
Sample records for actinium 229

  1. Extraction of actinium with di-(2-ethylhexyl)phosphoric acid from hydrochloric and nitric acid solutions

    International Nuclear Information System (INIS)

    The extraction of actinium with HDEHP from Cl- and NO3- systems has been investigated. It was found that extraction of actinium from HCl solutions is much better than from HNO3 solutions. Stability constants of actinium complexes Ac(X-)+2 with Cl- and NO3- ligands were determined. Our results show that the actinium formed less stable complexes with Cl- than with NO3- ligands. 5 refs., 3 figs., 1 tab. (author)

  2. The sorption of polonium, actinium and protactinium onto geological materials

    International Nuclear Information System (INIS)

    This paper describes a combined experimental and modeling program of generic sorption studies to increase confidence in the performance assessment for a potential high-level radioactive waste repository in Japan. The sorption of polonium, actinium and protactinium onto geological materials has been investigated. Sorption of these radioelements onto bentonite, tuff and granodiorite from equilibrated de-ionized water was studied under reducing conditions at room temperature. In addition, the sorption of actinium and protactinium was investigated at 60 C. Thermodynamic chemical modeling was carried out to aid interpretation of the results

  3. Separation of Actinium 227 from the uranium minerals

    International Nuclear Information System (INIS)

    The purpose of this work was to separate Actinium 227, whose content is 18%, from the mineral carnotite found in Gomez Chihuahua mountain range in Mexico. The mineral before processing is is pre-concentrated and passed, first through anionic exchange resins, later the eluate obtained is passed through cationic resins. The resins were 20-50 MESH QOWEX and 100-200 MESH 50 X 8-20 in some cased 200-400 MESH AG 50W-X8, 1X8 in other cases. The eluates from the ionic exchange were electrodeposited on stainless steel polished disc cathode and platinum electrode as anode; under a current ODF 10mA for 2.5 to 5 hours and of 100mA for .5 of an hour. it was possible to identify the Actinium 227 by means of its descendents, TH-227 and RA-223, through alpha spectroscopy. Due to the radiochemical purity which the electro deposits were obtained the Actinium 227 was low and was not quantitatively determined. A large majority of the members of the natural radioactive series 3 were identified and even alpha energies reported in the literature with very low percentages of non-identified emissions were observed. We conclude that a more precise study is needed concerning ionic exchange and electrodeposit to obtain an Actinium 227 of radiochemical purity. (Author)

  4. Spectroscopic and computational investigation of actinium coordination chemistry. (United States)

    Ferrier, Maryline G; Batista, Enrique R; Berg, John M; Birnbaum, Eva R; Cross, Justin N; Engle, Jonathan W; La Pierre, Henry S; Kozimor, Stosh A; Lezama Pacheco, Juan S; Stein, Benjamin W; Stieber, S Chantal E; Wilson, Justin J


    Actinium-225 is a promising isotope for targeted-α therapy. Unfortunately, progress in developing chelators for medicinal applications has been hindered by a limited understanding of actinium chemistry. This knowledge gap is primarily associated with handling actinium, as it is highly radioactive and in short supply. Hence, Ac(III) reactivity is often inferred from the lanthanides and minor actinides (that is, Am, Cm), with limited success. Here we overcome these challenges and characterize actinium in HCl solutions using X-ray absorption spectroscopy and molecular dynamics density functional theory. The Ac-Cl and Ac-OH2O distances are measured to be 2.95(3) and 2.59(3) Å, respectively. The X-ray absorption spectroscopy comparisons between Ac(III) and Am(III) in HCl solutions indicate Ac(III) coordinates more inner-sphere Cl(1-) ligands (3.2±1.1) than Am(III) (0.8±0.3). These results imply diverse reactivity for the +3 actinides and highlight the unexpected and unique Ac(III) chemical behaviour. PMID:27531582

  5. Discovery of the actinium, thorium, protactinium, and uranium isotopes


    Fry, C; Thoennessen, M


    Currently, 31 actinium, 31 thorium, 28 protactinium, and 23 uranium isotopes have so far been observed; the discovery of these isotopes is discussed. For each isotope a brief summary of the first refereed publication, including the production and identification method, is presented.

  6. Production of high-purity radium-223 from legacy actinium-beryllium neutron sources. (United States)

    Soderquist, Chuck Z; McNamara, Bruce K; Fisher, Darrell R


    Radium-223 is a short-lived alpha-particle-emitting radionuclide with potential applications in cancer treatment. Research to develop new radiopharmaceuticals employing (223)Ra has been hindered by poor availability due to the small quantities of parent actinium-227 available world-wide. The purpose of this study was to develop innovative and cost-effective methods to obtain high-purity (223)Ra from (227)Ac. We obtained (227)Ac from two surplus actinium-beryllium neutron generators. We retrieved the actinium/beryllium buttons from the sources and dissolved them in a sulfuric-nitric acid solution. A crude actinium solid was recovered from the solution by coprecipitation with thorium fluoride, leaving beryllium in solution. The crude actinium was purified to provide about 40 milligrams of actinium nitrate using anion exchange in methanol-water-nitric acid solution. The purified actinium was then used to generate high-purity (223)Ra. We extracted (223)Ra using anion exchange in a methanol-water-nitric acid solution. After the radium was separated, actinium and thorium were then eluted from the column and dried for interim storage. This single-pass separation produces high purity, carrier-free (223)Ra product, and does not disturb the (227)Ac/(227)Th equilibrium. A high purity, carrier-free (227)Th was also obtained from the actinium using a similar anion exchange in nitric acid. These methods enable efficient production of (223)Ra for research and new alpha-emitter radiopharmaceutical development. PMID:22697483

  7. Radium, thorium, and actinium extraction from seawater using an improved manganese-oxide-coated fiber

    International Nuclear Information System (INIS)

    Laboratory experiments were conducted to determine the efficiency with which improved manganese-oxide-coated acrylic fibers extract radium, thorium, and actinium from seawater. Tests were made using surface seawater spiked with 227Ac, 227Th and 223Ra. For sample volumes of approximately 30 liters and flow rates up to 0.5 liters per minute, radium and actinium are removed quantitatively. Approximately 80-95% of the thorium is removed under these same conditions. (Auth.)

  8. Production of Actinium-225 via High Energy Proton Induced Spallation of Thorium-232

    International Nuclear Information System (INIS)

    The science of cancer research is currently expanding its use of alpha particle emitting radioisotopes. Coupled with the discovery and proliferation of molecular species that seek out and attach to tumors, new therapy and diagnostics are being developed to enhance the treatment of cancer and other diseases. This latest technology is commonly referred to as Alpha Immunotherapy (AIT). Actinium-225/Bismuth-213 is a parent/daughter alpha-emitting radioisotope pair that is highly sought after because of the potential for treating numerous diseases and its ability to be chemically compatible with many known and widely used carrier molecules (such as monoclonal antibodies and proteins/peptides). Unfortunately, the worldwide supply of actinium-225 is limited to about 1,000mCi annually and most of that is currently spoken for, thus limiting the ability of this radioisotope pair to enter into research and subsequently clinical trials. The route proposed herein utilizes high energy protons to produce actinium-225 via spallation of a thorium-232 target. As part of previous R and D efforts carried out at Argonne National Laboratory recently in support of the proposed US FRIB facility, it was shown that a very effective production mechanism for actinium-225 is spallation of thorium-232 by high energy proton beams. The base-line simulation for the production rate of actinium-225 by this reaction mechanism is 8E12 atoms per second at 200 MeV proton beam energy with 50 g/cm2 thorium target and 100 kW beam power. An irradiation of one actinium-225 half-life (10 days) produces ∼100 Ci of actinium-225. For a given beam current the reaction cross section increases slightly with energy to about 400 MeV and then decreases slightly for beam energies in the several GeV regime. The object of this effort is to refine the simulations at proton beam energies of 400 MeV and above up to about 8 GeV. Once completed, the simulations will be experimentally verified using 400 MeV and 8 GeV protons

  9. Production of Actinium-225 via High Energy Proton Induced Spallation of Thorium-232

    Energy Technology Data Exchange (ETDEWEB)

    Harvey, James T.; Nolen, Jerry; Vandergrift, George; Gomes, Itacil; Kroc, Tom; Horwitz, Phil; McAlister, Dan; Bowers, Del; Sullivan, Vivian; Greene, John


    The science of cancer research is currently expanding its use of alpha particle emitting radioisotopes. Coupled with the discovery and proliferation of molecular species that seek out and attach to tumors, new therapy and diagnostics are being developed to enhance the treatment of cancer and other diseases. This latest technology is commonly referred to as Alpha Immunotherapy (AIT). Actinium-225/Bismuth-213 is a parent/daughter alpha-emitting radioisotope pair that is highly sought after because of the potential for treating numerous diseases and its ability to be chemically compatible with many known and widely used carrier molecules (such as monoclonal antibodies and proteins/peptides). Unfortunately, the worldwide supply of actinium-225 is limited to about 1,000mCi annually and most of that is currently spoken for, thus limiting the ability of this radioisotope pair to enter into research and subsequently clinical trials. The route proposed herein utilizes high energy protons to produce actinium-225 via spallation of a thorium-232 target. As part of previous R and D efforts carried out at Argonne National Laboratory recently in support of the proposed US FRIB facility, it was shown that a very effective production mechanism for actinium-225 is spallation of thorium-232 by high energy proton beams. The base-line simulation for the production rate of actinium-225 by this reaction mechanism is 8E12 atoms per second at 200 MeV proton beam energy with 50 g/cm2 thorium target and 100 kW beam power. An irradiation of one actinium-225 half-life (10 days) produces {approx}100 Ci of actinium-225. For a given beam current the reaction cross section increases slightly with energy to about 400 MeV and then decreases slightly for beam energies in the several GeV regime. The object of this effort is to refine the simulations at proton beam energies of 400 MeV and above up to about 8 GeV. Once completed, the simulations will be experimentally verified using 400 MeV and 8 Ge

  10. 22 CFR 229.310 - Recruitment. (United States)


    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Recruitment. 229.310 Section 229.310 Foreign... and Recruitment Prohibited § 229.310 Recruitment. (a) Nondiscriminatory recruitment. A recipient to which §§ 229.300 through 229.310 apply shall not discriminate on the basis of sex in the recruitment...

  11. 49 CFR 229.17 - Accident reports. (United States)


    ... CFR part 225. ... 49 Transportation 4 2010-10-01 2010-10-01 false Accident reports. 229.17 Section 229.17..., DEPARTMENT OF TRANSPORTATION RAILROAD LOCOMOTIVE SAFETY STANDARDS General § 229.17 Accident reports. (a)...

  12. Neutron-Induced Fission of Actinium-227, Protactinium-231 and Neptunium-237: Mass Distribution

    International Nuclear Information System (INIS)

    Results of radiochemical studies on the mass distribution in the neutron-induced fission of actinium-227, protactinium-231 and neptunium-237 have been presented. This work has been carried out as part of a programme to determine the mass distribution in the fission of heavy elements as a function of Z and A. All irradiations have been carried out in the core of the swimming-pool type reactor APSARA with cadmium shielding wherever necessary. Relative yields of several fission product nuclides have been obtained by a method involving a comparison of the fission product activities from the respective targets with those formed from uranium-235 simultaneously irradiated. Thermal-neutron fission yields of uranium-235 have been assumed. These results indicate a predominantly asymmetric mass distribution in all the three cases, and also a distinct though small symmetric peak in the case of actinium-227. (author)

  13. A new method for the determination of low-level actinium-227 in geological samples

    International Nuclear Information System (INIS)

    We developed a new method for the determination of 227Ac in geological samples. The method uses extraction chromatographic techniques and alpha-spectrometry and is applicable for a range of natural matrices. Here we report on the procedure and results of the analysis of water (fresh and seawater) and rock samples. Water samples were acidified and rock samples underwent total dissolution via acid leaching. A DGA (N,N,N',N'-tetra-n-octyldiglycolamide) extraction chromatographic column was used for the separation of actinium. The actinium fraction was prepared for alpha spectrometric measurement via cerium fluoride micro-precipitation. Recoveries of actinium in water samples were 80 ± 8 % (number of analyses n = 14) and in rock samples 70 ± 12 % (n = 30). The minimum detectable activities (MDA) were 0.017-0.5 Bq kg-1 for both matrices. Rock sample 227Ac activities ranged from 0.17 to 8.3 Bq kg-1 and water sample activities ranged from below MDA values to 14 Bq kg-1of 227Ac. From the analysis of several standard rock and water samples with the method we found very good agreement between our results and certified values. (author)

  14. Reactor production of Thorium-229. (United States)

    Hogle, Susan; Boll, Rose Ann; Murphy, Karen; Denton, David; Owens, Allison; Haverlock, Tamara J; Garland, Marc; Mirzadeh, Saed


    Limited availability of (229)Th for clinical applications of (213)Bi necessitates investigation of alternative production routes. In reactor production, (229)Th is produced from neutron transmutation of (226)Ra, (228)Ra, (227)Ac and (228)Th. Irradiations of (226)Ra, (228)Ra, and (227)Ac targets at the Oak Ridge National Laboratory High Flux Isotope Reactor result in yields of (229)Th at 26 days of 74.0±7.4MBq/g, 260±10MBq/g, and 1200±50MBq/g, respectively. Intermediate radionuclide yields and cross sections are also studied. PMID:27163437

  15. Analysis of the gamma spectra of the uranium, actinium, and thorium decay series

    Energy Technology Data Exchange (ETDEWEB)

    Momeni, M.H.


    This report describes the identification of radionuclides in the uranium, actinium, and thorium series by analysis of gamma spectra in the energy range of 40 to 1400 keV. Energies and absolute efficiencies for each gamma line were measured by means of a high-resolution germanium detector and compared with those in the literature. A gamma spectroscopy method, which utilizes an on-line computer for deconvolution of spectra, search and identification of each line, and estimation of activity for each radionuclide, was used to analyze soil and uranium tailings, and ore.

  16. Analysis of the gamma spectra of the uranium, actinium, and thorium decay series

    International Nuclear Information System (INIS)

    This report describes the identification of radionuclides in the uranium, actinium, and thorium series by analysis of gamma spectra in the energy range of 40 to 1400 keV. Energies and absolute efficiencies for each gamma line were measured by means of a high-resolution germanium detector and compared with those in the literature. A gamma spectroscopy method, which utilizes an on-line computer for deconvolution of spectra, search and identification of each line, and estimation of activity for each radionuclide, was used to analyze soil and uranium tailings, and ore

  17. 22 CFR 229.405 - Housing. (United States)


    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Housing. 229.405 Section 229.405 Foreign... Programs or Activities Prohibited § 229.405 Housing. (a) Generally. A recipient shall not, on the basis of... services or benefits related to housing, except as provided in this section (including housing...

  18. 22 CFR 229.500 - Employment. (United States)


    ... in Education Programs or Activities Prohibited § 229.500 Employment. (a) General. (1) No person shall... assistance. (2) A recipient shall make all employment decisions in any education program or activity operated... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Employment. 229.500 Section 229.500...

  19. 22 CFR 229.510 - Recruitment. (United States)


    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Recruitment. 229.510 Section 229.510 Foreign... in Education Programs or Activities Prohibited § 229.510 Recruitment. (a) Nondiscriminatory recruitment and hiring. A recipient shall not discriminate on the basis of sex in the recruitment and...

  20. 49 CFR 229.61 - Draft system. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Draft system. 229.61 Section 229.61 Transportation... TRANSPORTATION RAILROAD LOCOMOTIVE SAFETY STANDARDS Safety Requirements Draft System § 229.61 Draft system. (a) A.... Suspension System...

  1. 22 CFR 229.525 - Fringe benefits. (United States)


    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Fringe benefits. 229.525 Section 229.525... Employment in Education Programs or Activities Prohibited § 229.525 Fringe benefits. (a) “Fringe benefits” defined. For purposes of these Title IX regulations, fringe benefits means: Any medical,...

  2. 12 CFR 229.57 - Consumer awareness. (United States)


    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Consumer awareness. 229.57 Section 229.57 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM AVAILABILITY OF FUNDS AND COLLECTION OF CHECKS (REGULATION CC) Substitute Checks § 229.57 Consumer...

  3. 12 CFR 229.12 - Availability schedule. (United States)


    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Availability schedule. 229.12 Section 229.12... Availability Policies § 229.12 Availability schedule. (a) Effective date. The availability schedule contained...)(1)(vii). (e) Extension of schedule for certain deposits in Alaska, Hawaii, Puerto Rico, and the...

  4. 32 CFR 229.19 - Report. (United States)


    ... 32 National Defense 2 2010-07-01 2010-07-01 false Report. 229.19 Section 229.19 National Defense... ARCHAEOLOGICAL RESOURCES: UNIFORM REGULATIONS § 229.19 Report. (a) Each Federal land manager, when requested by... comply with section 13 of the Act and comprehensively report on activities carried out under...

  5. 49 CFR 234.229 - Shunting sensitivity. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Shunting sensitivity. 234.229 Section 234.229 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION..., Inspection, and Testing Maintenance Standards § 234.229 Shunting sensitivity. Each highway-rail...

  6. In-source laser spectroscopy developments at TRILIS—towards spectroscopy on actinium and scandium

    International Nuclear Information System (INIS)

    Resonance Ionization Laser Ion Sources (RILIS) have become a versatile tool for production and study of exotic nuclides at Isotope Separator On-Line (ISOL) facilities such as ISAC at TRIUMF. The recent development and addition of a grating tuned spectroscopy laser to the TRIUMF RILIS solid state laser system allows for wide range spectral scans to investigate atomic structures on short lived isotopes, e.g., those from the element actinium, produced in uranium targets at ISAC. In addition, development of new and improved laser ionization schemes for rare isotope production at ISAC is ongoing. Here spectroscopic studies on bound states, Rydberg states and autoionizing (AI) resonances on scandium using the existing off-line capabilities are reported. These results allowed to identify a suitable ionization scheme for scandium via excitation into an autoionizing state at 58,104 cm − 1 which has subsequently been used for ionization of on-line produced exotic scandium isotopes.

  7. 22 CFR 229.305 - Preference in admission. (United States)


    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Preference in admission. 229.305 Section 229... in Admission and Recruitment Prohibited § 229.305 Preference in admission. A recipient to which §§ 229.300 through 229.310 apply shall not give preference to applicants for admission, on the basis...

  8. Production of thorium-229 using helium nuclei (United States)

    Mirzadeh, Saed [Knoxville, TN; Garland, Marc Alan [Knoxville, TN


    A method for producing .sup.229Th includes the steps of providing .sup.226Ra as a target material, and bombarding the target material with alpha particles, helium-3, or neutrons to form .sup.229Th. When neutrons are used, the neutrons preferably include an epithermal neutron flux of at least 1.times.10.sup.13 n s.sup.-1cm.sup.-2. .sup.228Ra can also be bombarded with thermal and/or energetic neutrons to result in a neutron capture reaction to form .sup.229Th. Using .sup.230Th as a target material, .sup.229Th can be formed using neutron, gamma ray, proton or deuteron bombardment.

  9. 22 CFR 229.430 - Financial assistance. (United States)


    ... assist in the administration of scholarships, fellowships, or other forms of financial assistance... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Financial assistance. 229.430 Section 229.430... PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex...

  10. 49 CFR 229.64 - Plain bearings. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Plain bearings. 229.64 Section 229.64 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION....64 Plain bearings. A plain bearing box shall contain visible free oil and may not be cracked to...

  11. 49 CFR 229.69 - Side bearings. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Side bearings. 229.69 Section 229.69....69 Side bearings. (a) Friction side bearings with springs designed to carry weight may not have more than 25 percent of the springs in any one nest broken. (b) Friction side bearings may not be run...

  12. 49 CFR 229.55 - Piston travel. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Piston travel. 229.55 Section 229.55... Piston travel. (a) Brake cylinder piston travel shall be sufficient to provide brake shoe clearance when... piston travel may not exceed 11/2 inches less than the total possible piston travel. The total...

  13. 7 CFR 2.29 - Chief Economist. (United States)


    ... 7 Agriculture 1 2010-01-01 2010-01-01 false Chief Economist. 2.29 Section 2.29 Agriculture Office... Economist. (a) The following delegations of authority are made by the Secretary of Agriculture to the Chief Economist: (1) Related to economic analysis. (i) Coordinate economic analyses of, and review...

  14. 48 CFR 229.170-3 - Reports. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Reports. 229.170-3 Section... DEFENSE GENERAL CONTRACTING REQUIREMENTS TAXES General 229.170-3 Reports. The contracting officer shall submit a report to the designated Security Assistance Office when a foreign government or entity...

  15. 22 CFR 229.540 - Advertising. (United States)


    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Advertising. 229.540 Section 229.540 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in...

  16. Developments towards in-gas-jet laser spectroscopy studies of actinium isotopes at LISOL (United States)

    Raeder, S.; Bastin, B.; Block, M.; Creemers, P.; Delahaye, P.; Ferrer, R.; Fléchard, X.; Franchoo, S.; Ghys, L.; Gaffney, L. P.; Granados, C.; Heinke, R.; Hijazi, L.; Huyse, M.; Kron, T.; Kudryavtsev, Yu.; Laatiaoui, M.; Lecesne, N.; Luton, F.; Moore, I. D.; Martinez, Y.; Mogilevskiy, E.; Naubereit, P.; Piot, J.; Rothe, S.; Savajols, H.; Sels, S.; Sonnenschein, V.; Traykov, E.; Van Beveren, C.; Van den Bergh, P.; Van Duppen, P.; Wendt, K.; Zadvornaya, A.


    To study exotic nuclides at the borders of stability with laser ionization and spectroscopy techniques, highest efficiencies in combination with a high spectral resolution are required. These usually opposing requirements are reconciled by applying the in-gas-laser ionization and spectroscopy (IGLIS) technique in the supersonic gas jet produced by a de Laval nozzle installed at the exit of the stopping gas cell. Carrying out laser ionization in the low-temperature and low density supersonic gas jet eliminates pressure broadening, which will significantly improve the spectral resolution. This article presents the required modifications at the Leuven Isotope Separator On-Line (LISOL) facility that are needed for the first on-line studies of in-gas-jet laser spectroscopy. Different geometries for the gas outlet and extraction ion guides have been tested for their performance regarding the acceptance of laser ionized species as well as for their differential pumping capacities. The specifications and performance of the temporarily installed high repetition rate laser system, including a narrow bandwidth injection-locked Ti:sapphire laser, are discussed and first preliminary results on neutron-deficient actinium isotopes are presented indicating the high capability of this novel technique.

  17. Dicty_cDB: CFK229 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CF (Link to library) CFK229 (Link to dictyBase) - - - Contig-U15579-1 CFK229P (Link... to Original site) CFK229F 168 CFK229Z 401 CFK229P 549 - - Show CFK229 Library CF (Link to library) Clone ID CFK229 (Link to dict...yBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U15579-1 Original site URL http://dict...e 2001.11.22 Translated Amino Acid sequence yehlinktq*ksilfiyl**hymni*klenif*KLENIIKKRNKLIFNYKKK---*klenif*KLENIIKKRNKLIFNYKKK--- ---DXICTXXMXNV*xnlvk*vlxvxqxqxivmimihvxxixviqx*v

  18. 48 CFR 229.170-2 - Policy. (United States)


    ... DEFENSE GENERAL CONTRACTING REQUIREMENTS TAXES General 229.170-2 Policy. (a) By law, bilateral agreements....S. assistance programs shall be exempt from taxation by the foreign government. If taxes or...

  19. 49 CFR 229.105 - Steam generator number. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Steam generator number. 229.105 Section 229.105..., DEPARTMENT OF TRANSPORTATION RAILROAD LOCOMOTIVE SAFETY STANDARDS Safety Requirements Steam Generators § 229.105 Steam generator number. An identification number shall be marked on the steam...

  20. 48 CFR 252.229-7001 - Tax relief. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Tax relief. 252.229-7001... Clauses 252.229-7001 Tax relief. As prescribed in 229.402-70(a), use the following clause: Tax Relief (JUN 1997) (a) Prices set forth in this contract are exclusive of all taxes and duties from which the...

  1. 12 CFR 229.39 - lnsolvency of bank. (United States)


    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false lnsolvency of bank. 229.39 Section 229.39 Banks... AVAILABILITY OF FUNDS AND COLLECTION OF CHECKS (REGULATION CC) Collection of Checks § 229.39 lnsolvency of bank..., collecting, depositary, or returning bank that suspends payment, and which is not paid, shall be returned...

  2. 49 CFR 229.43 - Exhaust and battery gases. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Exhaust and battery gases. 229.43 Section 229.43... § 229.43 Exhaust and battery gases. (a) Products of combustion shall be released entirely outside the... conditions. (b) Battery containers shall be vented and batteries kept from gassing excessively....

  3. 49 CFR 229.213 - Locomotive manufacturing information. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Locomotive manufacturing information. 229.213 Section 229.213 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD... Design Requirements § 229.213 Locomotive manufacturing information. (a) Each railroad operating...

  4. 49 CFR 229.121 - Locomotive cab noise. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Locomotive cab noise. 229.121 Section 229.121... § 229.121 Locomotive cab noise. (a) Performance standards for locomotives. (1) When tested for static noise in accordance with paragraph (a)(3) of this section, all locomotives of each design or model...

  5. 7 CFR 58.229 - Filler and packaging equipment. (United States)


    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Filler and packaging equipment. 58.229 Section 58.229....229 Filler and packaging equipment. All filling and packaging equipment shall be of sanitary... equipment should comply with the 3-A Sanitary Standards for equipment for Packaging Dry Milk and Dry...

  6. 29 CFR 779.229 - Other arrangements. (United States)


    ..., Franchise and Other Business Arrangements § 779.229 Other arrangements. With respect to those arrangements...” establishment will be considered a part of the same “enterprise.” For example, whether a franchise, lease, or... the enterprise which grants the franchise, right, or concession. (S. Rept. 145, 87th Cong., 1st...

  7. Dicty_cDB: SLJ229 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Representative seq. ID SLJ22...9Z (Link to Original site) Representative DNA sequence >SLJ229 (SLJ229Q) /CSM/SL/SLJ2-B/SLJ229Q.Seq.d/ XXXXX...) Frame A: ---apstmkikiiapperkysvwiggsilaslstfqqmwiskeeydesgpsivhrkcf*t iktsdesashtnkyi*mynnnki*lflmvvdl...: 0.00 m_ : 1.00 44.0 %: cytoplasmic 28.0 %: mitochondrial 20.0 %: nuclear 4.0 %: plasma membrane 4.0 %: peroxisomal >> pre...yq Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits

  8. Track 8: health and radiological applications. Isotopes and radiation: general. 3. Extraction of 229Th from 233U for Medical Research Applications

    International Nuclear Information System (INIS)

    the handling of 233U. After separation, the thorium is transferred to the ORNL Radiochemical Development Laboratory (RDL) for decay and periodic extraction of actinium. The safety basis for the RMAL has recently been upgraded to allow the processing of batches containing up to 500 g of 233U. The 233U from Mound Laboratories was delivered in 20 packages, each containing 232U contamination ranges from 2 to 16 ppm. Individual packages of uranium oxide are transferred from the RDF to the RMAL, the package is opened, and the quantity of uranium is verified. The uranium oxide is dissolved in nitric acid, and the solution is adjusted to 8 M. The solution is passed over a Bio-Rad 1x4 anion exchange column at a rate of ∼5 ml/ min. Thorium and plutonium load on the column; uranium, radium, and actinium pass through. The column is washed with 8 M nitric acid to remove residual uranium. Thorium is then eluted from the resin with 0.1 M nitric acid. This solution, typically containing ∼4 mCi of 229Th, is transferred to the RDL for further purification and is then added to the existing thorium inventory. The uranium and acid wash solutions are combined and evaporated to 3O8 by heating in air to 800 deg. C. The oxide is sampled, weighed, packaged, and returned to storage in the RDF. In fiscal year 2000, the process was set up and two small batches of uranium, with 2 ppm 232U, were processed. Because of the low dose associated with this material and to allow refinements to the process, these initial batches were processed in a glove box. The process performed well, with more than 90% recovery of thorium. Just over 5 mCi of 229Th was added to the inventory. Funding already provided for fiscal year 2001 will allow the extraction of another 30 mCi of 229Th; if additional funding can be identified, a total of nearly 70 mCi can be separated by the end of the fiscal year. With this additional thorium, and with other improvements to the actinium extraction facilities at the RDL, the

  9. Dicty_cDB: CHO229 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHO229 (Link to dictyBase) - - - Contig-U15356-1 | Contig-U15914-1 CHO229P ... a novel protein, a ribosomal protein L29 (RPL29) (HIP , HUMRPL29) pseudogene and a CpG island. 38 0.047 7 ...

  10. 17 CFR 229.801 - Securities Act industry guides. (United States)


    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Securities Act industry guides. 229.801 Section 229.801 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION STANDARD INSTRUCTIONS FOR FILING FORMS UNDER SECURITIES ACT OF 1933, SECURITIES EXCHANGE ACT OF 1934 AND ENERGY POLICY AND CONSERVATION ACT OF...

  11. 17 CFR 229.802 - Exchange Act industry guides. (United States)


    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Exchange Act industry guides. 229.802 Section 229.802 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION STANDARD INSTRUCTIONS FOR FILING FORMS UNDER SECURITIES ACT OF 1933, SECURITIES EXCHANGE ACT OF 1934 AND ENERGY POLICY AND CONSERVATION ACT OF...

  12. 49 CFR 229.51 - Aluminum main reservoirs. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Aluminum main reservoirs. 229.51 Section 229.51... Aluminum main reservoirs. (a) Aluminum main reservoirs used on locomotives shall be designed and fabricated as follows: (1) The heads and shell shall be made of Aluminum Association Alloy No. 5083-0,...

  13. 40 CFR 229.2 - Transport of target vessels. (United States)


    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Transport of target vessels. 229.2... PERMITS § 229.2 Transport of target vessels. (a) The U.S. Navy is hereby granted a general permit to transport vessels from the United States or from any other location for the purpose of sinking such...

  14. 40 CFR 229.1 - Burial at sea. (United States)


    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Burial at sea. 229.1 Section 229.1... Burial at sea. (a) All persons subject to title I of the Act are hereby granted a general permit to... location for the purpose of burial at sea and to bury such remains at sea subject to the...

  15. 49 CFR 190.229 - Criminal penalties generally. (United States)


    ... 49 Transportation 3 2010-10-01 2010-10-01 false Criminal penalties generally. 190.229 Section 190... PROGRAMS AND RULEMAKING PROCEDURES Enforcement Criminal Penalties § 190.229 Criminal penalties generally... willfully and knowingly defaces, damages, removes, destroys any pipeline sign, right-of-way marker,...

  16. 48 CFR 229.402-70 - Additional clauses. (United States)


    ... performance will be in Spain. (f) Use the clause at 252.229-7006, Value Added Tax Exclusion (United Kingdom.... (i) Use the clause at 252.229-7009, Relief from Customs Duty and Value Added Tax on Fuel (Passenger... SYSTEM, DEPARTMENT OF DEFENSE GENERAL CONTRACTING REQUIREMENTS TAXES Contract Clauses...

  17. 49 CFR 229.139 - Sanitation, servicing requirements. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Sanitation, servicing requirements. 229.139... Cab Equipment § 229.139 Sanitation, servicing requirements. (a) The sanitation compartment of each... present that prevents waste from evacuating the bowl. (c) The sanitation compartment of each...

  18. 49 CFR 229.137 - Sanitation, general requirements. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Sanitation, general requirements. 229.137 Section... Cab Equipment § 229.137 Sanitation, general requirements. (a) Sanitation compartment. Except as provided in paragraph (b) of this section, all lead locomotives in use shall be equipped with a...

  19. 49 CFR 229.33 - Out-of-use credit. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Out-of-use credit. 229.33 Section 229.33... credit. When a locomotive is out of use for 30 or more consecutive days or is out of use when it is due... credit....

  20. 48 CFR 252.229-7002 - Customs exemptions (Germany). (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Customs exemptions... of Provisions And Clauses 252.229-7002 Customs exemptions (Germany). As prescribed in 229.402-70(b), use the following clause: Customs Exemptions (Germany) (JUN 1997) Imported products required for...

  1. New method for large scale production of medically applicable Actinium-225 and Radium-223

    International Nuclear Information System (INIS)

    Alpha-emitters (211At, 212Bi, 213Bi, 223Ra, 225Ac) are promising for targeted radiotherapy of cancer. Only two alpha decays near a cell membrane result in 50% death of cancer cell and only a single decay inside the cell is required for this. 225Ac may be used either directly or as a mother radionuclide in 213Bi isotope generator. Production of 225Ac is provided by three main suppliers - Institute for Transuranium Elements in Germany, Oak Ridge National Laboratory in USA and Institute of Physics and Power Engineering in Obninsk, Russia. The current worldwide production of 225Ac is approximately 1.7 Ci per year that corresponds to only 100-200 patients that could be treated annually. The common approach for 225Ac production is separation from mother 229Th or irradiation of 226Ra with protons in a cyclotron. Both the methods have some practical limitations to be applied routinely. 225Ac can be also produced by irradiation of natural thorium with medium energy protons . Cumulative cross sections of 225Ac, 227Ac, 227Th, 228Th formations have been obtained recently. Thorium targets (1-9 g) were irradiated by 114-91 MeV proton beam (1-50 μA) at INR linear accelerator. After dissolution in 8 M HNO3 + 0.004 M HF thorium was removed by double LLX by HDEHP in toluene (1:1). Ac and REE were pre-concentrated and separated from Ra and most fission products by DGA-Resin (Triskem). After washing out by 0.01 M HNO3 Ac was separated from REE by TRU Resin (Triskem) in 3 M HNO3 media. About 6 mCi 225Ac were separated in hot cell with chemical yield 85%. The method may be upscaled for production of Ci amounts of the radionuclide. The main impurity is 227Ac (0.1% at the EOB) but it does not hinder 225Ac from being used for medical 225Ac/213Bi generators. (author)

  2. Groundwater seepage from the Ranger uranium mine tailings dam: radioisotopes of radium, thorium and actinium. Supervising Scientist report 106

    International Nuclear Information System (INIS)

    Monitoring of bores near the Ranger uranium mine tailings dam has revealed deterioration in water quality in several bores since 1983. In a group of bores to the north of the dam, increases have been observed of up to 500 times for sulphate concentrations and of up to 5 times for 226Ra concentrations. Results are presented here of measurements of members of the uranium, thorium and actinium decay series in borewater samples collected between 1985 and 1993. In particular, measurements of all four naturally-occurring radium isotopes have been used in an investigation of the mechanism of radium concentration changes. For the most seepage-affected bores the major findings of the study include: 228Ra/226Ra 223Ra /226Ra and 224Ra/228Ra ratios all increased over the course of the study; barium concentrations show high seasonal variability, being lower in November than May, but strontium concentrations show a steady increase with time. Calculations show that the groundwater is probably saturated with respect to barite but not with respect to celestite or anglesite; sulphide concentrations are low in comparison with sulphate, and are higher in November than in May; and 227Ac concentrations have increased with time, but do not account for the high 223Ra/226Ra ratios. It is concluded on the basis of these observations that increases in Ra isotope concentrations observed in a number of seepage-affected bores arise from increases in salinity leading to desorption of radium from adsorption sites in the vicinity of the bore rather by direct transport of radium from the tailings. Increased salinity is also causing the observed increases in 227Ac and strontium concentrations, while formation of a barite solid phase in the groundwater is causing the removal of some radium from solution. This is the cause of the increasing radium isotope ratios noted above

  3. 48 CFR 252.229-7008 - Relief from import duty (United Kingdom). (United States)


    ... (United Kingdom). 252.229-7008 Section 252.229-7008 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.229-7008 Relief from import duty (United Kingdom). As prescribed in 229.402-70(h), use the following clause: Relief from Import Duty (United Kingdom) (JUN...

  4. 49 CFR 229.57 - Foundation brake gear. (United States)


    ..., DEPARTMENT OF TRANSPORTATION RAILROAD LOCOMOTIVE SAFETY STANDARDS Safety Requirements Brake System § 229.57... to the wheel to prevent localized thermal stress in the edge of the rim or the flange....

  5. 5 CFR 532.229 - Local wage survey committee. (United States)


    ... committee members, consideration shall be given to the requirement in the prevailing rate law for labor and... PREVAILING RATE SYSTEMS Prevailing Rate Determinations § 532.229 Local wage survey committee. (a)(1) A...

  6. 17 CFR 229.512 - (Item 512) Undertakings. (United States)


    ... statement to include any financial statements required by “Item 8.A. of Form 20-F (17 CFR 249.220f)” at the... with Item 1100(c)(1) of Regulation AB (17 CFR 229.1100(c)(1)) shall be deemed to be a new registration... CFR 229.1105), information provided in response to that Item pursuant to Rule 312 of Regulation...

  7. Dicty_cDB: SFF229 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SF (Link to library) SFF229 (Link to dictyBase) - - - Contig-U16287-1 SFF229Z (Link to Original ... equence. 42 4e-05 2 CF514038 |CF514038.1 CAbud0007_IVF _G07 Vitis vinifera cv. cabernet sauvignon (Clone 8 ... ) Bud - CABUD Vitis vinifera cDNA clone CAbud0007_IVF _G07 5', mRNA sequence. 60 4e-05 1 dna update 2003. ...

  8. The nuclear structure of 229Pa from the 231Pa(p,t)229Pa and 230Th(p,2nγ)229Pa reactions

    International Nuclear Information System (INIS)

    The level structure of the 229Pa nucleus has been investigated by means of the 231Pa(p,t)229Pa and 230Th(p,2nγ)229Pa reactions. Triton angular-distribution measurements were subjected to a CCBA analysis and combined with the results of in-beam conversion electron and γ-ray spectroscopy to establish a level scheme. Two low-lying bands of opposite parity were observed up to spins (23/2)- and (17/2)+, respectively. Rotational bands built on some 0+ excitations of the even-even core can be assigned. The lowest states of three further low-lying bands are observed. The level scheme is interpreted in terms of an octupole-deformed core with an unpaired proton. From the E1/E2 branching ratio the electric dipole moment can be deduced vertical stroke D0vertical stroke =(0.09 ±0.04) e .fm. ((orig.))

  9. Purify of MJ229 Chymosin%MJ229凝乳酶的纯化

    Institute of Scientific and Technical Information of China (English)



    Chymosin is one of the key enzymes during the production of cheese. With the development of cheese industry, chymosin made by traditional method is not sufficient for its production, so the researchers are looking for the new sources of cbymosin. MJ229 can produce chymosin, that was isolated from glutinous rice wine which was a traditional food in south of China. The enzyme liquor of MJ229 solid - state fermentation was concentrated through hollow fiber ultrafiltration membrane with aperture 60kDa and 6kDa during this experiment. The volume was concentrated 15. 6 times.The enzyme was purified 2. 15 times and the yield radio was 82. 6%. The concentration was purified by Sephadex G 100. The milk -clotting activity was 2200. 0U/mg after purification and it was confirmed by SDS - PAGE pattern that showed the chymosin was nearly purified with a molecular mass of 35.0kDa.%凝乳酶是干酪生产中的关键性酶,随着世界干酪工业的不断发展,传统来源的凝乳酶已远不能满足生产需要,各国研究者不断地寻找新的来源.MJ229是从我国传统食品江米酒酒醪中筛选得到的一株凝乳酶高产菌株.本实验利用截留分子量为60kDa和6kDa的中空纤维超滤膜对MJ229固态发酵物中凝乳酶的浸提液进行浓缩,浸提液体积被浓缩了15.6倍,凝乳酶纯化倍数达2.15倍,活力回收率为82.6%.进一步通过SephadexG-100纯化,得到电泳纯的凝乳酶,活力为2200.0U/mg,同时测得其分子量为35kDa.

  10. Electron capture decay of 58-min U-229(92) and levels in Pa-229(91)

    Energy Technology Data Exchange (ETDEWEB)

    Ahmad, I.; Chasman, R. R.; Greene, J. P.; Kondev, F. G.; Zhu, S.


    Electron capture decay of U-229 is investigated by measuring the gamma-ray and conversion electron spectra of mass-separated and unseparated U-229 sources with high-resolution germanium and silicon detectors, respectively. Gamma-gamma coincidence measurements are also performed using germanium detectors. These studies provide level energies and level ordering in Pa-229. Single-particle assignments are given to these levels which are in agreement with the systematics in this region and also with theory. In a previous study, we report the observation of a 5/2(+/-) parity doublet in the Pa-229 ground state, which is a signature of octupole deformation. The present analysis of the data still shows a splitting of 60 +/- 50 eV, but with this large uncertainty the existence of the doublet is not certain.

  11. Determination of the ^229Th isomer half-life (United States)

    Burke, Jason; Beck, Bret; Becker, John; Haydell, Michael; Norman, Rick; Scielzo, Nicholas; Sheets, Steven; Swanberg, Erik


    Recently there has been renewed interest in studying the nuclear properties of the ^229Th isomer. ^229Th has the lowest known isomer at 7.6 eV [1]. Direct laser manipulation of the ground and first excited states could lead to the realization of the world's first nuclear clock. To understand the linewidth of the isomeric state we are conducting experiments to directly observe the half-life of the isomer decay. We use a novel ``hot-atom'' technique in which we catch the recoiling ^229Th nuclei following the alpha decay of ^233U -> ^229Th + α. On average 2% of the ^229Th populate the isomeric 3/2+ state compared to the 5/2+ ground state. Recoils are collected on various catcher plate materials, rotated in vacuum in front of an einzel lense and multi-channel plate detector. The internal conversion electrons are counted as a function of time to determine the half-life. Varying the catcher plate material we can investigate the effect that the materials have on the half-life. Determination of the half-life we will provide valuable guidance to Th trapping research [2]. 1) Beck et al., PRL 98, 142501 (2007) 2) Campbell et al., PRL 102, 233004 (2009) This work performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.

  12. 33 CFR 110.229 - Straits of Juan de Fuca, Wash. (United States)


    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Straits of Juan de Fuca, Wash. 110.229 Section 110.229 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Anchorage Grounds § 110.229 Straits of Juan de Fuca, Wash. (a)...

  13. 49 CFR 173.229 - Chloric acid solution or chlorine dioxide hydrate, frozen. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Chloric acid solution or chlorine dioxide hydrate, frozen. 173.229 Section 173.229 Transportation Other Regulations Relating to Transportation PIPELINE AND... Than Class 1 and Class 7 § 173.229 Chloric acid solution or chlorine dioxide hydrate, frozen. When...

  14. 17 CFR 229.308 - (Item 308) Internal control over financial reporting. (United States)


    ... over financial reporting. 229.308 Section 229.308 Commodity and Securities Exchanges SECURITIES AND... § 229.308 (Item 308) Internal control over financial reporting. (a) Management's annual report on internal control over financial reporting. Provide a report of management on the registrant's...

  15. 17 CFR 229.308T - (Item 308T) Internal control over financial reporting. (United States)


    ... over financial reporting. 229.308T Section 229.308T Commodity and Securities Exchanges SECURITIES AND... § 229.308T (Item 308T) Internal control over financial reporting. Note to Item 308T: This is a special... internal control over financial reporting. Provide a report of management on the registrant's...

  16. 48 CFR 252.229-7010 - Relief from customs duty on fuel (United Kingdom). (United States)


    ... on fuel (United Kingdom). 252.229-7010 Section 252.229-7010 Federal Acquisition Regulations System... (United Kingdom). As prescribed in 229.402-70(j), use the following clause: Relief from Customs Duty on Fuel (United Kingdom) (JUN 1997) (a) Pursuant to an agreement between the United States Government...

  17. 50 CFR 229.33 - Harbor Porpoise Take Reduction Plan Regulations-New England. (United States)


    ... Regulations-New England. 229.33 Section 229.33 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE... Emergency Regulations § 229.33 Harbor Porpoise Take Reduction Plan Regulations—New England. (a) Restrictions... metric tons of landings. (5) Southern New England Management Area—(i) Area restrictions. From December...

  18. 17 CFR 229.1103 - (Item 1103) Transaction summary and risk factors. (United States)


    ... summary and risk factors. 229.1103 Section 229.1103 Commodity and Securities Exchanges SECURITIES AND... (Regulation AB) § 229.1103 (Item 1103) Transaction summary and risk factors. (a) Prospectus summary. In... be assigned. (b) Risk factors. In providing the information required by Item 503(c) of Regulation...

  19. 17 CFR 229.1112 - (Item 1112) Significant obligors of pool assets. (United States)


    ... obligors of pool assets. 229.1112 Section 229.1112 Commodity and Securities Exchanges SECURITIES AND... EXCHANGE ACT OF 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1112 (Item 1112) Significant obligors of pool assets. (a) Descriptive...

  20. 48 CFR 229.170 - Reporting of foreign taxation on U.S. assistance programs. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Reporting of foreign taxation on U.S. assistance programs. 229.170 Section 229.170 Federal Acquisition Regulations System... General 229.170 Reporting of foreign taxation on U.S. assistance programs....

  1. 49 CFR 229.75 - Wheels and tire defects. (United States)


    ..., DEPARTMENT OF TRANSPORTATION RAILROAD LOCOMOTIVE SAFETY STANDARDS Safety Requirements Suspension System § 229... in width. (c) A broken rim, if the tread, measured from the flange at a point five-eighths inch above... crack or break in the flange, tread, rim, plate, or hub. (l) A loose wheel or tire. (m) Fusion...

  2. 32 CFR 229.4 - Prohibited acts and criminal penalties. (United States)


    ... 32 National Defense 2 2010-07-01 2010-07-01 false Prohibited acts and criminal penalties. 229.4... and criminal penalties. (a) Under section 6(a) of the Act, no person may excavate, remove, damage, or..., regulation, ordinance, or permit in effect under any other provision of Federal law. (c) Under section (d)...

  3. 22 CFR 229.130 - Effect of employment opportunities. (United States)


    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Effect of employment opportunities. 229.130... Effect of employment opportunities. The obligation to comply with these Title IX regulations is not obviated or alleviated because employment opportunities in any occupation or profession are or may be...

  4. 36 CFR 223.229 - Contents of prospectus. (United States)


    ... AND DISPOSAL OF NATIONAL FOREST SYSTEM TIMBER Special Forest Products Advertisement and Bids § 223.229...: (a) The minimum acceptable value or unit price for a product and the amount or rate of any deposits required in addition to the unit price of a product; (b) The amount of the bid guarantee that...

  5. 17 CFR 229.406 - (Item 406) Code of ethics. (United States)


    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false (Item 406) Code of ethics. 229... 406) Code of ethics. (a) Disclose whether the registrant has adopted a code of ethics that applies to... code of ethics, explain why it has not done so. (b) For purposes of this Item 406, the term code...

  6. 48 CFR 229.101 - Resolving tax problems. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Resolving tax problems..., DEPARTMENT OF DEFENSE GENERAL CONTRACTING REQUIREMENTS TAXES General 229.101 Resolving tax problems. (a... Counsels of the Navy and Air Force, and for the Army, the Chief, Contract Law Division, Office of the...

  7. 50 CFR 229.5 - Requirements for Category III fisheries. (United States)


    ... Certificate. (b) Reporting. Vessel owners engaged in a Category III fishery must comply with the reporting... fishery must comply with the observer requirements specified under § 229.7(d). (e) Deterrence. When necessary to deter a marine mammal from damaging fishing gear, catch, or other private property, or...

  8. 50 CFR 229.35 - Bottlenose Dolphin Take Reduction Plan. (United States)


    ... National Oceanic and Atmospheric Administration (Coast Charts 1:80,000 scale), and as described in 33 CFR... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Bottlenose Dolphin Take Reduction Plan... § 229.35 Bottlenose Dolphin Take Reduction Plan. (a) Purpose and scope. The purpose of this section...

  9. 22 CFR 229.400 - Education programs or activities. (United States)


    ... SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 229.400 Education programs or activities... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Education programs or activities....

  10. 40 CFR 180.229 - Fluometuron; tolerances for residues. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Fluometuron; tolerances for residues...) PESTICIDE PROGRAMS TOLERANCES AND EXEMPTIONS FOR PESTICIDE CHEMICAL RESIDUES IN FOOD Specific Tolerances § 180.229 Fluometuron; tolerances for residues. (a) General. (1) Tolerances are established for...

  11. Dicty_cDB: CHS229 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHS229 (Link to dictyBase) - - - Contig-U15036-1 - (Link to Original site) ... ents: (bits) Value AM050060_1( AM050060 |pid:none) Azospirillum ... brasilense partial pu... 153 5e-38 CP000943_2544( ...

  12. Direct detection of the 229Th nuclear clock transition (United States)

    von der Wense, Lars; Seiferle, Benedict; Laatiaoui, Mustapha; Neumayr, Jürgen B.; Maier, Hans-Jörg; Wirth, Hans-Friedrich; Mokry, Christoph; Runke, Jörg; Eberhardt, Klaus; Düllmann, Christoph E.; Trautmann, Norbert G.; Thirolf, Peter G.


    Today’s most precise time and frequency measurements are performed with optical atomic clocks. However, it has been proposed that they could potentially be outperformed by a nuclear clock, which employs a nuclear transition instead of an atomic shell transition. There is only one known nuclear state that could serve as a nuclear clock using currently available technology, namely, the isomeric first excited state of 229Th (denoted 229mTh). Here we report the direct detection of this nuclear state, which is further confirmation of the existence of the isomer and lays the foundation for precise studies of its decay parameters. On the basis of this direct detection, the isomeric energy is constrained to between 6.3 and 18.3 electronvolts, and the half-life is found to be longer than 60 seconds for 229mTh2+. More precise determinations appear to be within reach, and would pave the way to the development of a nuclear frequency standard.

  13. CW, single-frequency 229nm laser source for Cd-cooling by harmonic conversion (United States)

    Kaneda, Yushi; Yarborough, J. M.; Merzlyak, Yevgeny


    More than 200mW of CW 229nm for Cd atom cooling application was generated by the 4th harmonic of a single frequency optically pumped semiconductor laser using a 10-mm long, Brewster-cut BBO crystal in an external cavity. With 650mW of 458nm input, 216mW of 229nm power was observed. Conversion efficiency from 458nm to 229nm was more than 33%.

  14. Dicty_cDB: SLG229 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Dictyostelium discoideum slug cDNA, clone SLG229. 313 e-120 2 ( AU052966 ) Dictyostelium discoideum slug cDN...A, clone SLF396. 313 e-107 4 ( AU053262 ) Dictyostelium discoideum slug cDNA, clone SLI263. 313 e-107 4 ( AU...034176 ) Dictyostelium discoideum slug cDNA, clone SLC144. 313 e-107 4 ( AU033450 ) Dictyostelium discoideum slug... cDNA, clone SLA841. 313 e-107 4 ( AU033594 ) Dictyostelium discoideum slug ...cDNA, clone SLB210. 313 e-107 4 ( AU039267 ) Dictyostelium discoideum slug cDNA, clone SLH314. 313 e-107 4 (

  15. Experiments towards optical nuclear spectroscopy with thorium-229

    Energy Technology Data Exchange (ETDEWEB)

    Zimmermann, Kai


    The discovery of the low-lying isomeric nuclear state of {sup 229}Th at 7.6{+-} 0.5 eV above the ground state opened a new field of research as a bridge between nuclear and atomic physics. Since indirect {gamma}-spectroscopy techniques were applied for detection of the isomeric state, the direct observation of the nuclear photon emission is still pending. This thesis describes the steps towards the direct observation of {sup 229m}Th. The first conducted experiments examine measurements of atoms in the isomeric state {sup 229m}Th being produced in the {alpha}-decay of {sup 229}U. Recoil atoms were ejected from a thin {sup 233}U source, accumulated in an absorber and analyzed for the emission of UV and VUV photons. No evidence for the decay of the isomeric state was found. The observed background signal has been identified as Cherenkov radiation. The main part of this theses describes the setup of a linear Paul trap with a high storage capacity that has been built and loaded with more than 8 . 10{sup 4} Th{sup +} ions using laser ablation loading. Laser ablation of thorium ions has been shown using a pulsed nitrogen laser at a wavelength of 337 nm, a pulse energy of 170 {mu}J and a pulse width of 4 ns in a time-of-flight mass spectrometer. The ratio of ablated Th{sup +} to Th{sup 2+} ions was investigated in relation to the laser pulse power. Th{sup +} ablation from a dried {sup 232}Th(NO{sub 3}){sub 4} solution has been shown from multiple substrate surfaces as a preparation for the loading of the more radioactive {sup 229}Th from a minimum amount of substance. The trapped ions were characterized by ion ejection and counting, electronic detection and optical detection methods. We investigated the loading conditions, trap potentials, the stored ion numbers, buffer gas cooling, the laser ablation velocity distribution, and the phase dependence of the radiofrequency field for the ion loading. Gas discharges were observed between the electrodes in the plasma created by

  16. 49 CFR Appendix D to Part 229 - Criteria for Certification of Crashworthy Event Recorder Memory Module (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Criteria for Certification of Crashworthy Event Recorder Memory Module D Appendix D to Part 229 Transportation Other Regulations Relating to Transportation... Memory Module Section 229.135(b) requires that certain locomotives be equipped with an event...

  17. 42 CFR 414.229 - Other durable medical equipment-capped rental items. (United States)


    ... 42 Public Health 3 2010-10-01 2010-10-01 false Other durable medical equipment-capped rental items. 414.229 Section 414.229 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICARE PROGRAM PAYMENT FOR PART B MEDICAL AND OTHER HEALTH...

  18. 20 CFR 229.22 - Beginning date of increase under overall minimum. (United States)


    ... social security earnings; or (4) The month the employee attains retirement age, if a DIB O/M was paid in the previous month. A DIB O/M is changed to an age O/M in the month the employee attains retirement... minimum. 229.22 Section 229.22 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER...

  19. 20 CFR 229.40 - When an annuity increase under the overall minimum ends. (United States)


    ... on age rather than disability, and the employee is under retirement age, the increase ends with the... the employee attains retirement age (the DIB O/M is changed to an age O/M); or (3) The second month... minimum ends. 229.40 Section 229.40 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER...

  20. 20 CFR 229.10 - What the social security overall minimum guarantee is. (United States)


    ... payable before the employee attains retirement age. An overall minimum may also be payable before age 62... guarantee is. 229.10 Section 229.10 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT SOCIAL SECURITY OVERALL MINIMUM GUARANTEE Social Security Overall Minimum...

  1. 40 CFR 52.229 - Control strategy and regulations: Photochemical oxidants (hydrocarbons), Metropolitan Los Angeles... (United States)


    ... 40 CFR 52.223 is retained. (ii) Rule 1115, Automotive Coatings, adopted on March 16, 1984 by the...: Photochemical oxidants (hydrocarbons), Metropolitan Los Angeles Intrastate Region. 52.229 Section 52.229... oxidants (hydrocarbons), Metropolitan Los Angeles Intrastate Region. (a) (b) The following rules...

  2. 17 CFR 229.1204 - (Item 1204) Oil and gas production, production prices and production costs. (United States)


    ... conversion to synthetic oil or gas, the product's production, transfer prices, and production costs should be... production, production prices and production costs. 229.1204 Section 229.1204 Commodity and Securities... production, production prices and production costs. (a) For each of the last three fiscal years...

  3. 40 CFR 264.229 - Special requirements for ignitable or reactive waste. (United States)


    ... reactive waste. 264.229 Section 264.229 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) STANDARDS FOR OWNERS AND OPERATORS OF HAZARDOUS WASTE TREATMENT, STORAGE... impoundment satisfy all applicable requirements of 40 CFR part 268, and: (a) The waste is treated,...

  4. 48 CFR 252.229-7006 - Value added tax exclusion (United Kingdom). (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Value added tax exclusion... CLAUSES Text of Provisions And Clauses 252.229-7006 Value added tax exclusion (United Kingdom). As prescribed in 229.402-70(f), use the following clause: Value Added Tax Exclusion (United Kingdom) (JUN...

  5. 42 CFR 435.229 - Optional targeted low-income children. (United States)


    ... 42 Public Health 4 2010-10-01 2010-10-01 false Optional targeted low-income children. 435.229... Coverage of Families and Children § 435.229 Optional targeted low-income children. The agency may provide Medicaid to— (a) All individuals under age 19 who are optional targeted low-income children as defined...

  6. 42 CFR 436.229 - Optional targeted low-income children. (United States)


    ... 42 Public Health 4 2010-10-01 2010-10-01 false Optional targeted low-income children. 436.229..., and Disabled Individuals, Including Pregnant Women § 436.229 Optional targeted low-income children. The agency may provide Medicaid to— (a) All individuals under age 19 who are optional targeted...

  7. 48 CFR 252.229-7000 - Invoices exclusive of taxes or duties. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Invoices exclusive of... CLAUSES Text of Provisions And Clauses 252.229-7000 Invoices exclusive of taxes or duties. As prescribed in 229.402-1, use the following clause: Invoices Exclusive of Taxes or Duties (JUN 1997)...

  8. 50 CFR 229.12 - Consultation with the Secretary of the Interior. (United States)


    ... Interior. 229.12 Section 229.12 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC... Secretary of the Interior. The Assistant Administrator will consult with the Secretary of the Interior prior... population stocks of marine mammals for which the Secretary of the Interior is responsible under the Act....

  9. 50 CFR 229.7 - Monitoring of incidental mortalities and serious injuries. (United States)


    ... serious injuries. 229.7 Section 229.7 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL... mortalities and serious injuries. (a) Purpose. The Assistant Administrator will establish a program to monitor incidental mortality and serious injury of marine mammals during the course of commercial fishing...

  10. 46 CFR 10.229 - Issuance of duplicate merchant mariner credentials. (United States)


    ... 46 Shipping 1 2010-10-01 2010-10-01 false Issuance of duplicate merchant mariner credentials. 10.229 Section 10.229 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY MERCHANT MARINE OFFICERS AND SEAMEN MERCHANT MARINER CREDENTIAL General Requirements for All Merchant Mariner Credentials §...

  11. Separation and estimation of 229Th and 233U by alpha and gamma ray spectrometric technique

    International Nuclear Information System (INIS)

    The individual estimation of 233U and 229Th in a plancheted source made out of liquid sample were done by using an alpha and γ-ray spectrometric techniques. Estimation of 229Th in the plancheted source was done by γ-ray spectrometry and 233U by alpha spectrometry after subtracting the estimated amount of 229Th. In spite of the same alpha energy of 4.8 MeV, the individual estimation of 233U and 229Th based on present technique is superior to conventional techniques and important in the 232Th-233U fuel reprocessing cycle of AHWR and ADSs. The activity of 229Th was also radiochemically separated from its parent activity of 233U by using an ion exchange resin and the purity was checked by the above mentioned technique. (author)

  12. 17 CFR 229.1114 - (Item 1114) Credit enhancement and other support, except for certain derivatives instruments. (United States)


    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false (Item 1114) Credit enhancement and other support, except for certain derivatives instruments. 229.1114 Section 229.1114 Commodity and...-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1114 (Item 1114) Credit enhancement and...

  13. 48 CFR 252.229-7009 - Relief from customs duty and value added tax on fuel (passenger vehicles) (United Kingdom). (United States)


    ... and value added tax on fuel (passenger vehicles) (United Kingdom). 252.229-7009 Section 252.229-7009... Relief from customs duty and value added tax on fuel (passenger vehicles) (United Kingdom). As prescribed in 229.402-70(i), use the following clause: Relief from Customs Duty and Value Added Tax on...

  14. Performance of a 229Thorium solid-state nuclear clock

    International Nuclear Information System (INIS)

    The 7.8 eV nuclear isomer transition in 229thorium has been suggested as a clock transition in a new type of optical frequency standard. Here we discuss the construction of a ‘solid-state nuclear clock’ from thorium nuclei implanted into single crystals transparent in the vacuum ultraviolet range. We investigate crystal-induced line shifts and broadening effects for the specific system of calcium fluoride. At liquid nitrogen temperatures, the clock performance will be limited by decoherence due to magnetic coupling of the thorium nuclei to neighboring nuclear moments, ruling out the commonly used Rabi or Ramsey interrogation schemes. We propose clock stabilization based on a fluorescence spectroscopy method and present optimized operation parameters. Taking advantage of the large number of quantum oscillators under continuous interrogation, a fractional instability level of 10−19 might be reached within the solid-state approach. (paper)

  15. Human Coronavirus 229E Binds to CD13 in Rafts and Enters the Cell through Caveolae


    Nomura, Ryuji; Kiyota, Asuka; Suzaki, Etsuko; Kataoka, Katsuko; Ohe, Yoshihide; Miyamoto, Kaoru; Senda, Takao; Fujimoto, Toyoshi


    CD13, a receptor for human coronavirus 229E (HCoV-229E), was identified as a major component of the Triton X-100-resistant membrane microdomain in human fibroblasts. The incubation of living fibroblasts with an anti-CD13 antibody on ice gave punctate labeling that was evenly distributed on the cell surface, but raising the temperature to 37°C before fixation caused aggregation of the labeling. The aggregated labeling of CD13 colocalized with caveolin-1 in most cells. The HCoV-229E virus parti...

  16. Continuous-wave, single-frequency 229 nm laser source for laser cooling of cadmium atoms


    Kaneda, Yushi; Yarborough, J. M.; Merzlyak, Yevgeny; Yamaguchi, Atsushi; Hayashida, Keitaro; Ohmae, Noriaki; Katori, Hidetoshi


    Continuous-wave output at 229 nm for the application of laser cooling of Cd atoms was generated by the 4th harmonic using two successive second harmonic generation stages. Employing a single-frequency optically pumped semiconductor laser as a fundamental source, 0.56 W of output at 229 nm was observed with a 10-mm long, Brewster-cut BBO crystal in an external cavity with 1.62 W of 458 nm input. Conversion efficiency from 458 nm to 229 nm was more than 34%. By applying a tapered amplifier as a...

  17. Does a 5/2+-5/2- ground-state parity doublet exist in 229Pa?

    International Nuclear Information System (INIS)

    The 1/2[530] decoupled band in 229Pa has been identified up to the 19/2- level in (p,t) and (p,2nγ) experiments. It is found that the 3/2- band head has an excitation energy of 19(10) keV, and can thus not be identified with a 123 keV level observed in the 229U electron capture decay. This removes the evidence presented earlier for a spin-parity assignment of 5/2+-5/2- to a proposed nearly degenerate ground-state doublet in 229Pa

  18. The extraction of 229Th3+ from a buffer-gas stopping cell (United States)

    Wense, L. v. d.; Seiferle, B.; Laatiaoui, M.; Thirolf, P. G.


    In the whole landscape of atomic nuclei, 229Th is currently the only known nucleus which could allow for the development of a nuclear-based frequency standard, as it possesses an isomeric state of just 7.6 eV energy above the ground state. The 3+ charge state is of special importance in this context, as Th3+ allows for a simple laser-cooling scheme. Here we emphasize the direct extraction of triply-charged 229Th from a buffer-gas stopping cell. This finding will not only simplify any future approach of 229Th ion cooling, but is also used for thorium-beam purification and in this way provides a powerful tool for the direct identification of the 229Th isomer to ground state nuclear transition.

  19. 229 people, 15,000 body parts: pathologists help solve Swissair 111's grisly puzzles.


    Robb, N.


    Only 1 of the 229 passengers and crew members killed when Swissair Flight 111 crashed off Nova Scotia in September was visually identifiable. Identifying everyone else on board involved medical and dental detective work of the first order.

  20. Human Coronavirus 229E Infects Polarized Airway Epithelia from the Apical Surface


    Wang, Guoshun; Deering, Camille; Macke, Michael; Shao, Jianqiang; Burns, Royce; Blau, Dianna M.; Holmes, Kathryn V.; Davidson, Beverly L.; Perlman, Stanley; McCray, Paul B.


    Gene transfer to differentiated airway epithelia with existing viral vectors is very inefficient when they are applied to the apical surface. This largely reflects the polarized distribution of receptors on the basolateral surface. To identify new receptor-ligand interactions that might be used to redirect vectors to the apical surface, we investigated the process of infection of airway epithelial cells by human coronavirus 229E (HCoV-229E), a common cause of respiratory tract infections. Usi...

  1. Continuous-wave, single-frequency 229 nm laser source for laser cooling of cadmium atoms

    CERN Document Server

    Kaneda, Yushi; Merzlyak, Yevgeny; Yamaguchi, Atsushi; Hayashida, Keitaro; Ohmae, Noriaki; Katori, Hidetoshi


    Continuous-wave output at 229 nm for the application of laser cooling of Cd atoms was generated by the 4th harmonic using two successive second harmonic generation stages. Employing a single-frequency optically pumped semiconductor laser as a fundamental source, 0.56 W of output at 229 nm was observed with a 10-mm long, Brewster-cut BBO crystal in an external cavity with 1.62 W of 458 nm input. Conversion efficiency from 458 nm to 229 nm was more than 34%. By applying a tapered amplifier as a fundamental source, we demonstrated magneto-optical trapping of all stable Cd isotopes including isotopes $^{111}$Cd and $^{113}$Cd, which are applicable to optical lattice clocks.

  2. 17 CFR 229.304 - (Item 304) Changes in and disagreements with accountants on accounting and financial disclosure. (United States)


    ... disagreements with accountants on accounting and financial disclosure. 229.304 Section 229.304 Commodity and... accounting and financial disclosure. (a)(1) If during the registrant's two most recent fiscal years or any... any matter of accounting principles or practices, financial statement disclosure, or auditing scope...

  3. 17 CFR 229.1201 - (Item 1201) General instructions to oil and gas industry-specific disclosures. (United States)


    ... instructions to oil and gas industry-specific disclosures. 229.1201 Section 229.1201 Commodity and Securities... instructions to oil and gas industry-specific disclosures. (a) If oil and gas producing activities are material... required tables. (c) The definitions in Rule 4-10(a) of Regulation S-X (17 CFR 210.4-10(a)) shall apply...

  4. 40 CFR 86.229-94 - Road load force, test weight, and inertia weight class determination. (United States)


    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Road load force, test weight, and... § 86.229-94 Road load force, test weight, and inertia weight class determination. (a) Flywheels... adjusted to simulate the operation of a vehicle on the road at 20 °F (−7 °C). Such adjustment may be...

  5. 14 CFR 417.229 - Far-field overpressure blast effects analysis. (United States)


    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Far-field overpressure blast effects... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION LICENSING LAUNCH SAFETY Flight Safety Analysis § 417.229 Far-field... criteria that protect the public from any hazard associated with far field blast overpressure effects...

  6. 17 CFR 229.912 - (Item 912) Source and amount of funds and transactional expenses. (United States)


    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false (Item 912) Source and amount... Transactions § 229.912 (Item 912) Source and amount of funds and transactional expenses. (a) State the source... sources of capital to finance such amount. (c) If all or any part of the consideration to be used by...

  7. 17 CFR 229.1003 - (Item 1003) Identity and background of filing person. (United States)


    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false (Item 1003) Identity and... (Regulation M-A) § 229.1003 (Item 1003) Identity and background of filing person. (a) Name and address. State...; (4) A statement whether or not the person was a party to any judicial or administrative...

  8. 20 CFR 229.50 - Age reduction in employee or spouse benefit. (United States)


    ... RETIREMENT ACT SOCIAL SECURITY OVERALL MINIMUM GUARANTEE Computation of the Overall Minimum Rate § 229.50 Age... benefit is reduced for each month the employee is under retirement age on the date the employee becomes... under retirement age on the date the spouse is eligible for an increase under the overall minimum...

  9. 22 CFR 229.425 - Counseling and use of appraisal and counseling materials. (United States)


    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Counseling and use of appraisal and counseling... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 229.425 Counseling and use of appraisal and counseling materials. (a) Counseling. A recipient shall not discriminate against any person...

  10. 48 CFR 252.229-7011 - Reporting of Foreign Taxes-U.S. Assistance Programs. (United States)


    ... all value added taxes and customs duties imposed by the recipient country. This exemption is in... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Reporting of Foreign Taxes... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.229-7011 Reporting of Foreign...

  11. Measuring the Th-229 nuclear isomer transition with U-233 doped crystals

    CERN Document Server

    Stellmer, Simon; Kazakov, Georgy; Sterba, Johannes; Schumm, Thorsten


    We propose a simple approach to measure the energy of the few-eV isomeric state in Th-229. To this end, U-229 nuclei are doped into VUV-transparent crystals, where they undergo alpha decay into Th-229, and, with a probability of 2%, populate the isomeric state. These Th-229m nuclei may decay into the nuclear ground state under emission of the sought-after VUV gamma, whose wavelength can be determined with a spectrometer. Based on measurements of the optical transmission of U:CaF2 crystals in the VUV range, we expect a signal at least 2 orders of magnitude larger compared to current schemes using surface-implantation of recoil nuclei. The signal background is dominated by Cherenkov radiation induced by beta decays of the thorium decay chain. We estimate that, even if the isomer undergoes radiative de-excitation with a probability of only 0.1%, the VUV gamma can be detected within a reasonable measurement time.

  12. 77 FR 3255 - Notice of 229 Boundary Revision at the Paducah Gaseous Diffusion Plant (United States)


    ... other facilities of the Paducah Gaseous Diffusion Plant, located in McCracken County, KY, published at (30 FR 13287, October 19, 1965 and at 45 FR 30106, May 7, 1980) are amended by substitution of the... of 229 Boundary Revision at the Paducah Gaseous Diffusion Plant AGENCY: Department of Energy...

  13. 22 CFR 229.210 - Military and merchant marine educational institutions. (United States)


    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Military and merchant marine educational... Coverage § 229.210 Military and merchant marine educational institutions. These Title IX regulations do not... service of the United States or for the merchant marine....

  14. BST2/CD317 counteracts human coronavirus 229E productive infection by tethering virions at the cell surface

    International Nuclear Information System (INIS)

    Bone marrow stromal antigen 2 (BST2), an interferon-inducible antiviral factor, has been shown to block the release of various enveloped viruses from cells. It has also been identified as an innate immune system component. Most enveloped viruses subject to BST2 restriction bud at the plasma membrane. Here we report our findings that (a) the production of human coronavirus 229E (HCoV-229E) progeny viruses, whose budding occurs at the ER-Golgi intermediate compartment (ERGIC), markedly decreases in the presence of BST2; and (b) BST2 knockdown expression results in enhanced HCoV-229E virion production. Electron microscopy analyses indicate that HCoV-229E virions are tethered to cell surfaces or intracellular membranes by BST2. Our results suggest that BST2 exerts a broad blocking effect against enveloped virus release, regardless of whether budding occurs at the plasma membrane or intracellular compartments. - Highlights: • BST2 knockdown expression results in enhanced HCoV-229E egress. • HCoV-229E virions are tethered to cell surfaces or intracellular membranes by BST2. • HCoV-229E infection at high MOI can significantly downregulate HeLa BST2 and rescue HIV-1 egress

  15. BST2/CD317 counteracts human coronavirus 229E productive infection by tethering virions at the cell surface

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Shiu-Mei [Department of Medical Research and Education, Taipei Veterans General Hospital and Institute of Clinical Medicine, Taipei 11217, Taiwan (China); Institute of Clinical Medicine, National Yang-Ming University School of Medicine, Taipei, Taiwan (China); Huang, Kuo-Jung [Department of Medical Research and Education, Taipei Veterans General Hospital and Institute of Clinical Medicine, Taipei 11217, Taiwan (China); Wang, Chin-Tien, E-mail: [Department of Medical Research and Education, Taipei Veterans General Hospital and Institute of Clinical Medicine, Taipei 11217, Taiwan (China); Institute of Clinical Medicine, National Yang-Ming University School of Medicine, Taipei, Taiwan (China)


    Bone marrow stromal antigen 2 (BST2), an interferon-inducible antiviral factor, has been shown to block the release of various enveloped viruses from cells. It has also been identified as an innate immune system component. Most enveloped viruses subject to BST2 restriction bud at the plasma membrane. Here we report our findings that (a) the production of human coronavirus 229E (HCoV-229E) progeny viruses, whose budding occurs at the ER-Golgi intermediate compartment (ERGIC), markedly decreases in the presence of BST2; and (b) BST2 knockdown expression results in enhanced HCoV-229E virion production. Electron microscopy analyses indicate that HCoV-229E virions are tethered to cell surfaces or intracellular membranes by BST2. Our results suggest that BST2 exerts a broad blocking effect against enveloped virus release, regardless of whether budding occurs at the plasma membrane or intracellular compartments. - Highlights: • BST2 knockdown expression results in enhanced HCoV-229E egress. • HCoV-229E virions are tethered to cell surfaces or intracellular membranes by BST2. • HCoV-229E infection at high MOI can significantly downregulate HeLa BST2 and rescue HIV-1 egress.

  16. Quantum interference effects in an ensemble of $^{229}$Th nuclei interacting with coherent light

    CERN Document Server

    Das, Sumanta; Keitel, Christoph H


    As a unique feature, the $^{229}$Th nucleus has an isomeric transition in the vacuum ultraviolet that can be accessed by optical lasers. The interference effects occurring in the interaction between coherent optical light and an ensemble of $^{229}$Th nuclei are investigated theoretically. We consider the scenario of nuclei doped in vacuum ultraviolet-vacuum ultraviolet transparent crystals and take into account the effect of different doping sites and therefore different lattice fields that broaden the nuclear transition width. This effect is shown to come in interplay with interference effects due to the hyperfine splitting of the ground and isomeric nuclear states. We investigate possible experimentally available situations involving two-, three- and four-level schemes of quadrupole sublevels of the ground and isomeric nuclear states coupling to one or two coherent fields. Specific configurations which offer clear signatures of the isomer excitation advantageous for the more precise experimental determinat...

  17. 49 CFR Appendix B to Part 229 - Schedule of Civil Penalties 1 (United States)


    ... 49 CFR part 209, appendix A. Failure to observe any condition for movement set forth in § 229.9 will...) Drilled telltale holes in welded main reservoirs 2,500 5,000 (d) Biennial tests of aluminum main... 5,000 7,500 (k) Crack of less than 1″ 5,000 7,500 (1) Crack of less than 1″ 2,500 5,000 (2) Crack...

  18. Molecular Abundances in the Atmosphere of the T Dwarf Gl 229B

    CERN Document Server

    Saumon, D S; Leggett, S K; Marley, M S; Freedman, R S; Lodders, K; Fegley, B; Sen-Gupta, S K


    We present new, high resolution, infrared spectra of the T dwarf Gliese 229B in the J, H, and K bandpasses. We analyze each of these as well as previously published spectra to determine its metallicity and the abundances of NH3 and CO in terms of the surface gravity of Gl 229B, which remains poorly constrained. The metallicity increases with increasing gravity and is below the solar value unless Gl 229B is a high-gravity brown dwarf with log g(cgs) ~ 5.5. The NH3 abundance is determined from both the H and the K band spectra which probe two different levels in the atmosphere. We find that the abundance from the K band data is well below that expected from chemical equilibrium, which we interpret as strong evidence for dynamical transport of NH3 in the atmosphere. This is consistent with the previous detection of CO and provides additional constraints on the dynamics of the atmosphere of this T dwarf.

  19. Anomalous Hyperfine Structure of the $^{229}$Th Ground-State Doublet in Muonic Atom

    CERN Document Server

    Tkalya, E V


    The hyperfine splitting of the ground and low-energy $3/2^+(7.8 \\pm 0.5$ eV) levels in the $^{229}$Th nucleus in muonic atom ($\\mu^-_{1S_{1/2}}{}^{229}$Th$)^*$ has been calculated considering the distribution of the nuclear magnetization in the framework of collective nuclear model with the wave functions of the Nilsson model for the unpaired neutron. It is shown that (a) the hyperfine splitting of the $3/2^+$ isomeric state is anomalously weak, and the reduction of hyperfine structure in comparison with the model of a point nuclear magnetic dipole is close to 100\\%, (b) partial inversion of levels of the $^{229}$Th ground-state doublet and spontaneous decay of the ground state with excitation of the isomeric state take place, (c) the energy of the isomeric transition lies in the range of 120--140 eV, which makes possible the direct observation of the transition, registration of conversion electrons and measurement of the nuclear matrix element.

  20. Anomalous magnetic hyperfine structure of the 229Th ground-state doublet in muonic atoms (United States)

    Tkalya, E. V.


    The magnetic hyperfine (MHF) splitting of the ground and low-energy 3 /2+(7.8 ±0.5 eV) levels in the 229Th nucleus in the muonic atom (μ1S1 /2 -229Th) * is calculated considering the distribution of the nuclear magnetization in the framework of the collective nuclear model with wave functions of the Nilsson model for the unpaired neutron. It is shown that (a) deviation of the MHF structure of the isomeric state exceeds 100% from its value for a pointlike nuclear magnetic dipole (the order of sublevels is reversed); (b) partial inversion of levels of the 229Th ground-state doublet and spontaneous decay of the ground state to the isomeric state occur; (c) the E 0 transition, which is sensitive to differences in the mean-square charge radii of the doublet states, is possible between mixed sublevels with F =2 ; and (d) MHF splitting of the 3 /2+ isomeric state may be in the optical range for certain values of the intrinsic gK factor and a reduced probability of a nuclear transition between the isomeric and the ground states.

  1. Generator method of 225Ac production without a carrier for nuclear medicine

    International Nuclear Information System (INIS)

    The two-steps isotope generator scheme of 225Ac production from 229Th has been developed. The first step is used for separation of thorium, actinium, radium and daughter decay products (DDP), and removals of parent radionuclide. The second step provides additional separation of actinium from traces of radium and DDP, and conversion of actinium in the nitrate form. The chosen solutions provide optimal conditions for carry out of process. The yield of the 225Ac was 99.9% at minimal losses of parent 229Th (less than 0.1%)

  2. Direct two-photon excitation of isomeric transition in thorium-229 nucleus


    Romanenko, V. I.; Udoviskaya, Ye. G.; Yatsenko, L. P.; Romanenko, A. V.; Litvinov, A. N.; Kazakov, G. A.


    A possibility of the two-photon excitation of an isomeric state in a nucleus of thorium-229 has been discussed. The fluorescence intensity of the excitation is demonstrated to be identical for the irradiation of nuclei with either monochromatic light or polychromatic radiation consisting of a sequence of short light pulses of the same intensity. The two-photon excitation of Th^{3+} ion in an electromagnetic trap with a focused laser beam with a wavelength of about 320 nm and power of 100 mW c...

  3. The rotational bands in the nuclei 229Pa and 231Pa

    International Nuclear Information System (INIS)

    Experimental evidence is presented for the similarity between the rotational spectra built on the 1/2-[530] state in 231Pa, where the 3/2- member of the band forms the ground state, and in 229Pa, where this state lies within 20 keV of the ground state. Our findings are in contrast with earlier work invoking octupole deformations in the ground state to account for the different positions of low-lying Nilsson states in the two isotopes. (author)

  4. Improved Value for the Energy Splitting of the Ground-State Doublet in the Nucleus 229mTh

    International Nuclear Information System (INIS)

    We have made an improved estimate of the 229mTh isomer energy. The new value, 7.8(5) eV, includes an estimate of possible spectral contamination effects due to the out-of-band E2 transition from the 42.43-keV 7/2+ member of the (633) ground state band to the 3/2+ (631) 229mTh bandhead and so a weak and unresolved transition a few eV different in energy. We estimate a 2% branching ratio for this unobserved transition in the 42.43-keV 7/2+ (633) deexcitation. The excitation of the 229mTh level is increased from the previously reported value of 7.6(5) eV to the new best value of 7.8(5) eV when this branch is included in the analysis

  5. Characterization of the expression and immunogenicity of the ns4b protein of human coronavirus 229E

    DEFF Research Database (Denmark)

    Chagnon, F; Lamarre, A; Lachance, C;


    and immunogenicity of the ns4b gene product from strain 229E of human coronavirus (HCV-229E), a respiratory virus with a neurotropic potential. The gene was cloned and expressed in bacteria. A fusion protein of ns4b with maltose-binding protein was injected into rabbits to generate specific antibodies...... that were used to demonstrate the expression of ns4b in HCV-229E-infected cells using flow cytometry. Given a previously reported contiguous five amino acid shared region between ns4b and myelin basic protein, a purified recombinant histidine-tagged ns4b protein and (or) human myelin basic protein were...... injected into mice to evaluate whether myelin-viral protein cross-reactive antibody responses could be generated. Each immunogen induced specific but not cross-reactive antibodies. We conclude that ns4b is expressed in infected cells and is immunogenic, although this does not involve amino acids shared...

  6. Continuous-wave, single-frequency 229  nm laser source for laser cooling of cadmium atoms. (United States)

    Kaneda, Yushi; Yarborough, J M; Merzlyak, Yevgeny; Yamaguchi, Atsushi; Hayashida, Keitaro; Ohmae, Noriaki; Katori, Hidetoshi


    Continuous-wave output at 229 nm for the application of laser cooling of Cd atoms was generated by the fourth harmonic using two successive second-harmonic generation stages. Employing a single-frequency optically pumped semiconductor laser as a fundamental source, 0.56 W of output at 229 nm was observed with a 10-mm long, Brewster-cut BBO crystal in an external cavity with 1.62 W of 458 nm input. Conversion efficiency from 458 nm to 229 nm was more than 34%. By applying a tapered amplifier (TA) as a fundamental source, we demonstrated magneto-optical trapping of all stable Cd isotopes including isotopes Cd111 and Cd113, which are applicable to optical lattice clocks. PMID:26872168

  7. Radiative lifetime and energy of the low-energy isomeric level in 229Th (United States)

    Tkalya, E. V.; Schneider, Christian; Jeet, Justin; Hudson, Eric R.


    We estimate the range of the radiative lifetime and energy of the anomalous, low-energy 3 /2+(7.8 ±0.5 eV) state in the 229Th nucleus. Our phenomenological calculations are based on the available experimental data for the intensities of M 1 and E 2 transitions between excited levels of the 229Th nucleus in the Kπ[N nZΛ ] =5 /2+[633 ] and 3 /2+[631 ] rotational bands. We also discuss the influence of certain branching coefficients, which affect the currently accepted measured energy of the isomeric state. From this work, we establish a favored region, 0.66 ×106seV3/ω3≤τ ≤2.2 ×106seV3/ω3 , where the transition lifetime τ as a function of transition energy ω should lie at roughly the 95% confidence level. Together with the result of Beck et al. [LLNL-PROC-415170 (2009)], we establish a favored area where transition lifetime and energy should lie at roughly the 90% confidence level. We also suggest new nuclear physics measurements, which would significantly reduce the ambiguity in the present data.

  8. Broad-Line Reverberation in the Kepler-Field Seyfert Galaxy Zw 229-015

    CERN Document Server

    Barth, A J; Malkan, M A; Filippenko, A V; Li, W; Gorjian, V; Joner, M D; Bennert, V N; Botyanszki, J; Cenko, S B; Childress, M; Choi, J; Comerford, J M; Cucciara, A; da Silva, R; Duchene, G; Fumagalli, M; Ganeshalingam, M; Gates, E L; Gerke, B F; Griffith, C V; Harris, C; Hintz, E G; Hsiao, E; Kandrashoff, M T; Keel, W C; Kirkman, D; Kleiser, I K W; Laney, C D; Lee, J; Lopez, L; Lowe, T B; Moody, J W; Morton, A; Nierenberg, A M; Nugent, P; Pancoast, A; Rex, J; Rich, R M; Silverman, J M; Smith, G H; Sonnenfeld, A; Suzuki, N; Tytler, D; Walsh, J L; Woo, J -H; Yang, Y; Zeisse, C


    The Seyfert 1 galaxy Zw 229-015 is among the brightest active galaxies being monitored by the Kepler mission. In order to determine the black hole mass in Zw 229-015 from H-beta reverberation mapping, we have carried out nightly observations with the Kast Spectrograph at the Lick 3m telescope during the dark runs from June through December 2010, obtaining 54 spectroscopic observations in total. We have also obtained nightly V-band imaging with the Katzman Automatic Imaging Telescope at Lick Observatory and with the 0.9m telescope at the Brigham Young University West Mountain Observatory over the same period. We detect strong variability in the source, which exhibited more than a factor of 2 change in broad H-beta flux. From cross-correlation measurements, we find that the H-beta light curve has a rest-frame lag of 3.86(+0.69,-0.90) days with respect to the V-band continuum variations. We also measure reverberation lags for H-alpha and H-gamma and find an upper limit to the H-delta lag. Combining the H-beta la...

  9. Activity determination of 229Th by means of liquid scintillation counting

    International Nuclear Information System (INIS)

    Liquid scintillation measurements of 229Th in radioactive equilibrium with its progenies were carried out. The counting efficiency was determined by means of a free parameter model. The measurements were made in a custom-built triple-to-double coincidence ratio (TDCR) system. In addition, a new portable mini-TDCR system with three channel photomultipliers and two commercial counters were tested. The decay of the short-lived 213Po requires great care, since it often occurs during the dead time of the counter systems. Also the rather short-lived 217At may decay during the dead time caused by 221Fr decay events. The overall counting efficiency of the TDCR system of PTB was found to be about 700% (depending on the degree of chemical quenching) and the relative standard uncertainty of the activity concentration was found to be about 0.23%. The determined activity concentration was compared with the outcome of alpha spectrometry under defined solid angle and excellent agreement was found. The TDCR efficiency calculations can be easily adapted to activity determinations of 225Ra or 225Ac in equilibrium with their progenies. - Highlights: • The activity of a 229Th solution was determined by means of TDCR measurements. • The relative standard uncertainty was found to be 0.23%. • A new portable mini-TDCR system was successfully tested. • Results are in good agreement with the outcome from alpha spectrometry

  10. Enhanced effect of quark mass variation in 229Th and limits from Oklo data

    CERN Document Server

    Flambaum, V V


    The effects of the variation of the dimensionless strong interaction parameter Xq=mq/Lambda{QCD} (mq is the quark mass, Lambda{QCD} is the QCD scale) are enhanced about 1.5 x 10**5 times in the 7.6 eV "nuclear clock" transition between the ground and first excited states in the 229Th nucleus and about 1 x 10**8 times in the relative shift of the 0.1 eV compound resonance in 150Sm.The best terrestrial limit on the temporal variation of the fundamental constants, |delta(Xq)/Xq| < 4 x 10**-9 at 1.8 billion years ago (|d(Xq/Xq)/dt| < 2.2 x 10**-18 y**-1), is obtained from the shift of this Sm resonance derived from the Oklo natural nuclear reactor data. The results for 229Th and 150Sm are obtained by extrapolation from light nuclei where the many-body calculations can be performed more accurately. The errors produced by such extrapolation may be smaller than the errors of direct calculations in heavy nuclei. The extrapolation results are compared with the "direct" estimates obtained using the Walecka model....

  11. CD229 (Ly9) lymphocyte cell surface receptor interacts homophilically through its N-terminal domain and relocalizes to the immunological synapse

    NARCIS (Netherlands)

    Romero, [No Value; Zapater, N; Calvo, M; Kalko, SG; de la Fuente, MA; Tovar, [No Value; Ockeloen, C; Pizcueta, P; Engel, P


    CD229 is a member of the CD150 family of the Ig superfamily expressed on T and B cells. Receptors of this family regulate cytokine production and cytotoxicity of lymphocytes and NK cells. The cytoplasmic tail of CD229 binds to SAP, a protein that is defective in X-linked lymphoproliferative syndrome

  12. A VUV detection system for the direct photonic identification of the first excited isomeric state of $^{229}$Th

    CERN Document Server

    Seiferle, Benedict; Laatiaoui, Mustapha; Thirolf, Peter G


    With an expected energy of 7.6(5) eV, $^{229}$Th possesses the lowest excited nuclear state in the landscape of all presently known nuclei. The energy corresponds to a wavelength of about 160 nm and would conceptually allow for an optical laser excitation of a nuclear transition. We report on a VUV optical detection system that was designed for the direct detection of the isomeric ground-state transition of $^{229}$Th. $^{229(m)}$Th ions originating from a $^{233}$U $\\alpha$-recoil source are collected on a micro electrode that is placed in the focus of an annular parabolic mirror. The latter is used to parallelize the UV fluorescence that may emerge from the isomeric ground-state transition of $^{229}$Th. The parallelized light is then focused by a second annular parabolic mirror onto a CsI-coated position-sensitive MCP detector behind the mirror exit. To achieve a high signal-to-background ratio, a small spot size on the MCP detector needs to be achieved. Besides extensive ray-tracing simulations of the opt...

  13. Creation of inverse population in the 229Th ground-state doublet by means of a narrowband laser

    International Nuclear Information System (INIS)

    A new method for obtaining inverse population between quadrupole sublevels of the ground state 5/2+(0.0) and the isomeric state 3/2+(7.6 eV) of the 229Th nucleus in a dielectric crystal with a large band gap by means of an external source of VUV radiation is proposed. The method is based on an efficient depopulation of the upper sublevels of the ground state of 229Th by resonant photons from a narrowband laser or a broader tunable free electron laser. The sublevels of the isomeric state play the role of intermediate states. The proposed scheme of optical pumping (1) results in inverse population of nuclear sublevels without using extremely low temperatures, and (2) shows a new means of creating a gamma-ray laser of optical range at the nuclear transition in 229Th (a) in crystals with isovalent substitution of host ions (e.g. Si4+ ions in the SiO2 crystal replaced by the 229Th4+ ions) and (b) in crystals such as Na2ThF6, where the substitution is not necessary. (letter)

  14. A VUV detection system for the direct photonic identification of the first excited isomeric state of 229Th (United States)

    Seiferle, Benedict; von der Wense, Lars; Laatiaoui, Mustapha; Thirolf, Peter G.


    With an expected energy of 7.6(5) eV, 229Th possesses the lowest excited nuclear state in the landscape of all presently known nuclei. The energy corresponds to a wavelength of about 160 nm and would conceptually allow for an optical laser excitation of a nuclear transition. We report on a VUV optical detection system that was designed for the direct detection of the isomeric ground-state transition of 229Th. 229(m)Th ions originating from a 233U α-recoil source are collected on a micro electrode that is placed in the focus of an annular parabolic mirror. The latter is used to parallelize the UV fluorescence that may emerge from the isomeric ground-state transition of 229Th. The parallelized light is then focused by a second annular parabolic mirror onto a CsI-coated position-sensitive MCP detector behind the mirror exit. To achieve a high signal-to-background ratio, a small spot size on the MCP detector needs to be achieved. Besides extensive ray-tracing simulations of the optical setup, we present a procedure for its alignment, as well as test measurements using a D2 lamp, where a focal-spot size of ≈100 μm has been achieved. Assuming a purely photonic decay, a signal-to-background ratio of ≈7000:1 could be achieved.

  15. 32 CFR 229.7 - Notification to Indian tribes of possible harm to, or destruction of, sites on public lands... (United States)


    ... to, or destruction of, sites on public lands having religious or cultural importance. 229.7 Section... of possible harm to, or destruction of, sites on public lands having religious or cultural importance... consider the site as having religious or cultural importance. Such notice shall not be deemed a...

  16. Kinematics and duty cycles of the SM-229 force-reflecting servomanipulator

    International Nuclear Information System (INIS)

    This report describes the first known experimental study of servomanipulator duty cycles to appear in the literature. The servomanipulator used was TeleOperator Systems Model SM-229. The experimental approach used was to record the joint positions and motor currents of the right slave arm at a rate of 10 Hz over about 50 h of typical remote manipulation operations. The results are presented as position usage patterns in joint and real-world coordinates, time-use histograms of joint velocities and motor currents, and three-dimensional mechanical power histograms for each joint. All results are presented in dimensionless form, scaled to the design ranges of the manipulator and the total operation time recorded. Applications of this study include improvements in kinematic ranges, gear reductions, motor sizings, drive configurations, and stress relief. Included in appendices are an uncertainty analysis, calibration procedures, and analysis of the kinematics of the manipulator. 12 refs., 42 figs., 15 tabs

  17. Direct two-photon excitation of isomeric transition in thorium-229 nucleus

    CERN Document Server

    Romanenko, V I; Yatsenko, L P; Romanenko, A V; Litvinov, A N; Kazakov, G A


    A possibility of the two-photon excitation of an isomeric state in a nucleus of thorium-229 has been discussed. The fluorescence intensity of the excitation is demonstrated to be identical for the irradiation of nuclei with either monochromatic light or polychromatic radiation consisting of a sequence of short light pulses of the same intensity. The two-photon excitation of Th^{3+} ion in an electromagnetic trap with a focused laser beam with a wavelength of about 320 nm and power of 100 mW can lead to the absorption saturation, at which the fluorescence emission with the frequency of the transition in a nucleus is maximal. In crystals doped with Th^{4+} to a concentration of about 10^{18} cm^{-3} and irradiated with a laser radiation 10 W in power, the emission of several photons per second with a wavelength of about 160 nm becomes possible.

  18. Energy splitting of the ground-state doublet in the nucleus 229Th. (United States)

    Beck, B R; Becker, J A; Beiersdorfer, P; Brown, G V; Moody, K J; Wilhelmy, J B; Porter, F S; Kilbourne, C A; Kelley, R L


    The energy splitting of the 229Th ground-state doublet is measured to be 7.6+/-0.5 eV, significantly greater than earlier measurements. Gamma rays produced following the alpha decay of 233U (105 muCi) were counted in the NASA/electron beam ion trap x-ray microcalorimeter spectrometer with an experimental energy resolution of 26 eV (FWHM). A difference technique was applied to the gamma-ray decay of the 71.82 keV level that populates both members of the doublet. A positive correction amounting to 0.6 eV was made for the unobserved interband decay of the 29.19 keV state (29.19-->0 keV). PMID:17501268

  19. Detection of Chlamydia trachomatis inclusions in McCoy and HeLa-229 cells: an alternative staining technique using toluidine blue.


    Mohammed, N R; Hillary, I B


    Toluidine blue staining was used to detect Chlamydia trachomatis inclusions in both McCoy and HeLa-229 cells from clinical specimens. This method was more sensitive than iodine staining for detecting C trachomatis inclusions in both McCoy and HeLa-229 cells and also more sensitive than Giemsa staining for detecting chlamydial inclusions in HeLa-229 cells. While its sensitivity for detection of chlamydial inclusions in McCoy cells is equal to that of Giemsa staining, toluidine blue staining is...

  20. Update of 233U, 229-232Th and 230-233Pa Fission Data

    International Nuclear Information System (INIS)

    The influence of the 235U(n,f) and 239Pu(n,f) prompt fission neutron spectra (PFNS) on modeling of integral benchmarks was estimated to be significant. For 233U(n,f) PFNS similar sensitivities could be envisaged. For the variety of Th/U fuels and systems, ranging from metal fast to deep thermal solutions, large positive/negative swings in calculated Keff can be expected. Th/U fuelled core criticality calculations would be sensitive to the modelled soft tail of fission neutrons or deficiency of hard tail fission neutrons, as revealed for U and Pu fuels. The deficiency of the 233U(nth,f) PFNS, adopted for the ENDF/B-VII.0. could be traced back to the 'propagation' of calculated 235U(nth,f) PFNS shape at En= 0.5 MeV. At higher energies, average energies of PFNS coincide only at ∼5 MeV, at other En the average energies and spectra shapes are drastically different. However, it might be argued that the response of the criticality benchmark calculations for the 233U thermal and fast systems would be similar to that observed for the PFNS of 239Pu. Our approach allowed to solve the longstanding problem of inconsistency of 235U integral data testing and differential prompt fission neutron spectra data, a similar approach may hold for 233U. Using modified PFNS, we may avoid arbitrary tweaking of neutron cross sections or neutron multiplicities for Th/U fuel-cycle related nuclides (233U, 229,230,231,232Th and 230,231,232,233Pa) to compensate the ill-defined shape of 233U PFNS. For metal fast benchmarks much would depend on the inelastic scattering cross section of 233U, which should be considered rather uncertain at the moment. The unrealistic evaluations of poorly investigated cross sections related to the Th/U fuel cycle could be excluded by consistent analysis of the available fission data base. The evaluation of 229,230,231,232Th(n,f) and 230,231,232,233Pa(n,f) cross sections could be supplemented by description of surrogate and ratio surrogate fission data, coming from

  1. Results of a direct search using synchrotron radiation for the low-energy $^{229}$Th nuclear isomeric transition

    CERN Document Server

    Jeet, Justin; Sullivan, Scott T; Rellergert, Wade G; Mirzadeh, Saed; Cassanho, A; Jenssen, H P; Tkalya, Eugene V; Hudson, Eric R


    We report the results of a direct search for the $^{229}$Th ($I^{p} = 3/2^+\\leftarrow 5/2^+$) nuclear isomeric transition, performed by exposing $^{229}$Th-doped LiSrAlF$_6$ crystals to tunable vacuum-ultraviolet synchrotron radiation and observing any resulting fluorescence. We also use existing nuclear physics data to establish a range of possible transition strengths for the isomeric transition. We find no evidence for the thorium nuclear transition between $7.3 \\mbox{eV}$ and $8.8 \\mbox{eV}$ with transition lifetime $(1-2)\\mbox{s} \\lesssim \\tau \\lesssim (2000-5600)\\mbox{s}$. This measurement excludes roughly half of the favored transition search area and can be used to direct future searches.

  2. Results of a Direct Search Using Synchrotron Radiation for the Low-Energy (229)Th Nuclear Isomeric Transition. (United States)

    Jeet, Justin; Schneider, Christian; Sullivan, Scott T; Rellergert, Wade G; Mirzadeh, Saed; Cassanho, A; Jenssen, H P; Tkalya, Eugene V; Hudson, Eric R


    We report the results of a direct search for the (229)Th (I(π)=3/2(+)←5/2(+)) nuclear isomeric transition, performed by exposing (229)Th-doped LiSrAlF(6) crystals to tunable vacuum-ultraviolet synchrotron radiation and observing any resulting fluorescence. We also use existing nuclear physics data to establish a range of possible transition strengths for the isomeric transition. We find no evidence for the thorium nuclear transition between 7.3 eV and 8.8 eV with transition lifetime (1-2) s≲τ≲(2000-5600)  s. This measurement excludes roughly half of the favored transition search area and can be used to direct future searches. PMID:26197124

  3. Above 8GHz Static T-Flip-Flop Operation using FT=22.9GHz GaAs MESFETs

    DEFF Research Database (Denmark)

    Riishøj, J; Danielsen, Per Lander


    A static SCFL Toggle Flip-Flop GaAs IC having maximum operating frequency of Fdiv=8.25GHz has been designed using a commercially available GaAs MESFET foundry service. The average Ft for the present wafer is Ft=22.9GHz giving a very high Fdiv/Ft-ratio of Fdiv/Ft=0.36. In addition output voltage...

  4. Involvement of Aminopeptidase N (CD13) in Infection of Human Neural Cells by Human Coronavirus 229E


    Lachance, Claude; Arbour, Nathalie; Cashman, Neil R.; Talbot, Pierre J


    Attachment to a cell surface receptor can be a major determinant of virus tropism. Previous studies have shown that human respiratory coronavirus HCV-229E uses human aminopeptidase N (hAPN [CD13]) as its cellular receptor for infection of lung fibroblasts. Although human coronaviruses are recognized respiratory pathogens, occasional reports have suggested their possible neurotropism. We have previously shown that human neural cells, including glial cells in primary cultures, are susceptible t...

  5. Identification and Characterization of a Novel Alpaca Respiratory Coronavirus Most Closely Related to the Human Coronavirus 229E

    Directory of Open Access Journals (Sweden)

    Sharon K. Hietala


    Full Text Available In 2007, a novel coronavirus associated with an acute respiratory disease in alpacas (Alpaca Coronavirus, ACoV was isolated. Full-length genomic sequencing of the ACoV demonstrated the genome to be consistent with other Alphacoronaviruses. A putative additional open-reading frame was identified between the nucleocapsid gene and 3'UTR. The ACoV was genetically most similar to the common human coronavirus (HCoV 229E with 92.2% nucleotide identity over the entire genome. A comparison of spike gene sequences from ACoV and from HCoV-229E isolates recovered over a span of five decades showed the ACoV to be most similar to viruses isolated in the 1960’s to early 1980’s. The true origin of the ACoV is unknown, however a common ancestor between the ACoV and HCoV-229E appears to have existed prior to the 1960’s, suggesting virus transmission, either as a zoonosis or anthroponosis, has occurred between alpacas and humans.

  6. Extraction of chymosin produced by solid state fermentation of mucor MJ229%毛霉MJ229固态发酵凝乳酶提取工艺研究

    Institute of Scientific and Technical Information of China (English)

    王艳萍; 张殿伟; 程巧玲; 白小佳


    Chymosin is a key enzyme in cheese production which causes milk curd.It plays a very important role in the formation of texture and flavor in cheese.With the development of cheese industry, chymosin made by traditional method is not sufficient for its production, so the researchers are looking for the new sources of chymosin.MJ229 can produce chymosin, that was isolated from glutinous rice wine which was a traditional food in south of China.This paper studied the extraction process of chymosin from the Mucor MJ229 solid state fermentation broth, using single factor analysis of the extraction time, salt concentration, extraction temperature, extraction times which affect extraction of chymosin.The results showed that the optimized extraction conditions were: the temperature is 40℃, NaCl concentration is 0.3 mol/L, extracted 20min for 3 times.%凝乳酶是干酪生产中的关键性酶.它对干酪的质构形成及特有风味的形成有非常重要的作用.随着干酪工业的不断发展,传统来源的凝乳酶已远不能满足生产需要,各国研究者不断地寻找新的来源.霉菌MJ229是从我国传统食品江米酒酒醪中筛选得到的一株凝乳酶高产菌株.本论文对霉菌MJ229固态发酵物中凝乳酶的提取工艺进行了研究,分别研究了提取时间、食盐浓度、提取温度、次数对固态发酵液中凝乳酶提取效果的影响.结果表明,霉菌MJ229固态发酵中凝乳酶在温度40℃条件下,用0.3mol/L的NaCl溶液提取20min,提取3次的效果为最好.

  7. Uranium doped LiSAF as a precursor for a 229 Th nuclear clock experiment (United States)

    Meyer, Edmund; Hehlen, Markus; Barker, Beau; Collins, Lee; Zhao, Xinxin


    We experimentally and numerically study the simple idea of growing 233 U doped LiSAF crystals. The micro-pulling-down technique is used to grow U:LiSAF single crystals with a high number density of U ions. The crystals are in the shape of rods that are geometrically well matched for imaging onto the spectrophotometer input slit. Growth is performed in an RF-heated chamber under argon inert atmosphere at elevated pressure. This reduces the evaporation of LiF and AlF3 from the melt and crystal surface during growth which otherwise tends to degrade the crystal quality. Through physical arguments and robust numerical calculation we determine the oxidation state of the U ion to likely be trivalent and occupying the Sr site. Charge compensation is numerically studied through F interstitials and Li vacancies. We determine the energetically most favorable state for U:LiSAF and investigate the effects upon α-decay of 233 U to 229 Th, which ~ 2% of the time is in the excited isomeric state. Additional charge compensation mechanisms are needed to accommodate the Th4+ ground oxidation state and we investigate F interstitial as well as Li vacancy. The band structure is calculated and analyzed for select cases.

  8. Promoter Hypermethylation of the EMP3 Gene in a Series of 229 Human Gliomas

    Directory of Open Access Journals (Sweden)

    Marta Mellai


    Full Text Available The epithelial membrane protein 3 (EMP3 is a candidate tumor suppressor gene in the critical region 19q13.3 for several solid tumors, including tumors of the nervous systems. The aim of this study was to investigate the EMP3 promoter hypermethylation status in a series of 229 astrocytic and oligodendroglial tumors and in 16 GBM cell lines. The analysis was performed by methylation-specific PCR and capillary electrophoresis. Furthermore, the EMP3 expression at protein level was evaluated by immunohistochemistry and Western blotting analysis. Associations of EMP3 hypermethylation with total 1p/19q codeletion, MGMT promoter hypermethylation, IDH1/IDH2 and TP53 mutations, and EGFR amplification were studied, as well as its prognostic significance. The EMP3 promoter hypermethylation has been found in 39.5% of gliomas. It prevailed in low-grade tumors, especially in gliomas with an oligodendroglial component, and in sGBMs upon pGBMs. In oligodendroglial tumors, it was strongly associated with both IDH1/IDH2 mutations and total 1p/19q codeletion and inversely with EGFR gene amplification. No association was found with MGMT hypermethylation and TP53 mutations. In the whole series, the EMP3 hypermethylation status correlated with 19q13.3 loss and lack of EMP3 expression at protein level. A favorable prognostic significance on overall survival of the EMP3 promoter hypermethylation was found in patients with oligodendroglial tumors.

  9. On the 7.8 eV isomer transition in {sup 229}Th

    Energy Technology Data Exchange (ETDEWEB)

    Stellmer, Simon; Schreitl, Matthias; Winkler, Georg; Tscherne, Christoph; Kazakov, Georgy; Schumm, Thorsten [VCQ and Atominstitut / TU Wien, Vienna (Austria); Fleischmann, Andreas; Gastaldo, Loredana; Pabinger, Andreas; Enss, Christian [KIP, University of Heidelberg (Germany)


    The best atom clocks today employ an optical transition between two electronic states of an atom or ion. It seems tantalizing to utilize a nuclear transition instead, as such a transition would be well-isolated from collisional, electronic, and even chemical perturbations from the environment. In addition, such transitions are expected to be very sensitive probes of drifts in fundamental constants. The only isotope known to possess an isomer transition in the optical domain is the radioactive element {sup 229}Th. Various attempts have been carried out to measure or calculate the transition energy and linewidth. To date, all of these measurements have been refuted, corrected, or at least strongly debated. While a direct evidence of this transition is still pending, its commonly agreed-upon energy is 7.8(5) eV. In this talk, we present the current status of a novel measurement campaign. In a concerted effort of the Heidelberg and Vienna groups, we use a microcalorimeter to measure the spectrum of gamma photons originating from the decay of excited nuclear states. A double-peaked structure would reveal the existence of the isomer state and allow us to measure its energy with unprecedented precision.

  10. Prospects for measuring the {sup 229}Th isomer energy using a metallic magnetic microcalorimeter

    Energy Technology Data Exchange (ETDEWEB)

    Kazakov, G.A., E-mail: [Wolfgang Pauli Institute, Univ. Wien – UZA 4 Nordbergstrasse 15, A, 1090 Vienna (Austria); Vienna Center for Quantum Science and Technology, Atominstitut, TU Wien, Stadionallee 2, 1020 Vienna (Austria); Schauer, V.; Schwestka, J.; Stellmer, S.P.; Sterba, J.H. [Vienna Center for Quantum Science and Technology, Atominstitut, TU Wien, Stadionallee 2, 1020 Vienna (Austria); Fleischmann, A.; Gastaldo, L.; Pabinger, A.; Enss, C. [Kirchhoff-Institute for Physics, Heidelberg University, INF 227, 69120 Heidelberg (Germany); Schumm, T. [Vienna Center for Quantum Science and Technology, Atominstitut, TU Wien, Stadionallee 2, 1020 Vienna (Austria)


    The Thorium-229 isotope features a nuclear isomer state with an extremely low energy. The currently most accepted energy value, 7.8±0.5 eV, was obtained from an indirect measurement using a NASA x-ray microcalorimeter with an instrumental resolution 26 eV. We study, how state-of-the-art magnetic metallic microcalorimeters with an energy resolution down to a few eV can be used to measure the isomer energy. In particular, resolving the 29.18 keV doublet in the γ-spectrum following the α-decay of Uranium-233, corresponding to the decay into the ground and isomer state, allows to measure the isomer transition energy without additional theoretical input parameters, and increase the energy accuracy. We study the possibility of resolving the 29.18 keV line as a doublet and the dependence of the attainable precision of the energy measurement on the signal and background count rates and the instrumental resolution.

  11. Excitation of the {sup 229m}Th nuclear isomer via resonance conversion in ionized atoms

    Energy Technology Data Exchange (ETDEWEB)

    Karpeshin, F. F., E-mail: [D.I. Mendeleev Institute for Metrology (VNIIM) (Russian Federation); Trzhaskovskaya, M. B. [National Research Center Kurchatov Institute, Petersburg Nuclear Physics Institute (Russian Federation)


    Pressing problems concerning the optical pumping of the 7.6-eV {sup 229m}Th nuclear isomer, which is a candidate for a new nuclear optical reference point for frequencies, are examined. Physics behind the mechanism of the two-photon optical pumping of the isomer is considered. It is shown that, irrespective of the pumping scheme, a dominant contribution comes, in accord with what was proven earlier for the 3.5-eV isomer, from the resonance 8s–7s transition. Details of an optimum experimental scheme are discussed. It is shown that, after isomer excitation, the atom involved remains with a high probability in an excited state at an energy of about 0.5 eV rather than in the ground state, the required energy of the two photons being equal to the energy of the nuclear level plus the energy of the lowest 7s state of the atom. The estimated pumping time is about 1.5 s in the case where the field strength of each laser is 1 V/cm.

  12. Prospects for measuring the $^{229}$Th isomer energy using a metallic magnetic microcalorimeter

    CERN Document Server

    Kazakov, G A; Sterba, J H; Fleischmann, A; Enss, C; Schumm, T


    The Thorium-229 isotope features a nuclear isomer state with extremely low energy. The currently most accepted energy value, $7.8 \\pm 0.5$\\,eV, was obtained from an indirect measurements using a NASA x-ray microcalorimeter with instrumental resolution (FWHM) of 26\\,eV. We study, how state-of-the-art magnetic metallic microcalorimeters with an energy resolution down to a few eV can be used to measure the isomer energy. Resolving the 29.18\\,keV doublet in the $\\gamma$-spectrum following the $\\alpha$-decay of Uranium-233, corresponding to the decay into the ground and isomer state, allows to measure the isomer transition energy without additional theoretical input parameters and increase the energy accuracy. We study the dependence of the attainable precision of this measurement on the signal and background count rates and the instrumental energy resolution. Assuming realistic experimental parameters corresponding to the currently available detector technology, we show that such a measurement is highly feasable.

  13. The S229L Colon Tumor-associated Variant of DNA Polymerase β Induces Cellular Transformation as a Result of Decreased Polymerization Efficiency* (United States)

    Nemec, Antonia A.; Murphy, Drew L.; Donigan, Katherine A.; Sweasy, Joann B.


    DNA polymerase β (Pol β) plays a key role in base excision repair (BER) by filling in small gaps that are generated after base adducts are excised from the DNA. Pol β is mutated in a large number of colorectal tumors, and these mutations may drive carcinogenesis. In the present study, we wished to determine whether the S229L somatic Pol β variant identified in a stage 3 colorectal tumor is a driver of carcinogenesis. We show that S229L does not possess any defects in binding to either DNA or nucleotides compared with the WT enzyme, but exhibits a significant loss of polymerization efficiency, largely due to an 8-fold decrease in the polymerization rate. S229L participates in BER, but due to its lower catalytic rate, does so more slowly than WT. Expression of S229L in mammalian cells induces the accumulation of BER intermediate substrates, chromosomal aberrations, and cellular transformation. Our results are consistent with the interpretation that S229L is a driver of carcinogenesis, likely as a consequence of its slow polymerization activity during BER in vivo. PMID:24668809

  14. Identification and Characterization of a Novel Alpaca Respiratory Coronavirus Most Closely Related to the Human Coronavirus 229E


    Crossley, Beate M.; Mock, Richard E.; Scott A. Callison; Hietala, Sharon K.


    In 2007, a novel coronavirus associated with an acute respiratory disease in alpacas (Alpaca Coronavirus, ACoV) was isolated. Full-length genomic sequencing of the ACoV demonstrated the genome to be consistent with other Alphacoronaviruses. A putative additional open-reading frame was identified between the nucleocapsid gene and 3'UTR. The ACoV was genetically most similar to the common human coronavirus (HCoV) 229E with 92.2% nucleotide identity over the entire genome. A comparison of spike ...

  15. Identification and Characterization of a Novel Alpaca Respiratory Coronavirus Most Closely Related to the Human Coronavirus 229E


    Hietala, Sharon K.; Mock, Richard E.; Scott A. Callison; Crossley, Beate M.


    In 2007, a novel coronavirus associated with an acute respiratory disease in alpacas (Alpaca Coronavirus, ACoV) was isolated. Full-length genomic sequencing of the ACoV demonstrated the genome to be consistent with other Alphacoronaviruses. A putative additional open-reading frame was identified between the nucleocapsid gene and 3'UTR. The ACoV was genetically most similar to the common human coronavirus (HCoV) 229E with 92.2% nucleotide identity over the entire genome. A comparison of s...

  16. Diversity and Evolutionary Histories of Human Coronaviruses NL63 and 229E Associated with Acute Upper Respiratory Tract Symptoms in Kuala Lumpur, Malaysia. (United States)

    Al-Khannaq, Maryam Nabiel; Ng, Kim Tien; Oong, Xiang Yong; Pang, Yong Kek; Takebe, Yutaka; Chook, Jack Bee; Hanafi, Nik Sherina; Kamarulzaman, Adeeba; Tee, Kok Keng


    The human alphacoronaviruses HCoV-NL63 and HCoV-229E are commonly associated with upper respiratory tract infections (URTI). Information on their molecular epidemiology and evolutionary dynamics in the tropical region of southeast Asia however is limited. Here, we analyzed the phylogenetic, temporal distribution, population history, and clinical manifestations among patients infected with HCoV-NL63 and HCoV-229E. Nasopharyngeal swabs were collected from 2,060 consenting adults presented with acute URTI symptoms in Kuala Lumpur, Malaysia, between 2012 and 2013. The presence of HCoV-NL63 and HCoV-229E was detected using multiplex polymerase chain reaction (PCR). The spike glycoprotein, nucleocapsid, and 1a genes were sequenced for phylogenetic reconstruction and Bayesian coalescent inference. A total of 68/2,060 (3.3%) subjects were positive for human alphacoronavirus; HCoV-NL63 and HCoV-229E were detected in 45 (2.2%) and 23 (1.1%) patients, respectively. A peak in the number of HCoV-NL63 infections was recorded between June and October 2012. Phylogenetic inference revealed that 62.8% of HCoV-NL63 infections belonged to genotype B, 37.2% was genotype C, while all HCoV-229E sequences were clustered within group 4. Molecular dating analysis indicated that the origin of HCoV-NL63 was dated to 1921, before it diverged into genotype A (1975), genotype B (1996), and genotype C (2003). The root of the HCoV-229E tree was dated to 1955, before it diverged into groups 1-4 between the 1970s and 1990s. The study described the seasonality, molecular diversity, and evolutionary dynamics of human alphacoronavirus infections in a tropical region. PMID:26928836

  17. Cloning, purification, crystallization and preliminary X-ray analysis of XC229, a conserved hypothetical protein from Xanthomonas campestris

    Energy Technology Data Exchange (ETDEWEB)

    Chin, Ko-Hsin; Kuo, Wei-Tien [Institute of Biochemistry, National Chung-Hsing University, Taichung 40227,Taiwan (China); Chou, Chia-Cheng; Shr, Hui-Lin [Institute of Biological Chemistry, Academia Sinica, Nankang, Taipei,Taiwan (China); Core Facility for Protein Crystallography, Academia Sinica, Nankang, Taipei,Taiwan (China); Lyu, Ping-Chiang [Department of Life Science, National Tsing Hua University, Hsin-Chu,Taiwan (China); Wang, Andrew H.-J. [Institute of Biological Chemistry, Academia Sinica, Nankang, Taipei,Taiwan (China); Core Facility for Protein Crystallography, Academia Sinica, Nankang, Taipei,Taiwan (China); Chou, Shan-Ho, E-mail: [Institute of Biochemistry, National Chung-Hsing University, Taichung 40227,Taiwan (China)


    A conserved hypothetical protein XC229 from X. campestris pv. campestris has been overexpressed in E. coli, purified and crystallized. A crystal of the purified recombinant protein diffracted to a resolution of 1.80 Å. Xanthomonas campestris pv. campestris is a Gram-negative yellow-pigmented pathogenic bacterium that causes black rot, one of the major worldwide diseases of cruciferous crops. Its genome contains approximately 4500 genes, roughly one third of which have no known structure and/or function. However, some of these unknown genes are highly conserved among several different bacterial genuses. XC229 is one such protein containing 134 amino acids. It was overexpressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystal diffracted to a resolution of at least 1.80 Å. It is cubic and belongs to space group I2{sub x}3, with unit-cell parameters a = b = c = 106.8 Å. It contains one or two molecules per asymmetric unit.

  18. Io-U dates of a coral formation from the last interglacial age on the Brazilian coast. Use of /sup 229/Th as a tracer

    Energy Technology Data Exchange (ETDEWEB)

    Bernat, M. (O.R.S.T.O.M., Universite de Nice, 06 - (France)); Martin, L.; Bittencourt, A.; Vilas Boas, G. (Universidade Federal da Bahia, Salvador (Brazil))


    Four coral samples taken in a quarry near the town of Ilheux (Bahia State, Brazil) analysed by an ..cap alpha.. spectrometry method for /sup 230/Th and uranium isotopes (using /sup 229/Th and /sup 232/U as tracers) gave a mean age of 123,500 years. These first datings confirm the general stability of the atlantic coast since that time.

  19. 12 CFR 609.910 - Compliance with the Electronic Signatures in Global and National Commerce Act (Public Law 106-229... (United States)


    ... FARM CREDIT ADMINISTRATION FARM CREDIT SYSTEM ELECTRONIC COMMERCE General Rules § 609.910 Compliance with the Electronic Signatures in Global and National Commerce Act (Public Law 106-229) (E-SIGN). (a... 12 Banks and Banking 6 2010-01-01 2010-01-01 false Compliance with the Electronic Signatures...

  20. Discovery of a ∼5 day characteristic timescale in the Kepler power spectrum of Zw 229–15

    Energy Technology Data Exchange (ETDEWEB)

    Edelson, R.; Smith, K. L.; Mushotzky, R. [Department of Astronomy, University of Maryland, College Park, MD 20742-2421 (United States); Vaughan, S. [X-Ray and Observational Astronomy Group, Department of Physics and Astronomy, University of Leicester, University Road, Leicester LE1 7RH (United Kingdom); Malkan, M. [Department of Physics and Astronomy, University of California, Los Angeles, CA 90095-1547 (United States); Kelly, B. C. [Department of Physics, Broida Hall, University of California, Santa Barbara, CA 93106-9530 (United States); Boyd, P. T., E-mail: [Astrophysics Science Division, NASA/GSFC, Code 660, Greenbelt, MD 20771 (United States)


    We present time series analyses of the full Kepler data set of Zw 229–15. This Kepler light curve—with a baseline greater than 3 yr, composed of virtually continuous, evenly sampled 30 minute measurements—is unprecedented in its quality and precision. We utilize two methods of power spectral analysis to investigate the optical variability and search for evidence of a bend frequency associated with a characteristic optical variability timescale. Each method yields similar results. The first interpolates across data gaps to use the standard Fourier periodogram. The second, using the CARMA-based time-domain modeling technique of Kelly et al., does not need evenly sampled data. Both methods find excess power at high frequencies that may be due to Kepler instrumental effects. More importantly, both also show strong bends (Δα ∼ 2) at timescales of ∼5 days, a feature similar to those seen in the X-ray power spectral densities of active galactic nuclei (AGNs) but never before in the optical. This observed ∼5 day timescale may be associated with one of several physical processes potentially responsible for the variability. A plausible association could be made with light-crossing dynamical or thermal timescales depending on the assumed value of the accretion disk size and on unobserved disk parameters such as α and H/R. This timescale is not consistent with the viscous timescale, which would be years in a ∼10{sup 7} M {sub ☉} AGN such as Zw 229–15. However, there must be a second bend on long (≳ 1 yr) timescales and that feature could be associated with the viscous timescale.

  1. Discovery of a ∼5 day characteristic timescale in the Kepler power spectrum of Zw 229–15

    International Nuclear Information System (INIS)

    We present time series analyses of the full Kepler data set of Zw 229–15. This Kepler light curve—with a baseline greater than 3 yr, composed of virtually continuous, evenly sampled 30 minute measurements—is unprecedented in its quality and precision. We utilize two methods of power spectral analysis to investigate the optical variability and search for evidence of a bend frequency associated with a characteristic optical variability timescale. Each method yields similar results. The first interpolates across data gaps to use the standard Fourier periodogram. The second, using the CARMA-based time-domain modeling technique of Kelly et al., does not need evenly sampled data. Both methods find excess power at high frequencies that may be due to Kepler instrumental effects. More importantly, both also show strong bends (Δα ∼ 2) at timescales of ∼5 days, a feature similar to those seen in the X-ray power spectral densities of active galactic nuclei (AGNs) but never before in the optical. This observed ∼5 day timescale may be associated with one of several physical processes potentially responsible for the variability. A plausible association could be made with light-crossing dynamical or thermal timescales depending on the assumed value of the accretion disk size and on unobserved disk parameters such as α and H/R. This timescale is not consistent with the viscous timescale, which would be years in a ∼107 M ☉ AGN such as Zw 229–15. However, there must be a second bend on long (≳ 1 yr) timescales and that feature could be associated with the viscous timescale.

  2. Magnetic hyperfine structure of the ground-state doublet in highly charged ions 89+,87+229Th and the Bohr-Weisskopf effect (United States)

    Tkalya, E. V.; Nikolaev, A. V.


    Background: The search for new opportunities to investigate the low-energy level in the 229Th nucleus, which is nowadays intensively studied experimentally, has motivated us to theoretical studies of the magnetic hyperfine (MHF) structure of the 5 /2+ (0.0 eV) ground state and the low-lying 3 /2+ (7.8 eV) isomeric state in highly charged 89+229Th and 87+229Th ions. Purpose: The aim is to calculate, with the maximal precision presently achievable, the energy of levels of the hyperfine structure of the 229Th ground-state doublet in highly charged ions and the probability of radiative transitions between these levels. Methods: The distribution of the nuclear magnetization (the Bohr-Weisskopf effect) is accounted for in the framework of the collective nuclear model with Nilsson model wave functions for the unpaired neutron. Numerical calculations using precise atomic density functional theory methods, with full account of the electron self-consistent field, have been performed for the electron structure inside and outside the nuclear region. Results: The deviations of the MHF structure for the ground and isomeric states from their values in a model of a pointlike nuclear magnetic dipole are calculated. The influence of the mixing of the states with the same quantum number F on the energy of sublevels is studied. Taking into account the mixing of states, the probabilities of the transitions between the components of the MHF structure are calculated. Conclusions: Our findings are relevant for experiments with highly ionized 229Th ions in a storage ring at an accelerator facility.

  3. Analysis of curative effect of gamma knife radiosurgery on 229 cases of acoustic neuromas%伽玛刀治疗听神经瘤229例疗效分析

    Institute of Scientific and Technical Information of China (English)

    粱恩顺; 佘永传


    Objective To evaluate the effect of the gamma Knife radiosurgery on acoustic neuromas. Methods 229 patients with acoustic neuromas were treated with OUR Rotating Gamma System, and the postoperative condition was observed. Result Follow-up ranged from 6 to 60 months in the group,tumor size reduced in 98 patients,remained unchanged in 115 and increased in 16. Functional hearing was reduced in 38 patients and preserved in 130 who had useful hearing prior to gamma knife treatment. 54 patients developed new facial paralysis and 11 developed trigeminal injury. Conclusion Gamma -knife radiosurgery achieves high tumor control rate for acoustic ncuromas with preservation of functional hearing, minimal facial and trigeminal injury. It provides an optional treatment for patients with small to medium size acoustic neuromas, and an important adjuvant therapy for treating residual and recurrent tumors.%[目的]评价伽玛刀治疗听神经瘤的疗效.[方法]采用OUR旋转式伽玛刀治疗229例听神经瘤患者,观察术后病情变化.[结果]本组伽玛刀治疗病例随访6~60个月,其中肿瘤缩小98例,肿瘤体积不变115例,肿瘤增大16例,治疗前存在有用听力病例中38例听力下降;130例患者有用听力得到保留;54例出现患侧面瘫;11例出现三叉神经功能部分受损.[结论]伽玛刀对听神经瘤有较高的肿瘤控制率,并能保留有用听力,对面神经、三又神经损伤小,是小至中等大小听神经瘤可供选择的治疗[方法],及术后残余和复发肿瘤的重要辅助治疗手段.

  4. A new assay for invasion of HeLa 229 cells by Bordetella pertussis: effects of inhibitors, phenotypic modulation, and genetic alterations.


    Lee, C. K.; Roberts, A. L.; Finn, T M; Knapp, S; Mekalanos, J J


    Invasion and intracellular survival of Bordetella pertussis in HeLa 229 cells was studied by a new assay that utilizes polymyxin B instead of gentamicin to rapidly kill extracellular organisms. Invasion measured by this assay was time and temperature dependent and was inhibited by the microfilament drug cytochalasin D. The invasion process was also dependent on a functional vir locus (also known as bvg), the positive regulator of virulence gene expression in B. pertussis. Four spontaneous Vir...

  5. The effect of HIV infection on the incidence and severity of circular external fixator pin track sepsis: a retrospective comparative study of 229 patients


    Ferreira, Nando; Marais, Leonard Charles


    Pin track sepsis is a common complication of circular external fixation. HIV status has been implicated as an independent risk factor for the development of pin track infection and has been cited as a reason not to attempt complex limb reconstruction in HIV-positive patients. This retrospective review of patients treated with circular external fixators looked at the incidence of pin track sepsis in HIV-positive, HIV-negative and patients whose HIV status was unknown. The records of 229 patien...

  6. Probing the effect of the non-active-site mutation Y229W in New Delhi metallo-β-lactamase-1 by site-directed mutagenesis, kinetic studies, and molecular dynamics simulations.

    Directory of Open Access Journals (Sweden)

    Jiao Chen

    Full Text Available New Delhi metallo-β-lactamase-1 (NDM-1 has attracted extensive attention for its high catalytic activities of hydrolyzing almost all β-lactam antibiotics. NDM-1 shows relatively higher similarity to subclass B1 metallo-β-lactamases (MβLs, but its residue at position 229 is identical to that of B2/B3 MβLs, which is a Tyr instead of a B1-MβL-conserved Trp. To elucidate the possible role of Y229 in the bioactivity of NDM-1, we performed mutagenesis study and molecular dynamics (MD simulations. Although residue Y229 is spatially distant from the active site and not contacting directly with the substrate or zinc ions, the Y229W mutant was found to have higher kcat and Km values than those of wild-type NDM-1, resulting in 1 ∼ 7 fold increases in k(cat /K(m values against tested antibiotics. In addition, our MD simulations illustrated the enhanced flexibility of Loop 2 upon Y229W mutation, which could increase the kinetics of both substrate entrance (kon and product egress (koff. The enhanced flexibility of Loop 2 might allow the enzyme to adjust the geometry of its active site to accommodate substrates with different structures, broadening its substrate spectrum. This study indicated the possible role of the residue at position 229 in the evolution of NDM-1.

  7. K2-29 b/WASP-152 b: An Aligned and Inflated Hot Jupiter in a Young Visual Binary (United States)

    Santerne, A.; Hébrard, G.; Lillo-Box, J.; Armstrong, D. J.; Barros, S. C. C.; Demangeon, O.; Barrado, D.; Debackere, A.; Deleuil, M.; Delgado Mena, E.; Montalto, M.; Pollacco, D.; Osborn, H. P.; Sousa, S. G.; Abe, L.; Adibekyan, V.; Almenara, J.-M.; André, P.; Arlic, G.; Barthe, G.; Bendjoya, P.; Behrend, R.; Boisse, I.; Bouchy, F.; Boussier, H.; Bretton, M.; Brown, D. J. A.; Carry, B.; Cailleau, A.; Conseil, E.; Coulon, G.; Courcol, B.; Dauchet, B.; Dalouzy, J.-C.; Deldem, M.; Desormières, O.; Dubreuil, P.; Fehrenbach, J.-M.; Ferratfiat, S.; Girelli, R.; Gregorio, J.; Jaecques, S.; Kugel, F.; Kirk, J.; Labrevoir, O.; Lachurié, J.-C.; Lam, K. W. F.; Le Guen, P.; Martinez, P.; Maurin, L. P. A.; McCormac, J.; Pioppa, J.-B.; Quadri, U.; Rajpurohit, A.; Rey, J.; Rivet, J.-P.; Roy, R.; Santos, N. C.; Signoret, F.; Strabla, L.; Suarez, O.; Toublanc, D.; Tsantaki, M.; Vienney, J.-M.; Wilson, P. A.; Bachschmidt, M.; Colas, F.; Gerteis, O.; Louis, P.; Mario, J.-C.; Marlot, C.; Montier, J.; Perroud, V.; Pic, V.; Romeuf, D.; Ubaud, S.; Verilhac, D.


    In the present paper we report the discovery of a new hot Jupiter, K2-29 b, first detected by the Super-WASP observatory and then by the K2 space mission during its campaign 4. The planet has a period of 3.25 days, a mass of 0.73 ± 0.04 M ♃, and a radius of 1.19 ± 0.02 R ♃. The host star is a relatively bright (V = 12.5) G7 dwarf with a nearby K5V companion. Based on stellar rotation and the abundance of lithium, we find that the system might be as young as ~450 Myr. The observation of the Rossiter–McLaughlin effect shows that the planet is aligned with respect to the stellar spin. Given the deep transit (20 mmag), the magnitude of the star and the presence of a nearby stellar companion, the planet is a good target for both space- and ground-based transmission spectroscopy, in particular in the near-infrared where both stars are relatively bright.

  8. Discovery of a ~5 day characteristic timescale in the Kepler power spectrum of Zw 229-15

    CERN Document Server

    Edelson, Rick; Malkan, Matt; Kelly, Brandon; Smith, Krista; Boyd, Padi; Mushotzky, Richard


    We present time series analyses of the full Kepler dataset of Zw 229-15. This Kepler light curve --- with a baseline greater than three years, composed of virtually continuous, evenly sampled 30-minute measurements --- is unprecedented in its quality and precision. We utilize two methods of power spectral analysis to investigate the optical variability and search for evidence of a bend frequency associated with a characteristic optical variability timescale. Each method yields similar results. The first interpolates across data gaps to use the standard Fourier periodogram. The second, using the CARMA-based time-domain modeling technique of Kelly et al. (2014), does not need evenly-sampled data. Both methods find excess power at high frequencies that may be due to Kepler instrumental effects. More importantly both also show strong bends ({\\Delta}{\\alpha} ~ 2) at timescales of ~5 days, a feature similar to those seen in the X-ray PSDs of AGN but never before in the optical. This observed ~5 day timescale may be...

  9. Computational simulations of the effects of the G229D KCNQ1 mutation on human atrial fibrillation. (United States)

    Zulfa, Indana; Shim, Eun Bo; Song, Kwang-Soup; Lim, Ki Moo


    Atrial fibrillation (AF) is related to mutations at the genetic level. This includes mutations in genes that encode KCNQ1, a subunit of the I Ks channel. Here, we investigate the mechanism of gain-of-function in I Ks towards the occurrence of AF. We used the Courtemanche-Ramirez-Nattel (CRN) human atrial cell model (Am J Physiol Heart Circ Physiol 275:H301-H321, 1998) and applied the modification proposed by Hasegawa et al. (Heart Rhythm 11:67-75, 2014) to fit the behavior of I Ks due to the G229D mutation in KCNQ1 under a heterozygous mutant form. This was incorporated into two-(2D) and three-dimensional (3D) tissue models, where the mutation sustained a reentrant wave. However, under the wild-type condition, the reentrant wave terminated before the end of our simulations (in 2D, the spiral wave terminated before 10 s, while in 3D, the spiral wave terminated before 13 s). Sustained reentry under the mutation conditions also resulted in a spiral wave breakup in the 3D model, which was sustained until the end of the simulation (20 s), indicating AF. PMID:26922794

  10. Investigation of HIV Infection and Living Condition of 229 HIV Related Died Male's Widows%229名HIV故亡者女性遗属HIV感染情况及生活现状调查

    Institute of Scientific and Technical Information of China (English)

    林赟; 杨佳; 罗志; 刘汶骏; 薛皓铭; 杨丽华; 朵林


    目的通过调查了解HIV故亡者女性遗属HIV感染现状及目前的生活状况,为下一步服务提供依据。方法横断面研究,回顾性调查,滚雪球抽样方法,云南省芒市、陇川、蒙自3县HIV故亡者女性遗属为调查对象,问卷收集基本信息、高危行为、生活现状及血样检测结果,SPSS17.0进行数据分析。结果共调查229人,汉族、农民和待业或无业为主;HIV检测阳性率61.1%;41.05%的调查对象曾经注射毒品;HIV检测结果为阳性和阴性的女性遗属在丈夫去世后单身时间、月收入有统计学差异,经济来源、受歧视程度、情绪消极程度无统计学差异。结论 HIV故亡者女性遗属吸毒人员较多,面临严峻的HIV感染风险,多无固定经济来源,社会歧视和自身消极情绪明显,需要社会各部门共同关注。%Objective Based on research the status quo and requirements of subsistence among HIV related died widows, to provide them further and targeted help. Methods Cross-section study and snowball sampling, retrospective investigation chose HIV related died widows distribute in Mangshi, Longchuan and Mengzi 3 counties in Yunnan to be the investigated object. Use questionnaire to collected demography, HIV related high risk behaviors, living condition and result of blood test. Meanwhile, use SPSS17.0 to analyze the data. Results Investigated 229 people, 41.05%respondents injected drug before. Most respondents are Han people, farmer and waiting job or unemployed. The HIV positive rate is 61.14%. there is statistic difference in single living time and salary per month between positive and negative HIV widows. However, no statistic difference among source of finance, the degree of discriminate and negative degree. Conclusion Most respondents are drug users themselves, they face high risk of HIV infection, social discrimination and their own negative emotions. they have no fixed income and need more concern from

  11. No-mesh inguinal hernia repair with continuous absorbable sutures: A dream or reality? (a study of 229 patients

    Directory of Open Access Journals (Sweden)

    Desarda Mohan


    Full Text Available Background/Aim: The author has published results from two series based on his new technique of inguinal hernia repair. Interrupted sutures with a nonabsorbable material were used for repairs in both theses series. The author now describes the results of repairs done with continuous absorbable sutures. Materials and Methods: This is a prospective study of 229 patients having 256 hernias operated from December 2003 to December 2006. An undetached strip of the external oblique aponeurosis was sutured between the inguinal ligament and the muscle arch to form the new posterior wall. Continuous sutures were taken with absorbable suture material (Monofilament Polydioxanone Violet. Data of hospital stay, complications, ambulation, recurrences, and pain were recorded. Follow-up was done until June 2007. Results: A total of 224 (97.8% patients were ambulatory within 6-8 h (mean: 6.42 h and they attained free ambulation within 18-24 h (mean: 19.26 h. A total of 222 (96.4% patients returned to work within 6-14 days (mean: 8.62 days and 209 (91.26% patients had one-night stays in the hospital. A total of 216 (94.3% patients had mild pain for 2 days. There were four minor complications, but no recurrence or incidence of chronic groin pain. Patients were followed up for a mean period of 24.28 months (range: 6-42 months. Conclusions: The results of this study correlate well with the author′s previous publications. Continuous suturing saves operative time and one packet of suture material. The dream of every surgeon to give recurrence-free inguinal hernia repair without leaving any foreign body inside the patient may well become a reality in future.

  12. Quantifying UV-B flux over the Late Triassic Carnian Pluvial Extinction Event (c. 233-229 Ma). (United States)

    Miller, Charlotte; Fraser, Wesley; Jardine, Phil; Kürschner, Wolfram


    The geological record contains numerous episodes of global environmental change associated with pronounced transient perturbations to the global carbon cycle, some of which are closely linked with ocean acidification and mass extinction. Here, we focus on the Late Triassic mass extinction during the Carnian Pluvial Event (CPE) which occurred c. 233-229 million-years-ago (Ma). The CPE extinction remains one of the least studied and most controversial biotic crises due primarily to the lack of well-dated sedimentary successions. The CPE interval features a -4 o δ13C excursion, which is interpreted as a massive atmospheric injection of 13C-depleted carbon from the Wrangellia Flood Basalts. The associated increase in atmospheric pCO2 may then have accelerated the hydrological cycle, resulting in increased weathering and enhanced siliciclastic delivery to shallow carbonate basins. Volcanic activity is known to significantly alter the amount of incoming solar UV-B radiation via dimming processes, the destruction of ozone and increased cloud formation via the addition of cloud condensation nuclei to the atmosphere. To reconstruct variations in UV-B flux we have measured the abundance of phenolic components (UV-B absorbing compounds) contained within the cell wall of Ovalipollis pollen grains across the CPE, from samples taken from the Lunz region (Austria). These phenolic components are part of the defensive system of plants, where the abundance of phenolics increases with elevated UV-B flux. Our preliminary data indicate i) that the highest abundance of phenolics occur in the latter stages of the CPE, ii) the abundance of phenolics are highly variable throughout the CPE, and iii) the abundance of phenolics broadly increase towards the end of the Late Triassic. Here we will discuss the significance of the obtained data in terms of palaeoclimatic variability and the impact of volcanism during the Carnian Pluvial Event.

  13. Resonance ionization spectroscopy of thorium isotopestowards a laser spectroscopic identification of the low-lying 7.6 eV isomer of 229Th


    Raeder, S.; Sonnenschein, V.; Gottwald, T; Moore, I. D.; Reponen, M.; Rothe, S.; Trautmann, N; Wendt, K


    Abstract In-source resonance ionization spectroscopy was used to identify an efficient and selective three step excitation/ionization scheme of thorium, suitable for titanium:sapphire (Ti:sa) lasers. The measurements were carried out in preparation of laser spectroscopic investigations for an identification of the low-lying 229 m Th isomer predicted at 7.6 ? 0.5 eV above the nuclear ground state. Using a sample of 232 Th, a multitude of optical transitions leading to over 20 previously unk...

  14. Correction to the paper “a simple model to determine the interrelation between the integral characteristics of hall thrusters” [Plasma Physics Reports 40, 229 (2014)

    Energy Technology Data Exchange (ETDEWEB)

    Shumilin, V. P. [All-Russian Electrotechnical Institute (Russian Federation); Shumilin, A. V.; Shumilin, N. V., E-mail: [Moscow Institute of Electronics and Mathematics (Russian Federation)


    The paper is devoted to comparison of experimental data with theoretical predictions concerning the dependence of the current of accelerated ions on the operating voltage of a Hall thruster with an anode layer. The error made in the paper published by the authors in Plasma Phys. Rep. 40, 229 (2014) occurred because of a misprint in the Encyclopedia of Low-Temperature Plasma. In the present paper, this error is corrected. It is shown that the simple model proposed in the above-mentioned paper is in qualitative and quantitative agreement with experimental results.

  15. Optical/Near-IR Polarization Survey of Sh 2-29: Magnetic Fields, Dense Cloud Fragmentations and Anomalous Dust Grain Sizes


    Santos, Fábio P.; Franco, Gabriel A. P.; Roman-Lopes, Alexandre; Reis, Wilson; Román-Zúñiga, Carlos G.


    Sh 2-29 is a conspicuous star-forming region marked by the presence of massive embedded stars as well as several notable interstellar structures. In this research, our goals were to determine the role of magnetic fields and to study the size distribution of interstellar dust particles within this turbulent environment. We have used a set of optical and near-infrared polarimetric data obtained at OPD/LNA (Brazil) and CTIO (Chile), correlated with extinction maps, 2MASS data and images from DSS...

  16. In vitro activity of nonoxynol 9 on HeLa 229 cells and primary monkey cervical epithelial cells infected with Chlamydia trachomatis.


    Patton, D L; Wang, S. K.; Kuo, C C


    Nonoxynol 9 (non-9) is the active ingredient in a wide variety of vaginal contraceptive preparations. The manufacturer recommendation for optimal contraceptive practice is repeated application every 6 h. We studied the in vitro activity of non-9 against Chlamydia trachomatis (E/UW-5/Cx) and its toxicity against HeLa 229 cells and monkey cervical epithelial cells. With a contact time of 6 h, non-9 was toxic to HeLa cells at concentrations of 50 micrograms/ml or greater and to monkey cervical c...

  17. Correction to the paper “a simple model to determine the interrelation between the integral characteristics of hall thrusters” [Plasma Physics Reports 40, 229 (2014)

    International Nuclear Information System (INIS)

    The paper is devoted to comparison of experimental data with theoretical predictions concerning the dependence of the current of accelerated ions on the operating voltage of a Hall thruster with an anode layer. The error made in the paper published by the authors in Plasma Phys. Rep. 40, 229 (2014) occurred because of a misprint in the Encyclopedia of Low-Temperature Plasma. In the present paper, this error is corrected. It is shown that the simple model proposed in the above-mentioned paper is in qualitative and quantitative agreement with experimental results

  18. Resonance ionization spectroscopy of thorium isotopes-towards a laser spectroscopic identification of the low-lying 7.6 eV isomer of 229Th

    International Nuclear Information System (INIS)

    In-source resonance ionization spectroscopy was used to identify an efficient and selective three-step excitation/ionization scheme of thorium, suitable for titanium:sapphire (Ti:sa) lasers. The measurements were carried out in the preparation of laser spectroscopic investigations for an identification of the low-lying 229mTh isomer predicted at 7.6 ± 0.5 eV above the nuclear ground state. Using a sample of 232Th, a multitude of optical transitions leading to over 20 previously unknown intermediate states of even parity as well as numerous high-lying odd parity auto-ionizing (AI) states were identified. Level energies were determined with an accuracy of 0.06 cm-1 for intermediate and 0.15 cm-1 for AI states. Using different excitation pathways, an assignment of total angular momenta for several energy levels was possible. One particularly efficient ionization scheme of thorium, exhibiting saturation in all three optical transitions, was studied in detail. For all three levels in this scheme, the isotope shifts of the isotopes 228Th, 229Th and 230Th relative to 232Th were measured. An overall efficiency including ionization, transport and detection of 0.6% was determined, which was predominantly limited by the transmission of the mass spectrometer ion optics.

  19. Resonance ionization spectroscopy of thorium isotopes-towards a laser spectroscopic identification of the low-lying 7.6 eV isomer of {sup 229}Th

    Energy Technology Data Exchange (ETDEWEB)

    Raeder, S; Sonnenschein, V; Gottwald, T; Rothe, S; Wendt, K [Institute of Physics, University of Mainz, Staudingerweg 7, 55128 Mainz (Germany); Moore, I D; Reponen, M [Department of Physics, University of Jyvaeskylae, Survontie 9, 40014 Jyvaeskylae (Finland); Trautmann, N, E-mail:, E-mail: [Institute of Nuclear Chemistry, University of Mainz, Fritz-Strassmann-Weg 2, 55128 Mainz (Germany)


    In-source resonance ionization spectroscopy was used to identify an efficient and selective three-step excitation/ionization scheme of thorium, suitable for titanium:sapphire (Ti:sa) lasers. The measurements were carried out in the preparation of laser spectroscopic investigations for an identification of the low-lying {sup 229m}Th isomer predicted at 7.6 {+-} 0.5 eV above the nuclear ground state. Using a sample of {sup 232}Th, a multitude of optical transitions leading to over 20 previously unknown intermediate states of even parity as well as numerous high-lying odd parity auto-ionizing (AI) states were identified. Level energies were determined with an accuracy of 0.06 cm{sup -1} for intermediate and 0.15 cm{sup -1} for AI states. Using different excitation pathways, an assignment of total angular momenta for several energy levels was possible. One particularly efficient ionization scheme of thorium, exhibiting saturation in all three optical transitions, was studied in detail. For all three levels in this scheme, the isotope shifts of the isotopes {sup 228}Th, {sup 229}Th and {sup 230}Th relative to {sup 232}Th were measured. An overall efficiency including ionization, transport and detection of 0.6% was determined, which was predominantly limited by the transmission of the mass spectrometer ion optics.

  20. Resonance ionization spectroscopy of thorium isotopes-towards a laser spectroscopic identification of the low-lying 7.6 eV isomer of 229Th (United States)

    Raeder, S.; Sonnenschein, V.; Gottwald, T.; Moore, I. D.; Reponen, M.; Rothe, S.; Trautmann, N.; Wendt, K.


    In-source resonance ionization spectroscopy was used to identify an efficient and selective three-step excitation/ionization scheme of thorium, suitable for titanium:sapphire (Ti:sa) lasers. The measurements were carried out in the preparation of laser spectroscopic investigations for an identification of the low-lying 229mTh isomer predicted at 7.6 ± 0.5 eV above the nuclear ground state. Using a sample of 232Th, a multitude of optical transitions leading to over 20 previously unknown intermediate states of even parity as well as numerous high-lying odd parity auto-ionizing (AI) states were identified. Level energies were determined with an accuracy of 0.06 cm-1 for intermediate and 0.15 cm-1 for AI states. Using different excitation pathways, an assignment of total angular momenta for several energy levels was possible. One particularly efficient ionization scheme of thorium, exhibiting saturation in all three optical transitions, was studied in detail. For all three levels in this scheme, the isotope shifts of the isotopes 228Th, 229Th and 230Th relative to 232Th were measured. An overall efficiency including ionization, transport and detection of 0.6% was determined, which was predominantly limited by the transmission of the mass spectrometer ion optics.

  1. Construction of testing facilities and verifying tests of a 22.9 kV/630 A class superconducting fault current limiter

    International Nuclear Information System (INIS)

    We have constructed and completed the preparation for a long-term operation test of a superconducting fault current limiter (SFCL) in a Korea Electric Power Corporation (KEPCO) test grid. The SFCL with rating of 22.9 kV/630 A, 3-phases, has been connected to the 22.9 kV test grid equipped with reclosers and other protection devices in Gochang Power Testing Center of KEPCO. The main goals of the test are the verification of SFCL performance and protection coordination studies. A line-commutation type SFCL was fabricated and installed for this project, and the superconducting components were cooled by a cryo-cooler to 77 K in the sub-cooled liquid nitrogen pressurized by 3 bar of helium gas. The verification test includes un-manned - long-term operation with and without loads and fault tests. Since the test site is 170 km away from the laboratory, we will adopt the un-manned operation with real-time remote monitoring and controlling using high speed internet. For the fault tests, we will apply fault currents up to around 8 kArms to the SFCL using an artificial fault generator. The fault tests may allow us not only to confirm the current limiting capability of the SFCL, but also to adjust the SFCL - recloser coordination such as resetting over-current relay parameters. This paper describes the construction of the testing facilities and discusses the plans for the verification tests.

  2. Band structure and decay channels of thorium-229 low-lying isomeric state for ensemble of thorium atoms adsorbed on calcium fluoride

    International Nuclear Information System (INIS)

    The results are presented on the study of the electronic structure of thorium atoms adsorbed by the liquid atomic layer deposition from aqueous solution of thorium nitrate on the surface of CaF2. The chemical state of the atoms and the change of the band structure in the surface layers of Th/CaF2 system on CaF2 substrate were investigated by XPS and REELS techniques. It was found that REELS spectra for Th/CaF2 system include peaks in the region of low energy losses (3-7 eV) which are missing in the similar spectra for pure CaF2. It is concluded that the presence of the observed features in the REELS spectra is associated with the chemical state of thorium atoms and is caused by the presence of uncompensated chemical bonds at the Th/CaF2 interface, and, therefore, by the presence of unbound 6d- and 7s-electrons of thorium atoms. Assuming the equivalence of the electronic configuration of thorium-229 and thorium-232 atoms, an estimate was made on the time decay of the excited state of thorium-229 nuclei through the channel of the electron conversion. It was found that the relaxation time is about 40 μs for 6d-electrons, and about 1 μs for 7s-electrons. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  3. MicroRNA-21 inhibitor sensitizes human glioblastoma cells U251 (PTEN-mutant) and LN229 (PTEN-wild type) to taxol

    International Nuclear Information System (INIS)

    Substantial data indicate that the oncogene microRNA 21 (miR-21) is significantly elevated in glioblastoma multiforme (GBM) and regulates multiple genes associated with cancer cell proliferation, apoptosis, and invasiveness. Thus, miR-21 can theoretically become a target to enhance the chemotherapeutic effect in cancer therapy. So far, the effect of downregulating miR-21 to enhance the chemotherapeutic effect to taxol has not been studied in human GBM. Human glioblastoma U251 (PTEN-mutant) and LN229 (PTEN wild-type) cells were treated with taxol and the miR-21 inhibitor (in a poly (amidoamine) (PAMAM) dendrimer), alone or in combination. The 50% inhibitory concentration and cell viability were determined by the MTT assay. The mechanism between the miR-21 inhibitor and the anticancer drug taxol was analyzed using the Zheng-Jun Jin method. Annexin V/PI staining was performed, and apoptosis and the cell cycle were evaluated by flow cytometry analysis. Expression of miR-21 was investigated by RT-PCR, and western blotting was performed to evaluate malignancy related protein alteration. IC(50) values were dramatically decreased in cells treated with miR-21 inhibitor combine with taxol, to a greater extent than those treated with taxol alone. Furthermore, the miR-21 inhibitor significantly enhanced apoptosis in both U251 cells and LN229 cells, and cell invasiveness was obviously weakened. Interestingly, the above data suggested that in both the PTEN mutant and the wild-type GBM cells, miR-21 blockage increased the chemosensitivity to taxol. It is worth noting that the miR-21 inhibitor additively interacted with taxol on U251cells and synergistically on LN229 cells. Thus, the miR-21 inhibitor might interrupt the activity of EGFR pathways, independently of PTEN status. Meanwhile, the expression of STAT3 and p-STAT3 decreased to relatively low levels after miR-21 inhibitor and taxol treatment. The data strongly suggested that a regulatory loop between miR-21 and STAT3 might

  4. User's guide to program RCN. [Set of 3 FORTRAN IV programs, RCN29, HFMOD7, and RCN229, for SCF calculations of radial wave functions; for CDC 7600 computer

    Energy Technology Data Exchange (ETDEWEB)

    Cowan, R. D.; Rajnak, K.; Renard, P.


    This is a set of three Fortran IV programs, RCN29, HFMOD7, and RCN229, based on the Herman--Skillman and Charlotte Froese Fischer programs, with extensive modifications and additions. The programs compute self-consistent-field radial wave functions and the various radial integrals involved in the computation of atomic energy levels and spectra.

  5. Magnetic hyperfine structure of the ground-state doublet in highly charged ions $^{229}$Th$^{89+,87+}$ and the Bohr-Weisskopf effect

    CERN Document Server

    Tkalya, E V


    The magnetic hyperfine (MHF) structure of the $5/2^+$(0.0 eV) ground state and the low-lying $3/2^+$(7.8 eV) isomeric state of the $^{229}$Th nucleus in highly charged ions Th$^{89+}$ and Th$^{87+}$ is calculated. The distribution of the nuclear magnetization (the Bohr-Weisskopf effect) is accounted for in the framework of the collective nuclear model with the wave functions of the Nilsson model for the unpaired neutron. The deviations of the MHF structure for the ground and isomeric states from their values in the model of point-like nuclear magnetic dipole are calculated. The influence of the mixing of the states with the same quantum number $F$ on the energy of sublevels is studied. Taking into account the mixing of states, the probabilities of the transitions between the components of MHF structure are found.

  6. Band structure and decay channels of thorium-229 low-lying isomeric state for ensemble of thorium atoms adsorbed on calcium fluoride

    Energy Technology Data Exchange (ETDEWEB)

    Borisyuk, Petr V.; Vasilyev, Oleg S.; Krasavin, Andrey V.; Troyan, Victor I. [National Research Nuclear University ' ' MEPhI' ' (Moscow Engineering Physics Institute), Kashirskoye shosse 31, 115409 Moscow (Russian Federation); Lebedinskii, Yury Yu. [National Research Nuclear University ' ' MEPhI' ' (Moscow Engineering Physics Institute), Kashirskoye shosse 31, 115409 Moscow (Russian Federation); Moscow Institute of Physics and Technology (State University), Institutskiy per. 9, 141700 Dolgoprudny, Moscow region (Russian Federation); Tkalya, Eugene V. [Skobeltsyn Institute of Nuclear Physics, Lomonosov Moscow State University, Leninskie gory, 119991 Moscow (Russian Federation); Nuclear Safety Institute of Russian Academy of Science, Bol' shaya Tulskaya 52, 115191 Moscow (Russian Federation)


    The results are presented on the study of the electronic structure of thorium atoms adsorbed by the liquid atomic layer deposition from aqueous solution of thorium nitrate on the surface of CaF{sub 2}. The chemical state of the atoms and the change of the band structure in the surface layers of Th/CaF{sub 2} system on CaF{sub 2} substrate were investigated by XPS and REELS techniques. It was found that REELS spectra for Th/CaF{sub 2} system include peaks in the region of low energy losses (3-7 eV) which are missing in the similar spectra for pure CaF{sub 2}. It is concluded that the presence of the observed features in the REELS spectra is associated with the chemical state of thorium atoms and is caused by the presence of uncompensated chemical bonds at the Th/CaF{sub 2} interface, and, therefore, by the presence of unbound 6d- and 7s-electrons of thorium atoms. Assuming the equivalence of the electronic configuration of thorium-229 and thorium-232 atoms, an estimate was made on the time decay of the excited state of thorium-229 nuclei through the channel of the electron conversion. It was found that the relaxation time is about 40 μs for 6d-electrons, and about 1 μs for 7s-electrons. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  7. Assessment of contralateral neck failure in 229 cases of carcinoma of the tonsillar region treated with techniques designed to spare contralateral parotid function

    International Nuclear Information System (INIS)

    Purpose/Objective: Radiation-induced xerostomia is a frequent cause of morbidity in head and neck cancer patients. To minimize this complication unilateral techniques (UT) designed to treat the primary tumor and ipsilateral neck have been used for many years in selected cases at our institution. Although such techniques exclude the contralateral parotid from the high dose target volume, they also leave the contralateral neck nodes untreated. The purpose of the study was to evaluate the risk of failure in the opposite neck. Materials and Methods: We identified 229 patients treated with UT from a series of 641 cases with carcinoma of the tonsillar region treated with curative intent between 1970 and 1991. Detailed documentation of the tumor, the radiation dosimetry, the sites of failure, and outcome including local, regional, and distant failure, and late complications, were performed. Actuarial 5-year plots were used to calculate local control, regional control, and survival rates. Results: Median age was 61 years (74 females/155 males); median follow-up 8 years (range 6 months to 21 years). AJCC (1992) T categories were T1:73, T2:120, T3:30, T4:6. The N category distribution was: N0:136, N1:53, N2a:29, N2b:8, and N3:8 cases. Base of tongue and palate were involved in 49 and 82 cases respectively. Irradiation techniques consisted of ipsilateral wedge pairs with Cobalt of 6MV photons in 210 cases (92%), while the remainder were electrons with or without photons. Customized compensators were used in the majority of cases in addition to the use of wedge filters. 75% received 50 Gy in 4 weeks, 10% received 60 Gy in 6 weeks, while the remainder received other doses intended to be curative. A radioactive implant was also used in 20 patients. The 5-year actuarial rates were as follows: overall local control: 76%, regional node control: 80%; cause specific survival: 80%. A total of 7 patients manifested regional disease in the opposite neck (crude rate of 3% or 7 of 229

  8. Resonance ionization spectroscopy of thorium isotopes-towards a laser spectroscopic identification of the low-lying 7.6 eV isomer of (229)Th

    CERN Document Server

    Raeder, S; Wendt, K; Sonnenschein, V; Trautmann, N; Rothe, S; Reponen, M; Gottwald, T


    In-source resonance ionization spectroscopy was used to identify an efficient and selective three-step excitation/ionization scheme of thorium, suitable for titanium: sapphire (Ti:sa) lasers. The measurements were carried out in the preparation of laser spectroscopic investigations for an identification of the low-lying (229m)Th isomer predicted at 7.6 +/- 0.5 eV above the nuclear ground state. Using a sample of (232)Th, a multitude of optical transitions leading to over 20 previously unknown intermediate states of even parity as well as numerous high-lying odd parity auto-ionizing (AI) states were identified. Level energies were determined with an accuracy of 0.06 cm(-1) for intermediate and 0.15 cm(-1) for AI states. Using different excitation pathways, an assignment of total angular momenta for several energy levels was possible. One particularly efficient ionization scheme of thorium, exhibiting saturation in all three optical transitions, was studied in detail. For all three levels in this scheme, the is...

  9. Lymphocytosis and Lymphopenia Induced by Imported Infectious Diseases: A Controlled Cross-Sectional Study of 17,229 Diseased German Travelers Returning from the Tropics and Subtropics. (United States)

    Herbinger, Karl-Heinz; Hanus, Ingrid; Beissner, Marcus; Berens-Riha, Nicole; Kroidl, Inge; von Sonnenburg, Frank; Löscher, Thomas; Hoelscher, Michael; Nothdurft, Hans Dieter; Schunk, Mirjam


    The present controlled cross-sectional study aimed to assess relative and absolute lymphocytosis and lymphopenia induced by imported infectious diseases (IDs) seen among patients consulting the Division of Infectious Diseases and Tropical Medicine, Medical Center of the University of Munich (1999-2014) after being in the tropics and subtropics. The analysis investigated data sets from 17,229 diseased German travelers returning from Latin America (3,238), Africa (5,467), and Asia (8,524), and from 1,774 healthy controls who had not recently traveled. Among the cases, the proportion of those with relative lymphopenia (10.5%) and absolute lymphopenia (8.0%) was significantly higher than among controls (3.2% and 3.6%, respectively), whereas relative lymphocytosis was significantly lower among cases (6.1%) than among controls (8.0%). The study identified IDs with significantly larger proportions of relative lymphocytosis (cytomegalovirus [CMV] infection [56%], infectious mononucleosis [51%], and dengue fever [11%]); absolute lymphocytosis (infectious mononucleosis [70%] and CMV infection [63%]); relative lymphopenia (streptococcal pharyngitis [56%], malaria [34%], Campylobacter infection [19%], salmonellosis [18%], and shigellosis [17%]); and of absolute lymphopenia (human immunodeficiency virus infection [53%], malaria [45%], dengue fever [40%], salmonellosis [16%], and Campylobacter infection [11%]). This study demonstrates that relative and absolute lymphocytosis and lymphopenia are useful laboratory findings for travelers returning from the tropics and subtropics, as they are typically caused by imported viral, bacterial, and protozoan IDs. PMID:27068397

  10. Basic design of 22.9 kV/630 A resistive superconducting fault current limiting coil using YBCO coated conductor

    International Nuclear Information System (INIS)

    Based on active developing of YBCO coated conductor (CC), various applications of the conductor have been developed recently. HTS systems offer tremendous advantages. Of them, since YBCO material has a high index number and specifications such as thickness and material of the stabilizer of the conductor can be controlled, CC has many advantages for applying to superconducting fault current limiter (SFCL). In general, coated conductor has a thick metal layer as a stabilizer above superconducting layer such as YBCO. Since SFCL plays a role of limiting fault current using high resistivity when a fault occurs, it is important for the design of SFCL to choose and design the stabilizer. In this paper, the design parameters for SFCL have been found. For optimal design, specifications of CC and reached temperature during the fault as well as winding structure are investigated by experiments. From this investigation, safe electric field intensity was 40-56 V/m under the condition of temperature limit of 300-400 K. Considering the electric field intensity and the number of stacks, total required length of coated conductor was estimated. Consequently, required length of YBCO CC already commercialized with stainless steel stabilizer is between 5.66 and 7.92 km for three-phase distribution class SFCL rated on 22.9 kV/630 A. In addition, a possible design using expected wire was also conducted

  11. Optical/Near-IR Polarization Survey of Sh 2-29: Magnetic Fields, Dense Cloud Fragmentations and Anomalous Dust Grain Sizes

    CERN Document Server

    Santos, Fábio P; Roman-Lopes, Alexandre; Reis, Wilson; Román-Zúñiga, Carlos G


    Sh 2-29 is a conspicuous star-forming region marked by the presence of massive embedded stars as well as several notable interstellar structures. In this research, our goals were to determine the role of magnetic fields and to study the size distribution of interstellar dust particles within this turbulent environment. We have used a set of optical and near-infrared polarimetric data obtained at OPD/LNA (Brazil) and CTIO (Chile), correlated with extinction maps, 2MASS data and images from DSS and Spitzer. The region's most striking feature is a swept out interstellar cavity whose polarimetric maps indicate that magnetic field lines were dragged outwards, pilling up along its borders. This led to a higher magnetic strength value ($\\approx400\\,\\mu$G) and an abrupt increase in polarization degree, probably due to an enhancement in alignment efficiency. Furthermore, dense cloud fragmentations with peak $A_{V}$ between 20 and 37 mag were probably triggered by its expansion. The presence of $24\\,\\mu$m point-like so...

  12. Laser excitation of 8-eV electronic states in Th{sup +}. A first pillar of the electronic bridge toward excitation of the Th-229 nucleus

    Energy Technology Data Exchange (ETDEWEB)

    Herrera-Sancho, Oscar-Andrey


    The possibility to realize a nuclear clock based on the optical magnetic dipole transition from the ground state to the low-energy isomeric state in the {sup 229}Th nucleus has motivated experiments and proposals toward highly accurate clocks with trapped ions and highly stable optical frequency standards with Th-doped solids. These systems hold great promise to open a field of research in the borderland between atomic and nuclear physics, which will enable highly sensitive tests of postulates from fundamental physics and also will allow us to coherently excite and control nuclear states, opening a wonderful and intriguing new field in physics. A major experimental obstacle that has to be overcome before any precision spectroscopy can be performed with this system is however the insufficient knowledge on the exact transition energy. The best experimental result so far is an indirect determination from {gamma}-spectroscopy with a relative uncertainty of about 6%. To facilitate the search for the nuclear transition within a wide uncertainty range around 8 eV, we investigate two-photon excitation in the dense electronic level structure of Th{sup +}, which enables the nuclear excitation via a resonantly enhanced inverse electronic bridge process. Experiments on one- and two-photon laser excitation of buffer gas cooled {sup 232}Th{sup +} ions in a radio-frequency ion trap are reported in this thesis. The strongest resonance line at 402 nm from the (6d{sup 2}7s)J=3/2 ground state to the (6d7s7p)J=5/2 state is driven as the first excitation step. Using nanosecond laser pulses in the 250-nm wavelength range for the second step of a two-photon excitation, we have observed seven previously unknown levels in the unexplored region of the electronic level structure around 8 eV. This investigation shows that the Th{sup +} ion seems to be well suited for the search of the isomer transition because both, theory and experimental results, agree on the density of strong transitions

  13. Optical/near-infrared polarization survey of Sh 2-29: Magnetic fields, dense cloud fragmentations, and anomalous dust grain sizes

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Fábio P.; Franco, Gabriel A. P.; Reis, Wilson [Departamento de Física, ICEx, UFMG, Caixa Postal 702, 30.123-970 Belo Horizote, MG (Brazil); Roman-Lopes, Alexandre [Departamento de Fisica-Universidad de La Serena, Cisternas 1200, La Serena (Chile); Román-Zúñiga, Carlos G., E-mail:, E-mail:, E-mail:, E-mail:, E-mail: [Instituto de Astronomía-Universidad Nacional Autónoma de México, Unidad Académica en Ensenada, Ensenada BC 22860 (Mexico)


    Sh 2-29 is a conspicuous star-forming region marked by the presence of massive embedded stars as well as several notable interstellar structures. In this research, our goals were to determine the role of magnetic fields and to study the size distribution of interstellar dust particles within this turbulent environment. We have used a set of optical and near-infrared polarimetric data obtained at OPD/LNA (Brazil) and CTIO (Chile), correlated with extinction maps, Two Micron All Sky Survey data, and images from the Digitized Sky Survey and Spitzer. The region's most striking feature is a swept out interstellar cavity whose polarimetric maps indicate that magnetic field lines were dragged outward, piling up along its borders. This led to a higher magnetic strength value (≈400 μG) and an abrupt increase in polarization degree, probably due to an enhancement in alignment efficiency. Furthermore, dense cloud fragmentations with peak A{sub V} between 20 and 37 mag were probably triggered by its expansion. The presence of 24 μm point-like sources indicates possible newborn stars inside this dense environment. A statistical analysis of the angular dispersion function revealed areas where field lines are aligned in a well-ordered pattern, seemingly due to compression effects from the H II region expansion. Finally, Serkowski function fits were used to study the ratio of the total-to-selective extinction, revealing a dual population of anomalous grain particle sizes. This trend suggests that both effects of coagulation and fragmentation of interstellar grains are present in the region.

  14. Optical/near-infrared polarization survey of Sh 2-29: Magnetic fields, dense cloud fragmentations, and anomalous dust grain sizes

    International Nuclear Information System (INIS)

    Sh 2-29 is a conspicuous star-forming region marked by the presence of massive embedded stars as well as several notable interstellar structures. In this research, our goals were to determine the role of magnetic fields and to study the size distribution of interstellar dust particles within this turbulent environment. We have used a set of optical and near-infrared polarimetric data obtained at OPD/LNA (Brazil) and CTIO (Chile), correlated with extinction maps, Two Micron All Sky Survey data, and images from the Digitized Sky Survey and Spitzer. The region's most striking feature is a swept out interstellar cavity whose polarimetric maps indicate that magnetic field lines were dragged outward, piling up along its borders. This led to a higher magnetic strength value (≈400 μG) and an abrupt increase in polarization degree, probably due to an enhancement in alignment efficiency. Furthermore, dense cloud fragmentations with peak AV between 20 and 37 mag were probably triggered by its expansion. The presence of 24 μm point-like sources indicates possible newborn stars inside this dense environment. A statistical analysis of the angular dispersion function revealed areas where field lines are aligned in a well-ordered pattern, seemingly due to compression effects from the H II region expansion. Finally, Serkowski function fits were used to study the ratio of the total-to-selective extinction, revealing a dual population of anomalous grain particle sizes. This trend suggests that both effects of coagulation and fragmentation of interstellar grains are present in the region.

  15. The effect of lance geometry and carbon coating of silicon lances on propidium iodide uptake in lance array nanoinjection of HeLa 229 cells (United States)

    Sessions, John W.; Lindstrom, Dallin L.; Hanks, Brad W.; Hope, Sandra; Jensen, Brian D.


    Connecting technology to biologic discovery is a core focus of non-viral gene therapy biotechnologies. One approach that leverages both the physical and electrical function of microelectromechanical systems (MEMS) in cellular engineering is a technology previously described as lance array nanoinjection (LAN). In brief, LAN consists of a silicon chip measuring 2 cm by 2 cm that has been etched to contain an array of 10 μm tall, solid lances that are spaced every 10 μm in a grid pattern. This array of lances is used to physically penetrate hundreds of thousands of cells simultaneously and to then electrically deliver molecular loads into cells. In this present work, two variables related to the microfabrication of the silicon lances, namely lance geometry and coating, are investigated. The purpose of both experimental variables is to assess these parameters’ effect on propidium iodide (PI), a cell membrane impermeable dye, uptake to injected HeLa 229 cells. For the lance geometry experimentation, three different microfabricated lance geometries were used which include a flat/narrow (FN, 1 μm diameter), flat/wide (FW, 2-2.5 μm diameter), and pointed (P, 1 μm diameter) lance geometries. From these tests, it was shown that the FN lances had a slightly better cell viability rate of 91.73% and that the P lances had the best PI uptake rate of 75.08%. For the lance coating experimentation, two different lances were fabricated, both silicon etched lances with some being carbon coated (CC) in a  <100 nm layer of carbon and the other lances being non-coated (Si). Results from this experiment showed no significant difference between lance types at three different nanoinjection protocols (0V, +1.5V DC, and  +5V Pulsed) for both cell viability and PI uptake rates. One exception to this is the comparison of CC/5V Pul and Si/5V Pul samples, where the CC/5V Pul samples had a cell viability rate 5% higher. Both outcomes were unexpected and reveal how to better

  16. The effect of lance geometry and carbon coating of silicon lances on propidium iodide uptake in lance array nanoinjection of HeLa 229 cells

    International Nuclear Information System (INIS)

    Connecting technology to biologic discovery is a core focus of non-viral gene therapy biotechnologies. One approach that leverages both the physical and electrical function of microelectromechanical systems (MEMS) in cellular engineering is a technology previously described as lance array nanoinjection (LAN). In brief, LAN consists of a silicon chip measuring 2 cm by 2 cm that has been etched to contain an array of 10 μm tall, solid lances that are spaced every 10 μm in a grid pattern. This array of lances is used to physically penetrate hundreds of thousands of cells simultaneously and to then electrically deliver molecular loads into cells. In this present work, two variables related to the microfabrication of the silicon lances, namely lance geometry and coating, are investigated. The purpose of both experimental variables is to assess these parameters’ effect on propidium iodide (PI), a cell membrane impermeable dye, uptake to injected HeLa 229 cells. For the lance geometry experimentation, three different microfabricated lance geometries were used which include a flat/narrow (FN, 1 μm diameter), flat/wide (FW, 2–2.5 μm diameter), and pointed (P, 1 μm diameter) lance geometries. From these tests, it was shown that the FN lances had a slightly better cell viability rate of 91.73% and that the P lances had the best PI uptake rate of 75.08%. For the lance coating experimentation, two different lances were fabricated, both silicon etched lances with some being carbon coated (CC) in a  <100 nm layer of carbon and the other lances being non-coated (Si). Results from this experiment showed no significant difference between lance types at three different nanoinjection protocols (0V, +1.5V DC, and  +5V Pulsed) for both cell viability and PI uptake rates. One exception to this is the comparison of CC/5V Pul and Si/5V Pul samples, where the CC/5V Pul samples had a cell viability rate 5% higher. Both outcomes were unexpected and reveal how to better

  17. Photodissociation of methyl iodide at 229.4 nm: A determination of the fragment recoil anisotropy using energy-selective electron impact ionization and time-of-flight mass spectrometry

    International Nuclear Information System (INIS)

    Energy-selective electron impact ionization of laser-produced photofragments together with time-of-flight mass spectrometry is a general and sensitive means of studying primary photodissociation processes. Low-energy electrons ionize photofragments without the production of background fragment ions from dissociative ionization of the parent molecules, and the time-of-flight mass spectral peak shapes provide direct information on the photofragment recoil anisotropy. In the first application of this combination of techniques, we have studied the photodissociation of methyl iodide at 229.4 nm, the short-wavelength end of the A band, in order to assess the contribution of transitions to the 1Q1 state to the absorption profile. The results presented here show that I(2P1/sub //2) is the primary iodine--atom product and that the transition is largely parallel [β = (1.6 +- 0.1) for I(2P1/sub //2)] at 229.4 nm. These data together with previous photofragmentation results suggest that excitation to the 3Q0 state dominates the entire A band absorption profile

  18. System for recovery of daughter isotopes from a source material (United States)

    Tranter, Troy J [Idaho Falls, ID; Todd, Terry A [Aberdeen, ID; Lewis, Leroy C [Idaho Falls, ID; Henscheid, Joseph P [Idaho Falls, ID


    A method of separating isotopes from a mixture containing at least two isotopes in a solution is disclosed. A first isotope is precipitated and is collected from the solution. A daughter isotope is generated and collected from the first isotope. The invention includes a method of producing an actinium-225/bismuth-213 product from a material containing thorium-229 and thorium-232. A solution is formed containing nitric acid and the material containing thorium-229 and thorium-232, and iodate is added to form a thorium iodate precipitate. A supernatant is separated from the thorium iodate precipitate and a second volume of nitric acid is added to the thorium iodate precipitate. The thorium iodate precipitate is stored and a decay product comprising actinium-225 and bismuth-213 is generated in the second volume of nitric acid, which is then separated from the thorium iodate precipitate, filtered, and treated using at least one chromatographic procedure. A system for producing an actinium-225/bismuth-213 product is also disclosed.

  19. Viscosity of {xCO2 + (1 − x)CH4} with x = 0.5174 for temperatures between (229 and 348) K and pressures between (1 and 32) MPa

    International Nuclear Information System (INIS)

    Highlights: • New viscosity data for CO2 + CH4 are reported for a wide range of (T,p). • The new measurements are consistent with and extend literature viscosity data. • The new data deviate systematically by up to 16% from two extended corresponding states models. • A molecular dynamics corresponding states model reproduces the data within 4.2%. - Abstract: A vibrating wire instrument, in which the wire was clamped at both ends, was used to measure the viscosity of {xCO2 + (1 − x)CH4} with x = 0.5174 with a combined uncertainty of 0.24 μPa · s (a relative uncertainty of about 0.8 %) at temperatures T between (229 and 348) K and pressures p from (1 to 32) MPa. The corresponding mass density ρ, estimated with the GERG-2008 equation of state, varied from (20 to 600) kg · m−3. The measured viscosities were consistent within combined uncertainties with data obtained previously for this system using entirely different experimental techniques. The new data were compared with three corresponding states-type models frequently used for predicting mixture viscosities: the Extended Corresponding States (ECS) model implemented in REFPROP 9.1; the SUPERTRAPP model implemented in MultiFlash 4.4; and a corresponding states model derived from molecular dynamics simulations of Lennard Jones fluids. The measured viscosities deviated systematically from the predictions of both the ECS and SUPERTRAPP models with a maximum relative deviations of 11 % at (229 K, 600 kg · m−3) and −16 % at (258 K, 470 kg · m−3), respectively. In contrast, the molecular dynamics based corresponding states model, which is predictive for mixtures in that it does not contain any binary interaction parameters, reproduced the density and temperature dependence of the measured viscosities well, with relative deviations of less than 4.2 %

  20. Genes Expression in Response to Re-watering after Drought Stress in Shaan 229 and Characterization of Ethylene Receptor Genes (TaERS) in Wheat%陕229干旱复水诱导基因表达及小麦乙烯受体(TaERS)基因特征分析

    Institute of Scientific and Technical Information of China (English)

    张宏; 陈锐; 黄林周; 胡银岗


    为了解小麦响应水分胁迫后复水条件下的基因表达特征,以小麦(Triticum aestivum L.)主栽品种陕229的3叶1心期幼苗为材料,采用消减杂交技术,构建了干旱复水条件下的SSH-cDNA表达文库.从消减文库中随机挑选59个插入片段大于400bp的阳性克隆测序,去除冗余序列和嵌合序列后,获得高质量EST序列32条(GenBank登录号为ES466767~ES466798).序列比对分析表明,小麦干旱后复水的基因表达与植物对其他非生物胁迫的响应具有交叉性;17条EST序列与已知编码蛋白的基因同源性较高,涉及植物的信号传导、能量代谢、转录调控等方面;其他序列为新的EST.以其中一个与乙烯受体基因(ERS)同源性较高的EST序列为基础,采用同源克隆及RACE技术从小麦中分离了4个乙烯受体基因的全长cDNA序列,长度分别为2090、2271、2216和1886bp.4个全长cDNA序列所编码氨基酸序列的同源性极高(99%以上),且均具有ERS典型的GAF、HisKA和HATPase-c跨膜结构,分别命名为TaERS1(HM347272),TaERS2(HM601437),TaERS3(HM601438)和TaERS4(HQ111523).植物ERS氨基酸序列多重比较表明,小麦与水稻的相似性最高(93%);TaERS基因的全长cDNA序列间比较共发现SNP位点23个.定量PCR表达分析显示,小麦TaERS家族基因参与了小麦植株响应水分胁迫和复水的调控机制.研究结果有助于进一步认识小麦干旱后复水的基因表达谱和小麦水分高效利用机制,探索小麦乙烯受体在水分高效利用中的作用.%To explore more genes for the improvement of drought-tolerance and water use efficiency in crops, the differential gene expression during re-watering after serious drought stress in common wheat (Triticumaestivum L.) was investigated by constructing SSH-cDNA library with the seedlings of Shaan 229 as materials. A total of 59 positive clones with insertions more than 400 bp were randomly picked from the library and sequenced. Then

  1. Reflection asymmetry in odd-A and odd-odd actinium nuclei

    International Nuclear Information System (INIS)

    Theoretical calculations and measurements indicate that octupole correlations are at a maximum in the ground states of the odd-proton nuclei Ac and Pa. It has been expected that odd-odd nuclei should have even larger amount of octupole-octupole correlations. We have recently made measurements on the structure of 224Ac. Although spin and parity assignments could not be made, two bands starting at 354.1 and 360.0 keV have properties characteristic of reflection asymmetric shape. These two bands have very similar rotational constants and also similar alpha decay rates, which suggest similarity between the wavefunctions of these bands. These signatures provide evidence for octupole correlations in these nuclides

  2. Bestimmung der Ionisationsenergie von Actinium und Ultraspurenanalyse von Plutonium mit resonanter Ionisationsmassenspektrometrie (RIMS)


    Waldek, Achim Marcus


    ZusammenfassungDie Resonanzionisationsmassenspektrometrie (RIMS) verbindet hohe Elementselektivität mit guter Nachweiseffizienz. Aufgrund dieser Eigenschaften ist die Methode für Ultraspurenanalyse und Untersuchungen an seltenen oder schwer handhabbaren Elementen gut geeignet. Für RIMS werden neutrale Atome mit monochromatischem Laserlicht ein- oder mehrfach resonant auf energetisch hoch liegende Niveaus angeregt und anschließend durch einen weiteren Laserstrahl oder durch ein elektrisches Fe...

  3. Radium-228 analysis of natural waters by Cherenkov counting of Actinium-228

    International Nuclear Information System (INIS)

    The activities of 228Ra in natural waters were determined by the Cherenkov counting of the daughter nuclide 228Ac. The radium was pre-concentrated on MnO2 and the radium purified via ion exchange and, after a 2-day period of incubation to allow for secular equilibrium between the parent-daughter 228Ra(228Ac), the daughter nuclide 228Ac was isolated by ion exchange according to the method of Nour et al. [2004. Radium-228 determination of natural waters via concentration on manganese dioxide and separation using Diphonix ion exchange resin. Appl. Radiat. Isot. 61, 1173-1178]. The Cherenkov photons produced by 228Ac were counted directly without the addition of any scintillation reagents. The optimum Cherenkov counting window, sample volume, and vial type were determined experimentally to achieve optimum Cherenkov photon detection efficiency and lowest background count rates. An optimum detection efficiency of 10.9±0.1% was measured for 228Ac by Cherenkov counting with a very low Cherenkov photon background of 0.317±0.013 cpm. The addition of sodium salicylate into the sample counting vial at a concentration of 0.1 g/mL yielded a more than 3-fold increase in the Cherenkov detection efficiency of 228Ac to 38%. Tests of the Cherenkov counting technique were conducted with several water standards of known activity and the results obtained compared closely with a conventional liquid scintillation counting technique. The advantages and disadvantages of Cherenkov counting compared to liquid scintillation counting methods are discussed. Advantages include much lower Cherenkov background count rates and consequently lower minimal detectable activities for 228Ra and no need for expensive environmentally unfriendly liquid scintillation cocktails. The disadvantages of the Cherenkov counting method include the need to measure 228Ac Cherenkov photon detection efficiency and optimum Cherenkov counting volume, which are not at all required when liquid scintillation analysis is used

  4. Linear free energy relationship applied to trivalent cations with lanthanum and actinium oxide and hydroxide structure

    International Nuclear Information System (INIS)

    Linear free energy relationships for trivalent cations with crystalline M2O3 and, M(OH)3 phases of lanthanides and actinides were developed from known thermodynamic properties of the aqueous trivalent cations, modifying the Sverjensky and Molling equation. The linear free energy relationship for trivalent cations is as ΔGf,MvX0=aMvXΔGn,M3+0+bMvX+βMvXrM3+, where the coefficients aMvX, bMvX, and βMvX characterize a particular structural family of MvX, rM3+ is the ionic radius of M3+ cation, ΔGf,MvX0 is the standard Gibbs free energy of formation of MvX and ΔGn,M3+0 is the standard non-solvation free energy of the cation. The coefficients for the oxide family are: aMvX=0.2705, bMvX=-1984.75 (kJ/mol), and βMvX=197.24 (kJ/molnm). The coefficients for the hydroxide family are: aMvX=0.1587, bMvX=-1474.09 (kJ/mol), and βMvX=791.70 (kJ/molnm).

  5. Actinium: A RESTful Runtime Container for Scriptable Internet of Things Applications


    Kovatsch, Matthias; Lanter, Martin; Duquennoy, Simon


    Programming Internet of Things (IoT) applications is challenging because developers have to be knowledgeable in various technical domains, from low-power networking, over embedded operating systems, to distributed algorithms. Hence, it will be challenging to find enough experts to provide software for the vast number of expected devices, which must also be scalable and particularly safe due to the connection to the physical world. To remedy this situation, we propose an architecture that pr...

  6. Synthesis of chelating agents for actinium 225 complexation and its application in radioimmunotherapy

    International Nuclear Information System (INIS)

    Immunotherapy with radiolabeled antibodies should allow fairly specific targeting of certain cancers. However, iodine 131 may not be the best isotope for tumor therapy because of its limited specific activity, low beta-energy, relatively long half life and strong gamma emission. Another approach to improve therapeutic efficacy is the use of replacement isotopes with better physical properties. Chelator that can hold radio-metals with high stability under physiological conditions are essential to avoid excessive damage to non-target cells; Moreover, the development of new bifunctional chelating agents is essential for this purpose. Accordingly, our efforts have been directed, for several years, to the synthesis of original chelating agents likely to form stable complexes in vivo with the numerous potential candidates for such applications. Therefore, we have developed a new simple and efficient synthesis pathway of 2-(4-iso-thio-cyanate-benzyl)-1,4,7,10,13,16- hexa-aza-cyclo-hexadecane- 1,4,7,10,13,16-hexa-acetic acid, though functionalized on the cycle by a termination allowed coupling to an antibody or any other biological substance such as a hapten. (author)

  7. Purification of selenium from thorium, uranium, radium, actinium and potassium impurities for low background measurements

    International Nuclear Information System (INIS)

    A technique of selenium purification from 232Th, 238U, 226,228Ra, 227Ac and 40K was developed. This technique is simple to perform and employs a minimum number of highly pure reagents (bidistilled water, nitric acid). Operations carried out during purification (elution, evaporation) practically exclude losses of the target product (chemical yields of Se > 99%). A test purification of 100 g of selenium was carried out using this technique. The efficiency of this technique was confirmed by low background gamma spectrometry of the purified selenium sample. Distribution coefficients of Th, U, Ra and Ac on DOWEX 50W- x 8 cation-exchange resin at different concentrations of selenium and nitric acid were experimentally determinated. Instrumental neutron activation analysis of bidistilled water, deionized water and nitric acid was performed. (orig.)

  8. Purification of selenium from thorium, uranium, radium, actinium and potassium impurities for low background measurements

    Energy Technology Data Exchange (ETDEWEB)

    Rakhimov, A.V. [Joint Institute for Nuclear Research (JINR), Dubna (Russian Federation); Uzbek Academy of Sciences, Tashkent (Uzbekistan). Inst. of Nuclear Physics (INP AS RUz); Warot, G. [CEA-CNRS, Modane (France). Laboratoire Souterrain de Modane (LSM); Karaivanov, D.V. [Joint Institute for Nuclear Research (JINR), Dubna (Russian Federation); Institute for Nuclear Research and Nuclear Energy (INRNE), Sofia (Bulgaria); Kochetov, O.I.; Lebedev, N.A.; Filosofov, D.V. [Joint Institute for Nuclear Research (JINR), Dubna (Russian Federation); Mukhamedshina, N.M.; Sadikov, I.I. [Uzbek Academy of Sciences, Tashkent (Uzbekistan). Inst. of Nuclear Physics (INP AS RUz)


    A technique of selenium purification from {sup 232}Th, {sup 238}U, {sup 226,228}Ra, {sup 227}Ac and {sup 40}K was developed. This technique is simple to perform and employs a minimum number of highly pure reagents (bidistilled water, nitric acid). Operations carried out during purification (elution, evaporation) practically exclude losses of the target product (chemical yields of Se > 99%). A test purification of 100 g of selenium was carried out using this technique. The efficiency of this technique was confirmed by low background gamma spectrometry of the purified selenium sample. Distribution coefficients of Th, U, Ra and Ac on DOWEX 50W- x 8 cation-exchange resin at different concentrations of selenium and nitric acid were experimentally determinated. Instrumental neutron activation analysis of bidistilled water, deionized water and nitric acid was performed. (orig.)

  9. 50 CFR 229.2 - Definitions. (United States)


    ... information indicating the frequency of incidental mortality and serious injury of marine mammals by a... the absence of reliable information indicating the frequency of incidental mortality and serious..., asymmetry in the shape of the body or body position, noticeable swelling or hemorrhage, laceration,...

  10. 47 CFR 22.229 - Designated entities. (United States)


    ... entrepreneur is an entity that, together with its controlling interests and affiliates, has average annual... entrepreneur, as defined in this section, or a consortium of entrepreneurs may use the bidding credit...

  11. QTL Information Table: 229 [Q-TARO

    Lifescience Database Archive (English)

    Full Text Available ). Characterization of the main effects, epistatic effects and their environmental interactions of QTLs on the genetic basis of yield traits in rice. Theor Appl Genet 105, 248-257. ...

  12. 49 CFR 229.107 - Pressure gauge. (United States)


    ....107 Pressure gauge. (a) Each steam generator shall have an illuminated steam gauge that correctly... the allowed working pressure of the steam generator. (b) Each steam pressure gauge on a steam generator shall have a siphon that prevents steam from entering the gauge. The pipe connection...

  13. 49 CFR 229.113 - Warning notice. (United States)


    ....113 Warning notice. Whenever any steam generator has been shut down because of defects, a distinctive warning notice giving reasons for the shut-down shall be conspicuously attached near the steam generator starting controls until the necessary repairs have been made. The locomotive in which the steam...

  14. 49 CFR 229.5 - Definitions. (United States)


    ...% confidence limit means the noise level below which 99% of all noise level measurements must lie. Washing... sound pressure level in decibels measured on the A-weighted scale. Dead locomotive means— (1) A... excess of 110 dB(A) and/or a minimum sound level below 96 dB(A), as measured 100 feet forward of...

  15. 20 CFR 229.2 - Definitions. (United States)


    ... Retirement Act). Retirement age means age 65, with respect to an employee or spouse who attains age 62 before...), or surviving divorced spouse) after December 31, 1999, retirement age means the age provided for in...' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT SOCIAL SECURITY...

  16. 50 CFR 229.9 - Emergency regulations. (United States)


    ... than 180 days or until the end of the applicable commercial fishing season, whichever is earlier... having, or is likely to have, an immediate and significant adverse impact on a stock or species, the... address such adverse impact; (2) In the case of a stock or species for which a take reduction plan...

  17. 49 CFR 229.27 - Annual tests. (United States)


    ... conducting the test and that person's supervisor shall sign the form. (c) Each steam generator that is not... the previous 48 hours of locomotive operation, reveals a failure to record a regularly recurring data element or reveals that any required data element is not representative of the actual operations of...

  18. 22 CFR 229.235 - Statutory amendments. (United States)


    ... abortion. Medical procedures, benefits, services, and the use of facilities, necessary to save the life of a pregnant woman or to address complications related to an abortion are not subject to this section... legal abortion. Accordingly, subject to paragraph (d)(1) of this section, no person shall be...

  19. 49 CFR 229.129 - Locomotive horn. (United States)


    ... defectives equal to an AQL of 1% or less, as set forth in 7 CFR part 43. (2) Each locomotive built before... horn that was replaced and the mounting location and type of mounting are the same. (c) Testing of the..., such as barriers, hills, billboards, tractor trailers or other large vehicles, locomotives or rail...

  20. 22 CFR 229.450 - Athletics. (United States)


    ... include boxing, wrestling, rugby, ice hockey, football, basketball, and other sports the purpose or major... of each sex or unequal expenditures for male and female teams if a recipient operates or...

  1. Purification of radium-226 for the manufacturing of actinium-225 in a cyclotron for alpha-immunotherapy; Radium-Aufreinigung zur Herstellung von Actinium-225 am Zyklotron fuer die Alpha-Immuntherapie

    Energy Technology Data Exchange (ETDEWEB)

    Marx, Sebastian Markus


    The thesis describes the development of methods for the purification of Ra-226. The objective was to obtain the radionuclide in the quality that is needed to be used as starting material in the manufacturing process for Ac-225 via proton-irradiated Ra-226. The radionuclide has been gained efficiently out of huge excesses of impurities. The high purity of the obtained radium affords its use as staring material in a pharmaceutical manufacturing process.

  2. Renal uptake of bismuth-213 and its contribution to kidney radiation dose following administration of actinium-225-labeled antibody

    Energy Technology Data Exchange (ETDEWEB)

    Schwartz, J; O' Donoghue, J A; Humm, J L [Department of Medical Physics, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10065 (United States); Jaggi, J S [Bristol-Myers Squibb, Plainsboro, NJ (United States); Ruan, S; Larson, S M [Nuclear Medicine Service Department of Radiology, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10065 (United States); McDevitt, M; Scheinberg, D A, E-mail: [Molecular Pharmacology and Chemistry, Sloan-Kettering Institute, 1275 York Avenue, New York, NY 10065 (United States)


    Clinical therapeutic studies using {sup 225}Ac-labeled antibodies have begun. Of major concern is renal toxicity that may result from the three alpha-emitting progeny generated following the decay of {sup 225}Ac. The purpose of this study was to determine the amount of {sup 225}Ac and non-equilibrium progeny in the mouse kidney after the injection of {sup 225}Ac-huM195 antibody and examine the dosimetric consequences. Groups of mice were sacrificed at 24, 96 and 144 h after injection with {sup 225}Ac-huM195 antibody and kidneys excised. One kidney was used for gamma ray spectroscopic measurements by a high-purity germanium (HPGe) detector. The second kidney was used to generate frozen tissue sections which were examined by digital autoradiography (DAR). Two measurements were performed on each kidney specimen: (1) immediately post-resection and (2) after sufficient time for any non-equilibrium excess {sup 213}Bi to decay completely. Comparison of these measurements enabled estimation of the amount of excess {sup 213}Bi reaching the kidney ({gamma}-ray spectroscopy) and its sub-regional distribution (DAR). The average absorbed dose to whole kidney, determined by spectroscopy, was 0.77 (SD 0.21) Gy kBq{sup -1}, of which 0.46 (SD 0.16) Gy kBq{sup -1} (i.e. 60%) was due to non-equilibrium excess {sup 213}Bi. The relative contributions to renal cortex and medulla were determined by DAR. The estimated dose to the cortex from non-equilibrium excess {sup 213}Bi (0.31 (SD 0.11) Gy kBq{sup -1}) represented {approx}46% of the total. For the medulla the dose contribution from excess {sup 213}Bi (0.81 (SD 0.28) Gy kBq{sup -1}) was {approx}80% of the total. Based on these estimates, for human patients we project a kidney-absorbed dose of 0.28 Gy MBq{sup -1} following administration of {sup 225}Ac-huM195 with non-equilibrium excess {sup 213}Bi responsible for approximately 60% of the total. Methods to reduce renal accumulation of radioactive progeny appear to be necessary for the success of {sup 225}Ac radioimmunotherapy.

  3. Purification of radium-226 for the manufacturing of actinium-225 in a cyclotron for alpha-immunotherapy

    International Nuclear Information System (INIS)

    The thesis describes the development of methods for the purification of Ra-226. The objective was to obtain the radionuclide in the quality that is needed to be used as starting material in the manufacturing process for Ac-225 via proton-irradiated Ra-226. The radionuclide has been gained efficiently out of huge excesses of impurities. The high purity of the obtained radium affords its use as staring material in a pharmaceutical manufacturing process.

  4. Distribution of trace elements in land plants and botanical taxonomy with special reference to rare earth elements and actinium

    International Nuclear Information System (INIS)

    Distribution profiles of trace elements in land plants were studied by neutron activation analysis and radioactivity measurements without activation. Number of botanical samples analyzed were more than three thousand in which more than three hundred botanical species were included. New accumulator plants of Co, Cr, Zn, Cd, rare earth elements, Ac, U, etc., were found. Capabilities of accumulating trace elements can be related to the botanical taxonomy. Discussions are given from view points of inorganic chemistry as well as from botanical physiology

  5. 基于FHQZn发光的新结构有机黄光器件%Novel Structure Yellow Organic Light-emitting Devices Based on (E)-2-(2-(9H-fluoren-2-yl)vinyl)Quinolato-Zinc as Emitter

    Institute of Scientific and Technical Information of China (English)

    丁桂英; 姜文龙; 黄涛; 高永慧; 孟昭辉; 欧阳新华; 曾和平


    利用一种新型材料(E)-2-(2-(9H-fluoren-2-y1)vinyl)quinolato-Zinc(FHQZn)制备了一种新结构的黄光OLED,器件的结构为:indium-tin oxide(ITO)/4,4',4"-(N,-(2-naphthyl)-N-phenylamino}-triphenylamine(2T-NATA)(15 nm)/FHQZn(x nm)/4,4'-bis(2,2'-diphenylvinyl)-1,1'-biphenyl(DPVBi)(20nm)/2,2',2"-(1,3,5-phenylene)tris(1-phenyl-iH-benzimidazole-(TPBi):6%fac tris(2一phenylpyridine)iridium(Ir(ppy)3)(45 nm)/LiF(0.5 nm)/Al,FHQZn作空穴传输层和黄色发光层,DPVBi作空穴阻挡层,TPBi中掺杂Ir(ppy); 作电子传输层;研究了发光层FHQZn的厚度对该器件的发光性能的影响.当FHQZn厚度x=25时,得到了效率和亮度最大的黄光器件,最大电流效率为1.31 cd/A(at 13 V),最大亮度为5 705 cd/m2(at 14 V),此时色坐标为(0.4,0.551 6).

  6. 17 CFR 229.1115 - (Item 1115) Certain derivatives instruments. (United States)


    ... derivative instrument as an exhibit. (b) Financial information. (1) If the aggregate significance percentage... “significance estimate” of the derivative instrument is to be determined based on a reasonable good-faith... pool assets, provided, that if the derivative instrument relates only to one or more classes of...

  7. Dicty_cDB: CHB229 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AATGTTAAAAAAATTAAAAAAATTAAAAATTAAAAAAAT AAATAAATAAATAATAAAAATATTGTAATAAAGTTTTAAAATTA Length of 3' end seq. 704 Connect...ed seq. ID - Connected seq. - Length of connected seq. - Full length Seq ID - Full length Seq. - Length of full length seq. - ... ...s: (bits) Value N AP004596 |AP004596.1 Oceanobacillus iheyensis HTE831 genomic DNA, cDNA, mRNA sequence. 36 0.11 2 AE006311 |AE006311.1 Lactococcus lactis subsp. lactis IL1403 sect... gamma-lyase; EC=4.... 412 e-114 BC082653_1( BC082653 |pid:none) Xenopus laevis hypotheti

  8. Dicty_cDB: VSF229 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available fltmvikinilqisghvlignllkpnf*mlwflie nin*d*nlllennlmhlnnxlftik*l Frame C: ftiritklspnfms*sf*tclrf*pw**k*iyckf...lvmy*leic*sqifecfgf**ri*i kiriscwktisci*tis*ftik*liklifn*kk--- ---ftiritklspnfms*sf*tclrf*pw**k*iyckflvmy*le

  9. 22 CFR 229.215 - Membership practices of certain organizations. (United States)


    ... education. (b) YMCA, YWCA, Girl Scouts, Boy Scouts, and Camp Fire Girls. These Title IX regulations do not apply to the membership practices of the Young Men's Christian Association (YMCA), the Young Women's Christian Association (YWCA), the Girl Scouts, the Boy Scouts, and Camp Fire Girls. (c) Voluntary...

  10. 17 CFR 229.1107 - (Item 1107) Issuing entities. (United States)


    ... capitalization of the issuing entity and the amount or nature of any equity contribution to the issuing entity by... loans originated under the Federal Family Education Loan Program of the Higher Education Act of 1965...

  11. 49 CFR 192.229 - Limitations on welders. (United States)


    ... and found acceptable under the sections 6 or 9 of API Standard 1104 (incorporated by reference, see... accordance with the qualifying test; or (ii) For welders who work only on service lines 2 inches (51 millimeters) or smaller in diameter, two sample welds tested and found acceptable in accordance with the...

  12. 49 CFR 229.111 - Water-flow indicator. (United States)


    ... of determining whether the steam generator is filled with water. The fill test valve may not discharge steam or hot water into the steam generator compartment. ..., DEPARTMENT OF TRANSPORTATION RAILROAD LOCOMOTIVE SAFETY STANDARDS Safety Requirements Steam Generators §...

  13. 49 CFR 229.23 - Periodic inspection: General. (United States)


    ... Periodic inspection: General. (a) Each locomotive and steam generator shall be inspected at each periodic... conditions shall be repaired before the locomotive or the steam generator is used. Except as provided in.... (b) The periodic inspection of the steam generator may be postponed indefinitely if the water...

  14. 17 CFR 229.903 - (Item 903) Summary. (United States)


    ... effect on investors, including, but not limited to: (i) Changes in the business plan, voting rights, cash..., including the valuation method used to allocate securities in the successor to investors in the partnerships... sponsor may participate in the business of the successor or receive compensation from the successor,...

  15. 7 CFR 1220.229 - Influencing governmental action. (United States)


    ... government, or any political subdivision thereof. (b) The prohibition in paragraph (a) of this section shall... communication to appropriate government officials of information relating to the conduct, implementation, or... political subdivision thereof....

  16. 17 CFR 229.1104 - (Item 1104) Sponsors. (United States)


    .... (c) Describe the sponsor's securitization program and state how long the sponsor has been engaged in the securitization of assets. The description must include, to the extent material, a general... material roles and responsibilities in its securitization program, including whether the sponsor or...

  17. 17 CFR 229.407 - (Item 407) Corporate governance. (United States)


    ... company's annual report on Form 10-K (17 CFR 249.310) (or, for closed-end investment companies registered... CFR 270.30d-1) thereunder) for the last fiscal year for filing with the Commission. (ii) The name of... annual report pursuant to General Instruction G(3) to Form 10-K (17 CFR 249.310). 2. If a...

  18. 17 CFR 229.1101 - (Item 1101) Definitions. (United States)


    ...-backed securities the yield, average life, expected maturity, interest rate sensitivity, cash flow characteristics, total rate of return, option adjusted spread or other financial or statistical information relating to the class or classes under specified prepayment, interest rate, loss or other...

  19. 49 CFR 229.31 - Main reservoir tests. (United States)


    ... (b) of this section, except the requirement for a pneumatic or hydrostatic test before it is placed... tests provided for by paragraphs (a) and (b) of this section, but shall receive a hydrostatic test... shall be subjected to a pneumatic or hydrostatic pressure of at least 25 percent more than the...

  20. 50 CFR 229.20 - Issuance of permits. (United States)


    ... impact on such species or stock; (2) A recovery plan has been developed or is being developed for such... mammals from a species or stock designated as depleted because of its listing as an endangered species or threatened species under the Endangered Species Act of 1973 if the Assistant Administrator determines...

  1. 48 CFR 252.229-7003 - Tax Exemptions (Italy). (United States)


    ... contract number. (ii) The IVA tax exemption claimed pursuant to Article 72 of Decree Law 633, dated October... this transaction is not subject to the tax in accordance with Article 72 of Decree Law 633, dated... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Tax Exemptions...

  2. 17 CFR 229.101 - (Item 101) Description of business. (United States)


    ... process; (ix) Effect of existing or probable governmental regulations on the business; (x) Estimate of the... impact on the registrant's business is represented by management to be important to its future... registrant includes, or is required by Article 3 of Regulation S-X (17 CFR 210) to include, interim...

  3. 49 CFR 229.91 - Motors and generators. (United States)


    ....91 Motors and generators. A motor or a generator may not have any of the following conditions: (a) Be... overheated support bearing. (e) Have an excessive accumulation of oil. Internal Combustion Equipment...

  4. 20 CFR 229.51 - Adjustment of age reduction. (United States)


    ... for certain months before the employee or spouse attains retirement age, or the employee becomes... amount, effective the month in which the employee attains retirement age or becomes entitled to a DIB O/M... month in which the spouse attains retirement age: (1) Months in which the spouse O/M benefit...

  5. Controlled low strength materials (CLSM), reported by ACI Committee 229

    International Nuclear Information System (INIS)

    Controlled low-strength material (CLSM) is a self-compacted, cementitious material used primarily as a backfill in lieu of compacted fill. Many terms are currently used to describe this material including flowable fill, unshrinkable fill, controlled density fill, flowable mortar, flowable fly ash, fly ash slurry, plastic soil-cement, soil-cement slurry, K-Krete and other various names. This report contains information on applications, material properties, mix proportioning, construction and quality-control procedures. This report's intent is to provide basic information on CLSM technology, with emphasis on CLSM material characteristics and advantages over conventional compacted fill. Applications include backfills, structural fills, insulating and isolation fills, pavement bases, conduit bedding, erosion control, void filling, and radioactive waste management

  6. 20 CFR 229.81 - Refusal to accept vocational rehabilitation. (United States)


    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Refusal to accept vocational rehabilitation... Refusal to accept vocational rehabilitation. The DIB O/M is not payable for any month in which the disabled employee refuses, without good reason, to accept vocational rehabilitation services...

  7. 32 CFR 229.8 - Issuance of permits. (United States)


    ..., education, and/or experience, and possesses demonstrable competence in archaeological theory and methods... archaeological resources of the historic period. Applicants proposing to engage in prehistoric archaeology should... prehistoric period. (2) The proposed work is to be undertaken for the purpose of furthering...

  8. 49 CFR 238.229 - Safety appliances-general. (United States)


    ... written list to FRA that identifies each piece of passenger equipment equipped with a welded safety... submit a written list to FRA that identifies each piece of passenger equipment equipped with a welded... section in accordance with 5 U.S.C. 552(a) and 1 CFR part 51. You may obtain a copy of the...

  9. 32 CFR 229.5 - Permit requirements and exceptions. (United States)


    ... destruction of any Indian tribal religious or cultural site, as determined by the Federal land manager, have... university, museum, or other scientific or educational institution approved by the Federal land manager....

  10. 17 CFR 229.402 - (Item 402) Executive compensation. (United States)


    ... performance of the registrant or an affiliate, the registrant's stock price, or any other performance measure... of stock that have not vested(#) Market value of shares or units of stock that have not vested...)); (viii) The aggregate market value of shares of stock that have not vested and that are not reported...

  11. 17 CFR 229.10 - (Item 10) General. (United States)


    ... Commission filings, consideration must be given to, among other things, the financial items to be projected... (17 CFR 210.11-01 through 210.11-03); or (E) Use titles or descriptions of non-GAAP financial measures... projections have been given for three financial items generally considered to be of primary importance...

  12. 49 CFR 229.125 - Headlights and auxiliary lights. (United States)


    ... than to pick up a detached portion of its train or to make terminal movements, it shall also have on..., each lead locomotive operated at a speed greater than 20 miles per hour over one or more public highway... a trailing position before departure from the place where an initial terminal inspection is...

  13. 17 CFR 229.1111 - (Item 1111) Pool assets. (United States)


    ... legal or regulatory provisions (such as bankruptcy, consumer protection, predatory lending, privacy... receivables and student loans, the location of the asset is the underlying obligor's billing address. For... student loans). If material, provide information required by paragraph (b)(14) of this section...

  14. 4 CFR 22.9 - Subpoenas [Rule 9]. (United States)


    ... ACCOUNTABILITY OFFICE GENERAL PROCEDURES RULES OF PROCEDURE OF THE GOVERNMENT ACCOUNTABILITY OFFICE CONTRACT... give testimony at a deposition or hearing, and/or produce documents or electronically stored... and time, appear and testify, or produce designated documents, electronically stored information,...

  15. 22 CFR 229.415 - Access to course offerings. (United States)


    ..., including health, physical education, industrial, business, vocational, technical, home economics, music... possible but in no event later than one year from September 29, 2000. With respect to physical education... this section as expeditiously as possible but in no event later than three years from September...

  16. 48 CFR 252.229-7005 - Tax exemptions (Spain). (United States)


    ... Tax). (12) Impuesto de Rentas Sobre el Capital (Capital Gains Tax). (13) Plus Vailia (Increase on Real Property). (14) Contribucion Territorial Urbana (Metropolitan Real Estate Tax). (15) Contribucion... Compensacion a la Importacion (Compensation Tax on Imports). (3) Transmissiones Patrionomiales...

  17. 30 CFR 229.123 - Standards for audit activities. (United States)


    ...) Independence. In all matters relating to the audit work, the audit organization and the individual auditors must be free from personal or external impairments to independence and shall maintain an independent... determined by the auditor or audit supervisor. Audit procedures should reflect the most efficient method...

  18. 17 CFR 229.1002 - (Item 1002) Subject company information. (United States)


    ... offered, the offering price per share (adjusted for stock splits, stock dividends, etc. as appropriate) and the aggregate proceeds received by the filing person. (f) Prior stock purchases. If the...


    International Nuclear Information System (INIS)

    As part of its commitment to clean up Cold War legacy sites, the U.S. Department of Energy (DOE) has initiated an exciting and unique project to dispose of its inventory of uranium-233 (233U) stored at Oak Ridge National Laboratory (ORNL), and extract isotopes that show great promise in the treatment of deadly cancers. In addition to increasing the supply of potentially useful medical isotopes, the project will rid DOE of a nuclear concern and cut surveillance and security costs. For more than 30 years, DOE's ORNL has stored over 1,200 containers of fissile 233U, originally produced for several defense-related projects, including a pilot study that looked at using 233U as a commercial reactor fuel. This uranium, designated as special nuclear material, requires expensive security, safety, and environmental controls. It has been stored at an ORNL facility, Building 3019A, that dates back to the Manhattan Project. Down-blending the material to a safer form, rather than continuing to store it, will eliminate a $15 million a year financial liability for the DOE and increase the supply of medical isotopes by 5,700 percent. During the down-blending process, thorium-229 (229Th) will be extracted. The thorium will then be used to extract actinium-225 (225Ac), which will ultimately supply its progeny, bismuth-213 (213Bi), for on-going cancer research. The research includes Phase II clinical trials for the treatment of acute myelogenous leukemia at Sloan-Kettering Memorial Cancer Center in New York, as well as other serious cancers of the lungs, pancreas, and kidneys using a technique known as alpha-particle radioimmunotherapy. Alpha-particle radioimmunotherapy is based on the emission of alpha particles by radionuclides. 213Bi is attached to a monoclonal antibody that targets specific cells. The bismuth then delivers a high-powered but short-range radiation dose, effectively killing the cancerous cells but sparing the surrounding tissue. Production of the actinium and


    Energy Technology Data Exchange (ETDEWEB)

    Nicholas, R.G.; Lacy, N.H.; Butz, T.R.; Brandon, N.E.


    As part of its commitment to clean up Cold War legacy sites, the U.S. Department of Energy (DOE) has initiated an exciting and unique project to dispose of its inventory of uranium-233 (233U) stored at Oak Ridge National Laboratory (ORNL), and extract isotopes that show great promise in the treatment of deadly cancers. In addition to increasing the supply of potentially useful medical isotopes, the project will rid DOE of a nuclear concern and cut surveillance and security costs. For more than 30 years, DOE's ORNL has stored over 1,200 containers of fissile 233U, originally produced for several defense-related projects, including a pilot study that looked at using 233U as a commercial reactor fuel. This uranium, designated as special nuclear material, requires expensive security, safety, and environmental controls. It has been stored at an ORNL facility, Building 3019A, that dates back to the Manhattan Project. Down-blending the material to a safer form, rather than continuing to store it, will eliminate a $15 million a year financial liability for the DOE and increase the supply of medical isotopes by 5,700 percent. During the down-blending process, thorium-229 (229Th) will be extracted. The thorium will then be used to extract actinium-225 (225Ac), which will ultimately supply its progeny, bismuth-213 (213Bi), for on-going cancer research. The research includes Phase II clinical trials for the treatment of acute myelogenous leukemia at Sloan-Kettering Memorial Cancer Center in New York, as well as other serious cancers of the lungs, pancreas, and kidneys using a technique known as alpha-particle radioimmunotherapy. Alpha-particle radioimmunotherapy is based on the emission of alpha particles by radionuclides. 213Bi is attached to a monoclonal antibody that targets specific cells. The bismuth then delivers a high-powered but short-range radiation dose, effectively killing the cancerous cells but sparing the surrounding tissue. Production of the actinium and

  1. Study on laser atomic spectroscopy

    International Nuclear Information System (INIS)

    Laser atomic spectroscopic study on actinium element has been performed in many areas of spectroscopy. The study on characteristic of atomic vapor has been proceeded for copper atom and the spatial density distribution of copper vapor is measured. This experimental data has been compared with the theoretically calculated data. In spectroscopic experiment, the first and second excited states for actinium element are identified and the most efficient ionization scheme for actinium element is identified. In addition, the corrosion problem for filament material due to the heating of the actinium element has been studied. (Author)

  2. Removal of actinium from europium for the determination of specific radioactivity of ultra low-level Eu-152 in a sample exposed to atomic-bomb neutrons in Nagasaki

    International Nuclear Information System (INIS)

    Measurements of specific radioactivities of residual neutron-induced radionuclides such as 152Eu and 60Co have been carried out to check the validity of a series of computer calculations employed for the atomic-bomb neutron dosimetry in Hiroshima (exposed to uranium bomb) and Nagasaki (exposed to plutonium bomb). The use of these nuclides for atomic-bomb neutron dosimetry, however, has been limited by the following difficulties: (1) today, these radionuclides are found only at extremely low concentrations in materials exposed to the atomic-bomb and (2) the neutrons that induced these radionuclides were thermal and epithermal, while the neutron dose received in Hiroshima and Nagasaki is attributable to fast neutrons. In order to overcome the first difficulty, we established a chemical procedure to extract Eu and Co from materials exposed to the atomic-bomb, and the chemical procedure has been successful for the materials exposed to atomic-bomb within 1400 m in slant distance from the explosion point. As for Nagasaki, materials exposed in the distances farther than 1200 m have never been subjected to the measurement of residual neutron-induced radionuclides. In this work, determination of specific radioactivity of 152Eu (half-life: 13.542 y) in a sample exposed to Nagasaki atomic-bomb at a distant place from the explosion point was undertaken. But, because of radioactive decay during this ∝60 years since 1945 and long distance from the explosion point, the present specific radioactivity of 152Eu in the sample is extremely low (estimated to be ∝3 x 10-4 Bq-152Eu/mg-Eu), and a serious problem is interferences from daughters of 227Ac (half-life: 21.8 y) in the measurement of ultra low-level radioactivity of 152Eu. Hence, our chemical procedure to obtain Eu-enriched counting source should be improved, and much attention is being denoted to removal of Ac from Eu. (orig.)

  3. AB229. Effect of berberine on human sperm parameters in vitro (United States)

    Chen, Liping; Wang, Tao; Liu, Jihong


    Objective Berberine is a natural compound isolated from plants with multiple pharmacological activities, like antioxidant and anti-inflammatory activities. The present study was to assess the effect of berberine with different concentration and at different time on sperm motility, viability and sperm membrane integrity of humans. Methods Semen samples were obtained from 30 patients (22–30 years of age) enrolled in this study, 15 of which were normospermic and 15 were asthenozoospermic. Semen were aseptically obtained by masturbation and prepared by swim-up method. After that they were incubated in Ham’s F-10 medium for 30 min at 37 °C to mimic the temperature inside the female reproductive tract. Semen samples were divided into aliquots. The negative control condition was supplemented with no drugs while 0.4 mmol/L L-carnitine was used as positive control condition. The treatment condition was supplemented with berberine at a concentration of 10-4, 10-5, 10-6, 10-7 mol/L. Measurements of sperm viability and motility were carried out at 10, 30, 60 and 120 min after incubation in all semen samples by computer-assisted sperm analysis (CASA). Results It showed that in both normal and asthenozoospermic samples, total and progressive sperm motility were maintained by in vitro treatment with berberine, whereas a significant decrease of these parameters occurred in parallel samples incubated in medium alone. Berberine also prevented the decrease of sperm kinetics but such an effect was highly significant only in asthenozoospermic samples. Moreover, berberine had similar effort as L-carnitine even at low concentration. Conclusions In vitro, berberine with suitable concentration exerted a direct protective effect on human sperm viability, motility rate and could modify plasma membrane functional integrity, especially in the asthenozoospermic patients. This could be a novel therapeutic drug for improving the function of sperm in vitro and treatment for male infertility.

  4. 17 CFR 229.401 - (Item 401) Directors, executive officers, promoters and control persons. (United States)


    ..., such specific information as the size of the operation supervised. (2) Directorships. Indicate any other directorships held, including any other directorships held during the past five years, held by... Item 401: For the purposes of paragraph (e)(2), where the other directorships of each director...

  5. 17 CFR 229.911 - (Item 911) Reports, opinions and appraisals. (United States)


    ... compensation paid to such outside party is contingent on the approval or completion of the roll-up transaction and, if so, the reasons for compensating such parties on a contingent basis. (3) Furnish a statement...) The appraised value of any separately appraised asset that is significant to the partnership...

  6. Yeast Interacting Proteins Database: YNL041C, YDR229W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available counteract the action of Vps33p and vice versa, localizes to the rim of the vacuole as cells approach the rim of the vacuole as cells approach stationary phase Rows with this prey as prey Rows with this prey

  7. Yeast Interacting Proteins Database: YMR047C, YDR229W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available , may partially counteract the action of Vps33p and vice versa, localizes to the rim of the vacuole as cells approach...s33p and vice versa, localizes to the rim of the vacuole as cells approach stationary phase Rows with this p

  8. Can Higher Education Foster Economic Growth? Chicago Fed Letter. Number 229 (United States)

    Mattoon, Richard H.


    Not all observers agree that higher education and economic growth are obvious or necessary complements to each other. The controversy may be exacerbated because of the difficulty of measuring the exact contribution of colleges and universities to economic growth. Recognizing that a model based on local conditions and higher education's response…

  9. SU-E-J-229: Magnetic Resonance Imaging of Small Fiducial Markers for Proton Beam Therapy

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Y; James, J; Panda, A; Vargas, C; Silva, A; Liu, W; Shen, J; Ding, X; Paden, R; Hanson, J; Wong, W; Schild, S; Bues, M [Mayo Clinic, Arizona, Scottsdale, AZ (United States)


    Purpose: For proton beam therapy, small fiducial markers are preferred for patient alignment due to less interference with the proton beam. Visualizing small fiducial markers can be challenging in MRI. This study intends to investigate MRI imaging protocols for better visualization of small fiducial markers. Methods: Two carbon and two coil-shaped gold markers were placed into a gel phantom. Both carbon markers had a diameter of 1mm and a length of 3mm. Both gold markers had a length of 5mm. One gold marker had a diameter of 0.5mm and the other had a diameter of 0.75mm. T1 VIBE, T2 SPACE, TrueFISP and susceptibility weighted (SW) images were acquired. To improve marker contrast, high spatial resolution was used to reduce partial volume effect. Slice thickness was 1.5mm for all four sequences and in-plane resolution was 0.6mm for TrueFISP, 0.7mm for T1 VIBE, and 0.8mm for T2 SPACE and SW. For comparison purpose, a 3D T1 VIBE image set at 3mm slice thickness and 1.2mm in-plane resolution was also acquired. Results: All markers were visible in all high-resolution image sets. In each image set, marker-induced signal void was the smallest (in diameter) for carbon markers, followed by the 0.5mm gold marker and the largest for the 0.75mm gold marker. The SW images had the largest marker-induced signal void. However, those might be confused by susceptibility-gradient-induced signal voids. T1 VIBE had good visualization of markers with nicely defined edges. T2 SPACE had reasonable visualization of markers but edges were slightly blurred. TrueFISP had good visualization of markers only if they were not masked by banding artifacts. As a comparison, all markers were hardly visible in the standard resolution T1 VIBE images. Conclusion: 3D high-resolution T1 VIBE and SW have great potential in providing good visualization of small fiducial markers for proton beam therapy.

  10. People and things. CERN Courier, November 1982, v. 22(9)

    International Nuclear Information System (INIS)

    The article reports on achievements of various people, staff changes and position opportunities within the CERN organization and contains news updates on upcoming or past events. The 11th International Symposium on Lepton-Photon Interactions at High Energies will be held at Cornell University, Ithaca, New York, from 4-9 August 1983. According to our present understanding of the quark forces acting deep inside strongly interacting particles (hadrons), these forces are communicated by the exchange of gluons. These new force carriers thus appear high up on experimenters' want lists. The contest to measure the lifetime of the positive muon to high accuracy has a new entry. A group from the College of William and Mary in Virginia, using a muon beam at the TRIUMF cyclotron in Vancouver has recently measured the positive muon lifetime to one part in 36 000. Early in September, first circulating beam was achieved in the X-ray ring of the US National Synchrotron Light Source at Brookhaven, just over a year after the first beams were obtained in the vacuum ultraviolet ring

  11. FRG sealed isotopic heat sources project (C-229) project management plan

    International Nuclear Information System (INIS)

    This Project Management Plan defines the cost, scope, schedule, organizational responsibilities, and work breakdown structure for the removal of the Federal Republic of Germany (FRG) Sealed Isotopic Heat Sources from the 324 Building and placed in interim storage at the Central Waste Complex (CWC)

  12. 48 CFR 252.229-7004 - Status of contractors as a direct contractor (Spain). (United States)


    ... commensurate with contingent import tax and duty-free liability. This bank guaranty or fund shall not be released to the Contractor until the Spanish General Directorate of Customs verifies the accounting, export... DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION...

  13. 17 CFR 229.202 - (Item 202) Description of registrant's securities. (United States)


    ... take action; (vi) any classification of the Board of Directors, and the impact of such classification... extraordinary corporate transaction involving the registrant (or any of its subsidiaries), such as a...

  14. 50 CFR 229.32 - Atlantic large whale take reduction plan regulations. (United States)


    ... consists of the Cape Cod Bay right whale critical habitat area specified under 50 CFR 226.203(b) unless the... consists of the Great South Channel right whale critical habitat area specified under 50 CFR 226.203(a... the Gulf of Maine, except those designated as right whale critical habitat under 50 CFR...

  15. 17 CFR 229.305 - (Item 305) Quantitative and qualitative disclosures about market risk. (United States)


    ... (17 CFR 210), discussion and analysis shall be provided so as to enable the reader to assess the... correlation, independence, or actual observed correlation). 5. Under paragraph 305(a)(2), limitations that... Interpretation No. 39, “Offsetting of Amounts Related to Certain Contracts” (March 1992)). For example,...

  16. Investigation of Maori ovens on the old Lyttelton waterfront (M36/229)

    International Nuclear Information System (INIS)

    The Canterbury earthquakes of 2011 caused widespread damage in the historic Lyttelton town centre. One of the many casualties was the former Lyttelton post office building. Constructed in 1875, the building as well as the parcel of land on which it was constructed was deemed archaeological and an emergency archaeological authority was obtained by the Canterbury Earthquake Recovery Agency prior to the building and its foundations being removed. During the removal of the foundations in August 2011 archaeological deposits associated with pre-contact Maori occupation were encountered. (author)

  17. 50 CFR 229.4 - Requirements for Category I and II fisheries. (United States)


    ... fisher participating in a Category I or II fishery who expects to receive automatic registration does not... Certificates under this part will be integrated and coordinated with existing fishery license, registration, or... may register under that program or how registration will be achieved if no action is required on...

  18. 48 CFR 52.229-10 - State of New Mexico Gross Receipts and Compensating Tax. (United States)


    ... Acquisition Regulation, 48 CFR part 29. (i) Paragraphs (a) through (h) of this clause shall be null and void... ACQUISITION REGULATION (CONTINUED) CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of... Contractor shall submit applications for Nontaxable Transaction Certificates, Form CSR-3C, to the State...

  19. 17 CFR 229.505 - (Item 505) Determination of offering price. (United States)


    ... equity is being registered for which there is no established public trading market for purposes of... the offering price of the common equity being registered and the market price of outstanding shares of... for common equity for which there is no established public trading market for purposes of paragraph...

  20. 50 CFR 229.36 - Atlantic Pelagic Longline Take Reduction Plan (PLTRP). (United States)


    ... injuries. In addition, all provisions of 50 CFR 600.746, Observers, apply. No waivers will be granted under... the U.S. east coast, a component of the Atlantic Ocean, Caribbean, Gulf of Mexico large pelagics... disconnected from the mainline; hooks are not baited; longline left on the drum is covered with a tarp; and...

  1. Duty cycle testing and performance evaluation of the SM-229 teleoperator

    International Nuclear Information System (INIS)

    This paper contains the first known experimental studies and analyses of teleoperator performance for specific duty cycles. The results are presented in two distinct areas as position usage patterns, and as three-dimensional power grids. The position usage patterns are a valuable means to assess the available motion range. The power grids are a unique concept for evaluating joint performance. Final conclusions contain recommendations to upgrade the teleoperator for optimum performance. 3 refs., 16 figs

  2. SU-E-J-229: Magnetic Resonance Imaging of Small Fiducial Markers for Proton Beam Therapy

    International Nuclear Information System (INIS)

    Purpose: For proton beam therapy, small fiducial markers are preferred for patient alignment due to less interference with the proton beam. Visualizing small fiducial markers can be challenging in MRI. This study intends to investigate MRI imaging protocols for better visualization of small fiducial markers. Methods: Two carbon and two coil-shaped gold markers were placed into a gel phantom. Both carbon markers had a diameter of 1mm and a length of 3mm. Both gold markers had a length of 5mm. One gold marker had a diameter of 0.5mm and the other had a diameter of 0.75mm. T1 VIBE, T2 SPACE, TrueFISP and susceptibility weighted (SW) images were acquired. To improve marker contrast, high spatial resolution was used to reduce partial volume effect. Slice thickness was 1.5mm for all four sequences and in-plane resolution was 0.6mm for TrueFISP, 0.7mm for T1 VIBE, and 0.8mm for T2 SPACE and SW. For comparison purpose, a 3D T1 VIBE image set at 3mm slice thickness and 1.2mm in-plane resolution was also acquired. Results: All markers were visible in all high-resolution image sets. In each image set, marker-induced signal void was the smallest (in diameter) for carbon markers, followed by the 0.5mm gold marker and the largest for the 0.75mm gold marker. The SW images had the largest marker-induced signal void. However, those might be confused by susceptibility-gradient-induced signal voids. T1 VIBE had good visualization of markers with nicely defined edges. T2 SPACE had reasonable visualization of markers but edges were slightly blurred. TrueFISP had good visualization of markers only if they were not masked by banding artifacts. As a comparison, all markers were hardly visible in the standard resolution T1 VIBE images. Conclusion: 3D high-resolution T1 VIBE and SW have great potential in providing good visualization of small fiducial markers for proton beam therapy

  3. Case 229: Burn-related Global Ankylosis of Interphalangeal Joints with Associated Acroosteolysis. (United States)

    Davis, Derik L; Resnik, Charles S


    History A 50-year-old woman presented with a 6-month history of polyarthralgia involving the left and right hands, wrists, elbows, ankles, and knees. Her pain was not associated with morning stiffness but did worsen over the course of the day. She denied experiencing fevers, chills, or mouth ulcers. She did not report paresthesias or blue discoloration of her fingers when they were exposed to cold. Her family history was remarkable for an aunt who died of systemic lupus erythematosus and for a brother with arthritis. Her medical history was remarkable for vitamin D deficiency, hypertension, and rehabilitation for burns. At clinical examination, she had mild tenderness to palpation of her joints, without associated erythema, swelling, or crepitus. Healed skin grafts were also noted. Blood chemistry tests revealed a rheumatoid factor of 8.5 IU/mL (normal range, 0-13.9 IU/mL), an erythrocyte sedimentation rate of 2 mm/hr (normal range, 0-40 mm/hr), and a C-reactive protein value of 0.4 mg/L (3.8 nmol/L) (normal range, 0-4.9 mg/L [0-46.7 nmol/L]). Antinuclear antibodies test results were negative. Radiography of the right and left hands was performed. PMID:27089192

  4. 四、P229 海洋测量学

    Institute of Scientific and Technical Information of China (English)


    CH20112035水下磁性目标探测中磁异常分量换算方法=Components Conversion of Magnetic Anomaly in Detec-ting Under water Magnetic Object/卞光浪(海军大连舰艇学院海测工程系),翟国君,刘雁春,欧阳永忠∥测绘学报.-2011,40(2).-232~237为了更加准确地判断水下磁性目标空间位置及形态有必要研究由磁场标量信息向矢量信息换算的方法。根

  5. Evidence for an ancestral association of human coronavirus 229E with bats

    Czech Academy of Sciences Publication Activity Database

    Corman, V. M.; Baldwin, H. J.; Tateno, A. F.; Zerbinati, R. M.; Annan, A.; Owusu, M.; Nkrumah, E. E.; Maganga, G. D.; Oppong, S.; Adu-Sarkodie, Y.; Vallo, Peter; da Silva Filho, L. V. R. F.; Leroy, E. M.; Thiel, V.; van der Hoek, L.; Poon, L. L. M.; Tschapka, M.; Drosten, C.; Drexler, J. F.


    Roč. 89, č. 23 (2015), s. 11858-11870. ISSN 0022-538X Institutional support: RVO:68081766 Keywords : respiratory syndrome coronavirus * SARS-coronavirus * genomic characterization * dromedary camels * clinical impact * virus * children * protein * spike * classification Subject RIV: FN - Epidemiology, Contagious Diseases ; Clinical Immunology Impact factor: 4.439, year: 2014

  6. Identification of a laccase from Ganoderma lucidum CBS 229.93 having potential for enhancing cellulase catalyzed lignocellulose degradation

    DEFF Research Database (Denmark)

    Sitarz, Anna Katarzyna; Mikkelsen, Jørn Dalgaard; Højrup, Peter;


    Based on a differential pre-screening of 44 white-rot fungi on a lignocellulose-supplemented minimal medium, four basidiomycetes were selected for further study: Ganoderma lucidum, Polyporus brumalis, Polyporus ciliatus and Trametes versicolor. Only G. lucidum was able to grow vividly on malt...... extract or minimal media supplemented with alkali lignin. When grown on malt extract or minimal medium supplemented with lignocellulose (sugar cane bagasse), the crude G. lucidum protein extract exhibited high laccase activity, ∼3U/mL toward syringaldazine. This activity was 13–17 fold higher than the...... corresponding activities of the crude protein extracts of P. brumalis, P. ciliatus and T. versicolor. Native PAGE electrophoresis of the crude G. lucidum extract confirmed the presence of an active laccase. The G. lucidum laccase had a molecular weight of ∼62.5kDa, and a Km value of 0.107mM (determined on ABTS...

  7. Assessment of foot health and animal welfare: clinical findings in 229 dairy Mediterranean Buffaloes (Bubalus bubalis) affected by foot disorders


    Guccione, Jacopo; Carcasole, Christian; Alsaaod, Maher; D’Andrea, Luigi; DI LORIA, Antonio; De Rosa, Angela; Ciaramella, Paolo; Steiner, Adrian


    Background Lameness represents the third most important health-related cause of economic loss in the dairy industry after fertility and mastitis. Although, dairy Mediterranean Buffaloes (MB) and dairy cows share similar breeding systems predisposing to similar herd problems, published studies exploring its relevance and role in these ruminants are still rare and incomplete. The aims of this study were to describe the clinical findings of foot disorders (FDs) in dairy MB and their influence on...

  8. Assessment of foot health and animal welfare: clinical findings in 229 dairy Mediterranean Buffaloes (Bubalus bubalis) affected by foot disorders.


    Guccione, Jacopo; Carcasole, Christian; Alsaaod, Maher; D'Andrea, Luigi; DI LORIA, Antonio; De Rosa, Angela; Ciaramella, Paolo; Steiner, Adrian


    BACKGROUND Lameness represents the third most important health-related cause of economic loss in the dairy industry after fertility and mastitis. Although, dairy Mediterranean Buffaloes (MB) and dairy cows share similar breeding systems predisposing to similar herd problems, published studies exploring its relevance and role in these ruminants are still rare and incomplete. The aims of this study were to describe the clinical findings of foot disorders (FDs) in dairy MB and their influenc...

  9. Government Intervention in Agriculture. Measurement, Evaluation, and Implications for Trade Negotiations. Foreign Agricultural Economic Report No. 229. (United States)

    Economic Research Service (USDA), Washington, DC.

    This report presents an analysis that defines and quantifies the extent of government intervention in the agricultural sectors of the market-oriented countries most active in trade. One aim is to provide usable economic information for the multilateral trade negotiations (MTN), recently launched under the auspices of the General Agreement on…

  10. 20 CFR 229.20 - When an employee is eligible for an increase under the overall minimum. (United States)


    .... The O/M is reduced for each month it is payable before the month the employee attains retirement age... increased under the DIB O/M if the employee is under retirement age, and (1) Is entitled to an age or...) Spouse with child in care or spouse retirement age or older. If the employee has not attained the...

  11. 49 CFR 1544.229 - Fingerprint-based criminal history records checks (CHRC): Unescorted access authority, authority... (United States)


    ... certification made to an airport operator on or after December 6, 2001, pursuant to 14 CFR 107.209(n) in effect prior to November 14, 2001 (see 14 CFR parts 60 to 139 revised as of January 1, 2001) or § 1542.209(n... employee or contract employee covered under a certification made to an airport operator pursuant to 14...

  12. PS2-29: Development, Implementation and Evaluation of a Web-based Curriculum on Pharmaceutical Marketing and Prescribing (United States)

    Salisbury, April L; Gunter, Margaret J; White, Robert


    Background/Aims: To develop, implement, and evaluate a web-based curriculum on drug marketing and prescribing with funding from off-label marketing lawsuit settlement funds. Methods: Content experts developed a course entitled “Optimal Prescribing” in two stages: a live pilot and a web-based course consisting of modules with slides, video clips, narration, cases, interviews, and interactive elements. The course was presented to physicians and midlevel providers from the Lovelace Health System in Albuquerque, New Mexico. Feedback was collected at the live pilot and participants were surveyed later, as well as a control group of providers who did not attend the pilot course, to assess the impact of the education on attitudes about relationships with industry representatives, the amount and source of information that guides prescribing decisions, and self-reported changes in prescribing patterns. Data were analyzed and summarized to revise the material to produce web-based modules for use by prescribers in the public domain. The final web-based, 3-credit course includes a pretest, posttest, and a 90-day follow up survey, which are currently being collected. Results: In the first two months the course was available, 173 people accessed it and 40 successfully completed it, earning credit (16 more took the posttest, but did not pass). Initial reports on the learner’s performance show improvements on all posttest questions. Of the 20 questions 17 showed >10% improvement, with a maximum 37.12% improvement. The greatest improvements were in the learner’s ability to: acknowledge the fact that even very brief sales calls can result in a 16% increase in drug sales, distinguish absolute from relative risk reduction, and identify acceptable evidence for off-label choices. Of the total users, 78% would recommend this course to colleagues (29.35% said yes, enthusiastically). Conclusions: Optimal Prescribing has been piloted, revised, and launched as a web-based course, and is being accessed by a number of people with positive results; however, less than 25% have fully utilized the course and earned continuing education credit. Data collection and analysis will continue over the remainder of the 3-year life of the course and may lead to improvements in course design.

  13. 17 CFR 229.303 - (Item 303) Management's discussion and analysis of financial condition and results of operations. (United States)


    ... Regulation S-X (17 CFR 210), a management's discussion and analysis of the financial condition and results of... is not excluded from the initial recognition and measurement provisions of FIN 45 pursuant to... or credit risk support to, or engages in leasing, hedging or research and development services...

  14. 17 CFR 229.201 - (Item 201) Market price of and dividends on the registrant's common equity and related... (United States)


    ... to give retroactive effect to material changes resulting from stock dividends, stock splits and reverse stock splits. 3. The computation of the approximate number of holders of registrant's common... filings other than an annual report to security holders required by Exchange Act Rule 14a-3 (17 CFR...

  15. Study on dependence of breakthrough time on flow rate of the carrier, gas in 229Rn adsorber bed

    International Nuclear Information System (INIS)

    Activated charcoal is a well-known adsorber of 222Rn and 220Rn gasses and its uses in mitigation of 222Rn and 220Rn in works places were reported earlier. A mitigation factor of >105 was achieved easily for 220Rn using cylindrical columns filled with activated charcoal. These studies have also reported the 222Rn breakthrough curves, breakthrough time and radon adsorption coefficient (K) for charcoal. In this paper we evaluate the effect of flow rate of the carrier gas on breakthrough time and the mitigation factor. This information is very useful in designing 220Rn migitation systems for the actual use in workplaces. The variations in breakthrough time and adsorption coefficient (K) with the flow-rate of the radon laden air in the charcoal adsorber bed were studied in detail. It was observed that the break through time was higher for lower flow rates and lower for higher flow rates. The details are presented and discussed in this paper. (author)

  16. Japan's emergence as a global power; James I. Matray : Greenwood Press. Westport, Connecticut-London. 2001. 229 pp.


    Stanganelli, Isabel Cecilia


    La derrota en la Segunda Guerra Mundial cambió la historia previa del Japón, que dedicó su atención al crecimiento económico. De esta manera se transformó en una de las más prósperas y productivas naciones en la historia de la humanidad. James Matray ofrece en este libro una prolija secuencia de los sucesos que afectaron a Japón desde 1945 hasta 2000, además de biografías de los principales actores involucrados y un anexo con los principales documentos que contribuyeron a edificicar el Japón ...

  17. SU-E-J-229: Quantitative Assessment for Timely Adaptive Re-Planning Using Weekly Dose Monitoring for Head and Neck Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Shang, Q; Liu, H; Greskovich, J; Koyfman, S; Xia, P [Cleveland Clinic, Cleveland, OH (United States); Li, Z [Cleveland Clinic, Cleveland, OH (United States); the 6th people' s hospital of Shanghai Jiaotong University, Shanghai, Shanghai (China)


    Purpose: For patients with head and neck (HN) cancer, mid-course adaptive radiation therapy (ART) is a common practice in our institution to accommodate anatomic changes. The aim of the study is to evaluate whether dose re-calculation on weekly verification images can provide quantitative assessment for timely adaptive re-planning with daily image-guided intensity modulated radiotherapy (IMRT). Methods: We retrospectively selected sixty daily verification images acquired on CT-on-rail/CBCT from ten HN patients. These image sets were typically a week apart. Among these patients, six patients received a mid-course ART. Contours of the tumors and organ-at-risks (OARs) were manually delineated by a physician on each verification CT. After placing the treatment iso-center on the verification CTs according to the recorded clinical shifts, daily dose was re-calculated with the same beam configuration as the original plan. For the purpose of this study, electron densities for both verification CTs and planning CTs were set to 1.0 g/cm3. Results: Two patients had D99 of the CTV < 97% of the planned dose for more than three fractions due to remarkable tumor volume shrinkages. D-max of the spinal cord exceeded a tolerance of 45 Gy for four fractions in additional two patients. D-mean of the parotid increased within 25% of the planned value. D-max of the brainstem and D-mean of the oral cavity did not show significant variation. If the re-planning criteria included D99 of the CTV < 97% of the planned dose and D-max of the spinal cord > 45 Gy, two out ten patients required ART at week 2 and two patients required ART at week 3, respectively. Conclusion: Weekly dose monitoring with re-calculation on verification images can provide quantitative dose guidance for timely adaptive re-planning. Future work will include accumulative dose analysis for the decision of adaptive re-planning. The study is supported in part by Siemens Medical Solutions.

  18. Decree no. 2004-832 from August 19, 2004 decided for the enforcement of articles L. 229-5 to L 229-19 of the environmental law and relative to the system of trade of greenhouse gas emission quotas; Decret no. 2004-832 du 19 aout 2004 pris pour l'application des articles L. 229-5 a L. 229-19 du code de l'environnement et relatif au systeme d'echange de quotas d'emission de gaz a effet de serre

    Energy Technology Data Exchange (ETDEWEB)



    This decree comprises 17 articles sorted in 7 chapters. It represents the start-up of an experimental phase covering the 2005-2007 era and during which only carbon dioxide is taken into consideration. In 2008 the list of greenhouse gases will be revised and other gases like methane and HFC will be involved. This decree concerns only the trading of emission quotas from iron making and transforming facilities, energy generating facilities, mineral transformation and paper transformation facilities registered in the environment protection classification. (J.S.)

  19. Pathological and incidental findings on brain MRI in a single-center study of 229 consecutive girls with early or precocious puberty

    DEFF Research Database (Denmark)

    Mogensen, Signe Sloth; Aksglaede, Lise; Mouritsen, Annette;


    Central precocious puberty may result from organic brain lesions, but is most frequently of idiopathic origin. Clinical or biochemical factors which could predict a pathological brain MRI in girls with CPP have been searched for. With the recent decline in age at pubertal onset among US and...... European girls, it has been suggested that only girls with CPP below 6 years of age should have brain MRI performed....

  20. Design procedure and operation experience of data acquisition and control system for 22.9 kV underground HTS power cable (United States)

    Ryoo, H. S.; Sohn, S. H.; Hwang, S. D.; Lim, J. H.; Choi, H. S.; Yatsuka, K.; Masuda, T.; Isojima, S.; Watanabe, M.; Suzawa, C.; Koo, J. Y.


    A new 100 m underground HTS cable system was planned for an experimental study in a real scale. The main targets of the project were the verification of the system application. Various types and multipoint analogue data including digital control sequence data were required to be measured. Because of the long operating period of the system cooling and warming sequence, very high operating stability was required. Additionally the economically designed main cooling facility was requested over-night manual operation. The basic function of the data acquisition and control system was the gathering of various type data and the control of test facilities include the cooling facility. Most effort of the design procedure was focused on making the automatic operation including under an emergency situation and the alerting of the emergency state to the operators staying even remote place. The main focus of this function was reducing of the operating man power, specially requested for over-night. So various emergency situations and scenarios were considered and analyzed for the automation operation.

  1. I. The metabolic properties of plutonium and allied materials

    Energy Technology Data Exchange (ETDEWEB)

    Hamilton, J.G.


    This report on the metabolic properties of plutonium and related radioactive materials presents experimental information in the following areas: radioautographic studies; tracer studies (with tables of accumulation in tissues) of actinium, radio-zirconium, technetium, radio-rubidium, radio-germanium, beryllium, and cadmium; decontamination and bone metabolism studies; and radio-chemical isolation.

  2. New production in the South China Sea

    Institute of Scientific and Technical Information of China (English)

    CAI; Pinghe


    [1]Dugdale, R. C., Goering, J. J., Uptake of new and regenerated nitrogen in primary productivity, Limnology and Oceanog-raphy, 1967, 12: 196-206.[2]Eppley, R. W., Peterson, B. J., Particulate organic matter flux and planktonic new production in the deep ocean, Nature, 1979, 282: 677-680.[3]Allen, C. B., Kanda, J., Laws, E. A., New production and photosynthetic rates within and outside a cyclonic mesoscale eddy in the North Pacific Subtropical gyre, Deep-Sea Research Ⅱ, 1996, 43(6): 917-936.[4]Jenkins, W. J., Tritium-helium dating in the Sargasso Sea: A measurement of oxygen utilization rates, Nature, 1977, 196: 291-292.[5]Spitzer, W. S., Jenkins, W. J., Rates of vertical mixing, gas exchange and new production: Estimates from seasonal gas cy-cle in the upper ocean near Bermuda, Journal of Marine Research, 1989, 47: 169-196.[6]Sarmiento, J. L., Thiele, G., Key, R. M. et al., Oxygen and nitrate new production and remineralization in the North At-lantic Subtropical Gyre, Journal of Geophysical Research, 1990, 95: 18303-18315.[7]Ku, T. L., Luo, S., Kusakabe, M. et al., 228Ra-derived nutrient budgets in upper equatorial Pacific and the role of "new" silicate in limiting productivity, Deep-Sea Research II, 1995, 42(2/3): 479-497.[8]Wheeler, P. A., Rates of nitrate assimilation at the equator during the US-JGOFS spring time series: Estimates of new pro-duction, EOS, Transactions, American Geophysical Union, 1992, 73: 281.[9]Huang, Y., Xie, Y., Chen, M. et al., Distribution feature of 228Ra in surface seawater of the Nansha sea area, in Isotopes Marine Chemistry of Nansha Islands Waters (in Chinese), Beijing: Ocean Press, 1996, 70-78.[10]Reid, D. F., Key, R. M., Schink, D., Radium, thorium and actinium extraction from seawater using an improved manga-nese-oxide-coated fiber, Earth and Planetary Science Letters, 1979, 43: 223-226.[11]Shi, W., Qiu, X., Huang, Y., Distribution of dissolved 226Ra in the Jiulongjiang-Xiamen bay

  3. Methyl 5,7-dihydroxy-2,2,9-trimethyl-6,11-dioxo-6,11-dihydro-2H-anthra[2,3-b]pyran-8-carboxylate

    Directory of Open Access Journals (Sweden)

    Annelise Lobstein


    Full Text Available The title compound, C22H18O7, also known as laurentiquinone B, is a new anthraquinone which was isolated from Vismia laurentii, a Cameroonian medicinal plant. The asymmetric unit contains two independent molecules. Each of them contains four fused rings, three of which are coplanar and typical of anthracene, while the heterocyclic rings adopt envelope conformations. Intramolecular O—H...O hydrogen bonds result in the formation of two planar rings, which are also almost coplanar with the adjacent rings. In the crystal structure, intermolecular O—H...O and C—H...O hydrogen bonds link the molecules and a π–π contact is also present [centroid-centroid distance = 3.967 (3 Å].

  4. A clínica terapêutica ocupacional com usuários de substâncias psicoativas: o desafio da práxis - doi:10.5020/18061230.2006.p229

    Directory of Open Access Journals (Sweden)

    Yvana Coutinho de Oliveira


    Full Text Available A Política do Ministério da Saúde para a Atenção Integral a Usuários de Álcool e outras Drogas tem priorizado ações de caráter terapêutico, reabilitativo e de humanização em suas diversas unidades assistenciais. Neste contexto, a Terapia Ocupacional tem um campo fértil de atuação no conjunto de atividades que estão relacionadas à reabilitação psicossocial de indivíduos drogadictos. Neste trabalho, a autora relata, então, a sua experiência clínica terapêutica ocupacional com usuários de substâncias psicoativas em uma instituição psiquiátrica hospitalar, fazendo uma revisão teórica sobre o tema e tecendo considerações metodológicas sobre a práxis terapêutica. A metodologia utilizada foi a do tipo descritiva, na qual a observação no espaço institucional e os atendimentos em grupo foram os principais instrumentos utilizados. Como resultados, a autora refere o enorme prejuízo causado pela dependência química nos usuários, em suas famílias e na sociedade de uma forma geral. A atuação terapêutica ocupacional, principalmente utilizando abordagens grupais, mostra-se bastante eficaz no processo terapêutico, por facilitar expressão de subjetividades e auxiliar a reconstrução psíquica destes indivíduos. No entanto, torna-se urgente a implantação de mais espaços terapêuticos especializados no tratamento de drogadictos, bem como medidas eficientes de prevenção e controle da problemática do narcotráfico.

  5. Les relations diplomatiques entre le monde musulman et l’Occident latin (XIIe-XVIe siècles). Vol. spécial d’Oriente Moderno, vol. 88/2, 2008, vi + 229-533 p.


    Piemontese, Angelo-Michele


    Michele Bernardini, « Introduction » (p. i-vi), illustre l’entreprise historiographique d’envergure internationale dont ce volume est le fruit, grâce à la coopération entre le CNRS, Paris - Unité mixte de Recherche 8167 « Orient et Méditerranée » (Laboratoire : Islam médiéval), l’École Pratique des Hautes Études (Paris, Sorbonne), l’Institute of Asian and African Studies (University of Jerusalem) et l’Istituto per l’Oriente, Rome. Le but du recueil consiste à examiner l’histoire des relations...

  6. Tolan John, L’Europe latine et le monde arabe au Moyen Âge. Cultures en conflit et en convergence, Presses universitaires de Rennes, collection « Histoire », 2009, 229 p.


    Abbès Zouache


    Si l’on admet que le titre est signe, celui choisi par John Tolan sonne comme un discret rappel, dans le contexte français – celui d’une exacerbation des tensions autour de la question des relations entre « l’Occident » et « l’Islam » au Moyen Âge (König, 2011). Du paradigme religieux et de la dialectique de la confrontation entre les deux ensembles ici nommés « Europe latine » et « monde arabe », l’on peut et l’on doit se passer, du moins comme référents uniques. Quelles que soient les expre...

  7. Dynamics Explorer 1, retarding ion mass spectrometer summary spectrograms-82/110 to 82/229 spin-time spectrograms for H(+), He(+), O(+), N(+), O(++), M/Z = 2, and molecular ions (United States)


    The retarding ion mass spectrometer (RIMS) experiment onboard the Dynamics Explorer 1 (DE 1) satellite was designed to perform energy and mass-per-charge analysis on low-energy ions (less than 50 eV) with mass/charge ratios ranging from 1 to 40 amu/Z. The DE 1 satellite, carrying the RIMS experiment, was launched into an elliptical polar orbit on August 3, 1981. The approximately 7.5 hour orbit has perigee of 675 km altitude and apogee of 24,875 km altitude. this document and those that following in this series, contains summary RIMS data spectrograms for each orbit for which RIMS data are available. The RIMS instrument began returning science data on day 280 of 1981 and continued to return usable data until the end of the DE mission in March 1991. It should be noted that studies of the RIMS data set should be conducted only with a thorough awareness of the material described in the introduction section presented here, or in collaboration with a scientist familiar with RIMS data analysis.

  8. Sorption studies of radioelements on geological materials

    International Nuclear Information System (INIS)

    Batch sorption experiments have been carried out to study the sorption of uranium, technetium, curium, neptunium, actinium, protactinium, polonium, americium and plutonium onto bentonite, granodiorite and tuff. Mathematical modelling using the HARPHRQ program and the HATCHES database was carried out to predict the speciation of uranium and technetium in the equilibrated seawater, and neptunium, americium and plutonium in the rock equilibrated water. Review of the literature for thermodynamic data for curium, actinium, protactinium and polonium was carried out. Where sufficient data were available, predictions of the speciation and solubility were made. This report is a summary report of the experimental work conducted by AEA Technology during April 1991-March 1998, and the main results have been presented at Material Research Society Symposium Proceedings and published as proceedings of them. (author)

  9. Investigation for determining the retention properties of rock over the ASSE II mine for dissolved radionuclides

    International Nuclear Information System (INIS)

    For a model consideration of groundwater movement and the associated transport of dissolved substance in deep groundwater, the retention properties of the ASSE II mine for radionuclides dissolved in water were determined. A series of properties of rocks were examined and described for this purpose. Apart from the chemical, mineralogical and petrophysical characteristics of the rocks, the retention was determined by 3 different methods and stated in the form of distribution coefficients for specific elements. A comparison of the results of vibration and diffusion experiments gave good agreement, while the results in through column experiments only reached the same order of magnitude after an expensive determination with the aid of a place concentration distribution. The distribution coefficients for the elements carbon, selenium, strontium, technetium, iodine, caesium, lead, radium, actinium, proto-actinium, uranium, neptunium, plutonium, americium and curium are listed and collected for model rock packages. (orig./HP)

  10. 76 FR 36905 - Information Collection Requirement; Defense Federal Acquisition Regulation Supplement; Taxes (United States)


    ... Regulation Supplement; Taxes AGENCY: Defense Acquisition Regulations System, Department of Defense (DoD... Supplement (DFARS) Part 229, Taxes, and related clause at DFARS 252.229-7010; OMB Control Number...

  11. Sorption studies of radioelements on geological materials


    Berry, J. A; 油井 三和; 北村 暁


    Batch sorption experiments have been carried out to study the sorption of uranium, technetium, curium, neptunium, actinium, protactinium, polonium, americium and plutonium onto bentonite, granodiorite and tuff. Mathematical modelling using the HARPHRQ program and the HATCHES database was carried out to predict the speciation of uranium and technetium in the equilibrated seawater, and neptunium, americium and plutonium in the rock equilibrated water. Review of the literature for thermodynamic ...

  12. Purification of cerium, neodymium and gadolinium for low background experiments


    Boiko R.S.; Barabash A.S.; Belli P.; Bernabei R.; Cappella F.; Cerulli R.; Danevich F.A.; Incicchitti A.; Laubenstein M.; Mokina V.M.; Nisi S.; Poda D.V.; Polischuk O.G.; Tretyak V.I.


    Cerium, neodymium and gadolinium contain double beta active isotopes. The most interesting are 150Nd and 160Gd (promising for 0ν2β search), 136Ce (2β+ candidate with one of the highest Q2β). The main problem of compounds containing lanthanide elements is their high radioactive contamination by uranium, radium, actinium and thorium. The new generation 2β experiments require development of methods for a deep purification of lanthanides from the radioactive elements. A combination of physical an...

  13. LASL experience in decontamination of the environment

    International Nuclear Information System (INIS)

    This discussion represents one part of a major effort in soil decontamination at the Los Alamos site. A contaminated industrial waste line in the Los Alamos townsite was removed, and a plutonium incineration facility, and a filter building contaminated with actinium-227 were dismantled. The former plutonium handling facility has been decontaminated, and canyons and an old firing site contaminated with strontium-90 have been surveyed

  14. Study of the origin of elements of the uranium-235 family observed in excess in the vicinity of the experimental nuclear EL4 reactor under dismantling. Lessons got at this day and conclusions; Etude de l'origine des elements de la famille de l'uranium-235 observes en exces dans les environs du reacteur nucleaire experimental EL4 en cours de demantelement. Enseignements retires a ce jour et conclusion

    Energy Technology Data Exchange (ETDEWEB)



    This study resumes the discovery of an excess of actinium 227 found around by EL4 nuclear reactor actually in dismantling. The search for the origin of this excess revealed a real inquiry of investigation during three years. Because a nuclear reactor existed in this area a particular attention will have concerned this region. The doubt became the line of conduct to find the answer to the human or natural origin of this excess. Finally and against any evidence, it appears that the origin of this phenomenon was natural, consequence of the particular local geology. The detail of the different investigations is given: search of a possible correlation with the composition of elevations constituent of lanes, search (and underlining) of new sites in the surroundings of the Rusquec pond and the Plouenez station, study of the atmospheric deposits under winds of the nuclear power plant and in the east direction, search of a possible relationship with the gaseous effluents of the nuclear power plant in the past, historical study of radioactive effluents releases in the fifty last years by the analysis of the sedimentary deposits in the Saint-Herbiot reservoir, search of a possible correlation between the excess of actinium 227 and the nuclear power plant activity; search of a possible correlation with a human activity without any relationship with the nuclear activities, search of a correlation with the underground waters, search of a correlation with the geological context, collect of information on the possible transfers in direction of the food chain, determination of the radiological composition of the underground waters ( not perturbed by human activity), search of the cause of an excess of actinium 227 in the old channel of liquid effluents release of the nuclear power plant. The results are given and discussed. And contrary to all expectations the origin of the excess of actinium 227 is completely natural. (N.C.)

  15. The discoveries of uranium 237 and symmetric fission — From the archival papers of Nishina and Kimura


    IKEDA, Nagao


    Shortly before the Second World War time, Nishina reported on a series of prominent nuclear physical and radiochemical studies in collaboration with Kimura. They artificially produced 231Th, a member of the natural actinium series of nuclides, by bombarding thorium with fast neutrons. This resulted in the discovery of 237U, a new isotope of uranium, by bombarding uranium with fast neutrons, and confirmed that 237U disintegrates into element 93 with a mass number of 237. They also identified t...

  16. History of the unraveling of the natural decay series

    International Nuclear Information System (INIS)

    Milestones in the subject of radioactivity, which were important to the unraveling of natural decay series, have been identified and described. The interplay between all these issues is very complex, and some aspects of the development of the uranium series is discussed as an example, the thorium and actinium series evolved in a similar way from research by many of the same people. All three series as understood in 1913 are compared with their present-day representation. (orig.)

  17. History of the unraveling of the natural decay series

    International Nuclear Information System (INIS)

    Milestones in the subject of radioactivity, which were important to the unraveling of natural decay series, have been identified and described. The interplay between all these issues is very complex, and some aspects of the development of the uranium series is discussed as an example, the thorium and actinium series evolved in a similar way from research by many of the same people. All three series as understood in 1913 are compared with their present-day representation. (author)

  18. Behaviour of uranium series radionuclides in surface water (Crouzille, Limousin). Geochemical implications

    International Nuclear Information System (INIS)

    Understanding natural radionuclides behaviour in surface water is a required step to achieve uranium mine rehabilitation and preserve water quality. The first objective of this thesis is to determine which are the radionuclides sources in a drinking water reservoir. The second objective is to improve the knowledge about the behaviour of uranium series radionuclides, especially actinium. The investigated site is a brook (Sagnes, Limousin, France) which floods a peat bog contaminated by a former uranium mine and which empties into the Crouzille lake. It allows studying radionuclides transport in surface water and radionuclides retention through organic substance or water reservoir. Radionuclides distribution in particulate, colloidal and dissolved phases is determined thanks to ultra-filtrations. Gamma spectrometry allows measuring almost all natural radionuclides with only two counting stages. However, low activities of 235U series radionuclides impose the use of very low background well-type Ge detectors, such as those of the Underground Laboratory of Modane (France). Firstly, this study shows that no or few radionuclides are released by the Sagnes peat bog, although its radioactivity is important. Secondly, it provides details on the behaviour of uranium series radionuclides in surface water. More specifically, it provides the first indications of actinium solubility in surface water. Actinium's behaviour is very close to uranium's even if it is a little less soluble. (author)

  19. 17 CFR 240.14e-1 - Unlawful tender offer practices. (United States)


    ...(c) of Regulation S-K (17 CFR 229.901(c)) and the securities being offered are registered (or authorized to be registered) on Form S-4 (17 CFR 229.25) or Form F-4 (17 CFR 229.34), the offer shall not be... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Unlawful tender...


    Energy Technology Data Exchange (ETDEWEB)

    P. Bernot


    The purpose of this study is to evaluate dissolved concentration limits (also referred to as solubility limits) of elements with radioactive isotopes under probable repository conditions, based on geochemical modeling calculations using geochemical modeling tools, thermodynamic databases, field measurements, and laboratory experiments. The scope of this activity is to predict dissolved concentrations or solubility limits for elements with radioactive isotopes (actinium, americium, carbon, cesium, iodine, lead, neptunium, plutonium, protactinium, radium, strontium, technetium, thorium, and uranium) relevant to calculated dose. Model outputs for uranium, plutonium, neptunium, thorium, americium, and protactinium are provided in the form of tabulated functions with pH and log fCO{sub 2} as independent variables, plus one or more uncertainty terms. The solubility limits for the remaining elements are either in the form of distributions or single values. Even though selection of an appropriate set of radionuclides documented in Radionuclide Screening (BSC 2002 [DIRS 160059]) includes actinium, transport of Ac is not modeled in the total system performance assessment for the license application (TSPA-LA) model because of its extremely short half-life. Actinium dose is calculated in the TSPA-LA by assuming secular equilibrium with {sup 231}Pa (Section 6.10); therefore, Ac is not analyzed in this report. The output data from this report are fundamental inputs for TSPA-LA used to determine the estimated release of these elements from waste packages and the engineered barrier system. Consistent modeling approaches and environmental conditions were used to develop solubility models for the actinides discussed in this report. These models cover broad ranges of environmental conditions so they are applicable to both waste packages and the invert. Uncertainties from thermodynamic data, water chemistry, temperature variation, and activity coefficients have been quantified or


    International Nuclear Information System (INIS)

    The purpose of this study is to evaluate dissolved concentration limits (also referred to as solubility limits) of elements with radioactive isotopes under probable repository conditions, based on geochemical modeling calculations using geochemical modeling tools, thermodynamic databases, field measurements, and laboratory experiments. The scope of this activity is to predict dissolved concentrations or solubility limits for elements with radioactive isotopes (actinium, americium, carbon, cesium, iodine, lead, neptunium, plutonium, protactinium, radium, strontium, technetium, thorium, and uranium) relevant to calculated dose. Model outputs for uranium, plutonium, neptunium, thorium, americium, and protactinium are provided in the form of tabulated functions with pH and log fCO2 as independent variables, plus one or more uncertainty terms. The solubility limits for the remaining elements are either in the form of distributions or single values. Even though selection of an appropriate set of radionuclides documented in Radionuclide Screening (BSC 2002 [DIRS 160059]) includes actinium, transport of Ac is not modeled in the total system performance assessment for the license application (TSPA-LA) model because of its extremely short half-life. Actinium dose is calculated in the TSPA-LA by assuming secular equilibrium with 231Pa (Section 6.10); therefore, Ac is not analyzed in this report. The output data from this report are fundamental inputs for TSPA-LA used to determine the estimated release of these elements from waste packages and the engineered barrier system. Consistent modeling approaches and environmental conditions were used to develop solubility models for the actinides discussed in this report. These models cover broad ranges of environmental conditions so they are applicable to both waste packages and the invert. Uncertainties from thermodynamic data, water chemistry, temperature variation, and activity coefficients have been quantified or otherwise

  2. Detection of rare earth elements in Powder River Basin sub-bituminous coal ash using laser-induced breakdown spectroscopy (LIBS)

    Energy Technology Data Exchange (ETDEWEB)

    Tran, Phuoc [National Energy Technology Lab. (NETL), Pittsburgh, PA, (United State; Mcintyre, Dustin [National Energy Technology Lab. (NETL), Pittsburgh, PA, (United State


    We reported our preliminary results on the use of laser-induced breakdown spectroscopy to analyze the rare earth elements contained in ash samples from Powder River Basin sub-bituminous coal (PRB-coal). We have identified many elements in the lanthanide series (cerium, europium, holmium, lanthanum, lutetium, praseodymium, promethium, samarium, terbium, ytterbium) and some elements in the actinide series (actinium, thorium, uranium, plutonium, berkelium, californium) in the ash samples. In addition, various metals were also seen to present in the ash samples

  3. The identification of soil radionuclides in the area of Puspiptek and surrounding

    International Nuclear Information System (INIS)

    The area of PUSPIPTEK and the surrounding are potentially exposed by radionuclides, because the operation of the nuclear research plant. The PPTN Serpong was operated long than 10 years, therefore soil radioactivity need to evaluate. The determination of radioactivity in the soil samples which be taken from research location using gamma spectrometry on June-August. The result of the research identified natural radionuclides K-40; Thorium decay series Ac-228, Bi-212, Pb-212, Tl-208, Ra-224 and Rn-220; Uranium decay series Bi-214, Pa-234, Pb-214 and Actinium decay series Bi-211, Po-211. There are no identification radionuclides produce from the activation of PPTN Serpong

  4. Towards a Coronavirus-Based HIV Multigene Vaccine

    Directory of Open Access Journals (Sweden)

    Klara K. Eriksson


    Full Text Available Human immunodeficiency virus (HIV infection represents one of the major health threats in the developing world. The costly treatment of infected individuals with multiple highly efficient anti-HIV drugs is only affordable in industrialized countries. Thus, an efficient vaccination strategy is required to prevent the further spread of the infection. The molecular biology of coronaviruses and particular features of the human coronavirus 229E (HCoV 229E indicate that HCoV 229E-based vaccine vectors can become a new class of highly efficient vaccines. First, the receptor of HCoV 229E, human aminopeptidase N (hAPN or CD13 is expressed mainly on human dendritic cells (DCs and macrophages indicating that targeting of HCoV 229E-based vectors to professional antigen presenting cells can be achieved by receptor-mediated transduction. Second, HCoV 229E structural genes can be replaced by multiple transcriptional units encoding various antigens. These virus-like particles (VLPs containing HCoV 229E-based vector RNA have the ability to transduce human DCs and to mediate heterologous gene expression in these cells. Finally, coronavirus infections are associated with mainly respiratory and enteric diseases, and natural transmission of coronaviruses occurs via mucosal surfaces. In humans, HCoV 229E causes common cold by infecting the upper respiratory tract. HCoV 229E infections are mainly encountered in children and re-infection occurs frequently in adults. It is thus most likely that pre-existing immunity against HCoV 229E will not significantly impact on the vaccination efficiency if HCoV 229E-based vectors are used in humans.

  5. Retraction: Reddy, K.R.N.; Abbas, H.K.; Abel, C.A.; Shier, W.T.; Salleh, B. Mycotoxin Contamination of Beverages: Occurrence of Patulin in Apple Juice and Ochratoxin A in Coffee, Beer and Wine and Their Control Methods. Toxins 2010, 2, 229-261.

    Directory of Open Access Journals (Sweden)

    Florian Lang


    Full Text Available It has been brought to our attention by a member of our Editorial Board that substantial portions of this review article have been copied verbatim from earlier publications without credit. After comparing the present paper and the other sources we have determined that indeed this manuscript clearly violates our policy on originality of all material submitted for publication and the generally accepted ethics of scientific publication. Consequently, the Editorial Team and Publisher have determined that it should be retracted. We apologize for any inconvenience this may cause.

  6. An aerial radiological survey of the Sandia National Laboratories and surrounding area

    International Nuclear Information System (INIS)

    A team from the Remote Sensing Laboratory conducted an aerial radiological survey of the area surrounding the Sandia National Laboratories and Kirtland Air Force Base in Albuquerque, New Mexico, during March and April 1993. The survey team measured the terrestrial gamma radiation at the site to determine the levels of natural and man-made radiation. This survey includes the areas covered by a previous survey in 1981. The results of the aerial survey show a background exposure rate which varies between 5 and 18 μR/h plus an approximate 6 μR/h contribution from cosmic rays. The major radioactive isotopes found in this survey were: potassium-40, thallium-208, bismuth-214, and actinium-228, which are all naturally-occurring isotopes, and cobalt-60, cesium-137, and excess amounts of thallium-208 and actinium-228, which are due to human actions in the survey area. In regions away from man-made activity, the exposure rates inferred from this survey's gamma ray measurements agree almost exactly with the exposure rates inferred from the 1981 survey. In addition to the aerial measurements, another survey team conducted in situ and soil sample radiation measurements at three sites within the survey perimeter. These ground-based measurements agree with the aerial measurements within ± 5%

  7. Mixed valency of the RE and Ac ions in solid states

    International Nuclear Information System (INIS)

    Full text: This review is devoted to consideration of the methods and results of the theoretical and experimental investigations of the electronic state of the rare earths and actinium ions in the separate compound. The methods of the high resolution X ray spectroscopy were used for our consideration. Energy of the X ray lines of the rare earths and actinium ions in free state and solid states was study carefully. Valency shifts of X Ray lines under change of electronic state of nf - ions in different oxide, fluoride and chloride compounds were determined for K -, L- and M - lines for these ions with accuracy near 10 -100 MeV. We studied the electronic state of nf- ions which is changed from '+2' to '+4' and determined the concentration of ions in different electronic state. Relative error for theoretical energy of the most lines for HFP - approach in comparison with experiment is less than 0.5%, and deviation for concentration is less than 5%

  8. A study of uranium and thorium migration at the Koongarra uranium deposit with application to actinide transport from nuclear waste repositories

    International Nuclear Information System (INIS)

    One way to gain confidence in modelling possible radionuclide releases is to study natural systems which are similar to components of the multibarrier waste repository. Several such analogues are currently under study and these provide useful data about radionuclide behaviour in the natural environment. One such system is the Koongarra uranium deposit in the Northern Territory. In this dissertation, the migration of actinides, primarily uranium and thorium, has been studied as an analogue for the behaviour of transuranics in the far-field of a waste repository. The major findings of this study are: 1. the main process retarding uranium migration in the dispersion fan at Koongarra is sorption, which suppresses dissolved uranium concentrations well below solubility limits, with ferrihydrite being a major sorbing phase; 2. thorium is extremely immobile, with very low dissolved concentrations and corresponding high distribution ratios for 230Th. Overall, it is estimated that colloids are relatively unimportant in Koongarra groundwater. Uranium migrates mostly as dissolved species, whereas thorium and actinium are mostly adsorbed to larger, relatively immobile particles and the stationary phase. However, of the small amount of 230Th that passes through a 1μm filter, a significant proportion is associated with colloidal particles. Actinium appears to be slightly more mobile than thorium and is associated with colloids to a greater extent, although generally present in low concentrations. These results support the possibility of colloidal transport of trivalent and tetravalent actinides in the vicinity of a nuclear waste repository. 112 refs., 23 tabs., 32 figs

  9. Purification of cerium, neodymium and gadolinium for low background experiments

    Directory of Open Access Journals (Sweden)

    Boiko R.S.


    Full Text Available Cerium, neodymium and gadolinium contain double beta active isotopes. The most interesting are 150Nd and 160Gd (promising for 0ν2β search, 136Ce (2β+ candidate with one of the highest Q2β. The main problem of compounds containing lanthanide elements is their high radioactive contamination by uranium, radium, actinium and thorium. The new generation 2β experiments require development of methods for a deep purification of lanthanides from the radioactive elements. A combination of physical and chemical methods was applied to purify cerium, neodymium and gadolinium. Liquid-liquid extraction technique was used to remove traces of Th and U from neodymium, gadolinium and for purification of cerium from Th, U, Ra and K. Co-precipitation and recrystallization methods were utilized for further reduction of the impurities. The radioactive contamination of the samples before and after the purification was tested by using ultra-low-background HPGe gamma spectrometry. As a result of the purification procedure the radioactive contamination of gadolinium oxide (a similar purification efficiency was reached also with cerium and neodymium oxides was decreased from 0.12 Bq/kg to 0.007 Bq/kg in 228Th, from 0.04 Bq/kg to <0.006 Bq/kg in 226Ra, and from 0.9 Bq/kg to 0.04 Bq/kg in 40K. The purification methods are much less efficient for chemically very similar radioactive elements like actinium, lanthanum and lutetium.

  10. The Technological Enhancement of Normally Occurring Radioactive Materials in Red Mud due to the Production of Alumina

    Directory of Open Access Journals (Sweden)

    Maurice O. Miller


    Full Text Available This study investigates the level of technological enhancement of normally occurring radioactive materials (TENORM in the red mud waste due to the production of alumina in Jamaica. Technological enhancements factors (TEF were determined for the uranium, thorium, actinium series, their progenies, and the nonseries potassium-40 using gamma spectrometry. The study concluded that bauxite production technologically enhances the uranium progenies Th-234, Pb-214, Bi-214, and Pa-234 and the thorium-232 progenies Ac-228, Pb-212, and Bi-212 in red mud. The actinium series was technologically enhanced, but K-40 and the thorium daughter, Tl-208, were reduced. The spectrometric comparison of Tl-208 (at 510 keV was unexpected since its other photopeaks at 583 keV, 934 keV, and 968 keV were markedly different. An explanation for this anomaly is discussed. An explanation regarding the process of accumulation and fractionation of organically derived phosphate deposits and potassium-feldspar is offered to explain the spectrometric differences between the alumina product and its waste material, red mud.

  11. Low background counting of 222Rn, 220Rn and 219Rn with electrostatic counters (United States)

    Mong, Brian; EXO-200 Collaboration; nEXO Collaboration


    The radon counting technique based on electrostatic precipitation of progenies in gas followed by alpha spectroscopy has been applied to support the material selection programs of low background, neutrino and dark matter experiments with emphasis on EXO. An array of 8 counters operated by Laurentian University at SNOLAB and the Waste Isolation Pilot Plant have reached the sensitivity of 10 atoms/day in the uranium, thorium and actinium chains. Hardware improvements are underway to further increase the capacity and sensitivity in support of nEXO. The radon counting technique based on electrostatic precipitation of progenies in gas followed by alpha spectroscopy has been applied to support the material selection programs of low background, neutrino and dark matter experiments with emphasis on EXO. An array of 8 counters operated by Laurentian University at SNOLAB and the Waste Isolation Pilot Plant have reached the sensitivity of 10 atoms/day in the uranium, thorium and actinium chains. Hardware improvements are underway to further increase the capacity and sensitivity in support of nEXO. Supported by NSERC Project Grants ``Search for Double Beta Decay with EXO.''

  12. Purification of cerium, neodymium and gadolinium for low background experiments (United States)

    Boiko, R. S.; Barabash, A. S.; Belli, P.; Bernabei, R.; Cappella, F.; Cerulli, R.; Danevich, F. A.; Incicchitti, A.; Laubenstein, M.; Mokina, V. M.; Nisi, S.; Poda, D. V.; Polischuk, O. G.; Tretyak, V. I.


    Cerium, neodymium and gadolinium contain double beta active isotopes. The most interesting are 150Nd and 160Gd (promising for 0ν2β search), 136Ce (2β+ candidate with one of the highest Q2β). The main problem of compounds containing lanthanide elements is their high radioactive contamination by uranium, radium, actinium and thorium. The new generation 2β experiments require development of methods for a deep purification of lanthanides from the radioactive elements. A combination of physical and chemical methods was applied to purify cerium, neodymium and gadolinium. Liquid-liquid extraction technique was used to remove traces of Th and U from neodymium, gadolinium and for purification of cerium from Th, U, Ra and K. Co-precipitation and recrystallization methods were utilized for further reduction of the impurities. The radioactive contamination of the samples before and after the purification was tested by using ultra-low-background HPGe gamma spectrometry. As a result of the purification procedure the radioactive contamination of gadolinium oxide (a similar purification efficiency was reached also with cerium and neodymium oxides) was decreased from 0.12 Bq/kg to 0.007 Bq/kg in 228Th, from 0.04 Bq/kg to <0.006 Bq/kg in 226Ra, and from 0.9 Bq/kg to 0.04 Bq/kg in 40K. The purification methods are much less efficient for chemically very similar radioactive elements like actinium, lanthanum and lutetium.

  13. Ixodes scapularis saliva mitigates inflammatory cytokine secretion during Anaplasma phagocytophilum stimulation of immune cells

    Czech Academy of Sciences Publication Activity Database

    Chen, G.; Severo, M. S.; Sohail, M.; Sakhon, O. S.; Wikel, S. K.; Kotsyfakis, Michalis; Pedra, J. H. F.


    Roč. 5, č. 1 (2012), s. 229. ISSN 1756-3305 Institutional support: RVO:60077344 Keywords : Tick * Ixodes scapularis * Saliva * Anaplasma phagocytophilum * Rickettsial agent Subject RIV: EC - Immunology Impact factor: 3.246, year: 2012

  14. Socio-economic status of Dog owners in Nagpur city of Maharashtra

    Directory of Open Access Journals (Sweden)

    A.D. Sawaimul


    Full Text Available The survey was carried out to study socioeconomic status of 50 dog owners in Nagpur of Maharashtra.The result revealed the businessmen (38% are more interested in dog keeping followed by government servants (16% and student (12%. [Vet World 2009; 2(6.000: 229-229

  15. 8 CFR 233.6 - Aliens entering Guam or the Commonwealth of the Northern Mariana Islands pursuant to Title VII of... (United States)


    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Aliens entering Guam or the Commonwealth of the Northern Mariana Islands pursuant to Title VII of Public Law 110-229, âConsolidated Natural... of the Northern Mariana Islands pursuant to Title VII of Public Law 110-229, “Consolidated...

  16. The Business of Politics Commerce, and Culture in East Asia

    DEFF Research Database (Denmark)

    Ooi, Can-Seng


    Review of: "Cultural Policies in East Asia: Dynamics Between the State, Arts and Creative Industries". Edited by Hye-Kyung Lee and Lorraine Lim. Basingstoke: Palgrave, Macmillan, 2014. 229 pp.......Review of: "Cultural Policies in East Asia: Dynamics Between the State, Arts and Creative Industries". Edited by Hye-Kyung Lee and Lorraine Lim. Basingstoke: Palgrave, Macmillan, 2014. 229 pp....

  17. AcEST: BP919015 [AcEST

    Lifescience Database Archive (English)


  18. Integrated interpretation of geophysical and geological data: Tectonic implications. Tectonic pattern of the intraplate deformation area

    Digital Repository Service at National Institute of Oceanography (India)

    Neprochnov, Y.P; Rao, D.G.; Buravtsev, A.A.; Levchenko, O.V; Murthy, K.S.R

    stream_size 4 stream_content_type text/plain stream_name Mem_Geol_Soc_India_1998_39_229.pdf.txt stream_source_info Mem_Geol_Soc_India_1998_39_229.pdf.txt Content-Encoding ISO-8859-1 Content-Type text/plain; charset=ISO-8859-1 ...

  19. 76 FR 7627 - Petition for Waiver of Compliance (United States)


    ... Federal Railroad Administration Petition for Waiver of Compliance In accordance with part 211 of Title 49...) received a request for a waiver of compliance with certain requirements of its safety standards. The... by the Railroad Locomotive Safety Standards per 49 CFR 229.27 Annual tests and Sec. 229.29...

  20. Selvoplevet og sand, men mest det første

    DEFF Research Database (Denmark)

    Haarder, Jon Helt


    Lars Saabye Christensen: SAABYES CIRKUS (Oversat fra norsk af Karsten Sand Iversen) 224 sider, 229 kr. Athene UDKOMMER I DAG Udgivelsesdato: 14.09......Lars Saabye Christensen: SAABYES CIRKUS (Oversat fra norsk af Karsten Sand Iversen) 224 sider, 229 kr. Athene UDKOMMER I DAG Udgivelsesdato: 14.09...

  1. Determination of the extraction efficiency for $^{233}$U source $\\alpha$-recoil ions from the MLL buffer-gas stopping cell

    CERN Document Server

    von der Wense, Lars; Laatiaoui, Mustapha; Thirolf, Peter G


    Following the $\\alpha$ decay of $^{233}$U, $^{229}$Th recoil ions are shown to be extracted in a significant amount from the MLL buffer-gas stopping cell. The produced recoil ions and subsequent daughter nuclei are mass purified with the help of a customized quadrupole mass spectrometer. The combined extraction and mass-purification efficiency for $^{229}$Th$^{3+}$ is determined via MCP-based measurements and via the direct detection of the $^{229}$Th $\\alpha$ decay. A large value of $(10\\pm2)$\\% for the combined extraction and mass-purification efficiency of $^{229}$Th$^{3+}$ is obtained at a mass resolution of about 1 u/e. In addition to $^{229}$Th, also other $\\alpha$-recoil ions of the $^{233,232}$U decay chains are addressed.

  2. 14C assimilate distribution and accumulation of hybrid spring wheat during fore-anthesis

    International Nuclear Information System (INIS)

    14C assimilate distribution and accumulation at fore-anthesis in various organs of hybrid spring wheat 901 and its parent Sh an 229 were studied by using 14C tracer techniques. The results showed that from fore-anthesis stage to filling stage, 14C assimilate distribution rate in leaves and sheath decreased by 23.1% and 7.8% respectively for 901, and decreased by 32.1% and 7.7% respectively for Sh an 229. 14C assimilate distribution rate in stems increased by 7.3% and 22.0% for 901 and Sh an 229 respectively. There was a certain accumulation of 14C assimilate at ear shell in both cultivars. From fore-anthesis stage to maturing stage the distribution rate in ear shell raised 12.2% for 901, and 8.7% for Shan 229. 14C assimilate distribution rate in flag leaf in both cultivars gradually reduced within 21 days after anthesis. There was a peak in radioactivity in flag leaf for 901 after 35 days of anthesis. The filling of Shan 229 was faster than that of 901. The radioactivity of 14C assimilate in grain for Shan 229 was higher than that of 901.4.5% of 14C assimilates labelled at fore -anthesis transported to seeds for 901, and 11.1% for Shan 229

  3. Production of soluble truncated spike protein of porcine epidemic diarrhea virus from inclusion bodies of Escherichia coli through refolding. (United States)

    Piao, Da-Chuan; Lee, Yoon-Seok; Bok, Jin-Duck; Cho, Chong-Su; Hong, Zhong-Shan; Kang, Sang-Kee; Choi, Yun-Jaie


    The emergence of highly pathogenic variant porcine epidemic diarrhea virus (PEDV) strains, from 2013 to 2014, in North American and Asian countries have greatly threatened global swine industry. Therefore, development of effective vaccines against PEDV variant strains is urgently needed. Recently, it has been reported that the N-terminal domain (NTD) of S1 domain of PEDV spike protein is responsible for binding to the 5-N-acetylneuraminic acid (Neu5Ac), a possible sugar co-receptor. Therefore, the NTD of S1 domain could be an attractive target for the development of subunit vaccines. In this study, the NTD spanning amino acid residues 25-229 (S25-229) of S1 domain of PEDV variant strain was expressed in Escherichia coli BL21 (DE3) in the form of inclusion bodies (IBs). S25-229 IBs were solubilized in 20 mM sodium acetate (pH 4.5) buffer containing 8 M urea and 1 mM dithiothreitol with 95% yield. Solubilized S25-229 IBs were refolded by 10-fold flash dilution and purified by one-step cation exchange chromatography with >95% purity and 20% yield. The CD spectrum of S25-229 showed the characteristic pattern of alpha helical structure. In an indirect ELISA, purified S25-229 showed strong reactivity with mouse anti-PEDV sera. In addition, immunization of mice with 20 μg of purified S25-229 elicited highly potent serum IgG titers. Finally, mouse antisera against S25-229 showed immune reactivity with native PEDV S protein in an immunofluorescence assay. These results suggest that purified S25-229 may have potential to be used as a subunit vaccine against PEDV variant strains. PMID:27260969

  4. Purification system of gram-amount neptunium using anion exchange chromatography

    International Nuclear Information System (INIS)

    To develop a purification system of gram-amount neptunium using anion exchange chromatography, adsorption elution of excess amount of actinium in 6M HNO3 aqueous solution was studied using thorium and uranium tracer. The partition coefficient (Kd) of Th (IV) decreased from Kd=99.1 of tracer to Kd=44.0, 5% load. By decreasing the partition coefficient, we can wash until 30 Vs under the purification conditions of 1% load and 95% recovery. The retention volume of U (IV) was about 300 Vs, a large value. The partition coefficient of Np (IV) may be larger than it and the large amount of washable eluting solution may be obtained. Washing of impurity of 3d transition metal and actinide (VI) can be done until 20Vs. With washing of 150Vs, impurity of alkali earth metal, metals (III) and platinum group metals decreased less than 0.1%. (S.Y.)

  5. A francium-223 reservoir source

    International Nuclear Information System (INIS)

    By improving and accelerating a method which had been earlier tried for caesium-rubidium separation on a cellulose column, i.e. elution with 2N HCl-equilibrated phenol, the author succeeded in obtaining consecutive and quasi-selective elutions of francium-223, starting with actinium-227 fixed at the top of a small cellulose column to which ZrO2 had been added. The francium-223, rapidly eluted under pressure, is extracted by water while the phenol is extracted by ether; it can easily be cleared of any residual traces of radioactive contaminants (thallium-207, radium-223, thorium-227) by two consecutive BaSO4 precipitations. The preparation of a Fr223 solution (HCl-H2SO4) requires approximately 20 min; the time noted for Fr223 was closer to 22 than to 21 min. (author)

  6. Radionuclide interactions with marine sediments

    International Nuclear Information System (INIS)

    A critical review of the literature on the subject of the interactions of radionuclides with marine sediments has been carried out. On the basis of the information available, an attempt has been made to give ranges and 'best estimates' for the distribution ratios between seawater and sediments. These estimates have been based on an understanding of the sediment seawater system and the porewater chemistry and mineralogy. Field measurements, laboratory measurements and estimates based on stable-element geochemical data are all taken into account. Laboratory measurements include distribution-ratio and diffusion-coefficient determinations. The elements reviewed are carbon, chlorine, calcium, nickel, selenium, strontium, zirconium, niobium, technetium, tin, iodine, caesium, lead, radium, actinium, thorium, protactinium, uranium, neptunium, plutonium, americium and curium. (author)

  7. Formerly utilized MED/AEC sites Remedial Action Program. Radiological survey of the St. Louis Airport Storage Site, St. Louis, Missouri. Final report

    International Nuclear Information System (INIS)

    Results of two radiological surveys of the St. Louis-Lambert Airport property, formerly known as the Airport Storage Site, St. Louis, Missouri, are presented. Uranium- and radium-bearing waste materials were stored from the 1940's to the late 1960's in this area. The surveys included direct measurements of beta-gamma radiation; determination of uranium, actinium, and radium concentrations in soil samples and from bore holes; determination of radionuclide concentrations in groundwater and surface water; measurement of radon flux from the ground surface; and measurements of 222Rn in air near the site. Results indicate that some offsite drainage pathways are becoming contaminated, probably by runoff from the site; no migration of 222Rn from the site was observed

  8. JAEA thermodynamic database for performance assessment of geological disposal of high-level and TRU wastes. Refinement of thermodynamic data for trivalent actinoids and samarium

    International Nuclear Information System (INIS)

    Within the scope of the JAEA thermodynamic database project for performance assessment of geological disposal of high-level radioactive and TRU wastes, the refinement of the thermodynamic data for the inorganic compounds and complexes of trivalent actinoids (actinium(III), plutonium(III), americium(III) and curium(III)) and samarium(III) was carried out. Refinement of thermodynamic data for these elements was based on the thermodynamic database for americium published by the Nuclear Energy Agency in the Organisation for Economic Co-operation and Development (OECD/NEA). Based on the similarity of chemical properties among trivalent actinoids and samarium, complementary thermodynamic data for their species expected under the geological disposal conditions were selected to complete the thermodynamic data set for the performance assessment of geological disposal of radioactive wastes. (author)

  9. Theoretical Study on Properties of New Isotope 265Bh

    Institute of Scientific and Technical Information of China (English)


    The properties of nuclei belonging to the newly observed α-decay chain starting from 265Bh have been studied. The axially deformed relativistic mean-field calculation with the force NL-Z2 has been performed in the blockedBCS approximation. Some ground state properties such as binding energies, deformations, spins, and parities, as well as Q-values of the α-decay for this decay chain have been calculated and compared with known experimental data. Good agreement is found. The single-particle spectrum of the nucleus 265 Bh is studied and some new magic numbers are found,while the magnitudes of the shell gaps in superheavy nuclei are much smaller than those of nuclei before the actinium region, and the Fermi surfaces are close to the continuum. Thus the superheavy nuclei are usually not stable. The The methods which give good agreement with the data are selected.

  10. Proposed training program for construction personnel involved in remedial action work at sites contaminated by naturally occurring radionuclides

    International Nuclear Information System (INIS)

    Many sites used during the early days of the US atomic energy program are contaminated with radionuclides of the primordial decay chains (uranium, thorium, and actinium series). This contamination consists of residues resulting from refining and processing uranium and thorium. Preparation of these sites for release to unrestricted private use will involve the assistance of construction workers, many of whom have limited knowledge of the hazards associated with radioactive materials. Therefore, there is a need to educate these workers in the fundamentals of radioactive material handling to minimize exposures and possible spread of contamination. This training should disseminate relevant information at an appropriate educational level and should instill a cautious, common-sense attitude toward the handling of radioactive materials. The training should emphasize basic information concerning environmental radiation within a context of relative risk. A multi-media format, including colorful visual aids, demonstration, and discussion, should be used to maximize motivation and retention. A detailed, proposed training program design is presented

  11. Dicty_cDB: Contig-U06090-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Strand = Plus / Plus Query: 38 cgttggntatctntacnccccnancaatgnaaaccaatntccatcaactgnanccgnana 97 |||||||||||||...||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 38 cgttggntatctntacnccccnancaatgnaaaccaatntccatcaactg...Plus / Plus Query: 38 cgttggntatctntacnccccnancaatgnaaaccaatntccatcaactgnanccgnan...) = 2e-79 Identities = 287/287 (100%) Strand = Plus / Minus Query: 38 cgttggntatctntacnccccna...||||| Sbjct: 288 cgttggntatctntacnccccnancaatgnaaaccaatntccatcaactgnanccgnana 229 Query: 98 ncaagnaatntcanac

  12. O przyczynach braku wyobrażeń miłości fizycznej w literaturze górnołużyckiej i kaszubskiej

    Czech Academy of Sciences Publication Activity Database

    Derlatka, Tomasz


    Roč. 161, č. 1 (2015), s. 221-229. ISSN 0137-1150 Institutional support: RVO:68378017 Keywords : Cassubian literature * Upper Lusatian literature * sexuality in literature Subject RIV: AJ - Letters, Mass-media, Audiovision

  13. Konzervace středověkého nože ze Senic

    Czech Academy of Sciences Publication Activity Database

    Hošek, Jiří; Šilhová, Alena


    Roč. 37, - (2004), s. 229-236. ISSN 0231-5769 Institutional research plan: CEZ:AV0Z8002910 Keywords : archaeometallurgy * knife * Middle Age * conservation science Subject RIV: AC - Archeology, Anthropology, Ethnology

  14. How Context Matters? Mobilization, Political Opportunity Structures and Non-Electoral Political Participation in Old and New Democracies

    Czech Academy of Sciences Publication Activity Database

    Vráblíková, Kateřina


    Roč. 47, č. 2 (2014), s. 203-229. ISSN 0010-4140 Institutional support: RVO:68378025 Keywords : Political participation * political opportunity structure * national institutions Subject RIV: AO - Sociology , Demography Impact factor: 2.028, year: 2014

  15. Experiment list: ERX149408 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available o sapiens || Sex=male || ClinicalHistory=cause of death: trauma || BMI=22.9kg_per_m2 || ClinicalInformation:... Premortem diagnosis of diabetes=No || Age=38 year || ClinicalInformation: Premor

  16. 47 CFR 24.833 - Post-auction divestitures. (United States)


    ....229(c) of this chapter) will be permitted to divest sufficient properties within 90 days of the... properties will be divested within 90 days of the license grant. If the licensee is otherwise qualified,...

  17. 77 FR 68147 - Gulf of Mexico, Outer Continental Shelf (OCS), Western Planning Area (WPA), Oil and Gas Lease... (United States)


    ...: Notice of Availability (NOA) of a Record of Decision (ROD) for WPA Lease Sale 229 in the Gulf of Mexico... (Multisale FEIS). Authority: This NOA is published pursuant to the regulations (40 CFR 1506) implementing...

  18. Effects of urban sprawl on sediment, surface water, and biota in the little Blackwater River, Blackwater National Wildlife Refuge, Dorchester County, Maryland (United States)

    US Fish and Wildlife Service, Department of the Interior — The Little Blackwater River drains a catchment area of approximately 11,229 hectares (27,748 acres). About 516 hectares (1,276 acres) in this watershed are...

  19. Material effect in the nuclear fuel-coolant interaction: Analyses of prototypic melt fragmentation and solidification in the KROTOS facility

    Czech Academy of Sciences Publication Activity Database

    Tyrpekl, V.; Piluso, P.; Bakardjieva, Snejana; Dugne, O.


    Roč. 186, č. 2 (2014), s. 229-240. ISSN 0029-5450 Institutional support: RVO:61388980 Keywords : fuel-coolant interaction * melt fragmentation * KROTOS facility Subject RIV: CA - Inorganic Chemistry Impact factor: 0.725, year: 2014

  20. Explaining Differences in Subjective Well-Being Across 33 Nations Using Multilevel Models: Universal Personality, Cultural Relativity, and National Income

    Czech Academy of Sciences Publication Activity Database

    Cheng, C.; Cheung, M. W.-L.; Montasem, A.; Awang-Hashim, R.; Bačová, V.; Baumane, I.; Chan, R.; Christou, M.; Chun, W. Y.; Clemena, R. M.; Comunian, A.L.; Czapinski, J.; Dayan, N.; Loving, R.D.; Duarte-Silva, M. E.; Falzon, A.; Falzon, R.; Gan, Y.; Golden, D. L.; de Zavala Golec, A.; Guil-Bozal, A.; Hadiyono, J. E. P.; Hadjar, A.; Hertel, J.; Ines Alcalay, S. L.; Jose, P. E.; Dzuka, J.; Kafetsios, K.; Lawal, O. A.; Liu, J.-T.; Neto, F.; Opre, A.; Panayiotou, A.; Raudsepp, M.; Roth, R.; Sheldon, K. M.; Sideridis, G.; Šolcová, Iva; Spyrou, S.; Suhail, K.; Tam, W.-Ch. C.; Tanti-Burlo, E.; Tao, V. Y.; Tonon, G.; Tiliouine, H.; Tsaousis, I.; Uglanova, E.


    Roč. 84, č. 1 (2016), s. 46-58. ISSN 0022-3506 Institutional support: RVO:68081740 Keywords : life satisfaction * self - esteem * individualism * collectivism * happiness * extroversion Subject RIV: AN - Psychology Impact factor: 3.229, year: 2014

  1. Tra Albania e Italia: storie solide e confini liquidi

    Directory of Open Access Journals (Sweden)

    Lorenzo Mari


    Full Text Available Recensione di: Emma Bond e Daniele Comberiati (a cura di, Il confine liquido. Rapporti interculturali fra Italia e Albania, Nardò, Besa, 2013, 229 p., ISBN: 9788849708950, € 18,00.

  2. FORCASCOMB: MATLAB function to combine forecasts of various models


    Shapour Mohammadi


    The code combines forecasts of various models based on minimization variance of combined forecast. This algorithm uses a logic similar to portfolio optimization. In Hendry and Clements(1998, p. 229) this method titled as Variance-Covariance method.

  3. Protectants used in the cryopreservation of microorganisms

    Czech Academy of Sciences Publication Activity Database

    Hubálek, Zdeněk


    Roč. 46, č. 3 (2003), s. 205-229. ISSN 0011-2240 Institutional research plan: CEZ:AV0Z6093917 Keywords : cryopreservation * cryoprotectants Subject RIV: EE - Microbiology, Virology Impact factor: 1.445, year: 2003

  4. Die Kunstkammer Rudolfs II. - Entstehung, Niedergang, Wiederentdeckung

    Czech Academy of Sciences Publication Activity Database

    Bukovinská, Beket

    Wien: Holzhausen, 2015 - (Haag, S.; Kirchweger, F.; Rainer, P.), s. 229-253. (Schriften des Kunsthistorischen Museums. 15). ISBN 978-3-902976-65-9 Institutional support: RVO:68378033 Keywords : Rudolf II * kunstkammer Subject RIV: AL - Art, Architecture, Cultural Heritage

  5. Nuclear physics: Elusive transition spotted in thorium (United States)

    Safronova, Marianna


    The highly precise atomic clocks used in science and technology are based on electronic transitions in atoms. The discovery of a nuclear transition in thorium-229 raises hopes of making nuclear clocks a reality. See Article p.47

  6. Immunophenotyping of hematopoietic progenitor cells: Comparison between cord blood and adult mobilized blood grafts



    AIM: To study the immunophenotype of hematopoietic progenitor cells from cord blood (CB) grafts (n = 39) in comparison with adult apheresis grafts (AG, n = 229) and pre-apheresis peripheral blood (PAPB) samples (n = 908) using flow cytometry analysis.

  7. Immune development of lymphoid tissue in the gut of young piglets

    Czech Academy of Sciences Publication Activity Database

    Haverson, K.; Šinkora, Jiří; Bailey, M.

    Uppsala: International Union of Immunological Societies, 2001. s. 229. [International Veterinary Immunology Symposium /6./. 15.07.2001-20.07.2001, Uppsala] Institutional research plan: CEZ:AV0Z5020903 Subject RIV: EC - Immunology

  8. Městečko Rajhrad v letech 1848-1918: Spolkový a společenský život

    Czech Academy of Sciences Publication Activity Database

    Altman, Karel

    1. Rajhrad: Město Rajhrad, 2014, s. 197-229. ISBN 978-80-260-5803-8 Institutional support: RVO:68378076 Keywords : town * Rajhrad * 1848-1918 * social life * fellowship Subject RIV: AC - Archeology, Anthropology, Ethnology

  9. Beyond a one-man show: The prelude of Revisionist Zionism, 1922-25

    Czech Academy of Sciences Publication Activity Database

    Zouplna, Jan


    Roč. 19, č. 3 (2013), s. 410-432. ISSN 1353-7121 Institutional support: RVO:68378009 Keywords : interwar Zionism * Israel i right * Russian-Jewish intelligentsia Subject RIV: AB - History Impact factor: 0.229, year: 2013

  10. Mathematical Language as a Bridge between Conceptualization of Motion and Experimental Practice

    Czech Academy of Sciences Publication Activity Database

    Kvasz, Ladislav

    Dordrecht: Springer, 2015 - (Pisano, R.), s. 229-248. (History of Mechanism and Machine Science. 27). ISBN 978-94-017-9644-6 Institutional support: RVO:67985955 Keywords : Galileo * Descartes * Newton * force * interaction * experimental practice Subject RIV: AA - Philosophy ; Religion

  11. Fish products and their trade in Tauric Chersonesos/Byzantine Cherson: the development of a traditional craft from Antiquity to the Middle Ages

    Czech Academy of Sciences Publication Activity Database

    Čechová, Martina


    Roč. 17, č. 1 (2014), s. 229-236. ISBN 978-2-87772-579-8. ISSN 2101-2849 Institutional support: RVO:68378017 Keywords : Tauric Chersonesos * fish products Subject RIV: AC - Archeology, Anthropology, Ethnology

  12. 32 CFR 516.22 - Miscellaneous reporting requirements. (United States)


    ... AUTHORITIES AND PUBLIC RELATIONS LITIGATION Reporting Legal Proceedings to HQDA § 516.22 Miscellaneous... transactions. (FAR and DFARS, 48 CFR parts 29 and 229). (2) Army and Air Force Exchange Service...

  13. Origin of elements of the Uranium-235 family observed in the Ellez river near the EL-4 experimental nuclear reactor in dismantling (Monts d'Arree- Finistere department); Origine des elements de la famille de l'uranium-235 observes dans la riviere Ellez a proximite du reacteur nucleaire experimental EL4 en cours de demantelement (Mont d'Arree - departement du Finistere). Resultats et premiers constats annee 2006

    Energy Technology Data Exchange (ETDEWEB)



    In a previous study which concerned the catchment basin of the harbour of Brest, the A.C.R.O. put in evidence a marking by artificial radioelements around the power plant of Brennilis which can be imputed without ambiguities to the nuclear installation. It also put in evidence abnormalities concerning the natural radioactivity which justifies this new study. In the area of the Monts d'Arree, actinium 227 ({sup 227}Ac), non born by its ascendents which are {sup 235}U and {sup 231}Pa is observed. This phenomenon is characterized by mass activities superior to these ones of {sup 235}U and able to reach these ones of {sup 238}U. Its presence corresponds with the drainage of the Ellez river since the former channel of radioactive effluents releases from the nuclear power plant EL-4 up to the reservoir Saint-Herblot situated 6 km downstream. The strongest values of radioactivity are registered near the disused power plant, at this place a relationship exists between the level of actinium 227 and this one of the artificial radioactivity as it exists a relationship with the decay products of radon exhaled from the subsoil ({sup 210}Pb). But its presence is not limited to a part of the Ellez river, it is equally observed in terrestrial medium, in places in priori not influenced by the direct liquid effluents of the power plant. This place is situated at more than 4 km and without any connection with the Ellez waters. At this stage of the study, it is not possible to answer with certainty the question of the origin of this phenomenon. A new reorientation is considered indispensable to clarify definitively the origin of this unknown phenomenon in the scientific publications and the environmental monitoring. (N.C.)

  14. origin of elements of the Uranium-235 family observed in the Ellez river near the EL-4 experimental nuclear reactor in dismantling (Monts d'Arree- Finistere department)

    International Nuclear Information System (INIS)

    In a previous study which concerned the catchment basin of the harbour of Brest, the A.C.R.O. put in evidence a marking by artificial radioelements around the power plant of Brennilis which can be imputed without ambiguities to the nuclear installation. It also put in evidence abnormalities concerning the natural radioactivity which justifies this new study. In the area of the Monts d'Arree, actinium 227 (227Ac), non born by its ascendents which are 235U and 231Pa is observed. This phenomenon is characterized by mass activities superior to these ones of 235U and able to reach these ones of 238U. Its presence corresponds with the drainage of the Ellez river since the former channel of radioactive effluents releases from the nuclear power plant EL-4 up to the reservoir Saint-Herblot situated 6 km downstream. The strongest values of radioactivity are registered near the disused power plant, at this place a relationship exists between the level of actinium 227 and this one of the artificial radioactivity as it exists a relationship with the decay products of radon exhaled from the subsoil (210Pb). But its presence is not limited to a part of the Ellez river, it is equally observed in terrestrial medium, in places in priori not influenced by the direct liquid effluents of the power plant. This place is situated at more than 4 km and without any connection with the Ellez waters. At this stage of the study, it is not possible to answer with certainty the question of the origin of this phenomenon. A new reorientation is considered indispensable to clarify definitively the origin of this unknown phenomenon in the scientific publications and the environmental monitoring. (N.C.)

  15. Physical Measurements and Clinical Findings of Persons with Radium Burdens

    International Nuclear Information System (INIS)

    Results of physical measurements and some clinical findings of persons with radium burdens are reported and discussed. Ten workers of the dial painting industry, two chemists, who have been working for between 10 and 20 yr in the radium- industry, one technician, who has been- working for over 20 yr with high-emanation radium preparations and one person with high radium intake of rather unknown history were measured in a whole-body counter for evaluation of the body burdens of radium-226 and radium-228+ actinium-228. In some cases the radon concentration of expired air was also measured. For four of the measured persons the radium-226 burden is of the order of the maximum permissible amount (MPA : 10-7 c) or more. In one case the burden amounts to more than three times the MPA, (3.4 x 10-7 c), in another case to more than 100 times the MPA (160 x 10-7 c). In one case the radium-228 + actinium-228 burden exceeds the MPA (6 x 10-8 c in bone). The measured radon concentrations in the expired air were used to calculate the excretion rate of radon. The average was 67%. Clinical findings with some of the measured persons are related to the measured body burdens. The patient with the high body burden of 160 x 10-7 c radium-226 shows heavy bone changes leading to spontaneous bone fractures. The blood picture shows a decrease in the number of erythrocytes and a low haemoglobin content but puncture of the sternum indicates normal haematopoiesis. It seems that the low number of erythrocytes is caused by chronic nephropathia, the reason for which might be an additional intake of uranium because.uranium was found in the urine by gamma spectroscopy. The results are discussed with respect to the MPA of radium-226 recommended by the International Commission on Radiological Protection. (author)

  16. Preliminary experiment and analysis of supersonic inlet buzz


    Hongprapas, Sorarat


    The inlet buzz phenomenon was investigated experimentally and analytically. An external-compression axisymmetric inlet model, having 74 mm in cowl lip diameter, was tested in the 229x229 sq mm blowdown wind tunnel at Mach 2.4. The test facility has shown potential for the supersonic inlet research. The occurrence of inlet buzz was indicated by the continuous shock oscillation and the static pressure fluctuation. The hypothesis based on internal pressure measurement and shadowgr...

  17. Draft Genome Sequence of Xylella fastidiosa Pear Leaf Scorch Strain in Taiwan. (United States)

    Su, C-C; Deng, W-L; Jan, F-J; Chang, C-J; Huang, H; Chen, J


    The draft genome sequence of Xylella fastidiosa pear leaf scorch strain PLS229, isolated from the pear cultivar Hengshan (Pyrus pyrifolia) in Taiwan, is reported here. The bacterium has a genome size of 2,733,013 bp, with a G+C content of 53.1%. The PLS229 genome was annotated and has 3,259 open reading frames and 50 RNA genes. PMID:24652975

  18. 杂交小麦不同发育时期叶绿素蛋白复合体的变化%Change in chlorophyll-protein complexes of hybrid wheat in different developmental periods

    Institute of Scientific and Technical Information of China (English)

    李妮亚; 高培元; 等


    杂交小麦“901”在不同发育时期及不同叶位,叶片色素蛋白复合体含量均高于对照品种陕229,尤其表现在“901”的旗叶;而陕229的倒二叶在籽粒形成后期、灌浆期,略高于“901”。倒三叶在籽粒发育后期至成熟期“901”的含量要高于陕229。叶绿素蛋白复合体分析结果说明,在不同发育时期、不同叶位,“901”杂交小麦的捕光色素蛋白复合体含量均高于陕229,并且其捕光叶绿素a/b—蛋白复合体的cha/b值均低于陕229的相应复合体,表明“901”叶片色素蛋白复合体中含有较高的叶绿素b,尤其表现在籽粒形成后期的旗叶上。2个品种在不同发育时期,不同叶位之间,色素蛋白复合体组分上没有差异,仅表现在成熟期,陕229的倒三叶各色素带含量减少,并且消失1条叶绿素蛋白复合体带,初步认为此带是LHCP的寡聚体之一,而“901”比陕229晚7 d,倒二叶上表现出同样的现象,表明“901”叶片色素蛋白复合体抗衰老能力很强。%This study was showed that the amount of chlorophyll-protein complexes of hybrid wheat “901” was more than the contrast variety (Shaan 229) in the developmental period and leaves with different ages,especially flag leaf of hybrid wheat.However,the amount of chlorophyll-protein complexes of second leaf of Shaan 229 was more than the hybrid wheat at the late stage of grain filling period,however,third leaf of “901” was more than the Shaan 229 from the late stage of grain developmental to mature period.The amount of light harvesting chlorophyll-protein complexes (LHCP) of hybrid wheat was higher than Shaan 229 and chla/b ratio of hybrid wheat was lower than that of corresponding band of Shaan 229,it shown that the amount of chlorophyll b was higher than its contrast variety (Shaan 229),especially,flag leaf of “901”.There was no differences in the chl-protein complexes from hybrid wheat and

  19. Level structure studies of 182W from the decay of 182Ta

    International Nuclear Information System (INIS)

    The relative intensities of X rays and γ rays from the decay of 182Ta were measured precisely using Si(Li) and HPGe detectors. The intensities of the different components of K and L X rays were measured for the first time. The conversion electron intensities for the transitions with energy above 800 keV from the 182Ta decay were measured using a mini-orange electron spectrometer and the internal conversion coefficients for various transitions in 182W deduced. The (M+N)-conversion coefficients for the 1001.7, 1189.1, 1231.0, 1257.2, 1289.2, and 1342.7 keV transitions in 182W were measured for the first time. Also, γ-γ coincidence and correlation measurements were carried out using a HPGe-HPGe coincidence setup (2τ = 7 ns). The directional correlation coefficients for the 928-229, 960-229, 1002-229, 1158-229, 1223-229, and 1002, 1113, 1158, 1223, and 1231 keV transitions are deduced from the present directional correlation and conversion coefficient measurements. Experimental ratios of reduced transition probabilities for the transitions in 182W from positive and negative parity states are deduced and compared with the values predicted by the symmetric rotor model. From this comparison a unique K assignment of Kπ = 1+ and Kπ = 1- is made to the bands built on the 1257 and 1553 keV levels, respectively. (Author) 33 refs., 4 figs., 7 tabs

  20. Piperlongumine inhibits migration of glioblastoma cells via activation of ROS-dependent p38 and JNK signaling pathways. (United States)

    Liu, Qian Rong; Liu, Ju Mei; Chen, Yong; Xie, Xiao Qiang; Xiong, Xin Xin; Qiu, Xin Yao; Pan, Feng; Liu, Di; Yu, Shang Bin; Chen, Xiao Qian


    Piperlongumine (PL) is recently found to kill cancer cells selectively and effectively via targeting reactive oxygen species (ROS) responses. To further explore the therapeutic effects of PL in cancers, we investigated the role and mechanisms of PL in cancer cell migration. PL effectively inhibited the migration of human glioma (LN229 or U87 MG) cells but not normal astrocytes in the scratch-wound culture model. PL did not alter EdU(+)-cells and cdc2, cdc25c, or cyclin D1 expression in our model. PL increased ROS (measured by DCFH-DA), reduced glutathione, activated p38 and JNK, increased IκBα, and suppressed NFκB in LN229 cells after scratching. All the biological effects of PL in scratched LN229 cells were completely abolished by the antioxidant N-acetyl-L-cysteine (NAC). Pharmacological administration of specific p38 (SB203580) or JNK (SP600125) inhibitors significantly reduced the inhibitory effects of PL on LN229 cell migration and NF κ B activity in scratch-wound and/or transwell models. PL prevented the deformation of migrated LN229 cells while NAC, SB203580, or SP600125 reversed PL-induced morphological changes of migrated cells. These results suggest potential therapeutic effects of PL in the treatment and prevention of highly malignant tumors such as glioblastoma multiforme (GBM) in the brain by suppressing tumor invasion and metastasis. PMID:24967005

  1. Piperlongumine Inhibits Migration of Glioblastoma Cells via Activation of ROS-Dependent p38 and JNK Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Qian Rong Liu


    Full Text Available Piperlongumine (PL is recently found to kill cancer cells selectively and effectively via targeting reactive oxygen species (ROS responses. To further explore the therapeutic effects of PL in cancers, we investigated the role and mechanisms of PL in cancer cell migration. PL effectively inhibited the migration of human glioma (LN229 or U87 MG cells but not normal astrocytes in the scratch-wound culture model. PL did not alter EdU+-cells and cdc2, cdc25c, or cyclin D1 expression in our model. PL increased ROS (measured by DCFH-DA, reduced glutathione, activated p38 and JNK, increased IκBα, and suppressed NFκB in LN229 cells after scratching. All the biological effects of PL in scratched LN229 cells were completely abolished by the antioxidant N-acetyl-L-cysteine (NAC. Pharmacological administration of specific p38 (SB203580 or JNK (SP600125 inhibitors significantly reduced the inhibitory effects of PL on LN229 cell migration and NFκB activity in scratch-wound and/or transwell models. PL prevented the deformation of migrated LN229 cells while NAC, SB203580, or SP600125 reversed PL-induced morphological changes of migrated cells. These results suggest potential therapeutic effects of PL in the treatment and prevention of highly malignant tumors such as glioblastoma multiforme (GBM in the brain by suppressing tumor invasion and metastasis.

  2. Piperlongumine selectively kills glioblastoma multiforme cells via reactive oxygen species accumulation dependent JNK and p38 activation. (United States)

    Liu, Ju Mei; Pan, Feng; Li, Li; Liu, Qian Rong; Chen, Yong; Xiong, Xin Xin; Cheng, Kejun; Yu, Shang Bin; Shi, Zhi; Yu, Albert Cheung-Hoi; Chen, Xiao Qian


    Piperlongumine (PL), a natural alkaloid isolated from the long pepper, may have anti-cancer properties. It selectively targets and kills cancer cells but leaves normal cells intact. Here, we reported that PL selectively killed glioblastoma multiforme (GBM) cells via accumulating reactive oxygen species (ROS) to activate JNK and p38. PL at 20μM could induce severe cell death in three GBM cell lines (LN229, U87 and 8MG) but not astrocytes in cultures. PL elevated ROS prominently and reduced glutathione levels in LN229 and U87 cells. Antioxidant N-acetyl-L-cysteine (NAC) completely reversed PL-induced ROS accumulation and prevented cell death in LN229 and U87 cells. In LN229 and U87 cells, PL-treatment activated JNK and p38 but not Erk and Akt, in a dosage-dependent manner. These activations could be blocked by NAC pre-treatment. JNK and p38 specific inhibitors, SB203580 and SP600125 respectively, significantly blocked the cytotoxic effects of PL in LN229 and U87 cells. Our data first suggests that PL may have therapeutic potential for one of the most malignant and refractory tumors GBM. PMID:23796709

  3. The Growth Analysis in the Kernel Filling Process of K-Type Hybrid 901 and Its Parent Wheat

    Institute of Scientific and Technical Information of China (English)

    GONG Yue-hua; LIU Ying-zhou; GAO Jun-feng


    Using Matlab software, the grain filling process of hybrid wheat 901 and its parents was fitted by Richards equation W = A/(1 +Be-kt in order to study the characteristics of grain filling of the hybrid. The active grain growth period of the hybrid was 6 d longer than that of Shaan 229, and its final grain weight (43.7 g/1000 grains) was higher than that of Shaan229 (36.3 g/1 000 grains). N values of 901 and R205 were both less than 1, and their grain growth was faster in the early filling stage, while slower in the middle-late stage. N value of Shaan 229 was >1, and its growth was slower in the early stage and faster in the middle stage. The period of early stage of 901 was shorter and of middle-late stage was longer. The situation of Shaan 229 was totally reversed. For parents, the father plant R205 was similar to hybrid wheat 901, whereas its mother plant K3314A similar to Shaan 229. It has been found that Richards equation was more suitable for fitting the grain filling process of wheat than Logistic equation.

  4. Minor Actinide Burning in Thermal Reactors. A Report by the Working Party on Scientific Issues of Reactor Systems

    International Nuclear Information System (INIS)

    The actinides (or actinoids) are those elements in the periodic table from actinium upwards. Uranium (U) and plutonium (Pu) are two of the principal elements in nuclear fuel that could be classed as major actinides. The minor actinides are normally taken to be the triad of neptunium (Np), americium (Am) and curium (Cm). The combined masses of the remaining actinides (i.e. actinium, thorium, protactinium, berkelium, californium, einsteinium and fermium) are small enough to be regarded as very minor trace contaminants in nuclear fuel. Those elements above uranium in the periodic table are known collectively as the transuranics (TRUs). The operation of a nuclear reactor produces large quantities of irradiated fuel (sometimes referred to as spent fuel), which is either stored prior to eventual deep geological disposal or reprocessed to enable actinide recycling. A modern light water reactor (LWR) of 1 GWe capacity will typically discharge about 20-25 tonnes of irradiated fuel per year of operation. About 93-94% of the mass of uranium oxide irradiated fuel is comprised of uranium (mostly 238U), with about 4-5% fission products and ∼1% plutonium. About 0.1-0.2% of the mass is comprised of neptunium, americium and curium. These latter elements accumulate in nuclear fuel because of neutron captures, and they contribute significantly to decay heat loading and neutron output, as well as to the overall radio-toxic hazard of spent fuel. Although the total minor actinide mass is relatively small - approximately 20-25 kg per year from a 1 GWe LWR - it has a disproportionate impact on spent fuel disposal, and thus the longstanding interest in transmuting these actinides either by fission (to fission products) or neutron capture in order to reduce their impact on the back end of the fuel cycle. The combined masses of the trace actinides actinium, thorium, protactinium, berkelium and californium in irradiated LWR fuel are only about 2 parts per billion, which is far too low for

  5. Site-specific regulatory interaction between spinach leaf sucrose-phosphate synthase and 14-3-3 proteins (United States)

    Toroser, D.; Athwal, G. S.; Huber, S. C.; Davies, E. (Principal Investigator)


    We report an Mg2+-dependent interaction between spinach leaf sucrose-phosphate synthase (SPS) and endogenous 14-3-3 proteins, as evidenced by co-elution during gel filtration and co-immunoprecipitation. The content of 14-3-3s associated with an SPS immunoprecipitate was inversely related to activity, and was specifically reduced when tissue was pretreated with 5-aminoimidazole-4-carboxamide riboside, suggesting metabolite control in vivo. A synthetic phosphopeptide based on Ser-229 was shown by surface plasmon resonance to bind a recombinant plant 14-3-3, and addition of the phosphorylated SPS-229 peptide was found to stimulate the SPS activity of an SPS:14-3-3 complex. Taken together, the results suggest a regulatory interaction of 14-3-3 proteins with Ser-229 of SPS.

  6. New Ideas in the Theory of Extrasolar Giant Planets and Brown Dwarfs

    CERN Document Server

    Burrows, A; Lunine, J I; Marley, M S; Saumon, D S; Burrows, Adam


    We summarize and extend recent work on the theory of extrasolar giant planets (EGPs) and brown dwarfs, paying particular attention to Gliese 229 B, the albedos of EGPs, the compositions of substellar atmospheres, the connections with the giant planets in the solar system, cloud physics, and non-gray spectral synthesis. The role of condensates in altering the optical spectrum of Gliese 229 B is explored, as are the systematics of the reflection spectra from extrasolar giant planets near their primaries. In addition, we discuss the role of convection and disequilibrium chemistry in explaining the anomalous detection of CO in Gliese 229 B. Throughout, we highlight the distinctive chemistry that defines this new class of objects and set goals for future study.

  7. CXCR7 is induced by hypoxia and mediates glioma cell migration towards SDF-1α

    International Nuclear Information System (INIS)

    Glioblastomas, the most common and malignant brain tumors of the central nervous system, exhibit high invasive capacity, which hinders effective therapy. Therefore, intense efforts aimed at improved therapeutics are ongoing to delineate the molecular mechanisms governing glioma cell migration and invasion. In order to perform the studies, we employed optimal cell culture methods and hypoxic conditions, lentivirus-mediated knockdown of protein expression, Western Blot analysis, migration assays and immunoprecipitation. We determined statistical significance by unpaired t-test. In this report, we show that U87MG, LN229 and LN308 glioma cells express CXCR7 and that exposure to hypoxia upregulates CXCR7 protein expression in these cell lines. CXCR7-expressing U87MG, LN229 and LN308 glioma cells migrated towards stromal-derived factor (SDF)-1α/CXCL12 in hypoxic conditions in the Boyden chamber assays. While shRNA-mediated knockdown of CXCR7 expression did not affect the migration of any of the three cell lines in normoxic conditions, we observed a reduction in the migration of LN229 and LN308, but not U87MG, glioma cells towards SDF-1α in hypoxic conditions. In addition, knockdown of CXCR7 expression in LN229 and LN308 glioma cells decreased levels of SDF-1α-induced phosphorylation of ERK1/2 and Akt. Inhibiting CXCR4 in LN229 and LN308 glioma cells that were knocked down for CXCR7 did not further reduce migration towards SDF-1α in hypoxic conditions and did not affect the levels of phosphorylated ERK1/2 and Akt. Analysis of immunoprecipitated CXCR4 from LN229 and LN308 glioma cells revealed co-precipitated CXCR7. Taken together, our findings indicate that both CXCR4 and CXCR7 mediate glioma cell migration towards SDF-1α in hypoxic conditions and support the development of therapeutic agents targeting these receptors

  8. EST Table: FS787334 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FS787334 E_FL_fcaL_21B10_R_0 10/09/28 47 %/229 aa ref|XP_975194.1| PREDICTED: similar to something...l|GB19080-PA 10/09/10 47 %/229 aa gi|91081571|ref|XP_975194.1| PREDICTED: similar to something about silencing protein 10 [Tribolium castaneum] FS823506 fcaL ... ... about silencing protein 10 [Tribolium castaneum] gb|EFA01562.1| hypothetical protein TcasGA2...28 aa AGAP002960-PA Protein|2R:30130647:30132122:-1|gene:AGAP002960 10/09/10 41 %/235 aa gnl|Ame

  9. A comprehensive database of Duchenne and Becker muscular dystrophy patients in Children's Hospital of Fudan University

    Directory of Open Access Journals (Sweden)

    Xi-hua LI


    Full Text Available Background China is one of the countries that have the largest number of patients suffering from Duchenne and Becker muscular dystrophy (DMD/BMD. Although the building of international DMD/BMD databases has laid a foundation for clinical drug development and clinical trials, it has not yet been carried out in China. In this study, a modified registry form of Remudy was applied to 229 DMD/BMD patients in order to establish a comprehensive database, which will lay the groundwork for international cooperation.  Methods A total of 229 DMD/BMD patients diagnosed by genetic testing or muscle biopsy admitted in Children's Hospital of Fudan University (CHFU during the period of August 2011 to December 2013 were enrolled in this study. The data included sex, age, age at diagnosis, geographic distribution of patients, DMD gene mutation types, family history, walking capability, cardiac and respiratory function, steroid treatment and rehabilitation intervention.  Results There were 194 DMD and 35 BMD male patients who were diagnosed at the age of 0-18 years, and among them, most patients were diagnosed at the age of > 3-4 (16.59%, 38/229 and > 7-8 (14.85%, 34/229 years. Exon deletion was the most frequent genetic mutations for DMD/BMD [65.46% (127/194 and 74.29% (26/35], respectively. Patients with a family history accounted for 23.14% (53/229. The rate of DMD registrants losing walking capability was 17.53% (34/194, and all the BMD registrants were able to walk. Cardiac functions were examined in 46.29% (106/229 DMD/BMD boys and respiratory functions were examined in 17.90% (41/229 DMD/BMD boys. The proportion of DMD patients receiving prednisone with dosage of 0.75 mg/(kg·d was 26.29% (51/194.  Conclusions This database describes in detail the genotype, clinical manifestation, diagnosis and treatment and rehabilitation status of 229 DMD/BMD patients in China. The database not only provides comprehensive information for DMD/BMD patient management

  10. Charakterystyka stratyfikacji termicznej i chemicznej wód jeziora Ostrowite (PNBT) w roku 2015 = Features of the thermal and chemical stratification of the Ostrowite Lake water in the year 2015


    Gierszewski, Piotr; Miler, Karol; Kaszubski, Michał


    Gierszewski Piotr, Miler Karol, Kaszubski Michał. Charakterystyka stratyfikacji termicznej i chemicznej wód jeziora Ostrowite (PNBT) w roku 2015 = Features of the thermal and chemical stratification of the Ostrowite Lake water in the year 2015. Journal of Education, Health and Sport. 2015;5(12):217-229. ISSN 2391-8306. DOI ...

  11. Structure-Based Engineering of Methionine Residues in the Catalytic Cores of Alkaline Amylase from Alkalimonas amylolytica for Improved Oxidative Stability


    Yang, Haiquan; Liu, Long; Wang, Mingxing; Li, Jianghua; Wang, Nam Sun; Du, Guocheng; Chen, Jian


    This work aims to improve the oxidative stability of alkaline amylase from Alkalimonas amylolytica through structure-based site-directed mutagenesis. Based on an analysis of the tertiary structure, five methionines (Met 145, Met 214, Met 229, Met 247, and Met 317) were selected as the mutation sites and individually replaced with leucine. In the presence of 500 mM H2O2 at 35°C for 5 h, the wild-type enzyme and the M145L, M214L, M229L, M247L, and M317L mutants retained 10%, 28%, 46%, 28%, 72%,...

  12. Dicty_cDB: SHI818 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SH (Link to library) SHI818 (Link to dictyBase) - - - Contig-U16061-1 - (Link to Original site) ... xliilfy*kmtxfdavatxncsfsytchrrk**k*rntrkktkrn*r*k**ngs ... kskg*krndwidq*ktnlfkfsqkckn*q*kkniskfig*nkfkxn*y*k ... k--- Homology vs CSM-cDNA Score E Sequences producing s ignificant alignments: (bits) Value SHL229 (SHL229 ... 004.12.25 Homology vs DNA Score E Sequences producing s ignificant alignments: (bits) Value N CT583636 |CT ... 5. 2 Homology vs Protein Score E Sequences producing s ignificant alignments: (bits) Value BC122571_1( BC ...

  13. Is marital status associated with quality of life?


    Han, Kyu-Tae; Park, Eun-Cheol; Kim, Jae-Hyun; Kim, Sun Jung; Park, Sohee


    Background The divorce rate has been increasing rapidly in Korea; the single rate and trends in divorce are also changing rapidly. This study aimed to examine the relationship between marital status and quality of life (QOL) in an attempt to understand these changes. We also investigated the relationship between QOL and marital status by age group. Methods We used data from the Community Health Survey (2008: n = 200,800; 2009: n = 227,700; 2010: n = 229,229) administered by the Korean Centers...

  14. The relationship between stroke and quality of life in Korean adults: based on the 2010 Korean community health survey


    Kim, Ki-Jong; Heo, Myoung; Chun, In-Ae; Jun, Hyun-Ju; ,; Lee, Jin-Su; Jegal, Hyuk; Yang, Young-Sik


    [Purpose] The purpose of this study was to investigate the status of stroke in the Republic of Korea and its relationship with QOL based on standardized data. [Subjects and Methods] This study utilized raw data from the 2010 KCHS. In total, 229,229 individuals participated in the 2010 survey. The final analysis identified 4,604 individuals who had been diagnosed by a doctor with stroke. To identify the correlation between the aftereffect-related characteristics of stroke patients and QOL, a m...


    Energy Technology Data Exchange (ETDEWEB)



    The purpose of this study is to evaluate dissolved concentration limits (also referred to as solubility limits) of elements with radioactive isotopes under probable repository conditions, based on geochemical modeling calculations using geochemical modeling tools, thermodynamic databases, field measurements, and laboratory experiments. The scope of this modeling activity is to predict dissolved concentrations or solubility limits for 14 elements with radioactive isotopes (actinium, americium, carbon, cesium, iodine, lead, neptunium, plutonium, protactinium, radium, strontium, technetium, thorium, and uranium) important to calculated dose. Model outputs for uranium, plutonium, neptunium, thorium, americium, and protactinium are in the form of tabulated functions with pH and log (line integral) CO{sub 2} as independent variables, plus one or more uncertainty terms. The solubility limits for the remaining elements are either in the form of distributions or single values. The output data from this report are fundamental inputs for Total System Performance Assessment for the License Application (TSPA-LA) to determine the estimated release of these elements from waste packages and the engineered barrier system. Consistent modeling approaches and environmental conditions were used to develop solubility models for all of the actinides. These models cover broad ranges of environmental conditions so that they are applicable to both waste packages and the invert. Uncertainties from thermodynamic data, water chemistry, temperature variation, and activity coefficients have been quantified or otherwise addressed.

  16. Formerly utilized MED/AEC sites remedial action program. Radiological survey of the E. I. Du Pont de Nemours and Co. , Deepwater, New Jersey. Final report

    Energy Technology Data Exchange (ETDEWEB)



    The results of a radiological survey of the E. I. Du Pont Company, Deepwater, New Jersey, are presented in this report. During the 1940's this site was used for development of a process for the conversion of uranium oxide to produce uranium tetrafluoride and small quantities of uranium metal. The survey included measurements of the following: residual alpha and beta--gamma contamination levels, both fixed and transferable, in the one remaining uranium tetrafluoride operations building; external gamma radiation levels at 1 m above the surface inside this building and at outdoor locations where radioactive materials were handled; radon and radon daughter concentrations in the air in the operations building; uranium, radium, actinium, and thorium concentrations in soil and water on and near the site; and the airborne concentrations of uranium, thorium, and radium in the operations building. Elevated concentrations of uranium were found in residues from the operations building and in some surface and subsurface soil samples. Alpha and beta--gamma contamination levels in some areas of the operations building were above the limits of current federal guidelines set for the release of property for unrestricted use. 18 figures, 11 tables.

  17. Geological disposal: security and R and D. Security of 'second draft for R and D of geological disposal'

    International Nuclear Information System (INIS)

    The second draft for R and D of geological disposal (second draft) was arranged in 1999. The idea of security of geological disposal in the second draft is explained. The evaluation results of the uncertainty analysis and an example of evaluation of the effect of separation nuclear transmutation on the geological disposal are shown. The construction of strong engineered barrier is a basic idea of geological disposal system. Three processes such as isolation, engineering countermeasures and safety evaluation are carried out for the security of geological disposal. The security of geological environment for a long time of 12 sites in Japan was studied by data. Provability of production and enforcement of engineered barrier were confirmed by trial of over pack, tests and the present and future technologies developed. By using the conditions of reference case in the second draft, the evaluation results of dose effects in the two cases: 1) 90 to 99% Cs and Sr removed from HLW (High Level radioactive Waste) and 2) high stripping ratio of actinium series are explained. (S.Y.)

  18. Selective Decontamination Effect of Metal Ions in Soil Using Supercritical CO{sub 2} and TBP Complex

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jihye; Park, Kwangheon; Jung, Wonyoung [Kyunghee Univ., Yongin (Korea, Republic of)


    Decontamination of soil pollution is difficult because the type of contamination largely depends on the characteristics of the pollutant and the area. Also, existing soil decontamination methods generate large quantities of secondary waste and additional process costs. For this reason, new decontamination methods are always under active investigation. A method involving the use of supercritical carbon dioxide with excellent permeability in place of chemical solvents is currently being studied. Unlike other heavy metals in fission products, uranium is used as fuel, and must be handled carefully. Therefore, in this paper, we studied a supercritical carbon dioxide method for decontaminating heavy metal ions in soil using tri-n-butyl phosphate(TBP), which is well known as a ligand for the extraction of metal ions of actinium. We investigated the decontamination effect of heavy metal ions in the soil using TBP-HNO{sub 3} Complex and supercritical carbon dioxide. The study results showed that when heavy metals in soil are extracted using supercritical carbon dioxide, the extraction efficiency is different according to the type of pollutant metal ions in the soil. When TBP-HNO{sub 3} Complex is used with an extractant, uranium extraction is very effective, but lithium, strontium, and cesium extraction is not effective. Therefore, in the case of a mixture of uranium and other metals such as lithium, strontium, cesium, and so on in soil contaminated by fission product leaks from nuclear power plants, we can selectively decontaminate uranium with supercritical carbon dioxide and TBP-HNO{sub 3} Complex.

  19. Tumor immunotargeting using innovative radionuclides. (United States)

    Kraeber-Bodéré, Françoise; Rousseau, Caroline; Bodet-Milin, Caroline; Mathieu, Cédric; Guérard, François; Frampas, Eric; Carlier, Thomas; Chouin, Nicolas; Haddad, Ferid; Chatal, Jean-François; Faivre-Chauvet, Alain; Chérel, Michel; Barbet, Jacques


    This paper reviews some aspects and recent developments in the use of antibodies to target radionuclides for tumor imaging and therapy. While radiolabeled antibodies have been considered for many years in this context, only a few have reached the level of routine clinical use. However, alternative radionuclides, with more appropriate physical properties, such as lutetium-177 or copper-67, as well as alpha-emitting radionuclides, including astatine-211, bismuth-213, actinium-225, and others are currently reviving hopes in cancer treatments, both in hematological diseases and solid tumors. At the same time, PET imaging, with short-lived radionuclides, such as gallium-68, fluorine-18 or copper-64, or long half-life ones, particularly iodine-124 and zirconium-89 now offers new perspectives in immuno-specific phenotype tumor imaging. New antibody analogues and pretargeting strategies have also considerably improved the performances of tumor immunotargeting and completely renewed the interest in these approaches for imaging and therapy by providing theranostics, companion diagnostics and news tools to make personalized medicine a reality. PMID:25679452

  20. Tumor Immunotargeting Using Innovative Radionuclides

    Directory of Open Access Journals (Sweden)

    Françoise Kraeber-Bodéré


    Full Text Available This paper reviews some aspects and recent developments in the use of antibodies to target radionuclides for tumor imaging and therapy. While radiolabeled antibodies have been considered for many years in this context, only a few have reached the level of routine clinical use. However, alternative radionuclides, with more appropriate physical properties, such as lutetium-177 or copper-67, as well as alpha-emitting radionuclides, including astatine-211, bismuth-213, actinium-225, and others are currently reviving hopes in cancer treatments, both in hematological diseases and solid tumors. At the same time, PET imaging, with short-lived radionuclides, such as gallium-68, fluorine-18 or copper-64, or long half-life ones, particularly iodine-124 and zirconium-89 now offers new perspectives in immuno-specific phenotype tumor imaging. New antibody analogues and pretargeting strategies have also considerably improved the performances of tumor immunotargeting and completely renewed the interest in these approaches for imaging and therapy by providing theranostics, companion diagnostics and news tools to make personalized medicine a reality.

  1. Purification of lanthanides for double beta decay experiments (United States)

    Polischuk, O. G.; Barabash, A. S.; Belli, P.; Bernabei, R.; Boiko, R. S.; Cappella, F.; Cerulli, R.; Danevich, F. A.; Incicchitti, A.; Laubenstein, M.; Mokina, V. M.; Nisi, S.; Poda, D. V.; Tretyak, V. I.


    There are several potentially double beta active isotopes among the lanthanide elements. However, even high purity grade lanthanide compounds contain 238U, 226Ra and 232,228Th typically on the level of ˜ (0.1 - 1) Bq/kg. The liquid-liquid extraction technique was used to remove traces of U, Ra and Th from CeO2, Nd2O3 and Gd2O3. The radioactive contamination of the samples before and after the purification was tested by using ultra-low-background HPGe γ spectrometry at the underground Gran Sasso National Laboratories of the INFN (Italy). After the purification the radioactive contamination of gadolinium oxide by Ra and Th was decreased at least one order of magnitude. The efficiency of the approach to purify cerium oxide from Ra was on same level, while the radioactive contamination of neodymium sample before and after the purification is below the sensitivity of analytical methods. The purification method is much less efficient for chemically very similar radioactive elements like lanthanum, lutetium and actinium. R&D of the methods to remove the pollutions with improved efficiency is in progress.

  2. Radionuclides in coastal swampland soils in South Australia - An unusual distribution?

    International Nuclear Information System (INIS)

    A plant processing uranium ore was constructed during the 1950's on coastal swamplands at Port Pirie, South Australia, with tailings and chemical residues stored in clay-lined dams on site. Environmental soil samples collected recently from this area showed an unusual radionuclide distribution which suggested possible contamination from the former uranium plant nearby. On subsequent investigation it appears this distribution is a general property of swampland soils. The concentration of uranium in these soils is significantly greater (2-10 times) than that of its decay products, with an observed range of uranium concentrations from 50 to 300 Bq/kg. In contrast, 'normal' soils in South Australia contain between 5 and 60 Bq/kg, with decay products close to secular equilibrium. In addition, actinium (and its parent, protactinium) occur in sediments in greater concentration than expected - 6 to 36 Bq/kg compared with a 'normal soil' range of 0.2 to 3 Bq/kg. Results obtained suggest: organic residues in the sediments play a major part in the concentration of radionuclides; and the probable source of radionuclides is sea-water. These observations are consistent with results of other workers who examined the incorporation of stable trace metals into coastal swampland sediments in South Australia. Representative data are presented and discussed

  3. Study of Thorium Utilization in a Large Scale Sodium Cooled Fast Reactor

    International Nuclear Information System (INIS)

    The breeding performance of 232Th in fast reactor is better than 238U, since the capture cross section of 232Th is slightly higher than 238U under the fast neutron spectrum. There are much less fission neutrons in the blanket, so the proportion of neutron with energy above 6MeV (the threshold energy of (n,2n) reaction of 232Th) is very small. Therefore, the 233U produced in fast reactor blanket would have high purity. In this paper, an large scale fast reactor core was taken as the reference core for 232Th utilization study. In the calculation results, the whole capability of 233U production is about 443kg/(GWe•a) in the blanket; at the end of the first cycle (160EFPD), the 233U production per unit mass of 232Th is about 10.71g/(kgTh), and the weight fraction of 232U in actinium is less than 0.019%. It is an attractive technology option to produce 233U in the blanket. (author)

  4. A Critical Review of Alpha Radionuclide Therapy-How to Deal with Recoiling Daughters? (United States)

    de Kruijff, Robin M; Wolterbeek, Hubert T; Denkova, Antonia G


    This review presents an overview of the successes and challenges currently faced in alpha radionuclide therapy. Alpha particles have an advantage in killing tumour cells as compared to beta or gamma radiation due to their short penetration depth and high linear energy transfer (LET). Touching briefly on the clinical successes of radionuclides emitting only one alpha particle, the main focus of this article lies on those alpha-emitting radionuclides with multiple alpha-emitting daughters in their decay chain. While having the advantage of longer half-lives, the recoiled daughters of radionuclides like 224Ra (radium), 223Ra, and 225Ac (actinium) can do significant damage to healthy tissue when not retained at the tumour site. Three different approaches to deal with this problem are discussed: encapsulation in a nano-carrier, fast uptake of the alpha emitting radionuclides in tumour cells, and local administration. Each approach has been shown to have its advantages and disadvantages, but when larger activities need to be used clinically, nano-carriers appear to be the most promising solution for reducing toxic effects, provided there is no accumulation in healthy tissue. PMID:26066613

  5. A Critical Review of Alpha Radionuclide Therapy—How to Deal with Recoiling Daughters? (United States)

    de Kruijff, Robin M.; Wolterbeek, Hubert T.; Denkova, Antonia G.


    This review presents an overview of the successes and challenges currently faced in alpha radionuclide therapy. Alpha particles have an advantage in killing tumour cells as compared to beta or gamma radiation due to their short penetration depth and high linear energy transfer (LET). Touching briefly on the clinical successes of radionuclides emitting only one alpha particle, the main focus of this article lies on those alpha-emitting radionuclides with multiple alpha-emitting daughters in their decay chain. While having the advantage of longer half-lives, the recoiled daughters of radionuclides like 224Ra (radium), 223Ra, and 225Ac (actinium) can do significant damage to healthy tissue when not retained at the tumour site. Three different approaches to deal with this problem are discussed: encapsulation in a nano-carrier, fast uptake of the alpha emitting radionuclides in tumour cells, and local administration. Each approach has been shown to have its advantages and disadvantages, but when larger activities need to be used clinically, nano-carriers appear to be the most promising solution for reducing toxic effects, provided there is no accumulation in healthy tissue. PMID:26066613

  6. A Critical Review of Alpha Radionuclide Therapy—How to Deal with Recoiling Daughters?

    Directory of Open Access Journals (Sweden)

    Robin M. de Kruijff


    Full Text Available This review presents an overview of the successes and challenges currently faced in alpha radionuclide therapy. Alpha particles have an advantage in killing tumour cells as compared to beta or gamma radiation due to their short penetration depth and high linear energy transfer (LET. Touching briefly on the clinical successes of radionuclides emitting only one alpha particle, the main focus of this article lies on those alpha-emitting radionuclides with multiple alpha-emitting daughters in their decay chain. While having the advantage of longer half-lives, the recoiled daughters of radionuclides like 224Ra (radium, 223Ra, and 225Ac (actinium can do significant damage to healthy tissue when not retained at the tumour site. Three different approaches to deal with this problem are discussed: encapsulation in a nano-carrier, fast uptake of the alpha emitting radionuclides in tumour cells, and local administration. Each approach has been shown to have its advantages and disadvantages, but when larger activities need to be used clinically, nano-carriers appear to be the most promising solution for reducing toxic effects, provided there is no accumulation in healthy tissue.

  7. Background radiation and individual dosimetry in the coastal area of Tamil Nadu (India)

    International Nuclear Information System (INIS)

    South coast of India is known as the high-level background radiation area (HBRA) mainly due to beach sands that contain natural radionuclides as components of the mineral monazite. The rich deposit of monazite is unevenly distributed along the coastal belt of Tamil Nadu and Kerala. An HBRA site that laid in 2x7 m along the sea was found in the beach of Chinnavillai, Tamil Nadu, where the maximum ambient dose equivalent reached as high as 162.7 mSv y-1. From the sands collected at the HBRA spot, the high-purity germanium semi-conductor detector identified six nuclides of thorium series, four nuclides of uranium series and two nuclides belonging to actinium series. The highest radioactivity observed was 43.7 Bq g-1 of Th-228. The individual dose of five inhabitants in Chinnavillai, as measured by the radiophotoluminescence glass dosimetry system, demonstrated the average dose of 7.17 mSv y-1 ranging from 2.79 to 14.17 mSv y-1. (authors)

  8. Emanations and 'induced' radioactivity: from mystery to (mis)use

    International Nuclear Information System (INIS)

    The natural Rn isotopes were discovered within the period 1899-1902 and at that time referred to as emanations because they came out (emanated) of sources/materials containing actinium, thorium and radium, respectively. The (somewhat mysterious) emanations appeared to disintegrate into radioactive decay products which by depositing at solid surfaces gave rise to 'induced' radioactivity i.e. radioactive substances with various half-lives. Following the discovery of the emanations the volume of the research involving them and their disintegration products grew steeply. The identity of a number of these radioactive products was soon established. Radium emanation was soon used as a source of RaD (210Pb) to be applied as an 'indicator' (radiotracer) for lead in a study on the solubility of lead sulphide and lead chromate. Moreover, radium and its emanation were introduced into the medical practice. Inhaling radon and drinking radon-containing water became an accepted medicinal use (or misuse?) of that gas. Shortly after the turn of the century, the healing (?) action of natural springs (spas) was attributed to their radium emanation, i.e. radon. Bathing in radioactive spring water and drinking it became very popular. Even today, bathing in radon-containing water is still a common medical treatment in Jachymov, Czech Republic. (author)

  9. Liquid Scintillation Counting of Environmental Radioisotopes: A Review of the Impact of Background Reduction

    Energy Technology Data Exchange (ETDEWEB)

    Douglas, Matthew; Bernacki, Bruce E.; Erchinger, Jennifer L.; Finn, Erin C.; Fuller, Erin S.; Hoppe, Eric W.; Keillor, Martin E.; Morley, Shannon M.; Mullen, Crystal A.; Orrell, John L.; Panisko, Mark E.; Warren, Glen A.; Wright, Michael E.


    Liquid scintillation counting (LSC) is a versatile and commonplace method for radiometric measurement of charged particle emitting radionuclides. The LSC method provides utility in a range of environmental science applications including hydrological studies of water transport, anthropogenic releases of radionuclides into the environment, and vertical mixing rates within oceans. Instrumental measurement background is one limiting factor of radiometric measurement sensitivity. As part of the development of a custom low background LSC system located in a shallow underground laboratory at Pacific Northwest National Laboratory, a number of measurement applications of LSC have been considered and are summarized here. The focus is on determining which aspects of such measurements would gain the greatest benefit from the reduction of LSC backgrounds by a factor of 10-100 relative to values reported in the literature. Examples of benefits include lowering the minimum detectable activity, reducing the sample size required, and shortening the elapsed timeline of the processing and analysis sequence. In particular tritium, strontium, and actinium isotopes are examined as these isotopes cover a range of requirements related to the LSC measurement method (e.g., 3H: low energy; Sr: spectral deconvolution; Ac: alpha/beta discrimination).

  10. Development of an Ultra-Low Background Liquid Scintillation Counter for Trace Level Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Erchinger, Jennifer L.; Orrell, John L.; Aalseth, Craig E.; Bernacki, Bruce E.; Douglas, Matthew; Finn, Erin C.; Fuller, Erin S.; Keillor, Martin E.; Morley, Shannon M.; Mullen, Crystal A.; Panisko, Mark E.; Shaff, Sarah M.; Warren, Glen A.; Wright, Michael E.


    Low-level liquid scintillation counting (LSC) has been established as one of the radiation detection techniques useful in elucidating environmental processes and environmental monitoring around nuclear facilities. The Ultra-Low Background Liquid Scintillation Counter (ULB-LSC) under construction in the Shallow Underground Laboratory at Pacific Northwest National Laboratory aims to further reduce the MDAs and/or required sample processing. Through layers of passive shielding in conjunction with an active veto and 30 meters water equivalent overburden, the background reduction is expected to be 10 to 100 times below typical analytic low-background liquid scintillation systems. Simulations have shown an expected background of around 14 counts per day. A novel approach to the light collection will use a coated hollow light guide cut into the inner copper shielding. Demonstration LSC measurements will show low-energy detection, spectral deconvolution, and alpha/beta discrimination capabilities, from trials with standards of tritium, strontium-90, and actinium-227, respectively. An overview of the system design and expected demonstration measurements will emphasize the potential applications of the ULB-LSC in environmental monitoring for treaty verification, reach-back sample analysis, and facility inspections.

  11. Enhanced radioactivity due to natural oil and gas production and related radiological problems

    International Nuclear Information System (INIS)

    Within the scope of a research contract, the following aspects are considered: External radiation exposure at production sites; internal radiation exposures during cleaning operations such as removing of scale by sand blasting; problems of waste disposal; internal radiation exposure due to radon inhalation by consumers; the origin of the high radium content of brines from oil and gas fields. Enhanced dose rates up to 50 μSv/h have been found at the external surface of saltwater tanks, but 72% of the 160 sites investigated did not show any increase above the natural background. Brines from gas contained radium-226 up to 286 Bq/1 and scale up to 1 kBq/g. In brines and scale from oil fields radium-228 was usually the dominating radionuclide. Some samples contained significant amounts of lead-210 and even actinium-227, too, but practically no uranium or thorium. The radon-222 concentrations in natural gas samples varied between 0.004 and 4 Bq/l with an average value of 0.6 Bq/l. Related radiological problems are discussed. (orig./HP)

  12. Neutron measurements with miniature fission chambers

    International Nuclear Information System (INIS)

    This report analyses the use and qualification of miniature fission chambers for two types of neutron measurements: 1) relative measurements in nuclear power reactors, or nuclear irradiation reactors. We consider the problem of burnable fissile material in detectors, under important neutron exposures and conclude on recommending the use of regenerating neutron detectors. 2) Measurements of integral physical parameters in experimental reactors. This method has been applied to measurements of fission rates in detectors with strong alpha-rays emitter deposits in order to establish standard tables of physical parameters. It has been used in particular for detectors including very radioactive actinium series. After a discussion of the instrumentation choice and data processing, specific to each measurements, we provide results on: 1) the technological and neutron behaviour of regenerating miniature fission chambers, in the swimming pool reactor 'TRITON', under a neutron exposure of 7.1020 n cm-2 and a gamma-rays exposure of 1,5.1011 rads about. The fissile material is 235U and the fertile material 234U. 2) The integral measurements of effective cross sections for 241Am and 238Pu in the experimental reactor 'MINERVE' use for study of problems of fast neutron reactors

  13. Quantification of radionuclide transfer in terrestrial and freshwater environments: A summary

    International Nuclear Information System (INIS)

    Exposure may occur as a result of incidental releases and discharges from all stages of the nuclear fuel cycle. This includes uranium mines, fuel fabrication facilities, reactors, reprocessing plants and low, intermediate and high level radioactive waste repository sites. Each of these releases involves mainly fission and neutron activation products as well as actinides. Uranium mining and fuel fabrication also involve radionuclides of the uranium, actinium and thorium decay series. In addition, some industries such as mineral sands production and processing, phosphate ore processing, coal burning and oil and gas production can generate naturally occurring radioactive materials (NORMs) as waste. Other sources of human exposure include nuclear weapon testing and radiation accidents or incidents. Any radiological assessments are based on an analysis of radionuclide transport patterns and processes governing radionuclide behaviour in the environment. Therefore, it is an aim of the IAEA to support Member States to enhance their capability for evaluating radionuclide transport, geochemical and biochemical enrichment, and radiation effects on human beings and other biota

  14. Study of Soil Decontamination Method Using Supercritical Carbon Dioxide and TBP

    International Nuclear Information System (INIS)

    The result of this study means that we have a possible new method for cheap and less wasteful nuclear waste decontamination. When severe accidents such as the incident at the Fukushima nuclear site occur, the soil near the power plant is contaminated with fission products or the activation metal structure of the power plant. The soil pollution form depends on the environment and soil characteristics of the contaminated areas. Thus, a- single-decontamination method is not effective for site cleanup. In addition, some soil decontamination methods are expensive and large amounts of secondary waste are generated. Therefore, we need new soil decontamination methods. In this study, instead of using a conventional solvent method that generates secondary waste, supercritical carbon dioxide was used to remove metal ions from the soil. Supercritical carbon dioxide is known for good permeation characteristics. We expect that we will reduce the cost of soil pollution management. Supercritical carbon dioxide can decontaminate soil easily, as it has the ability to penetrate even narrow gaps with very good moisture permeability. We used TBP, which is a known for extractant of actinium metal. TBP is usually used for uranium and strontium extraction. Using TBP-HNO3 complex and supercritical carbon dioxide, we did extraction experiments for several heavy metals in contaminated soil

  15. Selective Decontamination Effect of Metal Ions in Soil Using Supercritical CO2 and TBP Complex

    International Nuclear Information System (INIS)

    Decontamination of soil pollution is difficult because the type of contamination largely depends on the characteristics of the pollutant and the area. Also, existing soil decontamination methods generate large quantities of secondary waste and additional process costs. For this reason, new decontamination methods are always under active investigation. A method involving the use of supercritical carbon dioxide with excellent permeability in place of chemical solvents is currently being studied. Unlike other heavy metals in fission products, uranium is used as fuel, and must be handled carefully. Therefore, in this paper, we studied a supercritical carbon dioxide method for decontaminating heavy metal ions in soil using tri-n-butyl phosphate(TBP), which is well known as a ligand for the extraction of metal ions of actinium. We investigated the decontamination effect of heavy metal ions in the soil using TBP-HNO3 Complex and supercritical carbon dioxide. The study results showed that when heavy metals in soil are extracted using supercritical carbon dioxide, the extraction efficiency is different according to the type of pollutant metal ions in the soil. When TBP-HNO3 Complex is used with an extractant, uranium extraction is very effective, but lithium, strontium, and cesium extraction is not effective. Therefore, in the case of a mixture of uranium and other metals such as lithium, strontium, cesium, and so on in soil contaminated by fission product leaks from nuclear power plants, we can selectively decontaminate uranium with supercritical carbon dioxide and TBP-HNO3 Complex

  16. Exposure to radioactive aerosols in mining and milling operations: the importance of 227Ac and 231Pa

    International Nuclear Information System (INIS)

    'Full-Text:' 227Ac (half-life of 21.8 y) is the daughter or 231Pa; a beta emitter and parent of a subseries with five short-lived alpha-emitters. 231Pa (half-life of 3.27x104 y) is an alpha-emitter of the actinium series, the decay chain of 235U. As daughters of this uranium isotope they are thought to be unimportant as a radiological hazard, despite the fact that their ALI values for ingestion and inhalation are the lowest of any other radionuclide. Both nuclides can be considered as being in secular equilibrium with uranium in most geological media and so the mass concentration of 231Pa is the same of the 226Ra and that of 227Ac is the same of the 210Pa, to mention only two radionuclides of radiological concern. It is shown in this paper that if 231Pa and 227Ac are considered in the evaluations of dose commitments incurred by inhalation of aerosols in mining and milling operations, the results can be 70% higher than those calculated by the methodology of ICRP Publication 47. (author)

  17. Radium-228 determination of natural waters via concentration on manganese dioxide and separation using Diphonix ion exchange resin

    International Nuclear Information System (INIS)

    The objective of this work was to establish a new procedure for 228Ra determination of natural waters via preconcentration of radium on MnO2 and separation of its daughter, 228Ac, using Diphonix ion exchange resin. Following removal of potential interferences via passage through an initial Diphonix Resin column, the first daughter of 228Ra, 228Ac, is isolated by chromatographic separation via a second Diphonix column. A holding time of >30 h for 228Ac ingrowth in between the two column separations ensures secular equilibrium. Barium-133 is used as a yield tracer. Actinium-228 is eluted from the second Diphonix Resin with 5 ml 1 M 1-Hydroxyethane-1,1-diphosphonic acid (HEDPA) and quantified by addition of scintillation cocktail and LSC counting. Radium (and 133Ba) from the load and rinse solutions from the 2nd Diphonix column may be prepared for alpha spectrometry (for determination of 223Ra, 224Ra, and 226Ra) by BaSO4 microprecipitation and filtration. Decontamination tests indicate that U, Th, and Ra series nuclides do not interfere with these measurements, although high contents of 90Sr (90Y) require additional treatment for accurate measurement of 228Ra. Addition of stable Sr as a 'hold back' carrier during the initial MnO2 preconcentration step was shown to remove most 90Sr interference

  18. Soil and river sediments radionuclides monitoring at Aramar Experimental Center: an historical overview

    International Nuclear Information System (INIS)

    In order to evaluate possible effects to the environment resulting from the implementation of the Centro Tecnologico da Marinha - Centro Experimental Aramar (CTMSP-CEA) at Ipero in Sao Paulo state, Brazil, which came into operation in 1989, an Environmental Monitoring Program (PMA) was established in October, 1987. One of the aims of this program is to monitor the soil and river sediments radionuclides levels at CEA and beyond its boundary. The utilization of statistical tools to evaluate the results of radiometric environmental monitoring is a procedure required by National Nuclear Energy Commission (CNEN). The box plot is a simple statistical tool for displaying data. The central tendency and dispersion of the results as well as the observation of unusual results (outliers) in the dataset are easily visualized. Control chart is a graph that maps data and provides a picture of how a process is performing over time. A control chart always has a central line for the mean, an upper line for the upper control limit and a lower line for the lower control limit. Box plots and control charts were used to visualize the annual amount of natural uranium, lead-214, actinium-228 and lead-212 in soil and river sediment detected between 1987 and 2011, considering the measurements of all monitored places each year. This historical observation shows that, in average, the results obtained are below than the 1987-1988 levels (CEA's pre-operational) or below than the backgrounds radionuclides values. (author)

  19. Theoretical Study on Properties of New Isotope 265Bh

    International Nuclear Information System (INIS)

    The properties of nuclei belonging to the newly observed α-decay chain starting from 265Bh have been studied. The axially deformed relativistic mean-field calculation with the force NL-Z2 has been performed in the blocked BCS approximation. Some ground state properties such as binding energies, deformations, spins, and parities, as well as Q-values of the α-decay for this decay chain have been calculated and compared with known experimental data. Good agreement is found. The single-particle spectrum of the nucleus 265Bh is studied and some new magic numbers are found, while the magnitudes of the shell gaps in superheavy nuclei are much smaller than those of nuclei before the actinium region, and the Fermi surfaces are close to the continuum. Thus the superheavy nuclei are usually not stable. The α-decay lifetimes in the 265Bh decay chain are evaluated by different formulae, and compared with experimental data. The methods which give good agreement with the data are selected.

  20. Workplace monitoring and related health hazard evaluation in South African mining and mineral processing industries by application of nuclear and related analytical techniques

    International Nuclear Information System (INIS)

    The South African Government notice R 849 (23 April 1994) requires application to the South African Council for Nuclear Safety (CNS) for a nuclear licence if materials are dealt with that contain more than 0,2 but less than 1 Becquerel per gram of any radionuclide of the natural uranium, thorium and actinium decay series. If the material is to be used in the construction of buildings the application should have been made before 1 April 1996, otherwise before 31 March 1999. The first phase of the monitoring programme assesses the observed radioactivity levels of waste products and the possible radiological impact on people working on site and living in the direct environment of the operational site. Information has been obtained on the radionuclide content and elemental composition of the various sources of the coal, waste ash, ash related products, crusher materials and effluent water. Except for the effluent and coal samples all other materials showed activity levels for one or more nuclides above the 0,2 Bq/g but not exceeding the 1 Bq/g level. Accordingly a first order assessment of the possible radiological impact on workers and the public has been performed for water consumption and dust inhalation. Actual dust concentrations recorded at various sites within the operational area are used to evaluate the yearly dose to workers. (author)

  1. Purification of lanthanides for double beta decay experiments

    Energy Technology Data Exchange (ETDEWEB)

    Polischuk, O. G. [Institute for Nuclear Research, MSP 03680 Kyiv, Ukraine and INFN, Section of Rome, La Sapienza, I-00185 Rome (Italy); Barabash, A. S. [Institute of Theoretical and Experimental Physics, 117259 Moscow (Russian Federation); Belli, P. [INFN, Section of Rome Tor Vergata, I-00133 Rome (Italy); Bernabei, R. [INFN, Section of Rome Tor Vergata, I-00133 Rome, Italy and Department of Physics, University of Rome Tor Vergata, I-00133 Rome (Italy); Boiko, R. S.; Danevich, F. A.; Mokina, V. M.; Poda, D. V.; Tretyak, V. I. [Institute for Nuclear Research, MSP 03680 Kyiv (Ukraine); Cappella, F.; Incicchitti, A. [INFN, Section of Rome La Sapienza, I-00185 Rome, Italy and Department of Physics, University of Rome La Sapienza, I-00185 Rome (Italy); Cerulli, R.; Laubenstein, M.; Nisi, S. [INFN, Gran Sasso National Laboratories, I-67100 Assergi (Aq) (Italy)


    There are several potentially double beta active isotopes among the lanthanide elements. However, even high purity grade lanthanide compounds contain {sup 238}U, {sup 226}Ra and {sup 232,228}Th typically on the level of ∼ (0.1 - 1) Bq/kg. The liquid-liquid extraction technique was used to remove traces of U, Ra and Th from CeO{sub 2}, Nd{sub 2}O{sub 3} and Gd{sub 2}O{sub 3}. The radioactive contamination of the samples before and after the purification was tested by using ultra-low-background HPGe γ spectrometry at the underground Gran Sasso National Laboratories of the INFN (Italy). After the purification the radioactive contamination of gadolinium oxide by Ra and Th was decreased at least one order of magnitude. The efficiency of the approach to purify cerium oxide from Ra was on same level, while the radioactive contamination of neodymium sample before and after the purification is below the sensitivity of analytical methods. The purification method is much less efficient for chemically very similar radioactive elements like lanthanum, lutetium and actinium. R and D of the methods to remove the pollutions with improved efficiency is in progress.

  2. Response of Arabidopsis thaliana to N-hexanoyl-DL-homoserine-lactone, a bacterial quorum sensing molecule produced in the rhizosphere

    Czech Academy of Sciences Publication Activity Database

    von Rad, U.; Klein, I.; Dobrev, Petre; Kottová, Jana; Zažímalová, Eva; Fekete, A.; Hartmann, A.; Schmitt-Kopplin, P.; Durner, J.


    Roč. 229, č. 1 (2008), s. 73-85. ISSN 0032-0935 R&D Projects: GA MŠk(CZ) LC06034 Institutional research plan: CEZ:AV0Z50380511 Keywords : Quorum sensing * Plant defense * Plant hormones * Rhizosphere Subject RIV: ED - Physiology Impact factor: 3.088, year: 2008


    The Environmental Technology Verification report discusses the technology and performance of the PerfectPleat Ultra 175-102-863 air filter for dust and bioaerosol filtration manufactured by AAF International. The pressure drop across the filter was 112 Pa clean and 229 Pa dust lo...

  4. Humor a politika (zaslechli jsme v Parlamentě")

    Czech Academy of Sciences Publication Activity Database

    Hoffmannová, Jana

    Opole : Uniwersytet Opolski, 2000 - (Gajda, S.; Brzozowska, D.), s. 229-234 ISBN 83-86881-27-5. [Style humoru. Kamien Slaski (PL), 07.10.1999-09.10.1999] Grant ostatní: RSS/OSSF(XC) 1619/186/1998 Institutional research plan: CEZ:AV0Z9061902 Subject RIV: AI - Linguistics

  5. Focal mechanisms of micro-earthquakes in the Dobrá Voda seismoactive area in the Malé Karpaty Mts. (Little Carpathians), Slovakia

    Czech Academy of Sciences Publication Activity Database

    Fojtíková, L.; Vavryčuk, Václav; Cipciar, A.; Madarás, J.


    Roč. 492, č 1-4 (2010), s. 213-229. ISSN 0040-1951 R&D Projects: GA AV ČR IAA300120801 Institutional research plan: CEZ:AV0Z30120515 Keywords : earthquake * focal mechanism * moment tensor * tectonic stress Subject RIV: DC - Siesmology, Volcanology, Earth Structure Impact factor: 2.509, year: 2010

  6. Análisis de las olas de calor en la República Mexicana /


    Herrera Alanis, José Luis


     tesis que para obtener el grado de Doctorado en Ingeniería (Ingeniería Civil), presenta José Luis Herrera Alanis ; asesor Carlos Agustin Escalante Sandoval229 páginas : ilustracionesDoctorado en Ingeniería (Ingeniería Civil) UNAM, Facultad de Ingeniería, 2012

  7. Respiratory System

    Institute of Scientific and Technical Information of China (English)


    7.1 Bronchial asthma2004362 The effects of anti-inflammatory and anti-asthmatic agents on CD34+ hematopoietic cells in bone marrow of asthmatic mice. MAO Hui(毛辉) ,et al. Dept Respir, West China Hosp, Sichuan Univ, Chengdu 610041. Chin J Tuberc Respir Dis 2004; 27 (4):229-233.

  8. Rusíni a Ukrajinci v čs. vojenských jednotkách v zahraničí v letech druhé světové války

    Czech Academy of Sciences Publication Activity Database

    Maršálek, Zdenko

    Užgorod: Vydavnyctvo Šark, 2015 - (Fenič, V.; Šnicer, I.), s. 229-246 ISBN 978-617-7132-34-8. [Podkarpatska Rus v roky Drugoji svitovoji vijny. Užgorod (UA), 16.10.2014-17.10.2014] Institutional support: RVO:68378114 Keywords : WWII * Czechoslovak foreign resistance * Ruthenians Subject RIV: AB - History

  9. Pediatric Palliative Care: A Personal Story

    Medline Plus

    Full Text Available ... 51. WesternReservePBS 2,944 views 54:51 Phoebe's Cancer Story - Duration: 7:46. Family A-Fair 605, ... 29. NINRnews 3,309 views 2:29 Teen Cancer Stories | UCLA Daltrey/Townshend Teen & Young Adult Cancer ...

  10. 30 let výzkumu šumavských jezer. Regenerace z okyselení a vliv gradace lýkožrouta

    Czech Academy of Sciences Publication Activity Database

    Hruška, Jakub; Oulehle, Filip; Chuman, Tomáš; Kopáček, Jiří; Vrba, Jaroslav; Čtvrtlíková, Martina; Majer, V.


    Roč. 61, č. 5 (2013), s. 224-229. ISSN 0044-4812 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0073; GA ČR(CZ) GAP504/12/1218 Institutional support: RVO:60077344 ; RVO:67179843 Keywords : acidification * water chemistry * biological recovery Subject RIV: DJ - Water Pollution ; Quality

  11. Viron kirjallisuuden kieli 1990-luvulla modernismin, postmodernismin ja postkolonialismin taustaa vasten / Tiit Hennoste ; tõlk. Niko Remes

    Index Scriptorium Estoniae

    Hennoste, Tiit, 1953-


    Andmed autori kohta lk. 237. Orig.: Eesti kirjanduse keelest modernismi, postmodernismi ja postkolonialismi taustal. Ilmunud ka kogumikus: Hennoste, Tiit. Eurooplaseks saamine : kõrvaltkäija altkulmupilk. Tartu : Tartu Ülikooli Kirjastus, 2003, lk. 202-231. Bibliograafia lk. 229-231

  12. Arsenicals produce stable progressive changes in DNA methylation patterns that are linked to malignant transformation of immortalized urothelial cells

    Czech Academy of Sciences Publication Activity Database

    Jensen, T.J.; Novák, Petr; Wnek, S.M.; Gandolfi, A.J.; Futscher, B. W.


    Roč. 241, č. 2 (2009), s. 221-229. ISSN 0041-008X Institutional research plan: CEZ:AV0Z50510513 Keywords : DNA methylation * Epigenetic * Arsenic Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.359, year: 2009

  13. New ideas in technology for desulphatation

    Czech Academy of Sciences Publication Activity Database

    Ďurďová, Libuše

    Ostrava: VŠB-TU, 2006 - (Fečko, P.; Čablík, V.), s. 229-234 ISBN 80-248-1214-2. [Recyklace odpadů /10./. Ostrava (CZ), 03.11.2006] Institutional research plan: CEZ:AV0Z20600510 Keywords : AMD * desulphatation * organic substrate * biotechnologies * barriers * in situ application Subject RIV: DA - Hydrology ; Limnology

  14. Genetic variation of Phoma sorghina isolates from southern Africa and Texas

    Czech Academy of Sciences Publication Activity Database

    Pažoutová, Sylvie


    Roč. 54, č. 3 (2009), s. 217-229. ISSN 0015-5632 Institutional research plan: CEZ:AV0Z50200510 Keywords : phoma sorghina * phytopathogen * originating Subject RIV: EE - Microbiology, Virology Impact factor: 0.978, year: 2009

  15. TRAIL and docosahexaenoic acid cooperate to induce HT-29 colon cancer cell death

    Czech Academy of Sciences Publication Activity Database

    Vaculová, Alena; Hofmanová, Jiřina; Anděra, Ladislav; Kozubík, Alois


    Roč. 229, č. 1 (2005), s. 43-48. ISSN 0304-3835 R&D Projects: GA ČR(CZ) GA524/04/0895; GA ČR(CZ) GA524/03/0766 Institutional research plan: CEZ:AV0Z50040507 Keywords : TRAIL * DHA * cell death Subject RIV: BO - Biophysics Impact factor: 3.049, year: 2005

  16. Adresný příspěvek na nájemné

    Czech Academy of Sciences Publication Activity Database

    Sunega, Petr

    Praha : SLON, 2002 - (Lux, M.), s. 161-229 ISBN 80-86429-12-1 R&D Projects: GA AV ČR IBS7028004; GA AV ČR ICE7028203 Institutional research plan: CEZ:AV0Z7028912 Keywords : housing allowance * rent allowance -social benefit Subject RIV: AO - Sociology, Demography

  17. Experiment list: SRX170377 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Diagnosis=Normal 11861200,76.8,8.0,229 GSM971950: HEK293 HP1b ChIPSeq; Homo sapiens; ChIP-Seq source_name=HEK293..., HP1b ChIP || cell line=HEK293 || chip antibody=anti-FLAG M2 affinity gel || antibody vendor=Sigma-Aldr

  18. 76 FR 63573 - Roundtable on Issues Relating to Conflict Minerals (United States)


    ... COMMISSION 17 CFR Parts 229 and 249 Roundtable on Issues Relating to Conflict Minerals AGENCY: Securities and... conflict minerals originating in the Democratic Republic of the Congo and adjoining countries. Roundtable... reporting regulations regarding the use of conflict minerals from the Democratic Republic of the Congo...

  19. 76 FR 6110 - Conflict Minerals (United States)


    ... FR 80948 (December 23, 2010)]. The original comment period for Release No. 34-63547 is scheduled to... COMMISSION 17 CFR Parts 229 and 249 RIN 3235-AK84 Conflict Minerals AGENCY: Securities and Exchange... 1934 (the ``Exchange Act'') and would require any such issuer for which conflict minerals are...

  20. Teacher Militancy and Pupil Control Ideology. (United States)

    Stoops, Charles E.; Willower, Donald J.


    The hypothesis that highly militant teachers would favor strict control of students was tested using the Attitudinal Militancy Scale and the Pupil Control Ideology Form. Responses from 229 secondary school teachers from six school districts in the northeastern United States did not support the hypothesis. (PP)

  1. Šale i strašilice - najživli delovi usmene kniževnosti današne dece?

    Czech Academy of Sciences Publication Activity Database

    Pospíšilová, Jana

    Novi Sad : Filozofski fakultet, 2012 - (Karanovič, Z.; Blécourt, W.), s. 229-238 ISBN 978-86-6065-146-6. [The Third BNN Symposium Belief Narrative Genres. Novi Sad (RS), 28.08.2012-30.08.2012] Institutional support: RVO:68378076 Keywords : The living tradition * children's folklore * funny rhymes * horror stories * Czech Subject RIV: AC - Archeology, Anthropology, Ethnology

  2. Annotated phyto-taxonomical and phyto-geographical publications on the Malaysian Flora

    NARCIS (Netherlands)



    Blake, S.T.: The Cyperaceae collected in New Guinea by L.J. Brass II (Journ. Arn. Arbor. 28 (1947) 207-229, 1 fig. 2 pl.). Deals with the genera Hypolytrum, Thoracostachyum, Paramapania, Mapania, Lepironia, Cyperus, Eleocharis, Bulbostylis, Fuirena, Lipocarpha. Two new species of Cyperus, 1 of Mapan

  3. Dicty_cDB: AFF394 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFF394 (Link to dictyBase) - - - Contig-U15456-1 AFF394P (Link to Original ... _1( U60995 |pid:none) Schistosoma mansoni aspartic proteinas ... 229 2e-94 protein update 2009. 4.20 PSORT psg: ...

  4. Použití kultivovaných lidských autologních\

    Czech Academy of Sciences Publication Activity Database

    Havlas, V.; Kotaška, J.; Koníček, P.; Trč, T.; Langkramer-Konrádová, Šimona; Kočí, Zuzana; Syková, Eva


    Roč. 82, č. 3 (2015), s. 229-234. ISSN 0001-5415 R&D Projects: GA ČR GAP304/10/0326 Institutional support: RVO:68378041 Keywords : rotator cuff tear * arthroscopic repair * mesenchymal stem cells Subject RIV: FI - Traumatology, Orthopedics Impact factor: 0.388, year: 2014

  5. Smrt je jen stín – hroby, smrt a záhrobí ve středověkém muslimském Egyptě

    Czech Academy of Sciences Publication Activity Database

    Ostřanský, Bronislav

    Praha : Nakladatelství LIBRI, 2009 - (Maříková Vlčková, P.), s. 366-395 ISBN 978-80-7277-229-2 Institutional research plan: CEZ:AV0Z90210515 Keywords : egyptian tombs Subject RIV: AC - Archeology, Anthropology, Ethnology

  6. Blue native protein electrophoresis for studies of mouse polyomavirus morphogenesis and interactions between the major capsid protein VP1 and cellular proteins

    Czech Academy of Sciences Publication Activity Database

    Horníková, L.; Man, Petr; Forstová, J.


    Roč. 178, 1-2 (2011), s. 229-234. ISSN 0166-0934 R&D Projects: GA MŠk LC545 Institutional research plan: CEZ:AV0Z50200510 Keywords : BN-PAGE * Mouse polyomavirus * VP1 protein Subject RIV: CE - Biochemistry Impact factor: 2.011, year: 2011

  7. Air pollution control using particle filtration. 1964-November 1980 (citations from the NTIS Data Base). Report for 1964-November 1980

    Energy Technology Data Exchange (ETDEWEB)

    Cavagnaro, D.M.


    The citations discuss technology, equipment design and performance, ultrafiltration, and size distribution factors. Aerosol and dust filtration are included. Studies on electrostatic precipitators have been excluded. (This updated bibliography contains 229 citations, 56 of which are new entries to the previous edition.)

  8. Prediction of Participation of Undergraduate University Students in a Music and Dance Master's Degree Program (United States)

    Bebetsos, Evangelos


    The aim of the study was the investigation of students' attitudes and intention towards their possible participation in a graduate Music and Dance Distance Learning Master's Degree Program. The sample consisted of consisted of 229 undergraduate University students, between the ages of 20 to 63 yrs. of age (M = 34.24, SD = 10.70). More…

  9. 76 FR 41196 - Notice of Funding Availability (NOFA): Section 515 Rural Rental Housing Program for New... (United States)


    ... Estate Management, U.S. Green Building Council's Leadership in Energy and Environmental Design for... (603) 229- 0536, Robert McCarthy. New Jersey State Office, 5th Floor North Suite 500, 8000 Midlantic Dr... Gauna. New York State Office, The Galleries of Syracuse, 441 S. Salina Street, Suite 357 5th...

  10. 29 CFR 1910.6 - Incorporation by reference. (United States)


    ...(a) and 1 CFR part 51. (4) Copies of standards listed in this section and issued by private standards... (ASAE), 2950 Niles Road, Post Office Box 229, St. Joseph, MI 49085: (1) ASAE Emblem for Identifying Slow... Plastic Sheeting and Cellular Plastics, IBR approved for § 1910.103(c)(1)(v)(d). (19) ASTM D...

  11. Protective double-layer coatings prepared by plasma enhanced chemical vapor deposition on tool steel

    Czech Academy of Sciences Publication Activity Database

    Muresan, M.; Charvátová Campbell, A.; Ondračka, P.; Buršíková, V.; Peřina, Vratislav; Polcar, T.; Reuter, S.; Hammer, M. U.; Valtr, M.; Zajíčková, L.


    Roč. 272, JUN (2015), s. 229-238. ISSN 0257-8972 R&D Projects: GA MŠk LM2011019 Institutional support: RVO:61389005 Keywords : PECVD * DLC * amorphous carbon * hardness Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders Impact factor: 1.998, year: 2014

  12. Response of grapevine leaves to plasmopara viticola infection by means of measurement of reflectance and fluorescence signals

    Czech Academy of Sciences Publication Activity Database

    Šebela, David; Olejníčková, Julie; Župčanová, A.; Sotolář, R.


    Roč. 27, č. 8 (2012), s. 229-237. ISSN 1211-8516 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0073 Institutional support: RVO:67179843 Keywords : Plasmopara viticola * downy mildew * grapevine * leaf tissue * susceptible varieties * chlorophyll fluorescence imaging * reflectance Subject RIV: GM - Food Processing

  13. Assessment of genetic diversity in Saccharum using SSR markers and capillary electrophoresis (United States)

    This study was conducted to assess the genetic diversity amongst 12 Saccharum clones from 3 species using SSR markers and CE (capillary electrophoresis). Genomic DNA of 12 sugarcane cultivars was amplified with 19 SSR primer pairs. A total of 229 bands generated with a size range between 100 and 26...

  14. Česká reklama druhé poloviny 19. století ve službách národu

    Czech Academy of Sciences Publication Activity Database

    Vošahlíková, Pavla

    Praha: Historický ústav AV ČR, 2004 - (Hájek, J.), s. 229-239. (23). ISBN 80-7286-059-3 Institutional research plan: CEZ:AV0Z8015903 Keywords : history * ethnic relations * advertisement and promotion Subject RIV: AB - History

  15. K persuazivnímu stylu letáčků nabízejících "přivýdělek", "vedlejší příjem" (aneb jak nalákat spolupracovníky)

    Czech Academy of Sciences Publication Activity Database

    Hoffmannová, Jana

    Lodz: Wydawnictwo Uniwersytetu Lodzkiego, 2000 - (Michalewski, K.), s. 223-229 ISBN 83-7171-371-1. [Regulacyjna funkcja tekstów. Lodz (PL), 27.04.1999-28.04.1999] R&D Projects: GA ČR GV405/96/K096 Institutional research plan: CEZ:AV0Z9061902 Subject RIV: AI - Linguistics

  16. Dichelyne (Dichelyne) spinigerus sp. nov. (Nematoda: Cucullanidae) from the marine fish Otolithes ruber (Sciaenidae) off Iran and first description of the male of Philometra otolithi Moravec et Manoharan, 2013 (Nematoda: Philometridae)

    Czech Academy of Sciences Publication Activity Database

    Moravec, František; Khosheghbal, M.; Pazooki, J.


    Roč. 59, č. 2 (2014), s. 229-237. ISSN 1230-2821 R&D Projects: GA ČR GBP505/12/G112 Institutional support: RVO:60077344 Keywords : parasitic nematode * Dichelyne * Philometra * marine fish * Otolithes * Iran Subject RIV: EG - Zoology Impact factor: 0.905, year: 2014

  17. Sociologie veřejného mínění: Veřejné mínění jako sociální proces a komunikační koncept

    Czech Academy of Sciences Publication Activity Database

    Tabery, Paulína; Vinopal, Jiří

    Praha: Karolinum, 2014 - (Šubrt, J.), s. 213-229 ISBN 978-80-246-2558-4 R&D Projects: GA ČR GA13-10320S Institutional support: RVO:68378025 Keywords : Public opinion * public opinion proces * communication Subject RIV: AO - Sociology , Demography

  18. Antimatter and 20th Century Science (United States)

    Williams, Gary


    This article gives an outline of the history of antimatter from the concept first introduced in 1898 up to the present day and is intended to complement the article "Antihydrogen on Tap" on page 229 [of this issue of "Physics Education"]. It is hoped that it will provide enough historical background material along with interesting snippets of…

  19. Thorium isomer for radiative emission of neutrino pair

    CERN Document Server

    Sasao, N; Yoshimi, A; Yoshimura, K; Yoshimura, M


    It is proposed to use the isomer ionic ground state $^{229m}$Th$^{4+}$ embedded in transparent crystals for precision determination of unknown neutrino parameters. Isolation from solid environment of the proposed nuclear process, along with available experimental techniques of atomic physics, has a great potentiality for further study.

  20. Infectivity and pathogenicity of Cryptosporidium andersoni to a novel host, southern multimammate mouse (Mastomys coucha)

    Czech Academy of Sciences Publication Activity Database

    Kváč, Martin; Ondráčková, Z.; Květoňová, Dana; Sak, Bohumil; Vítovec, J.


    Roč. 143, 3/4 (2007), s. 229-233. ISSN 0304-4017 R&D Projects: GA ČR GA524/05/0992 Institutional research plan: CEZ:AV0Z60220518 Keywords : Cryptosporidium and ersoni * Mastomys coucha * infectivity * pathogenicity * 18S rRNA gene Subject RIV: EG - Zoology Impact factor: 2.016, year: 2007

  1. The Relationship between Latino Students' Learning Styles and Their Academic Performance (United States)

    Torres, Sonia Maldonado


    The purpose of this study was to explore the relationship between Latino Students' learning styles and their academic performance. Students' academic performance was measured using their overall grade point average (GPA). A group of 229 Latino students who were enrolled at an urban community college in New York City participated in the…

  2. Nepřipravené mluvené projevy: neurčitost, vágnost, ne-řád, chaos?

    Czech Academy of Sciences Publication Activity Database

    Hoffmannová, Jana

    Praha : Dokořán, 2013 - (Faltýnek, D.; Gvoždiak, V.), s. 212-229 ISBN 978-80-7363-544-2 R&D Projects: GA ČR GAP406/12/1829 Institutional support: RVO:68378092 Keywords : uncertainty * vagueness * spoken Czech * written text * spoken expression * coherence * cohesion Subject RIV: AI - Linguistics

  3. Late-Holocene evolution of a floodplain impounded by the Smrdutá landslide, Carpathian Mountains (Czech Republic)

    Czech Academy of Sciences Publication Activity Database

    Pánek, T.; Smolková, V.; Hradecký, J.; Sedláček, J.; Zernitskaya, V.; Kadlec, Jaroslav; Pazdur, A.; Řehánek, T.


    Roč. 23, č. 2 (2013), s. 218-229. ISSN 0959-6836 Institutional support: RVO:67985831 Keywords : Flysch Carpathians * landslide dam * late Holocene * recurrent landslide * sedimentary archive Subject RIV: DE - Earth Magnetism, Geodesy, Geography Impact factor: 3.794, year: 2013

  4. User's guide to program RCN

    International Nuclear Information System (INIS)

    This is a set of three Fortran IV programs, RCN29, HFMOD7, and RCN229, based on the Herman--Skillman and Charlotte Froese Fischer programs, with extensive modifications and additions. The programs compute self-consistent-field radial wave functions and the various radial integrals involved in the computation of atomic energy levels and spectra

  5. Sourozenci onkologicky nemocných dětí: subjektivně vnímané změny v životě a kvalita jejich života 6 měsíců po stanovení diagnózy nemocnému sourozenci

    Czech Academy of Sciences Publication Activity Database

    Kárová, Š.; Blatný, Marek; Jelínek, Martin; Kepák, T.; Tóthová, K.


    Roč. 57, č. 3 (2013), s. 218-229. ISSN 0009-062X R&D Projects: GA ČR GA406/09/1255 Institutional support: RVO:68081740 Keywords : oncology disease * siblings * quality of life Subject RIV: AN - Psychology Impact factor: 0.292, year: 2013

  6. Survey and Analysis of Dental Caries in Students at a Deaf-Mute High School (United States)

    Wei, Hong; Wang, Yan-Ling; Cong, Xiao-Na; Tang, Wan-Qin; Wei, Ping-Min


    The present cross-sectional study was conducted to assess and compare the prevalence of dental caries of 229 deaf adolescents in a special senior high school and to identify factors related to dental caries, with a match group of 196 healthy adolescents in a normal senior high school, in Jiangsu province of East China. In this study the prevalence…

  7. Domain Modeling: NP_000881.3 [SAHG[Archive

    Lifescience Database Archive (English)

    Full Text Available NP_000881.3 chr11 Crystal structure of a Kir3.1-prokaryotic Kir channel chimera p2qksb_ chr11/NP_000881.3.../NP_000881.3_apo_50-370.pdb blast 192Q,193P,194K,196R,210M,211R,212D,213E,228H,229I,23

  8. Domain Modeling: NP_003411.3 [SAHG[Archive

    Lifescience Database Archive (English)

    Full Text Available NP_003411.3 chr3 CRYSTAL STRUCTURE OF A DESIGNED ZINC FINGER PROTEIN BOUND TO DNA c1meyf_ chr3/NP_003411.3.../NP_003411.3_holo_219-301.pdb blast 224C,226V,227C,228G,229K,230G,231F,232S,233Q,234S

  9. Experiment list: ERX149419 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available sapiens || Sex=male || ClinicalHistory=cause of death: trauma || BMI=22.9kg_per_m2 || ClinicalInformation: ...Premortem diagnosis of diabetes=No || Age=38 year || ClinicalInformation: Premort...criptional and epigenetic high throughput sequencing of human and mouse pancreatic islet-cells Organism=Homo

  10. Experiment list: ERX166208 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available sapiens || Sex=male || ClinicalHistory=cause of death: trauma || BMI=22.9kg_per_m2 || ClinicalInformation: P...remortem diagnosis of diabetes=No || Age=38 year || ClinicalInformation: Premorte...riptional and epigenetic high throughput sequencing of human and mouse pancreatic islet-cells Organism=Homo

  11. Looking for the path: image segmentation

    Czech Academy of Sciences Publication Activity Database

    Coufal, J.; Krejsa, Jiří

    Bratislava: Slovak University of Technology in Bratislava, 2010, s. 229-233. ISBN 978-80-227-3353-3. [Robotics in Education . Bratislava (SK), 16.09.2010-17.09.2010] Institutional research plan: CEZ:AV0Z20760514 Keywords : vision-based navigation * image processing * image segmentation Subject RIV: JD - Computer Applications, Robotics

  12. New modular form identities associated to generalized vertex operator algebras

    Czech Academy of Sciences Publication Activity Database

    Zuevsky, Alexander


    Roč. 16, č. 1 (2015), s. 607-623. ISSN 1787-2405 Institutional support: RVO:67985840 Keywords : vertex operator superalgebras * intertwining operators * Riemann surfaces Subject RIV: BA - General Mathematics Impact factor: 0.229, year: 2014

  13. SETH1 and SETH2, Two Components of the Glycosylphosphatidylinositol Anchor Biosynthetic Pathway, Are Required for Pollen Germination and Tube Growth in Arabidopsis

    Czech Academy of Sciences Publication Activity Database

    Lalanne, E.; Honys, David; Johnson, A.; Borner, G. H. H.; Lilley, K. S.; Dupree, P.; Grossniklaus, U.; Twell, D.


    Roč. 16, - (2003), s. 229-240. ISSN 1040-4651 R&D Projects: GA AV ČR IAA5038207 Institutional research plan: CEZ:AV0Z5038910 Keywords : Glycosylphosphatidylinositol * Pollen Germination * Arabidopsis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 10.679, year: 2003

  14. SETH1 and SETH2, two components of the glycosylphosphatidylinositol anchor biosynthetic pathway, are required for pollen germination and tube growth in arabidopsis

    Czech Academy of Sciences Publication Activity Database

    Lalanne, E.; Honys, David; Johnson, A.; Borner, G. H. H.; Lilley, K. S.; Dupree, P.; Grossniklaus, U.; Twell, D.


    Roč. 16, č. 1 (2004), s. 229-240. ISSN 1040-4651 R&D Projects: GA AV ČR IAA5038207 Institutional research plan: CEZ:AV0Z5038910 Keywords : ARABINOGALACTAN PROTEIN * LEISHMANIA-MEXICANA * GENOMIC ANALYSIS Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 11.295, year: 2004

  15. Effects of Student-Written Wiki-Based Textbooks on Pre-Service Teachers' Epistemological Beliefs (United States)

    Ren, Zhongtang; Baker, Peter; Zhang, Shaoan


    Use of web technology in student construction of knowledge through writing their own textbooks via the Wikibooks platform may affect their epistemological beliefs. By using Epistemological Beliefs Inventory, this article investigates whether two groups (n = 229) of pre-service teachers' epistemological beliefs change in different learning…

  16. Raman and IR phonons in ferroelectric Sr.sub.0.35./sub.Ba.sub.0.69./sub.Nb.sub.2./sub.O.sub.6.04./sub. single crystals

    Czech Academy of Sciences Publication Activity Database

    Buixaderas, Elena; Gregora, Ivan; Hlinka, Jiří; Dec, J.; Lukasiewicz, T.


    Roč. 86, 2-3 (2013), s. 217-229. ISSN 0141-1594 R&D Projects: GA ČR GAP204/10/0616 Institutional research plan: CEZ:AV0Z10100520 Keywords : ferroelectrics * Raman spectroscopy * IR spectroscopy * phonons * relaxors * tungsten-bronze materials Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.044, year: 2013

  17. Molecular evidence for the existence of species complexes within Macvicaria Gibson & Bray, 1982 (Digenea: Opecoelidae) in the western Mediterranean, with descriptions of two new species

    Czech Academy of Sciences Publication Activity Database

    Antar, R.; Georgieva, Simona; Gargouri, L.; Kostadinova, Aneta


    Roč. 91, č. 3 (2015), s. 211-229. ISSN 0165-5752 R&D Projects: GA ČR GBP505/12/G112 Institutional support: RVO:60077344 Keywords : marine fishes * phylogeny * trematodes Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 1.336, year: 2014

  18. Diversity of insect intestinal microflora

    Czech Academy of Sciences Publication Activity Database

    Mrázek, Jakub; Štrosová, Lenka; Fliegerová, Kateřina; Kott, T.; Kopečný, Jan


    Roč. 53, č. 3 (2008), s. 229-233. ISSN 0015-5632 R&D Projects: GA ČR GA303/06/0974 Institutional research plan: CEZ:AV0Z50450515 Keywords : insect intestinal microflora Subject RIV: EE - Microbiology, Virology Impact factor: 1.172, year: 2008

  19. Amidase-catalyzed production of nicotinic acid in batch and continuous stirred membrane reactors

    Czech Academy of Sciences Publication Activity Database

    Cantarella, M.; Cantarella, L.; Gallifuoco, A.; Intellini, R.; Kaplan, Ondřej; Spera, A.; Martínková, Ludmila


    Roč. 42, č. 3 (2008), s. 222-229. ISSN 0141-0229 R&D Projects: GA MŠk OC D25.002 Institutional research plan: CEZ:AV0Z50200510 Keywords : amidase * nicotinic acid bioproduction * temperature dependence Subject RIV: EE - Microbiology, Virology Impact factor: 2.375, year: 2008

  20. Comparing Overexcitabilities of Gifted and Non-Gifted School Children in Hong Kong: Does Culture Make a Difference? (United States)

    Siu, Angela F. Y.


    Overexcitabilities (OEs) are ways that an individual experiences the world and can be understood as channels of information flow. The current study examined the profile of OEs among a group of Hong Kong children. Participants included 229 non-gifted and 217 gifted children. OEs were measured using the Overexcitability Questionnaire II. Results…