WorldWideScience

Sample records for actinomycetes 5s rrnas

  1. Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.

    Science.gov (United States)

    Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S

    1984-01-01

    Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981

  2. The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

    Science.gov (United States)

    Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

    1982-11-11

    The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

  3. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.

    Science.gov (United States)

    Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz

    2014-12-16

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Identifying small RNAs derived from maternal- and somatic-type rRNAs in zebrafish development.

    Science.gov (United States)

    Locati, Mauro D; Pagano, Johanna F B; Abdullah, Farah; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Spaink, Herman P; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

    2018-02-09

    rRNAs are non-coding RNAs present in all prokaryotes and eukaryotes. In eukaryotes there are four rRNAs: 18S, 5.8S, 28S, originating from a common precursor (45S), and 5S. We have recently discovered the existence of two distinct developmental types of rRNA: a maternal-type, present in eggs and a somatic-type, expressed in adult tissues. Lately, next-generation sequencing has allowed the discovery of new small-RNAs deriving from longer non-coding RNAs, including small-RNAs from rRNAs (srRNAs). Here, we systemically investigated srRNAs of maternal- or somatic-type 18S, 5.8S, 28S, with small-RNAseq from many zebrafish developmental stages. We identified new srRNAs for each rRNA. For 5.8S, we found srRNA consisting of the 5' or 3' halves, with only the latter having different sequence for the maternal- and somatic-types. For 18S, we discovered 21 nt srRNA from the 5' end of the 18S rRNA with a striking resemblance to microRNAs; as it is likely processed from a stem-loop precursor and present in human and mouse Argonaute-complexed small-RNA. For 28S, an abundant 80 nt srRNA from the 3' end of the 28S rRNA was found. The expression levels during embryogenesis of these srRNA indicate they are not generated from rRNA degradation and might have a role in the zebrafish development.

  5. Quantification of 16S rRNAs in complex bacterial communities by multiple competitive reverse transcription-PCR in temperature gradient gel electrophoresis fingerprints.

    Science.gov (United States)

    Felske, A; Akkermans, A D; De Vos, W M

    1998-11-01

    A novel approach was developed to quantify rRNA sequences in complex bacterial communities. The main bacterial 16S rRNAs in Drentse A grassland soils (The Netherlands) were amplified by reverse transcription (RT)-PCR with bacterium-specific primers and were separated by temperature gradient gel electrophoresis (TGGE). The primer pair used (primers U968-GC and L1401) was found to amplify with the same efficiency 16S rRNAs from bacterial cultures containing different taxa and cloned 16S ribosomal DNA amplicons from uncultured soil bacteria. The sequence-specific efficiency of amplification was determined by monitoring the amplification kinetics by kinetic PCR. The primer-specific amplification efficiency was assessed by competitive PCR and RT-PCR, and identical input amounts of different 16S rRNAs resulted in identical amplicon yields. The sequence-specific detection system used for competitive amplifications was TGGE, which also has been found to be suitable for simultaneous quantification of more than one sequence. We demonstrate that this approach can be applied to TGGE fingerprints of soil bacteria to estimate the ratios of the bacterial 16S rRNAs.

  6. Interaction of higher plant ribosomal 5S RNAs with ''Xenopus laevis'' transcriptional factor IIIA

    International Nuclear Information System (INIS)

    Barciszewska, M.Z.

    1994-01-01

    In this paper transcriptional factor IIIA (TFIIIA) has been used as a probe for identity of three-dimensional-structure of eukaryotic 5S rRNAs. I was interested in finding a common motif in plant and ''Xenopus'' 5S rRNAs for TFIIIA recognition. I found that the two eukaryotic 5S rRNAs (from wheat germ and lupin seeds) are recognized by ''X. laevis'' TFIIIA and the data clearly suggest that these 5S rRNAs have very similar if not identical three-dimensional structures. Also effects of various conditions on stability of these complexes have been studied. (author). 30 refs, 6 figs, 1 tab

  7. Isolation, identification and antagonistic activity evaluation of actinomycetes in barks of nine trees

    Directory of Open Access Journals (Sweden)

    Wang Dong-sheng

    2017-01-01

    Full Text Available Actinomycetes are important producers of novel bioactive compounds. New sources need to be explored for isolating previously unknown bioactive compound-producing actinomycetes. Here we evaluated the potential of bark as a natural source of novel bioactive actinomycete species. Bark samples were collected from nine tree species at different elevations (1600-3400 ma.s.l. on Qin Mountain, Shaanxi Province, China. Actinomycetes were cultivated, enumerated and isolated using serial dilution and spread-plate techniques. The antimicrobial activity of actinomycete isolates was analyzed using an agar block method against 15 typical bacterial and fungal species and plant pathogens. The dominant isolates were identified by 16S rRNA-based sequence analysis. Results showed that actinomycete counts in bark samples of Quercus liaotungensis Koidz. was the highest among all trees species tested. The numbers of actinomycete species in bark samples were highest in Q. aliena var. acutiserrata and Spiraea alpina Pall. Antagonistic activity wasdetected in approximately 54% of the actinomycete isolates. Of these, 20 isolates (25% showed broad-spectrum antagonistic activity against ≥5 of the microorganisms tested. In conclusion, the bark on coniferous and broadleaf trees possesses a high diversity of actinomycetes and serves as a natural source of bioactive compound-producing actinomycetes.

  8. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    Science.gov (United States)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  9. 5S ribosomal RNA database Y2K.

    Science.gov (United States)

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  10. Bioprospecting marine actinomycetes for multidrug-resistant pathogen control from Rameswaram coastal area, Tamil Nadu, India.

    Science.gov (United States)

    Wahaab, Femina; Subramaniam, Kalidass

    2018-01-01

    A potent Streptomyces bacillaris strain RAM25C4 was isolated for controlling methicillin-resistant Staphylococcus aureus and multidrug-resistant bacteria such as Staphylococcus aureus, Acinetobacter baumannii, and Pseudomonas aeruginosa. A total of 131 actinomycetes were isolated from the Rameswaram coastal region, Tamil Nadu, India. Among 131 actinomycetes, maximum number of actinomycetes (55%) isolated at the distance of 3-6 m from seashore. Out of 131 actinomycetes, 85% of the actinomycetes exhibited different degree of antagonistic activity against test pathogens. The antagonistic activity evaluated using actinomycetes direct culture filtrate and culture filtrate extracts. Among these culture filtrate, extracts had supreme antagonistic activity against multidrug-resistant bacteria and the solvent ethyl acetate was the best for extracting secondary metabolites from actinomycetes. In HPTLC analysis, the presence of macrolides, terpenoids, and quinolones was identified in RAM25C4 extract. In GC-MS analysis, various potent compounds such as phenolic compound-2,6-di-tert-butylphenol, alkaloid compound-1H, 5H, pyrrolo (1' 2':3, 4) imidazo, and quinolone compound-1,4-benzenediol, 2,5-bis(1,1-dimethylethyl) were identified in the ethyl acetate extract of RAM25C4. The phylogenetic analysis of 16S rRNA gene sequence of RAM25C4 isolate was deposited in NCBI with name Streptomyces bacillaris strain RAM25C4 and accession number KM513543.

  11. Secondary structures of rRNAs from all three domains of life.

    Directory of Open Access Journals (Sweden)

    Anton S Petrov

    Full Text Available Accurate secondary structures are important for understanding ribosomes, which are extremely large and highly complex. Using 3D structures of ribosomes as input, we have revised and corrected traditional secondary (2° structures of rRNAs. We identify helices by specific geometric and molecular interaction criteria, not by co-variation. The structural approach allows us to incorporate non-canonical base pairs on parity with Watson-Crick base pairs. The resulting rRNA 2° structures are up-to-date and consistent with three-dimensional structures, and are information-rich. These 2° structures are relatively simple to understand and are amenable to reproduction and modification by end-users. The 2° structures made available here broadly sample the phylogenetic tree and are mapped with a variety of data related to molecular interactions and geometry, phylogeny and evolution. We have generated 2° structures for both large subunit (LSU 23S/28S and small subunit (SSU 16S/18S rRNAs of Escherichia coli, Thermus thermophilus, Haloarcula marismortui (LSU rRNA only, Saccharomyces cerevisiae, Drosophila melanogaster, and Homo sapiens. We provide high-resolution editable versions of the 2° structures in several file formats. For the SSU rRNA, the 2° structures use an intuitive representation of the central pseudoknot where base triples are presented as pairs of base pairs. Both LSU and SSU secondary maps are available (http://apollo.chemistry.gatech.edu/RibosomeGallery. Mapping of data onto 2° structures was performed on the RiboVision server (http://apollo.chemistry.gatech.edu/RiboVision.

  12. Actinomycetes, an Inexhaustible Source of Naturally Occurring Antibiotics

    Directory of Open Access Journals (Sweden)

    Yōko Takahashi

    2018-05-01

    Full Text Available Global public health faces a desperate situation, due to the lack of effective antibiotics. Coordinated steps need to be taken, worldwide, to rectify this situation and protect the advances in modern medicine made over the last 100 years. Work at Japan’s Kitasato Institute has been in the vanguard of many such advances, and work is being proactively tailored to promote the discovery of urgently needed antimicrobials. Efforts are being concentrated on actinomycetes, the proven source of most modern antibiotics. We devised a novel physicochemical screening mechanism, whereby simple physico-chemical properties, in conjunction with related detection methods, such as LC/MS, LC/UV, and polarity, could be used to identify or predict new compounds in a culture broth, simply by comparing results with existing databases. New compounds are isolated, purified, and their structure determined before being tested for any bioactivity. We used lyophilized actinomycete strains from the Kitasato Microbial Library, most more than 35 years old, and found 330 strains were producers of useful bioactive substances. We also tested organisms found in fresh samples collected in the complex environments from around plant roots, as well as from sediments of mangrove forests and oceans, resulting in the discovery of 36 novel compounds from 11 actinomycete strains. A compound, designated iminimycin, containing an iminium ion in the structure was discovered from the culture broth of Streptomyces griseus OS-3601, which had been stored for a long time as a streptomycin-producing strain. This represented the first iminium ion discovery in actinomycetes. Compounds with a cyclopentadecane skeleton containing 5,6-dihydro-4-hydroxyl-2-pyrone ring and tetrahydrofuran ring, designated mangromicins, were isolated from the culture broth of Lechevalieria aerocolonigenes K10-0216 obtained from sediment in a mangrove forest. These structures are extremely unique among natural compounds

  13. Actinomycete enzymes and activities involved in straw saccharification

    Energy Technology Data Exchange (ETDEWEB)

    McCarthy, A J; Ball, A S [Liverpool Univ. (UK). Dept. of Genetics and Microbiology

    1990-01-01

    This research programme has been directed towards the analysis of actinomycete enzyme systems involved in the degradation of plant biomass (lignocellulose.) The programme was innovative in that a novel source of enzymes was systematically screened and wheat straw saccharifying activity was the test criterion. Over 200 actinomycete strains representing a broad taxonomic range were screened. A range of specific enzyme activities were involved and included cellulase, xylanase, arabinofuranosidase, acetylesterase, {beta}-xylosidase and {beta}-glucosidase. Since hemicellulose (arabinoxylan) was the primary source of sugar, xylanases were characterized. The xylan-degrading systems of actinomycetes were complex and nonuniform, with up to six separate endoxylanases identified in active strains. Except for microbispora bispora, actinomycetes were found to be a poor source of cellulase activity. Evidence for activity against the lignin fraction of straw was produced for a range of actinomycete strains. While modification reactions were common, cleavage of inter-monomer bonds, and utilization of complex polyphenolic compounds were restricted to two strains: Thermomonospora mesophila and Streptomyces badius. Crude enzyme preparations from actinomycetes can be used to generate sugar, particularly pentoses, directly from cereal straw. The potential for improvements in yield rests with the formulation to cooperative enzyme combinations from different strains. The stability properties of enzymes from thermophilic strains and the general neutral to alkali pH optima offer advantages in certain process situations. Actinomycetes are a particularly rich source of xylanases for commercial application and can rapidly solubilise a lignocarbohydrate fraction of straw which may have both product and pretreatment potential. 31 refs., 4 figs., 5 tabs.

  14. Actinomycetes from red sea sponges: Sources for chemical and phylogenetic diversity

    KAUST Repository

    Abdelmohsen, Usama Ramadan

    2014-05-12

    The diversity of actinomycetes associated with marine sponges collected off Fsar Reef (Saudi Arabia) was investigated in the present study. Forty-seven actinomycetes were cultivated and phylogenetically identified based on 16S rRNA gene sequencing and were assigned to 10 different actinomycete genera. Eight putatively novel species belonging to genera Kocuria, Mycobacterium, Nocardia, and Rhodococcus were identified based on sequence similarity values below 98.2% to other 16S rRNA gene sequences available in the NCBI database. PCR-based screening for biosynthetic genes including type I and type II polyketide synthases (PKS-I, PKS-II) as well as nonribosomal peptide synthetases (NRPS) showed that 20 actinomycete isolates encoded each at least one type of biosynthetic gene. The organic extracts of nine isolates displayed bioactivity against at least one of the test pathogens, which were Gram-positive and Gram-negative bacteria, fungi, human parasites, as well as in a West Nile Virus protease enzymatic assay. These results emphasize that marine sponges are a prolific resource for novel bioactive actinomycetes with potential for drug discovery. 2014 by the authors; licensee MDPI.

  15. Actinomycetes from red sea sponges: Sources for chemical and phylogenetic diversity

    KAUST Repository

    Abdelmohsen, Usama Ramadan; Yang, Chen; Horn, Hannes; Hajjar, Dina A.; Ravasi, Timothy; Hentschel, Ute

    2014-01-01

    The diversity of actinomycetes associated with marine sponges collected off Fsar Reef (Saudi Arabia) was investigated in the present study. Forty-seven actinomycetes were cultivated and phylogenetically identified based on 16S rRNA gene sequencing and were assigned to 10 different actinomycete genera. Eight putatively novel species belonging to genera Kocuria, Mycobacterium, Nocardia, and Rhodococcus were identified based on sequence similarity values below 98.2% to other 16S rRNA gene sequences available in the NCBI database. PCR-based screening for biosynthetic genes including type I and type II polyketide synthases (PKS-I, PKS-II) as well as nonribosomal peptide synthetases (NRPS) showed that 20 actinomycete isolates encoded each at least one type of biosynthetic gene. The organic extracts of nine isolates displayed bioactivity against at least one of the test pathogens, which were Gram-positive and Gram-negative bacteria, fungi, human parasites, as well as in a West Nile Virus protease enzymatic assay. These results emphasize that marine sponges are a prolific resource for novel bioactive actinomycetes with potential for drug discovery. 2014 by the authors; licensee MDPI.

  16. CRISPR-Cas9 Based Engineering of Actinomycetal Genomes

    DEFF Research Database (Denmark)

    Tong, Yaojun; Charusanti, Pep; Zhang, Lixin

    2015-01-01

    . To facilitate the genetic manipulation of actinomycetes, we developed a highly efficient CRISPR-Cas9 system to delete gene(s) or gene cluster(s), implement precise gene replacements, and reversibly control gene expression in actinomycetes. We demonstrate our system by targeting two genes, actIORF1 (SCO5087......) and actVB (SCO5092), from the actinorhodin biosynthetic gene cluster in Streptomyces coelicolor A3(2). Our CRISPR-Cas9 system successfully inactivated the targeted genes. When no templates for homology-directed repair (HDR) were present, the site-specific DNA double-strand breaks (DSBs) introduced by Cas9....... Moreover, we developed a system to efficiently and reversibly control expression of target genes, deemed CRISPRi, based on a catalytically dead variant of Cas9 (dCas9). The CRISPR-Cas9 based system described here comprises a powerful and broadly applicable set of tools to manipulate actinomycetal genomes....

  17. [Diversity and bioactivity analysis of actinomycetes isolated from grand Shangri-La soil].

    Science.gov (United States)

    Cao, Yanru; Jiang, Yi; Xu, Lihua

    2009-01-01

    To obtain new pharmaceuticals and enzymes with high activity,we studied the composition as well as antimicrobial and enzyme activities of actinomycetes in Grand Shangri-La. Using 4 media,we isolated mesophilic and psychrophilic actinomycetes from 220 soil samples collected from areas with different altitudes in Grand Shangri-La. Twenty-five representative isolates were phylogenetically analyzed based on their 16S rRNA gene sequences. Antimicrobial activities against four bacteria and seven fungi were tested using agar well diffusion method. Genes encoding type I and II polyketide synthases (PKS I, PKS II), nonribosomal peptide synthase (NRPS) and polyene cytochrome P450 hydroxylase (CYP) were screened by PCR. Furthermore,several enzyme activities of psychrophilic actinomycetes were examined. The 25 representative strains belonged to 6 suborders, 12 families and 15 genera of the order Actinomycetals. For NRPS and CYP genes screening, positive strains were 14 and 11, respectively. Among the 111 actinomycetes isolated under low-temperature conditions, 88% were psychrotroph strains, 12% were psychrophilic actinomycetes, and most of them utilized gelatin, cellulose and chitin. Actinomycetes diversity is rich in Grand Shangri-la, and has the potential for conservation and utilization of actinomycetes resources.

  18. [Isolation and antimicrobial activities of actinomycetes from vermicompost].

    Science.gov (United States)

    Wang, Xue-jun; Yan, Shuang-lin; Min, Chang-li; Yang, Yan

    2015-02-01

    In this paper, actinomycetes were isolated from vermicompost by tablet coating method. Antimicrobial activities of actinomycetes were measured by the agar block method. Strains with high activity were identified based on morphology and biochemical characteristics, as well as 16S rDNA gene sequence analysis. The results showed that 26 strains of actinomycetes were isolated, 16 of them had antimicrobial activities to the test strains which accounts for 61.54% of all strains. Among the 16 strains, the strain QYF12 and QYF22 had higher antimicrobial activity to Micrococcus luteus, with a formed inhibition zone of 27 mm and 31 mm, respectively. While the strain QYF26 had higher antimicrobial activity to Bacillus subtilis, and the inhibition zone diameter was 21 mm. Based on the identification of strains with high activity, the strain QYF12 was identified as Streptomyces chartreusis, the strain QYF22 was S. ossamyceticus and the strain QYF26 was S. gancidicus. This study provided a theoretical basis for further separate antibacterial product used for biological control.

  19. Isolation and characterization of actinomycete antagonists of a fungal root pathogen.

    Science.gov (United States)

    Crawford, D L; Lynch, J M; Whipps, J M; Ousley, M A

    1993-11-01

    By use of selective media, 267 actinomycete strains were isolated from four rhizosphere-associated and four non-rhizosphere-associated British soils. Organic media with low nutrient concentrations were found to be best for isolating diverse actinomycetes while avoiding contamination and overgrowth of isolation media by eubacteria and fungi. While all isolates grew well at pHs 6.5 to 8.0, a few were unable to grow at pH 6.0 and a significant number failed to grow at pH 5.5. Eighty-two selected isolates were screened for in vitro antagonism towards Pythium ultimum by use of a Difco cornmeal agar assay procedure. Five isolates were very strong antagonists of the fungus, four were strong antagonists, and ten others were weakly antagonistic. The remaining isolates showed no antagonism by this assay. Additional studies showed that several of the P. ultimum antagonists also strongly inhibited growth of other root-pathogenic fungi. Twelve isolates showing antifungal activity in the in vitro assay were also tested for their effects on the germination and short-term growth of lettuce plants in glasshouse pot studies in the absence of pathogens. None of the actinomycetes prevented seed germination, although half of the isolates retarded seed germination and outgrowth of the plants by 1 to 3 days. During 18-day growth experiments, biomass yields of some actinomycete-inoculated plants were reduced in comparison with untreated control plants, although all plants appeared healthy and well rooted. None of the actinomycetes significantly enhanced plant growth over these short-term experiments. For some, but not all, actinomycetes, some correlations between delayed seed germination and reduced 18-day plant biomass yields were seen. For others, plant biomass yields were not reduced despite an actinomycete-associated delay in seed germination and plant outgrowth. Preliminary glasshouse experiments indicated that some of the actinomycetes protect germinating lettuce seeds against

  20. Identification and screening of rare actinomycetes isolated from Neesia altissima Bl.

    Science.gov (United States)

    Pratiwi, R. H.; Hidayat, I.; Hanafi, M.; Mangunwardoyo, W.

    2017-07-01

    Actinomycetes is the main source of antibiotics and endophytic actinomycetes from medicinal plants has considerable potential as like the host. The aim of this research is to identify rare actinomycetes isolated from Neesia altissima and to screen their antagonistic activity against diarrhea-causing bacteria in order to find new potential secondary metabolites. Samples of N. altissima were collected from mount Halimun-Salak National Park. Endophytic actinomycetes were isolated from roots of N. altissima by surface sterilization method. Screening of antagonistic activity was conducted against five diarrhea-causing bacteria such as Bacillus cereus ATCC 10876, Escherichia coli ATCC 25922, Salmonella typhimurium ATCC 25241, Shigella flexneri ATCC 12022, and Staphylococcus aureus ATCC 25923 by using diffusion disc methods. The endophytic actinomycete showed in vitro antibacterial activity against four diarrhea-causing bacteria, except the B. cereus ATCC 10876. The phylogenetic tree generated from 16S rRNA sequence showed that sequence of endophytic actinomycetes isolates nested in the clade belonging to the genus Nonomuraea. Sequence of UICC B-94 formed a monophyletic clade with N. jabiensis strain A4036 and N. rubra strain AC 615. Therefore, it is named as Nonomuraea sp. strain UICC B-94.

  1. Isolation and Characterization of Actinomycete Antagonists of a Fungal Root Pathogen †

    Science.gov (United States)

    Crawford, Don L.; Lynch, James M.; Whipps, John M.; Ousley, Margaret A.

    1993-01-01

    By use of selective media, 267 actinomycete strains were isolated from four rhizosphere-associated and four non-rhizosphere-associated British soils. Organic media with low nutrient concentrations were found to be best for isolating diverse actinomycetes while avoiding contamination and overgrowth of isolation media by eubacteria and fungi. While all isolates grew well at pHs 6.5 to 8.0, a few were unable to grow at pH 6.0 and a significant number failed to grow at pH 5.5. Eighty-two selected isolates were screened for in vitro antagonism towards Pythium ultimum by use of a Difco cornmeal agar assay procedure. Five isolates were very strong antagonists of the fungus, four were strong antagonists, and ten others were weakly antagonistic. The remaining isolates showed no antagonism by this assay. Additional studies showed that several of the P. ultimum antagonists also strongly inhibited growth of other root-pathogenic fungi. Twelve isolates showing antifungal activity in the in vitro assay were also tested for their effects on the germination and short-term growth of lettuce plants in glasshouse pot studies in the absence of pathogens. None of the actinomycetes prevented seed germination, although half of the isolates retarded seed germination and outgrowth of the plants by 1 to 3 days. During 18-day growth experiments, biomass yields of some actinomycete-inoculated plants were reduced in comparison with untreated control plants, although all plants appeared healthy and well rooted. None of the actinomycetes significantly enhanced plant growth over these short-term experiments. For some, but not all, actinomycetes, some correlations between delayed seed germination and reduced 18-day plant biomass yields were seen. For others, plant biomass yields were not reduced despite an actinomycete-associated delay in seed germination and plant outgrowth. Preliminary glasshouse experiments indicated that some of the actinomycetes protect germinating lettuce seeds against

  2. 16S rRNA phylogenetic analysis of actinomycetes isolated from ...

    African Journals Online (AJOL)

    Subsequently, phylogenetic tree was constructed using suitable bioinformatics tools to identify the similarity which showed 97% similarity between strains. Moreover, all the selected strains of actinomycetes were subjected to study the protein and plasmid DNA expression profiles which showed prominent bands with ...

  3. Systematic and biotechnological aspects of halophilic and halotolerant actinomycetes.

    Science.gov (United States)

    Hamedi, Javad; Mohammadipanah, Fatemeh; Ventosa, Antonio

    2013-01-01

    More than 70 species of halotolerant and halophilic actinomycetes belonging to at least 24 genera have been validly described. Halophilic actinomycetes are a less explored source of actinomycetes for discovery of novel bioactive secondary metabolites. Degradation of aliphatic and aromatic organic compounds, detoxification of pollutants, production of new enzymes and other metabolites such as antibiotics, compatible solutes and polymers are other potential industrial applications of halophilic and halotolerant actinomycetes. Especially new bioactive secondary metabolites that are derived from only a small fraction of the investigated halophilic actinomycetes, mainly from marine habitats, have revealed the huge capacity of this physiological group in production of new bioactive chemical entities. Combined high metabolic capacities of actinomycetes and unique features related to extremophilic nature of the halophilic actinomycetes have conferred on them an influential role for future biotechnological applications.

  4. Lignin-solubilizing ability of actinomycetes isolated from termite (Termitidae) gut

    International Nuclear Information System (INIS)

    Pasti, M.B.; Crawford, D.L.; Pometto, A.L. III; Nuti, M.P.

    1990-01-01

    The lignocellulose-degrading abilities of 11 novel actinomycete strains isolated from termite gut were determined and compared with that of the well-characterized actinomycete, Streptomyces viridosporus T7A. Lignocellulose bioconversion was followed by (i) monitoring the degradation of [ 14 C]lignin- and [ 14 C]cellulose-labeled phloem of Abies concolor to 14 CO 2 and 14 C-labeled water-soluble products, (ii) determining lignocellulose, lignin, and carbohydrate losses resulting from growth on a lignocellulose substrate prepared from corn stalks (Zea mays), and (iii) quantifying production of a water-soluble lignin degradation intermediate (acid-precipitable polymeric lignin). Of the assays used, total lignocellulose weight loss was most useful in determining overall bioconversion ability but not in identifying the best lignin-solubilizing strains. A screening procedure based on 14 CO 2 evolution from [ 14 C-lignin]lignocellulose combined with measurement of acid-precipitable polymeric lignin yield was the most effective in identifying lignin-solubilizing strains. For the termite gut strains, the pH of the medium showed no increase after 3 weeks of growth on lignocellulose. This is markedly different from the pattern observed with S. viridosporus T7A, which raises the medium pH considerably. Production of extracellular peroxidases by the 11 strains and S. viridosporus T7A was followed for 5 days in liquid cultures. On the basis of an increase of specific peroxidase activity in the presence of lignocellulose in the medium, the actinomycetes could be placed into the same three groups

  5. Genome sequencing reveals complex secondary metabolome in themarine actinomycete Salinispora tropica

    Energy Technology Data Exchange (ETDEWEB)

    Udwary, Daniel W.; Zeigler, Lisa; Asolkar, Ratnakar; Singan,Vasanth; Lapidus, Alla; Fenical, William; Jensen, Paul R.; Moore, BradleyS.

    2007-05-01

    Recent fermentation studies have identified actinomycetes ofthe marine-dwelling genus Salinispora as prolific natural productproducers. To further evaluate their biosynthetic potential, we analyzedall identifiable secondary natural product gene clusters from therecently sequenced 5,184,724 bp S. tropica CNB-440 circular genome. Ouranalysis shows that biosynthetic potential meets or exceeds that shown byprevious Streptomyces genome sequences as well as other naturalproduct-producing actinomycetes. The S. tropica genome features ninepolyketide synthase systems of every known formally classified family,non-ribosomal peptide synthetases and several hybrid clusters. While afew clusters appear to encode molecules previously identified inStreptomyces species,the majority of the 15 biosynthetic loci are novel.Specific chemical information about putative and observed natural productmolecules is presented and discussed. In addition, our bioinformaticanalysis was critical for the structure elucidation of the novelpolyenemacrolactam salinilactam A. This study demonstrates the potentialfor genomic analysis to complement and strengthen traditional naturalproduct isolation studies and firmly establishes the genus Salinispora asa rich source of novel drug-like molecules.

  6. Marine actinomycetes: an ongoing source of novel bioactive metabolites.

    Science.gov (United States)

    Subramani, Ramesh; Aalbersberg, William

    2012-12-20

    Actinomycetes are virtually unlimited sources of novel compounds with many therapeutic applications and hold a prominent position due to their diversity and proven ability to produce novel bioactive compounds. There are more than 22,000 known microbial secondary metabolites, 70% of which are produced by actinomycetes, 20% from fungi, 7% from Bacillus spp. and 1-2% by other bacteria. Among the actinomycetes, streptomycetes group are considered economically important because out of the approximately more than 10,000 known antibiotics, 50-55% are produced by this genus. The ecological role of actinomycetes in the marine ecosystem is largely neglected and various assumptions meant there was little incentive to isolate marine strains for search and discovery of new drugs. The search for and discovery of rare and new actinomycetes is of significant interest to drug discovery due to a growing need for the development of new and potent therapeutic agents. Modern molecular technologies are adding strength to the target-directed search for detection and isolation of bioactive actinomycetes, and continued development of improved cultivation methods and molecular technologies for accessing the marine environment promises to provide access to this significant new source of chemical diversity with novel/rare actinomycetes including new species of previously reported actinomycetes. Copyright © 2012 Elsevier GmbH. All rights reserved.

  7. [Population dynamics of oligosporous actinomycetes in Chernozem soil].

    Science.gov (United States)

    Zenova, G M; Mikhaĭlova, N V; Zviagintsev, D G

    2000-01-01

    Investigation of the dynamics of an oligosporous actinomycete population in chernozem soil in the course of succession induced by soil wetting allowed us to reveal the time intervals and conditions optimal for the isolation of particular oligosporous actinomycetes. Saccharopolysporas and microbisporas proved to be best isolated in the early and late stages of succession, whereas actinomycetes of the subgroup Actinomadura and saccharomonosporas could be best isolated in the early and intermediate stages of succession.

  8. Natural Products from Mangrove Actinomycetes

    Science.gov (United States)

    Xu, Dong-Bo; Ye, Wan-Wan; Han, Ying; Deng, Zi-Xin; Hong, Kui

    2014-01-01

    Mangroves are woody plants located in tropical and subtropical intertidal coastal regions. The mangrove ecosystem is becoming a hot spot for natural product discovery and bioactivity survey. Diverse mangrove actinomycetes as promising and productive sources are worth being explored and uncovered. At the time of writing, we report 73 novel compounds and 49 known compounds isolated from mangrove actinomycetes including alkaloids, benzene derivatives, cyclopentenone derivatives, dilactones, macrolides, 2-pyranones and sesquiterpenes. Attractive structures such as salinosporamides, xiamycins and novel indolocarbazoles are highlighted. Many exciting compounds have been proven as potential new antibiotics, antitumor and antiviral agents, anti-fibrotic agents and antioxidants. Furthermore, some of their biosynthetic pathways have also been revealed. This review is an attempt to consolidate and summarize the past and the latest studies on mangrove actinomycetes natural product discovery and to draw attention to their immense potential as novel and bioactive compounds for marine drugs discovery. PMID:24798926

  9. Lignin-solubilizing ability of actinomycetes isolated from termite (Termitidae) gut.

    Science.gov (United States)

    Pasti, M B; Pometto, A L; Nuti, M P; Crawford, D L

    1990-01-01

    The lignocellulose-degrading abilities of 11 novel actinomycete strains isolated from termite gut were determined and compared with that of the well-characterized actinomycete, Streptomyces viridosporus T7A. Lignocellulose bioconversion was followed by (i) monitoring the degradation of [14C]lignin- and [14C]cellulose-labeled phloem of Abies concolor to 14CO2 and 14C-labeled water-soluble products, (ii) determining lignocellulose, lignin, and carbohydrate losses resulting from growth on a lignocellulose substrate prepared from corn stalks (Zea mays), and (iii) quantifying production of a water-soluble lignin degradation intermediate (acid-precipitable polymeric lignin). The actinomycetes were all Streptomyces strains and could be placed into three groups, including a group of five strains that appear superior to S. viridosporus T7A in lignocellulose-degrading ability, three strains of approximately equal ability, and three strains of lesser ability. Strain A2 was clearly the superior and most effective lignocellulose decomposer of those tested. Of the assays used, total lignocellulose weight loss was most useful in determining overall bioconversion ability but not in identifying the best lignin-solubilizing strains. A screening procedure based on 14CO2 evolution from [14C-lignin]lignocellulose combined with measurement of acid-precipitable polymeric lignin yield was the most effective in identifying lignin-solubilizing strains. For the termite gut strains, the pH of the medium showed no increase after 3 weeks of growth on lignocellulose. This is markedly different from the pattern observed with S. viridosporus T7A, which raises the medium pH considerably. Production of extracellular peroxidases by the 11 strains and S. viridosporus T7A was followed for 5 days in liquid cultures.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2167628

  10. Metagenomic of Actinomycetes Based on 16S rRNA and nifH Genes in Soil and Roots of Four Indonesian Rice Cultivars Using PCR-DGGE

    Directory of Open Access Journals (Sweden)

    Mahyarudin

    2015-07-01

    Full Text Available The research was conducted to study the metagenomic of actinomycetes based on 16S ribosomal RNA (rRNA and bacterial nifH genes in soil and roots of four rice cultivars. The denaturing gradient gel electrophoresis profile based on 16S rRNA gene showed that the diversity of actinomycetes in roots was higher than soil samples. The profile also showed that the diversity of actinomycetes was similar in four varieties of rice plant and three types of agroecosystem. The profile was partially sequenced and compared to GenBank database indicating their identity with closely related microbes. The blast results showed that 17 bands were closely related ranging from 93% to 100% of maximum identity with five genera of actinomycetes, which is Geodermatophilus, Actinokineospora, Actinoplanes, Streptomyces and Kocuria. Our study found that Streptomyces species in soil and roots of rice plants were more varied than other genera, with a dominance of Streptomyces alboniger and Streptomyces acidiscabies in almost all the samples. Bacterial community analyses based on nifH gene denaturing gradient gel electrophoresis showed that diversity of bacteria in soils which have nifH gene was higher than that in rice plant roots. The profile also showed that the diversity of those bacteria was similar in four varieties of rice plant and three types of agroecosystem. Five bands were closely related with nifH gene from uncultured bacterium clone J50, uncultured bacterium clone clod-38, and uncultured bacterium clone BG2.37 with maximum identity 99%, 98%, and 92%, respectively. The diversity analysis based on 16S rRNA gene differed from nifH gene and may not correlate with each other. The findings indicated the diversity of actinomycetes and several bacterial genomes analyzed here have an ability to fix nitrogen in soil and roots of rice plant.

  11. Airway inflammation among compost workers exposed to actinomycetes spores

    Directory of Open Access Journals (Sweden)

    Kari Kulvik Heldal

    2015-05-01

    Full Text Available Objectives. To study the associations between exposure to bioaerosols and work-related symptoms, lung function and biomarkers of airway inflammation in compost workers. Materials and method. Personal full-shift exposure measurements were performed on 47 workers employed at five windrow plants (n=20 and five reactor plants (n=27. Samples were analyzed for endotoxins, bacteria, fungal and actinomycetes spores. Health examinations were performed on workers and 37 controls before and after work on the day exposure was measured. The examinations included symptoms recorded by questionnaire, lung function by spirometry and nasal dimensions by acoustic rhinometry (AR. The pneumoproteins CC16, SP-D and SP-A were measured in a blood sample drawn at the end of the day. Results. The levels of endotoxins (median 3 EU/m[sup]3[/sup] , range 0–730 EU/m[sup]3[/sup] and actinomycetes spores (median 0.2 × 10[sup]6[/sup] spores/m[sup]3[/sup] , range 0–590 × 10[sup]6[/sup] spores/m[sup]3[/sup] were significantly higher in reactor plants compared to windrow plants. However, windrow composting workers reported more symptoms than reactor composting workers, probably due to use of respiratory protection. Exposure-response relationships between actinomycetes spores exposure and respiratory effects, found as cough and nose irritation during a shift, was significantly increased (OR 4.3, 95% CI 1.1–16, OR 6.1, 95% CI 1.5–25, respectively, p<0.05 among workers exposed to 0.02–0.3 × 10[sup]6[/sup] actinomycetes spores/m 3 , and FEV1/FVC% decreased cross shift (b=–3.2, SE=1.5%, p<0.01. Effects were weaker in the highest exposed group, but these workers used respiratory protection, frequently limiting their actual exposure. No relationships were found between exposure and pneumoprotein concentrations. Conclusions. The major agent in the aerosol generated at compost plants was actinomycetes spores which was associated with work related cough symptoms and work

  12. Proteolytic activity of alkaliphilic, salt-tolerant actinomycetes from ...

    African Journals Online (AJOL)

    tolerant alkaliphilic. All the isolates need to be further studied for the ability of their potential protease enzyme production. Key words: Alkaliphilic actinomycetes, salt tolerant actinomycetes, desert soil, isolation, proteolytic activity.

  13. [Diversity of uncultured actinomycetes in saline-alkali soil from Jiuquan area of Hexi Corridor].

    Science.gov (United States)

    Li, Hai-yun; Niu, Shi-quan; Kong, Wei-bao; Yan, Wei-ru; Geng, Hui; Han, Cai-hong; Da, Wen-yan; Zhang, Ai-mei; Zhu, Xue-tai

    2015-09-01

    In order to more accurately understand community structure and diversity of actinomycetes in saline-alkali soil from Jiuquan area of Hexi Corridor, the community structure and diversity from three kinds of soil samples (primary, secondary saline alkali soil and farmland soil) were analyzed using uncultured methods. The results showed that the 16S rDNA clone library of actinomycetales from the primary saline-alkali soil belonged to 19 OTUs, Micrococcineae, Propionibacterineae, Corynebacterineae, Frankineae, Pseudonocardineae and unknown groups of Actinomycetales; the 16S r DNA clone library of actinomycetales from the secondary saline-alkali soil belonged to 14 OTUs, Micrococcineae, Propionibacterineae, Corynebacterineae, Frankineae, Pseudonocardineae and unknown groups of Actinomycetales; the 16S rDNA clone library of farmland soil belonged to 7 OTUs, Micrococcineae, Propionibacterineae, Corynebacterineae, Frankineae, Pseudonocardineae and unknown groups of Actinomycetales; Micrococcineae was the common population in the three soils, and also was the dominant population in primary saline alkali soil and farmland soil. The diversity index and rarefaction curves analysis showed that actinomycetes species richness was in order of primary saline-alkali soil > secondary saline-alkali soil > farmland soil. The dilution curves of primary saline-alkali soil and secondary saline-alkali soil were not leveled off, which indicated the actinomycetes diversity in saline-alkali soil was more enriched than the actual. The rich and diverse actinomycetes resources in saline-alkali soil from Jiuquan area of Hexi Corridor provide important data on the actinomycetes ecology distribution research, exploitation and utilization in saline-alkali soil.

  14. Marine Actinomycetes screening of Banten West Coast and their antibiotics purification

    Directory of Open Access Journals (Sweden)

    ROFIQ SUNARYANTO

    2010-10-01

    Full Text Available Sunaryanto R, Marwoto B (2010 Marine Actinomycetes screening of Banten West Coast and their antibiotics purification. Biodiversitas 11: 176-181. Isolation and purification of active compounds produced by marine Actinomycetes has been carried out. Marine sediment samples were obtained from six different places at Anyer, Banten West Coast in October 20, 2007. Isolation was carried out using two methods pretreatments, acid treatment and heat shock treatment. A total of 29 Actinomycetes isolates were obtained from the various sediment samples collected, then tested for antimicrobial test against Escherichia coli ATCC 25922, Staphylococcus aureus ATCC25923, Pseudomonas aeruginosa ATCC27853, Bacillus subtilis ATCC 66923, Candida albicans BIOMCC00122 and Aspergillus niger BIOMCC00134. Identification of potential isolate was carried out using 16S rRNA. Purification of active compound was carried out using silica gel column chromatography and preparative HPLC. Result of this research showed that isolate A11 produced the most active compound against Gram-positive and Gram-negative bacteria. Morphology and identification test using 16S rRNA gen showed that isolate A11 is Streptomyces sp. Production of active compound from isolate A11 used yeast peptone medium. The single peak of active compound was detected by HPLC and showed retention time on 8.35 min and maximum absorbance UV visible of antibiotic was 210 nm and 274.5 nm. Active purified compound showed inhibition activity to Gram-positive and Gram-negative bacteria. Minimum inhibitory concentration (MIC to E. coli ATCC 25922 was 27 µg/mL, P. aeruginosa ATCC 27853 68.7 µg/mL, S. aureus ATCC 25923 80.2 µg/mL, and B. subtilis ATCC 66923 73.7 µg/mL.

  15. Natural Products from Mangrove Actinomycetes

    Directory of Open Access Journals (Sweden)

    Dong-Bo Xu

    2014-05-01

    Full Text Available Mangroves are woody plants located in tropical and subtropical intertidal coastal regions. The mangrove ecosystem is becoming a hot spot for natural product discovery and bioactivity survey. Diverse mangrove actinomycetes as promising and productive sources are worth being explored and uncovered. At the time of writing, we report 73 novel compounds and 49 known compounds isolated from mangrove actinomycetes including alkaloids, benzene derivatives, cyclopentenone derivatives, dilactones, macrolides, 2-pyranones and sesquiterpenes. Attractive structures such as salinosporamides, xiamycins and novel indolocarbazoles are highlighted. Many exciting compounds have been proven as potential new antibiotics, antitumor and antiviral agents, anti-fibrotic agents and antioxidants. Furthermore, some of their biosynthetic pathways have also been revealed. This review is an attempt to consolidate and summarize the past and the latest studies on mangrove actinomycetes natural product discovery and to draw attention to their immense potential as novel and bioactive compounds for marine drugs discovery.

  16. Isolation, Phylogenetic Analysis and Anti-infective Activity Screening of Marine Sponge-Associated Actinomycetes

    Directory of Open Access Journals (Sweden)

    Safwat Ahmed

    2010-02-01

    Full Text Available Terrestrial actinomycetes are noteworthy producers of a multitude of antibiotics, however the marine representatives are much less studied in this regard. In this study, 90 actinomycetes were isolated from 11 different species of marine sponges that had been collected from offshore Ras Mohamed (Egypt and from Rovinj (Croatia. Phylogenetic characterization of the isolates based on 16S rRNA gene sequencing supported their assignment to 18 different actinomycete genera representing seven different suborders. Fourteen putatively novel species were identified based on sequence similarity values below 98.2% to other strains in the NCBI database. A putative new genus related to Rubrobacter was isolated on M1 agar that had been amended with sponge extract, thus highlighting the need for innovative cultivation protocols. Testing for anti-infective activities was performed against clinically relevant, Gram-positive (Enterococcus faecalis, Staphylococcus aureus and Gram-negative (Escherichia coli, Pseudomonas aeruginosa bacteria, fungi (Candida albicans and human parasites (Leishmania major, Trypanosoma brucei. Bioactivities against these pathogens were documented for 10 actinomycete isolates. These results show a high diversity of actinomycetes associated with marine sponges as well as highlight their potential to produce anti-infective agents.

  17. Diversity and Antagonistic Activity of Actinomycete Strains From Myristica Swamp Soils Against Human Pathogens

    Directory of Open Access Journals (Sweden)

    Varghese Rlnoy

    2014-05-01

    Full Text Available Under the present investigation Actinomycetes were isolated from the soils of Myristica swamps of southern Western Ghats and the antagonistic activity against different human bacterial pathogens was evaluated. Results of the present study revealed that Actinomycetes population in the soils of Myristica swamp was spatially and seasonally varied. Actinomycetes load was varied from 24×104 to 71×103, from 129×103 to 40×103 and from 31×104 to 84×103 in post monsoon, monsoon and pre monsoon respectively. A total of 23 Actinomycetes strains belonging to six genera were isolated from swamp soils. Identification of the isolates showed that most of the isolates belonged to the genus Streptomyces (11, followed by Nocardia (6, Micromonospora (3, Pseudonocardia (1, Streptosporangium (1, and Nocardiopsis (1. Antagonistic studies revealed that 91.3% of Actinomycete isolates were active against one or more tested pathogens, of that 56.52% exhibited activity against Gram negative and 86.95% showed activity against Gram positive bacteria. 39.13% isolates were active against all the bacterial pathogens selected and its inhibition zone diameter was also high. 69.5% of Actinomycetes were exhibited antibacterial activity against Listeria followed by Bacillus cereus (65.21%, Staphylococcus (60.86%, Vibrio cholera (52.17%, Salmonella (52.17% and E. coli (39.13%. The results indicate that the Myristica swamp soils of Southern Western Ghats might be a remarkable reserve of Actinomycetes with potential antagonistic activity.

  18. Biological active compounds from actinomycetes isolated from soil ...

    African Journals Online (AJOL)

    These potential actinomycetes need to be further tested for their application and have their potential fully characterized before being distributed or made known to interested industries. Keywords: Actinomycetes, anthracnose, bioactivity, biodiversity, Malaysia. African Journal of Biotechnology, Vol 13(49) 4523-4528 ...

  19. Exploring plant growth-promotion actinomycetes from vermicompost and rhizosphere soil for yield enhancement in chickpea

    Science.gov (United States)

    Sreevidya, M.; Gopalakrishnan, S.; Kudapa, H.; Varshney, R.K.

    2016-01-01

    The main objective of the present study was to isolate and characterize actinomycetes for their plant growth-promotion in chickpea. A total of 89 actinomycetes were screened for their antagonism against fungal pathogens of chickpea by dual culture and metabolite production assays. Four most promising actinomycetes were evaluated for their physiological and plant growth-promotion properties under in vitro and in vivo conditions. All the isolates exhibited good growth at temperatures from 20 °C to 40 °C, pH range of 7–11 and NaCl concentrations up to 8%. These were also found highly tolerant to Bavistin, slightly tolerant to Thiram and Captan (except VAI-7 and VAI-40) but susceptible to Benlate and Ridomil at field application levels and were found to produce siderophore, cellulase, lipase, protease, chitinase (except VAI-40), hydrocyanic acid (except VAI-7 and VAI-40), indole acetic acid and β-1,3-glucanase. When the four actinomycetes were evaluated for their plant growth-promotion properties under field conditions on chickpea, all exhibited increase in nodule number, shoot weight and yield. The actinomycetes treated plots enhanced total N, available P and organic C over the un-inoculated control. The scanning electron microscope studies exhibited extensive colonization by actinomycetes on the root surface of chickpea. The expression profiles for indole acetic acid, siderophore and β-1,3-glucanase genes exhibited up-regulation for all three traits and in all four isolates. The actinomycetes were identified as Streptomyces but different species in the 16S rDNA analysis. It was concluded that the selected actinomycetes have good plant growth-promotion and biocontrol potentials on chickpea. PMID:26887230

  20. Exploring plant growth-promotion actinomycetes from vermicompost and rhizosphere soil for yield enhancement in chickpea

    Directory of Open Access Journals (Sweden)

    M. Sreevidya

    2016-03-01

    Full Text Available Abstract The main objective of the present study was to isolate and characterize actinomycetes for their plant growth-promotion in chickpea. A total of 89 actinomycetes were screened for their antagonism against fungal pathogens of chickpea by dual culture and metabolite production assays. Four most promising actinomycetes were evaluated for their physiological and plant growth-promotion properties under in vitro and in vivo conditions. All the isolates exhibited good growth at temperatures from 20 °C to 40 °C, pH range of 7–11 and NaCl concentrations up to 8%. These were also found highly tolerant to Bavistin, slightly tolerant to Thiram and Captan (except VAI-7 and VAI-40 but susceptible to Benlate and Ridomil at field application levels and were found to produce siderophore, cellulase, lipase, protease, chitinase (except VAI-40, hydrocyanic acid (except VAI-7 and VAI-40, indole acetic acid and β-1,3-glucanase. When the four actinomycetes were evaluated for their plant growth-promotion properties under field conditions on chickpea, all exhibited increase in nodule number, shoot weight and yield. The actinomycetes treated plots enhanced total N, available P and organic C over the un-inoculated control. The scanning electron microscope studies exhibited extensive colonization by actinomycetes on the root surface of chickpea. The expression profiles for indole acetic acid, siderophore and β-1,3-glucanase genes exhibited up-regulation for all three traits and in all four isolates. The actinomycetes were identified as Streptomyces but different species in the 16S rDNA analysis. It was concluded that the selected actinomycetes have good plant growth-promotion and biocontrol potentials on chickpea.

  1. New Dimensions of Research on Actinomycetes: Quest for Next Generation Antibiotics

    Directory of Open Access Journals (Sweden)

    Polpass Arul Jose

    2016-08-01

    Full Text Available Starting with the discovery of streptomycin, the promise of natural products research on actinomycetes has been captivat¬ing researchers and offered an array of life-saving antibiotics. However, most of the actinomycetes have received a little attention of researchers beyond isolation and activity screening. Noticeable gaps in genomic information and associated biosynthetic potential of actinomycetes are mainly the reasons for this situation, which has led to a decline in the discovery rate of novel antibiotics. Recent insights gained from genome mining have revealed a massive existence of previously unrecognized biosynthetic potential in actinomycetes. Successive developments in next-generation sequencing, genome editing, analytical separation and high-resolution spectroscopic methods have reinvigorated interest on such actinomycetes and opened new avenues for the discovery of natural and natural-inspired antibiotics. This article describes the new dimensions that have driven the ongoing resurgence of research on actinomycetes with historical background since the commencement in 1940, for the attention of worldwide researchers. Coupled with increasing advancement in molecular and analytical tools and techniques, the discovery of next-generation antibiotics could be possible by revisiting the untapped potential of actinomycetes from different natural sources.

  2. Isolation and screening of actinomycetes from Sundarbans soil for ...

    African Journals Online (AJOL)

    USER

    2010-07-19

    Jul 19, 2010 ... If we include secondary meta- ... marine environment and supports a rich and diverse group of ... plates of actinomycetes contaminated with bacteria and fungi were ..... Actinomycetes: a continuing source of new metabolites.

  3. Chitin degrading potential of three aquatic actinomycetes and its ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-12-01

    Dec 1, 2009 ... chitinase production by all tested actinomycetes was at pH 8. S. canus and M. ... Chitin is the most abundant biopolymer next to cellulose. It is the β –1, ... Microorganisms, lower animals, birds, fungi and plants are known to ...

  4. Synthetic polyester-hydrolyzing enzymes from thermophilic actinomycetes.

    Science.gov (United States)

    Wei, Ren; Oeser, Thorsten; Zimmermann, Wolfgang

    2014-01-01

    Thermophilic actinomycetes produce enzymes capable of hydrolyzing synthetic polyesters such as polyethylene terephthalate (PET). In addition to carboxylesterases, which have hydrolytic activity predominantly against PET oligomers, esterases related to cutinases also hydrolyze synthetic polymers. The production of these enzymes by actinomycetes as well as their recombinant expression in heterologous hosts is described and their catalytic activity against polyester substrates is compared. Assays to analyze the enzymatic hydrolysis of synthetic polyesters are evaluated, and a kinetic model describing the enzymatic heterogeneous hydrolysis process is discussed. Structure-function and structure-stability relationships of actinomycete polyester hydrolases are compared based on molecular dynamics simulations and recently solved protein structures. In addition, recent progress in enhancing their activity and thermal stability by random or site-directed mutagenesis is presented. © 2014 Elsevier Inc. All rights reserved.

  5. Characterisation of actinomycetes community from the heavy metals polluted soil

    Directory of Open Access Journals (Sweden)

    Monika Vítězová

    2013-01-01

    Full Text Available The isolation of actinomycetes was performed from soil samples influenced by car-traffic. The acute toxicity of soil leaches was tested by the help of Microtox® bioassay testing system which uses freeze dried luminescent bacteria Photobacterium phosphoreum as the test organisms. The content of heavy metals in biomass of soil microorganisms and in whole soil samples was determinate. 115 strains of actinomycetes were isolated and their total numbers in soil samples were estimated. The acute toxicity of soil influenced the total numbers of actinomycetes. By the help of DNA-DNA reassociation procedure the generic diversity of bacteria was estimated. The identification and differentiation of streptomycetes from the total isolated actinomycetes was made using specific morphological criteria and the gas chromatography-fatty acid methyl ester (GC-FAME analysis. FAME method is adequate only for differentiation of members of genus Streptomyces from other actinomycetes because of their characteristical profile of fatty acids.

  6. Consortium inoculum of five thermo-tolerant phosphate solubilizing Actinomycetes for multipurpose biofertilizer preparation.

    Science.gov (United States)

    Nandimath, Arusha P; Karad, Dilip D; Gupta, Shantikumar G; Kharat, Arun S

    2017-10-01

    Alkaline pH of the soil facilitates the conversion of phosphate present in phosphate fertilizer applied in the field to insoluble phosphate which is not available to plants. Problem of soluble phosphate deficiency arises, primarily due to needless use of phosphate fertilizer. We sought to biofertilizer with the thermo-tolerant phosphate solubilizing actinomycetes consortium that could convert insoluble phosphate to soluble phosphate at wider temperature range. In the present investigation consortium of five thermo-tolerant phosphate solubilizing actinomycetes was applied for preparation of inoculum to produce multipurpose bio-fertilizer. Phosphates solubilizing thermo-tolerant 32 actinomycetes strains were processed for identification with the use of PIBWIN software and were screened for phosphate solubilizing activity. Amongst these five actinomycetes were selected on the basis of their ability to produce cellulase, chitinase, pectinase, protease, lipase, amylase and phosphate solubilizing enzymes. Ability to produce these enzymes at 28°C and 50°C were examined. Biofertilizer was prepared by using agricultural waste as a raw material. While preparation of bio-fertilizer the pH decreased from 7.5 to 4.3 and temperature increased up to 74°C maximum at the end of 4 th week and in subsequent week it started to decline gradually till it reached around 50°C, which was found to be stable up to eighth week. This thermo-tolerant actinomycetes consortium released soluble phosphate of up to 46.7 μg ml -1 . As the mesophilic organisms die out at high temperature of composting hence thormo-tolerant actinomycetes would be the better substitute for preparation of phosphate solubilizing bio-fertilizer with added potential to degrade complex macromolecules in composting.

  7. Enzymatic degradation of cellulose for thermophilic actinomycete: isolation, characterization and cellulolytic activity determination

    Directory of Open Access Journals (Sweden)

    Pablo Ramírez

    2013-06-01

    Full Text Available One hundred and forty five cellulolytic thermophilic actinomycete strains were isolated from 71 compost, soil, hay and dung samples. Streptomyces sp. (50,63%, Thermomonospora curvata (15,82%, T. chromogena (13,92%, and other species were identified. Endoglucanase, exoglucanase and β-glucosidase activities were evaluated from 10 cellulolytic actinomycete strains. Among these the Streptomyces sp. 7CMC10 strain showed the biggest activity levels corresponding to 20,14; 2,61 and 5,40 UI/mg of protein, respectively.

  8. Screening the Egyptian desert actinomycetes as candidates for new ...

    African Journals Online (AJOL)

    In a screening program to study the antimicrobial activities of desert actinomycetes as potential producers of active metabolites, 75 actinomycete strains were isolated from the Egyptian desert habitats and tested. Out of the isolated 75 organisms, 32 (42.67%) showed activity against the used test organisms.

  9. Biosynthesis of gold nanoparticles by actinomycete Streptomyces viridogens strain HM10.

    Science.gov (United States)

    Balagurunathan, R; Radhakrishnan, M; Rajendran, R Babu; Velmurugan, D

    2011-10-01

    Biosynthesis of gold nanoparticles by Streptomycetes from Himalayan Mountain was undertaken for the first time. Out of 10 actinomycete strains tested, four strains (D10, HM10, ANS2 and MSU) showed evidence for the intracellular biosynthesis of gold nanoparticles, among which the strain HM10 showed high potency. Presence of spherical and rod shaped gold nanoparticles in mycelium of the strain HM10 was determined by transmission electron microscopy (TEM) and X-ray diffraction analysis. The average particle size ranged from 18-20 nm. UV spectral analysis indicated that the reduction of chloroauric acid (HAuCl4) occurred within 24 h of reaction period. Further, the strain HM10 showed enhanced growth at 1 and 10 mM concentration of HAuCl4. The gold nanoparticles synthesized by the strain HM10 showed good antibacterial activity against S. aureus and E. coli in well-diffusion method. The potential actinomycete HM10 strain was phenotypically characterized and identified as Streptomyces viridogens (HM10). Thus, actinomycete strain HM10 reported in this study is a newly added source for the biosynthesis of gold nanoparticles.

  10. Effect of gamma radiation on the survival of fungal and actinomycetal florae contaminating medicinal plants

    International Nuclear Information System (INIS)

    Aziz, N.H.; El-Fouly, M.Z.; Moussa, L.A.A.; Abu-Shady, M.R.

    1997-01-01

    This study evaluates the effect of gamma radiation on the viability of fungi and actinomycetes that contaminate medicinal plants. The relationship between the total lipids of some fungi and actinomycetes and their sensitivity to gamma radiation is also investigated. The data reveal that the viable counts of these florae decrease approximately exponentially with the radiation dose, the effective dose for the elimination of these microorganisms being about 5 kGy for all the medicinal plants under study. Response of pure cultures of fungi and actinomycetes isolated from medicinal plants to increasing absorbed doses of gamma radiation indicate that an increase in radioresistance is in the following order: Streptomyces rimosus, Fusarium solani, Nocardia kuroishii. F. oxysporum, A. fumigatus, A. flavus, A. parasiticus and A. ochraceus. The total lipid contents of molds and actinomycetes have been reported to be increased by increasing the radio-resistance of microorganisms, and hence there is a relationship between the radio-sensitivity of microorganisms and the total lipid mass of flora mycelia. (Author)

  11. Effect of gamma radiation on the survival of fungal and actinomycetal florae contaminating medicinal plants

    Energy Technology Data Exchange (ETDEWEB)

    Aziz, N.H.; El-Fouly, M.Z.; Moussa, L.A.A. [National Center for Radiation Research and Technology, Cairo (Egypt); Abu-Shady, M.R. [Ain Shams Univ., Cairo (Egypt). Faculty of Science

    1997-01-01

    This study evaluates the effect of gamma radiation on the viability of fungi and actinomycetes that contaminate medicinal plants. The relationship between the total lipids of some fungi and actinomycetes and their sensitivity to gamma radiation is also investigated. The data reveal that the viable counts of these florae decrease approximately exponentially with the radiation dose, the effective dose for the elimination of these microorganisms being about 5 kGy for all the medicinal plants under study. Response of pure cultures of fungi and actinomycetes isolated from medicinal plants to increasing absorbed doses of gamma radiation indicate that an increase in radioresistance is in the following order: Streptomyces rimosus, Fusarium solani, Nocardia kuroishii. F. oxysporum, A. fumigatus, A. flavus, A. parasiticus and A. ochraceus. The total lipid contents of molds and actinomycetes have been reported to be increased by increasing the radio-resistance of microorganisms, and hence there is a relationship between the radio-sensitivity of microorganisms and the total lipid mass of flora mycelia. (Author).

  12. Screening of Actinomycetes From Lipar Area of Oman Sea to Investigate the Antibacterial Compounds

    Directory of Open Access Journals (Sweden)

    Shams

    2015-02-01

    Full Text Available Background Actinomycetes are one of the most important sources for the production of antibacterial compounds. Marine environments, due to their unique characteristics, are considered a good option to search for bacteria with the capability of producing antimicrobial compounds. Objectives The purpose of this study was to isolate the actinomycetes producing antibacterial compounds. Materials and Methods A total of 35 actinomycetes were isolated from Oman Sea (Lipar Area. To investigate antibacterial activity, the isolated actinomycetes were assessed against reference and pathogenic bacteria, including Staphylococcus epidermidis, Staphylococcu intermedius, Staphylococcu chromogenes, Staphylococcu saprophyticus, Bacillus cereus and methicillin-resistance Staphylococcu aureus, Pseudomonas, Listeria, Klebsiella, Salmonella, Acinetobacter, and Escherichia coli O157:H7, using the cross streak method. Results Based on the morphological characterization, 35 isolated cases belonged to actinomycetes and %94 of them had the ability to produce antibacterial compounds. In the cross streak method, most of the isolated bacteria have antibacterial activity against reference S. aureus among Gram-positive bacteria and Acinetobacter among Gram-negative bacteria. Inhibition zone diameters were measured between 2-25 and 1-20 mm for Gram-positive and -negative bacteria, receptivity. Conclusions Preliminary results indicate that the native Iranian Actinobacteria could be considered a suitable option for screening of the new antibacterial compounds. Molecular research and antibacterial compound extraction against the aforementioned pathogenic strains are also being conducted.

  13. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    Science.gov (United States)

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  14. Stimulation of 2-methylisoborneol (MIB) production by actinomycetes after cyclic chlorination in drinking water distribution systems.

    Science.gov (United States)

    Abbaszadegan, Morteza; Yi, Min; Alum, Absar

    2015-01-01

    The impact of fluctuation in chlorine residual on actinomycetes and the production of 2-methylisoborneol (MIB) were studied in cast-iron and PVC model distribution systems. Actinomycetes were spiked in each system and continued operation for a 12-day non-chlorine experiment, resulting in no changes in actinomycetes and MIB concentrations. Three cyclic chlorination events were performed and chlorine residuals were maintained as follows: 1.0 mg L(-1) for 24 h, 0 mg L(-1) for 48 h, 0.5 mg L(-1) for 48 h, 0 mg L(-1) for 48 h and 2 mg L(-1) for 24 h. After each chlorination event, 2 -3 log decrease in actinomycetes was noted in both systems. However, within 48 h at 0 mg L(-1) chlorine, the actinomycetes recovered to the pre-chlorination levels. On the contrary, MIB concentration in both systems remained un-impacted after the first cycle and increased by fourfold ( 20 mg L(-1)) after the second cycle, which lasted through the third cycle despite the fact that actinomycetes numbers fluctuated 2-3 logs during this time period. For obtaining biofilm samples from field, water meters were collected from municipality drinking water distribution systems located in central Arizona. The actinomycetes concentration in asbestos cement pipe and cast iron pipe averaged 3.1 × 10(3) and 1.9 × 10(4) CFU cm(-2), respectively. The study shows that production of MIB is associated with changes in chlorine residual in the systems. This is the first report of cyclic chlorine shock as a stimulus for MIB production by actinomycetes in drinking water distribution system's ecology.

  15. Polyphasic identification of Lechevaliera fradia subsp. Iranica, A rare actinomycete isolated from Loshan region of Iran

    Directory of Open Access Journals (Sweden)

    Mahdi Moshtaghi Nikou

    2015-02-01

    Full Text Available Introduction: Actinomycetes are widely distributed in natural and man-made environments and have capability for degradation of organic matter. They are also well known as a rich source of antibiotics and bioactive molecules and are of considerable importance in industry. Materials and methods: In this study, a rare actinomycete was isolated and subjected to polyphasic identification. Identification of this rare actinomycetes was carried on according to polyphasic taxonomic approach which has been outlined by International Committee on Systematics of Prokaryotes (ICSP. Results: The cell wall of strain LO5 contained meso-diaminopimelic acid as diaminoacid and galactose, mannose and rhamnose as diagnostic sugars. The phospholipids consisted of diphosphatidylglycerol, phosphatidylglycerol and phosphatidylethanolamine. Phylogenetic analysis based on nearly complete 16S rRNA gene sequence comparison revealed affiliation to the family Pseudonocardiaceae and its similarity to the most closely related neighbor the Lechevalieria fradiae CGMCC 4.3506T was 98.6%. The level of DNA–DNA relatedness between the novel strain and Lechevalieria fradiae CGMCC 4.3506T was only 75 %. So according to the recommendations of a threshold value of 70% DNA-DNA similarity, LO5 belongs to the species Lechevalieria fradiae CGMCC 4.3506T. On the basis of genomic and phenotypic properties, the subspecies Lechevalieria fradiae subsp. Iranica IBRC-M 10378 is proposed. Discussion and conclusion: A polyphasic approach based on phenotypic, chemotaxonomic and phylogenetic investigations has been proposed for categorizing of a rare actinomycete in subspecies level. The techniques used to obtain the data required for determination of the taxonomic status of this isolate are based on minimal standards that have been established by some of the taxonomic subcommittees of the International Committee on Systematics of Prokaryotes (ICSP for specific groups of organisms.

  16. Biocontrol of charcoal-rot of sorghum by actinomycetes isolated from ...

    African Journals Online (AJOL)

    use

    2011-12-12

    Dec 12, 2011 ... Streptomyces but with different species in BLAST analysis. This study indicates that the selected actinomycetes have the potential for PGP and control of charcoal-rot disease in sorghum. Key words: Antagonistic actinomycetes, biocontrol, charcoal-rot, Macrophomina phaseolina. INTRODUCTION.

  17. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. Actinomycetes with antimicrobial activity isolated from paper wasp (Hymenoptera: Vespidae: Polistinae) nests.

    Science.gov (United States)

    Madden, Anne A; Grassetti, Andrew; Soriano, Jonathan-Andrew N; Starks, Philip T

    2013-08-01

    Actinomycetes-a group of antimicrobial producing bacteria-have been successfully cultured and characterized from the nest material of diverse arthropods. Some are symbionts that produce antimicrobial chemicals found to protect nest brood and resources from pathogenic microbes. Others have no known fitness relationship with their associated insects, but have been found to produce antimicrobials in vitro. Consequently, insect nest material is being investigated as a new source of novel antimicrobial producing actinomycetes, which could be harnessed for therapeutic potential. To extend studies of actinomycete-insect associations beyond soil-substrate dwelling insects and wood boring excavators, we conducted a preliminary assessment of the actinomycetes within the nests of the paper wasp, Polistes dominulus (Christ). We found that actinomycetes were readily cultured from nest material across multiple invasive P. dominulus populations-including members of the genera Streptomyces, Micromonospora, and Actinoplanes. Thirty of these isolates were assayed for antimicrobial activity against the challenge bacteria Pseudomonas aeruginosa, Escherichia coli, Staphylococcus aureus, Serratia marcescens, and Bacillus subtilis. Sixty percent of isolates inhibited the growth of at least one challenge strain. This study provides the first assessment of bacteria associated with nests of P. dominulus, and the first record of antimicrobial producing actinomycetes isolated from social wasps. We provide a new system to explore nest associated actinomycetes from a ubiquitous and cosmopolitan group of insects.

  19. Antimicrobial biosynthetic potential and genetic diversity of endophytic actinomycetes associated with medicinal plants.

    Science.gov (United States)

    Gohain, Anwesha; Gogoi, Animesh; Debnath, Rajal; Yadav, Archana; Singh, Bhim P; Gupta, Vijai K; Sharma, Rajeev; Saikia, Ratul

    2015-10-01

    Endophytic actinomycetes are one of the primary groups that share symbiotic relationships with medicinal plants and are key reservoir of biologically active compounds. In this study, six selective medicinal plants were targeted for the first time for endophytic actinomycetes isolation from Gibbon Wild Life Sanctuary, Assam, India, during winter and summer and 76 isolates were obtained. The isolates were found to be prevalent in roots followed by stem and leaves. 16S rRNA gene sequence analysis revealed 16 genera, including rare genera, Verrucosispora, Isoptericola and Kytococcus, which have never been previously reported as endophytic. The genus Streptomyces (66%) was dominant in both seasons. Shannon's diversity index showed that Azadirachta indica (1.49), Rauwolfia serpentina (1.43) and Emblica officinalis (1.24) were relatively good habitat for endophytic actinomycetes. Antimicrobial strains showed prevalence of polyketide synthase (PKS) type-II (85%) followed by PKS type-I (14%) encoded in the genomes. Expression studies showed 12-fold upregulation of PKSII gene in seventh day of incubation for Streptomyces antibioticus (EAAG90). Our results emphasize that the actinomycetes assemblages within plant tissue exhibited biosynthetic systems encoding for important biologically active compounds. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. Comparative analysis of oligonucleotide primers for high-throughput screening of genes encoding adenylation domains of nonribosomal peptide synthetases in actinomycetes

    Czech Academy of Sciences Publication Activity Database

    Bakal, Tomáš; Goo, K.-S.; Najmanová, Lucie; Plháčková, Kamila; Kadlčík, Stanislav; Ulanová, Dana

    2015-01-01

    Roč. 108, č. 5 (2015), s. 1267-1274 ISSN 0003-6072 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : Nonribosomal peptide synthetase * Adenylation domain * Actinomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 1.944, year: 2015

  1. Identification and Optimal Growth Conditions of Actinomycetes Isolated From Mangrove Environment

    International Nuclear Information System (INIS)

    Ameerah Abdul Hamid; Suhaidi Ariffin; Sharifah Aminah Syed Mohamad

    2015-01-01

    Actinomycetes are classified as saprophytes that play a significant role in the breakdown of organic matters into more readily assimilable nutrients. They are also known to produce a variety of secondary metabolites, which are useful for human, veterinary medicine and agriculture applications. The optimum growth conditions of actinomycetes isolated from mangrove environment at different temperature, pH and sodium chloride (NaCl) concentration were studied. The identification of the isolates by both biochemical test and 16S rRNA analysis was also done. All isolates were grown in ISP1 medium at different temperature (25, 30, 37 and 40 degree Celsius); pH (3.5, 5, 7 and 9); and salt concentration (0, 3, 5 and 7 % w/v). The optimum temperature for KMS1 and KMH2 isolates was at 25 degree Celsius. However, the optimum temperature for PCS1 and PMH1A was at 30 and 37 degree Celsius respectively. The optimum pH was pH 7 and the most preferred NaCl concentration of all isolates was at 3 % (w/v). All isolates showed negative result for carbohydrate fermentation except for KMS1 which showed utilisation of D-Fructose sugar with acid production. Only KMS1 and PCS1 exhibited amylolytic and proteolytic activity. The isolates were successfully identified as Streptomyces variables (KMS1), Streptomyces rubrolavendulae (KMH2), Streptomyces spp. CPE333 (PCS1) and Actinomycetales bacterium (PMH1A). (author)

  2. Isolation and characterization of a cellulolytic actinomycete Microbispora bispora

    Energy Technology Data Exchange (ETDEWEB)

    Waldron, Jr, C R; Becker-Vallone, C A; Eveleigh, D E

    1986-09-01

    Protocols for the isolation of cellulolytic actinomycetes are described, and their use illustrated in the selection of thermophilic bacteria from soil. One isolate, Microbispora bispora, was selected for further study. It grew readily at 55/sup 0/C, produced an extracellular cellulase in good yield (endoglucanase, 5.9 U/ml) that had a broad pH range (pH 5.5 - 7.2) and was thermally stable. Its aryl-..beta..-glucosidase was cell-associated and was relatively resistant to end-product inhibition.

  3. Screening of chitinolytic actinomycetes for biological control of Sclerotium rolfsii stem rot disease of chilli

    Directory of Open Access Journals (Sweden)

    Pranee Pattanapipitpaisal

    2012-09-01

    Full Text Available Two hundred and eighty three strains were isolated from rhizoshere-associated soils, from Ubon Ratchathani andSrisaket province, using Enrichment Media for isolation of Chitinase-producing Actinomycetes agar (EMCA agar. All strainswere screened for chitinolytic activity and sixty eight strains gave significant clear zone on EMCA agar plates. The selectedchitinolytic strains were assayed for in vitro antagonism against Sclerotium rolfsii using cornmeal agar (CMA agar assayprocedure and the result showed that thirteen isolates have remarkable inhibiting the growth of the fungus and the top fiveantagonistic actinomycetes were PACCH 277, PACCH129, PACCH225, PACCH24 and PACCH246, respectively. The resultindicated that these actinomycetes produce chitinase which catalyze the degradation of chitin, resulting in inhibition of S.rolfsii growth. Their abilities to control the disease development were tested for in vivo biocontrol assay on chilli seedlings.Two out of thirteen candidate, PACCH24 and PACCH225, antagonists reduced the disease development at 90%. It wassuggested that the ability to inhibit the growth of pathogen in vitro was not related to the disease reduction in vivo. Thestrain PACCH24 was further identified as Streptomyces hygroscopicus according to morphological characteristic, cell walland cellular sugar analysis and 16S rDNA sequencing. The study implies a novel chitinolytic actinomycete which could bedeveloped to be a biological agent which would be included as a complement with organic fertilizers in order to control stemrot disease and promote growth of chilli.

  4. In Vitro Investigation of Antifungal Activities of Actinomycetes against Microsporum gypseum

    Directory of Open Access Journals (Sweden)

    Naser Keikha

    2013-02-01

    Conclusion: The findings of the present research show that terrigenous actinomycetes have an antifungal effect upon Microsporum gypseum. So, one hopes that-in future-rather than administering antifungal chemicals that have side-effects, dermatophytic infections can be cured by applying these actinomycetes.

  5. Bioprospecting of Novel and Bioactive Compounds from Marine Actinomycetes Isolated from South China Sea Sediments.

    Science.gov (United States)

    Yang, Na; Song, Fuhang

    2018-02-01

    Marine actinomycetes are less investigated compared to terrestrial strains as potential sources of natural products. To date, few investigations have been performed on culturable actinomycetes associated with South China Sea sediments. In the present study, twenty-eight actinomycetes were recovered from South China Sea sediments after dereplication by traditional culture-dependent method. The 16S rRNA gene sequences analyses revealed that these strains related to five families and seven genera. Twelve representative strains possessed at least one of the biosynthetic genes coding for polyketide synthase I, II, and nonribosomal peptide synthetase. Four strains had anti-Mycobacterium phlei activities and five strains had activities against methicillin-resistant Staphylococcus aureus. 10 L-scale fermentation of strains Salinispora sp. NHF45, Nocardiopsis sp. NHF48, and Streptomyces sp. NHF86 were carried out for novel and bioactive compounds discovery. Finally, we obtained a novel α-pyrone compound from marine Nocardiopsis sp. NHF48, an analogue of paulomenol from marine Streptomyces sp. NHF86 and a new source of rifamycin B, produced by Salinispora sp. NHF45. The present study concluded that marine actinomycetes, which we isolated from South China Sea sediments, will be a suitable source for the development of novel and bioactive compounds.

  6. The biodegradation of layered silicates under the influence of cyanobacterial-actinomycetes associations

    Science.gov (United States)

    Ivanova, Ekaterina

    2013-04-01

    The weathering of sheet silicates is well known to be related to local and global geochemical cycles. Content and composition of clay minerals in soil determine the sorption properties of the soil horizons, water-holding capacity of the soil, stickiness, plasticity, etc. Microorganisms have a diverse range of mechanisms of minerals' structure transformation (acid- and alkali formation, biosorption, complexing, etc). One of the methods is an ability of exopolysaccharide-formation, in particular the formation of mucus, common to many bacteria, including cyanobacteria. Mucous covers cyanobacteria are the specific econiches for other bacteria, including actinomycetes. The objective was to analyze the structural changes of clay minerals under the influence of the cyanobacterial-actinomycetes associative growth. The objects of the study were: 1) the experimental symbiotic association, consisting of free-living heterocyst-formative cyanobacterium Anabaena variabilis Kutz. ATCC 294132 and actinomycete Streptomyces cyaneofuscatus FR837630, 2) rock samples obtained from the Museum of the Soil Science Department of the Lomonosov Moscow State University: kaolinite, consisting of kaolin (96%) Al4 (OH) 8 [Si4O10]; mixed with hydromica, chlorite and quartz; vermiculite, consisting of vermiculite (Ca, Mg, ...)*(Mg, Fe)3(OH)2[(Si, Al)4O10]*4H2O and trioctahedral mica (biotite). The mineralogical compositions of the rocks were determined by the universal X-ray Diffractometer Carl Zeiss Yena. The operationg regime was kept constant (30 kv, 40 mA). The cultivation of the association of actinomycete S. cyanoefuscatus and cyanobacterium A. variabilis caused a reduction in the intensity of kaolinite and hydromica reflexes. However, since both (mica and kaolinite) components have a rigid structure, the significant structural transformation of the minerals was not revealed. Another pattern was observed in the experiment, where the rock sample of vermiculite was used as the mineral

  7. Actinomycetes: still a source of novel antibiotics.

    Science.gov (United States)

    Genilloud, Olga

    2017-10-18

    Covering: 2006 to 2017Actinomycetes have been, for decades, one of the most important sources for the discovery of new antibiotics with an important number of drugs and analogs successfully introduced in the market and still used today in clinical practice. The intensive antibacterial discovery effort that generated the large number of highly potent broad-spectrum antibiotics, has seen a dramatic decline in the large pharma industry in the last two decades resulting in a lack of new classes of antibiotics with novel mechanisms of action reaching the clinic. Whereas the decline in the number of new chemical scaffolds and the rediscovery problem of old known molecules has become a hurdle for industrial natural products discovery programs, new actinomycetes compounds and leads have continued to be discovered and developed to the preclinical stages. Actinomycetes are still one of the most important sources of chemical diversity and a reservoir to mine for novel structures that is requiring the integration of diverse disciplines. These can range from novel strategies to isolate species previously not cultivated, innovative whole cell screening approaches and on-site analytical detection and dereplication tools for novel compounds, to in silico biosynthetic predictions from whole gene sequences and novel engineered heterologous expression, that have inspired the isolation of new NPs and shown their potential application in the discovery of novel antibiotics. This review will address the discovery of antibiotics from actinomycetes from two different perspectives including: (1) an update of the most important antibiotics that have only reached the clinical development in the recent years despite their early discovery, and (2) an overview of the most recent classes of antibiotics described from 2006 to 2017 in the framework of the different strategies employed to untap novel compounds previously overlooked with traditional approaches.

  8. Influência da antibiose exercida por actinomicetos às estirpes de Bradyrhizobium SPP., na nodulação da soja Influence of antibiosis produced by actinomycetes on strains of Bradyrhizobium SPP. on soybean nodulation

    Directory of Open Access Journals (Sweden)

    João Carlos Pereira

    1999-01-01

    Full Text Available Este trabalho teve por objetivo avaliar o espectro antibiótico de actinomicetos provenientes de solos de Cerrados e a sua influência na nodulação da soja. As estirpes BR 29, BR 33, BR 40, BR 85, BR 86, BR 96, 47/587, 3B-7 e 4A-5 de Bradyrhizobium spp. apresentaram comportamento diferenciado em relação à resistência natural aos antibióticos produzidos por 204 actinomicetos. As estirpes BR 29 e BR 96 foram sensíveis a 5,2 e 9,9% dos antibióticos produzidos, respectivamente, enquanto a BR 33 apresentou sensibilidade a 20,3%. O antagonismo exercido pelos actinomicetos exclusivamente à BR 29 e BR 33 foi de 1,6 e 5,7%, respectivamente. Esse efeito não foi observado nas estirpes BR 40 e BR 96. Inoculações simples e em mistura das estirpes na presença de actinomicetos influenciaram a nodulação da soja. A co-inoculação da BR 33 e BR 29 com o isolado 370 reduziu o percentual de ocorrência média, nos nódulos, da BR 29, de 94,1% para 83,7%, com conseqüente aumento da BR 33 de 6,7% para 17,2%. Os resultados evidenciam a importância de estudos ecológicos desses microrganismos, visando avaliar o seu papel no estabelecimento de uma nodulação eficiente.The aim of this work was to evaluate the antibiotic spectrum of actinomycetes from Cerrado soils and their influence on soybean nodulation. Strains BR 29, BR 33, BR 40, BR 85, BR 86, BR 96, 47/587, 3B-7 and 4A-5 of Bradyrhizobium spp. were characterized by their natural resistence to antibiotics produced by 204 actinomycete isolates. The strains BR 29 and BR 96 of B. elkanii were sensitive to 5.2% and 9.9% the products of actinomycete isolates, respectively, while BR 33 was sensitive up to 20.3%. The antagonistic effects caused by actinomycete exclusively to BR 29 and BR 33 were 1.6% and 5.7% respectively. This effect was not observed for strains BR 40 and BR 96. Single and multistrains inoculations in the presence or absence of actinomycetes affected soybean nodulation. On double

  9. Diketopiperazine Derivatives from the Marine-Derived Actinomycete Streptomyces sp. FXJ7.328

    Directory of Open Access Journals (Sweden)

    Weiming Zhu

    2013-03-01

    Full Text Available Five new diketopiperazine derivatives, (3Z,6E-1-N-methyl-3-benzy lidene-6-(2S-methyl-3-hydroxypropylidenepiperazine-2,5-dione (1, (3Z,6E-1-N-methyl-3-benzylidene-6-(2R-methyl-3-hydroxypropylidenepiperazine-2,5-dione (2, (3Z,6Z-3- (4-hydroxybenzylidene-6-isobutylidenepiperazine-2,5-dione (3, (3Z,6Z-3-((1H-imidazol-5-yl-methylene-6-isobutylidenepiperazine-2,5-dione (4, and (3Z,6S-3-benzylidene-6-(2S-but-2-ylpiperazine-2,5-dione (5, were isolated from the marine-derived actinomycete Streptomyces sp. FXJ7.328. The structures of 1–5 were determined by spectroscopic analysis, CD exciton chirality, the modified Mosher’s, Marfey’s and the C3 Marfey’s methods. Compound 3 showed modest antivirus activity against influenza A (H1N1 virus with an IC50 value of 41.5 ± 4.5 μM. In addition, compound 6 and 7 displayed potent anti-H1N1 activity with IC50 value of 28.9 ± 2.2 and 6.8 ± 1.5 μM, respectively. Due to the lack of corresponding data in the literature, the 13C NMR data of (3Z,6S-3-benzylidene-6-isobutylpiperazine-2,5-dione (6 were also reported here for the first time.

  10. Antagonistic Bioactivity of Endophytic Actinomycetes Isolated from Medicinal Plants

    Directory of Open Access Journals (Sweden)

    M. Gangwar

    2011-10-01

    Full Text Available Endophytic actinomycetes are promising biocontrol agents for use in agriculture and have been isolated from various plant species. In the present study, 40 endophytic actinomycetes were isolated from roots, stems and leaves of three medicinal plants viz. Aloe vera, Mentha arvensis and Ocimum sanctum. The identification revealed that the majority of the isolates were Streptomyces spp. and the rest were identified as Saccharopolyspora spp., Micromonospora spp. and Actinopolyspora spp. The dual tests revealed that nine endophytic actinomycete isolates displayed a wide spectrum activity against nine fungal phytopathogens. Out of 8 isolates, 90% inhibited the growth of at least one or more phytopathogenic fungi and Saccharopolyspora 0-9 (Out of 8 isolates, 90% inhibited the growth of at least one or more phytopathogenic fungi and Saccharopolyspora 0-9 exhibited antagonistic activity against Aspergillus niger, Aspergillus flavus, Alternaria brassicicola, Botrytis cinerea, Penicillium digitatum, Fusarium oxysporum, Penicillium pinophilum, Phytophthora dresclea and Colletotrichum falcatum.

  11. GlnR-mediated regulation of nitrogen metabolism in the actinomycete Saccharopolyspora erythraea.

    Science.gov (United States)

    Yao, Li-Li; Liao, Cheng-Heng; Huang, Gang; Zhou, Ying; Rigali, Sebastien; Zhang, Buchang; Ye, Bang-Ce

    2014-09-01

    Nitrogen source sensing, uptake, and assimilation are central for growth and development of microorganisms which requires the participation of a global control of nitrogen metabolism-associated genes at the transcriptional level. In soil-dwelling antibiotic-producing actinomycetes, this role is played by GlnR, an OmpR family regulator. In this work, we demonstrate that SACE_7101 is the ortholog of actinomycetes' GlnR global regulators in the erythromycin producer Saccharopolyspora erythraea. Indeed, the chromosomal deletion of SACE_7101 severely affects the viability of S. erythraea when inoculated in minimal media supplemented with NaNO3, NaNO2, NH4Cl, glutamine, or glutamate as sole nitrogen source. Combination of in silico prediction of cis-acting elements, subsequent in vitro (through gel shift assays) and in vivo (real-time reverse transcription polymerase chain reaction) validations of the predicted target genes revealed a very large GlnR regulon aimed at adapting the nitrogen metabolism of S. erythraea. Indeed, enzymes/proteins involved in (i) uptake and assimilation of ammonium, (ii) transport and utilization of urea, (iii) nitrite/nitrate, (iv) glutamate/glutamine, (v) arginine metabolism, (vi) nitric oxide biosynthesis, and (vii) signal transduction associated with the nitrogen source supplied have at least one paralog gene which expression is controlled by GlnR. Our work highlights a GlnR-binding site consensus sequence (t/gna/cAC-n6-GaAAc) which is similar although not identical to the consensus sequences proposed for other actinomycetes. Finally, we discuss the distinct and common features of the GlnR-mediated transcriptional control of nitrogen metabolism between S. erythraea and the model organism Streptomyces coelicolor.

  12. Actinomycetes of Orthosipon stamineus rhizosphere as producer of antibacterial compound against multidrug resistant bacteria

    Science.gov (United States)

    Rante, H.; Yulianty, R.; Usmar; Djide, N.; Subehan; Burhamzah, R.; Prasad, M. B.

    2017-11-01

    The increasing case of antibiotic resistence has become an important problem to be faced in treating the infection diseases. The diversities of microbia, especially actinomycetes bacteria which originated from rizosphere soil of medicinal plant, has opened a chance for discovering the metabolites which can be used in solving the antibiotic resistant pathogenic bacteria problems. The aim of this research was to isolate the actinobacteria originated from medicinal plant rizosphere of Orthosipon stamineus as the producer of anti-multidrug resistances bacteria compounds. Three isolates of actinomycetes has been isolated from Orthosipon stamineus rhizosphere named KC3-1, KC3-2 and KC3-3. One isolate (KC3-3) showed big activity in inhibiting the test microbes by antagonistic test of actinomycetes isolates against Staphylococcus aureus and Eschericia coli antibiotic resistant bacteria. Furthermore, the KC3-3 isolate was fermented in Starch Nitrate Broth (SNB) medium for 14 days. The supernatant and the biomass of the fermentation yield were separated. The supernatant were extracted using ethyl acetate as the solvent and the biomass were extracted using methanol. The antibacterial activity test of ethyl acetate and methanol extract revealed that the extracts can inhibit the bacteria test up to 5% concentration. The ethyl acetate and methanol extracts can inhibit the bacteria test up to 5% concentration.

  13. Biosurfactant produced from Actinomycetes nocardiopsis A17: Characterization and its biological evaluation.

    Science.gov (United States)

    Chakraborty, Samrat; Ghosh, Mandakini; Chakraborti, Srijita; Jana, Sougata; Sen, Kalyan Kumar; Kokare, Chandrakant; Zhang, Lixin

    2015-08-01

    This investigation aims to isolate an Actinomycetes strain producing a biosurfactant from the unexplored region of industrial and coal mine areas. Actinomycetes are selected for this study as their novel chemistry was not exhausted and they have tremendous potential to produce bioactive secondary metabolites. The biosurfactant was characterized and further needed to be utilized for pharmaceutical dosage form. Isolation, purification, screening, and characterization of the Actinomycetes A17 were done followed by its fermentation in optimized conditions. The cell-free supernatant was used for the extraction of the biosurfactant and precipitated by cold acetone. The dried precipitate was purified by TLC and the emulsification index, surface tension and CMC were determined. The isolated strain with preferred results was identified as Actinomycetes nocardiopsis A17 with high foam-forming properties. It gives lipase, amylase, gelatinase, and protease activity. The emulsification index was found to be 93±0.8 with surface tension 66.67 dyne/cm at the lowest concentration and cmc 0.6 μg/ml. These biosurfactants were characterized by Fourier transform infra red (FT-IR) spectroscopy and liquid chromatography-mass spectrometry (LC-MS). Therefore, it can be concluded that the biosurfactant produced by Actinomycetes nocardiopsis sp. strain A17 was found to have satisfactory results with high surface activity and emulsion-forming ability. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Diversity of Endophytic Actinomycetes from Wheat and its Potential as Plant Growth Promoting and Biocontrol Agents

    Directory of Open Access Journals (Sweden)

    M. Gangwar

    2012-01-01

    Full Text Available A total of 35 endophytic actinomycetes strains was isolated from the roots, stems and leaves tissues of healthy wheat plants and identified as Streptomyces sp. (24, Actinopolyspora sp. (3, Nocardia sp. (4, Saccharopolyspora sp. (2 Pseudonocardia (1 and Micromonospora sp. (1. Seventeen endophytic actinomycetes isolate showed abilities to solubilize phosphate and produce IAA in the range of 5 to 42mg/100ml and 18-42µg/ml respectively. Nineteen isolates produced catechol-type of siderophore ranging between 1.3-20.32µg/ml. Also, hydroxamate-type siderophore produced by 9 isolates in the range of 13.33-50.66µg/ml. Maximum catechol-type of siderophore production was observed in Streptomyces roseosporus W9 (20.32µg/ml which was also displaying maximum antagonistic activity against ten different pathogenic fungi. The results indicated that internal tissues of healthy wheat plants exhibited endophytic actinomycetes diversity not only in terms of different types of isolates but also in terms of functional diversity.

  15. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    Science.gov (United States)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  16. Actinomycetes as the causative organism of osteomyelitis in sickle cell disease

    International Nuclear Information System (INIS)

    Barter, S.J.; Hennessy, O.

    1984-01-01

    The case of a 17-year-old girl with sickle cell anaemia who presented with extensive osteomyelitis due to actinomycetes is reported. Osteomyelitis in the long bones due to actinomycosis is extremely rare. A review of the literature reveals only six cases in which actinomycetes have been isolated from lesions affecting a long bone. The occurence of this condition in sickle cell haemoglobinopathy has not been previously reported. (orig.)

  17. In silico studies on marine actinomycetes as potential inhibitors for Glioblastoma multiforme

    Science.gov (United States)

    Kirubakaran, Palani; Kothapalli, Roopa; Singh, Kh Dhanachandra; Nagamani, Selvaraman; Arjunan, Subramanian; Muthusamy, Karthikeyan

    2011-01-01

    Glioblastoma multiforme (GBM) is considered to be the most common and often deadly disorder which affects the brain. It is caused by the over expression of proteins such as ephrin type-A receptor 2 (EphA2), epidermal growth factor receptor (EGFR) and EGFRvIII. These 3 proteins are considered to be the potential therapeutic targets for GBM. Among these, EphA2 is reported to be over-expressed in ˜90% of GBM. Herein we selected 35 compounds from marine actinomycetes, 5 in vitro and in vivo studied drug candidates and 4 commercially available drugs for GBM which were identified from literature and analysed by using comparative docking studies. Based on the glide scores and other in silico parameters available in Schrödinger, two selected marine actinomycetes compounds which include Tetracenomycin D and Chartreusin exhibited better binding energy among all the compounds studied in comparative docking. In this study we have demonstrated the inhibition of the 3 selected targets by the two bioactive compounds from marine actinomycetes through in-silico docking studies. Furthermore molecular dynamics simulation were also been performed to check the stability and the amino acids interacted with the 3 molecular targets (EphA2 receptor, EGFR, EGFRvIII) for GBM. Our results suggest that Tetracinomycin D and Chartreusin are the novel and potential inhibitor for the treatment of GBM. PMID:21584184

  18. Identification of actinomycetes from plant rhizospheric soils with inhibitory activity against Colletotrichum spp., the causative agent of anthracnose disease.

    Science.gov (United States)

    Intra, Bungonsiri; Mungsuntisuk, Isada; Nihira, Takuya; Igarashi, Yasuhiro; Panbangred, Watanalai

    2011-04-01

    Colletotrichum is one of the most widespread and important genus of plant pathogenic fungi worldwide. Various species of Colletotrichum are the causative agents of anthracnose disease in plants, which is a severe problem to agricultural crops particularly in Thailand. These phytopathogens are usually controlled using chemicals; however, the use of these agents can lead to environmental pollution. Potential non-chemical control strategies for anthracnose disease include the use of bacteria capable of producing anti-fungal compounds such as actinomycetes spp., that comprise a large group of filamentous, Gram positive bacteria from soil. The aim of this study was to isolate actinomycetes capable of inhibiting the growth of Colletotrichum spp, and to analyze the diversity of actinomycetes from plant rhizospheric soil. A total of 304 actinomycetes were isolated and tested for their inhibitory activity against Colletotrichum gloeosporioides strains DoA d0762 and DoA c1060 and Colletotrichum capsici strain DoA c1511 which cause anthracnose disease as well as the non-pathogenic Saccharomyces cerevisiae strain IFO 10217. Most isolates (222 out of 304, 73.0%) were active against at least one indicator fungus or yeast. Fifty four (17.8%) were active against three anthracnose fungi and 17 (5.6%) could inhibit the growth of all three fungi and S. cerevisiae used in the test. Detailed analysis on 30 selected isolates from an orchard at Chanthaburi using the comparison of 16S rRNA gene sequences revealed that most of the isolates (87%) belong to the genus Streptomyces sp., while one each belongs to Saccharopolyspora (strain SB-2) and Nocardiopsis (strain CM-2) and two to Nocardia (strains BP-3 and LK-1). Strains LC-1, LC-4, JF-1, SC-1 and MG-1 exerted high inhibitory activity against all three anthracnose fungi and yeast. In addition, the organic solvent extracts prepared from these five strains inhibited conidial growth of the three indicator fungi. Preliminary analysis of crude

  19. YebU is a m5C methyltransferase specific for 16 S rRNA nucleotide 1407

    DEFF Research Database (Denmark)

    Andersen, Niels Møller; Douthwaite, Stephen

    2006-01-01

    generally require specific enzymes, and only one m5C rRNA methyltransferase, RsmB (formerly Fmu) that methylates nucleotide C967, has previously been identified. BLAST searches of the E.coli genome revealed a single gene, yebU, with sufficient similarity to rsmB to encode a putative m5C RNA...... methyltransferase. This suggested that the yebU gene product modifies C1407 and/or C1962. Here, we analysed the E.coli rRNAs by matrix assisted laser desorption/ionization mass spectrometry and show that inactivation of the yebU gene leads to loss of methylation at C1407 in 16 S rRNA, but does not interfere...

  20. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    Science.gov (United States)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  1. Antimicrobial Activity of Actinomycetes Against Multidrug Resistant ...

    African Journals Online (AJOL)

    Antimicrobial Activity of Actinomycetes Against Multidrug Resistant Staphylococcus aureus, E. coli and Various Other Pathogens. ... Purpose: The rapid emergence of drug resistance among pathogenic bacteria, especially multidrugresistant bacteria, underlines the need to look for new antibiotics. Methods: In the present ...

  2. A single methyltransferase YefA (RlmCD) catalyses both m5U747 and m5U1939 modifications in Bacillus subtilis 23S rRNA

    DEFF Research Database (Denmark)

    Desmolaize, Benoit; Fabret, Céline; Brégeon, Damien

    2011-01-01

    Escherichia coli possesses three paralogues. These comprise the methyltransferases TrmA that targets U54 in tRNAs, RlmC that modifies U747 in 23S rRNA and RlmD that is specific for U1939 in 23S rRNA. The tRNAs and rRNAs of the Gram-positive bacterium Bacillus subtilis have the same three m(5)U modifications....... However, as previously shown, the m(5)U54 modification in B. subtilis tRNAs is catalysed in a fundamentally different manner by the folate-dependent enzyme TrmFO, which is unrelated to the E. coli TrmA. Here, we show that methylation of U747 and U1939 in B. subtilis rRNA is catalysed by a single enzyme...

  3. [Study of marine actinomycetes isolated from the central coast of Peru and their antibacterial activity against methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus faecalis].

    Science.gov (United States)

    León, Jorge; Aponte, Juan José; Rojas, Rosario; Cuadra, D'Lourdes; Ayala, Nathaly; Tomás, Gloria; Guerrero, Marco

    2011-06-01

    To determine the antimicrobial potential of marine actinomycetes against drug-resistant pathogens represented by strains of methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant Enterococcus faecalis (VRE). Strains of actinomycetes (29) isolated from marine sediment were evaluated by their characteristics in two culture media and by testing their inhibitory capacity by in vitro antagonism against multi-drug resistant (MDR) pathogenic bacteria for MRSA and VRE. Organic extracts of 3 selected actinomicetes were processed to determine the minimum inhibitory concentration (MIC) of the active compound. Most isolated actinomycetes belong to a homogeneous group of write-gray actinomycetes with a good growth in Marine Agar. The inhibitory rates of the isolates were above 85% for both pathogens with inhibition zones greater than 69 and 78 mm in diameter for MRSA and VRE respectively. Dichloromethane extracts of 3 isolates (I-400A, B1-T61, M10-77) showed strong inhibitory activity of both pathogens, M10-77 being the highest actinomycete strain with antibiotic activity against methicillin-resistant S. aureus ATCC 43300 and vancomycin-resistant E. faecalis ATCC 51299 with a minimum inhibitory concentrations (MIC) of 7.9 and 31.7 μg/ml respectively. Phylogenetic analysis of M10-77 strain showed 99% similarity with the marine species Streptomyces erythrogriseus. Marine sediments of the central coast of Peru, are a source of actinomycetes strains showing high capacity to produce bioactive compounds able to inhibit pathogens classified as multi-drug-resistant such as methicillin-resistant S. aureus and vancomycin-resistant E. faecalis.

  4. Xylanase and feruloyl esterase from actinomycetes cultures could enhance sugarcane bagasse hydrolysis in the production of fermentable sugars.

    Science.gov (United States)

    Rahmani, Nanik; Kahar, Prihardi; Lisdiyanti, Puspita; Hermiati, Euis; Lee, Jaemin; Yopi; Prasetya, Bambang; Ogino, Chiaki; Kondo, Akihiko

    2018-02-23

    The addition of enzymes that are capable of degrading hemicellulose has a potential to reduce the need for commercial enzymes during biomass hydrolysis in the production of fermentable sugars. In this study, a high xylanase producing actinomycete strain (Kitasatospora sp. ID06-480) and the first ethyl ferulate producing actinomycete strain (Nonomuraea sp. ID06-094) were selected from 797 rare actinomycetes, respectively, which were isolated in Indonesia. The addition (30%, v/v) of a crude enzyme supernatant from the selected strains in sugarcane bagasse hydrolysis with low-level loading (1 FPU/g-biomass) of Cellic® CTec2 enhanced both the released amount of glucose and reducing sugars. When the reaction with Ctec2 was combined with crude enzymes containing either xylanase or feruloyl esterase, high conversion yield of glucose from cellulose at 60.5% could be achieved after 72 h-saccharification.

  5. Unusual multifocal granulomatous disease caused by actinomycetous bacteria in a nestling Derbyan parrot (Psittacula derbiana).

    Science.gov (United States)

    Park, F J; Jaensch, S

    2009-01-01

    A nestling Derbyan parrot (Psittacula derbiana) was presented with unusual subcutaneous swellings of the thigh regions, and poor growth. Histological examination revealed actinomycetous bacteria associated with multifocal systemic granulomas. The clinical and pathological findings of the case are presented, and some relevant aspects of actinomycetous bacterial infections in mammals and birds are discussed. Although granulomatous disease is encountered at times in avian species, the actinomycetous bacteria (Nocardia and Actinomyces spp.) have rarely been reported in association with multifocal granulomatous disease in birds.

  6. Genetic screening strategy for rapid access to polyether ionophore producers and products in actinomycetes.

    Science.gov (United States)

    Wang, Hao; Liu, Ning; Xi, Lijun; Rong, Xiaoying; Ruan, Jisheng; Huang, Ying

    2011-05-01

    Polyether ionophores are a unique class of polyketides with broad-spectrum activity and outstanding potency for the control of drug-resistant bacteria and parasites, and they are produced exclusively by actinomycetes. A special epoxidase gene encoding a critical tailoring enzyme involved in the biosynthesis of these compounds has been found in all five of the complete gene clusters of polyether ionophores published so far. To detect potential producer strains of these antibiotics, a pair of degenerate primers was designed according to the conserved regions of the five known polyether epoxidases. A total of 44 putative polyether epoxidase gene-positive strains were obtained by the PCR-based screening of 1,068 actinomycetes isolated from eight different habitats and 236 reference strains encompassing eight major families of Actinomycetales. The isolates spanned a wide taxonomic diversity based on 16S rRNA gene analysis, and actinomycetes isolated from acidic soils seemed to be a promising source of polyether ionophores. Four genera were detected to contain putative polyether epoxidases, including Micromonospora, which has not previously been reported to produce polyether ionophores. The designed primers also detected putative epoxidase genes from diverse known producer strains that produce polyether ionophores unrelated to the five published gene clusters. Moreover, phylogenetic and chemical analyses showed a strong correlation between the sequence of polyether epoxidases and the structure of encoded polyethers. Thirteen positive isolates were proven to be polyether ionophore producers as expected, and two new analogues were found. These results demonstrate the feasibility of using this epoxidase gene screening strategy to aid the rapid identification of known products and the discovery of unknown polyethers in actinomycetes.

  7. Actinomycetes from Eucalyptus and their biological activities for controlling Eucalyptus leaf and shoot blight.

    Science.gov (United States)

    Himaman, Winanda; Thamchaipenet, Arinthip; Pathom-Aree, Wasu; Duangmal, Kannika

    2016-01-01

    In Thailand, Eucalyptus plantations rapidly expand across the country. Leaf and shoot blight caused by Cryptosporiopsis eucalypti, Cylindrocladium sp. and Teratosphaeria destructans is a serious disease in Eucalyptus plantations. In this study, a total of 477 actinomycete strains were successfully isolated from roots and rhizosphere soil of Eucalyptus. Four hundred and thirty nine isolates were classified as streptomycetes and 38 isolates were non-streptomycetes. Among these isolates, 272 (57.0%), 118 (24.7%) and 241 (50.5%) isolates were antagonistic to Cryptosporiopsis eucalypti, Cylindrocladium sp. and Teratosphaeria destructans, respectively. All isolates were tested for their abilities to produce siderophores, indole acetic acid (IAA) and solubilise phosphate. Most isolates (464, 97.3%) produced siderophores. The majority of isolates (345, 72.3%) solubilised phosphate. In addition, almost half of these isolates (237, 49.7%) produced indole acetic acid. Strain EUSKR2S82 which showed the strongest inhibitory effect against all tested fungi with plant growth promoting ability was selected to test with Eucalyptus. This strain could colonize plant roots and increase Eucalyptus roots length. In a detached leaves bioassay, the disease severity of EUSKR2S82-inoculated Eucalyptus leaves was only 30% compared to 95% in the control treatment. The 16S rRNA gene sequence analysis revealed that the strain EUSKR2S82 was related to Streptomyces ramulosus NRRL-B 2714(T) (99.44% similarity). Identification of non-streptomycete isolates using 16S rRNA gene sequences classified them into 9 genera: Actinoallomurus, Actinomadura, Amycolatopsis, Cryptosporangium, Microbispora, Micromonospora, Nocardia, Nonomuraea and Pseudonocardia. It is evident that Eucalyptus tree harbored several genera of actinomycetes. The selected isolate, EUSKR2S82 showed potential as a candidate for biocontrol agent of leaf and shoot blight of Eucalyptus and to promote growth. Copyright © 2016 Elsevier Gmb

  8. Identification of some actinomycete species by restrication ...

    African Journals Online (AJOL)

    EcoRI, StyI, AvaI, BanI, HindIII, NaeI, AsnI and BanII) to obtain restriction fragment length polymorphisms (RFLPs). The PCR/RFLP profiles of SrRNA genes indicated that the actinomycete isolates are polyphylogenetic when digested with BanI ...

  9. Enrichment Method for the Isolation of Bioactive Actinomycetes From Mangrove Sediments of Andaman Islands, India

    Directory of Open Access Journals (Sweden)

    Baskaran, R.

    2011-01-01

    Full Text Available Various pre-treatment methods and three different media were employed for the isolation of bioactive actinomycetes from mangrove sediments of Andaman and Nicobar Islands, India. Sediments from four different sites of mangrove forest were collected and pre-treated by dry heat method, and the media were supplemented with cycloheximide 80 µg/mL and nalidixic acid 75 µg/mL. The mean actinomycetes population density in sediment samples were recorded as 22 CFU-10^-6/gm in KUA medium followed by 12 CFU-10^-6/gm in AIA medium and 8 CFU-10^-6/gm in SCA medium. A total of 42 actinomycetes were isolated, and all the isolates were evaluated for their antibacterial activity against pathogenic bacteria on two different media. Among 42 isolates tested, 22 species were found to be antibacterial metabolite producer against test bacteria namely, Staphylococcus aureus, Bacillus subtilis, Salmonella typhi and Klebsiella pneumoniae. Particularly, the actinomycete strains such as A101, A102, A107, A116, A121, A125, A130, F101, F102, F104, F106, De101 and De102 significantly inhibited the growth of all bacteria which were tested. Of these strains, A107 was identified as Streptomyces spp. This strain had the maximum activity against all used pathogens on both medium. Hence, the isolation, characterization and studies of secondary metabolites of actinomycetes from mangrove sediments in Andaman and Nicobar Island could be a pathway for discovery of antibiotics from marine actinomycetes.

  10. SCREENING OF ANTIMICROBIAL ACTIVITY AND GENES CODING POLYKETIDE SYNTHETASE AND NONRIBOSOMAL PEPTIDE SYNTHETASE OF ACTINOMYCETE ISOLATES

    Directory of Open Access Journals (Sweden)

    Silvia Kovácsová

    2013-12-01

    Full Text Available The aim of this study was to observe antimicrobial activity using agar plate diffusion method and screening genes coding polyketide synthetase (PKS-I and nonribosomal peptide synthetase (NRPS from actinomycetes. A total of 105 actinomycete strains were isolated from arable soil. Antimicrobial activity was demonstrated at 54 strains against at least 1 of total 12 indicator organisms. Antifungal properties were recorded more often than antibacterial properties. The presence of PKS-I and NRPS genes were founded at 61 of total 105 strains. The number of strains with mentioned biosynthetic enzyme gene fragments matching the anticipated length were 19 (18% and 50 (47% respectively. Overall, five actinomycete strains carried all the biosynthetical genes, yet no antimicrobial activity was found against any of tested pathogens. On the other hand, twenty-one strains showed antimicrobial activity even though we were not able to amplify any of the PKS or NRPS genes from them. Combination of the two methods showed broad-spectrum antimicrobial activity of actinomycetes isolated from arable soil, which indicate that actinomycetes are valuable reservoirs of novel bioactive compounds.

  11. Larvicidal potential of Asteraceae family endophytic actinomycetes against Culex quinquefasciatus mosquito larvae.

    Science.gov (United States)

    Tanvir, Rabia; Sajid, Imran; Hasnain, Shahida

    2014-01-01

    Pakistan is blessed with plants of Asteraceae family with known medicinal background used for centuries by Hakims (traditional physicians). Keeping in mind the background of their anti-larval potential, a total of 21 endophytic actinomycetes were isolated from four Asteraceae plants and screened against the first and fourth instar stages of Culex quinquefasciatus Say mosquito larvae. Of the 21 isolates, 6 of them gave strong larvicidal activity (80-100% mortality) in the screening results and 4 isolates gave a potent larvicidal activity (100% mortality) at the fourth instar stage. These isolates belonged to different species within the actinomycetes group, namely Streptomyces albovinaceus and Streptomyces badius. This communication reports the larvicidal potential of endophytic actinomycetes residing within the native Asteraceae plants in Pakistan. The study suggests further exploration through large-scale productions leading to the identification of the larvicidal compounds.

  12. Halophilic and halotolerant actinomycetes from a marine saltern of Goa, India producing anti-bacterial metabolites.

    Science.gov (United States)

    Ballav, Shuvankar; Kerkar, Savita; Thomas, Sabu; Augustine, Nimmy

    2015-03-01

    Marine salterns are estuarine ecosystems in Goa, receiving inputs from riverine and marine waters. The Salinity fluctuates between 0 and 300 psu which makes it a conducive niche for salt tolerant and salt loving Actinomycetales. Halotolerant and halophilic Actinomycetales producing anti-bacterial metabolites were studied from crystallizer pond sediments of Ribandar saltern, Goa. Three media viz. Starch casein, R2A and Inorganic salt starch agar at four different salinities (35, 50, 75 and 100 psu) were used for isolation. R2A agar at 35 psu was the most preferred by hypersaline actinomycetes. The dominant group was halotolerant Streptomyces spp. others being rare actinomycetes viz. Nocardiopsis, Micromonospora and Kocuria spp. More than 50% of the isolates showed anti-bacterial activity against one or more of the fifteen human pathogens tested. Eight strains from 4 genera showed consistent anti-bacterial activity and studied in detail. Most halotolerant isolates grew from 0 to 75 psu, with optimum antibiotic production at 35 psu whereas halophiles grew at 20 to 100 psu with optimum antibiotic production at 35 psu. Four Streptomyces strains showed multiple inhibition against test organisms while four rare actinomycetes were specific in their inhibitory activity. This is the first report of a halophilic Kocuria sp., Nocardiopsis sp., and halotolerant Micromonospora sp. producing anti-bacterial compound(s) against Staphylococcus aureus, Staphylococcus citreus, and Vibrio cholerae, respectively. Sequential extraction with varying polarity of organic solvents showed that the extracts inhibited different test pathogens. These results suggest that halophilic and halotolerant actinomycetes from marine salterns are a potential source of anti-bacterial compounds. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  13. Antibiotic Producing Potentials of Three Freshwater Actinomycetes Isolated from the Eastern Cape Province of South Africa

    Directory of Open Access Journals (Sweden)

    Timothy Sibanda

    2010-07-01

    Full Text Available Crude extracts of three actinomycetes species belonging to Saccharopolyspora (TR 046 and TR 039 and Actinosynnema (TR 024 genera were screened for antibacterial activities against a panel of several bacterial strains. The extracts showed antibacterial activities against both gram-negative and gram-positive test bacteria with inhibition zones ranging from 8 to 28 mm (TR 046; 8 to15 mm (TR 039; and 10 to 13 mm (TR 024. The minimum inhibitory concentrations ranged from 0.078 to 10 mg/mL (TR 046; 5 to >10 mg/mL (TR 039; and 1.25 to 5 mg/mL (TR 024. Time-kill studies revealed that crude extract of TR 046 showed strong bactericidal activity against Bacillus pumilus (ATCC14884, reducing the bacterial load by 104 cfu/mL and 102 cfu/mL at 4× MIC and 2× MIC, respectively, after 6 h of exposure. Similarly, against Proteus vulgaris (CSIR 0030, crude extract of TR 046 achieved a 0.9log10 and 0.13log10 cfu/mL reduction at 5 mg/mL (4× MIC and 1.25 mg/mL (2× MIC after 12 h of exposure. The extract was however weakly bactericidal against two environmental bacterial strains (Klebsiella pneumoniae and Staphylococcus epidermidis; and against Pseudomonas aeruginosa (ATCC 19582: the extract showed bacteriostatic activities at all concentrations tested. These freshwater actinomycetes appear to have immense potential as a source of new antibacterial compound(s.

  14. CRISPR-Cas9 Toolkit for Actinomycete Genome Editing

    DEFF Research Database (Denmark)

    Tong, Yaojun; Robertsen, Helene Lunde; Blin, Kai

    2018-01-01

    engineering approaches for boosting known and discovering novel natural products. In order to facilitate the genome editing for actinomycetes, we developed a CRISPR-Cas9 toolkit with high efficiency for actinomyces genome editing. This basic toolkit includes a software for spacer (sgRNA) identification......, a system for in-frame gene/gene cluster knockout, a system for gene loss-of-function study, a system for generating a random size deletion library, and a system for gene knockdown. For the latter, a uracil-specific excision reagent (USER) cloning technology was adapted to simplify the CRISPR vector...... construction process. The application of this toolkit was successfully demonstrated by perturbation of genomes of Streptomyces coelicolor A3(2) and Streptomyces collinus Tü 365. The CRISPR-Cas9 toolkit and related protocol described here can be widely used for metabolic engineering of actinomycetes....

  15. Problem-Based Test: Functional Analysis of Mutant 16S rRNAs

    Science.gov (United States)

    Szeberenyi, Jozsef

    2010-01-01

    Terms to be familiar with before you start to solve the test: ribosome, ribosomal subunits, antibiotics, point mutation, 16S, 5S, and 23S rRNA, Shine-Dalgarno sequence, mRNA, tRNA, palindrome, hairpin, restriction endonuclease, fMet-tRNA, peptidyl transferase, initiation, elongation, termination of translation, expression plasmid, transformation,…

  16. Enumerating actinomycetes in compost bioaerosols at source—Use of soil compost agar to address plate 'masking'

    Science.gov (United States)

    Taha, M. P. M.; Drew, G. H.; Tamer Vestlund, A.; Aldred, D.; Longhurst, P. J.; Pollard, S. J. T.

    Actinomycetes are the dominant bacteria isolated from bioaerosols sampled at composting facilities. Here, a novel method for the isolation of actinomycetes is reported, overcoming masking of conventional agar plates, as well as reducing analysis time and costs. Repeatable and reliable actinomycetes growth was best achieved using a soil compost media at an incubation temperature of 44 °C and 7 days' incubation. The results are of particular value to waste management operators and their advisors undertaking regulatory risk assessments that support environmental approvals for compost facilities.

  17. Isolation, characterization and identification of actinomycetes from ...

    African Journals Online (AJOL)

    A total of 62 isolates of actinomycetes were isolated from 7 soil samples collected from Agriculture Research Center Semongok, Sarawak. All 62 isolates exhibited a range of colony colours (dark grey, grey, dark brown, brownish, whitish and yellowish white). All the isolates were later purified and subjected to a few ...

  18. Changes in Actinomycetes community structure under the influence of Bt transgenic brinjal crop in a tropical agroecosystem.

    Science.gov (United States)

    Singh, Amit Kishore; Singh, Major; Dubey, Suresh Kumar

    2013-05-29

    The global area under brinjal cultivation is expected to be 1.85 million hectare with total fruit production about 32 million metric tons (MTs). Brinjal cultivars are susceptible to a variety of stresses that significantly limit productivity. The most important biotic stress is caused by the Brinjal fruit and shoot Borer (FSB) forcing farmers to deploy high doses of insecticides; a matter of serious health concern. Therefore, to control the adverse effect of insecticides on the environment including the soil, transgenic technology has emerged as the effective alternative. However, the reports, regarding the nature of interaction of transgenic crops with the native microbial community are inconsistent. The effect of a Bt transgenic brinjal expressing the bio-insecticidal protein (Cry1Ac) on the rhizospheric community of actinomycetes has been assessed and compared with its non-transgenic counterpart. Significant variation in the organic carbon observed between the crops (non-Bt and Bt brinjal) may be due to changes in root exudates quality and composition mediated by genetic attributes of Bt transgenic brinjal. Real time quantitative PCR indicated significant differences in the actinomycetes- specific 16S rRNA gene copy numbers between the non-Bt (5.62-27.86) × 1011 g-1 dws and Bt brinjal planted soil (5.62-24.04) × 1011 g-1 dws. Phylogenetic analysis indicated 14 and 11, actinomycetes related groups in soil with non-Bt and Bt brinjal crop, respectively. Micrococaceaea and Nocardiodaceae were the dominant groups in pre-vegetation, branching, flowering, maturation and post-harvest stage. However, Promicromonosporaceae, Streptosporangiaceae, Mycobacteriaceae, Geodermatophilaceae, Frankiaceae, Kineosporaceae, Actisymmetaceae and Streptomycetaceae were exclusively detected in a few stages in non-Bt brinjal rhizosphere soil while Nakamurellaceae, Corynebactericeae, Thermomonosporaceae and Pseudonocardiaceae in Bt brinjal counterpart. Field trails envisage

  19. Enhancement of antibiotic productions by engineered nitrate utilization in actinomycetes.

    Science.gov (United States)

    Meng, Sitong; Wu, Hang; Wang, Lei; Zhang, Buchang; Bai, Linquan

    2017-07-01

    Nitrate is necessary for primary and secondary metabolism of actinomycetes and stimulates the production of a few antibiotics, such as lincomycin and rifamycin. However, the mechanism of this nitrate-stimulating effect was not fully understood. Two putative ABC-type nitrate transporters were identified in Streptomyces lincolnensis NRRL2936 and verified to be involved in lincomycin biosynthesis. With nitrate supplementation, the transcription of nitrogen assimilation genes, nitrate-specific ABC1 transporter genes, and lincomycin exporter gene lmrA was found to be enhanced and positively regulated by the global regulator GlnR, whose expression was also improved. Moreover, heterologous expression of ABC2 transporter genes in Streptomyces coelicolor M145 resulted in an increased actinorhodin production. Further incorporation of a nitrite-specific transporter gene nirC, as in nirC-ABC2 cassette, led to an even higher actinorhodin production. Similarly, the titers of salinomycin, ansamitocin, lincomycin, and geldanamycin were increased with the integration of this cassette to Streptomyces albus BK3-25, Actinosynnema pretiosum ATCC31280, S. lincolnensis LC-G, and Streptomyces hygroscopicus XM201, respectively. Our work expanded the nitrate-stimulating effect to many antibiotic producers by utilizing the nirC-ABC2 cassette for enhanced nitrate utilization, which could become a general tool for titer increase of antibiotics in actinomycetes.

  20. Antimicrobial activity of some actinomycetes from Western Ghats of ...

    African Journals Online (AJOL)

    Antimicrobial activity of some actinomycetes from Western Ghats of Tamil Nadu, India. ... Alexandria Journal of Medicine ... Introduction: Microbial diseases are increasing year by year and they are becoming a big threat to public health.

  1. Genetic Screening Strategy for Rapid Access to Polyether Ionophore Producers and Products in Actinomycetes ▿ †

    Science.gov (United States)

    Wang, Hao; Liu, Ning; Xi, Lijun; Rong, Xiaoying; Ruan, Jisheng; Huang, Ying

    2011-01-01

    Polyether ionophores are a unique class of polyketides with broad-spectrum activity and outstanding potency for the control of drug-resistant bacteria and parasites, and they are produced exclusively by actinomycetes. A special epoxidase gene encoding a critical tailoring enzyme involved in the biosynthesis of these compounds has been found in all five of the complete gene clusters of polyether ionophores published so far. To detect potential producer strains of these antibiotics, a pair of degenerate primers was designed according to the conserved regions of the five known polyether epoxidases. A total of 44 putative polyether epoxidase gene-positive strains were obtained by the PCR-based screening of 1,068 actinomycetes isolated from eight different habitats and 236 reference strains encompassing eight major families of Actinomycetales. The isolates spanned a wide taxonomic diversity based on 16S rRNA gene analysis, and actinomycetes isolated from acidic soils seemed to be a promising source of polyether ionophores. Four genera were detected to contain putative polyether epoxidases, including Micromonospora, which has not previously been reported to produce polyether ionophores. The designed primers also detected putative epoxidase genes from diverse known producer strains that produce polyether ionophores unrelated to the five published gene clusters. Moreover, phylogenetic and chemical analyses showed a strong correlation between the sequence of polyether epoxidases and the structure of encoded polyethers. Thirteen positive isolates were proven to be polyether ionophore producers as expected, and two new analogues were found. These results demonstrate the feasibility of using this epoxidase gene screening strategy to aid the rapid identification of known products and the discovery of unknown polyethers in actinomycetes. PMID:21421776

  2. Evaluation of antagonistic and plant growth promoting activities of chitinolytic endophytic actinomycetes associated with medicinal plants against Sclerotium rolfsii in chickpea.

    Science.gov (United States)

    Singh, S P; Gaur, R

    2016-08-01

    To evaluate the potential of chitinolytic endophytic Actinomycetes isolated from medicinal plants in order to diminish the collar rot infestation induced by Sclerotium rolfsii in chickpea. Sixty-eight chitinolytic endophytic Actinomycetes were recovered from various medicinal plants and evaluated for their chitinase activity. Among these isolates, 12 were screened for their plant growth promoting abilities and antagonistic potential against Sc. rolfsii. Further, these isolates were validated in vivo for their ability to protect chickpea against Sc. rolfsii infestation under greenhouse conditions. The isolates significantly (P plant mortality (42-75%) of chickpea. On the basis of 16S rDNA profiling, the selected antagonistic strains were identified as Streptomyces diastaticus, Streptomyces fradiae, Streptomyces olivochromogenes, Streptomyces collinus, Streptomyces ossamyceticus and Streptomyces griseus. This study is the first report of the isolation of endophytic Actinomycetes from various medicinal plants having antagonistic and plant growth promoting abilities. The isolated species showed potential for controlling collar rot disease on chickpea and could be useful in integrated control against diverse soil borne plant pathogens. Our investigation suggests that endophytic Actinomycetes associated with medicinal plants can be used as bioinoculants for developing safe, efficacious and environment-friendly biocontrol strategies in the near future. © 2016 The Society for Applied Microbiology.

  3. First records of sponge-associated Actinomycetes from two coastal ...

    African Journals Online (AJOL)

    First records of sponge-associated Actinomycetes from two coastal sponges from Mauritius. Sandeep Shivram Beepat, Chandani Appadoo, Daniel Edgard Pierre Marie, Shamimtaz Bibi Sadally, Jose Pavao Mendes Paula, Kannan Sivakumar, Rashmi Ragothama Rao, Maryam Salah ...

  4. Biological active compounds from actinomycetes isolated from soil ...

    African Journals Online (AJOL)

    sunny

    2014-12-03

    Dec 3, 2014 ... Key words: Actinomycetes, anthracnose, bioactivity, biodiversity, Malaysia. INTRODUCTION. Soil microbes which had been known to possess the ability to act as degradation and biocontrol agents have been widely studied by researchers around the world. One of these well-known soil microbes are the.

  5. Competitive biosorption of thorium and uranium by actinomycetes

    International Nuclear Information System (INIS)

    Nakajima, Akira; Tsuruta, Takehiko

    2002-01-01

    The competitive biosorption of thorium and uranium by actinomycetes was examined. Of the actinomycetes tested, Streptomyces levoris showed the highest ability to sorb both thorium and uranium from aqueous systems. Thorium sorption was not affected by co-existed uranium, while uranium sorption was strongly hindered by co-existed thorium. The amounts of both thorium and uranium sorbed by Streptomyces levoris cells increased with an increase of the solution pH. Although the equilibrium isotherm of uranium biosorption is in similar manner as that of thorium biosorption, uranium was sorbed much faster than thorium. Biosorption isotherm of each metal ion could be well fitted by Langmuir isotherm taking the ionic charge of metal ions into account. The Langmuir isotherm for binary system did not explain completely the competitive biosorption of thorium and uranium by Streptomyces levoris. However, the results suggested that the ion species of both metals in the cells should be Th(OH) 2 2+ and UO 2 2+ , respectively. (author)

  6. Environmental and metabolomic study of antibiotic production by actinomycetes

    NARCIS (Netherlands)

    Zhu, Hua

    2014-01-01

    This thesis may be regarded as a concept work, to see how feasible drug discovery approaches still are. For this, a strain collection was built up consisting of actinomycetes from soil in the Qinling and Himalaya mountains, which were subsequently tested for antibiotic production against multi-drug

  7. A mixed community of actinomycetes produce multiple antibiotics for the fungus farming ant Acromyrmex octospinosus

    Directory of Open Access Journals (Sweden)

    Barke Jörg

    2010-08-01

    Full Text Available Abstract Background Attine ants live in an intensely studied tripartite mutualism with the fungus Leucoagaricus gongylophorus, which provides food to the ants, and with antibiotic-producing actinomycete bacteria. One hypothesis suggests that bacteria from the genus Pseudonocardia are the sole, co-evolved mutualists of attine ants and are transmitted vertically by the queens. A recent study identified a Pseudonocardia-produced antifungal, named dentigerumycin, associated with the lower attine Apterostigma dentigerum consistent with the idea that co-evolved Pseudonocardia make novel antibiotics. An alternative possibility is that attine ants sample actinomycete bacteria from the soil, selecting and maintaining those species that make useful antibiotics. Consistent with this idea, a Streptomyces species associated with the higher attine Acromyrmex octospinosus was recently shown to produce the well-known antifungal candicidin. Candicidin production is widespread in environmental isolates of Streptomyces, so this could either be an environmental contaminant or evidence of recruitment of useful actinomycetes from the environment. It should be noted that the two possibilities for actinomycete acquisition are not necessarily mutually exclusive. Results In order to test these possibilities we isolated bacteria from a geographically distinct population of A. octospinosus and identified a candicidin-producing Streptomyces species, which suggests that they are common mutualists of attine ants, most probably recruited from the environment. We also identified a Pseudonocardia species in the same ant colony that produces an unusual polyene antifungal, providing evidence for co-evolution of Pseudonocardia with A. octospinosus. Conclusions Our results show that a combination of co-evolution and environmental sampling results in the diversity of actinomycete symbionts and antibiotics associated with attine ants.

  8. Four new anthraquinones from a soil actinomycete Streptomyces sp. WS-13394 and their bioactivities.

    Science.gov (United States)

    Wu, Zhaoyuan; Zhang, Yani; Fang, Wei; Shi, Liqiao; Wan, Zhongyi

    2018-02-01

    Further chemical study of secondary metabolites from the soil actinomycete Streptomyces sp. WS-13394 resulted in the isolation of four new alkylated anthraquinone analogues (5-8). Their structures were elucidated on the basis of extensive spectroscopic analysis, including HR-ESI-MS, 1D and 2D NMR. The new compounds, together with analogues obtained before (1-4), were tested for their in vitro cytotoxicity against Huh-7 and SGC-7901.

  9. Effect of the presence of Actinomycetes in the activated sludge on the quality of the treated wastewater

    Directory of Open Access Journals (Sweden)

    Bezak-Mazur Elżbieta

    2017-01-01

    Full Text Available The aim of the study was to determine the effect of the Actinomycetes proliferation in the activated sludge on the quality of the treated wastewater and the sewage receiver. The river which is the sewage receiver flows near the wastewater treatment plant. The study was performed on the wastewater (raw and treated and on the river water samples (collected before and after wastewater discharge. The analysis of the research results, such as the content of total organic carbon (TOC, total phosphorus and oxygen consumption in the examined samples, permit the conclusion that the presence of relatively large population of the Actinomycetes in sewage sludge has a negative impact on the quality of the sewage receiver. Determining the effect of the Actinomycetes in the activated sludge on the wastewater treatment process involved the application of specific analyses, such as Sludge Biotic Index (SBI and the identification of filamentous bacteria in the activated sludge. The analysis of studies indicates that the presence of the Actinomycetes in the activated sludge adversely affects the efficiency of the wastewater treatment process.

  10. An Endophytic Actinomycete,Sterptomyces sp.AOK-30,Isolated from Mountain Laurel and Its Antifungal Activity

    OpenAIRE

    Tomio, NISHIMURA; Akane, MEGURO; Sachiko, HASEGAWA; Yoshiko, NAKAGAWA; Masafumi, SHIMIZU; Hitoshi, KUNOH; Akatsuka Orchid Co.,Ltd.; Akatsuka Orchid Co.,Ltd.; Akatsuka Orchid Co.,Ltd.; Akatsuka Orchid Co.,Ltd.; Laboratory of Ecological Circulation,Faculty of Bioresources,Mie University; Laboratory of Ecological Circulation,Faculty of Bioresources,Mie University

    2002-01-01

    To survey endophytic actinomycetes as potential biocontrol agents against fungal diseases of mountain laurel, young plants of mountain laurel (Kalmia latifolia L.) were used as an isolation source. From a total of 73 actinomycetes isolates obtained from leaves, stems and roots of test plants, Streptomyces sp. AOK-30 was selected, because i) it had a broad and intense antimicrobial spectrum against various yeasts and fungal pathogens of Ericaceae, ii) it grew on the multiplication and rooting ...

  11. Identification of the Entner-Doudoroff pathway in an antibiotic-producing actinomycete species

    DEFF Research Database (Denmark)

    Gunnarsson, Nina; Mortensen, Uffe Hasbro; Sosio, M.

    2004-01-01

    the primary metabolic pathways of the poorly characterized antibiotic-producing actinomycete Nonomuraea sp. ATCC 39727. Surprisingly, it was found that Nonomuraea sp. ATCC 39272 predominantly metabolizes glucose via the Entner-Doudoroff (ED) pathway. This represents the first time that the ED pathway has been...... to design metabolic engineering strategies towards construction of more efficient producers of specific metabolites. In this context, methods that allow rapid and reliable mapping of the central carbon metabolism are valuable. In the present study, a C-13 labelling-based method was used to identify...... recognized as the main catabolic pathway in an actinomycete. The Nonomuraea genes encoding the key enzymes of the ED pathway were subsequently identified, sequenced and functionally described....

  12. Biosynthetic potential of actinomycetes in brown forest soil on the eastern coast of the aegean sea

    Science.gov (United States)

    Shirokikh, I. G.; Shirokikh, A. A.

    2017-11-01

    The taxonomic and functional structures of the actinomycetal complex in the litter and upper horizon of the brown forest soil was studied in a Pinus brutia var. pendulifolia forest on the eastern coast of the Aegean Sea. The complex of actinomycetes included representatives of the Streptomyces and Micromonospora genera and oligosporus forms. Streptomycetes predominated (73.8%) in the soil, and micromonospores (66.7%) were dominants in the litter. Thirty isolates of ten Streptomyces species from five series and three sections prevailed. In the upper soil horizon, species of the Helvolo-Flavus Helvolus section predominated (48%); the S. felleus species occurred most frequently. Among the isolated cultures, the S. globisporus and S. sindenensis species capable to produce antitumor antibiotics were found. The testing of the antimicrobial activity of the natural isolates showed that five strains inhibit the growth of pathogenic Fusarium sp., Alternaria sp., Acremonium sp., and Bipolaris sorokiniana fungi. When testing the effect of streptomycetes on the production of cellulases, a high-efficient strain belonging to the S. noboritoensis species was revealed. All the streptomycetes isolated from the brown forest soil produced auxins at the rate of 7.8 to 19.7 μg of indole acetic acid/mL of the liquid medium in the presence of 200 mg/L of tryptophan. Twelve isolates of streptomycetes were transferred to the collection of biotechnologically promising cultures for studying their properties.

  13. In Vitro and In Vivo Plant Growth Promoting Activities and DNA Fingerprinting of Antagonistic Endophytic Actinomycetes Associates with Medicinal Plants.

    Science.gov (United States)

    Passari, Ajit Kumar; Mishra, Vineet Kumar; Gupta, Vijai Kumar; Yadav, Mukesh Kumar; Saikia, Ratul; Singh, Bhim Pratap

    2015-01-01

    Endophytic actinomycetes have shown unique plant growth promoting as well as antagonistic activity against fungal phytopathogens. In the present study forty-two endophytic actinomycetes recovered from medicinal plants were evaluated for their antagonistic potential and plant growth-promoting abilities. Twenty-two isolates which showed the inhibitory activity against at least one pathogen were subsequently tested for their plant-growth promoting activities and were compared genotypically using DNA based fingerprinting, including enterobacterial repetitive intergenic consensus (ERIC) and BOX repetitive elements. Genetic relatedness based on both ERIC and BOX-PCR generates specific patterns corresponding to particular genotypes. Exponentially grown antagonistic isolates were used to evaluate phosphate solubilization, siderophores, HCN, ammonia, chitinase, indole-3-acetic acid production, as well as antifungal activities. Out of 22 isolates, the amount of indole-3-acetic acid (IAA) ranging between 10-32 μg/ml was produced by 20 isolates and all isolates were positive for ammonia production ranging between 5.2 to 54 mg/ml. Among 22 isolates tested, the amount of hydroxamate-type siderophores were produced by 16 isolates ranging between 5.2 to 36.4 μg/ml, while catechols-type siderophores produced by 5 isolates ranging from 3.2 to 5.4 μg/ml. Fourteen isolates showed the solubilisation of inorganic phosphorous ranging from 3.2 to 32.6 mg/100ml. Chitinase and HCN production was shown by 19 and 15 different isolates, respectively. In addition, genes of indole acetic acid (iaaM) and chitinase (chiC) were successively amplified from 20 and 19 isolates respectively. The two potential strains Streptomyces sp. (BPSAC34) and Leifsonia xyli (BPSAC24) were tested in vivo and improved a range of growth parameters in chilli (Capsicum annuum L.) under greenhouse conditions. This study is the first published report that actinomycetes can be isolated as endophytes from within these

  14. Antimicrobial activity of some actinomycetes from Western Ghats of Tamil Nadu, India

    Directory of Open Access Journals (Sweden)

    Pathalam Ganesan

    2017-06-01

    Conclusions: The present work revealed that, among 106 actinomycetes screened, Streptomyces rimosus (FMS-20 (Accession No-KT827106 showed promising antimicrobial activity against all the tested human microbial pathogens.

  15. The SsgA-like proteins in actinomycetes: small proteins up to a big task.

    Science.gov (United States)

    Traag, Bjørn A; van Wezel, Gilles P

    2008-06-01

    Several unique protein families have been identified that play a role in the control of developmental cell division in streptomycetes. The SsgA-like proteins or SALPs, of which streptomycetes typically have at least five paralogues, control specific steps of sporulation-specific cell division in streptomycetes, affecting cell wall-related events such as septum localization and synthesis, thickening of the spore wall and autolytic spore separation. The expression level of SsgA, the best studied SALP, has a rather dramatic effect on septation and on hyphal morphology, which is not only of relevance for our understanding of (developmental) cell division but has also been successfully applied in industrial fermentation, to improve growth and production of filamentous actinomycetes. Recent observations suggest that SsgB most likely is the archetypal SALP, with only SsgB orthologues occurring in all morphologically complex actinomycetes. Here we review 10 years of research on the SsgA-like proteins in actinomycetes and discuss the most interesting regulatory, functional, phylogenetic and applied aspects of this relatively unknown protein family.

  16. Characterization of a chitinase from the cellulolytic actinomycete Thermobifida fusca

    NARCIS (Netherlands)

    Gaber, Yasser; Mekasha, Sophanit; Vaaje-Kolstad, Gustav; Eijsink, Vincent G H; Fraaije, Marco W

    Thermobifida fusca is a well-known cellulose-degrading actinomycete, which produces various glycoside hydrolases for this purpose. However, despite the presence of putative chitinase genes in its genome, T. fusca has not been reported to grow on chitin as sole carbon source. In this study, a gene

  17. Chemical Elicitors of Antibiotic Biosynthesis in Actinomycetes

    Directory of Open Access Journals (Sweden)

    Anton P. Tyurin

    2018-06-01

    Full Text Available Whole genome sequencing of actinomycetes has uncovered a new immense realm of microbial chemistry and biology. Most biosynthetic gene clusters present in genomes were found to remain “silent” under standard cultivation conditions. Some small molecules—chemical elicitors—can be used to induce the biosynthesis of antibiotics in actinobacteria and to expand the chemical diversity of secondary metabolites. Here, we outline a brief account of the basic principles of the search for regulators of this type and their application.

  18. Selection of unusual actinomycetal primary sigma70 factors by plant-colonizing Frankia strains.

    Science.gov (United States)

    Lavire, Céline; Blaha, Didier; Cournoyer, Benoit

    2004-02-01

    Functional adaptations of sigma70 transcriptional factors led to the emergence of several paralogous lineages, each one being specialized for gene transcription under particular growth conditions. Screening of a Frankia strain EaI-12 gene library by sigma70 DNA probing allowed the detection and characterization of a novel actinomycetal primary (housekeeping) sigma70 factor. Phylogenetic analysis positioned this factor in the RpoD cluster of proteobacterial and low-G+C-content gram-positive factors, a cluster previously free of any actinobacterial sequences. sigma70 DNA probing of Frankia total DNA blots and PCR screening detected one or two rpoD-like DNA regions per species. rpoD matched the conserved region in all of the species tested. The other region was found to contain sigA, an alternative primary factor. sigA appeared to be strictly distributed among Frankia species infecting plants by the root hair infection process. Both genes were transcribed by Frankia strain ACN14a grown in liquid cultures. The molecular phylogeny of the sigma70 family determined with Frankia sequences showed that the alternative actinomycetal factors and the essential ones belonged to the same radiation. At least seven distinct paralogous lineages were observed among this radiation, and gene transfers were detected in the HrdB actinomycetal lineage.

  19. Endophytic Actinomycetes: A Novel Source of Potential Acyl Homoserine Lactone Degrading Enzymes

    Directory of Open Access Journals (Sweden)

    Surang Chankhamhaengdecha

    2013-01-01

    Full Text Available Several Gram-negative pathogenic bacteria employ N-acyl-L-homoserine lactone (HSL quorum sensing (QS system to control their virulence traits. Degradation of acyl-HSL signal molecules by quorum quenching enzyme (QQE results in a loss of pathogenicity in QS-dependent organisms. The QQE activity of actinomycetes in rhizospheric soil and inside plant tissue was explored in order to obtain novel strains with high HSL-degrading activity. Among 344 rhizospheric and 132 endophytic isolates, 127 (36.9% and 68 (51.5% of them, respectively, possessed the QQE activity. The highest HSL-degrading activity was at 151.30±3.1 nmole/h/mL from an endophytic actinomycetes isolate, LPC029. The isolate was identified as Streptomyces based on 16S  rRNA gene sequence similarity. The QQE from LPC029 revealed HSL-acylase activity that was able to cleave an amide bond of acyl-side chain in HSL substrate as determined by HPLC. LPC029 HSL-acylase showed broad substrate specificity from C6- to C12-HSL in which C10HSL is the most favorable substrate for this enzyme. In an in vitro pathogenicity assay, the partially purified HSL-acylase efficiently suppressed soft rot of potato caused by Pectobacterium carotovorum ssp. carotovorum as demonstrated. To our knowledge, this is the first report of HSL-acylase activity derived from an endophytic Streptomyces.

  20. Streptomyces fuscichromogenes sp. nov., an actinomycete from soil.

    Science.gov (United States)

    Zhang, Hao; Zheng, Jimei; Zhuang, Junli; Xin, Yuhua; Zheng, Xiaowei; Zhang, Jianli

    2017-01-01

    A novel actinomycete, designated strain m16T, was isolated from a soil sample collected from the tropical rain forest of Xishuangbanna, a prefecture in Yunnan Province, south-west China, and characterized by using polyphasic taxomomy. Cells were aerobic and Gram-reaction-positive, and spore chains were observed to be of the helical type, with elliptical spores and smooth spore surfaces. The novel strain grew over a temperature range of 15-35 °C, at pH 5.0-11.0 and in the presence of 0-3 % (w/v) NaCl. The DNA G+C content of strain m16T was 70.0 mol%. The main fatty acids were iso-C16 : 0 (29.3 %), iso-C15: 0 (15.4 %) and anteiso-C15:0 (14.6 %), and the predominant menaquinones were MK-9(H6), MK-9(H8) and MK-9(H4). Comparative 16S rRNA gene sequence analysis showed that strain m16T was most closely related to Streptomyces jiujiangensis KCTC 29262T (98.7 %), Streptomyces panaciradicis KACC 17632T (98.7 %), Streptomyces rhizophilus NBRC 108885T (98.5 %), Streptomyces shenzhenensis DSM 42034T (98.4 %), Streptomyces graminisoli JR-19T (98.4 %) and Streptomyces gramineus JR-43T (98.3 %). Phylogenetic, chemotaxonomic and phenotypic analyses indicated that strain m16T represents a novel species within the genus Streptomyces, for which the name Streptomyces fuscichromogenes is proposed. The type strain is m16T (=CGMCC 4.7110T=KCTC 29195T).

  1. A Marine Actinomycete Rescues Caenorhabditis elegans from Pseudomonas aeruginosa Infection through Restitution of Lysozyme 7

    Directory of Open Access Journals (Sweden)

    Siti N. Fatin

    2017-11-01

    Full Text Available The resistance of Pseudomonas aeruginosa to conventional antimicrobial treatment is a major scourge in healthcare. Therefore, it is crucial that novel potent anti-infectives are discovered. The aim of the present study is to screen marine actinomycetes for chemical entities capable of overcoming P. aeruginosa infection through mechanisms involving anti-virulence or host immunity activities. A total of 18 actinomycetes isolates were sampled from marine sediment of Songsong Island, Kedah, Malaysia. Upon confirming that the methanolic crude extract of these isolates do not display direct bactericidal activities, they were tested for capacity to rescue Caenorhabditis elegans infected with P. aeruginosa strain PA14. A hexane partition of the extract from one isolate, designated as Streptomyces sp. CCB-PSK207, could promote the survival of PA14 infected worms by more than 60%. Partial 16S sequence analysis on this isolate showed identity of 99.79% with Streptomyces sundarbansensis. This partition did not impair feeding behavior of C. elegans worms. Tested on PA14, the partition also did not affect bacterial growth or its ability to colonize host gut. The production of biofilm, protease, and pyocyanin in PA14 were uninterrupted, although there was an increase in elastase production. In lys-7::GFP worms, this partition was shown to induce the expression of lysozyme 7, an important innate immunity defense molecule that was repressed during PA14 infection. GC-MS analysis of the bioactive fraction of Streptomyces sp. CCB-PSK207 revealed the presence of methyl esters of branched saturated fatty acids. In conclusion, this is the first report of a marine actinomycete producing metabolites capable of rescuing C. elegans from PA14 through a lys-7 mediated activity.

  2. Therapeutic Potential of Biologically Reduced Silver Nanoparticles from Actinomycete Cultures

    International Nuclear Information System (INIS)

    Sukanya, M.K.; Saju, K.A.; Praseetha, P.K.; Sakthivel, G.

    2013-01-01

    Silver nanoparticles are applied in nanomedicine from time immemorial and are still used as powerful antibiotic and anti-inflammatory agents. Antibiotics produced by actinomycetes are popular in almost all the therapeutic measures, and this study has proven that these microbes are also helpful in the biosynthesis of silver nanoparticles with good surface and size characteristics. Silver can be synthesized by various chemical methodologies, and most of them have turned to be toxic. This study has been successful in isolating the microbes from polluted environment, and subjecting them to the reduction of silver nanoparticles, characterizing the nanoparticles by UV spectrophotometry and transmission electron microscopy. The nanoparticles produced were tested for their antimicrobial property, and the zone of inhibition was greater than those produced by their chemically synthesized counterparts. Actinomycetes, helpful in bioremediating heavy metals, are useful for the production of metallic nanoparticles. The biosynthesized silver nanoparticles loaded with antibiotics prove to be better in killing the pathogens and have opened up new areas for developing nanobiotechnological research based on microbial applications.

  3. SELEKSI DAN PEMANFAATAN ACTINOMYCETES SEBAGAI MIKROBA ANTAGONIS YANG RAMAH LINGKUNGAN TERHADAP Fusarium oxysporum f.sp. cubense SECARA IN VITRO

    Directory of Open Access Journals (Sweden)

    I MADE SUDARMA

    2015-06-01

    Full Text Available A total of 119 different actinomycete isolate were recovered from banana crop habitats with and without Fusarium wilt disease symptom. These were than assessed for their antagonist ability against Fusarium oxysporum £sp. cubense (Foe in vitro. Results indicated that four of all actinomycete isolate active against Foe. The four of actinomycete isolates were Streptomyces sp. l (AAo4, Streptomyces sp.2 (AAo32 , Streptomyces sp.3 (AAo33 and Streptomyces sp. 4 (AAo35. It was can inhibit the Foe mycelium growth, 79,63%, 72,22%, 78,89% and 72,22% respectively. After tested with the 3 times replication, the four Streptomyces spp. isolate effective to control the Foe that attack Bali banana cultivars, such as Susu, Saba, Raja and Ketip.

  4. Antiviral property of marine actinomycetes against white spot syndrome virus in penaeid shrimps

    Digital Repository Service at National Institute of Oceanography (India)

    Kumar, S.S.; Philip, R.; Achuthankutty, C.T.

    Aquaculture farms, particularly in Southeast Asia are facing severe crisis due to increasing incidences of White Spot Syndrome Virus (WSSV). Actinomycetes have provided many important bioactive compounds of high prophylactic and therapeutic value...

  5. Isolation and screening of antibiotic producing actinomycetes from soils in Gondar town, North West Ethiopia

    Directory of Open Access Journals (Sweden)

    Abebe Bizuye

    2013-10-01

    Full Text Available Objective: To isolate and screen antibiotic producing actinomycetes from potential soil samples of Gondar town, Ethiopia. Methods: Fifteen soil samples were collected, serially diluted and spread on starch casein and oat meal agar supplemented with amoxicillin and cyclohexamide for inhibition of bacteria and fungi, respectively. Cross streak method was used to check antagonistic activity of isolated actinomycetes against test organisms. Solid state fermentation and crude extraction were used for the production of antibiotics from isolates. Agar well diffusion was used for antimicrobial activity of crude extracts against test organisms. Results: Three isolates (Ab18, Ab28 and Ab43 have been shown high antagonistic activity during primary screening. Inhibition zones obtained from crude extracts showed significance differences when compared with standard antibiotics tested against test organisms (P<0.05. Inhibition zone of crude extracts from isolate Ab18 against Klebsiella pneumonia ATCC7000603 and Escherichia coli ATCC25922 were (14依1 mm and (35依1 mm, respectively which were strong active when compared to amoxicillin (0 mm and tetracycline [(13依1 mm for Klebsiella pneumonia ATCC7000603 and (33依 1 mm for Escherichia coli ATCC25922]. Crude extracts from isolate Ab18 showed (20依1 mm and (15 依1 mm inhibition zones against methicillin resistant Staphylococcus aureus strains 2 (MRSA2 and MRSA4, respectively. Crude extract from isolate Ab43 has shown inhibition zones of (16依1 mm and (17依1 mm against MRSA2 and MRSA4, respectively. Combination of Ab18 and Ab43 has shown high antimicrobial activity (18依1 mm against MRSA2 and MRSA4. Conclusions: There was not any scientific report on soil actinomycetes producing antibiotic in the study areas. Therefore, isolation and screening of actinomycetes from such areas in optimum condition may contribute the discovery of new antibiotics. Potent antibiotics from these actinomycetes could contribute a

  6. Isolation, screening and characterization of uranium microremediable actinomycetes from fallen leaves of Azadirachta indica in Western Ghats

    International Nuclear Information System (INIS)

    Singh, M.J.; Padmavathy, S.

    2014-01-01

    Microremediation of harmful radioactive waste such as uranium has been carried out by the endophytic actinomycetes strains isolated from the unnoticed fallen leaves of commonly available medicinal plant Azadirachta indica, which are considered as unique source. Among six actinobacteria isolates, one microbe (A5) effectively removed uranium in 12 h at temperature 30 deg C and pH 8-9. Molecular characterization and phylogenetic analysis support the classification of the isolate A5 as a new strain which was named as Streptomyces sp. MINIYAA7 (Genbank accession number KF909129). (author)

  7. Isolation, screening and characterization of uranium microremediable actinomycetes from fallen leaves of Azadirachta indica in Western Ghats

    Energy Technology Data Exchange (ETDEWEB)

    Singh, M. J.; Padmavathy, S. [Nirmala College for Women, Coimbatore, Tamil Nadu (India). Department of Botany

    2014-12-15

    Microremediation of harmful radioactive waste such as uranium has been carried out by the endophytic actinomycetes strains isolated from the unnoticed fallen leaves of commonly available medicinal plant Azadirachta indica, which are considered as unique source. Among six actinobacteria isolates, one microbe (A5) effectively removed uranium in 12 h at temperature 30 deg C and pH 8-9. Molecular characterization and phylogenetic analysis support the classification of the isolate A5 as a new strain which was named as Streptomyces sp. MINIYAA7 (Genbank accession number KF909129). (author)

  8. Screening of phospholipase A activity and its production by new actinomycete strains cultivated by solid-state fermentation

    Directory of Open Access Journals (Sweden)

    Priscila Sutto-Ortiz

    2017-07-01

    Full Text Available Novel microbial phospholipases A (PLAs can be found in actinomycetes which have been poorly explored as producers of this activity. To investigate microbial PLA production, efficient methods are necessary such as high-throughput screening (HTS assays for direct search of PLAs in microbial cultures and cultivation conditions to promote this activity. About 200 strains isolated with selected media for actinomycetes and mostly belonging to Streptomyces (73% and Micromonospora (10% genus were first screened on agar-plates containing the fluorophore rhodamine 6G and egg yolk phosphatidylcholine (PC to detect strains producing phospholipase activity. Then, a colorimetric HTS assay for general PLA activity detection (cHTS-PLA using enriched PC (≈60% as substrate and cresol red as indicator was developed and applied; this cHTS-PLA assay was validated with known PLAs. For the first time, actinomycete strains were cultivated by solid-state fermentation (SSF using PC as inductor and sugar-cane bagasse as support to produce high PLA activity (from 207 to 2,591 mU/g of support. Phospholipase activity of the enzymatic extracts from SSF was determined using the implemented cHTS-PLA assay and the PC hydrolysis products obtained, were analyzed by TLC showing the presence of lyso-PC. Three actinomycete strains of the Streptomyces genus that stood out for high accumulation of lyso-PC, were selected and analyzed with the specific substrate 1,2-α-eleostearoyl-sn-glycero-3-phosphocholine (EEPC in order to confirm the presence of PLA activity in their enzymatic extracts. Overall, the results obtained pave the way toward the HTS of PLA activity in crude microbial enzymatic extracts at a larger scale. The cHTS-PLA assay developed here can be also proposed as a routine assay for PLA activity determination during enzyme purification,directed evolution or mutagenesis approaches. In addition, the production of PLA activity by actinomycetes using SSF allow find and

  9. Isolation and Characterization of Aerobic Actinomycetes from Soil in Northern Iran and Evaluation of their Antimicrobial Potential

    Directory of Open Access Journals (Sweden)

    Esmaeil Emami

    2017-10-01

    Full Text Available Background:   Aerobic actinomycetes can be detected in soil, worldwide. But, their diversity can differ depending on ecological and environmental factors including, temperature, humidity and vegetation, etc. The aim of this study was antimicrobial activities of aerobic actinomycetes Isolated from soil in Northern Iran.Methods:   Fifty soil samples throughout Northern Iran provinces, including Guilan, Mazandran and Golestan, have been collected and cultured in selective medium, Starch Casein Agar (SCA. In the first step, isolates were assayed by pointing inoculation in solid medium, agar spot, for antimicrobial activity. Then, for antibiotic production, International Streptomyces Projects 2 (ISP2 and Glucose Yeast Extract Malt extract (GYM media by submerge technique were used. Well diffusion agar method was used for detection of antimicrobial activity and antibiotic sensitivity, and finally metabolites of most active specious detected by GC/MS and GC techniques.Results:   In this study eighty strains were isolated from soil samples. In primary screening, 12 strains (15% recognized as active actinomycetes, among them strain SA3 showed the highest antimicrobial potential. In the secondary screening in the liquid ISP2 medium, 3 (25% isolates (SA7, SA3, SA16 and in GYM medium 7 (58.33% isolates (SA28, SA27, SA7, SA26, SA16, SA2, SA3 have shown the highest antimicrobial potentials; also it was found that there is a significant relation between humidity and pH of soil with the number of isolated colonies. According to results of primary and secondary screening, strains SA3 and SA7 were selected as active actinomycetes and biochemical test revealed that these two active strains isolates belong to the genus Streptomyces. Finally, produced metabolites by strain SA3 were analyzed by GC/MS and GC methods and Oleic acid was revealed as the highest peak.Conclusion:   The findings of the present research show that actinomycetes from Northern Iran

  10. Actinomadura gamaensis sp. nov., a novel actinomycete isolated from soil in Gama, Chad.

    Science.gov (United States)

    Abagana, Adam Yacoub; Sun, Pengyu; Liu, Chongxi; Cao, Tingting; Zheng, Weiwei; Zhao, Shanshan; Xiang, Wensheng; Wang, Xiangjing

    2016-06-01

    A novel single spore-producing actinomycete, designated strain NEAU-Gz5(T), was isolated from a soil sample from Gama, Chad. A polyphasic taxonomic study was carried out to establish the status of this strain. The diamino acid present in the cell wall is meso-diaminopimelic acid. Glucose, mannose and madurose occur in whole cell hydrolysates. The polar lipids were found to consist of diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylinositol mannoside and an unidentified glycolipid. The predominant menaquinones were identified as MK-9(H8) and MK-9(H6). The predominant cellular fatty acids were found to be C16:0, iso-C15:0, iso-C16:0 and C18:0 10-methyl. Phylogenetic analysis based on the 16S rRNA gene showed that strain NEAU-Gz5(T) belongs to the genus Actinomadura and is closely related to Actinomadura oligospora JCM 10648(T) (ATCC 43269(T); 98.3 % similarity). However, the low level of DNA-DNA relatedness and some different phenotypic characteristics allowed the strain to be distinguished from its close relatives. Therefore, it is concluded that strain NEAU-Gz5(T) represents a novel species of the genus of Actinomadura, for which the name Actinomadura gamaensis sp. nov. is proposed. The type strain is NEAU-Gz5(T) (= CGMCC 4.7301(T) = DSM 100815(T)).

  11. Nocardiopsis arabia sp. nov., a halotolerant actinomycete isolated from a sand-dune soil.

    Science.gov (United States)

    Hozzein, Wael N; Goodfellow, Michael

    2008-11-01

    The taxonomic status of an unknown actinomycete isolated from a sand-dune soil was established using a polyphasic approach. Isolate S186(T) had chemotaxonomic and morphological properties consistent with its classification in the genus Nocardiopsis, grew on agar plates at NaCl concentrations of up to 15 % (w/v) and formed a distinct phyletic line in the Nocardiopsis 16S rRNA gene sequence tree. Its closest phylogenetic neighbours were Nocardiopsis chromatogenes, Nocardiopsis composta, Nocardiopsis gilva and Nocardiopsis trehalosi, with sequence similarity to the various type strains of 96.9 %, but it was readily distinguished from the type strains of these and related species using a range of phenotypic properties. It is apparent from the genotypic and phenotypic data that strain S186(T) belongs to a novel species of the genus Nocardiopsis, for which the name Nocardiopsis arabia sp. nov. is proposed. The type strain is S186(T) (=CGMCC 4.2057(T) =DSM 45083(T)).

  12. Structural and functional characterizations of SsgB, a conserved activator of developmental cell division in morphologically complex actinomycetes.

    Science.gov (United States)

    Xu, Qingping; Traag, Bjørn A; Willemse, Joost; McMullan, Daniel; Miller, Mitchell D; Elsliger, Marc-André; Abdubek, Polat; Astakhova, Tamara; Axelrod, Herbert L; Bakolitsa, Constantina; Carlton, Dennis; Chen, Connie; Chiu, Hsiu-Ju; Chruszcz, Maksymilian; Clayton, Thomas; Das, Debanu; Deller, Marc C; Duan, Lian; Ellrott, Kyle; Ernst, Dustin; Farr, Carol L; Feuerhelm, Julie; Grant, Joanna C; Grzechnik, Anna; Grzechnik, Slawomir K; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K; Klock, Heath E; Knuth, Mark W; Kozbial, Piotr; Krishna, S Sri; Kumar, Abhinav; Marciano, David; Minor, Wladek; Mommaas, A Mieke; Morse, Andrew T; Nigoghossian, Edward; Nopakun, Amanda; Okach, Linda; Oommachen, Silvya; Paulsen, Jessica; Puckett, Christina; Reyes, Ron; Rife, Christopher L; Sefcovic, Natasha; Tien, Henry J; Trame, Christine B; van den Bedem, Henry; Wang, Shuren; Weekes, Dana; Hodgson, Keith O; Wooley, John; Deacon, Ashley M; Godzik, Adam; Lesley, Scott A; Wilson, Ian A; van Wezel, Gilles P

    2009-09-11

    SsgA-like proteins (SALPs) are a family of homologous cell division-related proteins that occur exclusively in morphologically complex actinomycetes. We show that SsgB, a subfamily of SALPs, is the archetypal SALP that is functionally conserved in all sporulating actinomycetes. Sporulation-specific cell division of Streptomyces coelicolor ssgB mutants is restored by introduction of distant ssgB orthologues from other actinomycetes. Interestingly, the number of septa (and spores) of the complemented null mutants is dictated by the specific ssgB orthologue that is expressed. The crystal structure of the SsgB from Thermobifida fusca was determined at 2.6 A resolution and represents the first structure for this family. The structure revealed similarities to a class of eukaryotic "whirly" single-stranded DNA/RNA-binding proteins. However, the electro-negative surface of the SALPs suggests that neither SsgB nor any of the other SALPs are likely to interact with nucleotide substrates. Instead, we show that a conserved hydrophobic surface is likely to be important for SALP function and suggest that proteins are the likely binding partners.

  13. Structural and Functional Characterizations of SsgB, a Conserved Activator of Developmental Cell Division in Morphologically Complex Actinomycetes*

    Science.gov (United States)

    Xu, Qingping; Traag, Bjørn A.; Willemse, Joost; McMullan, Daniel; Miller, Mitchell D.; Elsliger, Marc-André; Abdubek, Polat; Astakhova, Tamara; Axelrod, Herbert L.; Bakolitsa, Constantina; Carlton, Dennis; Chen, Connie; Chiu, Hsiu-Ju; Chruszcz, Maksymilian; Clayton, Thomas; Das, Debanu; Deller, Marc C.; Duan, Lian; Ellrott, Kyle; Ernst, Dustin; Farr, Carol L.; Feuerhelm, Julie; Grant, Joanna C.; Grzechnik, Anna; Grzechnik, Slawomir K.; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K.; Klock, Heath E.; Knuth, Mark W.; Kozbial, Piotr; Krishna, S. Sri; Kumar, Abhinav; Marciano, David; Minor, Wladek; Mommaas, A. Mieke; Morse, Andrew T.; Nigoghossian, Edward; Nopakun, Amanda; Okach, Linda; Oommachen, Silvya; Paulsen, Jessica; Puckett, Christina; Reyes, Ron; Rife, Christopher L.; Sefcovic, Natasha; Tien, Henry J.; Trame, Christine B.; van den Bedem, Henry; Wang, Shuren; Weekes, Dana; Hodgson, Keith O.; Wooley, John; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Wilson, Ian A.; van Wezel, Gilles P.

    2009-01-01

    SsgA-like proteins (SALPs) are a family of homologous cell division-related proteins that occur exclusively in morphologically complex actinomycetes. We show that SsgB, a subfamily of SALPs, is the archetypal SALP that is functionally conserved in all sporulating actinomycetes. Sporulation-specific cell division of Streptomyces coelicolor ssgB mutants is restored by introduction of distant ssgB orthologues from other actinomycetes. Interestingly, the number of septa (and spores) of the complemented null mutants is dictated by the specific ssgB orthologue that is expressed. The crystal structure of the SsgB from Thermobifida fusca was determined at 2.6 Å resolution and represents the first structure for this family. The structure revealed similarities to a class of eukaryotic “whirly” single-stranded DNA/RNA-binding proteins. However, the electro-negative surface of the SALPs suggests that neither SsgB nor any of the other SALPs are likely to interact with nucleotide substrates. Instead, we show that a conserved hydrophobic surface is likely to be important for SALP function and suggest that proteins are the likely binding partners. PMID:19567872

  14. Isolation, screening and identification of novel isolates of Actinomycetes from India for antimicrobial applications

    Directory of Open Access Journals (Sweden)

    Vineeta Singh

    2016-12-01

    Full Text Available The search for novel bioactive compounds from the natural environment has been rapidly increased with the increase in multi-drug resistant (MDR pathogens. In the present study, the antimicrobial potential of novel actinomycetes has been evaluated by initial screening of six soil samples. Primary and secondary screening was performed against Bacillus subtilis, Staphylococcus aureus, Escherichia coli, Candida albicans, Candida tropicalis, Trichophyton rubrum, and other MDR bacterial and fungal test strains, and at the end thirteen active isolates were selected for further study. Microbial strains were identified on the basis of growth conditions and other biochemical characters. Five most active microbial strains were identified using 16S rRNA sequence homology and designated as Streptomyces xanthophaeus MTCC 11938, Streptomyces variabilis MTCC 12266, Streptomyces xanthochromogenes MTCC 11937, Streptomyces levis EU 124569 and Streptomyces sp. NCIM 5500. Four antibacterial and three antifungal compounds isolated from the above five isolates were purified and partially characterized using UV absorption and IR spectra. Two antibacterial metabolites, belong to chromone and peptide antibiotic, respectively. The antifungal compounds were found to be of non-polyene nature. In conclusion, we study the isolation of novel bacterial strains of actinomycetes for producing novel compounds having antibacterial and antifungal activities from the unexplored agro-ecological niches of India. Also, this study paves the way for further characterization of these isolates of Streptomyces sp. for their optimum utilization for antimicrobial purposes.

  15. Bioactive 2(1H-Pyrazinones and Diketopiperazine Alkaloids from a Tunicate-Derived Actinomycete Streptomyces sp.

    Directory of Open Access Journals (Sweden)

    Lamiaa A. Shaala

    2016-08-01

    Full Text Available As a part of our ongoing effort to allocate marine microbial bioactive leads, a tunicate-derived actinomycete, Streptomyces sp. Did-27, was investigated. Three new 2(1H-pyrazinones derivatives, (S-6-(sec-butyl-3-isopropylpyrazin-2(1H-one (1, (S-3-(sec-butyl-6-isopropylpyrazin-2(1H-one (2 and (S-6-(sec-butyl-3-isobutylpyrazin-2(1H-one (3, together with the known (1H-pyrazinones analogues deoxymutaaspergillic acid (4, 3,6-diisobutyl-2(1H-pyrazinone (5 and 3,6-di-sec-butyl-2(1H-pyrazinone (6, and the diketopiperazine alkaloids cyclo(6-OH-d-Pro-l-Phe (7, bacillusamide B (8, cyclo(l-Pro-l-Leu and cyclo(l-Pro-l-Ile (10 were isolated from this strain. The structures of the compounds were determined by study of their one- and two-dimensional NMR spectra as well as high-resolution mass spectral determinations. Compound 4 was reported previously as a synthetic product, while compound 6 was reported as 2-hydroxy-3,6-di-sec-butylpyrazine. Herein, we report the complete NMR data for compounds 4 and 6. The compounds were evaluated for their cytotoxic activities against three cell lines. Compound 5 showed potent and selective activity against HCT-116 cell line with IC50 of 1.5 μg/mL, while 1–10 showed variable cytotoxic activities against these cancer cell lines. These results provide further understanding about the chemistry and bioactivities of the alkylated 2(1H-pyrazinone derivatives.

  16. Isolation and Identification of a Rare Actinomycete with Antibacterial Activity from Saline Region of Iran

    Directory of Open Access Journals (Sweden)

    Samaneh Mashhadi

    2016-07-01

    Full Text Available Background: The appearance of multi-drug resistant microorganisms is becoming a global problem. Already several strategies have been employed to overcome antibiotic resistance issue. Developing new antimicrobial compounds from microbial sources could be a beneficial solution. Hence screening programs in order to discover new antibiotics from microbial entities are interesting. Because of high capabilities of extremophiles for adaptation to harsh environmental conditions, the microbial communities of the extreme environments could be regarded as rich resources for new antibacterial metabolites. Materials and Methods: In this research different saline environments of Iran have been subjected to screening of antibiotic producing actinomycetes using overlaid method after the ingredient optimization of culture media. The strain which was shown pronounce inhibition zone in the screening step, has been phylogenetically analyzed followed by studying the effect of agar concentration and cultivation time on the production of antibacterial agent(s. Results: The strain RS1, a rare actinomycete, had antibacterial activity against Escherichia coli (PTCC 1330 and Bacillus subtilis (PTCC 1023 and taxonomically belongs to the genus Amycolatopsis with high similarity of 99.6% to Amycolatopsis coloradensis IMSNU 22096T based on sequencing of 16S rRNA gene nucleotide. The zone of growth inhibition of E.coli was the widest when the base layer had contained 1.2% agar, while no significant differences were observed on anti-gram-positive bacterial assay. This strain produced the antibacterial agent at the highest level after 5 days when B. subtilis was used as an indicator, but the production of antibacterial agent active against E.Coli was reached to its highest level on the 3rd days of cultivation and then was decreased significantly. Conclusion: Due to the results of agar concentration and time course study as well as possessing activity against both Gram

  17. Cytotoxicity of actinomycetes associated with the ascidian Eudistoma vannamei (Millar, 1977, endemic of northeastern coast of Brazil

    Directory of Open Access Journals (Sweden)

    Paula C Jimenez

    2013-04-01

    Full Text Available Previous studies demonstrated that the crude extract of the ascidian Eudistoma vannamei, endemic from northeasttern Brazil, strongly hinders growth of tumor cells in vitro by inducing apoptosis due to tryptophan derivatives, which are commonly found in bacteria. This study presents a bioactivity-guided screening among actinomycetes, associated with E. vannamei, aiming at recognizing active principles with biological relevance. Twenty strains of actinomycetes, designated as EVA 0101 through 0120, were isolated from colonies of E. vannamei among which 11 were selected for cytotoxicity evaluation. The extracts from EVA 0102, 0103, 0106, 0109 and 0113 were the most active, and were further studied for IC50 determination and chemical analysis by ¹H NMR. IC50 values obtained ranged from 3.62 µg mL-1 (for EVA 0109 in leukemia cells to 84.65 µg/mL (for EVA 0106 in melanoma cells. All active extracts exhibited the same TLC and spectroscopic profiles, suggesting the presence of quinones and other related secondary metabolites. Furthermore, these strains were identified and compared based on their respective 16S rRNA sequences. The results herein identified the five strains as Micromonospora spp. while phylogenetic analysis suggests that they are possibly two different Micromonospora species producing the cytotoxic compounds.

  18. Cephamycins, a New Family of β-Lactam Antibiotics I. Production by Actinomycetes, Including Streptomyces lactamdurans sp. n1

    Science.gov (United States)

    Stapley, E. O.; Jackson, M.; Hernandez, S.; Zimmerman, S. B.; Currie, S. A.; Mochales, S.; Mata, J. M.; Woodruff, H. B.; Hendlin, D.

    1972-01-01

    A number of actinomycetes isolated from soil were found to produce one or more members of a new family of antibiotics, the cephamycins, which are structurally related to cephalosporin C. The cephamycins were produced in submerged fermentation in a wide variety of media by one or more of eight different species of Streptomyces, including a newly described species, S. lactamdurans. These antibiotics exhibit antibacterial activity against a broad spectrum of bacteria which includes many that are resistant to the cephalosporins and penicillins. PMID:4790552

  19. Atrazine, chlorpyrifos, and iprodione effect on the biodiversity of bacteria, actinomycetes, and fungi in a pilot biopurification system with a green cover.

    Science.gov (United States)

    Elgueta, Sebastian; Correa, Arturo; Campo, Marco; Gallardo, Felipe; Karpouzas, Dimitrios; Diez, Maria Cristina

    2017-09-02

    The use of biopurification systems can mitigate the effects of pesticide contamination on farms. The primary aim of this study was to evaluate the effect of pesticide dissipation on microbial communities in a pilot biopurification system. The pesticide dissipation of atrazine, chlorpyrifos and iprodione (35 mg kg -1 active ingredient [a.i.]) and biological activity were determined for 40 days. The microbial communities (bacteria, actinomycetes and fungi) were analyzed using denaturing gradient gel electrophoresis (DGGE). In general, pesticide dissipation was the highest by day 5 and reached 95%. The pesticides did not affect biological activity during the experiment. The structure of the actinomycete and bacterial communities in the rhizosphere was more stable during the evaluation than that in the communities in the control without pesticides. The rhizosphere fungal communities, detected using DGGE, showed small and transitory shifts with time. To conclude, rhizosphere microbial communities were not affected during pesticide dissipation in a pilot biopurification system.

  20. Degradative crystal–chemical transformations of clay minerals under the influence of cyanobacterium-actinomycetal symbiotic associations

    Directory of Open Access Journals (Sweden)

    Ekaterina Ivanova

    2014-04-01

    Full Text Available Cyanobacteria and actinomycetes are essential components of soil microbial community and play an active role in ash elements leaching from minerals of the parent rock. Content and composition of clay minerals in soil determine the sorption properties of the soil horizons, water-holding capacity of the soil, stickiness, plasticity, etc. The transformative effect of cyanobacterial–actinomycetes associations on the structure of clay minerals – kaolinite, vermiculite, montmorillonite, biotite and muscovite – was observed, with the greatest structural lattice transformation revealed under the influence of association in comparison with monocultures of cyanobacterium and actinomycete. The range of the transformative effect depended both on the type of biota (component composition of association and on the crystal–chemical parameters of the mineral itself (trioctahedral mica – biotite, was more prone to microbial degradation than the dioctahedral – muscovite. The formation of the swelling phase – the product of biotite transformation into the mica–vermicullite mixed-layered formation was revealed as a result of association cultivation. Crystal chemical transformation of vermiculite was accompanied by the removal of potassium (К, magnesium (Mg and aluminum (Al from the crystal lattice. The study of such prokaryotic communities existed even in the early stages of the Earth's history helps to understand the causes and nature of the transformations undergone by the atmosphere, hydrosphere and lithosphere of the planet.contribution of treatments on structure induces and model parameters are discussed in the paper.

  1. [Secondary metabolites from a deep-sea-derived actinomycete Micrococcus sp. R21].

    Science.gov (United States)

    Peng, Kun; Su, Rui-qiang; Zhang, Gai-yun; Cheng, Xuan-xuan; Yang, Quan; Liu, Yong-hong; Yang, Xian-wen

    2015-06-01

    To investigate cytotoxic secondary metabolites of Micrococcus sp. R21, an actinomycete isolated from a deep-sea sediment (-6 310 m; 142 degrees 19. 9' E, 10 degrees 54. 6' N) of the Western Pacific Ocean, column chromatography was introduced over silica gel, ODS, and Sephadex LH-20. As a result, eight compounds were obtained. By mainly detailed analysis of the NMR data, their structures were elucidated as cyclo(4-hydroxy-L-Pro-L-leu) (1), cyclo(L-Pro-L-Gly) (2), cyclo( L-Pro-L-Ala) (3), cyclo( D-Pro-L-Leu) (4), N-β-acetyltryptamine (5), 2-hydroxybenzoic acid (6), and phenylacetic acid (7). Compound 1 exhibited weak cytotoxic activity against RAW264. 7 cells with IC50 value of 9.1 μmol x L(-1).

  2. CONTROL OF “DAMPING OFF” DISEASE CAUSED BY Sclerotium rolfsii SACC. USING ACTINOMYCETES AND VAM FUNGI ON SOYBEAN IN THE DRY LAND BASED ON MICROORGANISM DIVERSITY OF RHIZOSPHERE ZONE

    Directory of Open Access Journals (Sweden)

    Ika Rochdjatun Sastrahidayat

    2011-02-01

    Full Text Available One of the obstacles in the efforts to increase soybean production in Indonesia is disease such as damping off which is caused by Sclerotium rolfsii. In East Java, the intensity of S. Rolfsii reached approximately 8.61% that spread all over Indonesia region, even in our neighbor countries such as Malaysia, Thailand and the Philippines. This research was carried out to determine the efficacy of Actinomycetes and VAM (Vesicular Arbuscular Mycorrhizal against damping-off attack and the diversity of micro-organisms in rhizosfer. Research conducted in the laboratory and screen house on Plant Protection Department, Faculty of Agriculture, University of Brawijaya and in Lawang District Malang. Observation variables include level of pathogen attack and infection rate of damping-off pathogen. Plant height, number of pods, pod weight, seed weight and weight of 100 seeds from each treatment, diversity and identification of microorganisms in rhizosphere were also observed. The results showed that Actinomycetes and VAM application could decrease the percentage of plant death due to damping-off. Application of Actinomycetes and VAM gave effect on microorganism diversity of Ratai Rhizosphere but not on Wilis.

  3. Old meets new: using interspecies interactions to detect secondary metabolite production in actinomycetes.

    Science.gov (United States)

    Seyedsayamdost, Mohammad R; Traxler, Matthew F; Clardy, Jon; Kolter, Roberto

    2012-01-01

    Actinomycetes, a group of filamentous, Gram-positive bacteria, have long been a remarkable source of useful therapeutics. Recent genome sequencing and transcriptomic studies have shown that these bacteria, responsible for half of the clinically used antibiotics, also harbor a large reservoir of gene clusters, which have the potential to produce novel secreted small molecules. Yet, many of these clusters are not expressed under common culture conditions. One reason why these clusters have not been linked to a secreted small molecule lies in the way that actinomycetes have typically been studied: as pure cultures in nutrient-rich media that do not mimic the complex environments in which these bacteria evolved. New methods based on multispecies culture conditions provide an alternative approach to investigating the products of these gene clusters. We have recently implemented binary interspecies interaction assays to mine for new secondary metabolites and to study the underlying biology of interactinomycete interactions. Here, we describe the detailed biological and chemical methods comprising these studies. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. Chitinolytic Streptomyces vinaceusdrappus S5MW2 isolated from Chilika lake, India enhances plant growth and biocontrol efficacy through chitin supplementation against Rhizoctonia solani.

    Science.gov (United States)

    Yandigeri, Mahesh S; Malviya, Nityanand; Solanki, Manoj Kumar; Shrivastava, Pooja; Sivakumar, G

    2015-08-01

    A chitinolytic actinomycete Streptomyces vinaceusdrappus S5MW2 was isolated from water sample of Chilika lake, India and identified using 16S rRNA gene sequencing. It showed in vitro antifungal activity against the sclerotia producing pathogen Rhizoctonia solani in a dual culture assay and by chitinase enzyme production in a chitin supplemented minimal broth. Moreover, isolate S5MW2 was further characterized for biocontrol (BC) and plant growth promoting features in a greenhouse experiment with or without colloidal chitin (CC). Results of greenhouse experiment showed that CC supplementation with S5MW2 showed a significant growth of tomato plants and superior disease reduction as compared to untreated control and without CC treated plants. Moreover, higher accumulation of chitinase also recovered in the CC supplemented plants. Significant effect of CC also concurred with the Analysis of Variance of greenhouse parameters. These results show that the a marine antagonist S5MW2 has BC efficiency against R. solani and chitinase enzyme played important role in plant resistance.

  5. [Diversity of actinomycetes associated with root-knot nematode and their potential for nematode control].

    Science.gov (United States)

    Luo, Hong-li; Sun, Man-hong; Xie, Jian-ping; Liu, Zhi-heng; Huang, Ying

    2006-08-01

    Twenty actinomycetes were isolated from root-knot nematode eggs and females collected from 11 plant root samples infested by Meloidogyne spp.. The isolates were assigned to the genera Streptomyces, Nocardia and Pseudonocardia respectively, based on analysis of morphological characteristics, cell-wall DAPs and 16S rRNA gene sequences. 80% of them were streptomycetes. Biocontrol potential of the isolates against Meloidogyne hapla was evaluated in liquid culture in vitro. The average percentages of egg parasitism, egg hatching, and juvenile mortality were 54.1, 40.4 and 26.2, respectively. Three Streptomyces strains and one Nocardia strain with high pathogenicity in vitro were selected to determine their ability to reduce tomato root galls in greenhouse. The results demonstrated good biocontrol efficacy (31.4%-56.4%) of the strains.

  6. Diversity of foam producing nocardioform actinomycetes isolated from biological foam from activated sludge plants in Comunidad Valenciana; Diversidad de actinomicetos nocardioformes productores de espumas biologicas aislados de plantas depuradoras de aguas residuales de la Comunidad Valenciana

    Energy Technology Data Exchange (ETDEWEB)

    Soler, A.; Alonso, J.L.; Cuesta, G.

    2009-07-01

    The formation of biological foams in activated sludge systems is one of the most important problems of solid separation in wastewater treatment plants. Nocardioform actinomycetes are the most important filamentous bacteria responsible of foam formation. This group of microorganisms has hydrophobic cellular surfaces due to the mycolic acids. These foams interfere in wastewater treatment process because retain many suspended solids, block conductions and produce overflowing in the digesters and corridors. To identify correctly the nocardioform actinomycetes we have to do poli phasic taxonomy that includes 16S rDNA sequences analysis, determinate several chemo taxonomic markers and some phenotypic tests. (Author) 18 refs.

  7. [Identification and analysis of an actinomycete strain suppressing Clavibacter michiganensis subsp, michiganensis].

    Science.gov (United States)

    Zhang, Yan; Zhang, Weihong; Wang, Songhong; Li, Yaning; Zhao, Zhiquan; Liu, Daqun; Yang, Wenxiang

    2009-07-01

    To identify and analyze bioactive compounds of an actinomycete strain Z-L-22 suppressing Clavibacter michiganensis subsp. michiganensis, the causal agent of bacterial canker of tomato. Morphological, biological and biochemical characterization, chemotaxonomy analysis and 16S rDNA sequences homology analysis were performed to identify the strain Z-L-22. Bioactive compounds were separated and retrieved by thin layer chromatography. Paper chromatography and confirmation tests were used to identify the antibiotic. PCR was carried out using the primers targeted to synthetase of the antibiotic. Strain Z-L-22 belonged to Streptomyces sp. and was similar to Streptomyces setonii. Two main bioactive components were isolated by thin layer chromatography, which were all identified as actinomycin. New actinomycin synthetase gene was cloned using the primers designed from actinomycin synthetase conserve domain. Strain Z-L-22 was classified as Streptomyces setonii. Actinomycin produced by Streptomyces setonii was first reported.

  8. The genus Nonomuraea: A review of a rare actinomycete taxon for novel metabolites.

    Science.gov (United States)

    Sungthong, Rungroch; Nakaew, Nareeluk

    2015-05-01

    The genus Nonomuraea is a rare actinomycete taxon with a long taxonomic history, while its generic description was recently emended. The genus is less known among the rare actinomycete genera as its taxonomic position was revised several times. It can be found in diverse ecological niches, while most of its member species were isolated from soil samples. However, new trends to discover the genus in other habitats are increasing. Generic abundance of the genus was found to be dependent on geographical changes. Novel sources together with selective and invented isolation techniques might increase a chance to explore the genus and its novel candidates. Interestingly, some of its members have been revealed as a valuable source of novel metabolites for medical and industrial purposes. Broad-range of potent bioactive compounds including antimicrobial, anticancer, and antipsychotic substances, broad-spectrum antibiotics and biocatalysts can be synthesized by the genus. In order to investigate biosynthetic pathways of the bioactive compounds and self-resistant mechanisms to these compounds, the links from genes to metabolites have yet been needed for further discovery and biotechnological development of the genus Nonomuraea. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Specificity of the mutualistic association between actinomycete bacteria and two sympatric species of Acromyrmex leaf-cutting ants

    DEFF Research Database (Denmark)

    Poulsen, M; Cafaro, M; Boomsma, J J

    2005-01-01

    Acromyrmex leaf-cutting ants maintain two highly specialized, vertically transmitted mutualistic ectosymbionts: basidiomycete fungi that are cultivated for food in underground gardens and actinomycete Pseudonocardia bacteria that are reared on the cuticle to produce antibiotics that suppress...

  10. The 5s25p2 - (5s25p5d + 5s5p3 + 5s25p6s + 5s25p7s) transitions in Sb II and 5s25p - (5s5p2 + 5s2nl) transitions in Sb III

    International Nuclear Information System (INIS)

    Arcimowicz, B.; Joshi, Y.N.; Kaufman, V.

    1989-01-01

    The spectrum of antimony was photographed in the 575-2300 A region (1A 10 -10 m) using a hollow cathode and a triggered spark source. The analysis of the 5s 2 5p 2 - (5s 2 5p5d + 5s5p 3 + 5s 2 5p6s + 5s 2 5p7s) transitions in Sb II spectrum was revised and interpreted on the basis of multiconfiguration interaction calculations. Accurate wavelength measurements of Sb III lines lead to a revised ground-state 5s 2 5p 2 P interval value of 6574.5 cm -1 . (author). 15 refs., 9 tabs., 1 fig

  11. Genome Sequence of Streptomyces viridosporus Strain T7A ATCC 39115, a Lignin-Degrading Actinomycete

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Jennifer R. [Brown University; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Teshima, Hazuki [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Huntemann, Marcel [U.S. Department of Energy, Joint Genome Institute; Wei, Chia-Lin [Los Alamos National Laboratory (LANL); Han, James [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Szeto, Ernest [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Peters, Lin [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Sello, Jason K. [Brown University

    2013-01-01

    We announce the availability of the genome sequence of Streptomyces viridosporus strain T7A ATCC 39115, a plant biomass- degrading actinomycete. This bacterium is of special interest because of its capacity to degrade lignin, an underutilized compo- nent of plants in the context of bioenergy. It has a full complement of genes for plant biomass catabolism.

  12. Streptomyces atlanticus sp. nov., a novel actinomycete isolated from marine sponge Aplysina fulva (Pallas, 1766).

    Science.gov (United States)

    Silva, Fábio Sérgio Paulino; Souza, Danilo Tosta; Zucchi, Tiago Domingues; Pansa, Camila Cristiane; de Figueiredo Vasconcellos, Rafael Leandro; Crevelin, Eduardo José; de Moraes, Luiz Alberto Beraldo; Melo, Itamar Soares

    2016-11-01

    The taxonomic position of a novel marine actinomycete isolated from a marine sponge, Aplysina fulva, which had been collected in the Archipelago of Saint Peter and Saint Paul (Equatorial Atlantic Ocean), was determined by using a polyphasic approach. The organism showed a combination of morphological and chemotaxonomic characteristics consistent with its classification in the genus Streptomyces and forms a distinct branch within the Streptomyces somaliensis 16S rRNA gene tree subclade. It is closely related to Streptomyces violascens ISP 5183 T (97.27 % 16S rRNA gene sequence similarity) and Streptomyces hydrogenans NBRC 13475 T (97.15 % 16S rRNA gene sequence similarity). The 16S rRNA gene similarities between the isolate and the remaining members of the subclade are lower than 96.77 %. The organism can be distinguished readily from other members of the S. violacens subclade using a combination of phenotypic properties. On the basis of these results, it is proposed that isolate 103 T (=NRRL B-65309 T  = CMAA 1378 T ) merits recognition as the type strain of a new Streptomyces species, namely Streptomyces atlanticus sp. nov.

  13. Functional interactions within 23S rRNA involving the peptidyltransferase center

    DEFF Research Database (Denmark)

    Douthwaite, S

    1992-01-01

    resistance than either mutation alone. 23S rRNAs containing mutations at position 2058 that confer clindamycin and erythromycin resistance become deleterious to cell growth when combined with the 2032A mutation and, additionally, confer hypersensitivity to erythromycin and sensitivity to clindamycin...

  14. Metabolic engineering of antibiotic factories: New tools for antibiotic production in actinomycetes

    DEFF Research Database (Denmark)

    Weber, Tilmann; Charusanti, Pep; Musiol-Kroll, Ewa Maria

    2015-01-01

    -resistant pathogens and the development of new technologies to find and produce such compounds have again attracted interest in this field. Based on improvements in whole-genome sequencing, novel methods have been developed to identify the secondary metabolite biosynthetic gene clusters by genome mining, to clone......Actinomycetes are excellent sources for novel bioactive compounds, which serve as potential drug candidates for antibiotics development. While industrial efforts to find and develop novel antimicrobials have been severely reduced during the past two decades, the increasing threat of multidrug...

  15. Isolation, characterization and chromatography based purification of antibacterial compound isolated from rare endophytic actinomycetes Micrococcus yunnanensis

    Directory of Open Access Journals (Sweden)

    Ravi Ranjan

    2017-10-01

    Full Text Available Endophytic actinomycetes are considered as one of the relatively unexplored potential sources in search of antibiotic producer against antibiotic resistant pathogens. A potent strain isolated from Catharanthus roseus that displays antibacterial potential against antibiotic resistant human pathogen Staphylococcus aureus was characterized and designated as Micrococcus yunnanensis strain rsk5. Rsk5 is capable of producing optimum antibacterial metabolites on starch casein medium at 30 °C, pH 5 and 2% NaCl condition. The crude antibacterial agent was extracted from fermentation broth by ethyl acetate and separated by TLC using chloroform-methanol (24:1, v/v solvent system with Rf value of 0.26. It was partially purified by flash chromatography, followed by HPLC and analyzed by ultraviolet visible spectrophotometer to get absorption maxima at 208.4 nm. The ESI-MS spectra showed molecular ion peaks at m/z 472.4 [M-H], which does not match with any known antibacterial compound.

  16. Isolation, characterization and chromatography based purification of antibacterial compound isolated from rare endophytic actinomycetes Micrococcus yunnanensis.

    Science.gov (United States)

    Ranjan, Ravi; Jadeja, Vasantba

    2017-10-01

    Endophytic actinomycetes are considered as one of the relatively unexplored potential sources in search of antibiotic producer against antibiotic resistant pathogens. A potent strain isolated from Catharanthus roseus that displays antibacterial potential against antibiotic resistant human pathogen Staphylococcus aureus was characterized and designated as Micrococcus yunnanensis strain rsk5. Rsk5 is capable of producing optimum antibacterial metabolites on starch casein medium at 30 °C, pH 5 and 2% NaCl condition. The crude antibacterial agent was extracted from fermentation broth by ethyl acetate and separated by TLC using chloroform-methanol (24:1, v/v) solvent system with R f value of 0.26. It was partially purified by flash chromatography, followed by HPLC and analyzed by ultraviolet visible spectrophotometer to get absorption maxima at 208.4 nm. The ESI-MS spectra showed molecular ion peaks at m / z 472.4 [M-H], which does not match with any known antibacterial compound.

  17. Effect of thermo-tolerant actinomycetes inoculation on cellulose degradation and the formation of humic substances during composting.

    Science.gov (United States)

    Zhao, Yi; Zhao, Yue; Zhang, Zhechao; Wei, Yuquan; Wang, Huan; Lu, Qian; Li, Yanjie; Wei, Zimin

    2017-10-01

    The inoculum containing four cellulolytic thermophilic actinomycetes was screened from compost samples, and was inoculated into co-composting during different inoculation phases. The effect of different inoculation phases on cellulose degradation, humic substances formation and the relationship between inoculation and physical-chemical parameters was determined. The results revealed that inoculation at different phases of composting improved cellulase activities, accelerated the degradation of cellulose, increased the content of humic substances and influenced the structure of actinomycetic community, but there were significant differences between different inoculation phases. Redundancy analysis showed that the different inoculation phases had different impacts on the relationship between exogenous actinobacteria and physical-chemical parameters. Therefore, based on the promoting effort of inoculation in thermophilic phase of composting for the formation of humic substances, we suggested an optimized inoculation strategy to increase the content of humic substances, alleviate CO 2 emission during composting. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Nonomuraea glycinis sp. nov., a novel actinomycete isolated from the root of black soya bean [Glycine max (L.) Merr].

    Science.gov (United States)

    Li, Zhilei; Song, Wei; Zhao, Junwei; Zhuang, Xiaoxin; Zhao, Yue; Wang, Xiangjing; Xiang, Wensheng

    2017-12-01

    A novel actinomycete, designated strain NEAU-BB2C19 T , was isolated from the root of black soya bean [Glycine max (L.) Merr] collected from Harbin, Heilongjiang Province, China, and characterized using a polyphasic approach. The strain was an aerobic, Gram-stain-positive actinomycete that formed extensively branched substrate mycelium and aerial hyphae. The predominant menaquinones were MK-9(H2) and MK-9(H0). The major cellular fatty acid profile consisted of iso-C16 : 0, 10-methyl C17 : 0 and 10-methyl C18 : 0. The polar lipid profile consisted of diphosphatidylglycerol, phosphatidylethanolamine, hydroxy-phosphatidylethanolamine, phosphatidylinositol, phosphatidylinositol mannoside, phosphatidylglycerol and glycolipid. The DNA G+C content was 68.2±0.4 mol%. Phylogenetic analysis based on 16S rRNA gene sequences indicated that strain NEAU-BB2C19 T should be assigned to the genus Nonomuraea and formed a distinct branch with its closest neighbour Nonomuraea guangzhouensis NEAU-ZJ3 T (98.75 % 16S rRNA gene sequence similarity). The morphological and chemotaxonomic properties of the strain were also consistent with those of members of the genus Nonomuraea. A combination of DNA-DNA hybridization results and some phenotypic characteristics indicated that strain NEAU-BB2C19 T could be clearly differentiated from its closest phylogenetic relative. Thus, the strain is concluded to represent a novel species of the genus Nonomuraea, for which the name Nonomuraea glycinis sp. nov. is proposed. The type strain is NEAU-BB2C19 T (=CGMCC 4.7430 T =DSM 104838 T ).

  19. Micromonospora zeae sp. nov., a novel endophytic actinomycete isolated from corn root (Zea mays L.).

    Science.gov (United States)

    Shen, Yue; Zhang, Yuejing; Liu, Chongxi; Wang, Xiangjing; Zhao, Junwei; Jia, Feiyu; Yang, Lingyu; Yang, Deguang; Xiang, Wensheng

    2014-11-01

    A novel actinomycete, designated strain NEAU-gq9(T), was isolated from corn root (Zea mays L.) and characterized using a polyphasic approach. The organism was found to have morphological and chemotaxonomic characteristics typical of the genus Micromonospora. On the basis of 16S rRNA gene sequence similarity studies, strain NEAU-gq9(T) was most closely related to Micromonospora zamorensis CR38(T) (99.3%), Micromonospora jinlongensis NEAU-GRX11(T) (99.2%), Micromonospora saelicesensis Lupac 09(T) (99.2%), Micromonospora chokoriensis 2-19(6)(T) (98.9%), Micromonospora coxensis 2-30-b(28)(T) (98.6%) and Micromonospora lupini Lupac 14N(T) (98.5%). Phylogenetic analysis based on the 16S rRNA gene and gyrB gene demonstrated that strain NEAU-gq9(T) is a member of the genus Micromonospora and supported the closest phylogenetic relationship to M. zamorensis CR38(T), M. jinlongensis NEAU-GRX11(T), M. saelicesensis Lupac 09(T), M. chokoriensis 2-19(6)(T) and M. lupini Lupac 14N(T). A combination of DNA-DNA hybridization, morphological and physiological characteristics indicated that the novel strain could be readily distinguished from the closest phylogenetic relatives. Therefore, it is proposed that strain NEAU-gq9(T) represents a novel species of the genus Micromonospora, for which the name Micromonospora zeae sp. nov. is proposed. The type strain is NEAU-gq9(T) (=CGMCC 4.7092(T)=DSM 45882(T)).

  20. Streptomyces formicae sp. nov., a novel actinomycete isolated from the head of Camponotus japonicus Mayr.

    Science.gov (United States)

    Bai, Lu; Liu, Chongxi; Guo, Lifeng; Piao, Chenyu; Li, Zhilei; Li, Jiansong; Jia, Feiyu; Wang, Xiangjing; Xiang, Wensheng

    2016-02-01

    During a screening for novel and biotechnologically useful actinobacteria in insects, a novel actinomycete with antifungal activity, designated strain 1H-GS9(T), was isolated from the head of a Camponotus japonicus Mayr ant, which were collected from Northeast Agricultural University (Harbin, Heilongjiang, China). Strain 1H-GS9(T) was characterised using a polyphasic approach. The organism was found to have morphological and chemotaxonomic characteristics typical of members of the genus Streptomyces. 16S rRNA gene sequence similarity studies showed that strain 1H-GS9(T) belongs to the genus Streptomyces with high sequence similarities to Streptomyces scopuliridis DSM 41917(T) (98.8 %) and Streptomyces mauvecolor JCM 5002(T) (98.6 %). However, phylogenetic analysis based on the 16S rRNA gene sequence indicated that it forms a monophyletic clade with Streptomyces kurssanovii JCM 4388(T) (98.6 %), Streptomyces xantholiticus JCM 4282(T) (98.6 %) and Streptomyces peucetius JCM 9920(T) (98.5 %). Thus, a combination of DNA-DNA hybridization experiments and phenotypic tests were carried out between strain 1H-GS9(T) and the above-mentioned five strains, which further clarified their relatedness and demonstrated that strain 1H-GS9(T) could be distinguished from these strains. Therefore, the strain is concluded to represent a novel species of the genus Streptomyces, for which the name Streptomyces formicae sp. nov. is proposed. The type strain is 1H-GS9(T) (=CGMCC 4.7277(T) = DSM 100524(T)).

  1. Streptomyces gamaensis sp. nov., a novel actinomycete with antifungal activity isolated from soil in Gama, Chad.

    Science.gov (United States)

    Zhao, Shanshan; Ye, Lan; Liu, Chongxi; Abagana, Adam Yacoub; Zheng, Weiwei; Sun, Pengyu; Li, Jiansong; Xiang, Wensheng; Wang, Xiangjing

    2017-04-01

    During an investigation exploring potential sources of novel species and natural products, a novel actinomycete with antifungal activity, designated strain NEAU-Gz11 T , was isolated from a soil sample, which was collected from Gama, Chad. The isolate was found to have morphological and chemotaxonomic characteristics typical of members of the genus Streptomyces. 16S rRNA gene sequence similarity studies showed that strain NEAU-Gz11 T belongs to the genus Streptomyces with high sequence similarity to Streptomyces hiroshimensis JCM 4098 T (98.0 %). Similarities to other type strains of the genus Streptomyces were lower than 98.0 %. However, the physiological and biochemical characteristics and low levels of DNA-DNA relatedness could differentiate the isolate genotypically and phenotypically from S. hiroshimensis JCM 4098 T . Therefore, the strain is concluded to represent a novel species of the genus Streptomyces, for which the name Streptomyces gamaensis sp. nov. is proposed. The type strain is NEAU-Gz11 T (=CGMCC 4.7304 T =DSM 101531 T ).

  2. Screening of chitinolytic actinomycetes for biological control of Sclerotium rolfsii stem rot disease of chilli

    OpenAIRE

    Pranee Pattanapipitpaisal; Rillapat Kamlandharn

    2012-01-01

    Two hundred and eighty three strains were isolated from rhizoshere-associated soils, from Ubon Ratchathani andSrisaket province, using Enrichment Media for isolation of Chitinase-producing Actinomycetes agar (EMCA agar). All strainswere screened for chitinolytic activity and sixty eight strains gave significant clear zone on EMCA agar plates. The selectedchitinolytic strains were assayed for in vitro antagonism against Sclerotium rolfsii using cornmeal agar (CMA agar) assayprocedure and the r...

  3. Higher-order organisation of extremely amplified, potentially functional and massively methylated 5S rDNA in European pikes (Esox sp.).

    Science.gov (United States)

    Symonová, Radka; Ocalewicz, Konrad; Kirtiklis, Lech; Delmastro, Giovanni Battista; Pelikánová, Šárka; Garcia, Sonia; Kovařík, Aleš

    2017-05-18

    Pikes represent an important genus (Esox) harbouring a pre-duplication karyotype (2n = 2x = 50) of economically important salmonid pseudopolyploids. Here, we have characterized the 5S ribosomal RNA genes (rDNA) in Esox lucius and its closely related E. cisalpinus using cytogenetic, molecular and genomic approaches. Intragenomic homogeneity and copy number estimation was carried out using Illumina reads. The higher-order structure of rDNA arrays was investigated by the analysis of long PacBio reads. Position of loci on chromosomes was determined by FISH. DNA methylation was analysed by methylation-sensitive restriction enzymes. The 5S rDNA loci occupy exclusively (peri)centromeric regions on 30-38 acrocentric chromosomes in both E. lucius and E. cisalpinus. The large number of loci is accompanied by extreme amplification of genes (>20,000 copies), which is to the best of our knowledge one of the highest copy number of rRNA genes in animals ever reported. Conserved secondary structures of predicted 5S rRNAs indicate that most of the amplified genes are potentially functional. Only few SNPs were found in genic regions indicating their high homogeneity while intergenic spacers were more heterogeneous and several families were identified. Analysis of 10-30 kb-long molecules sequenced by the PacBio technology (containing about 40% of total 5S rDNA) revealed that the vast majority (96%) of genes are organised in large several kilobase-long blocks. Dispersed genes or short tandems were less common (4%). The adjacent 5S blocks were directly linked, separated by intervening DNA and even inverted. The 5S units differing in the intergenic spacers formed both homogeneous and heterogeneous (mixed) blocks indicating variable degree of homogenisation between the loci. Both E. lucius and E. cisalpinus 5S rDNA was heavily methylated at CG dinucleotides. Extreme amplification of 5S rRNA genes in the Esox genome occurred in the absence of significant pseudogenisation

  4. Genome Sequence and Analysis of the Soil Cellulolytic ActinomyceteThermobifida fusca

    Energy Technology Data Exchange (ETDEWEB)

    Lykidis, Athanasios; Mavromatis, Konstantinos; Ivanova, Natalia; Anderson, Iain; Land, Miriam; DiBartolo, Genevieve; Martinez, Michele; Lapidus, Alla; Lucas, Susan; Copeland, Alex; Richardson, Paul; Wilson,David B.; Kyrpides, Nikos

    2007-02-01

    Thermobifida fusca is a moderately thermophilic soilbacterium that belongs to Actinobacteria. 3 It is a major degrader ofplant cell walls and has been used as a model organism for the study of 4secreted, thermostable cellulases. The complete genome sequence showedthat T. fusca has a 5 single circular chromosome of 3642249 bp predictedto encode 3117 proteins and 65 RNA6 species with a coding densityof 85percent. Genome analysis revealed the existence of 29 putative 7glycoside hydrolases in addition to the previously identified cellulasesand xylanases. The 8 glycosyl hydrolases include enzymes predicted toexhibit mainly dextran/starch and xylan 9 degrading functions. T. fuscapossesses two protein secretion systems: the sec general secretion 10system and the twin-arginine translocation system. Several of thesecreted cellulases have 11 sequence signatures indicating theirsecretion may be mediated by the twin-arginine12 translocation system. T.fusca has extensive transport systems for import of carbohydrates 13coupled to transcriptional regulators controlling the expression of thetransporters and14 glycosylhydrolases. In addition to providing anoverview of the physiology of a soil 15 actinomycete, this study presentsinsights on the transcriptional regulation and secretion of16 cellulaseswhich may facilitate the industrial exploitation of thesesystems.

  5. Nonomuraea indica sp. nov., novel actinomycetes isolated from lime-stone open pit mine, India.

    Science.gov (United States)

    Quadri, Syed Raziuddin; Tian, Xin-Peng; Zhang, Jing; Li, Jie; Nie, Guo-Xing; Tang, Shu-Kun; Al Ruwaili, Jamal; Agsar, Dayanand; Li, Wen-Jun; Dastager, Syed G

    2015-08-01

    A Gram-positive, aerobic, nonmotile actinomycete strain designated DRQ-2(T) was isolated from the soil sample collected from lime-stone open pit mine from the Gulbarga region, Karnataka province, India. Strain DRQ-2(T) was identified as a member of the genus Nonomuraea by a polyphasic approach. Strain DRQ-2(T) could be differentiated from other members of the genus Nonomuraea on the basis of physiology and 16S rRNA gene sequence analysis. The 16S rRNA gene sequence similarity of strain DRQ-2(T) showed highest sequence similarity to Nonomuraea muscovyensis DSM 45913(T) (99.1%), N. salmonea DSM 43678(T) (98.2%) and N. maheshkhaliensis JCM 13929(T) with 98.0%, respectively. Chemotaxonomic properties showing predominant menaquinones of MK-9 (H4), MK-9(H2) and MK-9(H6), major polar lipids comprised diphosphatidylglycerol, phosphatidylmono methyl ethanolamine (PME), phosphatidylethanolamine (PE), hydroxy-PME (OH-PME), hydroxy PE (OH-PEE), phosphatidylglycerol (PG), ninhydrin-positive phosphoglycolipid and unknown phospholipid, fatty acids with major amounts of i-C16:0, ai-C15:0 and ai-C17:0 supported allocation of the strain to the genus Nonomuraea. Results of DNA-DNA hybridization and physiological tests allowed genotypic and phenotypic differentiation of strain DRQ-2(T) from closely related species. The genomic DNA G+C content of the organism was 72.5 mol%. On the basis of phenotypic, chemotypic and molecular characteristics, strain DRQ-2(T) represents a novel species of the genus Nonomuraea, for which the name N. indica sp. nov. is proposed, with type strain DRQ-2(T) (=NCIM 5480(T)= CCTCC AA 209050(T)).

  6. Streptomyces tritici sp. nov., a novel actinomycete isolated from rhizosphere soil of wheat (Triticum aestivum L.).

    Science.gov (United States)

    Zhao, Junwei; Shi, Linlin; Li, Wenchao; Wang, Jiabin; Wang, Han; Tian, Yuanyuan; Xiang, Wensheng; Wang, Xiangjing

    2018-02-01

    Two novel actinomycete isolates, designated strains NEAU-A4 T and NEAU-A3, were isolated from rhizosphere soil of wheat (Triticumaestivum L.) and characterized using a polyphasic approach. Morphological and chemotaxonomic characteristics of the two strains coincided with those of the genus Streptomyces. The 16S rRNA gene sequence analysis showed that the two isolates exhibited 99.6 % 16S rRNA gene sequence similarity with each other and that they were most closely related to Streptomyces violaceorectus DSM 40279 T (98.8, 99.0 %). Phylogenetic analysis based on 16S rRNA gene sequences indicated that the two strains clustered together and formed a separate subclade. Furthermore, a combination of DNA-DNA hybridization results and some physiological and biochemical properties demonstrated that the two strains could be distinguished from its closest relative. Therefore, it is proposed that strains NEAU-A4 T and NEAU-A3 should be classified as representatives of a novel species of the genus Streptomyces, for which the name Streptomycestritici sp. nov. is proposed. The type strain is NEAU-A4 T (=CGMCC 4.7393 T =DSM 104540 T ).

  7. Tetrocarcin Q, a New Spirotetronate with a Unique Glycosyl Group from a Marine-Derived Actinomycete Micromonospora carbonacea LS276

    Directory of Open Access Journals (Sweden)

    Ting Gong

    2018-02-01

    Full Text Available A new spirotetronate glycoside tetrocarcin Q (1 and six known analogues tetrocarcin A (2, AC6H (3, tetrocarcin N (4, tetrocarcin H (5, arisostatin A (6, and tetrocarcin F1 (7 were isolated from the fermentation broth of the marine-derived actinomycete Micromonospora carbonacea LS276. Their chemical structures were established on the basis of 1D- and 2D-NMR spectroscopy, as well as HR-ESI-MS analysis. The absolute configurations of their stereogenic carbons were determined by circular dichroism (CD analysis. Compound 1 possesses 2-deoxy-allose, which is a unique sugar type at the C-9 position. This type has not been found in the previously reported spirotetronate glycosides. Compound 1 displayed moderate antibacterial activity against Bacillus subitlis ATCC 63501 with minimum inhibitory concentration (MIC value of 12.5 μM.

  8. Nocardia kroppenstedtii sp. nov., an actinomycete isolated from a lung transplant patient with a pulmonary infection.

    LENUS (Irish Health Repository)

    Jones, Amanda L

    2014-03-01

    A novel actinomycete, strain N1286(T), isolated from a lung transplant patient with a pulmonary infection, was provisionally assigned to the genus Nocardia. The strain had chemotaxonomic and morphological properties typical of members of the genus Nocardia and formed a distinct phyletic line in the Nocardia 16S rRNA gene tree. Isolate N1286(T) was most closely related to Nocardia farcinica DSM 43665(T) (99.8% gene sequence similarity) but could be distinguished from the latter by the low level of DNA-DNA relatedness. These strains were also distinguishable on the basis of a broad range of phenotypic properties. It is concluded that strain N1286(T) represents a novel species of the genus Nocardia for which the name Nocardia kroppenstedtii sp. nov. is proposed. The type strain is N1286(T) ( = DSM 45810(T) = NCTC 13617(T)).

  9. Streptomyces bryophytorum sp. nov., an endophytic actinomycete isolated from moss (Bryophyta).

    Science.gov (United States)

    Li, Chuang; Jin, Pinjiao; Liu, Chongxi; Ma, Zhaoxu; Zhao, Junwei; Li, Jiansong; Wang, Xiangjing; Xiang, Wensheng

    2016-09-01

    A novel endophytic actinomycete, designated strain NEAU-HZ10(T) was isolated from moss and characterised using a polyphasic approach. The strain was found to have morphological and chemotaxonomic characteristics typical of the genus Streptomyces. Strain NEAU-HZ10(T) formed grayish aerial mycelia, which differentiated into straight to flexuous chains of cylindrical spores. The cell wall peptidoglycan was found to contain LL-diaminopimelic acid. Predominant menaquinones were identified as MK-9(H6) and MK-9(H8). The polar lipid profile was found to consist of phosphatidylethanolamine, phosphatidylinositol and two unidentified phospholipids. The major fatty acids were identified as iso-C16:0, anteiso-C15:0 and C16:0. 16S rRNA gene sequence similarity studies showed that strain NEAU-HZ10(T) belongs to the genus Streptomyces and exhibits high sequence similarity to Streptomyces cocklensis DSM 42063(T) (98.9 %). Phylogenetic analysis based on the 16S rRNA gene sequence indicated that strain NEAU-HZ10(T) clustered with S. cocklensis DSM 42063(T), Streptomyces yeochonensis CGMCC 4.1882(T) (98.7 %), Streptomyces paucisporeus CGMCC 4.2025(T) (98.4 %) and Streptomyces yanglinensis CGMCC 4.2023(T) (98.1 %). However, a combination of DNA-DNA hybridisation results and some phenotypic characteristics indicated that strain NEAU-HZ10(T) can be distinguished from its phylogenetically closely related strains. Therefore, it is proposed that strain NEAU-HZ10(T) represents a novel species of the genus Streptomyces for which the name Streptomyces bryophytorum sp. nov. is proposed. The type strain is NEAU-HZ10(T) (= CGMCC 4.7151(T) = DSM 42138(T)).

  10. Streptomyces kronopolitis sp. nov., an actinomycete that produces phoslactomycins isolated from a millipede (Kronopolites svenhedind Verhoeff).

    Science.gov (United States)

    Liu, Chongxi; Ye, Lan; Li, Yao; Jiang, Shanwen; Liu, Hui; Yan, Kai; Xiang, Wensheng; Wang, Xiangjing

    2016-12-01

    A phoslactomycin-producing actinomycete, designated strain NEAU-ML8T, was isolated from a millipede (Kronopolites svenhedind Verhoeff) and characterized using a polyphasic approach. 16S rRNA gene sequence analysis showed that strain NEAU-ML8T belongs to the genus Streptomyces with the highest sequence similarities to Streptomyces lydicus NBRC 13058T (99.39 %) and Streptomyces chattanoogensis DSM 40002T (99.25 %). The maximum-likelihood phylogenetic tree based on 16S rRNA gene sequences showed that the isolate formed a distinct phyletic line with NBRC 13058T and S. chattanoogensis DSM 40002T. This branching pattern was also supported by the tree rconstructed with the neighbour-joining method. A combination of DNA-DNA hybridization experiments and phenotypic tests were carried out between strain NEAU-ML8T and its phylogenetically closely related strains, which further clarified their relatedness and demonstrated that NEAU-ML8T could be distinguished from NBRC 13058T and S. chattanoogensis DSM 40002T. Therefore, it is concluded that strain NEAU-ML8T can be classified as representing a novel species of the genus Streptomyces, for which the name Streptomyces kronopolitis sp. nov. is proposed. The type strain is NEAU-ML8T (=DSM 101986T=CGMCC 4.7323T).

  11. Rhodococcus equi: the many facets of a pathogenic actinomycete.

    Science.gov (United States)

    Vázquez-Boland, José A; Giguère, Steeve; Hapeshi, Alexia; MacArthur, Iain; Anastasi, Elisa; Valero-Rello, Ana

    2013-11-29

    Rhodococcus equi is a soil-dwelling pathogenic actinomycete that causes pulmonary and extrapulmonary pyogranulomatous infections in a variety of animal species and people. Young foals are particularly susceptible and develop a life-threatening pneumonic disease that is endemic at many horse-breeding farms worldwide. R. equi is a facultative intracellular parasite of macrophages that replicates within a modified phagocytic vacuole. Its pathogenicity depends on a virulence plasmid that promotes intracellular survival by preventing phagosome-lysosome fusion. Species-specific tropism of R. equi for horses, pigs and cattle appears to be determined by host-adapted virulence plasmid types. Molecular epidemiological studies of these plasmids suggest that human R. equi infection is zoonotic. Analysis of the recently determined R. equi genome sequence has identified additional virulence determinants on the bacterial chromosome. This review summarizes our current understanding of the clinical aspects, biology, pathogenesis and immunity of this fascinating microbe with plasmid-governed infectivity. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. In vitro antimicrobial activity and characterization of mangrove isolates of streptomycetes effective against bacteria and fungi of nosocomial origin

    Directory of Open Access Journals (Sweden)

    Arijit Das

    2014-06-01

    Full Text Available The study aimed at determining the in vitro antimicrobial activity of alkaliphilic and halotolerant actinomycetes isolated from a mangrove ecosystem and identification of a potent strain. Twenty five isolates of actinomycetes were isolated from the sediment samples of Valapattanam mangrove swamp in Kerala, India. Antimicrobial activity of four selected actinomycete isolates was determined against bacterial and fungal pathogens of nosocomial origin by agar well diffusion method. Molecular characterization of the potent isolate was performed by 16S rDNA sequencing. Isolate no I-1 significantly inhibited Staphylococcus aureus ATCC 25923 (12 mm, S. aureus (15±0.05 mm, S. citreus (20±0.5 mm, Bacillus cereus (17±0.2 mm and Serratia marcescens (12 mm. It also demonstrated effective antifungal action against Penicillium sp. (12±0.2 mm, Candida albicans (20±0.5 mm, C. parapsilosis (12 mm and Cryptococcus neoformans (12 mm. Morphological study revealed that all the isolated actinomycetes belonged to the genus Streptomyces. Based on 16S rDNA sequence data, the selected isolate I-1 was shown to be closely related to Streptomyces xiamenensis. The results revealed that the mangrove ecosystem of Valapattanam harboured a rich consortium of many potent actinomycetes, which could synthesize novel bioactive compounds of pharmacological significance.

  13. Genetic Screening Strategy for Rapid Access to Polyether Ionophore Producers and Products in Actinomycetes ▿ †

    OpenAIRE

    Wang, Hao; Liu, Ning; Xi, Lijun; Rong, Xiaoying; Ruan, Jisheng; Huang, Ying

    2011-01-01

    Polyether ionophores are a unique class of polyketides with broad-spectrum activity and outstanding potency for the control of drug-resistant bacteria and parasites, and they are produced exclusively by actinomycetes. A special epoxidase gene encoding a critical tailoring enzyme involved in the biosynthesis of these compounds has been found in all five of the complete gene clusters of polyether ionophores published so far. To detect potential producer strains of these antibiotics, a pair of d...

  14. Multiple, novel biologically active endophytic actinomycetes isolated from upper Amazonian rainforests.

    Science.gov (United States)

    Bascom-Slack, Carol A; Ma, Cong; Moore, Emily; Babbs, Beatrice; Fenn, Kathleen; Greene, Joshua S; Hann, Bradley D; Keehner, Jocelyn; Kelley-Swift, Elizabeth G; Kembaiyan, Vivek; Lee, Sun Jin; Li, Puyao; Light, David Y; Lin, Emily H; Schorn, Michelle A; Vekhter, Daniel; Boulanger, Lori-Ann; Hess, W M; Vargas, Percy Núñez; Strobel, Gary A; Strobel, Scott A

    2009-08-01

    Microbial biodiversity provides an increasingly important source of medically and industrially useful compounds. We have isolated 14 actinomycete species from a collection of approximately 300 plant stem samples from the upper Amazonian rainforest in Peru. All of the cultured isolates produce substances with inhibitory activity directed at a range of potential fungal and bacterial pathogens. For some organisms, this activity is very broad in spectrum while other organisms show specific activity against a limited number of organisms. Two of these organisms preferentially inhibit bacterial test organisms over eukaryotic organisms. rDNA sequence analysis indicates that these organisms are not equivalent to any other cultured deposits in GenBank. Our results provide evidence of the untapped biodiversity in the form of biologically active microbes present within the tissues of higher plants.

  15. YgdE is the 2'-O-ribose methyltransferase RlmM specific for nucleotide C2498 in bacterial 23S rRNA

    DEFF Research Database (Denmark)

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M

    2009-01-01

    The rRNAs of Escherichia coli contain four 2'-O-methylated nucleotides. Similar to other bacterial species and in contrast with Archaea and Eukaryota, the E. coli rRNA modifications are catalysed by specific methyltransferases that find their nucleotide targets without being guided by small...... complementary RNAs. We show here that the ygdE gene encodes the methyltransferase that catalyses 2'-O-methylation at nucleotide C2498 in the peptidyl transferase loop of E. coli 23S rRNA. Analyses of rRNAs using MALDI mass spectrometry showed that inactivation of the ygdE gene leads to loss of methylation...... at nucleotide C2498. The loss of ygdE function causes a slight reduction in bacterial fitness. Methylation at C2498 was restored by complementing the knock-out strain with a recombinant copy of ygdE. The recombinant YgdE methyltransferase modifies C2498 in naked 23S rRNA, but not in assembled 50S subunits...

  16. Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

    Science.gov (United States)

    Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

    2018-01-01

    Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion

  17. Characterization of a chitinase from the cellulolytic actinomycete Thermobifida fusca.

    Science.gov (United States)

    Gaber, Yasser; Mekasha, Sophanit; Vaaje-Kolstad, Gustav; Eijsink, Vincent G H; Fraaije, Marco W

    2016-09-01

    Thermobifida fusca is a well-known cellulose-degrading actinomycete, which produces various glycoside hydrolases for this purpose. However, despite the presence of putative chitinase genes in its genome, T. fusca has not been reported to grow on chitin as sole carbon source. In this study, a gene encoding a putative membrane-anchored GH18 chitinase (Tfu0868) from T. fusca has been cloned and overexpressed in Escherichia coli. The protein was produced as SUMO fusion protein and, upon removal of the SUMO domain, soluble pure TfChi18A was obtained with yields typically amounting to 150mg per litre of culture. The enzyme was found to be relatively thermostable (apparent Tm=57.5°C) but not particularly thermoactive, the optimum temperature being 40-45°C. TfChi18A bound to α- and β-chitin and degraded both these substrates. Interestingly, activity towards colloidal chitin was minimal and in this case, substrate inhibition was observed. TfChi18A also cleaved soluble chito-oligosaccharides and showed a clear preference for substrates having five sugars or more. While these results show that TfChi18A is a catalytically competent GH18 chitinase, the observed catalytic rates were low compared to those of well-studied GH18 chitinases. This suggests that TfChi18A is not a true chitinase and not likely to endow T. fusca with the ability to grow on chitin. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Prokaryotic and eukaryotic features observed on the secondary structures of Giardia SSU rRNAs and its phylogenetic implications.

    Science.gov (United States)

    Hwang, Ui Wook

    2007-04-01

    Phylogenetic position of a diplomonad protist Giardia, a principle cause of diarrhea, among eukaryotes has been vigorously debated so far. Through the comparisons of primary and secondary structures of SSU rRNAs of G. intestinalis, G. microti, G. ardeae, and G. muris, I found two major indel regions (a 6-nt indel and a 22-26-nt indel), which correspond to the helix 10 of the V2 region and helices E23-8 to E23-9 of the V4 region, respectively. As generally shown in eukaryotes, G. intestinalis and G. microti have commonly a relatively longer helix 10 (a 7-bp stem and a 4-nt loop), and also the eukaryote-specific helices E23-6 to E23-9. On the other hand, G. muris and G. ardeae have a shorter helix 10: a 2-bp stem and a 6-nt loop in G. ardeae and a 3-bp stem and a 6-nt loop in G. muris. In the V4, they have a single long helix (like the P23-1 helix in prokaryotes) instead of the helices E23-6 to E23-9. Among the four Giardia species, co-appearance of prokaryote- and eukaryote-typical features might be significant evidence to suggest that Giardia (Archezoa) is a living fossil showing an "intermediate stage" during the evolution from prokaryotes to eukaryotes.

  19. Streptomyces castaneus sp. nov., a novel actinomycete isolated from the rhizosphere of Peucedanum praeruptorum Dunn.

    Science.gov (United States)

    Zhou, Shuyu; Li, Zhilei; Bai, Lu; Yan, Kai; Zhao, Junwei; Lu, Chang; Liu, Chongxi; Wang, Xiangjing; Xiang, Wensheng

    2017-01-01

    During an investigation of microbial diversity in medicinal herbs, a novel actinomycete, strain NEAU-QHHV11 T was isolated from the rhizosphere of Peucedanum praeruptorum Dunn collected from Xianglu Mountain in Heilongjiang Province, northeast China and characterized using a polyphasic approach. The organism was found to have typical characteristics of the genus Streptomyces. Phylogenetic analysis based on 16S rRNA gene sequence also indicated that strain NEAU-QHHV11 T belongs to the genus Streptomyces and was most closely related to Streptomyces graminilatus NBRC 108882 T (98.7 % sequence similarity) and Streptomyces turgidiscabies NBRC 16080 T (98.7 % sequence similarity). The results of DNA-DNA hybridization and some phenotypic characteristics indicated that strain NEAU-QHHV11 T could be distinguished from its close phylogenetic relatives. Thus, strain NEAU-QHHV11 T represents a novel species of the genus Streptomyces, for which the name Streptomyces castaneus sp. nov. is proposed. The type strain is NEAU-QHHV11 T (=CGMCC 4.7235 T  = DSM 100520 T ).

  20. Transcriptome-wide mapping of 5-methylcytidine RNA modifications in bacteria, archaea, and yeast reveals m5C within archaeal mRNAs.

    Directory of Open Access Journals (Sweden)

    Sarit Edelheit

    2013-06-01

    Full Text Available The presence of 5-methylcytidine (m(5C in tRNA and rRNA molecules of a wide variety of organisms was first observed more than 40 years ago. However, detection of this modification was limited to specific, abundant, RNA species, due to the usage of low-throughput methods. To obtain a high resolution, systematic, and comprehensive transcriptome-wide overview of m(5C across the three domains of life, we used bisulfite treatment on total RNA from both gram positive (B. subtilis and gram negative (E. coli bacteria, an archaeon (S. solfataricus and a eukaryote (S. cerevisiae, followed by massively parallel sequencing. We were able to recover most previously documented m(5C sites on rRNA in the four organisms, and identified several novel sites in yeast and archaeal rRNAs. Our analyses also allowed quantification of methylated m(5C positions in 64 tRNAs in yeast and archaea, revealing stoichiometric differences between the methylation patterns of these organisms. Molecules of tRNAs in which m(5C was absent were also discovered. Intriguingly, we detected m(5C sites within archaeal mRNAs, and identified a consensus motif of AUCGANGU that directs methylation in S. solfataricus. Our results, which were validated using m(5C-specific RNA immunoprecipitation, provide the first evidence for mRNA modifications in archaea, suggesting that this mode of post-transcriptional regulation extends beyond the eukaryotic domain.

  1. PCR screening reveals considerable unexploited biosynthetic potential of ansamycins and a mysterious family of AHBA-containing natural products in actinomycetes.

    Science.gov (United States)

    Wang, H-X; Chen, Y-Y; Ge, L; Fang, T-T; Meng, J; Liu, Z; Fang, X-Y; Ni, S; Lin, C; Wu, Y-Y; Wang, M-L; Shi, N-N; He, H-G; Hong, K; Shen, Y-M

    2013-07-01

    Ansamycins are a family of macrolactams that are synthesized by type I polyketide synthase (PKS) using 3-amino-5-hydroxybenzoic acid (AHBA) as the starter unit. Most members of the family have strong antimicrobial, antifungal, anticancer and/or antiviral activities. We aimed to discover new ansamycins and/or other AHBA-containing natural products from actinobacteria. Through PCR screening of AHBA synthase gene, we identified 26 AHBA synthase gene-positive strains from 206 plant-associated actinomycetes (five positives) and 688 marine-derived actinomycetes (21 positives), representing a positive ratio of 2·4-3·1%. Twenty-five ansamycins, including eight new compounds, were isolated from six AHBA synthase gene-positive strains through TLC-guided fractionations followed by repeated column chromatography. To gain information about those potential ansamycin gene clusters whose products were unknown, seven strains with phylogenetically divergent AHBA synthase genes were subjected to fosmid library construction. Of the seven gene clusters we obtained, three show characteristics for typical ansamycin gene clusters, and other four, from Micromonospora spp., appear to lack the amide synthase gene, which is unusual for ansamycin biosynthesis. The gene composition of these four gene clusters suggests that they are involved in the biosynthesis of a new family of hybrid PK-NRP compounds containing AHBA substructure. PCR screening of AHBA synthase is an efficient approach to discover novel ansamycins and other AHBA-containing natural products. This work demonstrates that the AHBA-based screening method is a useful approach for discovering novel ansamycins and other AHBA-containing natural products from new microbial resources. Journal of Applied Microbiology © 2013 The Society for Applied Microbiology.

  2. Streptomyces luozhongensis sp. nov., a novel actinomycete with antifungal activity and antibacterial activity.

    Science.gov (United States)

    Zhang, Renwen; Han, Xiaoxue; Xia, Zhanfeng; Luo, Xiaoxia; Wan, Chuanxing; Zhang, Lili

    2017-02-01

    A novel actinomycete strain, designated TRM 49605 T , was isolated from a desert soil sample from Lop Nur, Xinjiang, north-west China, and characterised using a polyphasic taxonomic approach. The strain exhibited antifungal activity against the following strains: Saccharomyces cerevisiae, Curvularia lunata, Aspergillus flavus, Aspergillus niger, Fusarium oxysporum, Penicillium citrinum, Candida albicans and Candida tropicalis; Antibacterial activity against Bacillus subtilis, Staphylococcus epidermidis and Micrococcus luteus; and no antibacterial activity against Escherichia coli. Phylogenetic analysis based on 16S rRNA gene sequences affiliated strain TRM 49605 T to the genus Streptomyces. Strain TRM 49605 T shows high sequence similarities to Streptomyces roseolilacinus NBRC 12815 T (98.62 %), Streptomyces flavovariabilis NRRL B-16367 T (98.45 %) and Streptomyces variegatus NRRL B-16380 T (98.45 %). Whole cell hydrolysates of strain TRM 49605 T were found to contain LL-diaminopimelic acid as the diagnostic diamino acid and galactose, glucose, xylose and mannose as the major whole cell sugars. The major fatty acids in strain TRM 49605 T were identified as iso C 16:0 , anteiso C 15:0 , C 16:0 and Summed Feature 5 as defined by MIDI. The main menaquinones were identified as MK-9(H 4 ), MK-9(H 6 ), MK-9(H 8 ) and MK-10(H 6 ). The polar lipids were diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylcholine, phosphatidylinositol and phosphatidylinositol mannoside. The G+C content of the genomic DNA was determined to be 71.2 %. The DNA-DNA relatedness between strain TRM 49605 T and the phylogenetically related strain S. roseolilacinus NBRC 12815 T was 60.12 ± 0.06 %, which is lower than the 70 % threshold value for delineation of genomic prokaryotic species. Based on the phenotypic, chemotaxonomic and phylogenetic data, strain TRM 49605 T (=CCTCC AA2015026 T  = KCTC 39666 T ) should be designated as the type strain of a novel species of the genus

  3. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    Science.gov (United States)

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Flocculation mechanism of the actinomycete Streptomyces sp. hsn06 on Chlorella vulgaris.

    Science.gov (United States)

    Li, Yi; Xu, Yanting; Zheng, Tianling; Wang, Hailei

    2017-09-01

    In this study, an actinomycete Streptomyces sp. hsn06 with the ability to harvest Chlorella vulgaris biomass was used to investigate the flocculation mechanism. Streptomyces sp. hsn06 exhibited flocculation activity on algal cells through mycelial pellets with adding calcium. Calcium was determined to promote flocculation activity of mycelial pellets as a bridge binding with mycelial pellets and algal cells, which implied that calcium bridging is the main flocculation mechanism for mycelial pellets. Characteristics of flocculation activity confirmed proteins in mycelial pellets involved in flocculation procedure. The morphology and structure of mycelial pellets also caused dramatic effects on flocculation activity of mycelial pellets. According to the results, Streptomyces sp. hsn06 can be used as a novel flocculating microbial resource for high-efficiency harvesting of microalgae biomass. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Observation of the strongest 5s2 5p6 5d-(5s2 5p5 5d6s+5s25p6 7p) transitions in Au XI to Bi XV ions

    International Nuclear Information System (INIS)

    Churilov, S.S.; Joshi, Y.N.

    2001-01-01

    The spectra of gold till bismuth were studied in the 90-135 A region. Nine most intense lines belonging to the 5s 2 5p 6 5d-5s 2 5p 5 5d6s array were identified in Au XI to Bi XV ions. The 5s 2 5p 6 7p 2 P 3/2,1/2 levels in Au XI and the 5s 2 5p 6 7p 2 P 3/2 level in Hg XII were also identified. The observed wavelengths and intensities agree quite well with the Hartree-Fock calculations. (orig.)

  6. Actinoplanes rhizophilus sp. nov., an actinomycete isolated from the rhizosphere of Sansevieria trifasciata Prain.

    Science.gov (United States)

    He, Hairong; Xing, Jia; Liu, Chongxi; Li, Chuang; Ma, Zhaoxu; Li, Jiansong; Xiang, Wensheng; Wang, Xiangjing

    2015-12-01

    A novel actinomycete, designated strain NEAU-A-2T, was isolated from the rhizosphere soil of Sansevieria trifasciata Prain collected from Heilongjiang province, north-east China. The taxonomic status of this organism was established using a polyphasic approach. The isolate formed irregular sporangia containing motile spores on the substrate mycelium. The whole-cell sugars were xylose and galactose. The predominant menaquinones were MK-9(H10), MK-9(H2), MK-10(H2) and MK-10(H4). The major fatty acids were iso-C15 : 0, iso-C16 : 0 and anteiso-C15 : 0. The polar lipids were diphosphatidylglycerol, phosphatidylmonomethylethanolamine, phosphatidylethanolamine, phosphatidylinositol, three unidentified phospholipids and an unidentified glycolipid. 16S rRNA gene sequence similarity studies showed that strain NEAU-A-2T belongs to the genus Actinoplanes with the highest sequence similarities to Actinoplanes globisporus NBRC 13912T (97.7 % 16S rRNA gene sequence similarity), Actinoplanes ferrugineus IMSNU 22125T (97.5 %), Actinoplanes toevensis MN07-A0368T (97.2 %) and Actinoplanes rishiriensis NBRC 108556T (97.2 %); similarities to type strains of other species of this genus were < 97 %. Two tree-making algorithms showed that strain NEAU-A-2T formed a distinct clade with A. globisporus NBRC 13912T and A. rishiriensis NBRC 108556T. However, low DNA-DNA relatedness values allowed the isolate to be differentiated from the above-mentioned two species of the genus Actinoplanes. Moreover, strain NEAU-A-2T could also be distinguished from the most closely related species by morphological and physiological characteristics. Therefore, in conclusion, isolate NEAU-A-2T represents a novel species of the genus Actinoplanes, for which the name Actinoplanes rhizophilus sp. nov. is proposed. The type strain is NEAU-A-2T ( = CGMCC 4.7133T = DSM 46672T).

  7. Bioethanol Production from Empty Fruit Bunch using Direct Fermentation by an Actinomycete Streptosporangium roseum

    Science.gov (United States)

    Nik Him, N. R.; Huda, T.

    2018-05-01

    Study on the production of bioethanol using palm oil empty fruit bunch (EFB) has been performed using actinomycete Streptosporangium roseum. Positive result of bioethanol production was recorded using Iodoform test followed by confirmation with GC-FID using a polar capillary column (PEG-type, 10m x 0.53, with autosampler) and n-propanol as internal standard. The first and second round distillation has produced azeotrope (85-15% ethanol-water) and the third round has concentrated the ethanol to 96.1%. Therefore, the process was accomplished by using molecular sieves that selectively absorbed the final excess water. Direct fermentation using Streptosporangium roseum has shown to be a very potential way to catalyst for the synthesis of bioethanol from EFB.

  8. Generalized oscillator strengths for 5s, 5s', and 5p excitations of krypton

    International Nuclear Information System (INIS)

    Li Wenbin; Zhu Linfan; Yuan Zhensheng; Sun Jianmin; Cheng Huadong; Xu Kezun; Zhong Zhiping; Liu Xiaojing

    2003-01-01

    The absolute generalized oscillator strengths (GOSs) for 5s, 5s ' , 5p [5/2] 3,2 , 5p [3/2] 1,2 , and 5p [1/2] 0 transitions of krypton have been determined in a large K 2 region at a high electron-impact energy of 2500 eV. The positions of the minima and maxima of these GOSs have been determined. The present results show that the angular resolution and pressure effect have great influence on the position and the amplitude of the minimum for the GOS of 5s+5s ' transitions. When these effects are considered, the measured minimum position for the GOS of 5s+5s ' transitions is in excellent agreement with the calculation of Chen and Msezane [J. Phys. B 33, 5397 (2000)

  9. Estudio de actinomicetos marinos aislados de la costa central del Perú y su actividad antibacteriana frente a Staphylococcus aureus Meticilina Resistentes y Enterococcus faecalis Vancomicina Resistentes Study of marine actinomycetes isolated from the central coast of Peru and their antibacterial activity against Methicillin-Resistant Staphylococcus aureus and Vancomycin-Resistant Enterococcus faecalis

    Directory of Open Access Journals (Sweden)

    Jorge León

    2011-06-01

    Full Text Available Objetivos. Determinar el potencial antimicrobiano de actinomicetos marinos frente a cepas S. aureus meticilino-resistentes (MRSA y E. faecalis vancomicina-resistentes (VRE. Materiales y métodos. En dos medios de cultivo se sembraron 29 cepas de actinomicetos aislados de sedimento marino. Se evaluó la capacidad inhibitoria mediante pruebas de antagonismo in vitro para MRSA y VRE. Se procesó los extractos orgánicos de tres actinomicetos seleccionados para determinar la Concentración Mínima Inhibitoria (CMI del compuesto activo. Resultados. La mayoría de los actinomicetos aislados correspondieron a un grupo homogéneo de blanco-grisáceos (62% con buen nivel de crecimiento en agar marino. Los porcentajes inhibitorios fueron superiores a 85% para ambos patógenos con halos de inhibición mayores a 69 y 78 mm de diámetro para MRSA y VRE respectivamente. Los extractos diclorometánicos de tres de los actinomicetos aislados (I-400A, B1-T61, M10-77 mostraron gran potencial inhibitorio de ambos patógenos, siendo M10-77 la cepa de actinomiceto de mayor actividad antibiótica frente a S. aureus ATCC 43300 resistente a meticilina y E. faecalis ATCC 51299 resistente a vancomicina con una Concentración Mínima Inhibitoria (CMI de 7,9 y 31,7 μg/ mL respectivamente. El análisis filogenético de la cepa M10- 77 presenta un 99% de similaridad con la especie marina Streptomyces erythrogriseus. Conclusiones. El sedimento marino de la costa central del Perú es fuente promisorio de cepas de actinomicetos con gran capacidad de producir compuestos bioactivos capaces de inhibir patógenos tipificados como multidrogo-resistentes tales como S. aureus meticilino resistentes y E. faecalis vancomicina resistentes.Objectives. To determine the antimicrobial potential of marine actinomycetes against drug-resistant pathogens represented by strains of methicillin-resistant Staphylococcus aureus (MRSA and vancomycin-resistant Enterococcus faecalis (VRE. Materials and

  10. Endophytic actinomycetes from spontaneous plants of Algerian Sahara: indole-3-acetic acid production and tomato plants growth promoting activity.

    Science.gov (United States)

    Goudjal, Yacine; Toumatia, Omrane; Sabaou, Nasserdine; Barakate, Mustapha; Mathieu, Florence; Zitouni, Abdelghani

    2013-10-01

    Twenty-seven endophytic actinomycete strains were isolated from five spontaneous plants well adapted to the poor sandy soil and arid climatic conditions of the Algerian Sahara. Morphological and chemotaxonomical analysis indicated that twenty-two isolates belonged to the Streptomyces genus and the remaining five were non-Streptomyces. All endophytic strains were screened for their ability to produce indole-3-acetic acid (IAA) in vitro on a chemically defined medium. Eighteen strains were able to produce IAA and the maximum production occurred with the Streptomyces sp. PT2 strain. The IAA produced was further extracted, partially purified and confirmed by thin layer chromatography (TLC) analysis. The 16S rDNA sequence analysis and phylogenetic studies indicated that strain PT2 was closely related to Streptomyces enissocaecilis NRRL B 16365(T), Streptomyces rochei NBRC 12908(T) and Streptomyces plicatus NBRC 13071(T), with 99.52 % similarity. The production of IAA was affected by cultural conditions such as temperature, pH, incubation period and L-tryptophan concentration. The highest level of IAA production (127 μg/ml) was obtained by cultivating the Streptomyces sp. PT2 strain in yeast extract-tryptone broth supplemented with 5 mg L-tryptophan/ml at pH 7 and incubated on a rotary shaker (200 rpm) at 30 °C for 5 days. Twenty-four-hour treatment of tomato cv. Marmande seeds with the supernatant culture of Streptomyces sp. PT2 that contained the crude IAA showed the maximum effect in promoting seed germination and root elongation.

  11. Lipoquinones of some spore-forming rods, lactic-acid bacteria and actinomycetes.

    Science.gov (United States)

    Hess, A; Holländer, R; Mannheim, W

    1979-11-01

    The respiratory quinones of 73 strains of Gram-positive bacteria including spore-forming rods, lactic-acid bacteria and actinomyctes were examined. Menaquinones with seven isoprenoid units (MK-7) were the main quinone type found in representatives of the genus Bacillus and in Sporolactobacillus inulinus. However, a strain of B. thuringiensis produced MK-8 in addition to MK-7, and strains of B. lentus and B. pantothenticus appeared to produce MK-9 and MK-8, respectively, with no MK-7. In the clostridia and lactic-acid bacteria, no quinones were found, except in Pediococcus cerevisiae NCTC 8066 and Lactobacillus casei subsp. rhamnosus ATCC 7469, which contained menaquinones, and Streptococcus faecalis NCTC 775 and HIM 478-1, which contained demethylmenaquinones, in relatively low concentrations. Menaquinones were also found in the actinomycetes (except Actinomyces odontolyticus and Bifidobacterium bifidum which did not produce any quinones) and in Protaminobacter alboflavus ATCC 8458, the so-called Actinobacillus actinoides ATCC 15900 and Noguchia granulosis NCTC 10559.

  12. Streptomyces halophytocola sp. nov., an endophytic actinomycete isolated from the surface-sterilized stems of a coastal halophyte Tamarix chinensis Lour.

    Science.gov (United States)

    Qin, Sheng; Bian, Guang-Kai; Tamura, Tomohiko; Zhang, Yue-Ji; Zhang, Wen-Di; Cao, Cheng-Liang; Jiang, Ji-Hong

    2013-08-01

    A novel actinomycete, designated KLBMP 1284(T), was isolated from the surface-sterilized stems of a coastal halophyte Tamarix chinensis Lour. collected from the city of Nantong, Jiangsu Province, east China. The strain was found to have morphological and chemotaxonomic characteristics typical of members of the genus Streptomyces. Analysis of the 16S rRNA gene sequence of strain KLBMP 1284(T) revealed that the strain formed a distinct clade within the phylogenetic tree based on 16S rRNA gene sequences and the highest sequence similarity (99.43 %) was to Streptomyces sulphureus NRRL B-1627(T). 16S rRNA gene sequence similarity to other species of the genus Streptomyces was lower than 97 %. Based on DNA-DNA hybridization values and comparison of morphological and phenotypic data, KLBMP 1284(T) could be distinguished from the closest phylogenetically related species, Streptomyces sulphureus NRRL B-1627(T). Thus, based on these data, it is evident that strain KLBMP 1284(T) represents a novel species of the genus Streptomyces, for which the name Streptomyces halophytocola sp. nov. is proposed. The type strain is KLBMP 1284(T) (= KCTC 19890(T) = NBRC 108770(T)).

  13. RNA Processing Factor 5 is required for efficient 5' cleavage at a processing site conserved in RNAs of three different mitochondrial genes in Arabidopsis thaliana.

    Science.gov (United States)

    Hauler, Aron; Jonietz, Christian; Stoll, Birgit; Stoll, Katrin; Braun, Hans-Peter; Binder, Stefan

    2013-05-01

    The 5' ends of many mitochondrial transcripts are generated post-transcriptionally. Recently, we identified three RNA PROCESSING FACTORs required for 5' end maturation of different mitochondrial mRNAs in Arabidopsis thaliana. All of these factors are pentatricopeptide repeat proteins (PPRPs), highly similar to RESTORERs OF FERTILTY (RF), that rescue male fertility in cytoplasmic male-sterile lines from different species. Therefore, we suggested a general role of these RF-like PPRPs in mitochondrial 5' processing. We now identified RNA PROCESSING FACTOR 5, a PPRP not classified as an RF-like protein, required for the efficient 5' maturation of the nad6 and atp9 mRNAs as well as 26S rRNA. The precursor molecules of these RNAs share conserved sequence elements, approximately ranging from positions -50 to +9 relative to mature 5' mRNA termini, suggesting these sequences to be at least part of the cis elements required for processing. The knockout of RPF5 has only a moderate influence on 5' processing of atp9 mRNA, whereas the generation of the mature nad6 mRNA and 26S rRNA is almost completely abolished in the mutant. The latter leads to a 50% decrease of total 26S rRNA species, resulting in an imbalance between the large rRNA and 18S rRNA. Despite these severe changes in RNA levels and in the proportion between the 26S and 18S rRNAs, mitochondrial protein levels appear to be unaltered in the mutant, whereas seed germination capacity is markedly reduced. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  14. Cloning and characterization of the first actinomycete β-propeller phytase from Streptomyces sp. US42.

    Science.gov (United States)

    Boukhris, Ines; Farhat-Khemakhem, Ameny; Bouchaala, Kameleddine; Virolle, Marie-Joëlle; Chouayekh, Hichem

    2016-10-01

    A gene encoding an extracellular phytase was cloned for the first time from an Actinomycete, Streptomyces sp. US42 and sequenced. The sequence of this gene revealed an encoded polypeptide (PHY US42) exhibiting one and six residues difference with the putative phytases of Streptomyces lividans TK24 and Streptomyces coelicolor A3(2), respectively. The molecular modeling of PHY US42 indicated that this phytase belongs to the group of β-propeller phytases that are usually calcium-dependent. PHY US42 was purified and characterized. Its activity was calcium-dependent and maximal at pH 7 and 65 °C. The enzyme was perfectly stable at pH ranging from 5 to 10 and its thermostability was greatly enhanced in the presence of calcium. Indeed, PHY US42 maintained 80% of activity after 10 min of incubation at 75 °C in the presence of 5 mM CaCl 2 . PHY US42 was also found to exhibit high stability after incubation at 37 °C for 1 h in the presence of bovine bile and digestive proteases like of pepsin, trypsin, and chymotrypsin. Considering its biochemical properties, PHY US42 could be used as feed additive in combination with an acid phytase for monogastric animals. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Poblaciones de hongos y actinomicetos presentes en el proceso de compostaje con base en bora (Eichhornia crassipes, residuos de café y de jardinería | Fungi and actinomycetes populations present in the composting process based on water hyacinth (Eichhornia crassipes, coffee and garden waste

    Directory of Open Access Journals (Sweden)

    Magalys Rivas-Nichorzon

    2017-11-01

    Full Text Available Composting is a bio-oxidative process involving numerous and varied microorganisms, whose population dynamics are influenced by the type of organic substrate used. In order to quantify fungal and actinomycetes populations and identifying fungi present during the composting process, three compost were developed with the inclusion of different organic materials, differing by the inclusion of fibrous substrates water hyacinth (Eichhornia crassipes, coffee husks and garden waste. Three metal composters were used with dimensions: 62.5 x 77.5 x 75.0 cm. The statistical design was a randomized block with repeated measurements over time, with treatments from a 3x3 factorial arrangement, three types of compost, three evaluation times (20, 40 and 60 days and three repetitions. The values obtained were transformed to log10 and an analysis of variance was performed; means were compared by Tukey test at 5% probability. The fungi count was elevated at the beginning and during the course of composting for compost based on garden waste and bora. The most frequent fungi species identified during the composting process were Aspergillus sp., Mucor sp. and Penicillium sp. Stocks of actinomycetes fell at the end of the composting process in all composts.

  16. Actinopolyspora biskrensis sp. nov., a novel halophilic actinomycete isolated from Northern Sahara.

    Science.gov (United States)

    Saker, Rafika; Bouras, Noureddine; Meklat, Atika; Zitouni, Abdelghani; Schumann, Peter; Spröer, Cathrin; Klenk, Hans-Peter; Sabaou, Nasserdine

    2015-03-01

    A novel halophilic, filamentous actinomycete, designated H254(T), was isolated from a Saharan soil sample collected from Biskra (Northern Sahara), and subjected to a polyphasic taxonomic characterization. The strain is Gram-positive, aerobic, and halophilic, and the optimum NaCl concentration for growth is 15-20 % (w/v). The cell-wall hydrolysate contained meso-diaminopimelic acid, and the diagnostic whole-cell sugars were arabinose and galactose. The diagnostic phospholipid detected was phosphatidylcholine, and MK-9(H4) was the predominant menaquinone. The major fatty acid profiles were anteiso-C17:0 (32.8 %), C15:0 (28 %), and iso-C17:0 (12.3 %). Comparative analysis of the 16S rRNA gene sequences revealed that the strain H254(T) formed a well-separated sub-branch within the radiation of the genus Actinopolyspora, and the microorganism was most closely related to Actinopolyspora saharensis DSM 45459(T) (99.2 %), Actinopolyspora halophila DSM 43834(T) (99.1 %), and Actinopolyspora algeriensis DSM 45476(T) (99.0 %). Nevertheless, the strain had relatively lower mean values for DNA-DNA relatedness with the above strains (57.2, 68.4, and 45.6 %, respectively). Based on phenotypic features and phylogenetic position, we propose that strain H254(T) represents a novel species of the genus Actinopolyspora, for which the name Actinopolyspora biskrensis sp. nov. is proposed. The type strain of A. biskrensis is strain H254(T) (=DSM 46684(T) =CECT 8576(T)).

  17. Streptomyces capitiformicae sp. nov., a novel actinomycete producing angucyclinone antibiotics isolated from the head of Camponotus japonicus Mayr.

    Science.gov (United States)

    Jiang, Shanwen; Piao, Chenyu; Yu, Yang; Cao, Peng; Li, Chenxu; Yang, Fan; Li, Mutong; Xiang, Wensheng; Liu, Chongxi

    2018-01-01

    A novel actinomycete, designated strain 1H-SSA4 T , was isolated from the head of an ant (Camponotus japonicus Mayr) and was found to produce angucyclinone antibiotics. A polyphasic approach was used to determine the taxonomic status of strain 1H-SSA4 T . The DNA G+C content of the draft genome sequence, consisting of 11.4 Mbp, was 70.0 mol%. 16S rRNA gene sequence similarity studies showed that strain 1H-SSA4 T belongs to the genus Streptomyces with the highest sequence similarity to Streptomyces hygroscopicus subsp. ossamyceticus NBRC 13983 T (98.9 %), and phylogenetically clustered with this species, Streptomyces torulosus LMG 20305 T (98.8 %), Streptomyces ipomoeae NBRC 13050 T (98.5 %) and Streptomyces decoyicus NRRL 2666 T (98.4 %). The morphological and chemotaxonomic properties of the strain were also consistent with those members of the genus Streptomyces. A combination of DNA-DNA hybridization experiments and phenotypic tests were carried out between strain 1H-SSA4 T and the above-mentioned strains, which further clarified their relatedness and demonstrated that strain 1H-SSA4 T could be distinguished from these strains. Therefore, the strain is concluded to represent a novel species of the genus Streptomyces, for which the name Streptomyces capitiformicae sp. nov. is proposed. The type strain is 1H-SSA4 T (=CGMCC 4.7403 T =DSM 104537 T ).

  18. A combined quantitative mass spectrometry and electron microscopy analysis of ribosomal 30S subunit assembly in E. coli.

    Science.gov (United States)

    Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R

    2014-10-14

    Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3' domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3'-domain is unanchored and the 5'-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells.

  19. Localized AdS_{5S^{5} Black Holes.

    Science.gov (United States)

    Dias, Óscar J C; Santos, Jorge E; Way, Benson

    2016-10-07

    According to heuristic arguments, global AdS_{5S^{5} black holes are expected to undergo a phase transition in the microcanonical ensemble. At high energies, one expects black holes that respect the symmetries of the S^{5}; at low energies, one expects "localized" black holes that appear pointlike on the S^{5}. According to anti-de Sitter/conformal field theory correspondence, N=4 supersymmetric Yang-Mills (SYM) theory on a 3-sphere should therefore exhibit spontaneous R-symmetry breaking at strong coupling. In this Letter, we numerically construct these localized black holes. We extrapolate the location of this phase transition, and compute the expectation value of the broken scalar operator with lowest conformal dimension. Via the correspondence, these results offer quantitative predictions for N=4 SYM theory.

  20. Sphaerisporangium dianthi sp. nov., an endophytic actinomycete isolated from a root of Dianthus chinensis L.

    Science.gov (United States)

    Xing, Jia; Liu, Chongxi; Zhang, Yuejing; He, Hairong; Zhou, Ying; Li, Lianjie; Zhao, Junwei; Liu, Shuanghe; Wang, Xiangjing; Xiang, Wensheng

    2015-01-01

    A novel actinomycete, designated strain NEAU-CY18(T), was isolated from the root of a Chinese medicinal plant Dianthus chinensis L and subjected to a polyphasic taxonomic study. The novel strain was found to develop spherical sporangia with non-motile spores on aerial mycelium. The cell-wall peptidoglycan was found to contain meso-diaminopimelic acid. The whole-cell sugars were identified as madurose, mannose, ribose, galactose and glucose. The phospholipid profile was found to contain diphosphatidylglycerol, phosphatidylmethylethanolamine, phosphatidylethanolamine, hydroxy-phosphatidylmethylethanolamine, phosphatidylglycerol, phosphatidylinositol, phosphatidylinositol mannosides and an unidentified phospholipid. The predominant menaquinones were identified as MK-9(H4), MK-9(H2) and MK-9(H6). The major fatty acids were identified as C17:0 10-methyl, iso-C16:0 and C16:0. EzTaxon-e analysis of the 16S rRNA gene sequence indicated that the strain belongs to the genus Sphaerisporangium and was most closely related to Sphaerisporangium cinnabarinum JCM 3291(T) (98.9 %) and Sphaerisporangium melleum JCM 13064(T) (98.3 %). Phylogenetic analysis based on the 16S rRNA gene sequence indicated that strain NEAU-CY18(T) forms a monophyletic clade with S. cinnabarinum JCM 3291(T), an association that was supported by a bootstrap value of 97 % in the neighbour-joining tree and also recovered with the maximum-likelihood algorithm. Comparisons of some phenotypic properties and low DNA-DNA relatedness values enabled the strain to be differentiated from S. cinnabarinum JCM 3291(T) and S. melleum JCM 13064(T). Therefore, it is concluded that strain NEAU-CY18(T) represents a novel Sphaerisporangium species, for which the name Sphaerisporangium dianthi sp. nov. is proposed. The type strain is NEAU-CY18(T) ( = CGMCC 4.7132(T) = DSM 46736(T)).

  1. Folded three-spin string solutions in AdS5 x S5

    International Nuclear Information System (INIS)

    Ryang Shijong

    2004-01-01

    We construct a spinning closed string solution in AdS 5 x S 5 which is folded in the radial direction and has two equal spins in AdS 5 and a spin in S 5 . The energy expression of the three-spin solution specified by the folding and winding numbers for the small S 5 spin shows a logarithmic behavior and a one-third power behavior of the large total AdS 5 spin, in the long string and in the short string located near the boundary of AdS 5 respectively. It exhibits the non-regular expansion in the 't Hooft coupling constant, while it takes the regular one when the S 5 spin becomes large. (author)

  2. Alkalithermophilic actinomycetes in a subtropical area of Jujuy, Argentina Actinomicetos termoalcalófilos del área subtropical de Jujuy, Argentina

    Directory of Open Access Journals (Sweden)

    L. Carrillo

    2009-06-01

    Full Text Available The objective of this study was to examine the alkalithermophilic actinomycete communities in the subtropical environment of Jujuy, Argentina, characterized by sugarcane crops. Laceyella putida, Laceyella sacchari, Thermoactinomyces intermedius, Thermoactinomyces vulgaris and Thermoflavimicrobium dichotomicum were isolated on the media with novobiocin, from sugar cane plants and renewal rhizospheres, and grass and wood soils. Soil pH was almost neutral or lightly alkaline, except for grass soil acidified by lactic liquor. A smaller number of actinomycetes was found on the living plants and bagasse (recently obtained or stored according to the Ritter method with respect to decomposed leaves on the soil. Thermophilic species of Laceyella, Thermoactinomyces, Thermoflavimicrobium, Saccharomonospora, Streptomyces and Thermononospora were isolated on the media without novobiocin, from composted sugar cane residues. Air captured near composted bagasse piles, contained alkalithermophilic actinomycete spores.El objetivo de este trabajo fue examinar los actinomicetos termoalcalófilos presentes en el área subtropical de Jujuy, Argentina, caracterizada por el cultivo de la caña de azúcar. Se aislaron en medio con novobiocina las especies Laceyella putida, Laceyella sacchari, Thermoactinomyces intermedius, Thermoactinomyces vulgaris y Thermoflavimicrobium dichotomicum a partir de la rizósfera de plantas y de renuevos de caña de azúcar, así como de suelos de pastura y de monte natural. El pH de los suelos era casi neutro a ligeramente alcalino, excepto en un solo caso en que el suelo estaba acidificado por licor láctico. El número de actinomicetos encontrados sobre los tejidos vivos y en el bagazo recién obtenido o almacenado según el método de Ritter fue pequeño en comparación con el observado sobre las hojas en descomposición. L. sacchari predominó respecto de T. vulgaris. Se aislaron especies termoalcalófilas de Laceyella

  3. Rock phosphate solubilizing and cellulolytic actinomycete isolates of earthworm casts

    Science.gov (United States)

    Mba, Caroline C.

    1994-03-01

    Four microbial isolates, OP2, OP3, OP6, and OP7, of earthworm casts of Pontoscolex corethrurus were found to be acid tolerant actinomycetes and efficient rock phosphate (RP) solubilizers that could grow fast on NH4Cl-enriched or N-free carboxymethyl cellulose or glucose as sole carbon source. CMC (carboxymethyl cellulose) induced production of extracellular cellulase enzyme and the production of reducing sugar in all the isolates. RP solubilizing power was observed to be inversely related to glucose consumption. The most efficient RP solubilizer was found to consume the least glucose. Growth was faster on cellulose than on glucose media. N-free CMC induced greater glucose production than NH4Cl-enriched CMC medium. Both CMC and glucose media were acidified by all the isolates, however, RP solubilizing power decreased with acidification. Solubilization power was greatest with isolate OP7, which also produced the greatest amount of reducing sugar per gram CMC. Both RP solubilizing power and the cellulolytic efficiency varied among isolates. A minimum of 631 µg P/0.1 g RP and a maximum of 951.4 µg P/0.1 g RP was recorded.

  4. A novel alkaloid from marine-derived actinomycete Streptomyces xinghaiensis with broad-spectrum antibacterial and cytotoxic activities.

    Directory of Open Access Journals (Sweden)

    Wence Jiao

    Full Text Available Due to the increasing emergence of drug-resistant bacteria and tumor cell lines, novel antibiotics with antibacterial and cytotoxic activities are urgently needed. Marine actinobacteria are rich sources of novel antibiotics, and here we report the discovery of a novel alkaloid, xinghaiamine A, from a marine-derived actinomycete Streptomyces xinghaiensis NRRL B24674(T. Xinghaiamine A was purified from the fermentation broth, and its structure was elucidated based on extensive spectroscopic analysis, including 1D and 2D NMR spectrum as well as mass spectrometry. Xinghaiamine A was identified to be a novel alkaloid with highly symmetric structure on the basis of sulfoxide functional group, and sulfoxide containing compound has so far never been reported in microorganisms. Biological assays revealed that xinghaiamine A exhibited broad-spectrum antibacterial activities to both Gram-negative persistent hospital pathogens (e.g. Acinetobacter baumannii, Pseudomonas aeruginosa and Escherichia coli and Gram-positive ones, which include Staphylococcus aureus and Bacillus subtilis. In addition, xinghaiamine A also exhibited potent cytotoxic activity to human cancer cell lines of MCF-7 and U-937 with the IC50 of 0.6 and 0.5 µM, respectively.

  5. A comprehensive study of eco-friendly natural pigment and its applications

    OpenAIRE

    Parmar, Ramendra Singh; Singh, Charu

    2017-01-01

    Actinomycetes, a large group of filamentous bacteria account for 70–80% of secondary metabolites available commercially. The present investigation was undertaken with an aim to identify and characterize pigment from actinomycetes. Actinomycetes were isolated from rhizosphere soil samples collected from different regions of Madhya Pradesh state. Out of 85 actinomycetes, only 5 actinomycetes showed pigment production and based on diffusible pigment production ability one actinomycete ARITM02 wa...

  6. Streptomyces camponoticapitis sp. nov., an actinomycete isolated from the head of an ant (Camponotus japonicus Mayr).

    Science.gov (United States)

    Li, Yao; Ye, Lan; Wang, Xiangjing; Zhao, Junwei; Ma, Zhaoxu; Yan, Kai; Xiang, Wensheng; Liu, Chongxi

    2016-10-01

    A novel single-spore-producing actinomycete, designated strain 2H-TWYE14T, was isolated from the head of an ant (Camponotus japonicus Mayr) and characterized using a polyphasic approach. 16S rRNA gene sequence analysis showed that strain 2H-TWYE14T belongs to the genus Streptomyces, with highest sequence similarity to Streptomyces niveus NRRL 2466T (98.84 %). Analysis based on the gyrB gene also indicated that strain 2H-TWYE14T should be assigned to the genus Streptomyces. The chemotaxonomic properties of strain 2H-TWYE14T were consistent with those of members of the genus Streptomyces. The cell wall contained ll-diaminopimelic acid. The predominant menaquinones were MK-9(H6), MK-9(H8) and MK-9(H4). The phospholipid profile consisted of diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylinositol and phosphatidylinositol mannoside. The major fatty acids were iso-C16 : 0 and iso-C15 : 0. DNA-DNA hybridization experiments and phenotypic tests were carried out between strain 2H-TWYE14T and its phylogenetically closely related strain S. niveus JCM 4251T, which further clarified their relatedness and demonstrated that 2H-TWYE14T could be distinguished from S. niveus. Therefore, it is concluded that strain 2H-TWYE14T can be classified as representing a novel species of the genus Streptomyces, for which the name Streptomyces camponoticapitis sp. nov. is proposed. The type strain is 2H-TWYE14T (=DSM 100523T=CGMCC 4.7275T).

  7. Foundations of the AdS5 x S5 superstring: I

    International Nuclear Information System (INIS)

    Arutyunov, Gleb; Frolov, Sergey

    2009-01-01

    We review the recent advances towards finding the spectrum of the AdS 5 x S 5 superstring. We thoroughly explain the theoretical techniques which should be useful for the ultimate solution of the spectral problem. In certain cases our exposition is original and cannot be found in the existing literature. The present part I deals with foundations of classical string theory in AdS 5 x S 5 , light-cone perturbative quantization and the derivation of the exact light-cone world-sheet scattering matrix

  8. The AdS5xS5 superstring worldsheet S matrix and crossing symmetry

    International Nuclear Information System (INIS)

    Janik, Romuald A.

    2006-01-01

    An S matrix satisfying the Yang-Baxter equation with symmetries relevant to the AdS 5 xS 5 superstring recently has been determined up to an unknown scalar factor. Such scalar factors are typically fixed using crossing relations; however, due to the lack of conventional relativistic invariance, in this case its determination remained an open problem. In this paper we propose an algebraic way to implement crossing relations for the AdS 5 xS 5 superstring worldsheet S matrix. We base our construction on a Hopf-algebraic formulation of crossing in terms of the antipode and introduce generalized rapidities living on the universal cover of the parameter space which is constructed through an auxillary, coupling-constant dependent, elliptic curve. We determine the crossing transformation and write functional equations for the scalar factor of the S matrix in the generalized rapidity plane

  9. Biotechnological potential of endophytic actinomycetes associated with Asteraceae plants: isolation, biodiversity and bioactivities.

    Science.gov (United States)

    Tanvir, Rabia; Sajid, Imran; Hasnain, Shahida

    2014-04-01

    Endophytic actinomycetes from five Asteraceae plants were isolated and evaluated for their bioactivities. From Parthenium hysterophorus, Ageratum conyzoides, Sonchus oleraceus, Sonchus asper and Hieracium canadense, 42, 45, 90, 3, and 2 isolates, respectively, were obtained. Of the isolates, 86 (47.2 %) showed antimicrobial activity. Majority of the isolates were recovered from the roots (n = 127, 69.7 %). The dominant genus was Streptomyces (n = 96, 52.7 %), while Amycolatopsis, Pseudonocardia, Nocardia and Micromonospora were also recovered. Overall, 36 of the 86 isolates were significantly bioactivity while 18 (20.9 %) showed strong bioactivity. In total, 52.1 and 66.6 % showed potent cytotoxicity and antioxidant activities. The LC50 for 15 strains was <20 μg/ml. Compared to the ascorbate standard (EC50 0.34 μg/ml), all isolates gave impressive results with notable EC50 values of 0.65, 0.67, 0.74 and 0.79 μg/ml.

  10. Jordanian deformations of the AdS5×S5 superstring

    NARCIS (Netherlands)

    Kawaguchi, I.; Matsumoto, T.; Yoshida, K

    2014-01-01

    We consider Jordanian deformations of the AdS_5xS^5 superstring action. The deformations correspond to non-standard q-deformation. In particular, it is possible to perform partial deformations, for example, only for the S^5 part. Then the classical action and the Lax pair are constructed with a

  11. Evolutionary conservation of nuclear and nucleolar targeting sequences in yeast ribosomal protein S6A

    International Nuclear Information System (INIS)

    Lipsius, Edgar; Walter, Korden; Leicher, Torsten; Phlippen, Wolfgang; Bisotti, Marc-Angelo; Kruppa, Joachim

    2005-01-01

    Over 1 billion years ago, the animal kingdom diverged from the fungi. Nevertheless, a high sequence homology of 62% exists between human ribosomal protein S6 and S6A of Saccharomyces cerevisiae. To investigate whether this similarity in primary structure is mirrored in corresponding functional protein domains, the nuclear and nucleolar targeting signals were delineated in yeast S6A and compared to the known human S6 signals. The complete sequence of S6A and cDNA fragments was fused to the 5'-end of the LacZ gene, the constructs were transiently expressed in COS cells, and the subcellular localization of the fusion proteins was detected by indirect immunofluorescence. One bipartite and two monopartite nuclear localization signals as well as two nucleolar binding domains were identified in yeast S6A, which are located at homologous regions in human S6 protein. Remarkably, the number, nature, and position of these targeting signals have been conserved, albeit their amino acid sequences have presumably undergone a process of co-evolution with their corresponding rRNAs

  12. Structural Studies of RNA Helicases Involved in Eukaryotic Pre-mRNA Splicing, Ribosome Biogenesis, and Translation Initiation

    DEFF Research Database (Denmark)

    He, Yangzi

    and ligates the neighbouring exons to generate mature mRNAs. Prp43 is an RNA helicase of the DEAH/RHA family. In yeast, once mRNAs are released, Prp43 catalyzes the disassembly of spliceosomes. The 18S, 5.8S and 25S rRNAs are transcribed as a single polycistronic transcript—the 35S pre......-rRNA. It is nucleolytically cleaved and chemically modified to generate mature rRNAs, which assemble with ribosomal proteins to form the ribosome. Prp43 is required for the processing of the 18S rRNA. Using X-ray crystallography, I determined a high resolution structure of Prp43 bound to ADP, the first structure of a DEAH....../RHA helicase. It defined the conserved structural features of all DEAH/RHA helicases, and unveiled a novel nucleotide binding site. Additionally a preliminary low resolution structure of a ternary complex comprising Prp43, a non-hydrolyzable ATP analogue, and a single-stranded RNA, was obtained. The ribosome...

  13. Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Aagaard, C; Douthwaite, S

    1994-01-01

    RNA. Every substitution that disrupts the potential for Watson-Crick base pairing between these positions reduces or abolishes the participation of 23S rRNA in protein synthesis. All mutant 23S rRNAs are assembled into 50S subunits, but the mutant subunits are less able to stably interact with 30S subunits...... is nonfunctional. In contrast to the considerable effect the mutations have on function, they impart only slight structural changes on the naked rRNA, and these are limited to the immediate vicinity of the mutations. The data show that positions 1262 and 2017 pair in a Watson-Crick manner, but the data also...

  14. Quantum spectral curve for the η-deformed AdS5 × S5 superstring

    Science.gov (United States)

    Klabbers, Rob; van Tongeren, Stijn J.

    2017-12-01

    The spectral problem for the AdS5 ×S5 superstring and its dual planar maximally supersymmetric Yang-Mills theory can be efficiently solved through a set of functional equations known as the quantum spectral curve. We discuss how the same concepts apply to the η-deformed AdS5 ×S5 superstring, an integrable deformation of the AdS5 ×S5 superstring with quantum group symmetry. This model can be viewed as a trigonometric version of the AdS5 ×S5 superstring, like the relation between the XXZ and XXX spin chains, or the sausage and the S2 sigma models for instance. We derive the quantum spectral curve for the η-deformed string by reformulating the corresponding ground-state thermodynamic Bethe ansatz equations as an analytic Y system, and map this to an analytic T system which upon suitable gauge fixing leads to a Pμ system - the quantum spectral curve. We then discuss constraints on the asymptotics of this system to single out particular excited states. At the spectral level the η-deformed string and its quantum spectral curve interpolate between the AdS5 ×S5 superstring and a superstring on "mirror" AdS5 ×S5, reflecting a more general relationship between the spectral and thermodynamic data of the η-deformed string. In particular, the spectral problem of the mirror AdS5 ×S5 string, and the thermodynamics of the undeformed AdS5 ×S5 string, are described by a second rational limit of our trigonometric quantum spectral curve, distinct from the regular undeformed limit.

  15. Trehalose lipid biosurfactants produced by the actinomycetes Tsukamurella spumae and T. pseudospumae.

    Science.gov (United States)

    Kügler, Johannes H; Muhle-Goll, Claudia; Kühl, Boris; Kraft, Axel; Heinzler, Raphael; Kirschhöfer, Frank; Henkel, Marius; Wray, Victor; Luy, Burkhard; Brenner-Weiss, Gerald; Lang, Siegmund; Syldatk, Christoph; Hausmann, Rudolf

    2014-11-01

    Actinomycetales are known to produce various secondary metabolites including products with surface-active and emulsifying properties known as biosurfactants. In this study, the nonpathogenic actinomycetes Tsukamurella spumae and Tsukamurella pseudospumae are described as producers of extracellular trehalose lipid biosurfactants when grown on sunflower oil or its main component glyceryltrioleate. Crude extracts of the trehalose lipids were purified using silica gel chromatography. The structure of the two trehalose lipid components (TL A and TL B) was elucidated using a combination of matrix-assisted laser desorption/ionization time-of-flight/time-of-flight/tandem mass spectroscopy (MALDI-ToF-ToF/MS/MS) and multidimensional NMR experiments. The biosurfactants were identified as 1-α-glucopyranosyl-1-α-glucopyranosid carrying two acyl chains varying of C4 to C6 and C16 to C18 at the 2' and 3' carbon atom of one sugar unit. The trehalose lipids produced demonstrate surface-active behavior and emulsifying capacity. Classified as risk group 1 organisms, T. spumae and T. pseudospumae hold potential for the production of environmentally friendly surfactants.

  16. Efecto Antagónico in vitro de Actinomicetos Aislados de Purines de Chipaca (Bidens pilosa L. Frente a Phytophthora infestans (Mont de Bary In vitro Antagonistic Effect of Actinomycetes Isolated from Chipaca (Bidens pilosa L. Purins Against Phytophthora infestans (Mont de Bary

    Directory of Open Access Journals (Sweden)

    Yudy Astrid Fonseca Ardila

    2011-12-01

    Full Text Available Se estudió el efecto inhibidor de los actinomicetos presentes en purines o extractos fermentados de plantas de chipaca (Bidens pilosa L., sobre el crecimiento de Phytophthora infestans (Mont de Bary, causante del tizón tardío de la papa. Se elaboraron cuatro purines de flores, raíces, hojas-tallos y su mezcla. De estos purines se obtuvieron 25 aislamientos de actinomicetos, cada uno de los cuales se enfrentó con P. infestans en placas de medio de cultivo, utilizando la técnica de anillos de Gauze y estableciendo las concentraciones iniciales de esporas mediante conteos microscópicos en cámara de Neubauer. Los actinomicetos no crecieron en el purin de flores debido, posiblemente, a que en él no se utiliza suelo rizosférico o porque su pH (9 es mayor que el rango normal de crecimiento de estos microorganismos ( pH 6 -; 8. Se evidenció inhibición del crecimiento del oomycete por parte de 8 aislamientos de actinomicetos con porcentajes de inhibición entre 33,3 - 77,8%, provenientes de los purines de raíces, tallos-hojas y mezcla de partes de la planta. La mayor inhibición se obtuvo en los aislamientos AC001, AC010, AC011 y AC025 con conteos de 0,4, 6,0, 3,0, y 3,6 x10(5 esporas mL-1.Purins or liquid fermented extracts of chipaca (Bidens pilosa L. were prepared to establish the inhibitory effect of the actinomycetes found in such biopharmaceutical preparations on the growth of Phytophthora infestans (Mont de Bary, the causative of potato late blight disease. Four purins made from flowers, roots, leaf-steams and a mixture of them were prepared; 25 actinomycete isolates were obtained from these purins and their ability to resist challenge by P. infestans was ascertained in medium plates using the ring Gauze technique and establishing initial concentrations of spores by microscopic counting in Neubauer chamber. Actinomycetes did not grow in flower purin as rhizosphere soil was not used in its preparation or because this particular pH (9

  17. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    DEFF Research Database (Denmark)

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea...... increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits...

  18. Rare actinomycetes Nocardia caishijiensis and Pseudonocardia carboxydivorans as endophytes, their bioactivity and metabolites evaluation.

    Science.gov (United States)

    Tanvir, Rabia; Sajid, Imran; Hasnain, Shahida; Kulik, Andreas; Grond, Stephanie

    2016-04-01

    Two strains identified as Nocardia caishijiensis (SORS 64b) and Pseudonocardia carboxydivorans (AGLS 2) were isolated as endophytes from Sonchus oleraceus and Ageratum conyzoides respectively. The analysis of their extracts revealed them to be strongly bioactive. The N. caishijiensis extract gave an LC50 of 570 μg/ml(-1) in the brine shrimp cytotoxicity assay and an EC50 of 0.552 μg/ml(-1) in the DPPH antioxidant assay. Antimicrobial activity was observed against Methicillin resistant Staphlococcus aureus (MRSA) and Escherichia coli ATCC 25922 (14 mm), Klebsiella pneumoniae ATCC 706003 (13 mm), S. aureus ATCC 25923 (11 mm) and Candida tropicalis (20 mm). For the extract of P. carboxydivorans the EC50 was 0.670 μg/ml(-1) and it was observed to be more bioactive against Bacillus subtilis DSM 10 ATCC 6051 (21 mm), C. tropicalis (20 mm), S. aureus ATCC 25923 (17 mm), MRSA (17 mm), E. coli K12 (W1130) (16 mm) and Chlorella vulgaris (10 mm). The genotoxicity testing revealed a 20 mm zone of inhibition against the polA mutant strain E. coli K-12 AB 3027 suggesting damage to the DNA and polA genes. The TLC and bioautography screening revealed a diversity of active bands of medium polar and nonpolar compounds. Metabolite analysis by HPLC-DAD via UV/vis spectral screening suggested the possibility of stenothricin and bagremycin A in the mycelium extract of N. caishijiensis respectively. In the broth and mycelium extract of P. carboxydivorans borrelidin was suggested along with α-pyrone. The HPLC-MS revealed bioactive long chained amide derivatives such as 7-Octadecenamide, 9, 12 octadecandienamide. This study reports the rare actinomycetes N. caishijiensis and P. carboxydivorans as endophytes and evaluates their bioactive metabolites. Copyright © 2016 Elsevier GmbH. All rights reserved.

  19. Posttranscriptional modifications in the A-loop of 23S rRNAs from selected archaea and eubacteria.

    OpenAIRE

    Hansen, M A; Kirpekar, F; Ritterbusch, W; Vester, B

    2002-01-01

    Posttranscriptional modifications were mapped in helices 90-92 of 23S rRNA from the following phylogenetically diverse organisms: Haloarcula marismortui, Sulfolobus acidocaldarius, Bacillus subtilis, and Bacillus stearothermophilus. Helix 92 is a component of the ribosomal A-site, which contacts the aminoacyl-tRNA during protein synthesis, implying that posttranscriptional modifications in helices 90-92 may be important for ribosome function. RNA fragments were isolated from 23S rRNA by site-...

  20. The antibiotics micrococcin and thiostrepton interact directly with 23S rRNA nucleotides 1067A and 1095A

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1994-01-01

    The antibiotics thiostrepton and micrococcin bind to the GTPase region in domain II of 23S rRNA, and inhibit ribosomal A-site associated reactions. When bound to the ribosome, these antibiotics alter the accessibility of nucleotides 1067A and 1095A towards chemical reagents. Plasmid......-coded Escherichia coli 23S rRNAs with single mutations at positions 1067 or 1095 were expressed in vivo. Mutant ribosomes are functional in protein synthesis, although those with transversion mutations function less effectively. Antibiotics were bound under conditions where wild-type and mutant ribosomes compete...

  1. Lumpy AdS5× S5 black holes and black belts

    International Nuclear Information System (INIS)

    Dias, Óscar J.C.; Santos, Jorge E.; Way, Benson

    2015-01-01

    Sufficiently small Schwarzschild black holes in global AdS 5 ×S 5 are Gregory-Laflamme unstable. We construct new families of black hole solutions that bifurcate from the onset of this instability and break the full SO(6) symmetry group of the S 5 down to SO(5). These new “lumpy" solutions are labelled by the harmonics ℓ. We find evidence that the ℓ=1 branch never dominates the microcanonical/canonical ensembles and connects through a topology-changing merger to a localised black hole solution with S 8 topology. We argue that these S 8 black holes should become the dominant phase in the microcanonical ensemble for small enough energies, and that the transition to Schwarzschild black holes is first order. Furthermore, we find two branches of solutions with ℓ=2. We expect one of these branches to connect to a solution containing two localised black holes, while the other branch connects to a black hole solution with horizon topology S 4 ×S 4 which we call a “black belt”.

  2. Streptomyces euryhalinus sp. nov., a new actinomycete isolated from a mangrove forest.

    Science.gov (United States)

    Biswas, Kaushik; Choudhury, Jayanta D; Mahansaria, Riddhi; Saha, Malay; Mukherjee, Joydeep

    2017-06-01

    A Gram-positive, aerobic, non-motile actinomycete (strain MS 3/20 T ) was isolated from the sediment of the Sundarbans mangrove forest in India. On International Streptomyces Project (ISP) medium 2, the isolate produced yellowish brown to red aerial hyphae that carried spiny-surfaced spores in a retinaculum-apertum arrangement. Whole-cell hydrolysate of the strain contained LL-diaminopimelic acid and galactose. Predominant menaquinones were MK-9(H 8 ) and MK-9(H 6 ). Diagnostic polar lipids were glycolipid, phosphatidylglycerol, phosphatidylethanolamine, phosphatidylcholine, unidentified phospholipid and unidentified amino lipid. The major fatty acids were anteiso-C 15:0 (17.53%), iso-C 16:0 (23.89%) and anteiso-C 17:0 (10.29%). The strain showed 100% 16S ribosomal RNA (rRNA) gene sequence similarity with Streptomyces variabilis NBRC 12825 T , Streptomyces erythrogriseus LMG 19406 T , Streptomyces griseoincarnatus LMG 19316 T and Streptomyces labedae NBRC 15864 T . However, strain MS 3/20 T could be distinguished from these and seven other closely related species based on low levels of DNA-DNA relatedness (27.2-53.8%), supported by the unique banding pattern obtained from random amplified polymorphic DNA-PCR amplification and the distinctive matrix-assisted laser desorption/ionization-time-of-flight/mass spectrometry (MALDI-TOF/MS) profile of whole-cell proteins acquired for strain MS 3/20 T in comparison with its phylogenetic relatives. Disparate morphological, physiological and chemotaxonomic features, principally growth in NaCl, further corroborated the distinction of strain MS 3/20 T from other phylogenetic relatives. Strain MS 3/20 T is therefore suggested to be a novel species of the genus Streptomyces, for which the name Streptomyces euryhalinus sp. nov. is proposed. The type strain is MS 3/20 T (=CICC 11032 T =DSM 103378 T ).

  3. Isolation, identification, and the growth promoting effects of two antagonistic actinomycete strains from the rhizosphere of Mikania micrantha Kunth.

    Science.gov (United States)

    Han, Dandan; Wang, Lanying; Luo, Yanping

    2018-03-01

    Actinomycetes are an important group of gram-positive bacteria that play an essential role in the rhizosphere ecosystem. The confrontation culture and Oxford cup method were used to evaluate the antagonistic activities of strains, which were isolated from the rhizosphere soil of Mikania micrantha. The two isolates were identified using morphological and physiological tests combined with 16S rRNA-based molecular analysis, respectively. The type I polyketone synthase (PKS-I) was amplified. The constituents of fermentation metabolites were analyzed by gas chromatography mass spectrometry. The plant growth promoting effect was determined. Finally, the growth of wheat seedlings was assessed using the Petri dish method. Overall, of the isolated twelve strains, WZS1-1 and WZS2-1 could significantly inhibit target fungi. Isolate WZS1-1 was identified as Streptomyces rochei, and WZS2-1 was identified as Streptomyces sundarbansensis. In particular, Fusarium graminearum (FG) from wheat was inhibited by more than 80%, and the inhibitory bandwidths against FG were 31 ± 0.3 mm and 19 ± 0.5 mm, respectively. The genes PKS-I were successfully amplified, confirming that these strains are capable of producing biosynthetic secondary metabolites. Major component analysis revealed aliphatic ketones, carboxylic acids, and esters, with n-hexadecanoic acid being the most abundant compound. Plant growth promoting test indicated that both strains produced IAA, presented with orange loops on CAS plates, dissolved phosphorus and potassium, fixed nitrogen, but did not generate organic acids; both strains colonized in soil, while only WZS1-1 colonized in wheat roots. Additionally, the fermentation broth significantly promoted the growth of wheat. Copyright © 2018 Elsevier GmbH. All rights reserved.

  4. Total synthesis of (3S, 5R, 3'S, 5'R)-capsorubin

    International Nuclear Information System (INIS)

    Frederico, Daniel; Constantino, Mauricio G.; Donate, Paulo M.

    2009-01-01

    The total synthesis of enantiomerically enriched (3S, 5R, 3'S, 5'R)-capsorubin (1) by aldol condensation of (1R, 4S)-1-(4-hydroxy-1,2,2-trimethyl-cyclopentyl)ethanone (2a) and crocetindial (3) is described. An alternative, short eight-step synthesis of the optically active compound 2a (ee 89%) is also reported. (author)

  5. Chaperoning 5S RNA assembly.

    Science.gov (United States)

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

  6. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Form U5S, for annual reports filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed under...

  7. Pre-potential in the AdS{sub 5S{sup 5} type IIB superspace

    Energy Technology Data Exchange (ETDEWEB)

    Poláček, Martin; Siegel, Warren [C.N. Yang Institute for Theoretical Physics, State University of New York,100 Nicolls Rd., Stony Brook, NY 11794-3840 (United States)

    2017-01-16

    We found the pre-potential in the superspace with AdS{sub 5} × S{sup 5} background. The pre-potential appears as part of the vielbeins, without derivatives. In both subspaces (AdS{sub 5} and S{sup 5}) we used Poincaré coordinates. We picked one bulk coordinate in AdS{sub 5} and one bulk coordinate in S{sup 5} to define the space-cone gauge. Such space-cone gauge destroys the bulk Lorentz covariance. However, it still preserves boundary Lorentz covariance (and gives projective superspace) SO(3,1)⊗SO(4) and so symmetries of boundary CFT are manifest.

  8. Streptomyces amphotericinicus sp. nov., an amphotericin-producing actinomycete isolated from the head of an ant (Camponotus japonicus Mayr).

    Science.gov (United States)

    Cao, Tingting; Mu, Shan; Lu, Chang; Zhao, Shanshan; Li, Dongmei; Yan, Kai; Xiang, Wensheng; Liu, Chongxi

    2017-12-01

    A novel actinomycete, designated strain 1H-SSA8 T , was isolated from the head of an ant (Camponotus japonicus Mayr) and was found to produce amphotericin. A polyphasic approach was employed to determine the status of strain 1H-SSA8 T . Morphological and chemotaxonomic characteristics were consistent with those of members of the genus Streptomyces. The menaquinones detected were MK-9(H6), MK-9(H8) and MK-9(H4). The phospholipid profile consisted of diphosphatidylglycerol, phosphatidylmethylethanolamine, phosphatidylethanolamine and phosphatidylinositol mannoside. The major fatty acids were identified as iso-C16 : 0, C16 : 0, C15 : 0 and anteiso-C15 : 0. Analysis of the 16S rRNA gene sequence showed that strain 1H-SSA8 T belongs to the genus Streptomyces with high sequence similarity to Streptomyces ramulosus NRRL B-2714 T (99.2 %). Two tree-making algorithms based on 16S rRNA gene sequences showed that the isolate formed a phyletic line with Streptomyces himastatinicus ATCC 53653 T (98.7 %). The MLSA utilizing partial sequences of the housekeeping genes (atpD, gyrB, recA, rpoB and trpB) also supported the position. However, evolutionary distances were higher than the 0.007 MLSA evolutionary distance threshold proposed for species-level relatedness. Moreover, the low level of DNA-DNA relatedness and phenotypic differences allowed the novel isolate to be differentiated from its most closely related strain S. ramulosus NRRL B-2714 T and strain S. himastatinicus ATCC 53653 T . It is concluded that the organism can be classified as representing a novel species of the genus Streptomyces, for which the name Streptomyces amphotericinicus sp. nov. is proposed. The type strain is 1H-SSA8 T (=CGMCC 4.7350 T =DSM 103128 T ).

  9. Three spin string configuration in γ-Deformed AdS5xS5 background

    International Nuclear Information System (INIS)

    Bobev, N.; Rashkov, R.; Dimov, H.

    2006-01-01

    The aim of this paper is to investigate semiclassical rotating string configurations in the recently found Lunin-Maldacena background. This background is conjectured to be dual to the Leigh-Strassler β-deformation of N = 4 SYM and therefore a good laboratory for tests of the AdS/CFT correspondence beyond the well explored AdS 5 xS 5 case. We consider different multispin configurations of rotating strings by allowing the strings to move in both the AdS 5 and the deformed S 5 part of the Lunin-Maldacena background. For all of these configurations we compute the string energy in terms of the angular momenta and the string winding numbers and thus provide the possibility of reproducing our results from a computation of the anomalous dimension of the corresponding dilatation operator. This can be achieved by means of the Bethe ansatz techniques for the relevant sectors of the corresponding Yang-Mills theory. We also compare our results to those for multispin rotating strings on AdS 5 xS 5 . (authors)

  10. Pseudonocardians A–C, New Diazaanthraquinone Derivatives from a Deap-Sea Actinomycete Pseudonocardia sp. SCSIO 01299

    Directory of Open Access Journals (Sweden)

    Xianwen Yang

    2011-08-01

    Full Text Available Pseudonocardians A–C (2–4, three new diazaanthraquinone derivatives, along with a previously synthesized compound deoxynyboquinone (1, were produced by the strain SCSIO 01299, a marine actinomycete member of the genus Pseudonocardia, isolated from deep-sea sediment of the South China Sea. The structures of compounds 1–4 were determined by mass spectrometry and NMR experiments (1H, 13C, HSQC, and HMBC. The structure of compound 1, which was obtained for the first time from a natural source, was confirmed by X-ray analysis. Compounds 1–3 exhibited potent cytotoxic activities against three tumor cell lines of SF-268, MCF-7 and NCI-H460 with IC50 values between 0.01 and 0.21 μm, and also showed antibacterial activities on Staphylococcus aureus ATCC 29213, Enterococcus faecalis ATCC 29212 and Bacillus thuringensis SCSIO BT01, with MIC values of 1–4 μg mL−1.

  11. The calculation of oscillator strengths for the 5s21S0→5s5p1,3P1 transitions in Cd-like ions

    International Nuclear Information System (INIS)

    Li Guangyuan

    1998-01-01

    The screened hydrogenic model is employed to calculate the oscillator strength of the 5s 2 1 S 0 -5s5p 1 P 1 resonance transition in Cd-like ions (Z = 48 -74). The expression for the oscillator strength of the 5s 2 1 S 0 -5s5p 3 P1 is given, with the introduction of the correctional coefficient K and the mixing angle in jj-coupling. The results are compared with that of other authors, and some discussions are also given

  12. Foundations of the AdS5 × S5 Superstring Part I

    NARCIS (Netherlands)

    Arutyunov, G.E.; Frolov, S.

    2009-01-01

    We review the recent advances towards finding the spectrum of the AdS_5 x S^5 superstring. We thoroughly explain the theoretical techniques which should be useful for the ultimate solution of the spectral problem. In certain cases our exposition is original and cannot be found in the existing

  13. Biological control of phytopathogenic fungi by endophytic actinomycetes isolated from maize (Zea mays L.

    Directory of Open Access Journals (Sweden)

    Francisco Gheler Costa

    2013-12-01

    Full Text Available This work aimed a survey on the biodiversity of maize endophytic actinomycete, and an evaluation of their potential to control the phytopathogenic fungi. From several regions of São Paulo state, 40 strains were isolated from the healthy maize plants. The identification of these strains, based on morphological properties and fatty acid methyl ester (FAME profile showed that most of them belonged to the Streptomyces genus. These isolates were first screened for the growth inhibition of phytopathogenic fungi and results showed that all the isolate were able to inhibit the development of at least one tested pathogen. Two selected isolates were then evaluated for the control of P. aphanidermatum in cucumber (Cucumis sativa L. under greenhouse conditions. Isolate 16R3B was able to reduce up to 71% damping-off incidence whereas isolate 14F1D/2 reduced the disease incidence by 36%. Damping- off control in cucumber, mainly for the isolate 16R3B, suggested for its use in greenhouse cucumber producing fields and to be tested in field trials.

  14. Efficient secretory expression of recombinant proteins in Escherichia coli with a novel actinomycete signal peptide.

    Science.gov (United States)

    Cui, Yanbing; Meng, Yiwei; Zhang, Juan; Cheng, Bin; Yin, Huijia; Gao, Chao; Xu, Ping; Yang, Chunyu

    2017-01-01

    In well-established heterologous hosts, such as Escherichia coli, recombinant proteins are usually intracellular and frequently found as inclusion bodies-especially proteins possessing high rare codon content. In this study, successful secretory expression of three hydrolases, in a constructed inducible or constitutive system, was achieved by fusion with a novel signal peptide (Kp-SP) from an actinomycete. The signal peptide efficiently enabled extracellular protein secretion and also contributed to the active expression of the intracellular recombinant proteins. The thermophilic α-amylase gene of Bacillus licheniformis was fused with Kp-SP. Both recombinants, carrying inducible and constitutive plasmids, showed remarkable increases in extracellular and intracellular amylolytic activity. Amylase activity was observed to be > 10-fold in recombinant cultures with the constitutive plasmid, pBSPPc, compared to that in recombinants lacking Kp-SP. Further, the signal peptide enabled efficient secretion of a thermophilic cellulase into the culture medium, as demonstrated by larger halo zones and increased enzymatic activities detected in both constructs from different plasmids. For heterologous proteins with a high proportion of rare codons, it is difficult to obtain high expression in E. coli owing to the codon bias. Here, the fusion of an archaeal homologue of the amylase encoding gene, FSA, with Kp-SP resulted in > 5-fold higher extracellular activity. The successful extracellular expression of the amylase indicated that the signal peptide also contributed significantly to its active expression and signified the potential value of this novel and versatile signal peptide in recombinant protein production. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Posttranscriptional modifications in the A-loop of 23S rRNAs from selected archaea and eubacteria.

    Science.gov (United States)

    Hansen, M A; Kirpekar, F; Ritterbusch, W; Vester, B

    2002-02-01

    Posttranscriptional modifications were mapped in helices 90-92 of 23S rRNA from the following phylogenetically diverse organisms: Haloarcula marismortui, Sulfolobus acidocaldarius, Bacillus subtilis, and Bacillus stearothermophilus. Helix 92 is a component of the ribosomal A-site, which contacts the aminoacyl-tRNA during protein synthesis, implying that posttranscriptional modifications in helices 90-92 may be important for ribosome function. RNA fragments were isolated from 23S rRNA by site-directed RNase H digestion. A novel method of mapping modifications by analysis of short, nucleotide-specific, RNase digestion fragments with Matrix Assisted Laser Desorption/Ionization Mass Spectrometry (MALDI-MS) was utilized. The MALDI-MS data were complemented by two primer extension techniques using reverse transcriptase. One technique utilizes decreasing concentrations of deoxynucleotide triphosphates to map 2'-O-ribose methylations. In the other, the rRNA is chemically modified, followed by mild alkaline hydrolysis to map pseudouridines (psis). A total of 10 posttranscriptionally methylated nucleotides and 6 psis were detected in the five organisms. Eight of the methylated nucleotides and one psi have not been reported previously. The distribution of modified nucleotides and their locations on the surface of the ribosomal peptidyl transferase cleft suggests functional importance.

  16. Three-spin Strings on AdS_5 x S^5 from N=4 SYM

    DEFF Research Database (Denmark)

    Kristjansen, C.

    2004-01-01

    Using the integrable spin chain picture we study the one-loop anomalous dimension of certain single trace scalar operators of N=4 SYM expected to correspond to semi-classical string states on AdS_5 x S^5 with three large angular momenta (J_1,J_2,J_3) on S^5. In particular, we investigate the anal......Using the integrable spin chain picture we study the one-loop anomalous dimension of certain single trace scalar operators of N=4 SYM expected to correspond to semi-classical string states on AdS_5 x S^5 with three large angular momenta (J_1,J_2,J_3) on S^5. In particular, we investigate...... the analyticity structure encoded in the Bethe equations for various distributions of Bethe roots. In a certain region of the parameter space our operators reduce to the gauge theory duals of the folded string with two large angular momenta and in another region to the duals of the circular string with angular...... momentum assignment (J,J',J'), J>J'. In between we locate a critical line. We propose that the operators above the critical line are the gauge theory duals of the circular elliptic string with three different spins and support this by a perturbative calculation....

  17. Metabolomics of the Bio-Degradation Process of Aflatoxin B1 by Actinomycetes at an Initial pH of 6.0

    Directory of Open Access Journals (Sweden)

    Manal Eshelli

    2015-02-01

    Full Text Available Contamination of food and feed by Aflatoxin B1 (AFB1 is a cause of serious economic and health problems. Different processes have been used to degrade AFB1. In this study, biological degradation of AFB1 was carried out using three Actinomycete species, Rhodococcus erythropolis ATCC 4277, Streptomyces lividans TK 24, and S. aureofaciens ATCC 10762, in liquid cultures. Biodegradation of AFB1 was optimised under a range of temperatures from 25 to 40 °C and pH values of 4.0 to 8.0. An initial concentration of 20 µg/mL of AFB1 was used in this study. The amount of AFB1 remaining was measured against time by thin layer chromatography (TLC and high-performance liquid chromatography (HPLC, coupled with UV and mass spectrometry (LC-MS. All species were able to degrade the AFB1, and no significant difference was found between them. AFB1 remained in the liquid culture for R. erythropolis, S. lividans and S. aureofaciens were 0.81 µg/mL, 2.41 µg/mL and 2.78 µg/mL respectively, at the end of the first 24 h. Degradation occurred at all incubation temperatures and the pH with the optimal conditions for R. erythropolis was achieved at 30 °C and pH 6, whereas for S. lividans and S. aureofaciens the optimum conditions for degradation were 30 °C and pH 5. Analysis of the degradative route indicated that each microorganism has a different way of degrading AFB1. The metabolites produced by R. erythropolis were significantly different from the other two microorganisms. Products of degradation were identified through metabolomic studies by utilizing high-resolution mass spectral data. Mass spectrometric analysis indicated that the degradation of AFB1 was associated with the appearance of a range of lower molecular weight compounds. The pathway of degradation or chemical alteration of AFB1 was followed by means of high resolution Fourier transform mass spectrometry (HR-FTMS analysis as well as through the MS2 fragmentation to unravel the degradative pathway for

  18. Nocardiopsis akesuensis sp. nov., an actinomycete isolated from a salt water beach.

    Science.gov (United States)

    Gao, Guang-Bin; Luo, Xiao-Xia; Xia, Zhan-Feng; Zhang, Yao; Wan, Chuan-Xing; Zhang, Li-Li

    2016-12-01

    The taxonomic position of a novel actinomycete, strain TRM 46250T, isolated from the sediment of a salt water beach at Baicheng, Xinjiang, China, was determined by a polyphasic approach. Strain TRM 46250T grew optimally in the presence of 2 % (w/v) NaCl and an optimum temperature range for growth of 28-37 °C. The whole-cell sugars of strain TRM 46250T were ribose, xylose, mannose and galactose. The diagnostic diamino acid was meso-diaminopimelic acid. The polar lipids were phosphatidylinositol, phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, diphosphatidylglycerol, phosphatidylmethyl ethanolamine and six unidentified phospholipids. The predominant menaquinones were MK-10, MK-10(H6) and MK-10(H8). The major fatty acids were 10-methyl C18 : 0, iso-C16 : 0, C16 : 0, iso-G C16 : 1 and C18 : 1ω9c. Based on morphological and chemotaxonomic characteristics the isolate was determined to belong to the genus Nocardiopsis. The phylogenetic tree based on its nearly complete 16S rRNA gene sequence (1493 nt) with those of representative strains showed that the strain consistently falls into a distinct phyletic line together with Nocardiopsis gilva YIM 90087T (97.68 % similarity) and a subclade consisting of Nocardiopsis composta KS9T (97.52 %), Nocardiopsis rosea YIM 90094T (97.44 %) and Nocardiopsis rhodophaea YIM 90096T (97.16 %). However, DNA-DNA hybridization studies between strain TRM 46250T and N. gilva YIM 90087T showed only 36.94 % relatedness. On the basis of these data, strain TRM 46250T should be designated as a representative of a novel species of the genus Nocardiopsis, for which the name Nocardiopsis akesuensis sp. nov. is proposed. The type strain is TRM 46250T (=CCTCC AA 2015027T=KCTC 39725T).

  19. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Science.gov (United States)

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Lobophorin C and D, New Kijanimicin Derivatives from a Marine Sponge-Associated Actinomycetal Strain AZS17

    Directory of Open Access Journals (Sweden)

    Yong-Cheng Lin

    2011-03-01

    Full Text Available Marine sponge Hymeniacidon sp. was collected from coastal waters of the East China Sea to isolate symbiotic microorganisms. The resulting sponge-associated actinomycete, Streptomyces carnosus strain AZS17, was cultivated in a 20 L volume of medium for production of bioactive secondary metabolites. Bioassay-guided isolation and purification by varied chromatographic methods yielded two new compounds of kijanimicin derivatives, AS7-2 and AS9-12. Their structures were elucidated by spectroscopy and comparison with literatures. Results showed these two compounds were structurally similar to the previously reported compounds lobophorin A and B, yet differed in specific bond forms, stereochemistry and optical activities. The two novel compounds were named lobophorin C and D. In vitro cytotoxicity investigation by MTT assay indicated their selective activities. Lobophorin C displayed potent cytotoxic activity against the human liver cancer cell line 7402, while lobophorin D showed significant inhibitory effect on human breast cancer cells MDA-MB 435.

  1. Simplified TBA equations of the AdS5 × S5 mirror model

    NARCIS (Netherlands)

    Arutyunov, G.E.; Frolov, S.

    2009-01-01

    We use the recently found integral representation for the dressing phase in the kinematic region of the mirror theory to simplify the TBA equations for the AdS5 × S5 mirror model. The resulting set of equations provides an efficient starting point for both analytic and numerical studies.

  2. Thermoactinomyces guangxiensis sp. nov., a thermophilic actinomycete isolated from mushroom compost.

    Science.gov (United States)

    Wu, Hao; Liu, Bin; Pan, Shangli

    2015-09-01

    A novel thermophilic actinomycete, designated strain CD-1(T), was isolated from mushroom compost in Nanning, Guangxi province, China. The strain grew at 37-55 °C (optimum 45-50 °C), pH 6.0-11.0 (optimum pH 7.0-9.0) and with 0-2.0% NaCl (optimum 0-1.0%), formed well-developed white aerial mycelium and pale-yellow vegetative mycelium, and single endospores (0.8-1.0 μm diameter) were borne on long sporophores (2-3 μm length). The endospores were spherical-polyhedron in shape with smooth surface. Based on its phenotypic and phylogenetic characteristics, strain CD-1(T) is affiliated to the genus Thermoactinomyces. It contained meso-diaminopimelic acid as the diagnostic diamino acid; the whole-cell sugars were ribose and glucose. Major fatty acids were iso-C15 :  0, C16 : 0, anteiso-C15  : 0 and iso-C17  : 0. MK-7 was the predominant menaquinone. The polar phospholipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine, phosphatidylethanolamine containing hydroxylated fatty acids, ninhydrin-positive glycophospholipid, an unknown phospholipid and glycolipids. The G+C content of the genomic DNA was 48.8%. 16S rRNA gene sequence analysis showed that the organism was closely related to Lihuaxuella thermophila YIM 77831(T) (95.69% sequence similarity), Thermoactinomyces daqus H-18(T) (95.49%), Laceyella putida KCTC 3666(T) (95.05%), Thermoactinomyces vulgaris KCTC 9076(T) (95.01%) and Thermoactinomyces intermedius JCM 3312(T) (94.55%). Levels of DNA-DNA relatedness between strain CD-1T and Lihuaxuella thermophila JCM 18059(T), Thermoactinomyces daqus DSM 45914(T), Laceyella putida JCM 8091(T), Thermoactinomyces vulgaris JCM 3162(T) and Thermoactinomyces intermedius JCM 3312(T) were low (22.8, 33.3, 24.7, 29.4 and 30.0%, respectively). A battery of phenotypic, genotypic and DNA-DNA relatedness data indicated that strain CD-1T represented a novel species of the genus Thermoactinomyces, for which the name Thermoactinomyces guangxiensis sp. nov

  3. Spectrum and quantum symmetries of the AdS{sub 5} x S{sup 5} superstring

    Energy Technology Data Exchange (ETDEWEB)

    Heinze, Martin

    2014-12-18

    The initial AdS/CFT duality pair, the duality between N=4 SYM and the AdS{sub 5} x S{sup 5} superstring, appears to enjoy quantum integrability in the planar limit, which allowed to devise powerful methods ostensibly solving the spectral problem. However, quantization of the AdS{sub 5} x S{sup 5} superstring from first principles is still an open question and especially the spectrum of short string states has previously been derived only at leading order in large 't Hooft coupling. In this thesis we investigate possible routes to quantize short string states perturbatively beyond the leading order, where equally our aim is to gain better appreciation of the quantum symmetries at play. A prominent role is played by the lowest excited string states, dual to the Konishi supermultiplet, and we start by reviewing critically an asserted derivation of the Konishi anomalous dimension in the setup of pure spinor string theory. Next, we constrain ourselves to bosonic AdS{sub 5} x S{sup 5} String in static gauge, where we construct a so-called single-mode string solution, a generalization of the pulsating string allowing for unconstrained zero-modes. This solution shows classical integrability and invariance under the isometries SO(2,4) x SO(6) at the quantum level. Arguing heuristically about the effects of supersymmetry, we indeed recover the first non-trivial quantum correction to the Konishi anomalous dimension. We continue by implementing static gauge for the full AdS{sub 5} x S{sup 5} superstring and find elegant expressions for the Lagrangian density and the supercharges. We then constrain our interest to the superparticle and, using two different methods, find canonical coordinates at quadratic order in fermions. We conclude by exploring another quantization scheme: As the single-mode string is nothing but the SO(2,4) x SO(6) orbit of the pulsating string, we apply orbit method quantization to the particle and spinning string solutions in bosonic AdS{sub 3} x S

  4. Puzzles of η-deformed AdS_5×S"5

    International Nuclear Information System (INIS)

    Arutyunov, Gleb; Borsato, Riccardo; Frolov, Sergey

    2015-01-01

    We derive the part of the Lagrangian for the sigma model on the η-deformed AdS_5×S"5 space which is quadratic in fermions and has the full dependence on bosons. We then show that there exists a field redefinition which brings the corresponding Lagrangian to the standard form of type IIB Green-Schwarz superstring. Reading off the corresponding RR couplings, we observe that they fail to satisfy the supergravity equations of motion, despite the presence of κ-symmetry. However, in a special scaling limit our solution reproduces the supergravity background found by Maldacena and Russo. Further, using the fermionic Lagrangian, we compute a number of new matrix elements of the tree level world-sheet scattering matrix. We then show that after a unitary transformation on the basis of two-particle states which is not one-particle factorisable, the corresponding T-matrix factorises into two equivalent parts. Each part satisfies the classical Yang-Baxter equation and coincides with the large tension limit of the q-deformed S-matrix.

  5. Field studies on two rock phosphate solubilizing actinomycete isolates as biofertilizer sources

    Science.gov (United States)

    Mba, Caroline C.

    1994-03-01

    Recently biotechnology is focusing attention on utilization of biological resources to solve a number of environmental problems such as soil fertility management. Results of microbial studies on earthworm compost in the University of Nigeria farm identified a number of rock phosphate solubilizing actinomycetes. Two of these, isclates 02 and 13, were found to be efficient rock phosphate (RP) solubilizers and fast-growing cellulolytic microbes producing extracellular hydrolase enzymes. In this preliminary field study the two microbial isolates were investigated with respect to their effects on the growth of soybean and egusi as well as their effect on the incidence of toxicity of poultry droppings. Application of these isolates in poultry manure-treated field plots, as microbial fertilizers, brought about yield increases of 43% and 17% with soybeans and 19% and 33% with egusi, respectively. Soil properties were also improved. With isolates 02 and 13, the soil available phosphorus increased at the five-leaf stage, while N-fixation in the soil increased by 45% or 11% relative to control. It was further observed that air-dried poultry manure after four days of incubation was still toxic to soybean. The toxic effect of the applied poultry manure was reduced or eliminated with microbial fertilizers 02 or 13, respectively. The beneficial effects of the microbial organic fertilizer are discussed. Justification for more intensive research on rock phosphate organic fertilizer is highlighted.

  6. Pharmacology of (S)-homoquisqualic acid and (S)-2-amino-5-phosphonopentanoic acid [(S)-AP5] at cloned metabotropic glutamate receptors

    DEFF Research Database (Denmark)

    Bräuner-Osborne, Hans; Krogsgaard-Larsen, P

    1998-01-01

    1 In this study we have determined the pharmacological profile of (S)-quisqualic acid, (S)-2-amino-4-phosphonobutyric acid ((S)-AP4) and their higher homologues (S)-homoquisqualic acid, (S)-2-amino-5-phosphonopentanoic acid ((S)-AP5), respectively, and (R)-AP5 at subtypes of metabotropic (S)-glutamic...... demonstrate that incorporation of an additional carbon atom into the backbone of (S)-glutamic acid and its analogues, to give the corresponding homologues, and replacement of the terminal carboxyl groups by isosteric acidic groups have profound effects on the pharmacological profiles at mGlu receptor subtypes...... acid (mGlu) receptors expressed in Chinese hamster ovary cells. 2 (S)-Quisqualic acid was a potent mGlu1/mGlu5 agonist (EC50 values of 1.1 microM and 0.055 microM, respectively) showing no activity at mGlu2 and weak agonism at mGlu4 (EC50 approximately 1000 microM). 3 (S)-Homoquisqualic acid displayed...

  7. D = 4 Yang-Mills correlators from NSR strings on AdS5 x S5

    International Nuclear Information System (INIS)

    Polyakov, D.

    1999-07-01

    In our previous work (hep-th/9812044) we have proposed the sigma-model action, conjectured to be the NSR analogue of superstring theory on AdS 5 x S 5 . This sigma-model is the NSR superstring action with potential term corresponding to the exotic 5-form vertex operator (branelike state). This 5-form potential plays the role of cosmological term, effectively curving the flat space-time geometry to that of AdS 5 x S 5 . In this paper we study this ansatz in more detail and provide the derivation of the correlators of the four-dimensional super Yang-Mills theory from the above mentioned sigma-model. In particular, we show that the correlation function of two dilaton vertex operators in such a model reproduces the well-known result for the two-point function in N = 4 four-dimensional super Yang-Mills theory. (author)

  8. Streptomyces lasiicapitis sp. nov., an actinomycete that produces kanchanamycin, isolated from the head of an ant (Lasius fuliginosus L.).

    Science.gov (United States)

    Ye, Lan; Zhao, Shanshan; Li, Yao; Jiang, Shanwen; Zhao, Yue; Li, Jinmeng; Yan, Kai; Wang, Xiangjing; Xiang, Wensheng; Liu, Chongxi

    2017-05-01

    During a screening for novel and biotechnologically useful actinobacteria in insects, a kanchanamycin-producing actinomycete with antifungal activity, designated strain 3H-HV17(2)T, was isolated from the head of an ant (Lasius fuliginosus L.) and characterized using a polyphasic approach. 16S rRNA gene sequence similarity studies showed that strain 3H-HV17(2)T belongs to the genus Streptomyces with the highest sequence similarities to Streptomyces spectabilis NBRC 13424T (98.90 %, with which it phylogenetically clustered, Streptomyces alboflavus NRRL B-2373T (98.65 %) and Streptomyces flavofungini NBRC 13371T (98.36 %). Phylogenetic analysis based on the gyrB gene also supported the close relationship of these strains. The morphological and chemotaxonomic properties of the strain are also consistent with those members of the genus Streptomyces. A combination of DNA-DNA hybridization experiments and phenotypic tests were carried out between strain 3H-HV17(2)T and its phylogenetically closely related strains, which further clarified their relatedness and demonstrated that strain 3H-HV17(2)T could be distinguished from these strains. Therefore, strain 3H-HV17(2)T is concluded to represent a novel species of the genus Streptomyces, for which the name Streptomyces lasiicapitis sp. nov. is proposed. The type strain is 3H-HV17(2)T (=CGMCC 4.7349T=DSM 103124T).

  9. High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

    Science.gov (United States)

    Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

    2015-10-01

    Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. New holographic limit of AdS5(multiply-in-circle sign)S5

    International Nuclear Information System (INIS)

    Hatsuda, Machiko; Siegel, Warren

    2003-01-01

    We reexamine the projective light cone limit of the gauge-invariant Green-Schwarz action on five-dimensional anti-de Sitter (multiply-in-circle sign) the five-sphere. It implies the usual holography for AdS 5 , but also (a complex) one for S 5 . The result is N=4 projective superspace, which unlike N=4 harmonic superspace can describe N=4 super Yang-Mills theory off shell

  11. Evolution of primary and secondary structures in 5S and 5.8S rRNA

    International Nuclear Information System (INIS)

    Curtiss, W.C.

    1986-01-01

    The secondary structure of Bombyx mori 5S rRNA was studied using the sing-strand specific S1 nuclease and the base pair specific cobra venom ribonuclease. The RNA was end-labeled with [ 32 P] at either the 5' or 3' end and sequenced using enzymatic digestion techniques. These enzymatic data coupled with thermodynamic structure prediction were used to generate a secondary structure for 5S rRNA. A computer algorithm has been implemented to aid in the comparison of a large set of homologous RNAs. Eukaryotic 5S rRNA sequences from thirty four diverse species were compared by (1) alignment or the sequences, (2) the positions of substitutions were located with respect to the aligned sequence and secondary structure, and (3) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. Eukaryotic 5S rRNA was found to have significant sequence variation throughout much of the molecule while maintaining a relatively constant secondary structure. A detailed analysis of the sequence and structure variability in each region of the molecule is presented

  12. Fine structure of the 1s5f and 1s5g levels of He I

    International Nuclear Information System (INIS)

    Kriescher, Y.; Hilt, O.; Oppen, G. v.

    1994-01-01

    The fine structure of the 1s 5f and 1s 5g levels of He I was measured using microwave spectroscopy. The helium atoms were excited by ion impact, and the eleven allowed 1s 5f 2S+1 F J -1s 5g 2S'+1 G J , transitions near ν∼15 GHz were induced and detected by measuring the 1s 4d-1s 2p or 1s 3d-1s 2p spectral-line intensities of the impact radiation as a function of the microwave frequency. The measured transition frequencies are in accord with theoretical values and, except for one transition frequency, with earlier experimental data. The existing discrepancy between these earlier data and theory could be solved. (orig.)

  13. A method for rapid similarity analysis of RNA secondary structures

    Directory of Open Access Journals (Sweden)

    Liu Na

    2006-11-01

    Full Text Available Abstract Background Owing to the rapid expansion of RNA structure databases in recent years, efficient methods for structure comparison are in demand for function prediction and evolutionary analysis. Usually, the similarity of RNA secondary structures is evaluated based on tree models and dynamic programming algorithms. We present here a new method for the similarity analysis of RNA secondary structures. Results Three sets of real data have been used as input for the example applications. Set I includes the structures from 5S rRNAs. Set II includes the secondary structures from RNase P and RNase MRP. Set III includes the structures from 16S rRNAs. Reasonable phylogenetic trees are derived for these three sets of data by using our method. Moreover, our program runs faster as compared to some existing ones. Conclusion The famous Lempel-Ziv algorithm can efficiently extract the information on repeated patterns encoded in RNA secondary structures and makes our method an alternative to analyze the similarity of RNA secondary structures. This method will also be useful to researchers who are interested in evolutionary analysis.

  14. The positive transcription factor of the 5S RNA gene proteolyses during direct exchange between 5S DNA sites

    OpenAIRE

    1986-01-01

    We have examined the association, dissociation, and exchange of the 5S specific transcription factor (TFIIIA) with somatic- and oocyte-type 5S DNA. The factor associates faster with somatic than with oocyte 5S DNA, and the rate of complex formation is accelerated by vector DNA. Once formed, the TFIIIA-5S DNA complex is stable for greater than 4 h in the absence of free 5S DNA, and its dissociation is identical for somatic and for oocyte 5S DNA. In the presence of free 5S DNA, the factor trans...

  15. Finite-size effect of η-deformed AdS5×S5 at strong coupling

    Directory of Open Access Journals (Sweden)

    Changrim Ahn

    2017-04-01

    Full Text Available We compute Lüscher corrections for a giant magnon in the η-deformed (AdS5×S5η using the su(2|2q-invariant S-matrix at strong coupling and compare with the finite-size effect of the corresponding string state, derived previously. We find that these two results match and confirm that the su(2|2q-invariant S-matrix is describing world-sheet excitations of the η-deformed background.

  16. Energy, fine structure, and hyperfine structure of the core-excited states 1s2s2pnp 5P (n = 2-5) and 1s2p2mp 5S (m = 2-5) for Li- ion

    International Nuclear Information System (INIS)

    Wang, Z.B.; Gou, B.C.; Chen, F.

    2006-01-01

    The relativistic energies, the oscillator strength, and the lifetimes of high-lying core-excited states 1s2s2pnp 5 P (n=2-5) and 1s2p 2 mp 5 S 0 (m=2-5) of Li - ion are calculated with the saddle-point variational method and restricted variation method. The fine structure and the hyperfine structure of the core-excited states for this system are also explored. The results are compared with other theoretical and experimental data in the literature. The energy obtained in this work are much lower than the others previously published whereas the wavelengths and radiative life-times are in agreement

  17. Finite-size giant magnons on η-deformed AdS5×S5

    Directory of Open Access Journals (Sweden)

    Changrim Ahn

    2014-10-01

    Full Text Available We consider strings moving in the Rt×Sη3 subspace of the η-deformed AdS5×S5 and obtain a class of solutions depending on several parameters. They are characterized by the string energy and two angular momenta. Finite-size dyonic giant magnon belongs to this class of solutions. Further on, we restrict ourselves to the case of giant magnon with one nonzero angular momentum, and obtain the leading finite-size correction to the dispersion relation.

  18. The kinematical AdS{sub 5S{sup 5} Neumann coefficient

    Energy Technology Data Exchange (ETDEWEB)

    Bajnok, Zoltan [MTA Lendület Holographic QFT Group, Wigner Research Centre,P.O.B. 49, Budapest 114, H-1525 (Hungary); Janik, Romuald A. [Institute of Physics, Jagiellonian University,ul. Łojasiewicza 11, Kraków, 30-348 (Poland)

    2016-02-22

    For the case of two particles a solution of the string field theory vertex axioms can be factorized into a standard form factor and a kinematical piece which includes the dependence on the size of the third string. In this paper we construct an exact solution of the kinematical axioms for AdS{sub 5S{sup 5} which includes all order wrapping corrections w.r.t. the size of the third string. This solution is expressed in terms of elliptic Gamma functions and ordinary elliptic functions. The solution is valid at any coupling and we analyze its weak coupling, pp-wave and large L limit.

  19. Master symmetry in the AdS{sub 5S{sup 5} pure spinor string

    Energy Technology Data Exchange (ETDEWEB)

    Chandía, Osvaldo [Departamento de Ciencias, Facultad de Artes Liberales & Facultad de Ingeniería y Ciencias, Universidad Adolfo Ibáñez,Diagonal Las Torres 2640, Peñalolén, Santiago (Chile); III, William Divine Linch [George P. and Cynthia Woods Mitchell Institute for Fundamental Physics and Astronomy,Texas A& M University,College Station, TX 77843-4242 (United States); Vallilo, Brenno Carlini [Departamento de Ciencias Físicas, Universidad Andres Bello,Sazie 2212, Santiago (Chile)

    2017-01-09

    We lift the set of classical non-local symmetries recently studied by Klose, Loebbert, and Münkler in the context of ℤ{sub 2} cosets to the pure spinor description of the superstring in the AdS{sub 5S{sup 5} background.

  20. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  1. Isolation and characterization of fatty acid methyl ester (FAME)-producing Streptomyces sp. S161 from sheep (Ovis aries) faeces.

    Science.gov (United States)

    Lu, Y; Wang, J; Deng, Z; Wu, H; Deng, Q; Tan, H; Cao, L

    2013-09-01

    An actinomycete producing oil-like mixtures was isolated and characterized. The strain was isolated from sheep faeces and identified as Streptomyces sp. S161 based on 16S rRNA gene sequence analysis. The strain showed cellulase and xylanase activities. The (1) H nuclear magnetic resonance (NMR) spectra of the mixtures showed that the mixtures were composed of fatty acid methyl esters (52·5), triglycerides (13·7) and monoglycerides (9·1) (mol.%). Based on the gas chromatography-mass spectrometry (GC-MS) analysis, the fatty acid methyl esters were mainly composed of C14-C16 long-chain fatty acids. The results indicated that Streptomyces sp. S161 could produce fatty acid methyl esters (FAME) directly from starch. To our knowledge, this is the first isolated strain that can produce biodiesel (FAME) directly from starch. © 2013 The Society for Applied Microbiology.

  2. Complete genome sequence of Paenibacillus riograndensis SBR5(T), a Gram-positive diazotrophic rhizobacterium.

    Science.gov (United States)

    Brito, Luciana Fernandes; Bach, Evelise; Kalinowski, Jörn; Rückert, Christian; Wibberg, Daniel; Passaglia, Luciane M; Wendisch, Volker F

    2015-08-10

    Paenibacillus riograndensis is a Gram-positive rhizobacterium which exhibits plant growth promoting activities. It was isolated from the rhizosphere of wheat grown in the state of Rio Grande do Sul, Brazil. Here we announce the complete genome sequence of P. riograndensis strain SBR5(T). The genome of P. riograndensis SBR5(T) consists of a circular chromosome of 7,893,056bps. The genome was finished and fully annotated, containing 6705 protein coding genes, 87 tRNAs and 27 rRNAs. The knowledge of the complete genome helped to explain why P. riograndensis SBR5(T) can grow with the carbon sources arabinose and mannitol, but not myo-inositol, and to explain physiological features such as biotin auxotrophy and antibiotic resistances. The genome sequence will be valuable for functional genomics and ecological studies as well as for application of P. riograndensis SBR5(T) as plant growth-promoting rhizobacterium. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Streptomyces pini sp. nov., an actinomycete isolated from phylloplane of pine (Pinus sylvestris L.) needle-like leaves.

    Science.gov (United States)

    Madhaiyan, Munusamy; Poonguzhali, Selvaraj; Saravanan, Venkatakrishnan Sivaraj; Duraipandiyan, Veeramuthu; Al-Dhabi, Naif Abdullah; Pragatheswari, Dhandapani; Santhanakrishnan, Palani; Kim, Soo-Jin; Weon, Hang-Yeon; Kwon, Soon-Wo

    2016-10-01

    A novel siderophore-producing actinomycete, designated PL19T, was isolated from the Scots-pine needle-like leaves collected from TNAU campus, Coimbatore, India. The isolate was chemoorganotrophic in nutrition and able to grow at 30 °C, and the optimum pH and NaCl facilitated the growth pH 6-11 and 0-8 % (w/v), respectively. The cells are filamentous and the mycelia formed are basically of wide and intricately branched substrate mycelium from which aerial mycelia arises, later gets differentiated into spores that are warty and arranged spirally. The 16S rRNA gene of strain PL19T was sequenced and was highly similar to the type strains of species of the genus Streptomyces, including Streptomyces barkulensis RC1831T (98.8 % pairwise similarity), Streptomyces fenghuangensis GIMN4.003T (98.2 %), Streptomyces nanhaiensis SCSIO 01248T (98.0 %), Streptomyces radiopugnans R97T (97.9 %), Streptomyces atacamensis C60T (97.8 %) and Streptomyces macrosporus NBRC 14749T (97.2 %), all of which were subjected to taxonomical characterization using a polyphasic approach. The strains showed unique carbon utilization patterns, and it possesses iso-C16 : 0 anteiso-C15 : 0 and anteiso-C17 : 0 as a major cellular fatty acids. The cell-wall was dominated with ll-type diaminopimelic acid, and the menaquinone type was MK-9(H6, H8). These chemotaxonomic evidences placed strain PL19T within the genus Streptomyces. The determination of G+C ratio (69.5 mol%) and DNA-DNA hybridization values (13.4-31.8 % with the phylogenetically related species) helped in further hierarchical classification of strain PL19T. Based on morphological, physiological and chemotaxonomic data as well as DNA-DNA hybridization values, strain PL19T could be distinguished from the evolutionarily closest species currently available. All these collective data show that strain PL19T represents a novel species of the genus Streptomyces, for which the name Streptomyces pini sp. nov. is proposed

  4. 5S-menetelmän implementointi

    OpenAIRE

    Kaikula, Kari-Marko

    2017-01-01

    Tässä opinnäytetyössä tavoiteltiin siisteyden ja järjestyksen tuomista 5S-menetelmän avulla Helen Oy:n kunnossapidon varaosavarastoon Salmisaaren voimalaitoksella. Helen Oy on Helsingin kaupungin omistama energia-alan yritys. Kehittämistehtävänä työssä oli 5S-menetelmän implementointi. Tutkimuksen tarkoituksena oli tutkia niitä seikkoja, jotka vaikuttavat 5S-menetelmän käyttöönottoon. 5S on menetelmä, jolla tuodaan siisteyttä ja järjestystä työympäristöön. Tutkimusmenetelmänä oli toiminta...

  5. Samsung Galaxy S5 for dummies

    CERN Document Server

    Hughes, Bill

    2014-01-01

    Explore Samsung's next generation Galaxy smartphone Do you want an easy-to-follow guide to everything your new Galaxy S5 smartphone can do? From the basics of texting and accessing the Internet to the most advanced features and new software apps, Samsung Galaxy S5 For Dummies makes the need for tech support obsolete. The Galaxy S5 is designed to be faster and more powerful than ever. This latest release in the market-leading line of smartphones is full of new features for you to explore with the help of Samsung Galaxy S5 For Dummies. With over 1 million apps available for the Google Android o

  6. Cross-linking of L5 protein to 5 S RNA in rat liver 60-S subunits by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Terao, K.; Uchiumi, T.; Ogata, K.

    1980-01-01

    After rat liver 60-S ribosomal subunits were irradiated with ultraviolet light at 254 nm, they were treated with EDTA and then subjected to sucrose density-gradient centrifugation to isolate 5 S RNA-protein complex. When 5 S RNA-protein was analyzed by SDS-acrylamide gel electrophoresis which dissociated noncovalent 5 S RNA-protein, two protein bands were observed. The one showed a slower mobility than the protein band (L5) of 5 S RNA-protein from non-irradiated 60 S subunit and the other showed the same mobility as L5 protein. Since the former band was shown to be specific to ultraviolet-irradiation, it was considered as cross-linked 5 S RNA-protein. After the two protein bands were iodinated with 125 I, labeled protein was extracted and treated with RNAase. Thereafter, it was analyzed by two-dimensional acrylamide gel electrophoresis, followed by autoradiography. The results indicate that the protein component of cross-linked 5 S RNA-protein is L5 protein (ribosomal protein); these proteins are designated according to the proposed uniform nomenclature. (Auth.)

  7. Resurgence of the dressing phase for AdS5 × S5

    Science.gov (United States)

    Arutyunov, Gleb; Dorigoni, Daniele; Savin, Sergei

    2017-01-01

    We discuss the resummation of the strong coupling asymptotic expansion of the dressing phase of the AdS5 × S5 superstring. The dressing phase proposed by Beisert, Eden and Staudacher can be recovered from a modified Borel-Ecalle resummation of this asymptotic expansion only by completing it with new, non-perturbative and exponentially suppressed terms that can be organized into different sectors labelled by an instanton-like number. We compute the contribution to the dressing phase coming from the sum over all the instanton sectors and show that it satisfies the homogeneous crossing symmetry equation. We comment on the semiclassical origin of the non-perturbative terms from the world-sheet theory point of view even though their precise explanation remains still quite mysterious.

  8. Finite-size giant magnons on η-deformed AdS{sub 5S{sup 5}

    Energy Technology Data Exchange (ETDEWEB)

    Ahn, Changrim, E-mail: ahn@ewha.ac.kr; Bozhilov, Plamen, E-mail: bozhilov@inrne.bas.bg

    2014-10-07

    We consider strings moving in the R{sub t}×S{sub η}{sup 3} subspace of the η-deformed AdS{sub 5S{sup 5} and obtain a class of solutions depending on several parameters. They are characterized by the string energy and two angular momenta. Finite-size dyonic giant magnon belongs to this class of solutions. Further on, we restrict ourselves to the case of giant magnon with one nonzero angular momentum, and obtain the leading finite-size correction to the dispersion relation.

  9. Quantizing String Theory in AdS_5 X S^5: Beyond the pp-Wave

    OpenAIRE

    Callan, Jr., Curtis G.; Lee, Hok Kong; McLoughlin, Tristan; Schwarz, John H.; Swanson, Ian; Wu, Xinkai

    2003-01-01

    In a certain kinematic limit, where the effects of spacetime curvature (and other background fields) greatly simplify, the light-cone gauge world-sheet action for a type IIB superstring on AdS_5 x S^5 reduces to that of a free field theory. It has been conjectured by Berenstein, Maldacena, and Nastase that the energy spectrum of this string theory matches the dimensions of operators in the appropriately defined large R-charge large-N_c sector of N=4 supersymmetric Yang--Mills theory in four d...

  10. Isolation, Characterization, and Bioactivity Evaluation of 3-((6-Methylpyrazin-2-ylmethyl-1H-indole, a New Alkaloid from a Deep-Sea-Derived Actinomycete Serinicoccus profundi sp. nov.

    Directory of Open Access Journals (Sweden)

    Yong-Hong Liu

    2012-12-01

    Full Text Available One new alkaloid, 3-((6-methylpyrazin-2-ylmethyl-1H-indole (1 was obtained from the deep-sea actinomycete Serinicoccus profundi sp. nov., along with five known compounds (2–6. Their structures were determined on the basis of detailed analysis of the 1D and 2D NMR as well as MS data. The new indole alkaloid displayed weak antimicrobial activity against Staphylococcus aureus ATCC 25923 with an MIC value of 96 μg/mL. It showed no cytotoxicity on a normal human liver cell line (BEL7402 and a human liver tumor cell line (HL-7702.

  11. An actinomycete isolate from solitary wasp mud nest having strong antibacterial activity and kills the Candida cells due the shrinkage and the cytosolic loss

    Directory of Open Access Journals (Sweden)

    Vijay eKumar

    2014-08-01

    Full Text Available An actinomycetes strain designated as MN 2(6 was isolated from the solitary wasp mud nest. The isolate was identified using polyphasic taxonomy. It produced the extensive branched brown substrate and white aerial hyphae that changed into grayish black. The aerial mycelia produced the spiral spore chains with rugose spore surface. The growth was observed between temperature range of 27-37°C, pH 8-10 and below salt concentration of 6% (w/v. The comparative analysis of 16S rRNA gene sequence and phylogenetic relationship showed that strain MN 2(6 lies in clade with Streptomyces hygroscopicus subsp. hygroscopicus NRRL 2387T, Streptomyces sporocinereus NBRC 100766T and Streptomyces demainii NRRL B-1478T with which it shares a 16S rRNA gene sequence similarity of 99.3%. The strain MN 2(6 can be differentiated from type strains based on phenotypic characteristics. The strain MN 2(6 showed most promising activity against Gram-positive, Gram-negative bacteria, acid-fast bacilli and Candida species suggesting broad-spectrum characteristics of the active metabolite. Evaluation of anti-candidal activity of the metabolite of strain MN 2(6 by scanning electron microscopy (SEM revealed changed external morphology of yeast. It kills the Candida cells due to the shrinkage and the cytosolic loss. However, further studies are required to elucidate the structure of the active metabolite produced by the isolate MN 2(6

  12. Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.

    Science.gov (United States)

    Tan, M K

    1991-08-01

    A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.

  13. 5S-menetelmän pilotointi

    OpenAIRE

    Lampela, Saara

    2017-01-01

    Tämän opinnäytetyön tavoitteena oli siisteys- ja järjestystason parantaminen 5S-menetelmän avulla UPM Kaukaan paperitehtaalla. 5S on tuottavuuden parantamiseen keskittyvä lean-työkalu, jonka päätehtäväksi paperitehtaalla määritettiin erityisesti seisokkitilanteissa työvälineiden ja tavaroiden etsimiseen käytetyn ajan vähentäminen sekä työn yleinen jouhevoituminen. 5S-menetelmän nimi tulee japanin kielen sanoista Seiri, Seiton, Seiso, Seiketsu ja Shitsuke. Suomeksi vaiheet ovat lajittelu, järj...

  14. Broad spectrum antimicrobial activity of forest-derived soil actinomycete, Nocardia sp. PB-52

    Directory of Open Access Journals (Sweden)

    Priyanka eSharma

    2016-03-01

    Full Text Available A mesophilic actinomycete strain designated as PB-52 was isolated from soil samples of Pobitora Wildlife Sanctuary of Assam, India. Based on phenotypic and molecular characteristics, the strain was identified as Nocardia sp. which shares 99.7% sequence similarity with Nocardia niigatensis IFM 0330 (NR_112195. The strain is a Gram-positive filamentous bacterium with rugose spore surface which exhibited a wide range of antimicrobial activity against Gram-positive bacteria including methicillin resistant Staphylococcus aureus (MRSA, Gram-negative bacteria and yeasts. Optimization for the growth and antimicrobial metabolite production of the strain PB-52 was carried out in batch culture under shaking condition. The optimum growth and the antimicrobial metabolite production by the strain PB-52 was recorded in GLM medium at 28ºC, initial pH 7.4 of the medium and incubation period of eight days. Based on polyketide synthases (PKS and nonribosomal peptide synthetases (NRPS gene-targeted PCR amplification, the occurrence of both of these biosynthetic pathways was detected which might be involved in the production of antimicrobial metabolite in PB-52. Extract of the fermented broth culture of PB-52 was prepared with organic solvent extraction method using ethyl acetate. The ethyl acetate extract of PB-52 (EA-PB-52 showed lowest minimum inhibitory concentration (MIC against Staphylococcus aureus MTCC 96 (0.975 μg/ml whereas highest was recorded against Klebsiella pneumoniae ATCC 13883 (62.5 μg/ml. Scanning electron microscopy (SEM revealed that treatment of the test microorganisms with EA-PB-52 destroyed the targeted cells with prominent loss of cell shape and integrity. In order to determine the constituents responsible for its antimicrobial activity, EA-PB-52 was subjected to chemical analysis using gas chromatography-mass spectrometry (GC-MS. GC-MS analysis showed the presence of twelve different chemical constituents in the extract, some of which

  15. Interspecies modulation of bacterial development through iron competition and siderophore piracy.

    Science.gov (United States)

    Traxler, Matthew F; Seyedsayamdost, Mohammad R; Clardy, Jon; Kolter, Roberto

    2012-11-01

    While soil-dwelling actinomycetes are renowned for secreting natural products, little is known about the roles of these molecules in mediating actinomycete interactions. In a previous co-culture screen, we found that one actinomycete, Amycolatopsis sp. AA4, inhibited aerial hyphae formation in adjacent colonies of Streptomyces coelicolor. A siderophore, amychelin, mediated this developmental arrest. Here we present genetic evidence that confirms the role of the amc locus in the production of amychelin and in the inhibition of S. coelicolor development. We further characterize the Amycolatopsis sp. AA4 - S. coelicolor interaction by examining expression of developmental and iron acquisition genes over time in co-culture. Manipulation of iron availability and/or growth near Amycolatopsis sp. AA4 led to alterations in expression of the critical developmental gene bldN, and other key downstream genes in the S. coelicolor transcriptional cascade. In Amycolatopsis sp. AA4, siderophore genes were downregulated when grown near S. coelicolor, leading us to find that deferrioxamine E, produced by S. coelicolor, could be readily utilized by Amycolatopsis sp. AA4. Collectively these results suggest that competition for iron via siderophore piracy and species-specific siderophores can alter patterns of gene expression and morphological differentiation during actinomycete interactions. © 2012 Blackwell Publishing Ltd.

  16. Interspecies interactions stimulate diversification of the Streptomyces coelicolor secreted metabolome.

    Science.gov (United States)

    Traxler, Matthew F; Watrous, Jeramie D; Alexandrov, Theodore; Dorrestein, Pieter C; Kolter, Roberto

    2013-08-20

    Soils host diverse microbial communities that include filamentous actinobacteria (actinomycetes). These bacteria have been a rich source of useful metabolites, including antimicrobials, antifungals, anticancer agents, siderophores, and immunosuppressants. While humans have long exploited these compounds for therapeutic purposes, the role these natural products may play in mediating interactions between actinomycetes has been difficult to ascertain. As an initial step toward understanding these chemical interactions at a systems level, we employed the emerging techniques of nanospray desorption electrospray ionization (NanoDESI) and matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) imaging mass spectrometry to gain a global chemical view of the model bacterium Streptomyces coelicolor interacting with five other actinomycetes. In each interaction, the majority of secreted compounds associated with S. coelicolor colonies were unique, suggesting an idiosyncratic response from S. coelicolor. Spectral networking revealed a family of unknown compounds produced by S. coelicolor during several interactions. These compounds constitute an extended suite of at least 12 different desferrioxamines with acyl side chains of various lengths; their production was triggered by siderophores made by neighboring strains. Taken together, these results illustrate that chemical interactions between actinomycete bacteria exhibit high complexity and specificity and can drive differential secondary metabolite production. Actinomycetes, filamentous actinobacteria from the soil, are the deepest natural source of useful medicinal compounds, including antibiotics, antifungals, and anticancer agents. There is great interest in developing new strategies that increase the diversity of metabolites secreted by actinomycetes in the laboratory. Here we used several metabolomic approaches to examine the chemicals made by these bacteria when grown in pairwise coculture. We found that

  17. Higher conserved charges and integrability for spinning strings in AdS5 x S5

    International Nuclear Information System (INIS)

    Engquist, Johan

    2004-01-01

    We demonstrate the existence of an infinite number of local commuting charges for classical solutions of the string sigma model on AdS 5 x S 5 associated with a certain circular three-spin solution spinning with large angular momenta in three orthogonal directions on the five-sphere. Using the AdS/CFT correspondence we find agreement to one-loop with the tower of conserved higher charges in planar N = 4 super Yang-Mills theory associated with the dual composite single-trace operator in the highest weight representation (J 1 ,J 2 ,J 2 ) of SO(6). The agreement can be explained by the presence of integrability on both sides of the duality. (author)

  18. On stringy AdS5 x S5 and higher spin holography

    International Nuclear Information System (INIS)

    Bianchi, Massimo; Morales, Jose F.; Samtleben, Henning

    2003-01-01

    We derive the spectrum of Kaluza-Klein descendants of string excitations on AdS 5 x S 5 . String states are organized in long multiplets of the AdS supergroup SU(2,2|4,R) with a rich pattern of shortenings at the higher spin enhancement point λ=0. The string states holographically dual to the higher spin currents of SYM theory in the strict zero coupling limit are identified together with the corresponding Goldstone particles responsible for the Higgsing of the higher spin symmetry at λ≠ 0. Exploiting higher spin symmetry we propose a very simple yet effective mass formula and establish a one-to-one correspondence between the complete spectrum of Δ 0 ≤ 4 string states and relevant/marginal single-trace deformations in N = 4 SYM theory at large N. To this end, we describe how to efficiently enumerate scaling operators in 'free' YM theory, with the inclusion of fermionic 'letters', by resorting to Polya theory. Comparison between the spectra of 1/4-BPS states is also presented. Finally, we discuss how to organize the spectrum of N = 4 SYM theory in SU(2,2|4,R) supermultiplets by means of some kind of 'Eratostenes's sieve'. (author)

  19. Developmental regulation of Xenopus 5S RNA genes

    International Nuclear Information System (INIS)

    Wormington, W.M.; Schlissel, M.; Brown, D.D.

    1983-01-01

    In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table

  20. Type IIB supergravity solution for the T-dual of the η-deformed AdS_5×S"5 superstring

    International Nuclear Information System (INIS)

    Hoare, B.; Tseytlin, A.A.

    2015-01-01

    We find an exact type IIB supergravity solution that represents a one-parameter deformation of the T-dual of the AdS_5×S"5 background (with T-duality applied in all 6 abelian bosonic isometric directions). The non-trivial fields are the metric, dilaton and RR 5-form only. The latter has remarkably simple “undeformed” form when written in terms of a “deformation-rotated” vielbein basis. An unusual feature of this solution is that the dilaton contains a linear dependence on the isometric coordinates of the metric precluding a straightforward reversal of T-duality. If we still formally dualize back, we find exactly the metric, B-field and product of dilaton with RR field strengths as recently extracted from the η-deformed AdS_5×S"5 superstring action in http://arxiv.org/abs/1507.04239. We also discuss similar solutions for deformed AdS_n×S"n backgrounds with n=2,3. In the η→i limit we demonstrate that all these backgrounds can be interpreted as special limits of gauged WZW models and are also related to (a limit of) the Pohlmeyer-reduced models of the AdS_n×S"n superstrings.

  1. A comprehensive study of eco-friendly natural pigment and its applications.

    Science.gov (United States)

    Parmar, Ramendra Singh; Singh, Charu

    2018-03-01

    Actinomycetes, a large group of filamentous bacteria account for 70-80% of secondary metabolites available commercially. The present investigation was undertaken with an aim to identify and characterize pigment from actinomycetes. Actinomycetes were isolated from rhizosphere soil samples collected from different regions of Madhya Pradesh state. Out of 85 actinomycetes, only 5 actinomycetes showed pigment production and based on diffusible pigment production ability one actinomycete ARITM02 was selected. The extraction of pigment was done by solvent extraction method using methanol and purified by TLC and column chromatography. The pigment was characterized by UV-Vis spectroscopy which showed the lamda maximum of 277.44. FTIR spectroscopy suggested various functional groups like amino group, amide group, hydroxide, benzene and lactone group. The Mass spectroscopy and NMR spectroscopy showed that the molecular mass of pigment is 621.7 and molecular formula is C34H43N3O8. The pigment was also tested for Antimicrobial activity against broad spectrum human pathogens, antioxidant test and toxicity test for safe use as a natural colorant in cosmetic, food, pharmaceutical and textile industries. The conclusion of study suggested that this novel pigment could be a versatile natural, safe and multipurpose.

  2. Studies of inelastic cross-section in Rb(7S) + Rb(5S) collisions

    International Nuclear Information System (INIS)

    Caiyan, L.; Ekers, A.; Latvia Univ., Riga; Klavins, J.; Jansons, M.

    1996-01-01

    The cross section σ = (8 ± 4) x 10 -15 cm 2 was determined for the Rb(7S) + Rb(5S) → Rb(5D) + Rb(5S) excitation energy transfer process, and the quenching cross section σ q = (2 ± 1) x 10 -14 cm 2 for the Rb(5D) state in collisions with ground state Rb atoms. Applying rubidium quasimolecular asymptotic potential curves at relatively large internuclear distances, a qualitative interpretation of the experimental results is presented. It is shown that the quenching of the Rb(5D) atoms in collisions may be explained by a reversed energy pooling process Rb(5D) + Rb(5S) → Rb(5P) + Rb(5P). (orig.)

  3. Hyperfine structure in 5s4d 3D-5snf transitions of 87Sr

    International Nuclear Information System (INIS)

    Bushaw, B.A.; Kluge, H.J.; Lantzsch, J.; Schwalbach, R.; Stenner, J.; Stevens, H.; Wendt, K.; Zimmer, K.

    1993-01-01

    The hyperfine spectra of the 5s4d 3 D 1 -5s20f, 5s4d 3 D 2 -5s23f, and 5s4d 3 D 3 -5s32f transitions of 87 Sr (I=9/2) have been measured by collinear fast beam laser spectroscopy. The structure in the upper configurations is highly perturbed by fine structure splitting that is of comparable size to the hyperfine interaction energy. These perturbations can be adequately treated with conventional matrix diagonalization methods, using the 5s-electron magnetic dipole interaction term a 5s and the unperturbed fine structure splittings as input parameters. Additionally, hyperfine constants for the lower 5s4d 3 D configurations, including the A- and B-factors and a separation of the individual s- and d-electron contributions to these factors, are derived. (orig.)

  4. Resurgence of the dressing phase for AdS{sub 5S{sup 5}

    Energy Technology Data Exchange (ETDEWEB)

    Arutyunov, Gleb [Institut für Theoretische Physik, Universität Hamburg, Luruper Chaussee 149, 22761 Hamburg (Germany); Zentrum für Mathematische Physik, Universität Hamburg, Bundesstrasse 55, 20146 Hamburg (Germany); Dorigoni, Daniele [Centre for Particle Theory & Department of Mathematical Sciences, Durham University, Lower Mountjoy Stockton Road, Durham DH1 3LE (United Kingdom); Savin, Sergei [Institut für Theoretische Physik, Universität Hamburg, Luruper Chaussee 149, 22761 Hamburg (Germany); Zentrum für Mathematische Physik, Universität Hamburg, Bundesstrasse 55, 20146 Hamburg (Germany)

    2017-01-13

    We discuss the resummation of the strong coupling asymptotic expansion of the dressing phase of the AdS{sub 5S{sup 5} superstring. The dressing phase proposed by Beisert, Eden and Staudacher can be recovered from a modified Borel-Ecalle resummation of this asymptotic expansion only by completing it with new, non-perturbative and exponentially suppressed terms that can be organized into different sectors labelled by an instanton-like number. We compute the contribution to the dressing phase coming from the sum over all the instanton sectors and show that it satisfies the homogeneous crossing symmetry equation. We comment on the semiclassical origin of the non-perturbative terms from the world-sheet theory point of view even though their precise explanation remains still quite mysterious.

  5. 5S IN QUALITY MANAGEMENT

    Directory of Open Access Journals (Sweden)

    BOCA GRATIELA DANA

    2015-07-01

    Full Text Available The fundamental principles of organization are customer satisfaction, eliminating waste, achieving a continuous flow in production and continuous improvement. The 5S method is a structured program for implementation the standardization and organization, simplifies the environment of the workplace (Gemba, reduce losses and unnecessary activities, and improve quality efficiency and safety. Keeping the workplace clean, providing a good working environment and promote productivity, reducing costs, ensure security and removes all types of losses. The case study present the 5S method as a tool which can be used efficiently to keep those things necessary for the proper conduct of the organization and the elimination of unless things.

  6. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro

    Science.gov (United States)

    Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.

    2011-01-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395

  7. Assembly and disassembly of the nucleolus during the cell cycle.

    Science.gov (United States)

    Hernandez-Verdun, Danièle

    2011-01-01

    The nucleolus is a large nuclear domain in which transcription, maturation and assembly of ribosomes take place. In higher eukaryotes, nucleolar organization in three sub-domains reflects the compartmentation of the machineries related to active or inactive transcription of the ribosomal DNA, ribosomal RNA processing and assembly with ribosomal proteins of the two (40S and 60S) ribosomal subunits. The assembly of the nucleoli during telophase/early G(1) depends on pre-existing machineries inactivated during prophase (the transcription machinery and RNP processing complexes) and on partially processed 45S rRNAs inherited throughout mitosis. In telophase, the 45S rRNAs nucleate the prenucleolar bodies and order the dynamics of nucleolar assembly. The assembly/disassembly processes of the nucleolus depend on the equilibrium between phosphorylation/dephosphorylation of the transcription machinery and on the RNP processing complexes under the control of the CDK1-cyclin B kinase and PP1 phosphatases. The dynamics of assembly/disassembly of the nucleolus is time and space regulated.

  8. Plasma modified PLA electrospun membranes for actinorhodin production intensification in Streptomyces coelicolor immobilized-cell cultivations.

    Science.gov (United States)

    Scaffaro, Roberto; Lopresti, Francesco; Sutera, Alberto; Botta, Luigi; Fontana, Rosa Maria; Gallo, Giuseppe

    2017-09-01

    Most of industrially relevant bioproducts are produced by submerged cultivations of actinomycetes. The immobilization of these Gram-positive filamentous bacteria on suitable porous supports may prevent mycelial cell-cell aggregation and pellet formation which usually negatively affect actinomycete submerged cultivations, thus, resulting in an improved biosynthetic capability. In this work, electrospun polylactic acid (PLA) membranes, subjected or not to O 2 -plasma treatment (PLA-plasma), were used as support for immobilized-cell submerged cultivations of Streptomyces coelicolor M145. This strain produces different bioactive compounds, including the blue-pigmented actinorhodin (ACT) and red-pigmented undecylprodigiosin (RED), and constitutes a model for the study of antibiotic-producing actinomycetes. Wet contact angles and X-ray photoelectron spectroscopy analysis confirmed the increased wettability of PLA-plasma due to the formation of polar functional groups such as carboxyl and hydroxyl moieties. Scanning electron microscope observations, carried out at different incubation times, revealed that S. coelicolor immobilized-cells created a dense "biofilm-like" mycelial network on both kinds of PLA membranes. Cultures of S. coelicolor immobilized-cells on PLA or PLA-plasma membranes produced higher biomass (between 1.5 and 2 fold) as well as higher levels of RED and ACT than planktonic cultures. In particular, cultures of immobilized-cells on PLA and PLA-plasma produced comparable levels of RED that were approximatively 4 and 5 fold higher than those produced by planktonic cultures, respectively. In contrast, levels of ACT produced by immobilized-cell cultures on PLA and PLA-plasma were different, being 5 and 10 fold higher than those of planktonic cultures, respectively. Therefore, this is study demonstrated the positive influence of PLA membrane on growth and secondary metabolite production in S. coelicolor and also revealed that O 2 -plasma treated PLA membranes

  9. Linking Baecklund and monodromy charges for strings on AdS5 x S5

    International Nuclear Information System (INIS)

    Arutyunov, Gleb; Zamaklar, Marija

    2005-01-01

    We find an explicit relation between the two known ways of generating an infinite set of local conserved charges for the string sigma model on AdS 5 x S 5 : the Baecklund and monodromy approaches. We start by constructing the two-parameter family of Baecklund transformations for the string with an arbitrary world-sheet metric. We then show that only for a special value of one of the parameters the solutions generated by this transformation are compatible with the Virasoro constraints. By solving the Baecklund equations in a non-perturbative fashion, we finally show that the generating functional of the Baecklund conservation laws is equal to a certain sum of the quasi-momenta. The positions of the quasi-momenta in the complex spectral plane are uniquely determined by the real parameter of the Baecklund transform

  10. Discovering potential Streptomyces hormone producers by using disruptants of essential biosynthetic genes as indicator strains.

    Science.gov (United States)

    Thao, Nguyen B; Kitani, Shigeru; Nitta, Hiroko; Tomioka, Toshiya; Nihira, Takuya

    2017-10-01

    Autoregulators are low-molecular-weight signaling compounds that control the production of many secondary metabolites in actinomycetes and have been referred to as 'Streptomyces hormones'. Here, potential producers of Streptomyces hormones were investigated in 40 Streptomyces and 11 endophytic actinomycetes. Production of γ-butyrolactone-type (IM-2, VB) and butenolide-type (avenolide) Streptomyces hormones was screened using Streptomyces lavendulae FRI-5 (ΔfarX), Streptomyces virginiae (ΔbarX) and Streptomyces avermitilis (Δaco), respectively. In these strains, essential biosynthetic genes for Streptomyces hormones were disrupted, enabling them to respond solely to the externally added hormones. The results showed that 20% of each of the investigated strains produced IM-2 and VB, confirming that γ-butyrolactone-type Streptomyces hormones are the most common in actinomycetes. Unlike the γ-butyrolactone type, butenolide-type Streptomyces hormones have been discovered in recent years, but their distribution has been unclear. Our finding that 24% of actinomycetes (12 of 51 strains) showed avenolide activity revealed for the first time that the butenolide-type Streptomyces hormone is also common in actinomycetes.

  11. Synthesis and growth mechanism of Zn0.5Cd0.5S nanohexagon dendrite

    Science.gov (United States)

    Yu, Wen; Fang, Pengfei; Wang, Shaojie

    2014-12-01

    Hierarchical Zn0.5Cd0.5S nanohexagon dendrites were synthesized by a one-step hydrothermal method. The Zn0.5Cd0.5S nanohexagon dendrites were made up of nanohexagons with a side length of about 90 nm. The nanohexagons were regularly arranged forming as embranchments which were parallel to each other along certain hexagonal directions. Furthermore, these embranchments made up primary trunks shaping as dendrites. The growth mechanism of Zn0.5Cd0.5S nanohexagon dendrites was proposed in which molecular soft template and lowest energy principle played key roles. By adjusting the composition of the reactants, a series of ZnxCd1-xS solid solutions could be obtained. The morphology of the synthesized ZnxCd1-xS depended much on the x value. The UV-vis spectra absorb edges of the ZnxCd1-xS samples continuously shifted indicating the changes of the band gap.

  12. Antimicrobial activities of Streptomyces pulcher, S. canescens and S. citreofluorescens against fungal and bacterial pathogens of tomato in vitro.

    Science.gov (United States)

    el-Abyad, M S; el-Sayed, M A; el-Shanshoury, A R; el-Sabbagh, S M

    1996-01-01

    Thirty-seven actinomycete species isolated from fertile cultivated soils in Egypt were screened for the production of antimicrobial compounds against a variety of test organisms. Most of the isolates exhibited antimicrobial activities against Gram-positive, Gram-negative, and acid-fast bacteria, yeasts and filamentous fungi, with special attention to fungal and bacterial pathogens of tomato. On starch-nitrate agar, 14 strains were active against Fusarium oxysporum f.sp. lycopersici (the cause of Fusarium wilt), 18 against Verticillium albo-atrum (the cause of Verticillium wilt), and 18 against Alternaria solani (the cause of early blight). In liquid media, 14 isolates antagonized Pseudomonas solanacearum (the cause of bacterial wilt) and 20 antagonized Clavibacter michiganensis ssp. michiganensis (the cause of bacterial canker). The most active antagonists of the pathogenic microorganisms studied were found to be Streptomyces pulcher, S. canescens (syn. S. albidoflavus) and S. citreofluorescens (syn. S. anulatus). The antagonistic activities of S. pulcher and S. canescens against pathogenic fungi were assessed on solid media, and those of S. pulcher and S. citreofluorescens against pathogenic bacteria in liquid media under shaking conditions. The optimum culture conditions were determined.

  13. The blue light indicator in rubidium 5S-5P-5D cascade excitation

    Science.gov (United States)

    Raja, Waseem; Ali, Md. Sabir; Chakrabarti, Alok; Ray, Ayan

    2017-07-01

    The cascade system has played an important role in contemporary research areas related to fields like Rydberg excitation, four wave mixing and non-classical light generation, etc. Depending on the specific objective, co or counter propagating pump-probe laser experimental geometry is followed. However, the stepwise excitation of atoms to states higher than the first excited state deals with increasingly much fewer number of atoms even compared to the population at first excited level. Hence, one needs a practical indicator to study the complex photon-atom interaction of the cascade system. Here, we experimentally analyze the case of rubidium 5S5P → 5D as a specimen of two-step excitation and highlight the efficacy of monitoring one branch, which emits 420 nm, of associated cascade decay route 5D → 6P → 5S, as an effective monitor of the coherence in the system.

  14. Increased 5S rRNA oxidation in Alzheimer's disease.

    Science.gov (United States)

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  15. Noncentral extension of the $AdS_5 x S^5$ superalgebra supermultiplet of brane charges

    CERN Document Server

    Lee, S; Lee, Sangmin; Park, Jeong-Hyuck

    2004-01-01

    We propose an extension of the su(2,2|4) superalgebra to incorporate the F1/D1 string charges in type IIB string theory on the AdS_5 X S^5 background, or the electro-magnetic charges in the dual super Yang-Mills theory. With the charges introduced, the superalgebra inevitably undergoes a noncentral extension, as noted recently in [1]. After developing a group theoretical method of obtaining the noncentral extension, we show that the charges form a certain nonunitary representation of the original unextended superalgebra, subject to some constraints. We solve the constraints completely and show that, apart from the su(2,2|4) generators, there exist 899 complex brane charges in the extended algebra. Explicitly we present all the super-commutators among them.

  16. Strong decays and dipion transitions of Y(5S)

    International Nuclear Information System (INIS)

    Simonov, Yu.A.; Veselov, A.I.

    2009-01-01

    Dipion transitions of Y(nS) with n=5, n ' =1,2,3 are studied using the Field Correlator Method, applied previously to dipion transitions with n=2,3,4. The only two parameters of effective Lagrangian were fixed in that earlier study, and total widths Γ ππ (5,n ' ) as well as pionless decay widths Γ BB (5S), Γ BB* (5S), Γ B*B* (5S) and Γ KK (5,n ' ) were calculated and are in a reasonable agreement with experiment. The experimental ππ spectra for (5,1) and (5,2) transitions are well reproduced taking into account FSI in the ππ

  17. Making safety an integral part of 5S in healthcare.

    Science.gov (United States)

    Ikuma, Laura H; Nahmens, Isabelina

    2014-01-01

    Healthcare faces major challenges with provider safety and rising costs, and many organizations are using Lean to instigate change. One Lean tool, 5S, is becoming popular for improving efficiency of physical work environments, and it can also improve safety. This paper demonstrates that safety is an integral part of 5S by examining five specific 5S events in acute care facilities. We provide two arguments for how safety is linked to 5S:1. Safety is affected by 5S events, regardless of whether safety is a specific goal and 2. Safety can and should permeate all five S's as part of a comprehensive plan for system improvement. Reports of 5S events from five departments in one health system were used to evaluate how changes made at each step of the 5S impacted safety. Safety was affected positively in each step of the 5S through initial safety goals and side effects of other changes. The case studies show that 5S can be a mechanism for improving safety. Practitioners may reap additional safety benefits by incorporating safety into 5S events through a safety analysis before the 5S, safety goals and considerations during the 5S, and follow-up safety analysis.

  18. Influence of 45S5 Bioglass addition on microstructure and properties of ultrafine grained (Mg-4Y-5.5Dy-0.5Zr) alloy

    Energy Technology Data Exchange (ETDEWEB)

    Kowalski, K., E-mail: kamil.kowalski@put.poznan.pl [Institute of Materials Science and Engineering, Poznan University of Technology, Jana Pawla II 24, 61-138 Poznan (Poland); Jurczyk, M.U. [Division of Mother’s and Child’s Health, Poznan University of Medical Sciences, Polna 33, 60-535 Poznan (Poland); Wirstlein, P.K. [Department of Gynecology and Obstetrics, Division of Reproduction, Poznan University of Medical Sciences, Polna 33, 60-535 Poznan (Poland); Jakubowicz, J.; Jurczyk, M. [Institute of Materials Science and Engineering, Poznan University of Technology, Jana Pawla II 24, 61-138 Poznan (Poland)

    2017-05-15

    Highlights: • Ultrafine grained composites were formed by consolidating mechanically alloyed powders. • Mechanical properties were sensitive to the content of 45S5 Bioglass in Mg-4Y-5.5Dy-0.5Zr alloy. • Fluoride treated composites displayed superior corrosion resistance in Ringer solution. • Composites modified with MgF{sub 2} have a higher degree of biocompatibility in comparison with the unmodified reference material. - Abstract: Bulk samples of an ultrafine grained (Mg-4Y-5.5Dy-0.5Zr)-x wt% 45S5 Bioglass (x = 0, 5) and (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass-1 wt% Ag composites have been synthesized by consolidating mechanically alloyed powders. The influence of the chemical composition on the microstructure, mechanical properties and corrosion behavior of bulk composites were studied. The sintering of (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass powders led to the formation of a bulk composite with grain size of approx. 95 nm. The corrosion behavior of Mg-based composites before and after hydrofluoric acid treatment was also investigated. The ultrafine grained (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass composite was more corrosion resistant than the bulk Mg-4Y-5.5Dy-0.5Zr alloy after HF treatment. The in vitro biocompatibility of synthesized composites was evaluated and compared with microcrystalline magnesium. Magnesium, (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass and (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass-1 wt% Ag composites modified with MgF{sub 2} have a higher degree of biocompatibility in comparison with the unmodified reference material.

  19. Phase transition and thermodynamical geometry for Schwarzschild AdS black hole in AdS_5×S"5 spacetime

    International Nuclear Information System (INIS)

    Zhang, Jia-Lin; Cai, Rong-Gen; Yu, Hongwei

    2015-01-01

    We study the thermodynamics and thermodynamic geometry of a five-dimensional Schwarzschild AdS black hole in AdS_5×S"5 spacetime by treating the cosmological constant as the number of colors in the boundary gauge theory and its conjugate quantity as the associated chemical potential. It is found that the chemical potential is always negative in the stable branch of black hole thermodynamics and it has a chance to be positive, but appears in the unstable branch. We calculate the scalar curvatures of the thermodynamical Weinhold metric, Ruppeiner metric and Quevedo metric, respectively and we find that the scalar curvature in the Weinhold metric is always vanishing, while in the Ruppeiner metric the divergence of the scalar curvature is related to the divergence of the heat capacity with fixed chemical potential, and in the Quevedo metric the divergence of the scalar curvature is related to the divergence of the heat capacity with fixed number of colors and to the vanishing of the heat capacity with fixed chemical potential.

  20. On semiclassical analysis of pure spinor superstring in an AdS{sub 5} x S{sup 5} background

    Energy Technology Data Exchange (ETDEWEB)

    Aisaka, Yuri [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Sao Paulo State Univ. (Brazil). Inst. de Fisica Teorica; Ibiapina Bevilaqua, L. [Univ. Federal do Rio Grande do Norte, Natal (Brazil). Esola de Ciencias e Tecnologia; Vallilo, Brenno C. [Santiago Univ. (Chile). Dept. de Ciencias Fisicas

    2012-06-15

    Relation between semiclassical analyses of Green-Schwarz and pure spinor formalisms in an AdS{sub 5} x S{sup 5} background is clarified. It is shown that the two formalisms have identical semiclassical partition functions for a simple family of classical solutions. It is also shown that, when the classical string is furthermore rigid, this in turn implies that the two formalisms predict the same one-loop corrections to spacetime energies.

  1. M5-branes, orientifolds, and S-duality

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, Yoonseok [Department of Physics and Astronomy & Center for Theoretical Physics,Seoul National University, 1 Gwanak-ro, Seoul (Korea, Republic of); Kim, Joonho [School of Physics, Korea Institute for Advanced Study,85 Hoegiro, Seoul (Korea, Republic of); Kim, Seok [Department of Physics and Astronomy & Center for Theoretical Physics,Seoul National University, 1 Gwanak-ro, Seoul (Korea, Republic of)

    2016-12-29

    We study the instanton partition functions of 5d maximal super Yang-Mills theories with all classical gauge groups. They are computed from the ADHM quantum mechanics of the D0-D4-O4 systems. Our partition functions respect S-dualities of the circle compactified Yang-Mills theories and various orientifold backgrounds. We also compute and study the S{sup 5} partition functions that correspond to the 6d (2,0) superconformal indices. Our SO(2N) index takes the form of the vacuum character of W{sub D} algebra in a special limit, supporting the W algebra conjecture. We propose new indices for (2,0) theories with outer automorphism twists along the temporal circle, obtained from non-simply-laced SYMs on S{sup 5}.

  2. High resolution emission Fourier transform infrared spectra of the 4p-5s and 5p-6s bands of ArH.

    Science.gov (United States)

    Baskakov, O I; Civis, S; Kawaguchi, K

    2005-03-15

    In the 2500-8500 cm(-1) region several strong emission bands of (40)ArH were observed by Fourier transform spectroscopy through a dc glow discharge in a mixture of argon and hydrogen. Rotational-electronic transitions of the two previously unstudied 4p-5s and 5p-6s,v = 0-0, bands of (40)ArH were measured and assigned in the 6060 and 3770 cm(-1) regions, respectively. A simultaneous fit of the emission transitions of the 4p-5s and 5p-6s bands and an extended set of transitions of the 6s-4p band observed by Dabrowski, Tokaryk, and Watson [J. Mol. Spectrosc. 189, 95 (1998)] and remeasured in the present work yielded consistent values of the spectroscopic parameters of the electronic states under investigation. In the branch of the 4p-5s band with transitions of type (Q)Q(f(3)e) we observed a narrowing in the linewidths with increasing rotational quantum number N. The rotational dependence of the linewidth is caused by predissociation of the 5s state by the repulsive ground 4s state through homogeneous coupling and changes in overlap integrals of the vibrational wave functions with the rotational level. Analysis was based on the Fermi's golden rule approximation model. In the 4p-5s band region a vibrational sequence ofv(')-v(")=1-1, 2-2, and 3-3 were recorded and a number of transitions belonging to the strongest (Q)Q(f(3)e) form branch of the 1-1 band were analyzed.

  3. Pressure broadening and frequency shift of the 5S1/2 → 5D5/2 and 5S1/2 → 7S1/2 two photon transitions in 85Rb by the noble gases and N2

    International Nuclear Information System (INIS)

    Zameroski, Nathan D; Hager, Gordon D; Erickson, Christopher J; Burke, John H

    2014-01-01

    Doppler free two photon absorption spectroscopy was employed to measure the pressure broadening and frequency shift rates of the 5S 1/2 (F = 3) → 5D 5/2 (F = 5, 4, 3, 2, 1) (778.105 nm) and the 5S 1/2 (F = 2) → 7S 1/2 (F = 2) (760.126 nm) two photon transitions in 85 Rb by the noble gases and N 2 . To our knowledge, these rates are reported on for the first time. The self-broadening and shift rate of the 5S 1/2 (F = 3) → 5D 5/2 (F = 5, 4, 3, 2, 1) transition and self -broadening rate of the 5S 1/2 (F = 2) → 7S 1/2 (F = 2) transition were also measured. The temperature dependence of the self-frequency shift (Rb-Rb collisions) of these transitions is presented. Helium diffusion rates through Quartz and Pyrex cells are also calculated and the implication of helium diffusion through glass vapor cells is discussed in regards to atomic frequency standards based on these transitions. Experimental pressure broadening and shift rates are compared to theoretically calculated rates assuming a 6, 8 or 6, 8, 10 difference potential and pseudo potential model. Reasonable agreement is achieved between experimental and theoretical values. (paper)

  4. Large spin limit of AdS5xS5 string theory and low energy expansion of ferromagnetic spin chains

    International Nuclear Information System (INIS)

    Kruczenski, M.; Ryzhov, A.V.; Tseytlin, A.A.

    2004-01-01

    By considering AdS 5 xS 5 string states with large S 5 angular momenta one can provide non-trivial quantitative checks of the AdS/CFT duality. A string rotating in S 5 with two angular momenta J 1 , J 2 is dual to an operator in N=4 SYM theory whose conformal dimension can be computed by diagonalizing a (generalization of) spin 1/2 Heisenberg chain Hamiltonian. It was recently argued and verified to lowest order in a large J=J 1 +J 2 expansion, that the Heisenberg chain can be described using a non-relativistic low energy effective 2d action for a unit vector field n i which exactly matches the corresponding large J limit of the classical AdS 5 xS 5 string action. In this paper we show that this agreement extends to the next order and develop a systematic procedure for computing higher orders in such large angular momentum expansion. This involves several non-trivial steps. On the string side, we need to choose a special gauge with a non-diagonal world-sheet metric which insures that the angular momentum is uniformly distributed along the string, as indeed is the case on the spin chain side. We need also to implement an order by order redefinition of the field n i to get an action linear in the time derivative. On the spin chain side, it turns out to be crucial to include the effects of integrating out short wave-length modes. In this way we gain a better understanding of how (a subsector of) the string sigma model emerges from the dual gauge theory, allowing us to demonstrate the duality beyond comparing particular examples of states with large J

  5. Implementation of 5S Method for Ergonomic Laboratory

    Science.gov (United States)

    Dila Sari, Amarria; Ilma Rahmillah, Fety; Prabowo Aji, Bagus

    2017-06-01

    This article discusses 5S implementation in Work System Design and Ergonomic Laboratory, Department of Industrial Engineering, Islamic University of Indonesia. There are some problems related to equipment settings for activity involving students such as files which is accumulated over the previous year practicum, as well as the movement of waste in the form of time due to the placement of goods that do not fit. Therefore, this study aims to apply the 5S method in DSK & E laboratory to facilitate the work processes and reduce waste. The project is performed by laboratory management using 5S methods in response to continuous improvement (Kaizen). Moreover, some strategy and suggestions are promoted to impose 5S system within the laboratory. As a result, the tidiness and cleanliness can be achieved that lead to the great performance of laboratory users. Score assessment before implementing 5S DSKE laboratory is at 64 (2.56) while the score after implementation is 32 (1.28) and shows an improvement of 50%. This has implications for better use in the laboratory area, save time when looking for tools and materials due to its location and good visual control, as well as improving the culture and spirit of ‘5S’ on staff regarding better working environment

  6. The heavy quarkonium spectrum at order $m\\alpha_{s}^{5}\\ln\\alpha_{s}$

    CERN Document Server

    Brambilla, Nora; Soto, Joan; Vairo, Antonio

    1999-01-01

    We compute the complete leading-log terms of the next-to-next-to-next-to-leading-order corrections to potential NRQCD. As a by-product we obtain the leading logs at $O(m\\alpha_s^5)$ in the heavy quarkonium spectrum. These leading logs, when $\\Lambda_{QCD} \\ll m\\alpha_s^2$, give the complete $O(m\\alpha_s^5 \\ln \\alpha_s)$ corrections to the heavy quarkonium spectrum.

  7. The 5C Concept and 5S Principles in Inflammatory Bowel Disease Management.

    Science.gov (United States)

    Hibi, Toshifumi; Panaccione, Remo; Katafuchi, Miiko; Yokoyama, Kaoru; Watanabe, Kenji; Matsui, Toshiyuki; Matsumoto, Takayuki; Travis, Simon; Suzuki, Yasuo

    2017-10-27

    The international Inflammatory Bowel Disease [IBD] Expert Alliance initiative [2012-2015] served as a platform to define and support areas of best practice in IBD management to help improve outcomes for all patients with IBD. During the programme, IBD specialists from around the world established by consensus two best practice charters: the 5S Principles and the 5C Concept. The 5S Principles were conceived to provide health care providers with key guidance for improving clinical practice based on best management approaches. They comprise the following categories: Stage the disease; Stratify patients; Set treatment goals; Select appropriate treatment; and Supervise therapy. Optimised management of patients with IBD based on the 5S Principles can be achieved most effectively within an optimised clinical care environment. Guidance on optimising the clinical care setting in IBD management is provided through the 5C Concept, which encompasses: Comprehensive IBD care; Collaboration; Communication; Clinical nurse specialists; and Care pathways. Together, the 5C Concept and 5S Principles provide structured recommendations on organising the clinical care setting and developing best-practice approaches in IBD management. Consideration and application of these two dimensions could help health care providers optimise their IBD centres and collaborate more effectively with their multidisciplinary team colleagues and patients, to provide improved IBD care in daily clinical practice. Ultimately, this could lead to improved outcomes for patients with IBD. Copyright © 2017 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com

  8. Strong nondipole effects in low-energy photoionization of the 5s and 5p subshells of xenon

    International Nuclear Information System (INIS)

    Johnson, W. R.; Cheng, K. T.

    2001-01-01

    Large nondipole effects are predicted in the angular distribution of photoelectrons from the 5s and 5p subshells of xenon for photon energies below 200 eV. The nondipole parameter γ 5s exhibits a dispersion-curve variation near the first minimum of the 5s cross section at 35 eV, reaching a minimum value of -0.8 near 40 eV. Rapid variation of γ 5s is also found near the second minimum of the 5s cross section at 150 eV, where γ 5s reaches a maximum value of 1.2. Smaller, but significant, nondipole effects are also found in the parameter ζ 5p =γ 5p +3δ 5p , which has a maximum value of 0.15 near 50 eV, and a second maximum value of 0.18 near 160 eV. The higher energy maxima in γ 5s and ζ 5p arise from correlation enhanced by shape resonances in the 4p→f quadrupole photoionization channels. These predictions are based on relativistic random-phase approximation calculations in which excitations from 5p, 5s, 4d, 4p, and 4s subshells are coupled

  9. Hyperfine structure in 5s4d [sup 3]D-5snf transitions of [sup 87]Sr

    Energy Technology Data Exchange (ETDEWEB)

    Bushaw, B.A. (Pacific Northwest Lab., Richland, WA (United States)); Kluge, H.J. (Mainz Univ. (Germany). Inst. fuer Physik); Lantzsch, J. (Mainz Univ. (Germany). Inst. fuer Physik); Schwalbach, R. (Mainz Univ. (Germany). Inst. fuer Physik); Stenner, J. (Mainz Univ. (Germany). Inst. fuer Physik); Stevens, H. (Mainz Univ. (Germany). Inst. fuer Physik); Wendt, K. (Mainz Univ. (Germany). Inst. fuer Physik); Zimmer, K. (Mainz Univ. (Germany). Inst. fuer Physik)

    1993-12-01

    The hyperfine spectra of the 5s4d[sup 3]D[sub 1]-5s20f, 5s4d[sup 3]D[sub 2]-5s23f, and 5s4d[sup 3]D[sub 3]-5s32f transitions of [sup 87]Sr (I=9/2) have been measured by collinear fast beam laser spectroscopy. The structure in the upper configurations is highly perturbed by fine structure splitting that is of comparable size to the hyperfine interaction energy. These perturbations can be adequately treated with conventional matrix diagonalization methods, using the 5s-electron magnetic dipole interaction term a[sub 5s] and the unperturbed fine structure splittings as input parameters. Additionally, hyperfine constants for the lower 5s4d[sup 3]D configurations, including the A- and B-factors and a separation of the individual s- and d-electron contributions to these factors, are derived. (orig.)

  10. Electron correlation in the 4d-16p→5s-26p and 5s-15p-16p resonance Auger transitions of Xe

    International Nuclear Information System (INIS)

    Osmekhin, S.; Nikkinen, J.; Sankari, R.; Maeaettae, M.; Kukk, E.; Huttula, M.; Heinaesmaeki, S.; Aksela, H.; Aksela, S.

    2007-01-01

    The Xe 4d -1 6p→5s 0 5p 6 6p and 5s 1 5p 5 6p resonant Auger transitions have been studied both theoretically and experimentally. High resolution resonant Auger spectra have been recoded with different photon bandwidths which have enabled to separate the first step Auger transition from the overlapping second step transitions. Theoretical calculations using multi-configuration Dirac-Fock approach with different configuration expansions were carried out, compared to each other and to the experiment. The calculations with the largest basis set were found to reproduce the distribution of the intensity to the main and satellite lines in both the 5s 0 5p 6 6p and 5s 1 5p 5 6p Auger groups reasonably well, and to predict the structure of the 4d -1 6p→5s 0 5p 6 6p main lines very well

  11. Attosecond relative delay among xenon 5p, 5s, and 4d photoionization

    Science.gov (United States)

    Magrakvelidze, Maia; Madjet, Mohamed; Chakraborty, Himadri

    2017-04-01

    Attosecond Wigner-Smith (WS) time delays of the photoemissions of Xe valence 5p, 5s, and core 4d electrons are investigated in details using the time-dependent local density approximation (TDLDA). Electron correlations determine the energy-dependent structures in ionization phases of the dipole channels and in the resulting WS delays at various shape resonances, induced by the collective motion of 4d electrons, and at various Cooper minima. We find that our calculation closely agrees with the streaking measurement for the delay of 4d relative to 5s, and predicts accelerated emission of 5p with respect to 4d as was experimentally observed at similar photon energies for Xe atoms adsorbed on the tungsten surface. This work was supported by the U.S. National Science Foundation.

  12. TEXTILE INDUSTRY APPLICATION OF THE 5S METHOD

    Directory of Open Access Journals (Sweden)

    Raluca BRAD

    2015-05-01

    Full Text Available The paper presents the 5S method, developed to ensure ergonomics in the workplace, productivity growth, reducing defects and increasing cleaning. 5S is a fundamental tool to promote continuous improvement process in organizations and represents a transformation in 5 steps of a job, which is characterized by maximum efficiency at the micro level and minimum loss. The tools which can be used for implementing could be the Kaizen circles for training, analysis and implementation, as well as visual elements, posters or graphics. The 5 phases are Seiri, Seiton, Seiso, Seiketsu and Shitsuke, which can be translate as Sort, Set in order, Scrub, Standardize, and Sustain, focusing on orderliness and being applied especially in Japanese factories. The stages includes inputs objectives related to the efficiency and effectiveness of the process, but also subjective, which refers to moral values, education, training, culture. For each S stage, the most important elements which are underlying the implementation and maintain the compliance are described. Any company that applied the 5S program will have quick and visible results, reducing different types of waste. The final section presents a case study and some rules in order to sustain the designed standards and implement a continuous quality improvement. The concluding remarks could be considered as work instructions in order to implement the 5S rules.

  13. Purification and biochemical characterization of a detergent-stable keratinase from a newly thermophilic actinomycete Actinomadura keratinilytica strain Cpt29 isolated from poultry compost.

    Science.gov (United States)

    Habbeche, Amina; Saoudi, Boudjema; Jaouadi, Bassem; Haberra, Soumaya; Kerouaz, Bilal; Boudelaa, Mokhtar; Badis, Abdelmalek; Ladjama, Ali

    2014-04-01

    An extracellular thermostable keratinase (KERAK-29) was purified and biochemically characterized from a thermophilic actinomycete Actinomadura keratinilytica strain Cpt29 newly isolated from Algerian poultry compost. The isolate exhibited high keratinase production when grown in chicken feather meal media (24,000 U/ml). Based on matrix assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF/MS) analysis, the purified enzyme is a monomer with a molecular mass of 29,233.10-Da. The data revealed that the 25 N-terminal residue sequence displayed by KERAK-29 was TQADPPSWGLNNIDRQTAFTKATSI, which showed high homology with those of Streptomyces proteases. This keratinase was completely inhibited by phenylmethanesulfonyl fluoride (PMSF) and diiodopropyl fluorophosphates (DFP), which suggests that it belongs to the serine protease family. Using keratin azure as a substrate, the optimum pH and temperature values for keratinase activity were pH 10 and 70°C, respectively. KERAK-29 was stable between 20 and 60°C and pH 3 and 10 for 5 and 120 h, respectively, and its thermoactivity and thermostability were enhanced in the presence of 5 mM Mn(2+). Its catalytic efficiency was higher than that of the KERAB keratinase from Streptomyces sp. strain AB1. KERAK-29 was also noted to show high keratinolytic activity and significant stability in the presence of detergents, which made it able to accomplish the entire feather-biodegradation process on its own. The ability of the A. keratinilytica strain Cpt29 to grow and produce substantial levels of keratinase using feather as a substrate could open new promising opportunities for the valorization of keratin-containing wastes and reduction of its impacts on the environment. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  14. Specific structural probing of plasmid-coded ribosomal RNAs from Escherichia coli

    DEFF Research Database (Denmark)

    Aagaard, C; Rosendahl, G; Dam, M

    1991-01-01

    The preferred method for construction and in vivo expression of mutagenised Escherichia coli ribosomal RNAs (rRNAs) is via high copy number plasmids. Transcription of wild-type rRNA from the seven chromosomal rrn operons in strains harbouring plasmid-coded mutant rRNAs leads to a heterogeneous...

  15. A practical and improved synthesis of (3S,5S)-3-[(tert-butyloxycarbonyl)methyl]- 5-[(methanesulfonyloxy)methyl]-2- pyrrolidinone.

    Science.gov (United States)

    Yee, Nathan K; Dong, Yong; Kapadia, Suresh R; Song, Jinhua J

    2002-11-29

    A practical and improved synthesis of (3S,5S)-3-[(tert-butyloxycarbonyl)methyl]-5-[(methanesulfonyloxy)methyl]-2-pyrrolidinone (1) is described. The key transformations involve a highly efficient reaction sequence consisting of ethoxycarbonylation, alkylation, hydrolysis, and decarboxylation to produce compound 10. The process described herein is practical, robust, and cost-effective, and it has been successfully implemented in a pilot plant to produce a multikilogram quantity of mesylate 1.

  16. Crystal structure and optical absorption spectra of Ga0.5Fe0.5InS3 and Ga0.5Fe0.25In1.25S3 crystals

    International Nuclear Information System (INIS)

    Gusejnov, G.G.; Musaeva, N.N.; Kyazumov, M.G.; Asadova, I.B.; Aliev, O.M.

    2003-01-01

    Single crystals of Ga 0.5 Fe 0.5 InS 3 are grown by the method of chemical gas-transport reactions and those of Ga 0.5 Fe 0.25 In 1.25 S 3 - by Bridgman method. X-ray diffraction studies reveal that they crystallize in trigonal and rhombohedral systems with lattice parameters of a = 3.796 x 2 A, c = 12.210 A, P3m1; a = 3.786 x 2 A, c = 36.606 A, R3m, respectively. An optical absorption edge in a wide range of photon energy and an energy gap width are determined: E g = 1.885 eV for Ga 0.5 Fe 0.5 InS 3 and E g 1.843 eV for Ga 0.5 Fe 0.25 In 1.25 S 3 [ru

  17. Accumulation of radiocesium in wild mushrooms collected from a Japanese forest and cesium uptake by microorganisms isolated from the mushroom-growing soils

    International Nuclear Information System (INIS)

    Kuwahara, Chikako; Fukumoto, Atsushi; Ohsone, Ayako; Furuya, Nobutaka; Shibata, Hisashi; Sugiyama, Hideo; Kato, Fumio

    2005-01-01

    Mushrooms and soils samples collected from a sub-alpine forest of Mt. Fuji in Japan were measured for 137 Cs and stable Cs. The ranges of 137 Cs specific activities and stable Cs concentrations in the mushrooms were 291-7950 Bq kg -1 dry weight and 4.69-58.1 mg kg -1 dry weight, respectively. Both 137 Cs specific activities and stable Cs concentrations in the mushrooms were higher than those in common agricultural plants. The 137 Cs specific activities and stable Cs concentrations in the soils were 3.18-149 Bq kg -1 dry weight and 0.618-2.18 mg kg -1 dry weight, respectively. The appearance frequencies of filamentous actinomycetes and planktonic bacteria from the soils decreased according to increasing Cs contents in the medium. No relationship was observed between the appearance frequencies of those and the stable Cs concentrations in the soils. The filamentous actinomycetes from any soil sample could not grow in the presence of 25 mM Cs, although the planktonic bacteria from the soil samples could grow with up to 50 mM Cs in YM agar. In addition, the planktonic bacteria from approximately 70% of the soil samples could grow even in the presence of 100 mM Cs. Filamentous actinomycetes were more sensitive to Cs than planktonic bacteria. In in vitro experiments, Cs uptake by these strains of filamentous actinomycetes and planktonic bacteria was high in the presence of 5 mM CsCl and the strains accumulated Cs, the same as in mushrooms. Our results indicate that filamentous actinomycetes in the soils have higher sensitivity to Cs than planktonic bacteria, and several strains of filamentous actinomycetes have a high Cs accumulation in the presence of 5 mM Cs

  18. Large Scale Construction Project Innovative Management Through 5-S

    Directory of Open Access Journals (Sweden)

    Hashim Hj. Abdul Ghani Mohd.

    2014-11-01

    Full Text Available It has been well-recognised that Japanese construction firms are good in safety, hygiene, quality, productivity and image. Over the last century, the Japanese have formalised the technique and name it as '5S' Practice. Through his research in Japan in 1988, the author has re-define the name as '5-S' and developed the world's first 5-S Audit Checklist. Since 1993, he used an innovative 5-S Checklist developed at SIRIM for training and consultancy in no less than 20 countries with over 100,000 persons from around 8,000 organisations world-wide. The objective of this paper is to explain the intricacy of the 5-S so that it can be understood easily and adopted readily by those who may find the tool useful. Some experience will also be shared in this article. It is hoped that this article can arouse the interest of the construction industry in Malaysia to take up this important and effective tool for quality improvement.

  19. Spectral analysis of 5s25p2(6p+6d+7s) configurations of Ba VI

    International Nuclear Information System (INIS)

    Sharma, M.K.; Tauheed, A.; Rahimullah, K.

    2014-01-01

    The sixth spectrum of barium (Ba VI) has been investigated with the aid of experimental recordings made on a 3-m normal incidence vacuum spectrograph of Antigonish laboratory (Canada) in the wavelength region 300–2080 Å using triggered spark as an excitation source. The spectral analysis has been extended considerably to include new configuration the 5s 2 5p 2 6p in odd parity matrix and the 5s 2 5p 2 6d and 5s 2 5p 2 7s configurations in even parity matrix. Previously reported levels of the ground configuration (5s 2 5p 3 ) and three lowest excited configurations the 5s5p 4 , 5s 2 5p 2 5d and 5s 2 5p 2 6s have been confirmed and the two unknown levels of the 5s 2 5p 2 5d configuration with J=9/2, have now been established through the identification of transitions from the 5s 2 5p 2 6p levels. All twenty one levels of the 5s 2 5p 2 6p configuration and twenty nine levels out of thirty six of the 5s 2 5p 2 6d and 5s 2 5p 2 7s configurations have now been established. Hartree–Fock calculations involving configuration interactions support the analyses. The accuracy of our wavelength measurement is ±0.005 Å for sharp lines. - Highlights: • The spectrum of Ba was recorded on a 3-m spectrograph with triggered spark source. • Atomic transitions for Ba VI were identified to established new energy levels. • CI calculations with relativistic corrections were made for theoretical predictions. • Weighted oscillator strength (gf) and transition probabilities (gA) were calculated

  20. 5S-toimintamallin kehittäminen nostintuotannossa

    OpenAIRE

    Laine, Atte

    2017-01-01

    TIIVISTELMÄ Opinnäytetyön aiheena oli kehittää 5S-toimintamallia Konecranes Finland Oy:n nostintuotannossa Hämeenlinnan nostintehtaalla. Konecranesilla käytetään Lean Six Sigma -menetelmiä prosessien ja liiketoiminnan kehittämiseen ja 5S-toimintamalli on yksi näistä Lean Six Sigmaan kuuluvista menetelmistä. Se on jo osittain käytössä Hämeenlinnan nostintehtaalla ja nyt tehtaan nostinkokoonpanoon oli saatava sama toimintamalli kuin muillakin tehtaan osastoilla. Opinnäytetyössä perehdyttiin...

  1. Eukaryotic 5S rRNA biogenesis

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  2. Review on Implementation of 5S in Various Organization

    OpenAIRE

    Vipulkumar C. Patel; Dr. Hemant Thakkar

    2014-01-01

    This paper explains the methods and techniques of 5 S uses to increase the efficiency of all processes in the company. Special emphasis will be given to the implementation of 5S system and elimination of losses in the company. It can be observed that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs‟ reduction, increasing of effectiveness and efficiency in the processes, maintenance and improvement of the machines‟ effic...

  3. AdS5 black holes with fermionic hair

    International Nuclear Information System (INIS)

    Burrington, Benjamin A.; Liu, James T.; Sabra, W. A.

    2005-01-01

    The study of new Bogomol'nyi-Prasad-Sommerfield (BPS) objects in AdS 5 has led to a deeper understanding of AdS/CFT. To help complete this picture, and to fully explore the consequences of the supersymmetry algebra, it is also important to obtain new solutions with bulk fermions turned on. In this paper we construct superpartners of the 1/2 BPS black hole in AdS 5 using a natural set of fermion zero modes. We demonstrate that these superpartners, carrying fermionic hair, have conserved charges differing from the original bosonic counterpart. To do so, we find the R-charge and dipole moment of the new system, as well as the mass and angular momentum, defined through the boundary stress tensor. The complete set of superpartners fits nicely into a chiral representation of AdS 5 supersymmetry, and the spinning solutions have the expected gyromagnetic ratio, g=1

  4. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    Science.gov (United States)

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  5. The 5HT(1A) receptor ligand, S15535, antagonises G-protein activation: a [35S]GTPgammaS and [3H]S15535 autoradiography study.

    Science.gov (United States)

    Newman-Tancredi, A; Rivet, J; Chaput, C; Touzard, M; Verrièle, L; Millan, M J

    1999-11-19

    4-(Benzodioxan-5-yl)1-(indan-2-yl)piperazine (S15535) is a highly selective ligand at 5-HT(1A) receptors. The present study compared its autoradiographic labelling of rat brain sections with its functional actions, visualised by guanylyl-5'-[gamma-thio]-triphosphate ([35S]GTPgammaS) autoradiography, which affords a measure of G-protein activation. [3H]S15535 binding was highest in hippocampus, frontal cortex, entorhinal cortex, lateral septum, interpeduncular nucleus and dorsal raphe, consistent with specific labelling of 5-HT(1A) receptors. In functional studies, S15535 (10 microM) did not markedly stimulate G-protein activation in any brain region, but abolished the activation induced by the selective 5-HT(1A) agonist, (+)-8-hydroxy-dipropyl-aminotetralin ((+)-8-OH-DPAT, 1 microM), in structures enriched in [3H]S15535 labelling. S15535 did not block 5-HT-stimulated activation in caudate nucleus or substantia nigra, regions where (+)-8-OH-DPAT was ineffective and [3H]S15535 binding was absent. Interestingly, S15535 attenuated (+)-8-OH-DPAT and 5-HT-stimulated G-protein activation in dorsal raphe, a region in which S15535 is known to exhibit agonist properties in vivo [Lejeune, F., Millan, M.J., 1998. Induction of burst firing in ventral tegmental area dopaminergic neurons by activation of serotonin (5-HT)(1A) receptors: WAY100,635-reversible actions of the highly selective ligands, flesinoxan and S15535. Synapse 30, 172-180.]. The present data show that (i) [3H]S15535 labels pre- and post-synaptic populations of 5-HT(1A) sites in rat brain sections, (ii) S15535 exhibits antagonist properties at post-synaptic 5-HT(1A) receptors in corticolimbic regions, and (iii) S15535 also attenuates agonist-stimulated G-protein activation at raphe-localised 5-HT(1A) receptors.

  6. Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP).

    Science.gov (United States)

    Kamina, Anyango D; Williams, Noreen

    2017-01-01

    RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.

  7. Exploring the ϒ (4 S ,5 S ,6 S )→hb(1 P )η hidden-bottom hadronic transitions

    Science.gov (United States)

    Zhang, Yawei; Li, Gang

    2018-01-01

    Recently, the Belle Collaboration has reported the measurement of the spin-flipping transition ϒ (4 S )→hb(1 P )η with an unexpectedly large branching ratio: B (ϒ (4 S )→hb(1 P )η )=(2.18 ±0.11 ±0.18 )×10-3 . Such a large branching fraction contradicts with the anticipated suppression for the spin flip. In this work, we examine the effects induced by intermediate bottomed meson loops and point out that these effects are significantly important. Using the effective Lagrangian approach (ELA), we find the experimental data on ϒ (4 S )→hb(1 P )η can be accommodated with the reasonable inputs. We then explore the decays ϒ (5 S ,6 S )→hb(1 P )η and find that these two channels also have sizable branching fractions. We also calculate these processes in the framework of nonrelativistic effective field theory (NREFT). For the decays ϒ (4 S )→hb(1 P )η , the NREFT results are at the same order of magnitude but smaller than the ELA results by a factor of 2 to 5. For the decays ϒ (5 S ,6 S )→hb(1 P )η , the NREFT results are smaller than the ELA results by approximately 1 order of magnitude. We suggest a future experiment Belle-II to search for the ϒ (5 S ,6 S )→hb(1 P )η decays, which will be helpful for understanding the transition mechanism.

  8. Short range structural models of the glass transition temperatures and densities of 0.5Na2S + 0.5[xGeS2 + (1 - x)PS5/2] mixed glass former glasses.

    Science.gov (United States)

    Bischoff, Christian; Schuller, Katherine; Martin, Steve W

    2014-04-03

    The 0.5Na2S + 0.5[xGeS2 + (1 - x)PS5/2] mixed glass former (MGF) glass system exhibits a nonlinear and nonadditive negative change in the Na(+) ion conductivity as one glass former, PS5/2, is exchanged for the other, GeS2. This behavior, known as the mixed glass former effect (MGFE), is also manifest in a negative deviation from the linear interpolation of the glass transition temperatures (T(g)) of the binary end-member glasses, x = 0 and x = 1. Interestingly, the composition dependence of the densities of these ternary MGF glasses reveals a slightly positive MGFE deviation from a linear interpolation of the densities of the binary end-member glasses, x = 0 and x = 1. From our previous studies of the structures of these glasses using IR, Raman, and NMR spectroscopies, we find that a disproportionation reaction occurs between PS7/2(4-) and GeS3(2-) units into PS4(3-) and GeS5/2(1-) units. This disproportionation combined with the formation of Ge4S10(4-) anions from GeS5/2(1-) groups leads to the negative MGFE in T(g). A best-fit model of the T(g)s of these glasses was developed to quantify the amount of GeS5/2(1-) units that form Ge4S10(4-) molecular anions in the ternary glasses (∼ 5-10%). This refined structural model was used to develop a short-range structural model of the molar volumes, which shows that the slight densification of the ternary glasses is due to the improved packing efficiency of the germanium sulfide species.

  9. Draft genome sequence of Halorubrum tropicale strain V5, a novel halophilic archaeon isolated from the solar salterns of Cabo Rojo, Puerto Rico.

    Science.gov (United States)

    Sánchez-Nieves, Rubén; Facciotti, Marc T; Saavedra-Collado, Sofía; Dávila-Santiago, Lizbeth; Rodríguez-Carrero, Roy; Montalvo-Rodríguez, Rafael

    2016-03-01

    The genus Halorubrum is a member of the family Halobacteriaceae which currently has the highest number of described species (31) of all the haloarchaea. Here we report the draft genome sequence of strain V5, a new species within this genus that was isolated from the solar salterns of Cabo Rojo, Puerto Rico. Assembly was performed and rendered the genome into 17 contigs (N50 = 515,834 bp), the largest of which contains 1,031,026 bp. The genome consists of 3.57 MB in length with G + C content of 67.6%. In general, the genome includes 4 rRNAs, 52 tRNAs, and 3246 protein-coding sequences. The NCBI accession number for this genome is LIST00000000 and the strain deposit number is CECT9000.

  10. INAA study of U sorption from technological solution by different microorganisms

    International Nuclear Information System (INIS)

    Mukhamedshina, N. M.; Mirsagatova, A. A.; Bekmukhamrdova, N. K.; Khamidova, M. Kh.; Rakhimova, M. S.

    2004-01-01

    Extraction of U from technological solution excludes a loss of valuable metal and pollution of the environment by heavy and radioactive element. For the purpose, nontraditional method of extraction using capacity of the microorganism sells to accumulate metal ions (cation) has been applied. Aim of this work is to study of U sorption from technological solutions by different microorganisms and to search more effective bio sorbents among microorganisms- actinomycetes, fungal culture (Acremonium, Aspergillus) by using INAA. INAA is more available and cheap method for us also it has high enough sensitivity and allows to avoid exposing the bacteria to radioactive metals. Atomic absorptive analyzer is more suitable for the determination of impurities in solutions, but it is expensive and not available for us. Actinomycetes were reproduced on starch-ammoniac agar medium: NaNO 3 - 1 g, actinomycetes MgSO 4 - 1 g, K 2 HPO 4 -1 g, starch -10 g, agar -20 g, distilled water - 1000 ml, pH = 6.8 - 7.0 on horizontal shaker (180 rpm) at temperature 28-30 degree for 1-3 days. Fungi were reproduced in liquid medium: NaNO 3 - 2 g, K 2 HPO 4 -1 g, KCl - 0.5 g, MgSO 4 - 0.5 g, FeSO 4 - 0.01 g, saccharose -20.0 g, tap water -1000 ml, pH = 7.0-7.2 on horizontal shaker (180 rpm) at temperature 28-30 degree for 1-3 days. After reproduction strains actinomycetes and fungi were separated by centrifuging (6000 rpm) and washed many times by distilled water. Strains of actinomycetes and fungi (1 g of each) were placed in 1 litre of the U technological solution (70.0 mg/l) and mixed on horizontal shaker (180 rpm). Interaction between strains and solution lasted 5, 10, 15, 30 and 60 min. After interaction the content of U not sorbed by strains (residual content) was measured from the over-sedimentary solution (decantate). 1 ml solution (decantate) was dropped on strip of ash free filter paper. The strips (samples) were dried, wrapped in the aluminum packets and placed in a container for

  11. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    Science.gov (United States)

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  12. Entropy of near-extremal black holes in AdS_5

    NARCIS (Netherlands)

    Balasubramanian, V.; de Boer, J.; Jejjala, V.; Simón, J.

    2008-01-01

    We construct the microstates of near-extremal black holes in AdS_5 x S^5 as gases of defects distributed in heavy BPS operators in the dual SU(N) Yang-Mills theory. These defects describe open strings on spherical D3-branes in the S^5, and we show that they dominate the entropy by directly

  13. Untwisting the pure spinor formalism to the RNS and twistor string in a flat and AdS{sub 5S{sup 5} background

    Energy Technology Data Exchange (ETDEWEB)

    Berkovits, Nathan [ICTP South American Institute for Fundamental Research,Instituto de Física Teórica, UNESP - Universidade Estadual Paulista,Rua Dr. Bento T. Ferraz 271, 01140-070, São Paulo, SP (Brazil)

    2016-06-21

    The pure spinor formalism for the superstring can be formulated as a twisted N=2 worldsheet theory with fermionic generators j{sub BRST} and composite b ghost. After untwisting the formalism to an N=1 worldsheet theory with fermionic stress tensor j{sub BRST}+b, the worldsheet variables combine into N=1 worldsheet superfields X{sup m} and Θ{sup α} together with a superfield constraint relating DX{sup m} and DΘ{sup α}. The constraint implies that the worldsheet superpartner of θ{sup α} is a bosonic twistor variable, and different solutions of the constraint give rise to the pure spinor or extended RNS formalisms, as well as a new twistor-string formalism with manifest N=1 worldsheet supersymmetry. These N=1 worldsheet methods generalize in curved Ramond-Ramond backgrounds, and a manifestly N=1 worldsheet supersymmetric action is proposed for the superstring in an AdS{sub 5S{sup 5} background in terms of the twistor superfields. This AdS{sub 5S{sup 5} worldsheet action is a remarkably simple fermionic coset model with manifest PSU(2,2|4) symmetry and might be useful for computing AdS{sub 5S{sup 5} superstring scattering amplitudes.

  14. Semiclassical equivalence of Green–Schwarz and pure–spinor/hybrid formulations of superstrings in AdS5 × S5 and AdS2 × S2 × T6

    International Nuclear Information System (INIS)

    Cagnazzo, Alessandra; Sorokin, Dmitri; Tseytlin, Arkady A; Wulff, Linus

    2013-01-01

    We demonstrate the equivalence between the worldsheet one-loop partition functions computed near classical string solutions in the Green–Schwarz and in the pure–spinor formulations of superstrings in AdS 5 × S 5 . While their bosonic sectors are the same in the conformal gauge, their fermionic sectors superficially appear to be very different (first versus second-derivative kinetic terms, presence versus absence of fermionic gauge symmetry). Still, we show that the quadratic fluctuation spectrum of 16 fermionic modes of the pure–spinor formulation is the same as in the Green–Schwarz superstring and the contribution of the extra ‘massless’ fermionic modes cancels against that of the pure–spinor ghosts. We also provide evidence for a similar semiclassical equivalence between the Green–Schwarz and the hybrid formulations of superstrings in AdS 2 × S 2 × T 6 by studying several particular examples of string solutions. (paper)

  15. Metallic 1T-LixMoS2 Cocatalyst Significantly Enhanced the Photocatalytic H2 Evolution over Cd0.5Zn0.5S Nanocrystals under Visible Light Irradiation.

    Science.gov (United States)

    Du, Hong; Guo, Hong-Li; Liu, Ya-Nan; Xie, Xiao; Liang, Kuang; Zhou, Xiao; Wang, Xin; Xu, An-Wu

    2016-02-17

    In the present work, metallic 1T-LixMoS2 is utilized as a novel cocatalyst for Cd0.5Zn0.5S photocatalyst. The obtained LixMoS2/Cd0.5Zn0.5S hybrids show excellent photocatalytic performance for H2 generation from aqueous solution containing Na2S and Na2SO3 under splitting visible light illumination (λ ≥ 420 nm) without precious metal cocatalysts. It turns out that a certain amount of intercalating Li(+) ions ultimately drives the transition of MoS2 crystal from semiconductor triagonal phase (2H phase) to metallic phase (1T phase). The distinct properties of 1T-LixMoS2 promote the efficient separation of photoexcited electrons and holes when used as cocatalyst for Cd0.5Zn0.5S photocatalyst. As compared to 2H-MoS2 nanosheets only having edge active sites, photoinduced electrons not only transfer to the edge sites of 1T-LixMoS2, but also to the plane active sites of 1T-LixMoS2 nanosheets. The content of LixMoS2 in hybrid photocatalysts influences the photocatalytic activity. The optimal 1T-LixMoS2 (1.0 wt %)/Cd0.5Zn0.5S nanojunctions display the best activity for hydrogen production, achieving a hydrogen evolution rate of 769.9 μmol h(-1), with no use of noble metal loading, which is about 3.5 times higher than that of sole Cd0.5Zn0.5S, and 2 times higher than that of 2H-MoS2 (1.0 wt %)/Cd0.5Zn0.5S samples. Our results demonstrate that Li(+)-intercalated MoS2 nanosheets with high conductivity, high densities of active sites, low cost, and environmental friendliness are a prominent H2 evolution cocatalyst that might substitute for noble metal for potential hydrogen energy applications.

  16. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    Science.gov (United States)

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  17. Karyotype characterization of Crotalaria juncea (L. by chromosome banding and physical mapping of 18S-5.8S-26S and 5S rRNA gene sites

    Directory of Open Access Journals (Sweden)

    Mateus Mondin

    2007-01-01

    Full Text Available The chromosomes of Crotalaria juncea, a legume of agronomic interest with a 2n = 16 karyotype composed of metacentric chromosomes, were analyzed using several cytogenetic techniques. C-banding revealed heterochromatic regions around the centromeres in all chromosomes and adjacent to the secondary constriction on the chromosome 1 short arm. Fluorescent staining with the GC-specific chromomycin A3 (CMA highlighted these heterochromatic regions and a tiny site on the chromosome 1 long arm while the AT-specific stain 4'-6-diamidino-2-phenylindole (DAPI induced a reversed pattern. Staining with CMA combined with AT-specific distamycin A (DA counterstaining quenched the pericentromeric regions of all chromosomes, but enhanced fluorescence was observed at the heterochromatic regions around the secondary constriction and on the long arms of chromosomes 1 and 4. Fluorescence in situ hybridization (FISH revealed 18S-5.8S-26S rRNA gene sites (45S rDNA on chromosomes 1 and 4, and one 5S rDNA locus on chromosome 1. All the rDNA sites were co-located with the positive-CMA/DA bands, suggesting they were very rich in GC. Silver staining revealed signals at the main 45S rDNA locus on chromosome 1 and, in some cells, chromosome 4 was labeled. Two small nucleoli were detected in a few interphase cells, suggesting that the minor site on chromosome 4 could be active at some stages of the cell cycle.

  18. RNA Export through the NPC in Eukaryotes.

    Science.gov (United States)

    Okamura, Masumi; Inose, Haruko; Masuda, Seiji

    2015-03-20

    In eukaryotic cells, RNAs are transcribed in the nucleus and exported to the cytoplasm through the nuclear pore complex. The RNA molecules that are exported from the nucleus into the cytoplasm include messenger RNAs (mRNAs), ribosomal RNAs (rRNAs), transfer RNAs (tRNAs), small nuclear RNAs (snRNAs), micro RNAs (miRNAs), and viral mRNAs. Each RNA is transported by a specific nuclear export receptor. It is believed that most of the mRNAs are exported by Nxf1 (Mex67 in yeast), whereas rRNAs, snRNAs, and a certain subset of mRNAs are exported in a Crm1/Xpo1-dependent manner. tRNAs and miRNAs are exported by Xpot and Xpo5. However, multiple export receptors are involved in the export of some RNAs, such as 60S ribosomal subunit. In addition to these export receptors, some adapter proteins are required to export RNAs. The RNA export system of eukaryotic cells is also used by several types of RNA virus that depend on the machineries of the host cell in the nucleus for replication of their genome, therefore this review describes the RNA export system of two representative viruses. We also discuss the NPC anchoring-dependent mRNA export factors that directly recruit specific genes to the NPC.

  19. Organism-specific rRNA capture system for application in next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Sai-Kam Li

    Full Text Available RNA-sequencing is a powerful tool in studying RNomics. However, the highly abundance of ribosomal RNAs (rRNA and transfer RNA (tRNA have predominated in the sequencing reads, thereby hindering the study of lowly expressed genes. Therefore, rRNA depletion prior to sequencing is often performed in order to preserve the subtle alteration in gene expression especially those at relatively low expression levels. One of the commercially available methods is to use DNA or RNA probes to hybridize to the target RNAs. However, there is always a concern with the non-specific binding and unintended removal of messenger RNA (mRNA when the same set of probes is applied to different organisms. The degree of such unintended mRNA removal varies among organisms due to organism-specific genomic variation. We developed a computer-based method to design probes to deplete rRNA in an organism-specific manner. Based on the computation results, biotinylated-RNA-probes were produced by in vitro transcription and were used to perform rRNA depletion with subtractive hybridization. We demonstrated that the designed probes of 16S rRNAs and 23S rRNAs can efficiently remove rRNAs from Mycobacterium smegmatis. In comparison with a commercial subtractive hybridization-based rRNA removal kit, using organism-specific probes is better in preserving the RNA integrity and abundance. We believe the computer-based design approach can be used as a generic method in preparing RNA of any organisms for next-generation sequencing, particularly for the transcriptome analysis of microbes.

  20. Streptococcal 5'-Nucleotidase A (S5nA), a Novel Streptococcus pyogenes Virulence Factor That Facilitates Immune Evasion.

    Science.gov (United States)

    Zheng, Lisa; Khemlani, Adrina; Lorenz, Natalie; Loh, Jacelyn M S; Langley, Ries J; Proft, Thomas

    2015-12-25

    Streptococcus pyogenes is an important human pathogen that causes a wide range of diseases. Using bioinformatics analysis of the complete S. pyogenes strain SF370 genome, we have identified a novel S. pyogenes virulence factor, which we termed streptococcal 5'-nucleotidase A (S5nA). A recombinant form of S5nA hydrolyzed AMP and ADP, but not ATP, to generate the immunomodulatory molecule adenosine. Michaelis-Menten kinetics revealed a Km of 169 μm and a Vmax of 7550 nmol/mg/min for the substrate AMP. Furthermore, recombinant S5nA acted synergistically with S. pyogenes nuclease A to generate macrophage-toxic deoxyadenosine from DNA. The enzyme showed optimal activity between pH 5 and pH 6.5 and between 37 and 47 °C. Like other 5'-nucleotidases, S5nA requires divalent cations and was active in the presence of Mg(2+), Ca(2+), or Mn(2+). However, Zn(2+) inhibited the enzymatic activity. Structural modeling combined with mutational analysis revealed a highly conserved catalytic dyad as well as conserved substrate and cation-binding sites. Recombinant S5nA significantly increased the survival of the non-pathogenic bacterium Lactococcus lactis during a human whole blood killing assay in a dose-dependent manner, suggesting a role as an S. pyogenes virulence factor. In conclusion, we have identified a novel S. pyogenes enzyme with 5'-nucleotidase activity and immune evasion properties. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. PROBLEMS OF IMPLEMENTATION 5S PRACTICES IN AN INDUSTRIAL COMPANY

    Directory of Open Access Journals (Sweden)

    Beata GALA

    2013-10-01

    Full Text Available 5S is a one of the tools of Lean Management enabling to organize workplace in an effective way. It could be implemented in all the spheres of the company. The article provides the theoretic description of Lean Management and 5S and also shows a case study based on gained experience. The author also describe the problems occured during the implementation of the 5S.

  2. Mo0.5W0.5S2 for Q-switched pulse generation in ytterbium-doped fiber laser

    Science.gov (United States)

    Wang, Junli; Chen, Lei; Dou, Chenxi; Yan, Haiting; Meng, Lingjie; Wei, Zhiyi

    2018-06-01

    In this work, we fabricate the Mo0.5W0.5S2 by microwave-assisted solvothermal method, and report the Q-switched Yb-doped fiber lasers (YDFL) using Mo0.5W0.5S2 polymer film and tapered fiber as the saturable absorbers (SAs). The modulation depth and saturable intensity of the film SA are 5.63% and 6.82 MW cm‑2. The shortest pulse duration and the maximum single pulse energy are 1.22 μs and 148.8 nJ for the film SA, 1.46 μs and 339 nJ for the fiber-taper SA. To the best of our knowledge, this is the first report on the Q-switched YDFL using Mo0.5W0.5S2 SAs.

  3. A proposal of the gauge theory description of the small Schwarzschild black hole in AdS5×S5

    International Nuclear Information System (INIS)

    Hanada, Masanori; Maltz, Jonathan

    2017-01-01

    Based on 4d N=4 SYM on ℝ 1 ×S 3 , a gauge theory description of a small black hole in AdS 5 ×S 5 is proposed. The change of the number of dynamical degrees of freedom associated with the emission of the scalar fields’ eigenvalues plays a crucial role in this description. By analyzing the microcanonical ensemble, the Hagedorn behavior of long strings at low energy is obtained. Modulo an assumption based on the AdS/CFT duality for a large black hole, the energy of the small ten-dimensional Schwarzschild black hole E∼1/(G 10,N T 7 ) is derived. A heuristic gauge theory argument supporting this assumption is also given. The same argument applied to the ABJM theory correctly reproduces the relation for the eleven-dimensional Schwarzschild black hole. One of the consequences of our proposal is that the small and large black holes are very similar when seen from the gauge theory point of view.

  4. Genome Sequence of Vibrio campbellii Strain UMTGB204, a Marine Bacterium Isolated from a Green Barrel Tunicate

    Science.gov (United States)

    Gan, Huan You; Noor, Mohd Ezhar Mohd; Saari, Nur Azna; Musa, Najiah; Mustapha, Baharim; Usup, Gires

    2015-01-01

    Vibrio campbellii strain UMTGB204 was isolated from a green barrel tunicate. The genome of this strain comprises 5,652,224 bp with 5,014 open reading frames, 9 rRNAs, and 116 tRNAs. It contains genes related to virulence and environmental tolerance. Gene clusters for the biosynthesis of nonribosomal peptides and bacteriocin were also identified. PMID:25814609

  5. Crystal structure and optical absorption spectra of Ga{sub 0.5}Fe{sub 0.5}InS{sub 3} and Ga{sub 0.5}Fe{sub 0.25}In{sub 1.25}S{sub 3} crystals; Struktura i opticheskoe pogloshchenie kristallov Ga{sub 0.5}Fe{sub 0.5}InS{sub 3} i Ga{sub 0.5}Fe{sub 0.25}In{sub 1.25}S{sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Gusejnov, G G; Musaeva, N N; Kyazumov, M G [NAN Azerbajdzhana, Inst. Fiziki, Baku (Azerbaijan); Asadova, I B; Aliev, O M [NAN Azerbajdzhana, Inst. Neorganicheskoj i Fizicheskoj Khimii, Baku (Azerbaijan)

    2003-09-01

    Single crystals of Ga{sub 0.5}Fe{sub 0.5}InS{sub 3} are grown by the method of chemical gas-transport reactions and those of Ga{sub 0.5}Fe{sub 0.25}In{sub 1.25}S{sub 3} - by Bridgman method. X-ray diffraction studies reveal that they crystallize in trigonal and rhombohedral systems with lattice parameters of a = 3.796 x 2 A, c = 12.210 A, P3m1; a = 3.786 x 2 A, c = 36.606 A, R3m, respectively. An optical absorption edge in a wide range of photon energy and an energy gap width are determined: E{sub g} = 1.885 eV for Ga{sub 0.5}Fe{sub 0.5}InS{sub 3} and E{sub g} 1.843 eV for Ga{sub 0.5}Fe{sub 0.25}In{sub 1.25}S{sub 3}.

  6. Cleavage of rRNA ensures translational cessation in sperm at fertilization

    Science.gov (United States)

    Johnson, G.D.; Sendler, E.; Lalancette, C.; Hauser, R.; Diamond, M.P.; Krawetz, S.A.

    2011-01-01

    Intact ribosomal RNAs (rRNAs) comprise the majority of somatic transcripts, yet appear conspicuously absent in spermatozoa, perhaps reflecting cytoplasmic expulsion during spermatogenesis. To discern their fate, total RNA retained in mature spermatozoa from three fertile donors was characterized by Next Generation Sequencing. In all samples, >75% of total sequence reads aligned to rRNAs. The distribution of reads along the length of these transcripts exhibited a high degree of non-uniformity that was reiterated between donors. The coverage of sequencing reads was inversely correlated with guanine-cytosine (GC)-richness such that sequences greater than ∼70% GC were virtually absent in all sperm RNA samples. To confirm the loss of sequence, the relative abundance of specific regions of the 28S transcripts in sperm was established by 7-Deaza-2′-deoxy-guanosine-5′-triphosphate RT–PCR. The inability to amplify specific regions of the 28S sequence from sperm despite the abundant representation of this transcript in the sequencing libraries demonstrates that approximately three-quarters of RNA retained in the mature male gamete are products of rRNA fragmentation. Hence, cleavage (not expulsion of the RNA component of the translational machinery) is responsible for preventing spurious translation following spermiogenesis. These results highlight the potential importance of those transcripts, including many mRNAs, which evade fragmentation and remain intact when sperm are delivered at fertilization. Sequencing data are deposited in GEO as: GSE29160. PMID:21831882

  7. Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.

    Science.gov (United States)

    Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera

    2017-01-23

    Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental

  8. New antiferromagnetic semiconductor CuCr1.5Sb0.5S4

    International Nuclear Information System (INIS)

    Kesler, Ya.A.; Koroleva, L.I.; Mikheev, M.G.; Odintsov, A.G.; Filimonov, D.S.

    1993-01-01

    New halcogenide compound with spinel-antiferromagnetic semiconductor CuCr 1.5 Sb 0.5 S 4 are obtained and studied for the first time. Magnetic properties of this compound, namely, magnetization linear dependence, maximum on PHI(T) curve in the low-temperature area and realization of the Curie-Weis law for paramagnetic susceptibility with negative paramagnetic temperature testiby to the fact that this compound is antiferromagnetic

  9. Measurement of B(Υ(5S)→Bs(*)Bs(*)) using φ mesons

    International Nuclear Information System (INIS)

    Huang, G. S.; Miller, D. H.; Pavlunin, V.; Sanghi, B.; Shipsey, I. P. J.; Xin, B.; Adams, G. S.; Anderson, M.; Cummings, J. P.; Danko, I.; Napolitano, J.; He, Q.; Insler, J.; Muramatsu, H.; Park, C. S.; Thorndike, E. H.; Yang, F.; Coan, T. E.; Gao, Y. S.; Liu, F.

    2007-01-01

    Knowledge of the B s decay fraction of the Υ(5S) resonance, f S , is important for B s meson studies at the Υ(5S) energy. Using a data sample collected by the CLEO III detector at CESR consisting of 0.423 fb -1 on the Υ(5S) resonance, 6.34 fb -1 on the Υ(4S) and 2.32 fb -1 in the continuum below the Υ(4S), we measure B(Υ(5S)→φX)=(13.8±0.7 -1.5 +2.3 )% and B(Υ(4S)→φX)=(7.1±0.1±0.6)%; the ratio of the two rates is (1.9±0.1 -0.2 +0.3 ). This is the first measurement of the φ meson yield from the Υ(5S). Using these rates, and a model dependent estimate of B(B s →φX), we determine f S =(24.6±2.9 -5.3 +11.0 )%. We also update our previous independent measurement of f S made using the inclusive D s yields to now be (16.8±2.6 -3.4 +6.7 )%, due to a better estimate of the number of hadronic events. We also report the total Υ(5S) hadronic cross section above continuum to be σ(e + e - →Υ(5S))=(0.301±0.002±0.039) nb. This allows us to extract the fraction of B mesons as (58.9±10.0±9.2)%, equal to 1-f S . Averaging the three methods gives a model dependent result of f S =(21 -3 +6 )%

  10. Photoassociation spectroscopy of 87Rb2 (5s1/2+5p1/2)0u+ long-range molecular states: Coupling with the (5s1/2+5p3/2)0u+ series analyzed using the Lu-Fano approach

    International Nuclear Information System (INIS)

    Jelassi, H.; Viaris de Lesegno, B.; Pruvost, L.

    2006-01-01

    We report on photoassociation of cold 87 Rb atoms providing the spectroscopy of (5s 1/2 +5p 1/2 )0 u + long-range molecular states, in the energy range of [-12.5, -0.7 cm -1 ] below the dissociation limit. A Lu-Fano approach coupled to the LeRoy-Bernstein formula is used to analyze the data. The Lu-Fano graph exhibits the coupling of the molecular series with the (5s 1/2 +5p 3/2 )0 u + one, which is due to spin effects in the molecule. A two-channel model involving an improved LeRoy-Bernstein formula allows us to characterize the molecular series, to localize (5s 1/2 +5p 3/2 )0 u + levels, to evaluate the coupling, and to predict the energy and width of the first predissociated level of (5s 1/2 +5p 3/2 )0 u + series. An experimental spectrum confirms the prediction

  11. The 5S methodology as a tool for improving the organisation

    OpenAIRE

    J. Michalska; D. Szewieczek

    2007-01-01

    Purpose: The aim of this paper is showing the 5S methodology. In this paper it was introduced the way of implementing the 5S methodology in the company.Design/methodology/approach: In the frames of own research it has been analysed and implemented the 5S rules in the production process.Findings: On the basis of the own research it can be stated, that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs’ reduction, increasing of effectivene...

  12. Synthesis and crystal structures of two α-bromoamides, (2'R,1S,2S)-N(2-bromopropanoyl)-2-amino-1-phenylpropane-1,3-diol and (2'S,5S,6S)-N(2-bromopropanoyl)-5-amino-6-phenyl-2-oxo-1,3,2-dioxathiane

    International Nuclear Information System (INIS)

    English, R.B.; Liddell, R.J.; Whiteley, C.G.

    1987-01-01

    One pair of diastereomeric bromoamides, (2'R,1S,2S)- and (2'S,1S,2S)-N(2-bromopropanoyl)-2-amino-1-phenylpropane-1,3-diol have been synthesized from ethyl 2-bromopropionate and an optically active amino-diol. The crystal structures of both were determined from single-crystal X-ray analyses. Both compounds are orthorhombic with space group P2 1 2 1 2 1 with Z = 4 in a unit cell of dimensions a 22,124(5),b 12,812(5), and c 4,886(5)A and a 15,510(5), b 9,707(5), and c 9,457(5)A. The proton chemical shifts of the groups attached to the asymmetric centre C(2'), and consequently, the identification of the configuration of the molecules, were resolved with the help of high-resolution nuclear magnetic resonance

  13. Implementacija metode 5S v proces proizvodnje

    Directory of Open Access Journals (Sweden)

    Alojz Gorše

    2016-03-01

    Full Text Available Abstract: Research Question (RQ: The following research tries to show how the introduction of 5S methodology of work affects the production process itself, where the greatest changes are shown and how they are reflected in performance indicators. Purpose: The purpose of this project is to examine the existing methods and their application in practice as well as show the logic of actions we introduce in a particular process by using the 5S method. We will try to compare all the information using a practical example of company X. The results obtained are the basis for further improvements in an analyzed company. Method: We expect positive results in terms of certain improvements in the working environment within the company, as well as the opportunity for improvement in terms of increased efficiency and, consequently, more profit. Results: The results can represent the basis for achieving eve n better work in other processes in the studied company. It is very important to identify all the key activities that are important in generating profits while all the rest are eliminated from the process. Organization: The 5S model is applicable to all levels of the organization so it can be experienced by the highest levels of management in running a business. Society: The impact of the model will surely be seen by employees as they are offered a model after which they will work well, quickly, safely and without loss of time, which in today's world means competitive advantage. Originality: The research work represents an important contribution to the implementation of the 5S model in the company and to the positive things it brings. Limitations/Future Research: The survey as a case study was done in only one organization, in which they were implemented all phases of the method. In the direction of further research it is reasonable to make a quantitative analysis of the increase in profit, increase employee satisfaction analysis, to determine the reduction

  14. Effect Of Laser Irradiation On Biosynthesis Of Antibiotics

    International Nuclear Information System (INIS)

    SALAMA, S.M.; MAHMOUD, S.M.; EL-KABBANY, H.M.

    2010-01-01

    An investigation concerning the effect of He:Ne laser irradiation on some isolated actinomycetes was carried out. Seven isolated actinomycetes were considered as most potent producing broad spectrum antibiotics. The strains have been identified on the basis of taxonomic studies as Streptomyces nogalator (H12), Streptomyces griseoluteus (YM23), Amycolatopsis mediterranei (B40), Glycomyces harbinensis (KA16), Streptosporangium corrugatum (B67), Streptoalloteichus hindustamus (B74) and Streptomyces aurantiogriseus (S15). Seven genotypes were chosen after He:Ne laser irradiation as representative for each isolated strain. The active metabolite from most potent genotype of Streptomyces nogalator (H12) was extracted by ethyl acetate then concentrated under vacuo and the crude fraction was purified using thin layer and column chromatography. Ultra violet maximum absorption peak was recorded at 231.5 and 206 nm. The IR and NMR were consulted to confirm the chemical characteristics of the antibiotic. The biological activity and toxicity were also investigated.

  15. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  16. Precision calculation of 1/4-BPS Wilson loops in AdS{sub 5S{sup 5}

    Energy Technology Data Exchange (ETDEWEB)

    Forini, V. [Institut für Physik, Humboldt-Universität zu Berlin, IRIS Adlershof, Zum Großen Windkanal 6, 12489 Berlin (Germany); Puletti, V. Giangreco M. [Science Institute, University of Iceland,Dunhaga 3, 107 Reykjavik (Iceland); Griguolo, L. [Dipartimento di Fisica e Scienze della Terra, Università di Parma andINFN Gruppo Collegato di Parma,Viale G.P. Usberti 7/A, 43100 Parma (Italy); Seminara, D. [Dipartimento di Fisica, Università di Firenze and INFN Sezione di Firenze,Via G. Sansone 1, 50019 Sesto Fiorentino (Italy); Vescovi, E. [Institut für Physik, Humboldt-Universität zu Berlin, IRIS Adlershof, Zum Großen Windkanal 6, 12489 Berlin (Germany)

    2016-02-16

    We study the strong coupling behaviour of 1/4-BPS circular Wilson loops (a family of “latitudes') in N=4 Super Yang-Mills theory, computing the one-loop corrections to the relevant classical string solutions in AdS{sub 5S{sup 5}. Supersymmetric localization provides an exact result that, in the large ’t Hooft coupling limit, should be reproduced by the sigma-model approach. To avoid ambiguities due to the absolute normalization of the string partition function, we compare the ratio between the generic latitude and the maximal 1/2-BPS circle: any measure-related ambiguity should simply cancel in this way. We use the Gel’fand-Yaglom method with Dirichlet boundary conditions to calculate the relevant functional determinants, that present some complications with respect to the standard circular case. After a careful numerical evaluation of our final expression we still find disagreement with the localization answer: the difference is encoded into a precise “remainder function'. We comment on the possible origin and resolution of this discordance.

  17. Time of action of 4.5 S RNA in Escherichia coli translation

    DEFF Research Database (Denmark)

    Brown, S

    1989-01-01

    A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...

  18. Decay rate ratios of Υ(5S)→B anti B reactions

    International Nuclear Information System (INIS)

    Hwang, Dae Sung; Son, Hyungsuk

    2010-01-01

    We calculate the decay rate ratios for OZI allowed decays of Υ(5S) to two B mesons by using the decay amplitudes which incorporate the wave function of the Υ(5S) state. We obtain the result that the branching ratio of the Υ(5S) decay to B s * anti B s * is much larger than the branching ratio to B s anti B s * or anti B s B s * , in good agreement with the recent experimental results of CLEO and BELLE. This agreement with the experimental results is made possible since the nodes of the Υ(5S) radial wave function induce the nodes of the decay amplitude. We find that the results for the Υ(5S) decays to B u (*) anti B u (*) or B d (*) anti B d (*) pairs are sensitive to the parameter values used for the potential between heavy quarks. (orig.)

  19. Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

    Science.gov (United States)

    Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

    2018-04-24

    Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

  20. AdS5 solutions from M5-branes on Riemann surface and D6-branes sources

    Energy Technology Data Exchange (ETDEWEB)

    Bah, Ibrahima [Department of Physics and Astronomy, University of Southern California,Los Angeles, CA 90089 (United States); Institut de Physique Théorique, CEA/Saclay,91191 Gif-sur-Yvette (France)

    2015-09-24

    We describe the gravity duals of four-dimensional N=1 superconformal field theories obtained by wrapping M5-branes on a punctured Riemann surface. The internal geometry, normal to the AdS{sub 5} factor, generically preserves two U(1)s, with generators (J{sup +},J{sup −}), that are fibered over the Riemann surface. The metric is governed by a single potential that satisfies a version of the Monge-Ampère equation. The spectrum of N=1 punctures is given by the set of supersymmetric sources of the potential that are localized on the Riemann surface and lead to regular metrics near a puncture. We use this system to study a class of punctures where the geometry near the sources corresponds to M-theory description of D6-branes. These carry a natural (p,q) label associated to the circle dual to the killing vector pJ{sup +}+qJ{sup −} which shrinks near the source. In the generic case the world volume of the D6-branes is AdS{sub 5S{sup 2} and they locally preserve N=2 supersymmetry. When p=−q, the shrinking circle is dual to a flavor U(1). The metric in this case is non-degenerate only when there are co-dimension one sources obtained by smearing M5-branes that wrap the AdS{sub 5} factor and the circle dual the superconformal R-symmetry. The D6-branes are extended along the AdS{sub 5} and on cups that end on the co-dimension one branes. In the special case when the shrinking circle is dual to the R-symmetry, the D6-branes are extended along the AdS{sub 5} and wrap an auxiliary Riemann surface with an arbitrary genus. When the Riemann surface is compact with constant curvature, the system is governed by a Monge-Ampère equation.

  1. Housekeeping Genes as Internal Standards: Use and Limits

    OpenAIRE

    Thellin, Olivier; Zorzi, Willy; Lakaye, Bernard; De Borman, B.; Coumans, Bernard; Hennen, Georges; Grisar, Thierry; Igout, Ahmed; Heinen, Ernst

    1999-01-01

    Quantitative studies are commonly realised in the biomedical research to compare RNA expression in different experimental or clinical conditions. These quantifications are performed through their comparison to the expression of the housekeeping gene transcripts like glyceraldehyde-3-phosphate dehydrogenase (G3PDH), albumin, actins, tubulins, cyclophilin, hypoxantine phsophoribosyltransferase (HRPT), L32. 28S, and 18S rRNAs are also used as internal standards. In this paper, it is recalled tha...

  2. 5S-MENETELMÄN KÄYTTÖÖNOTTO SERVICEPOINTILLA

    OpenAIRE

    Ovaskainen, Tatu-Pekka

    2014-01-01

    Opinnäytetyö on tehty Servicepoint Kuopio Oy:n toimeksiannosta. Servicepoint Kuopio on teollisuuden kunnossapitoon automaatio- ja sähköistysprojekteihin sekä robottisovelluksiin erikoistunut yritys. Yrityksen kahden toimipisteen yhdistyminen lisäsi toimipisteellä henkilöstön ja työkalujen määrää. Yrityksessä toteutetaan sovelletusti Lean-ajattelumallia. Yksi Leanin työkaluista on 5S, joka haluttiin ottaa käyttöön yrityksessä. Opinnäytetyön tavoitteena oli ottaa käyttöön 5S-menetelmä Servi...

  3. Genes for 7S RNAs can replace the gene for 4.5S RNA in growth of Escherichia coli

    DEFF Research Database (Denmark)

    Brown, S

    1991-01-01

    4.5S RNAs of eubacteria and 7S RNAs of archaebacteria and eukaryotes exist in a hairpin conformation. The apex of this hairpin displays structural and sequence similarities among both 4.5S and 7S RNAs. Furthermore, a hyphenated sequence of 16 nucleotides is conserved in all eubacterial 4.5S RNAs...... examined. In this article I report that 7S RNAs that contain this 16-nucleotide sequence are able to replace 4.5S RNAs and permit growth of Escherichia coli....

  4. Fine organization of genomic regions tagged to the 5S rDNA locus of the bread wheat 5B chromosome.

    Science.gov (United States)

    Sergeeva, Ekaterina M; Shcherban, Andrey B; Adonina, Irina G; Nesterov, Michail A; Beletsky, Alexey V; Rakitin, Andrey L; Mardanov, Andrey V; Ravin, Nikolai V; Salina, Elena A

    2017-11-14

    The multigene family encoding the 5S rRNA, one of the most important structurally-functional part of the large ribosomal subunit, is an obligate component of all eukaryotic genomes. 5S rDNA has long been a favored target for cytological and phylogenetic studies due to the inherent peculiarities of its structural organization, such as the tandem arrays of repetitive units and their high interspecific divergence. The complex polyploid nature of the genome of bread wheat, Triticum aestivum, and the technically difficult task of sequencing clusters of tandem repeats mean that the detailed organization of extended genomic regions containing 5S rRNA genes remains unclear. This is despite the recent progress made in wheat genomic sequencing. Using pyrosequencing of BAC clones, in this work we studied the organization of two distinct 5S rDNA-tagged regions of the 5BS chromosome of bread wheat. Three BAC-clones containing 5S rDNA were identified in the 5BS chromosome-specific BAC-library of Triticum aestivum. Using the results of pyrosequencing and assembling, we obtained six 5S rDNA- containing contigs with a total length of 140,417 bp, and two sets (pools) of individual 5S rDNA sequences belonging to separate, but closely located genomic regions on the 5BS chromosome. Both regions are characterized by the presence of approximately 70-80 copies of 5S rDNA, however, they are completely different in their structural organization. The first region contained highly diverged short-type 5S rDNA units that were disrupted by multiple insertions of transposable elements. The second region contained the more conserved long-type 5S rDNA, organized as a single tandem array. FISH using probes specific to both 5S rDNA unit types showed differences in the distribution and intensity of signals on the chromosomes of polyploid wheat species and their diploid progenitors. A detailed structural organization of two closely located 5S rDNA-tagged genomic regions on the 5BS chromosome of bread

  5. Laser and radiofrequency spectroscopy of the 4d55s5Dsub(0,1,2,3,4) and 4d45s5p5Psub(1,2,3) states in Mo I: Hyperfine structure and isotope shifts

    International Nuclear Information System (INIS)

    Olsson, T.; Fraenkel, L.; Lindgren, I.; Nyberg, A.; Robertsson, L.; Rosen, A.

    1986-01-01

    A series of experiments has been performed to determine the hyperfine structure in the metastable 4d 5 5s 5 Dsub(1,2,3,4) states of Mo I by means of the laser radiofrequency double-resonance technique. Furthermore, hyperfine structure splittings and isotope shifts in seven optical transitions connecting the 4d 5 5s 5 Dsub(0,1,2,3,4) and the 4d 4 5s5p 5 Psub(1,2,3) states were resolved with the high-resolution laser spectroscopy technique. Radial hyperfine structure parameters are deduced for the effective operator within the 5 D states using the configurations 4d 4 5s 2 , 4d 5 5s and 4d 6 as a model space. The isotope shifts are also discussed, utilizing an effective operator, with particular emphasis on the J dependence. (orig.)

  6. A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex

    Science.gov (United States)

    Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981

  7. Dark-red-emitting CdTe0.5Se0.5/Cd0.5Zn0.5S quantum dots: Effect of chemicals on properties

    International Nuclear Information System (INIS)

    Yang, Ping; Zhang, Aiyu; Li, Xiaoyu; Liu, Ning; Zhang, Yulan; Zhang, Ruili

    2013-01-01

    CdTe 0.5 Se 0.5 /Cd 0.5 Zn 0.5 S core/shell quantum dots (QDs) with a tunable photoluminescence (PL) range from yellow to dark red (up to a PL peak wavelength of 683 nm) were fabricated using various reaction systems. The core/shell QDs created in the reaction solution of trioctylamine (TOA) and oleic acid (OA) at 300 °C exhibited narrow PL spectra and a related low PL efficiency (38%). In contrast, the core/shell QDs prepared in the solution of 1-octadecene (ODE) and hexadecylamine (HDA) at 200 °C revealed a high PL efficiency (70%) and broad PL spectra. This phenomenon is ascribed that the precursor of Cd, reaction temperature, solvents, and ligands affected the formation process of the shell. The slow growth rate of the shell in the solution of ODE and HDA made QDs with a high PL efficiency. Metal acetate salts without reaction with HDA led to the core/shell QDs with a broad size distribution. - Graphical abstract: CdTe 0.5 Se 0.5 /Cd 0.5 Zn 0.5 S quantum dots (QDs) with tunable photoluminescence, high PL efficiency, and high stability through organic synthesis, in which chemicals affected the properties of the QDs. Display Omitted - Highlights: • CdTe 0.5 Se 0.5 /Cd 0.5 Zn 0.5 S quantum dots created via organic synthesis. • Chemicals affected the properties of the quantum dots. • The quantum dots revealed high photoluminescence efficiency and stability. • The quantum dots with tunable photoluminescence in a range from yellow to dark red. • The QDs are utilizable for various applications such as biological labeling

  8. Wilson lines for AdS5 black strings

    International Nuclear Information System (INIS)

    Hristov, Kiril; Katmadas, Stefanos

    2015-01-01

    We describe a simple method of extending AdS 5 black string solutions of 5d gauged supergravity in a supersymmetric way by addition of Wilson lines along a circular direction in space. When this direction is chosen along the string, and due to the specific form of 5d supergravity that features Chern-Simons terms, the existence of magnetic charges automatically generates conserved electric charges in a 5d analogue of the Witten effect. Therefore we find a rather generic, model-independent way of adding electric charges to already existing solutions with no backreaction from the geometry or breaking of any symmetry. We use this method to explicitly write down more general versions of the Benini-Bobev black strings (http://dx.doi.org/10.1103/PhysRevLett.110.061601, http://dx.doi.org/10.1007/JHEP06(2013)005) and comment on the implications for the dual field theory and the similarities with generalizations of the Cacciatori-Klemm black holes (http://dx.doi.org/10.1007/JHEP01(2010)085) in AdS 4 .

  9. Perturbative computation of string one-loop corrections to Wilson loop minimal surfaces in AdS{sub 5S{sup 5}

    Energy Technology Data Exchange (ETDEWEB)

    Forini, V. [Institut für Physik, Humboldt-Universität zu Berlin, IRIS Adlershof,Zum Großen Windkanal 6, 12489 Berlin (Germany); Tseytlin, A.A. [Theoretical Physics Group, Blackett Laboratory, Imperial College,London, SW7 2AZ (United Kingdom); Vescovi, E. [Institut für Physik, Humboldt-Universität zu Berlin, IRIS Adlershof,Zum Großen Windkanal 6, 12489 Berlin (Germany); Institute of Physics, University of São Paulo,Rua do Matão 1371, 05508-090 São Paulo (Brazil)

    2017-03-01

    We revisit the computation of the 1-loop string correction to the “latitude' minimal surface in AdS{sub 5S{sup 5} representing 1/4 BPS Wilson loop in planar N=4 SYM theory previously addressed in https://arxiv.org/abs/1512.00841 and https://arxiv.org/abs/1601.04708. We resolve the problem of matching with the subleading term in the strong coupling expansion of the exact gauge theory result (derived previously from localization) using a different method to compute determinants of 2d string fluctuation operators. We apply perturbation theory in a small parameter (angle of the latitude) corresponding to an expansion near the AdS{sub 2} minimal surface representing 1/2 BPS circular Wilson loop. This allows us to compute the corrections to the heat kernels and zeta-functions of the operators in terms of the known heat kernels on AdS{sub 2}. We apply the same method also to two other examples of Wilson loop surfaces: generalized cusp and k-wound circle.

  10. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    Science.gov (United States)

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.

  11. Isolation and morphological characterization of antibiotic producing ...

    African Journals Online (AJOL)

    Purpose: To isolate and characterize antibiotic producing actinomycetes from soil samples in Belgaum, Karnataka, India. Methods: Crowded plate technique was used for the isolation of actinomycetes in media such as soybean – casein digest medium and actinomycetes isolation agar. The morphological and cultural ...

  12. The 4p-5d, 6d and 4p-6s, 7s transitions of Mo IX

    International Nuclear Information System (INIS)

    Khatoon, S.; Chaghtai, M.S.Z.; Rahimullah, K.

    1979-01-01

    The transitions 4p-5d, 6d and 4p-6s, 7s have been studied for the first time in Mo IX. The authors have identified 42 4p-5d, 36 4p-6d, 22 4p-6s and 22 4p-7s transitions, establishing 16 4p 3 5d, 14 4p 3 6d and all the ten 4p 3 6s, 7s levels of the spectrum concerned. The ionization energy is estimated to be (1 323 700 +- 700)cm -1 or (164.11 +- 0.09)eV. The spectrum was recorded in sliding and open spark discharges with a 5 m grazing incidence spectrograph of Lund University (Sweden) from about 40 A to 440 A. (Auth.)

  13. O5S, Calibration of Organic Scintillation Detector by Monte-Carlo

    International Nuclear Information System (INIS)

    1985-01-01

    1 - Nature of physical problem solved: O5S is designed to directly simulate the experimental techniques used to obtain the pulse height distribution for a parallel beam of mono-energetic neutrons incident on organic scintillator systems. Developed to accurately calibrate the nominally 2 in. by 2 in. liquid organic scintillator NE-213 (composition CH-1.2), the programme should be readily adaptable to many similar problems. 2 - Method of solution: O5S is a Monte Carlo programme patterned after the general-purpose Monte Carlo neutron transport programme system, O5R. The O5S Monte Carlo experiment follows the course of each neutron through the scintillator and obtains the energy-deposits of the ions produced by elastic scatterings and reactions. The light pulse produced by the neutron is obtained by summing up the contributions of the various ions with the use of appropriate light vs. ion-energy tables. Because of the specialized geometry and simpler cross section needs O5S is able to by-pass many features included in O5R. For instance, neutrons may be followed individually, their histories analyzed as they occur, and upon completion of the experiment, the results analyzed to obtain the pulse-height distribution during one pass on the computer. O5S does allow the absorption of neutrons, but does not allow splitting or Russian roulette (biased weighting schemes). SMOOTHIE is designed to smooth O5S histogram data using Gaussian functions with parameters specified by the user

  14. Heavy ion collisions in AdS5

    International Nuclear Information System (INIS)

    Kovchegov, Yuri V.

    2011-01-01

    We study heavy ion collisions at strong 't Hooft coupling using AdS/CFT correspondence. Heavy ion collisions correspond to gravitational shock wave collisions in AdS 5 . We construct the metric in the forward light cone after the collision perturbatively through expansion of Einstein equations in graviton exchanges. We obtain an analytic expression for the metric including all-order graviton exchanges with one shock wave, while keeping the exchanges with another shock wave at the lowest order. We read off the corresponding energy-momentum tensor of the produced medium. Unfortunately this energy-momentum tensor does not correspond to ideal hydrodynamics, indicating that higher order graviton exchanges are needed to construct the full solution of the problem. We also show that shock waves must completely stop almost immediately after the collision in AdS 5 , which, on the field theory side, corresponds to complete nuclear stopping due to strong coupling effects, likely leading to Landau hydrodynamics. Finally, we perform trapped surface analysis of the shock wave collisions demonstrating that a bulk black hole, corresponding to ideal hydrodynamics on the boundary, has to be created in such collisions, thus constructing a proof of thermalization in heavy ion collisions at strong coupling.

  15. Superconductivity in REO0.5F0.5BiS2 with high-entropy-alloy-type blocking layers

    Science.gov (United States)

    Sogabe, Ryota; Goto, Yosuke; Mizuguchi, Yoshikazu

    2018-05-01

    We synthesized new REO0.5F0.5BiS2 (RE: rare earth) superconductors with high-entropy-alloy-type (HEA-type) REO blocking layers. The lattice constant a systematically changed in the HEA-type samples with the RE concentration and the RE ionic radius. A sharp superconducting transition was observed in the resistivity measurements for all the HEA-type samples, and the transition temperature of the HEA-type samples was higher than that of typical REO0.5F0.5BiS2. The sharp superconducting transition and the enhanced superconducting properties of the HEA-type samples may indicate the effectiveness of the HEA states of the REO blocking layers in the REO0.5F0.5BiS2 system.

  16. 2.5 Gb/s laser-driver GaAS IC

    DEFF Research Database (Denmark)

    Riishøj, Jesper

    1993-01-01

    A laser-diode driver GaAs IC incorporating an optional NRZ/RZ (non-return-to-zero/return-to-zero) conversion facility, having ECL (emitter-coupled logic) and SCFL (source-coupled FET logic)-compatible inputs and providing a 0-60-mA adjustable output current into a 50-Ω/5-V termination at bit rates...... obtained. To verify laser driving performance a back-to-back optical-fiber transmission experiment was performed, giving good optical eye diagrams at 2.5 Gb/s. The electrooptical interplay between laser-diode driver and laser-diode has been demonstrated using SPICE simulations...... up to 2 Gb/s NRZ and maintaining a clear eye opening of 50 mA at 2.5 Gb/s NRZ bit rate has been designed, using a commercial 1-μm gate-length (Fτ=12 GHz) GaAs MESFET foundry service. The high maximum output current is obtained by implementing the output driver as a cascode differential amplifier...

  17. Potencialidade de um actinomiceto de rizosfera de tomateiro como agente de biocontrole de doenças Potenciality of an actinomycete from tomato rhizosphere as a biocontrol agent for tomato diseases

    Directory of Open Access Journals (Sweden)

    Renato Carrer Filho

    2009-09-01

    Full Text Available Um actinomiceto (Streptomyces setonii, isolado 'UFV-RD1', obtido de rizosfera de planta sadia de tomateiro, foi selecionado dentre outros 117, como promissor agente de biocontrole de enfermidades da cultura. Em testes de antagonismo in vitro contra patógenos do tomateiro, o isolado 'UFV-RD1' foi incapaz de inibir o crescimento de bactérias (Pseudomonas syringae pv. tomato, Ralstonia solanacearum, Pectobacterium carotovorum subsp. carotovorum, Xanthomonas campestris pv. vesicatoria mas inibiu a germinação de conídios de alguns fungos (Alternaria solani, Phytophthora infestans, Corynespora cassiicola, Stemphylium solani. Em ensaios de biocontrole experimental in vivo, em casa de vegetação, o actinomiceto foi efetivo em reduzir a severidade de sintomas no caso de patógenos fúngicos e bacterianos testados como desafiantes. A campo, quando A. solani e P. infestans ocorreram naturalmente, as plantas originárias de sementes microbiolizadas com propágulos da estirpe 'UFV-RD1' exibiram sintomas menos severos que as plantas controle para o caso da pinta preta. O agente de biocontrole é promissor para futuros protocolos de manejo integrado, como forma de reduzir a quantidade de defensivos utilizados.An actinomycete (Streptomyces setonii, isolate 'UFV-RD1', isolated from the rhizosphere of a healthy tomato plant was selected out of 117 as a promising biocontrol agent for tomato diseases. In in vitro antagonism tests against tomato pathogens, the isolate 'UFV-RD1' was unable to inhibit growth of bacterial pathogens (Pseudomonas syringae pv. tomato, Ralstonia solanacearum, Pectobacterium carotovorum subsp. carotovorum, Xanthomonas campestris pv. vesicatoria but inhibited conidium germination of fungi (Alternaria solani, Phytophthora infestans, Corynespora cassiicola, Stemphylium solani. Experimental biocontrol assays in a greenhouse indicated that the actinomycete was effective for reducing symptom severity in the case of bacteria and fungi tested

  18. 25 Tb/s transmission over 5,530 km using 16QAM at 5.2 b/s/Hz spectral efficiency.

    Science.gov (United States)

    Cai, J-X; Batshon, H G; Zhang, H; Davidson, C R; Sun, Y; Mazurczyk, M; Foursa, D G; Sinkin, O; Pilipetskii, A; Mohs, G; Bergano, Neal S

    2013-01-28

    We transmit 250x100G PDM RZ-16QAM channels with 5.2 b/s/Hz spectral efficiency over 5,530 km using single-stage C-band EDFAs equalized to 40 nm. We use single parity check coded modulation and all channels are decoded with no errors after iterative decoding between a MAP decoder and an LDPC based FEC algorithm. We also observe that the optimum power spectral density is nearly independent of SE, signal baud rate or modulation format in a dispersion uncompensated system.

  19. Nucleolar integrity is required for the maintenance of long-term synaptic plasticity.

    Directory of Open Access Journals (Sweden)

    Kim D Allen

    Full Text Available Long-term memory (LTM formation requires new protein synthesis and new gene expression. Based on our work in Aplysia, we hypothesized that the rRNA genes, stimulation-dependent targets of the enzyme Poly(ADP-ribose polymerase-1 (PARP-1, are primary effectors of the activity-dependent changes in synaptic function that maintain synaptic plasticity and memory. Using electrophysiology, immunohistochemistry, pharmacology and molecular biology techniques, we show here, for the first time, that the maintenance of forskolin-induced late-phase long-term potentiation (L-LTP in mouse hippocampal slices requires nucleolar integrity and the expression of new rRNAs. The activity-dependent upregulation of rRNA, as well as L-LTP expression, are poly(ADP-ribosylation (PAR dependent and accompanied by an increase in nuclear PARP-1 and Poly(ADP ribose molecules (pADPr after forskolin stimulation. The upregulation of PARP-1 and pADPr is regulated by Protein kinase A (PKA and extracellular signal-regulated kinase (ERK--two kinases strongly associated with long-term plasticity and learning and memory. Selective inhibition of RNA Polymerase I (Pol I, responsible for the synthesis of precursor rRNA, results in the segmentation of nucleoli, the exclusion of PARP-1 from functional nucleolar compartments and disrupted L-LTP maintenance. Taken as a whole, these results suggest that new rRNAs (28S, 18S, and 5.8S ribosomal components--hence, new ribosomes and nucleoli integrity--are required for the maintenance of long-term synaptic plasticity. This provides a mechanistic link between stimulation-dependent gene expression and the new protein synthesis known to be required for memory consolidation.

  20. 4p-5s transitions in In XIII, In XIV and In XV

    International Nuclear Information System (INIS)

    Carroll, P.K.; Costello, J.T.; O'Sullivan, G.

    1986-01-01

    The spectrum of an indium plasma produced by a 1.5 J, 25 ns ruby laser was recorded in the XUV. At wavelengths below 100 A, the spectrum is dominated by 4p-5s transitions in a number of ion stages. Many lines arising from 4p 6 4d-4p 5 4d5s, 4p 6 -4p 5 5s and 4p 5 -4p 4 5s transitions in In XIII, In XIV and In XV have been identified by isoelectronic extrapolation and Dirac-Fock calculations. (orig.)

  1. Radiative transitions from Υ(5S) to molecular bottomonium

    International Nuclear Information System (INIS)

    Voloshin, M. B.

    2011-01-01

    The heavy quark spin symmetry implies that in addition to the recently observed Z(10610) and Z(10650) molecular resonances with I G =1 + , there should exist two or four molecular bottomonium-like states with I G =1 - . Properties of these G-odd states are considered, including their production in the radiative transitions from Υ(5S), by applying the same symmetry to the Υ(5S) resonance and the transition amplitudes. The considered radiative processes can provide a realistic option for observing the yet hypothetical states.

  2. Brewer’s spent grain and corn steep liquor as alternative culture medium substrates for proteinase production by Streptomyces malaysiensis AMT-3

    Science.gov (United States)

    do Nascimento, Rodrigo Pires; Junior, Nelson Alves; Coelho, Rosalie Reed Rodrigues

    2011-01-01

    Brewer’s spent grain and corn steep liquor or yeast extract were used as the sole organic forms for proteinase production by Streptomyces malaysiensis in submerged fermentation. The influence of the C and N concentrations, as well as the incubation periods, were assessed. Eight proteolytic bands were detected through gelatin-gel-electrophoresis in the various extracts obtained from the different media and after different incubation periods, with apparent molecular masses of 20, 35, 43, 50, 70, 100, 116 and 212 kDa. The results obtained suggest an opportunity for exploring this alternative strategy for proteinases production by actinomycetes, using BSG and CSL as economically feasible substrates. PMID:24031767

  3. Implementation Of 5S Quality Tool In Manufacturing Company A Case Study

    Directory of Open Access Journals (Sweden)

    Vibhor Kakkar

    2015-02-01

    Full Text Available Abstract 5S system is a technique which maintains the quality of working conditions in the organization. Amongst various available Lean resources 5S is a powerful technique that can bolster objectives of the organization to get continuous improvement in performance and productivity. This paper presents the implementation of 5S in a manufacturing company amp 5S rating system was used to audit all changes in the company which enhanced the efficiency of the workers amp ultimately the productivity of the company is enhanced to 91 .

  4. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    International Nuclear Information System (INIS)

    Hirose, Yutaka; Harada, Fumio

    2008-01-01

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus

  5. Scale invariance of the η-deformed AdS5×S5 superstring, T-duality and modified type II equations

    Directory of Open Access Journals (Sweden)

    G. Arutyunov

    2016-02-01

    Full Text Available We consider the ABF background underlying the η-deformed AdS5×S5 sigma model. This background fails to satisfy the standard IIB supergravity equations which indicates that the corresponding sigma model is not Weyl invariant, i.e. does not define a critical string theory in the usual sense. We argue that the ABF background should still define a UV finite theory on a flat 2d world-sheet implying that the η-deformed model is scale invariant. This property follows from the formal relation via T-duality between the η-deformed model and the one defined by an exact type IIB supergravity solution that has 6 isometries albeit broken by a linear dilaton. We find that the ABF background satisfies candidate type IIB scale invariance conditions which for the R–R field strengths are of the second order in derivatives. Surprisingly, we also find that the ABF background obeys an interesting modification of the standard IIB supergravity equations that are first order in derivatives of R–R fields. These modified equations explicitly depend on Killing vectors of the ABF background and, although not universal, they imply the universal scale invariance conditions. Moreover, we show that it is precisely the non-isometric dilaton of the T-dual solution that leads, after T-duality, to modification of type II equations from their standard form. We conjecture that the modified equations should follow from κ-symmetry of the η-deformed model. All our observations apply also to η-deformations of AdSS3×T4and AdSS2×T6models.

  6. Evolution of cyclizing 5-aminolevulinate synthases in the biosynthesis of actinomycete secondary metabolites: outcomes for genetic screening techniques

    Czech Academy of Sciences Publication Activity Database

    Petříčková, Kateřina; Chroňáková, Alica; Zelenka, Tomáš; Chrudimský, Tomáš; Pospíšil, Stanislav; Petříček, Miroslav; Krištůfek, Václav

    2015-01-01

    Roč. 6, AUG 2015 (2015) ISSN 1664-302X R&D Projects: GA MŠk LH12191 Institutional support: RVO:61388971 ; RVO:60077344 Keywords : 5-aminolevulinate synthase * C5N unit * Streptomyces Subject RIV: EE - Microbiology, Virology Impact factor: 4.165, year: 2015

  7. Polarization dependence of double-resonance optical pumping and electromagnetically induced transparency in the 5S1/2-5P3/2-5D5/2 transition of 87Rb atoms

    International Nuclear Information System (INIS)

    Moon, Han Seb; Noh, Heung-Ryoul

    2011-01-01

    The polarization dependence of double-resonance optical pumping (DROP) in the ladder-type electromagnetically induced transparency (EIT) of the 5S 1/2 -5P 3/2 -5D 5/2 transition of 87 Rb atoms is studied. The transmittance spectra in the 5S 1/2 (F=2)-5P 3/2 (F'=3)-5D 5/2 (F''=2,3,4) transition were observed as caused by EIT, DROP, and saturation effects in the various polarization combinations between the probe and coupling lasers. The features of the double-structure transmittance spectra in the 5S 1/2 (F=2)-5P 3/2 (F'=3)-5D 5/2 (F''=4) cycling transition were attributed to the difference in saturation effect according to the transition routes between the Zeeman sublevels and the EIT according to the two-photon transition probability.

  8. Charged bottomoniumlike states Zb(10610) and Zb(10650) and the Υ(5S)→Υ(2S)π+π- decay

    International Nuclear Information System (INIS)

    Chen Dianyong; Liu Xiang; Zhu Shilin

    2011-01-01

    Inspired by the newly observed two charged bottomoniumlike states, we consider the possible contribution from the intermediate Z b (10610) and Z b (10650) states to the Υ(5S)→Υ(2S)π + π - decay process, which naturally explains Belle's previous observation of the anomalous Υ(2S)π + π - production near the peak of Υ(5S) at √(s)=10.87 GeV [K. F. Chen et al. (Belle Collaboration), Phys. Rev. Lett. 100, 112001 (2008)]. The resulting dΓ(Υ(5S)→Υ(2S)π + π - )/dm π + π - and dΓ(Υ(5S)→Υ(2S)π + π - )/dcosθ distributions agree with Belle's measurement after inclusion of these Z b states. This formalism also reproduces the Belle observation of the double-peak structure and its reflection in the Υ(2S)π + invariant mass spectrum of the Υ(5S)→Υ(2S)π + π - decay.

  9. (3R,6S,7aS-3-Phenyl-6-(phenylsulfanylperhydropyrrolo[1,2-c]oxazol-5-one

    Directory of Open Access Journals (Sweden)

    Anthony D. Woolhouse

    2009-05-01

    Full Text Available Molecules of the title compound [systematic name: (2R,5S,7S-2-phenyl-7-phenylsulfanyl-1-aza-3-oxabicyclo[3.3.0]octan-8-one], C18H17NO2S, form high quality crystals even though they are only packed using C—H...O(carbonyl and weak C—H...S interactions. The dihedral angle between the aromatic rings is 85.53 (5°. The fused rings adopt envelope and twist conformations.

  10. LuxS-independent formation of AI-2 from ribulose-5-phosphate

    Directory of Open Access Journals (Sweden)

    Hardie Kim R

    2008-06-01

    Full Text Available Abstract Background In many bacteria, the signal molecule AI-2 is generated from its precursor S-ribosyl-L-homocysteine in a reaction catalysed by the enzyme LuxS. However, generation of AI-2-like activity has also been reported for organisms lacking the luxS gene and the existence of alternative pathways for AI-2 formation in Escherichia coli has recently been predicted by stochastic modelling. Here, we investigate the possibility that spontaneous conversion of ribulose-5-phosphate could be responsible for AI-2 generation in the absence of luxS. Results Buffered solutions of ribulose-5-phosphate, but not ribose-5-phosphate, were found to contain high levels of AI-2 activity following incubation at concentrations similar to those reported in vivo. To test whether this process contributes to AI-2 formation by bacterial cells in vivo, an improved Vibrio harveyi bioassay was used. In agreement with previous studies, culture supernatants of E. coli and Staphylococcus aureus luxS mutants were found not to contain detectable levels of AI-2 activity. However, low activities were detected in an E. coli pgi-eda-edd-luxS mutant, a strain which degrades glucose entirely via the oxidative pentose phosphate pathway, with ribulose-5-phosphate as an obligatory intermediate. Conclusion Our results suggest that LuxS-independent formation of AI-2, via spontaneous conversion of ribulose-5-phosphate, may indeed occur in vivo. It does not contribute to AI-2 formation in wildtype E. coli and S. aureus under the conditions tested, but may be responsible for the AI-2-like activities reported for other organisms lacking the luxS gene.

  11. S5 1803+78 Revisited

    Directory of Open Access Journals (Sweden)

    R. Nesci

    2012-01-01

    Full Text Available We report on our optical monitoring of the BL Lac object S5 1803+78 from 1996 to 2011. The source showed no clear periodicity, but a time scale of about 1 300 days between major flares is possibly present. No systematic trend of the color index with flux variations is evident, at variance with other BL Lacs. In one flare, however, the source was bluer in the rising phase and redder in the falling one. Two ?-ray flares were detected by Fermi-GST during our monitoring: on the occasion of only one of them we found simultaneous optical brightening. A one-zone Synchrotron Self Compton (SSC model appears too simple to explain the source behavior.

  12. Phenomenology with F-theory S U (5 )

    Science.gov (United States)

    Leontaris, George K.; Shafi, Qaisar

    2017-09-01

    We explore the low-energy phenomenology of an F-theory-based S U (5 ) model which, in addition to the known quarks and leptons, contains Standard Model (SM) singlets and vectorlike color triplets and S U (2 ) doublets. Depending on their masses and couplings, some of these new particles may be observed at the LHC and future colliders. We discuss the restrictions by Cabibbo-Kobayashi-Maskawa matrix constraints on their mixing with the ordinary down quarks of the three chiral families. The model is consistent with gauge coupling unification at the usual supersymmetric GUT scale; dimension-five proton decay is adequately suppressed, while dimension-six decay mediated by the superheavy gauge bosons is enhanced by a factor of 5-7. The third generation charged fermion Yukawa couplings yield the corresponding low-energy masses in reasonable agreement with observations. The hierarchical nature of the masses of lighter generations is accounted for via nonrenormalizable interactions, with the perturbative vacuum expectation values (VEVs) of the SM singlet fields playing an essential role.

  13. Constructing Cd0.5Zn0.5S@ZIF-8 nanocomposites through self-assembly strategy to enhance Cr(VI) photocatalytic reduction.

    Science.gov (United States)

    Qiu, Jianhao; Zhang, Xiong-Fei; Zhang, Xingguang; Feng, Yi; Li, Yuxin; Yang, Lvye; Lu, Haiqiang; Yao, Jianfeng

    2018-05-05

    A novel and highly efficient photocatalyst of Cd 0.5 Zn 0.5 S@ZIF-8 nanocomposite has been developed by a facile self-assembly strategy. This is the first report on the application of Cd x Zn 1-x S and metal-organic framework (MOF) nanocomposite as photocatalysts for the reduction of Cr(VI). The resulting Cd 0.5 Zn 0.5 S@ZIF-8 exhibited higher photocatalytic activity than that of pristine Cd 0.5 Zn 0.5 S and ZIF-8. Particularly, the CZS@Z60 composite with 60 wt% of ZIF-8 exhibited a photocatalytic activity that is about 1.6 times as high as that of Cd 0.5 Zn 0.5 S. The dominant reason for the improved photocatalytic reduction potential is proved to be the newly-formed interfacial SZn bonds that firmly connect Cd 0.5 Zn 0.5 S and ZIF-8 and substantially improve the separation efficiency of photo-excited electrons and holes. The newly-formed chemical bonds are confirmed by XPS analyses, and the prolonged lifetime of photo-excited electrons is evidenced by the electrochemical measurement of photocurrent, which shows that the photocurrent on Cd 0.5 Zn 0.5 S@ZIF-8 is much higher than that of Cd 0.5 Zn 0.5 S and ZIF-8. This study clearly demonstrates that the MOF-based composite nanomaterials hold great promises for applications in the field of environmental remediation and for design of novel photocatalytic materials. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Chloroplast RNA-Binding Protein RBD1 Promotes Chilling Tolerance through 23S rRNA Processing in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Shuai Wang

    2016-05-01

    Full Text Available Plants have varying abilities to tolerate chilling (low but not freezing temperatures, and it is largely unknown how plants such as Arabidopsis thaliana achieve chilling tolerance. Here, we describe a genome-wide screen for genes important for chilling tolerance by their putative knockout mutants in Arabidopsis thaliana. Out of 11,000 T-DNA insertion mutant lines representing half of the genome, 54 lines associated with disruption of 49 genes had a drastic chilling sensitive phenotype. Sixteen of these genes encode proteins with chloroplast localization, suggesting a critical role of chloroplast function in chilling tolerance. Study of one of these proteins RBD1 with an RNA binding domain further reveals the importance of chloroplast translation in chilling tolerance. RBD1 is expressed in the green tissues and is localized in the chloroplast nucleoid. It binds directly to 23S rRNA and the binding is stronger under chilling than at normal growth temperatures. The rbd1 mutants are defective in generating mature 23S rRNAs and deficient in chloroplast protein synthesis especially under chilling conditions. Together, our study identifies RBD1 as a regulator of 23S rRNA processing and reveals the importance of chloroplast function especially protein translation in chilling tolerance.

  15. A General and Simple Diastereoselective Reduction by L-Selectride: Efficient Synthesis of Protected (4S,5S)-Dihydroxy Amides

    OpenAIRE

    Yin; Ye; Yu; Liu

    2010-01-01

    A general approach to (4S,5S)-4-benzyloxy-5-hydroxy-N-(4-methoxybenzyl) amides 10 based on a diastereoselective reduction of (5S,6RS)-6-alkyl-5-benzyloxy-6-hydroxy-2-piperidinones 6 and their tautomeric ring-opened keto amides 7 is described. The reduction with L-Selectride at -20 °C to room temperature afforded the products 10 in excellent yields and moderate to high syn-diastereoselectivities.

  16. A general and simple diastereoselective reduction by L-Selectride: efficient synthesis of protected (4S,5S)-dihydroxy amides.

    Science.gov (United States)

    Yin, Bo; Ye, Dong-Nai; Yu, Kai-Hui; Liu, Liang-Xian

    2010-04-16

    A general approach to (4S,5S)-4-benzyloxy-5-hydroxy-N-(4-methoxybenzyl) amides 10 based on a diastereoselective reduction of (5S,6RS)-6-alkyl-5-benzyloxy-6-hydroxy-2-piperidinones 6 and their tautomeric ring-opened keto amides 7 is described. The reduction with L-Selectride at -20 degrees C to room temperature afforded the products 10 in excellent yields and moderate to high syn-diastereoselectivities.

  17. In situ hybridization of iodinated 5S and 18/25S RNA to Vicia faba metaphase chromosomes

    International Nuclear Information System (INIS)

    Schubert, I.; Baeumlein, H.; Wobus, U.

    1978-01-01

    In vitro labelled 125 I ribosomal RNA fractions (18/25S and 5S) were in situ hybridized to metaphase chromosomes of a reconstructed karyotype of Vicia faba (characterized by two translocations and one pericentric inversion, each being present homozygously). The sites of 18S and 25S RNA were found to be confined to the nucleolus organizing secondary constriction. Two loci of 5S RNA were recognized on the satellite of nucleolus bearing chromosome. Possible correlations between the location of ribosomal genes, heterochromatic G-bands and clusters of mutagen induced chromatid aberrations are discussed. (author)

  18. Influence of lanthanum on the physico-chemical properties of solid solutions GeS0.5Se0.5

    International Nuclear Information System (INIS)

    Murquzov, M.I.; Alekperov, A.S.; Bayramov, R.B.

    2010-01-01

    By the methods of physical-chemical analysis (X-ray, MSA, as well as measurement of microhardness and density determination) the influence of La on the physico-chemical properties of solid solutions (GeS 0 .5Se 0 .5) 1 -x(La) x was studied and its microdiagram was plotted. At room temperature the GeS 0 .5Se 0 .5 based solid solution extent 4 at. percent of La. The dependence of lanthane microhardness was studied

  19. The S4-S5 linker acts as a signal integrator for HERG K+ channel activation and deactivation gating.

    Directory of Open Access Journals (Sweden)

    Chai Ann Ng

    Full Text Available Human ether-à-go-go-related gene (hERG K(+ channels have unusual gating kinetics. Characterised by slow activation/deactivation but rapid inactivation/recovery from inactivation, the unique gating kinetics underlie the central role hERG channels play in cardiac repolarisation. The slow activation and deactivation kinetics are regulated in part by the S4-S5 linker, which couples movement of the voltage sensor domain to opening of the activation gate at the distal end of the inner helix of the pore domain. It has also been suggested that cytosolic domains may interact with the S4-S5 linker to regulate activation and deactivation kinetics. Here, we show that the solution structure of a peptide corresponding to the S4-S5 linker of hERG contains an amphipathic helix. The effects of mutations at the majority of residues in the S4-S5 linker of hERG were consistent with the previously identified role in coupling voltage sensor movement to the activation gate. However, mutations to Ser543, Tyr545, Gly546 and Ala548 had more complex phenotypes indicating that these residues are involved in additional interactions. We propose a model in which the S4-S5 linker, in addition to coupling VSD movement to the activation gate, also contributes to interactions that stabilise the closed state and a separate set of interactions that stabilise the open state. The S4-S5 linker therefore acts as a signal integrator and plays a crucial role in the slow deactivation kinetics of the channel.

  20. Agonist and antagonist actions of antipsychotic agents at 5-HT1A receptors: a [35S]GTPgammaS binding study.

    Science.gov (United States)

    Newman-Tancredi, A; Gavaudan, S; Conte, C; Chaput, C; Touzard, M; Verrièle, L; Audinot, V; Millan, M J

    1998-08-21

    Recombinant human (h) 5-HT1A receptor-mediated G-protein activation was characterised in membranes of transfected Chinese hamster ovary (CHO) cells by use of guanosine-5'-O-(3-[35S]thio)-triphosphate ([35S]GTPgammaS binding). The potency and efficacy of 21 5-HT receptor agonists and antagonists was determined. The agonists, 5-CT (carboxamidotryptamine) and flesinoxan displayed high affinity (subnanomolar Ki values) and high efficacy (Emax > 90%, relative to 5-HT = 100%). In contrast, ipsapirone, zalospirone and buspirone displayed partial agonist activity. EC50s for agonist stimulation of [35S]GTPgammaS binding correlated well with Ki values from competition binding (r = +0.99). Among the compounds tested for antagonist activity, methiothepin and (+)butaclamol exhibited 'inverse agonist' behaviour, inhibiting basal [35S]GTPgammaS binding. The actions of 17 antipsychotic agents were investigated. Clozapine and several putatively 'atypical' antipsychotic agents, including ziprasidone, quetiapine and tiospirone, exhibited partial agonist activity and marked affinity at h5-HT1A receptors, similar to their affinity at hD2 dopamine receptors. In contrast, risperidone and sertindole displayed low affinity at h5-HT1A receptors and behaved as 'neutral' antagonists, inhibiting 5-HT-stimulated [35S]GTPgammaS binding. Likewise the 'typical' neuroleptics, haloperidol, pimozide, raclopride and chlorpromazine exhibited relatively low affinity and 'neutral' antagonist activity at h5-HT1A receptors with Ki values which correlated with their respective Kb values. The present data show that (i) [35S]GTPgammaS binding is an effective method to evaluate the efficacy and potency of agonists and antagonists at recombinant human 5-HT1A receptors. (ii) Like clozapine, several putatively 'atypical' antipsychotic drugs display balanced serotonin h5-HT1A/dopamine hD2 receptor affinity and partial agonist activity at h5-HT1A receptors. (iii) Several 'typical' and some putatively 'atypical

  1. Peak shifts due to B(*)-B(*) rescattering in Υ(5S) dipion transitions

    International Nuclear Information System (INIS)

    Meng Ce; Chao Kuangta

    2008-01-01

    We study the energy distributions of dipion transitions Υ(5S) to Υ(1S,2S,3S)π + π - in the final-state rescattering model. Since the Υ(5S) is well above the open bottom thresholds, the dipion transitions are expected to mainly proceed through the real processes Υ(5S)→B ( * ) B ( * ) and B ( * ) B ( * ) →Υ(1S,2S,3S)π + π - . We find that the energy distributions of Υ(1S,2S,3S)π + π - markedly differ from that of Υ(5S)→B ( * ) B ( * ) . In particular, the resonance peak will be pushed up by about 7-20 MeV for these dipion transitions relative to the main hadronic decay modes. These predictions can be used to test the final-state rescattering mechanism in hadronic transitions for heavy quarkonia above the open flavor thresholds.

  2. Antifungal activity of terrestrial Streptomyces rochei strain HF391 against clinical azole -resistant Aspergillus fumigatus

    Science.gov (United States)

    Hadizadeh, S; Forootanfar, H; Shahidi Bonjar, GH; Falahati Nejad, M; Karamy Robati, A; Ayatollahi Mousavi, SA; Amirporrostami, S

    2015-01-01

    Background and Purpose: Actinomycetes have been discovered as source of antifungal compounds that are currently in clinical use. Invasive aspergillosis (IA) due to Aspergillus fumigatus has been identified as individual drug-resistant Aspergillus spp. to be an emerging pathogen opportunities a global scale. This paper described the antifungal activity of one terrestrial actinomycete against the clinically isolated azole-resistant A. fumigatus. Materials and Methods: Soil samples were collected from various locations of Kerman, Iran. Thereafter, the actinomycetes were isolated using starch-casein-nitrate-agar medium and the most efficient actinomycetes (capable of inhibiting A. fumigatus) were screened using agar block method. In the next step, the selected actinomycete was cultivated in starch-casein- broth medium and the inhibitory activity of the obtained culture broth was evaluated using agar well diffusion method. Results: The selected actinomycete, identified as Streptomyces rochei strain HF391, could suppress the growth of A. fumigatus isolates which was isolated from the clinical samples of patients treated with azoles. This strain showed higher inhibition zones on agar diffusion assay which was more than 15 mm. Conclusion: The obtained results of the present study introduced Streptomyces rochei strain HF391 as terrestrial actinomycete that can inhibit the growth of clinically isolated A. fumigatus. PMID:28680984

  3. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    Science.gov (United States)

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-12-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

  4. Geodermatophilus poikilotrophi sp. nov.: A Multitolerant Actinomycete Isolated from Dolomitic Marble

    Directory of Open Access Journals (Sweden)

    Maria del Carmen Montero-Calasanz

    2014-01-01

    Full Text Available A novel Gram-reaction-positive, aerobic actinobacterium, tolerant to mitomycin C, heavy metals, metalloids, hydrogen peroxide, desiccation, and ionizing- and UV-radiation, designated G18T, was isolated from dolomitic marble collected from outcrops in Samara (Namibia. The growth range was 15–35°C, at pH 5.5–9.5 and in presence of 1% NaCl, forming greenish-black coloured colonies on GYM Streptomyces agar. Chemotaxonomic and molecular characteristics of the isolate matched those described for other representatives of the genus Geodermatophilus. The peptidoglycan contained meso-diaminopimelic acid as diagnostic diaminoacid. The main phospholipids were phosphatidylethanolamine, phosphatidylcholine, phosphatidylinositol, and small amount of diphosphatidylglycerol. MK-9(H4 was the dominant menaquinone and galactose was detected as diagnostic sugar. The major cellular fatty acids were branched-chain saturated acids iso-C16:0 and iso-C15:0 and the unsaturated C17:1ω8c and C16:1ω7c. The 16S rRNA gene showed 97.4–99.1% sequence identity with the other representatives of genus Geodermatophilus. Based on phenotypic results and 16S rRNA gene sequence analysis, strain G18T is proposed to represent a novel species, Geodermatophilus poikilotrophi. Type strain is G18T (= DSM 44209T = CCUG 63018T. The INSDC accession number is HF970583. The novel R software package lethal was used to compute the lethal doses with confidence intervals resulting from tolerance experiments.

  5. A General and Simple Diastereoselective Reduction by L-Selectride: Efficient Synthesis of Protected (4S,5S-Dihydroxy Amides

    Directory of Open Access Journals (Sweden)

    Bo Yin

    2010-04-01

    Full Text Available A general approach to (4S,5S-4-benzyloxy-5-hydroxy-N-(4-methoxybenzyl amides 10 based on a diastereoselective reduction of (5S,6RS-6-alkyl-5-benzyloxy-6-hydroxy-2-piperidinones 6 and their tautomeric ring-opened keto amides 7 is described. The reduction with L-Selectride at -20 °C to room temperature afforded the products 10 in excellent yields and moderate to high syn-diastereoselectivities.

  6. (1S,3S,4S-tert-Butyl N-[1-benzyl-3-hydroxy-5-phenyl-4-(picolinamidopentyl]carbamate

    Directory of Open Access Journals (Sweden)

    Jian-Feng Zheng

    2008-07-01

    Full Text Available The title compound, C29H35N3O4, was obtained by the reaction of (2S,4S,5S-tert-butyl N-(4-amino-1-benzyl-3-hydroxy-5-phenylpentylcarbamate and picolinic acid using oxalyl chloride as a chlorinating reagent to activate the carboxyl group. In the crystal structure there are two molecules in the asymmetric unit, which are aligned edge-to-face. In one molecule, the pyridyl ring forms a dihedral angle of 22.0 (1° with the phenyl ring of the terminal benzyl group and 14.3 (1° with the other phenyl ring; in the other molecule, the corresponding angles are 12.1 (1 and 10.6 (1°, respectively. The packing is stabilized by intermolecular hydrogen bonds and C—H...π interactions.

  7. On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

    Science.gov (United States)

    Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

    2009-10-09

    The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its

  8. Experimental transition probabilities for several spectral lines arising from the 5d10 6s{8s, 7p, 5f, 5g} electronic configurations of Pb III

    International Nuclear Information System (INIS)

    Alonso-Medina, A.

    2010-01-01

    Transition probabilities for 30 spectral lines, arising from the 5d 10 6s{8s, 7p, 5f, 5g} electronic configurations of Pb III (20 measured for the first time), have been experimentally determined from measurements of emission line intensities in a plasma lead induced by ablation with a Nd:YAG laser. The line intensities were obtained with the target placed in molecular argon at 6 Torr, recorded at a 400 ns delay from the laser pulse, which provides appropriate measurement conditions, and analysed between 200 and 700 nm. They are measured when the plasma reaches local thermodynamic equilibrium (LTE). The plasma under study had an electron temperature (T) of 21,400 K and an electron number density (N e ) of 7x10 16 cm -3 . The influence of self-absorption has been estimated for every line, and plasma homogeneity has been checked. The values obtained were compared with previous experimental values and theoretical estimates where possible.

  9. The 5S lean method as a tool of industrial management performances

    Science.gov (United States)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  10. Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH.

    Science.gov (United States)

    Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

    2013-01-01

    We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution.

  11. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    OpenAIRE

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-01-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in ...

  12. The Conserved RNA Exonuclease Rexo5 Is Required for 3′ End Maturation of 28S rRNA, 5S rRNA, and snoRNAs

    Directory of Open Access Journals (Sweden)

    Stefanie Gerstberger

    2017-10-01

    Full Text Available Non-coding RNA biogenesis in higher eukaryotes has not been fully characterized. Here, we studied the Drosophila melanogaster Rexo5 (CG8368 protein, a metazoan-specific member of the DEDDh 3′-5′ single-stranded RNA exonucleases, by genetic, biochemical, and RNA-sequencing approaches. Rexo5 is required for small nucleolar RNA (snoRNA and rRNA biogenesis and is essential in D. melanogaster. Loss-of-function mutants accumulate improperly 3′ end-trimmed 28S rRNA, 5S rRNA, and snoRNA precursors in vivo. Rexo5 is ubiquitously expressed at low levels in somatic metazoan cells but extremely elevated in male and female germ cells. Loss of Rexo5 leads to increased nucleolar size, genomic instability, defective ribosome subunit export, and larval death. Loss of germline expression compromises gonadal growth and meiotic entry during germline development.

  13. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    Science.gov (United States)

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  14. Ethical and psychological factors in 5S and total productive maintenance

    Energy Technology Data Exchange (ETDEWEB)

    Jamal Ahmed Hama Kareem; Othman Abdul-Qader Hama Amin

    2017-07-01

    The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results. Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b) Panneerselvam (2012) Singh et al. (2013) and Poduval & Pramod (2015) in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others) in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological) that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM) that are used to bring out the best productivity.

  15. Ethical and psychological factors in 5S and total productive maintenance

    International Nuclear Information System (INIS)

    Jamal Ahmed Hama Kareem; Othman Abdul-Qader Hama Amin

    2017-01-01

    The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results. Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b) Panneerselvam (2012) Singh et al. (2013) and Poduval & Pramod (2015) in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others) in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological) that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM) that are used to bring out the best productivity.

  16. Fine 5 sõidab ühelt festivalilt teisele

    Index Scriptorium Estoniae

    2004-01-01

    Tantsuteatri Fine 5 lavastus "Püha kevad" on kutsutud kolmele rahvusvahelisele festivalile. Läinud nädalal osaleti Riias Balti balletifestivalil, täna astutakse üles Kaliningradis festivalil "Tants-transiit" ja juuni algul sõidetakse Moskvasse vene teatri festivalile

  17. Response of 45S5 Bioglasss foams to tensile loading

    Czech Academy of Sciences Publication Activity Database

    Řehořek, Lukáš; Chlup, Zdeněk; Meng, D.; Yunos, D. M.; Boccaccini, A. R.; Dlouhý, Ivo

    2013-01-01

    Roč. 39, č. 7 (2013), s. 8015-8020 ISSN 0272-8842 R&D Projects: GA ČR GA101/09/1821 Institutional support: RVO:68081723 Keywords : 45S5 Bioglasss * Scaffolds * Foams * Openporosity * Tensilestrength Subject RIV: JH - Ceramic s, Fire-Resistant Materials and Glass Impact factor: 2.086, year: 2013

  18. 9 CFR 102.5 - U.S. Veterinary Biological Product License.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false U.S. Veterinary Biological Product... BIOLOGICAL PRODUCTS § 102.5 U.S. Veterinary Biological Product License. (a) Authorization to produce each biological product shall be specified on a U.S. Veterinary Biological Product License, issued by the...

  19. Development of socketed foundations for S3X5.7 posts.

    Science.gov (United States)

    2015-04-01

    The objective of this study was to develop a socketed foundation for use with the S3x5.7 (S76x8.5) weak : post. The design focused on cylindrical, reinforced concrete foundations with a steel tube placed in the center for : use as the socket. The fou...

  20. Manifestation of Strongly Delocalized Atomic States in the 5s Photoionization of Xenon

    International Nuclear Information System (INIS)

    Schmoranzer, H.; Lauer, S.; Vollweiler, F.; Reichardt, G.; Schartner, K.; Mentzel, G.; Wilhelmi, O.; Sukhorukov, V.L.; Lagutin, B.M.; Petrov, I.D.

    1997-01-01

    The photoionization (PI) of the Xe atom was investigated in the vicinity of the 5s -shell threshold by photon-induced fluorescence spectroscopy. The highest resolution so far attained of 2meV enabled us to observe a new series of resonance structures in the 5s -PI cross section closely above threshold. Calculations of the partial 5s - and 5p -PI cross sections were performed taking into account many-electron correlations. These structures were related with strongly delocalized f -resonances which affect the 5s -PI cross section due to their mixing with p -resonances. copyright 1997 The American Physical Society

  1. Absolute transition probabilities of 5s-5p transitions of Kr I from interferometric measurements in LTE-plasmas

    International Nuclear Information System (INIS)

    Kaschek, K.; Ernst, G.K.; Boetticher, W.

    1984-01-01

    Absolute transition probabilities of nine 5s-5p transitions of Kr I have been evaluated by using the hook method. The plasma was produced in a shock tube. The population density of the 5s-levels was calculated, under the assumption of LTE, from the electron density and the ground state number measured by means of a dual wavelength interferometer. An evaluation is given which proves the validity of the LTE assumption. (orig.)

  2. Assessment of application of 5S practices in ceramic industry

    Directory of Open Access Journals (Sweden)

    Danel Kleszcz

    2017-10-01

    Full Text Available Results of research connected with determining the degree of implementation of 5S practices in ceramics industry are discussed in this paper. Direct survey with employees of companies plus ex-pert interview was used in the research. A 21 point scale was used to assess the degree of implemen-tation the 5S practices at individual stages of the manufacturing process. The specificity of produc-tion in ceramics industry enforces maintaining the regime of cleanliness during production. The research revealed that the level of conscious implementation of the 5S practices in companies de-pends on the culture of organization and the degree of involvement of employees in the improvement actions in their company. The presented results are a part of the research aimed at determining refer-ence requirements for companies in terms of implementation and making use of the Lean Manage-ment (LM instruments.

  3. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Science.gov (United States)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  4. Genomics of Sponge-Associated Streptomyces spp. Closely Related to Streptomyces albus J1074: Insights into Marine Adaptation and Secondary Metabolite Biosynthesis Potential

    Science.gov (United States)

    Ian, Elena; Malko, Dmitry B.; Sekurova, Olga N.; Bredholt, Harald; Rückert, Christian; Borisova, Marina E.; Albersmeier, Andreas; Kalinowski, Jörn; Gelfand, Mikhail S.; Zotchev, Sergey B.

    2014-01-01

    A total of 74 actinomycete isolates were cultivated from two marine sponges, Geodia barretti and Phakellia ventilabrum collected at the same spot at the bottom of the Trondheim fjord (Norway). Phylogenetic analyses of sponge-associated actinomycetes based on the 16S rRNA gene sequences demonstrated the presence of species belonging to the genera Streptomyces, Nocardiopsis, Rhodococcus, Pseudonocardia and Micromonospora. Most isolates required sea water for growth, suggesting them being adapted to the marine environment. Phylogenetic analysis of Streptomyces spp. revealed two isolates that originated from different sponges and had 99.7% identity in their 16S rRNA gene sequences, indicating that they represent very closely related strains. Sequencing, annotation, and analyses of the genomes of these Streptomyces isolates demonstrated that they are sister organisms closely related to terrestrial Streptomyces albus J1074. Unlike S. albus J1074, the two sponge streptomycetes grew and differentiated faster on the medium containing sea water. Comparative genomics revealed several genes presumably responsible for partial marine adaptation of these isolates. Genome mining targeted to secondary metabolite biosynthesis gene clusters identified several of those, which were not present in S. albus J1074, and likely to have been retained from a common ancestor, or acquired from other actinomycetes. Certain genes and gene clusters were shown to be differentially acquired or lost, supporting the hypothesis of divergent evolution of the two Streptomyces species in different sponge hosts. PMID:24819608

  5. Indigenous and acquired modifications in the aminoglycoside binding sites of Pseudomonas aeruginosa rRNAs

    DEFF Research Database (Denmark)

    Gutierrez, Belen; Douthwaite, Stephen Roger; Gonzalez-Zorn, Bruno

    2013-01-01

    (housekeeping) modifications at m (4)Cm1402, m (3)U1498, m (2)G1516, m (6) 2A1518, and m (6) 2A1519; helix 69 is modified at m (3)Ψ1915, with m (5)U1939 and m (5)C1962 modification in adjacent sequences. All modifications were close to stoichiometric, with the exception of m (3)Ψ1915, where about 80% of r...

  6. Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?

    Science.gov (United States)

    Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo

    2017-04-15

    Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Ethical and psychological factors in 5S and total productive maintenance

    Directory of Open Access Journals (Sweden)

    Jamal Ahmed Hama Kareem

    2017-08-01

    Full Text Available Purpose: The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results.  Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b Panneerselvam (2012 Singh et al. (2013 and Poduval & Pramod (2015 in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM that are used to bring out the best productivity.

  8. Genetic selection and DNA sequences of 4.5S RNA homologs

    DEFF Research Database (Denmark)

    Brown, S; Thon, G; Tolentino, E

    1989-01-01

    A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

  9. 22 CFR 212.42 - Exemption from 5 U.S.C. 552.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Exemption from 5 U.S.C. 552. 212.42 Section 212.42 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT PUBLIC INFORMATION Exemptions From Disclosure § 212.42 Exemption from 5 U.S.C. 552. Whenever a request is made which involves access to records...

  10. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....

  11. Quasimolecular emission near the Xe(5p 56s 1,3 P 1 - 5p 6 1 S 0) and Kr (4p 55s 1,3 P 1 - 4p 6 1 S 0) resonance lines induced by collisions with He atoms

    Science.gov (United States)

    Alekseeva, O. S.; Devdariani, A. Z.; Grigorian, G. M.; Lednev, M. G.; Zagrebin, A. L.

    2017-02-01

    This study is devoted to the theoretical investigation of the quasimolecular emission of Xe*-He and Kr*-He collision pairs near the Xe (5p 56s 1,3 P 1 - 5p 6 1 S 0) and Kr (4p 55s 1,3 P 1 - 4p 6 1 S 0) resonance atomic lines. The potential curves of the quasimolecules Xe(5p 56s) + He and Kr(4p 55s) + He have been obtained with the use of the effective Hamiltonian and pseudopotential methods. Based on these potential curves the processes of quasimolecular emission of Xe*+He and Kr*+He mixtures have been considered and the spectral distributions I(ħΔω) of photons emitted have been obtained in the framework of quasistatic approximation.

  12. Unique dielectric features of a ceramic-semiconductor nanocomposite MgNb2O6 + 0.25Zn0.5Cd0.5S

    Science.gov (United States)

    Pukazhselvan, D.; Selvaraj, Nivas Babu; Bdikin, Igor; Saravanan, R. Sakthi Sudar; Jakka, Suresh Kumar; Soares, M. J.; Fagg, Duncan Paul

    2017-12-01

    The present communication deals with the optical/dielectric characteristics of MgNb2O6 + 0.25Zn0.5Cd0.5S nanocomposite (10-30 nm) mixture. Zn0.5Cd0.5S (size ∼10 nm) was synthesized by microwave assisted solvo-thermal method. Monophase magnesium niobate (MN) nanoparticles (10-20 nm) were synthesized in a single step by mechanochemical treatment of MgO + Nb2O5 under dry N2 atmosphere. The nanocomposite, MgNb2O6 + 0.25Zn0.5Cd0.5S, was prepared by mechanical admixing of MgNb2O6 and Zn0.5Cd0.5S taken in 4:1 molar ratio. The photoluminescence study shows violet, yellow and orange-red emissions by the MgNb2O6 + 0.25Zn0.5Cd0.5S composite. The observed dielectric constant value (ε) for MgNb2O6 + 0.25Zn0.5Cd0.5S is only 4.7, which is ∼5 times smaller than the ε value of MgNb2O6 while a dielectric loss for the composite being closer to zero ensures promising commercial applications.

  13. 5-12 klasių mokinių psichologinės savijautos veiksniai (sveikatos kontrolės lokusas, savęs vertinimas)

    OpenAIRE

    Naktinytė, Eglė

    2007-01-01

    Jaunesniojo paauglio psichologinė savijauta - neabejotinai aktualus klausimas šiandieną ugdant sveiką visuomenę. Svarbiausias paauglio asmenybės ir psichologinės savijautos aspektas yra sveikatos kontrolės lokusas, kuris parodo, kaip žmogus suvokia savo sveikatą bei priežastis, nuo kurių priklauso jo sveikata, ir savęs vertinimas. Šio magistro darbo tikslas - ištirti 5-12 klasių mokinių savęs vertinimo ir sveikatos kontrolės lokuso ypatumus sąryšyje su sveikata ir mokymosi sėkme. Siekiama nus...

  14. Hyperfine splitting of B mesons and Bs production at the Υ(5S)

    International Nuclear Information System (INIS)

    Lee-Franzini, J.; Heintz, U.; Lovelock, D.M.J.; Narain, M.; Schamberger, R.D.; Willins, J.; Yanagisawa, C.; Franzini, P.; Tuts, P.M.

    1990-01-01

    Using the Columbia University--Stony Brook (CUSB-II) detector we have studied the inclusive photon spectrum from 2.9x10 4 Υ(5S) decays. We observe a strong signal due to B * →Bγ decays. From this we obtain (i) the average B * -B mass difference, 46.7±0.4 MeV, (ii) the photon yield per Υ(5S) decay, left-angle γ/Υ(5S)right-angle=1.09±0.06, and (iii) the average velocity of the B * 's, left-angle β right-angle=0.156±0.010, for a mix of nonstrange (B) and strange (B s ) B * mesons from Υ(5S) decays. From the shape of the photon line, we find that both B and B s mesons are produced with nearly equal values for the hyperfine splitting of the B and B s meson systems

  15. The nature of Zb states from a combined analysis of Υ(5S) → hb(mP)π+π- and Υ(5S) → B(*) anti B(*)π

    International Nuclear Information System (INIS)

    Huo, Wen-Sheng; Chen, Guo-Ying

    2016-01-01

    With a combined analysis of data on Υ(5S) → h b (1P, 2P)π + π - and Υ(5S) → B (*) anti B (*) π in an effective field theory approach, we determine resonance parameters of Z b states in two scenarios. In one scenario we assume that Z b states are pure molecular states, while in the other one we assume that Z b states contain compact components. We find that the present data favor that there should be some compact components inside Z b (') associated with themolecular components. By fitting the invariant mass spectra of Υ(5S) → h b (1P, 2P)π + π - and Υ(5S) → B (*) anti B * π, we determine that the probability of finding the compact components in Z b states may be as large as about 40 %. (orig.)

  16. Identification of Rhodococcus fascians cytokinins and their modus operandi to reshape the plant

    Czech Academy of Sciences Publication Activity Database

    Pertry, I.; Václavíková, Kateřina; Depuydt, S.; Galuszka, P.; Spíchal, Lukáš; Temmerman, W.; Stes, E.; Schmülling, T.; Kakimoto, T.; Van Montagu, M. C. E.; Strnad, Miroslav; Holsters, M.; Tarkowski, Petr; Vereecke, D.

    2009-01-01

    Roč. 106, č. 3 (2009), s. 929-934 ISSN 0027-8424 Institutional research plan: CEZ:AV0Z50380511 Keywords : phytopathogen * actinomycete * phytohormone Subject RIV: CE - Biochemistry Impact factor: 9.432, year: 2009

  17. Influence of lanthanium atoms on the physico-chemical properties of GeS0,5Se0,5 solid solutions

    International Nuclear Information System (INIS)

    Murguzov, M.I.; Alakbarov, A.S.; Bayramov, R.B.

    2010-01-01

    By the methods of physical-chemical analysis (DTA, X-ray, MSA, as well as measurement of microhardness and density determination) the influence of La on the physico-chemical properties of solid solutions (GeS 0 ,5Se 0 ,5) 1 -x(La) x was studied and its microdiagram was plotted. At room temperature the GeS 0 ,5Se 0 ,5 based solid solid solution extent to 4 at. percent La. The dependence of lanthane microhardness was studied

  18. IMPLEMENTING THE 5S METHOD IN THE PRODUCTION SYSTEM OF DACIA & RENAULT

    Directory of Open Access Journals (Sweden)

    Marin CIOBANU

    2014-11-01

    Full Text Available The aim of this paper is to demonstrate the usefulness of the 5S method in addressing the issues of continuous improvement of productivity and quality of work. There are presented the 5 steps, techniques and the adjacent tools. Solutions implemented in the production system Dacia & Renault are indicated. This article provides a practical framework. The 5S method follows the Deming PDCA cycle which constitutes the starting point of the SDCA cycle of continuous improvement of the company's activities in order to obtain excellence. The implementing time of the method depends on the resources and materials allocated. Deployment of 5S is achieved by a scheme of "3+2": the first 3S are tangible and immediate actions, the last 2S appeal to specific management actions. The efficacy of their own workplace in total autonomy creates comfort in the work environment and gives personal benefits to workers.

  19. snoSeeker: an advanced computational package for screening of guide and orphan snoRNA genes in the human genome

    OpenAIRE

    Yang, Jian-Hua; Zhang, Xiao-Chen; Huang, Zhan-Peng; Zhou, Hui; Huang, Mian-Bo; Zhang, Shu; Chen, Yue-Qin; Qu, Liang-Hu

    2006-01-01

    Small nucleolar RNAs (snoRNAs) represent an abundant group of non-coding RNAs in eukaryotes. They can be divided into guide and orphan snoRNAs according to the presence or absence of antisense sequence to rRNAs or snRNAs. Current snoRNA-searching programs, which are essentially based on sequence complementarity to rRNAs or snRNAs, exist only for the screening of guide snoRNAs. In this study, we have developed an advanced computational package, snoSeeker, which includes CDseeker and ACAseeker ...

  20. Implementation Of 5S Methodology In The Small Scale Industry A Case Study

    Directory of Open Access Journals (Sweden)

    R. S. Agrahari

    2015-04-01

    Full Text Available Abstract 5S is a basic foundation of Lean Manufacturing systems. It is a tool for cleaning sorting organizing and providing the necessary groundwork for workpiece improvement. This paper dealt with the implementation of 5S methodology in the small scale industry. By following the 5S methodology it shows significant improvements to safety productivity efficiency and housekeeping. The improvements before and after 5S implementation is shown by pictures in the paper. It also intends to build a stronger work ethic within the management and workers who would be expected to continue the good practices.

  1. 16S rRNA phylogenetic analysis of actinomycetes isolated from ...

    African Journals Online (AJOL)

    SNPK

    2012-07-26

    Jul 26, 2012 ... Marine mangroves and eastern Ghats of Indian eco- systems facilitate the .... U of Ex Taq polymerase chain reaction (PCR). Conditions consisted of ... its building blocks of amino acids in the cell wall. (Fredimoses, 2010).

  2. Radionuclides of foods in Japan and uptake of radio/stable elements by terrestrial food, microorganism

    International Nuclear Information System (INIS)

    Sugiyama, H.; Kuwahara, C.; Kato, F.

    2004-01-01

    According to our recent investigation from 2000 to 2003, radiocesium concentrations of foods in Japan imported from various foreign countries were low levels ( 137 Cs concentrations. And also, we obtained the data that wild mushrooms collected from four points of Japanese forests in 2002 had been still contaminated by 137 Cs ( 137 Cs to mushrooms is both a direct path way from soil and an indirect path way from the cells of soil microorganisms. We performed the culture experiments of the saprophytic edible mushroom (Pleurotus otsreatus) mycelia and one of the representative soil microorganisms isolated from wild mushroom substrata, using several stable elements. On the isolation of soil microorganisms from mushroom substrata, the appearance frequencies of planktonic bacteria and filamentous actinomycetes were affected by pH of isolation medium. Cs tolerance of the planktonic bacteria and the filamentous actinomycetes showed considerable difference; as far as tested 13 soil samples, planktonic bacteria being able to grow in the presence of 50 mM CsCl were present in all the samples at a higher density but no filamentous actinomycetes could grow in the presence of 50 mM. Accumulation of Cs in filamentous actinomycetes (Streptomyces sp. K202) were two to eight times higher than those in bacteria when they were incubated in the presence of 5 mM CsCl. (author)

  3. The prohibition order according to paragraph 5 S. 4 EnWG; Die Untersagungsverfuegung nach paragraph 5 S. 4 EnWG

    Energy Technology Data Exchange (ETDEWEB)

    Rauch, Karsten [WSW Netz GmbH, Wuppertal (Germany)

    2011-02-10

    The introduction of prosecutorial investigation on suspicion of delaying the insolvency proceedings published in the autumn 2010 results to a general question of whether and to what extent a concomitant intervention of the regulatory authorities is indicated. Central to this are the basis for authorization given in paragraph 5 S. 4 Energy Economy Law and the related prohibition authority.

  4. Adaptation of the S-5-S Pendulím Seismometer for Measurement of Rotational Ground Motion

    Czech Academy of Sciences Publication Activity Database

    Knejzlík, Jaromír; Kaláb, Zdeněk; Rambouský, Zdeněk

    2012-01-01

    Roč. 16, č. 4 (2012), s. 649-656 ISSN 1383-4649 Institutional support: RVO:68145535 Keywords : rotation al ground motion * experimental measurement * mining induced seismicity * S-5-S seismometer Subject RIV: DC - Siesmology, Volcanology, Earth Structure Impact factor: 1.388, year: 2012 http://link.springer.com/article/10.1007%2Fs10950-012-9279-6

  5. The complete mitochondrial genome of the alvinocaridid shrimp Shinkaicaris leurokolos (Decapoda, Caridea): Insight into the mitochondrial genetic basis of deep-sea hydrothermal vent adaptation in the shrimp.

    Science.gov (United States)

    Sun, Shao'e; Hui, Ming; Wang, Minxiao; Sha, Zhongli

    2018-03-01

    Deep-sea hydrothermal vent is one of the most extreme environments on Earth with low oxygen and high levels of toxins. Decapod species from the family Alvinocarididae have colonized and successfully adapted to this extremely harsh environment. Mitochondria plays a vital role in oxygen usage and energy metabolism, thus it may be under selection in the adaptive evolution of the hydrothermal vent shrimps. In this study, the mitochondrial genome (mitogenome) of alvinocaridid shrimp Shinkaicaris leurokolos (Kikuchi & Hashimoto, 2000) was determined through Illumina sequencing. The mitogenome of S. leurokolos was 15,903bp in length, containing 13 protein-coding genes, 2 rRNAs, and 22 tRNAs. The gene order and orientation were identical to those of sequenced alvinocaridids. It has the longest concatenated sequences of protein-coding genes, tRNAs and shortest pooled rRNAs among the alvinocaridids. The control regions (CRs) of alvinocaridid were significantly longer (penergy metabolism to adapt to the hydrothermal environment. Phylogenetic analysis supported that the deep-sea hydrothermal vent shrimps may have originated from those living in shallow area. Positive selection analysis reveals the evidence of adaptive change in the mitogenome of Alvinocarididae. Thirty potentially important adaptive residues were identified, which were located in atp6, cox1, cox3, cytb and nad1-5. This study explores the mitochondrial genetic basis of hydrothermal vent adaptation in alvinocaridid for the first time, and provides valuable clues regarding the adaptation. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Non-Random Distribution of 5S rDNA Sites and Its Association with 45S rDNA in Plant Chromosomes.

    Science.gov (United States)

    Roa, Fernando; Guerra, Marcelo

    2015-01-01

    5S and 45S rDNA sites are the best mapped chromosome regions in eukaryotic chromosomes. In this work, a database was built gathering information about the position and number of 5S rDNA sites in 784 plant species, aiming to identify patterns of distribution along the chromosomes and its correlation with the position of 45S rDNA sites. Data revealed that in most karyotypes (54.5%, including polyploids) two 5S rDNA sites (a single pair) are present, with 58.7% of all sites occurring in the short arm, mainly in the proximal region. In karyotypes of angiosperms with only 1 pair of sites (single sites) they are mostly found in the proximal region (52.0%), whereas in karyotypes with multiple sites the location varies according to the average chromosome size. Karyotypes with multiple sites and small chromosomes (6 µm) more commonly show terminal or interstitial sites. In species with holokinetic chromosomes, the modal value of sites per karyotype was also 2, but they were found mainly in a terminal position. Adjacent 5S and 45S rDNA sites were often found in the short arm, reflecting the preferential distribution of both sites in this arm. The high frequency of genera with at least 1 species with adjacent 5S and 45S sites reveals that this association appeared several times during angiosperm evolution, but it has been maintained only rarely as the dominant array in plant genera. © 2015 S. Karger AG, Basel.

  7. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    Directory of Open Access Journals (Sweden)

    Garcia Sònia

    2012-06-01

    Full Text Available Abstract Background In plants, the 5S rRNA genes usually occur as separate tandems (S-type arrangement or, less commonly, linked to 35 S rDNA units (L-type. The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5S genes in several species from family Asteraceae known to contain linked 35 S-5S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6 but not all species. Two species contained major L-type and minor S-type units (termed Ls-type. The linked genes dominate 5S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’ is proposed. The 5S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5S arrays with nucleolar periphery indicating that transcription of 5S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs.

  8. MINERAL INFORMATION EXTRACTION BASED ON GAOFEN-5S THERMAL INFRARED DATA

    Directory of Open Access Journals (Sweden)

    L. Liu

    2018-04-01

    Full Text Available Gaofen-5 carries six instruments aimed at various land and atmosphere applications, and it’s an important unit of China High-resolution Earth Observation System. As Gaofen-5s thermal infrared payload is similar to that of ASTER, which is widely used in mineral exploration, application of Gaofen-5s thermal infrared data is discussed regarding its capability in mineral classification and silica content estimation. First, spectra of silicate, carbonate, sulfate minerals from a spectral library are used to conduct spectral feature analysis on Gaofen-5s thermal infrared emissivities. Spectral indices of band emissivities are proposed, and by setting thresholds of these spectral indices, it can classify three types of minerals mentioned above. This classification method is tested on a simulated Gaofen-5 emissivity image. With samples acquired from the study area, this method is proven to be feasible. Second, with band emissivities of silicate and their silica content from the same spectral library, correlation models have been tried to be built for silica content inversion. However, the highest correlation coefficient is merely 0.592, which is much lower than that of correlation model built on ASTER thermal infrared emissivity. It can be concluded that GF-5s thermal infrared data can be utilized in mineral classification but not in silica content inversion.

  9. Isolation and identification of biocontrol agent Streptomyces rimosus M527 against Fusarium oxysporum f. sp. cucumerinum.

    Science.gov (United States)

    Lu, Dandan; Ma, Zheng; Xu, Xianhao; Yu, Xiaoping

    2016-08-01

    Actinomycetes have received considerable attention as biocontrol agents against fungal plant pathogens and as plant growth promoters. In this study, a total of 320 actinomycetes were isolated from various habitats in China. Among which, 77 strains have been identified as antagonistic activities against Fusarium oxysporum f. sp. cucumerinum which usually caused fusarium wilt of cucumber. Of these, isolate actinomycete M527 not only displayed broad-spectrum antifungal activity but also showed the strongest antagonistic activity against the spore germination of F. oxysporum f. sp. cucumerinum. In pot experiments, the results indicated that isolate M527 could promote the shoot growth and prevent the development of the disease on cucumber caused by F. oxysporum f. sp. cucumerinum. The control efficacy against seedling fusarium wilt of cucumber after M527 fermentation broth root-irrigation was up to 72.1% as compared to control. Based on 16S rDNA sequence analysis, the isolate M527 was identified as Streptomyces rimosus. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. A Congruence Theorem for Minimal Surfaces in $S^{5}$ with Constant Contact Angle

    OpenAIRE

    Montes, Rodrigo Ristow; Verderesi, Jose A.

    2006-01-01

    We provide a congruence theorem for minimal surfaces in $S^5$ with constant contact angle using Gauss-Codazzi-Ricci equations. More precisely, we prove that Gauss-Codazzi-Ricci equations for minimal surfaces in $S^5$ with constant contact angle satisfy an equation for the Laplacian of the holomorphic angle. Also, we will give a characterization of flat minimal surfaces in $S^5$ with constant contact angle.

  11. Analysis of glow curve of GaS{sub 0.5}Se{sub 0.5} single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Isik, Mehmet, E-mail: mehmet.isik@atilim.edu.tr [Department of Electrical and Electronics Engineering, Atilim University, 06836 Ankara (Turkey); Delice, Serdar [Department of Physics, Middle East Technical University, 06800 Ankara (Turkey); Gasanly, Nizami [Department of Physics, Middle East Technical University, 06800 Ankara (Turkey); Virtual International Scientific Research Centre, Baku State University, 1148 Baku (Azerbaijan)

    2015-12-15

    Characterization of shallow trapping centers in GaS{sub 0.5}Se{sub 0.5} crystals grown by a Bridgman method was carried out in the present work using thermoluminescence (TL) measurements performed in the low temperature range of 10–300 K. The activation energies of the trapping centers were obtained under the light of results of various analysis methods. The presence of three trapping centers located at 6, 30 and 72 meV was revealed. The analysis of the experimental glow curve gave reasonable results under the model that assumes slow retrapping which states the order of kinetics as b=1. Heating rate dependence of the observed TL peaks was studied for the rates between 0.4 and 1.0 K/s. Distribution of the traps was also investigated using an experimental technique based on the thermal cleaning of centers giving emission at lower temperatures. The distributed levels with activation energies increasing from 6 to 136 meV were revealed by increasing the stopping temperature from 10 to 52 K. - Highlights: • TL measurements were performed in the 10–300 K range on GaS{sub 0.5}Se{sub 0.5} crystals. • Atomic composition ratio of the elements was found. • Three trapping centers located at 6, 30 and 72 meV were revealed. • Distribution of trapping centers was studied on as-grown crystal.

  12. Structural similarities between prokaryotic and eukaryotic 5S ribosomal RNAs

    International Nuclear Information System (INIS)

    Welfle, H.; Boehm, S.; Damaschun, G.; Fabian, H.; Gast, K.; Misselwitz, R.; Mueller, J.J.; Zirwer, D.; Filimonov, V.V.; Venyaminov, S.Yu.; Zalkova, T.N.

    1986-01-01

    5S RNAs from rat liver and E. coli have been studied by diffuse X-ray and dynamic light scattering and by infrared and Raman spectroscopy. Identical structures at a resolution of 1 nm can be deduced from the comparison of the experimental X-ray scattering curves and electron distance distribution functions and from the agreement of the shape parameters. A flat shape model with a compact central region and two protruding arms was derived. Double helical stems are eleven-fold helices with a mean base pair distance of 0.28 nm. The number of base pairs (26 GC, 9 AU for E. coli; 27 GC, 9 AU for rat liver) and the degree of base stacking are the same within the experimental error. A very high regularity in the ribophosphate backbone is indicated for both 5S RNAs. The observed structural similarity and the consensus secondary structure pattern derived from comparative sequence analyses suggest the conclusion that prokaryotic and eukaryotic 5S RNAs are in general very similar with respect to their fundamental structural features. (author)

  13. Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

    Science.gov (United States)

    Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

    2017-11-01

    Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

  14. How many 5S rRNA genes and pseudogenes are there in ''Aspergillus nidulans''?

    International Nuclear Information System (INIS)

    Pelczar, P.; Fiett, J.; Bartnik, E.

    1994-01-01

    We have estimated the number of 5S rRNA genes in ''Aspergillus nidulans'' using two-dimensional agarose gel electrophoresis and hybridization to appropriate probes, representing the 5'-halves, the 3'-halves of the 5S rRNA sequence and a sequence found at the 3'-end of all known. ''A. nidulans'' pseudogenes (block C). We have found 23 5S rRNA genes, 15 pseudogenes consisting of the 5'-half of the 5S rRNA sequence (of which 3 are flanked by block C) and 12 copies of block C which do not seem to be in the vicinity of 5S rRNA sequences. This number of genes is much lower than our earlier estimates, and makes our previously analyzed sample of 9 sequenced genes and 3 pseudogenes much more representative. (author). 7 refs, 1 fig

  15. Shock wave collisions and thermalization in AdS5

    International Nuclear Information System (INIS)

    Kovchegov, Yuri V.

    2011-01-01

    We study heavy ion collisions at strong 't Hooft coupling using AdS/CFT correspondence. According to the AdS/CFT dictionary heavy ion collisions correspond to gravitational shock wave collisions in AdS 5 . We construct the metric in the forward light cone after the collision perturbatively through expansion of Einstein equations in graviton exchanges. We obtain an analytic expression for the metric including all-order graviton exchanges with one shock wave, while keeping the exchanges with another shock wave at the lowest order. We read off the corresponding energy-momentum tensor of the produced medium. Unfortunately this energy-momentum tensor does not correspond to ideal hydrodynamics, indicating that higher order graviton exchanges are needed to construct the full solution of the problem. We also show that shock waves must completely stop almost immediately after the collision in AdS 5 , which, on the field theory side, corresponds to complete nuclear stopping due to strong coupling effects, likely leading to Landau hydrodynamics. Finally, we perform trapped surface analysis of the shock wave collisions demonstrating that a bulk black hole, corresponding to ideal hydrodynamics on the boundary, has to be created in such collisions, thus constructing a proof of thermalization in heavy ion collisions at strong coupling. (author)

  16. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    Science.gov (United States)

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  17. Achieve Sustainable Hospital Excellence Through 5-S in an Emergency Department in Hong Kong

    Directory of Open Access Journals (Sweden)

    Tsoi Vincent F. K.

    2014-11-01

    Full Text Available 5-S is the first step towards TQM. Over the last century, the Japanese have formalised the technique and named it as 5-S Practice. Since 1993, Sam Ho has improved and defined its terms in English/Chinese and developed the world's first 5-S Audit Checklist. In the article, an emergency department of a Hong Kong hospital was examined against 5-S 50-point Checklist for the improvement of their quality assurance systems towards its accreditation process with Australian standards. The findings evidently reveal that the impact of 5-S on hospital quality assurance in the unit are positive. Riding on the above scenario, the research aim is to identify whether the 5-S practice is a suitable and effective tool for healthcare quality assurance in an emergency setting which is led towards its accreditation process set by other mechanisms.

  18. Expression of the innate defense receptor S5D-SRCRB in the urogenital tract

    DEFF Research Database (Denmark)

    Miro-Julia, C.; Escoda-Ferran, C.; Carrasco, E.

    2014-01-01

    S5D-SRCRB is a novel mouse secretory glycoprotein belonging to the ancient and highly conserved scavenger receptor cysteine-rich superfamily of protein receptors. Available evidence indicates that S5D-SRCRB interacts with conserved microbial cell wall components, as well as with some endogenous...... proteins, and presents a restricted tissue expression pattern. This study further analyzes the expression of S5D-SRCRB along the mouse urogenital tract. Immunohistochemical staining for S5D-SRCRB was observed in spermatocytes from seminiferous tubules and in the epithelial surface from urethra and bladder......-SRCRB was observed in the apical border of terminally differentiated IC. Colocalization of S5D-SRCRB with galectin-3 (Gal-3) was also observed in kidney and bladder, but not in testis, supporting concurrent biochemical studies demonstrating the carbohydrate-dependent interaction of Gal-3 and S5D-SRCRB. Furthermore...

  19. Analyzing Digital Library Initiatives: 5S Theory Perspective

    Science.gov (United States)

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  20. SUSY S4×SU(5) revisited

    International Nuclear Information System (INIS)

    Hagedorn, Claudia; King, Stephen F.; Luhn, Christoph

    2012-01-01

    Following the recent results from Daya Bay and RENO, which measure the lepton mixing angle θ 13 l ≈0.15, we revisit a supersymmetric (SUSY) S 4 ×SU(5) model, which predicts tri-bimaximal (TB) mixing in the neutrino sector with θ 13 l being too small in its original version. We show that introducing one additional S 4 singlet flavon into the model gives rise to a sizable θ 13 l via an operator which leads to the breaking of one of the two Z 2 symmetries preserved in the neutrino sector at leading order (LO). The results of the original model for fermion masses, quark mixing and the solar mixing angle are maintained to good precision. The atmospheric and solar mixing angle deviations from TB mixing are subject to simple sum rule bounds.

  1. Dark-red-emitting CdTe{sub 0.5}Se{sub 0.5}/Cd{sub 0.5}Zn{sub 0.5}S quantum dots: Effect of chemicals on properties

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Ping, E-mail: mse_yangp@ujn.edu.cn; Zhang, Aiyu; Li, Xiaoyu; Liu, Ning; Zhang, Yulan; Zhang, Ruili

    2013-08-15

    CdTe{sub 0.5}Se{sub 0.5}/Cd{sub 0.5}Zn{sub 0.5}S core/shell quantum dots (QDs) with a tunable photoluminescence (PL) range from yellow to dark red (up to a PL peak wavelength of 683 nm) were fabricated using various reaction systems. The core/shell QDs created in the reaction solution of trioctylamine (TOA) and oleic acid (OA) at 300 °C exhibited narrow PL spectra and a related low PL efficiency (38%). In contrast, the core/shell QDs prepared in the solution of 1-octadecene (ODE) and hexadecylamine (HDA) at 200 °C revealed a high PL efficiency (70%) and broad PL spectra. This phenomenon is ascribed that the precursor of Cd, reaction temperature, solvents, and ligands affected the formation process of the shell. The slow growth rate of the shell in the solution of ODE and HDA made QDs with a high PL efficiency. Metal acetate salts without reaction with HDA led to the core/shell QDs with a broad size distribution. - Graphical abstract: CdTe{sub 0.5}Se{sub 0.5}/Cd{sub 0.5}Zn{sub 0.5}S quantum dots (QDs) with tunable photoluminescence, high PL efficiency, and high stability through organic synthesis, in which chemicals affected the properties of the QDs. Display Omitted - Highlights: • CdTe{sub 0.5}Se{sub 0.5}/Cd{sub 0.5}Zn{sub 0.5}S quantum dots created via organic synthesis. • Chemicals affected the properties of the quantum dots. • The quantum dots revealed high photoluminescence efficiency and stability. • The quantum dots with tunable photoluminescence in a range from yellow to dark red. • The QDs are utilizable for various applications such as biological labeling.

  2. Relative expression of rRNA transcripts and 45S rDNA promoter methylation status are dysregulated in tumors in comparison with matched-normal tissues in breast cancer.

    Science.gov (United States)

    Karahan, Gurbet; Sayar, Nilufer; Gozum, Gokcen; Bozkurt, Betul; Konu, Ozlen; Yulug, Isik G

    2015-06-01

    Ribosomal RNA (rRNA) expression, one of the most important factors regulating ribosome production, is primarily controlled by a CG-rich 45 S rDNA promoter. However, the DNA methylation state of the 45 S rDNA promoter, as well as its effect on rRNA gene expression in types of human cancers is controversial. In the present study we analyzed the methylation status of the rDNA promoter (-380 to +53 bp) as well as associated rRNA expression levels in breast cancer cell lines and breast tumor-normal tissue pairs. We found that the aforementioned regulatory region was extensively methylated (74-96%) in all cell lines and in 68% (13/19 tumor-normal pairs) of the tumors. Expression levels of rRNA transcripts 18 S, 28 S, 5.8 S and 45 S external transcribed spacer (45 S ETS) greatly varied in the breast cancer cell lines regardless of their methylation status. Analyses of rRNA transcript expression levels in the breast tumor and normal matched tissues showed no significant difference when normalized with TBP. On the other hand, using the geometric mean of the rRNA expression values (GM-rRNA) as reference enabled us to identify significant changes in the relative expression of rRNAs in the tissue samples. We propose GM-rRNA normalization as a novel strategy to analyze expression differences between rRNA transcripts. Accordingly, the 18S rRNA/GM-rRNA ratio was significantly higher whereas the 5.8S rRNA/GM-rRNA ratio was significantly lower in breast tumor samples than this ratio in the matched normal samples. Moreover, the 18S rRNA/GM-rRNA ratio was negatively correlated with the 45 S rDNA promoter methylation level in the normal breast tissue samples, yet not in the breast tumors. Significant correlations observed between the expression levels of rRNA transcripts in the normal samples were lost in the tumor samples. We showed that the expression of rRNA transcripts may not be based solely on promoter methylation. Carcinogenesis may cause dysregulation of the correlation

  3. Structure of Staphylococcus aureus 5′-methylthioadenosine/S-adenosylhomocysteine nucleosidase

    International Nuclear Information System (INIS)

    Siu, Karen K. W.; Lee, Jeffrey E.; Smith, G. David; Horvatin-Mrakovcic, Cathy; Howell, P. Lynne

    2008-01-01

    The crystal structure of S. aureus 5′-methylthioadenosine/S-adenosylhomocysteine nucleosidase has been determined at 1.7 Å resolution in complex with formycin A. 5′-Methylthioadenosine/S-adenosylhomocysteine nucleosidase (MTAN) catalyzes the irreversible cleavage of the glycosidic bond in 5′-methylthioadenosine (MTA) and S-adenosylhomocysteine (SAH) and plays a key role in four metabolic processes: biological methylation, polyamine biosynthesis, methionine recycling and bacterial quorum sensing. The absence of the nucleosidase in mammalian species has implicated this enzyme as a target for antimicrobial drug design. MTAN from the pathogenic bacterium Staphylococcus aureus (SaMTAN) has been kinetically characterized and its structure has been determined in complex with the transition-state analogue formycin A (FMA) at 1.7 Å resolution. A comparison of the SaMTAN–FMA complex with available Escherichia coli MTAN structures shows strong conservation of the overall structure and in particular of the active site. The presence of an extra water molecule, which forms a hydrogen bond to the O4′ atom of formycin A in the active site of SaMTAN, produces electron withdrawal from the ribosyl group and may explain the lower catalytic efficiency that SaMTAN exhibits when metabolizing MTA and SAH relative to the E. coli enzyme. The implications of this structure for broad-based antibiotic design are discussed

  4. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Science.gov (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Distraction manipulation reduction of an L5-S1 disk herniation.

    Science.gov (United States)

    Cox, J M; Hazen, L J; Mungovan, M

    1993-06-01

    A computed tomography (CT)-confirmed L5-S1 disk protrusion is reported to be reduced following chiropractic adjustment, as seen on repeat CT scanning. Correlation of the CT reports with the patient's symptoms before and after manipulation is reported. A 38-yr-old female was treated for low back pain and right lower extremity first sacral dermatome sciatica. CT confirmed disk herniations at both the L4-L5 and L5-S1 levels were found. Motor weakness of the right gluteus maximus muscle was found and extremely tight hamstring muscles accompanying positive straight leg signs were elicited. A clinical and imaging diagnosis of an L5-S1 disk herniation was made. Distraction type chiropractic manipulation, electrical stimulation, exercises, nutrition advice and low back wellness class were administered with complete relief of sciatic pain and nearly complete relief of low back pain. Chiropractic distraction manipulation is an effective treatment of lumbar disk herniation, if the chiropractor is observant during its administration for patient tolerance to manipulation under distraction and any signs of neurological deficit demanding other types of care.

  6. Mixed-symmetry fields in AdS(5), conformal fields, and AdS/CFT

    Energy Technology Data Exchange (ETDEWEB)

    Metsaev, R.R. [Department of Theoretical Physics, P.N. Lebedev Physical Institute,Leninsky prospect 53, Moscow 119991 (Russian Federation)

    2015-01-15

    Mixed-symmetry arbitrary spin massive, massless, and self-dual massive fields in AdS(5) are studied. Light-cone gauge actions for such fields leading to decoupled equations of motion are constructed. Light-cone gauge formulation of mixed-symmetry anomalous conformal currents and shadows in 4d flat space is also developed. AdS/CFT correspondence for normalizable and non-normalizable modes of mixed-symmetry AdS fields and the respective boundary mixed-symmetry anomalous conformal currents and shadows is studied. We demonstrate that the light-cone gauge action for massive mixed-symmetry AdS field evaluated on solution of the Dirichlet problem amounts to the light-cone gauge 2-point vertex of mixed-symmetry anomalous shadow. Also we show that UV divergence of the action for mixed-symmetry massive AdS field with some particular value of mass parameter evaluated on the Dirichlet problem amounts to the action of long mixed-symmetry conformal field, while UV divergence of the action for mixed-symmetry massless AdS field evaluated on the Dirichlet problem amounts to the action of short mixed-symmetry conformal field. We speculate on string theory interpretation of a model which involves short low-spin conformal fields and long higher-spin conformal fields.

  7. Heterochromatin diversity and its co-localization with 5S and 45S rDNA sites in chromosomes of four Maxillaria species (Orchidaceae

    Directory of Open Access Journals (Sweden)

    Juliano S. Cabral

    2006-01-01

    Full Text Available We investigated four orchids of the genus Maxillaria (M. discolor, M. acicularis, M. notylioglossa and M. desvauxiana in regard to the position of heterochromatin blocks as revealed using chromomycin A3 (CMA and 4'-6-diamidino-2-phenylindole (DAPI fluorochrome staining and 5S and 45S rDNA sites using fluorescence in situ hybridization (FISH. The species showed differences in chromosome number and a diversified pattern of CMA+ and DAPI+ bands, including heteromorphism for CMA+ bands. The 5S and 45S rDNA sites also varied in number and most of them were co-localized with CMA+ bands. The relationship between 5S rDNA sites and CMA+ bands was more evident in M. notylioglossa, in which the brighter CMA+ bands were associated with large 5S rDNA sites. However, not all 5S and 45S rDNA sites were co-localized with CMA+ bands, probably due to technical constraints. We compare these results to banding data from other species and suggest that not all blocks of tandemly repetitive sequences, such as 5S rDNA sites, can be observed as heterochromatin blocks.

  8. N-[(2S-4-Chloro-2-(l-menthyloxy-5-oxo-2,5-dihydro-3-furyl]-l-alanine

    Directory of Open Access Journals (Sweden)

    Kai Yang

    2009-05-01

    Full Text Available The title compound, C17H26ClNO5, was prepared via a tandem asymmetric Michael addition–elimination reaction of (5S-3,4-dichloro-5-(l-menthyloxyfuran-2(5H-one and l-alanine in the presence of potassium hydroxide. The five-membered furanone ring is approximately planar while the six-membered menthyloxy ring adopts a chair conformation. The crystal packing is stabilized by intermolecular O—H...O and N—H...O hydrogen bonds.

  9. Pro-inflammatory wnt5a and anti-inflammatory sFRP5 are differentially regulated by nutritional factors in obese human subjects.

    Directory of Open Access Journals (Sweden)

    Dominik M Schulte

    Full Text Available Obesity is associated with macrophage infiltration of adipose tissue. These inflammatory cells affect adipocytes not only by classical cytokines but also by the secreted glycopeptide wnt5a. Healthy adipocytes are able to release the wnt5a inhibitor sFRP5. This protective effect, however, was found to be diminished in obesity. The aim of the present study was to examine (1 whether obese human subjects exhibit increased serum concentrations of wnt5a and (2 whether wnt5a and/or sFRP5 serum concentrations in obese subjects can be influenced by caloric restriction.23 obese human subjects (BMI 44.1 ± 1.1 kg/m(2 and 12 age- and sex-matched lean controls (BMI 22.3 ± 0.4 kg/m(2 were included in the study. Obese subjects were treated with a very low-calorie diet (approximately 800 kcal/d for 12 weeks. Body composition was assessed by impedance analysis, insulin sensitivity was estimated by HOMA-IR and the leptin-to-adiponectin ratio and wnt5a and sFRP5 serum concentrations were measured by ELISA. sFRP5 expression in human adipose tissue biopsies was further determined on protein level by immunohistology.Pro-inflammatory wnt5a was not measurable in any serum sample of lean control subjects. In patients with obesity, however, wnt5a became significantly detectable consistent with low grade inflammation in such subjects. Caloric restriction resulted in a weight loss from 131.9 ± 4.0 to 112.3 ± 3.2 kg in the obese patients group. This was accompanied by a significant decrease of HOMA-IR and leptin-to-adiponectin ratio, indicating improved insulin sensitivity. Interestingly, these metabolic improvements were associated with a significant increase in serum concentrations of the anti-inflammatory factor and wnt5a-inhibitor sFRP5.Obesity is associated with elevated serum levels of pro-inflammatory wnt5a in humans. Furthermore, caloric restriction beneficially affects serum concentrations of anti-inflammatory sFRP5 in such subjects. These findings suggest a

  10. Computing Optical Variable Periods of BL Lac Object S5 0716+714 ...

    Indian Academy of Sciences (India)

    2016-01-27

    Jan 27, 2016 ... From a large volume of literature, we have collected effective observation of BL Lac object S5 0716+714 in the optical band, and constructed its long-term light curve from 1994 to 2006 AD. The light curve shows that S5 0716+714 is very active and exhibits very complicated non-sinusoidal variations.

  11. Acetyl coenzyme A synthetase is acetylated on multiple lysine residues by a protein acetyltransferase with a single Gcn5-type N-acetyltransferase (GNAT) domain in Saccharopolyspora erythraea.

    Science.gov (United States)

    You, Di; Yao, Li-Li; Huang, Dan; Escalante-Semerena, Jorge C; Ye, Bang-Ce

    2014-09-01

    Reversible lysine acetylation (RLA) is used by cells of all domains of life to modulate protein function. To date, bacterial acetylation/deacetylation systems have been studied in a few bacteria (e.g., Salmonella enterica, Bacillus subtilis, Escherichia coli, Erwinia amylovora, Mycobacterium tuberculosis, and Geobacillus kaustophilus), but little is known about RLA in antibiotic-producing actinomycetes. Here, we identify the Gcn5-like protein acetyltransferase AcuA of Saccharopolyspora erythraea (SacAcuA, SACE_5148) as the enzyme responsible for the acetylation of the AMP-forming acetyl coenzyme A synthetase (SacAcsA, SACE_2375). Acetylated SacAcsA was deacetylated by a sirtuin-type NAD(+)-dependent consuming deacetylase (SacSrtN, SACE_3798). In vitro acetylation/deacetylation of SacAcsA enzyme was studied by Western blotting, and acetylation of lysine residues Lys(237), Lys(380), Lys(611), and Lys(628) was confirmed by mass spectrometry. In a strain devoid of SacAcuA, none of the above-mentioned Lys residues of SacAcsA was acetylated. To our knowledge, the ability of SacAcuA to acetylate multiple Lys residues is unique among AcuA-type acetyltransferases. Results from site-specific mutagenesis experiments showed that the activity of SacAcsA was controlled by lysine acetylation. Lastly, immunoprecipitation data showed that in vivo acetylation of SacAcsA was influenced by glucose and acetate availability. These results suggested that reversible acetylation may also be a conserved regulatory posttranslational modification strategy in antibiotic-producing actinomycetes. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  12. Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Garrett, R A

    1981-01-01

    The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....

  13. Nanostructured Titanium-10 wt% 45S5 Bioglass-Ag Composite Foams for Medical Applications

    Directory of Open Access Journals (Sweden)

    Karolina Jurczyk

    2015-03-01

    Full Text Available The article presents an investigation on the effectiveness of nanostructured titanium-10 wt% 45S5 Bioglass-1 wt% Ag composite foams as a novel class of antibacterial materials for medical applications. The Ti-based composite foams were prepared by the combination of mechanical alloying and a “space-holder” sintering process. In the first step, the Ti-10 wt% 45S5 Bioglass-1 wt% Ag powder synthesized by mechanical alloying and annealing mixed with 1.0 mm diameter of saccharose crystals was finally compacted in the form of pellets. In the next step, the saccharose crystals were dissolved in water, leaving open spaces surrounded by metallic-bioceramic scaffold. The sintering of the scaffold leads to foam formation. It was found that 1:1 Ti-10 wt% 45S5 Bioglass-1 wt% Ag/sugar ratio leads to porosities of about 70% with pore diameter of about 0.3–1.1 mm. The microstructure, corrosion resistance in Ringer’s solution of the produced foams were investigated. The value of the compression strength for the Ti-10 wt% 45S5 Bioglass-1 wt% Ag foam with 70% porosity was 1.5 MPa and the Young’s modulus was 34 MPa. Silver modified Ti-10 wt% 45S5 Bioglass composites possess excellent antibacterial activities against Staphylococcus aureus. Porous Ti-10 wt% 45S5 Bioglass-1 wt% foam could be a possible candidate for medical implants applications.

  14. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  15. [Effects of grape seed addition in swine manure-wheat straw composting on the compost microbial community and carbon and nitrogen contents].

    Science.gov (United States)

    Huang, Yi-Mei; Liu, Xue-Ling; Jiang, Ji-Shao; Huang, Hua; Liu, Dong

    2012-08-01

    Taking substrates swine manure and wheat straw (fresh mass ratio 10.5:1) as the control (PMW), a composting experiment was conducted in a self-made aerated static composting bin to study the effects of adding 8% grape seed (treatment PMW + G) on the succession of microbial community and the transformation of carbon and nitrogen in the substrates during the composting. Seven samples were collected from each treatment, according to the temperature of the compost during the 30 d composting period. The microbial population and physiological groups were determined, and the NH4(+)-N, NO3(-)-N, organic N, and organic C concentrations in the compost were measured. Grape seed addition induced a slight increase of bacterial count and a significant increase of actinomycetes count, but decreased the fungal count significantly. Grape seed addition also decreased the ratio of bacteria to actinomycetes and the counts of ammonifiers and denitrifiers, but increased the counts of nitrifiers, N-fixing bacteria, and cellulose-decomposing microorganisms. The contents of NH4(+)-N and organic C decreased, while that of NO3(-)-N increased obviously. The NO3(-)-N content in the compost was positively correlated with the actinomycetes count. During composting, the compost temperature in treatment PMW + G increased more rapidly, and remained steady in thermophilic phase, while the water content changed little, which provided a stable and higher population of actinomycetes and nitrifiers in thermophilic phase, being beneficial to the increase of compost nitrate N.

  16. 5'S implementation in warehouse and improving stock management using MRP

    OpenAIRE

    Silva, Pedro Miguel Menino

    2016-01-01

    A presente dissertação, intitulada “Implementação dos 5S no armazém de peças e do MRP na gestão de stocks”, decorreu no âmbito do estágio curricular do 5º ano do Mestrado em Engenharia e Gestão Industrial da Universidade de Coimbra. O projeto, proposto pela Sociedade da Água de Luso (SAL), consiste na implementação da metodologia dos 5S, no armazém de peças de apoio à manutenção das linhas de enchimento e, posteriormente, na implementação do Material Requirement Planning (MRP), na ajuda ...

  17. Quaternary rare-earth sulfides RE{sub 3}M{sub 0.5}GeS{sub 7} (RE=La–Nd, Sm; M=Co, Ni) and Y{sub 3}Pd{sub 0.5}SiS{sub 7}

    Energy Technology Data Exchange (ETDEWEB)

    Iyer, Abishek K. [Department of Chemistry, University of Alberta, Edmonton, Alberta, Canada T6G 2G2 (Canada); Yin, Wenlong [Department of Chemistry, University of Alberta, Edmonton, Alberta, Canada T6G 2G2 (Canada); Institute of Chemical Materials, China Academy of Engineering Physics, Mianyang 621900 (China); Lee, Emma J. [Department of Chemistry, University of Alberta, Edmonton, Alberta, Canada T6G 2G2 (Canada); Lin, Xinsong [Centre for Oil Sands Sustainability, Northern Alberta Institute of Technology, Edmonton, Alberta, Canada T6N 1E5 (Canada); Mar, Arthur, E-mail: arthur.mar@ualberta.ca [Department of Chemistry, University of Alberta, Edmonton, Alberta, Canada T6G 2G2 (Canada)

    2017-06-15

    The two metal-deficient series of quaternary Ge-containing sulfides RE{sub 3}M{sub 0.5}GeS{sub 7} (RE = La–Nd, Sm; M = Co, Ni), as well as the related Si-containing sulfide Y{sub 3}Pd{sub 0.5}SiS{sub 7}, were prepared by reactions of the elements at 1050 °C. Single-crystal X-ray diffraction analysis performed on all compounds confirmed noncentrosymmetric hexagonal structures (space group P6{sub 3}, Z =2) with cell parameters in the ranges of a =10.0–10.3 Å and c =5.7–5.8 Å for RE{sub 3}Co{sub 0.5}GeS{sub 7} and RE{sub 3}Ni{sub 0.5}GeS{sub 7}, or a =9.7891(3) Å and c =5.6840(4) Å for Y{sub 3}Pd{sub 0.5}SiS{sub 7}. They are classified as La{sub 3}Mn{sub 0.5}SiS{sub 7}-type structures, with M atoms centred within octahedra (in contrast to La{sub 3}CuSiS{sub 7}-type structures in which M atoms occupy trigonal planar sites) and Ge atoms centred within tetrahedra, both types of polyhedra being arranged in one-dimensional stacks aligned along the c-direction. Charge balance requirements dictate half-occupancy of the M sites. However, bond valence sum arguments indicated that the M atoms are somewhat underbonded within these octahedral sites, so that there is evidence that in some compounds, they can also enter the trigonal planar site at low occupancy (~5%). Magnetic measurements on RE{sub 3}Co{sub 0.5}GeS{sub 7} (RE = Ce, Pr, Sm) revealed paramagnetic behaviour for the Ce and Pr members and apparent antiferromagnetic ordering (T{sub N} =14 K) for the Sm member; fitting to the Curie-Weiss law gave effective magnetic moments consistent with the presence of RE{sup 3+} and Co{sup 2+} species. Band structure calculations on ordered models of La{sub 3}M{sub 0.5}GeS{sub 7} (M = Co, Ni) showed that the Fermi level cuts through M 3d states in the DOS curve and supported the presence of strong M–S and Ge–S bonding interactions. - Graphical abstract: RE{sub 3}M{sub 0.5}GeS{sub 7} (M = Co, Ni) and Y{sub 3}Pd{sub 0.5}SiS{sub 7} contain M atoms partially occupying

  18. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    Science.gov (United States)

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Crystal structures of two eukaryotic nucleases involved in RNA metabolism

    DEFF Research Database (Denmark)

    Jonstrup, Anette Thyssen; Midtgaard, Søren Fuglsang; Van, Lan Bich

    RNA serves a number of functions in the cell: mRNAs are the carriers of information between gene and protein, tRNAs and rRNAs are involved in the synthesis of proteins, whereas a number of additional RNA species are responsible for other functions in the cell. The quality of the different RNAs...... RNAs. We have solved the structures of two nucleases involved in 3'-5' degradation of RNA; the S. pombe Pop2p and the S. cerevisiae Rrp6p. Pop2p is part of the main cytoplasmatic deadenylation complex in yeast, which also contains the nuclease Ccr4p. Deadenylation, where the poly(A)-tail is removed...... specific transcripts. Here, we present the crystal structure of the S. pombe Pop2p protein to 1.4 Å resolution. The high resolution structure provides a clear picture of the active site architecture. Structural alignment of single nucleotides and poly(A)-oligonucleotides from earlier co-crystal structures...

  20. Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.

    Science.gov (United States)

    Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

    2015-11-17

    rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.

  1. Fabrication and characterization of biomorphic 45S5 bioglass scaffold from sugarcane

    International Nuclear Information System (INIS)

    Qian Junmin; Kang Yahong; Wei Zilin; Zhang Wei

    2009-01-01

    A biomorphic 45S5 bioglass scaffold has been fabricated from natural plant sugarcane successfully by a novel biotemplating process. Scanning electron microscopy (SEM), X-ray powder diffraction (XRD), Fourier-transform infrared spectroscopy (FTIR), and thermogravimetry and differential scanning calorimetry (TG-DSC) technologies were employed to characterize the morphology, phase and chemical composition of the products. Experimental results show that the as-fabricated 45S5 bioglass scaffold retained the microstructure of sugarcane very well, and consisted of major crystal phase Na 2 Ca 2 Si 3 O 9 of hexagonal system, secondary crystal phase orthorhombic NaCaPO 4 and amorphous glass. The biomorphic 45S5 bioglass scaffold may be a promising candidate scaffold for bone tissue engineering.

  2. EKSPLORASI AKTINOMISET SEBAGAI PENGHASIL ANTIBIOTIKA DARI TANAH MANGROVE Sonneratia caseolaris DI TANJUNG API API

    Directory of Open Access Journals (Sweden)

    Awalul Fatiqin

    2015-08-01

    Full Text Available Actinomycetes are soil organisms that have traits that are common to bacteria and fungi but also have quite different characteristics that limit into one group which is distinctly different. Study aimed to explore the mangrove actinomycetes from soil and tested the antibacterial potency. Soil samples taken from the mangrove land at Tanjung Api-api mangrove species Sonneratia caseolaris. Activity test antibacterial using a method modified disk a test bacterium Escherichia coli. Identification isolates of actinomycetes by observing the character of macroscopic colonies, microscopic conidia. The results showed that the obtained three different actinomycetes isolates, 1 isolate has the most potential ability to inhibit bacterial growth test with an average value of 1:13 cm in inhibiting the bacteria Escherichia coli.

  3. Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

    Science.gov (United States)

    Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

    2018-04-06

    Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

  4. q-Poincaré supersymmetry in AdS5/CFT4

    Science.gov (United States)

    Borsato, Riccardo; Torrielli, Alessandro

    2018-03-01

    We consider the exact S-matrix governing the planar spectral problem for strings on AdS5 ×S5 and N = 4 super Yang-Mills, and we show that it is invariant under a novel "boost" symmetry, which acts as a differentiation with respect to the particle momentum. This generator leads us also to reinterpret the usual centrally extended psu (2 | 2) symmetry, and to conclude that the S-matrix is invariant under a q-Poincaré supersymmetry algebra, where the deformation parameter is related to the 't Hooft coupling. We determine the two-particle action (coproduct) that turns out to be non-local, and study the property of the new symmetry under crossing transformations. We look at both the strong-coupling (large tension in the string theory) and weak-coupling (spin-chain description of the gauge theory) limits; in the former regime we calculate the cobracket utilising the universal classical r-matrix of Beisert and Spill. In the eventuality that the boost has higher partners, we also construct a quantum affine version of 2D Poincaré symmetry, by contraction of the quantum affine algebra Uq (sl2 ˆ) in Drinfeld's second realisation.

  5. q-Poincaré supersymmetry in AdS5/CFT4

    Directory of Open Access Journals (Sweden)

    Riccardo Borsato

    2018-03-01

    Full Text Available We consider the exact S-matrix governing the planar spectral problem for strings on AdS5×S5 and N=4 super Yang–Mills, and we show that it is invariant under a novel “boost” symmetry, which acts as a differentiation with respect to the particle momentum. This generator leads us also to reinterpret the usual centrally extended psu(2|2 symmetry, and to conclude that the S-matrix is invariant under a q-Poincaré supersymmetry algebra, where the deformation parameter is related to the 't Hooft coupling. We determine the two-particle action (coproduct that turns out to be non-local, and study the property of the new symmetry under crossing transformations. We look at both the strong-coupling (large tension in the string theory and weak-coupling (spin-chain description of the gauge theory limits; in the former regime we calculate the cobracket utilising the universal classical r-matrix of Beisert and Spill. In the eventuality that the boost has higher partners, we also construct a quantum affine version of 2D Poincaré symmetry, by contraction of the quantum affine algebra Uq(sl2ˆ in Drinfeld's second realisation.

  6. Methylation of 23S rRNA nucleotide G748 by RlmAII methyltransferase renders Streptococcus pneumoniae telithromycin susceptible.

    Science.gov (United States)

    Takaya, Akiko; Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko

    2013-08-01

    Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmA(II), which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmA(II) to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmA(II) renders S. pneumoniae TEL susceptible.

  7. Biosynthesis of tert-butyl (3R,5S)-6-chloro-3,5-dihydroxyhexanoate by carbonyl reductase from Rhodosporidium toruloides in mono and biphasic media.

    Science.gov (United States)

    Liu, Zhi-Qiang; Wu, Lin; Zheng, Ling; Wang, Wen-Zhong; Zhang, Xiao-Jian; Jin, Li-Qun; Zheng, Yu-Guo

    2018-02-01

    tert-Butyl (3R,5S)-6-chloro-3,5-dihydroxyhexanoate ((3R,5S)-CDHH) is the key intermediate for synthesis of atorvastatin and rosuvastatin. Carbonyl reductase exhibits excellent activity toward tert-butyl (S)-6-chloro-5-hydroxy-3-oxohexanoate ((S)-CHOH) to synthesize (3R,5S)-CDHH. In this study, a whole cell biosynthesis reaction system to produce (3R,5S)-CDHH was constructed in organic solvents. A solution of 10% (v/v) Tween-80 was introduced to the reaction system as a co-solvent, which greatly enhanced biotransformation process, giving 98.9% yield, >99% ee and 1.8-fold higher space time yield in 5 h bioconversion of 1 M (S)-CHOH, compared with 98.7% yield and >99% ee in 9 h bioconversion of a purely aqueous reaction system. Moreover, a water-octanol biphasic reaction system was built and 20% of octanol was added as reservoir of substrate resulting in 98% yield, >99% ee and 4.08 mmol L -1  h -1  g -1 (wet cell weight) space time yield. This study paved a way for the whole cell biosynthesis of (3R,5S)-CDHH in mono and biphasic media. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Enhanced Photocatalytic Hydrogen Evolution by Loading Cd0.5Zn0.5S QDs onto Ni2P Porous Nanosheets.

    Science.gov (United States)

    Xiao, Lingfeng; Su, Tong; Wang, Zhuo; Zhang, Kun; Peng, Xiaoniu; Han, Yibo; Li, Quan; Wang, Xina

    2018-02-02

    Ni 2 P has been decorated on CdS nanowires or nanorods for efficient photocatalytic H 2 production, whereas the specific surface area remains limited because of the large size. Here, the composites of Cd 0.5 Zn 0.5 S quantum dots (QDs) on thin Ni 2 P porous nanosheets with high specific surface area were constructed for noble metal-free photocatalytic H 2 generation. The porous Ni 2 P nanosheets, which were formed by the interconnection of 15-30 nm-sized Ni 2 P nanoparticles, allowed the uniform loading of 7 nm-sized Cd 0.5 Zn 0.5 S QDs and the loading density being controllable. By tuning the content of Ni 2 P, H 2 generation rates of 43.3 μM h - 1 (1 mg photocatalyst) and 700 μM h - 1 (100 mg photocatalyst) and a solar to hydrogen efficiency of 1.5% were achieved for the Ni 2 P-Cd 0.5 Zn 0.5 S composites. The effect of Ni 2 P content on the light absorption, photoluminescence, and electrochemical property of the composite was systematically studied. Together with the band structure calculation based on density functional theory, the promotion of Ni 2 P in charge transfer and HER activity together with the shading effect on light absorption were revealed. Such a strategy can be applied to other photocatalysts toward efficient solar hydrogen generation.

  9. Enhanced Photocatalytic Hydrogen Evolution by Loading Cd0.5Zn0.5S QDs onto Ni2P Porous Nanosheets

    Science.gov (United States)

    Xiao, Lingfeng; Su, Tong; Wang, Zhuo; Zhang, Kun; Peng, Xiaoniu; Han, Yibo; Li, Quan; Wang, Xina

    2018-02-01

    Ni2P has been decorated on CdS nanowires or nanorods for efficient photocatalytic H2 production, whereas the specific surface area remains limited because of the large size. Here, the composites of Cd0.5Zn0.5S quantum dots (QDs) on thin Ni2P porous nanosheets with high specific surface area were constructed for noble metal-free photocatalytic H2 generation. The porous Ni2P nanosheets, which were formed by the interconnection of 15-30 nm-sized Ni2P nanoparticles, allowed the uniform loading of 7 nm-sized Cd0.5Zn0.5S QDs and the loading density being controllable. By tuning the content of Ni2P, H2 generation rates of 43.3 μM h- 1 (1 mg photocatalyst) and 700 μM h- 1 (100 mg photocatalyst) and a solar to hydrogen efficiency of 1.5% were achieved for the Ni2P-Cd0.5Zn0.5S composites. The effect of Ni2P content on the light absorption, photoluminescence, and electrochemical property of the composite was systematically studied. Together with the band structure calculation based on density functional theory, the promotion of Ni2P in charge transfer and HER activity together with the shading effect on light absorption were revealed. Such a strategy can be applied to other photocatalysts toward efficient solar hydrogen generation.

  10. Synthesis, resolution and radioiodination of S(-)trans-5-hydroxy-2-[N-n-propyl-N-(3'-iodo-2'-propenyl)amino]tet ralin-S(-)trans-5-OH-PIPAT: a new dopamine D2-like receptor ligand

    International Nuclear Information System (INIS)

    Chumpradit, Sumalee; Meiping Kung; Vessotskie, Janet; Kung, H.F.

    1995-01-01

    A new dopamine D2-like receptor ligand, (R,S)trans-5-hydroxy-2-[N-n0propyl-N-(3'-iodo-2'-propeny)amino]tet ralin ((R,S)trans-5-OH-PIPAT,3), based on high affinity dopamine receptor agonist 5-hydroxy-2-[N,N-(di-n-propyl)-2-amino]tetralin (5-OH-DPAT,1), was prepared. The synthesis was achieved by a reductive amination of 5-methoxy-2-tetralone with n-propylamine, followed by N-alkylation, to afford 5-methoxy-N-propyl-N-2'-aminotetralin,7. Reduction of 7 with tributyltin hydride gave the tri-n-butyl tin derivative,8, which was converted to 9 by an iododemetalation reaction. Demethylation of 9 gave the desired compound, (R,S)trans-5-OH-PIPAT,3. The resolved (R) and (S)trans-5-OH-PIPAT,3 were also quantitatively prepared. (author)

  11. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    Science.gov (United States)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  12. Beam-foil lifetime measurements for some 5d10 nl and 5d96s6p levels of Pb IV

    International Nuclear Information System (INIS)

    Pinnington, E.H.; Ansbacher, W.; Tauheed, A.; Kernahan, J.A.

    1991-01-01

    The beam-foil technique was used to measure the lifetimes of the 5d 10 5f, 5g, 6d, 6h, 7p, 7d, 8s and 5d 9 6s6p (2) 0 , (3) 0 , (6) 0 , (14) 0 , (17) 0 levels of Pb IV. Correlated decay-curve analyses were used to correct for the effects of cascading in the case of the 5d 10 5f, 5g, 6d, and 7p levels. The numerical Coulomb approximation was used to calculate comparison values for the 5d 10 nl levels. The need for a more rigorous calculation for specific levels is discussed. (12 refs., fig., tab.)

  13. Quantum mechanically guided design of Co43Fe20Ta5.5X31.5 (X=B, Si, P, S) metallic glasses

    International Nuclear Information System (INIS)

    Hostert, C; Music, D; Schneider, J M; Bednarcik, J; Keckes, J

    2012-01-01

    A systematic ab initio molecular dynamics study was carried out to identify valence electron concentration and size induced changes on structure, elastic and magnetic properties for Co 43 Fe 20 Ta 5.5 X 31.5 (X=B, Si, P, S). Short range order, charge transfer and the bonding nature are analyzed by means of density of states, Bader decomposition and pair distribution function analysis. A clear trend of a decrease in density and bulk modulus as well as a weaker cohesion was observed as the valence electron concentration is increased by replacing B with Si and further with P and S. These changes may be understood based on increased interatomic distances, variations in coordination numbers and the electronic structure changes; as the valence electron concentration of X is increased the X bonding becomes more ionic, which disrupts the overall metallic interactions, leading to lower cohesion and stiffness. The highest magnetic moments for the transition metals are identified for X=S, despite the fact that the presence of X generally reduces the magnetic moment of Co. Furthermore, this study reveals an extended diagonal relationship between B and P within these amorphous alloys. Based on quantum mechanical data we identify composition induced changes in short range order, charge transfer and bonding nature and link them to density, elasticity and magnetism. The interplay between transition metal d band filling and s-d hybridization was identified to be a key materials design criterion. (paper)

  14. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

    Science.gov (United States)

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

    2016-12-01

    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  15. TFP5/TP5 peptide provides neuroprotection in the MPTP model of Parkinson′s disease

    Directory of Open Access Journals (Sweden)

    B K Binukumar

    2016-01-01

    Full Text Available Cyclin-dependent kinase 5 (Cdk5 is a member of the serine-threonine kinase family of cyclin-dependent kinases. Cdk5 is critical to normal mammalian nervous system development and plays important regulatory roles in multiple cellular functions. Recent evidence indicates that Cdk5 is inappropriately activated in several neurodegenerative conditions, including Parkinson′s disease (PD. PD is a chronic neurodegenerative disorder characterized by the loss of dopamine neurons in the substantia nigra, decreased striatal dopamine levels, and consequent extrapyramidal motor dysfunction. During neurotoxicity, p35 is cleaved to form p25. Binding of p25 with Cdk5 leads deregulation of Cdk5 resulting in number of neurodegenerative pathologies. To date, strategies to specifically inhibit Cdk5 hyperactivity have not been successful without affecting normal Cdk5 activity. Here we show that inhibition of p25/Cdk5 hyperactivation through TFP5/TP5, truncated 24-aa peptide derived from the Cdk5 activator p35 rescues nigrostriatal dopaminergic neurodegeneration induced by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP/MPP + in a mouse model of PD. TP5 peptide treatment also blocked dopamine depletion in the striatum and improved gait dysfunction after MPTP administration. The neuroprotective effect of TFP5/TP5 peptide is also associated with marked reduction in neuroinflammation and apoptosis. Here we show inhibition of Cdk5/p25-hyperactivation by TFP5/TP5 peptide, which identifies Cdk5/p25 as a potential therapeutic target to reduce neurodegeneration in PD.

  16. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    Science.gov (United States)

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first,