)

    Nijenbandring de Boer, Renee; Oliveira e Souza Filho, João Baptista de; Cobelens, Frank; Ramalho, Daniela de Paula; Campino Miranda, Pryscilla Fernandes; Logo, Karina de; Oliveira, Hedi; Mesquita, Eliene; Oliveira, Martha Maria; Kritski, Afrânio

    2014-01-01

    Although many studies have assessed factors affecting culture conversion during tuberculosis treatment, few have looked into the effect of tobacco smoking. This study included 89 active pulmonary tuberculosis patients with positive sputum culture upon presentation and collected information regarding

  19. MicroRNA-365 in macrophages regulates Mycobacterium tuberculosis-induced active pulmonary tuberculosis via interleukin-6.

    Science.gov (United States)

    Song, Qingzhang; Li, Hui; Shao, Hua; Li, Chunling; Lu, Xiao

    2015-01-01

    The present study is to investigate the relationship between microRNA (miR)-365 expression and the levels of interleukin (IL)-6 mRNA and protein in patients with active tuberculosis. From June 2011 to June 2014, 48 patients with active pulmonary tuberculosis induced by Mycobacterium tuberculosis were included in the study. In addition, 23 healthy subjects were enrolled as control. Macrophages were collected by pulmonary alveolus lavage. In addition, serum and mononuclear cells were isolated from peripheral blood. The levels of miR-365 and IL-6 in macrophages, mononuclear cells and serum were determined using quantitative real-time polymerase chain reaction. The protein expression of IL-6 in macrophages and mononuclear cells was measured using Western blotting, while that in serum was detected by enzyme-linked immunoabsorbent assay. Expression of IL-6 mRNA and protein was significantly enhanced in patients with active pulmonary tuberculosis. Increase of IL-6 protein concentration in serum was probably due to the release of IL-6 protein from mononuclear cells in the blood. In addition, miR-365 levels were significantly lowered in patients with active pulmonary tuberculosis. Up-regulated IL-6 expression in macrophages, mononuclear cells and serum in patients with active pulmonary tuberculosis is related to the down-regulation of miR-365, suggesting that miR-365 may regulate the occurrence and immune responses of active pulmonary tuberculosis via IL-6.

  20. Nutritional supplements for people being treated for active tuberculosis

    African Journals Online (AJOL)

    2018-01-17

    Jan 17, 2018 ... review assessing the effects of oral nutritional supplements in people with active tuberculosis who are receiving antituberculosis drug therapy. The review ... 2 Cochrane Nutrition, hosted jointly by the Centre for Evidence-Based Health Care, Faculty of Medicine and Health Sciences, Stellenbosch. University ...

  1. Treatment of Latent Tuberculosis Infection: An Updated Network Meta-analysis

    OpenAIRE

    Zenner, D.; Beer, N.; Harris, R. J.; Lipman, M. C.; Stagg, H. R.; van der Werf, M. J.

    2017-01-01

    Background: Treatment of latent tuberculosis infection (LTBI) is an important component of tuberculosis (TB) control, and this study updates a previous network meta-analysis of the best LTBI treatment options to inform public health action and programmatic management of LTBI. Purpose: To evaluate the comparative efficacy and harms of LTBI treatment regimens aimed at preventing active TB among adults and children. Data Sources: PubMed, Embase, and Web of Science from indexing ...

  2. Identification of Serum microRNA Biomarkers for Tuberculosis Using RNA-seq

    OpenAIRE

    Zhang, Hongtai; Sun, Zhaogang; Wei, Wenjing; Liu, Zhonghui; Fleming, Joy; Zhang, Shuai; Lin, Nan; Wang, Ming; Chen, Maoshan; Xu, Yuhui; Zhou, Jie; Li, Chuanyou; Bi, Lijun; Zhou, Guangming

    2014-01-01

    Tuberculosis (TB) remains a significant human health issue. More effective biomarkers for use in tuberculosis prevention, diagnosis, and treatment, including markers that can discriminate between healthy individuals and those with latent infection, are urgently needed. To identify a set of such markers, we used Solexa sequencing to examine microRNA expression in the serum of patients with active disease, healthy individuals with latent TB, and those with or without prior BCG inoculation. We i...

  3. Tuberculosis

    OpenAIRE

    Latorre Tortello, Pablo

    2011-01-01

    Por definición, la tuberculosis pulmonar es la localizaci6n del M. tuberculosis en el tracto respiratorio, la forma más común y principal de la afección y la única capaz de contagiar a otras personas. El M. tuberculosis, descubierto por Robert Koch en 1882, el bacilo de Koch, es un bacilo delgado, inmóvil, de 4 micras de longitud media, aerobio obligado, que se tiñe de rajo por la tinción de Ziehl-Neelsen. Debido a la coraza lipídica de su pared, lo hace resistente a la decoloración con ácido...

  4. Tuberculosis

    Directory of Open Access Journals (Sweden)

    Pablo Latorre Tortello

    1998-10-01

    Full Text Available Por definición, la tuberculosis pulmonar es la localizaci6n del M. tuberculosis en el tracto respiratorio, la forma más común y principal de la afección y la única capaz de contagiar a otras personas. El M. tuberculosis, descubierto por Robert Koch en 1882, el bacilo de Koch, es un bacilo delgado, inmóvil, de 4 micras de longitud media, aerobio obligado, que se tiñe de rajo por la tinción de Ziehl-Neelsen. Debido a la coraza lipídica de su pared, lo hace resistente a la decoloración con ácidos y alcohol, de ahí el nombre de bacilos ácido-alcohol resistente (BAAR. Su transmisión es directa, de persona a persona.

  5. Tuberculosis

    OpenAIRE

    Pablo Latorre Tortello

    1998-01-01

    Por definición, la tuberculosis pulmonar es la localizaci6n del M. tuberculosis en el tracto respiratorio, la forma más común y principal de la afección y la única capaz de contagiar a otras personas. El M. tuberculosis, descubierto por Robert Koch en 1882, el bacilo de Koch, es un bacilo delgado, inmóvil, de 4 micras de longitud media, aerobio obligado, que se tiñe de rajo por la tinción de Ziehl-Neelsen. Debido a la coraza lipídica de su pared, lo hace resistente a la decoloración con ácido...

  6. Validación de instrumento para identificar el nivel de vulnerabilidad de los trabajadores de la salud a la tuberculosis en instituciones de salud (IVTS TB-001

    Directory of Open Access Journals (Sweden)

    Óscar Andrés Cruz Martínez

    2015-12-01

    Full Text Available La Salud y Seguridad en el trabajo son una prioridad en los trabajadores que cuidan la salud, dada su permanente exposición a factores de riesgo en el proceso de trabajo que desarrollan. De forma particular, la exposición a la tuberculosis en los trabajadores sanitarios, se considera una problemática frecuente y relevante en su estudio, lo cual precisa la necesidad de desarrollar procesos metodológicos y de validación de instrumentos sólidos, que contribuyan a la identificación e intervención de los factores de vulnerabilidad de los trabajadores del sector salud a la tuberculosis. Objetivo: Diseñar y validar un instrumento que permita identificar el nivel de vulnerabilidad de los Trabajadores de la Salud a la Tuberculosis en Instituciones de Salud. Materiales y Métodos: Estudio de tipo metodológico, correspondiente al diseño y validación de un instrumento en sus fases de validación aparente y validación de contenido, que permita identificar el nivel de vulnerabilidad de los Trabajadores de la Salud a la Tuberculosis en Instituciones de Salud Resultados: Se efectuó el diseño del instrumento, en sus 4 dimensiones, 19 subdimensiones y 50 ítems, con su posterior validación aparente en la población objeto, mediante la valoración de la comprensibilidad, en una muestra aleatoria de N° = (502 trabajadores de la salud de dos instituciones en las cuales se brinda atención a pacientes con diagnóstico de tuberculosis. La valoración de la Comprensibilidad del instrumento en los trabajadores, fue del (97,8%. De igual manera, se realizó juicio de expertos y se obtuvo un índice mayor de > 0.58 en la comprensión de los ítems con N= (0.90, una precisión del N = (0.90, y una claridad del N = (0.92. En la validación de contenido se obtuvo una razón de validez de Lawshe modificado por Tristán del N = (0,91, demostrando características de validez aparente y de contenido. Conclusión: El diseño y validación del instrumento (IVTS TB

  7. Conjugation with an Inulin-Chitosan Adjuvant Markedly Improves the Immunogenicity of Mycobacterium tuberculosis CFP10-TB10.4 Fusion Protein.

    Science.gov (United States)

    Yu, Weili; Hu, Tao

    2016-11-07

    Protein-based vaccines are of potential to deal with the severe situations posed by Mycobacterium tuberculosis (Mtb). Due to inherently poor immunogenicity of Mtb protein antigens, a potent immunostimulatory adjuvant is needed to enhance the cellular and humoral immune response to Mtb protein antigens. Inulin and chitosan (Cs) are polysaccharide adjuvants that can be used to achieve such an objective. The inulin-Cs conjugate (inulin-Cs) acted as a potent adjuvant through a synergistic interaction of inulin and Cs. CFP10 and TB10.4 are two important virulent protein antigens of Mtb. The CFP10-TB10.4 fusion protein (CT) was constructed and used as the protein antigen. In the present study, an adjuvant delivery system (inulin-Cs-CT) was developed by covalent conjugation of CT with inulin-Cs. Conjugation with inulin-Cs significantly increased the hydrodynamic volume of CT and did not alter the structure of CT. High levels of Th1-type cytokines (IFN-γ, TNF-α, and IL-2) and Th2-type cytokine (IL-4) were secreted by provocation of inulin-Cs-CT. Inulin-Cs-CT elicited high CT-specific antibody titers, mostly in the form of IgG1 and IgG2b. Pharmacokinetics revealed that conjugation with inulin-Cs could prolong the serum exposure of CT to the immune system. Pharmacodynamics suggested that conjugation with inulin-Cs led to an efficient production of CT-specific IgG. Thus, conjugation of inulin-Cs can serve as a potent adjuvant delivery system to improve the immunogenicity of the Mtb protein antigens.

  8. Immune Responses Involved in Mycobacterium Tuberculosis Infection

    Directory of Open Access Journals (Sweden)

    Roghayeh Teimourpour

    2016-09-01

    Full Text Available Background and Objectives: Mycobacterium tuberculosis is the causative agent of tuberculosis (TB. Approximately one-third of the world's population is infected with M. tuberculosis. Despite the availability of drug and vaccine, it remains one of the leading causes of death in humans especially in developing countries. Epidemiological studies have indicated that only 10-30% of people exposed to tubercle bacillus are infected with M. tuberculosis, and at least 90% of the infected people finally do not acquire TB. The studies have indicated that the host efficient immune system has essential roles in the control of TB infection such that the highest rate of mortality and morbidity is seen in immunocompromised patients such as people infected with HIV. M. tuberculosis is an obligatory intracellular bacterium. It enters the body mainly through the respiratory tract and alveolar macrophages combat this pathogen most commonly. In addition to alveolar macrophages, various T-cell subpopulations need to be activated to overcome this bacterium's resistance to the host defense systems. CD4+ T cells, through production of several cytokines such as IFN-γ and TNF-α, and CD8+ T cells, through cytotoxic activities and induction of apoptosis in infected cells, play critical roles in inducing appropriate immune responses against M. tuberculosis. Although cell-mediated immunity is the cornerstone of host responses against TB and the recent studies have provided evidence for the importance of humoral and innate immune system in the control of TB, a profound understanding of the immune responses would provide a basis for development of new generations of vaccines and drugs. The present study addresses immune responses involved in M. tuberculosis infection.

  9. Challenges from Tuberculosis Diagnosis to Care in Community-Based Active Case Finding among the Urban Poor in Cambodia: A Mixed-Methods Study.

    Science.gov (United States)

    Lorent, Natalie; Choun, Kimcheng; Malhotra, Shelly; Koeut, Pichenda; Thai, Sopheak; Khun, Kim Eam; Colebunders, Robert; Lynen, Lut

    2015-01-01

    While community-based active case finding (ACF) for tuberculosis (TB) holds promise for increasing early case detection among hard-to-reach populations, limited data exist on the acceptability of active screening. We aimed to identify barriers and explore facilitators on the pathway from diagnosis to care among TB patients and health providers. Mixed-methods study. We administered a survey questionnaire to, and performed in-depth interviews with, TB patients identified through ACF from poor urban settlements in Phnom Penh, Cambodia. Additionally, we conducted focus group discussions and in-depth interviews with community and public health providers involved in ACF, respectively. Acceptance of home TB screening was strong among key stakeholders due to perceived reductions in access barriers and in direct and indirect patient costs. Privacy and stigma were not an issue. To build trust and facilitate communication, the participation of community representatives alongside health workers was preferred. Most health providers saw ACF as complementary to existing TB services; however, additional workload as a result of ACF was perceived as straining operating capacity at public sector sites. Proximity to a health facility and disease severity were the strongest determinants of prompt care-seeking. The main reasons reported for delays in treatment-seeking were non-acceptance of diagnosis, high indirect costs related to lost income/productivity and transportation expenses, and anticipated side-effects from TB drugs. TB patients and health providers considered home-based ACF complementary to facility-based TB screening. Strong engagement with community representatives was believed critical in gaining access to high risk communities. The main barriers to prompt treatment uptake in ACF were refusal of diagnosis, high indirect costs, and anticipated treatment side-effects. A patient-centred approach and community involvement were essential in mitigating barriers to care in

  10. Challenges from Tuberculosis Diagnosis to Care in Community-Based Active Case Finding among the Urban Poor in Cambodia: A Mixed-Methods Study.

    Directory of Open Access Journals (Sweden)

    Natalie Lorent

    Full Text Available While community-based active case finding (ACF for tuberculosis (TB holds promise for increasing early case detection among hard-to-reach populations, limited data exist on the acceptability of active screening. We aimed to identify barriers and explore facilitators on the pathway from diagnosis to care among TB patients and health providers.Mixed-methods study. We administered a survey questionnaire to, and performed in-depth interviews with, TB patients identified through ACF from poor urban settlements in Phnom Penh, Cambodia. Additionally, we conducted focus group discussions and in-depth interviews with community and public health providers involved in ACF, respectively.Acceptance of home TB screening was strong among key stakeholders due to perceived reductions in access barriers and in direct and indirect patient costs. Privacy and stigma were not an issue. To build trust and facilitate communication, the participation of community representatives alongside health workers was preferred. Most health providers saw ACF as complementary to existing TB services; however, additional workload as a result of ACF was perceived as straining operating capacity at public sector sites. Proximity to a health facility and disease severity were the strongest determinants of prompt care-seeking. The main reasons reported for delays in treatment-seeking were non-acceptance of diagnosis, high indirect costs related to lost income/productivity and transportation expenses, and anticipated side-effects from TB drugs.TB patients and health providers considered home-based ACF complementary to facility-based TB screening. Strong engagement with community representatives was believed critical in gaining access to high risk communities. The main barriers to prompt treatment uptake in ACF were refusal of diagnosis, high indirect costs, and anticipated treatment side-effects. A patient-centred approach and community involvement were essential in mitigating barriers

  11. Vitamin D: Immuno-modulation and tuberculosis treatment.

    Science.gov (United States)

    Selvaraj, Paramasivam; Harishankar, Murugesan; Afsal, Kolloli

    2015-05-01

    Tuberculosis (TB) is a major global health problem and often coincides with vitamin D deficiency. High doses of vitamin D were widely used to treat TB during the pre-antibiotic era. Vitamin D exerts its action through vitamin D receptor (VDR), and VDR gene polymorphisms are associated with susceptibility or resistance to tuberculosis as well as sputum smear and culture conversion during anti-TB treatment. In-vitro studies have revealed that 1,25-dihydroxyvitamin D3 enhances innate immunity by increased expression of various antimicrobial peptides, including cathelicidin, and induction of autophagy of the infected cells thus restricts the intracellular growth of Mycobacterium tuberculosis in macrophages. On the other hand, vitamin D has been shown to suppress the pro-inflammatory cytokine response and enhance the anti-inflammatory response. Supplementation with vitamin D in concert with treatment for TB may be beneficial with respect to minimizing the excessive tissue damage that occurs during the active stage of tuberculosis disease. Several clinical trials have evaluated vitamin D supplementation as an adjunct therapy in the treatment for tuberculosis. However, results are conflicting, owing to variations in dose regimens and outcomes. Further investigations are needed to find the optimal concentration of vitamin D for supplementation with standard anti-TB drugs to optimize treatment, which could help to effectively manage both drug-sensitive and drug-resistant tuberculosis.

  12. Progression to active tuberculosis, but not transmission, varies by Mycobacterium tuberculosis lineage in The Gambia

    NARCIS (Netherlands)

    de Jong, Bouke C.; Hill, Philip C.; Aiken, Alex; Awine, Timothy; Antonio, Martin; Adetifa, Ifedayo M.; Jackson-Sillah, Dolly J.; Fox, Annette; Deriemer, Kathryn; Gagneux, Sebastien; Borgdorff, Martien W.; McAdam, Keith P. W. J.; Corrah, Tumani; Small, Peter M.; Adegbola, Richard A.

    2008-01-01

    BACKGROUND: There is considerable variability in the outcome of Mycobacterium tuberculosis infection. We hypothesized that Mycobacterium africanum was less likely than M. tuberculosis to transmit and progress to tuberculosis disease. METHODS: In a cohort study of patients with tuberculosis and their

  13. Risk assessment of tuberculosis in immunocompromised patients

    DEFF Research Database (Denmark)

    Sester, Martina; van Leth, Frank; Bruchfeld, Judith

    2014-01-01

    RATIONALE: In the absence of active tuberculosis, a positive tuberculin skin test (TST) or interferon-γ release assay (IGRA) result defines latent infection with Mycobacterium tuberculosis, although test results may vary depending on immunodeficiency. OBJECTIVES: This study compared the performance...... of TST and IGRAs in five different groups of immunocompromised patients, and evaluated their ability to identify those at risk for development of tuberculosis. METHODS: Immunocompromised patients with HIV infection, chronic renal failure, rheumatoid arthritis, solid-organ or stem-cell transplantation......, and healthy control subjects were evaluated head-to-head by the TST, QuantiFERON-TB-Gold in-tube test (ELISA), and T-SPOT.TB test (enzyme-linked immunospot) at 17 centers in 11 European countries. Development of tuberculosis was assessed during follow-up. MEASUREMENTS AND MAIN RESULTS: Frequencies of positive...

  14. Molecular Diagnosis of Tuberculosis.

    Science.gov (United States)

    Nurwidya, Fariz; Handayani, Diah; Burhan, Erlina; Yunus, Faisal

    2018-01-01

    Tuberculosis (TB) is one of the leading causes of adult death in the Asia-Pacific Region, including Indonesia. As an infectious disease caused by Mycobacterium tuberculosis (MTB), TB remains a major public health issue especially in developing nations due to the lack of adequate diagnostic testing facilities. Diagnosis of TB has entered an era of molecular detection that provides faster and more cost-effective methods to diagnose and confirm drug resistance in TB cases, meanwhile, diagnosis by conventional culture systems requires several weeks. New advances in the molecular detection of TB, including the faster and simpler nucleic acid amplification test (NAAT) and whole-genome sequencing (WGS), have resulted in a shorter time for diagnosis and, therefore, faster TB treatments. In this review, we explored the current findings on molecular diagnosis of TB and drug-resistant TB to see how this advancement could be integrated into public health systems in order to control TB.

  15. Drug-Resistant Tuberculosis: A Genetic Analysis Using Online Bioinformatics Tools

    Science.gov (United States)

    Taylor, Jessica M.; Davidson, Rebecca M.; Strong, Michael

    2014-01-01

    Tuberculosis (TB) continues to be a serious global health problem, resulting in >1.4 million deaths each year. Of increasing concern is the evolution of antibiotic resistant strains of the bacterium that causes TB. Using this real-world scenario, we created a 90-minute activity for high school or undergraduate students to use online…

  16. Screening Strategies for Tuberculosis Prevalence Surveys: The Value of Chest Radiography and Symptoms

    NARCIS (Netherlands)

    van't Hoog, Anna H.; Meme, Helen K.; Laserson, Kayla F.; Agaya, Janet A.; Muchiri, Benson G.; Githui, Willie A.; Odeny, Lazarus O.; Marston, Barbara J.; Borgdorff, Martien W.

    2012-01-01

    Background: We conducted a tuberculosis (TB) prevalence survey and evaluated the screening methods used in our survey, to assess if screening in TB prevalence surveys could be simplified, and to assess the accuracy of screening algorithms that may be applicable for active case finding. Methods: All

  17. Poncet's disease: Reactive arthritis accompanying tuberculosis. Two case reports and a review of the literature

    NARCIS (Netherlands)

    E.-J.A. Kroot (Eric-Jan); J.M.W. Hazes (Mieke); E.M. Colin (Edgar); R.J.E.M. Dolhain (Radboud)

    2007-01-01

    textabstractObjective. Reactive arthritis (ReA) in tuberculosis (TB) is known as Poncet's disease. It is a rare aseptic form of arthritis observed in patients with active TB. We present two such patients and review the literature on Poncet's disease. Methods. Two patients who were identified with

  18. Copper and zinc in hair samples from Filipinos with pulmonary tuberculosis

    International Nuclear Information System (INIS)

    Tolosa, L.M.; Sevilla, F. III.

    1987-01-01

    An investigation of the copper and zinc concentrations in active cases of pulmonary tuberculosis was undertaken. Concentrations of copper and zinc in scalp hair of TB patients and controls were determined by atomic absorption spectrophotometry. Elevated copper levels were characteristics of hair samples from TB patients. (Author)

  19. Tuberculosis

    OpenAIRE

    Mendoza Zuñiga, Marleny; Bastidas Párraga, Gustavo; León Untiveros, Paúl Albert

    2013-01-01

    La tuberculosis es una enfermedad infectocontagiosa producida por el bacilo de Koch, que ataca a los pulmones pero puede ser difuminada por todo el cuerpo. El siguiente artículo de información nos da una visión amplia de la detección, diagnóstico y tratamiento de la misma.

  20. Re-activation of bovine tuberculosis in a patient treated with infliximab

    DEFF Research Database (Denmark)

    Larsen, Mette Vang; Thomsen, V Ø; Sørensen, Inge Juul

    2008-01-01

    . QuantiFERON-TB (QFT) testing performed during screening and immunosuppressive treatment was indeterminate, whereas the QFT test performed at the time of ascites puncture was positive. The patient history revealed previous work at a dairy, with probable exposure to unpasteurised milk from M. bovis......Treatment with tumour necrosis factor-alpha inhibitors increases the risk of tuberculosis (TB). Screening for latent TB infection (LTBI) and prophylactic treatment has become mandatory. A 79-yr-old female with a history of severe erosive sero-positive rheumatoid arthritis was screened for LTBI...... before initiation of treatment with infliximab. The tuberculin skin test (TST) was negative, chest radiography was normal and she had no known risk factors for TB. After 4 months of treatment with infliximab, the patient developed ascites caused by Mycobacterium bovis. The TST was repeatedly negative...

  1. Inappropriate Tuberculosis Treatment Regimens in Chinese Tuberculosis Hospitals

    NARCIS (Netherlands)

    Xue He, Guang; van den Hof, Susan; van der Werf, Marieke J.; Guo, Hui; Hu, Yuan Lian; Fan, Ji Huan; Zhang, Wei Min; Tostado, Christopher P.; Borgdorff, Martien W.

    2011-01-01

    This investigation of tuberculosis (TB) treatment regimens in 6 TB hospitals in China showed that only 18% of patients with new cases and 9% of patients with retreatment cases were prescribed standard TB treatment regimens. Adherence to treatment guidelines needs to be improved in TB hospitals to

  2. Latent M. tuberculosis infection--pathogenesis, diagnosis, treatment and prevention strategies.

    Science.gov (United States)

    Druszczyńska, Magdalena; Kowalewicz-Kulbat, Magdalena; Fol, Marek; Włodarczyk, Marcin; Rudnicka, Wiesława

    2012-01-01

    One third of the earths population is infected with Mycobacterium tuberculosis (Mtb), but only 5-10% of the infected individuals develop active tuberculosis (TB) over their lifetime. The remaining 90-95% stay healthy and are called latently infected individuals. They are the biggest reservoir of the tubercle bacilli and identifying the cases of latent TB is a part of the global plan of TB control. From the clinical point of view detection of latent TB infections (LTBI) in individuals with the highest active TB risk including cases of HIV infection, autoimmune inflammatory diseases or cancer, is a priority. This review summarizes the recent findings in the pathogenesis of latent TB, its diagnosis, treatment and prevention.

  3. Discriminating active from latent tuberculosis in patients presenting to community clinics.

    Directory of Open Access Journals (Sweden)

    Gurjinder Sandhu

    Full Text Available Because of the high global prevalence of latent TB infection (LTBI, a key challenge in endemic settings is distinguishing patients with active TB from patients with overlapping clinical symptoms without active TB but with co-existing LTBI. Current methods are insufficiently accurate. Plasma proteomic fingerprinting can resolve this difficulty by providing a molecular snapshot defining disease state that can be used to develop point-of-care diagnostics.Plasma and clinical data were obtained prospectively from patients attending community TB clinics in Peru and from household contacts. Plasma was subjected to high-throughput proteomic profiling by mass spectrometry. Statistical pattern recognition methods were used to define mass spectral patterns that distinguished patients with active TB from symptomatic controls with or without LTBI.156 patients with active TB and 110 symptomatic controls (patients with respiratory symptoms without active TB were investigated. Active TB patients were distinguishable from undifferentiated symptomatic controls with accuracy of 87% (sensitivity 84%, specificity 90%, from symptomatic controls with LTBI (accuracy of 87%, sensitivity 89%, specificity 82% and from symptomatic controls without LTBI (accuracy 90%, sensitivity 90%, specificity 92%.We show that active TB can be distinguished accurately from LTBI in symptomatic clinic attenders using a plasma proteomic fingerprint. Translation of biomarkers derived from this study into a robust and affordable point-of-care format will have significant implications for recognition and control of active TB in high prevalence settings.

  4. Tuberculosis activa en una cohorte de reclusos infectados por VIH en una cárcel de la Ciudad de México: características clínicas y epidemiológicas Active tuberculosis in a cohort of HIV-infected inmates in a prison in Mexico City: clinical and epidemiological characteristics

    Directory of Open Access Journals (Sweden)

    Christian Hernández-León

    2012-12-01

    Full Text Available OBJETIVO: Determinar las características clínicas y epidemiológicas de los casos con tuberculosis (TB activa en población de cárceles con VIH, que se ve especialmente afectada por ambas epidemias. La infección por VIH incrementa significativamente la probabilidad del desarrollo de TB. MATERIAL Y MÉTODOS: Se realizó un estudio de cohorte en sujetos infectados por VIH e internados en un reclusorio de la Ciudad de México. RESULTADOS: Se encontraron 172 pacientes con VIH, 28 con TB activa (16.3% - 21 (12.2% con afección pulmonar - con una tasa de incidencia de 7.7 por 100 sujetos/año para TB activa y de 4.7 por 100 sujetos/ año para TB pulmonar. No se encontró drogorresistencia. Dieciocho aislados fueron tipificados por RFLP, con una tasa de transmisión calculada de 11%. CONCLUSIÓN: Se encontró una prevalencia de TB en esta población mil veces superior a la observada en la población general y datos sugerentes de transmisión al interior de la cárcel.OBJECTIVE: To determine the clinical and epidemiological characteristics of prison inmates with active tuberculosis in HIV-positive prison populations. MATERIALS AND METHODS: We conducted a cohort study in HIV-infected subjects in a prison in Mexico City, with the aim of determining clinical and epidemiological characteristics of cases with active TB. RESULTS: We detected 172 HIV infected inmates and TB in 28 of them (16.3% - 21 (12.2 with pulmonary TB - with an incidence rate of 7.7/100 persons/year for active TB and 4.7/100 persons/year for pulmonary TB. No drug resistance was found. Two clusters (4 and 2 subjects were observed after RFLP-typing of 18 isolates, with a transmission rate of 11% by molecular and clinical analysis. CONCLUSIONS: The prevalence of active TB was found to be a thousand times greater than in the general population. Evidence of transmission inside the prison was also found

  5. Low prevalence of malnourishment among household contacts of patients with tuberculosis in Guinea-Bissau

    DEFF Research Database (Denmark)

    Patsche, C B; Rudolf, F; Mogensen, S W

    2017-01-01

    Setting: An urban demographic surveillance site in Bissau, the capital of Guinea-Bissau, West Africa. Background: We hypothesised that if previous malnutrition plays a part in acquiring active tuberculosis (TB) disease, households of TB cases would have a higher prevalence of malnutrition than...... those of healthy controls. Design: A cross-sectional study comparing nutritional and socio-economic status of all newly diagnosed patients with TB in 2014 with household contacts (persons residing in the household of TB cases) and random controls. Exclusion criteria were extra-pulmonary TB, age ,15...

  6. Treatment of rheumatoid arthritis with tumor necrosis factor inhibitors may predispose to significant increase in tuberculosis risk: a multicenter active-surveillance report.

    Science.gov (United States)

    Gómez-Reino, Juan J; Carmona, Loreto; Valverde, Vicente Rodríguez; Mola, Emilio Martín; Montero, Maria Dolores

    2003-08-01

    The long-term safety of therapeutic agents that neutralize tumor necrosis factor (TNF) is uncertain. Recent evidence based on spontaneous reporting shows an association with active tuberculosis (TB). We undertook this study to determine and describe the long-term safety of 2 of these agents, infliximab and etanercept, in rheumatic diseases based on a national active-surveillance system following the commercialization of the drugs. We analyzed the safety data actively collected in the BIOBADASER (Base de Datos de Productos Biológicos de la Sociedad Española de Reumatología) database, which was launched in February 2000 by the Spanish Society of Rheumatology. For the estimation of TB risk, the annual incidence rate in patients treated with these agents was compared with the background rate and with the rate in a cohort of patients with rheumatoid arthritis (RA) assembled before the era of anti-TNF treatment. Seventy-one participating centers sent data on 1,578 treatments with infliximab (86%) or etanercept (14%) in 1,540 patients. Drug survival rates (reported as the cumulative percentage of patients still receiving medication) for infliximab and etanercept pooled together were 85% and 81% at 1 year and 2 years, respectively. Instances of discontinuation were essentially due to adverse events. Seventeen cases of TB were found in patients treated with infliximab. The estimated incidence of TB associated with infliximab in RA patients was 1,893 per 100,000 in the year 2000 and 1,113 per 100,000 in the year 2001. These findings represent a significant increased risk compared with background rates. In the first 5 months of 2002, after official guidelines were established for TB prevention in patients treated with biologics, only 1 new TB case was registered (in January). Therapy with infliximab is associated with an increased risk of active TB. Proper measures are needed to prevent and manage this adverse event.

  7. Latent tuberculosis infection in individuals with human immunodeficiency virus infection: comparison of tuberculin skin test to the anti TB-IgM antibodies

    International Nuclear Information System (INIS)

    Alvi, S.M.; Nadimi, M.; Shokri, S.; Zamani, G.A.

    2010-01-01

    To determine Latent Tuberculosis Infection (LTBI) prevalence and compare TST results to the anti TB-IgM anti bodies (ATIA) for the diagnosis of LTBI in HIV infected individuals. Sixty two randomized sampled HIV infected subjects from an addict treatment center in Ahvaz southwest Iran underwent TST, using 5 TU of purified protein derivative, and measuring ATIA. Data were analyzed in SPSS (version 16, USA). Of 62 participants, 34 (54.8%) had positive result for TST, whereas 6(9.7%) had positive ATIA. Overall concordance between TST and ATIA was 45.2% (Kappa= 0.37, P = 0.32). In subjects with positive test results by either TST or ATIA, only 4.8% had positive test results by both tests. Discordant results were found in 54.8% of subjects. Positive results for both tests in subjects categorized in two groups (above and below 200 CD4-cell/mm3) had no significant difference (P>0.05). LTBI prevalence among HIV infected individuals in studied area is higher than other parts of the world. TST is a useful test for LTBI diagnosis and prefer to ATIA. Concordance between TST and ATIA is low. (author)

  8. Taking medicines to treat tuberculosis

    Science.gov (United States)

    Tuberculosis - medicines; DOT; Directly observed therapy; TB - medicines ... Ellner JJ. Tuberculosis. In: Goldman L, Schafer AI, eds. Goldman-Cecil Medicine . 25th ed. Philadelphia, PA: Elsevier Saunders; 2016:chap 324. ...

  9. MCL Plays an Anti-Inflammatory Role in Mycobacterium tuberculosis-Induced Immune Response by Inhibiting NF-κB and NLRP3 Inflammasome Activation

    Directory of Open Access Journals (Sweden)

    Qingwen Zhang

    2017-01-01

    Full Text Available Mycobacterium tuberculosis (Mtb remains a significant menace to global health as it induces granulomatous lung lesions and systemic inflammatory responses during active tuberculosis (TB. Micheliolide (MCL, a sesquiterpene lactone, was recently reported to have a function of relieving LPS-induced inflammatory response, but the regulative role of MCL on the immunopathology of TB still remains unknown. In this experiment, we examined the inhibitory effect of MCL on Mtb-induced inflammatory response in mouse macrophage-like cell line Raw264.7 by downregulating the activation of nuclear factor kappa B (NF-κB and NLRP3 inflammasome. Evidences showed that MCL decreased the secretion of Mtb-induced inflammatory cytokines (IL-1β and TNF-α in a dose-dependent manner. Meanwhile, MCL dramatically suppressed Mtb-induced activation of iNOS and COX2 as well as subsequent production of NO. Furthermore, MCL inhibited Mtb-induced phosphorylation of Akt (Ser 473 in Raw264.7. According to our results, MCL plays an important role in modulating Mtb-induced inflammatory response through PI3K/Akt/NF-κB pathway and subsequently downregulating the activation of NLRP3 inflammasome. Therefore, MCL may represent as a potential drug candidate in the adjuvant treatment of TB by regulating host immune response.

  10. Infection caused by Mycobacterium tuberculosis.

    Science.gov (United States)

    Peloquin, C A; Berning, S E

    1994-01-01

    To update readers on the clinical management of infections caused by Mycobacterium tuberculosis, to provide a general description of the organism, culture and susceptibility testing, and clinical manifestations of the disease, and to provide several aspects of the treatment of the disease, including historical perspective, current approaches, and research opportunities for the future. The current medical literature, including abstracts presented at recent international meetings, is reviewed. References were identified through MEDLINE, MEDLARS II, Current Contents, and published meeting abstracts. Data regarding the epidemiology, clinical manifestations, culture and susceptibility testing, and treatment of tuberculosis are cited. Specific attention has been focused on the clinical management of patients with noncontagious infection and potentially contagious active disease (TB) caused by M. tuberculosis. Information contributing to the discussion of the topics selected by the authors is reviewed. Data supporting and disputing specific conclusions are presented. The incidence of TB is increasing in the US, despite the fact that available technologies are capable of controlling the vast majority of existing cases. Fueling the fire is the problem of coinfection with HIV and M. tuberculosis. Very few drugs are available for the treatment of TB, and few of these approach the potency of isoniazid and rifampin. Preventive therapy of patients exposed to multiple-drug-resistant M. tuberculosis (MDR-TB) is controversial and of unknown efficacy. Treatment of active disease caused by MDR-TB requires up to four times longer, is associated with increased toxicity, and is far less successful than the treatment of drug-susceptible TB. Strategies for the management of such cases are presented. The rising incidence of TB in the US reflects a breakdown in the healthcare systems responsible for controlling the disease, which reflects the past budgetary reductions. Although TB control

  11. A comparative examination of tuberculosis immigration medical screening programs from selected countries with high immigration and low tuberculosis incidence rates

    Science.gov (United States)

    2011-01-01

    Background Tuberculosis (TB) in migrants is an ongoing challenge in several low TB incidence countries since a large proportion of TB in these countries occurs in migrants from high incidence countries. To meet these challenges, several countries utilize TB screening programs. The programs attempt to identify and treat those with active and/or infectious stages of the disease. In addition, screening is used to identify and manage those with latent or inactive disease after arrival. Between nations, considerable variation exists in the methods used in migration-associated TB screening. The present study aimed to compare the TB immigration medical examination requirements in selected countries of high immigration and low TB incidence rates. Methods Descriptive study of immigration TB screening programs Results 16 out of 18 eligible countries responded to the written standardized survey and phone interview. Comparisons in specific areas of TB immigration screening programs included authorities responsible for TB screening, the primary objectives of the TB screening program, the yield of detection of active TB disease, screening details and aspects of follow up for inactive pulmonary TB. No two countries had the same approach to TB screening among migrants. Important differences, common practices, common problems, evidence or lack of evidence for program specifics were noted. Conclusions In spite of common goals, there is great diversity in the processes and practices designed to mitigate the impact of migration-associated TB among nations that screen migrants for the disease. The long-term goal in decreasing migration-related introduction of TB from high to low incidence countries remains diminishing the prevalence of the disease in those high incidence locations. In the meantime, existing or planned migration screening programs for TB can be made more efficient and evidenced based. Cooperation among countries doing research in the areas outlined in this study should

  12. TB Terms

    Science.gov (United States)

    ... sputum can also be used to do a culture. TB blood test – a test that uses a blood sample to find out if you are infected with TB bacteria. The test measures the response to TB proteins when they are mixed with a small amount of blood. Examples of these TB blood tests include QuantiFERON ® -TB ...

  13. [Comparative study of concordance and costs between tuberculin skin test and QuantiFERON(®)-TB Gold In-Tube in the diagnosis of latent tuberculosis infection among contacts of patients with pulmonary tuberculosis].

    Science.gov (United States)

    Martinez Lacasa, Xavier; Canals Font, Roser; Jaen Manzanera, Angels; Cuchi Burgos, Eva; Lite Lite, Josep

    2015-11-20

    Recently diagnosis of latent tuberculosis infection (LTBI) can be made using the tuberculin skin test (TST) or by techniques known as interferon-γ release assays (IGRAS), being QuantiFERON(®)-TB Gold In-Tube (QF-G-IT) the most used. The IGRAS avoid some drawbacks of the TST, especially cross-reaction with bacillus Calmette-Guérin (BCG) vaccine, but also present some problems such as those arising from cost and the need of having an adequate infrastructure and experience. There is no clear consensus on which technique should be preferentially used for the diagnosis of LTBI. This is a comparative study between the TST and QT-G-IT in a cohort of contacts of patients with pulmonary tuberculosis during the study period. An analysis of global agreement and groups was performed according to whether the contacts were vaccinated with BCG or not. A study of costs of both techniques and diagnostic strategies based on these techniques was performed. The agreement between TST and QF-G-IT was acceptable in the whole sample yet it was very good in the unvaccinated group. Few cases of indeterminate values were recorded. The cost study showed that TST was cheaper than QF-G-IT; however when we analyzed the cost of the strategies according to each technique, the QF-G-IT showed a better cost-benefit. We suggest considering QF-G-IT as the only preferred technique for the diagnosis of LTBI in household contacts, based on good overall agreement between the 2 techniques (even if we eliminate the effect of the vaccine) and a cost analysis favorable to QF-G-IT. Copyright © 2015 Elsevier España, S.L.U. All rights reserved.

  14. Serial QuantiFERON-TB Gold In-Tube assay and tuberculin skin test to diagnose latent tuberculosis in household Mexican contacts: conversion and reversion rates and associated factors using conventional and borderline zone definitions

    Directory of Open Access Journals (Sweden)

    Joel Monárrez-Espino

    2014-11-01

    Full Text Available A cohort of 123 adult contacts was followed for 18‐24 months (86 completed the follow-up to compare conversion and reversion rates based on two serial measures of QuantiFERON (QFT and tuberculin skin test (TST (PPD from TUBERSOL, Aventis Pasteur, Canada for diagnosing latent tuberculosis (TB in household contacts of TB patients using conventional (C and borderline zone (BZ definitions. Questionnaires were used to obtain information regarding TB exposure, TB risk factors and socio-demographic data. QFT (IU/mL conversion was defined as 0.70 (BZ and reversion was defined as ≥0.35 to 10 (BZ and reversion was defined as ≥5 to <5 (C. The QFT conversion and reversion rates were 10.5% and 7% with C and 8.1% and 4.7% with the BZ definitions, respectively. The TST rates were higher compared with QFT, especially with the C definitions (conversion 23.3%, reversion 9.3%. The QFT conversion and reversion rates were higher for TST ≥5; for TST, both rates were lower for QFT <0.35. No risk factors were associated with the probability of converting or reverting. The inconsistency and apparent randomness of serial testing is confusing and adds to the limitations of these tests and definitions to follow-up close TB contacts.

  15. Paediatric TB/HIV co-infection – 'an uncompromising duet that ...

    African Journals Online (AJOL)

    2011-10-01

    Oct 1, 2011 ... tuberculosis (TB) in 2009, childhood TB accounted for 11% (884 000 cases).1 ... reduction in incident TB in ART-treated children compared with ..... Obesity is associated with an increased risk of miscarriage but its effect on.

  16. Hierarchy Low CD4+/CD8+ T-Cell Counts and IFN-γ Responses in HIV-1+ Individuals Correlate with Active TB and/or M.tb Co-Infection.

    Science.gov (United States)

    Shao, Lingyun; Zhang, Xinyun; Gao, Yan; Xu, Yunya; Zhang, Shu; Yu, Shenglei; Weng, Xinhua; Shen, Hongbo; Chen, Zheng W; Jiang, Weimin; Zhang, Wenhong

    2016-01-01

    Detailed studies of correlation between HIV-M.tb co-infection and hierarchy declines of CD8+/CD4+ T-cell counts and IFN-γ responses have not been done. We conducted case-control studies to address this issue. 164 HIV-1-infected individuals comprised of HIV-1+ATB, HIV-1+LTB and HIV-1+TB- groups were evaluated. Immune phenotyping and complete blood count (CBC) were employed to measure CD4+ and CD8+ T-cell counts; T.SPOT.TB and intracellular cytokine staining (ICS) were utilized to detect ESAT6, CFP10 or PPD-specific IFN-γ responses. There were significant differences in median CD4+ T-cell counts between HIV-1+ATB (164/μL), HIV-1+LTB (447/μL) and HIV-1+TB- (329/μL) groups. Hierarchy low CD4+ T-cell counts (500/μL) were correlated significantly with active TB but not M.tb co-infection. Interestingly, hierarchy low CD8+ T-cell counts were not only associated significantly with active TB but also with M.tb co-infection (PHierarchy low CD8+ T-cell counts and effector function in HIV-1-infected individuals are correlated with both M.tb co-infection and active TB. Hierarchy low CD4+ T-cell counts and Th1 effector function in HIV-1+ individuals are associated with increased frequencies of active TB, but not M.tb co-infection.

  17. Local level epidemiological analysis of TB in people from a high incidence country of birth

    OpenAIRE

    Massey Peter D; Durrheim David N; Stephens Nicola; Christensen Amanda

    2013-01-01

    Abstract Background The setting for this analysis is the low tuberculosis (TB) incidence state of New South Wales (NSW), Australia. Local level analysis of TB epidemiology in people from high incidence countries-of-birth (HIC) in a low incidence setting has not been conducted in Australia and has not been widely reported. Local level analysis could inform measures such as active case finding and targeted earlier diagnosis. The aim of this study was to use a novel approach to identify local ar...

  18. Differential Recognition of Mycobacterium tuberculosis-Specific Epitopes as a Function of Tuberculosis Disease History.

    Science.gov (United States)

    Scriba, Thomas J; Carpenter, Chelsea; Pro, Sebastian Carrasco; Sidney, John; Musvosvi, Munyaradzi; Rozot, Virginie; Seumois, Grégory; Rosales, Sandy L; Vijayanand, Pandurangan; Goletti, Delia; Makgotlho, Edward; Hanekom, Willem; Hatherill, Mark; Peters, Bjoern; Sette, Alessandro; Arlehamn, Cecilia S Lindestam

    2017-09-15

    Individuals with a history of tuberculosis (TB) disease are at elevated risk of disease recurrence. The underlying cause is not known, but one explanation is that previous disease results in less-effective immunity against Mycobacterium tuberculosis (Mtb). We hypothesized that the repertoire of Mtb-derived epitopes recognized by T cells from individuals with latent Mtb infection differs as a function of previous diagnosis of active TB disease. T-cell responses to peptide pools in samples collected from an adult screening and an adolescent validation cohort were measured by IFN-γ enzyme-linked immunospot assay or intracellular cytokine staining. We identified a set of "type 2" T-cell epitopes that were recognized at 10-fold-lower levels in Mtb-infected individuals with a history of TB disease less than 6 years ago than in those without previous TB. By contrast, "type 1" epitopes were recognized equally well in individuals with or without previous TB. The differential epitope recognition was not due to differences in HLA class II binding, memory phenotypes, or gene expression in the responding T cells. Instead, "TB disease history-sensitive" type 2 epitopes were significantly (P < 0.0001) more homologous to sequences from bacteria found in the human microbiome than type 1 epitopes. Preferential loss of T-cell reactivity to Mtb epitopes that are homologous to bacteria in the microbiome in persons with previous TB disease may reflect long-term effects of antibiotic TB treatment on the microbiome.

  19. Patient satisfaction with TB care clinical consultations in Kampala: a ...

    African Journals Online (AJOL)

    ... on treatment outcome. Keywords: Patient satisfaction, TB care clinical consultations, cross sectional study. ... Background: Tuberculosis (TB) remains a major global ... Measurement of outcome: Variables considered were; how long the ... Key: ART= Antiretroviral Therapy. Characteristic. Parameter n (%). Sex. Female.

  20. Management of latent Mycobacterium tuberculosis infection: WHO guidelines for low tuberculosis burden countries.

    Science.gov (United States)

    Getahun, Haileyesus; Matteelli, Alberto; Abubakar, Ibrahim; Aziz, Mohamed Abdel; Baddeley, Annabel; Barreira, Draurio; Den Boon, Saskia; Borroto Gutierrez, Susana Marta; Bruchfeld, Judith; Burhan, Erlina; Cavalcante, Solange; Cedillos, Rolando; Chaisson, Richard; Chee, Cynthia Bin-Eng; Chesire, Lucy; Corbett, Elizabeth; Dara, Masoud; Denholm, Justin; de Vries, Gerard; Falzon, Dennis; Ford, Nathan; Gale-Rowe, Margaret; Gilpin, Chris; Girardi, Enrico; Go, Un-Yeong; Govindasamy, Darshini; D Grant, Alison; Grzemska, Malgorzata; Harris, Ross; Horsburgh, C Robert; Ismayilov, Asker; Jaramillo, Ernesto; Kik, Sandra; Kranzer, Katharina; Lienhardt, Christian; LoBue, Philip; Lönnroth, Knut; Marks, Guy; Menzies, Dick; Migliori, Giovanni Battista; Mosca, Davide; Mukadi, Ya Diul; Mwinga, Alwyn; Nelson, Lisa; Nishikiori, Nobuyuki; Oordt-Speets, Anouk; Rangaka, Molebogeng Xheedha; Reis, Andreas; Rotz, Lisa; Sandgren, Andreas; Sañé Schepisi, Monica; Schünemann, Holger J; Sharma, Surender Kumar; Sotgiu, Giovanni; Stagg, Helen R; Sterling, Timothy R; Tayeb, Tamara; Uplekar, Mukund; van der Werf, Marieke J; Vandevelde, Wim; van Kessel, Femke; van't Hoog, Anna; Varma, Jay K; Vezhnina, Natalia; Voniatis, Constantia; Vonk Noordegraaf-Schouten, Marije; Weil, Diana; Weyer, Karin; Wilkinson, Robert John; Yoshiyama, Takashi; Zellweger, Jean Pierre; Raviglione, Mario

    2015-12-01

    Latent tuberculosis infection (LTBI) is characterised by the presence of immune responses to previously acquired Mycobacterium tuberculosis infection without clinical evidence of active tuberculosis (TB). Here we report evidence-based guidelines from the World Health Organization for a public health approach to the management of LTBI in high risk individuals in countries with high or middle upper income and TB incidence of <100 per 100 000 per year. The guidelines strongly recommend systematic testing and treatment of LTBI in people living with HIV, adult and child contacts of pulmonary TB cases, patients initiating anti-tumour necrosis factor treatment, patients receiving dialysis, patients preparing for organ or haematological transplantation, and patients with silicosis. In prisoners, healthcare workers, immigrants from high TB burden countries, homeless persons and illicit drug users, systematic testing and treatment of LTBI is conditionally recommended, according to TB epidemiology and resource availability. Either commercial interferon-gamma release assays or Mantoux tuberculin skin testing could be used to test for LTBI. Chest radiography should be performed before LTBI treatment to rule out active TB disease. Recommended treatment regimens for LTBI include: 6 or 9 month isoniazid; 12 week rifapentine plus isoniazid; 3-4 month isoniazid plus rifampicin; or 3-4 month rifampicin alone. Copyright ©ERS 2015.

  1. Lateral Flow Urine Lipoarabinomannan Assay (LF-LAM) for Diagnosis of Active Tuberculosis in HIV-Infected Adults: a Prospective Cohort Study

    Science.gov (United States)

    Na Songkhla, Munjit; Tantipong, Hutsaya; Tongsai, Sasima; Angkasekwinai, Nasikarn

    2017-01-01

    Abstract Background Early diagnosis and treatment of active tuberculosis (TB) in HIV-positive patients is challenging. Tests based on the detection of mycobacterial lipoarabinomannan (LAM) antigen in urine have emerged as potential point-of-care tests for TB. However, limited data exists on their performance among HIV-TB co-infected patients from Southeast Asian countries. Methods We prospectively recruited HIV-positive adult patients with CD4 count less than or equal to 200/mm3 and symptoms suspected of active TB from two tertiary hospitals between December 2015 and March 2017. Freshly collected urine was applied to the Determine®-TB LAM Ag test strip (4 bands of graded intensity), using grade 1 cutoff. Diagnostic accuracy of urine LAM strip test were assessed against microbiological reference standard, defined as positive Mycobacterium tuberculosis cultured from one or more clinical specimens (definite TB) or composite reference standard including definite TB and probable TB, defined as those have symptoms consistent with TB and response to anti-TB treatment. Results A total of 280 patients were enrolled. Of whom, 72 (25.7%) and 65 (23.2%) had definite and probable TB. Amongst those with definite TB, LF-LAM test gave a sensitivity of 75.0% (95% CI 63.9–83.6), specificity of 86.0% (95% CI 79.4–90.8) and accuracy of 82.3% (95% CI 76.7–86.8). When compared with the composite reference standard, the test yielded a lower sensitivity (61.3%, 95% CI 53.0–69.1) and accuracy (73.9%, 95% CI 68.5–78.7), with equal specificity. The test showed the highest sensitivity (90.5%, 95% CI 77.9–96.2) and accuracy (85.9%, 95% CI 79.2–90.7) but lower specificity (84.0%, 95% CI 75.6–89.9) in HIV-infected patients with CD4 count less than 50/mm3. The sensitivity of the combined LF-LAM or sputum microscopy was higher than that of either test alone (86.1% vs. 75.0%, 61.1%, respectively). Mycobacterium avium complex (MAC) was cultured in 7 out of 20 with false positive

  2. Large-scale genomic analysis shows association between homoplastic genetic variation in Mycobacterium tuberculosis genes and meningeal or pulmonary tuberculosis.

    NARCIS (Netherlands)

    Ruesen, Carolien; Chaidir, Lidya; van Laarhoven, Arjan; Dian, Sofiati; Ganiem, Ahmad Rizal; Nebenzahl-Guimaraes, Hanna; Huynen, Martijn A; Alisjahbana, Bachti; Dutilh, Bas E; van Crevel, Reinout

    2018-01-01

    Meningitis is the most severe manifestation of tuberculosis. It is largely unknown why some people develop pulmonary TB (PTB) and others TB meningitis (TBM); we examined if the genetic background of infecting M. tuberculosis strains may be relevant.

  3. An Evaluation of Passive and Active Approaches to Improve Tuberculosis Notifications in Afghanistan.

    Directory of Open Access Journals (Sweden)

    A Sanaie

    Full Text Available In Afghanistan, improving TB case detection remains challenging. In 2014, only half of the estimated incident TB cases were notified, and notifications have decreased since peaking in 2007. Active case finding has been increasingly considered to improve TB case notifications. While access to health services has improved in Afghanistan, it remains poor and many people seeking health services won't receive proper care.From October 2011 through December 2012 we conducted three separate case finding strategies in six provinces of Afghanistan and measured impact on TB case notification. Systematically screening cough among attendees at 47 health facilities, active household contact investigation of smear-positive index TB patients, and active screening at 15 camps for internally displaced people were conducted. We collected both intervention yield and official quarterly notification data. Additional TB notifications were calculated by comparing numbers of cases notified during the intervention with those notified before the intervention, then adjusting for secular trends in notification.We screened 2,022,127 people for TB symptoms during the intervention, tested 59,838 with smear microscopy and detected 5,046 people with smear-positive TB. Most cases (81.7%, 4,125 were identified in health facilities while nearly 20% were found through active case finding. A 56% increase in smear-positive TB notifications was observed between the baseline and intervention periods among the 47 health facilities, where cases detected by all three strategies were notified.While most people with TB are likely to be identified through health facility screening, there are many people who remain without a proper diagnosis if outreach is not attempted. This is especially true in places like Afghanistan where access to general services is poor. Targeted active case finding can improve the number of people who are detected and treated for TB and can push towards the targets of

  4. An Evaluation of Passive and Active Approaches to Improve Tuberculosis Notifications in Afghanistan.

    Science.gov (United States)

    Sanaie, A; Mergenthaler, C; Nasrat, A; Seddiq, M K; Mahmoodi, S D; Stevens, R H; Creswell, J

    2016-01-01

    In Afghanistan, improving TB case detection remains challenging. In 2014, only half of the estimated incident TB cases were notified, and notifications have decreased since peaking in 2007. Active case finding has been increasingly considered to improve TB case notifications. While access to health services has improved in Afghanistan, it remains poor and many people seeking health services won't receive proper care. From October 2011 through December 2012 we conducted three separate case finding strategies in six provinces of Afghanistan and measured impact on TB case notification. Systematically screening cough among attendees at 47 health facilities, active household contact investigation of smear-positive index TB patients, and active screening at 15 camps for internally displaced people were conducted. We collected both intervention yield and official quarterly notification data. Additional TB notifications were calculated by comparing numbers of cases notified during the intervention with those notified before the intervention, then adjusting for secular trends in notification. We screened 2,022,127 people for TB symptoms during the intervention, tested 59,838 with smear microscopy and detected 5,046 people with smear-positive TB. Most cases (81.7%, 4,125) were identified in health facilities while nearly 20% were found through active case finding. A 56% increase in smear-positive TB notifications was observed between the baseline and intervention periods among the 47 health facilities, where cases detected by all three strategies were notified. While most people with TB are likely to be identified through health facility screening, there are many people who remain without a proper diagnosis if outreach is not attempted. This is especially true in places like Afghanistan where access to general services is poor. Targeted active case finding can improve the number of people who are detected and treated for TB and can push towards the targets of the Stop TB

  5. A review of tuberculosis-related referrals among children in Ireland.

    LENUS (Irish Health Repository)

    Iroh Tam, P Y

    2012-02-01

    BACKGROUND: Immigration has been shown to have an increasingly important effect on the epidemiology of tuberculosis (TB) in developed countries. AIM: To review patterns of TB-related referrals to a paediatric infectious diseases clinic. METHODS: Retrospective chart review of TB-related referrals of children attending the Rainbow Clinic at OLCHC between 2003-2005. RESULTS: Forty-seven children were assessed: 18 referred from public health clinics, 5 from general practitioners, and 24 from paediatricians. Most common reason for referral was history of TB exposure (60%). Eighteen (38%) were female, 29 (62%) were male. Thirteen (28%) had latent TB, and 17 (36%) had active disease. Of children with TB disease, 25 (83%) were Caucasian Irish, and the remainder was African. Twenty-five children completed TB treatment and were discharged, and 2 (7%) were lost to follow-up. CONCLUSION: Our study highlights the problem of TB in children, the majority of whom are native to this country.

  6. Deterministic SLIR model for tuberculosis disease mapping

    Science.gov (United States)

    Aziz, Nazrina; Diah, Ijlal Mohd; Ahmad, Nazihah; Kasim, Maznah Mat

    2017-11-01

    Tuberculosis (TB) occurs worldwide. It can be transmitted to others directly through air when active TB persons sneeze, cough or spit. In Malaysia, it was reported that TB cases had been recognized as one of the most infectious disease that lead to death. Disease mapping is one of the methods that can be used as the prevention strategies since it can displays clear picture for the high-low risk areas. Important thing that need to be considered when studying the disease occurrence is relative risk estimation. The transmission of TB disease is studied through mathematical model. Therefore, in this study, deterministic SLIR models are used to estimate relative risk for TB disease transmission.

  7. Tuberculosis and Stigmatization: Pathways and Interventions

    OpenAIRE

    Courtwright, Andrew; Turner, Abigail Norris

    2010-01-01

    The institutional and community norms that lead to the stigmatization of tuberculosis (TB) are thought to hinder TB control. We performed a systematic review of the literature on TB stigma to identify the causes and evaluate the impact of stigma on TB diagnosis and treatment. Several themes emerged: fear of infection is the most common cause of TB stigma; TB stigma has serious socioeconomic consequences, particularly for women; qualitative approaches to measuring TB stigma are more commonly u...

  8. Hyperthermostable binding molecules on phage: Assay components for point-of-care diagnostics for active tuberculosis infection.

    Science.gov (United States)

    Zhao, Ning; Spencer, John; Schmitt, Margaret A; Fisk, John D

    2017-03-15

    Tuberculosis is the leading cause of death from infectious disease worldwide. The low sensitivity, extended processing time, and high expense of current diagnostics are major challenges to the detection and treatment of tuberculosis. Mycobacterium tuberculosis ornithine transcarbamylase (Mtb OTC, Rv1656) has been identified in the urine of patients with active TB infection and is a promising target for point-of-care diagnostics. Specific binding proteins with low nanomolar affinities for Mtb OTC were selected from a phage display library built upon a hyperthermostable Sso7d scaffold. Phage particles displaying Sso7d variants were utilized to generate a sandwich ELISA-based assay for Mtb OTC. The assay response is linear between 2 ng/mL and 125 ng/mL recombinant Mtb OTC and has a limit of detection of 400 pg/mL recombinant Mtb OTC. The assay employing a phage-based detection reagent is comparable to commercially-available antibody-based biosensors. Importantly, the assay maintains functionality at both neutral and basic pH in presence of salt and urea over the range of concentrations typical for human urine. Phage-based diagnostic systems may feature improved physical stability and cost of production relative to traditional antibody-based reagents, without sacrificing specificity and sensitivity. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Population-level impact of active tuberculosis case finding in an Asian megacity.

    Directory of Open Access Journals (Sweden)

    David W Dowdy

    Full Text Available BACKGROUND: The potential population-level impact of private-sector initiatives for tuberculosis (TB case finding in Southeast Asia remains uncertain. In 2011, the Indus Hospital TB Control Program in Karachi, Pakistan, undertook an aggressive case-finding campaign that doubled notification rates, providing an opportunity to investigate potential population-level effects. METHODS: We constructed an age-structured compartmental model of TB in the intervention area. We fit the model using field and literature data, assuming that TB incidence equaled the estimated nationwide incidence in Pakistan (primary analysis, or 1.5 times greater (high-incidence scenario. We modeled the intervention as an increase in the rate of formal-sector TB diagnosis and evaluated the potential impact of sustaining this rate for five years. RESULTS: In the primary analysis, the five-year intervention averted 24% (95% uncertainty range, UR: 18-30% of five-year cumulative TB cases and 52% (95% UR: 45-57% of cumulative TB deaths. Corresponding reductions in the high-incidence scenario were 12% (95% UR: 8-17% and 27% (95% UR: 21-34%, although the absolute number of lives saved was higher. At the end of five years, TB notification rates in the primary analysis were below their 2010 baseline, incidence had dropped by 45%, and annual mortality had fallen by 72%. About half of the cumulative impact on incidence and mortality could be achieved with a one-year intervention. CONCLUSIONS: Sustained, multifaceted, and innovative approaches to TB case-finding in Asian megacities can have substantial community-wide epidemiological impact.

  10. Tuberculosis

    OpenAIRE

    Juan Carlos Rodríguez, D.

    2014-01-01

    La tuberculosis sigue constituyendo un problema de salud pública a nivel mundial con casi nueve millones de casos nuevos en 2012 y se estima que un tercio de la humanidad está infectada. A nivel nacional, si bien las tasas son alentadoras, la variación regional es muy importante. En los últimos años se han registrado progresos importantes tanto en el conocimiento de la conducta del bacilo de Koch, el causante de la enfermedad, como en los métodos para detectarlo. Así los IGRAS (Interferon G R...

  11. Strategy to better select HIV-infected individuals for latent TB treatment in BCG-vaccinated population.

    Directory of Open Access Journals (Sweden)

    Chin-Hui Yang

    Full Text Available OBJECTIVE: To evaluate the T-SPOT.TB interferon-γ releasing assay and the tuberculin skin test (TST, for the diagnosis of latent tuberculosis infection(LTBI and the development of subsequent active tuberculosis, in BCG-vaccinated HIV-infected individuals. METHODS: HIV-infected individuals without clinical suspicion of active TB or a past history of TB were enrolled from 1 January 2008 to 30 November 2010. Both T-SPOT.TB test and TST were offered to the participants whom were followed up prospectively until April 30, 2012 for development of TB. RESULTS: Among the 909 participants, 25% had positive TST reactions with cut-off point of 5 mm and 15% had positive T-SPOT.TB results. After a median follow-up of 2.97 years, there were 5 cases developed culture-confirmed active TB (all had dual positive TST and T-SPOT.TB results, and the incidence was 0.17 per 100 person-years. The relative risks (RRs for subsequent active TB in HIV-infected individuals with positive TST results, positive T-SPOT.TB results and dual positive results compared with the risk for individuals with negative results were 40.6 (95% CI 2.1-767.9, 73.9 (95% CI 3.9-1397.7 and 226.5 (95% CI 12.0-4284, respectively. The number needed to treat to prevent one subsequent TB case among patients with a positive TST, a positive T-SPOT.TB and dual positive results was 35, 22 and 8 respectively. CONCLUSIONS: Adopting positive results of the TST and T-SPOT.TB to screen LTBI among BCG-vaccinated HIV-infected individuals might be feasible. Number needed to treat for isoniazid preventive therapy could be reduced significantly by using dual positive strategy.

  12. The impact of HIV status and antiretroviral treatment on TB treatment outcomes of new tuberculosis patients attending co-located TB and ART services in South Africa: a retrospective cohort study.

    Science.gov (United States)

    Nglazi, Mweete D; Bekker, Linda-Gail; Wood, Robin; Kaplan, Richard

    2015-11-19

    The implementation of collaborative TB-HIV services is challenging. We, therefore, assessed TB treatment outcomes in relation to HIV infection and antiretroviral therapy (ART) among TB patients attending a primary care service with co-located ART and TB clinics in Cape Town, South Africa. In this retrospective cohort study, all new TB patients aged ≥ 15 years who registered and initiated TB treatment between 1 October 2009 and 30 June 2011 were identified from an electronic database. The effects of HIV-infection and ART on TB treatment outcomes were analysed using a multinomial logistic regression model, in which treatment success was the reference outcome. The 797 new TB patients included in the analysis were categorized as follows: HIV- negative, in 325 patients (40.8 %); HIV-positive on ART, in 339 patients (42.5 %) and HIV-positive not on ART, in 133 patients (16.7 %). Overall, bivariate analyses showed no significant difference in death and default rates between HIV-positive TB patients on ART and HIV-negative patients. Statistically significant higher mortality rates were found among HIV-positive patients not on ART compared to HIV-negative patients (unadjusted odds ratio (OR) 3.25; 95 % confidence interval (CI) 1.53-6.91). When multivariate analyses were conducted, the only significant difference between the patient categories on TB treatment outcomes was that HIV-positive TB patients not on ART had significantly higher mortality rates than HIV-negative patients (adjusted OR 4.12; 95 % CI 1.76-9.66). Among HIV-positive TB patients (n = 472), 28.2 % deemed eligible did not initiate ART in spite of the co-location of TB and ART services. When multivariate analyses were restricted to HIV-positive patients in the cohort, we found that being HIV-positive not on ART was associated with higher mortality (adjusted OR 7.12; 95 % CI 2.95-18.47) and higher default rates (adjusted OR 2.27; 95 % CI 1.15-4.47). There was no significant difference in death and

  13. Managing latent tuberculosis infection and tuberculosis in children

    Directory of Open Access Journals (Sweden)

    I. Carvalho

    2018-03-01

    Full Text Available Tuberculosis (TB is a major cause of childhood morbidity and mortality worldwide. The aim of this review is to describe the management of the child with TB and latent tuberculosis infection (LTBI.To develop this article, a working group reviewed relevant epidemiological and other scientific studies and established practices in conducting LBTI and TB in children. The article describes how to manage the child with LTBI, considering transmission and infectiousness of tuberculosis, contact screening and prioritization of contacts and recommendations on treatment of children with LTBI and how to manage the child with TB considering the susceptibility of children to developing tuberculosis, epidemiology and classification of tuberculosis in children, diagnosis and treatment. Keywords: Tuberculosis, Pediatric, Childhood, Latent tuberculosis infection

  14. Descriptive review of tuberculosis surveillance systems across the circumpolar regions

    Directory of Open Access Journals (Sweden)

    Annie-Claude Bourgeois

    2016-04-01

    Full Text Available Background: Tuberculosis is highly prevalent in many Arctic areas. Members of the International Circumpolar Surveillance Tuberculosis (ICS-TB Working Group collaborate to increase knowledge about tuberculosis in Arctic regions. Objective: To establish baseline knowledge of tuberculosis surveillance systems used by ICS-TB member jurisdictions. Design: Three questionnaires were developed to reflect the different surveillance levels (local, regional and national; all 3 were forwarded to the official representative of each of the 15 ICS-TB member jurisdictions in 2013. Respondents self-identified the level of surveillance conducted in their region and completed the applicable questionnaire. Information collected included surveillance system objectives, case definitions, data collection methodology, storage and dissemination. Results: Thirteen ICS-TB jurisdictions [Canada (Labrador, Northwest Territories, Nunavik, Nunavut, Yukon, Finland, Greenland, Norway, Sweden, Russian Federation (Arkhangelsk, Khanty-Mansiysk Autonomous Okrug, Yakutia (Sakha Republic, United States (Alaska] voluntarily completed the survey – representing 2 local, 7 regional and 4 national levels. Tuberculosis reporting is mandatory in all jurisdictions, and case definitions are comparable across regions. The common objectives across systems are to detect outbreaks, and inform the evaluation/planning of public health programmes and policies. All jurisdictions collect data on confirmed active tuberculosis cases and treatment outcomes; 11 collect contact tracing results. Faxing of standardized case reporting forms is the most common reporting method. Similar core data elements are collected; 8 regions report genotyping results. Data are stored using customized programmes (n=7 and commercial software (n=6. Nine jurisdictions provide monthly, bi-annual or annual reports to principally government and/or scientific/medical audiences. Conclusion: This review successfully establishes

  15. Fixed Dose Combination for TB treatment

    Directory of Open Access Journals (Sweden)

    Tjandra Y. Aditama

    2003-06-01

    Full Text Available According to the World Health Organization, a third of the world’s population is infected with tuberculosis. The disease is responsible for nearly 2 million deaths each year and over 8 million were developing active diseases. Moreover, according to WHO (2000, tuberculosis deaths are estimated to increase to 35 million between 2000-2020. The majority of tuberculosis patients worldwide are still treated with single drugs, or with 2-drug fixed-dose combinations (FDCs. To improve tuberculosis treatment, 2- and 3-drug FDCs were recommended by the World Health Organization (WHO as part of the DOTS strategy. Since 1999 a 4-drug FDC was included on the WHO Model List of Essential Drugs. Today, FDCs are important tools to further improve the quality of care for people with TB, and accelerate DOTS expansion to reach the global TB control targets. Fixed dose combination TB drugs could simplifies both treatment and management of drug supply, and may prevent the emergence of drug resistance .Prevention of drug resistance is just one of the potential benefits of the use of FDCs. FDCs simplify administration of drugs by reducing the number of pills a patient takes each day and decreasing the risk of incorrect prescriptions. Most tuberculosis patients need only take 3–4 FDCs tablets per day during the intensive phase of treatment, instead of the 15–16 tablets per day that is common with single-drug formulations It is much simpler to explain to patients that they need to take four tablets of the same type and colour, rather than a mixture of tablets of different shapes, colours and sizes. Also, the chance of taking an incomplete combination of drugs is eliminated, since the four essential drugs are combined into one tablet. FDCs are also simpler for care-givers as they minimize the risk of confusion. Finally, drug procurement, in all its components (stock management, shipping, distribution, is simplified by FDCs. Adverse reactions to drugs are not more

  16. Anti-Mycobacterium tuberculosis activity of fungus Phomopsis stipata

    Directory of Open Access Journals (Sweden)

    Karina Andrade de Prince

    2012-03-01

    Full Text Available Our purpose was to determine the anti-Mycobacterium tuberculosis activity of the metabolites produced by the endophitic fungus Phomopsis stipata (Lib. B. Sutton, (Diaporthaceae, cultivated in different media. The antimycobacterial activity was assessed through the Resazurin Microtiter Assay (REMA and the cytotoxicity test performed on macrophage cell line. The extracts derived from fungi grown on Corn Medium and Potato Dextrose Broth presented the smallest values of Minimum Inhibitory Concentration (MIC and low cytotoxicity, which implies a high selectivity index. This is the first report on the chemical composition and antitubercular activity of metabolites of P. stipata, as well as the influence of culture medium on these properties.

  17. Innovative Tuberculosis Symposium held during Cuba Salud 2015.

    Science.gov (United States)

    Chapman, Helena J; Armas Pérez, Luisa

    2016-12-01

    The fourth Tuberculosis (TB) Symposium, held during the Cuba Salud 2015 International Convention, highlighted advancements in research on TB and Mycobacterium tuberculosis (Mtb) by interdisciplinary teams from academic and federal institutions in Cuba, Colombia, Mexico, and the Dominican Republic. Delegates focused on the targets presented in the World Health Organization End TB Strategy for 2016-2035 and elaborated on four primary themes: 1) attention to vulnerable populations such as immunocompromised individuals, health care workers, and residents of long-term institutions such as prisons and nursing homes; 2) identification of active and latent TB cases through contact investigations; 3) spread and control of drug-resistant Mtb strains; and 4) advancements in the development of novel vaccines or "booster" immunizations. This international TB forum served as a platform for experts in diverse disciplines in these Latin American countries to discuss challenges faced by TB research and control programs, proposing novel research initiatives and promoting collaborative teamwork strategies for TB elimination. In solidarity, collaborative efforts in TB control require identification of symptomatic individuals, rapid diagnostic testing for TB, drug susceptibility assays on Mtb strains, and management that provide universal and gratuitous access to directly observed short-course therapy. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Prevalence of hepatitis C virus and human immunodeficiency virus in a group of patients newly diagnosed with active tuberculosis in Porto Alegre, Southern Brazil

    Directory of Open Access Journals (Sweden)

    Cintia Costi

    Full Text Available BACKGROUND Porto Alegre is the Brazilian state capital with second highest incidence of tuberculosis (TB and the highest proportion of people infected with human immunodeficiency virus (HIV among patients with TB. Hepatitis C virus (HCV infection increases the risk of anti-TB drug-induced hepatotoxicity, which may result in discontinuation of the therapy. OBJECTIVES The aim of this study was (i to estimate prevalence of HCV and HIV in a group of patients newly diagnosed with active TB in a public reference hospital in Porto Alegre and (ii to compare demographic, behavioural, and clinical characteristics of patients in relation to their HCV infection status. METHODS One hundred and thirty-eight patients with TB were tested for anti-HCV antibody, HCV RNA, and anti-HIV1/2 antibody markers. HCV RNA from real-time polymerase chain reaction (PCR-positive samples was submitted to reverse transcription and PCR amplification. The 5′ non-coding region of the HCV genome was sequenced, and genotypes of HCV isolates were determined. FINDINGS Anti-HCV antibody, HCV RNA, and anti-HIV antibodies were detected in 27 [20%; 95% confidence interval (CI, 13-26%], 17 (12%; 95% CI, 7-18%, and 34 (25%; 95% CI, 17-32% patients, respectively. HCV isolates belonged to genotypes 1 (n = 12 and 3 (n = 4. Some characteristics were significantly more frequent in patients infected with HCV. Among them, non-white individuals, alcoholics, users of illicit drugs, imprisoned individuals, and those with history of previous TB episode were more commonly infected with HCV (p < 0.05. MAIN CONCLUSIONS HCV screening, including detection of anti-HCV antibody and HCV RNA, will be important to improving the management of co-infected patients, given their increased risk of developing TB treatment-related hepatotoxicity.

  19. Prevalence of hepatitis C virus and human immunodeficiency virus in a group of patients newly diagnosed with active tuberculosis in Porto Alegre, Southern Brazil.

    Science.gov (United States)

    Costi, Cintia; Grandi, Tarciana; Halon, Maria Laura; Silva, Márcia Susana Nunes; Silva, Cláudia Maria Dornelles da; Gregianini, Tatiana Schäffer; Possuelo, Lia Gonçalves; Jarczewski, Carla Adriane; Niel, Christian; Rossetti, Maria Lucia Rosa

    2017-04-01

    Porto Alegre is the Brazilian state capital with second highest incidence of tuberculosis (TB) and the highest proportion of people infected with human immunodeficiency virus (HIV) among patients with TB. Hepatitis C virus (HCV) infection increases the risk of anti-TB drug-induced hepatotoxicity, which may result in discontinuation of the therapy. The aim of this study was (i) to estimate prevalence of HCV and HIV in a group of patients newly diagnosed with active TB in a public reference hospital in Porto Alegre and (ii) to compare demographic, behavioural, and clinical characteristics of patients in relation to their HCV infection status. One hundred and thirty-eight patients with TB were tested for anti-HCV antibody, HCV RNA, and anti-HIV1/2 antibody markers. HCV RNA from real-time polymerase chain reaction (PCR)-positive samples was submitted to reverse transcription and PCR amplification. The 5' non-coding region of the HCV genome was sequenced, and genotypes of HCV isolates were determined. Anti-HCV antibody, HCV RNA, and anti-HIV antibodies were detected in 27 [20%; 95% confidence interval (CI), 13-26%], 17 (12%; 95% CI, 7-18%), and 34 (25%; 95% CI, 17-32%) patients, respectively. HCV isolates belonged to genotypes 1 (n = 12) and 3 (n = 4). Some characteristics were significantly more frequent in patients infected with HCV. Among them, non-white individuals, alcoholics, users of illicit drugs, imprisoned individuals, and those with history of previous TB episode were more commonly infected with HCV (p < 0.05). HCV screening, including detection of anti-HCV antibody and HCV RNA, will be important to improving the management of co-infected patients, given their increased risk of developing TB treatment-related hepatotoxicity.

  20. MULTIDISCIPLINARY APPROACH TO SUPPORTING TREATMENT COMPLIANCE IN TUBERCULOSIS PATIENTS

    Directory of Open Access Journals (Sweden)

    T. V. Sherstneva

    2017-01-01

    Full Text Available The article presents the algorithm for working with tuberculosis patients in TB hospital, providing implementation of multidisciplinary patient-centered activities for early diagnostics of psychiatric and social disorders, therapy and rehabilitation of concurrent psychiatric disorders and addictions. Multidisciplinary approach to activities within TB unit is aimed at improvement of treatment compliance of tuberculosis patients. The training programme has been developed in order to improve competency of medical personnel on the issue of treatment interruption prevention and motivating patients to undergo the continuous treatment.

  1. Interferon-gamma treatment kinetics among patients with active ...

    African Journals Online (AJOL)

    Introduction: Interferon-γ (IFN-γ) is essential for defence against Mycobacterium tuberculosis; however, levels in patients with active tuberculosis (TB) and changes during treatment have not been documented in our tuberculosis patients in Nigeria, hence this study has been carried out. Objective: To determine variations, ...

  2. Diagnostic accuracy, incremental yield and prognostic value of Determine TB-LAM for routine diagnostic testing for tuberculosis in HIV-infected patients requiring acute hospital admission in South Africa: a prospective cohort.

    Science.gov (United States)

    Lawn, Stephen D; Kerkhoff, Andrew D; Burton, Rosie; Schutz, Charlotte; Boulle, Andrew; Vogt, Monica; Gupta-Wright, Ankur; Nicol, Mark P; Meintjes, Graeme

    2017-03-21

    We previously reported that one-third of HIV-positive adults requiring medical admission to a South African district hospital had laboratory-confirmed tuberculosis (TB) and that almost two-thirds of cases could be rapidly diagnosed using Xpert MTB/RIF-testing of concentrated urine samples obtained on the first day of admission. Implementation of urine-based, routine, point-of-care TB screening is an attractive intervention that might be facilitated by use of a simple, low-cost diagnostic tool, such as the Determine TB-LAM lateral-flow rapid test for HIV-associated TB. Sputum, urine and blood samples were systematically obtained from unselected HIV-positive adults within 24 hours of admission to a South African township hospital. Additional clinical samples were obtained during hospitalization as clinically indicated. TB was defined by the detection of Mycobacterium tuberculosis in any sample using Xpert MTB/RIF or liquid culture. The diagnostic yield, accuracy and prognostic value of urine-lipoarabinomannan (LAM) testing were determined, but urine-LAM results did not inform treatment decisions. Consecutive HIV-positive adult acute medical admissions not already receiving TB treatment (n = 427) were enrolled regardless of clinical presentation or symptoms. TB was diagnosed in 139 patients (TB prevalence 32.6%; median CD4 count 80 cells/μL). In the first 24 hours of admission, sputum (spot and/or induced) samples were obtained from 37.0% of patients and urine samples from 99.5% of patients (P < 0.001). The diagnostic yields from these specimens were 19.4% (n = 27/139) for sputum-microscopy, 26.6% (n = 37/139) for sputum-Xpert, 38.1% (n = 53/139) for urine-LAM and 52.5% (n = 73/139) for sputum-Xpert/urine-LAM combined (P < 0.01). Corresponding yields among patients with CD4 counts <100 cells/μL were 18.9%, 24.3%, 55.4% and 63.5%, respectively (P < 0.01). The diagnostic yield of urine-LAM was unrelated to respiratory symptoms, and

  3. Management of newborns at risk of neonatal and perinatal tuberculosis

    Directory of Open Access Journals (Sweden)

    Vania Giacomet

    2017-09-01

    Full Text Available Tuberculosis (TB is one of the commonest infectious diseases in the world with 10.4 million new cases estimated in 2015, of which one million are children. The prevalence of active TB in pregnant and postpartum women from high-prevalence countries is higher than 60 cases per 100 000 people per year. Here we presented three different cases of infants born to mothers with active TB and we reviewed the current recommendations on the prophylaxis of neonatal and perinatal tuberculosis. Currently there is a lack of concordance regarding the most appropriate time for TB reassessment and discontinuation of prophylaxis after birth. More reliable diagnostic tests are still needed to help physicians to decide the appropriate time to safely discontinue prophylaxis. An uniform consensus on management of infants born to TBC- infected mothers is highly necessary to improve the measures and interventions to limit the infection at birth.

  4. Increased level of acute phase reactants in patients infected with modern Mycobacterium tuberculosis genotypes in Mwanza, Tanzania

    DEFF Research Database (Denmark)

    Stavrum, Ruth; PrayGod, George; Range, Nyagosya

    2014-01-01

    a distinct genetic ancestry. This study describes the genetic biodiversity of M. tuberculosis genotypes in Mwanza city, Tanzania and the clinical presentation of the disease caused by isolates of different lineages. METHODS: Two-hundred-fifty-two isolates from pulmonary TB patients in Mwanza, Tanzania were......BACKGROUND: There is increasing evidence to suggest that different Mycobacterium tuberculosis lineages cause variations in the clinical presentation of tuberculosis (TB). Certain M. tuberculosis genotypes/lineages have been shown to be more likely to cause active TB in human populations from....... tuberculosis lineage of the infectious agent for each patient. RESULTS: The most frequent genotype was ST59 (48 out of 248 [19.4%]), belonging to the Euro-American lineage LAM11_ZWE, followed by ST21 (CAS_KILI lineage [44 out of 248 [17.7%]). A low degree of diversity (15.7% [39 different ST's out of 248...

  5. HTLV-1 infection is associated with a history of active tuberculosis among family members of HTLV-1-infected patients in Peru.

    Science.gov (United States)

    Verdonck, K; González, E; Schrooten, W; Vanham, G; Gotuzzo, E

    2008-08-01

    The purpose of this study was to assess the association between human T-lymphotropic virus 1 (HTLV-1) and a lifetime history of active tuberculosis (TB) among relatives of HTLV-1-infected patients. We reviewed clinical charts of all relatives of HTLV-1-infected index cases who attended our institute in Lima from 1990-2004. The data of 1233 relatives was analysed; 394 (32.0%) were HTLV-1 positive. Eighty-one subjects (6.6%) had a history of active TB, including 45/394 (11.4%) HTLV-1-positive and 36/839 (4.3%) HTLV-1-negative relatives (Phistory: HTLV-1 infection (adjusted OR 2.5, 95% CI 1.6-3.9), age (adjusted OR 1.3, 95% CI 1.1-1.5 per 10-year age increase) and relation to the index case (adjusted OR 2.6, 95% CI 1.3-5.1, for siblings vs. spouses of index cases). In conclusion, HTLV-1 infection may increase the susceptibility to active TB. In populations where both infections are frequent, such an association could affect the dynamics of TB.

  6. T-cell recognition of Mycobacterium tuberculosis culture filtrate fractions in tuberculosis patients and their household contacts

    DEFF Research Database (Denmark)

    Demissie, A; Ravn, P; Olobo, J

    1999-01-01

    We examined the immune responses of patients with active pulmonary tuberculosis (TB) and their healthy household contacts to short-term culture filtrate (ST-CF) of Mycobacterium tuberculosis or molecular mass fractions derived from it. Our goal was to identify fractions strongly recognized...... antigens and immune responses were determined. Household contacts produced significantly higher levels of gamma interferon (IFN-gamma) than the TB patients in response to antigens present in ST-CF and the 10 narrow-molecular-mass fractions. A similar difference in leukocyte proliferative responses...... to the antigens between the two groups was also found. In general, while all fractions stimulated immune responses, the highest activity was seen with the low-molecular-mass fractions, which include well-defined TB antigens such as ESAT-6. Leukocytes from contacts of TB patients with severe disease produced...

  7. Comparative evaluation of GenoType MTBDRplus line probe assay with solid culture method in early diagnosis of multidrug resistant tuberculosis (MDR-TB at a tertiary care centre in India.

    Directory of Open Access Journals (Sweden)

    Raj N Yadav

    Full Text Available The objectives of the study were to compare the performance of line probe assay (GenoType MTBDRplus with solid culture method for an early diagnosis of multidrug resistant tuberculosis (MDR-TB, and to study the mutation patterns associated with rpoB, katG and inhA genes at a tertiary care centre in north India.In this cross-sectional study, 269 previously treated sputum-smear acid-fast bacilli (AFB positive MDR-TB suspects were enrolled from January to September 2012 at the All India Institute of Medical Sciences hospital, New Delhi. Line probe assay (LPA was performed directly on the sputum specimens and the results were compared with that of conventional drug susceptibility testing (DST on solid media [Lowenstein Jensen (LJ method].DST results by LPA and LJ methods were compared in 242 MDR-TB suspects. The LPA detected rifampicin (RIF resistance in 70 of 71 cases, isoniazid (INH resistance in 86 of 93 cases, and MDR-TB in 66 of 68 cases as compared to the conventional method. Overall (rifampicin, isoniazid and MDR-TB concordance of the LPA with the conventional DST was 96%. Sensitivity and specificity were 98% and 99% respectively for detection of RIF resistance; 92% and 99% respectively for detection of INH resistance; 97% and 100% respectively for detection of MDR-TB. Frequencies of katG gene, inhA gene and combined katG and inhA gene mutations conferring all INH resistance were 72/87 (83%, 10/87 (11% and 5/87 (6% respectively. The turnaround time of the LPA test was 48 hours.The LPA test provides an early diagnosis of monoresistance to isoniazid and rifampicin and is highly sensitive and specific for an early diagnosis of MDR-TB. Based on these findings, it is concluded that the LPA test can be useful in early diagnosis of drug resistant TB in high TB burden countries.

  8. Improving Tuberculosis Case Finding in Indonesia

    NARCIS (Netherlands)

    R.A. Ahmad (Riris)

    2011-01-01

    textabstractTuberculosis (TB) is an infectious disease caused by the bacterium Mycobacterium tuberculosis. The most frequent clinical manifestation of the disease is pulmonary TB, but it can affect any part of the body (extra-pulmonary TB), including the skin, lymph nodes, spine, joints,

  9. High prevalence of tuberculosis diagnosed during autopsy ...

    African Journals Online (AJOL)

    The primary aims of tuberculosis (TB) control programmes is early diagnosis and prompt treatment of infectious cases to limit transmission. Failure to diagnose and adequately treat TB could lead to premature death and unrecognized transmission of Mycobacterium tuberculosis. The proportion of missed TB cases has not ...

  10. Low sputum smear positive tuberculosis among pulmonary ...

    African Journals Online (AJOL)

    Low sputum smear positive tuberculosis among pulmonary tuberculosis suspects in a tertiary hospital in Mwanza, Tanzania. ... The risk factors among smear positive TB patients were co-illness (32.5%), previous history of TB (7.5%) and history of positive TB contact (4.7%). These findings also show that as CD4+ T Cells ...

  11. Atypical tuberculosis presenting with primary infertility and ...

    African Journals Online (AJOL)

    Tuberculosis (TB) is caused by mycobacterium tuberculosis. It remains a public health concern especially in developing country. Pulmonary infection is the main presentation. However, genitourinary TB is common especially with the increase in Human Immunodeficiency virus (HIV) infection. Genitourinary TB is one of the ...

  12. Evaluation of the Antibody in Lymphocyte Supernatant Assay to Detect Active Tuberculosis.

    Directory of Open Access Journals (Sweden)

    Margaretha Sariko

    Full Text Available We aimed to evaluate the antibody in lymphocyte supernatant (ALS assay as a biomarker to diagnose tuberculosis among adults from Tanzania with and without HIV.Adults admitted with suspicion for tuberculosis had sputa obtained for GeneXpert MTB/RIF, acid-fast bacilli smear and mycobacterial culture; blood was obtained prior to treatment initiation and after 4 weeks. Adults hospitalized with non-infectious conditions served as controls. Peripheral blood mononuclear cells were cultured unstimulated for 72 hours. Anti-mycobacterial antibodies were measured from culture supernatants by ELISA, using BCG vaccine as the coating antigen. Median ALS responses were compared between cases and controls at baseline and between cases over time.Of 97 TB cases, 85 were microbiologically confirmed and 12 were clinically diagnosed. Median ALS responses from TB cases (0.366 OD from confirmed cases and 0.285 from clinical cases were higher compared to controls (0.085, p<0.001. ALS responses did not differ based on HIV status, CD4 count or sputum smear status. Over time, the median ALS values declined significantly (0.357 at baseline; 0.198 after 4-weeks, p<0.001.Robust ALS responses were mounted by patients with TB regardless of HIV status, CD4 count, or low sputum bacillary burden, potentially conferring a unique niche for this immunologic biomarker for TB.

  13. Disease-related knowledge, attitude and practices of tuberculosis ...

    African Journals Online (AJOL)

    Preferred Customer

    BACKGROUND: Tuberculosis (TB) is a major public health problem. World Health ... hospitals were interviewed on their knowledge, attitude and practice related to TB using pre-tested ..... patients exercise care to limit the spread of. TB, only ...

  14. The QuantiFERON-TB Gold In-Tube Assay in Neuro-Ophthalmology.

    Science.gov (United States)

    Little, Leanne M; Rigi, Mohammed; Suleiman, Ayman; Smith, Stacy V; Graviss, Edward A; Foroozan, Rod; Lee, Andrew G

    2017-09-01

    Although QuantiFERON-TB Gold In-Tube (QFT-GIT) testing is regularly used to detect infection with Mycobacterium tuberculosis, its utility in a patient population with a low risk for tuberculosis (TB) has been questioned. The following is a cohort study analyzing the efficacy of QFT-GIT testing as a method for detection of active TB disease in low-risk individuals in a neuro-ophthalmologic setting. Ninety-nine patients from 2 neuro-ophthalmology centers were identified as having undergone QFT-GIT testing between January 2012 and February 2016. Patients were divided into groups of negative, indeterminate, and positive QFT-GIT results. Records of patients with positive QFT-GIT results were reviewed for development of latent or active TB, as determined by clinical, bacteriologic, and/or radiographic evidence. Of the 99 cases reviewed, 18 patients had positive QFT-GIT tests. Of these 18 cases, 12 had documentation of chest radiographs or computed tomography which showed no evidence for either active TB or pulmonary latent TB infection (LTBI). Four had chest imaging which was indicative of possible LTBI. None of these 18 patients had symptoms of active TB and none developed active TB within the follow-up period. Based on our results, we conclude that routine testing with QFT-GIT in a low-risk cohort did not diagnose active TB infection. We do not recommend routine QFT-GIT testing for TB low-risk individuals, as discerned through patient and exposure history, ocular examination, and clinical judgment, in neuro-ophthalmology practice.

  15. CCL2 responses to Mycobacterium tuberculosis are associated with disease severity in tuberculosis.

    Directory of Open Access Journals (Sweden)

    Zahra Hasan

    Full Text Available BACKGROUND: Leucocyte activating chemokines such as CCL2, CCL3, and CXCL8 together with proinflammatory IFNgamma, TNFalpha and downmodulatory IL10 play a central role in the restriction of M. tuberculosis infections, but is unclear whether these markers are indicative of tuberculosis disease severity. METHODOLOGY: We investigated live M. tuberculosis- and M. bovis BCG-induced peripheral blood mononuclear cell responses in patients with tuberculosis (TB and healthy endemic controls (ECs, n = 36. TB patients comprised pulmonary (PTB, n = 34 and extrapulmonary groups, subdivided into those with less severe localized extrapulmonary TB (L-ETB, n = 16 or severe disseminated ETB (D-ETB, n = 16. Secretion of CCL2, IFNgamma, IL10 and CCL3, and mRNA expression of CCL2, TNFalpha, CCL3 and CXCL8 were determined. RESULTS: M. tuberculosis- and BCG-induced CCL2 secretion was significantly increased in both PTB and D-ETB (p<0.05, p<0.01 as compared with L-ETB patients. CCL2 secretion in response to M. tuberculosis was significantly greater than to BCG in the PTB and D-ETB groups. M. tuberculosis-induced CCL2 mRNA transcription was greater in PTB than L-ETB (p = 0.023, while CCL2 was reduced in L-ETB as compared with D-ETB (p = 0.005 patients. M. tuberculosis-induced IFNgamma was greater in L-ETB than PTB (p = 0.04, while BCG-induced IFNgamma was greater in L-ETB as compared with D-ETB patients (p = 0.036. TNFalpha mRNA expression was raised in PTB as compared with L-ETB group in response to M. tuberculosis (p = 0.02 and BCG (p = 0.03. Mycobacterium-induced CCL3 and CXCL8 was comparable between TB groups. CONCLUSIONS: The increased CCL2 and TNFalpha in PTB patients may support effective leucocyte recruitment and M. tuberculosis localization. CCL2 alone is associated with severity of TB, possibly due to increased systemic inflammation found in severe disseminated TB or due to increased monocyte infiltration to lung parenchyma in pulmonary disease.

  16. Phosphodiesterase-4 inhibition combined with isoniazid treatment of rabbits with pulmonary tuberculosis reduces macrophage activation and lung pathology.

    Science.gov (United States)

    Subbian, Selvakumar; Tsenova, Liana; O'Brien, Paul; Yang, Guibin; Koo, Mi-Sun; Peixoto, Blas; Fallows, Dorothy; Zeldis, Jerome B; Muller, George; Kaplan, Gilla

    2011-07-01

    Tuberculosis (TB) is responsible for significant morbidity and mortality worldwide. Even after successful microbiological cure of TB, many patients are left with residual pulmonary damage that can lead to chronic respiratory impairment and greater risk of additional TB episodes due to reinfection with Mycobacterium tuberculosis. Elevated levels of the proinflammatory cytokine tumor necrosis factor-α and several other markers of inflammation, together with expression of matrix metalloproteinases, have been associated with increased risk of pulmonary fibrosis, tissue damage, and poor treatment outcomes in TB patients. In this study, we used a rabbit model of pulmonary TB to evaluate the impact of adjunctive immune modulation, using a phosphodiesterase-4 inhibitor that dampens the innate immune response, on the outcome of treatment with the antibiotic isoniazid. Our data show that cotreatment of M. tuberculosis infected rabbits with the phosphodiesterase-4 inhibitor CC-3052 plus isoniazid significantly reduced the extent of immune pathogenesis, compared with antibiotic alone, as determined by histologic analysis of infected tissues and the expression of genes involved in inflammation, fibrosis, and wound healing in the lungs. Combined treatment with an antibiotic and CC-3052 not only lessened disease but also improved bacterial clearance from the lungs. These findings support the potential for adjunctive immune modulation to improve the treatment of pulmonary TB and reduce the risk of chronic respiratory impairment. Copyright © 2011 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  17. Oral Administration of Heat-Killed Mycobacterium manresensis Delays Progression toward Active Tuberculosis in C3HeB/FeJ Mice.

    Science.gov (United States)

    Cardona, Paula; Marzo-Escartín, Elena; Tapia, Gustavo; Díaz, Jorge; García, Vanessa; Varela, Ismael; Vilaplana, Cristina; Cardona, Pere-Joan

    2015-01-01

    Low-dose tolerance using heat-killed mycobacteria has been tested as a means of stopping progression toward active tuberculosis (TB) lesions in a human-like murine model using C3HeB/FeJ mice. In the present study, we studied the effect of different treatment schedules with heat-killed non-tuberculous-mycobacteria (NTM) species when given orally, based on the hypothesis of generating oral tolerance. This study included M. manresensis, a new species belonging to the fortuitum group, present in drinking water. Oral treatment with M. manresensis for 2 weeks was able to induce a PPD-specific Tregs population, which has been related to a decrease in the neutrophilic infiltration found in TB lesions. Further mechanistic analysis using PPD-stimulated splenocytes links this 2-week treatment with heat-killed M. manresensis to IL-10 production and memory PPD-specific Tregs, and also to a weak PPD-specific global immune response stimulation, increasing IL-6, TNF, and IFN-γ production. In lungs, this treatment decreased the bacillary load, granulomatous infiltration and pro-inflammatory cytokines (TNF, IFN-γ, IL-6, and IL-17). Oral administration of M. manresensis during standard treatment for TB also significantly reduced the relapse of active TB after ending the treatment. Overall the data suggest that the use of heat-killed M. manresensis could be a new and promising tool for avoiding active TB induction and as adjunctive to TB treatment. This supports the usefulness of generating a new kind of protection based on a complex balanced immune response focused on both destroying the bacilli and including control of an excessive inflammatory response.

  18. Beyond multidrug-resistant tuberculosis in Europe: a TBNET study

    NARCIS (Netherlands)

    Günther, G.; van Leth, F.; Altet, N.; Dedicoat, M.; Duarte, R.; Gualano, G.; Kunst, H.; Muylle, I.; Spinu, V.; Tiberi, S.; Viiklepp, P.; Lange, C.; Alexandru, S.; Cernenco, I.; Ciobanu, A.; Donica, A.; Cayla, J.; Fina, L.; Galvao, M. L. de Souza; Maldonado, J.; Avsar, K.; Bang, D.; Andersen, A. B.; Barbuta, R.; Dubceac, V.; Bothamley, G.; Crudu, V.; Davilovits, M.; Atunes, A.; de Lange, W.; Leimane, V.; Rusmane, L.; de Lorenzo, S.; Cuppen, F.; de Guchtenaire, I.; Magis-Escurra, C.; McLaughlin, A.-M.; Meesters, R.; te Pas, M.; Prins, B.; Mütterlein, R.; Kotrbova, J.; Polcová, V.; Vasakova, M.; Pontali, E.; Rumetshofer, R.; Rowhani, M.; Skrahina, A.; Avchinko, V.; Katovich, D.

    2015-01-01

    The emergence of drug-resistant tuberculosis (TB) is a challenge to TB control in Europe. We evaluated second-line drug susceptibility testing in Mycobacterium tuberculosis isolates from patients with multidrug-resistant, pre-extensively drug-resistant (pre-XDR-TB) and XDR-TB at 23 TBNET sites in 16

  19. Potential Immunological Biomarkers for Detection of Mycobacterium tuberculosis Infection in a Setting Where M. tuberculosis Is Endemic, Ethiopia.

    Science.gov (United States)

    Teklu, Takele; Kwon, Keehwan; Wondale, Biniam; HaileMariam, Milkessa; Zewude, Aboma; Medhin, Girmay; Legesse, Mengistu; Pieper, Rembert; Ameni, Gobena

    2018-04-01

    Accurate diagnosis and early treatment of tuberculo