Linear response theory of activated surface diffusion with interacting adsorbates
Energy Technology Data Exchange (ETDEWEB)
Marti' nez-Casado, R. [Department of Chemistry, Imperial College London, South Kensington, London SW7 2AZ (United Kingdom); Sanz, A.S.; Vega, J.L. [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cientificas, Serrano 123, 28006 Madrid (Spain); Rojas-Lorenzo, G. [Instituto Superior de Tecnologi' as y Ciencias Aplicadas, Ave. Salvador Allende, esq. Luaces, 10400 La Habana (Cuba); Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain); Miret-Artes, S., E-mail: s.miret@imaff.cfmac.csic.es [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain)
2010-05-12
Graphical abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed. - Abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed.
Stochastic Description of Activated Surface Diffusion with Interacting Adsorbates
Martínez-Casado, Ruth; Vega, José Luis; Sanz, Ángel S.; Miret-Artés, Salvador
Activated surface diffusion on metal surfaces is receiving much attention both experimentally and theoretically. One of the main theoretical problems in this field is to explain the line-shape broadening observed when the surface coverage is increased. Recently, we have proposed a fully stochastic model, the interacting single adsorbate (ISA) model, aimed at explaining and understanding this type of experiments, which essentially consists of considering the classical Langevin formulation with two types of noise forces: (i) a Gaussian white noise accounting for the substrate friction, and (ii) a shot noise simulating the interacting adsorbates at different coverages. No interaction potential between adsorbates is included because any trace of microscopic interaction seems to be wiped out in a Markovian regime. This model describes in a good approximation, and at a very low computational cost, the line-shape broadening observed experimentally. Furthermore, its mathematical simplicity also allows to derive some analytical expressions which are of much help in the interpretation of the physics underlying surface diffusion processes.
Single atom self-diffusion on nickel surfaces
International Nuclear Information System (INIS)
Tung, R.T.; Graham, W.R.
1980-01-01
Results of a field ion microscope study of single atom self-diffusion on Ni(311), (331), (110), (111) and (100) planes are presented, including detailed information on the self-diffusion parameters on (311), (331), and (110) surfaces, and activation energies for diffusion on the (111), and (100) surfaces. Evidence is presented for the existence of two types of adsorption site and surface site geometry for single nickel atoms on the (111) surface. The presence of adsorbed hydrogen on the (110), (311), and (331) surfaces is shown to lower the onset temperature for self-diffusion on these planes. (orig.)
Surface diffusion of sorbed radionuclides
International Nuclear Information System (INIS)
Berry, J.A.; Bond, K.A.
1991-01-01
Surface diffusion has in the past been invoked to explain rates of radionuclide migration which were greater than those predicted. Results were generally open to interpretation but the possible existence of surface diffusion, whereby sorbed radionuclides could potentially migrate at much enhanced rates, necessitated investigation. In this work through-diffusion experiments have shown that although surface diffusion does exist for some nuclides, the magnitude of the phenomenon is not sufficient to affect repository safety assessment modelling. (author)
Nonthermal Effects of Photon Illumination on Surface Diffusion
International Nuclear Information System (INIS)
Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E.G.
1998-01-01
Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally for the first time. Activation energies and preexponential factors for diffusion of germanium and indium on silicon change substantially in response to illumination by photons having energies greater than the substrate band gap. Results depend on doping type. Ionization of surface vacancies by photogenerated charge carriers seems to play a key role. The results have significant implications for aspects of microelectronics fabrication governed by surface mobility. copyright 1998 The American Physical Society
Pore and surface diffusion in multicomponent adsorption and liquid chromatography systems
International Nuclear Information System (INIS)
Ma, Z.; Whitley, R.D.; Wang, N.H.L.
1996-01-01
A generalized parallel pore and surface diffusion model for multicomponent adsorption and liquid chromatography is formulated and solved numerically. Analytical solution for first- and second-order central moments for a pulse on a plateau input is used as benchmarks for the numerical solutions. Theoretical predictions are compared with experimental data for two systems: ion-exchange of strontium, sodium, and calcium in a zeolite and competitive adsorption of two organics on activated carbon. In a linear isotherm region of single-component systems, both surface and pore diffusion cause symmetric spreading in breakthrough curves. In a highly nonlinear isotherm region, however, surface diffusion causes pronounced tailing in breakthrough curves; the larger the step change in concentration, the more pronounced tailing, in contrast to relatively symmetric breakthroughs due to pore diffusion. If only a single diffusion mechanism is assumed in analyzing the data of parallel diffusion systems, a concentration-dependent apparent surface diffusivity or pore diffusivity results; for a convex isotherm, the apparent surface diffusivity increases, whereas the apparent pore diffusivity decreases with increasing concentration. For a multicomponent nonlinear system, elution order can change if pore diffusion dominates for a low-affinity solute, whereas surface diffusion dominates for a high-affinity solute
Pfaffmann, Lukas; Birkenmaier, Claudia; Müller, Marcus; Bauer, Werner; Mitsch, Tim; Feinauer, Julian; Krämer, Yvonne; Scheiba, Frieder; Hintennach, Andreas; Schleid, Thomas; Schmidt, Volker; Ehrenberg, Helmut
2016-03-01
Negative electrodes of lithium-ion batteries generally consist of graphite-based active materials. In order to realize batteries with a high current density and therefore accelerated charging processes, the intercalation of lithium and the diffusion processes of these carbonaceous materials must be understood. In this paper, we visualized the electrochemical active surface area for three different anode materials using a novel OsO4 staining method in combination with scanning electron microscopy techniques. The diffusion behavior of these three anode materials is investigated by potentiostatic intermittent titration technique measurements. From those we determine the diffusion coefficient with and without consideration of the electrochemical active surface area.
International Nuclear Information System (INIS)
Richter, Armin; Benick, Jan; Kimmerle, Achim; Hermle, Martin; Glunz, Stefan W.
2014-01-01
Thin layers of Al 2 O 3 are well known for the excellent passivation of p-type c-Si surfaces including highly doped p + emitters, due to a high density of fixed negative charges. Recent results indicate that Al 2 O 3 can also provide a good passivation of certain phosphorus-diffused n + c-Si surfaces. In this work, we studied the recombination at Al 2 O 3 passivated n + surfaces theoretically with device simulations and experimentally for Al 2 O 3 deposited with atomic layer deposition. The simulation results indicate that there is a certain surface doping concentration, where the recombination is maximal due to depletion or weak inversion of the charge carriers at the c-Si/Al 2 O 3 interface. This pronounced maximum was also observed experimentally for n + surfaces passivated either with Al 2 O 3 single layers or stacks of Al 2 O 3 capped by SiN x , when activated with a low temperature anneal (425 °C). In contrast, for Al 2 O 3 /SiN x stacks activated with a short high-temperature firing process (800 °C) a significant lower surface recombination was observed for most n + diffusion profiles without such a pronounced maximum. Based on experimentally determined interface properties and simulation results, we attribute this superior passivation quality after firing to a better chemical surface passivation, quantified by a lower interface defect density, in combination with a lower density of negative fixed charges. These experimental results reveal that Al 2 O 3 /SiN x stacks can provide not only excellent passivation on p + surfaces but also on n + surfaces for a wide range of surface doping concentrations when activated with short high-temperature treatments
Direct measurement of Cu surface self-diffusion on a checked surface
International Nuclear Information System (INIS)
Cousty, Jacques; Peix, Roger; Perraillon, Bernard.
1976-01-01
A radiotracer technique ( 64 Cu) was developed to measure surface diffusion on copper surfaces of total impurity concentration not exceeding some 10 -3 monolayers. The apparatus used consists of a slow electron diffraction device, an Auger analysis spectrometer (CMA), an ion gun and an evaporation device assembled in an ultra-vacuum chamber holding a residual pressure below 10 -10 Torr. A sample handler enables the surface studied to be positioned in front of each of these instruments. During the diffusion treatment the chemical composition of the surface is checked intermittently, and afterwards the spread of the deposit is measured outside the ultravacuum chamber. Slices several microns thick are removed and dissolved separately in dishes containing HNO 3 . The activity is then measured with a flow counter [fr
Laser-induced desorption determinations of surface diffusion on Rh(111)
International Nuclear Information System (INIS)
Seebauer, E.G.; Schmidt, L.D.
1987-01-01
Surface diffusion of hydrogen, deuterium and CO on Rh(111) has been investigated by laser-induced thermal desorption (LITD) and compared with previous results for these species on Pt(111) and on other metals. For deuterium in the coverage range 0.02 0 - 8 x 10 -2 cm 2 /s, with a diffusion activation energy 3.7 0 rises from 10 -3 to 10 -2 cm 2 /s between θ = 0.01 and 0.40. Values of E/sub diff/ on different surfaces appear to correlate with differences in heats of adsorption in different binding states which form saddle point configurations in surface diffusion. In addition, oxidation reactions on Rh and on several other transition metal surfaces may be limited to CO or H surface diffusion. 30 refs., 3 figs., 1 tab
Gallium surface diffusion on GaAs (001) surfaces measured by crystallization dynamics of Ga droplets
International Nuclear Information System (INIS)
Bietti, Sergio; Somaschini, Claudio; Esposito, Luca; Sanguinetti, Stefano; Fedorov, Alexey
2014-01-01
We present accurate measurements of Ga cation surface diffusion on GaAs surfaces. The measurement method relies on atomic force microscopy measurement of the morphology of nano–disks that evolve, under group V supply, from nanoscale group III droplets, earlier deposited on the substrate surface. The dependence of the radius of such nano-droplets on crystallization conditions gives direct access to Ga diffusion length. We found an activation energy for Ga on GaAs(001) diffusion E A =1.31±0.15 eV, a diffusivity prefactor of D 0 = 0.53(×2.1±1) cm 2 s −1 that we compare with the values present in literature. The obtained results permit to better understand the fundamental physics governing the motion of group III ad–atoms on III–V crystal surfaces and the fabrication of designable nanostructures.
The influence of the surface atomic structure on surface diffusion
International Nuclear Information System (INIS)
Ghaleb, Dominique
1984-03-01
This work represents the first quantitative study of the influence of the surface atomic structure on surface diffusion (in the range: 0.2 Tf up 0.5 Tf; Tf: melting temperature of the substrate). The analysis of our results on a microscopic scale shows low formation and migration energies for adatoms; we can describe the diffusion on surfaces with a very simple model. On (110) surfaces at low temperature the diffusion is controlled by the exchange mechanism; at higher temperature direct jumps of adatoms along the channels contribute also to the diffusion process. (author) [fr
Palladium diffusion into bulk copper via the (100) surface
Energy Technology Data Exchange (ETDEWEB)
Bussmann, E; Kellogg, G L [Sandia National Laboratories, Albuquerque, NM 87185 (United States); Sun, J; Pohl, K [Department of Physics and Materials Science Program, University of New Hampshire, Durham, NH 03824 (United States)
2009-08-05
Using low-energy electron microscopy, we measure the diffusion of Pd into bulk Cu at the Cu(100) surface. Interdiffusion is tracked by measuring the dissolution of the Cu(100)-c(2 x 2)-Pd surface alloy during annealing (T>240 deg. C). The activation barrier for Pd diffusion from the surface alloy into the bulk is determined to be (1.8 +- 0.6) eV. During annealing, we observe the growth of a new layer of Cu near step edges. Under this new Cu layer, dilute Pd remaining near the surface develops a layered structure similar to the Cu{sub 3}Pd L 1{sub 2} bulk alloy phase.
Theory and experiments on surface diffusion
Energy Technology Data Exchange (ETDEWEB)
Silvestri, W.L.
1998-11-01
The following topics were dealt with: adatom formation and self-diffusion on the Ni(100) surface, helium atom scattering measurements, surface-diffusion parameter measurements, embedded atom method calculations.
SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS
Directory of Open Access Journals (Sweden)
M. R. Monazzam
2006-10-01
Full Text Available Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier was raised. Diffusion coefficients of a diffuser in different conditions at some receiver locations were predicted by using a 2D boundary element method. It was found that the diffusion coefficient of diffuser at the top of barrier is so small that the diffusivity of the structure is almost the same as rigid T-shape barrier. To find the barrier’s cap behavior, the total field above the top surface of profile barriers was also predicted. It was found that the lowest total energy is at the receiver side of the cap very close to the top surface,which could demonstrate the effect of top surface on absorbing the energy as wave transfers from source edge toward the receiver side of the cap. In this case the amount of minimum total energy depends on the frequency and the configuration of the top surface. A comparison between the reductions of total field at the source side of the cap with the improvements of barrier’s performance was also done. It was shown that the amount of decrease in total field compared to that of an absorbent barrier “Ref” is directly associated to the amount of improvement in the insertion loss made by the diffuser barrier compared to the “Ref” barrier in the wide area on the ground at the shadow zone. Finally it was concluded that the diffuser on the top of barrier does not act as a diffuser and a kind of similarity between the contribution of diffuser and absorbent material on the top of T-profile barrier is seen.
Novel surface diffusion characteristics for a robust pentacene derivative on Au(1 1 1) surfaces
Miller, Ryan A.; Larson, Amanda; Pohl, Karsten
2017-06-01
Molecular dynamics simulations have been performed in both the ab initio and classical mechanics frameworks of 5,6,7-trithiapentacene-13-one (TTPO) molecules on flat Au(1 1 1) surfaces. Results show new surface diffusion characteristics including a strong preference for the molecule to align its long axis parallel to the sixfold Au(1 1 1) symmetry directions and subsequently diffuse along these close-packed directions, and a calculated activation energy for diffusion of 0.142 eV, about four times larger than that for pure pentacene on Au. The temperature-dependent diffusion coefficients were calculated to help quantify the molecular mobility during the experimentally observed process of forming self-assembled monolayers on gold electrodes.
Surface diffusion studies by optical diffraction techniques
International Nuclear Information System (INIS)
Xiao, X.D.
1992-11-01
The newly developed optical techniques have been combined with either second harmonic (SH) diffraction or linear diffraction off a monolayer adsorbate grating for surface diffusion measurement. Anisotropy of surface diffusion of CO on Ni(l10) was used as a demonstration for the second harmonic dim reaction method. The linear diffraction method, which possesses a much higher sensitivity than the SH diffraction method, was employed to study the effect of adsorbate-adsorbate interaction on CO diffusion on Ni(l10) surface. Results showed that only the short range direct CO-CO orbital overlapping interaction influences CO diffusion but not the long range dipole-dipole and CO-NI-CO interactions. Effects of impurities and defects on surface diffusion were further explored by using linear diffraction method on CO/Ni(110) system. It was found that a few percent S impurity can alter the CO diffusion barrier height to a much higher value through changing the Ni(110) surface. The point defects of Ni(l10) surface seem to speed up CO diffusion significantly. A mechanism with long jumps over multiple lattice distance initiated by CO filled vacancy is proposed to explain the observed defect effect
Semiconductor surface diffusion: Nonthermal effects of photon illumination
International Nuclear Information System (INIS)
Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E. G.
2000-01-01
Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally. Activation energies and pre-exponential factors for diffusion of germanium, indium, and antimony on silicon change by up to 0.3 eV and two orders of magnitude, respectively, in response to illumination by photons having energies greater than the substrate band gap. The parameters decrease for n-type material and increase for p-type material. Aided by results from photoreflectance spectroscopy, we suggest that motion of the surface quasi-Fermi-level for minority carriers accounts for much of the effect by changing the charge states of surface vacancies. An additional adatom-vacancy complexation mechanism appears to operate on p-type substrates. The results have significant implications for aspects of microelectronics fabrication by rapid thermal processing that are governed by surface mobility. (c) 2000 The American Physical Society
Tracer surface diffusion on UO2
International Nuclear Information System (INIS)
Zhou, S.Y.; Olander, D.R.
1983-06-01
Surface diffusion on UO 2 was measured by the spreading of U-234 tracer on the surface of a duplex diffusion couple consisting of wafers of depleted and enriched UO 2 joined by a bond of uranium metal
Diffusion and surface alloying of gradient nanostructured metals
Directory of Open Access Journals (Sweden)
Zhenbo Wang
2017-03-01
Full Text Available Gradient nanostructures (GNSs have been optimized in recent years for desired performance. The diffusion behavior in GNS metals is crucial for understanding the diffusion mechanism and relative characteristics of different interfaces that provide fundamental understanding for advancing the traditional surface alloying processes. In this paper, atomic diffusion, reactive diffusion, and surface alloying processes are reviewed for various metals with a preformed GNS surface layer. We emphasize the promoted atomic diffusion and reactive diffusion in the GNS surface layer that are related to a higher interfacial energy state with respect to those in relaxed coarse-grained samples. Accordingly, different surface alloying processes, such as nitriding and chromizing, have been modified significantly, and some diffusion-related properties have been enhanced. Finally, the perspectives on current research in this field are discussed.
Active colloidal propulsion over a crystalline surface
Choudhury, Udit; Straube, Arthur V.; Fischer, Peer; Gibbs, John G.; Höfling, Felix
2017-12-01
We study both experimentally and theoretically the dynamics of chemically self-propelled Janus colloids moving atop a two-dimensional crystalline surface. The surface is a hexagonally close-packed monolayer of colloidal particles of the same size as the mobile one. The dynamics of the self-propelled colloid reflects the competition between hindered diffusion due to the periodic surface and enhanced diffusion due to active motion. Which contribution dominates depends on the propulsion strength, which can be systematically tuned by changing the concentration of a chemical fuel. The mean-square displacements (MSDs) obtained from the experiment exhibit enhanced diffusion at long lag times. Our experimental data are consistent with a Langevin model for the effectively two-dimensional translational motion of an active Brownian particle in a periodic potential, combining the confining effects of gravity and the crystalline surface with the free rotational diffusion of the colloid. Approximate analytical predictions are made for the MSD describing the crossover from free Brownian motion at short times to active diffusion at long times. The results are in semi-quantitative agreement with numerical results of a refined Langevin model that treats translational and rotational degrees of freedom on the same footing.
Diffusion processes in bombardment-induced surface topography
International Nuclear Information System (INIS)
Robinson, R.S.
1984-01-01
A treatment is given of the problem of surface diffusion processes occurring during surface topography development, whenever a surface is simultaneously seeded with impurities and ion bombarded. The development of controllable topography and the importance of surface diffusion parameters, which can be obtained during these studies, are also analyzed. 101 refs.; 7 figs.; 2 tabs
Modifying glass surfaces via internal diffusion
DEFF Research Database (Denmark)
Smedskjaer, M.M.; Yue, Y.Z.; Deubener, J.
2010-01-01
leads to outward diffusion (OD) of divalent cations (primarily Mg2+), i.e., diffusion from the interior of the glass to the surface, and thereby, to formation of an oxide surface nano-layer. in contrast, when the glasses are heat-treated in H-2/N-2 gas containing 10 vol.% H-2, reduction of Fe3+ to Fe2...... on some properties such as hardness, chemical durability, and surface wettability....
Plasma diffusion in systems with disrupted magnetic surfaces
International Nuclear Information System (INIS)
Morozov, D.K.; Pogutse, O.P.
1982-01-01
Plasma diffusion is analyzed in the case in which the system of magnetic surfaces is disrupted by a stochastic perturbation of the magnetic field. The diffusion coefficient is related to the statistical properties of the field. The statistical characteristics of the field are found when the magnetic surfaces near the separatrix are disrupted by an external perturbation. The diffusion coefficient is evaluated in the region in which the magnetic surfaces are disrupted. In this region the diffusion coefficient is of the Bohm form
Reactive solid surface morphology variation via ionic diffusion.
Sun, Zhenchao; Zhou, Qiang; Fan, Liang-Shih
2012-08-14
In gas-solid reactions, one of the most important factors that determine the overall reaction rate is the solid morphology, which can be characterized by a combination of smooth, convex and concave structures. Generally, the solid surface structure varies in the course of reactions, which is classically noted as being attributed to one or more of the following three mechanisms: mechanical interaction, molar volume change, and sintering. Here we show that if a gas-solid reaction involves the outward ionic diffusion of a solid-phase reactant then this outward ionic diffusion could eventually smooth the surface with an initial concave and/or convex structure. Specifically, the concave surface is filled via a larger outward diffusing surface pointing to the concave valley, whereas the height of the convex surface decreases via a lower outward diffusion flux in the vertical direction. A quantitative 2-D continuum diffusion model is established to analyze these two morphological variation processes, which shows consistent results with the experiments. This surface morphology variation by solid-phase ionic diffusion serves to provide a fourth mechanism that supplements the traditionally acknowledged solid morphology variation or, in general, porosity variation mechanisms in gas-solid reactions.
SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS
M. R. Monazzam
2006-01-01
Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers) on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier wa...
Effect of strain on surface diffusion and nucleation
DEFF Research Database (Denmark)
Brune, Harald; Bromann, Karsten; Röder, Holger
1995-01-01
The influence of strain on diffusion and nucleation has been studied by means of scanning tunneling microscopy and effective-medium theory for Ag self-diffusion on strained and unstrained (111) surfaces. Experimentally, the diffusion barrier is observed to be substantially lower on a pseudomorphic...... effect on surface diffusion and nucleation in heteroepitaxy and are thus of significance for the film morphology in the kinetic growth regime....
Polymer diffusion in the interphase between surface and solution.
Weger, Lukas; Weidmann, Monika; Ali, Wael; Hildebrandt, Marcus; Gutmann, Jochen Stefan; Hoffmann-Jacobsen, Kerstin
2018-05-22
Total internal reflection fluorescence correlation spectroscopy (TIR-FCS) is applied to study the self-diffusion of polyethylene glycol solutions in the presence of weakly attractive interfaces. Glass coverslips modified with aminopropyl- and propyl-terminated silanes are used to study the influence of solid surfaces on polymer diffusion. A model of three phases of polymer diffusion allows to describe the experimental fluorescence autocorrelation functions. Besides the two-dimensional diffusion of adsorbed polymer on the substrate and three-dimensional free diffusion in bulk solution, a third diffusion time scale is observed with intermediate diffusion times. This retarded three-dimensional diffusion in solution is assigned to long range effects of solid surfaces on diffusional dynamics of polymers. The respective diffusion constants show Rouse scaling (D~N -1 ) indicating a screening of hydrodynamic interactions by the presence of the surface. Hence, the presented TIR-FCS method proves to be a valuable tool to investigate the effect of surfaces on polymer diffusion beyond the first adsorbed polymer layer on the 100 nm length scale.
DEFF Research Database (Denmark)
Hjelt, T.; Vattulainen, Ilpo Tapio
2000-01-01
stiffness. Our primary aim is to consider the role played by chain stiffness and the resulting memory effects in tracer diffusion, and in particular their role in the effective tracer diffusion barrier E-A(T) extracted from the well-known Arrhenius form. We show that the memory effects in tracer diffusion......, for a single diffusing chain, about 20% of E-A(T) arises from temperature variations in the memory effects, while only the remaining part comes from thermally activated chain segment movements. At a finite coverage, the memory contribution in E-A(T) is even larger and is typically about 20%-40%. Further...... of recent experimental work as regards surface diffusion of long DNA molecules on a biological interface. (C) 2000 American Institute of Physics....
Diffusion of zinc into an unpassivated surface of indium phosphide
International Nuclear Information System (INIS)
Budko, T.O.; Gushchinskaya, E.V.; Emelyanenko, Yu.S.; Malyshev, S.A.
1989-01-01
Peculiarities are studied of the diffusion of Zn into an unpassivated surface of InP in an open gasflow system. In the region where the carrier concentration profile is described by an erfc (error function compliment), the diffusion coefficient and activation energy are determined. It is shown that thermal processes cause changes in the charge state of Zn in InP which result in a variation of the carrier profile in the semiconductor. (author)
Chemical diffusion on solid surfaces. Final report
International Nuclear Information System (INIS)
Hudson, J.B.
1980-12-01
The techniques of surface science have been applied to the problem of the measurement of the surface diffusion rate of an adsorbed species over the surface of a chemically dissimilar material. Studies were carried out for hydrogen and nitrogen adatoms on a Ni(100) surface and for silver adatoms on a sapphire surface. Positive results were obtained only for the case of nitrogen on Ni(100). In this system the diffusivity is characterized by the expression D = D 0 exp (/sup -ΔH//RT), with D 0 = 0.25 cm 2 /sec and ΔH = 28kcal/mol
International Nuclear Information System (INIS)
Ku'rpick, Ulrike
2001-01-01
We calculate activation barriers and prefactors for diffusion via hopping on (100), (110), and (111) surfaces of Ni and Cu. The calculations reveal that, when activation barriers decrease there is also a decrease in the prefactors such that the changes in both quantities partly compensate for each other with respect to the diffusivities. Thermodynamic functions which contribute to the prefactors are calculated from local vibrational density of states, showing that mainly entropy contributions control the prefactors. Our method allows one to trace the obtained values back to vibrational properties of the adatoms in both the minimum-energy and transition-state configurations, and enables a physical understanding of why prefactors have certain values
Impurity diffusion, point defect engineering, and surface/interface passivation in germanium
Chroneos, Alexander I.
2012-01-26
In recent years germanium has been emerging as a mainstream material that could have important applications in the microelectronics industry. The principle aim of this study is to review investigations of the diffusion of technologically important p- and n-type dopants as well as surface and interface passivation issues in germanium. The diffusion of impurities in germanium is interrelated to the formation of clusters whenever possible, and possibilities for point defect engineering are discussed in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices. © 2012 by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Friction and diffusion dynamics of adsorbates at surfaces
Fusco, C.
2005-01-01
A theoretical study of the motion of adsorbates (e. g. atoms, molecules or clusters) on solid surfaces is presented, with a focus on surface diffusion and atomic-scale friction. These two phenomena are inextricably linked, because when an atomic or molecular adsorbate diffuses, or is pulled, it
Diffusion processes in bombardment-induced surface topography
International Nuclear Information System (INIS)
Robinson, R.S.
1984-01-01
The bombardment of surfaces with moderate energy ions can lead to the development of various micron-sized surface structures. These structures include ridges, ledges, flat planes, pits and cones. The causal phenomena in the production of these features are sputtering, ion reflection, redeposition of sputtered material, and surface diffusion of both impurity and target-atom species. The authors concentrate on the formation of ion bombardment-induced surface topography wherein surface diffusion is a dominant process. The most thoroughly understood aspect of this topography development is the generation of cone-like structures during sputtering. The formation of cones during sputtering has been attributed to three effects. These are: (1) the presence of asperities, defects, or micro-inclusions in the surface layers, (2) the presence of impurities on the surfaces, and (3) particular crystal orientations. (Auth.)
Extra metal adatom surface diffusion simulation on 1/3 ML Si(111) √3×√3 metal-induced surfaces
International Nuclear Information System (INIS)
Luniakov, Yu V
2013-01-01
A first-principle simulation of the surface diffusion of an extra metal (Me) adatom has been performed on the corresponding 1/3 monolayer (ML) Si(111) √3×√3 Me-induced surfaces. Using the nudged elastic band (NEB) optimization method, the minimum energy paths and the activation energy barrier profiles for all known Me-inducing √3×√3 reconstruction on an Si(111) surface at the 1/3 ML coverage have been obtained and compared with the available experimental data. The activation barrier is shown to depend on the atomic size of the diffusing adatom: the barrier has the highest value for the largest Me adatom, Pb (0.44 eV); lower values for the smaller Me adatoms, Sn (0.36 eV), In (0.22 eV) and Ga (0.13 eV); and the lowest value for the smallest Me adatom, Al (0.08 eV). The Arrhenius pre-exponential factors that were obtained in the harmonic approximation are as large as ∼10 11−13 Hz for all of the investigated surfaces, which supports the single-adatom diffusion model considered here. (paper)
A diffuse radar scattering model from Martian surface rocks
Calvin, W. M.; Jakosky, B. M.; Christensen, P. R.
1987-01-01
Remote sensing of Mars has been done with a variety of instrumentation at various wavelengths. Many of these data sets can be reconciled with a surface model of bonded fines (or duricrust) which varies widely across the surface and a surface rock distribution which varies less so. A surface rock distribution map from -60 to +60 deg latitude has been generated by Christensen. Our objective is to model the diffuse component of radar reflection based on this surface distribution of rocks. The diffuse, rather than specular, scattering is modeled because the diffuse component arises due to scattering from rocks with sizes on the order of the wavelength of the radar beam. Scattering for radio waves of 12.5 cm is then indicative of the meter scale and smaller structure of the surface. The specular term is indicative of large scale surface undulations and should not be causally related to other surface physical properties. A simplified model of diffuse scattering is described along with two rock distribution models. The results of applying the models to a planet of uniform fractional rock coverage with values ranging from 5 to 20% are discussed.
International Nuclear Information System (INIS)
Cousty, J.P.
1981-12-01
In this work, we have studied the influence of atomic structure of crystal surface on surface self-diffusion in the medium temperature range. Two ways are followed. First, we have measured, using a radiotracer method, the self-diffusion coefficient at 820 K (0.6 T melting) on copper surfaces both the structure and the cleanliness of which were stable during the experiment. We have shown that the interaction between mobile surface defects and steps can be studied through measurements of the anisotropy of surface self diffusion. Second, the behavior of an adatom and a surface vacancy is simulated via a molecular dynamics method, on several surfaces of a Lennard Jones crystal. An inventory of possible migration mechanisms of these surface defects has been drawn between 0.35 and 0.45 Tsub(m). The results obtained with both the methods point out the influence of the surface atomic structure in surface self-diffusion in the medium temperature range [fr
Stochastic models for surface diffusion of molecules
Energy Technology Data Exchange (ETDEWEB)
Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)
2014-07-28
We derive a stochastic model for the surface diffusion of molecules, starting from the classical equations of motion for an N-atom molecule on a surface. The equation of motion becomes a generalized Langevin equation for the center of mass of the molecule, with a non-Markovian friction kernel. In the Markov approximation, a standard Langevin equation is recovered, and the effect of the molecular vibrations on the diffusion is seen to lead to an increase in the friction for center of mass motion. This effective friction has a simple form that depends on the curvature of the lowest energy diffusion path in the 3N-dimensional coordinate space. We also find that so long as the intramolecular forces are sufficiently strong, memory effects are usually not significant and the Markov approximation can be employed, resulting in a simple one-dimensional model that can account for the effect of the dynamics of the molecular vibrations on the diffusive motion.
Self-diffusion on copper surfaces
DEFF Research Database (Denmark)
Hansen, L.; Stoltze, Per; Jacobsen, Karsten Wedel
1991-01-01
The diffusion paths and activation energies of a Cu adatom on Cu(100), Cu(111), and Cu(110) are studied using the effective-medium theory to calculate the energetics. For the (100) and (110) faces, diffusion via an exchange mechanism is found to be important. The transition state for these paths ...
Temperature Activated Diffusion of Radicals through Ion Implanted Polymers
DEFF Research Database (Denmark)
Wakelin, Edgar A.; Davies, Michael J.; Bilek, Marcela M. M.
2015-01-01
Plasma immersion ion implantation (PIII) is a promising technique for immobilizing biomolecules on the surface of polymers. Radicals generated in a subsurface layer by PIII treatment diffuse throughout the substrate, forming covalent bonds to molecules when they reach the surface. Understanding...... to the surface. The model makes useful predictions for the lifetime over which the surface is sufficiently active to covalently immobilize biomolecules and it can be used to determine radical fluence during biomolecule incubation for a range of storage and incubation temperatures so facilitating selection...
Thermal Diffusion Processes in Metal-Tip-Surface Interactions: Contact Formation and Adatom Mobility
DEFF Research Database (Denmark)
Sørensen, Mads Reinholdt; Jacobsen, Karsten Wedel; Jonsson, Hannes
1996-01-01
and the surface can occur by a sequence of atomic hop and exchange processes which become active on a millisecond time scale when the tip is about 3-5 Angstrom from the surface. Adatoms on the surface are stabilized by the presence of the tip and energy barriers for diffusion processes in the region under the tip......We have carried out computer simulations to identify and characterize various thermally activated atomic scale processes that can play an important role in room temperature experiments where a metal tip is brought close to a metal surface. We find that contact formation between the tip...
Radiation induced diffusion as a method to protect surface
International Nuclear Information System (INIS)
Baumvol, I.J.R.
1980-01-01
Radiation induced diffusion forms a coating adeherent and without interface on the surface of metalic substrates. This coating improves the behaviour of metal to corrosion and abrasion. The effect of radiation induced diffusion of tin and calcium on pure iron surface is described and analyzed in this work. (author) [pt
Diffusion accessibility as a method for visualizing macromolecular surface geometry.
Tsai, Yingssu; Holton, Thomas; Yeates, Todd O
2015-10-01
Important three-dimensional spatial features such as depth and surface concavity can be difficult to convey clearly in the context of two-dimensional images. In the area of macromolecular visualization, the computer graphics technique of ray-tracing can be helpful, but further techniques for emphasizing surface concavity can give clearer perceptions of depth. The notion of diffusion accessibility is well-suited for emphasizing such features of macromolecular surfaces, but a method for calculating diffusion accessibility has not been made widely available. Here we make available a web-based platform that performs the necessary calculation by solving the Laplace equation for steady state diffusion, and produces scripts for visualization that emphasize surface depth by coloring according to diffusion accessibility. The URL is http://services.mbi.ucla.edu/DiffAcc/. © 2015 The Protein Society.
Controlled surface diffusion in plasma-enhanced chemical vapor deposition of GaN nanowires
International Nuclear Information System (INIS)
Hou, W C; Hong, Franklin Chau-Nan
2009-01-01
This study investigates the growth of GaN nanowires by controlling the surface diffusion of Ga species on sapphire in a plasma-enhanced chemical vapor deposition (CVD) system. Under nitrogen-rich growth conditions, Ga has a tendency to adsorb on the substrate surface diffusing to nanowires to contribute to their growth. The significance of surface diffusion on the growth of nanowires is dependent on the environment of the nanowire on the substrate surface as well as the gas phase species and compositions. Under nitrogen-rich growth conditions, the growth rate is strongly dependent on the surface diffusion of gallium, but the addition of 5% hydrogen in nitrogen plasma instantly diminishes the surface diffusion effect. Gallium desorbs easily from the surface by reaction with hydrogen. On the other hand, under gallium-rich growth conditions, nanowire growth is shown to be dominated by the gas phase deposition, with negligible contribution from surface diffusion. This is the first study reporting the inhibition of surface diffusion effects by hydrogen addition, which can be useful in tailoring the growth and characteristics of nanowires. Without any evidence of direct deposition on the nanowire surface, gallium and nitrogen are shown to dissolve into the catalyst for growing the nanowires at 900 deg. C.
Energy Technology Data Exchange (ETDEWEB)
Han, Zongying [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Union Research Center of Fuel Cell, School of Chemical and Environmental Engineering, China University of Mining and Technology, Beijing 100083 (China); Chen, Haipeng [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Zhou, Shixue, E-mail: zhoushixue66@163.com [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China)
2017-02-01
Highlights: • Clarify the effect of vacancy defect on H{sub 2} dissociation on Mg (0001) surface. • Demonstrate the effects of vacancy defect on H atom diffusion. • Reveal the minimum energy diffusion path of H atom from magnesium surface into bulk. - Abstract: First-principles calculations with the density functional theory (DFT) have been carried out to study dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces. Results show that energy barriers of 1.42 eV and 1.28 eV require to be overcome for H{sub 2} dissociation on defect-free and vacancy defective Mg (0001) surfaces respectively, indicating that reactivity of Mg (0001) surface is moderately increased due to vacancy defect. Besides, the existence of vacancy defect changes the preferential H atom diffusion entrance to the subsurface and reduces the diffusion energy barrier. An interesting remark is that the minimum energy diffusion path of H atom from magnesium surface into bulk is a spiral channel formed by staggered octahedral and tetrahedral interstitials. The diffusion barriers computed for H atom penetration from the surface into inner-layers are all less than 0.70 eV, which is much smaller than the activation energy for H{sub 2} dissociation on the Mg (0001) surface. This suggests that H{sub 2} dissociation is more likely than H diffusion to be rate-limiting step for magnesium hydrogenation.
Gold Cluster Diffusion Kinetics on Stoichiometric and Reduced Surfaces of Rutile TiO 2 (110)
Energy Technology Data Exchange (ETDEWEB)
Goldman, Nir; Browning, Nigel D.
2011-06-16
Gold clusters on rutile TiO2 are known to serve as efficient oxidation catalysts for pollutants and environmental contaminants. However, the mechanism by which highly mobile small clusters migrate and aggregate into larger species relevant to gold’s catalytic activity remains unresolved. We report herein on ab initio simulations of the diffusion of atomic gold clusters up to the trimer on rutile TiO2(110) surfaces. We show that, on the stoichiometric surface, both the dimer and the trimer can exhibit relatively low surface mobility due to high energetic barriers for diffusion out of their energetic minima coupled with low barriers for the reverse motion. On the reduced surface, these clusters can diffuse relatively quickly between energetic minima within the oxygen vacancy site due to the large degree of vibrational entropy in their transition states. Our computed diffusion times provide a point of comparison for future experiments and will aid in development of models of gold cluster island sintering.
A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface
Energy Technology Data Exchange (ETDEWEB)
Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India)
2016-08-15
In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.
A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface
Naderi, Ebadollah; Ghaisas, S. V.
2016-08-01
In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.
A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface
International Nuclear Information System (INIS)
Naderi, Ebadollah; Ghaisas, S. V.
2016-01-01
In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.
Diffusion of particles adsorbed on reconstructive surface
Czech Academy of Sciences Publication Activity Database
Tarasenko A., Nataliya; Tarasenko, Alexander; Jastrabík, Lubomír
2005-01-01
Roč. 11, č. 1 (2005), s. 485-489 ISSN 0929-5607 R&D Projects: GA MŠk LN00A015 Institutional research plan: CEZ:AV0Z10100522 Keywords : lattice gas * surface reconstruction * surface diffusion * phase transitions Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.323, year: 2005
Transient Convection, Diffusion, and Adsorption in Surface-Based Biosensors
DEFF Research Database (Denmark)
Hansen, Rasmus; Bruus, Henrik; Callisen, Thomas H.
2012-01-01
This paper presents a theoretical and computational investigation of convection, diffusion, and adsorption in surface-based biosensors. In particular, we study the transport dynamics in a model geometry of a surface plasmon resonance (SPR) sensor. The work, however, is equally relevant for other...... microfluidic surface-based biosensors, operating under flow conditions. A widely adopted approximate quasi-steady theory to capture convective and diffusive mass transport is reviewed, and an analytical solution is presented. An expression of the Damköhler number is derived in terms of the nondimensional...... concentration to the maximum surface capacity is critical for reliable use of the quasi-steady theory. Finally, our results provide users of surface-based biosensors with a tool for correcting experimentally obtained adsorption rate constants....
A desk study of surface diffusion and mass transport in clay
International Nuclear Information System (INIS)
Cook, A.J.
1988-09-01
The concept of a geological barrier to radionuclide migration from theoretical radioactive waste repositories has drawn attention to the physico-chemical properties of clays, which are traditionally regarded as retarding media. This report addresses the different mechanisms of transport of radionuclides through clay and in particular focuses on the surface diffusion movement of sorbed cations. The relative contributory importance of the different transport mechanisms is governed by the pore size distributions and interconnections within the clay fabric. Surface diffusion data in the literature have been from experiments using compacted montmorillonite and biotite gneiss. A possible programme of laboratory work is outlined, based on diffusion experiments, which describes the way of measuring the effect of surface diffusion more accurately in clays, mudstones and shales. (author)
Carmody, Onuma; Frost, Ray L; Kristóf, János; Kokot, Serge; Kloprogge, J Theo; Makó, Eva
2006-12-01
Studies of kaolinite surfaces are of industrial importance. One useful method for studying the changes in kaolinite surface properties is to apply chemometric analyses to the kaolinite surface infrared spectra. A comparison is made between the mechanochemical activation of Kiralyhegy kaolinites with significant amounts of natural quartz and the mechanochemical activation of Zettlitz kaolinite with added quartz. Diffuse reflectance infrared Fourier transform (DRIFT) spectra were analyzed using principal component analysis (PCA) and multi-criteria decision making (MCDM) methods, the preference ranking organization method for enrichment evaluations (PROMETHEE) and geometrical analysis for interactive assistance (GAIA). The clear discrimination of the Kiralyhegy spectral objects on the two PC scores plots (400-800 and 800-2030 cm(-1)) indicated the dominance of quartz. Importantly, no ordering of any spectral objects appeared to be related to grinding time in the PC plots of these spectral regions. Thus, neither the kaolinite nor the quartz are systematically responsive to grinding time according to the spectral criteria investigated. The third spectral region (2600-3800 cm(-1), OH vibrations), showed apparent systematic ordering of the Kiralyhegy and, to a lesser extent, Zettlitz spectral objects with grinding time. This was attributed to the effect of the natural quartz on the delamination of kaolinite and the accompanying phenomena (i.e., formation of kaolinite spheres and water). The mechanochemical activation of kaolinite and quartz, through dry grinding, results in changes to the surface structure. Different grinding times were adopted to study the rate of destruction of the kaolinite and quartz structures. This relationship (i.e., grinding time) was classified using PROMETHEE and GAIA methodology.
International Nuclear Information System (INIS)
Shah, Syed Islamuddin; Nandipati, Giridhar; Rahman, Talat S; Karim, Altaf
2016-01-01
We studied self-diffusion of small two-dimensional Ag islands, containing up to ten atoms, on the Ag(111) surface using self-learning kinetic Monte Carlo (SLKMC) simulations. Activation barriers are calculated using the semi-empirical embedded atom method (EAM) potential. We find that two- to seven-atom islands primarily diffuse via concerted translation processes with small contributions from multi-atom and single-atom processes, while eight- to ten-atom islands diffuse via single-atom processes, especially edge diffusion, corner rounding and kink detachment, along with a minimal contribution from concerted processes. For each island size, we give a detailed description of the important processes, and their activation barriers, responsible for its diffusion. (paper)
Atomic diffusion in laser surface modified AISI H13 steel
Aqida, S. N.; Brabazon, D.; Naher, S.
2013-07-01
This paper presents a laser surface modification process of AISI H13 steel using 0.09 and 0.4 mm of laser spot sizes with an aim to increase surface hardness and investigate elements diffusion in laser modified surface. A Rofin DC-015 diffusion-cooled CO2 slab laser was used to process AISI H13 steel samples. Samples of 10 mm diameter were sectioned to 100 mm length in order to process a predefined circumferential area. The parameters selected for examination were laser peak power, pulse repetition frequency (PRF), and overlap percentage. The hardness properties were tested at 981 mN force. Metallographic study and energy dispersive X-ray spectroscopy (EDXS) were performed to observe presence of elements and their distribution in the sample surface. Maximum hardness achieved in the modified surface was 1017 HV0.1. Change of elements composition in the modified layer region was detected in the laser modified samples. Diffusion possibly occurred for C, Cr, Cu, Ni, and S elements. The potential found for increase in surface hardness represents an important method to sustain tooling life. The EDXS findings signify understanding of processing parameters effect on the modified surface composition.
International Nuclear Information System (INIS)
Hwang, J.C.M.; Pan, J.D.; Balluffi, R.W.
1979-01-01
Grain-boundary diffusion rates in the gold-silver system were measured at relatively low temperatures by the surface-accumulation method which was analyzed in Paper I. The specimen was a polycrystalline gold film possessing columnar grains on which a silver layer was initially deposited epitaxially on one surface. During subsequent low-temperature annealing lattice diffusion was frozen out, and diffusion then occurred along the grain boundary and free-surface short circuits. The silver, therefore, diffused into the film from the silver layer along the boundaries, eventually reaching the opposite surface where it accumulated and was measured by Auger spectroscopy. The silver layer acted as an effective constant silver source, and grain-boundary diffusivities were calculated from the accumulation data. However, the exact location of the effective constant source in the silver layer could not be determined and this led to an uncertainty in the values of the grain-boundary diffusivities of a factor of 10. Lower- and upper-bound values were therefore described by D/sub b/(lower bound) =7.8 x 10 -6 exp(-0.62eV/kT) and D/sub b/(upper bound) =7.8 x 10 -5 exp(-0.62eV/kT) cm 2 /s in the temperature range 30--269 0 C. An examination of available grain-boundary diffusion data (including the present) suggests a tendency for the observed activation energy to decrease with decreasing temperature, and this was ascribed to a spectrum of activated jumps in the grain boundary and/or a spectrum of grain-boundary types in the specimen employed. The constant source behavior was tentatively ascribed, at least in part, to a grain-boundary ''Kirkendall effect'' resulting from the faster diffusion of silver than gold. The work indicates a need for increased understanding of the details of grain-boundary diffusion in alloys
International Nuclear Information System (INIS)
Vree, C; Mayr, S G
2010-01-01
The impact of free surfaces on the mobility and conformational fluctuations of model polymer chains is investigated with the help of classical molecular dynamics simulations over a broad temperature range. Below a critical temperature, T*, similar to the critical temperature of the mode coupling theory, the center-of-mass displacements and temporal fluctuations of the radius of gyration of individual chains-as a fingerprint of structural reconfigurations-reveal a strong enhancement close to surfaces, while this effect diminishes with increasing temperature and observation time. Interpreting conformational fluctuations as a random walk in conformational space, identical activation enthalpies for structural reconfigurations and diffusion are obtained within the error bars in the bulk and at the surfaces, thus indicating a coupling of diffusive and conformational dynamics.
Bulk-mediated surface diffusion: non-Markovian desorption dynamics
International Nuclear Information System (INIS)
Revelli, Jorge A; Budde, Carlos E; Prato, Domingo; Wio, Horacio S
2005-01-01
Here we analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework, when the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption as well as its motion in the bulk is governed by Markovian dynamics. We study the diffusion of particles in both semi-infinite and finite cubic lattices, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The results are compared with known Markovian cases showing the differences that can be exploited to distinguish between Markovian and non-Markovian desorption mechanisms in experimental situations
Energy Technology Data Exchange (ETDEWEB)
Kono, Hitoshi; Fujimoto, Akira; Nakano, Hiroshi
1988-03-31
In recent years, in order to attain a total quantity regulation of air pollution and to prepare a local air-control program, a diffusion simulation is often made using a Gaussian plume model. NOx diffusion simulation of the urban area was carried out using a vertical diffusion width by taking a parameter of ground-surface roughness using Smith's correction to the Gaussian model. For the diffusion of car exhaust gas, comparison was made for the estimate and the measurement by jointly using the values of ground-surface roughness and the initial diffusion width. As a result, change in the diffusion width of the car exhaust gas due to the urban buildings was expressed at a necessary practical level by giving the height of the point of calculation, 1 - 3 m in the central part and 30 cm at the peripheral part, and giving the initial diffusion width of roughly half to equal size of initial diffusion width to the average height of the buildings. (2 figs, 8 tabs, 20 refs)
A thermal spike analysis of low energy ion activated surface processes
International Nuclear Information System (INIS)
Gilmore, G.M.; Haeri, A.; Sprague, J.A.
1989-01-01
This paper reports a thermal spike analysis utilized to predict the time evolution of energy propagation through a solid resulting from energetic particle impact. An analytical solution was developed that can predict the number of surface excitations such as desorption, diffusion or chemical reaction activated by an energetic particle. The analytical solution is limited to substrates at zero Kelvin and to materials with constant thermal diffusivities. These limitations were removed by developing a computer numerical integration of the propagation of the thermal spike through the solid and the subsequent activation of surface processes
Diffusion of N adatoms on the Fe(100) surface
DEFF Research Database (Denmark)
Pedersen, M. Ø.; Österlund, L.; Mortensen, Jens Jørgen
2000-01-01
The diffusion of individual N adatoms on Fe(100) has been studied using scanning tunneling microscopy and ab initio density functional theory (DFT) calculations. The measured diffusion barrier for isolated N adatoms is E-d = (0.92 +/- 0.04) eV, with a prefactor of nu(0) = 4.3 x 10(12) s(-1), which...... is in quantitative agreement with the DFT calculations. Thr; diffusion is strongly coupled to lattice distortions. and. as a consequence, the presence of other N adatoms introduces an anisotropy in the diffusion. Based on experimentally determined values of the diffusion barriers and adsorbate......-adsorbate: interactions, the potential energy surface experienced by a N adatom is determined....
Directory of Open Access Journals (Sweden)
Ivan E Collier
Full Text Available Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 can initiate (MT1-MMP and complete (MMP-2 degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 represents a Mobile Cell Surface-Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions.
Molecular dynamics simulation of nanoscale surface diffusion of heterogeneous adatoms clusters
International Nuclear Information System (INIS)
Imran, Muhammad; Hussain, Fayyaz; Ullah, Hafeez; Ahmad, Ejaz; Rashid, Muhammad; Ismail, Muhammad; Cai, Yongqing; Javid, M Arshad; Ahmad, S A
2016-01-01
Molecular dynamics simulation employing the embedded atom method potential is utilized to investigate nanoscale surface diffusion mechanisms of binary heterogeneous adatoms clusters at 300 K, 500 K, and 700 K. Surface diffusion of heterogeneous adatoms clusters can be vital for the binary island growth on the surface and can be useful for the formation of alloy-based thin film surface through atomic exchange process. The results of the diffusion process show that at 300 K, the diffusion of small adatoms clusters shows hopping, sliding, and shear motion; whereas for large adatoms clusters (hexamer and above), the diffusion is negligible. At 500 K, small adatoms clusters, i.e., dimer, show almost all possible diffusion mechanisms including the atomic exchange process; however no such exchange is observed for adatoms clusters greater than dimer. At 700 K, the exchange mechanism dominates for all types of clusters, where Zr adatoms show maximum tendency and Ag adatoms show minimum or no tendency toward the exchange process. Separation and recombination of one or more adatoms are also observed at 500 K and 700 K. The Ag adatoms also occupy pop-up positions over the adatoms clusters for short intervals. At 700 K, the vacancies are also generated in the vicinity of the adatoms cluster, vacancy formation, filling, and shifting can be observed from the results. (paper)
Shukla-Spatschek diffusion effects on surface plasma waves in astrophysical turbulent plasmas
Lee, Myoung-Jae; Jung, Young-Dae
2017-02-01
The effects of Shukla-Spatschek turbulent diffusion on a temporal mode of surface waves propagating at the interface of an astrophysical turbulent plasma are investigated. The damping rates for high and low modes of surface wave are kinetically derived by employing the Vlasov-Poisson equation and the specular reflection boundary condition. We found that the diffusion caused by the fluctuating electric fields leads to damping for both high and low modes of surface waves. The high-mode damping is enhanced with an increase of the wavenumber and the diffusion coefficient, but suppressed by an increase of electron thermal energy. By contrast, the low-mode damping is suppressed as the wavenumber and the thermal energy increase although it is enhanced as the diffusion increases. The variation of the damping rate due to the Shukla-Spatschek turbulent diffusion is also discussed.
Cholesterol enhances surface water diffusion of phospholipid bilayers
Energy Technology Data Exchange (ETDEWEB)
Cheng, Chi-Yuan; Kausik, Ravinath; Han, Songi, E-mail: songi@chem.ucsb.edu [Department of Chemistry and Biochemistry and Materials Research Laboratory, University of California, Santa Barbara, California 93106 (United States); Olijve, Luuk L. C. [Laboratory of Macromolecular and Organic Chemistry and Institute for Complex Molecular Systems, Eindhoven University of Technology, P.O. Box 513, 5600 MB, Eindhoven (Netherlands)
2014-12-14
Elucidating the physical effect of cholesterol (Chol) on biological membranes is necessary towards rationalizing their structural and functional role in cell membranes. One of the debated questions is the role of hydration water in Chol-embedding lipid membranes, for which only little direct experimental data are available. Here, we study the hydration dynamics in a series of Chol-rich and depleted bilayer systems using an approach termed {sup 1}H Overhauser dynamic nuclear polarization (ODNP) NMR relaxometry that enables the sensitive and selective determination of water diffusion within 5–10 Å of a nitroxide-based spin label, positioned off the surface of the polar headgroups or within the nonpolar core of lipid membranes. The Chol-rich membrane systems were prepared from mixtures of Chol, dipalmitoyl phosphatidylcholine and/or dioctadecyl phosphatidylcholine lipid that are known to form liquid-ordered, raft-like, domains. Our data reveal that the translational diffusion of local water on the surface and within the hydrocarbon volume of the bilayer is significantly altered, but in opposite directions: accelerated on the membrane surface and dramatically slowed in the bilayer interior with increasing Chol content. Electron paramagnetic resonance (EPR) lineshape analysis shows looser packing of lipid headgroups and concurrently tighter packing in the bilayer core with increasing Chol content, with the effects peaking at lipid compositions reported to form lipid rafts. The complementary capability of ODNP and EPR to site-specifically probe the hydration dynamics and lipid ordering in lipid membrane systems extends the current understanding of how Chol may regulate biological processes. One possible role of Chol is the facilitation of interactions between biological constituents and the lipid membrane through the weakening or disruption of strong hydrogen-bond networks of the surface hydration layers that otherwise exert stronger repulsive forces, as reflected in
A theoretical study of hydrogen atoms adsorption and diffusion on PuO_2 (110) surface
International Nuclear Information System (INIS)
Yu, H.L.; Tang, T.; Zheng, S.T.; Shi, Y.; Qiu, R.Z.; Luo, W.H.; Meng, D.Q.
2016-01-01
The mechanisms of adsorption and diffusion of hydrogen atoms on the PuO_2 (110) surface are investigated by density functional theory corrected for onsite Coulombic interactions (GGA + U). In order to find out the energetically more favorable adsorption site and optimum diffusion path, adsorption energy of atomic H on various sites and the diffusion energy barrier are derived and compared. Our results show that both chemisorption and physisorption exist for H atoms adsorption configurations on PuO_2 (110) surface. Two processes for H diffusion are investigated using the climbing nudged-elastic-band (cNEB) approach. We have identified two diffusion mechanisms, leading to migration of atomic H on the surface and diffusion from surface to subsurface. The energy barriers indicate that it is energetically more favorable for H atom to be on the surface. Hydrogen permeation through purity PuO_2 surface is mainly inhibited from hydrogen atom diffusion from surface to subsurface. - Highlights: • H atoms adsorption on PuO_2 (110) surface are investigated by GGA + U. • Both chemisorption and physisorption exist for H atoms adsorption configurations. • H atoms migration into PuO_2 (100) surface are inhibited with the barrier of 2.15 eV. • H atoms diffusion on PuO_2 (110) surface are difficult at room temperature.
Cleaning of niobium surface by plasma of diffuse discharge at atmospheric pressure
Tarasenko, V. F.; Erofeev, M. V.; Shulepov, M. A.; Ripenko, V. S.
2017-07-01
Elements composition of niobium surface before and after plasma treatment by runaway electron preionized diffuse discharge was investigated in atmospheric pressure nitrogen flow by means of an Auger electron spectroscopy. Surface characterizations obtained from Auger spectra show that plasma treatment by diffuse discharge after exposure of 120000 pulses provides ultrafine surface cleaning from carbon contamination. Moreover, the surface free energy of the treated specimens increased up to 3 times, that improve its adhesion property.
Classically exact surface diffusion constants at arbitrary temperature
International Nuclear Information System (INIS)
Voter, A.F.; Cohen, J.M.
1989-01-01
An expression is presented for computing the classical diffusion constant of a point defect (e.g., an adatom) in an infinite lattice of binding sites at arbitrary temperature. The transition state theory diffusion constant is simply multiplied by a dynamical correction factor that is computed from short-time classical trajectories initiated at the site boundaries. The time scale limitations of direct molecular dynamics are thus avoided in the low- and middle-temperature regimes. The expression results from taking the time derivative of the particle mean-square displacement in the lattice-discretized coordinate system. Applications are presented for surface diffusion on fcc(100) and fcc(111) Lennard-Jones crystal faces
Collier, Ivan E.; Legant, Wesley; Marmer, Barry; Lubman, Olga; Saffarian, Saveez; Wakatsuki, Tetsuro; Elson, Elliot; Goldberg, Gregory I.
2011-01-01
Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 can initiate (MT1-MMP) and complete (MMP-2) degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP) hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 represents a Mobile Cell Surface – Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions. PMID:21912660
Marquardt, Katharina; Dohmen, Ralf; Wagner, Johannes
2014-05-01
Diffusion along interface and grain boundaries provides an efficient pathway and may control chemical transport in rocks as well as their mechanical strength. Besides the significant relevance of these diffusion processes for various geologic processes, experimental data are still very limited (e.g., Dohmen & Milke, 2010). Most of these data were measured using polycrystalline materials and the formalism of LeClaire (1951) to fit integrated concentration depth profiles. To correctly apply this formalism, certain boundary conditions of the diffusion problem need to be fulfilled, e.g., surface diffusion is ignored, and furthermore the lattice diffusion coefficient has to be known from other studies or is an additional fitting parameter, which produces some ambiguity in the derived grain boundary diffusion coefficients. We developed an experimental setup where we can measure the lattice and grain boundary diffusion coefficients simultaneously but independent and demonstrate the relevance of surface diffusion for typical grain boundary diffusion experiments. We performed Mg2SiO4 bicrystal diffusion experiments, where a single grain boundary is covered by a thin-film of pure Ni2SiO4 acting as diffusant source, produced by pulsed laser deposition. The investigated grain boundary is a 60° (011)/[100]. This specific grain boundary configuration was modeled using molecular dynamics for comparison with the experimental observations in the transmission electron microscope (TEM). Both, experiment and model are in good agreement regarding the misorientation, whereas there are still some disagreements regarding the strain fields along the grain boundary that are of outmost importance for the strengths of the material. The subsequent diffusion experiments were carried out in the temperature range between 800° and 1450° C. The inter diffusion profiles were measured using the TEMs energy dispersive x-ray spectrometer standardized using the Cliff-Lorimer equation and EMPA
Nuclear surface diffuseness revealed in nucleon-nucleus diffraction
Hatakeyama, S.; Horiuchi, W.; Kohama, A.
2018-05-01
The nuclear surface provides useful information on nuclear radius, nuclear structure, as well as properties of nuclear matter. We discuss the relationship between the nuclear surface diffuseness and elastic scattering differential cross section at the first diffraction peak of high-energy nucleon-nucleus scattering as an efficient tool in order to extract the nuclear surface information from limited experimental data involving short-lived unstable nuclei. The high-energy reaction is described by a reliable microscopic reaction theory, the Glauber model. Extending the idea of the black sphere model, we find one-to-one correspondence between the nuclear bulk structure information and proton-nucleus elastic scattering diffraction peak. This implies that we can extract both the nuclear radius and diffuseness simultaneously, using the position of the first diffraction peak and its magnitude of the elastic scattering differential cross section. We confirm the reliability of this approach by using realistic density distributions obtained by a mean-field model.
International Nuclear Information System (INIS)
Valderrama, C.; Gamisans, X.; Heras, X. de las; Farran, A.; Cortina, J.L.
2008-01-01
Granular activated carbon (GAC) was evaluated as a suitable sorbent for polycyclic aromatic hydrocarbons (PAHs) removal from aqueous solutions. For this purpose, kinetic measurements on the extraction of a family of six PAHs were taken. A morphology study was performed by means of a scanning electron microscopy (SEM) analysis of GAC samples. Analyses of the batch rate data for each PAH were carried out using two kinetic models: the homogenous particle diffusion model (HPDM) and the shell progressive model (SPM). The process was controlled by diffusion rate the solutes (PAHs) that penetrated the reacted layer at PAH concentrations in the range of 0.2-10 mg L -1 . The effective particle diffusion coefficients (D eff ) derived from the two models were determined from the batch rate data. The Weber and Morris intraparticle diffusion model made a double contribution to the surface and pore diffusivities in the sorption process. The D eff values derived from both the HPMD and SPM equations varied from 1.1 x 10 -13 to 6.0 x 10 -14 m 2 s -1 . The simplest model, the pore diffusion model, was applied first for data analysis. The model of the next level of complexity, the surface diffusion model, was applied in order to gain a deeper understanding of the diffusion process. This model is able to explain the data, and the apparent surface diffusivities are in the same order of magnitude as the values for the sorption of functionalized aromatic hydrocarbons (phenols and sulphonates) that are described in the literature
Passive Frequency Selective Surface Array as a Diffuser for Destroying Millimeter Wave Coherence
Directory of Open Access Journals (Sweden)
Saiful Islam
2008-01-01
Full Text Available This paper presents the design, construction, and testing of grounded frequency selective surface (FSS array as a diffuser for destroying millimeter wave coherence which is used to eliminate speckle in active millimeter wave imaging. To create stochastically independent illumination patterns, we proposed a diffuser based on random-phase distributions obtained by changing the incident frequency. The random-phase diffuser was obtained by mixing up the phase relations between the cells of a deterministic function (e.g., beam splitter. The slot length of FSS is the main design parameter used to optimize the phase shifting properties of the array. The critical parameters of the diffuser array design, such as phase relation with slot lengths, losses, and bandwidth, are discussed. We designed the FSS arrays with finite integral technique (FIT, fabricated by etching technique, and characterized the S-parameters with a free-space MVNA, and measured the radiation patterns with a BWO in motorized setup.
The Role of Lattice Vibrations in Adatom Diffusion at Metal Stepped Surfaces
International Nuclear Information System (INIS)
Durakanoglu, S.
2004-01-01
Diffusion of a single atom on metal surfaces remains a subject of continuing interest in the surface science community because of the important role it plays in several technologically important phenomena such as thin-film and eptaxial growth, catalysis and chemical reactions. Except for a few studies, most of theoretical works, ranging from molecular dynamic simulations to first principle electronic structure calculations, are devoted to determination of the characteristics of the diffusion processes and the energy barriers, neglecting the contribution of lattice vibrations in adatom diffusion. However, in a series of theoretical works on self-diffusion on the flat surfaces of Cu(100), Ag(100) and Ni(100), Ulrike et al.[1-3], showed that the vibrational contributions are important and should be included in any complete description of the temperature dependence of the diffusion coefficient. In this work, it is our aim to examine the role of lattice vibrations in adatom diffusion at stepped surfaces of Cu(100) and Ni(100) within the framework of transition state theory. Ehrlich-Shwoebel energy barriers for an adatom diffusing over a step-edge are calculated through the inclusion of vibrational internal energy. Local vibrational density of states, main ingredient to the vibrational thermodynamic functions, are calculated in the harmonic approximation, using real space Green's function method with the force constants derived from interaction potentials based on the embedded atom method. We emphasize the sensitivity of the local vibrational density of states to the local atomic environment. We, furthermore, discuss the contribution of thermodynamic functions calculated from local vibrational density of states to the prefactors in diffusion coefficient
Chu, Khim Hoong
2017-11-09
Surface diffusion coefficients may be estimated by fitting solutions of a diffusion model to batch kinetic data. For non-linear systems, a numerical solution of the diffusion model's governing equations is generally required. We report here the application of the classic Langmuir kinetics model to extract surface diffusion coefficients from batch kinetic data. The use of the Langmuir kinetics model in lieu of the conventional surface diffusion model allows derivation of an analytical expression. The parameter estimation procedure requires determining the Langmuir rate coefficient from which the pertinent surface diffusion coefficient is calculated. Surface diffusion coefficients within the 10 -9 to 10 -6 cm 2 /s range obtained by fitting the Langmuir kinetics model to experimental kinetic data taken from the literature are found to be consistent with the corresponding values obtained from the traditional surface diffusion model. The virtue of this simplified parameter estimation method is that it reduces the computational complexity as the analytical expression involves only an algebraic equation in closed form which is easily evaluated by spreadsheet computation.
Surface diffusion of carbon atom and carbon dimer on Si(0 0 1) surface
International Nuclear Information System (INIS)
Zhu, J.; Pan, Z.Y.; Wang, Y.X.; Wei, Q.; Zang, L.K.; Zhou, L.; Liu, T.J.; Jiang, X.M.
2007-01-01
Carbon (C) atom and carbon dimer (C2) are known to be the main projectiles in the deposition of diamond-like carbon (DLC) films. The adsorption and diffusion of the C adatom and addimer (C2) on the fully relaxed Si(0 0 1)-(2 x 1) surface was studied by a combination of the molecular dynamics (MD) and Monte Carlo (MC) simulation. The adsorption sites of the C and C2 on the surface and the potential barriers between these sites were first determined using the semi-empirical many-body Brenner and Tersoff potential. We then estimated their hopping rates and traced their pathways. It is found that the diffusion of both C and C2 is strongly anisotropic in nature. In addition, the C adatom can diffuse a long distance on the surface while the adsorbed C2 is more likely to be confined in a local region. Thus we can expect that smoother films will be formed on the Si(0 0 1) surface with single C atoms as projectile at moderate temperature, while with C2 the films will grow in two-dimensional islands. In addition, relatively higher kinetic energy of the projectile, say, a few tens of eV, is needed to grow DLC films of higher quality. This is consistent with experimental findings
Self-diffusion dynamic behavior of atomic clusters on Re(0 0 0 1) surface
Energy Technology Data Exchange (ETDEWEB)
Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu, E-mail: wangyuhu2001cn@yahoo.com.cn [Department of Applied Physics, Hunan University, Changsha 410082 (China); Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)
2009-08-15
Using molecular dynamics simulations and a modified analytic embedded atom potential, the self-diffusion dynamics of rhenium atomic clusters up to seven atoms on Re(0 0 0 1) surface have been studied in the temperature ranges from 600 K to 1900 K. The simulation time varies from 20 ns to 200 ns according to the cluster sizes and the temperature. The heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center, and diffusion prefactors D{sub 0} and activation energies E{sub a} are derived from the Arrhenius relation. It is found that the Arrhenius relation of the adatom can be divided into two parts at different temperature range. The activation energy of clusters increases with the increasing of the atom number in clusters. The prefactor of the heptamer is 2-3 orders of magnitude higher than a usual prefactor because of a large number of nonequivalent diffusion processes. The trimer and heptamer are the nuclei at different temperature range according to the nucleation theory.
Jump rates for surface diffusion of large molecules from first principles
Energy Technology Data Exchange (ETDEWEB)
Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)
2015-04-21
We apply a recently developed stochastic model for the surface diffusion of large molecules to calculate jump rates for 9,10-dithioanthracene on a Cu(111) surface. The necessary input parameters for the stochastic model are calculated from first principles using density functional theory (DFT). We find that the inclusion of van der Waals corrections to the DFT energies is critical to obtain good agreement with experimental results for the adsorption geometry and energy barrier for diffusion. The predictions for jump rates in our model are in excellent agreement with measured values and show a marked improvement over transition state theory (TST). We find that the jump rate prefactor is reduced by an order of magnitude from the TST estimate due to frictional damping resulting from energy exchange with surface phonons, as well as a rotational mode of the diffusing molecule.
New sensitive micro-measurements of dynamic surface tension and diffusion coefficients
DEFF Research Database (Denmark)
Kinoshita, Koji; Ortiz, Elisa Parra; Needham, David
2017-01-01
Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain “dead time” at initial measurement....... These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the “micropipette interfacial area-expansion method” was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion...... for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2 ± 0.8 × 10−6 cm2/s, showed excellent agreement with the result from an alternative method, “single microdroplet catching method”, to measure the diffusion coefficient from diffusion-controlled microdroplet...
A surface diffuse scattering model for the mobility of electrons in surface charge coupled devices
International Nuclear Information System (INIS)
Ionescu, M.
1977-01-01
An analytical model for the mobility of electrons in surface charge coupled devices is studied on the basis of the results previously obtained, considering a surface diffuse scattering; the importance of the results obtained for a better understanding of the influence of the fringing field in surface charge coupled devices is discussed. (author)
International Nuclear Information System (INIS)
Abraham, P.M.; Chandra, D.; Mintz, J.M.; Elleman, T.S.; Verghese, K.
1976-01-01
Major results of tritium and rare gas diffusion research conducted under the contract are summarized. The materials studied were austenitic stainless steels, Zircaloy, and niobium. In all three of the metal systems investigated, tritium release rates were found to be inhibited by surface oxide films. The effective diffusion coefficients that control tritium release from surface films on Zircaloy and niobium were determined to be eight to ten orders of magnitude lower than the bulk diffusion coefficients. A rapid component of diffusion due to grain boundaries was identified in stainless steels. The grain boundary diffusion coefficient was determined to be about six orders of magnitude greater than the bulk diffusion coefficient for tritium in stainless steel. In Zircaloy clad fuel pins, the permeation rate of tritium through the cladding is rate-limited by the extremely slow diffusion rate in the surface films. Tritium diffusion rates through surface oxide films on niobium appear to be controlled by cracks in the surface films at temperatures up to 600 0 C. Beyond 600 0 C, the cracks appear to heal, thereby increasing the activation energy for diffusion through the oxide film. The steady-state diffusion of tritium in a fusion reactor blanket has been evaluated in order to calculate the equilibrium tritium transport rate, approximate time to equilibrium, and tritium inventory in various regions of the reactor blanket as a function of selected blanket parameters. Values for these quantities have been tabulated
Diffuse Surface Scattering in the Plasmonic Resonances of Ultralow Electron Density Nanospheres.
Monreal, R Carmina; Antosiewicz, Tomasz J; Apell, S Peter
2015-05-21
Localized surface plasmon resonances (LSPRs) have recently been identified in extremely diluted electron systems obtained by doping semiconductor quantum dots. Here, we investigate the role that different surface effects, namely, electronic spill-out and diffuse surface scattering, play in the optical properties of these ultralow electron density nanosystems. Diffuse scattering originates from imperfections or roughness at a microscopic scale on the surface. Using an electromagnetic theory that describes this mechanism in conjunction with a dielectric function including the quantum size effect, we find that the LSPRs show an oscillatory behavior in both position and width for large particles and a strong blue shift in energy and an increased width for smaller radii, consistent with recent experimental results for photodoped ZnO nanocrystals. We thus show that the commonly ignored process of diffuse surface scattering is a more important mechanism affecting the plasmonic properties of ultralow electron density nanoparticles than the spill-out effect.
Coupling between diffusion and orientation of pentacene molecules on an organic surface.
Rotter, Paul; Lechner, Barbara A J; Morherr, Antonia; Chisnall, David M; Ward, David J; Jardine, Andrew P; Ellis, John; Allison, William; Eckhardt, Bruno; Witte, Gregor
2016-04-01
The realization of efficient organic electronic devices requires the controlled preparation of molecular thin films and heterostructures. As top-down structuring methods such as lithography cannot be applied to van der Waals bound materials, surface diffusion becomes a structure-determining factor that requires microscopic understanding. Scanning probe techniques provide atomic resolution, but are limited to observations of slow movements, and therefore constrained to low temperatures. In contrast, the helium-3 spin-echo (HeSE) technique achieves spatial and time resolution on the nm and ps scale, respectively, thus enabling measurements at elevated temperatures. Here we use HeSE to unveil the intricate motion of pentacene admolecules diffusing on a chemisorbed monolayer of pentacene on Cu(110) that serves as a stable, well-ordered organic model surface. We find that pentacene moves along rails parallel and perpendicular to the surface molecules. The experimental data are explained by admolecule rotation that enables a switching between diffusion directions, which extends our molecular level understanding of diffusion in complex organic systems.
Investigation of ion diffusion towards plasmonic surfaces
International Nuclear Information System (INIS)
Gmucova, K.; Nadazdy, V.; Vojtko, A.; Majkova, E.; Kotlar, M.
2013-01-01
Plasmonic sensors have recently attracted much attention. The past few decades have seen a massive and continued interest in studying electrochemical processes at artificially structured electrodes. Such electrochemical sensors provide sensitive, selective, and easy to use approaches to the detection of many chemical species, e.g. environmental pollutants, biomolecules, drugs etc. The issue raised in this paper is to study the kinetic of the diffusion towards plasmonic surfaces in dark and under illumination with white LED diode. The possibility to use anomalous charge transfer towards plasmonic surfaces in electrochemical sensorics will be discussed, too. (authors)
On the diffusion and self-trapping of surface dimers
Kappus, W.
1982-03-01
The theory of elastic interactions between surface atoms which are caused by substrate strains is applied to the interaction of dimers on the (211) surface of tungsten. From the comparison of theoretical and experimental interactions which were derived from the diffusion behaviour of dimers, conclusions are drawn on the nature of the adatom-substrate bond.
Energy Technology Data Exchange (ETDEWEB)
Eriksen, T.E.; Jansson, Mats [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Nuclear Chemistry
1996-11-01
The diffusion of I, Cs and Sr ions in bentonite compacted to a dry density of 1.8 gr/cm{sup 3} and saturated with two groundwaters of different ionic strength have been studied experimentally using the through diffusion technique. The I{sup -} diffusivity and diffusion porosity were found to be concentration independent in the concentration range exp(-8) to exp(-2) mol/dm{sup 3}. The diffusion porosity, being only a fraction of the water porosity for normal groundwaters, is strongly ionic strength dependent due to anion exclusion. The dependence of the diffusion of Cs{sup +} and Sr{sup 2+} on the sorption intensity is accommodated by a model encompassing diffusion of the sorbed cations within the electrical double layer next to the mineral surface in addition to diffusion in the pore water. 18 refs, 12 figs.
Convergence of surface diffusion parameters with model crystal size
Cohen, Jennifer M.; Voter, Arthur F.
1994-07-01
A study of the variation in the calculated quantities for adatom diffusion with respect to the size of the model crystal is presented. The reported quantities include surface diffusion barrier heights, pre-exponential factors, and dynamical correction factors. Embedded atom method (EAM) potentials were used throughout this effort. Both the layer size and the depth of the crystal were found to influence the values of the Arrhenius factors significantly. In particular, exchange type mechanisms required a significantly larger model than standard hopping mechanisms to determine adatom diffusion barriers of equivalent accuracy. The dynamical events that govern the corrections to transition state theory (TST) did not appear to be as sensitive to crystal depth. Suitable criteria for the convergence of the diffusion parameters with regard to the rate properties are illustrated.
Diffusion of particles on a fluctuating surface
Czech Academy of Sciences Publication Activity Database
Tarasenko, Alexander; Jastrabík, Lubomír
2011-01-01
Roč. 29, č. 5 (2011), s. 487-494 ISSN 0263-6174 R&D Projects: GA AV ČR KAN301370701; GA MŠk(CZ) 1M06002 Institutional research plan: CEZ:AV0Z10100522 Keywords : kinetic Monte Carlo simulations * diffusion on a fluctuating surface Subject RIV: BH - Optics, Masers, Lasers Impact factor: 0.606, year: 2011
Collisional diffusion in a torus with imperfect magnetic surfaces
International Nuclear Information System (INIS)
White, R.B.
1983-03-01
A Hamiltonian forumlation of the guiding-center drift equations is used to investigate the modification of neoclassical diffusion for low collisonality in a toroidal magnetic field with partially destroyed magnetic surfaces. The magnetic field is assumed to be given by the small perturbation of an axisymmetric system. The results are applicable to particle diffusion in realistic confinement systems, midway between axisymmetric and purely stochastic ones. Significant enhancement of electron diffusion over neoclassical rates is found. This increase can be accounted for by the contributions due to the first few island chains in the Fibonacci sequence generated by the zero-order islands, and by associated stochastic domains
International Nuclear Information System (INIS)
Xu, Guigui; Zhong, Kehua; Zhang, Jian-Min; Huang, Zhigao
2014-01-01
We present a first-principles calculation for the electronic and Li-ion diffusion properties of the LiFePO 4 (010) surface modified by sulfur. The calculated formation energy indicates that the sulfur adsorption on the (010) surface of the LiFePO 4 is energetically favored. Sulfur is found to form Fe-S bond with iron. A much narrower band gap (0.67 eV) of the sulfur surface-modified LiFePO 4 [S-LiFePO 4 (010)] is obtained, indicating the better electronic conductive properties. By the nudged elastic band method, our calculations show that the activation energy of Li ions diffusion along the one-dimensional channel on the surface can be effectively reduced by sulfur surface modification. In addition, the surface diffusion coefficient of S-LiFePO 4 (010) is estimated to be about 10 −11 (cm 2 /s) at room temperature, which implies that sulfur modification will give rise to a higher Li ion carrier mobility and enhanced electrochemical performance
Plateau diffusion coefficient for arbitrary flux surface geometry
International Nuclear Information System (INIS)
Meier, H.K.; Hirshman, S.P.; Sigmar, D.J.; Lao, L.L.
1981-03-01
A relatively simple but accurate representation has been developed for magnetic flux surfaces; it is valid for finite β and it describes configurations with both ellipticity and D-shape. This representation has been applied to the computation of the diffusion coefficient in the plateau regime
A new approach to the problem of bulk-mediated surface diffusion.
Berezhkovskii, Alexander M; Dagdug, Leonardo; Bezrukov, Sergey M
2015-08-28
This paper is devoted to bulk-mediated surface diffusion of a particle which can diffuse both on a flat surface and in the bulk layer above the surface. It is assumed that the particle is on the surface initially (at t = 0) and at time t, while in between it may escape from the surface and come back any number of times. We propose a new approach to the problem, which reduces its solution to that of a two-state problem of the particle transitions between the surface and the bulk layer, focusing on the cumulative residence times spent by the particle in the two states. These times are random variables, the sum of which is equal to the total observation time t. The advantage of the proposed approach is that it allows for a simple exact analytical solution for the double Laplace transform of the conditional probability density of the cumulative residence time spent on the surface by the particle observed for time t. This solution is used to find the Laplace transform of the particle mean square displacement and to analyze the peculiarities of its time behavior over the entire range of time. We also establish a relation between the double Laplace transform of the conditional probability density and the Fourier-Laplace transform of the particle propagator over the surface. The proposed approach treats the cases of both finite and infinite bulk layer thicknesses (where bulk-mediated surface diffusion is normal and anomalous at asymptotically long times, respectively) on equal footing.
Surface self-diffusion behavior of individual tungsten adatoms on rhombohedral clusters
International Nuclear Information System (INIS)
Yang Jianyu; Hu Wangyu; Tang Jianfeng
2011-01-01
The diffusion of single tungsten adatoms on the surfaces of rhombohedral clusters is studied by means of molecular dynamics and the embedded atom method. The energy barriers for the adatom diffusing across and along the step edge between a {110} facet and a neighboring {110} facet are calculated using the nudged elastic band method. We notice that the tungsten adatom diffusion across the step edge has a much higher barrier than that for face-centered cubic metal clusters. The result shows that diffusion from the {110} facet to a neighboring {110} facet could not take place at low temperatures. In addition, the calculated energy barrier for an adatom diffusing along the step edge is lower than that for an adatom on the flat (110) surface. The results show that the adatom could diffuse easily along the step edge, and could be trapped by the facet corner. Taking all of this evidence together, we infer that the {110} facet starts to grow from the facet corner, and then along the step edge, and finally toward the {110} facet center. So the tungsten rhombohedron can grow epitaxially along the {110} facet one facet at a time and the rhombohedron should be the stable structure for both large and small tungsten clusters. (paper)
Dynamics diffusion behaviors of Pd small clusters on a Pd(1 1 1) surface
International Nuclear Information System (INIS)
Liu, Fusheng; Hu, Wangyu; Deng, Huiqiu; He, Rensheng; Yang, Xiyuan; Lu, Kuilin; Deng, Lei; Luo, Wenhua
2010-01-01
Using molecular dynamics, nudged elastic band and modified analytic embedded atom methods, the self-diffusion dynamics properties of palladium atomic clusters up to seven atoms on the Pd (1 1 1) surface have been studied at temperatures ranging from 300 to 1000 K. The simulation time varies from 20 to 75 ns according to the cluster sizes and the temperature ranges. The heptamer and trimer are more stable than the other neighboring clusters. The diffusion coefficients of the clusters are derived from the mean square displacement of the cluster's mass-center, and the diffusion prefactors D 0 and activation energies E a are derived from the Arrhenius relation. The activation energy of the clusters increases with the increasing atom number in the clusters, especially for Pd 6 to Pd 7 . The analysis of trajectories shows the noncompact clusters diffuse by the local diffusion mechanism but the compact clusters diffuse mainly by the whole gliding mechanism, and some static energy barriers of the diffusion modes are calculated. From Pd 2 to Pd 6 , the prefactors are in the range of the standard value 10 −3 cm 2 s −1 , and the prefactor of Pd 7 cluster is 2 orders of magnitude greater than that of the single Pd adatom because of a large number of nonequivalent diffusion processes. The heptamer can be the nucleus in the room temperature range according to nucleation theory
NTERACTION BETWEEN SURFACE CHARGE PHENOMENA AND MULTI-SPECIES DIFFUSION IN CEMENT BASED MATERIALS
DEFF Research Database (Denmark)
Johannesson, Björn
2008-01-01
Measurements strongly indicate that the ‘inner’ surface of the microscopic structure of cement based materials has a fixed negative charge. This charge contributes to the formation of so-called electrical double layers. In the case of cement based materials the ionic species located in such layers...... are typically potassium -, sodium - and calcium ions. Due to the high specific surface area of hydrated cement, a large amount of ions can be located in theses double layers even if the surface charge is relatively low. The attraction force, caused by the fixed surface charge on ions located close to surfaces......, is one possible explanation for the observed low global diffusion rates in the pore system of positively charged ions compared to the negatively charged ones. Here it is of interest to simulate the multi ionic diffusion behavior when assigning positively charged ions a comparably lower diffusion constant...
M. C. Sagis, Leonard
2001-03-01
In this paper, we develop a theory for the calculation of the surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. The theory is valid for systems in hydrodynamic equilibrium, with zero mass-averaged velocities in the bulk and interfacial regions. We restrict our attention to systems with isotropic bulk phases, and an interfacial region that is isotropic in the plane parallel to the dividing surface. The dividing surface is assumed to be a simple interface, without memory effects or yield stresses. We derive an expression for the surface diffusion coefficient in terms of two parameters of the interfacial region: the coefficient for plane-parallel diffusion D (AB)aa(ξ) , and the driving force d(B)I||(ξ) . This driving force is the parallel component of the driving force for diffusion in the interfacial region. We derive an expression for this driving force using the entropy balance.
Dimer-flipping-assisted diffusion on a Si(001) surface
International Nuclear Information System (INIS)
Zi, J.; Min, B. J.; Lu, Y.; Wang, C. Z.; Ho, K. M.
2000-01-01
The binding sites and diffusion pathways of Si adatoms on a c(4x2) reconstructed Si(001) surface are investigated by a tight-binding method with an environment-dependent silicon potential in conjunction with ab initio calculations using the Car--Parrinello method. A new diffusion pathway along the trough edge driven by dimer flipping is found with a barrier of 0.74 eV, comparable to that of 0.68 eV along the top of the dimer rows
Effect of surface characteristics on diffuse reflection radiation at lambda=0. 40. mu. m
Energy Technology Data Exchange (ETDEWEB)
Takashima, T [Atmospheric Environment Service, Downsview, Ontario (Canada)
1976-08-01
The diffuse radiation in the upward direction at the top and at an internal level of an inhomogeneous atmosphere is computed at lambda=0.40 ..mu..m. The surface is assumed to reflect light in accordance with a hybrid mode of a diffuse and specular reflector. The objective is to estimate the effect of underlying surface characteristics in terms of the diffuse radiation field. By making use of these results, accuracy in monitoring the atmospheric aerosols would be increased for the use of remote sensing satellite techniques. Junge power law (..gamma..*=3) is adopted for the size distribution of aerosols (1963), while the data given by McClatchy et al. (1971) is used for the number density of aerosols with height distribution. It is noted from the computations that the diffuse reflection radiation is affected by the surface characteristics, even if the albedo of the surface is a fixed constant and very small.
Nitrogen diffusion in near-surface range of ion doped molybdenum
Zamalin, E Y
2001-01-01
The dynamics of change in nitrogen near-the-surface concentration in the Mo ion-alloyed monocrystalline foil is studied through the Auger-electron spectroscopy and the secondary ion mass spectrometry. The implantation dose constituted 5 x 10 sup 1 sup 7 ion/cm sup 2 and the implantation energy equaled 50 and 100 keV. The samples diffusion annealing was performed at the temperature of 800-900 deg C. The evaluation of the nitrogen diffusion coefficient indicates the values by 3-5 orders lesser than the diffusion coefficient in the nitrogen solid-state solution in the molybdenum. At the same time the molybdenum self-diffusion coefficient value is by 3-5 orders lesser as compared to the obtained value. The supposition is made, the the surplus nitrogen relative to the solubility limit is deposited on the radiation defects and in the process of the diffusion annealing it nitrates together with them
Li, Xiaofan; Nie, Qing
2009-01-01
Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratu...
Fielitz, Peter; Borchardt, Günter
2016-08-10
In the dedicated literature the oxygen surface exchange coefficient KO and the equilibrium oxygen exchange rate [Fraktur R] are considered to be directly proportional to each other regardless of the experimental circumstances. Recent experimental observations, however, contradict the consequences of this assumption. Most surprising is the finding that the apparent activation energy of KO depends dramatically on the kinetic regime in which it has been determined, i.e. surface exchange controlled vs. mixed or diffusion controlled. This work demonstrates how the diffusion boundary condition at the gas/solid interface inevitably entails a correlation between the oxygen surface exchange coefficient KO and the oxygen self-diffusion coefficient DO in the bulk ("on top" of the correlation between KO and [Fraktur R] for the pure surface exchange regime). The model can thus quantitatively explain the range of apparent activation energies measured in the different regimes: in the surface exchange regime the apparent activation energy only contains the contribution of the equilibrium exchange rate, whereas in the mixed or in the diffusion controlled regime the contribution of the oxygen self-diffusivity has also to be taken into account, which may yield significantly higher apparent activation energies and simultaneously quantifies the correlation KO ∝ DO(1/2) observed for a large number of oxides in the mixed or diffusion controlled regime, respectively.
Transient enhanced diffusion in preamorphized silicon: the role of the surface
Cowern, N. E. B.; Alquier, D.; Omri, M.; Claverie, A.; Nejim, A.
1999-01-01
Experiments on the depth dependence of transient enhanced diffusion (TED) of boron during rapid thermal annealing of Ge-preamorphized layers reveal a linear decrease in the diffusion enhancement between the end-of-range (EOR) defect band and the surface. This behavior, which indicates a quasi-steady-state distribution of excess interstitials, emitted from the EOR band and absorbed at the surface, is observed for annealing times as short as 1 s at 900°C. Using an etching procedure we vary the distance xEOR from the EOR band to the surface in the range 80-175 nm, and observe how this influences the interstitial supersaturation, s( x). The supersaturations at the EOR band and the surface remain unchanged, while the gradient d s/d x, and thus the flux to the surface, varies inversely with xEOR. This confirms the validity of earlier modelling of EOR defect evolution in terms of Ostwald ripening, and provides conclusive evidence that the surface is the dominant sink for interstitials during TED.
Modelisation de la diffusion sur les surfaces metalliques: De l'adatome aux processus de croissance
Boisvert, Ghyslain
Cette these est consacree a l'etude des processus de diffusion en surface dans le but ultime de comprendre, et de modeliser, la croissance d'une couche mince. L'importance de bien mai triser la croissance est primordiale compte tenu de son role dans la miniaturisation des circuits electroniques. Nous etudions ici les surface des metaux nobles et de ceux de la fin de la serie de transition. Dans un premier temps, nous nous interessons a la diffusion d'un simple adatome sur une surface metallique. Nous avons, entre autres, mis en evidence l'apparition d'une correlation entre evenements successifs lorsque la temperature est comparable a la barriere de diffusion, i.e., la diffusion ne peut pas etre associee a une marche aleatoire. Nous proposons un modele phenomenologique simple qui reproduit bien les resultats des simulations. Ces calculs nous ont aussi permis de montrer que la diffusion obeit a la loi de Meyer-Neldel. Cette loi stipule que, pour un processus active, le prefacteur augmente exponentiellement avec la barriere. En plus, ce travail permet de clarifier l'origine physique de cette loi. En comparant les resultats dynamiques aux resultats statiques, on se rend compte que la barriere extraite des calculs dynamiques est essentiellement la meme que celle obtenue par une approche statique, beaucoup plus simple. On peut donc obtenir cette barriere a l'aide de methodes plus precises, i.e., ab initio, comme la theorie de la fonctionnelle de la densite, qui sont aussi malheureusement beaucoup plus lourdes. C'est ce que nous avons fait pour plusieurs systemes metalliques. Nos resultats avec cette derniere approche se comparent tres bien aux resultats experimentaux. Nous nous sommes attardes plus longuement a la surface (111) du platine. Cette surface regorge de particularites interessantes, comme la forme d'equilibre non-hexagonale des i lots et deux sites d'adsorption differents pour l'adatome. De plus, des calculs ab initio precedents n'ont pas reussi a confirmer la
Inward Cationic Diffusion and Formation of Silica-Rich Surface Nanolayer of Glass
DEFF Research Database (Denmark)
Smedskjær, Morten Mattrup; Deubener, Joachim; Yue, Yuanzheng
2009-01-01
form and are incorporated into the glass structure. Both the V4+ and the hydroxyl contents increase with increasing ta and hydrogen partial pressure. The inward diffusion enhances the hardness of the glass surface. The mechanism of the inward diffusion is suggested on the basis of a model describing...
Diffusion of C and Cr During Creation of Surface Layer on Cast Steel Casting
Directory of Open Access Journals (Sweden)
Szajnar J.
2014-10-01
Full Text Available In paper a method of improvement in utility properties of unalloyed cast steel casting in result of diffusion of C and Cr in process of creation of surface layer is presented. The aim of paper was determination of diffusion range of basic elements of alloyed surface layer. Moreover a quantitative analysis of carbides phase strengthens alloyed surface layer of casting was carried out. The results of studies shown that important factors of surface layer creation are maximal temperature Tmax on granular insert – cast steel boundary dependent of pouring temperature, granularity Zw of Fe-Cr-C alloy insert and thickness of casting wall gśo. On the basis of obtained results was affirmed that with increase of thickness of casting wall increases range of diffusion in solid state in Fe-Cr-C grains and in liquid state. Moreover the range of Tmax = 13001500oC favours creation of the proper alloyed surface layers on cast steel.
Carbon out-diffusion mechanism for direct graphene growth on a silicon surface
International Nuclear Information System (INIS)
Kim, Byung-Sung; Lee, Jong Woon; Jang, Yamujin; Choi, Soon Hyung; Cha, Seung Nam; Sohn, Jung Inn; Kim, Jong Min; Joo, Won-Jae; Hwang, Sungwoo; Whang, Dongmok
2015-01-01
Direct growth of graphene on silicon (Si) through chemical vapor deposition has predominantly focused on surface-mediated processes due to the low carbon (C) solubility in Si. However, a considerable quantity of C atoms was incorporated in Si and formed Si 1−x C x alloy with a reduced lattice dimension even in the initial stage of direct graphene growth. Subsequent high temperature annealing promoted active C out-diffusion, resulting in the formation of a graphitic layer on the Si surface. Furthermore, the significantly low thermal conductivity of the Si 1−x C x alloy shows that the incorporated C atoms affect the properties of a semiconductor adjacent to the graphene. These findings provide a key guideline for controlling desirable properties of graphene and designing hybrid semiconductor/graphene architectures for various applications
International Nuclear Information System (INIS)
Singha, Somdutta; Sarkar, Ujjaini; Luharuka, Pallavi
2013-01-01
Cr(VI) is present in the aqueous medium as chromate (CrO 4 2− ) and bi-chromate (HCrO 4 − ). Functionalized granular activated carbons (FACs) are used as adsorbents in the treatment of wastewaters containing hexavalent chromium. The FACs are prepared by chemical modifications of granular activated carbons (GACs) using functionalizing agents like HNO 3 , HCl and HF. The Brunauer, Emmett and Teller surface areas of FAC-HCl (693.5 m 2 /g), FAC-HNO 3 (648.8 m 2 /g) and FAC-HF (726.2 m 2 /g) are comparable to the GAC (777.7 m 2 /g). But, the adsorption capacity of each of the FAC-HNO 3 , FAC-HCl and FAC-HF is found to be higher than the GAC. The functional groups play an important role in the adsorption process and pH has practically no role in this specific case. The FACs have hydrophilic protonated external surfaces in particular, along with the functional surface sites capable to make complexes with the CrO 4 2− and HCrO 4 − present. Surface complex formation is maximized in the order FAC-HNO 3 > FAC-HF > FAC-HCl, in proportion to the total surface acidity. This is also confirmed by the well-known pseudo second-order kinetic model. Physi-sorption equilibrium isotherms are parameterized by using standard Freundlich and Langmuir models. Langmuir fits better. The formation of surface complexes with the functional groups and hexavalent chromium is also revealed in the images of field emission scanning electron micrograph; energy dispersive X-ray spectroscopy and Fourier transform infrared spectroscopy analysis after adsorption. The intra-particle diffusion is not the only rate-controlling factor. The Boyd's film diffusion model fits very well with R 2 as high as 98.1% for FAC-HNO 3 . This result demonstrates that the functionalization of the GAC by acid treatments would increase the diffusion rate, predominantly with a boundary layer diffusion effect. - Highlights: ► Physico-chemical adsorption using functionalized activated carbon (FACs) is applied. ► FACs
Surface modifications by field induced diffusion.
Directory of Open Access Journals (Sweden)
Martin Olsen
Full Text Available By applying a voltage pulse to a scanning tunneling microscope tip the surface under the tip will be modified. We have in this paper taken a closer look at the model of electric field induced surface diffusion of adatoms including the van der Waals force as a contribution in formations of a mound on a surface. The dipole moment of an adatom is the sum of the surface induced dipole moment (which is constant and the dipole moment due to electric field polarisation which depends on the strength and polarity of the electric field. The electric field is analytically modelled by a point charge over an infinite conducting flat surface. From this we calculate the force that cause adatoms to migrate. The calculated force is small for voltage used, typical 1 pN, but due to thermal vibration adatoms are hopping on the surface and even a small net force can be significant in the drift of adatoms. In this way we obtain a novel formula for a polarity dependent threshold voltage for mound formation on the surface for positive tip. Knowing the voltage of the pulse we then can calculate the radius of the formed mound. A threshold electric field for mound formation of about 2 V/nm is calculated. In addition, we found that van der Waals force is of importance for shorter distances and its contribution to the radial force on the adatoms has to be considered for distances smaller than 1.5 nm for commonly used voltages.
Du, X.; Savich, G. R.; Marozas, B. T.; Wicks, G. W.
2018-02-01
Surface leakage and lateral diffusion currents in InAs-based nBn photodetectors have been investigated. Devices fabricated using a shallow etch processing scheme that etches through the top contact and stops at the barrier exhibited large lateral diffusion current but undetectably low surface leakage. Such large lateral diffusion current significantly increased the dark current, especially in small devices, and causes pixel-to-pixel crosstalk in detector arrays. To eliminate the lateral diffusion current, two different approaches were examined. The conventional solution utilized a deep etch process, which etches through the top contact, barrier, and absorber. This deep etch processing scheme eliminated lateral diffusion, but introduced high surface current along the device mesa sidewalls, increasing the dark current. High device failure rate was also observed in deep-etched nBn structures. An alternative approach to limit lateral diffusion used an inverted nBn structure that has its absorber grown above the barrier. Like the shallow etch process on conventional nBn structures, the inverted nBn devices were fabricated with a processing scheme that only etches the top layer (the absorber, in this case) but avoids etching through the barrier. The results show that inverted nBn devices have the advantage of eliminating the lateral diffusion current without introducing elevated surface current.
Dynamics of an optically confined nanoparticle diffusing normal to a surface.
Schein, Perry; O'Dell, Dakota; Erickson, David
2016-06-01
Here we measure the hindered diffusion of an optically confined nanoparticle in the direction normal to a surface, and we use this to determine the particle-surface interaction profile in terms of the absolute height. These studies are performed using the evanescent field of an optically excited single-mode silicon nitride waveguide, where the particle is confined in a height-dependent potential energy well generated from the balance of optical gradient and surface forces. Using a high-speed cmos camera, we demonstrate the ability to capture the short time-scale diffusion dominated motion for 800-nm-diam polystyrene particles, with measurement times of only a few seconds per particle. Using established theory, we show how this information can be used to estimate the equilibrium separation of the particle from the surface. As this measurement can be made simultaneously with equilibrium statistical mechanical measurements of the particle-surface interaction energy landscape, we demonstrate the ability to determine these in terms of the absolute rather than relative separation height. This enables the comparison of potential energy landscapes of particle-surface interactions measured under different experimental conditions, enhancing the utility of this technique.
Energy Technology Data Exchange (ETDEWEB)
Zhang, C. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Laboratoire de Mecanique des Contacts et des Structures (LaMCoS), INSA Lyon, 20 Avenue des Sciences, F-69621 Villeurbanne Cedex (France); Li, H. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Li, M.Q., E-mail: zc9997242256@126.com [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China)
2016-05-15
Graphical abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural component. A special surface with regular patterns was processed to be joined so as to observe the extent of surface asperity deformation under different applied bonding pressures. Fracture surface characteristic combined with surface roughness profiles distinctly revealed the enhanced surface asperity deformation as the applied pressure increases. The influence of surface asperity deformation mechanism on joint formation was analyzed: (a) surface asperity deformation not only directly expanded the interfacial contact areas, but also released deformation heat and caused defects, indirectly accelerating atomic diffusion, then benefits to void shrinkage; (b) surface asperity deformation readily introduced stored energy difference between two opposite sides of interface grain boundary, resulting in strain induced interface grain boundary migration. In addition, the influence of void on interface grain boundary migration was analyzed in detail. - Highlights: • A high quality hollow structural component has been fabricated by diffusion bonding. • Surface asperity deformation not only expands the interfacial contact areas, but also causes deformation heat and defects to improve the atomic diffusion. • Surface asperity deformation introduces the stored energy difference between the two opposite sides of interface grain boundary, leading to strain induced interface grain boundary migration. • The void exerts a dragging force on the interface grain boundary to retard or stop interface grain boundary migration. - Abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in similar diffusion bonding as well as on the fabrication of high quality martensitic stainless steel hollow structural components. A special surface with regular patterns was processed to be joined so as to
International Nuclear Information System (INIS)
Ferrieri, R.A.; Wolf, A.P.
1984-01-01
A study has been performed on the rate of the translational surface diffusivity of propyne on a silica-alumina-supported Cr(VI) catalyst. This rate was measured via nonchemical acetylene-propyne sorbate interactions coupled with positron annihilation surface detection (PASD). The surface displacement rate of [ 11 C]acetylene by propyne was measured in a transient experiment as a function of the adjacent Cr-site distance and correlated to propyne surface diffusivity, D/sub s/. Results indicated that D/sub s/ increased linearly when the adjacent site distance was decreased for catalysts loaded with between 0.08 and 0.8 wt % of chromium. However, D/sub s/ fell off drastically to nearly zero when greater Cr-site dispersion was achieved at support loadings below 0.08 wt % of chromium. Catalytic selectivity for p-xylene production was also measured as a function of D/sub s/ and was shown to have a strong dependence of its rate. 25 references, 4 figures
Mechanisms of self-diffusion on Pt(110)
DEFF Research Database (Denmark)
Lorensen, Henrik Qvist; Nørskov, Jens Kehlet; Jacobsen, Karsten Wedel
1999-01-01
The self-diffusion of Pt on the missing row reconstructed Pt(110) surface is discussed based on density functional calculations of activation energy barriers. Different competing diffusion mechanisms are considered and we show that several different diffusion paths along the reconstruction troughs...
DEFF Research Database (Denmark)
Mejlbro, Leif
1996-01-01
Fick's Second Law of Diffusion with time-dependent diffusioncoefficient and surface concentration is solved. Mimicking the classicalsolution, special time-dependent surface concentration functions areconsidered. These models are used in giving estimates of the lifetimeof the structure, when...... the concrete cover is given, as well as estimatesof the thickness of the concrete cover, when the expected lifetime is given.*Note: Book tilte: Durability of Concrete in Saline Environment...
Marbán, Gregorio; Ramírez-Montoya, Luis A; García, Héctor; Menéndez, J Ángel; Arenillas, Ana; Montes-Morán, Miguel A
2018-02-01
The adsorption of cytochrome c in water onto organic and carbon xerogels with narrow pore size distributions has been studied by carrying out transient and equilibrium batch adsorption experiments. It was found that equilibrium adsorption exhibits a quasi-Langmuirian behavior (a g coefficient in the Redlich-Peterson isotherms of over 0.95) involving the formation of a monolayer of cyt c with a depth of ∼4nm on the surface of all xerogels for a packing density of the protein inside the pores of 0.29gcm -3 . A load-dependent surface diffusion model (LDSDM) has been developed and numerically solved to fit the experimental kinetic adsorption curves. The results of the LDSDM show better fittings than the standard homogeneous surface diffusion model. The value of the external mass transfer coefficient obtained by numerical optimization confirms that the process is controlled by the intraparticle surface diffusion of cyt c. The surface diffusion coefficients decrease with increasing protein load down to zero for the maximum possible load. The decrease is steeper in the case of the xerogels with the smallest average pore diameter (∼15nm), the limit at which the zero-load diffusion coefficient of cyt c also begins to be negatively affected by interactions with the opposite wall of the pore. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
María I. Vázquez
2015-12-01
Full Text Available Synthesis of a nanoporous alumina membrane (NPAM by the two-step anodization method and its morphological and chemical surface characterization by analyzing Scanning Electron Microscopy (SEM micrographs and X-Ray Photoelectron Spectroscopy (XPS spectra is reported. Influence of electrical and diffusive effects on the NaCl transport across the membrane nanopores is determined from salt diffusion measurements performed with a wide range of NaCl concentrations, which allows the estimation of characteristic electrochemical membrane parameters such as the NaCl diffusion coefficient and the concentration of fixed charges in the membrane, by using an appropriated model and the membrane geometrical parameters (porosity and pore length. These results indicate a reduction of ~70% in the value of the NaCl diffusion coefficient through the membrane pores with respect to solution. The transport number of ions in the membrane pores (Na+ and Cl−, respectively were determined from concentration potential measurements, and the effect of concentration-polarization at the membrane surfaces was also considered by comparing concentration potential values obtained with stirred solutions (550 rpm and without stirring. From both kinds of results, a value higher than 0.05 M NaCl for the feed solution seems to be necessary to neglect the contribution of electrical interactions in the diffusive transport.
Trapping of diffusing particles by striped cylindrical surfaces. Boundary homogenization approach
Dagdug, Leonardo; Berezhkovskii, Alexander M.; Skvortsov, Alexei T.
2015-01-01
We study trapping of diffusing particles by a cylindrical surface formed by rolling a flat surface, containing alternating absorbing and reflecting stripes, into a tube. For an arbitrary stripe orientation with respect to the tube axis, this problem is intractable analytically because it requires dealing with non-uniform boundary conditions. To bypass this difficulty, we use a boundary homogenization approach which replaces non-uniform boundary conditions on the tube wall by an effective uniform partially absorbing boundary condition with properly chosen effective trapping rate. We demonstrate that the exact solution for the effective trapping rate, known for a flat, striped surface, works very well when this surface is rolled into a cylindrical tube. This is shown for both internal and external problems, where the particles diffuse inside and outside the striped tube, at three orientations of the stripe direction with respect to the tube axis: (a) perpendicular to the axis, (b) parallel to the axis, and (c) at the angle of π/4 to the axis. PMID:26093574
Hydrogen activation, diffusion, and clustering on CeO{sub 2}(111): A DFT+U study
Energy Technology Data Exchange (ETDEWEB)
Fernández-Torre, Delia [Departamento de Física Teórica de la Materia Condensada, Universidad Autónoma de Madrid, E-28049 Madrid (Spain); Instituto de Estructura de la Materia, CSIC, C/ Serrano 121, E-28006 Madrid (Spain); Carrasco, Javier [CIC Energigune, Albert Einstein 48, 01510 Miñano, Álava (Spain); Instituto de Catálisis y Petroleoquímica, CSIC, C/ Marie Curie 2, E-28049 Madrid (Spain); Ganduglia-Pirovano, M. Verónica [Instituto de Catálisis y Petroleoquímica, CSIC, C/ Marie Curie 2, E-28049 Madrid (Spain); Pérez, Rubén, E-mail: ruben.perez@uam.es [Departamento de Física Teórica de la Materia Condensada, Universidad Autónoma de Madrid, E-28049 Madrid (Spain); Condensed Matter Physics Center (IFIMAC), Universidad Autónoma de Madrid, E-28049 Madrid (Spain)
2014-07-07
We present a comprehensive density functional theory+U study of the mechanisms underlying the dissociation of molecular hydrogen, and diffusion and clustering of the resulting atomic species on the CeO{sub 2}(111) surface. Contrary to a widely held view based solely on a previous theoretical prediction, our results show conclusively that H{sub 2} dissociation is an activated process with a large energy barrier ∼1.0 eV that is not significantly affected by coverage or the presence of surface oxygen vacancies. The reaction proceeds through a local energy minimum – where the molecule is located close to one of the surface oxygen atoms and the H–H bond has been substantially weaken by the interaction with the substrate –, and a transition state where one H atom is attached to a surface O atom and the other H atom sits on-top of a Ce{sup 4+} ion. In addition, we have explored how several factors, including H coverage, the location of Ce{sup 3+} ions as well as the U value, may affect the chemisorption energy and the relative stability of isolated OH groups versus pair and trimer structures. The trimer stability at low H coverages and the larger upward relaxation of the surface O atoms within the OH groups are consistent with the assignment of the frequent experimental observation by non-contact atomic force and scanning tunneling microscopies of bright protrusions on three neighboring surface O atoms to a triple OH group. The diffusion path of isolated H atoms on the surface goes through the adsorption on-top of an oxygen in the third atomic layer with a large energy barrier of ∼1.8 eV. Overall, the large energy barriers for both, molecular dissociation and atomic diffusion, are consistent with the high activity and selectivity found recently in the partial hydrogenation of acetylene catalyzed by ceria at high H{sub 2}/C{sub 2}H{sub 2} ratios.
Electroless Ni-Mo-P diffusion barriers with Pd-activated self-assembled monolayer on SiO2
International Nuclear Information System (INIS)
Liu Dianlong; Yang Zhigang; Zhang Chi
2010-01-01
Ternary Ni-based amorphous films can serve as a diffusion barrier layer for Cu interconnects in ultralarge-scale integration (ULSI) applications. In this paper, electroless Ni-Mo-P films deposited on SiO 2 layer without sputtered seed layer were prepared by using Pd-activated self-assembled monolayer (SAM). The solutions and operating conditions for pretreatment and deposition were presented, and the formation of Pd-activated SAM was demonstrated by XPS (X-ray photoelectron spectroscopy) analysis and BSE (back-scattered electron) observation. The effects of the concentration of Na 2 MoO 4 added in electrolytes, pH value, and bath temperature on the surface morphology and compositions of Ni-Mo-P films were investigated. The microstructures, diffusion barrier property, electrical resistivity, and adhesion were also examined. Based on the experimental results, the Ni-Mo-P alloys produced by using Pd-activated SAM had an amorphous or amorphous-like structure, and possessed good performance as diffusion barrier layer.
Heat Transfer and Mass Diffusion in Nanofluids over a Moving Permeable Convective Surface
Directory of Open Access Journals (Sweden)
Muhammad Qasim
2013-01-01
Full Text Available Heat transfer and mass diffusion in nanofluid over a permeable moving surface are investigated. The surface exhibits convective boundary conditions and constant mass diffusion. Effects of Brownian motion and thermophoresis are considered. The resulting partial differential equations are reduced into coupled nonlinear ordinary differential equations using suitable transformations. Shooting technique is implemented for the numerical solution. Velocity, temperature, and concentration profiles are analyzed for different key parameters entering into the problem. Performed comparative study shows an excellent agreement with the previous analysis.
Zhan, Hanyu; Voelz, David G.
2016-12-01
The polarimetric bidirectional reflectance distribution function (pBRDF) describes the relationships between incident and scattered Stokes parameters, but the familiar surface-only microfacet pBRDF cannot capture diffuse scattering contributions and depolarization phenomena. We propose a modified pBRDF model with a diffuse scattering component developed from the Kubelka-Munk and Le Hors et al. theories, and apply it in the development of a method to jointly estimate refractive index, slope variance, and diffuse scattering parameters from a series of Stokes parameter measurements of a surface. An application of the model and estimation approach to experimental data published by Priest and Meier shows improved correspondence with measurements of normalized Mueller matrix elements. By converting the Stokes/Mueller calculus formulation of the model to a degree of polarization (DOP) description, the estimation results of the parameters from measured DOP values are found to be consistent with a previous DOP model and results.
DEFF Research Database (Denmark)
Liu, S.J.; Tao, H.Z.; Zhang, Y.F.
2015-01-01
We investigate the sodium inward diffusion (i.e., sodium diffusion from surface toward interior) in iron containing alkaline earth silicate glasses under reducing conditions around Tg and the induced surface crystallization. The surface crystallization is caused by formation of a silicate-gel lay......+ ions have stronger bonds to oxygen and lower coordination number (4~5) than Ca2+, Sr2+ and Ba2+ ions. In contrast, a cristobalite layer forms in Ca-, Sr- and Ba-containing glasses....
Energy Technology Data Exchange (ETDEWEB)
Singha, Somdutta; Sarkar, Ujjaini, E-mail: usarkar@chemical.jdvu.ac.in; Luharuka, Pallavi
2013-03-01
Cr(VI) is present in the aqueous medium as chromate (CrO{sub 4}{sup 2−}) and bi-chromate (HCrO{sub 4}{sup −}). Functionalized granular activated carbons (FACs) are used as adsorbents in the treatment of wastewaters containing hexavalent chromium. The FACs are prepared by chemical modifications of granular activated carbons (GACs) using functionalizing agents like HNO{sub 3}, HCl and HF. The Brunauer, Emmett and Teller surface areas of FAC-HCl (693.5 m{sup 2}/g), FAC-HNO{sub 3} (648.8 m{sup 2}/g) and FAC-HF (726.2 m{sup 2}/g) are comparable to the GAC (777.7 m{sup 2}/g). But, the adsorption capacity of each of the FAC-HNO{sub 3}, FAC-HCl and FAC-HF is found to be higher than the GAC. The functional groups play an important role in the adsorption process and pH has practically no role in this specific case. The FACs have hydrophilic protonated external surfaces in particular, along with the functional surface sites capable to make complexes with the CrO{sub 4}{sup 2−} and HCrO{sub 4}{sup −} present. Surface complex formation is maximized in the order FAC-HNO{sub 3} > FAC-HF > FAC-HCl, in proportion to the total surface acidity. This is also confirmed by the well-known pseudo second-order kinetic model. Physi-sorption equilibrium isotherms are parameterized by using standard Freundlich and Langmuir models. Langmuir fits better. The formation of surface complexes with the functional groups and hexavalent chromium is also revealed in the images of field emission scanning electron micrograph; energy dispersive X-ray spectroscopy and Fourier transform infrared spectroscopy analysis after adsorption. The intra-particle diffusion is not the only rate-controlling factor. The Boyd's film diffusion model fits very well with R{sup 2} as high as 98.1% for FAC-HNO{sub 3}. This result demonstrates that the functionalization of the GAC by acid treatments would increase the diffusion rate, predominantly with a boundary layer diffusion effect. - Highlights: ► Physico
International Nuclear Information System (INIS)
Olin, M.; Valkiainen, M.; Aalto, H.
1997-12-01
This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments
Energy Technology Data Exchange (ETDEWEB)
Olin, M.; Valkiainen, M.; Aalto, H. [VTT Chemical Technology, Espoo (Finland)
1997-12-01
This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments. 21 refs.
The effect of step thickness on the surface diffusion of a Pt adatom
International Nuclear Information System (INIS)
Yang, Jianyu; Deng, Yonghe; Xiao, Gang; Hu, Wangyu; Chen, Shuguang
2009-01-01
The diffusion of a single Pt adatom on the Pt(1 1 1) surface with {1 1 1}-faceted steps is studied using a combination of molecular dynamics and the nudged elastic band method. The interatomic interactions are described with the analytic embedded atom method. The simulation indicates that before diffusion across the descending step, the adatom becomes trapped at the step edge, and has to overcome an energy barrier to return the plane's center. The energy barrier for adatom migration to the step edge is almost independent of step thickness. In addition, the step thickness dependence of the diffusion energy barrier for the adatom over descending and ascending steps edge is obtained. For a monolayer step, the upward diffusion of the adatom to the {1 1 1}-faceted steps is very rare as compared with the downward diffusion. However, the probability of the adatom to ascend the {1 1 1}-faceted steps increases with increasing step thickness. The calculated character temperatures indicate the three-dimensional pyramidal island on the clean Pt(1 1 1) surface can be formed at higher temperature
Energy Technology Data Exchange (ETDEWEB)
Zhao, Yanyun [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Li, Chunjing, E-mail: chunjing.li@fds.org.cn [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Bo; Liu, Shaojun [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Qunying [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China)
2014-12-15
Hot Isostatic Pressing (HIP) diffusion bonding with CLAM steel is the primary candidate fabrication technique for the first wall (FW) of DFLL-TBM. Surface state is one of the key factors for the joints quality. The effect of surface state prepared with grinder and miller on HIP diffusion bonding joints of CLAM steel was investigated. HIP diffusion bonding was performed at 140 MPa and 1373 K within 3 h. The mechanical properties of the joints were investigated with instrumented Charpy V-notch impact tests and the microstructures of the joints were analyzed with scanning electron microscopy (SEM). The results showed that the milled samples with fine surface roughness were more suitable for CLAM steel HIP diffusion bonding.
Energy Technology Data Exchange (ETDEWEB)
Nimlos, M. R.; Beckham, G. T.; Matthews, J. F.; Bu, L.; Himmel, M. E.; Crowley, M. F.
2012-06-08
Cellulase enzymes often contain carbohydrate-binding modules (CBMs) for binding to cellulose. The mechanisms by which CBMs recognize specific surfaces of cellulose and aid in deconstruction are essential to understand cellulase action. The Family 1 CBM from the Trichoderma reesei Family 7 cellobiohydrolase, Cel7A, is known to selectively bind to hydrophobic surfaces of native cellulose. It is most commonly suggested that three aromatic residues identify the planar binding face of this CBM, but several recent studies have challenged this hypothesis. Here, we use molecular simulation to study the CBM binding orientation and affinity on hydrophilic and hydrophobic cellulose surfaces. Roughly 43 {mu}s of molecular dynamics simulations were conducted, which enables statistically significant observations. We quantify the fractions of the CBMs that detach from crystal surfaces or diffuse to other surfaces, the diffusivity along the hydrophobic surface, and the overall orientation of the CBM on both hydrophobic and hydrophilic faces. The simulations demonstrate that there is a thermodynamic driving force for the Cel7A CBM to bind preferentially to the hydrophobic surface of cellulose relative to hydrophilic surfaces. In addition, the simulations demonstrate that the CBM can diffuse from hydrophilic surfaces to the hydrophobic surface, whereas the reverse transition is not observed. Lastly, our simulations suggest that the flat faces of Family 1 CBMs are the preferred binding surfaces. These results enhance our understanding of how Family 1 CBMs interact with and recognize specific cellulose surfaces and provide insights into the initial events of cellulase adsorption and diffusion on cellulose.
Centrifugal Compressor Surge Margin Improved With Diffuser Hub Surface Air Injection
Skoch, Gary J.
2002-01-01
Aerodynamic stability is an important parameter in the design of compressors for aircraft gas turbine engines. Compression system instabilities can cause compressor surge, which may lead to the loss of an aircraft. As a result, engine designers include a margin of safety between the operating line of the engine and the stability limit line of the compressor. The margin of safety is typically referred to as "surge margin." Achieving the highest possible level of surge margin while meeting design point performance objectives is the goal of the compressor designer. However, performance goals often must be compromised in order to achieve adequate levels of surge margin. Techniques to improve surge margin will permit more aggressive compressor designs. Centrifugal compressor surge margin improvement was demonstrated at the NASA Glenn Research Center by injecting air into the vaned diffuser of a 4:1-pressure-ratio centrifugal compressor. Tests were performed using injector nozzles located on the diffuser hub surface of a vane-island diffuser in the vaneless region between the impeller trailing edge and the diffuser-vane leading edge. The nozzle flow path and discharge shape were designed to produce an air stream that remained tangent to the hub surface as it traveled into the diffuser passage. Injector nozzles were located near the leading edge of 23 of the 24 diffuser vanes. One passage did not contain an injector so that instrumentation located in that passage would be preserved. Several orientations of the injected stream relative to the diffuser vane leading edge were tested over a range of injected flow rates. Only steady flow (nonpulsed) air injection was tested. At 100 percent of the design speed, a 15-percent improvement in the baseline surge margin was achieved with a nozzle orientation that produced a jet that was bisected by the diffuser vane leading edge. Other orientations also improved the baseline surge margin. Tests were conducted at speeds below the
Interaction dynamics of two diffusing particles: contact times and influence of nearby surfaces.
Tränkle, B; Ruh, D; Rohrbach, A
2016-03-14
Interactions of diffusing particles are governed by hydrodynamics on different length and timescales. The local hydrodynamics can be influenced substantially by simple interfaces. Here, we investigate the interaction dynamics of two micron-sized spheres close to plane interfaces to mimic more complex biological systems or microfluidic environments. Using scanned line optical tweezers and fast 3D interferometric particle tracking, we are able to track the motion of each bead with precisions of a few nanometers and at a rate of 10 kilohertz. From the recorded trajectories, all spatial and temporal information is accessible. This way, we measure diffusion coefficients for two coupling particles at varying distances h to one or two glass interfaces. We analyze their coupling strength and length by cross-correlation analysis relative to h and find a significant decrease in the coupling length when a second particle diffuses nearby. By analysing the times the particles are in close contact, we find that the influence of nearby surfaces and interaction potentials reduce the diffusivity strongly, although we found that the diffusivity hardly affects the contact times and the binding probability between the particles. All experimental results are compared to a theoretical model, which is based on the number of possible diffusion paths following the Catalan numbers and a diffusion probability, which is biased by the spheres' surface potential. The theoretical and experimental results agree very well and therefore enable a better understanding of hydrodynamically coupled interaction processes.
Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure
International Nuclear Information System (INIS)
Yang Jianyu; Hu Wangyu; Chen Shuguang
2010-01-01
Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {111} and {100} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {111} to neighboring {111} facet. Owing to the small barrier of adatom diffusion across the step edge between {111} and {100} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {100} microfacet and the Pt clusters can have only {111} facets in epitaxial growth.
Growth and decay of surface voltage on silver diffused polyimide exposed to 3-15 keV electrons
Energy Technology Data Exchange (ETDEWEB)
Mahapatra, S K; Dhole, S D; Bhoraskar, V N [Department of Physics, University of Pune, Pune-411007 (India)
2007-02-21
During electron irradiation, the growth in the surface voltage on virgin and silver diffused polyimide sample was studied by varying electron energy from 3 to 15 keV and beam diameter from 3 to 15 mm. At a constant beam current, the surface voltage increased nonlinearly with electron energy but decreased slowly with beam diameter at fixed electron energy. At a surface voltage around saturation or beyond 3 kV, the electron beam was switched off and the decay in the surface voltage was studied for a period of 9 x 10{sup 4} s. The surface analysis revealed that the relative concentrations of carbon increased and that of the oxygen and the nitrogen decreased in the electron irradiated virgin and silver diffused polyimide sample, however in different proportions. Under the identical conditions of electron irradiation, the growth rate of the surface voltage, the post irradiated surface resistivity and the voltage decay constant of the silver diffused polyimide were lower than that of the virgin polyimide. The results of the present study reveal that the resistance of the silver diffused polyimide to keV electrons is higher than that of the virgin polyimide.
International Nuclear Information System (INIS)
Goddard, P.J.
1989-01-01
The stomach is thought to be protected from luminal acid by a gastric mucosal barrier that restricts the diffusion of acid into tissue. This study tested the hypothesis that the hydrophobic luminal surface of canine gastric mucosa incubated in Ussing chambers, impedes the back-diffusion of luminal acid into the tissue. Isolated sheets of mucosa were treated with cimetidine to inhibit spontaneous acid secretion, and incubated under conditions that prevented significant secretion of luminal bicarbonate. By measuring acid loss from the luminal compartment using the pH-stat technique, acid back-diffusion was continuously monitored; potential difference (PD) was measured as an index of tissue viability. Tissue luminal surface hydrophobicity was estimated by contact angle analysis at the end of each experiment. Addition of 16,16-dimethyl prostaglandin E 2 to the nutrient compartment enhanced luminal surface hydrophobicity, but did not reduce acid back-diffusion in tissues that maintained a constant PD. 10 mM salicylate at pH 4.00 in the luminal compartment reduced surface hydrophobicity, but this decrease did not occur if 1 ug/ml prostaglandin was present in the nutrient solution. Despite possessing relatively hydrophilic and relatively hydrophobic surface properties, respectively, acid back-diffusion in the absence of salicylate was not significantly different between these two groups. Neither group maintained a PD after incubation with salicylate. Lastly, radiolabeled salicylate was used to calculate the free (non-salicylate associated) acid loss in tissues incubated with salicylate and/or prostaglandin. No significant correlation was found between free acid back-diffusion and luminal surface hydrophobicity. These data do not support the hypothesis that acid back-diffusion in impeded by the hydrophobic surface presented by isolated canine gastric mucosa
'Thermal ghosts': apparent decay of fixed surfaces caused by heat diffusion
International Nuclear Information System (INIS)
Livadiotis, George
2007-01-01
The behaviour concerning classical heat diffusion on fixed thermal surfaces, studied by observations, still holds surprises. As soon as convective and radiative processes are negligible within the medium, this is considered to be free from energy sources and sinks. Then, the heat diffusion equation is conveniently solved using standard Fourier methods. Some considerations about the contrast effect suggest that the surface boundary would rather be observed to follow specific area decay dynamics than remaining fixed and static. Here it is shown that the apparent boundary lies on a specific isothermal spatiotemporal curve, which depends on the observing device. This is characterized by a slight, though determinative, difference between its radiance and that of the ambient background. Thereafter, the heat diffusion yields apparent boundary shrinkage with the passing of time. This phenomenon is particularly notable for two reasons: its lifetime and final decay rate depend only on the medium thermal properties, while being independent of the apparent boundary spatiotemporal curve. Thus, the former provides a suitable method for measuring the medium thermal properties via the observational data. The latter strongly reveal a kind of universality of some characteristic properties of the phenomenon, common to all observers
International Nuclear Information System (INIS)
Yan Shi-Chao; Xie Nan; Gong Hui-Qi; Guo Yang; Shan Xin-Yan; Lu Xing-Hua; Sun Qian
2012-01-01
The adsorption and diffusion behaviors of benzene molecules on an Au(111) surface are investigated by low-temperature scanning tunneling microscopy. A herringbone surface reconstruction of the Au(111) surface is imaged with atomic resolution, and significantly different behaviors are observed for benzene molecules adsorbed on step edges and terraces. The electric field induced modification in the molecular diffusion potential is revealed with a 2D molecular gas model, and a new method is developed to map the diffusion potential over the reconstructed Au(111) surface at the nanometer scale. (condensed matter: structure, mechanical and thermal properties)
Bulk-mediated surface diffusion: non-Markovian desorption and biased behaviour in an infinite system
International Nuclear Information System (INIS)
Revelli, Jorge A; Budde, Carlos E; Wio, Horacio S
2005-01-01
We analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework. We consider that the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption and its motion in the bulk are governed by Markovian dynamics, and include the effect of an external field in the form of a bias in the normal motion to the surface. We study this system for the diffusion of particles in a semi-infinite lattice, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The agreement between numerical and analytical asymptotic results is discussed
Kapranov, Sergey V.; Kouzaev, Guennadi A.
2018-01-01
Variations of effective diffusion coefficient of polar molecules exposed to microwave electric fields in a surface potential are studied by solving coupled stochastic differential equations of motion with a deterministic component of the surface force. Being an essential tool for the simulation interpretation, a theoretical approach to effective diffusion in surface potential is first developed. The effective diffusion coefficient is represented as the product of the normal diffusion coefficient and potential-dependent correction function, whose temperature dependence is close to the Arrhenius form. The analytically found zero-diffusion condition defines the state of thermal equilibrium at the surface. The diffusion of a water-like dipole molecule in the potential of graphite surface is simulated in the field-free conditions and in the presence of the alternating electric fields of various magnitude intensities and frequencies. Temperature dependence of the correction function exhibits field-induced variations of the effective Lennard-Jones energy parameter. It demonstrates maximum departure from the zero-field value at certain frequencies and intensities, which is associated with variations in the rotational dynamics. A concept of the amplitude-frequency resonance put forward to interpret the simulation results is explained using a heuristic reasoning and is corroborated by semi-quantitative considerations in terms of the Dissado-Hill cluster theory of dielectric relaxation.
Fractional Diffusion Equations and Anomalous Diffusion
Evangelista, Luiz Roberto; Kaminski Lenzi, Ervin
2018-01-01
Preface; 1. Mathematical preliminaries; 2. A survey of the fractional calculus; 3. From normal to anomalous diffusion; 4. Fractional diffusion equations: elementary applications; 5. Fractional diffusion equations: surface effects; 6. Fractional nonlinear diffusion equation; 7. Anomalous diffusion: anisotropic case; 8. Fractional Schrödinger equations; 9. Anomalous diffusion and impedance spectroscopy; 10. The Poisson–Nernst–Planck anomalous (PNPA) models; References; Index.
International Nuclear Information System (INIS)
Kim, Sung Hoon
2001-01-01
Planarization of the free-standing diamond film surface as smooth as possible could be obtained by using the hydrogen plasma etching with the diffusion of the carbon species into the metal alloy (Fe, Cr, Ni). For this process, we placed the free-standing diamond film between the metal alloy and the Mo substrate like a metal-diamond-molybdenum (MDM) sandwich. We set the sandwich-type MDM in a microwave-plasma-enhanced chemical vapor deposition (MPECVD) system. The sandwich-type MDM was heated over ca. 1000 .deg. C by using the hydrogen plasma. We call this process as the hydrogen plasma etching with carbon diffusion process. After etching the free-standing diamond film surface, we investigated surface roughness, morphologies, and the incorporated impurities on the etched diamond film surface. Finally, we suggest that the hydrogen plasma etching with carbon diffusion process is an adequate etching technique for the fabrication of the diamond film surface applicable to electronic devices
Hernández, Pedro A.; Norrie, Janice; Withoos, Yannick; García-Merino, Marta; Melián, Gladys; Padrón, Eleazar; Barrancos, José; Padilla, Germán; Rodríguez, Fátima; Pérez, Nemesio M.
2017-04-01
Even during repose periods, volcanoes release large amounts of gases from both visible (fumaroles, solfataras, plumes) and non-visible emanations (diffuse degassing). In the last 20 years, there has been considerable interest in the study of diffuse degassing as a powerful tool in volcano monitoring programs, particularly in those volcanic areas where there are no visible volcanic-hydrothermal gas emissions. Historically, soil gas and diffuse degassing surveys in volcanic environments have focused mainly on CO2 because it is, after water vapor, the most abundant gas dissolved in magma. As CO2 travels upward by advective-diffusive transport mechanisms and manifests itself at the surface, changes in its flux pattern over time provide important information for monitoring volcanic and seismic activity. Since 1998, diffuse CO2 emission has been monitored at El Hierro Island, the smallest and south westernmost island of the Canarian archipelago with an area of 278 km2. As no visible emanations occur at the surface environment of El Hierro, diffuse degassing studies have become the most useful geochemical tool to monitor the volcanic activity in this volcanic island. The island experienced a volcano-seismic unrest that began in July 2011, characterized by the location of a large number of relatively small earthquakes (MHierro at depths between 8 and 15 km. On October 12, 2011, a submarine eruption was confirmed during the afternoon of October 12, 2011 by visual observations off the coast of El Hierro, about 2 km south of the small village of La Restinga in the southernmost part of the island. During the pre-eruptive and eruptive periods, the time series of the diffuse CO2 emission released by the whole island experienced two significant increases. The first started almost 2 weeks before the onset of the submarine eruption, reflecting a clear geochemical anomaly in CO2 emission, most likely due to increasing release of deep seated magmatic gases to the surface. The second
International Nuclear Information System (INIS)
Lohmann, Rainer; Jurado, Elena; Dijkstra, Henk A.; Dachs, Jordi
2013-01-01
Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole cause for the transport of PFOA to depth. The global oceanic sink due to eddy diffusion for PFOA is high, with accumulated removal fluxes over the last 40 years of 660 t, with the Atlantic Ocean accounting for 70% of the global oceanic sink. The global oceans have removed 13% of all PFOA produced to a depth greater than 100 m via vertical eddy diffusion; an additional 4% has been removed via deep water formation. The top 100 m of the surface oceans store another 21% of all PFOA produced (∼1100 t). Highlights: •Eddy diffusion has removed ∼660 t of PFOA from surface oceans over the last 40 years. •Atlantic Ocean accounts for 70% of the global oceanic sink of PFOA. •Vertical eddy diffusion has moved ∼13% of PFOA to oceans deeper than 100 m. •Around 4% of PFOA has been removed via deep water formation. •The top 100 m of global oceans contain ∼21% of historical PFOA production. -- Vertical eddy diffusion is an important removal process for hydrophilic organic pollutants such as PFOA from the surface ocean
Novel exchange mechanisms in the surface diffusion of oxides
International Nuclear Information System (INIS)
Harris, Duncan J; Lavrentiev, Mikhail Yu; Harding, John H; Allan, Neil L; Purton, John A
2004-01-01
We use temperature-accelerated dynamics to show the importance of exchange mechanisms in surface diffusion and growth of simple oxides. Such mechanisms can dominate transport processes both on terraces and steps for both homoepitaxial and heteroepitaxial growth. We suggest that the mixing inevitable when an exchange mechanism is present must be considered when attempts are made to grow sharp interfaces in oxide nanostructures. (letter to the editor)
Ku, Bon Ki; Kulkarni, Pramod
2012-05-01
We compare different approaches to measure surface area of aerosol agglomerates. The objective was to compare field methods, such as mobility and diffusion charging based approaches, with laboratory approach, such as Brunauer, Emmett, Teller (BET) method used for bulk powder samples. To allow intercomparison of various surface area measurements, we defined 'geometric surface area' of agglomerates (assuming agglomerates are made up of ideal spheres), and compared various surface area measurements to the geometric surface area. Four different approaches for measuring surface area of agglomerate particles in the size range of 60-350 nm were compared using (i) diffusion charging-based sensors from three different manufacturers, (ii) mobility diameter of an agglomerate, (iii) mobility diameter of an agglomerate assuming a linear chain morphology with uniform primary particle size, and (iv) surface area estimation based on tandem mobility-mass measurement and microscopy. Our results indicate that the tandem mobility-mass measurement, which can be applied directly to airborne particles unlike the BET method, agrees well with the BET method. It was also shown that the three diffusion charging-based surface area measurements of silver agglomerates were similar within a factor of 2 and were lower than those obtained from the tandem mobility-mass and microscopy method by a factor of 3-10 in the size range studied. Surface area estimated using the mobility diameter depended on the structure or morphology of the agglomerate with significant underestimation at high fractal dimensions approaching 3.
Oxidative Corrosion of the UO 2 (001) Surface by Nonclassical Diffusion
Energy Technology Data Exchange (ETDEWEB)
Stubbs, Joanne E.; Biwer, Craig A.; Chaka, Anne M. [Pacific Northwest; Ilton, Eugene S. [Pacific Northwest; Du, Yingge [Pacific Northwest; Bargar, John R. [Stanford Synchrotron; Eng, Peter J.
2017-11-07
Uranium oxide is central to every stage of the nuclear fuel cycle, from mining through fuel fabrication and use, to waste disposal and environmental cleanup. Its chemical and mechanical stability are intricately linked to the concentration of interstitial O atoms within the structure and the oxidation state of U. We have previously shown that during corrosion of the UO2 (111) surface under either 1 atm O2 gas or oxygenated water at room temperature, oxygen interstitials diffuse into the substrate to form a superlattice with three-layer periodicity. In the current study, we present results from surface x-ray scattering that reveal the structure of the oxygen diffusion profile beneath the (001) surface. The first few layers below the surface oscillate strongly in their surface-normal lattice parameters, suggesting preferential interstitial occupation of every other layer below the surface, which is geometrically consistent with the interstitial network that forms below the oxidized (111) surface. Deeper layers are heavily contracted and indicate that the oxidation front penetrates ~52 Å below the (001) surface after 21 days of dry O2 gas exposure at ambient pressure and temperature. X-ray photoelectron spectroscopy indicates U is present as U(IV), U(V), and U(VI).
Room temperature Cu-Cu direct bonding using surface activated bonding method
International Nuclear Information System (INIS)
Kim, T.H.; Howlader, M.M.R.; Itoh, T.; Suga, T.
2003-01-01
Thin copper (Cu) films of 80 nm thickness deposited on a diffusion barrier layered 8 in. silicon wafers were directly bonded at room temperature using the surface activated bonding method. A low energy Ar ion beam of 40-100 eV was used to activate the Cu surface prior to bonding. Contacting two surface-activated wafers enables successful Cu-Cu direct bonding. The bonding process was carried out under an ultrahigh vacuum condition. No thermal annealing was required to increase the bonding strength since the bonded interface was strong enough at room temperature. The chemical constitution of the Cu surface was examined by Auger electron spectroscope. It was observed that carbon-based contaminations and native oxides on copper surface were effectively removed by Ar ion beam irradiation for 60 s without any wet cleaning processes. An atomic force microscope study shows that the Ar ion beam process causes no surface roughness degradation. Tensile test results show that high bonding strength equivalent to bulk material is achieved at room temperature. The cross-sectional transmission electron microscope observations reveal the presence of void-free bonding interface without intermediate layer at the bonded Cu surfaces
Energy Technology Data Exchange (ETDEWEB)
Mirigian, Stephen, E-mail: kschweiz@illinois.edu, E-mail: smirigian@gmail.com; Schweizer, Kenneth S., E-mail: kschweiz@illinois.edu, E-mail: smirigian@gmail.com [Departments of Materials Science and Chemistry, University of Illinois, Urbana, Illinois 61801 (United States)
2015-12-28
We have constructed a quantitative, force level, statistical mechanical theory for how confinement in free standing thin films introduces a spatial mobility gradient of the alpha relaxation time as a function of temperature, film thickness, and location in the film. The crucial idea is that relaxation speeds up due to the reduction of both near-surface barriers associated with the loss of neighbors in the local cage and the spatial cutoff and dynamical softening near the vapor interface of the spatially longer range collective elasticity cost for large amplitude hopping. These two effects are fundamentally coupled. Quantitative predictions are made for how an apparent glass temperature depends on the film thickness and experimental probe technique, the emergence of a two-step decay and mobile layers in time domain measurements, signatures of confinement in frequency-domain dielectric loss experiments, the dependence of film-averaged relaxation times and dynamic fragility on temperature and film thickness, surface diffusion, and the relationship between kinetic experiments and pseudo-thermodynamic measurements such as ellipsometry.
International Nuclear Information System (INIS)
Mirigian, Stephen; Schweizer, Kenneth S.
2015-01-01
We have constructed a quantitative, force level, statistical mechanical theory for how confinement in free standing thin films introduces a spatial mobility gradient of the alpha relaxation time as a function of temperature, film thickness, and location in the film. The crucial idea is that relaxation speeds up due to the reduction of both near-surface barriers associated with the loss of neighbors in the local cage and the spatial cutoff and dynamical softening near the vapor interface of the spatially longer range collective elasticity cost for large amplitude hopping. These two effects are fundamentally coupled. Quantitative predictions are made for how an apparent glass temperature depends on the film thickness and experimental probe technique, the emergence of a two-step decay and mobile layers in time domain measurements, signatures of confinement in frequency-domain dielectric loss experiments, the dependence of film-averaged relaxation times and dynamic fragility on temperature and film thickness, surface diffusion, and the relationship between kinetic experiments and pseudo-thermodynamic measurements such as ellipsometry
Speckle noise reduction for computer generated holograms of objects with diffuse surfaces
Symeonidou, Athanasia; Blinder, David; Ahar, Ayyoub; Schretter, Colas; Munteanu, Adrian; Schelkens, Peter
2016-04-01
Digital holography is mainly used today for metrology and microscopic imaging and is emerging as an important potential technology for future holographic television. To generate the holographic content, computer-generated holography (CGH) techniques convert geometric descriptions of a 3D scene content. To model different surface types, an accurate model of light propagation has to be considered, including for example, specular and diffuse reflection. In previous work, we proposed a fast CGH method for point cloud data using multiple wavefront recording planes, look-up tables (LUTs) and occlusion processing. This work extends our method to account for diffuse reflections, enabling rendering of deep 3D scenes in high resolution with wide viewing angle support. This is achieved by modifying the spectral response of the light propagation kernels contained by the look-up tables. However, holograms encoding diffuse reflective surfaces depict significant amounts of speckle noise, a problem inherent to holography. Hence, techniques to improve the reduce speckle noise are evaluated in this paper. Moreover, we propose as well a technique to suppress the aperture diffraction during numerical, viewdependent rendering by apodizing the hologram. Results are compared visually and in terms of their respective computational efficiency. The experiments show that by modelling diffuse reflection in the LUTs, a more realistic yet computationally efficient framework for generating high-resolution CGH is achieved.
O'Neill, Kelly C; Lee, Young Jin
2018-05-01
The ability to determine the age of fingerprints would be immeasurably beneficial in criminal investigations. We explore the possibility of determining the age of fingerprints by analyzing various compounds as they diffuse from the ridges to the valleys of fingerprints using matrix-assisted laser desorption/ionization mass spectrometry imaging. The diffusion of two classes of endogenous fingerprint compounds, fatty acids and triacylglycerols (TGs), was studied in fresh and aged fingerprints on four surfaces. We expected higher molecular weight TGs would diffuse slower than fatty acids and allow us to determine the age of older fingerprints. However, we found interactions between endogenous compounds and the surface have a much stronger impact on diffusion than molecular weight. For example, diffusion of TGs is faster on hydrophilic plain glass or partially hydrophilic stainless steel surfaces, than on a hydrophobic Rain-x treated surface. This result further complicates utilizing a diffusion model to age fingerprints. © 2017 American Academy of Forensic Sciences.
DEFF Research Database (Denmark)
Zhang, Chen; Heiselberg, Per Kvols; Pomianowski, Michal Zbigniew
2015-01-01
the opposite effect on energy performance when TABS is activated in heating or cooling mode. Finally, the air temperature distribution in the plenum and the surface temperature distribution of the diffuse ceiling point out that the air does not perfectly mix in the plenum, the air is not evenly distributed...
Cleaning of diffusion bonding surface by argon ion bombardment treatment
International Nuclear Information System (INIS)
Wang, Airu; Ohashi, Osamu; Yamaguchi, Norio; Aoki, Masanori; Higashi, Yasuo; Hitomi, Nobuteru
2003-01-01
The specimens of oxygen-free high conductivity copper, SUS304L stainless steel and pure iron were treated by argon ion bombardment and then were bonded by diffusion bonding method. The effects of argon ion bombardment treatment on faying surface morphology, tensile strength of bonding joints and inclusions at the fracture surface were investigated. The results showed that argon ion bombardment treatment was effective to remove the oxide film and contamination at the faying surface and improve the quality of joints. The tensile strength of the bonded joints was improved, and minimum bonding temperature to make the metallic bonding at the interface was lowered by argon ion bombardment treatment. At the joints with argon ion bombardment treatment, ductile fractured surface was seen and the amount of inclusions was obviously decreased
Energy Technology Data Exchange (ETDEWEB)
Xiaodong, Dai [Chemistry and Chemical Engineering School, China University of Petroleum, Dongying 257061, Shandong (China); Institute for Sustainability and Innovation, Victoria University, Melbourne, VIC 8001 (Australia); Zou, Linda [SA Water Centre for Water Management and Reuse, University of South Australia, Adelaide, SA5095 (Australia); Zifeng, Yan [Chemistry and Chemical Engineering School, China University of Petroleum, Dongying 257061, Shandong (China); Millikan, Mary [Institute for Sustainability and Innovation, Victoria University, Melbourne, VIC 8001 (Australia)
2009-08-30
This study investigated the removal of N-nitrosodimethylamine (NDMA) by an adsorption mechanism using commercially available activated carbons and surface-modified activated carbons. The effects of the modification on the properties of the activated carbon were studied by N{sub 2} adsorption/desorption, Diffuse Reflectance Infrared Fourier Transmission (DRIFT) analysis and X-Ray Photoelectron Spectroscopy (XPS). Adsorption experiments revealed that the activated carbons demonstrated a greater capacity for NDMA adsorption capacity than can be achieved using zeolite. The equilibrium data was fitted to the Freundlich equation and it was found that the adsorption capacity was significantly influenced by the micropore size, relative pore volume and surface characteristics. Adsorption experiments were conducted using unmodified and modified activated carbons. The results indicated that the adsorption capacity of NDMA can be significantly improved by heat treatment and doping of TiO{sub 2} particles. This was because the surface treatments yielded more hydrophobic sites and fewer oxygen-containing surface functional groups, and consequently an increased capacity for NDMA adsorption.
International Nuclear Information System (INIS)
Dai Xiaodong; Zou, Linda; Yan Zifeng; Millikan, Mary
2009-01-01
This study investigated the removal of N-nitrosodimethylamine (NDMA) by an adsorption mechanism using commercially available activated carbons and surface-modified activated carbons. The effects of the modification on the properties of the activated carbon were studied by N 2 adsorption/desorption, Diffuse Reflectance Infrared Fourier Transmission (DRIFT) analysis and X-Ray Photoelectron Spectroscopy (XPS). Adsorption experiments revealed that the activated carbons demonstrated a greater capacity for NDMA adsorption capacity than can be achieved using zeolite. The equilibrium data was fitted to the Freundlich equation and it was found that the adsorption capacity was significantly influenced by the micropore size, relative pore volume and surface characteristics. Adsorption experiments were conducted using unmodified and modified activated carbons. The results indicated that the adsorption capacity of NDMA can be significantly improved by heat treatment and doping of TiO 2 particles. This was because the surface treatments yielded more hydrophobic sites and fewer oxygen-containing surface functional groups, and consequently an increased capacity for NDMA adsorption.
Effects of angular dependence of surface diffuseness in deformed nuclei on Coulomb barrier
International Nuclear Information System (INIS)
Adamian, G.G.; Antonenko, N.V.; Malov, L.A.; Scamps, G.; Lacroix, D.
2014-01-01
The angular dependence of surface diffuseness is further discussed. The results of self-consistent calculations are compared with those obtained with the phenomenological mean-field potential. The rather simple parametrizations are suggested. The effects of surface polarization and hexadecapole deformation on the height of the Coulomb barrier are revealed. (authors)
Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure
Energy Technology Data Exchange (ETDEWEB)
Yang Jianyu, E-mail: wuliyangjianyu@yahoo.com.c [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China); Hu Wangyu, E-mail: wangyuhu2001@yahoo.com.c [Department of Applied Physics, Hunan University, Changsha 410082 (China); Chen Shuguang [Department of Applied Physics, Hunan University, Changsha 410082 (China)
2010-05-03
Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {l_brace}111{r_brace} to neighboring {l_brace}111{r_brace} facet. Owing to the small barrier of adatom diffusion across the step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {l_brace}100{r_brace} microfacet and the Pt clusters can have only {l_brace}111{r_brace} facets in epitaxial growth.
Potential Energy Surface of NO on Pt(997: Adsorbed States and Surface Diffusion
Directory of Open Access Journals (Sweden)
N. Tsukahara
2012-01-01
Full Text Available The potential energy surface (PES of NO on Pt(997 has been elucidated: the adsorption states and diffusion processes of NO on Pt(997 at low coverage were investigated by using infrared reflection absorption spectroscopy (IRAS and scanning tunneling microscopy (STM. When NO molecules adsorb on a surface at a low temperature (11 K, each molecule transiently migrates on the surface from the first impact point to a possible adsorption site. We found that there are four stable adsorption sites for NO on Pt(997: a bridge site of the upper step, an fcc- (or hcp- hollow site of the terrace, an on-top site of the terrace, and an fcc-hollow site of the lower step. At higher temperatures above 45 K, NO molecules start to migrate thermally to more stable adsorption sites on a terrace, and they are finally trapped at the bridge sites of the step, which are the most stable among the four sites.
Diffusion bonding of reduced activation ferritic steel F82H for demo blanket application
International Nuclear Information System (INIS)
Kurasawa, T.; Tamura, M.
1996-01-01
A reduced activation ferritic steel, a grade F82H developed by JAERI, is a promising candidate structural material for the blanket and the first wall of DEMO reactors. In the present study, diffusion bonding of F82H has been investigated to develop the fabrication procedures of the blanket box and the first wall panel with cooling channels embedded by F82H. The parameters examined are the bonding temperature (810-1050 C), bonding pressure (2-10 MPa) and roughness of the bonding surface (0.5-12.8 μR max ), and metallurgical examination and mechanical tests of the diffusion bonded joints have been conducted. From the tests, sufficient bonding was obtained under the temperatures of 840-1 050 C (compressive stress of 3-12 MPa), and it was found that heat treatment following diffusion bonding is essential to obtain the mechanical properties similar to that of the base metal. (orig.)
International Nuclear Information System (INIS)
Su, Qiulei; Deng, Huiqiu; Xiao, Shifang; Li, Xiaofan; Hu, Wangyu; Ao, Bingyun; Chen, Piheng
2014-01-01
Experimental studies of nitriding on uranium surfaces show that the modified layers provide considerable protection against air corrosion. The bimodal distribution of nitrogen is affected by both its implantation and diffusion, and the diffusion of nitrogen during implantation is also governed by vacancy trapping. In the present paper, nitrogen adsorption, absorption, diffusion, and vacancy trapping on the surface of and in the bulk of α–uranium are studied with a first-principles density functional theory approach and the climbing image nudged elastic band method. The calculated results indicate that, regardless of the nitrogen coverage, a nitrogen atom prefers to reside at the hollow1 site and octahedral (Oct) site on and below the surface, respectively. The lowest energy barriers for on-surface and penetration diffusion occur at a coverage of 1/2 monolayer. A nitrogen atom prefers to occupy the Oct site in bulk α–uranium. High energy barriers are observed during the diffusion between neighboring Oct sites. A vacancy can capture its nearby interstitial nitrogen atom with a low energy barrier, providing a significant attractive nitrogen-vacancy interaction at the trapping center site. This study provides a reference for understanding the nitriding process on uranium surfaces
Effect of Surface Diffusion on Transfer Processes in Heterogeneous Systems
Czech Academy of Sciences Publication Activity Database
Levdansky, V.V.; Smolík, Jiří; Moravec, Pavel
2008-01-01
Roč. 51, 9-10 (2008), s. 2471-2481 ISSN 0017-9310 R&D Projects: GA ČR GA101/05/2214; GA ČR(CZ) GA101/05/2524; GA ČR GA104/07/1093 Institutional research plan: CEZ:AV0Z40720504 Keywords : adsorption * gas flow * surface diffusion Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.894, year: 2008
Kalinin, Sergei V; Balke, Nina; Kumar, Amit; Dudney, Nancy J; Jesse, Stephen
2014-05-06
A method and system for probing mobile ion diffusivity and electrochemical reactivity on a nanometer length scale of a free electrochemically active surface includes a control module that biases the surface of the material. An electrical excitation signal is applied to the material and induces the movement of mobile ions. An SPM probe in contact with the surface of the material detects the displacement of mobile ions at the surface of the material. A detector measures an electromechanical strain response at the surface of the material based on the movement and reactions of the mobile ions. The use of an SPM tip to detect local deformations allows highly reproducible measurements in an ambient environment without visible changes in surface structure. The measurements illustrate effective spatial resolution comparable with defect spacing and well below characteristic grain sizes of the material.
Non-rigid registration of breast surfaces using the laplace and diffusion equations
Directory of Open Access Journals (Sweden)
Ou Jao J
2010-02-01
Full Text Available Abstract A semi-automated, non-rigid breast surface registration method is presented that involves solving the Laplace or diffusion equations over undeformed and deformed breast surfaces. The resulting potential energy fields and isocontours are used to establish surface correspondence. This novel surface-based method, which does not require intensity images, anatomical landmarks, or fiducials, is compared to a gold standard of thin-plate spline (TPS interpolation. Realistic finite element simulations of breast compression and further testing against a tissue-mimicking phantom demonstrate that this method is capable of registering surfaces experiencing 6 - 36 mm compression to within a mean error of 0.5 - 5.7 mm.
Free surface modelling with two-fluid model and reduced numerical diffusion of the interface
International Nuclear Information System (INIS)
Strubelj, Luka; Tiselj, Izrok
2008-01-01
Full text of publication follows: The free surface flows are successfully modelled with one of existing free surface models, such as: level set method, volume of fluid method (with/without surface reconstruction), front tracking, two-fluid model (two momentum equations) with modified interphase force and others. The main disadvantage of two-fluid model used for simulations of free surface flows is numerical diffusion of the interface, which can be significantly reduced using the method presented in this paper. Several techniques for reduction of numerical diffusion of the interface have been implemented in the volume of fluid model and are based on modified numerical schemes for advection of volume fraction near the interface. The same approach could be used also for two-fluid method, but according to our experience more successful reduction of numerical diffusion of the interface can be achieved with conservative level set method. Within the conservative level set method, continuity equation for volume fraction is solved and after that the numerical diffusion of the interface is reduced in such a way that the thickness of the interface is kept constant during the simulation. Reduction of the interface diffusion can be also called interface sharpening. In present paper the two-fluid model with interface sharpening is validated on Rayleigh-Taylor instability. Under assumptions of isothermal and incompressible flow of two immiscible fluids, we simulated a system with the fluid of higher density located above the fluid of smaller density in two dimensions. Due to gravity in the system, fluid with higher density moves below the fluid with smaller density. Initial condition is not a flat interface between the fluids, but a sine wave with small amplitude, which develops into a mushroom-like structure. Mushroom-like structure in simulation of Rayleigh-Taylor instability later develops to small droplets as result of numerical dispersion of interface (interface sharpening
Anomalous behavior of the diffusion coefficient in thin active films
International Nuclear Information System (INIS)
Basu, Abhik; Joanny, Jean-Francois; Prost, Jacques; Jülicher, Frank
2012-01-01
Inspired by recent experiments in cell biology, we elucidate the visco-elastic properties of an active gel by studying the dynamics of a small tracer particle inside it. In a stochastic hydrodynamic approach for an active gel of finite thickness L, we calculate the mean square displacement of a particle. These particle displacements are governed by fluctuations in the velocity field. We characterize the short-time behavior when the gel is a solid as well as the limit of long times when the gel becomes a fluid and the particle shows simple diffusion. Active stresses together with local polar order give rise to velocity fluctuations that lead to characteristic behaviors of the diffusion coefficient that differ fundamentally from those found in a passive system: the diffusion coefficient can depend on system size and diverges as L approaches an instability threshold. Furthermore, the diffusion coefficient becomes independent of the particle size in this case. (paper)
Living on the edge : STM studies of the creation, diffusion and annihilation of surface vacancies
Schoots, Koen
2007-01-01
This thesis describes an STM study of the creation, diffusion and annihilation of missing atoms, so-called surface vacancies, in the Cu(100) surface. Because of the extremely high mobility of surface vacancies in combination with their extremely low density, we have been forced to use tracer
Kang, Jia-Jhen; Yang, Tsung-Yu; Lan, Yi-Kang; Wu, Wei-Ru; Su, Chun-Jen; Weng, Shih-Chang; Yamada, Norifumi L; Su, An-Chung; Jeng, U-Ser
2018-04-01
Cathode buffer layers (CBLs) can effectively further the efficiency of polymer solar cells (PSCs), after optimization of the active layer. Hidden between the active layer and cathode of the inverted PSC device configuration is the critical yet often unattended vertical diffusion of the active layer components across CBL. Here, a novel methodology of contrast variation with neutron and anomalous X-ray reflectivity to map the multicomponent depth compositions of inverted PSCs, covering from the active layer surface down to the bottom of the ZnO-based CBL, is developed. Uniquely revealed for a high-performance model PSC are the often overlooked porosity distributions of the ZnO-based CBL and the differential diffusions of the polymer PTB7-Th and fullerene derivative PC 71 BM of the active layer into the CBL. Interface modification of the ZnO-based CBL with fullerene derivative PCBEOH for size-selective nanochannels can selectively improve the diffusion of PC 71 BM more than that of the polymer. The deeper penetration of PC 71 BM establishes a gradient distribution of fullerene derivatives over the ZnO/PCBE-OH CBL, resulting in markedly improved electron mobility and device efficiency of the inverted PSC. The result suggests a new CBL design concept of progressive matching of the conduction bands. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
The Conceptual Definitions of the Diffusion of Results of Innovation Activity of Enterprises
Directory of Open Access Journals (Sweden)
Vankovych Lyubomyr Ya.
2017-03-01
Full Text Available The article considers evolution of the conceptual definitions of the diffusion of results of innovation activity of enterprises, systematizes and allocates the principles of implementing the indicated diffusion, in particular: information security, decomposition, specification of innovation as to the specific market sectors, optimizing the costs on diffusion, priority of quality, validity of strategies and appropriateness of tactics, informative advertising, creative activity, scientific validity, consistency, integrity, cohesiveness, flexibility, hierarchy, efficiency, alternative, purposefulness, informativeness, longtermness, consciousness, accessibility, and harmonization of interests. Compliance by diffusers with the totality of the above principles of the diffusion of results of innovation activity of enterprise comprises a system of visions (conception of market adoption of the diffusion objects.
A model for diffuse and global irradiation on horizontal surface
International Nuclear Information System (INIS)
Jain, P.C.
1984-01-01
The intensity of the direct radiation and the diffuse radiation at any time on a horizontal surface are each expressed as fractions of the intensity of the extraterrestrial radiation. Using these and assuming a random distribution of the bright sunshine hours and not too wide variations in the values of the transmission coefficients, a number of relations for estimating the global and the diffuse irradiation are derived. Two of the relations derived are already known empirically. The formulation lends more confidence in the use of the already empirically known relations providing them a theoretical basis, and affords more flexibility to the estimation techniques by supplying new equations. The study identifies three independent basic parameters and the constants appearing in the various equations as simple functions of these three basic parameters. Experimental data for the diffuse irradiation, the global irradiation and the bright sunshine duration for Macerata (Italy), Salisbury and Bulawayo (Zimbabwe) is found to show good correlation for the linear equations, and the nature and the interrelationships of the constants are found to be as predicted by the theory
Objective and Subjective Evaluation of Reflecting and Diffusing Surfaces in Auditoria
Cox, Trevor John
Available from UMI in association with The British Library. Requires signed TDF. The performance of reflectors and diffusers used in auditoria have been evaluated both objectively and subjectively. Two accurate systems have been developed to measure the scattering from surfaces via the cross correlation function. These have been used to measure the scattering from plane panels, curved panels and quadratic residue diffusers (QRDs). The scattering measurements have been used to test theoretical prediction methods based on the Helmholtz-Kirchhoff integral equation. Accurate prediction methods were found for all surfaces tested. The limitations of the more approximate methods have been defined. The assumptions behind Schroeder's design of the QRD have been tested and the local reacting admittance assumption found to be valid over a wide frequency range. It was found that the QRD only produces uniform scattering at low frequencies. For an on-axis source the scattering from a curved panel was as good as from a QRD. For an oblique source the QRD produced much more uniform scattering than the curved panel. The subjective measurements evaluated the smallest perceivable change in the early sound field, the part most influenced by reflectors and diffusers. A natural sounding simulation of a concert hall field within an anechoic chamber was used. Standard objective parameters were reasonable values when compared to values found in real halls and subjective preference measurements. A difference limen was measured for early lateral energy fraction (.048 +/-.005); inter aural cross correlation (.075 +/-.008); clarity index (.67 +/-.13 dB); and centre time (8.6 +/- 1.6 ms). It was found that: (i) when changes are made to diffusers and reflectors, changes in spatial impression will usually be larger than those in clarity; and (ii) acousticians can gain most by paying attention to lateral sound in auditoria. It was also found that: (i) diffuse reflections in the early sound field
Effects of quenched impurities on surface diffusion, spreading, and ordering of O/W(110)
DEFF Research Database (Denmark)
Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.
2002-01-01
We study how quenched impurities affect the surface diffusion and ordering of strongly interacting adsorbate atoms on surfaces. To this end, we carry out Monte Carlo simulations for a lattice-gas model of O/W(110), including small concentrations of immobile impurities which block their adsorption...
Taoka, Toshiaki; Masutani, Yoshitaka; Kawai, Hisashi; Nakane, Toshiki; Matsuoka, Kiwamu; Yasuno, Fumihiko; Kishimoto, Toshifumi; Naganawa, Shinji
2017-04-01
The activity of the glymphatic system is impaired in animal models of Alzheimer's disease (AD). We evaluated the activity of the human glymphatic system in cases of AD with a diffusion-based technique called diffusion tensor image analysis along the perivascular space (DTI-ALPS). Diffusion tensor images were acquired to calculate diffusivities in the x, y, and z axes of the plane of the lateral ventricle body in 31 patients. We evaluated the diffusivity along the perivascular spaces as well as projection fibers and association fibers separately, to acquire an index for diffusivity along the perivascular space (ALPS-index) and correlated them with the mini mental state examinations (MMSE) score. We found a significant negative correlation between diffusivity along the projection fibers and association fibers. We also observed a significant positive correlation between diffusivity along perivascular spaces shown as ALPS-index and the MMSE score, indicating lower water diffusivity along the perivascular space in relation to AD severity. Activity of the glymphatic system may be evaluated with diffusion images. Lower diffusivity along the perivascular space on DTI-APLS seems to reflect impairment of the glymphatic system. This method may be useful for evaluating the activity of the glymphatic system.
International Nuclear Information System (INIS)
Melkior, T.; Motellier, S.; Yahiaoui, S.
2005-01-01
Full text of publication follows: This work is devoted to cesium diffusion through mud-rock samples from Bure (Meuse/Haute- Marne, France). This rock is mainly composed of interstratified illite/smectite, quartz and calcite. According to published data, positively charged solutes exhibit high diffusion coefficients in argillaceous media compared to neutral species. This effect was actually observed for cesium in Bure mud-rock samples: the effective diffusion coefficients (De) of tritiated water and cesium were found to be ca. 2 x 10 -11 m 2 s -1 and 2.5 x 10 -10 m 2 s -1 , respectively. Some authors assign this 'enhanced diffusion' of cations to the particular migration of ions within the electrical double layer, next to mineral surfaces (surface diffusion mechanism). To assess the role of sorbed ions in the diffusive transfer, cesium diffusion coefficients in Bure mud-rock were measured at different cesium concentrations. The distribution coefficient of cesium onto Bure mud-rock was measured in batch: it significantly varies over the concentration range investigated in the diffusion tests (between 2 x 10 -6 M and 2 x 10 -2 M). If sorbed ions contribute to the transfer, the effective diffusion coefficients deduced from these different tests should depend on cesium concentration. Nevertheless, the measured effective diffusion coefficients are found to be relatively unaffected by cesium concentration. It is thus concluded that ions at the sorbed state play a minor role in the diffusion. Following the assumption of an 'accelerated' transfer due to ions located in the diffuse double layer, the charge of the clay particles should affect the 'enhanced diffusion' of cesium. Therefore, a mud-rock sample was first crushed and contacted with a cationic surfactant at different solid/liquid ratios. The conditions were adjusted to obtain suspensions having positive, neutral and negative zeta potentials respectively. Three compact samples were then made with these different
An Analytical Model for Adsorption and Diffusion of Atoms/Ions on Graphene Surface
Directory of Open Access Journals (Sweden)
Yan-Zi Yu
2015-01-01
Full Text Available Theoretical investigations are made on adsorption and diffusion of atoms/ions on graphene surface based on an analytical continuous model. An atom/ion interacts with every carbon atom of graphene through a pairwise potential which can be approximated by the Lennard-Jones (L-J potential. Using the Fourier expansion of the interaction potential, the total interaction energy between the adsorption atom/ion and a monolayer graphene is derived. The energy-distance relationships in the normal and lateral directions for varied atoms/ions, including gold atom (Au, platinum atom (Pt, manganese ion (Mn2+, sodium ion (Na1+, and lithium-ion (Li1+, on monolayer graphene surface are analyzed. The equilibrium position and binding energy of the atoms/ions at three particular adsorption sites (hollow, bridge, and top are calculated, and the adsorption stability is discussed. The results show that H-site is the most stable adsorption site, which is in agreement with the results of other literatures. What is more, the periodic interaction energy and interaction forces of lithium-ion diffusing along specific paths on graphene surface are also obtained and analyzed. The minimum energy barrier for diffusion is calculated. The possible applications of present study include drug delivery system (DDS, atomic scale friction, rechargeable lithium-ion graphene battery, and energy storage in carbon materials.
Transport and diffusion on crystalline surfaces under external forces
International Nuclear Information System (INIS)
Lindenberg, Katja; Lacasta, A M; Sancho, J M; Romero, A H
2005-01-01
We present a numerical study of classical particles obeying a Langevin equation and moving on a solid crystalline surface under an external force that may either be constant or modulated by periodic oscillations. We focus on the particle drift velocity and diffusion. The roles of friction and equilibrium thermal fluctuations are studied for two nonlinear dynamical regimes corresponding to low and to high but finite friction. We identify a number of resonances and antiresonances, and provide phenomenological interpretations of the observed behaviour
International Nuclear Information System (INIS)
Bera, Susanta; Khan, Hasmat; Biswas, Indranil; Jana, Sunirmal
2016-01-01
Highlights: • Polyaniline (PANI) hybridized ZnO nanorods was synthesized by solution method. • Surface defects were found in the nanorods. • The hybrid material exhibited an enhancement in visible light absorption. • A long-term stable photoelectrochemical activity of the material was found. • Advancement in the properties would be PANI hybridization and surface defects. - Abstract: We report surfactant/template free precursor solution based synthesis of polyaniline (PANI) hybridized surface defective ZnO nanorods by a two-step process. Initially, ZnO nanorods have been prepared at 95 °C, followed by hybridization (coating) of PANI onto the ZnO via in situ polymerization of aniline monomer, forming ZnO-PANI nanohybrid (ZP). The structural properties of ZP have been analyzed by X-ray diffraction (XRD) and transmission electron microscopic (TEM) studies. The presence of surface defects especially the oxygen vacancies in ZnO has been characterized by photoluminescence emission, high resolution TEM, X-ray photoelectron spectroscopy (XPS) and micro-Raman spectral measurements. The chemical interaction of PANI with ZnO has been examined by Fourier transform infrared (FTIR) and XPS analyses. A significant enhancement in visible absorption of ZP sample is found as evidenced from UV–vis diffused reflectance spectral study. BET nitrogen adsorption-desorption isotherm shows an improved textural property (pore size, pore volume) of ZP. Moreover, a long-term stable photoelectrochemical activity (PEC) of ZP is found compare to pristine ZnO. The synergic effect of PANI hybridization and the presence of surface defects in ZnO NRs can enhance the PEC by prolonging the recombination rate of photogenerated charge carriers. The effect can also provide large number of active sites to make electrolyte diffusion and mass transportation easier in the nanohybrid. This simple synthesis strategy can be adopted for PANI hybridization with different metal oxide semiconductors
Energy Technology Data Exchange (ETDEWEB)
Bera, Susanta; Khan, Hasmat [Sol-Gel Division, CSIR-Central Glass and Ceramic Research Institute (CSIR-CGCRI), 196 Raja S.C. Mullick Road, P.O. Jadavpur University, Kolkata 700 032, West Bengal (India); Biswas, Indranil [Materials Characterization and Instrumentation Division, CSIR-Central Glass and Ceramic Research Institute (CSIR-CGCRI), 196 Raja S.C. Mullick Road, P.O. Jadavpur University, Kolkata 700 032, West Bengal (India); Jana, Sunirmal, E-mail: sjana@cgcri.res.in [Sol-Gel Division, CSIR-Central Glass and Ceramic Research Institute (CSIR-CGCRI), 196 Raja S.C. Mullick Road, P.O. Jadavpur University, Kolkata 700 032, West Bengal (India)
2016-10-15
Highlights: • Polyaniline (PANI) hybridized ZnO nanorods was synthesized by solution method. • Surface defects were found in the nanorods. • The hybrid material exhibited an enhancement in visible light absorption. • A long-term stable photoelectrochemical activity of the material was found. • Advancement in the properties would be PANI hybridization and surface defects. - Abstract: We report surfactant/template free precursor solution based synthesis of polyaniline (PANI) hybridized surface defective ZnO nanorods by a two-step process. Initially, ZnO nanorods have been prepared at 95 °C, followed by hybridization (coating) of PANI onto the ZnO via in situ polymerization of aniline monomer, forming ZnO-PANI nanohybrid (ZP). The structural properties of ZP have been analyzed by X-ray diffraction (XRD) and transmission electron microscopic (TEM) studies. The presence of surface defects especially the oxygen vacancies in ZnO has been characterized by photoluminescence emission, high resolution TEM, X-ray photoelectron spectroscopy (XPS) and micro-Raman spectral measurements. The chemical interaction of PANI with ZnO has been examined by Fourier transform infrared (FTIR) and XPS analyses. A significant enhancement in visible absorption of ZP sample is found as evidenced from UV–vis diffused reflectance spectral study. BET nitrogen adsorption-desorption isotherm shows an improved textural property (pore size, pore volume) of ZP. Moreover, a long-term stable photoelectrochemical activity (PEC) of ZP is found compare to pristine ZnO. The synergic effect of PANI hybridization and the presence of surface defects in ZnO NRs can enhance the PEC by prolonging the recombination rate of photogenerated charge carriers. The effect can also provide large number of active sites to make electrolyte diffusion and mass transportation easier in the nanohybrid. This simple synthesis strategy can be adopted for PANI hybridization with different metal oxide semiconductors
Energy Technology Data Exchange (ETDEWEB)
Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Nanavati, Sachin [Center for Development of Advanced Computing (C-DAC), SPPU campus, Pune 411007 (India); Majumder, Chiranjib [Chemistry Division, Bhabha Atomic Research Center, Mumbai, 400085 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India)
2015-01-15
CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A{sub a} site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A{sub a} (occupied) to A{sub a} (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.
Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.
2015-01-01
CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as Aa site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from Aa (occupied) to Aa (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.
International Nuclear Information System (INIS)
Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.
2015-01-01
CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A a site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A a (occupied) to A a (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth
Sushko, Gennady B; Verkhovtsev, Alexey V; Yakubovich, Alexander V; Schramm, Stefan; Solov'yov, Andrey V
2014-08-21
The process of self-diffusion of titanium atoms in a bulk material, on grain junctions and on surface is explored numerically in a broad temperature range by means of classical molecular dynamics simulation. The analysis is carried out for a nanoscale cylindrical sample consisting of three adjacent sectors and various junctions between nanocrystals. The calculated diffusion coefficient varies by several orders of magnitude for different regions of the sample. The calculated values of the bulk diffusion coefficient correspond reasonably well to the experimental data obtained for solid and molten states of titanium. Investigation of diffusion in the nanocrystalline titanium is of a significant importance because of its numerous technological applications. This paper aims to reduce the lack of data on diffusion in titanium and describe the processes occurring in bulk, at different interfaces and on surface of the crystalline titanium.
Qin, Dan; Ge, Xu-Jin; Lü, Jing-Tao
2018-05-01
Through density functional theory based calculations, we study the adsorption and diffusion of tin phthalocyanine (SnPc) molecule on Au(111) and Cu(111) surfaces. SnPc has two conformers with Sn pointing to the vacuum (Sn-up) and substrate (Sn-down), respectively. The binding energies of the two conformers with different adsorption sites on the two surfaces, including top, bridge, fcc, hcp, are calculated and compared. It is found that the SnPc molecule binds stronger on Cu(111) surface, with binding energy about 1 eV larger than that on Au(111). Only the bridge and top adsorption sites are stable on Cu(111), while all the four adsorption sites are stable on Au(111), with small diffusion barriers between them. Moreover, the flipping barrier from Sn-up to Sn-down conformer is of the same magnitude on the two metal surfaces. These results are consistent with a recent experiment [Zhang, et al., Angew. Chem., 56, 11769 (2017)], which shows that conformation change from Sn-up to Sn-down on Cu(111) surface can be induced by a C60-functionalized STM tip, while similar change is difficult to realize on Au(111), due to smaller diffusion barrier on Au(111).
Energy Technology Data Exchange (ETDEWEB)
Manuel, Lozano [Iowa State Univ., Ames, IA (United States)
1996-01-12
The transport of atoms or molecules over surfaces has been an important area of study for several decades now, with its progress generally limited by the available experimental techniques to characterize the phenomena. A number of methods have been developed over the years to measure surface diffusion yet only very few systems have been characterized to this day mainly due to the physical limitations inherent in these available methods. Even the STM with its astonishing atomically-resolved images of the surface has been limited in terms of its capability to determine mass transport properties. This is because the STM is inherently a ``slow`` instrument, i.e., a finite time is needed for signal averaging in order to produce the image. A need exists for additional surface diffusion measurement techniques, ideally ones which are able to study varied systems and measure a wide range of diffusion rates. The STM (especially because of its highly local nature) presents itself as a promising tool to conduct dynamical studies if its poor time resolution during ``normal operation`` can somehow be overcome. The purpose of this dissertation is to introduce a new technique of using the STM to measure adatom mobility on surfaces -- one with a capacity to achieve excellent time resolution.
Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium
International Nuclear Information System (INIS)
R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein
2004-01-01
FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were ∼ 4 x 10 -7 cm 2 /s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10 -5 to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form
Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium
Energy Technology Data Exchange (ETDEWEB)
R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein
2004-12-14
FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were {approx} 4 x 10{sup -7} cm{sup 2}/s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10{sup -5} to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form.
Shielding gas effect to diffusion activities of magnesium and copper on aluminum clad
Manurung, Charles SP; Napitupulu, Richard AM
2017-09-01
Aluminum is the second most metal used in many application, because of its corrosion resistance. The Aluminum will be damaged in over time if it’s not maintained in good condition. That is important to give protection to the Aluminums surface. Cladding process is one of surface protection methodes, especially for metals. Aluminum clad copper (Al/Cu) or copper clad aluminum (Cu/Al) composite metals have been widely used for many years. These mature protection method and well tested clad metal systems are used industrially in a variety application. The inherent properties and behavior of both copper and aluminum combine to provide unique performance advantages. In this paper Aluminum 2024 series will be covered with Aluminum 1100 series by hot rolling process. Observations will focus on diffusion activities of Mg and Cu that not present on Aluminum 1100 series. The differences of clad material samples is the use of shielding gas during heating before hot rolling process. The metallurgical characteristics will be examined by using optical microscopy. Transition zone from the interface cannot be observed but from Energy Dispersive Spectrometry it’s found that Mg and Cu are diffused from base metal (Al 2024) to the clad metal (Al 1100). Hardness test proved that base metals hardness to interface was decrease.
Salbreux, Guillaume; Jülicher, Frank
2017-09-01
We derive a fully covariant theory of the mechanics of active surfaces. This theory provides a framework for the study of active biological or chemical processes at surfaces, such as the cell cortex, the mechanics of epithelial tissues, or reconstituted active systems on surfaces. We introduce forces and torques acting on a surface, and derive the associated force balance conditions. We show that surfaces with in-plane rotational symmetry can have broken up-down, chiral, or planar-chiral symmetry. We discuss the rate of entropy production in the surface and write linear constitutive relations that satisfy the Onsager relations. We show that the bending modulus, the spontaneous curvature, and the surface tension of a passive surface are renormalized by active terms. Finally, we identify active terms which are not found in a passive theory and discuss examples of shape instabilities that are related to active processes in the surface.
Multimodal surface-based morphometry reveals diffuse cortical atrophy in traumatic brain injury.
Directory of Open Access Journals (Sweden)
Sorenson Donna J
2009-12-01
Full Text Available Abstract Background Patients with traumatic brain injury (TBI often present with significant cognitive deficits without corresponding evidence of cortical damage on neuroradiological examinations. One explanation for this puzzling observation is that the diffuse cortical abnormalities that characterize TBI are difficult to detect with standard imaging procedures. Here we investigated a patient with severe TBI-related cognitive impairments whose scan was interpreted as normal by a board-certified radiologist in order to determine if quantitative neuroimaging could detect cortical abnormalities not evident with standard neuroimaging procedures. Methods Cortical abnormalities were quantified using multimodal surfaced-based morphometry (MSBM that statistically combined information from high-resolution structural MRI and diffusion tensor imaging (DTI. Normal values of cortical anatomy and cortical and pericortical DTI properties were quantified in a population of 43 healthy control subjects. Corresponding measures from the patient were obtained in two independent imaging sessions. These data were quantified using both the average values for each lobe and the measurements from each point on the cortical surface. The results were statistically analyzed as z-scores from the mean with a p Results The TBI patient showed significant regional abnormalities in cortical thickness, gray matter diffusivity and pericortical white matter integrity that replicated across imaging sessions. Consistent with the patient's impaired performance on neuropsychological tests of executive function, cortical abnormalities were most pronounced in the frontal lobes. Conclusions MSBM is a promising tool for detecting subtle cortical abnormalities with high sensitivity and selectivity. MSBM may be particularly useful in evaluating cortical structure in TBI and other neurological conditions that produce diffuse abnormalities in both cortical structure and tissue properties.
Theory of activated penetrant diffusion in viscous fluids and colloidal suspensions
International Nuclear Information System (INIS)
Zhang, Rui; Schweizer, Kenneth S.
2015-01-01
We heuristically formulate a microscopic, force level, self-consistent nonlinear Langevin equation theory for activated barrier hopping and non-hydrodynamic diffusion of a hard sphere penetrant in very dense hard sphere fluid matrices. Penetrant dynamics is controlled by a rich competition between force relaxation due to penetrant self-motion and collective matrix structural (alpha) relaxation. In the absence of penetrant-matrix attraction, three activated dynamical regimes are predicted as a function of penetrant-matrix size ratio which are physically distinguished by penetrant jump distance and the nature of matrix motion required to facilitate its hopping. The penetrant diffusion constant decreases the fastest with size ratio for relatively small penetrants where the matrix effectively acts as a vibrating amorphous solid. Increasing penetrant-matrix attraction strength reduces penetrant diffusivity due to physical bonding. For size ratios approaching unity, a distinct dynamical regime emerges associated with strong slaving of penetrant hopping to matrix structural relaxation. A crossover regime at intermediate penetrant-matrix size ratio connects the two limiting behaviors for hard penetrants, but essentially disappears if there are strong attractions with the matrix. Activated penetrant diffusivity decreases strongly with matrix volume fraction in a manner that intensifies as the size ratio increases. We propose and implement a quasi-universal approach for activated diffusion of a rigid atomic/molecular penetrant in a supercooled liquid based on a mapping between the hard sphere system and thermal liquids. Calculations for specific systems agree reasonably well with experiments over a wide range of temperature, covering more than 10 orders of magnitude of variation of the penetrant diffusion constant
Surface-based brain morphometry and diffusion tensor imaging in schizoaffective disorder.
Landin-Romero, Ramón; Canales-Rodríguez, Erick J; Kumfor, Fiona; Moreno-Alcázar, Ana; Madre, Mercè; Maristany, Teresa; Pomarol-Clotet, Edith; Amann, Benedikt L
2017-01-01
The profile of grey matter abnormalities and related white-matter pathology in schizoaffective disorder has only been studied to a limited extent. The aim of this study was to identify grey- and white-matter abnormalities in patients with schizoaffective disorder using complementary structural imaging techniques. Forty-five patients meeting Diagnostic and Statistical Manual of Mental Disorders-Fourth Edition criteria and Research Diagnostic Criteria for schizoaffective disorder and 45 matched healthy controls underwent structural-T1 and diffusion magnetic resonance imaging to enable surface-based brain morphometry and diffusion tensor imaging analyses. Analyses were conducted to determine group differences in cortical volume, cortical thickness and surface area, as well as in fractional anisotropy and mean diffusivity. At a threshold of p = 0.05 corrected, all measures revealed significant differences between patients and controls at the group level. Spatial overlap of abnormalities was observed across the various structural neuroimaging measures. In grey matter, patients with schizoaffective disorder showed abnormalities in the frontal and temporal lobes, striatum, fusiform, cuneus, precuneus, lingual and limbic regions. White-matter abnormalities were identified in tracts connecting these areas, including the corpus callosum, superior and inferior longitudinal fasciculi, anterior thalamic radiation, uncinate fasciculus and cingulum bundle. The spatial overlap of abnormalities across the different imaging techniques suggests widespread and consistent brain pathology in schizoaffective disorder. The abnormalities were mainly detected in areas that have commonly been reported to be abnormal in schizophrenia, and to some extent in bipolar disorder, which may explain the clinical and aetiological overlap in these disorders.
Effective diffusion of confined active Brownian swimmers
Sandoval, Mario; Dagdug, Leonardo
2014-11-01
We find theoretically the effect of confinement and thermal fluctuations, on the diffusivity of a spherical active swimmer moving inside a two-dimensional narrow cavity of general shape. The explicit formulas for the effective diffusion coefficient of a swimmer moving inside two particular cavities are presented. We also compare our analytical results with Brownian Dynamics simulations and we obtain excellent agreement. L.D. thanks Consejo Nacional de Ciencia y Tecnologia (CONACyT) Mexico, for partial support by Grant No. 176452. M. S. thanks CONACyT and Programa de Mejoramiento de Profesorado (PROMEP) for partially funding this work under Grant No. 103.5/13/6732.
Energy barriers for diffusion on heterogeneous stepped metal surfaces: Ag/Cu(110)
International Nuclear Information System (INIS)
Sbiaai, K.; Boughaleb, Y.; Mazroui, M.; Hajjaji, A.; Kara, A.
2013-01-01
In this paper we investigated the diffusion of Ag adatom by computing the energy barriers for many elementary diffusive processes which are likely to happen near to the step edge on Cu (110). The barriers are calculated by means of molecular dynamics simulation by using embedded atom potentials. The proximity to steps alters these barriers considerably, and very different results may be expected. In fact, our numerical calculations show that the diffusion via jump process along step edge is predominant for Ag/Cu(110) and the diffusion over the step occurs sometimes, but only via exchange mechanisms. The adatom diffusion across channels is difficult due to the high value of activation energy required (around 1 eV). Furthermore, we found the Ehrlich–Schwoebel barrier for diffusion around 120 meV in order to descend via exchange process and of the order of 170 meV via hopping mode. This aspect may have a strong influence on the growth character. In general our results suggest that, for our metal system, diffusion mechanism may be important for mass transport across the steps. Implications of these findings are discussed. - Highlights: • Study of adatom diffusion near the step edge • The diffusion along channel is enhanced through jump process. • Arrhenius law is satisfied for a wide range of temperature (310–600 K)
Mikuni, Shintaro; Yamamoto, Johtaro; Horio, Takashi; Kinjo, Masataka
2017-08-25
The glucocorticoid receptor (GR) is a transcription factor, which interacts with DNA and other cofactors to regulate gene transcription. Binding to other partners in the cell nucleus alters the diffusion properties of GR. Raster image correlation spectroscopy (RICS) was applied to quantitatively characterize the diffusion properties of EGFP labeled human GR (EGFP-hGR) and its mutants in the cell nucleus. RICS is an image correlation technique that evaluates the spatial distribution of the diffusion coefficient as a diffusion map. Interestingly, we observed that the averaged diffusion coefficient of EGFP-hGR strongly and negatively correlated with its transcriptional activities in comparison to that of EGFP-hGR wild type and mutants with various transcriptional activities. This result suggests that the decreasing of the diffusion coefficient of hGR was reflected in the high-affinity binding to DNA. Moreover, the hyper-phosphorylation of hGR can enhance the transcriptional activity by reduction of the interaction between the hGR and the nuclear corepressors.
Comparison of diffusion coefficients and activation energies for AG diffusion in silicon carbide
International Nuclear Information System (INIS)
Kim, Bong Goo; Yeo, Sung Hwan; Lee, Young Woo; Cho, Moon Sung
2015-01-01
The migration of silver (Ag) in silicon carbide (SiC) and 110mAg through SiC of irradiated tri-structural isotropic (TRISO) fuel has been studied for the past three to four decades. However, there is no satisfactory explanation for the transport mechanism of Ag in SiC. In this work, the diffusion coefficients of Ag measured and/or estimated in previous studies were reviewed, and then pre-exponential factors and activation energies from the previous experiments were evaluated using Arrhenius equation. The activation energy is 247.4 kJ·mol -1 from Ag paste experiments between two SiC layers produced using fluidized-bed chemical vapor deposition (FBCVD), 125.3 kJ·mol -1 from integral release experiments (annealing of irradiated TRISO fuel), 121.8 kJ·mol -1 from fractional Ag release during irradiation of TRISO fuel in high flux reactor (HFR), and 274.8 kJ·mol -1 from Ag ion implantation experiments, respectively. The activation energy from ion implantation experiments is greater than that from Ag paste, fractional release and integral release, and the activation energy from Ag paste experiments is approximately two times greater than that from integral release experiments and fractional Ag release during the irradiation of TRISO fuel in HFR. The pre-exponential factors are also very different depending on the experimental methods and estimation. From a comparison of the pre-exponential factors and activation energies, it can be analogized that the diffusion mechanism of Ag using ion implantation experiment is different from other experiments, such as a Ag paste experiment, integral release experiments, and heating experiments after irradiating TRISO fuel in HFR. However, the results of this work do not support the long held assumption that Ag release from FBCVD-SiC, used for the coating layer in TRISO fuel, is dominated by grain boundary diffusion. In order to understand in detail the transport mechanism of Ag through the coating layer, FBCVD-SiC in TRISO fuel, a
Plasma surface treatment of Cu by nanosecond-pulse diffuse discharges in atmospheric air
Cheng, ZHANG; Jintao, QIU; Fei, KONG; Xingmin, HOU; Zhi, FANG; Yu, YIN; Tao, SHAO
2018-01-01
Nanosecond-pulse diffuse discharges could provide high-density plasma and high-energy electrons at atmospheric pressure. In this paper, the surface treatment of Cu by nanosecond-pulse diffuse discharges is conducted in atmospheric air. Factors influencing the water contact angle (WCA), chemical composition and microhardness, such as the gap spacing and treatment time, are investigated. The results show that after the plasma surface treatment, the WCA considerably decreases from 87° to 42.3°, and the surface energy increases from 20.46 mJ m-2 to 66.28 mJ m-2. Results of energy dispersive x-ray analysis show that the concentration of carbon decreases, but the concentrations of oxygen and nitrogen increase significantly. Moreover, the microhardness increases by approximately 30% after the plasma treatment. The aforementioned changes on the Cu surface indicate the plasma surface treatment enhances the hydrophilicity and microhardness, and it cleans the carbon and achieves oxidization on the Cu surface. Furthermore, by increasing the gap spacing and treatment time, better treatment effects can be obtained. The microhardness in the case of a 2.5 cm gap is higher than that in the case of a 3 cm gap. More oxygen and nitrogen species appear on the Cu surface for the 2.5 cm gap treatment than for the 3 cm gap treatment. The WCA significantly decreases with the treatment time when it is no longer than 90 s, and then it reaches saturation. In addition, more oxygen-containing and nitrogen-containing groups appear after extended plasma treatment time. They contribute to the improvement of the hydrophilicity and oxidation on the Cu surface.
Diffusion of torqued active particles
Sandoval, Mario; Lauga, Eric
2012-11-01
Motivated by swimming microorganisms whose trajectories are affected by the presence of an external torque, we calculate the diffusivity of an active particle subject to an external torque and in a fluctuating environment. The analytical results are compared with Brownian dynamics simulations showing excellent agreement between theory and numerical experiments. This work was funded in part by the Consejo Nacional de Ciencia y Tecnologia of Mexico (Conacyt postdoctoral fellowship to M. S.) and the US National Science Foundation (Grant CBET-0746285 to E.L.).
Diffuse Reflectance Spectroscopy for Surface Measurement of Liver Pathology.
Nilsson, Jan H; Reistad, Nina; Brange, Hannes; Öberg, Carl-Fredrik; Sturesson, Christian
2017-01-01
Liver parenchymal injuries such as steatosis, steatohepatitis, fibrosis, and sinusoidal obstruction syndrome can lead to increased morbidity and liver failure after liver resection. Diffuse reflectance spectroscopy (DRS) is an optical measuring method that is fast, convenient, and established. DRS has previously been used on the liver with an invasive technique consisting of a needle that is inserted into the parenchyma. We developed a DRS system with a hand-held probe that is applied to the liver surface. In this study, we investigated the impact of the liver capsule on DRS measurements and whether liver surface measurements are representative of the whole liver. We also wanted to confirm that we could discriminate between tumor and liver parenchyma by DRS. The instrumentation setup consisted of a light source, a fiber-optic contact probe, and two spectrometers connected to a computer. Patients scheduled for liver resection due to hepatic malignancy were included, and DRS measurements were performed on the excised liver part with and without the liver capsule and alongside a newly cut surface. To estimate the scattering parameters and tissue chromophore volume fractions, including blood, bile, and fat, the measured diffuse reflectance spectra were applied to an analytical model. In total, 960 DRS spectra from the excised liver tissue of 18 patients were analyzed. All factors analyzed regarding tumor versus liver tissue were significantly different. When measuring through the capsule, the blood volume fraction was found to be 8.4 ± 3.5%, the lipid volume fraction was 9.9 ± 4.7%, and the bile volume fraction was 8.2 ± 4.6%. No differences could be found between surface measurements and cross-sectional measurements. In measurements with/without the liver capsule, the differences in volume fraction were 1.63% (0.75-2.77), -0.54% (-2.97 to 0.32), and -0.15% (-1.06 to 1.24) for blood, lipid, and bile, respectively. This study shows that it is possible to manage DRS
Innovation diffusion on time-varying activity driven networks
Rizzo, Alessandro; Porfiri, Maurizio
2016-01-01
Since its introduction in the 1960s, the theory of innovation diffusion has contributed to the advancement of several research fields, such as marketing management and consumer behavior. The 1969 seminal paper by Bass [F.M. Bass, Manag. Sci. 15, 215 (1969)] introduced a model of product growth for consumer durables, which has been extensively used to predict innovation diffusion across a range of applications. Here, we propose a novel approach to study innovation diffusion, where interactions among individuals are mediated by the dynamics of a time-varying network. Our approach is based on the Bass' model, and overcomes key limitations of previous studies, which assumed timescale separation between the individual dynamics and the evolution of the connectivity patterns. Thus, we do not hypothesize homogeneous mixing among individuals or the existence of a fixed interaction network. We formulate our approach in the framework of activity driven networks to enable the analysis of the concurrent evolution of the interaction and individual dynamics. Numerical simulations offer a systematic analysis of the model behavior and highlight the role of individual activity on market penetration when targeted advertisement campaigns are designed, or a competition between two different products takes place.
International Nuclear Information System (INIS)
Lou, D.C.; Solberg, J.K.; Borvik, T.
2009-01-01
This paper deals with surface strengthening of steel plates using a self-protective diffusion paste. During the surface strengthening process, a paste containing carbon, boron or similar is applied on the steel surface. In addition to serving as a source for the various diffusion ingredients, the paste protects the steel against contact with the environment, so no packing or gas protection is necessary. Thus, the handling is in general very simple, and the surface strengthening process can be performed in a conventional air furnace. The method provides the same type of surface strengthening that is obtained by more conventional methods. In this work, the main focus will be surface strengthening by carburizing, but also boronizing and boronizing followed by carburizing have been tested out. The methods have been applied to increase the ballistic resistance of the low-strength carbon steel NVE36 (with nominal yield stress of 355 MPa) against impacts from small-arms bullets. An empirical model combining diffusion depth, heat-treatment temperature and soaking time was established on the basis of a series of experimental data. By means of this equation, the various heat-treatment parameters can be predicted when others are chosen. Ballistic perforation tests using 7.62 mm APM2 bullets showed that the low-strength carbon steel after surface strengthening obtained a ballistic limit higher than that of Hardox 400, which is a wear steel with a yield stress of about 1200 MPa.
Self-activated, self-limiting reactions on Si surfaces
DEFF Research Database (Denmark)
Morgen, Per; Hvam, Jeanette; Bahari, Ali
The direct thermally activated reactions of oxygen and ammonia with Si surfaces in furnaces have been used for a very long time in the semiconductor industry for the growth of thick oxides and nitride layers respectively. The oxidation mechanism was described in the Deal-Grove model as a diffusion...... mechanism for the direct growth of ultrathin films (0-3 nm) of oxides and nitrides under ultrahigh vacuum conditions. Neutral oxygen and a microwave excited nitrogen plasma interact directly with Si surfaces kept at different temperatures during the reaction. The gas pressures are around 10-6 Torr...... energy of an oxide system, which happened for an ordered structure, at a thickness of 0.7-0.8 nm. Thus this thin oxide structure has definite crystalline features. We have closely monitored the reaction kinetics with normal x-ray induced photoelectron spectroscopies, and also the structure, composition...
Energy Technology Data Exchange (ETDEWEB)
Brune, D; Lorenzen, J [AB Atomenergi, Nykoeping (Sweden); Witalis, E [Swedish National Defence Research Inst., Stockholm (Sweden)
1972-05-15
Depth distribution studies of carbon in steel and iron were carried out in the concentration range 0.05-1 %, using proton activation analysis. Surface content studies were performed in the concentration range 0.01-1 % using deuteron activation analysis. The following reactions were utilized: {sup 12}C(p,{gamma}){sup 13}N and {sup 12}C(d,n){sup 13}N Evaluations of depth distribution were based on resonances in the excitation function. The carbon content was determined with the aid of the positron emitter, {sup 13}N, using either single-peak or coincidence measurements. The heat dissipation in the irradiated region of the samples was calculated, and the temperature rise was measured using thermocouples. The temperature distribution within the hot zone subjected to irradiation by charged particles, together with the temperature distribution around this zone, was studied in order to estimate any effect this might have on the carbon diffusion. A device for automatic sample exchange which is remotely controlled is described.
International Nuclear Information System (INIS)
Brune, D.; Lorenzen, J.; Witalis, E.
1972-05-01
Depth distribution studies of carbon in steel and iron were carried out in the concentration range 0.05-1 %, using proton activation analysis. Surface content studies were performed in the concentration range 0.01-1 % using deuteron activation analysis. The following reactions were utilized: 12 C(p,γ) 13 N and 12 C(d,n) 13 N Evaluations of depth distribution were based on resonances in the excitation function. The carbon content was determined with the aid of the positron emitter, 13 N, using either single-peak or coincidence measurements. The heat dissipation in the irradiated region of the samples was calculated, and the temperature rise was measured using thermocouples. The temperature distribution within the hot zone subjected to irradiation by charged particles, together with the temperature distribution around this zone, was studied in order to estimate any effect this might have on the carbon diffusion. A device for automatic sample exchange which is remotely controlled is described
Lohmann, R.; Jurado Cojo, E.|info:eu-repo/dai/nl/325788227; Dijkstra, H.A.|info:eu-repo/dai/nl/073504467; Dachs, J.
2013-01-01
Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole
Energy Technology Data Exchange (ETDEWEB)
Lei, Huaping; Wang, Caizhuang; Yao, Yongxin; Hupalo, Myron [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Wang, Yangang [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Supercomputing Center of Computer Network Information Center, CAS, Beijing 100190 (China); McDougall, Dan; Tringides, Michael; Ho, Kaiming [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Department of Physics and Astronomy, Iowa State University, Ames, Iowa 50011 (United States)
2013-12-14
The adsorption, diffusion, and molecular dissociation of hydrogen on the biaxially strained Mg (0001) surface have been systematically investigated by the first principle calculations based on density functional theory. When the strain changes from the compressive to tensile state, the adsorption energy of H atom linearly increases while its diffusion barrier linearly decreases oppositely. The dissociation barrier of H{sub 2} molecule linearly reduces in the tensile strain region. Through the chemical bonding analysis including the charge density difference, the projected density of states and the Mulliken population, the mechanism of the strain effect on the adsorption of H atom and the dissociation of H{sub 2} molecule has been elucidated by an s-p charge transfer model. With the reduction of the orbital overlap between the surface Mg atoms upon the lattice expansion, the charge transfers from p to s states of Mg atoms, which enhances the hybridization of H s and Mg s orbitals. Therefore, the bonding interaction of H with Mg surface is strengthened and then the atomic diffusion and molecular dissociation barriers of hydrogen decrease accordingly. Our works will be helpful to understand and to estimate the influence of the lattice deformation on the performance of Mg-containing hydrogen storage materials.
Energy Technology Data Exchange (ETDEWEB)
Hama, Tetsuya; Kuwahata, Kazuaki; Watanabe, Naoki; Kouchi, Akira; Chigai, Takeshi [Institute of Low Temperature Science, Hokkaido University, Sapporo, Hokkaido 060-0819 (Japan); Kimura, Yuki [Department of Earth and Planetary Materials Science, Tohoku University, Sendai 980-8578 (Japan); Pirronello, Valerio, E-mail: hama@lowtem.hokudai.ac.jp [Dipartimento di Fisica e Astronomia, Universita' di Catania, I-95125 Catania, Sicily (Italy)
2012-10-01
To understand elementary processes leading to H{sub 2} formation, and the hydrogenation and deuteration reactions of adsorbed species on dust grains in dense clouds, we experimentally investigated the diffusion of atomic hydrogen and deuterium on amorphous solid water (ASW) at temperatures of 8-15 K. The present study extended our previous study for selective detections of H and D atoms, and of H{sub 2} (J = 0 and 1) and D{sub 2} (J = 0 and 1) molecules adsorbed on ASW using both photo-stimulated desorption and resonance-enhanced multiphoton ionization, to investigate potential sites on ASW for diffusion, recombination dynamics, and the diffusion mechanism of H and D atoms. Our results demonstrate that the ASW surface contains various potential sites that can be categorized into at least three groups: very shallow, middle-, and deep-potential sites, with diffusion activation energies of {<=}18, 22 (23 meV for D atoms), and {>=}30 meV, respectively. The present study pictured the outline of H{sub 2} formation on cosmic ice dust at low temperatures: H atoms landing on the dust will diffuse rapidly at the abundant shallow and middle sites on ASW, and finally become trapped at deep sites. The H atoms that arrive next recombine with such trapped H atoms to yield H{sub 2} molecules. The small isotopic difference between the diffusion of H and D atoms on ASW indicates that the diffusion mechanism can be explained by thermal hopping, at least at middle-potential sites.
International Nuclear Information System (INIS)
Cucumo, M.; De Rosa, A.; Ferraro, V.; Kaliakatsos, D.; Marinelli, V.
2009-01-01
Measurements of natural global and diffuse illuminance on four vertical surfaces exposed to north, east, south and west have been carried out at Arcavacata di Rende (Italy). In the work the mean hourly values of the global and diffuse luminous efficacy measured in the period of a year are presented. The hourly data have been compared with the predictions of many calculation models. The comparisons show that, for global efficacy, the differences among the various models are not significant, and the use of a model with a constant value of efficacy gives good predictions of global illuminance. For the prediction of diffuse illuminance the different models behave in a similar way if their coefficients are recalculated and, again, the use of a constant diffuse efficacy provides a good estimate of diffuse illuminance on vertical surfaces
Memory Effects and Coverage Dependence of Surface Diffusion in a Model Adsorption System
DEFF Research Database (Denmark)
Vattulainen, Ilpo Tapio; Ying, S. C.; Ala-Nissila, T.
1999-01-01
in tracer and collective diffusion. We show that memory effects can be very pronounced deep inside the ordered phases and in regions close to first and second order phase transition boundaries. Particular attention is paid to the details of the time dependence of memory effects. The memory effect in tracer......We study the coverage dependence of surface diffusion coefficients for a strongly interacting adsorption system O/W(110) via Monte Carlo simulations of a lattice-gas model. In particular, we consider the nature and emergence of memory effects as contained in the corresponding correlation factors...... diffusion is found to decay following a power law after an initial transient period. This behavior persists until the hydrodynamic regime is reached, after which the memory effect decays exponentially. The time required to reach the hydrodynamical regime and the related exponential decay is strongly...
Taoka, Toshiaki; Masutani, Yoshitaka; Kawai, Hisashi; Nakane, Toshiki; Matsuoka, Kiwamu; Yasuno, Fumihiko; Kishimoto, Toshifumi; Naganawa, Shinji
2017-01-01
Purpose: The activity of the glymphatic system is impaired in animal models of Alzheimer’s disease (AD). We evaluated the activity of the human glymphatic system in cases of AD with a diffusion-based technique called diffusion tensor image analysis along the perivascular space (DTI-ALPS). Materials and methods: Diffusion tensor images were acquired to calculate diffusivities in the x, y, and z axes of the plane of the lateral ventricle body in 31 patients. We evaluated the diffusivity along t...
Kourmouli, Angeliki; Valenti, Marco; van Rijn, Erwin; Beaumont, Hubertus J. E.; Kalantzi, Olga-Ioanna; Schmidt-Ott, Andreas; Biskos, George
2018-03-01
The use of disc diffusion susceptibility tests to determine the antibacterial activity of engineered nanoparticles (ENPs) is questionable because their low diffusivity practically prevents them from penetrating through the culture media. In this study, we investigate the ability of such a test, namely the Kirby-Bauer disc diffusion test, to determine the antimicrobial activity of Au and Ag ENPs having diameters from 10 to 40 nm on Escherichia coli cultures. As anticipated, the tests did not show any antibacterial effects of Au nanoparticles (NPs) as a result of their negligible diffusivity through the culture media. Ag NPs on the other hand exhibited a strong antimicrobial activity that was independent of their size. Considering that Ag, in contrast to Au, dissolves upon oxidation and dilution in aqueous solutions, the apparent antibacterial behavior of Ag NPs is attributed to the ions they release. The Kirby-Bauer method, and other similar tests, can therefore be employed to probe the antimicrobial activity of ENPs related to their ability to release ions rather than to their unique size-dependent properties. [Figure not available: see fulltext.
Modeling diffuse sources of surface water contamination with plant protection products
Wendland, Sandra; Bock, Michael; Böhner, Jürgen; Lembrich, David
2015-04-01
Entries of chemical pollutants in surface waters are a serious environmental problem. Among water pollutants plant protection products (ppp) from farming practice are of major concern not only for water suppliers and environmental agencies, but also for farmers and industrial manufacturers. Lost chemicals no longer fulfill their original purpose on the field, but lead to severe damage of the environment and surface waters. Besides point-source inputs of chemical pollutants, the diffuse-source inputs from agricultural procedures play an important and not yet sufficiently studied role concerning water quality. The two most important factors for diffuse inputs are erosion and runoff. The latter usually occurs before erosion begins, and is thus often not visible in hindsight. Only if it has come to erosion, it is obvious to expect runoff in foresight at this area, too. In addition to numerous erosion models, there are also few applications to model runoff processes available. However, these conventional models utilize approximations of catchment parameters based on long-term average values or theoretically calculated concentration peaks which can only provide indications to relative amounts. Our study aims to develop and validate a simplified spatially-explicit dynamic model with high spatiotemporal resolution that enables to measure current and forecast runoff potential not only at catchment scale but field-differentiated. This method allows very precise estimations of runoff risks and supports risk reduction measures to be targeted before fields are treated. By focusing on water pathways occurring on arable land, targeted risk reduction measures like buffer strips at certain points and adapted ppp use can be taken early and pollution of rivers and other surface waters through transported pesticides, fertilizers and their products could be nearly avoided or largely minimized. Using a SAGA-based physical-parametric modeling approach, major factors influencing runoff
Carbon diffusion behavior in molybdenum at relatively low temperatures
Energy Technology Data Exchange (ETDEWEB)
Hiraoka, Yutaka, E-mail: hiraoka@dap.ous.ac.j [Department of Applied Physics, Okayama University of Science, 1-1 Ridai-cho, Okayama 700-0005 (Japan); Imamura, Kyosuke [Graduate School of Science, Okayama University of Science, 1-1 Ridai-cho, Okayama 700-0005 (Japan); Kadokura, Takanori; Yamamoto, Yoshiharu [Materials Research Department, A.L.M.T. Corp., 2 Iwasekoshi-machi, Toyama 931-8543 (Japan)
2010-01-07
Purpose of this study is to investigate the carbon diffusion behavior in pure molybdenum at relatively low temperatures by means of fracture surface observation. Carbon addition was performed at a temperature of 1273-1373 K with the heating time being changed. Fracture surface of the specimen after carbon addition was examined using SEM and the carbon diffusion distance was estimated from the change of fracture mode as a function of the distance from the surface. Results are summarized as follows. First, the carbon diffusion distance increased approximately linearly with the increase of heating time from 1.2 to 10.8 ks. This relationship does not agree with that obtained at much higher temperatures. From Arrhenius plots of the slope of the straight line and the temperature, activation energy was calculated (155 kJ/mol). Secondly, the carbon diffusion distance estimated in this study was generally larger than that simulated using the data of Rudman, particularly at a longer heating time.
Diffusion behavior in the films of Nb-Ti systems
International Nuclear Information System (INIS)
Yoshitake, Michiko; Yoshihara, Kazuhiro
1990-01-01
The diffusion behavior of substrate element into a deposited film was investigated. The observed systems were a Nb film/Ti substrate and a Ti film/Nb substrate. When the Nb film/Ti substrate was heated in a vacuum, Ti diffused very rapidly in the Nb film. The pre-exponential factor of the diffusion constant of Ti in the Nb film was 5.6x10 -2 m 2 s -1 , and the activation energy was 220 kJmol -1 . The observed activation energy is about 60% of that of Ti in the bulk Nb. On the other hand, when the Ti film/Nb substrate was heated in a vacuum, Nb did not diffuse so rapidly. Titanium diffused through the Nb film rapidly and was concentrated on the surface of the Nb film. The chemical state of the concentrated Ti was metallic, and neither titanium oxides nor titanium carbide was observed. Therefore, the driving force of the rapid diffusion of Ti in the Nb film is considered as the reduction of the surface energy of Nb film. The difference in the diffusion behavior between Ti through the Nb film and Nb through the Ti film is explained supposing that the segregation of Ti reduces the surface energy of the Nb film but the segregation of Nb does not reduce the surface energy of the Ti film. After heating of the Nb film/Ti substrate for a long time, a new phase was formed at the interface between the Nb film and the Ti substrate. The chemical composition of the new phase is about 50% of Ti and 50% of Nb. This phase has not been reported in the phase diagram of the bulk Ti-Nb system. The surface area of the Nb film is considered to be quite large, so the contribution of surface energy to the thermodynamic state of the Nb film cannot be neglected. Therefore, the chemical potential of the film is different from that of the bulk. Then, the new phase, which does not exist in the phase diagram of the bulk system, is formed by an interaction of the films. (author)
[A correlation between diffusion kurtosis imaging and the proliferative activity of brain glioma].
Tonoyan, A S; Pronin, I N; Pitshelauri, D I; Shishkina, L V; Fadeeva, L M; Pogosbekyan, E L; Zakharova, N E; Shults, E I; Khachanova, N V; Kornienko, V N; Potapov, A A
2015-01-01
The aim of the study was to assess the capabilities of diffusion kurtosis imaging (DKI) in diagnosis of the glioma proliferative activity and to evaluate a relationship between the glioma proliferative activity index and diffusion parameters of the contralateral normal appearing white matter (CNAWM). The study included 47 patients with newly diagnosed brain gliomas (23 low grade, 13 grade III, and 11 grade IV gliomas). We determined a relationship between absolute and normalized parameters of the diffusion tensor (mean (MD), axial (AD), and radial (RD) diffusivities; fractional (FA) and relative (RA) anisotropies) and diffusion kurtosis (mean (MK), axial (AK), and radial (RK) kurtosis; kurtosis anisotropy (KA)) and the proliferative activity index in the most malignant glioma parts (pAK, and RK) and anisotropy (KA, FA, RA) values increased, and diffusivity (MD, AD, RD) values decreased as the glioma proliferative activity index increased. A strong correlation between the proliferative activity index and absolute RK (r=0,71; p=0.000001) and normalized values of MK (r=0.8; p=0.000001), AK (r=0.71; p=0.000001), RK (r=0.81; p=0.000001), and RD (r=-0.71; p=0.000001) was found. A weak, but statistically significant correlation between the glioma proliferative activity index and diffusion values RK (r=-0.36; p=0.014), KA (r=-0.39; p=0.007), RD (r=0.35; p=0.017), FA (r=-0.42; p=0.003), and RA (r=-0.41; p=0.004) of CNAWM was found. DKI has good capabilities to detect immunohistochemical changes in gliomas. DKI demonstrated a high sensitivity in detection of microstructural changes in the contralateral normal appearing white matter in patients with brain gliomas.
Kojic, M; Milosevic, M; Kojic, N; Kim, K; Ferrari, M; Ziemys, A
2014-02-01
Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts.
International Nuclear Information System (INIS)
Seddeek, M.A.; Abdelmeguid, M.S.
2006-01-01
The effect of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux has been studied. The thermal diffusivity is assumed to vary as a linear function of temperature. The governing partial differential equations have been transformed to ordinary differential equations. The exact analytical solution for the velocity and the numerical solution for the temperature field are given. Numerical solutions are obtained for different values of variable thermal diffusivity, radiation, temperature parameter and Prandtl number
Tracer gas diffusion sampling test plan
International Nuclear Information System (INIS)
Rohay, V.J.
1993-01-01
Efforts are under way to employ active and passive vapor extraction to remove carbon tetrachloride from the soil in the 200 West Area an the Hanford Site as part of the 200 West Area Carbon Tetrachloride Expedited Response Action. In the active approach, a vacuum is applied to a well, which causes soil gas surrounding the well to be drawn up to the surface. The contaminated air is cleaned by passage through a granular activated carbon bed. There are questions concerning the radius of influence associated with application of the vacuum system and related uncertainties about the soil-gas diffusion rates with and without the vacuum system present. To address these questions, a series of tracer gas diffusion sampling tests is proposed in which an inert, nontoxic tracer gas, sulfur hexafluoride (SF 6 ), will be injected into a well, and the rates of SF 6 diffusion through the surrounding soil horizon will be measured by sampling in nearby wells. Tracer gas tests will be conducted at sites very near the active vacuum extraction system and also at sites beyond the radius of influence of the active vacuum system. In the passive vapor extraction approach, barometric pressure fluctuations cause soil gas to be drawn to the surface through the well. At the passive sites, the effects of barometric ''pumping'' due to changes in atmospheric pressure will be investigated. Application of tracer gas testing to both the active and passive vapor extraction methods is described in the wellfield enhancement work plan (Rohay and Cameron 1993)
Anisotropy in diffusion and activation energies of I- and CS+ ions in compacted smectite
International Nuclear Information System (INIS)
Haruo Sato
2005-01-01
The anisotropies and the effect of salinity in the apparent diffusivities (D a ) and activation energies (ΔE a ) of I - and Cs + in compacted Na-smectite were studied. The diffusion experiments in the parallel and perpendicular directions to the orientated direction of smectite particles were performed as a function of smectite's dry density (0.9-1.4 Mg/m 3 ), salinity ([NaCl]=0.01, 0.51 M) and temperature (295-333 K). The Da-values for both ions tended to be higher in the parallel direction than in the perpendicular direction to the orientated direction of smectite particles. The Da-values of I - in the parallel direction decreased with increasing salinity only at low-dry density, but those of Cs + increased with increasing salinity in all conditions. Considering electrostatic effect from the surface of smectite aggregates and the change in tortuosity on dry density, salinity and diffusion direction, I - is interpreted to mainly diffuse in interstitial pores. While, Cs + can diffuse in both interlayer and interstitial pores, and the Da-values of Cs + are presumed to have elevated by the decrease in retardation by competition with Na + . The ΔE a -values of I - , similar levels (ΔE a =15.1-16.1 kJ/mol) to that of the ionic diffusivity in free water (Do) for I - (ΔE a =17.36 kJ/mol) at low-dry density, increased with increasing dry density. On the contrary, the ΔE a -values of Cs + , clearly higher (ΔE a =23.7-25.7 kJ/mol) than that of the Do for Cs + (ΔE a =16.47 kJ/mol) even at low-dry density, increased with increasing dry density. Such high ΔE a -values for Cs + can be explained by considering the ion exchange enthalpy between Cs + and Na + in smectite (ΔH 0 = -11.1 kJ/mol) at low-dry density, and are considered to be due to the effects of the decrease in the activity of porewater and ΔH 0 at high-dry density. (authors)
Diffusion Influenced Adsorption Kinetics.
Miura, Toshiaki; Seki, Kazuhiko
2015-08-27
When the kinetics of adsorption is influenced by the diffusive flow of solutes, the solute concentration at the surface is influenced by the surface coverage of solutes, which is given by the Langmuir-Hinshelwood adsorption equation. The diffusion equation with the boundary condition given by the Langmuir-Hinshelwood adsorption equation leads to the nonlinear integro-differential equation for the surface coverage. In this paper, we solved the nonlinear integro-differential equation using the Grünwald-Letnikov formula developed to solve fractional kinetics. Guided by the numerical results, analytical expressions for the upper and lower bounds of the exact numerical results were obtained. The upper and lower bounds were close to the exact numerical results in the diffusion- and reaction-controlled limits, respectively. We examined the validity of the two simple analytical expressions obtained in the diffusion-controlled limit. The results were generalized to include the effect of dispersive diffusion. We also investigated the effect of molecular rearrangement of anisotropic molecules on surface coverage.
Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO
International Nuclear Information System (INIS)
Pal, Subrata; Maiti, Prabal K; Bagchi, Biman
2005-01-01
We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics
Detection of 41Ar diffusion from a TRIGA pool
International Nuclear Information System (INIS)
Foss, Scott; Nelson, George
1990-01-01
Argon-41 levels in very low concentrations in the reactor room air can be inferred from the rate of escape from the pool water surface. The rate of Argon-41 diffusion from pool water to room air was determined by the measurement of the activity buildup in containers of air in contact with the pool surface. The Argon-41 concentration in each container was measured by gamma-ray spectrometry with a calibrated GeLi detector. At 100 KW power with the water temperature at 10 deg. Celsius the total release of Argon-41 was determined to be 3.5e10±15% atoms for 80 minutes of operation. The corresponding activity released from the pool was 98.6 microcuries, while the total activity produced in the pool was 4900 microcuries. The diffusion coefficient of Argon-41 from the pool water surface to the air at this temperature was measured to be 3.14e-14 sec-cm 2 . (author)
Active Teaching of Diffusion through History of Science, Computer Animation and Role Playing
Krajsek, Simona Strgulc; Vilhar, Barbara
2010-01-01
We developed and tested a lesson plan for active teaching of diffusion in secondary schools (grades 10-13), which stimulates understanding of the thermal (Brownian) motion of particles as the principle underlying diffusion. During the lesson, students actively explore the Brownian motion through microscope observations of irregularly moving small…
Diffusion of small Cu islands on the Ni(111) surface: A self-learning kinetic Monte Carlo study
Acharya, Shree Ram; Shah, Syed Islamuddin; Rahman, Talat S.
2017-08-01
We elucidate the diffusion kinetics of a heteroepitaxial system consisting of two-dimensional small (1-8 atoms) Cu islands on the Ni(111) surface at (100-600) K using the Self-Learning Kinetic Monte Carlo (SLKMC-II) method. Study of the statics of the system shows that compact CuN (3≤N≤8) clusters made up of triangular units on fcc occupancy sites are the energetically most stable structures of those clusters. Interestingly, we find a correlation between the height of the activation energy barrier (Ea) and the location of the transition state (TS). The Ea of processes for Cu islands on the Ni(111) surface are in general smaller than those of their counterpart Ni islands on the same surface. We find this difference to correlate with the relative strength of the lateral interaction of the island atoms in the two systems. While our database consists of hundreds of possible processes, we identify and discuss the energetics of those that are the most dominant, or are rate-limiting, or most contributory to the diffusion of the islands. Since the Ea of single- and multi-atom processes that convert compact island shapes into non-compact ones are larger (with a significantly smaller Ea for their reverse processes) than that for the collective (concerted) motion of the island, the later dominate in the system kinetics - except for the cases of the dimer, pentamer and octamer. Short-jump involving one atom, long jump dimer-shearing, and long-jump corner shearing (via a single-atom) are, respectively, the dominating processes in the diffusion of the dimer, pentamer and octamer. Furthermore single-atom corner-rounding are the rate-limiting processes for the pentamer and octamer islands. Comparison of the energetics of selected processes and lateral interactions obtained from semi-empirical interatomic potentials with those from density functional theory show minor quantitative differences and overall qualitative agreement.
Surface diffusion coefficient of Au atoms on single layer graphene grown on Cu
Energy Technology Data Exchange (ETDEWEB)
Ruffino, F., E-mail: francesco.ruffino@ct.infn.it; Cacciato, G.; Grimaldi, M. G. [Dipartimento di Fisica ed Astronomia-Universitá di Catania, via S. Sofia 64, 95123 Catania, Italy and MATIS IMM-CNR, via S. Sofia 64, 95123 Catania (Italy)
2014-02-28
A 5 nm thick Au film was deposited on single layer graphene sheets grown on Cu. By thermal processes, the dewetting phenomenon of the Au film on the graphene was induced so to form Au nanoparticles. The mean radius, surface-to-surface distance, and surface density evolution of the nanoparticles on the graphene sheets as a function of the annealing temperature were quantified by scanning electron microscopy analyses. These quantitative data were analyzed within the classical mean-field nucleation theory so to obtain the temperature-dependent Au atoms surface diffusion coefficient on graphene: D{sub S}(T)=[(8.2±0.6)×10{sup −8}]exp[−(0.31±0.02(eV)/(at) )/kT] cm{sup 2}/s.
Diffraction and diffusion in room acoustics
DEFF Research Database (Denmark)
Rindel, Jens Holger; Rasmussen, Birgit
1996-01-01
Diffraction and diffusion are two phenomena that are both related to the wave nature of sound. Diffraction due to the finite size of reflecting surfaces and the design of single reflectors and reflector arrays are discussed. Diffusion is the result of scattering of sound reflected from surfaces...... that are not plane but curved or irregular. The importance of diffusion has been demonstrated in concert halls. Methods for the design of diffusing surfaces and the development of new types of diffusers are reviewed. Finally, the importance of diffraction and diffusion in room acoustic computer models is discussed....
Global, direct and diffuse solar radiation on horizontal and tilted surfaces in Jeddah, Saudi Arabia
International Nuclear Information System (INIS)
El-Sebaii, A.A.; Al-Hazmi, F.S.; Al-Ghamdi, A.A.; Yaghmour, S.J.
2010-01-01
The measured data of global and diffuse solar radiation on a horizontal surface, the number of bright sunshine hours, mean daily ambient temperature, maximum and minimum ambient temperatures, relative humidity and amount of cloud cover for Jeddah (lat. 21 o 42'37''N, long. 39 o 11'12''E), Saudi Arabia, during the period (1996-2007) are analyzed. The monthly averages of daily values for these meteorological variables have been calculated. The data are then divided into two sets. The sub-data set I (1996-2004) are employed to develop empirical correlations between the monthly average of daily global solar radiation fraction (H/H 0 ) and the various weather parameters. The sub-data set II (2005-2007) are then used to evaluate the derived correlations. Furthermore, the total solar radiation on horizontal surfaces is separated into the beam and diffuses components. Empirical correlations for estimating the diffuse solar radiation incident on horizontal surfaces have been proposed. The total solar radiation incident on a tilted surface facing south H t with different tilt angles is then calculated using both Liu and Jordan isotropic model and Klucher's anisotropic model. It is inferred that the isotropic model is able to estimate H t more accurate than the anisotropic one. At the optimum tilt angle, the maximum value of H t is obtained as ∼36 (MJ/m 2 day) during January. Comparisons with 22 years average data of NASA SSE Model showed that the proposed correlations are able to predict the total annual energy on horizontal and tilted surfaces in Jeddah with a reasonable accuracy. It is also found that at Jeddah, the solar energy devices have to be tilted to face south with a tilt angle equals the latitude of the place in order to achieve the best performance all year round.
1992-11-01
is more compact relative to that in the [001] direction. Detailed MD studies (De Lorenzi, Jacucci, and Pontikis 1982), using Lennard-Jones...Jacucci, and Pontikis 1982) have shown that the predominance of the adatom exchange mechanism results in nearly isotropic diffusion which is further...G., G. Jacucci, and V. Pontikis . Surface Science, vol. 116, p. 391, 1982. Doll, J. D., and A. F. Voter. Ann. Rev. Phys. Chem., vol. 38, p. 413, 1987
International Nuclear Information System (INIS)
Zhang, De-Long; Zhang, Qun; Zhang, Pei; Kang, Jian; Wong, Wing-Han; Yu, Dao-Yin
2016-01-01
Graphical abstract: Diffusion growth of Ga"3"+-doped LiTaO_3(LT) thin film was studied thermodynamically. Some Ga"3"+-doped LT thin films were grown on LT surface by in-diffusion of homogeneously coated Ga_2O_3 film at the temperature range of (1273 to 1473) K. The Ga"3"+ profile in the grown thin film was analyzed by secondary ion mass spectrometry. Form the measured Ga"3"+ profiles, some thermodynamic parameters were obtained. These include diffusivity, diffusion constant, chemical activation energy, solubility, solubility constant and enthalpy of solution. These parameters are crucial to design and growth of a Ga"3"+-doped LT thin film with desired Ga"3"+ profile for integrated optics application. A thermodynamic model is suggested for the growth and verified experimentally. - Highlights: • Diffusion growth of Ga"3"+-doped LiTaO_3 thin film were studied thermodynamically. • Diffusion constant is 1.41 · 10"−"6 m"2/s and activation energy is 237.2 kJ/mol. • Solubility constant is 22.9 · 10"2"6 ions/m"3 and enthalpy of solution is 28.9 kJ/mol. • Ga"3"+ dopant has small effect on LiTaO_3 refractive index. • Ga"3"+ growth can be described by a Fick-type equation with a constant diffusivity. - Abstract: A thermodynamic study was performed on diffusion growth of Ga"3"+-doped LiTaO_3(LT) thin film for integrated optics. Some Ga"3"+-doped LT thin films were grown on LT surface by in-diffusion of homogeneously coated Ga_2O_3 film at the temperature range of (1273 to 1473) K. After growth, the refractive indices at Ga"3"+-doped and un-doped surface parts were measured by prism coupling technique and Li composition there was evaluated from the measured refractive indices. The results show that Ga"3"+ dopant has small effect on the LT index. Li_2O out-diffusion is not measurable. The Ga"3"+ profile in the grown thin film was analysed by secondary ion mass spectrometry. It is found that the grown Ga"3"+ ions follow a complementary error function profile. A
Kojic, M.; Milosevic, M.; Kojic, N.; Kim, K.; Ferrari, M.; Ziemys, A.
2014-01-01
Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts. PMID:24578582
Zhang, Wei; Gan, Jie; Li, Qian; Gao, Kun; Sun, Jian; Xu, Ning; Ying, Zhifeng; Wu, Jiada
2011-06-01
The self-diffusion dynamics of Cu adatoms on Cu(1 0 0) surface has been studied based on the calculation of the energy barriers for various hopping events using lattice-gas based approach and a modified model. To simplify the description of the interactions and the calculation of the energy barrier, a three-tier hierarchy of description of atomic configurations was conceived in which the active adatom and its nearest atoms were chosen to constitute basic configuration and taken as a whole to study many-body interactions of the atoms in various atomic configurations, whereas the impacts of the next nearest atoms on the diffusion of the active adatom were considered as multi-site interactions. Besides the simple hopping of single adatoms, the movements of dimers and trimers as the results of multiple hopping events have also been examined. Taking into account the hopping events of all adatoms, the stability of atomic configurations has been examined and the evolution of atomic configurations has also been analyzed.
International Nuclear Information System (INIS)
Zhang Wei; Gan Jie; Li Qian; Gao Kun; Sun Jian; Xu Ning; Ying Zhifeng; Wu Jiada
2011-01-01
The self-diffusion dynamics of Cu adatoms on Cu(1 0 0) surface has been studied based on the calculation of the energy barriers for various hopping events using lattice-gas based approach and a modified model. To simplify the description of the interactions and the calculation of the energy barrier, a three-tier hierarchy of description of atomic configurations was conceived in which the active adatom and its nearest atoms were chosen to constitute basic configuration and taken as a whole to study many-body interactions of the atoms in various atomic configurations, whereas the impacts of the next nearest atoms on the diffusion of the active adatom were considered as multi-site interactions. Besides the simple hopping of single adatoms, the movements of dimers and trimers as the results of multiple hopping events have also been examined. Taking into account the hopping events of all adatoms, the stability of atomic configurations has been examined and the evolution of atomic configurations has also been analyzed.
Active Flow Control in an Aggressive Transonic Diffuser
Skinner, Ryan W.; Jansen, Kenneth E.
2017-11-01
A diffuser exchanges upstream kinetic energy for higher downstream static pressure by increasing duct cross-sectional area. The resulting stream-wise and span-wise pressure gradients promote extensive separation in many diffuser configurations. The present computational work evaluates active flow control strategies for separation control in an asymmetric, aggressive diffuser of rectangular cross-section at inlet Mach 0.7 and Re 2.19M. Corner suction is used to suppress secondary flows, and steady/unsteady tangential blowing controls separation on both the single ramped face and the opposite flat face. We explore results from both Spalart-Allmaras RANS and DDES turbulence modeling frameworks; the former is found to miss key physics of the flow control mechanisms. Simulated baseline, steady, and unsteady blowing performance is validated against experimental data. Funding was provided by Northrop Grumman Corporation, and this research used resources of the Argonne Leadership Computing Facility, which is a DOE Office of Science User Facility supported under Contract DE-AC02-06CH11357.
Energy Technology Data Exchange (ETDEWEB)
Lawrenz, M.
2007-10-30
In the present work the dynamics of CO-molecules on a stepped Pt(111)-surface induced by fs-laser pulses at low temperatures was studied by using laser spectroscopy. In the first part of the work, the laser-induced diffusion for the CO/Pt(111)-system could be demonstrated and modelled successfully for step diffusion. At first, the diffusion of CO-molecules from the step sites to the terrace sites on the surface was traced. The experimentally discovered energy transfer time of 500 fs for this process confirms the assumption of an electronically induced process. In the following it was explained how the experimental results were modelled. A friction coefficient which depends on the electron temperature yields a consistent model, whereas for the understanding of the fluence dependence and time-resolved measurements parallel the same set of parameters was used. Furthermore, the analysis was extended to the CO-terrace diffusion. Small coverages of CO were adsorbed to the terraces and the diffusion was detected as the temporal evolution of the occupation of the step sites acting as traps for the diffusing molecules. The additional performed two-pulse correlation measurements also indicate an electronically induced process. At the substrate temperature of 40 K the cross-correlation - where an energy transfer time of 1.8 ps was extracted - suggests also an electronically induced energy transfer mechanism. Diffusion experiments were performed for different substrate temperatures. (orig.)
Li, Xiaofan; Nie, Qing
2009-07-01
Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratures along with an extrapolation technique, leading to an arbitrarily high-order quadrature; in addition, a high-order (temporal) integration factor method, based on explicit representation of the mean curvature, is used to reduce the stability constraint on time-step. To apply this method to a periodic (in axial direction) and axi-symmetric elastically stressed cylinder, we also present a fast and accurate summation method for the periodic Green's functions of isotropic elasticity. Using the high-order boundary integral method, we demonstrate that in absence of elasticity the cylinder surface pinches in finite time at the axis of the symmetry and the universal cone angle of the pinching is found to be consistent with the previous studies based on a self-similar assumption. In the presence of elastic stress, we show that a finite time, geometrical singularity occurs well before the cylindrical solid collapses onto the axis of symmetry, and the angle of the corner singularity on the cylinder surface is also estimated.
DEFF Research Database (Denmark)
Tripkovic, Vladimir; Hansen, Heine Anton; Rossmeisl, Jan
2015-01-01
driving force for surface segregation, diffusion to defects or surface self-assembling. On the basis of stability and activity analysis we conclude that the near surface alloy of Pd in Pt and some PdAu binary and PtPdAu ternary thin films with a controlled amount of Au are the best catalysts for oxygen......Further advances in fuel cell technologies are hampered by kinetic limitations associated with the sluggish cathodic oxygen reduction reaction. We have investigated a range of different formulations of binary and ternary Pt, Pd and Au thin films as electrocatalysts for oxygen reduction. The most...... active binary thin films are near-surface alloys of Pt with subsurface Pd and certain PdAu and PtAu thin films with surface and/or subsurface Au. The most active ternary thin films are with pure metal Pt or Pd skins with some degree of Au in the surface and/or subsurface layer and the near-surface alloys...
Prediction Of Abrasive And Diffusive Tool Wear Mechanisms In Machining
Rizzuti, S.; Umbrello, D.
2011-01-01
Tool wear prediction is regarded as very important task in order to maximize tool performance, minimize cutting costs and improve the quality of workpiece in cutting. In this research work, an experimental campaign was carried out at the varying of cutting conditions with the aim to measure both crater and flank tool wear, during machining of an AISI 1045 with an uncoated carbide tool P40. Parallel a FEM-based analysis was developed in order to study the tool wear mechanisms, taking also into account the influence of the cutting conditions and the temperature reached on the tool surfaces. The results show that, when the temperature of the tool rake surface is lower than the activation temperature of the diffusive phenomenon, the wear rate can be estimated applying an abrasive model. In contrast, in the tool area where the temperature is higher than the diffusive activation temperature, the wear rate can be evaluated applying a diffusive model. Finally, for a temperature ranges within the above cited values an adopted abrasive-diffusive wear model furnished the possibility to correctly evaluate the tool wear phenomena.
International Nuclear Information System (INIS)
Wang, Zhiwen; Guo, Xinjun; Wu, Mingyi; Sun, Qiang; Jia, Yu
2014-01-01
First-principles calculations within the density functional theory (DFT) have been carried out to study hydrogen molecules dissociation and diffusion on clean and transition metals (TMs) doped Mg(0 0 0 1) surfaces following Pozzo et al. work. Firstly, the stability of Mg(0 0 0 1) surface doped with transition metals atom has been studied. The results showed that transition metals on the left of the table tend to substitute Mg in the second layer, while the other transition metals prefer to substitute Mg in the first layer. Secondly, we studied hydrogen molecules dissociation and diffusion on clean and Mg(0 0 0 1) surfaces which the transition metal atoms substituted both in the first layer and second layer. When transition metal atoms substitute in the first layer, the results agree with the Pozzo et al. result; when transition metal atoms substitute in the second layer, the results showed that the transition metals on the left of the periodic table impact on the dissociation barriers is less. However, for the transition metals (Mn, Fe, Co, Ni) on the right, there is a great impact on the barriers. The transition metals doped surfaces bind the dissociated H atoms loosely, making them easily diffused. The results further reveal that the Fe dopant on the Mg surface is the best choice for H 2 dissociation and hydrogen storage.
Kourmouli, A.; Valenti, M.; van Rijn, E.; Beaumont, H.J.E.; Kalantzi, Olga Ioanna; Schmidt-Ott, A.; Biskos, G.
2018-01-01
The use of disc diffusion susceptibility tests to determine the antibacterial activity of engineered nanoparticles (ENPs) is questionable because their low diffusivity practically prevents them from penetrating through the culture media. In this study, we investigate the ability of such a test,
Determination of activation energy of hydrogen diffusion in Zr-2.5%Nb alloy
International Nuclear Information System (INIS)
Chandra, Komal; Kulkarni, A.S.; Ramanjaneyulu, P.S.; Yadav, C.S.; Saxena, M.K.; Tomar, B.S.; Ramakumar, K.L.; Sunil, Sourav; Singh, R.N.
2013-01-01
The present paper describes the study on the determination of diffusion coefficient of hydrogen in Zr-2.5%Nb alloy. Hydrogen was charged on Zr-2.5% Nb alloy electrolytically. After annealing at required temperature, hydrogen concentration at various depths from the charged end was determined employing hot vacuum extraction-quadrupole mass spectrometer (HVE-QMS). The depth profile was used to obtain the diffusion coefficient employing Fick's second law of diffusion. From the Arrhenius relation between diffusion coefficient and temperature, activation energy of hydrogen diffusion was calculated. (author)
International Nuclear Information System (INIS)
Zhang, Tao; Guo, Zhansheng
2014-01-01
The effects of electrode properties and fabricated pressure on Li ion diffusion and diffusion-induced stress in a cylindrical Li-ion battery are studied. It is found that hydrostatic pressure or elastic modulus variation in the active layer have little effect on the distribution of Li ions for a higher diffusivity coefficient, but both can facilitate Li ion diffusion for a lower diffusivity coefficient. The elastic modulus variation has a significant effect on the distribution of stress and hydrostatic pressure can reduce the surface stress for the lower diffusivity coefficient. A higher charging rate causes a more transient response in the stress history, but a linear charging history is observed for slow charging rates. A higher charging rate would not inflict extra damage on the electrode for the higher diffusivity coefficient and the stress history becomes highly transient and charging rate dependent for the lower diffusivity coefficient. The effect of fabricated pressure can be neglected. (paper)
Self-diffusion dynamics processes relevant to 2D homoepitaxy growth of Ni adatom on Ni(111) surface
Energy Technology Data Exchange (ETDEWEB)
Liu, Fusheng [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Chen, Yifeng, E-mail: yefengc63@sina.com [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Wang, Yufei, E-mail: yejin802@126.com [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Liu, Zhulin; Hu, Zhongliang [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Yang, Xiyuan [Department of Physics, Hunan University of Arts and Science, Changde 415000 (China); Luo, Wenhua [Department of Physics and Electronic Information Science, Hunan Institute of Science and Technology, Yueyang 414006 (China)
2014-07-01
Using molecular dynamics and modified analytic embedded atom methods, the atomic self-diffusion dynamics behaviors relevant to 2D crystal growth on Ni(111) surface have been studied between 150 and 600 K. On perfect Ni(111) surface, the activation energy and prefactor are 0.058±0.001 eV and 4.2×10{sup −4} cm{sup 2}/s between 150 and 350 K, and 0.082±0.003 eV and 7.8×10{sup −4} cm{sup 2}/s from 400 to 600 K. Ni adatom just hops along the directions of close-packed steps on stepped Ni(111) surface, the corresponding activation energies and prefactors are 0.188±0.002 eV and (3.8–4.4)×10{sup −3} cm{sup 2}/s along the direction of A-type step, 0.140±0.001 eV and (1.1–1.2)×10{sup −3} cm{sup 2}/s along the direction of B-type step, and both fitting lines of Arrhenius law intersect at T{sub c}=420–440 K. Our results show that the atomic growth dynamics under nonequilibrium conditions is gradually dominated by the prefactor with increasing temperature. In addition, the shape-change of the 2D nanometer-size island has been discussed on stepped Ni(111) surface in different temperature range.
Contribution of diffuser surfaces to efficiency of tilted T shape parallel highway noise barriers
Directory of Open Access Journals (Sweden)
N. Javid Rouzi
2009-04-01
Full Text Available Background and aimsThe paper presents the results of an investigation on the acoustic performance of tilted profile parallel barriers with quadratic residue diffuser tops and faces.MethodsA2D boundary element method (BEM is used to predict the barrier insertion loss. The results of rigid and with absorptive coverage are also calculated for comparisons. Using QRD on the top surface and faces of all tilted profile parallel barrier models introduced here is found to improve the efficiency of barriers compared with rigid equivalent parallel barrier at the examined receiver positions.Results Applying a QRD with frequency design of 400 Hz on 5 degrees tilted parallel barrier improves the overall performance of its equivalent rigid barrier by 1.8 dB(A. Increase the treated surfaces with reactive elements shifts the effective performance toward lower frequencies. It is found that by tilting the barriers from 0 to 10 degrees in parallel set up, the degradation effects in parallel barriers is reduced but the absorption effect of fibrous materials and also diffusivity of thequadratic residue diffuser is reduced significantly. In this case all the designed barriers have better performance with 10 degrees tilting in parallel set up.ConclusionThe most economic traffic noise parallel barrier, which produces significantly high performance, is achieved by covering the top surface of the barrier closed to the receiver by just a QRD with frequency design of 400 Hz and tilting angle of 10 degrees. The average Aweighted insertion loss in this barrier is predicted to be 16.3 dB (A.
International Nuclear Information System (INIS)
Anderson, R.C.
1976-01-01
A method is described for joining beryllium to beryllium by diffusion bonding. At least one surface portion of at least two beryllium pieces is coated with nickel. A coated surface portion is positioned in a contiguous relationship with another surface portion and subjected to an environment having an atmosphere at a pressure lower than ambient pressure. A force is applied on the beryllium pieces for causing the contiguous surface portions to abut against each other. The contiguous surface portions are heated to a maximum temperature less than the melting temperature of the beryllium, and the applied force is decreased while increasing the temperature after attaining a temperature substantially above room temperature. A portion of the applied force is maintained at a temperature corresponding to about maximum temperature for a duration sufficient to effect the diffusion bond between the contiguous surface portions
Advection and diffusion in random media implications for sea surface temperature anomalies
Piterbarg, Leonid I
1997-01-01
The book presents the foundations of the theory of turbulent transport within the context of stochastic partial differential equations. It serves to establish a firm connection between rigorous and non-rigorous results concerning turbulent diffusion. Mathematically all of the issues addressed in this book are concentrated around a single linear equation: stochastic advection-diffusion (transport) equation. There is no attempt made to derive universal statistics for turbulent flow. Instead emphasis is placed on a statistical description of a passive scalar (tracer) under given velocity statistics. An application concerning transport of sea surface temperature anomalies reconciles the developed theory and a highly practical issue of modern physical oceanography by using the newly designed inversion techniques which take advantage of powerful maximum likelihood and autoregressive estimators. Audience: Graduate students and researchers in mathematics, fluid dynamics, and physical oceanography.
Energy Technology Data Exchange (ETDEWEB)
Flytzani-Stephanopoulos, M; Schmidt, L D
1979-01-01
Simple models incorporating surface reaction and diffusion of volatile products through a boundary layer are developed to calculate effective rates of evaporation and local surface profiles on surfaces having active and inactive regions. The coupling between surface heterogeneities with respect to a particular reaction and external mass transfer may provide a mechanism for the surface rearrangement and metal loss encountered in several catalytic systems of practical interest. Calculated transport rates for the volatilization of platinum in oxidizing environments and the rearrangement of this metal during the ammonia oxidation reaction agree well with published experimental data.
Energy Technology Data Exchange (ETDEWEB)
Ren, Cui-Lan, E-mail: rencuilan@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Han, Han [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Gong, Wen-Bin [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Suzhou Institute of Nano-Tech and Nano-Bionics, Chinese Academy of Sciences, Shanghai 215123 (China); Wang, Cheng-Bin; Zhang, Wei [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Cheng, Cheng [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Huai, Ping, E-mail: huaiping@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Zhu, Zhi-Yuan [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China)
2016-09-15
Adsorption and diffusion behaviors of fluorine on Cr-doped Ni(111) surface are investigated by using first-principles simulation. It shows that the Cr in the Cr-doped Ni(111) surface serve a trap site for fluorine with adsorption energy 3.52 eV, which is 1.04 eV higher than that on Ni(111) surface. Moreover, the Cr atom is pulled out the surface for 0.41 Å after the fluorine adsorption, much higher than that on Ni(111) surface. Further diffusion behaviors analysis confirms the conclusion because the fluorine diffusion from neighbored sites onto the Cr top site is an energy barrierless process. Detailed electronic structure analysis shows that a deeper hybrid state of F 2 p-Cr 3 d indicates a strong F−Cr interaction. The Ni−Cr bond is elongated and weakened due to the new formed F−Cr bonding. Our results help to understanding the basic fluorine-induced initial corrosion mechanism for Ni-based alloy in molten salt environment.
Nanoporous, Metal Carbide, Surface Diffusion Membranes for High Temperature Hydrogen Separations
Energy Technology Data Exchange (ETDEWEB)
Way, J. Douglas [Colorado School of Mines, Golden, CO (United States). Dept. of Chemical and Biological Engineering; Wolden, Colin A. [Colorado School of Mines, Golden, CO (United States)
2013-09-30
Colorado School of Mines (CSM) developed high temperature, hydrogen permeable membranes that contain no platinum group metals with the goal of separating hydrogen from gas mixtures representative of gasification of carbon feedstocks such as coal or biomass in order to meet DOE NETL 2015 hydrogen membrane performance targets. We employed a dual synthesis strategy centered on transition metal carbides. In the first approach, novel, high temperature, surface diffusion membranes based on nanoporous Mo2C were fabricated on ceramic supports. These were produced in a two step process that consisted of molybdenum oxide deposition followed by thermal carburization. Our best Mo2C surface diffusion membrane achieved a pure hydrogen flux of 367 SCFH/ft2 at a feed pressure of only 20 psig. The highest H2/N2 selectivity obtained with this approach was 4.9. A transport model using “dusty gas” theory was derived to describe the hydrogen transport in the Mo2C coated, surface diffusion membranes. The second class of membranes developed were dense metal foils of BCC metals such as vanadium coated with thin (< 60 nm) Mo2C catalyst layers. We have fabricated a Mo2C/V composite membrane that in pure gas testing delivered a H2 flux of 238 SCFH/ft2 at 600 °C and 100 psig, with no detectable He permeance. This exceeds the 2010 DOE Target flux. This flux is 2.8 times that of pure Pd at the same membrane thickness and test conditions and over 79% of the 2015 flux target. In mixed gas testing we achieved a permeate purity of ≥99.99%, satisfying the permeate purity milestone, but the hydrogen permeance was low, ~0.2 SCFH/ft2.psi. However, during testing of a Mo2C coated Pd alloy membrane with DOE 1 feed gas mixture a hydrogen permeance of >2 SCFH/ft2.psi was obtained which was stable during the entire test, meeting the permeance associated with
First-principles simulations of iron with nitrogen: from surface adsorption to bulk diffusion
International Nuclear Information System (INIS)
Wu, M H; Liu, X H; Gu, J F; Jin, Z H
2013-01-01
Adsorption, absorption and diffusion pathways of nitrogen are studied for ferromagnetic body-centered cubic iron via spin-polarized density functional theory in combination with the climbing image nudged elastic band method. The computed data suggest that, depending on the coverage of N atoms, N prefers to stay on particular surface sites. Once pinned down well below the surface, N prefers to move into octahedral interstices rather than tetrahedral interstices. However, the tetrahedral interstices are crucial because they act as transition states and yield the saddle point energies of the corresponding minimum energy pathways. In comparison with carbon, we found that nitrogen prefers a different pathway from the (1 0 0) surface to the subsurface due to its strong repulsive interaction with Fe ions. (paper)
Kinoshita, Koji; Parra, Elisa; Needham, David
2017-02-15
Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain "dead time" at initial measurement. These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the "micropipette interfacial area-expansion method" was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion controlled molecular adsorption at the air-water interfaces. To validate the new technique, the diffusion coefficient of 1-Octanol in water was investigated with existing models: the Ward Tordai model for the long time adsorption regime (1-100s), and the Langmuir and Frumkin adsorption isotherm models for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2±0.8×10 -6 cm 2 /s, showed excellent agreement with the result from an alternative method, "single microdroplet catching method", to measure the diffusion coefficient from diffusion-controlled microdroplet dissolution, 7.3±0.1×10 -6 cm 2 /s. These new techniques for determining adsorption and diffusion coefficients can apply for a range of surface active molecules, especially the less-characterized ionic surfactants, and biological compounds such as lipids, peptides, and proteins. Copyright © 2016 Elsevier Inc. All rights reserved.
Models of diffuse solar radiation
Energy Technology Data Exchange (ETDEWEB)
Boland, John; Ridley, Barbara [Centre for Industrial and Applied Mathematics, University of South Australia, Mawson Lakes Boulevard, Mawson Lakes, SA 5095 (Australia); Brown, Bruce [Department of Statistics and Applied Probability, National University of Singapore, Singapore 117546 (Singapore)
2008-04-15
For some locations both global and diffuse solar radiation are measured. However, for many locations, only global is measured, or inferred from satellite data. For modelling solar energy applications, the amount of radiation on a tilted surface is needed. Since only the direct component on a tilted surface can be calculated from trigonometry, we need to have diffuse on the horizontal available. There are regression relationships for estimating the diffuse on a tilted surface from diffuse on the horizontal. Models for estimating the diffuse radiation on the horizontal from horizontal global that have been developed in Europe or North America have proved to be inadequate for Australia [Spencer JW. A comparison of methods for estimating hourly diffuse solar radiation from global solar radiation. Sol Energy 1982; 29(1): 19-32]. Boland et al. [Modelling the diffuse fraction of global solar radiation on a horizontal surface. Environmetrics 2001; 12: 103-16] developed a validated model for Australian conditions. We detail our recent advances in developing the theoretical framework for the approach reported therein, particularly the use of the logistic function instead of piecewise linear or simple nonlinear functions. Additionally, we have also constructed a method, using quadratic programming, for identifying values that are likely to be erroneous. This allows us to eliminate outliers in diffuse radiation values, the data most prone to errors in measurement. (author)
International Nuclear Information System (INIS)
Sze, M.F.F.; McKay, G.
2010-01-01
Batch adsorption experiments were carried out to study the adsorptive removal and diffusion mechanism of para-chlorophenol (p-CP) onto Calgon Filtrasorb 400 (F400) activated carbon. The external mass transfer resistance is negligible in the adsorption process carried out under different conditions in batch operation. Intraparticle diffusion model plots were used to correlate the batch p-CP adsorption data; three distinct linear sections were obtained for every batch operation. The textural properties of F400 activated carbon showed that it has a large portion of supermicropores, which is comparable to the size of the p-CP molecules. Due to the stronger interactions between p-CP molecules and F400 micropores, p-CP molecules predominantly diffused and occupied active sites in micropore region by hopping mechanism, and eventually followed by a slow filling of mesopores and micropores. This hypothesis is proven by the excellent agreement of the intraparticle diffusion model plots and the textural properties of F400 activated carbon. - Integration of intraparticle diffusion model plots and textural properties of F400 activated carbon explain the diffusion mechanism of p-CP into porous carbon.
A desk study of surface diffusion and mass transport in clay
International Nuclear Information System (INIS)
Cook, A.J.
1989-01-01
Research into the properties of clays as barrier materials for nuclear waste disposal has led to the realization that they have important transport properties which are relatively insignificant in most other geological materials. Sorption has always been regarded as a purely retarding mechanism, but laboratory experiments over the past decade have indicated that surface diffusion of sorbed cations is a potentially significant transport mechanism in both compacted montmorillonite, and biotite gneiss. The present desk study about these issues was part of the CEC coordinated project Mirage-Second phase, research area Natural analogues
Surface diffusion driven morphological instability in free-standing nickel nanorod arrays
Energy Technology Data Exchange (ETDEWEB)
Alrashid, Ebtihaj; Ye, Dexian [Department of Physics, Virginia Commonwealth University, PO Box 842000, Richmond, Virginia 23284-2000 (United States)
2014-07-28
Metallic nanostructures are thermodynamically unstable due to the excess of energy of large numbers of surface atoms. Morphological instability, such as Rayleigh breakup, sintering, and coalescence, can be observed at a temperature much lower than the bulk melting point of the metal. We study the morphological and crystalline evolution of well-aligned free-standing nickel nanorod arrays at elevated temperatures up to 600 °C. The as-deposited nickel nanorods are faceted with sharp nanotips, which are deformed at annealing temperatures higher than 400 °C due to strong surface diffusion. A mud-crack like pattern is formed in the samples annealed above 400 °C, leading to the generation of interconnected porous structure. Meanwhile, the X-ray diffraction reveals the recrystallization of nickel nanocrystals when annealed from 300 to 600 °C.
Impurity diffusion activation energies in Al from first principles
Simonovic, D.; Sluiter, M.H.
2009-01-01
Activation energies for vacancy-mediated impurity diffusion in face-centered-cubic aluminum have been computed ab initio for all technologically important alloying elements, as well as for most of the lanthanides. The so-called five-frequency rate model is used to establish the limiting vacancy
Expanding the calculation of activation volumes: Self-diffusion in liquid water
Piskulich, Zeke A.; Mesele, Oluwaseun O.; Thompson, Ward H.
2018-04-01
A general method for calculating the dependence of dynamical time scales on macroscopic thermodynamic variables from a single set of simulations is presented. The approach is applied to the pressure dependence of the self-diffusion coefficient of liquid water as a particularly useful illustration. It is shown how the activation volume associated with diffusion can be obtained directly from simulations at a single pressure, avoiding approximations that are typically invoked.
Diffusion-controlled regime of surface-wave-produced plasmas in helium gas
International Nuclear Information System (INIS)
Berndt, J; Makasheva, K; Schlueter, H; Shivarova, A
2002-01-01
The study presents a numerical fluid-plasma model of diffusion-controlled surface-wave-sustained discharges in helium gas. The self-consistent behaviour of the discharge based on the interrelation between plasma density and Θ, the power absorbed on average by one electron, is described. The nonlinear process of step ionization in the charged particle balance equation is the main factor, which ensures the self-consistency. However, it is shown that in helium discharges, the ionization frequencies enter the dependence of Θ on the plasma density also through the ambipolar-diffusion coefficient. Results at two different values of the gas pressure and of the wave frequency are discussed. The lower value of the gas pressure is chosen according to the condition to have a pure diffusion-controlled regime without interference with a transition to the free-fall regime. The boundary condition for the ion flux at the wall sheath is used for determination of the value of μ, the quantity denoting the degree of the radial plasma-density inhomogeneity which, together with the electron-neutral elastic collision frequency, influences the wave propagation characteristics. The two values of the wave frequency chosen provide descriptions of high-frequency and microwave discharges. The model results in the self-consistent structure of the discharge: interrelated variations along the discharge length of wavenumber, space damping rate, Θ, plasma density and electron temperature. The power necessary for sustaining discharges of a given length is also calculated. Comparisons with argon discharges are shown
Hou, Ruixiang; Li, Lei; Fang, Xin; Xie, Ziang; Li, Shuti; Song, Weidong; Huang, Rong; Zhang, Jicai; Huang, Zengli; Li, Qiangjie; Xu, Wanjing; Fu, Engang; Qin, G. G.
2018-01-01
Generally, the diffusion and gettering of impurities in GaN needs high temperature. Calculated with the ambient-temperature extrapolation value of the high temperature diffusivity of Pt atoms in GaN reported in literature, the time required for Pt atoms diffusing 1 nm in GaN at ambient temperature is about 19 years. Therefore, the ambient-temperature diffusion and gettering of Pt atoms in GaN can hardly be observed. In this work, the ambient-temperature diffusion and gettering of Pt atoms in GaN is reported for the first time. It is demonstrated by use of secondary ion mass spectroscopy that in the condition of introducing a defect region on the GaN film surface by plasma, and subsequently, irradiated by 60Co gamma-ray or 3 MeV electrons, the ambient-temperature diffusion and gettering of Pt atoms in GaN can be detected. It is more obvious with larger irradiation dose and higher plasma power. With a similar surface defect region, the ambient-temperature diffusion and gettering of Pt atoms in GaN stimulated by 3 MeV electron irradiation is more marked than that stimulated by gamma irradiation. The physical mechanism of ambient-temperature diffusion and gettering of Pt atoms in a GaN film with a surface defect region stimulated by gamma or MeV electron irradiation is discussed.
Effect of diffusion on enzyme activity in a microreactor
Swarts, J.W.; Kolfschoten, R.C.; Jansen, M.C.A.A.; Janssen, A.E.M.; Boom, R.M.
2010-01-01
To establish general rules for setting up an enzyme microreactor system, we studied the effect of diffusion on enzyme activity in a microreactor. As a model system we used the hydrolysis of ortho-nitrophenyl-ß-d-galactopyranoside by ß-galactosidase from Kluyveromyces lactis. We found that the
Energy Technology Data Exchange (ETDEWEB)
Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng, E-mail: hbchew@illinois.edu [Department of Aerospace Engineering, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States)
2015-02-14
Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C–C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C–C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C–C bonding over C–Cu bonding, which results in C–C dimer pair formation near the surface. The dramatically different C–C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.
Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng
2015-02-14
Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C-C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C-C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C-C bonding over C-Cu bonding, which results in C-C dimer pair formation near the surface. The dramatically different C-C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.
Hard Surface Layers by Pack Boriding and Gaseous Thermo-Reactive Deposition and Diffusion Treatments
DEFF Research Database (Denmark)
Christiansen, Thomas Lundin; Bottoli, Federico; Dahl, Kristian Vinter
2017-01-01
) layers with hardnesses up to 1800 HV. Titanizing of ARNE tool steel results in a surface layer consisting of TiC with a hardness of approximately 4000 HV. Duplex treatments, where boriding is combined with subsequent (TRD) titanizing, result in formation of hard TiB2 on top of a thick layer of Fe......Thermo-reactive deposition and diffusion (TRD) and boriding are thermochemical processes that result in very high surface hardness by conversion of the surface into carbides/nitrides and borides, respectively. These treatments offer significant advantages in terms of hardness, adhesion, tribo...... subjected to TRD (chromizing and titanizing) and boriding treatments. For the steels with low carbon content, chromizing results in surface alloying with chromium, i.e., formation of a (soft) “stainless” surface zone. Steels containing higher levels of carbon form chromium carbide (viz. Cr23C6, Cr7C3...
Surface energy anisotropy of tungsten
Energy Technology Data Exchange (ETDEWEB)
Kumar, R; Grenga, H E [Georgia Inst. of Tech., Atlanta (USA). School of Chemical Engineering
1976-10-01
Field-ion microscopy was used to study the faceting behavior and/or surface energy anisotropy of tungsten in vacuum and in hydrogen. In vacuum below 1700 K the activation energy for (110) facet growth agreed with values previously reported for surface diffusion on tungsten. The observed anisotropy values at 0.5 Tsub(m), where Tsub(m) is the absolute melting temperature of tungsten (approximately 3680 K), were different from those previously reported at higher temperatures and more nearly agreed with broken bond calculations based on Mie potential using m=5, n=8, and a 1.5% lattice expansion. Hydrogen appeared to have a negligible effect on surface energy anisotropy, but did preferentially increase surface diffusion rates on (310) regions.
Tong, Cunzhu; Yoon, Soon Fatt; Wang, Lijun
2012-09-24
We demonstrate experimentally the submicron size self-assembled (SA) GaAs quantum rings (QRs) by quantum size effect (QSE). An ultrathin In0.1 Ga0.9As layer with different thickness is deposited on the GaAs to modulate the surface nucleus diffusion barrier, and then the SA QRs are grown. It is found that the density of QRs is affected significantly by the thickness of inserted In0.1 Ga0.9As, and the diffusion barrier modulation reflects mainly on the first five monolayer . The physical mechanism behind is discussed. The further analysis shows that about 160 meV decrease in diffusion barrier can be achieved, which allows the SA QRs with density of as low as one QR per 6 μm2. Finally, the QRs with diameters of 438 nm and outer diameters of 736 nm are fabricated using QSE.
Electrolyte diffusion in compacted montmorillonite engineered barriers
International Nuclear Information System (INIS)
Jahnke, F.M.; Radke, C.J.
1985-09-01
The bentonite-based engineered barrier or packing is a proposed component of several designs conceived to dispose of high-level nuclear waste in geologic repositories. Once radionuclides escape the waste package, they must first diffuse through the highly impermeable clay-rich barrier before they reach the host repository. To determine the effectiveness of the packing as a sorption barrier in the transient release period and as a mass-transfer barrier in the steady release period over the geologic time scales involved in nuclear waste disposal, a fundamental understanding of the diffusion of electrolytes in compacted clays is required. We present, and compare with laboratory data, a model quantifying the diffusion rates of cationic cesium and uncharged tritium in compacted montmorillonite clay. Neutral tritium characterizes the geometry (i.e., tortuosity) of the particulate gel. After accounting for cation exchange, we find that surface diffusion is the dominant mechanism of cation transport, with an approximate surface diffusion coefficient of 2 x 10 -6 cm 2 /s for cesium. This value increases slightly with increasing background ionic strength. The implications of this work for the packing as a migration barrier are twofold. During the transient release period, K/sub d/ values are of little importance in retarding ion migration. This is because sorption also gives rise to a surface diffusion path, and it is surface diffusion which controls the diffusion rate of highly sorbing cations in compacted montmorillonite. During the steady release period, the presence of surface diffusion leads to a flux through the packing which is greatly enhanced. In either case, if surface diffusion is neglected, the appropriate diffusion coefficient of ions in compacted packing will be in considerable error relative to current design recommendations. 11 refs., 4 figs., 1 tab
Fractional diffusion equations and anomalous diffusion
Evangelista, Luiz Roberto
2018-01-01
Anomalous diffusion has been detected in a wide variety of scenarios, from fractal media, systems with memory, transport processes in porous media, to fluctuations of financial markets, tumour growth, and complex fluids. Providing a contemporary treatment of this process, this book examines the recent literature on anomalous diffusion and covers a rich class of problems in which surface effects are important, offering detailed mathematical tools of usual and fractional calculus for a wide audience of scientists and graduate students in physics, mathematics, chemistry and engineering. Including the basic mathematical tools needed to understand the rules for operating with the fractional derivatives and fractional differential equations, this self-contained text presents the possibility of using fractional diffusion equations with anomalous diffusion phenomena to propose powerful mathematical models for a large variety of fundamental and practical problems in a fast-growing field of research.
Fast and direct detection of neuronal activation with diffusion MRI
Energy Technology Data Exchange (ETDEWEB)
Le Bihan, D. [Service Hospitalier Frederic Joliot (CEA/DSV/DRM), Lab. Anatomical and Functional Neuroimaging, 91 - Orsay (France); Urayama, S.; Aso, T.; Hanakawa, T.; Fukuyama, H. [Kyoto Univ. Graduate School of Medicine, Human Brain Research Center, Kyoto (Japan)
2006-07-01
pathological conditions or in the presence of drugs. Also, it has been pointed out that the spatial functional resolution of vascular based functional neuroimaging might be limited, because vessels responsible for the increase of blood flow and blood volume feed or drain somewhat large territories which include clusters of neurons with potentially different functions. Similarly the physiological delay necessary for the mechanisms triggering the vascular response to work intrinsically limits the temporal resolution of BOLD f MRI. On the other hand, a fundamentally new paradigm is being proposed to look at brain activity through the observation with MRI of the diffusion behavior of the water molecules. It has been shown that the diffusion of water slightly slows down during brain activation. This slowdown, which occurs several seconds before the hemodynamic response detected by BOLD f MRI, has been described in terms of a phase transition of the water molecules in the cells undergoing activation and tentatively attributed to the swelling of those cells. This finding marks a significant departure from the former blood flow based PET and MRI approaches, and potentially offers improved spatial and temporal resolution, because the proposed mechanism appears more intimately linked to neuronal activation. However, the step might even extend further: Contrarily to the former approaches based on changes in artificially induced water physical properties, namely radioactivity and magnetization, required for the external PET or MR I detection, the new, diffusion based approach, merely uses MRI as a means to reveal changes in intrinsic water physical properties. These changes in the diffusion behaviour of water during activation seem to belong to an endogenous part of the activation process, and perhaps even more, could be an active component of this process that evolution has capitalized upon. The aim of this presentation is to review our current knowledge on the water physical properties
Fast and direct detection of neuronal activation with diffusion MRI
International Nuclear Information System (INIS)
Le Bihan, D.; Urayama, S.; Aso, T.; Hanakawa, T.; Fukuyama, H.
2006-01-01
conditions or in the presence of drugs. Also, it has been pointed out that the spatial functional resolution of vascular based functional neuroimaging might be limited, because vessels responsible for the increase of blood flow and blood volume feed or drain somewhat large territories which include clusters of neurons with potentially different functions. Similarly the physiological delay necessary for the mechanisms triggering the vascular response to work intrinsically limits the temporal resolution of BOLD f MRI. On the other hand, a fundamentally new paradigm is being proposed to look at brain activity through the observation with MRI of the diffusion behavior of the water molecules. It has been shown that the diffusion of water slightly slows down during brain activation. This slowdown, which occurs several seconds before the hemodynamic response detected by BOLD f MRI, has been described in terms of a phase transition of the water molecules in the cells undergoing activation and tentatively attributed to the swelling of those cells. This finding marks a significant departure from the former blood flow based PET and MRI approaches, and potentially offers improved spatial and temporal resolution, because the proposed mechanism appears more intimately linked to neuronal activation. However, the step might even extend further: Contrarily to the former approaches based on changes in artificially induced water physical properties, namely radioactivity and magnetization, required for the external PET or MR I detection, the new, diffusion based approach, merely uses MRI as a means to reveal changes in intrinsic water physical properties. These changes in the diffusion behaviour of water during activation seem to belong to an endogenous part of the activation process, and perhaps even more, could be an active component of this process that evolution has capitalized upon. The aim of this presentation is to review our current knowledge on the water physical properties i n
Bläckberg, Lisa
2014-01-01
This thesis investigates surface coatings as xenon diffusion barriers on plastic scintillators. The motivation for the work is improved radioxenon detection systems, used within the verification regime of the Comprehensive Nuclear-Test-Ban Treaty (CTBT). One type of radioxenon detection systems used in this context is the Swedish SAUNA system. This system uses a cylindrical plastic scintillator cell to measure the beta decay from radioxenon isotopes. The detector cell also acts as a container...
Surface-Activated Coupling Reactions Confined on a Surface.
Dong, Lei; Liu, Pei Nian; Lin, Nian
2015-10-20
Chemical reactions may take place in a pure phase of gas or liquid or at the interface of two phases (gas-solid or liquid-solid). Recently, the emerging field of "surface-confined coupling reactions" has attracted intensive attention. In this process, reactants, intermediates, and products of a coupling reaction are adsorbed on a solid-vacuum or a solid-liquid interface. The solid surface restricts all reaction steps on the interface, in other words, the reaction takes place within a lower-dimensional, for example, two-dimensional, space. Surface atoms that are fixed in the surface and adatoms that move on the surface often activate the surface-confined coupling reactions. The synergy of surface morphology and activity allow some reactions that are inefficient or prohibited in the gas or liquid phase to proceed efficiently when the reactions are confined on a surface. Over the past decade, dozens of well-known "textbook" coupling reactions have been shown to proceed as surface-confined coupling reactions. In most cases, the surface-confined coupling reactions were discovered by trial and error, and the reaction pathways are largely unknown. It is thus highly desirable to unravel the mechanisms, mechanisms of surface activation in particular, of the surface-confined coupling reactions. Because the reactions take place on surfaces, advanced surface science techniques can be applied to study the surface-confined coupling reactions. Among them, scanning tunneling microscopy (STM) and X-ray photoelectron spectroscopy (XPS) are the two most extensively used experimental tools. The former resolves submolecular structures of individual reactants, intermediates, and products in real space, while the latter monitors the chemical states during the reactions in real time. Combination of the two methods provides unprecedented spatial and temporal information on the reaction pathways. The experimental findings are complemented by theoretical modeling. In particular, density
International Nuclear Information System (INIS)
Posadillo, R.; Lopez Luque, R.
2009-01-01
The performance of three diffuse hourly irradiation models on tilted surfaces was evaluated by making a database of hourly global and diffuse solar irradiation on a horizontal surface, as well as global solar irradiation on a tilted surface, recorded in a solar radiation station located at Cordoba University (Spain). The method for a comparison of the performance of these models was developed from a study of the 'utilizable energy' statistics, a value representing, for a specific period of time, the mean monthly radiation that exceeded a critical level of radiation. This model comparison method seemed to us to be highly suitable since it provides a way of comparing the capacity of these models to estimate, however, much energy is incident on a tilted surface above a critical radiation level. Estimated and measured values were compared using the normalized RMBE and RRMSE statistics. According to the results of the method let us verify that, of the three models evaluated, one isotropic and two anisotropic, the Reindl et al. anisotropic model was the one giving the best results.
Kailasanathan, Ranjith Kumar Abhinavam; Zhang, Ji; Fang, Tiegang; Roberts, William L.
2014-01-01
Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both
Energetics and self-diffusion behavior of Zr atomic clusters on a Zr(0 0 0 1) surface
Energy Technology Data Exchange (ETDEWEB)
Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu [Department of Applied Physics, Hunan University, Changsha 410082 (China)], E-mail: wangyuhu2001cn@yahoo.com.cn; Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)
2009-09-15
Using a molecular dynamics method and a modified analytic embedded atom potential, the energetic and the self-diffusion dynamics of Zr atomic clusters up to eight atoms on {alpha}-Zr(0 0 0 1) surface have been studied. The simulation temperature ranges from 300 to 1100 K and the simulation time varies from 20 to 40 ns. It's found that the heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center and the present diffusion coefficients for clusters exhibit an Arrhenius behavior. The Arrhenius relation of the single adatom can be divided into two parts in different temperature range because of their different diffusion mechanisms. The migration energies of clusters increase with increasing the number of atoms in cluster. The differences of the prefactors also come from the diverse diffusion mechanisms. On the facet of 60 nm, the heptamer can be the nuclei in the crystal growth below 370 K.
Surface mobilities on solid materials
International Nuclear Information System (INIS)
Binh, V.T.
1983-01-01
This book constitutes the proceedings of the NATO Advanced Study Institute on Surface Mobilities on Solid Materials held in France in 1981. The goal of the two-week meeting was to review up-to-date knowledge on surface diffusion, both theoretical and experimental, and to highlight those areas in which much more knowledge needs to be accumulated. Topics include theoretical aspects of surface diffusion (e.g., microscopic theories of D at zero coverage; statistical mechanical models and surface diffusion); surface diffusion at the atomic level (e.g., FIM studies of surface migration of single adatoms and diatomic clusters; field emission studies of surface diffusion of adsorbates); foreign adsorbate mass transport; self-diffusion mass transport (e.g., different driving forces for the matter transport along surfaces; measurements of the morphological evolution of tips); the role of surface diffusion in some fundamental and applied sciences (e.g. adatomadatom pair interactions and adlayer superstructure formation; surface mobility in chemical reactions and catalysis); and recent works on surface diffusion (e.g., preliminary results on surface self-diffusion measurements on nickel and chromium tips)
International Nuclear Information System (INIS)
Svoboda, J.; Fischer, F.D.
2011-01-01
Diffusion in solids is a well-known phenomenon that has many consequences in technology and material science. Modelling of diffusion-controlled processes requires both a reliable theory of diffusion and reliable kinetic coefficients, as well as other thermodynamic data. Often the classical Darken theory, valid for stress-free systems with ideal vacancy source and sink activity, is generalized to multicomponent systems with ideal vacancy source and sink activity. Nazarov and Gurov presented a theory for stress-free systems with no vacancy source and sink activity. Recently we published a general theory of diffusion that accounted for the role of non-ideal vacancy source and sink activity, as well as the stress state. Since diffusion theories are tested and diffusion coefficients measured usually on diffusion couples, this paper presents evolution equations based on that general theory for a diffusion couple. In the limit, the equations of the Darken theory and the Nazarov and Gurov theory are valid for ideal vacancy source and sink activity and no vacancy source and sink activity, respectively. Simulations for binary and ternary diffusion couples demonstrate the influence of the vacancy source and sink activity and the stress state on evolution of site fraction profiles of components and vacancies, and on the Kirkendall effect.
Direct measurement of gaseous activities by diffusion-in long proportional counter method
International Nuclear Information System (INIS)
Yoshida, M.; Yamamoto, T.; Wu, Y.; Aratani, T.; Uritani, A.; Mori, C.
1993-01-01
Direct measurement of gaseous activities by the diffusion-in long proportional counter method (DLPC method) was studied. The measuring time without end effect was estimated by observing the behavior of 37 Ar in the counter and was long enough to carry out the accurate activity measurement. The correction for wall effect was also examined on the basis of the measured and calculated correction factors. Among the tested gases of methane, P10 gas and propane, P10 gas was made clear to be a suitable counting gas for the DLPC method because of good diffusion properties and small wall effect. This method is quite effective for standardization of gaseous activities used for tracer experiments and calibration works of radioactive gas monitoring instruments. (orig.)
Czech Academy of Sciences Publication Activity Database
Kromka, Alexander; Čech, J.; Kozak, Halyna; Artemenko, Anna; Ižák, Tibor; Čermák, Jan; Rezek, Bohuslav; Černák, M.
2015-01-01
Roč. 252, č. 11 (2015), s. 2602-2607 ISSN 0370-1972 R&D Projects: GA ČR(CZ) GBP108/12/G108 Institutional support: RVO:68378271 Keywords : atmospheric plasma * diamond nanoparticles * diffuse coplanar surface barrier discharge * FTIR * XPS Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 1.522, year: 2015
Cowan, A E; Myles, D G; Koppel, D E
1991-03-01
The redistribution of membrane proteins on the surface of cells is a prevalent feature of differentiation in a variety of cells. In most cases the mechanism responsible for such redistribution is poorly understood. Two potential mechanisms for the redistribution of surface proteins are: (1) passive diffusion coupled with trapping, and (2) active translocation. We have studied the process of membrane protein redistribution for the PH-20 protein of guinea pig sperm, a surface protein required for sperm binding to the egg zona pellucida (P. Primakoff, H. Hyatt, and D. G. Myles (1985). J. Cell Biol. 101, 2239-2244). PH-20 protein is localized to the posterior head plasma menbrane of the mature sperm cell. Following the exocytotic acrosome reaction, PH-20 protein moves into the newly incorporated inner acrosomal membrane (IAM), placing it in a position favorable for a role in binding sperm to the egg zona pellucida (D. G. Myles, and P. Primakoff (1984), J. Cell Biol. 99, 1634-1641). To analyze the mechanistic basis for this protein migration, we have used fluorescence microscopy and digital image processing to characterize PH-20 protein migration in individual cells. PH-20 protein was observed to move against a concentration gradient in the posterior head plasma membrane. This result argues strongly against a model of passive diffusion followed by trapping in the IAM, and instead suggests that an active process serves to concentrate PH-20 protein toward the boundary separating the posterior head and IAM regions. A transient gradient of PH-20 concentration observed in the IAM suggests that once PH-20 protein reaches the IAM, it is freely diffusing. Additionally, we observed that migration of PH-20 protein was calcium dependent.
Energy Technology Data Exchange (ETDEWEB)
Arguelles O, J. L.; Corona R, M. A. [Universidad Autonoma de San Luis Potosi, Doctorado Institucional en Ingenieria y Ciencia de Materiales, San Luis Potosi 78000, SLP (Mexico); Marquez H, A.; Saldana R, A. L.; Saldana R, A. [Universidad de Guanajuato, Ingenieria Mecanica Agricola DICIVA, Irapuato, Guanajuato 36500 (Mexico); Moreno P, J., E-mail: amarquez@ugto.mx [Universidad de Guanajuato, Departamento de Minas, Metalurgia y Geologia, Ex-Hacienda San Matias s/n, Guanajuato, Guanajuato 36020 (Mexico)
2017-11-01
In this study, the Response Surface Methodology (Rsm) and Central Composite Design (Ccd) were used to optimize the hardness of boride diffusion layer on Astm F-75 alloy (also called Haynes alloy). A boronizing thermochemical treatment was carried out at different temperatures and for different time periods. Hardness tests were conducted. The boride diffusion layer was verified by the X-ray diffraction (XRD) analysis indicating the formation of Co B, Co{sub 2}B, Cr B and Mo{sub 2}B phases. An optimal hardness of 3139.7 Hv was obtained for the samples subjected to the boriding process for a duration of 6.86 h at 802.4 degrees Celsius. (Author)
Matrane, I.; Mazroui, M.; Sbiaai, K.
2018-03-01
We present a density functional theory (DFT) and embedded atom method (EAM) studies of Pt2 , Au2 and AuPt dimers adsorption and diffusion on the clean Pt (1 1 0) (1 × 1) surface and (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. As a first step, adsorption energies are calculated for all considered dimers, and their stability is checked by computing the binding energies. Furthermore, the energy barriers for the elementary diffusion mechanisms (concerted jump, dissociation-reassociation and leapfrog) are calculated for dimers diffusion on all considered geometries. The potential energy profile for the leapfrog mechanism is provided for dimers diffusion on the (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. Our results show that each of the three dimers exhibits a qualitatively different behaviours. In addition, the obtained results provide interesting atomistic information about dimers stability and mobility, which is required for understanding the macroscopic kinetics of crystal growth.
Results on positron diffusion in Si
International Nuclear Information System (INIS)
Nielsen, B.; Lynn, K.G.; Vehanen, A.; Schultz, P.J.
1984-10-01
Positron diffusion in Si(100) and Si(111) has been measured using a variable energy positron beam. The diffusion related parameter, E 0 is found to be 4.2 +- 0.2 keV, significantly longer than previously reported values. The positron diffusion coefficient is estimated at D/sub +/ = 2.3 +- 0.4 cm 2 /sec, the uncertainty arising mainly from the characteristics of the assumed positron implantation profile. A drastic reduction in E 0 is found after heating the sample to 1300 0 K, showing that previously reported low values of E 0 are associated with the thermal history of the sample. A high sensitivity to defects introduced by low energy ion bombardment is found, and the defect recovery was followed during heat treatments. Reconstruction of the Si(111) surface into the so-called 7 x 7 structure had no detectable influence on the positron diffusion behavior. No changes in the positron diffusion was observed after covering the surface with atomic hydrogen. However the yield of positronium formation at the surface was enhanced, attributed to an increased density of states at the surface
Sze, M F F; McKay, G
2010-05-01
Batch adsorption experiments were carried out to study the adsorptive removal and diffusion mechanism of para-chlorophenol (p-CP) onto Calgon Filtrasorb 400 (F400) activated carbon. The external mass transfer resistance is negligible in the adsorption process carried out under different conditions in batch operation. Intraparticle diffusion model plots were used to correlate the batch p-CP adsorption data; three distinct linear sections were obtained for every batch operation. The textural properties of F400 activated carbon showed that it has a large portion of supermicropores, which is comparable to the size of the p-CP molecules. Due to the stronger interactions between p-CP molecules and F400 micropores, p-CP molecules predominantly diffused and occupied active sites in micropore region by hopping mechanism, and eventually followed by a slow filling of mesopores and micropores. This hypothesis is proven by the excellent agreement of the intraparticle diffusion model plots and the textural properties of F400 activated carbon. Copyright 2009 Elsevier Ltd. All rights reserved.
Performance of active feedforward control systems in non-ideal, synthesized diffuse sound fields.
Misol, Malte; Bloch, Christian; Monner, Hans Peter; Sinapius, Michael
2014-04-01
The acoustic performance of passive or active panel structures is usually tested in sound transmission loss facilities. A reverberant sending room, equipped with one or a number of independent sound sources, is used to generate a diffuse sound field excitation which acts as a disturbance source on the structure under investigation. The spatial correlation and coherence of such a synthesized non-ideal diffuse-sound-field excitation, however, might deviate significantly from the ideal case. This has consequences for the operation of an active feedforward control system which heavily relies on the acquisition of coherent disturbance source information. This work, therefore, evaluates the spatial correlation and coherence of ideal and non-ideal diffuse sound fields and considers the implications on the performance of a feedforward control system. The system under consideration is an aircraft-typical double panel system, equipped with an active sidewall panel (lining), which is realized in a transmission loss facility. Experimental results for different numbers of sound sources in the reverberation room are compared to simulation results of a comparable generic double panel system excited by an ideal diffuse sound field. It is shown that the number of statistically independent noise sources acting on the primary structure of the double panel system depends not only on the type of diffuse sound field but also on the sample lengths of the processed signals. The experimental results show that the number of reference sensors required for a defined control performance exhibits an inverse relationship to control filter length.
Li, Ting
2016-07-21
Silicon-based nanostructures and their related composites have drawn tremendous research interest in solar energy storage and conversion. Mesoporous silicon with a huge surface area of 400-900 m2 g-1 developed by electrochemical etching exhibits excellent photocatalytic ability and stability after 10 cycles in degrading methyl orange under visible light irradiation, owing to its unique mesoporous network, abundant surface hydrides and efficient light harvesting. This work showcases the profound effects of surface area, crystallinity, pore topology on charge migration/recombination and mass transportation. Therein the ordered 1D channel array has outperformed the interconnected 3D porous network by greatly accelerating the mass diffusion and enhancing the accessibility of the active sites on the extensive surfaces. © 2016 The Royal Society of Chemistry.
Measurements of cesium and strontium diffusion in biotite gneiss
International Nuclear Information System (INIS)
Skagius, K.; Neretnieks, I.
1988-01-01
A significant retardation of radionuclides transported by flowing water from an underground repository can be expected if the nuclides are able to diffuse into the water filled micropores in the rock. This diffusion into the pores will also increase the surface available to interactions between the nuclides in the ground water and the rock material, such as sorption. To calculate the retardation, it is necessary to know the sorption properties and the diffusivities in the rock matrix for the radionuclides. Diffusion experiments with cesium and strontium in biotite gneiss samples have been performed. Both the transport of strontium and cesium through rock samples and the concentration profiles of cesium and strontium inside rock samples have been determined. The result shows that diffusion of cesium and strontium occurs in the rock material. A diffusion model has been used to evaluate the diffusivity. Both pore diffusion and surface diffusion had to be included in the model to give good agreement with the experimental data. If surface diffusion is not included in the model, the effective pore diffusivity that gives the best fit to the experimental data is found to be higher than expected from earlier measurement of iodide diffusion in the same type of rock material. This indicates that the diffusion of cesium and strontium (sorbing components) in rock material is caused by both pore diffusion and surface diffusion acting in parallel
Diffusion measurements of cesium and strontium in biotite gneiss
International Nuclear Information System (INIS)
Skagius, K.; Neretnieks, I.
1985-01-01
A significant retardation of radionuclides transported by flowing water from an underground repository can be expected if the nuclides are able to diffuse into the water filled micropores in the rock. This diffusion into the pores will also increase the surface available to interaction between the nuclides in the groundwater and the rock material, such as sorption. To calculate the retardation it is necessary to know the sorption properties and the diffusivities in the rock matrix for the radionuclides. Diffusion experiments with cesium and strontium in biotite gneiss samples have been performed. Both the transport of strontium and cesium through rock samples and the concentration profiles of cesium and strontium inside rock samples have been determined. The result show that diffusion of cesium and strontium occurs in the rock material. A diffusion model has been used to evaluate the diffusivity. Both pore diffusion and surface diffusion had to be included in the model to give good agreement with the experimental data. If surface diffusion is not included in the model, the effective pore diffusivity that gives the best fit to the experimental data is found to be higher than expected from earlier measurements of iodide diffusion in the same type of rock material. This indicates that the diffusion of cesium and strontium (sorbing components) in rock material is caused by both pore diffusion and surface diffusion acting in parallel. (author)
Imura, Takeshi; Nagasawa, Yuki; Inagawa, Tetsuji; Imada, Naoki; Izumi, Hiroaki; Emoto, Katsuya; Tani, Itaru; Yamasaki, Hiroyuki; Ota, Yuichiro; Oki, Shuichi; Maeda, Tadanori; Araki, Osamu
2015-05-01
[Purpose] The efficacy of diffusion tensor imaging in the prediction of motor outcomes and activities of daily living function remains unclear. We evaluated the most appropriate diffusion tensor parameters and methodology to determine whether the region of interest- or tractography-based method was more useful for predicting motor outcomes and activities of daily living function in stroke patients. [Subjects and Methods] Diffusion tensor imaging data within 10 days after stroke onset were collected and analyzed for 25 patients. The corticospinal tract was analyzed. Fractional anisotropy, number of fibers, and apparent diffusion coefficient were used as diffusion tensor parameters. Motor outcomes and activities of daily living function were evaluated on the same day as diffusion tensor imaging and at 1 month post-onset. [Results] The fractional anisotropy value of the affected corticospinal tract significantly correlated with the motor outcome and activities of daily living function within 10 days post-onset and at 1 month post-onset. Tthere were no significant correlations between other diffusion tensor parameters and motor outcomes or activities of daily living function. [Conclusion] The fractional anisotropy value of the affected corticospinal tract obtained using the tractography-based method was useful for predicting motor outcomes and activities of daily living function in stroke patients.
Directory of Open Access Journals (Sweden)
K.A. Widi
2016-09-01
Full Text Available The surface layer characteristics of the AISI 4140 tool steel treated by nitriding gas before and after hard chrome plating utilizing pure nitrogen diffusion media (fluidized bed reactor and the without gas (muffle reactor has been studied experimentally. The result shows that nitriding substrate with hard chrome layers has nitrogen atoms concentration almost twice greater than that without hard chrome layers. After being given a hard chrome plating, nitriding on AISI 4140 steel generally has a nitrogen concentration of up to 4 times more than the substrate without hard chrome coating. Almost the entire specimen showed the highest concentration of N atoms in the area below the surface (hardening depth of 200 to 450 µm. N atoms diffusion depth profile has a correlation with hardening depth profile, especially on the specimens layered with hard chromium. The substrate without hard chrome plating tends to have higher surface hardness than the sub-surface. The results show that the effectiveness and efficiency of the gas nitriding diffusion process can be produced without the use of gas in the muffle reactor but the specimens must be hard chromium coated first. This phenomenon can be explained by the role of the passive layer formation that works as a barrier to keeps the spreading of N atoms concentrated in sub-surface areas.
Cooper, Samuel J; Niania, Mathew; Hoffmann, Franca; Kilner, John A
2017-05-17
A novel two-step Isotopic Exchange (IE) technique has been developed to investigate the influence of oxygen containing components of ambient air (such as H 2 O and CO 2 ) on the effective surface exchange coefficient (k*) of a common mixed ionic electronic conductor material. The two step 'back-exchange' technique was used to introduce a tracer diffusion profile, which was subsequently measured using Time-of-Flight Secondary Ion Mass Spectrometry (ToF-SIMS). The isotopic fraction of oxygen in a dense sample as a function of distance from the surface, before and after the second exchange step, could then be used to determine the surface exchange coefficient in each atmosphere. A new analytical solution was found to the diffusion equation in a semi-infinite domain with a variable surface exchange boundary, for the special case where D* and k* are constant for all exchange steps. This solution validated the results of a numerical, Crank-Nicolson type finite-difference simulation, which was used to extract the parameters from the experimental data. When modelling electrodes, D* and k* are important input parameters, which significantly impact performance. In this study La 0.6 Sr 0.4 Co 0.2 Fe 0.8 O 3-δ (LSCF6428) was investigated and it was found that the rate of exchange was increased by around 250% in ambient air compared to high purity oxygen at the same pO 2 . The three experiments performed in this study were used to validate the back-exchange approach and show its utility.
Robinson, Philip W; Pätynen, Jukka; Lokki, Tapio; Jang, Hyung Suk; Jeon, Jin Yong; Xiang, Ning
2013-06-01
In musical or theatrical performance, some venues allow listeners to individually localize and segregate individual performers, while others produce a well blended ensemble sound. The room acoustic conditions that make this possible, and the psycho-acoustic effects at work are not fully understood. This research utilizes auralizations from measured and simulated performance venues to investigate spatial discrimination of multiple acoustic sources in rooms. Signals were generated from measurements taken in a small theater, and listeners in the audience area were asked to distinguish pairs of speech sources on stage with various spatial separations. This experiment was repeated with the proscenium splay walls treated to be flat, diffusive, or absorptive. Similar experiments were conducted in a simulated hall, utilizing 11 early reflections with various characteristics, and measured late reverberation. The experiments reveal that discriminating the lateral arrangement of two sources is possible at narrower separation angles when reflections come from flat or absorptive rather than diffusive surfaces.
International Nuclear Information System (INIS)
Pinnioja, S.; Kaemaeraeinen, E.L.; Jaakkola, T.; Siitari, M.; Muuronen, S.; Lindberg, A.
1985-06-01
A method based on autoradiography was developed to determine the diffusion of radionuclides into the rock matrix. To investigate the diffusion the samples, which has been in contact with radioactive tracer solution up to 6 months, were splitted by sawing. From the autoradiograms of the cross sections the penetration depths of radionuclides were determined and the apparent diffusion coefficient Dsup(a) calculated. The filled and unfilled natural fissure surfaces chosen to this study were bars of drilling cores and drill core cups of tonalite, mica gneiss and rapakivi granite. After contact time of 3 months the highest penetration depths of cesium were observed for natural fissure surface sample of rapakivi granite up to 2.5 mm and of mica gneiss up to 3.7 mm. For strontium the penetration depths of 6 mm and 11 mm for unfilled and filled natural fissure samples of rapakivi granite were found. Dsup(a)-values for cesium varied between 1.5 x 10 -15 and 3.2 x 10 -14 , for strontium between 3.5 x 10 -14 and 2.1 x 10 -13 m 2 /s. D-value obtained for cobalt (drill core cup sample, tonalite) was 5.4 x 10 -17 m 2 /s. 241 Am was only sorbed on the surface of the sample and thus no apparent diffusion coefficient could be calculated. Filling materials, chlorite and secondary minerals in tonalite and rapakivi granite increased diffusion into the mother rock. Radionuclides were sorbed both into the filling material and through fillers into the rock matrix. Cs and Sr penetrated though calcite filling material in mica gneiss into the mother rock. Calcite didn't influence on diffusion of radionuclides. Penetration depths of Cs and Sr were about the same for filled and unfilled samples
Simple computation of reaction–diffusion processes on point clouds
Macdonald, Colin B.
2013-05-20
The study of reaction-diffusion processes is much more complicated on general curved surfaces than on standard Cartesian coordinate spaces. Here we show how to formulate and solve systems of reaction-diffusion equations on surfaces in an extremely simple way, using only the standard Cartesian form of differential operators, and a discrete unorganized point set to represent the surface. Our method decouples surface geometry from the underlying differential operators. As a consequence, it becomes possible to formulate and solve rather general reaction-diffusion equations on general surfaces without having to consider the complexities of differential geometry or sophisticated numerical analysis. To illustrate the generality of the method, computations for surface diffusion, pattern formation, excitable media, and bulk-surface coupling are provided for a variety of complex point cloud surfaces.
Simple computation of reaction–diffusion processes on point clouds
Macdonald, Colin B.; Merriman, Barry; Ruuth, Steven J.
2013-01-01
The study of reaction-diffusion processes is much more complicated on general curved surfaces than on standard Cartesian coordinate spaces. Here we show how to formulate and solve systems of reaction-diffusion equations on surfaces in an extremely simple way, using only the standard Cartesian form of differential operators, and a discrete unorganized point set to represent the surface. Our method decouples surface geometry from the underlying differential operators. As a consequence, it becomes possible to formulate and solve rather general reaction-diffusion equations on general surfaces without having to consider the complexities of differential geometry or sophisticated numerical analysis. To illustrate the generality of the method, computations for surface diffusion, pattern formation, excitable media, and bulk-surface coupling are provided for a variety of complex point cloud surfaces.
Diffusion Under Geometrical Constraint
Ogawa, Naohisa
2014-01-01
Here we discus the diffusion of particles in a curved tube. This kind of transport phenomenon is observed in biological cells and porous media. To solve such a problem, we discuss the three dimensional diffusion equation with a confining wall forming a thinner tube. We find that the curvature appears in a effective diffusion coefficient for such a quasi-one-dimensional system. As an application to higher dimensional case, we discuss the diffusion in a curved surface with ...
Aldarf, M; Fourcade, F; Amrane, A; Prigent, Y
2004-07-05
Geotrichum candidum was cultivated at the surface of solid model media containing peptone to simulate the composition of Camembert cheese. The surface growth of G. candidum induced the diffusion of substrates from the core to the rind and the diffusion of produced metabolites from the rind to the core. In the range of pH measured during G. candidum growth, constant diffusion coefficients were found for lactate and ammonium, 0.4 and 0.8 cm(2) day(-1), respectively, determined in sterile culture medium. Growth kinetics are described using the Verlhust model and both lactate consumption and ammonium production are considered as partially linked to growth. The experimental diffusion gradients of lactate and ammonium recorded during G. candidum growth have been fitted. The diffusion/reaction model was found to match with experimental data until the end of growth, except with regard to ammonium concentration gradients in the presence of lactate in the medium. Indeed, G. candidum preferentially assimilated peptone over lactate as a carbon source, resulting in an almost cessation of ammonium release before the end of growth. On peptone, it was found that the proton transfer did not account for the ammonium concentration gradients. Indeed, amino acids, being positively charged, are involved in the proton transfer at the beginning of growth. This effect can be neglected in the presence of lactate within the medium, and the sum of both lactate consumption and ammonium release gradients corresponded well to the proton transfer gradients, confirming that both components are responsible for the pH increase observed during the ripening of soft Camembert cheese. Copyright 2004 Wiley Periodicals, Inc.
Rapid nickel diffusion in cold-worked type 316 austenitic steel at 360-500 C
Energy Technology Data Exchange (ETDEWEB)
Arioka, Koji [Institute of Nuclear Safety Systems, Inc., Mihama (Japan); Iijima, Yoshiaki [Tohoku Univ., Sendai (Japan). Dept. of Materials Science; Miyamoto, Tomoki [Kobe Material Testing Laboratory Co. Ltd., Harima (Japan)
2017-10-15
The diffusion coefficient of nickel in cold-worked Type 316 austenitic steel was determined by the diffusion couple method in the temperature range between 360 and 500 C. A diffusion couple was prepared by electroless nickel plating on the surface of a 20 % cold-worked Type 316 austenitic steel specimen. The growth in width of the interdiffusion zone was proportional to the square root of diffusion time until 14 055 h. The diffusion coefficient of nickel (D{sub Ni}) in cold-worked Type 316 austenitic steel was determined by extrapolating the concentration-dependent interdiffusion coefficient to 11 at.% of nickel. The value of D{sub Ni} at 360 C was about 5 000 times higher than the lattice diffusion coefficient of nickel in Type 316 austenitic steel. The determined activation energy 117 kJ mol{sup -1} was 46.6 % of the activation energy 251 kJ mol{sup -1} for the lattice diffusion of nickel in Type 316 austenitic steel.
Measuring nanoparticle diffusion in an ABELtrap
Dienerowitz, M.; Dienerowitz, F.; Börsch, M.
2018-03-01
Monitoring the Brownian motion of individual nanoscopic objects is key to investigate their transport properties and interactions with their close environment. Most techniques rely on transient diffusion through a detection volume or immobilisation, which restrict observation times or motility. We measure the diffusion coefficient and surface charge of individual nanoparticles and DNA molecules in an anti-Brownian electrokinetic trap (ABELtrap). This instrument is an active feedback trap confining the Brownian motion of a nanoparticle to the detection site by applying an electric field based on the particle’s current position. We simulate the Brownian motion of nanospheres in our sample geometry, including wall effects, due to partial confinement in the third dimension. The theoretically predicted values are in excellent agreement with our diffusion measurements in the ABELtrap. We also demonstrate the ABELtrap’s ability to measure varying sizes of DNA origami structures during denaturation.
Diffusion of hydrogen into and through γ-iron by density functional theory
Chohan, Urslaan K.; Koehler, Sven P. K.; Jimenez-Melero, Enrique
2018-06-01
This study is concerned with the early stages of hydrogen embrittlement on an atomistic scale. We employed density functional theory to investigate hydrogen diffusion through the (100), (110) and (111) surfaces of γ-Fe. The preferred adsorption sites and respective energies for hydrogen adsorption were established for each plane, as well as a minimum energy pathway for diffusion. The H atoms adsorb on the (100), (110) and (111) surfaces with energies of ∼4.06 eV, ∼3.92 eV and ∼4.05 eV, respectively. The barriers for bulk-like diffusion for the (100), (110) and (111) surfaces are ∼0.6 eV, ∼0.5 eV and ∼0.7 eV, respectively. We compared these calculated barriers with previously obtained experimental data in an Arrhenius plot, which indicates good agreement between experimentally measured and theoretically predicted activation energies. Texturing austenitic steels such that the (111) surfaces of grains are preferentially exposed at the cleavage planes may be a possibility to reduce hydrogen embrittlement.
Directory of Open Access Journals (Sweden)
Wen-juan Wu
2017-01-01
Full Text Available Signal transducer and activator of transcription (STAT is a unique protein family that binds to DNA, coupled with tyrosine phosphorylation signaling pathways, acting as a transcriptional regulator to mediate a variety of biological effects. Cerebral ischemia and reperfusion can activate STATs signaling pathway, but no studies have confirmed whether STAT activation can be verified by diffusion-weighted magnetic resonance imaging (DWI in rats after cerebral ischemia/reperfusion. Here, we established a rat model of focal cerebral ischemia injury using the modified Longa method. DWI revealed hyperintensity in parts of the left hemisphere before reperfusion and a low apparent diffusion coefficient. STAT3 protein expression showed no significant change after reperfusion, but phosphorylated STAT3 expression began to increase after 30 minutes of reperfusion and peaked at 24 hours. Pearson correlation analysis showed that STAT3 activation was correlated positively with the relative apparent diffusion coefficient and negatively with the DWI abnormal signal area. These results indicate that DWI is a reliable representation of the infarct area and reflects STAT phosphorylation in rat brain following focal cerebral ischemia/reperfusion.
Lavoine, Nathalie; Guillard, Valérie; Desloges, Isabelle; Gontard, Nathalie; Bras, Julien
2016-09-20
Cellulose nanofibers (CNFs) were recently investigated for the elaboration of new functional food-packaging materials. Their nanoporous network was especially of interest for controlling the release of active species. Qualitative release studies were conducted, but quantification of the diffusion phenomenon observed when the active species are released from and through CNF coating has not yet been studied. Therefore, this work aims to model CNF-coated paper substrates as controlled release system for food-packaging using release data obtained for two model molecules, namely caffeine and chlorhexidine digluconate. The applied mathematical model - derived from Fickian diffusion - was validated for caffeine only. When the active species chemically interacts with the release device, another model is required as a non-predominantly diffusion-controlled release was observed. From caffeine modeling data, a theoretical active food-packaging material was designed. The use of CNFs as barrier coating was proved to be the ideal material configuration that best meets specifications. Copyright © 2016. Published by Elsevier Ltd.
Surface diffuse discharge mechanism of well-aligned atmospheric pressure microplasma arrays
International Nuclear Information System (INIS)
Zhou Ren-Wu; Li Jiang-Wei; Chen Mao-Dong; Zhang Xian-Hui; Liu Dong-Ping; Yang Si-Ze; Zhou Ru-Sen; Zhuang Jin-Xing; Ostrikov, Kostya
2016-01-01
A stable and homogeneous well-aligned air microplasma device for application at atmospheric pressure is designed and its electrical and optical characteristics are investigated. Current-voltage measurements and intensified charge coupled device (ICCD) images show that the well-aligned air microplasma device is able to generate a large-area and homogeneous discharge at the applied voltages ranging from 12 kV to 14 kV, with a repetition frequency of 5 kHz, which is attributed to the diffusion effect of plasma on dielectric surface. Moreover, this well-aligned microplasma device may result in the uniform and large-area surface modification of heat-sensitive PET polymers without damage, such as optimization in hydrophobicity and biocompatibility. In the biomedical field, the utility of this well-aligned microplasma device is further testified. It proves to be very efficient for the large-area and uniform inactivation of E. coli cells with a density of 10 3 /cm 2 on LB agar plate culture medium, and inactivation efficiency can reach up to 99% for 2-min treatment. (paper)
Energy Technology Data Exchange (ETDEWEB)
Gardin, Denis Emmanuel [Univ. of California, Berkeley, CA (United States)
1993-12-01
Nitrile hydrogenation is the most commonly used method for preparing diverse amines. This thesis is aimed at the mechanism and factors affecting the performance of Ni-based catalysts in nitrile hydrogenations. Surface science techniques are used to study bonding of nitriles and amines to a Ni(111) surface and to identify surface intermediates. Liquid-phase hydrogenations of cyclohexene and 1-hexene on a Pt foil were carried out successfully. Finally, knowledge about the surface structure, surface chemical bond, dynamics of surface atoms (diffusion, growth), and reactivity of metal surfaces from solid-gas interface studies, is discussed.
Energy Technology Data Exchange (ETDEWEB)
Kimmich, R; Nusser, W; Gneiting, T [Ulm Universitaet (Federal Republic of Germany). Sektion Kernresonanzspektroskopie
1990-04-01
A model theory is presented explaining a series of striking phenomena observed with nuclear magnetic relaxation in protein systems such as solutions or tissue. The frequency, concentration and temperature dependences of proton or deuteron relaxation times of protein solutions and tissue are explained. It is concluded that the translational diffusion of water molecules along the rugged surfaces of proteins and, to a minor degree, protein backbone fluctuations are crucial processes. The rate limiting factor of macromolecular tumbling is assumed to be given by the free water content in a certain analogy to the free-volume model of Cohen ad Turnbull. There are two characteristic water mass fractions indicating the saturation of the hydration shells and the onset of protein tumbling. A closed and relatively simple set of relaxation formulas is presented. The potentially fractal nature of the diffusion of water molecules on the protein surface is discussed. (author). 43 refs.; 4 figs.
Rapid nickel diffusion in cold-worked carbon steel at 320-450 °C
Arioka, Koji; Iijima, Yoshiaki; Miyamoto, Tomoki
2015-11-01
The diffusion coefficient of nickel in cold-worked carbon steel was determined with the diffusion couple method in the temperature range between 320 and 450 °C. Diffusion couple was prepared by electro-less nickel plating on the surface of a 20% cold-worked carbon steel. The growth in width of the interdiffusion zone was proportional to the square root of diffusion time to 12,000 h. The diffusion coefficient (DNi) of nickel in cold-worked carbon steel was determined by extrapolating the concentration-dependent interdiffusion coefficient to 0% of nickel. The temperature dependence of DNi is expressed by DNi = (4.5 + 5.7/-2.5) × 10-11 exp (-146 ± 4 kJ mol-1/RT) m2s-1. The value of DNi at 320 °C is four orders of magnitude higher than the lattice diffusion coefficient of nickel in iron. The activation energy 146 kJ mol-1 is 54% of the activation energy 270.4 kJ mol-1 for lattice diffusion of nickel in the ferromagnetic state iron.
Cowley, M J; Mantle, J A; Rogers, W J; Russell, R O; Rackley, C E; Logic, J R
1979-06-01
It has been suggested that diffuse Tc-99m pyrophosphate precordial activity may be due to persistent blood-pool activity in routine delayed views during myocardial imaging. To answer this question, we reviewed myocardial scintigrams recorded 60--90 min following the injection of 12--15 mCi of Tc-99m pyrophosphate for the presence of diffuse precordial activity, and compared these with early images of the blood pool in 265 patients. Diffuse activity in the delayed images was identified in 48 patients: in 20 with acute myocardial infarction and in 28 with no evidence of it. Comparison of these routine delayed images with early views of the blood pool revealed two types of patterns. In patients with acute infarction, 95% had delayed images that were distinguishable from blood pool either because the activity was smaller than the early blood pool, or by the presence of localized activity superimposed on diffuse activity identical to blood pool. In those without infarction, 93% had activity distribution in routine delayed views matching that in the early blood-pool images. The usefulness of the diffuse TcPPi precordial activity in myocardial infarction is improved when early blood-pool imaging is used to exclude persistence of blood-pool activity as its cause. Moreover, it does not require additional amounts of radioactivity nor complex computer processing, a feature that may be of value in the community hospital using the technique to "rule out" infarction 24--72 hr after onset of suggestive symptoms.
Au nanowire junction breakup through surface atom diffusion
Vigonski, Simon; Jansson, Ville; Vlassov, Sergei; Polyakov, Boris; Baibuz, Ekaterina; Oras, Sven; Aabloo, Alvo; Djurabekova, Flyura; Zadin, Vahur
2018-01-01
Metallic nanowires are known to break into shorter fragments due to the Rayleigh instability mechanism. This process is strongly accelerated at elevated temperatures and can completely hinder the functioning of nanowire-based devices like e.g. transparent conductive and flexible coatings. At the same time, arranged gold nanodots have important applications in electrochemical sensors. In this paper we perform a series of annealing experiments of gold and silver nanowires and nanowire junctions at fixed temperatures 473, 673, 873 and 973 K (200 °C, 400 °C, 600 °C and 700 °C) during a time period of 10 min. We show that nanowires are especially prone to fragmentation around junctions and crossing points even at comparatively low temperatures. The fragmentation process is highly temperature dependent and the junction region breaks up at a lower temperature than a single nanowire. We develop a gold parametrization for kinetic Monte Carlo simulations and demonstrate the surface diffusion origin of the nanowire junction fragmentation. We show that nanowire fragmentation starts at the junctions with high reliability and propose that aligning nanowires in a regular grid could be used as a technique for fabricating arrays of nanodots.
Surface active monomers synthesis, properties, and application
Borzenkov, Mykola
2014-01-01
This brief includes information on the background?of and development of synthesis of various types of surface active monomers. The authors explain the importance of utilization of surface active monomers for creation of surface active polymers? and the various biomedical applications of such compounds . This brief introduces techniques for the synthesis of novel types of surface active monomers, their colloidal and polymerizable properties and application for needs of medicine and biology.
Directory of Open Access Journals (Sweden)
Kaewploy Somsak
2015-01-01
Full Text Available Liquid state welding techniques available are prone to gas porosity problems. To avoid this solid state bonding is usually an alternative of preference. Among solid state bonding techniques, diffusion bonding is often employed in aluminium alloy automotive parts welding in order to enhance their mechanical properties. However, there has been no standard procedure nor has there been any definitive criterion for judicious welding parameters setting. It is thus a matter of importance to find the set of optimal parameters for effective diffusion bonding. This work proposes the use of response surface methodology in determining such a set of optimal parameters. Response surface methodology is more efficient in dealing with complex process compared with other techniques available. There are two variations of response surface methodology. The one adopted in this work is the central composite design approach. This is because when the initial upper and lower bounds of the desired parameters are exceeded the central composite design approach is still capable of yielding the optimal values of the parameters that appear to be out of the initially preset range. Results from the experiments show that the pressing pressure and the holding time affect the tensile strength of jointing. The data obtained from the experiment fits well to a quadratic equation with high coefficient of determination (R2 = 94.21%. It is found that the optimal parameters in the process of jointing semi-solid casting aluminium alloy by using diffusion bonding are the pressing pressure of 2.06 MPa and 214 minutes of the holding time in order to achieve the highest tensile strength of 142.65 MPa
Effective transport properties for the pyridine-granular activated carbon adsorption system
Directory of Open Access Journals (Sweden)
S. A. Baz-Rodríguez
2012-09-01
Full Text Available In this work, the kinetics of pyridine adsorption onto granular activated carbon was studied from the point of view of an up-scaling process by using the method of volume averaging. The pore and surface effective diffusivities were estimated by supposing simple microscale geometries (ordered media of cylinders and spheres and those of images processed from SEM (Scanning Electron Microscopy micrographs. In addition, as a rough estimate, the point surface diffusivity is reported. The results revealed that the up-scaled diffusional model satisfactorily interpreted the concentration decay curves and the effective diffusivity was found to be an increasing function of the concentration, mainly due to the contribution of surface diffusion. In general, the diffusivity coefficients involved in the adsorption system are related through the expression molecular diffusivity = 22 ï‚' point surface diffusivity = 5/2 x‚' pore effective diffusivity = 1/12 x ‚' surface effective diffusivity.
International Nuclear Information System (INIS)
Rios Perez, Carlos A.; Biegalski, Steve R.; Deinert, Mark R.
2012-01-01
Highlights: ► Prompt gamma activation analysis is used to study gas diffusion in a porous system. ► Diffusion coefficients are determined using prompt gamma activation analysis. ► Predictions concentrations fit experimental measurements with an R 2 of 0.98. - Abstract: Diffusion plays a critical role in determining the rate at which gases migrate through porous systems. Accurate estimates of diffusion coefficients are essential if gas transport is to be accurately modeled and better techniques are needed that can be used to measure these coefficients non-invasively. Here we present a novel method for using prompt gamma activation analysis to determine the binary diffusion coefficients of a gas in a porous system. Argon diffusion experiments were conducted in a 1 m long, 10 cm diameter, horizontal column packed with a SiO 2 sand. The temporal variation of argon concentration within the system was measured using prompt gamma activation analysis. The binary diffusion coefficient was obtained by comparing the experimental data with the predictions from a numerical model in which the diffusion coefficient was varied until the sum of square errors between experiment and model data was minimized. Predictions of argon concentration using the optimal diffusivity fit experimental measurements with an R 2 of 0.983.
Takeuchi, Noboru; Selloni, Annabella; Myers, T. H.; Doolittle, A.
2005-09-01
We present density-functional-theory calculations of the binding and diffusion of Ga and N adatoms on GaN (0001) and (000-1) surfaces under different conditions, including stoichiometric and Ga-rich surfaces, as well as in the presence of electron-hole (e-h) pairs induced by light- or electron-beam irradiation. We find that both Ga-rich conditions and electronic excitations cause a significant reduction of the adatom diffusion barriers, as required to improve the quality of the material. However, the two effects are nonadditive, as the influence of e-h pairs are found to be less important for the more metallic situations.
Gallium diffusion in zinc oxide via the paired dopant-vacancy mechanism
Sky, T. N.; Johansen, K. M.; Riise, H. N.; Svensson, B. G.; Vines, L.
2018-02-01
Isochronal and isothermal diffusion experiments of gallium (Ga) in zinc oxide (ZnO) have been performed in the temperature range of 900-1050 °C. The samples used consisted of a sputter-deposited and highly Ga-doped ZnO film at the surface of a single-crystal bulk material. We use a novel reaction diffusion (RD) approach to demonstrate that the diffusion behavior of Ga in ZnO is consistent with zinc vacancy (VZn) mediation via the formation and dissociation of GaZnVZn complexes. In the RD modeling, experimental diffusion data are fitted utilizing recent density-functional-theory estimates of the VZn formation energy and the binding energy of GaZnVZn. From the RD modeling, a migration energy of 2.3 eV is deduced for GaZnVZn, and a total/effective activation energy of 3.0 eV is obtained for the Ga diffusion. Furthermore, and for comparison, employing the so-called Fair model, a total/effective activation energy of 2.7 eV is obtained for the Ga diffusion, reasonably close to the total value extracted from the RD-modeling.
Energy Technology Data Exchange (ETDEWEB)
Gao, Wei; Jiao, Yang; Dai, Lenore L., E-mail: Lenore.Dai@asu.edu [Arizona State University, School of Engineering of Matter, Transport, and Energy (United States)
2016-04-15
We have employed molecular dynamics simulations to systematically investigate the effects of nanoparticles’ structural and chemical properties on their diffusive behaviors at/across the water–benzene interface. Four different nanoparticles were studied: modified hydrocarbon nanoparticles with a mean diameter of 1.2 nm (1.2HCPs), modified hydrocarbon nanoparticles with a mean diameter of 0.6 nm (0.6HCPs), single-walled carbon nanotubes (SWCNTs), and buckyballs. We found that the diffusion coefficients of 0.6 and 1.2HCP were larger than the corresponding values predicted using the Stokes–Einstein (SE) equation and attributed this deviation to the small particle size and the anisotropy of the interface system. In addition, the observed directional diffusive behaviors for various particles were well-correlated with the derivative of the potential of mean force (PMF), which might indicate an effective driving force for the particles along the direction perpendicular to the interface. We also found that nanoparticles with isotropic shape and uniform surface, e.g., buckyballs, tend to have smaller diffusion coefficients than those of nanoparticles with comparable dimensions but anisotropic shapes and non-uniform surface composition, e.g., SWCNT and 0.6HCP. One possible hypothesis for this behavior is that the “perfect” isotropic shape and uniform surface of buckyballs result in a better-defined “solvation shell” (i.e., a shell of solution molecules), which leads to a larger “effective radius” of the particle, and thus, a reduced diffusion coefficient.
International Nuclear Information System (INIS)
Solovetskii, Yu.I.; Miroshinichenko, I.I.; Lunin, V.V.
1993-01-01
Radiation-thermal damage of the surface and the active metal phases of hydrodesulfurization Ni-Mo/Al 2 O 3 catalysts by a fast electron beam of up to 2.0 MeV energy was studied. UV-Vis diffuse reflectance spectra of the industrial and model coked systems after radiation-thermal treatment were measured. 14 refs., 2 figs
3-D Spherical Convection Modeling Applied to Mercury: Dislocation Versus Diffusion Rheology
Robertson, S. D.; King, S. D.
2016-12-01
Mercury is the smallest among the terrestrial planets and, prior to NASA's MESSENGER mission was thought to be the least tectonically and volcanically active body. Gravity and moment of inertia from MESSENGER constrain Mercury to have a thin silicate mantle shell of approximately 400 km over a massive iron core. This mantle is thinner than previously thought and the smallest end-member in comparison with the other terrestrial planets. Although Mercury currently has a stagnant lid and the present day mantle is likely not convecting, a significant proportion of Mercury's surface features could have been derived from convection in the viscous mantle. Given Mercury's small size, the amount of volcanism and tectonic activity was a surprise. We investigate the effect of dislocation creep rheology in olivine on the dynamics of Mercury. At the pressures and temperatures of Mercury's mantle, laboratory creep studies indicate that olivine deforms by dislocation creep. Previous studies using diffusion creep rheology find that the thin mantle shell of Mercury quickly becomes diffusive and, this is difficult to reconcile with the surface observations. We use the three-dimensional spherical code, CitcomS, to compare numerical models with both dislocation and diffusion creep. We compare gravity, topography, and mantle temperature as a function of time from the models with constraints on the timing of volcanic and tectonic activity on Mercury. The results show that with the dislocation creep mechanism, there is potential for convective flow in the mantle over billions of years. In contrast, models with the diffusion creep mechanism start with a convecting mantle that transitions to global diffusive cooling within 500 Myrs. Diffusion creep rheology does not adequately produce a dynamic interior that is consistent with the historical volcanic and tectonic evolution of the planet. This research is the result of participation in GLADE, a nine-week summer REU program directed by Dave
SIMS study of oxygen diffusion in monoclinic HfO2
Mueller, Michael P.; De Souza, Roger A.
2018-01-01
The diffusion of oxygen in dense ceramics of monoclinic HfO2 was studied by means of (18O/16O) isotope exchange annealing and subsequent determination of isotope depth profiles by Secondary Ion Mass Spectrometry. Anneals were performed in the temperature range of 573 ≤T /K ≤ 973 at an oxygen partial pressure of p O2=200 mbar . All measured isotope profiles exhibited two features: the first feature, closer to the surface, was attributed mainly to slow oxygen diffusion in an impurity silicate phase; the second feature, deeper in the sample, was attributed to oxygen diffusion in bulk monoclinic HfO2 . The activation enthalpy of oxygen tracer diffusion in bulk HfO2 was found to be ΔHD∗≈0.5 eV .
Directory of Open Access Journals (Sweden)
Louena Shtrepi
2017-02-01
Full Text Available Simulations of the acoustic effects that diffusive surfaces have on the objective acoustic parameters and on sound perception have not yet been fully understood. To this end, acoustic simulations have been performed in Odeon in the model of a variable-acoustic concert hall. This paper is presented as a follow-up study to a previous paper that dealt with in-field measurements only. As in measurements, a diffusive and a reflective condition of one of the lateral walls have been considered in the room models. Two modeling alternatives of the diffusive condition, that is, (a a flat surface with high scattering coefficient applied; and (b a triangular relief modeled including edge diffraction, have been investigated. Objective acoustic parameters, such as early decay time (EDT, reverberation time (T30, clarity (C80, definition (D50, and interaural cross correlation (IACC, have been compared between the two conditions. Moreover, an auditory experiment has been performed to determine the maximum distance from a diffusive surface at which the simulated acoustic scattering effects are still audible. Although the simulated objective results showed a good match with measured values, the subjective results showed that the differences between the diffuse and reflective conditions become significant when model (b is used.
Method for measurement of radon diffusion and solubility in solid materials
Maier, Andreas; Weber, Uli; Dickmann, Jannis; Breckow, Joachim; van Beek, Patrick; Schardt, Dieter; Kraft, Gerhard; Fournier, Claudia
2018-02-01
In order to study the permeation i.e. the diffusion and solubility of radon gas in biological material, a new setup was constructed and a novel analysis was applied to obtain diffusion and solubility coefficients. Thin slabs of solid materials were installed between detector housing and the surrounding radon exposure chamber of 50 Ls volume. In this setup radon can diffuse through thin test samples into a cylindrical volume of 5 mm height and 20 mm diameter and reach an α-particle detector. There the 5.49 MeV α-decay of the penetrating radon atoms is measured by a silicon surface barrier detector. The time dependent activities inside the small detector volume are recorded after injection of a known radon activity concentration into the outer chamber. Analyzing the time behavior of the integral α-activity from radon in the small vessel, both, the diffusion coefficient and solubility of the test material can be determined, based on a new mathematical model of the diffusion process concerning the special boundary conditions given by the experimental setup. These first measurements were intended as proof of concept for the detection system and the data analysis. Thin polyethylene foils (LDPE) were selected as material for the diffusion measurements and the results were in agreement with data from literature. In further measurements, we will concentrate on biological material like bone, fat and other tissues.
International Nuclear Information System (INIS)
Cowley, M.J.; Mantle, J.A.; Rogers, W.J.; Russell, R.O. Jr.; Rackley, C.E.; Logic, J.R.
1979-01-01
It has been suggested that diffuse 99m Tc pyrophosphate precordial activity may be due to persistent blood-pool activity in routine delayed views during myocardial imaging. To answer this question, we reviewed myocardial scintigrams recorded 60 to 90 min following the injection of 12 to 15 mCi of 99m Tc pyrophosphate for the presence of diffuse precordial activity, and compared these with early images of the blood pool in 265 patients. Diffuse activity in the delayed images was identified in 48 patients: in 20 with acute myocardial infarction and in 28 with no evidence of it. Comparison of these routine delayed images with early views of the blood pool revealed two types of patterns. In patients with acute infarction, 95% had delayed images that were distinguishable from blood pool either because the activity was smaller than the early blood pool, or by the presence of localized activity superimposed on diffuse activity identical to blood pool. In those without infarction, 93% had activity distribution in routine delayed views matching that in the early blood-pool images. The usefulness of the diffuse TcPPi precordial activity in myocardial infarction is improved when early blood-pool imaging is used to exclude persistence of blood-pool activity as its cause. Moreover, it does not require additional amounts of radioactivity nor complex computer processing, a feature that may be of value in the community hospital using the technique to rule out infarction 24 to 72 hr after onset of suggestive symptoms
Li, Xuechen; Geng, Jinling; Jia, Pengying; Zhang, Panpan; Zhang, Qi; Li, Yaru
2017-11-01
Excited by an alternating current voltage, a patterned discharge and a diffuse discharge are generated in a needle to liquid configuration. Using an intensified charge-coupled device (ICCD), temporal evolution of the discharge between the two electrodes is investigated for the diffuse mode and the patterned mode, respectively. For the diffuse mode, the positive discharge is in a glow regime, and the negative discharge is in a Townsend discharge regime. For the patterned mode, the discharge always belongs to the Townsend discharge regime. Moreover, in the patterned mode, various patterns including the single loop, single loop with the surrounding corona, triple loops, and concentric loops with a central spot are observed on the water surface with the increasing positive peak-value of the applied voltage (Upp). Temporally resolved images of the loop-patterns are captured on the water surface. From the electrical measurements and the ICCD imaging, it is found that the loop pattern emerges after the discharge bridges the two electrodes. Then, it begins to evolve and finally degenerates with the decrease in the discharge current. The pattern does not disappear until the discharge quenches. Formation of the loop-patterns is attributed to the role of negative ions.
International Nuclear Information System (INIS)
Agarwal, A.; Gossmann, H.-.; Eaglesham, D.J.; Pelaz, L.; Jacobson, D.C.; Haynes, T.E.; Erokhin, Y.E.
1997-01-01
The reduction of transient enhanced diffusion (TED) with reduced implantation energy has been investigated and quantified. A fixed dose of 1x10 14 cm -2 Si + was implanted at energies ranging from 0.5 to 20 keV into boron doping superlattices and enhanced diffusion of the buried boron marker layers was measured for anneals at 810, 950, and 1050 degree C. A linearly decreasing dependence of diffusivity enhancement on decreasing Si + ion range is observed at all temperatures, extrapolating to ∼1 for 0 keV. This is consistent with our expectation that at zero implantation energy there would be no excess interstitials from the implantation and hence no TED. Monte Carlo modeling and continuum simulations are used to fit the experimental data. The results are consistent with a surface recombination length for interstitials of <10 nm. The data presented here demonstrate that in the range of annealing temperatures of interest for p-n junction formation, TED is reduced at smaller ion implantation energies and that this is due to increased interstitial annihilation at the surface. copyright 1997 American Institute of Physics
DEFF Research Database (Denmark)
Zhang, Chen; Heiselberg, Per Kvols; Pomianowski, Michal Zbigniew
2016-01-01
An integrated system combining diffuse ceiling ventilation with thermally activated building construction (TABS) was proposed recently. In this system, TABS is encapsulated by diffuse ceiling panel and cannot have directly heat exchange with the room. The aim of this study is to investigate...... the effect of diffuse ceiling panel on the energy performance of TABS in both heat and cooling mode. Experiments are carried out in a full-scale test facility with the integrated system, and the cases without diffuse ceiling are also measured as references. The results indicate that the diffuse ceiling has...... an opposite effect on the heating and cooling capacity of TABS. In addition, a numerical model is built and validated by the measured data. The validated model is further applied to conduct a paramedical study on the materials of the diffuse ceiling panel....
Symmetries and modelling functions for diffusion processes
International Nuclear Information System (INIS)
Nikitin, A G; Spichak, S V; Vedula, Yu S; Naumovets, A G
2009-01-01
A constructive approach to the theory of diffusion processes is proposed, which is based on application of both symmetry analysis and the method of modelling functions. An algorithm for construction of the modelling functions is suggested. This algorithm is based on the error function expansion (ERFEX) of experimental concentration profiles. The high-accuracy analytical description of the profiles provided by ERFEX approximation allows a convenient extraction of the concentration dependence of diffusivity from experimental data and prediction of the diffusion process. Our analysis is exemplified by its employment in experimental results obtained for surface diffusion of lithium on the molybdenum (1 1 2) surface precovered with dysprosium. The ERFEX approximation can be directly extended to many other diffusion systems.
Measuring methods of matrix diffusion
International Nuclear Information System (INIS)
Muurinen, A.; Valkiainen, M.
1988-03-01
In Finland the spent nuclear fuel is planned to be disposed of at large depths in crystalline bedrock. The radionuclides which are dissolved in the groundwater may be able to diffuse into the micropores of the porous rock matrix and thus be withdrawn from the flowing water in the fractures. This phenomenon is called matrix diffusion. A review over matrix diffusion is presented in the study. The main interest is directed to the diffusion of non-sorbing species. The review covers diffusion experiments and measurements of porosity, pore size, specific surface area and water permeability
Impurity diffusion, point defect engineering, and surface/interface passivation in germanium
Chroneos, Alexander I.; Schwingenschlö gl, Udo; Dimoulas, Athanasios Dimoulas
2012-01-01
in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices
Application of impulsive methods to the study of diffusion in solid state alloys
International Nuclear Information System (INIS)
Belaidouni, Said
1979-01-01
This research thesis deals with the field of high temperature melt environments, and more particularly with the determination of the contribution of different steps of the electrochemical reaction (charge transfer, transport of electro-active species, variation of the electrode surface condition). The use of metal electrodes highlighted the importance of phenomena of diffusion in the metal. This leaded to the use of impulsive methods to determine solid-state transport properties. After a presentation of the theoretical processing of impulsive methods (cell potential, transport equations, double-layer charge), and a discussion of the diffusion in metal alloys (diffusion flow, diffusion coefficients, grain boundary diffusion), the author reports an experimental investigation (installation and measurement equipment) and discusses the obtained results (alloy thermodynamics, diffusion studied by the deposition method, impulsive methods with potentiostatic or galvano-static pulses) [fr
Bläckberg, Lisa
2011-01-01
This thesis investigates the ability of transparent surface coatings to reduce xenon diffusion into plastic scintillators. The motivation for the work is improved radioxenon monitoring equipment, used with in the framework of the verification regime of the Comprehensive Nuclear-Test-Ban Treaty. A large part of the equipment used in this context incorporates plastic scintillators which are in direct contact with the radioactive gas to be detected. One problem with such setup is that radioxenon...
Atmospheric turbulence and diffusion research
International Nuclear Information System (INIS)
Hosker, R.P. Jr.
1993-01-01
The Atmospheric Turbulence and Diffusion Division (well known in the atmospheric dispersion community as the Atmospheric Turbulence and Diffusion Laboratory, ATDL) is one of several field facilities of NOAAs Air Resources Laboratory, headquartered in Silver Spring, Maryland. The laboratory conducts research on matters of atmospheric diffusion and turbulent exchange, concerning air quality. ATDD focuses attention on the physics of the lower atmosphere, with special emphasis on the processes contributing to atmospheric transport, dispersion, deposition, and air-surface exchange, and on the development of predictive capabilities using the results of this research. Research is directed toward issues of national and global importance related to the missions of DOE, to DOE's Oak Ridge Field Office, and to NOAA. The program is divided into four major projects: plume transport and diffusion in the planetary boundary layer, complex topography, canopy micrometeorology, and air-surface exchange
Effect of diffusion from a lateral surface on the rate of GaN nanowire growth
International Nuclear Information System (INIS)
Sibirev, N. V.; Tchernycheva, M.; Cirlin, G. E.; Patriarche, G.; Harmand, J. C.; Dubrovskii, V. G.
2012-01-01
The kinetics of the growth of GaN crystalline nanowires on a Si (111) surface with no catalyst is studied experimentally and theoretically. Noncatalytic GaN nanowires were grown by molecular-beam epitaxy with AlN inserts, which makes it possible to determine the rate of the vertical growth of nanowires. A model for the formation of GaN nanowires is developed, and an expression for their rate of growth is derived. It is shown that, in the general case, the dependence of the rate of growth on the nanowire diameter has a minimum. The diameter corresponding to the experimentally observed minimum of the rate of growth steadily increases with increasing diffusion flux from the lateral surface.
Directory of Open Access Journals (Sweden)
Daniel Felix Schaffhauser
Full Text Available An integrated microdevice for measuring proton-dependent membrane activity at the surface of Xenopus laevis oocytes is presented. By establishing a stable contact between the oocyte vitelline membrane and an ion-sensitive field-effect (ISFET sensor inside a microperfusion channel, changes in surface pH that are hypothesized to result from facilitated proton lateral diffusion along the membrane were detected. The solute diffusion barrier created between the sensor and the active membrane area allowed detection of surface proton concentration free from interference of solutes in bulk solution. The proposed sensor mechanism was verified by heterologously expressing membrane transport proteins and recording changes in surface pH during application of the specific substrates. Experiments conducted on two families of phosphate-sodium cotransporters (SLC20 & SLC34 demonstrated that it is possible to detect phosphate transport for both electrogenic and electroneutral isoforms and distinguish between transport of different phosphate species. Furthermore, the transport activity of the proton/amino acid cotransporter PAT1 assayed using conventional whole cell electrophysiology correlated well with changes in surface pH, confirming the ability of the system to detect activity proportional to expression level.
Density functional theory prediction for diffusion of lithium on boron-doped graphene surface
International Nuclear Information System (INIS)
Gao Shuanghong; Ren Zhaoyu; Wan Lijuan; Zheng Jiming; Guo Ping; Zhou Yixuan
2011-01-01
The density functional theory (DFT) investigation shows that graphene has changed from semimetal to semiconductor with the increasing number of doped boron atoms. Lithium and boron atoms acted as charge contributors and recipients, which attracted to each other. Further investigations show that, the potential barrier for lithium diffusion on boron-doped graphene is higher than that of intrinsic graphene. The potential barrier is up to 0.22 eV when six boron atoms doped (B 6 C 26 ), which is the lowest potential barrier in all the doped graphene. The potential barrier is dramatically affected by the surface structure of graphene.
Second generation diffusion model of interacting gravity waves on the surface of deep fluid
Directory of Open Access Journals (Sweden)
A. Pushkarev
2004-01-01
Full Text Available We propose a second generation phenomenological model for nonlinear interaction of gravity waves on the surface of deep water. This model takes into account the effects of non-locality of the original Hasselmann diffusion equation still preserving important properties of the first generation model: physically consistent scaling, adherence to conservation laws and the existence of Kolmogorov-Zakharov solutions. Numerical comparison of both models with the original Hasselmann equation shows that the second generation models improves the angular distribution in the evolving wave energy spectrum.
Diffuse-Illumination Systems for Growing Plants
May, George; Ryan, Robert
2010-01-01
Agriculture in both terrestrial and space-controlled environments relies heavily on artificial illumination for efficient photosynthesis. Plant-growth illumination systems require high photon flux in the spectral range corresponding with plant photosynthetic active radiation (PAR) (400 700 nm), high spatial uniformity to promote uniform growth, and high energy efficiency to minimize electricity usage. The proposed plant-growth system takes advantage of the highly diffuse reflective surfaces on the interior of a sphere, hemisphere, or other nearly enclosed structure that is coated with highly reflective materials. This type of surface and structure uniformly mixes discrete light sources to produce highly uniform illumination. Multiple reflections from within the domelike structures are exploited to obtain diffuse illumination, which promotes the efficient reuse of photons that have not yet been absorbed by plants. The highly reflective surfaces encourage only the plant tissue (placed inside the sphere or enclosure) to absorb the light. Discrete light sources, such as light emitting diodes (LEDs), are typically used because of their high efficiency, wavelength selection, and electronically dimmable properties. The light sources are arranged to minimize shadowing and to improve uniformity. Different wavelengths of LEDs (typically blue, green, and red) are used for photosynthesis. Wavelengths outside the PAR range can be added for plant diagnostics or for growth regulation
Diffusion of Radionuclides in Bentonite Clay - Laboratory and in situ Studies
International Nuclear Information System (INIS)
Jansson, Mats
2002-12-01
This thesis deals with the diffusion of ions in compacted bentonite clay. Laboratory experiments were performed to examine in detail different processes that affect the diffusion. To demonstrate that the results obtained from the laboratory investigations are valid under in situ conditions, two different kinds of in situ experiments were performed. Laboratory experiments were performed to better understand the impact of ionic strength on the diffusion of S 2+ and Cs + ions, which sorb to mineral surfaces primarily by ion exchange. Furthermore, surface related diffusion was examined and demonstrated to take place for Sr 2+ and Cs + but not for Co 2+ , which sorbs on mineral surfaces by complexation. The diffusion of anions in bentonite clay compacted to different dry densities was also investigated. The results indicate that anion diffusion in bentonite clay consists of two processes, one fast and another slower. We ascribe the fast diffusive process to intralayer diffusion and the slow process to diffusion in interparticle water, where anions are to some extent sorbed to edge sites of the montmorillonite. Two different types of in situ experiments were performed, CHEMLAB and LOT. CHEMLAB is a borehole laboratory, where cation (Cs + , Sr 2+ and Co 2+ ) and anion (I- and TcO 4 - ) diffusion experiments were performed using groundwater from a fracture in the borehole. In the LOT experiments cylindrical bentonite blocks surrounding a central copper rod were placed in a 4 m deep vertical borehole. The borehole was then sealed and the blocks are left for 1, 5 or >> 5 years. When the bentonite was water saturated the central copper rod is heated to simulate the temperature increase due to radioactive decay of the spent fuel. Bentonite doped with radioactive Cs and Co was placed in one of the lower blocks. Interestingly, the redox-sensitive pertechnetate ion (TcO 4 - ) which thermodynamically should be reduced and precipitate as TcO 2 n H 2 O, travelled unreduced through
Directory of Open Access Journals (Sweden)
Shaoying Lu
2008-07-01
Full Text Available Genetically encoded biosensors based on fluorescence resonance energy transfer (FRET have been widely applied to visualize the molecular activity in live cells with high spatiotemporal resolution. However, the rapid diffusion of biosensor proteins hinders a precise reconstruction of the actual molecular activation map. Based on fluorescence recovery after photobleaching (FRAP experiments, we have developed a finite element (FE method to analyze, simulate, and subtract the diffusion effect of mobile biosensors. This method has been applied to analyze the mobility of Src FRET biosensors engineered to reside at different subcompartments in live cells. The results indicate that the Src biosensor located in the cytoplasm moves 4-8 folds faster (0.93+/-0.06 microm(2/sec than those anchored on different compartments in plasma membrane (at lipid raft: 0.11+/-0.01 microm(2/sec and outside: 0.18+/-0.02 microm(2/sec. The mobility of biosensor at lipid rafts is slower than that outside of lipid rafts and is dominated by two-dimensional diffusion. When this diffusion effect was subtracted from the FRET ratio images, high Src activity at lipid rafts was observed at clustered regions proximal to the cell periphery, which remained relatively stationary upon epidermal growth factor (EGF stimulation. This result suggests that EGF induced a Src activation at lipid rafts with well-coordinated spatiotemporal patterns. Our FE-based method also provides an integrated platform of image analysis for studying molecular mobility and reconstructing the spatiotemporal activation maps of signaling molecules in live cells.
DEFF Research Database (Denmark)
Laursen, Mads Brink; Fernandes, Frederico Augusto Pires; Christiansen, Thomas Lundin
2015-01-01
. In this study halide-activated pack cementation techniques were used on tool steel Vanadis 6 and martensitic stainless steel AISI 420 in order to produce hard layers of titanium carbide (TiC), vanadium carbide (V8C7) and chromium carbides (Cr23C6 and Cr7C3). Surface layers were characterized by scanning......Hard wear resistant surface layers of transition metal carbides can be produced by thermo-reactive diffusion processes where interstitial elements from a steel substrate together with external sources of transition metals (Ti, V, Cr etc.) form hard carbide and/or nitride layers at the steel surface...... electron microscopy, X-ray diffraction and Vickers hardness testing. The study shows that porosityfree, homogenous and very hard surface layers can be produced by thermo-reactive diffusion processes. The carbon availability of the substrate influences thickness of obtained layers, as Vanadis 6 tool steel...
Studies of ionic diffusion in crystalline rock
International Nuclear Information System (INIS)
Ohlsson, Yvonne
2001-01-01
Matrix diffusion is of great importance in delaying radionuclides escaping from a deep geologic repository, on their way to the biosphere. There are, however, poorly understood mechanisms related to transport in pores with charged pore surfaces. Ions are affected by this charge and may be repelled or attracted by it. The rate of transport may be reduced, or even enhanced, as a result of this. Transport of ions is studied by traditional diffusion experiments, but mainly by a faster electrical conductivity method. With this method the pore connectivity, the formation factor variability and its relation to the porosity, as well as the surface conductivity are investigated. The method is compared. with traditional diffusion experiments, and an in-situ application is suggested and qualitatively tested. Furthermore, surface diffusion is studied by evaluating literature data and recently developed diffusion models. The pore connectivity reached to a depth of at least 15 cm in the rocks studied. The formation factor did not generally decrease with increasing sample length. It was also found that not only cations in the free pore water add to the electrical conductivity, but also at least part of those sorbed to the pore surfaces of the minerals. This surface conductivity influences the determination of the formation factor in low ionic strength pore waters, and was also found to be a function of the formation factor. It was furthermore dependent on the type of ion at the surface, giving for example a higher conductivity for Na + than for Cs + . It is not fully understood which part of the sorbed ions that are mobile. A simple model was developed assigning the mobile ions to the diffuse layer, and this model explained experimental data for diffusion of Cs + in clay well. This is contradicted by surface conductivity measurements that have shown that most mobile ions are found behind the Stern layer. The in-situ formation factor determination method seems promising. The most
International Nuclear Information System (INIS)
Niwase, Kazuhito; Sugihashi, Naoyuki; Tsuji, Yukikazu
2010-01-01
This paper describes the design procedure for the material selection and mix proportion of the self-compacting mortar used for low diffusion layer cementitious material in the sub-surface radioactive waste disposal facility in Japan. The low diffusion layer is required for reducing transportation by controlling diffusion of a radionuclide. Therefore the low diffusion, cracks control, and low leaching are the important matters in the mix design. The process to select mortar mix design of the low diffusion layer is explained in detail. Of 33 kinds mix proportions used in laboratory comparative testing, the combinations of low heat portland cement, fly ash, lime powder and expansive addition was provisionally set to the mix proportion of the self-compacting mortar used for low diffusion layer. (author)
Directory of Open Access Journals (Sweden)
Xiaojun Ma
2014-06-01
Full Text Available High surface area activated carbon fibers (ACF have been prepared from bamboo by steam activation after liquefaction and curing. The influences of activation temperature on the microstructure, surface area and porosity were investigated. The results showed that ACF from bamboo at 850 °C have the maximum iodine and methylene blue adsorption values. Aside from the graphitic carbon, phenolic and carbonyl groups were the predominant functions on the surface of activated carbon fiber from bamboo. The prepared ACF from bamboo were found to be mainly type I of isotherm, but the mesoporosity presented an increasing trend after 700 °C. The surface area and micropore volume of samples, which were determined by application of the Brunauer-Emmett-Teller (BET and t-plot methods, were as high as 2024 m2/g and 0.569 cm3/g, respectively. It was also found that the higher activation temperature produced the more ordered microcrystalline structure of ACF from bamboo.
Energy Technology Data Exchange (ETDEWEB)
Placidi, E., E-mail: ernesto.placidi@ism.cnr.it; Arciprete, F. [Istituto di Struttura della Materia, CNR, Via del Fosso del Cavaliere 100, 00133 Rome (Italy); Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Latini, V.; Latini, S.; Patella, F. [Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Magri, R. [Dipartimento di Scienze Fisiche, Informatiche e Matematiche (FIM), Università di Modena e Reggio Emilia, and Centro S3 CNR-Istituto Nanoscienze, Via Campi 213/A, 4100 Modena (Italy); Scuderi, M.; Nicotra, G. [CNR-IMM, Strada VIII, 5, 95121 Catania (Italy)
2014-09-15
An innovative multilayer growth of InAs quantum dots on GaAs(100) is demonstrated to lead to self-aggregation of correlated quantum dot chains over mesoscopic distances. The fundamental idea is that at critical growth conditions is possible to drive the dot nucleation only at precise locations corresponding to the local minima of the Indium chemical potential. Differently from the known dot multilayers, where nucleation of new dots on top of the buried ones is driven by the surface strain originating from the dots below, here the spatial correlations and nucleation of additional dots are mostly dictated by a self-engineering of the surface occurring during the growth, close to the critical conditions for dot formation under the fixed oblique direction of the incoming As flux, that drives the In surface diffusion.
Diffusion mechanisms of strontium, cesium and cobalt in compacted sodium bentonite
International Nuclear Information System (INIS)
Muurinen, A.; Rantanen, J.; Penttilae-Hiltunen, P.
1986-01-01
For a porous water-saturated material where diffusion in the porewater, sorption on the solid material and diffusion of the sorbed ions (surface diffusion) occur, a diffusion equation can be derived where the apparent diffusivity includes two terms. One represents diffusion in the pore-water, the other surface diffusion. In this research diffusion mechanisms were studied. The apparent diffusivities of strontium, cesium and cobalt in compacted sodium bentonite were measured by a non-steady state method. The sorption factors were adjusted using different sodium chloride solutions, groundwater and addition of EDTA for saturation of the bentonite samples. The corresponding sorption factors were measured by a batch method. The results suggest that cations diffuse also while being sorbed. A combined pore diffusion-surface diffusion model has been used to explain the transport and the corresponding diffusivities have been evaluated. The surface diffusivities (D/sub s/) of Sr and Cs were 8-9 x 10 -12 m 2 /s and 4-7 x 10 -13 m 2 /s respectively. The pore diffusivity epsilon D/sub p/ of Cs was 3.5 x 10 -11 m 2 /s which has been used also for Sr. The sorption mechanisms of Co seems to be different from that of Sr or Cs and the results allow no specific conclusions of the diffusion mechanisms of Co. The apparent diffusivity of Co ranged from 2 x 10 -14 to 7 x 10 -14 m 2 /s. The anionic Co-EDTA seems to follow some other diffusion mechanism than the cations
Method of coating the interior surface of hollow objects with a diffusion coating
Knowles, Shawn D.; Senor, David J.; Forbes, Steven V.; Johnson, Roger N.; Hollenberg, Glenn W.
2005-03-15
A method for forming a diffusion coating on the interior of surface of a hollow object wherein a filament, extending through a hollow object and adjacent to the interior surface of the object, is provided, with a coating material, in a vacuum. An electrical current is then applied to the filament to resistively heat the filament to a temperature sufficient to transfer the coating material from the filament to the interior surface of the object. The filament is electrically isolated from the object while the filament is being resistively heated. Preferably, the filament is provided as a tungsten filament or molybdenum filament. Preferably, the coating materials are selected from the group consisting of Ag, Al, As, Au, Ba, Be, Bi, Ca, Cd, Co, Cr, Cu, Dy, Er, Eu, Fe, Ga, Ge, Hg, In, K, Li, Mg, Mn, Na, Ni P, Pb, Pd, Pr, S, Sb, Sc, Se, Si, Sn, Sr, Te, Tl, Y, Yb, Zn, and combinations thereof. The invention additionally allows for the formation of nitrides, hydrides, or carbides of all the possible coating materials, where such compounds exist, by providing a partial pressure of nitrogen, hydrogen, hydrocarbons, or combination thereof, within the vacuum.
The precipitation behavior of titanium carbide on the surface of SUS 321 stainless steel
International Nuclear Information System (INIS)
Yoshihara, Kazuhiro; Nii, Kazuyoshi
1982-01-01
The surface composition of SUS 321 stainless steel at high temperatures was observed in vacuum with Auger electron spectroscopy. The precipitation of titanium carbide was found on the surface of SUS 321. The thickness of precipitated titanium carbide layer increased in proportion to the square root of annealing time and became about 0.05 μm after heated at 1100 K for 432 ks. The precipitated titanium carbide was not replaced by the most surface active element sulfur, and remained stable on the surface. The precipitated layer, however, was not even and had many holes about 1 μm in diameter. The bottom of a hole was SUS 321, on which phosphorus, oxygen and sulfur segregated. As the annealing time was prolonged, these segregants were replaced one by one in the order of the surface activity, and finally the most surface active element, sulfur, remained on the bottom of the hole. Moreover, sulfur diffused over the outside of the hole. The precipitation of titanium carbide on the surface occurred according to the following processes: (1) The titanium and carbon which had been dissolved in the bulk diffused onto the surface of the stainless steel. (2) The titanium carbide which had been precipitated in the bulk dissolved because the concentration of titanum and carbon fell under their solubility limits in the bulk. (3) The titanium and carbon diffused onto the surface which was exposed to vacuum. (4) The titanium and carbon recombined into titanium carbide and precipitated on the surface. The growth rate of the thickness of the precipitated layer was controlled by the diffusion of titanium and carbon in the precipitated titanium carbide. (J.P.N.)
Development of neutron diffuse scattering analysis code by thin film and multilayer film
International Nuclear Information System (INIS)
Soyama, Kazuhiko
2004-01-01
To research surface structure of thin film and multilayer film by neutron, a neutron diffuse scattering analysis code using DWBA (Distorted-Wave Bron Approximation) principle was developed. Subjects using this code contain the surface and interface properties of solid/solid, solid/liquid, liquid/liquid and gas/liquid, and metal, magnetism and polymer thin film and biomembran. The roughness of surface and interface of substance shows fractal self-similarity and its analytical model is based on DWBA theory by Sinha. The surface and interface properties by diffuse scattering are investigated on the basis of the theoretical model. The calculation values are proved to be agreed with the experimental values. On neutron diffuse scattering by thin film, roughness of surface of thin film, correlation function, neutron propagation by thin film, diffuse scattering by DWBA theory, measurement model, SDIFFF (neutron diffuse scattering analysis program by thin film) and simulation results are explained. On neutron diffuse scattering by multilayer film, roughness of multilayer film, principle of diffuse scattering, measurement method and simulation examples by MDIFF (neutron diffuse scattering analysis program by multilayer film) are explained. (S.Y.)To research surface structure of thin film and multilayer film by neutron, a neutron diffuse scattering analysis code using DWBA (Distorted-Wave Bron Approximation) principle was developed. Subjects using this code contain the surface and interface properties of solid/solid, solid/liquid, liquid/liquid and gas/liquid, and metal, magnetism and polymer thin film and biomembran. The roughness of surface and interface of substance shows fractal self-similarity and its analytical model is based on DWBA theory by Sinha. The surface and interface properties by diffuse scattering are investigated on the basis of the theoretical model. The calculation values are proved to be agreed with the experimental values. On neutron diffuse scattering
Lai, King C.; Liu, Da-Jiang; Evans, James W.
2017-12-01
For diffusion of two-dimensional homoepitaxial clusters of N atoms on metal (100) surfaces mediated by edge atom hopping, macroscale continuum theory suggests that the diffusion coefficient scales like DN˜ N-β with β =3 /2 . However, we find quite different and diverse behavior in multiple size regimes. These include: (i) facile diffusion for small sizes N mediated diffusion with small β 2 for N =Np+1 and Np+2 also for moderate sizes 9 ≤N ≤O (102) ; (iv) merging of the above distinct branches and subsequent anomalous scaling with 1 ≲β analysis must account for a strong enhancement of diffusivity for short time increments due to back correlation in the cluster motion. Further understanding of this enhancement, of anomalous size scaling behavior, and of the merging of various branches, is facilitated by combinatorial analysis of the number of the ground-state and low-lying excited state cluster configurations, and also of kink populations.
Diffusion and chemical activity of Zr-Sn and Zr-Ti systems
International Nuclear Information System (INIS)
Zee, R.H.; Watters, J.F.; Davidson, R.D.
1986-01-01
A modified evaporation method was used to determine the diffusion coefficients and the emission rates of Sn and Ti in Zr-Sn and Zr-Ti, respectively, at temperatures between 1605 and 1970 K. Results show that both Sn and Ti diffuse in their respective alloys via a vacancy mechanism. Comparison with data in the literature reveals that the activation energy for diffusion of Sn in Zr-Sn, with Sn content between 3 and 5 at.X is relatively constant from 1200 to 1970 K. From the measured emission rates, values of 103 and 98 kcal/mol were obtained for the enthalpies of sublimation for Sn and Ti in their alloys. With a comparison of the solute vapor pressures with those of the pure elements, partial molar free energies, entropies, and enthalpies for the two systems were determined in the temperature range investigated. The Zr-Sn system shows a very large negative heat of formation (-33 kcal/mol) whereas the Zr-Ti system behaves quite ideally, in agreement with phase-diagram predictions
Bicarbonate diffusion through mucus.
Livingston, E H; Miller, J; Engel, E
1995-09-01
The mucus layer overlying duodenal epithelium maintains a pH gradient against high luminal acid concentrations. Despite these adverse conditions, epithelial surface pH remains close to neutrality. The exact nature of the gradient-forming barrier remains unknown. The barrier consists of mucus into which HCO3- is secreted. Quantification of the ability of HCO3- to establish and maintain the gradient depends on accurate measurement of this ion's diffusion coefficient through mucus. We describe new experimental and mathematical methods for diffusion measurement and report diffusion coefficients for HCO3- diffusion through saline, 5% mucin solutions, and rat duodenal mucus. The diffusion coefficients were 20.2 +/- 0.10, 3.02 +/- 0.31, and 1.81 +/- 0.12 x 10(-6) cm2/s, respectively. Modeling of the mucobicarbonate layer with this latter value suggests that for conditions of high luminal acid strength the neutralization of acid by HCO3- occurs just above the epithelial surface. Under these conditions the model predicts that fluid convection toward the lumen could be important in maintaining the pH gradient. In support of this hypothesis we were able to demonstrate a net luminal fluid flux of 5 microliters.min-1.cm-2 after perfusion of 0.15 N HCl in the rat duodenum.
Effects of repository environment on diffusion behavior of radionuclides in buffer materials
International Nuclear Information System (INIS)
Kozaki, Tamotsu; Sato, Seichi
2004-03-01
Compacted bentonite is considered as a candidate buffer material in the geological disposal of high-level radioactive waste. An important function of the compacted bentonite is to retard the transport of radionuclides from waste forms to the surrounding host rock after degradation of an overpack. Therefore, diffusion behavior of radionuclides in the compacted bentonite has been extensively studied by many researchers for the performance assessments of the geological disposal. However, diffusion mechanism of radionuclides in the bentonite cannot be fully understood, and most experimental data have been obtained at room temperature for the bentonite saturated with low salinity water, which would disagree often with real repository conditions. In this study, therefore, apparent diffusion coefficients were determined at various diffusion temperatures for chloride ions in Na-montmorillonite samples saturated with NaCl solution of high salinity. Activation energies for the apparent diffusion were also obtained from the temperature dependence of the diffusion coefficients at different salinity. As the salinity increased, the apparent diffusion coefficients of chloride ions in montmorillonite were found to increase slightly. On the other hand, the activation energies for the chloride diffusion were found to be almost constant (approximately 12 kJ mol -1 ) and less than that in free water (17.4 kJ mol -1 ). Effects of salinity on diffusion behavior of radionuclides in montmorillonite were discussed from the viewpoints of microstructure of montmorillonite and distribution of ions in the montmorillonite. As a result, the diffusion behavior of sodium ions could be explained by the changes of the predominant diffusion process among pore water diffusion, surface diffusion, and interlayer diffusion that could be caused by the increase of salinity. (author)
Activation energy of tracer-diffusion of manganese ions (Mn2+) in alkali metal chloride solutions
International Nuclear Information System (INIS)
Borhade, A.V.
2000-01-01
The activation energy of the tracer diffusion of Mn 2+ ions in alkali chloride solutions (0.1M) has been determined in agar gel medium (1-2.5%) over the temperature range of 25 - 45 deg C. The decrease in the value of the Arrhenius parameters, E and D 0 , with gel percentage is explained on the basis of the transition state theory. Further, the activation energy as a function of electrolyte concentration is also investigated using 1% agar gel in the temperature range of 25 - 45 deg C. In both the cases, the activation energies are determined by the least square fitting of the diffusion coefficient data obtained at various temperatures through the Arrhenius plots. (author)
Influence of radon diffusion on the 210Pb distribution in sediments
International Nuclear Information System (INIS)
Imboden, D.M.; Stiller, M.
1982-01-01
A mathematical model is presented which describes the distribution of radon 222 in sediments having a constant or variable depth distribution of radium 226. The model is extended to the distribution of lead 210, taking into account the mobility of radon (the precursor of 210 Pb) within the sediment column. The 210 Pb model is compared, at constant radium activity, with the conventional approach which disregards the radon diffusion when estimating sedimentation rates by the 210 Pb method. The ratio between apparent and real sedimentation rate, s'/s, expressed as a function of three dimensionless parameters, demonstrates the importance of the radon diffusion effect. This effect is particularly important for sediments with small initial excess 210 Pb activity, small sedimentation rate, large radon diffusivity, or a combination of these factors. Applied to Lake Geneva, the sedimentation is estimated to be larger by 30--50% than the original value by Krishnaswami et al, (1971). In sediments which are mixed at the surface (physical mixing or bioturbation), the 210 PB activity in the mixed layer is diminished compared to that in the settling sediment material (Robbins et al., 1977), and radon diffusion makes the activity difference even larger, especially for low initial excess 210 Pb activity, small sedimentation rate, and large mixing intensity. This result may be of importance for the balance of 210 Pb in an aquatic system if the calculations are based on activities measured in the sediment
Active-Site Hydration and Water Diffusion in Cytochrome P450cam: A Highly Dynamic Process
Energy Technology Data Exchange (ETDEWEB)
Miao, Yinglong [ORNL; Baudry, Jerome Y [ORNL
2011-01-01
Long-timescale molecular dynamics simulations (300 ns) are performed on both the apo- (i.e., camphor-free) and camphor-bound cytochrome P450cam (CYP101). Water diffusion into and out of the protein active site is observed without biased sampling methods. During the course of the molecular dynamics simulation, an average of 6.4 water molecules is observed in the camphor-binding site of the apo form, compared to zero water molecules in the binding site of the substrate-bound form, in agreement with the number of water molecules observed in crystal structures of the same species. However, as many as 12 water molecules can be present at a given time in the camphor-binding region of the active site in the case of apo-P450cam, revealing a highly dynamic process for hydration of the protein active site, with water molecules exchanging rapidly with the bulk solvent. Water molecules are also found to exchange locations frequently inside the active site, preferentially clustering in regions surrounding the water molecules observed in the crystal structure. Potential-of-mean-force calculations identify thermodynamically favored trans-protein pathways for the diffusion of water molecules between the protein active site and the bulk solvent. Binding of camphor in the active site modifies the free-energy landscape of P450cam channels toward favoring the diffusion of water molecules out of the protein active site.
Diffuse sound field: challenges and misconceptions
DEFF Research Database (Denmark)
Jeong, Cheol-Ho
2016-01-01
Diffuse sound field is a popular, yet widely misused concept. Although its definition is relatively well established, acousticians use this term for different meanings. The diffuse sound field is defined by a uniform sound pressure distribution (spatial diffusion or homogeneity) and uniform...... tremendously in different chambers because the chambers are non-diffuse in variously different ways. Therefore, good objective measures that can quantify the degree of diffusion and potentially indicate how to fix such problems in reverberation chambers are needed. Acousticians often blend the concept...... of mixing and diffuse sound field. Acousticians often refer diffuse reflections from surfaces to diffuseness in rooms, and vice versa. Subjective aspects of diffuseness have not been much investigated. Finally, ways to realize a diffuse sound field in a finite space are discussed....
Mineral paragenesis on Mars: The roles of reactive surface area and diffusion.
Fairén, Alberto G; Gil-Lozano, Carolina; Uceda, Esther R; Losa-Adams, Elisabeth; Davila, Alfonso F; Gago-Duport, Luis
2017-09-01
Geochemical models of secondary mineral precipitation on Mars generally assume semiopen systems (open to the atmosphere but closed at the water-sediment interface) and equilibrium conditions. However, in natural multicomponent systems, the reactive surface area of primary minerals controls the dissolution rate and affects the precipitation sequences of secondary phases, and simultaneously, the transport of dissolved species may occur through the atmosphere-water and water-sediment interfaces. Here we present a suite of geochemical models designed to analyze the formation of secondary minerals in basaltic sediments on Mars, evaluating the role of (i) reactive surface areas and (ii) the transport of ions through a basalt sediment column. We consider fully open conditions, both to the atmosphere and to the sediment, and a kinetic approach for mineral dissolution and precipitation. Our models consider a geochemical scenario constituted by a basin (i.e., a shallow lake) where supersaturation is generated by evaporation/cooling and the starting point is a solution in equilibrium with basaltic sediments. Our results show that cation removal by diffusion, along with the input of atmospheric volatiles and the influence of the reactive surface area of primary minerals, plays a central role in the evolution of the secondary mineral sequences formed. We conclude that precipitation of evaporites finds more restrictions in basaltic sediments of small grain size than in basaltic sediments of greater grain size.
International Nuclear Information System (INIS)
Tiwari, G.P.; Kale, G.B.; Patil, R.V.
1999-01-01
The article presents a brief survey of process of diffusion in solids. It is emphasised that the essence of diffusion is the mass transfer through the atomic jumps. To begin with formal equations for diffusion coefficient are presented. This is followed by discussions on mechanisms of diffusion. Except for solutes which form interstitial solid solution, diffusion in majority of cases is mediated through exchange of sites between an atom and its neighbouring vacancy. Various vacancy parameters such as activation volume, correlation factor, mass effect etc are discussed and their role in establishing the mode of diffusion is delineated. The contribution of dislocations and grain boundaries in diffusion process is brought out. The experimental determination of different types of diffusion coefficients are described. Finally, the pervasive nature of diffusion process in number of commercial processes is outlined to show the importance of diffusion studies in materials science and technology. (author)
Internal Diffusion-Controlled Enzyme Reaction: The Acetylcholinesterase Kinetics.
Lee, Sangyun; Kim, Ji-Hyun; Lee, Sangyoub
2012-02-14
Acetylcholinesterase is an enzyme with a very high turnover rate; it quenches the neurotransmitter, acetylcholine, at the synapse. We have investigated the kinetics of the enzyme reaction by calculating the diffusion rate of the substrate molecule along an active site channel inside the enzyme from atomic-level molecular dynamics simulations. In contrast to the previous works, we have found that the internal substrate diffusion is the determinant of the acetylcholinesterase kinetics in the low substrate concentration limit. Our estimate of the overall bimolecular reaction rate constant for the enzyme is in good agreement with the experimental data. In addition, the present calculation provides a reasonable explanation for the effects of the ionic strength of solution and the mutation of surface residues of the enzyme. The study suggests that internal diffusion of the substrate could be a key factor in understanding the kinetics of enzymes of similar characteristics.
International Nuclear Information System (INIS)
Hanna, S.R.
1976-01-01
It is hoped that urban diffusion models of air pollutants can eventually confidently be used to make major decisions, such as in planning the layout of a new industrial park, determining the effects of a new highway on air quality, or estimating the results of a new automobile emissions exhaust system. The urban diffusion model itself should be able to account for point, line, and area sources, and the local aerodynamic effects of street canyons and building wakes. Removal or transformations due to dry or wet deposition and chemical reactions are often important. It would be best if the model included meteorological parameters such as wind speed and temperature as dependent variables, since these parameters vary significantly when air passes from rural surfaces over urban surfaces
Wang, Z. B.; Lu, K.; Wilde, G.; Divinski, S.
2008-09-01
Room temperature diffusion of Ni63 in Cu with a gradient microstructure prepared by surface mechanical attrition treatment (SMAT) was investigated by applying the radiotracer technique. The results reveal significant penetration of Ni into the nanostructured layer. The relevant diffusivity is higher than that along the conventional high-angle grain boundaries by about six orders of magnitude. This behavior is associated with a higher energy state of internal interfaces produced via plastic deformation. The diffusivity in the top surface layer is somewhat smaller than that in the subsurface layer. This fact is related to nanotwin formation in the former during SMAT.
Yamamoto, Takehiro; Emura, Chie; Oya, Masashi
2016-12-01
The growth of a biofilm begins with the adhesion of bacteria to a solid surface. Consequently, biofilm growth can be managed by the control of bacterial adhesion. Recent experimental studies have suggested that bacterial adhesion can be controlled by modifying a solid surface using nanostructures. Computational prediction and analysis of bacterial adhesion behavior are expected to be useful for the design of effective arrangements of nanostructures for controlling bacterial adhesion. The present study developed a cellular automaton (CA) model for bacterial adhesion simulation that could describe both the diffusive motion of bacteria and dependence of their adhesion patterns on the distance between nanostructures observed in experimental studies. The diffusive motion was analyzed by the moment scaling spectrum theory, and the present model was confirmed to describe subdiffusion behavior due to obstacles. Adhesion patterns observed in experimental studies can be successfully simulated by introducing CA rules to describe a mechanism by which bacteria tend to move to increase the area of contact with nanostructures. Copyright © 2016 Elsevier Ltd. All rights reserved.
Thermally activated reaction–diffusion-controlled chemical bulk reactions of gases and solids
Directory of Open Access Journals (Sweden)
S. Möller
2015-01-01
Full Text Available The chemical kinetics of the reaction of thin films with reactive gases is investigated. The removal of thin films using thermally activated solid–gas to gas reactions is a method to in-situ control deposition inventory in vacuum and plasma vessels. Significant scatter of experimental deposit removal rates at apparently similar conditions was observed in the past, highlighting the need for understanding the underlying processes. A model based on the presence of reactive gas in the films bulk and chemical kinetics is presented. The model describes the diffusion of reactive gas into the film and its chemical interaction with film constituents in the bulk using a stationary reaction–diffusion equation. This yields the reactive gas concentration and reaction rates. Diffusion and reaction rate limitations are depicted in parameter studies. Comparison with literature data on tokamak co-deposit removal results in good agreement of removal rates as a function of pressure, film thickness and temperature.
International Nuclear Information System (INIS)
Ikeda, Minoru; Yamasaki, Takahiro; Kaneta, Chioko
2010-01-01
Using the projector-augmented plane wave method, we study diffusion and dissociation processes of C 2 H 2 molecules on the ferromagnetic bcc-Fe(110) surface and investigate the formation process of graphene created by C 2 H 2 molecules. The most stable site for C 2 H 2 on the Fe surface is a hollow site and its adsorption energy is - 3.5 eV. In order to study the diffusion process of the C 2 H 2 molecule, the barrier height energies for the C atom, C 2 -dimer and CH as well as the C 2 H 2 molecule are estimated using the nudged elastic band method. The barrier height energy for C 2 H 2 is 0.71 eV and this indicates that the C 2 H 2 diffuses easily on this FM bcc-Fe(110) surface. We further investigate the two step dissociation process of C 2 H 2 on Fe. The first step is the dissociation of C 2 H 2 into C 2 H and H, and the second step is that of C 2 H into C 2 and H. Their dissociation energies are 0.9 and 1.2 eV, respectively. These energies are relatively small compared to the dissociation energy 7.5 eV of C 2 H 2 into C 2 H and H in the vacuum. Thus, the Fe surface shows catalytic effects. We further investigate the initial formation process of graphene by increasing the coverage of C 2 H 2 . The formation process of the benzene molecule on the FM bcc(110) surface is also discussed. We find that there exists a critical coverage of C 2 H 2 which characterizes the beginning of the formation of the graphene.
Ikeda, Minoru; Yamasaki, Takahiro; Kaneta, Chioko
2010-09-29
Using the projector-augmented plane wave method, we study diffusion and dissociation processes of C(2)H(2) molecules on the ferromagnetic bcc-Fe(110) surface and investigate the formation process of graphene created by C(2)H(2) molecules. The most stable site for C(2)H(2) on the Fe surface is a hollow site and its adsorption energy is - 3.5 eV. In order to study the diffusion process of the C(2)H(2) molecule, the barrier height energies for the C atom, C(2)-dimer and CH as well as the C(2)H(2) molecule are estimated using the nudged elastic band method. The barrier height energy for C(2)H(2) is 0.71 eV and this indicates that the C(2)H(2) diffuses easily on this FM bcc-Fe(110) surface. We further investigate the two step dissociation process of C(2)H(2) on Fe. The first step is the dissociation of C(2)H(2) into C(2)H and H, and the second step is that of C(2)H into C(2) and H. Their dissociation energies are 0.9 and 1.2 eV, respectively. These energies are relatively small compared to the dissociation energy 7.5 eV of C(2)H(2) into C(2)H and H in the vacuum. Thus, the Fe surface shows catalytic effects. We further investigate the initial formation process of graphene by increasing the coverage of C(2)H(2). The formation process of the benzene molecule on the FM bcc(110) surface is also discussed. We find that there exists a critical coverage of C(2)H(2) which characterizes the beginning of the formation of the graphene.
Homogeneous near surface activity distribution by double energy activation for TLA
International Nuclear Information System (INIS)
Takacs, S.; Ditroi, F.; Tarkanyi, F.
2007-01-01
Thin layer activation (TLA) is a versatile tool for activating thin surface layers in order to study real-time the surface loss by wear, corrosion or erosion processes of the activated parts, without disassembling or stopping running mechanical structures or equipment. The research problem is the determination of the irradiation parameters to produce point-like or large area optimal activity-depth distribution in the sample. Different activity-depth profiles can be produced depending on the type of the investigated material and the nuclear reaction used. To produce activity that is independent of the depth up to a certain depth is desirable when the material removed from the surface by wear, corrosion or erosion can be collected completely. By applying dual energy irradiation the thickness of this quasi-constant activity layer can be increased or the deviation of the activity distribution from a constant value can be minimized. In the main, parts made of metals and alloys are suitable for direct activation, but by using secondary particle implantation the wear of other materials can also be studied in a surface range a few micrometers thick. In most practical cases activation of a point-like spot (several mm 2 ) is enough to monitor the wear, corrosion or erosion, but for special problems relatively large surfaces areas of complicated spatial geometry need to be activated uniformly. Two ways are available for fulfilling this task, (1) production of large area beam spot or scanning the beam over the surface in question from the accelerator side, or (2) a programmed 3D movement of the sample from the target side. Taking into account the large variability of tasks occurring in practice, the latter method was chosen as the routine solution in our cyclotron laboratory
Energy Technology Data Exchange (ETDEWEB)
Ajmal, Muhammad; Siddiq, Mohammad [Quaid-I-Azam University, Islamabad (Pakistan); Farooqi, Zahoor Hussain [University of the Punjab, Lahore (Pakistan)
2013-11-15
Multi-responsive poly(N-isopropylacrylamide-methacrylic acid-acrylamide) [P(NIPAM-MAA-AAm)] copolymer microgel was prepared by free radical emulsion polymerization. Silver nanoparticles were fabricated inside the microgel network by in-situ reduction of silver nitrate. Swelling and deswelling behavior of the pure microgels was studied under various conditions of pH and temperature using dynamic light scattering. A red shift was observed in surface plasmon resonance wavelength of Ag nanoparticles with pH induced swelling of hybrid microgel. The catalytic activity of the hybrid system was investigated by monitoring the reduction of p-nitrophenol under different conditions of temperature and amount of catalysts. For this catalytic reaction a time delay of 8 to 10min was observed at room temperature, which was reduced to 2 min at high temperature due to swelling of microgels, which facilitated diffusion of reactants to catalyst surface and increased rate of reaction.
International Nuclear Information System (INIS)
Kaarmann, H.; Hoinkes, H.; Wilsch, H.
1983-01-01
The thermally activated disappearance of a carbon layer on a Ni(110) surface was investigated by the scattering of atomic hydrogen and by secondary-ion mass spectrometry. Decreasing C coverage at surface temperatures kept constant in each case at values between 650 and 750 K resulted in an exponential decrease of specular H-beam intensity as well as C + secondary-ion yield. This decrease in both cases fits first-order kinetics (presumable diffusion into the bulk) with an identical rate constant as a function of surface temperature and results finally in a preexponential frequency ν = 10/sup() 10plus-or-minus1/ s -1 and an activation energy E/sub A/ = 1.8 +- 0.2 eV
International Nuclear Information System (INIS)
Ishida, Tadashi; Nakajima, Yuuki; Fujita, Hiroyuki; Endo, Junji; Collard, Dominique
2009-01-01
Gold diffusion into silicon at room temperature was observed in real time with atomic resolution. Gold nanoclusters were formed on a silicon surface by an electrical discharge between a silicon tip and a gold coated tip inside an ultrahigh-vacuum transmission electron microscope (TEM) specimen chamber. At the moment of the gold nanocluster deposition, the gold nanoclusters had a crystalline structure. The crystalline structure gradually disappeared due to the interdiffusion between silicon and gold as observed after the deposition of gold nanoclusters. The shape of the nanocluster gradually changed due to the gold diffusion into the damaged silicon. The diffusion front between silicon and gold moved toward the silicon side. From the observations of the diffusion front, the gold diffusivity at room temperature was extracted. The extracted activation energy, 0.21 eV, matched the activation energy in bulk diffusion between damaged silicon and gold. This information is useful for optimizing the hybridization between solid-state and biological nanodevices in which gold is used as an adhesive layer between the two devices.
Energy Technology Data Exchange (ETDEWEB)
Wang, Chi-Jen [Iowa State Univ., Ames, IA (United States)
2013-01-01
In this thesis, we analyze both the spatiotemporal behavior of: (A) non-linear “reaction” models utilizing (discrete) reaction-diffusion equations; and (B) spatial transport problems on surfaces and in nanopores utilizing the relevant (continuum) diffusion or Fokker-Planck equations. Thus, there are some common themes in these studies, as they all involve partial differential equations or their discrete analogues which incorporate a description of diffusion-type processes. However, there are also some qualitative differences, as shall be discussed below.
An inverse diffusivity problem for the helium production–diffusion equation
International Nuclear Information System (INIS)
Bao, Gang; Xu, Xiang
2012-01-01
Thermochronology is a technique for the extraction of information about the thermal history of rocks. Such information is crucial for determining the depth below the surface at which rocks were located at a given time (Bao G et al 2011 Commun. Comput. Phys. 9 129). Mathematically, extracting the time–temperature path can be formulated as an inverse diffusivity problem for the helium production–diffusion equation which is the underlying process of thermochronology. In this paper, to reconstruct the diffusivity which depends on space only and accounts for the structural information of rocks, a local Hölder conditional stability is obtained by a Carleman estimate. A uniqueness result is also proven for extracting the thermal history, i.e. identifying the time-dependant part of the diffusion coefficient, provided that it is analytical with respect to time. Numerical examples are presented to illustrate the validity and effectiveness of the proposed regularization scheme. (paper)
International Nuclear Information System (INIS)
Grandjean, A.
1996-01-01
The aim of this work is a better understanding of the diffusion mechanism in amorphous metallic alloys. Then interdiffusion and hafnium diffusion in amorphous NiZr alloy have been studied. Samples used are made by sputtering co-deposition under vacuum and are well relaxed before the diffusion measurements. The time evolution of resistivity during annealing due to the decay of a composition modulated film has been measured and from this change in resistivity interdiffusion coefficients have been determined. Dependence of Hf diffusion on temperature and pressure has been studied using (SIMS). In this two cases, the diffusion process obeys an Arrhenius law and gives an activation energy of 1.33 eV for interdiffusion, and 0.76 eV for Hf diffusion. An effect of pressure on Hf diffusion has been found leading to an activation volume of 8.5 angstrom 3 . Thanks to these results, two approaches of the diffusion mechanisms in these systems have been proposed. The first comes from a comparison with the diffusion mechanisms in crystalline metals, that is to say by point defects. The second is an hypothesis of collective motions in these non crystalline alloys. (author)
Consistency in the description of diffusion in compacted bentonite
International Nuclear Information System (INIS)
Lehikoinen, J.; Muurinen, A.
2009-01-01
A macro-level diffusion model, which aims to provide a unifying framework for explaining the experimentally observed co-ion exclusion and greatly controversial counter-ion surface diffusion in a consistent fashion, is presented. It is explained in detail why a term accounting for the non-zero mobility of the counter-ion surface excess is required in the mathematical form of the macroscopic diffusion flux. The prerequisites for the consistency of the model and the problems associated with the interpretation of diffusion in such complex pore geometries as in compacted smectite clays are discussed. (author)
Modelling water fluxes for the analysis of diffuse pollution at the river basin scale
Wit, de M.; Meinardi, C.R.; Wendland, F.; Kunkel, R.
2000-01-01
Diffuse pollution is a significant and sometimes even major component of surface water pollution. Diffuse inputs of pollutants to the surface water are related to runoff of precipitation. This means that the analysis of diffuse pollutant fluxes from the land surface to the surface water requires an
International Nuclear Information System (INIS)
Lee, Gun Do; Wang, C. Z.; Lu, Z. Y.; Ho, K. M.
1999-01-01
The diffusion pathways along the trough and between the trough and the dimer row on the Si(100) surface are investigated by tight-binding molecular dynamics calculations using the environment dependent tight-binding silicon potential and by ab initio calculations using the Car-Parrinello method. The studies discover new diffusion pathways consisting of rotation of addimer. The calculated energy barrier are in excellent agreement with experiment. The rotational diffusion pathway between the trough and the dimer row is much more energetically favorable than other diffusion pathways by parallel and perpendicular addimer. The new pathway along the trough is nearly same as the energy barrier of the diffusion pathway by dissociation of the addimer
Influence of Diffusivity in Room on its Acoustic Response
Directory of Open Access Journals (Sweden)
D. Šumarac Pavlović
2010-11-01
Full Text Available Diffusivity is a geometrical feature of the room which is proportional to the dimension of relief on its interior surfaces. This paper presents the results of analysis which investigates the correlation between diffusivity in a room and parameters calculated from a recorded impulse response. The analysis was performed using a specially prepared physical model of a parallelepipedic room with different combinations of flat and diffusive interior surfaces.
1979-01-01
A reflectometer which can separately evaluate the spectral and diffuse reflectivities of surfaces is described. A phase locked detection system for the reflectometer is also described. A selective coating on aluminum potentially useful for flat plate solar collector applications is presented. The coating is composed of strongly bound copper oxide (divalent) and is formed by an etching process performed on an aluminum alloy with high copper content. Fabrication costs are expected to be small due to the one stop fabrication process. A number of conclusions gathered from the literature as to the required optical properties of flat plate solar collectors are discussed.
Czech Academy of Sciences Publication Activity Database
Jirásek, Vít; Čech, J.; Kozak, Halyna; Artemenko, Anna; Černák, M.; Kromka, Alexander
2016-01-01
Roč. 213, č. 10 (2016), s. 2680-2686 ISSN 1862-6300 R&D Projects: GA ČR(CZ) GA14-04790S Institutional support: RVO:68378271 Keywords : amination * diamond * diffuse coplanar surface barrier discharge * nanomaterials * surface functionalization Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.775, year: 2016
Anisotropic Oxygen Ion Diffusion in Layered PrBaCo 2 O 5+δ
Burriel, Mónica
2012-02-14
Oxygen diffusion and surface exchange coefficients have been measured on polycrystalline samples of the double perovskite oxide PrBaCo 2O 5+δ by the isotope exchange depth profile method, using a time-of-flight SIMS instrument. The measured diffusion coefficients show an activation energy of 1.02 eV, as compared to 0.89 eV for the surface exchange coefficients in the temperature range from 300 to 670 °C. Inhomogeneity was observed in the distribution of the oxygen-18 isotopic fraction from grain to grain in the ceramic samples, which was attributed to anisotropy in the diffusion and exchange of oxygen. By the use of a novel combination of electron back scattered diffraction measurements, time-of-flight, and focused ion beam SIMS, this anisotropy was confirmed by in-depth analysis of single grains of known orientation in a ceramic sample exchanged at 300 °C. Diffusion was shown to be faster in a grain oriented with the surface normal close to 100 and 010 (ab-plane oriented) than a grain with a surface normal close to 001 (c-axis oriented). The magnitude of this anisotropy is estimated to be close to a factor of 4, but this is only a lower bound due to experimental limitations. These findings are consistent with recent molecular dynamic simulations of this material where anisotropy in the oxygen transport was predicted. © 2012 American Chemical Society.
Anisotropic Oxygen Ion Diffusion in Layered PrBaCo 2 O 5+δ
Burriel, Mó nica; Peñ a-Martí nez, Juan; Chater, Richard J.; Fearn, Sarah; Berenov, Andrey V.; Skinner, Stephen J.; Kilner, John A.
2012-01-01
Oxygen diffusion and surface exchange coefficients have been measured on polycrystalline samples of the double perovskite oxide PrBaCo 2O 5+δ by the isotope exchange depth profile method, using a time-of-flight SIMS instrument. The measured diffusion coefficients show an activation energy of 1.02 eV, as compared to 0.89 eV for the surface exchange coefficients in the temperature range from 300 to 670 °C. Inhomogeneity was observed in the distribution of the oxygen-18 isotopic fraction from grain to grain in the ceramic samples, which was attributed to anisotropy in the diffusion and exchange of oxygen. By the use of a novel combination of electron back scattered diffraction measurements, time-of-flight, and focused ion beam SIMS, this anisotropy was confirmed by in-depth analysis of single grains of known orientation in a ceramic sample exchanged at 300 °C. Diffusion was shown to be faster in a grain oriented with the surface normal close to 100 and 010 (ab-plane oriented) than a grain with a surface normal close to 001 (c-axis oriented). The magnitude of this anisotropy is estimated to be close to a factor of 4, but this is only a lower bound due to experimental limitations. These findings are consistent with recent molecular dynamic simulations of this material where anisotropy in the oxygen transport was predicted. © 2012 American Chemical Society.
Physical bases for diffusion welding processes optimization
International Nuclear Information System (INIS)
Bulygina, S.M.; Berber, N.N.; Mukhambetov, D.G.
1999-01-01
One of wide-spread method of different materials joint is diffusion welding. It has being brought off at the expense of mutual diffusion of atoms of contacting surfaces under long-duration curing at its heating and compression. Welding regime in dependence from properties of welding details is defining of three parameters: temperature, pressure, time. Problem of diffusion welding optimization concludes in determination less values of these parameters, complying with requirements for quality of welded joint. In the work experiments on diffusion welding for calculated temperature and for given surface's roughness were carried out. Tests conduct on samples of iron and iron-nickel alloy with size 1·1·1 cm 3 . Optimal regime of diffusion welding of examined samples in vacuum is defined. It includes compression of welding samples, heating, isothermal holding at temperature 650 deg C during 0.5 h and affords the required homogeneity of joint
Nuclear diffuseness as a degree of freedom
Myers, W. D.; ŚwiaŢecki, W. J.
1998-12-01
The response of the nuclear energy to changes in neutron and proton surface diffusenesses is investigated using the Thomas-Fermi model. Algebraic expressions are provided for the energy cost of changing the two diffusenesses away from their equilibrium values. This will make it possible to generalize the macroscopic-microscopic calculations of nuclear masses and deformation energies by the inclusion of the neutron and proton diffusenesses as degrees of freedom (to be varied along with the shape degrees of freedom). One result, which is suggested by the relatively low cost in macroscopic energy of increasing the diffuseness of a heavy nucleus by 10% (about 4 MeV), is that superheavy nuclei near Z=126, N=184 may have a fair chance of becoming stabilized by shell effects. An appendix introduces an improved measure of surface diffuseness, with certain advantages over the conventional Süssmann width b.
Nuclear diffuseness as a degree of freedom
International Nuclear Information System (INIS)
Myers, W.D.; Swiatecki, W.J.
1998-01-01
The response of the nuclear energy to changes in neutron and proton surface diffusenesses is investigated using the Thomas-Fermi model. Algebraic expressions are provided for the energy cost of changing the two diffusenesses away from their equilibrium values. This will make it possible to generalize the macroscopic-microscopic calculations of nuclear masses and deformation energies by the inclusion of the neutron and proton diffusenesses as degrees of freedom (to be varied along with the shape degrees of freedom). One result, which is suggested by the relatively low cost in macroscopic energy of increasing the diffuseness of a heavy nucleus by 10% (about 4 MeV), is that superheavy nuclei near Z=126, N=184 may have a fair chance of becoming stabilized by shell effects. An appendix introduces an improved measure of surface diffuseness, with certain advantages over the conventional Suessmann width b. copyright 1998 The American Physical Society
Boron Diffusion in Surface-Treated Framing Lumber
Patricia K. Lebow; Stan T. Lebow; Steven A. Halverson
2013-01-01
The extent of boron penetration in framing lumber treated by spray applications during construction is not well quantified. This study evaluated the effect of formulation and concentration on diffusion of boron in lumber specimens that were equilibrated in conditions that produced wood moisture contents of 18 to 21 percent. One set of specimens was pressure treated...
Determination of carrier diffusion length in GaN
Hafiz, Shopan; Zhang, Fan; Monavarian, Morteza; Avrutin, Vitaliy; Morkoç, Hadis; Özgür, Ümit; Metzner, Sebastian; Bertram, Frank; Christen, Jürgen; Gil, Bernard
2015-01-01
Diffusion lengths of photo-excited carriers along the c-direction were determined from photoluminescence (PL) and cross-sectional cathodoluminescence (CL) measurements in p- and n-type GaN epitaxial layers grown on c-plane sapphire by metal-organic chemical vapor deposition. The investigated samples incorporate a 6 nm thick In0.15Ga0.85N active layer capped with either 500 nm p-GaN or 1500 nm n-GaN. The top GaN layers were etched in steps and PL from the InGaN active region and the underlying layers was monitored as a function of the top GaN thickness upon photo-generation near the surface region by above bandgap excitation. Taking into consideration the absorption in the top GaN layer as well as active and underlying layers, the diffusion lengths at 295 K and at 15 K were measured to be 93 ± 7 nm and 70 ± 7 nm for Mg-doped p-type GaN and 432 ± 30 nm and 316 ± 30 nm for unintentionally doped n-type GaN, respectively, at photogenerated carrier densities of 4.2 × 1018 cm-3 using PL spectroscopy. CL measurements of the unintentionally doped n-type GaN layer at much lower carrier densities of 1017 cm-3 revealed a longer diffusion length of 525 ± 11 nm at 6 K.
Rate Theory for Correlated Processes: Double Jumps in Adatom Diffusion
DEFF Research Database (Denmark)
Jacobsen, J.; Jacobsen, Karsten Wedel; Sethna, J.
1997-01-01
We study the rate of activated motion over multiple barriers, in particular the correlated double jump of an adatom diffusing on a missing-row reconstructed platinum (110) surface. We develop a transition path theory, showing that the activation energy is given by the minimum-energy trajectory...... which succeeds in the double jump. We explicitly calculate this trajectory within an effective-medium molecular dynamics simulation. A cusp in the acceptance region leads to a root T prefactor for the activated rate of double jumps. Theory and numerical results agree....
Amphoteric surface active agents
Directory of Open Access Journals (Sweden)
Eissa, A.M. F.
1995-10-01
Full Text Available 2-[trimethyl ammonium, triethyl ammonium, pyridinium and 2-amino pyridinium] alkanoates, four series of surface active agents containing carbon chain C12, C14, C16 and C18carbon atoms, were prepared. Their structures were characterized by microanalysis, infrared (IR and nuclear magnetic resonance (NMR. Surface and interfacial tension, Krafft point, wetting time, emulsification power, foaming height and critical micelle concentration (cmc were determined and a comparative study was made between their chemical structure and surface active properties. Antimicrobial activity of these surfactants was also determined.
Se prepararon cuatro series de agentes tensioactivos del tipo 2-[trimetil amonio, trietil amonio, piridinio y 2-amino piridinio] alcanoatos, que contienen cadenas carbonadas con C12, C14, C16 y C18 átomos de carbono.
Se determinaron la tensión superficial e interfacial, el punto de Krafft, el tiempo humectante, el poder de emulsionamiento, la altura espumante y la concentración critica de miscela (cmc y se hizo un estudio comparativo entre la estructura química y sus propiedades tensioactivas. Se determinó también la actividad antimicrobiana de estos tensioactivos. Estas estructuras se caracterizaron por microanálisis, infrarrojo (IR y resonancia magnética nuclear (RMN.
Carey, Graham H; Levina, Larissa; Comin, Riccardo; Voznyy, Oleksandr; Sargent, Edward H
2015-06-03
Through a combination of chemical and mutual dot-to-dot surface passivation, high-quality colloidal quantum dot solids are fabricated. The joint passivation techniques lead to a record diffusion length for colloidal quantum dots of 230 ± 20 nm. The technique is applied to create thick photovoltaic devices that exhibit high current density without losing fill factor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Modeling cytoskeletal traffic: an interplay between passive diffusion and active transport.
Neri, Izaak; Kern, Norbert; Parmeggiani, Andrea
2013-03-01
We introduce the totally asymmetric simple exclusion process with Langmuir kinetics on a network as a microscopic model for active motor protein transport on the cytoskeleton, immersed in the diffusive cytoplasm. We discuss how the interplay between active transport along a network and infinite diffusion in a bulk reservoir leads to a heterogeneous matter distribution on various scales: we find three regimes for steady state transport, corresponding to the scale of the network, of individual segments, or local to sites. At low exchange rates strong density heterogeneities develop between different segments in the network. In this regime one has to consider the topological complexity of the whole network to describe transport. In contrast, at moderate exchange rates the transport through the network decouples, and the physics is determined by single segments and the local topology. At last, for very high exchange rates the homogeneous Langmuir process dominates the stationary state. We introduce effective rate diagrams for the network to identify these different regimes. Based on this method we develop an intuitive but generic picture of how the stationary state of excluded volume processes on complex networks can be understood in terms of the single-segment phase diagram.
Directory of Open Access Journals (Sweden)
Matthieu Epiard
2017-10-01
Full Text Available Active volcanoes exhibit diffuse gas emanations through the ground, the most abundant species of which is CO2. However, the relationship between diffuse degassing and volcanic activity is not often clear and some volcanoes may have low diffuse degassing levels despite having strong volcanic activity. The main goals of this study are to quantify diffuse CO2 degassing and determine whether patterns exist in relation to volcanic activity through the study of Turrialba, Poás, and Irazú, three active volcanoes in Costa Rica which are at different stages of activity. Structural controls of spatial distribution of diffuse degassing were also investigated. Measurement campaigns were conducted using the accumulation chamber method coupled with 10 cm depth ground temperature sampling with the aim of estimating the total diffuse CO2 degassing budget. The total amount of CO2 emitted diffusely by each volcano is ~113 ± 46 t/d over ~0.705 km2 for Turrialba, 0.9 ± 0.5 t/d for Poás over ~0.734 km2, 3.8 ± 0.9 t/d over ~0.049 km2 for Irazú's main crater, and 15 ± 12 t/d over 0.0059 km2 for Irazú's north flank. Turrialba and Poás volcano diffuse degassing budget represent about 10% of the whole gas output. Both volcanoes were in a transitional stage and the opening of new conduits may cause a loss in diffuse degassing and an increase of active degassing. Numerous diffuse degassing structures were also identified. At Turrialba, one of which was closely associated with the collapse of a crater wall in 2014 during the initiation of a new period of heightened eruptive activity. Similar structures were also observed on the outer slopes of the west crater, suggesting strong alteration and perhaps destabilization of the upper outer cone. Irazú's north flank is highly permeable and has experienced intense hydrothermal alteration.
Diffusion time scales and accretion in the sun
International Nuclear Information System (INIS)
Michaud, G.
1977-01-01
It is thought that surface abundances in the Sun could be due largely to accretion either of comets or grains, and it has been suggested that if surface convection zones were smaller than is usually indicated by model calculations, accretion would be especially important. Unless the zone immediately below the surface convection zone is sufficiently stable for diffusion to be important, other transport processes, such as turbulence and meridional circulation, more efficient than diffusion, will tend to homogenise the Sun. Diffusion is the slowest of the transport processes and will become important when other transport processes become inoperative. Using diffusion theory the minimum mass of the convection zone can be determined in order that transport processes at the bottom of the zone are not to influence abundances in the convection zone. If diffusion time scales are shorter than the life of the star (Sun) diffusion will modify the abundances in the convection zone. The mass in the convection zone for which diffusion time scales are equal to the life of the star on the main sequence then determines the minimum mass in the convection zone that justifies neglect of transport processes at the bottom of the convection zone. It is calculated here that, for the Sun, this mass is between 3 x 10 -3 and 10 -2 solar mass, and a general explosion is derived for the diffusion time scale as a function of the mass of the convection zone. (U.K.)
Energy Technology Data Exchange (ETDEWEB)
Adda, Y [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires; Philibert, J [Institut de Recherches de la Siderurgie Francaise (IRSID), 78 - Saint-Germain-en-Laye (France)
1958-07-01
After a brief description of the experimental procedure, the curves representing the concentration versus the depth of penetration are presented for the various systems under study. From these curves, it is possible to derive the diffusion coefficient and the activation energy as functions of the concentration. Moreover in the multiphase region, these curves enable one to establish the equilibrium diagram. The growth kinetics of the various zones characterized by their micrographic aspect is also studied and the corresponding activation energies calculated. These activations energies are compared to the ones for the diffusion process at the same concentration. Finally in order to precise the diffusion mechanism, the Kirkendall effect is studied and the Darken intrinsic coefficients calculated. (author)Fren. [French] Apres avoir decrit brievement les methodes experimentales, nous presentons les courbes concentration-penetration caracterisant la diffusion dans les differents systemes etudies. Celles-ci permettent de calculer les coefficients de diffusion et leur energie d'activation, en fonction de la concentration, et de plus, dans le domaine polyphase, d'etablir le diagramme d'equilibre. En outre, on a etudie la cinetique de croissance des diverses zones caracterisees par leur aspect micrographique et calcule les energies d'activation correspondantes; celles-ci ont ete comparees aux energies d'activation de diffusion, pour les memes valeurs de la concentration. Enfin, en vue de preciser les mecanismes de diffusion, nous avons etudie l'effet Kirkendall et calcule les coefficients intrinseques de Darken. (auteur)
Diffusion and sorption properties of radionuclides in compacted bentonite
Energy Technology Data Exchange (ETDEWEB)
Yu Ji-Wei; Neretnieks, I. [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Chemical Engineering and Technology
1997-07-01
In this report, recent studies on sorption and diffusion of radionuclides in compacted bentonite have been reviewed. The sorption distribution coefficient and diffusion coefficient data obtained from experiments in the literature have been compiled. Based on these experimental data and the report SKB-TR--91-16 (Brandberg and Skagius, 1991), this report proposes a set of sorption distribution coefficient and diffusion coefficient values for modelling purpose for safety analysis of nuclear waste repositories. The variability and uncertainty of the diffusivity data span somewhat more than an order or magnitude up and down. Most of the nuclides have an effective diffusivity in around 10{sup -10} m{sup 2}/s. Ion exclusion effects are observed for C, Cl and for Tc in oxidizing waters. Effective diffusivities are nearly tow orders of magnitude lower for these elements and of the order of 10{sup -12} m{sup 2}/s. Surface diffusion effects are found for Cs, Ni, Pa, Pb, Ra, Sn, Sr and Zr. Effective diffusivities for these elements are of the order of 10{sup -8} m{sup 2}/s. The surface diffusion effect should decrease in saline waters which is seen for Cs and Sr where there are data available. It is also deemed that Ra will have this effect because of its similarity with Sr. The other nuclides should also show this decrease but no data is available. Sorption and diffusion mechanisms in compacted bentonite are discussed in the report. In highly compacted bentonite, sorption and hence its distribution coefficient is not well defined, and a pore diffusion coefficient or a surface diffusion coefficient is not well defined either. Therefore, an apparent diffusion coefficient and a total concentration gradient should be more relevant in describing the diffusion process in compacted bentonite. 99 refs.
Gómora-Herrera, Diana; Navarrete Bolaños, Juan; Lijanova, Irina V; Olivares-Xometl, Octavio; Likhanova, Natalya V
2018-04-01
The effects exerted by the adsorption of vapors of a non-polar compound (deuterated benzene) and a polar compound (water) on the surface of Ottawa sand and a sample of reservoir sand (Channel), which was previously impregnated with silicon oil or two kinds of surfactants, (2-hydroxyethyl) trimethylammonium oleate (HETAO) and (2-hydroxyethyl)trimethylammonium azelate (HETAA), were studied by diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS) and thermogravimetric analysis (TGA). The surface chemistry of the sandstone rocks was elucidated by X-ray photoelectron spectroscopy (XPS) and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDX). Terminal surface groups such as hydroxyls can strongly adsorb molecules that interact with these surface groups (surfactants), resulting in a wettability change. The wettability change effect suffered by the surface after treating it with surfactants was possible to be detected by the DRIFTS technique, wherein it was observed that the surface became more hydrophobic after being treated with silicon oil and HETAO; the surface became more hydrophilic after treating it with HETAA.
Accelerated ceria–zirconia solubilization by cationic diffusion inversion at low oxygen activity
DEFF Research Database (Denmark)
Esposito, Vincenzo; Ni, De Wei; Marani, Debora
2016-01-01
Fast elemental diffusion at the Gd-doped ceria/Y-stabilized zirconia interface occurs under reducing conditions at low oxygen activity (pO2 < 10−12 atm) and high temperature (1400 °C). This effect leads to formation of thick ceria–zirconia solid solution reaction layers in the micro-range vs. thi...
Activation energies of diffusion for I and Cs in interlayer of smectite
International Nuclear Information System (INIS)
Sato, H.
2009-01-01
The apparent diffusivities (Da) and activation energies (ΔEa) for I - and Cs + ions in compacted Na-smectite with an interlayer space of only 2 water layers were measured at a dry density of 1.79 Mg/m 3 . In-diffusion experiments were carried out under the conditions that interlayer space, orientation of smectite stacks and dry density were controlled. Basal spacing was checked by X-ray diffractometry (XRD). All diffraction peaks to d(001) indicated basal spacing, of which interlayer space was equal to 2 water layers. The ΔEa of I - ions was at similar level as that for the ionic diffusivity of I - ions in free water (Do) at a dry density of 1.0 Mg/m 3 , but was 35.24 kJ/mol at a dry density of 1.79 Mg/m 3 . The ΔEa for Cs + ions was 46.27 kJ/mol which was higher than that for I? ions, at a dry density of 1.79 Mg/m 3 . Such high ΔEa for I - ions in the interlayer of smectite could be explained by the lowering in the activity (a H 2 O ) of interlayer water. Since Cs + ions sorb onto smectite by ion exchange, such high ΔEa for Cs + ions could be explained by the combined effects of the Cs+/Na+ ion exchange enthalpy (ΔH o ) in smectite and the lowering in the a H 2 O of interlayer water. (author)
Slaved diffusion in phospholipid bilayers
Zhang, Liangfang; Granick, Steve
2005-01-01
The translational diffusion of phospholipids in supported fluid bilayers splits into two populations when polyelectrolytes adsorb at incomplete surface coverage. Spatially resolved measurements using fluorescence correlation spectroscopy show that a slow mode, whose magnitude scales inversely with the degree of polymerization of the adsorbate, coexists with a fast mode characteristic of naked lipid diffusion. Inner and outer leaflets of the bilayer are affected nearly equally. Mobility may vary from spot to spot on the membrane surface, despite the lipid composition being the same. This work offers a mechanism to explain how nanosized domains with reduced mobility arise in lipid membranes. PMID:15967988
International Nuclear Information System (INIS)
Singh, Gyanendra; Mehta, Dalip Singh
2013-01-01
We report the studies on photoluminescence (PL) of organic phosphor coated on a diffusing surface using a blue inorganic light-emitting diode (LED) array as an excitation source. The organic phosphor composite coated diffuser was used to scatter the directional blue light from the LED array. Some of the blue light is absorbed by the organic phosphor composite and the phosphor molecules are excited and re-emit light at longer wavelengths due to the PL process. The output light consists of scattered blue light plus phosphor generated broadband yellow light, thus making white light. The diffuser was made up of a plastic substrate coated with an organic composite of small molecule fluorescent material zinc(II)bis(8-hydroxyquinoline) (Znq 2 ) doped with different percentages of electro-phosphorescent metal complex iridium(III)bis(2-methyldibenzo-[f, h] quinoxaline) (acetylacetonate) ([Ir(MDQ) 2 (acac)]). By means of changing the concentration and the thickness of the phosphor composite material the colour coordinates of white light were achieved. The CIE coordinates and correlated colour temperature were calculated for various thicknesses and phosphor composite concentrations and the results are reported. (paper)
Diffuse γ-ray emission from misaligned active galactic nuclei
Energy Technology Data Exchange (ETDEWEB)
Di Mauro, M.; Donato, F. [Physics Department, Torino University, and Istituto Nazionale di Fisica Nucleare, Sezione di Torino, via Giuria 1, I-10125 Torino (Italy); Calore, F. [II. Institute for Theoretical Physics, University of Hamburg, Luruper Chaussee 149, D-22761 Hamburg (Germany); Ajello, M. [Space Sciences Laboratory, University of California, Berkeley, CA 94720 (United States); Latronico, L., E-mail: donato@to.infn.it [Istituto Nazionale di Fisica Nucleare, Sezione di Torino, via Giuria 1, I-10125 Torino (Italy)
2014-01-10
Active galactic nuclei (AGNs) with jets seen at small viewing angles are the most luminous and abundant objects in the γ-ray sky. AGNs with jets misaligned along the line of sight appear fainter in the sky but are more numerous than the brighter blazars. We calculate the diffuse γ-ray emission due to the population of misaligned AGNs (MAGNs) unresolved by the Large Area Telescope (LAT) on the Fermi Gamma-ray Space Telescope (Fermi). A correlation between the γ-ray luminosity and the radio-core luminosity is established and demonstrated to be physical by statistical tests, as well as compatible with upper limits based on Fermi-LAT data for a large sample of radio-loud MAGNs. We constrain the derived γ-ray luminosity function by means of the source-count distribution of the radio galaxies detected by the Fermi-LAT. We finally calculate the diffuse γ-ray flux due to the whole MAGN population. Our results demonstrate that MAGNs can contribute from 10% up to nearly the entire measured isotropic gamma-ray background. We evaluate a theoretical uncertainty on the flux of almost an order of magnitude.
International Nuclear Information System (INIS)
Ahmad Hasnulhadi Che Kamaruddin
2012-01-01
The apparent diffusivity of strontium-85 in the compacted MX-80 bentonite under different salinity conditions and dry densities was conducted were studied from the viewpoint of activation energy. Through in-diffusions experiments the effect of salinity on diffusion behavior of Sr-85 ions can also can be explained. As we know, Sr-90 is by product of the fission materials of nuclear wastes and should be manage properly. Sr-85 is radioactive isotope with the same chemical properties of Sr-90. Adsorption affects only non-steady-state diffusion while at the steady state (e.g., a constant concentration gradient between a constant source and a constant sink), there is no net uptake or release by adsorption, so adsorption has no effect on diffusion (Drever, James I., 1997). The changes in the basal spacing of bentonite as a function of salinity are needed to be observed by the X-ray diffraction method to understand the microstructure changes in diffusion pathways for Sr-85 in MX-80 bentonite. As we know, there could be three potential pathways for radionuclide diffusion in solution-saturated, compacted montmorillonite, i.e., pore water, external surfaces and the internal surface (interlayer spaces) of montmorillonite aggregates (Kozaki et al., 2008). So, it is important to understand the diffusion processes in term of apparent diffusivity of Sr-85 ions in different salinity concentration at low dry density of MX-80. Several parameters are needed in explaining the process such as dry density, activation energy, temperature dependence and concentration of the salinity solutions. (author)
Ion diffusion in compacted bentonite
Energy Technology Data Exchange (ETDEWEB)
Lehikoinen, J. [VTT Chemical Technology, Espoo (Finland)
1999-03-01
In the study, a two-dimensional molecular-level diffusion model, based on a modified form of the Gouy-Chapman (GC) theory of the electrical double layers, for hydrated ionic species in compacted bentonite was developed. The modifications to the GC theory, which forms the very kernel of the diffusion model, stem from various non-conventional features: ionic hydration, dielectric saturation, finite ion-sizes and specific adsorption. The principal objectives of the study were met. With the aid of the consistent diffusion model, it is a relatively simple matter to explain the experimentally observed macroscopic exclusion for anions as well as the postulated, but greatly controversial, surface diffusion for cations. From purely theoretical grounds, it was possible to show that the apparent diffusivities of cations, anions and neutral molecules (i) do not exhibit order-or-magnitude differences, and (ii) are practically independent of the solution ionic strength used and, consequently, of the distribution coefficient, K{sub d}, unless they experience specific binding onto the substrate surface. It was also of interest to investigate the equilibrium anionic concentration distribution in the pore geometry of the GMM model as a function of the solution ionic strength, and to briefly speculate its consequences to diffusion. An explicit account of the filter-plate effect was taken by developing a computerised macroscopic diffusion model, which is based upon the very robust and efficient Laplace Transform Finite-Difference technique. Finally, the inherent limitations as well as the potential fields of applications of the models were addressed. (orig.) 45 refs.
Ion diffusion in compacted bentonite
International Nuclear Information System (INIS)
Lehikoinen, J.
1999-03-01
In the study, a two-dimensional molecular-level diffusion model, based on a modified form of the Gouy-Chapman (GC) theory of the electrical double layers, for hydrated ionic species in compacted bentonite was developed. The modifications to the GC theory, which forms the very kernel of the diffusion model, stem from various non-conventional features: ionic hydration, dielectric saturation, finite ion-sizes and specific adsorption. The principal objectives of the study were met. With the aid of the consistent diffusion model, it is a relatively simple matter to explain the experimentally observed macroscopic exclusion for anions as well as the postulated, but greatly controversial, surface diffusion for cations. From purely theoretical grounds, it was possible to show that the apparent diffusivities of cations, anions and neutral molecules (i) do not exhibit order-or-magnitude differences, and (ii) are practically independent of the solution ionic strength used and, consequently, of the distribution coefficient, K d , unless they experience specific binding onto the substrate surface. It was also of interest to investigate the equilibrium anionic concentration distribution in the pore geometry of the GMM model as a function of the solution ionic strength, and to briefly speculate its consequences to diffusion. An explicit account of the filter-plate effect was taken by developing a computerised macroscopic diffusion model, which is based upon the very robust and efficient Laplace Transform Finite-Difference technique. Finally, the inherent limitations as well as the potential fields of applications of the models were addressed. (orig.)
The influence of excess vacancy generation on the diffusion of ion implanted phosphorus into silicon
International Nuclear Information System (INIS)
Bakowski, A.
1985-01-01
The diffusion of ion implanted phosphorus in silicon has been studied. It was found that the diffusion coefficient is not only dependent on the phosphorus surface concentration (the concentration effect) but also on the conditions at the silicon surface (the surface effect). The phosphorus diffusion coefficient is considerably lower when the silicon surface during annealing is covered with a CVD oxide layer. It is suggested that excess vacancies generated at the surface are reponsible for both the concentration and surface effects. Enhanced phosphorus diffusion is attributed to the disturbance of thermodynamic equilibrium in the crystal through phosphorus-vacancy part formation by vacancies introduced into silicon at the surface. On the basis of the data presented, it can be concluded that two mechanisms for excess vacancy generation are involved. Assuming that phosphorus diffuses via E-centers, calculations of the concentration profiles and the diffusion coefficient were performed for different concentrations and surface conditions. (orig.)
Density functional theory study of hydrogenation mechanism in Fe-doped Mg(0 0 0 1) surface
International Nuclear Information System (INIS)
Wu Guangxin; Zhang Jieyu; Wu Yongquan; Li Qian; Chou Kuochih; Bao Xinhua
2009-01-01
Using density functional theory (DFT) in combination with nudged elastic band (NEB) method, the dissociative chemisorptions and diffusion processes of hydrogen on both pure and Fe-doped Mg(0 0 0 1) surfaces are studied. Firstly, the dissociation pathway of H 2 and the relative barrier were investigated. The calculated dissociation barrier (1.08 eV) of hydrogen molecule on a pure Mg(0 0 0 1) surface is in good agreement with comparable experimental and theoretical studies. For the Fe-doped Mg(0 0 0 1) surface, the activated barrier decreases to 0.101 eV due to the strong interaction between the s orbital of H and the d orbital of Fe. Then, the diffusion processes of atomic hydrogen on pure and Fe-doped Mg(0 0 0 1) are presented. The obtained diffusion barrier to the first subsurface is 0.45 eV and 0.98 eV, respectively. Finally, Chou method was used to investigate the hydrogen sorption kinetic mechanism of pure MgH 2 and Mg mixed with 5 at.% Fe atoms composites. The obtained activation energies are 0.87 ± 0.02 and 0.31 ± 0.01 eV for H 2 dissociation on the pure surface and H atom diffusion in Fe-doped Mg surfaces, respectively. It suggests that the rate-controlling step is dissociation of H 2 on the pure Mg surface while it is diffusion of H atom in the Fe-doped Mg surface. And both of fitting data are matching well with our calculation results.
Tao, Xinyong; Wang, Jianguo; Liu, Chong; Wang, Haotian; Yao, Hongbin; Zheng, Guangyuan; Seh, Zhi Wei; Cai, Qiuxia; Li, Weiyang; Zhou, Guangmin; Zu, Chenxi; Cui, Yi
2016-04-05
Lithium-sulfur batteries have attracted attention due to their six-fold specific energy compared with conventional lithium-ion batteries. Dissolution of lithium polysulfides, volume expansion of sulfur and uncontrollable deposition of lithium sulfide are three of the main challenges for this technology. State-of-the-art sulfur cathodes based on metal-oxide nanostructures can suppress the shuttle-effect and enable controlled lithium sulfide deposition. However, a clear mechanistic understanding and corresponding selection criteria for the oxides are still lacking. Herein, various nonconductive metal-oxide nanoparticle-decorated carbon flakes are synthesized via a facile biotemplating method. The cathodes based on magnesium oxide, cerium oxide and lanthanum oxide show enhanced cycling performance. Adsorption experiments and theoretical calculations reveal that polysulfide capture by the oxides is via monolayered chemisorption. Moreover, we show that better surface diffusion leads to higher deposition efficiency of sulfide species on electrodes. Hence, oxide selection is proposed to balance optimization between sulfide-adsorption and diffusion on the oxides.
Tao, Xinyong; Wang, Jianguo; Liu, Chong; Wang, Haotian; Yao, Hongbin; Zheng, Guangyuan; Seh, Zhi Wei; Cai, Qiuxia; Li, Weiyang; Zhou, Guangmin; Zu, Chenxi; Cui, Yi
2016-01-01
Lithium–sulfur batteries have attracted attention due to their six-fold specific energy compared with conventional lithium-ion batteries. Dissolution of lithium polysulfides, volume expansion of sulfur and uncontrollable deposition of lithium sulfide are three of the main challenges for this technology. State-of-the-art sulfur cathodes based on metal-oxide nanostructures can suppress the shuttle-effect and enable controlled lithium sulfide deposition. However, a clear mechanistic understanding and corresponding selection criteria for the oxides are still lacking. Herein, various nonconductive metal-oxide nanoparticle-decorated carbon flakes are synthesized via a facile biotemplating method. The cathodes based on magnesium oxide, cerium oxide and lanthanum oxide show enhanced cycling performance. Adsorption experiments and theoretical calculations reveal that polysulfide capture by the oxides is via monolayered chemisorption. Moreover, we show that better surface diffusion leads to higher deposition efficiency of sulfide species on electrodes. Hence, oxide selection is proposed to balance optimization between sulfide-adsorption and diffusion on the oxides. PMID:27046216
A current induced diffusion model of gas sputtering
International Nuclear Information System (INIS)
Hotston, E.S.
1980-01-01
A model is proposed to explain the experimental results on deuteron trapping in stainless steel targets at low temperatures carried out at Garching and Culham. The model proposes that the ions are trapped in two kinds of sites: Deep sites with high activation energy and shallow sites of low activation energy. Trapped deuterons reach the surface of the target by being expelled from shallow sites by the action of the ion beam and migrate to nearby sites in a random way, thus moving by a bombardment induced diffusion. Ions diffusing to the target surface and being released are said to be sputtered from the target. It has been necessary to assume numerical values for sizes of some of the processes which occur. With a suitable choice of values the model successfully predicts the numbers of deuterons trapped per unit area of the target, the obserbed density profile of the trapped ions and the threshold at which sputtering starts. The model also successfully describes the replacement of the trapped deuterons by protons, when the deuteron beam is replaced by a proton beam. The collision cross-section for beam ions and ions trapped in shallow sites is too large, 4 x 10 -13 cm 2 , for a binary collision and it is tentatively suggested that the ions in the shallow sites may be in small voids in the target which may be connected with blister formation. Comparison of the present model with one being developed to describe the trapping of deuterons in carbon suggests that it may be possible to describe all gas sputtering experiments in terms of diffusion processes. (orig.)
Kailasanathan, Ranjith Kumar Abhinavam
2014-05-20
Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both temperature and soot measurements presented are line-of-sight averages. The results aid in understanding the kinetic and thermodynamic behavior of the soot formation and oxidation chemistry with changes in diluents, ultimately leading to possible methods of reducing soot emission from practical combustion hardware. The diluted fuel and coflow exit velocities (top-hat profiles) were matched at all pressures to minimize shear effects. In addition to the velocity-matched flow rates, the mass fluxes were held constant for all pressures. Addition of a diluent has a pronounced effect on both the soot surface temperature and volume fraction, with the helium diluted flame yielding the maximum and carbon dioxide diluted flame yielding minimum soot surface temperature and volume fraction. At low pressures, peak soot volume fraction exists at the tip of the flame, and with an increase in pressure, the location shifts lower to the wings of the flame. Due to the very high diffusivity of helium, significantly higher temperature and volume fraction are measured and explained. Carbon dioxide has the most dramatic soot suppression effect. By comparing the soot yield with previously measured soot precursor concentrations in the same flame, it is clear that the lower soot yield is a result of enhanced oxidation rates rather than a reduction in precursor formation. Copyright © 2014 Taylor & Francis Group, LLC.
Pan, Yichang; Liu, Wei; Zhao, Yingjie; Wang, Chongqing; Lai, Zhiping
2015-01-01
Zeolitic imidazolate framework ZIF-8 has shown great potential for effective separation of hydrocarbon mixtures based on its intrinsic ultramicroporous feature. In order to explore the permeation and diffusion properties of hydrocarbons through ZIF-8 membrane, high-quality ZIF-8 membranes with a separation factor of ~90 for propylene/propane are successfully prepared via optimizing the activation processes. Single-component permeation data for hydrocarbons (C1–C4) through the improved ZIF-8 membrane are measured and analyzed by Maxwell-Stefan (MS) model to get the transport diffusivities of these hydrocarbons. The diffusivity values of hydrocarbon compare well with those obtained by other experimental techniques. Binary mixture permeation also can be well predicted through single-component adsorption parameters.
Pan, Yichang
2015-06-23
Zeolitic imidazolate framework ZIF-8 has shown great potential for effective separation of hydrocarbon mixtures based on its intrinsic ultramicroporous feature. In order to explore the permeation and diffusion properties of hydrocarbons through ZIF-8 membrane, high-quality ZIF-8 membranes with a separation factor of ~90 for propylene/propane are successfully prepared via optimizing the activation processes. Single-component permeation data for hydrocarbons (C1–C4) through the improved ZIF-8 membrane are measured and analyzed by Maxwell-Stefan (MS) model to get the transport diffusivities of these hydrocarbons. The diffusivity values of hydrocarbon compare well with those obtained by other experimental techniques. Binary mixture permeation also can be well predicted through single-component adsorption parameters.
International Nuclear Information System (INIS)
Abbaszadegan, A.; Ghahramani, Y.; Nabavizadeh, M.; Gholami, A.; Hemmateenejad, I.; Dorostkar, S.; Sharghi, H.
2014-01-01
The bactericidal efficiency of various positively and negatively charged silver nanoparticles has been extensively evaluated in literature, but there is no report on efficacy of neutrally charged silver nanoparticles. The goal of this study is to evaluate the role of electrical charge at the surface of silver nanoparticles on antibacterial activity against a panel of microorganisms. Three different silver nanoparticles were synthesized by different methods, providing three different electrical surface charges (positive, neutral, and negative). The antibacterial activity of these nanoparticles was tested against gram-positive (i.e., Staphylococcus aureus, Streptococcus mutans, and Streptococcus pyogenes) and gram-negative (i.e., Escherichia coli and Proteus vulgaris) bacteria. Well diffusion and micro-dilution tests were used to evaluate the bactericidal activity of the nanoparticles. According to the obtained results, the positively-charged silver nanoparticles showed the highest bactericidal activity against all microorganisms tested. The negatively charged silver nanoparticles had the least and the neutral nanoparticles had intermediate antibacterial activity. The most resistant bacteria were Proteus vulgaris. We found that the surface charge of the silver nanoparticles was a significant factor affecting bactericidal activity on these surfaces. Although the positively charged nanoparticles showed the highest level of effectiveness against the organisms tested, the neutrally charged particles were also potent against most bacterial species.
A Study on the Characteristics of Design Variables for IRSS Diffuser
Cho, Yong-Jin; Ko, Dae-Eun
2017-11-01
In modern naval ships, infrared signature suppression systems (IRSS) are installed to decrease the temperature of waste gas generated in propulsion engine and the metallic surface temperature of heated exhaust pipes. Generally, IRSS is composed of eductor, mixing tube, and diffuser. Diffuser serves to reduce the temperature by creating an air film using the pressure difference between internal gas and external air. In this study, design variables were selected by analyzing the diffuser and the characteristics of design variables that affect the performance of diffuser were examined using Taguchi experiment method. For the diffuser performance analysis, a heat flow analysis technique established in previous research was used. The IRSS performance evaluation was carried out based on the average area value of the metal surface temperature and the temperature of the exhaust gas at the outlet of the diffuser, which are variables directly related to the intensity of infrared signature in naval ships. It was verified that the exhaust gas temperature is greatly affected by changes in the diameter of the diffuser outlet, and the metal surface temperature of diffuser is greatly affected by changes in the number of diffuser rings.
Atmospheric diffusion of large clouds
Energy Technology Data Exchange (ETDEWEB)
Crawford, T. V. [Univ. of California, Lawrence Radiation Lab., Livermore, California (United States)
1967-07-01
Clouds of pollutants travel within a coordinate system that is fixed to the earth's surface, and they diffuse and grow within a coordinate system fixed to the cloud's center. This paper discusses an approach to predicting the cloud's properties, within the latter coordinate system, on space scales of a few hundred meters to a few hundred kilometers and for time periods of a few days. A numerical cloud diffusion model is presented which starts with a cloud placed arbitrarily within the troposphere. Similarity theories of atmospheric turbulence are used to predict the horizontal diffusivity as a function of initial cloud size, turbulent atmospheric dissipation, and time. Vertical diffusivity is input as a function of time and height. Therefore, diurnal variations of turbulent diffusion in the boundary layer and effects of temperature inversions, etc. can be modeled. Nondiffusive cloud depletion mechanisms, such as dry deposition, washout, and radioactive decay, are also a part of this numerical model. An effluent cloud, produced by a reactor run at the Nuclear Rocket Development Station, Nevada, is discussed in this paper. Measurements on this cloud, for a period of two days, are compared to calculations with the above numerical cloud diffusion model. In general, there is agreement. within a factor of two, for airborne concentrations, cloud horizontal area, surface air concentrations, and dry deposition as airborne concentration decreased by seven orders of magnitude during the two-day period. (author)
Diffusion properties of active particles with directional reversal
International Nuclear Information System (INIS)
Großmann, R; Bär, M; Peruani, F
2016-01-01
The diffusion properties of self-propelled particles which move at constant speed and, in addition, reverse their direction of motion repeatedly are investigated. The internal dynamics of particles triggering these reversal processes is modeled by a stochastic clock. The velocity correlation function as well as the mean squared displacement is investigated and, furthermore, a general expression for the diffusion coefficient for self-propelled particles with directional reversal is derived. Our analysis reveals the existence of an optimal, finite rotational noise amplitude which maximizes the diffusion coefficient. We comment on the relevance of these results with regard to biological systems and suggest further experiments in this context. (paper)
Theoretical and computational studies of entangled rod-coil block copolymer diffusion
Wang, Muzhou; Alexander-Katz, Alfredo; Olsen, B. D.
2012-02-01
Despite continued interest in the thermodynamics of rod-coil block copolymers for functional nanostructured materials in organic electronics and biomaterials, relatively few studies have investigated the dynamics of these systems which are important for understanding diffusion, mechanics, and self-assembly kinetics. Here, the diffusion of coil-rod-coil block copolymers through entangled melts is simulated using the Kremer-Grest molecular dynamics model, demonstrating that the mismatch between the curvature of the rod and coil blocks results in dramatically slower reptation through the entanglement tube. For rod lengths near the tube diameter, this hindered diffusion is explained by a local curvature-dependent free energy penalty produced by the curvature mismatch, resulting in a rough energy surface as the rod moves along the tube contour. Compared to coil homopolymers which reptate freely along the tube, rod-coil block copolymers undergo an activated diffusion process which is considerably slower as the rod length increases. For large rods, diffusion of the rod through the tube only occurs when the coil blocks occupy straight entanglement tubes, which requires ``arm retraction'' as the dominant relaxation mechanism.
Creep effects in diffusion bonding of oxygen-free copper
Moilanen, Antti
Diffusion is the transport of atoms or particles through the surrounding material. Various microstructural changes in metals are based on the diffusion phenomena. In solid metals the diffusion is closely related to crystallographic defects. In single-component metals the dominant mechanism of diffusion is the vacancy mechanism. Diffusion bonding is a direct technological application of diffusion. It is an advanced solidstate joining process in which the surfaces of two components are brought to contact with each other and heated under a pressing load in a controlled environment. During the process, the contact surfaces are bonded by atomic diffusion across the interface and as a result, one solid piece is formed. The condition of high temperature and low applied stress combined with relatively long process duration enables the creep effects to take place in bonded metals. Furthermore, creep causes unwanted permanent deformations in the bonded components. Some authors suggest that there could be a threshold fo...
Energy Technology Data Exchange (ETDEWEB)
Grandjean, A.
1996-03-01
The aim of this work is a better understanding of the diffusion mechanism in amorphous metallic alloys. Then interdiffusion and hafnium diffusion in amorphous NiZr alloy have been studied. Samples used are made by sputtering co-deposition under vacuum and are well relaxed before the diffusion measurements. The time evolution of resistivity during annealing due to the decay of a composition modulated film has been measured and from this change in resistivity interdiffusion coefficients have been determined. Dependence of Hf diffusion on temperature and pressure has been studied using (SIMS). In this two cases, the diffusion process obeys an Arrhenius law and gives an activation energy of 1.33 eV for interdiffusion, and 0.76 eV for Hf diffusion. An effect of pressure on Hf diffusion has been found leading to an activation volume of 8.5 angstrom{sup 3}. Thanks to these results, two approaches of the diffusion mechanisms in these systems have been proposed. The first comes from a comparison with the diffusion mechanisms in crystalline metals, that is to say by point defects. The second is an hypothesis of collective motions in these non crystalline alloys. (author).
Energy Technology Data Exchange (ETDEWEB)
Adda, Y. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires; Philibert, J. [Institut de Recherches de la Siderurgie Francaise (IRSID), 78 - Saint-Germain-en-Laye (France)
1958-07-01
After a brief description of the experimental procedure, the curves representing the concentration versus the depth of penetration are presented for the various systems under study. From these curves, it is possible to derive the diffusion coefficient and the activation energy as functions of the concentration. Moreover in the multiphase region, these curves enable one to establish the equilibrium diagram. The growth kinetics of the various zones characterized by their micrographic aspect is also studied and the corresponding activation energies calculated. These activations energies are compared to the ones for the diffusion process at the same concentration. Finally in order to precise the diffusion mechanism, the Kirkendall effect is studied and the Darken intrinsic coefficients calculated. (author)Fren. [French] Apres avoir decrit brievement les methodes experimentales, nous presentons les courbes concentration-penetration caracterisant la diffusion dans les differents systemes etudies. Celles-ci permettent de calculer les coefficients de diffusion et leur energie d'activation, en fonction de la concentration, et de plus, dans le domaine polyphase, d'etablir le diagramme d'equilibre. En outre, on a etudie la cinetique de croissance des diverses zones caracterisees par leur aspect micrographique et calcule les energies d'activation correspondantes; celles-ci ont ete comparees aux energies d'activation de diffusion, pour les memes valeurs de la concentration. Enfin, en vue de preciser les mecanismes de diffusion, nous avons etudie l'effet Kirkendall et calcule les coefficients intrinseques de Darken. (auteur)
Germanium diffusion with vapor-phase GeAs and oxygen co-incorporation in GaAs
Wang, Wei-Fu; Cheng, Kai-Yuan; Hsieh, Kuang-Chien
2018-01-01
Vapor-phase germanium diffusion has been demonstrated in Zn-doped and semi-insulating GaAs in sealed ampoules with GeAs powders and excess arsenic. Secondary-ion-mass spectroscopy (SIMS) profiles indicate the presence of unintentional co-incorporation of oxygen in high densities (>1017/cm3) along with diffused germanium donors whose concentration (>>1018/cm3) determined by electro-chemical capacitance-voltage (ECV) profiler shows significant compensation near the surface. The source of oxygen mainly originates from the GeAs powder which contains Ge-O surface oxides. Variable-temperature photoluminescence (PL) shows that in GeAs-diffused samples, a broad peak ranging from 0.86-1.38 eV with the peak position around 1.1 eV predominates at low temperatures while the near band-edge luminescence quenches. The broad band is attributed to the GeGa-VGa self-activated (SA) centers possibly associated with nearby oxygen-related defect complex, and its luminescence persists up to 400 K. The configurational-coordinate modeling finds that the SA defect complex has a thermal activation energy of 150-180 meV and a vibrational energy 26.8 meV. The presence of oxygen does not much affect the SA emission intensity but may have influenced the peak position, vibration frequency and activation energy as compared to other common donor-VGa defects in GaAs.
Germanium diffusion with vapor-phase GeAs and oxygen co-incorporation in GaAs
Directory of Open Access Journals (Sweden)
Wei-Fu Wang
2018-01-01
Full Text Available Vapor-phase germanium diffusion has been demonstrated in Zn-doped and semi-insulating GaAs in sealed ampoules with GeAs powders and excess arsenic. Secondary-ion-mass spectroscopy (SIMS profiles indicate the presence of unintentional co-incorporation of oxygen in high densities (>1017/cm3 along with diffused germanium donors whose concentration (>>1018/cm3 determined by electro-chemical capacitance-voltage (ECV profiler shows significant compensation near the surface. The source of oxygen mainly originates from the GeAs powder which contains Ge-O surface oxides. Variable-temperature photoluminescence (PL shows that in GeAs-diffused samples, a broad peak ranging from 0.86-1.38 eV with the peak position around 1.1 eV predominates at low temperatures while the near band-edge luminescence quenches. The broad band is attributed to the GeGa-VGa self-activated (SA centers possibly associated with nearby oxygen-related defect complex, and its luminescence persists up to 400 K. The configurational-coordinate modeling finds that the SA defect complex has a thermal activation energy of 150-180 meV and a vibrational energy 26.8 meV. The presence of oxygen does not much affect the SA emission intensity but may have influenced the peak position, vibration frequency and activation energy as compared to other common donor-VGa defects in GaAs.
Diffuse scattering and the fundamental properties of materials
EIce, Gene; Barabash, Rozaliya
2009-01-01
Diffuse Scattering-the use of off-specular X-Rays and neutrons from surfaces and interfaces-has grown rapidly as a tool for characterizing the surface properties of materials and related fundamental structural properties. It has proven to be especially useful in the understanding of local properties within materials. This book reflects the efforts of physicists and materials scientists around the world who have helped to refine the techniques and applications of diffuse scattering. Major topics specifically covered include: -- Scattering in Low Dimensions -- Elastic and Thermal Diffuse Scattering from Alloys -- Scattering from Complex and Disordered Materials -- Scattering from Distorted Crystals.
Radon transport processes below the earth's surface
International Nuclear Information System (INIS)
Wilkening, M.
1980-01-01
Processes by which 222 Rn is transported from the soil to the earth's surface are reviewed. The mechanisms effective in transporting 222 Rn to the surface are related to the size and configuration of the spaces occupied by the soil gas which may vary from molecular interstices to large underground caverns. The near-surface transport processes are divided into two categories: (1) a microscopic process that includes molecular diffusion and viscous flow in fine capillaries and (2) macroscopic flow in fissures and channels. Underground air rich in 222 Rn can also reach the surface through cracks, fissures, and underground channels. This type of transport is shown for (1) a horizontal tunnel penetrating a fractured hillside, (2) a large underground cave, and (3) volcanic activity. Pressure differentials having various natural origins and thermal gradients are responsible for the transport in these examples. 222 Rn transport by ordinary molecular diffusion appears to be the dominant process
Swiss roll nanomembranes with controlled proton diffusion as redox micro-supercapacitors.
Ji, Hengxing; Mei, Yongfeng; Schmidt, Oliver G
2010-06-14
We demonstrate a redox Swiss roll micro-supercapacitor by rolling up a multilayered nanomembrane with an electrochemical active layer at either the outer or inner surface for different proton diffusion behaviors. The Swiss roll micro-supercapacitor could achieve high performance (e.g. capacity and life time) in a microscale power source and is helpful for studying charge transfer at the electrolyte/electrode interface.
Theoretical study of the diffusion 222Rn gas on activated charcoal
International Nuclear Information System (INIS)
Lopez, Fabio O.; Canoba, Analia C.
2001-01-01
The 222 Rn adsorption coefficient is the fundamental parameter characterizing activated carbon's ability to adsorb 222 Rn . In this work, it has been determined the 222 Rn coefficient adsorption for 222 Rn activated carbon detectors. Scintillation vials were used as detectors. The measurement of the 222 Rn activity adsorbed in activated carbon was made by a liquid scintillation measurement of its alpha-beta progeny decay. On the other hand, in this work a diffusion and adsorption model has been developed for the transport of 222 Rn in an activated carbon porous bed. The equation that describes these processes is a partial differential equation, of the second order with respect to axial coordinate, and the first order with respect to time. The equation was numerically solved using a finites differences method. With this model the 222 Rn activity adsorbed in the detector, for several situations, was calculated. The results were tested with the data obtained from series of experiences made in our laboratories. (author)
Bao, Cheng; Jiang, Zeyi; Zhang, Xinxin
2015-10-01
Fuel flexibility is a significant advantage of solid oxide fuel cell (SOFC). A comprehensive macroscopic framework is proposed for synthesis gas (syngas) fueled electrochemistry and transport in SOFC anode with two main novelties, i.e. analytical H2/CO electrochemical co-oxidation, and correction of gas species concentration at triple phase boundary considering competitive absorption and surface diffusion. Staring from analytical approximation of the decoupled charge and mass transfer, we present analytical solutions of two defined variables, i.e. hydrogen current fraction and enhancement factor. Giving explicit answer (rather than case-by-case numerical calculation) on how many percent of the current output contributed by H2 or CO and on how great the water gas shift reaction plays role on, this approach establishes at the first time an adaptive superposition mechanism of H2-fuel and CO-fuel electrochemistry for syngas fuel. Based on the diffusion equivalent circuit model, assuming series-connected resistances of surface diffusion and bulk diffusion, the model predicts well at high fuel utilization by keeping fixed porosity/tortuosity ratio. The model has been validated by experimental polarization behaviors in a wide range of operation on a button cell for H2-H2O-CO-CO2-N2 fuel systems. The framework could be helpful to narrow the gap between macro-scale and meso-scale SOFC modeling.
The modeling method of diffusion of radio activated materials in clay waste disposals
International Nuclear Information System (INIS)
Saberi, Reza; Sepanloo, Kamran; Alinejad, Majid; Mozaffari, Ali
2017-01-01
New nuclear power plants are necessary to meet today's and future challenges of energy supply. Nuclear power is the only large-scale energy source that takes full responsibility for all its wastes. Nuclear wastes are particularly hazardous and hard to manage relative to different toxic industrial wastes. Three methods are presented and analysed to model the diffusion of the waste from the waste disposal to the bottom surface. For this purpose three software programmes such as ABAQUS, Matlab coding, Geostudio and ArcGIS have been applied.
Energy Technology Data Exchange (ETDEWEB)
Khatri, Om P.; Hatanaka, Takeshi; Murase, Kuniaki [Department of Materials Science and Engineering, Kyoto University, Sakyo-ku, Kyoto 606-8501 (Japan); Sugimura, Hiroyuki, E-mail: hiroyuki.sugimura@materials.mbox.media.kyoto-u.ac.jp [Department of Materials Science and Engineering, Kyoto University, Sakyo-ku, Kyoto 606-8501 (Japan)
2009-09-30
Vacuum ultraviolet (VUV, {lambda} = 172 nm) patterning of alkyl monolayer on silicon surface has been demonstrated with emphasis on the diffusion of VUV induced oxygen-derived active species, which are accountable for the pattern broadening. The VUV photons photo-dissociates the atmospheric oxygen and water molecules into the oxygen-derived active species (oxidants). These oxidants photo-oxidize the hexadecyl (HD) monolayer in VUV irradiated regions (Khatri et al., Langmuir. 24 (2008) 12077), as well as the little concentration of oxidants diffuses towards the masked areas. In this study, we performed VUV patterning at a vacuum pressure of 10 Pa to track the diffusion pathways for the oxidants with help of gold nanoparticles (AuNPs; {phi} = 10 nm) immobilization. At VUV irradiated sites AuNPs are found as uniformly distributed, but adjacent to the pattern boundary we observed quasi-linear arrays of AuNPs, which are determined by diffusion pathways of the oxidants. The diffusion of oxidants plays vital role in pattern broadening. The site selective anchoring of AuNPs demonstrates the utility of VUV photons for the construction of functional materials with microstructural architecture.
Hydrogen diffusion along grain boundaries in erbium oxide coatings
International Nuclear Information System (INIS)
Mao, Wei; Chikada, Takumi; Suzuki, Akihiro; Terai, Takayuki
2014-01-01
Diffusion of interstitial atomic hydrogen in erbium oxide (Er 2 O 3 ) was investigated using density functional theory (DFT) and molecular dynamics (MD) methods. Hydrogen diffusivity in bulk, on (0 0 1) surface, and along Σ13 (4–3–1)/[1 1 1] symmetric tilt grain boundaries (GBs) were evaluated in a temperature range of 673–1073 K, as well as hydrogen diffusion barriers. It was found that H diffusion shows the faster on (0 0 1) surface than along GBs and in bulk. Also, energy barrier of H diffusion in bulk estimated by DFT and MD methods is somewhat higher than that along GBs evaluated in the experiments. This suggests that H diffusion in Er 2 O 3 coatings depends on GBs rather than bulk. In addition, with a correction of GB density, the simulated diffusivity along GBs in MD simulations is in good agreement with the experimental data within one order of magnitude. The discrepancy of H diffusivity between the experiments and the simulations should be reduced by considering H concentration, H diffusion direction, deviations of the initial configuration, vacancy defects, etc
Acid-base characteristics of powdered-activated-carbon surfaces
Energy Technology Data Exchange (ETDEWEB)
Reed, B.E. (West Virginia Univ., Morgantown (United States)); Jensen, J.N.; Matsumoto, M.R. (State Univ. of New York, Buffalo (United States))
Adsorption of heavy metals onto activated carbon has been described using the surface-complex-formation (SCF) model, a chemical equilibrium model. The SCF model requires a knowledge of the amphoteric nature of activated carbon prior to metal adsorption modeling. In the past, a single-diprotic-acid-site model had been employed to describe the amphoteric nature of activated-carbon surfaces. During this study, the amphoteric nature of two powdered activated carbons were investigated, and a three-monoprotic site surface model was found to be a plausible alternative. The single-diprotic-acid-site and two-monoprotic-site models did not describe the acid-base behavior of the two carbons studied adequately. The two-diprotic site was acceptable for only one of the study carbons. The acid-base behavior of activated carbon surfaces seem to be best modeled as a series of weak monoprotic acids.
Active Surface Compensation for Large Radio Telescope Antennas
Directory of Open Access Journals (Sweden)
Congsi Wang
2018-01-01
Full Text Available With the development of radio telescope antennas with large apertures, high gain, and wide frequency bands, compensation methods, such as mechanical or electronic compensation, are obviously essential to ensure the electrical performance of antennas that work in complex environments. Since traditional compensation methods can only adjust antenna pointing but not the surface accuracy, which are limited for obtaining high surface precision and aperture efficiency, active surface adjustment has become an indispensable tool in this field. Therefore, the development process of electrical performance compensation methods for radio telescope antennas is introduced. Further, a series of analyses of the five key technologies of active surface adjustment is presented. Then, four typical large antennas that have been designed with active main reflector technology are presented and compared. Finally, future research directions and suggestions for reflector antenna compensation methods based on active surface adjustment are presented.
Polyphase diffusion of fission products in graphite
International Nuclear Information System (INIS)
Dannert, V.
1989-05-01
The report attempts to give an introduction into the subject of fission product transport in nuclear graphite and results in an extended proposal of a transport-model. Beginning with a rough description of the graphite in question, an idea about the physical transport-phenomena in graphite is developed. Some of the basic experimental methods, especially techniques of porosimetry, determination of sorption-isotherms and of course several transport-experiments, are briefly described and their results are discussed. Some of the most frequent transport models are introduced and assessed with the criteria emphasized in this report. An extended model is proposed including the following main ideas: The transport of the fission-products is regarded as a two-phase-diffusion process through the open pores of the graphite. The two phases are: surface-diffusion and gas-diffusion. A time-dependent coupling of the two diffusion-phases by sorption-isotherms and a concentration-dependence of the surface diffusion coefficient, also related to the physical behaviour of the sorption-isotherms, are the basic properties of the proposed model. (orig./HP) [de
Hydrogen isotope in erbium oxide: Adsorption, penetration, diffusion, and vacancy trapping
International Nuclear Information System (INIS)
Mao, Wei; Chikada, Takumi; Suzuki, Akihiro; Terai, Takayuki; Matsuzaki, Hiroyuki
2015-01-01
Highlights: • H adsorption on cubic Er 2 O 3 surface results in electron transfer from H to the surface. • The H penetration energy of at least 1.6 eV is required for cubic Er 2 O 3 surface. • The dominated mechanisms of H diffusion in bulk Er 2 O 3 are elucidated. • H diffusion near or at vacancies in Er 2 O 3 is an exothermic reaction. - Abstract: In this study, we report results using first-principles density functional theory calculations for four critical aspects of the interaction: H adsorption on Er 2 O 3 surface, surface-to-subsurface penetration of H into Er 2 O 3 , bulk diffusion of H in Er 2 O 3 , and trapping of H at vacancies. We identify surface stable adsorption positions and find that H prefers to transfer electrons to the surfaces and form covalent bonds with the nearest neighboring four oxygen atoms. For low surface coverage of H as in our case (0.89 × 10 14 H/cm 2 ), a penetration energy of at least 1.60 eV is required for cubic Er 2 O 3 surfaces. Further, the H diffusion barrier between the planes defined by Er 2 O 3 units along the favorable <1 1 1> direction is found to be very small – 0.16 eV – whereas higher barriers of 0.41 eV and 1.64 eV are required for diffusion across the planes, somewhat higher than the diffusion energy barrier of 0.20 eV observed experimentally at 873 K. In addition, we predict that interstitial H is exothermically trapped when it approaches a vacancy with the vacancy defect behaving as an electron trap since the H-vacancy defect is found to be more stable than the intrinsic defect
Study of uranium-titanium diffusion; Etude de la diffusion uranium-titane
Energy Technology Data Exchange (ETDEWEB)
Adda, Y; Philibert, J [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires; Institut de Recherches de la Siderurgie Francaise (IRSID), 78 - Saint-Germain-en-Laye (France)
1959-07-01
In the overall scheme of research on the chemical diffusion of uranium and the transition metals we have studied the uranium-titanium system. The diffusion couples are prepared by welding together small plates of uranium and titanium under pressure, using a technique already described by us. After diffusion under vacuum, polished sections of the samples were micro-graphically examined. This inspection showed that intergranular diffusion occurred at temperatures below 650 deg. C. At higher temperatures, the diffusion occurred uniquely throughout the volume of the metal, and the diffusion zone appeared as a succession of micro-graphically distinguishable bands. Study of the rate of increase of these corresponding 'penetration coefficients'. In addition, we have observed important variations in microhardness within the diffusion zone, we have tried to relate these variations to the variation of concentration. This is measured with the Castaing microprobe. We have thus accurately established the concentration-penetration curves for temperatures between 950 and 1075 deg. C. From these curves, we have calculated the diffusion coefficient D as a function of the concentration using Matano's method. At all temperatures, D(c) curve has a U form as for the U-Zr system. The activation energy has a maximum value of 42 kcal/g atom at an atomic concentration of 0,5. Even though we have rarely seen pores in the diffusion zone, we have nevertheless observed an important Kirkendall-effect by studying the displacements x{sub i} of the interface using tungsten wires as markers. These displacements can be expressed as a function of time and temperature by the equation: x{sub i} = 0,9 t {sup 1/2} exp ( - 14600/(RT)). Finally, using Darken's equations we calculated the intrinsic diffusion coefficients Du and Dti as well as the corresponding activation energies. These energies are similar (QU = 38,5 and QTi = 40 kcal/at. g) and also almost the same as those found for the U-Zr system
Directory of Open Access Journals (Sweden)
Nobumichi Fujisawa
2017-01-01
Full Text Available The transition process from a diffuser rotating stall to a stage stall in a centrifugal compressor with a vaned diffuser was investigated by experimental and numerical analyses. From the velocity measurements, it was found that the rotating stall existed on the shroud side of the diffuser passage in the off-design flow condition. The numerical results revealed the typical vortical structure of the diffuser stall. The diffuser stall cell was caused by the systematic vortical structure which consisted of the tornado-type vortex, the longitudinal vortex at the shroud/suction surface corner (i.e., leading edge vortex (LEV, and the vortex in the throat area of the diffuser passages. Furthermore, the stage stall, which rotated within both the impeller and diffuser passages, occurred instead of the diffuser stall as the mass flow rate was decreased. According to the velocity measurements at the diffuser inlet, the diffuser stall which rotated on the shroud side was shifted to the hub side. Then, the diffuser stall moved into the impeller passages and formed the stage stall. Therefore, the stage stall was caused by the development of the diffuser stall, which transferred from the shroud side to the hub side in the vaneless space and expanded to the impeller passages.
[Detection of surface EMG signal using active electrode].
He, Qinghua; Peng, Chenglin; Wu, Baoming; Wang, He
2003-09-01
Research of surface electromyogram(EMG) signal is important in rehabilitation medicine, sport medicine and clinical diagnosis, accurate detection of signal is the base of quantitative analysis of surface EMG signal. In this article were discussed how to reduce possible noise in the detection of surface EMG. Considerations on the design of electrode unit were presented. Instrumentation amplifier AD620 was employed to design a bipolar active electrode for use in surface EMG detection. The experiments showed that active electrode could be used to improve signal/noise ratio, reduce noise and detect surface EMG signal effectively.
Fernandes, Marisa Narciso; da Cruz, André Luis; da Costa, Oscar Tadeu Ferreira; Perry, Steven Franklin
2012-09-01
The gills and the respiratory swim bladders of juvenile specimens (mean body mass 100g) of the basal teleost Arapaima gigas (Cuvier 1829) were evaluated using stereological methods in vertical sections. The surface areas, harmonic mean barrier thicknesses and morphometric diffusing capacities for oxygen and carbon dioxide were estimated. The average respiratory surface area of the swim bladder (2173 cm² kg⁻¹) exceeded that of the gills (780 cm² kg⁻¹) by a factor of 2.79. Due to the extremely thin air-blood barrier in the swim bladder (harmonic mean 0.22 μm) and the much thicker water-blood barrier of the gills (9.61 μm), the morphometric diffusing capacity for oxygen and carbon dioxide was 88 times greater in the swim bladder than in the gills. These data clearly indicate the importance of the swim bladder, even in juvenile A. gigas that still engage in aquatic respiration. Because of the much greater diffusion constant of CO₂ than O₂ in water, the gills also remain important for CO₂ release. Copyright © 2012 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Gruber, Mathis; Hermann, Klaus [Fritz-Haber-Institut der MPG, und Sfb 546, Berlin (Germany)
2009-07-01
Various selective oxidation reactions as the selective catalytic reduction (SCR) of NO{sub x} or the ammoxidation of propane/propene to acrylonitrile are processed on vanadium based metal-oxide catalysts in the presence of ammonia. In the reactions the intermediates NH{sub 2}, NH{sub 3}, and NH{sub 4} are involved indicating that the adsorption and dehydrogenation of NH{sub x}, x < 4, are important steps. We have performed theoretical studies of corresponding reaction steps where the catalyst is simulated by a finite section of the V{sub 2}O{sub 5} (010) surface. The calculations apply density-functional theory combined with clusters modeling the adsorbate system. The substrate lowers corresponding dehydrogenation energies considerably compared with values for the gas phase reaction. However, the lowering is too small to make dehydrogenation of NH{sub 3} likely to happen. Our results on the role of oxygen vacancies for the dehydrogenation indicate that such surface defects become important for the reaction. Besides the energetics also the diffusion at the surface influences the reaction. A nudged elastic band (NEB) routine has been implemented to evaluate diffusion paths and barriers. Hydrogen diffusion on the surface will be discussed and additional examples for NH{sub x} diffusion will be shown. Based on these results possible reaction scenarios for the dehydrogenation reaction will be presented.
Multicomponent diffusivities from the free volume theory
Wesselingh, J.A; Bollen, A.M
In this paper the free volume theory of diffusion is extended to multicomponent mixtures. The free volume is taken to be accessible for any component according to its surface. fraction. The resulting equations predict multicomponent (Maxwell-Stefan) diffusivities in simple liquid mixtures from pure
International Nuclear Information System (INIS)
Sun Jianzhong; Wang Zhikang; Gong Xiangyang
2006-01-01
Objective: To compare two methods 3D flash and diffusion-weighted images (DWI) in reconstructing the brain surface anatomy, and to evaluate their displaying ability, advantages, limitations and clinical application. Methods: Thrity normal cases were prospectively examined with 3D flash sequence and echo-planar DWI. Three-dimensional images were acquired with volume-rendering on workstation. Brain surface structures were evaluated and scored by a group of doctors. Results: Main structures of brain surface were clearly displayed on three-dimensional images based on 3D flash sequence. Average scores were all above 2.50. For images based on DWI, precentral gyrus, postcentral gyrus, superior parietal lobule, superior frontal gyrus, precentral sulcus, central sulcus, postcentral sulcus, intraparietal sulcus and superior frontal sulcus were best shown with average scores between 2.60-2.75, However, supramarginal gyrus, angular gyrus, middle frontal gyrus, inferior frontal gyrus, superior temporal gyrus, lateral sulcus, inferior frontal sulcus could not be well shown, with average scores between 1.67-2.48. Middle temporal gyrus, inferior temporal gyrus, superior temporal sulcus and inferior temporal sulcus can only get scores from 0.88 to 1.27. Scores of images based on 3D flash were much higher than that based on DWI with distinct differentiations, P values were all below 0.01. Conclusion: Three-dimensional images based on 3D flash can really display brain surface structures. It is very useful for anatomic researches. Three-dimensional reconstruction of brain surface based on DWI is a worthy technique to display brain surface anatomy, especially for frontal and parietal structures. (authors)
Thermal diffusivity effect in opto-thermal skin measurements
International Nuclear Information System (INIS)
Xiao, P; Imhof, R E; Cui, Y; Ciortea, L I; Berg, E P
2010-01-01
We present our latest study on the thermal diffusivity effect in opto-thermal skin measurements. We discuss how thermal diffusivity affects the shape of opto-thermal signal, and how to measure thermal diffusivity in opto-thermal measurements of arbitrary sample surfaces. We also present a mathematical model for a thermally gradient material, and its corresponding opto-thermal signal. Finally, we show some of our latest experimental results of this thermal diffusivity effect study.
International Nuclear Information System (INIS)
Sato, Haruo
2005-01-01
The diffusion experiments for I - and Cs + in the parallel and perpendicular directions to the orientated direction of smectite particles were performed as a function of smectite's dry density, salinity and temperature. The anisotropies and the effect of salinity in the apparent diffusivities (D a ) and activation energies (ΔE a ) for both ions were additionally discussed. The D a -values for both ions showed a tendency to be higher in the parallel direction than in the perpendicular direction. The D a -values of I - in the parallel direction decreased with increasing salinity at low-dry density, but those of Cs + increased with increasing salinity for all conditions. Based on this, it is interpreted that I - mainly diffuses in interstitial pores and that Cs + diffuses in interlayer and interstitial pores. The ΔE a -values for I - , similar levels to that for the diffusivity in free water (D o ) at low-dry density, increased with increasing dry density. The ΔE a -values for Cs + , higher than that for D o even at low-dry density, increased with increasing dry density. Such high ΔE a -values for Cs + are considered to be due to the effects of ion exchange enthalpy (ΔH o ) between Cs + and Na + and the decrease in the activity of porewater. (author)
Laser Induced Selective Activation For Subsequent Autocatalytic Electroless Plating
DEFF Research Database (Denmark)
Zhang, Yang
. The third hypothesis is that the activation and rinsing process can be described by diffusion. This hypothesis is proved using Fick’s diffusion laws combined with the short-time-plating experiment. The influence of laser parameters on the surface structure is investigated for Nd:YAG, UV, and fiber lasers......The subject of this PhD thesis is “Laser induced selective activation for subsequent autocatalytic electroless plating.” The objective of the project is to investigate the process chains for micro structuring of polymer surfaces for selective micro metallization. Laser induced selective activation...... (LISA) is introduced and studied as a new technique for producing 3D moulded interconnect devices (3D-MIDs). This technique enables the metallization of polymer surface modified by laser and subsequently activated by a PdCl2/SnCl2 system. Various technologies exist on an industrial level...
Determination of carrier diffusion length in p- and n-type GaN
Hafiz, Shopan; Metzner, Sebastian; Zhang, Fan; Monavarian, Morteza; Avrutin, Vitaliy; Morkoç, Hadis; Karbaum, Christopher; Bertram, Frank; Christen, Jürgen; Gil, Bernard; Özgür, Ümit
2014-03-01
Diffusion lengths of photo-excited carriers along the c-direction were determined from photoluminescence (PL) measurements in p- and n-type GaN epitaxial layers grown on c-plane sapphire by metal-organic chemical vapor deposition. The investigated samples incorporate a 6 nm thick In0.15Ga0.85N active layer capped with either 500 nm p- GaN or 1300 nm n-GaN. The top GaN layers were etched in steps and PL from the InGaN active region and the underlying layers was monitored as a function of the top GaN thickness upon photogeneration near the surface region by above bandgap excitation. Taking into consideration the absorption in the active and underlying layers, the diffusion lengths at 295 K and at 15 K were measured to be about 92 ± 7 nm and 68 ± 7 nm for Mg-doped p-type GaN and 432 ± 30 nm and 316 ± 30 nm for unintentionally doped n-type GaN, respectively. Cross-sectional cathodoluminescence line-scan measurement was performed on a separate sample and the diffusion length in n-type GaN was measured to be 280 nm.
The modeling method of diffusion of radio activated materials in clay waste disposals
Energy Technology Data Exchange (ETDEWEB)
Saberi, Reza; Sepanloo, Kamran [NSTRI, Tehran (Iran, Islamic Republic of); Alinejad, Majid [Engineering Research Institute of Natural Hazard, Isfahan (Iran, Islamic Republic of); Mozaffari, Ali [KNT Univ. of Technology, Tehran (Iran, Islamic Republic of)
2017-02-15
New nuclear power plants are necessary to meet today's and future challenges of energy supply. Nuclear power is the only large-scale energy source that takes full responsibility for all its wastes. Nuclear wastes are particularly hazardous and hard to manage relative to different toxic industrial wastes. Three methods are presented and analysed to model the diffusion of the waste from the waste disposal to the bottom surface. For this purpose three software programmes such as ABAQUS, Matlab coding, Geostudio and ArcGIS have been applied.
The solubility and diffusivity of hydrogen in well-annealed and deformed iron
International Nuclear Information System (INIS)
Kiuchi, K.; McLellan, R.B.
1983-01-01
It has been shown that a large volume of data for the solubility of hydrogen in iron is affected by spurious surface conditions. Arrhenius plots of solubility data in the temperature range 300-1750 K, which are free of such effects, exhibit a temperature variation which, despite the low H-solubility in the entire temperature range, is not consistent with regular mixing statistics. This departure from regular behavior is consistent with the thermal activation of H atoms into energetically less favorable octahedral sites as the temperature is increased. The enhancement in H-solubility caused by the cold deformation of iron can be understood in terms of a simple Maxwell-Boltzmann distribution of H atoms between ''normal'' lattice sites and ''trapping'' sites of depth 34 kJ/mol. The 62 currently existing sets of data for the diffusivity of hydrogen through b.c.c. iron exhibit a large degree of mutual inconsistency. Exhaustive statistical analysis of this large data mass has shown that only those data obtained by electrochemical methods and H 2 -gas equilibration methods using UHV techniques and Pd-coated membranes are reliable. The problem of H-diffusion in deformed iron has been analysed using a semi-quantitative model in which the retarding effect of trapping sites on the diffusivity is partially compensated by a ''pipe'' diffusion contribution along dislocations. It is shown that this model is in accord with the diffusivities measured in deformed iron when data not encumbered by spurious surface effects are considered
Diffusion in membranes: Toward a two-dimensional diffusion map
Directory of Open Access Journals (Sweden)
Toppozini Laura
2015-01-01
Full Text Available For decades, quasi-elastic neutron scattering has been the prime tool for studying molecular diffusion in membranes over relevant nanometer distances. These experiments are essential to our current understanding of molecular dynamics of lipids, proteins and membrane-active molecules. Recently, we presented experimental evidence from X-ray diffraction and quasi-elastic neutron scattering demonstrating that ethanol enhances the permeability of membranes. At the QENS 2014/WINS 2014 conference we presented a novel technique to measure diffusion across membranes employing 2-dimensional quasi-elastic neutron scattering. We present results from our preliminary analysis of an experiment on the cold neutron multi-chopper spectrometer LET at ISIS, where we studied the self-diffusion of water molecules along lipid membranes and have the possibility of studying the diffusion in membranes. By preparing highly oriented membrane stacks and aligning them horizontally in the spectrometer, our aim is to distinguish between lateral and transmembrane diffusion. Diffusion may also be measured at different locations in the membranes, such as the water layer and the hydrocarbon membrane core. With a complete analysis of the data, 2-dimensional mapping will enable us to determine diffusion channels of water and ethanol molecules to quantitatively determine nanoscale membrane permeability.
Ethanol Diffusion on Rutile TiO2(110) Mediated by H Adatoms
DEFF Research Database (Denmark)
Huo, Peipei; Hansen, Jonas Ørbæk; Martinez, Umberto
2012-01-01
and perpendicular to the rows of surface Ti atoms. The diffusion of ethanol molecules perpendicular to the rows of surface Ti atoms was found to be mediated by H adatoms in the rows of bridge-bonded O (Obr) atoms similarly to previous results obtained for water monomers. In contrast, the diffusion of H adatoms...... across the Ti rows, mediated by ethanol molecules, was observed only very rarely and exclusively on fully hydrogenated TiO2(110) surfaces. Possible reasons why the diffusion of H adatoms across the Ti rows mediated by ethanol molecules occurs less frequently than the cross-row diffusion of ethanol...... molecules mediated by H adatoms are discussed....
A diffusive ink transport model for lipid dip-pen nanolithography
Urtizberea, A.; Hirtz, M.
2015-09-01
Despite diverse applications, phospholipid membrane stacks generated by dip-pen nanolithography (DPN) still lack a thorough and systematic characterization that elucidates the whole ink transport process from writing to surface spreading, with the aim of better controlling the resulting feature size and resolution. We report a quantitative analysis and modeling of the dependence of lipid DPN features (area, height and volume) on dwell time and relative humidity. The ink flow rate increases with humidity in agreement with meniscus size growth, determining the overall feature size. The observed time dependence indicates the existence of a balance between surface spreading and the ink flow rate that promotes differences in concentration at the meniscus/substrate interface. Feature shape is controlled by the substrate surface energy. The results are analyzed within a modified model for the ink transport of diffusive inks. At any humidity the dependence of the area spread on the dwell time shows two diffusion regimes: at short dwell times growth is controlled by meniscus diffusion while at long dwell times surface diffusion governs the process. The critical point for the switch of regime depends on the humidity.Despite diverse applications, phospholipid membrane stacks generated by dip-pen nanolithography (DPN) still lack a thorough and systematic characterization that elucidates the whole ink transport process from writing to surface spreading, with the aim of better controlling the resulting feature size and resolution. We report a quantitative analysis and modeling of the dependence of lipid DPN features (area, height and volume) on dwell time and relative humidity. The ink flow rate increases with humidity in agreement with meniscus size growth, determining the overall feature size. The observed time dependence indicates the existence of a balance between surface spreading and the ink flow rate that promotes differences in concentration at the meniscus
Sun, Haitao; Liu, Kai; Liu, Hao; Ji, Zongfei; Yan, Yan; Jiang, Lindi; Zhou, Jianjun
2018-04-01
Background There has been a growing need for a sensitive and effective imaging method for the differentiation of the activity of ankylosing spondylitis (AS). Purpose To compare the performances of intravoxel incoherent motion (IVIM)-derived parameters and the apparent diffusion coefficient (ADC) for distinguishing AS-activity. Material and Methods One hundred patients with AS were divided into active (n = 51) and non-active groups (n = 49) and 21 healthy volunteers were included as control. The ADC, diffusion coefficient ( D), pseudodiffusion coefficient ( D*), and perfusion fraction ( f) were calculated for all groups. Kruskal-Wallis tests and receiver operator characteristic (ROC) curve analysis were performed for all parameters. Results There was good reproducibility of ADC /D and relatively poor reproducibility of D*/f. ADC, D, and f were significantly higher in the active group than in the non-active and control groups (all P 0.050). In the ROC analysis, ADC had the largest AUC for distinguishing between the active group and the non-active group (0.988) and between the active and control groups (0.990). Multivariate logistic regression analysis models showed no diagnostic improvement. Conclusion ADC provided better diagnostic performance than IVIM-derived parameters in differentiating AS activity. Therefore, a straightforward and effective mono-exponential model of diffusion-weighted imaging may be sufficient for differentiating AS activity in the clinic.
Process for forming a chromium diffusion portion and articles made therefrom
Helmick, David Andrew; Cavanaugh, Dennis William; Feng, Ganjiang; Bucci, David Vincent
2012-09-11
In one embodiment, a method for forming an article with a diffusion portion comprises: forming a slurry comprising chromium and silicon, applying the slurry to the article, and heating the article to a sufficient temperature and for a sufficient period of time to diffuse chromium and silicon into the article and form a diffusion portion comprising silicon and a microstructure comprising .alpha.-chromium. In one embodiment, a gas turbine component comprises: a superalloy and a diffusion portion having a depth of less than or equal to 60 .mu.m measured from the superalloy surface into the gas turbine component. The diffusion portion has a diffusion surface having a microstructure comprising greater than or equal to 40% by volume .alpha.-chromium.
The effect of excimer laser pretreatment on diffusion and activation of boron implanted in silicon
International Nuclear Information System (INIS)
Monakhov, E.V.; Svensson, B.G.; Linnarsson, M.K.; La Magna, A.; Italia, M.; Privitera, V.; Fortunato, G.; Cuscuna, M.; Mariucci, L.
2005-01-01
We have investigated the effect of excimer laser annealing (ELA) on transient enhanced diffusion (TED) and activation of boron implanted in Si during subsequent rapid thermal annealing (RTA). It is observed that ELA with partial melting of the implanted region causes reduction of TED in the region that remains solid during ELA, where the diffusion length of boron is reduced by a factor of ∼4 as compared to the as-implanted sample. This is attributed to several mechanisms such as liquid-state annealing of a fraction of the implantation induced defects, introduction of excess vacancies during ELA, and solid-state annealing of the defects beyond the maximum melting depth by the heat wave propagating into the Si wafer. The ELA pretreatment provides a substantially improved electrical activation of boron during subsequent RTA
Diffuse neutron scattering signatures of rough films
International Nuclear Information System (INIS)
Pynn, R.; Lujan, M. Jr.
1992-01-01
Patterns of diffuse neutron scattering from thin films are calculated from a perturbation expansion based on the distorted-wave Born approximation. Diffuse fringes can be categorised into three types: those that occur at constant values of the incident or scattered neutron wavevectors, and those for which the neutron wavevector transfer perpendicular to the film is constant. The variation of intensity along these fringes can be used to deduce the spectrum of surface roughness for the film and the degree of correlation between the film's rough surfaces
Energy Technology Data Exchange (ETDEWEB)
Altman, S.J.; Tidwell, V.C. [Sandia National Laboratories, Albuquerque, NM (United States); Uchida, M. [Japan Nuclear Cycle Development Inst., Ibaraki (Japan)
2001-08-01
Matrix diffusion is one of the most important contaminant migration retardation processes in crystalline rocks. Performance assessment calculations in various countries assume that only the area of the fracture surface where advection is active provides access to the rock matrix. However, accessibility to the matrix could be significantly enhanced with diffusion into stagnant zones, fracture fillings, and through an alteration rim in the matrix. Laboratory visualization experiments were conducted on granodiorite samples to investigate and quantify diffusion rates within different zones of a Cretaceous granodiorite. Samples were collected from the Kamaishi experimental site in the northern part of the main island of Japan. Diffusion of iodine out of the sample is visualized and rates are measured using x-ray absorption imaging. X-ray images allow for measurements of relative iodine concentration and relative iodine mass as a function of time and two-dimensional space at a sub-millimeter spatial resolution. In addition, two-dimensional heterogeneous porosity fields (at the same resolution as the relative concentration fields) are measured. This imaging technique allows for a greater understanding of the spatial variability of diffusion rates than can be accomplished with standard bulk measurements. It was found that diffusion rates were fastest in partially gouge-filled fractures. Diffusion rates in the recrystallized calcite-based fracture-filling material were up to an order of magnitude lower than in gouge-filled fractures. Diffusion in altered matrix around the fractures was over an order of magnitude lower than that in the gouge-filled fractures. Healed fractures did not appear to have different diffusion rates than the unaltered matrix.
International Nuclear Information System (INIS)
Altman, S.J.; Tidwell, V.C.; Uchida, M.
2001-01-01
Matrix diffusion is one of the most important contaminant migration retardation processes in crystalline rocks. Performance assessment calculations in various countries assume that only the area of the fracture surface where advection is active provides access to the rock matrix. However, accessibility to the matrix could be significantly enhanced with diffusion into stagnant zones, fracture fillings, and through an alteration rim in the matrix. Laboratory visualization experiments were conducted on granodiorite samples to investigate and quantify diffusion rates within different zones of a Cretaceous granodiorite. Samples were collected from the Kamaishi experimental site in the northern part of the main island of Japan. Diffusion of iodine out of the sample is visualized and rates are measured using x-ray absorption imaging. X-ray images allow for measurements of relative iodine concentration and relative iodine mass as a function of time and two-dimensional space at a sub-millimeter spatial resolution. In addition, two-dimensional heterogeneous porosity fields (at the same resolution as the relative concentration fields) are measured. This imaging technique allows for a greater understanding of the spatial variability of diffusion rates than can be accomplished with standard bulk measurements. It was found that diffusion rates were fastest in partially gouge-filled fractures. Diffusion rates in the recrystallized calcite-based fracture-filling material were up to an order of magnitude lower than in gouge-filled fractures. Diffusion in altered matrix around the fractures was over an order of magnitude lower than that in the gouge-filled fractures. Healed fractures did not appear to have different diffusion rates than the unaltered matrix
Mechanochemical activation and gallium and indiaarsenides surface catalycity
Kirovskaya, I. A.; Mironova, E. V.; Umansky, I. V.; Brueva, O. Yu; Murashova, A. O.; Yureva, A. V.
2018-01-01
The present work has been carried out in terms of determining the possibilities for a clearer identification of the active sites nature, intermediate surface compounds nature, functional groups during adsorption and catalysis, activation of the diamond-like semiconductors surface (in particular, the AIIIBV type) based on mechanochemical studies of the “reaction medium (H2O, iso-C3H7OH) - dispersible semiconductor (GaAs, InAs)” systems. As a result, according to the read kinetic curves of dispersion in water, both acidification and alkalinization of the medium have been established and explained; increased activity of the newly formed surface has been noted; intermediate surface compounds, functional groups appearing on the real surface and under H2O adsorption conditions, adsorption and catalytic decomposition of iso-C3H7OH have been found (with explanation of the origin). The unconcealed role of coordinatively unsaturated atoms as active sites of these processes has been shown; the relative catalytic activity of the semiconductors studied has been evaluated. Practical recommendations on the preferred use of gallium arsenide in semiconductor gas analysis and semiconductor catalysis have been given in literature searches, great care should be taken in constructing both.
Modelling of diffuse solar fraction with multiple predictors
Energy Technology Data Exchange (ETDEWEB)
Ridley, Barbara; Boland, John [Centre for Industrial and Applied Mathematics, University of South Australia, Mawson Lakes Boulevard, Mawson Lakes, SA 5095 (Australia); Lauret, Philippe [Laboratoire de Physique du Batiment et des Systemes, University of La Reunion, Reunion (France)
2010-02-15
For some locations both global and diffuse solar radiation are measured. However, for many locations, only global radiation is measured, or inferred from satellite data. For modelling solar energy applications, the amount of radiation on a tilted surface is needed. Since only the direct component on a tilted surface can be calculated from direct on some other plane using trigonometry, we need to have diffuse radiation on the horizontal plane available. There are regression relationships for estimating the diffuse on a tilted surface from diffuse on the horizontal. Models for estimating the diffuse on the horizontal from horizontal global that have been developed in Europe or North America have proved to be inadequate for Australia. Boland et al. developed a validated model for Australian conditions. Boland et al. detailed our recent advances in developing the theoretical framework for the use of the logistic function instead of piecewise linear or simple nonlinear functions and was the first step in identifying the means for developing a generic model for estimating diffuse from global and other predictors. We have developed a multiple predictor model, which is much simpler than previous models, and uses hourly clearness index, daily clearness index, solar altitude, apparent solar time and a measure of persistence of global radiation level as predictors. This model performs marginally better than currently used models for locations in the Northern Hemisphere and substantially better for Southern Hemisphere locations. We suggest it can be used as a universal model. (author)
SHREDI, Neutron Flux and Neutron Activation in 2-D Shields by Removal Diffusion
International Nuclear Information System (INIS)
Daneri, A.; Toselli, G.
1976-01-01
1 - Nature of physical problem solved: SHREDI is a removal - diffusion neutron shielding code. The program computes neutron fluxes and activations in bidimensional sections (x,y or r,z) of the shield. It is also possible to consider shielding points with the same y or z coordinate (mono-dimensional problems). 2 - Method of solution: The integrals which define the removal fluxes are computed in some shield points by means of a particular algorithm based on the Simpson's and trapezoidal rules. For the diffusion calculation the finite difference method is used. The removal sources are interpolated in all diffusion points by Chebyshev polynomials. 3 - Restrictions on the complexity of the problem: Maxima: number of removal energy groups NGR = 40; number of diffusion energy groups NGD = 40; number of the reactor core and shield materials NCMP = 50; number of core mesh points in r (or x) direction for integral calculation = 75; number of core mesh points in z (or y) direction for integral calculation = 75; number of core mesh points in theta (or z) direction for integral calculation = 75; number of shield mesh points for the neutron flux calculation in r (or x) direction NPX = 200; number of shield mesh points for the neutron flux calculation in z (or y) direction NPY = 200; n.b. (NPX * NPY) le 12000
Radon progeny distribution in cylindrical diffusion chambers
International Nuclear Information System (INIS)
Pressyanov, Dobromir S.
2008-01-01
An algorithm to model the diffusion of radioactive decay chain atoms is presented. Exact mathematical solutions in cylindrical geometry are given. They are used to obtain expressions for the concentrations of 222 Rn progeny atoms in the volume and deposited on the wall surface in cylindrical diffusion chambers. The dependence of volume fractions of 222 Rn progeny and chamber sensitivity on the coefficient of diffusion of 222 Rn progeny atoms in air is modeled.
Design Method for Channel Diffusers of Centrifugal Compressors
Directory of Open Access Journals (Sweden)
Mykola Kalinkevych
2013-01-01
Full Text Available The design method for channel diffusers of centrifugal compressors, which is based on the solving of the inverse problem of gas dynamics, is presented in the paper. The concept of the design is to provide high pressure recovery of the diffuser by assuming the preseparation condition of the boundary layer along one of the channel surfaces. The channel diffuser was designed with the use of developed method to replace the vaned diffuser of the centrifugal compressor model stage. The numerical simulation of the diffusers was implemented by means of CFD software. Obtained gas dynamic characteristics of the designed diffuser were compared to the base vaned diffuser of the compressor stage.
Diffusion in crushed rock and in bentonite clay
International Nuclear Information System (INIS)
Olin, M.
1994-04-01
Diffusion theories for porous media with sorption are reviewed to serve as a basis for considering diffusion in simple systems like sand of crushed rock. A Fickian diffusion and linear sorption model is solved both by analytical Laplance transform and Green's function methods and by numerical methods, and then applied to small-scale experiments for Finnish low- and medium-level operating waste repositories. The main properties of bentonite are reviewed. The hydraulic conductivity of compacted bentonite is so low that the major transport mechanism is diffusion. A Fickian diffusion and linear sorption model is applied to bentonite. The main component of bentonite, montmorillonite, has a high ion-exchange capacity and thus, transport in bentonite consists of interactive chemical and diffusion phenomena. A chemical equilibrium model, CHEQ, is developed for ion-exchange reactions in bentonite water systems. CHEQ is applied to some bentonite experiments with success, especially for monovalent ions. The fitted log-binding constants for sodium exchange with potassium, magnesium, and calcium were 0.27, 1.50, and 2.10, respectively. A coupled chemical and diffusion model, CHEQDIFF, is developed to take account of diffusion in pore water, surface diffusion and ion-exchange reactions. The model is applied to the same experiments as CHEQ, and validation is partly successful. In the diffusion case, the above-mentioned values for binding constants are used. The apparent diffusion (both anions and cations) and surface diffusion (only for cations) constants used are 3.0*10 -11 m 2 /s and 6.0*10 -12 m 2 /s, respectively, but these values are questionable, as experimental results good enough for fitting are not available. (orig.). (74 refs., 27 figs., 12 tabs.)
Active Surfaces and Interfaces of Soft Materials
Wang, Qiming
A variety of intriguing surface patterns have been observed on developing natural systems, ranging from corrugated surface of white blood cells at nanometer scales to wrinkled dog skins at millimeter scales. To mimetically harness functionalities of natural morphologies, artificial transformative skin systems by using soft active materials have been rationally designed to generate versatile patterns for a variety of engineering applications. The study of the mechanics and design of these dynamic surface patterns on soft active materials are both physically interesting and technologically important. This dissertation starts with studying abundant surface patterns in Nature by constructing a unified phase diagram of surface instabilities on soft materials with minimum numbers of physical parameters. Guided by this integrated phase diagram, an electroactive system is designed to investigate a variety of electrically-induced surface instabilities of elastomers, including electro-creasing, electro-cratering, electro-wrinkling and electro-cavitation. Combing experimental, theoretical and computational methods, the initiation, evolution and transition of these instabilities are analyzed. To apply these dynamic surface instabilities to serving engineering and biology, new techniques of Dynamic Electrostatic Lithography and electroactive anti-biofouling are demonstrated.
Moisture diffusivity in structure of random fractal fiber bed
Energy Technology Data Exchange (ETDEWEB)
Zhu, Fanglong, E-mail: zhufanglong_168@163.com [College of Textile, Zhongyuan University of Technology, Zhengzhou City (China); The Chinese People' s Armed Police Forces Academy, Langfan City (China); Zhou, Yu; Feng, Qianqian [College of Textile, Zhongyuan University of Technology, Zhengzhou City (China); Xia, Dehong [School of Mechanical Engineering, University of Science and Technology, Beijing (China)
2013-11-08
A theoretical expression related to effective moisture diffusivity to random fiber bed is derived by using fractal theory and considering both parallel and perpendicular channels to diffusion flow direction. In this Letter, macroporous structure of hydrophobic nonwoven material is investigated, and Knudsen diffusion and surface diffusion are neglected. The effective moisture diffusivity predicted by the present fractal model are compared with water vapor transfer rate (WVTR) experiment data and calculated values obtained from other theoretical models. This verifies the validity of the present fractal diffusivity of fibrous structural beds.
Efficient and Enhanced Diffusion of Vector Field for Active Contour Model
Liu, Guoqi; Sun, Lin; Liu, Shangwang
2015-01-01
Gradient vector flow (GVF) is an important external force field for active contour models. Various vector fields based on GVF have been proposed. However, these vector fields are obtained with many iterations and have difficulty in capturing the whole image area. On the other hand, the ability to converge to deep and complex concavity with these vector fields is also needed to improve. In this paper, by analyzing the diffusion equation of GVF, a normalized set is defined and a dynamically nor...
Cherniak, D. J.; Zhang, X. Y.; Nakamura, M.; Watson, E. B.
2004-09-01
We report measurements of oxygen diffusion in natural monazites under both dry, 1-atm conditions and hydrothermal conditions. For dry experiments, 18O-enriched CePO4 powder and monazite crystals were sealed in Ag-Pd capsules with a solid buffer (to buffer at NNO) and annealed in 1-atm furnaces. Hydrothermal runs were conducted in cold-seal pressure vessels, where monazite grains were encapsulated with 18O-enriched water. Following the diffusion anneals, oxygen concentration profiles were measured with Nuclear Reaction Analysis (NRA) using the reaction 18O(p,α)15N. Over the temperature range 850-1100 °C, the Arrhenius relation determined for dry diffusion experiments on monazite is given by: Under wet conditions at 100 MPa water pressure, over the temperature range 700-880 °C, oxygen diffusion can be described by the Arrhenius relationship: Oxygen diffusion under hydrothermal conditions has a significantly lower activation energy for diffusion than under dry conditions, as has been found the case for many other minerals, both silicate and nonsilicate. Given these differences in activation energies, the differences between dry and wet diffusion rates increase with lower temperatures; for example, at 600 °C, dry diffusion will be more than 4 orders of magnitude slower than diffusion under hydrothermal conditions. These disparate diffusivities will result in pronounced differences in the degree of retentivity of oxygen isotope signatures. For instance, under dry conditions (presumably rare in the crust) and high lower-crustal temperatures (∼800 °C), monazite cores of 70-μm radii will preserve O isotope ratios for about 500,000 years; by comparison, they would be retained at this temperature under wet conditions for about 15,000 years.
Low-frequency active surface plasmon optics on semiconductors
Gómez Rivas, J.; Kuttge, M.; Kurz, H.; Haring Bolivar, P.; Sánchez-Gil, J.A.
2006-01-01
A major challenge in the development of surface plasmon optics or plasmonics is the active control of the propagation of surface plasmon polaritons (SPPs). Here, we demonstrate the feasibility of low-frequency active plasmonics using semiconductors. We show experimentally that the Bragg scattering
A new model of anomalous phosphorus diffusion in silicon
International Nuclear Information System (INIS)
Budil, M.; Poetzl, H.; Stingeder, G.; Grasserbauer, M.
1989-01-01
A model is presented to describe the 'kink and tail' diffusion of phosphorus. The diffusion behaviour of phosphorus is expplained by the motion of phosphorus-interstitial and phosphorus-vacancy pairs in different charge states. The model yields the enhancement of diffusion in the tail region depending on surface concentration. Furthermore it yields the same selfdiffusion coefficient for interstitials as the gold diffusion experiments. A transformation of the diffusion equation was found to reduce the number of simulation equations. (author) 7 refs., 5 figs
International Nuclear Information System (INIS)
Munoz-Jaramillo, Andres; Martens, Petrus C. H.; Nandy, Dibyendu; Yeates, Anthony R.
2010-01-01
The emergence of tilted bipolar active regions (ARs) and the dispersal of their flux, mediated via processes such as diffusion, differential rotation, and meridional circulation, is believed to be responsible for the reversal of the Sun's polar field. This process (commonly known as the Babcock-Leighton mechanism) is usually modeled as a near-surface, spatially distributed α-effect in kinematic mean-field dynamo models. However, this formulation leads to a relationship between polar field strength and meridional flow speed which is opposite to that suggested by physical insight and predicted by surface flux-transport simulations. With this in mind, we present an improved double-ring algorithm for modeling the Babcock-Leighton mechanism based on AR eruption, within the framework of an axisymmetric dynamo model. Using surface flux-transport simulations, we first show that an axisymmetric formulation-which is usually invoked in kinematic dynamo models-can reasonably approximate the surface flux dynamics. Finally, we demonstrate that our treatment of the Babcock-Leighton mechanism through double-ring eruption leads to an inverse relationship between polar field strength and meridional flow speed as expected, reconciling the discrepancy between surface flux-transport simulations and kinematic dynamo models.
A volume-based method for denoising on curved surfaces
Biddle, Harry
2013-09-01
We demonstrate a method for removing noise from images or other data on curved surfaces. Our approach relies on in-surface diffusion: we formulate both the Gaussian diffusion and Perona-Malik edge-preserving diffusion equations in a surface-intrinsic way. Using the Closest Point Method, a recent technique for solving partial differential equations (PDEs) on general surfaces, we obtain a very simple algorithm where we merely alternate a time step of the usual Gaussian diffusion (and similarly Perona-Malik) in a small 3D volume containing the surface with an interpolation step. The method uses a closest point function to represent the underlying surface and can treat very general surfaces. Experimental results include image filtering on smooth surfaces, open surfaces, and general triangulated surfaces. © 2013 IEEE.
A volume-based method for denoising on curved surfaces
Biddle, Harry; von Glehn, Ingrid; Macdonald, Colin B.; Marz, Thomas
2013-01-01
We demonstrate a method for removing noise from images or other data on curved surfaces. Our approach relies on in-surface diffusion: we formulate both the Gaussian diffusion and Perona-Malik edge-preserving diffusion equations in a surface-intrinsic way. Using the Closest Point Method, a recent technique for solving partial differential equations (PDEs) on general surfaces, we obtain a very simple algorithm where we merely alternate a time step of the usual Gaussian diffusion (and similarly Perona-Malik) in a small 3D volume containing the surface with an interpolation step. The method uses a closest point function to represent the underlying surface and can treat very general surfaces. Experimental results include image filtering on smooth surfaces, open surfaces, and general triangulated surfaces. © 2013 IEEE.
Hydrogen Diffusion and H{sub 2}S Corrosion in Steel
Energy Technology Data Exchange (ETDEWEB)
Haugstveit, Bjarte Erlend
2001-01-01
The electrochemical permeation technique introduced by Devanathan and Stachurski has been used to measure the effective diffusivity of hydrogen in steel in a H{sub 2}S-saturated aqueous environment. The linear polarization resistance (LPR) method has been used to measure the corrosion rate. The effective diffusion coefficient of hydrogen has been found to be in the range of 1*10-12 to 7*10-11, depending on the environmental conditions. The corrosion film was identified as mackinawite, and it affected the permeation process of hydrogen. The results supported the assumption that the diffusion process can be described by a three layer model and indicated that the model could be reduced to a two layer model in the cases of iron and steel. A model aimed to describe the reaction pathway of hydrogen through the surface film and into the steel is proposed. The corrosion film influenced the corrosion rate, and it was least protective against corrosion at pH 6.5. Corrosion rates were in the range of 0.2-1 mm/year. The corrosion rate was increased significantly at pH 3.5, but the effect of the surface film was stronger and overshadowed the pH effect at the higher pH values. Increased flow velocity also lead to increased corrosion rate, but this effect was less significant compared to the effect of pH and the surface film. DEG decreased the corrosion rate. The uncertainty in the diffusion measurements was mainly due to the assumption of a constant sub-surface concentration of atomic hydrogen, which was not fulfilled. A method less dependent on constant surface conditions would probably yield better estimates of the effective diffusivity. The uncertainty in the corrosion measurements was mainly due to the uncertainty in the value of the Stern-Geary constant. The qualitative assumptions based on the results in this thesis are assumed to be valid. A test section designed for this thesis was tested and was found successful in corrosion rate measurements, but proved to be
Surface activation of dyed fabric for cellulase treatment.
Schimper, Christian B; Ibanescu, Constanta; Bechtold, Thomas
2011-10-01
Surface activation of fabric made from cellulose fibres, such as viscose, lyocell, modal fibres and cotton, can be achieved by printing of a concentrated NaOH-containing paste. From the concentration of reducing sugars formed in solution, an increase in intensity of the cellulase hydrolysis by a factor of six to eight was observed, which was mainly concentrated at the activated parts of the fabric surface. This method of local activation is of particular interest for modification of materials that have been dyed with special processes to attain an uneven distribution of dyestuff within the yarn cross-section, e.g., indigo ring-dyed denim yarn for jeans production. Fabrics made from regenerated cellulose fibres were used as model substrate to express the effects of surface activation on indigo-dyed material. Wash-down experiments on indigo-dyed denim demonstrated significant colour removal from the activated surface at low overall weight loss of 4-5%. The method is of relevance for a more eco-friendly processing of jeans in the garment industry. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hydrogen isotope in erbium oxide: Adsorption, penetration, diffusion, and vacancy trapping
Energy Technology Data Exchange (ETDEWEB)
Mao, Wei, E-mail: mao@nuclear.jp [Department of Nuclear Engineering and Management, School of Engineering, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-8656 (Japan); The University Museum, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan); Chikada, Takumi [Department of Chemistry, Graduate School of Science, Shizuoka University, 836 Ohya, Suruga-ku, Shizuoka 422-8529 (Japan); Suzuki, Akihiro [Nuclear Professional School, School of Engineering, The University of Tokyo, 2-22, Shirakata-shirane, Tokai, Naka 319-1188, Ibaraki (Japan); Terai, Takayuki [Department of Nuclear Engineering and Management, School of Engineering, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-8656 (Japan); Matsuzaki, Hiroyuki [The University Museum, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan)
2015-03-15
Highlights: • H adsorption on cubic Er{sub 2}O{sub 3} surface results in electron transfer from H to the surface. • The H penetration energy of at least 1.6 eV is required for cubic Er{sub 2}O{sub 3} surface. • The dominated mechanisms of H diffusion in bulk Er{sub 2}O{sub 3} are elucidated. • H diffusion near or at vacancies in Er{sub 2}O{sub 3} is an exothermic reaction. - Abstract: In this study, we report results using first-principles density functional theory calculations for four critical aspects of the interaction: H adsorption on Er{sub 2}O{sub 3} surface, surface-to-subsurface penetration of H into Er{sub 2}O{sub 3}, bulk diffusion of H in Er{sub 2}O{sub 3}, and trapping of H at vacancies. We identify surface stable adsorption positions and find that H prefers to transfer electrons to the surfaces and form covalent bonds with the nearest neighboring four oxygen atoms. For low surface coverage of H as in our case (0.89 × 10{sup 14} H/cm{sup 2}), a penetration energy of at least 1.60 eV is required for cubic Er{sub 2}O{sub 3} surfaces. Further, the H diffusion barrier between the planes defined by Er{sub 2}O{sub 3} units along the favorable <1 1 1> direction is found to be very small – 0.16 eV – whereas higher barriers of 0.41 eV and 1.64 eV are required for diffusion across the planes, somewhat higher than the diffusion energy barrier of 0.20 eV observed experimentally at 873 K. In addition, we predict that interstitial H is exothermically trapped when it approaches a vacancy with the vacancy defect behaving as an electron trap since the H-vacancy defect is found to be more stable than the intrinsic defect.
International Nuclear Information System (INIS)
Nag, Manaswita; Guin, Debanjan; Basak, Pratyay; Manorama, Sunkara V.
2008-01-01
This article presents the synthesis of phase-pure rutile titania with different morphologies via hydrothermal method at significantly low temperatures (40-150 deg. C) without any additives and their application as efficient photocatalyst for environmental remediation. Phase and morphology has been determined with X-ray diffraction (XRD) and transmission electron microscopy (TEM). Ultra violet diffuse reflectance spectroscopy (UV-DRS) shows the optical band-gap in the range of ∼2.8-3.1 eV and Brunauer-Emmett-Teller specific surface area is found to be between 70 and 140 m 2 /g depending on the synthesis conditions. Raman spectroscopic analyses of the samples provide valuable insights into the structural and stoichiometric details. Photodegradation of the pollutant azo-dye, methyl orange (MO) in presence and absence of oxygen was performed to study the photocatalytic efficiency of the synthesized materials. Complete photodegradation of the dye is confirmed with high performance liquid chromatography (HPLC) and liquid chromatography-mass spectrometry (LC-MS) study. Dependence of dye photodegradation rate on morphology, specific surface area, surface nonstoichiometry and acidity were investigated in detail. Catalyst performance was compared from the rate constants obtained for each reaction using non-linear least square fitting (NLSF) to the experimental data in a concentration ratio (C 0 /C t ) versus time (t) plot which shows extraordinarily high activity for all samples compared to commercial reference. Among them the catalyst synthesized at 40 deg. C for 16 h showed best activity. Kinetic study of the reaction matches well with simulated fit to experimental data and confirms to be pseudo-first order reaction
Diffusive limits for linear transport equations
International Nuclear Information System (INIS)
Pomraning, G.C.
1992-01-01
The authors show that the Hibert and Chapman-Enskog asymptotic treatments that reduce the nonlinear Boltzmann equation to the Euler and Navier-Stokes fluid equations have analogs in linear transport theory. In this linear setting, these fluid limits are described by diffusion equations, involving familiar and less familiar diffusion coefficients. Because of the linearity extant, one can carry out explicitly the initial and boundary layer analyses required to obtain asymptotically consistent initial and boundary conditions for the diffusion equations. In particular, the effects of boundary curvature and boundary condition variation along the surface can be included in the boundary layer analysis. A brief review of heuristic (nonasymptotic) diffusion description derivations is also included in our discussion
Radiative heat exchange between surfaces
International Nuclear Information System (INIS)
Yener, Y.; Yuncu, H.
1987-01-01
The geometrical features of radiative heat exchange between surfaces are discussed first by developing various radiation shape factor relations. The governing equations for enclosures with diffusely emitting and diffusely reflecting surfaces, as well as the equations for enclosures with gray surfaces having specular component of reflectivity are introduced next. Finally, a simplified model for enclosures with isothermal surfaces under the assumption of uniform radiosity over the surfaces is discussed, and various working relations for different conditions are presented
Thin-source concentration dependent diffusion
International Nuclear Information System (INIS)
Eng, G.
1978-01-01
The diffusion of (Ca ++ ) in NaCl has been measured for various diffusion times and for the temperature range (575 0 to 775 0 C), using a thin-source of 45 Ca tracer, rectangular geometry, and serial sectioning. The pre-diffusion surface concentration was approximately 3 x 10 16 (Ca)-atoms/cm 2 , which, for an average penetration depth of 100 to 300 μm, produces a maximum (post-diffusion) impurity concentration comparable to or greater than the intrinsic cation vacancy concentration. The high-temperature function closely matches the D 0 (T) function obtained from low impurity concentration experiments. The lower-temperature function, combined with the sudden failure of the D(C) = D 0 (1 + [C] + 0.5[C] 2 ) function at these lower temperatures, indicates the onset of a second diffusion process, one which would operate only at extremely high impurity concentrations. This low-temperature behavior is shown to be consistent with a breakdown of the conditions assumed for vacancy equilibrium
Farrar, Danielle; Budson, Andrew E
2017-04-01
While the relationship between diffusion tensor imaging (DTI) measurements and training effects is explored by Voelker et al. (this issue), a cursory discussion of functional magnetic resonance imaging (fMRI) measurements categorizes increased activation with findings of greater white matter integrity. Evidence of the relationship between fMRI activation and white matter integrity is conflicting, as is the relationship between fMRI activation and training effects. An examination of the changes in fMRI activation in response to training is helpful, but the relationship between DTI and fMRI activation, particularly in the context of white matter changes, must be examined further before general conclusions can be drawn.
Study of the influence of surface-active substances on the initial stage of copper electrodeposition
Directory of Open Access Journals (Sweden)
Amantay Dalbanbay
2017-12-01
Full Text Available In this research, the effect of surface-active substances (CMC and DFP on the electrolysis of copper by cyclic voltammetry (CVA and chronoamperometric methods was studied. The working electrode was a glassy carbon electrode. Studies show that in the acid solution of copper sulfate (10-2 M CuSO4 + 0.5 M H2SO4, the three-dimensional electrochemical deposition of copper occurs by the mechanism of instantaneous nucleation. The added surface active substances affect the dischargeionization process, the standard electroreduction potential is shifted to the negative side. The added DFP reduces the cathodic peak current, and the addition of CMC results in its increase. At the deposition potentials corresponding to the regions up to the CVA peak current (here, still, the mixed electrodeposition kinetics, the number of nuclei formed is greater for a pure solution, but at current decay potentials, where the diffusion regime takes place, the nuclei population density (NPD is higher for solutions with surfactants. The most powerful effect here is caused by the addition of DFP. In the case of mixed additives, the NPD values are close to those of the CMC, obviously indicating the preferential adsorption of CMC, whereas the DFP as complexes with copper ions is closer to the near-electrode region.
International Nuclear Information System (INIS)
Tian, Ye; Jiang, Lianjun; Zhang, Xuejun; Deng, Yangbao; Deng, Shuguang
2014-01-01
We study the physical-vapor-deposition of 1D bismuth nanostructures. Bi nanowire elongating along [012] and/or [110] direction as well as anisotropic Bi nano-columns are physical-vapor-deposited successfully. The coexistence and competition of surface diffusion and geometric shielding are critical to their formation as well as growth mode transition among them. Since physical-vapor-deposition is a vacuum process, we make use of it to fabricate the ohmic contact to prevent the damage to the bismuth nanostructures brought by the etching to their thick surface oxide layer. (paper)
International Nuclear Information System (INIS)
Wei Suxia
1992-01-01
A method concerning selection of design parameters of diffusion barrier in a passive 222 Rn sampler based on activated charcoal adsorption. The proper parameter value of diffusion barrier is obtained by means of linearization of 222 Rn adsorption versus the exposure time. Thus, the influence of temperature on measured results may be greatly decreased, and higher sensitivity of the detector may be maintained
Interaction between diffusion and chemical stresses
International Nuclear Information System (INIS)
Yang Fuqian
2005-01-01
The present work studies the interaction between chemical stresses and diffusion. A new relation between hydrostatic stress and concentration of solute atoms is established. For a solid free of action of body force, the Laplacian of the hydrostatic stress is proportional to the Laplacian of the concentration of solute atoms, that is, deviation of the hydrostatic stress from its local average is proportional to deviation of the local concentration of solute atoms. A general relationship among surface concentration of solute atoms, normal stress and surface deformation of a solid is then derived, in which the normal stress is dependent on the mean curvature of the undeformed surface and tangential components of the surface displacement. A closed-form solution of the steady state concentration of solute atoms in a thin plate is obtained. It turns out that linear distribution of solute atoms in the plate is non-existent due to the interaction between chemical stresses and diffusion
Energy Technology Data Exchange (ETDEWEB)
Garcia-Gutierrez, M.; Alonso de los Rios, U.; Missana, T.; Cormenzana, J.L.; Mingarro, M.; Morejon, J.; Gil, P.
2008-08-06
The Opalinus Clay (OPA) formation in the Zurcher Weiland (Switzerland) is a potential host rock for a repository for high-level radioactive waste. Samples collected in the Mont Terri Underground Rock Laboratory (URL), where the OPA formation is located at a depth between -200 and -300 m below the surface, were used to study the radionuclide diffusion in clay materials. Classical laboratory essays and a novel experimental set-up for large-scale diffusion experiments were performed together to a novel application of the nuclear ion beam technique Rutherford Backscattering Spectrometry (RBS), to understand the transport properties of the OPA and to enhance the methodologies used for in situ diffusion experiments. Through-Diffusion and In-Diffusion conventional laboratory diffusion experiments were carried out with HTO, 36{sup C}l-, I-, 22{sup N}a, 75{sup S}e, 85{sup S}r, 233{sup U}, 137{sup C}s, 60{sup C}o and 152{sup E}u. Large-scale diffusion experiments were performed with HTO, 36{sup C}l, and 85{sup S}r, and new experiments with 60{sup C}o, 137{sup C}s and 152{sup E}u are ongoing. Diffusion experiments with RBS technique were done with Sr, Re, U and Eu. (Author) 38 refs.
Energy Technology Data Exchange (ETDEWEB)
Park, Soo Jin; Jang, Yu Sin [Advanced Materials Division., Korea Research Institute of Chimical Technology, Taejon (Korea)
2001-04-01
In this work, the effect of surface treatments on activated carbons (ACs) has been studied in the context of gas and liquid adsorption behaviors. The chemical solutions used in this experiment were 35% sodium hydroxide, and these were used for the acidic and basic treatments, respectively. The surface properties have been determined by pH, acid-base values, and FT-IR. The adsorption isotherms of Cr(VI) ion on activated carbons have been studied with the 5 mg/l concentration at ambient temperature. N{sub 2} adsorption isotherm characteristics, which include the specific surface area, micro pore volume, and microporosity, were determined by BET and Boer's-plot methods. In case of the acidic treatment of activated carbons, it was observed that the adsorption of Cr(VI) ion was more effective due to the increase acid value (or acidic functional group) of activated carbon surfaces. However, the basic treatment on activated carbons was caused no significant effects, probably due to the decreased specific surface area and total pore volume. 27 refs., 7 figs., 4 tabs.
Energy Technology Data Exchange (ETDEWEB)
Avila, R.E., E-mail: ravila@cchen.c [Departamento de Materiales Nucleares, Comision Chilena de Energia Nuclear, Cas. 188-D, Santiago (Chile); Pena, L.A.; Jimenez, J.C. [Departamento de Produccion y Servicios, Comision Chilena de Energia Nuclear, Cas. 188-D, Santiago (Chile)
2010-10-30
The release of tritium from Li{sub 2}TiO{sub 3} and Li{sub 2}ZrO{sub 3} pebbles, in batch experiments, is studied by means of temperature programmed desorption. Data reduction focuses on the analysis of the non-oxidized and oxidized tritium components in terms of release limited by diffusion from the bulk of ceramic grains, or by first or second order surface desorption. By analytical and numerical methods the in-furnace tritium release is deconvoluted from the ionization chamber transfer functions, for which a semi-empirical form is established. The release from Li{sub 2}TiO{sub 3} follows second order desorption kinetics, requiring a temperature for a residence time of 1 day (T{sub 1dRes}) of 620 K, and 603 K, of the non-oxidized, and the oxidized components, respectively. The release from Li{sub 2}ZrO{sub 3} appears as limited by either diffusion from the bulk of the ceramic grains, or by first order surface desorption, the first possibility being the more probable. The respective values of T{sub 1dRes} for the non-oxidized component are 661 K, according to the first order surface desorption model, and 735 K within the bulk diffusion limited model.
Peng, Yuhan; Geng, Zhigang; Zhao, Songtao; Wang, Liangbing; Li, Hongliang; Wang, Xu; Zheng, Xusheng; Zhu, Junfa; Li, Zhenyu; Si, Rui; Zeng, Jie
2018-06-13
Single-atom catalysts exhibit high selectivity in hydrogenation due to their isolated active sites, which ensure uniform adsorption configurations of substrate molecules. Compared with the achievement in catalytic selectivity, there is still a long way to go in exploiting the catalytic activity of single-atom catalysts. Herein, we developed highly active and selective catalysts in selective hydrogenation by embedding Pt single atoms in the surface of Ni nanocrystals (denoted as Pt 1 /Ni nanocrystals). During the hydrogenation of 3-nitrostyrene, the TOF numbers based on surface Pt atoms of Pt 1 /Ni nanocrystals reached ∼1800 h -1 under 3 atm of H 2 at 40 °C, much higher than that of Pt single atoms supported on active carbon, TiO 2 , SiO 2 , and ZSM-5. Mechanistic studies reveal that the remarkable activity of Pt 1 /Ni nanocrystals derived from sufficient hydrogen supply because of spontaneous dissociation of H 2 on both Pt and Ni atoms as well as facile diffusion of H atoms on Pt 1 /Ni nanocrystals. Moreover, the ensemble composed of the Pt single atom and nearby Ni atoms in Pt 1 /Ni nanocrystals leads to the adsorption configuration of 3-nitrostyrene favorable for the activation of nitro groups, accounting for the high selectivity for 3-vinylaniline.
Carroll, M. S.; Chang, C.-L.; Sturm, J. C.; Büyüklimanli, T.
1998-12-01
In this letter, we show the ability, through introduction of a thin Si1-x-yGexCy layer, to eliminate the enhancement of enhanced boron diffusion in silicon due to an oxidizing surface or ion implant damage. This reduction of diffusion is accomplished through a low-temperature-grown thin epitaxial Si1-x-yGexCy layer which completely filters out excess interstitials introduced by oxidation or ion implant damage. We also quantify the oxidation-enhanced diffusion (OED) and transient-enhanced diffusion (TED) dependence on substitutional carbon level, and further report both the observation of carbon TED and OED, and its dependence on carbon levels.
Directory of Open Access Journals (Sweden)
Xuefeng Zhang
2015-01-01
Full Text Available Sequential, adaptive, and gradient diffusion filters are implemented into spatial multiscale three-dimensional variational data assimilation (3DVAR as alternative schemes to model background error covariance matrix for the commonly used correction scale method, recursive filter method, and sequential 3DVAR. The gradient diffusion filter (GDF is verified by a two-dimensional sea surface temperature (SST assimilation experiment. Compared to the existing DF, the new GDF scheme shows a superior performance in the assimilation experiment due to its success in extracting the spatial multiscale information. The GDF can retrieve successfully the longwave information over the whole analysis domain and the shortwave information over data-dense regions. After that, a perfect twin data assimilation experiment framework is designed to study the effect of the GDF on the state estimation based on an intermediate coupled model. In this framework, the assimilation model is subject to “biased” initial fields from the “truth” model. While the GDF reduces the model bias in general, it can enhance the accuracy of the state estimation in the region that the observations are removed, especially in the South Ocean. In addition, the higher forecast skill can be obtained through the better initial state fields produced by the GDF.
Study of cation diffusion in Zn O using 65Zn as radioactive tracer
International Nuclear Information System (INIS)
Ferraz, Wilmar B.; Correa, Ricardo F.; Nogueira, Maria A.N.; Ramos, Marcelo; Sabioni, Antonio C.S.
2000-01-01
Zinc self-diffusion coefficient were measured in polycrystalline Zn O of high purity (99,999%) prepared by conventional sintering at 1393 deg C, 4 h, in oxygen atmosphere. The Zn O samples had high density (>99% of the theoretical density) and grain size of 20 μm. These samples were resintered for 72 h at 1400 deg C in order to increase the grain-size higher than 50 μ m. Samples of 15 x 15 x 2 mm 3 were polished with diamond paste, and pre-annealed under the same conditions of temperature and atmosphere of the diffusion annealing. A thin film of 65 Zn - radioactive tracer - applied to the polished surface was oxidized in oxygen atmosphere for a short time before diffusion annealing. The diffusion experiments were performed between 1002 and 1201 deg C in oxygen atmosphere. The 65 Zn diffusion profiles were measured by sectioning in conjunction with residual-activity measurements. The results of the determination of the zinc in Zn O diffusion coefficients in function of temperature are presented and a comparison of these results obtained by the two radioactive method is showed. (author)
Magnetoresistance of films and strips with the diffuse surface scattering
International Nuclear Information System (INIS)
Aronov, A.G.
1993-08-01
Magnetoresistance of films in a parallel magnetic field and strips in a perpendicular field is considered. The temperature and magnetic field dependencies of magnetoconductance depend on the time evolution of the correlator of phases. This correlator has different behavior as the function of time: the ergodic behavior at small magnetic fields is changed on the nonergodic one at large magnetic fields in spite of the diffusion electron motion due to a diffuse scattering on boundaries. This leads to unusual temperature and magnetic field dependencies of magnetoresistance. The ergodic hypothesis is not applicable to mesoscopical fluctuations at such a large quasiclassical field. (author). 6 refs, 5 figs
Transient diffusion from a waste solid into fractured porous rock
International Nuclear Information System (INIS)
Ahn, J.; Chambre, P.L.; Pigford, T.H.
1988-01-01
Previous analytical studies of the advective transport of dissolved contaminants through fractured rock have emphasized the effect of molecular diffusion in the rock matrix in affecting the space-time-dependent concentration of the contaminant as it moves along the fracture. Matrix diffusion only in the direction normal to the fracture surface was assumed. Contaminant sources were constant-concentration surfaces of width equal to the fracture aperture and of finite or infinite extent in the transverse direction. Such studies illustrate the far-field transport features of fractured media. To predict the time-dependent mass transfer from a long waste cylinder surrounded by porous rock and intersected by a fracture, the present study includes diffusion from the waste surface directly into porous rock, as well as the more realistic geometry. Here the authors present numerical results from Chambre's analytical solution for the time-dependent mass transfer from the cylinder for the low-flow conditions wherein near-field mass transfer is expected to be controlled by molecular diffusion
Zhang, Fang
2011-08-01
Activated carbon (AC) air-cathodes are inexpensive and useful alternatives to Pt-catalyzed electrodes in microbial fuel cells (MFCs), but information is needed on their long-term stability for oxygen reduction. AC cathodes were constructed with diffusion layers (DLs) with two different porosities (30% and 70%) to evaluate the effects of increased oxygen transfer on power. The 70% DL cathode initially produced a maximum power density of 1214±123mW/m 2 (cathode projected surface area; 35±4W/m 3 based on liquid volume), but it decreased by 40% after 1 year to 734±18mW/m 2. The 30% DL cathode initially produced less power than the 70% DL cathode, but it only decreased by 22% after 1 year (from 1014±2mW/m 2 to 789±68mW/m 2). Electrochemical tests were used to examine the reasons for the degraded performance. Diffusion resistance in the cathode was found to be the primary component of the internal resistance, and it increased over time. Replacing the cathode after 1 year completely restored the original power densities. These results suggest that the degradation in cathode performance was due to clogging of the AC micropores. These findings show that AC is a cost-effective material for oxygen reduction that can still produce ~750mW/m 2 after 1 year. © 2011 Elsevier B.V.
Ling, Hangjian; Katz, Joseph; Fu, Matthew; Hultmark, Marcus
2017-12-01
This experimental study investigates the effects of ambient pressure and Reynolds number on the volume of a plastron in a superhydrophobic surface (SHS) due to compression and gas diffusion. The hierarchical SHS consists of nanotextured, ˜100 μm wide spanwise grooves. Microscopic observations measure the time evolution of interface height and contact angle. The water tunnel tests are performed both without flow as well as in transitional and turbulent boundary layers at several Reynolds numbers. Particle image velocimetry is used for estimating the wall shear stress and calculating the momentum thickness for the SHSs under Cassie-Baxter (CB) and Wenzel states as well as a smooth wall at the same conditions. Holographic microscopy is used for determining the wall shear stress directly for one of the CB cases. The mass diffusion rate is calculated from changes to the plastron volume when the liquid is under- or supersaturated. For stationary water, the mass diffusion is slow. With increasing pressure, the interface is initially pinned and then migrates into the groove with high advancing contact angle. Upon subsequent decrease in pressure, the interface migrates upward at a shallow angle and, after being pinned to the tip corner, becomes convex. With flow and exposure to undersaturated liquid, the diffusion-induced wetting also involves pinned and downward migration states, followed by shrinkage of the plastron until it decreases below the resolution limit. The corresponding changes to the velocity profile indicate a transition from slight drag reduction to significant drag increase. In supersaturated water starting at a Wenzel state, a bubble grows from one of the bottom corners until it reaches the other side of the groove. Subsequently, dewetting involves upward migration of the interface, pinning to the tip corners, and formation of a convex interface. The diffusion rate increases with the level of under- or supersaturation and with the Reynolds number. A power
Energy Technology Data Exchange (ETDEWEB)
Brogaard Kristensen, S
2000-06-01
This report describes the work done on modelling and simulation of the complex diffusion of gas through the wall of a flexible pipe. The diffusion and thus the pressure in annulus depends strongly on the diffusion and solubility parameters of the gas-polymer system and on the degree of blocking of the outer surface of the inner liner due to pressure reinforcements. The report evaluates the basis modelling required to describe the complex geometries and flow patterns. Qualitatively results of temperature and concentration profiles are shown in the report. For the program to serve any modelling purpose in 'real life' the results need to be validated and possibly the model needs corrections. Hopefully, a full-scale test of a flexible pipe will provide the required temperatures and pressures in annulus to validate the models. (EHS)
García-Hernández, Rubén; Melián, Gladys; D'Auria, Luca; Asensio-Ramos, María; Alonso, Mar; Padilla, Germán D.; Rodríguez, Fátima; Padrón, Eleazar; Barrancos, José; García-Merino, Marta; Amonte, Cecilia; Pérez, Aarón; Calvo, David; Hernández, Pedro A.; Pérez, Nemesio M.
2017-04-01
Tenerife (2034 km2) is the largest of the Canary Islands and hosts four main active volcanic edifices: three volcanic rifts and a central volcanic complex, Las Cañadas, which is characterized by the eruption of differentiated magmas. Laying inside Las Cañadas a twin stratovolcanoes system, Pico Viejo and Teide, has been developed. Although there are no visible gas emanations along the volcanic rifts of Tenerife, the existence of a volcanic-hydrothermal system beneath Teide volcano is suggested by the occurrence of a weak fumarolic system, steamy ground and high rates of diffuse CO2 degassing all around the summit cone of Teide. Soil CO2 efflux surveys have been performed at the summit crater of Teide volcano since 1999, to determine the diffuse CO2 emission from the summit crater and to evaluate the temporal variations of CO2 efflux and their relationships with seismic-volcanic activity. Soil CO2 efflux and soil temperature have been always measured at the same 38 observation sites homogeneously distributed within an area of about 6,972 m2 inside the summit crater. Soil CO2 diffuse effluxes were estimated according to the accumulation chamber method by means of a non-dispersive infrared (NDIR) LICOR-820 CO2 analyzer. Historical seismic activity in Tenerife has been characterized by low- to moderate-magnitude events (M de Canarias (INVOLCAN) registered an earthquake of M 2.5 located in the vertical of Teide volcano with a depth of 6.6 km. It was the strongest earthquake located inside Cañadas caldera since 2004. Between October 11 and December 13, 2016, a continuous increase on the diffuse CO2 emission was registered, from 21.3 ± 2.0 to 101.7 ± 20.7 t d-1, suggesting the occurrence of future increase in the seismic-volcanic activity. In fact, this precursory signal preceded the occurrence of the 2.5 seismic event and no significant horizontal and vertical displacements were registered by the Canary GPS network belonged to INVOLCAN. This seismic event was
Literature survey of matrix diffusion theory and of experiments and data including natural analogues
International Nuclear Information System (INIS)
Ohlsson, Yvonne; Neretnieks, I.
1995-08-01
Diffusion theory in general and matrix diffusion in particular has been outlined, and experimental work has been reviewed. Literature diffusion data has been systematized in the form of tables and data has been compared and discussed. Strong indications of surface diffusion and anion exclusion have been found, and natural analogue studies and in-situ experiments suggest pore connectivity in the scale of meters. Matrix diffusion, however, mostly seem to be confined to zones of higher porosity extending only a few centimeters into the rock. Surface coating material do not seem to hinder sorption or diffusion into the rock. 54 refs, 18 tabs
International Nuclear Information System (INIS)
Kostela, J.; Elmgren, M.; Almgren, M.
2005-01-01
The objective of this study was to investigate the electrochemical behaviour of the divalent redox active surfactant, N-cetyl-N'-methylviologen (CMV), in bicontinuous cubic and lamellar phases. The liquid crystalline phases were prepared from the system glycerolmonooleate (GMO)-water (and brine)-cationic surfactant. A comparison of the phase behaviour of GMO with the monovalent cetyltrimethylammonium bromide (CTAB) and the divalent CMV surfactant showed that the surfactants gave about the same effect at the same surface charge density. The electrochemical measurements were made with a mixture of CTAB and CMV as the surfactant. Cyclic voltammetry was used to study the electrochemistry of CMV incorporated in the cubic and lamellar phases that were spread on a gold electrode. The E 0 -values in the cubic samples were more negative (-0.55 V versus SCE) than in the lamellar samples (-0.53 V versus SCE). This can be explained by the higher charge density in the lamellar phase. The diffusion coefficients were also measured in the cubic phase. The mass transport is slowed down about fifty times in the cubic phase compared to in the pure electrolyte. The concentration dependence on the diffusion coefficient was also investigated. No electron hopping could be observed, which suggest that diffusional movement of the redox probe is the main source of charge transport. By placing the samples on a conducting glass slide, spectroelectrochemical investigations were performed. In the lamellar phase strong dimerization was detected at high concentration of viologen, but much less in the cubic phase
Energy Technology Data Exchange (ETDEWEB)
Kostela, J. [Uppsala University, Department of Physical Chemistry, Box 579, S-75123 Uppsala (Sweden)]. E-mail: johan.kostela@fki.uu.se; Elmgren, M. [Uppsala University, Department of Physical Chemistry, Box 579, S-75123 Uppsala (Sweden); Almgren, M. [Uppsala University, Department of Physical Chemistry, Box 579, S-75123 Uppsala (Sweden)
2005-05-30
The objective of this study was to investigate the electrochemical behaviour of the divalent redox active surfactant, N-cetyl-N'-methylviologen (CMV), in bicontinuous cubic and lamellar phases. The liquid crystalline phases were prepared from the system glycerolmonooleate (GMO)-water (and brine)-cationic surfactant. A comparison of the phase behaviour of GMO with the monovalent cetyltrimethylammonium bromide (CTAB) and the divalent CMV surfactant showed that the surfactants gave about the same effect at the same surface charge density. The electrochemical measurements were made with a mixture of CTAB and CMV as the surfactant. Cyclic voltammetry was used to study the electrochemistry of CMV incorporated in the cubic and lamellar phases that were spread on a gold electrode. The E {sup 0}-values in the cubic samples were more negative (-0.55 V versus SCE) than in the lamellar samples (-0.53 V versus SCE). This can be explained by the higher charge density in the lamellar phase. The diffusion coefficients were also measured in the cubic phase. The mass transport is slowed down about fifty times in the cubic phase compared to in the pure electrolyte. The concentration dependence on the diffusion coefficient was also investigated. No electron hopping could be observed, which suggest that diffusional movement of the redox probe is the main source of charge transport. By placing the samples on a conducting glass slide, spectroelectrochemical investigations were performed. In the lamellar phase strong dimerization was detected at high concentration of viologen, but much less in the cubic phase.
Fibroblast adhesion and activation onto micro-machined titanium surfaces.
Guillem-Marti, J; Delgado, L; Godoy-Gallardo, M; Pegueroles, M; Herrero, M; Gil, F J
2013-07-01
Surface modifications performed at the neck of dental implants, in the manner of micro-grooved surfaces, can reduce fibrous tissue encapsulation and prevent bacterial colonization, thereby improving fibrointegration and the formation of a biological seal. However, the applied procedures are technically complex and/or time consuming methods. The aim of this study was to analyse the fibroblast behaviour on modified titanium surfaces obtained, applying a simple and low-cost method. An array of titanium surfaces was obtained using a commercial computerized numerical control lathe, modifying the feed rate and the cutting depth. To elucidate the potential ability of the generated surfaces to activate connective tissue cells, a thorough gene (by real time - qPCR) and protein (by western blot or zymography) expression and cellular response characterization (cell morphology, cell adhesion and cell activation by secreting extracellular matrix (ECM) components and their enzyme regulators) was performed. Micro-grooved surfaces have statistically significant differences in the groove's width (approximately 10, 50 and 100 μm) depending on the applied advancing fixed speed. Field emission scanning electron microscopy images showed that fibroblasts oriented along the generated grooves, but they were only entirely accommodated on the wider grooves (≥50 μm). Micro-grooved surfaces exhibited an earlier cell attachment and activation, as seen by collagen Iα1 and fibronectin deposition and activation of ECM remodelling enzymes, compared with the other surfaces. However, fibroblasts could remain in an activated state on narrower surfaces (fibrotic response. © 2012 John Wiley & Sons A/S.
Directory of Open Access Journals (Sweden)
Murat Kuscu
Full Text Available We consider a microfluidic molecular communication (MC system, where the concentration-encoded molecular messages are transported via fluid flow-induced convection and diffusion, and detected by a surface-based MC receiver with ligand receptors placed at the bottom of the microfluidic channel. The overall system is a convection-diffusion-reaction system that can only be solved by numerical methods, e.g., finite element analysis (FEA. However, analytical models are key for the information and communication technology (ICT, as they enable an optimisation framework to develop advanced communication techniques, such as optimum detection methods and reliable transmission schemes. In this direction, we develop an analytical model to approximate the expected time course of bound receptor concentration, i.e., the received signal used to decode the transmitted messages. The model obviates the need for computationally expensive numerical methods by capturing the nonlinearities caused by laminar flow resulting in parabolic velocity profile, and finite number of ligand receptors leading to receiver saturation. The model also captures the effects of reactive surface depletion layer resulting from the mass transport limitations and moving reaction boundary originated from the passage of finite-duration molecular concentration pulse over the receiver surface. Based on the proposed model, we derive closed form analytical expressions that approximate the received pulse width, pulse delay and pulse amplitude, which can be used to optimize the system from an ICT perspective. We evaluate the accuracy of the proposed model by comparing model-based analytical results to the numerical results obtained by solving the exact system model with COMSOL Multiphysics.
Kuscu, Murat; Akan, Ozgur B
2018-01-01
We consider a microfluidic molecular communication (MC) system, where the concentration-encoded molecular messages are transported via fluid flow-induced convection and diffusion, and detected by a surface-based MC receiver with ligand receptors placed at the bottom of the microfluidic channel. The overall system is a convection-diffusion-reaction system that can only be solved by numerical methods, e.g., finite element analysis (FEA). However, analytical models are key for the information and communication technology (ICT), as they enable an optimisation framework to develop advanced communication techniques, such as optimum detection methods and reliable transmission schemes. In this direction, we develop an analytical model to approximate the expected time course of bound receptor concentration, i.e., the received signal used to decode the transmitted messages. The model obviates the need for computationally expensive numerical methods by capturing the nonlinearities caused by laminar flow resulting in parabolic velocity profile, and finite number of ligand receptors leading to receiver saturation. The model also captures the effects of reactive surface depletion layer resulting from the mass transport limitations and moving reaction boundary originated from the passage of finite-duration molecular concentration pulse over the receiver surface. Based on the proposed model, we derive closed form analytical expressions that approximate the received pulse width, pulse delay and pulse amplitude, which can be used to optimize the system from an ICT perspective. We evaluate the accuracy of the proposed model by comparing model-based analytical results to the numerical results obtained by solving the exact system model with COMSOL Multiphysics.
International Nuclear Information System (INIS)
Lai, King C.; Liu, Da-Jiang; Evans, James W.
2017-01-01
For diffusion of two-dimensional homoepitaxial clusters of N atoms on metal(100) surfaces mediated by edge atom hopping, macroscale continuum theory suggests that the diffusion coefficient scales like DN ~ N -β with β = 3/2. However, we find quite different and diverse behavior in multiple size regimes. These include: (i) facile diffusion for small sizes N < 9; (ii) slow nucleation-mediated diffusion with small β < 1 for “perfect” sizes N = N p = L 2 or L(L+1), for L = 3, 4,… having unique ground state shapes, for moderate sizes 9 ≤ N ≤ O(10 2 ); the same also applies for N = N p +3, N p + 4,… (iii) facile diffusion but with large β > 2 for N = Np + 1 and N p + 2 also for moderate sizes 9 ≤ N ≤ O(10 2 ); (iv) merging of the above distinct branches and subsequent anomalous scaling with 1 ≲ β < 3/2, reflecting the quasi-facetted structure of clusters, for larger N = O(10 2 ) to N = O(10 3 ); and (v) classic scaling with β = 3/2 for very large N = O(103) and above. The specified size ranges apply for typical model parameters. We focus on the moderate size regime where show that diffusivity cycles quasi-periodically from the slowest branch for N p + 3 (not Np) to the fastest branch for Np + 1. Behavior is quantified by Kinetic Monte Carlo simulation of an appropriate stochastic lattice-gas model. However, precise analysis must account for a strong enhancement of diffusivity for short time increments due to back-correlation in the cluster motion. Further understanding of this enhancement, of anomalous size scaling behavior, and of the merging of various branches, is facilitated by combinatorial analysis of the number of the ground state and low-lying excited state cluster configurations, and also of kink populations.
Energy Technology Data Exchange (ETDEWEB)
Bhati, Surendra; Mahur, J. S.; Choubey, O. N. [Barkatullah Univ., Bhopal (India); Dixit, Mahur Savita [Maulana Azad National Institute of Technology, Bhopla (India)
2013-02-15
In this study, activated carbon fabric was prepared from a cellulose-based polymer (viscose rayon) via a combination of physical and chemical activation (mixed activation) processes by means of CO{sub 2} as a gasifying agent and surface and adsorption properties were evaluated. Experiments were performed to investigate the consequence of activation temperature (750, 800, 850 and 925 .deg. C), activation time (15, 30, 45 and 60 minutes) and CO{sub 2} flow rate (100, 200, 300 and 400 mL/min) on the surface and adsorption properties of ACF. The nitrogen adsorption isotherm at 77 K was measured and used for the determination of surface area, total pore volume, micropore volume, mesopore volume and pore size distribution using BET, t-plot, DR, BJH and DFT methods, respectively. It was observed that BET surface area and TPV increase with rising activation temperature and time due to the formation of new pores and the alteration of micropores into mesopores. It was also found that activation temperature dominantly affects the surface properties of ACF. The adsorption of iodine and CCl{sub 4} onto ACF was investigated and both were found to correlate with surface area.
International Nuclear Information System (INIS)
Bhati, Surendra; Mahur, J. S.; Choubey, O. N.; Dixit, Mahur Savita
2013-01-01
In this study, activated carbon fabric was prepared from a cellulose-based polymer (viscose rayon) via a combination of physical and chemical activation (mixed activation) processes by means of CO 2 as a gasifying agent and surface and adsorption properties were evaluated. Experiments were performed to investigate the consequence of activation temperature (750, 800, 850 and 925 .deg. C), activation time (15, 30, 45 and 60 minutes) and CO 2 flow rate (100, 200, 300 and 400 mL/min) on the surface and adsorption properties of ACF. The nitrogen adsorption isotherm at 77 K was measured and used for the determination of surface area, total pore volume, micropore volume, mesopore volume and pore size distribution using BET, t-plot, DR, BJH and DFT methods, respectively. It was observed that BET surface area and TPV increase with rising activation temperature and time due to the formation of new pores and the alteration of micropores into mesopores. It was also found that activation temperature dominantly affects the surface properties of ACF. The adsorption of iodine and CCl 4 onto ACF was investigated and both were found to correlate with surface area
Schultz Moreira, Adriana R; Garcimartín, Alba; Bastida, Sara; Jiménez-Escrig, Antonio; Rupérez, Pilar; Green, Brian D; Rafferty, Eamon; Sánchez-Muniz, Francisco J; Benedí, Juana
2014-06-01
Seaweeds are good sources of dietary fibre, which can influence glucose uptake and glycemic control. To investigate and compare the in vitro inhibitory activity of different extracts from Undaria pinnatifida (Wakame), Himanthalia elongata (Sea spaghetti) and Porphyra umbilicalis (Nori) on α-glucosidase activity and glucose diffusion. The in vitro effects Chloroform-, ethanol- and water-soluble extracts of the three algae were assayed on α- glucosidase activity and glucose diffusion through membrane. Principal Components Analysis (PCA) was applied to identify patterns in the data and to discriminate which extract will show the most proper effect. Only water extracts of Sea spaghetti possessed significant in vitro inhibitory effects on α-glucosidase activity (26.2% less mmol/L glucose production than control, p < 0.05) at 75 min. PCA distinguished Sea spaghetti effects, supporting that soluble fibre and polyphenols were involved. After 6 h, Ethanol-Sea spaghetti and water-Wakame extracts exerted the highest inhibitory effects on glucose diffusion (65.0% and 60.2% vs control, respectively). This extracts displayed the lowest slopes for glucose diffusion-time lineal adjustments (68.2% and 62.8% vs control, respectively). The seaweed hypoglycemic effects appear multi-faceted and not necessarily concatenated. According to present results, ethanol and water extracts of Sea spaghetti, and water extracts of Wakame could be useful for the development of functional foods with specific hypoglycemic properties. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.
Diffusion characteristics in the Cu-Ti system
Energy Technology Data Exchange (ETDEWEB)
Laik, Arijit; Kale, Gajanan Balaji [Bhabha Atomic Reseach Centre, Mumbai (India). Materials Science Div.; Bhanumurthy, Karanam [Bhabha Atomic Reseach Centre, Mumbai (India). Scientific Information Resource Div.; Kashyap, Bhagwati Prasad [Indian Institute of Technology Bombay, Mumbai (India). Dept. of Metallurgical Engineering
2012-06-15
The formation and growth of intermetallic compounds by diffusion reaction of Cu and Ti were investigated in the temperature range 720 - 860 C using bulk diffusion couples. Only four, out of the seven stable intermediate compounds of the Cu-Ti system, were formed in the diffusion reaction zone in the sequence CuTi, Cu{sub 4}Ti, Cu{sub 4}Ti{sub 3} and CuTi{sub 2}. The activation energies required for the growth of these compounds were determined. The diffusion characteristics of Cu{sub 4}Ti, CuTi and Cu{sub 4}Ti{sub 3} and Cu(Ti) solid solution were evaluated. The activation energies for diffusion in these compounds were 192.2, 187.7 and 209.2 kJ mol{sup -1} respectively, while in Cu(Ti), the activation energy increased linearly from 201.0 kJ mol{sup -1} to 247.5 kJ mol{sup -1} with increasing concentration of Ti, in the range 0.5 - 4.0 at.%. The impurity diffusion coefficient of Ti in Cu and its temperature dependence were also estimated. A correlation between the impurity diffusion parameters for several elements in Cu matrix has been established. (orig.)
A coupled theory for chemically active and deformable solids with mass diffusion and heat conduction
Zhang, Xiaolong; Zhong, Zheng
2017-10-01
To analyse the frequently encountered thermo-chemo-mechanical problems in chemically active material applications, we develop a thermodynamically-consistent continuum theory of coupled deformation, mass diffusion, heat conduction and chemical reaction. Basic balance equations of force, mass and energy are presented at first, and then fully coupled constitutive laws interpreting multi-field interactions and evolving equations governing irreversible fluxes are constructed according to the energy dissipation inequality and the chemical kinetics. To consider the essential distinction between mass diffusion and chemical reactions in affecting free energy and dissipations of a highly coupled system, we regard both the concentrations of diffusive species and the extent of reaction as independent state variables. This new formulation then distinguishes between the energy contribution from the diffusive species entering the solid and that from the subsequent chemical reactions occurring among these species and the host solid, which not only interact with stresses or strains in different manners and on different time scales, but also induce different variations of solid microstructures and material properties. Taking advantage of this new description, we further establish a specialized isothermal model to predict precisely the transient chemo-mechanical response of a swelling solid with a proposed volumetric constraint that accounts for material incompressibility. Coupled kinetics is incorporated to capture the volumetric swelling of the solid caused by imbibition of external species and the simultaneous dilation arised from chemical reactions between the diffusing species and the solid. The model is then exemplified with two numerical examples of transient swelling accompanied by chemical reaction. Various ratios of characteristic times of diffusion and chemical reaction are taken into account to shed light on the dependency on kinetic time scales of evolution patterns for
Diffusion of water into SU-8 microcantilevers
DEFF Research Database (Denmark)
Liu, C.J.; Liu, Y.; Sokuler, M.
2010-01-01
We present a method to monitor the diffusion of liquid molecules in polymers. A microdrop of water is deposited by a piezoelectric drop generator onto the upper surface of a cantilever made of SU-8 based photoresist. In response, the cantilever bends in the opposite direction. We find...... sophisticated finite element model the diffusion coefficient of water in the SU-8 polymer can be determined quantitatively from the dynamics of cantilever bending....... that this bending is mainly caused by the diffusion of water into the cantilever and the consequent swelling of SU-8. Using a one-dimensional diffusion model and assuming a simple swelling law, we qualitatively model the bending of the cantilever during in and out diffusion of water in SU-8. With a more...