WorldWideScience

Sample records for actin gene promoter

  1. TGF-beta-induced early gene-1 overexpression promotes oxidative stress protection and actin cytoskeleton rearrangement in human skin fibroblasts.

    Science.gov (United States)

    Leduc, Chloe; Sobilo, Lauren; Toumi, Hechmi; Mondon, Philippe; Lespessailles, Eric; Ossant, Fédéric; Kurfurst, Robin; Pichon, Chantal

    2016-06-01

    Transforming growth factor beta inducible early gene-1 (TIEG-1), a member of the Krüppel-like factor, was identified as a primary response gene for TGF-β. The role of TIEG-1 in skin repair has been mainly addressed in vivo on TIEG-1 null mice model and the mechanism remains unexplored. We investigated the modulation of TIEG-1 expression in normal human skin fibroblasts by either down-expressing or overexpressing the gene. We evaluated reactive oxygen species production and the cell viability of treated cells. The effect of TIEG-1 overexpression was monitored by wound healing assay and immunofluorescence staining of actin fibers organization and alpha-smooth muscle actin (α-SMA). Western blots were carried out to identify the level of expression or phosphorylation of key proteins such as cofilin, Rho GTPases, and p38 mitogen-activated protein kinase (p38 MAPK). TIEG-1 down-regulation had a deleterious effect on the cell viability. It was significantly reduced (65±5%) and exposure to ultraviolet further increased this effect (47±3%). By contrast, cells overexpressing TIEG-1 had a reduced reactive oxygen species production (75%) compared to control and mock-transfected cells. This overexpression also resulted in formation of actin stress fibers and increased α-SMA expression and an enhanced wound healing feature. RhoB GTPase was upregulated and phosphorylation of cofilin and p38 MAPK was observed. TIEG-1 overexpression in normal human skin fibroblasts results in improved resistance to oxidative stress, myofibroblast-like conversion that involved RhoB signaling pathway with cofilin and p38 MAPK proteins activation. This study enlightens the role of TIEG-1 role in skin biology. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Bioinformatics study of the mangrove actin genes

    Science.gov (United States)

    Basyuni, M.; Wasilah, M.; Sumardi

    2017-01-01

    This study describes the bioinformatics methods to analyze eight actin genes from mangrove plants on DDBJ/EMBL/GenBank as well as predicted the structure, composition, subcellular localization, similarity, and phylogenetic. The physical and chemical properties of eight mangroves showed variation among the genes. The percentage of the secondary structure of eight mangrove actin genes followed the order of a helix > random coil > extended chain structure for BgActl, KcActl, RsActl, and A. corniculatum Act. In contrast to this observation, the remaining actin genes were random coil > extended chain structure > a helix. This study, therefore, shown the prediction of secondary structure was performed for necessary structural information. The values of chloroplast or signal peptide or mitochondrial target were too small, indicated that no chloroplast or mitochondrial transit peptide or signal peptide of secretion pathway in mangrove actin genes. These results suggested the importance of understanding the diversity and functional of properties of the different amino acids in mangrove actin genes. To clarify the relationship among the mangrove actin gene, a phylogenetic tree was constructed. Three groups of mangrove actin genes were formed, the first group contains B. gymnorrhiza BgAct and R. stylosa RsActl. The second cluster which consists of 5 actin genes the largest group, and the last branch consist of one gene, B. sexagula Act. The present study, therefore, supported the previous results that plant actin genes form distinct clusters in the tree.

  3. Generation of an efficient artificial promoter of bovine skeletal muscle α-actin gene (ACTA1) through addition of cis-acting element.

    Science.gov (United States)

    Hu, Qian; Tong, Huili; Zhao, Dandan; Cao, Yunkao; Zhang, Weiwei; Chang, Shuwei; Yang, Yu; Yan, Yunqin

    2015-03-01

    The promoter of skeletal muscle α-actin gene (ACTA1) is highly muscle specific. The core of the bovine ACTA1 promoter extends from +29 to -233, about 262 base pairs (bp), which is sufficient to activate transcription in bovine muscle satellite cells. In this study, analysis by PCR site-specific mutagenesis showed that the cis-acting element SRE (serum response element binding factor) was processed as a transcriptional activator. In order to enhance the bovine ACTA1 promoter's activity, we used a strategy to modify it. We cloned a fragment containing three SREs from the promoter of ACTA1, and then one or two clones were linked upstream of the core promoter (262 bp) of ACTA1. One and two clones increased the activity of the ACTA1 promoter 3-fold and 10-fold, respectively, and maintained muscle tissue specificity. The modified promoter with two clones could increase the level of ACTA1 mRNA and protein 4-fold and 1.1-fold, respectively. Immunofluorescence results showed that green fluorescence of ACTA1 increased. Additionally, the number of total muscle microfilaments increased. These genetically engineered promoters might be useful for regulating gene expression in muscle cells and improving muscle mass in livestock.

  4. Activation of the skeletal alpha-actin promoter during muscle regeneration.

    Science.gov (United States)

    Marsh, D R; Carson, J A; Stewart, L N; Booth, F W

    1998-11-01

    Little is known concerning promoter regulation of genes in regenerating skeletal muscles. In young rats, recovery of muscle mass and protein content is complete within 21 days. During the initial 5-10 days of regeneration, mRNA abundance for IGF-I, myogenin and MyoD have been shown to be dramatically increased. The skeletal alpha-actin promoter contains E box and serum response element (SRE) regulatory regions which are directly or indirectly activated by myogenin (or MyoD) and IGF-I proteins, respectively. We hypothesized that the skeletal alpha-actin promoter activity would increase during muscle regeneration, and that this induction would occur before muscle protein content returned to normal. Total protein content and the percentage content of skeletal alpha-actin protein was diminished at 4 and 8 days and re-accumulation had largely occurred by 16 days post-bupivacaine injection. Skeletal alpha-actin mRNA per whole muscle was decreased at day 8, and thereafter returned to control values. During regeneration at day 8, luciferase activity (a reporter of promoter activity) directed by -424 skeletal alpha-actin and -99 skeletal alpha-actin promoter constructs was increased by 700% and 250% respectively; however, at day 16, skeletal alpha-actin promoter activities were similar to control values. Thus, initial activation of the skeletal alpha-actin promoter is associated with regeneration of skeletal muscle, despite not being sustained during the later stages of regrowth. The proximal SRE of the skeletal alpha-actin promoter was not sufficient to confer a regeneration-induced promoter activation, despite increased serum response factor protein binding to this regulatory element in electrophoretic mobility shift assays. Skeletal alpha-actin promoter induction during regeneration is due to a combination of regulatory elements, at least including the SRE and E box.

  5. ISOLASI DAN KARAKTERISASI PROMOTER β-ACTIN DARI IKAN KERAPU BEBEK (Cromileptes altivelis

    Directory of Open Access Journals (Sweden)

    Alimuddin Alimuddin

    2016-11-01

    Promoter as gene expression regulator is one of the factors affecting the successful of transgenesis. Isolation and characterization of β -actin promoter (ktBA from humpback grouper (Cromileptes altivelis towards generation of autotransgenic grouper have been conducted.  β -actin promoter has high activity in muscle. Sequence of ktBA promoter was isolated by using degenerate PCR method. Sequencing was performed using ABI PRISM 3100 machine. Analysis of sequences was conducted using BLAST, GENETYX version 7 and TFBind softwares. DNA fragment of PCR amplification product digested from the vector cloning was then ligated with pEGFPN1 to generate pktBA-GFP construct. The construct was microinjected into one-cell stage of zebrafish (Danio rerio embryos to test the ktBA promoter activity. EGFP gene expression was observed by fluorescence microscope. The result of sequence analysis showed that the length of DNA fragment obtained is about 1.6 kb and containing the evolutionary conserved sequences of transcription factor for β -actin promoter including CCAAT, CArG and TATA boxes. Furthermore, ktBA sequence in pktBA-EGFP construct could drove GFP expression in muscle of zebrafish embryos injected with the construct. The results suggested that PCR amplification product is the regulator sequence of humpback grouper β -actin gene. Autotransgenic grouper can be then produced by changing GFP gene fragment of pktBA-EGFP construct with genes from grouper encoding important traits in aquaculture.

  6. Wnt Signalling Promotes Actin Dynamics during Axon Remodelling through the Actin-Binding Protein Eps8.

    Directory of Open Access Journals (Sweden)

    Eleanna Stamatakou

    Full Text Available Upon arrival at their synaptic targets, axons slow down their growth and extensively remodel before the assembly of presynaptic boutons. Wnt proteins are target-derived secreted factors that promote axonal remodelling and synaptic assembly. In the developing spinal cord, Wnts secreted by motor neurons promote axonal remodelling of NT-3 responsive dorsal root ganglia neurons. Axon remodelling induced by Wnts is characterised by growth cone pausing and enlargement, processes that depend on the re-organisation of microtubules. However, the contribution of the actin cytoskeleton has remained unexplored. Here, we demonstrate that Wnt3a regulates the actin cytoskeleton by rapidly inducing F-actin accumulation in growth cones from rodent DRG neurons through the scaffold protein Dishevelled-1 (Dvl1 and the serine-threonine kinase Gsk3β. Importantly, these changes in actin cytoskeleton occurs before enlargement of the growth cones is evident. Time-lapse imaging shows that Wnt3a increases lamellar protrusion and filopodia velocity. In addition, pharmacological inhibition of actin assembly demonstrates that Wnt3a increases actin dynamics. Through a yeast-two hybrid screen, we identified the actin-binding protein Eps8 as a direct interactor of Dvl1, a scaffold protein crucial for the Wnt signalling pathway. Gain of function of Eps8 mimics Wnt-mediated axon remodelling, whereas Eps8 silencing blocks the axon remodelling activity of Wnt3a. Importantly, blockade of the Dvl1-Eps8 interaction completely abolishes Wnt3a-mediated axonal remodelling. These findings demonstrate a novel role for Wnt-Dvl1 signalling through Eps8 in the regulation of axonal remodeling.

  7. Developmental expression of the alpha-skeletal actin gene

    Directory of Open Access Journals (Sweden)

    Vonk Freek J

    2008-06-01

    Full Text Available Abstract Background Actin is a cytoskeletal protein which exerts a broad range of functions in almost all eukaryotic cells. In higher vertebrates, six primary actin isoforms can be distinguished: alpha-skeletal, alpha-cardiac, alpha-smooth muscle, gamma-smooth muscle, beta-cytoplasmic and gamma-cytoplasmic isoactin. Expression of these actin isoforms during vertebrate development is highly regulated in a temporal and tissue-specific manner, but the mechanisms and the specific differences are currently not well understood. All members of the actin multigene family are highly conserved, suggesting that there is a high selective pressure on these proteins. Results We present here a model for the evolution of the genomic organization of alpha-skeletal actin and by molecular modeling, illustrate the structural differences of actin proteins of different phyla. We further describe and compare alpha-skeletal actin expression in two developmental stages of five vertebrate species (mouse, chicken, snake, salamander and fish. Our findings confirm that alpha-skeletal actin is expressed in skeletal muscle and in the heart of all five species. In addition, we identify many novel non-muscular expression domains including several in the central nervous system. Conclusion Our results show that the high sequence homology of alpha-skeletal actins is reflected by similarities of their 3 dimensional protein structures, as well as by conserved gene expression patterns during vertebrate development. Nonetheless, we find here important differences in 3D structures, in gene architectures and identify novel expression domains for this structural and functional important gene.

  8. Actin-interacting Protein 1 Promotes Disassembly of Actin-depolymerizing Factor/Cofilin-bound Actin Filaments in a pH-dependent Manner.

    Science.gov (United States)

    Nomura, Kazumi; Hayakawa, Kimihide; Tatsumi, Hitoshi; Ono, Shoichiro

    2016-03-04

    Actin-interacting protein 1 (AIP1) is a conserved WD repeat protein that promotes disassembly of actin filaments when actin-depolymerizing factor (ADF)/cofilin is present. Although AIP1 is known to be essential for a number of cellular events involving dynamic rearrangement of the actin cytoskeleton, the regulatory mechanism of the function of AIP1 is unknown. In this study, we report that two AIP1 isoforms from the nematode Caenorhabditis elegans, known as UNC-78 and AIPL-1, are pH-sensitive in enhancement of actin filament disassembly. Both AIP1 isoforms only weakly enhance disassembly of ADF/cofilin-bound actin filaments at an acidic pH but show stronger disassembly activity at neutral and basic pH values. However, a severing-defective mutant of UNC-78 shows pH-insensitive binding to ADF/cofilin-decorated actin filaments, suggesting that the process of filament severing or disassembly, but not filament binding, is pH-dependent. His-60 of AIP1 is located near the predicted binding surface for the ADF/cofilin-actin complex, and an H60K mutation of AIP1 partially impairs its pH sensitivity, suggesting that His-60 is involved in the pH sensor for AIP1. These biochemical results suggest that pH-dependent changes in AIP1 activity might be a novel regulatory mechanism of actin filament dynamics. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Actin genes and their expression in pacific white shrimp, Litopenaeus vannamei.

    Science.gov (United States)

    Zhang, Xiaoxi; Zhang, Xiaojun; Yuan, Jianbo; Du, Jiangli; Li, Fuhua; Xiang, Jianhai

    2018-04-01

    Actin is a multi-functional gene family that can be divided into muscle-type actins and non-muscle-type actins. In this study, 37 unigenes encoding actins were identified from RNA-Seq data of Pacific white shrimp, Litopenaeus vannamei. According to phylogenetic analysis, four and three cDNAs belong to cytoplasmic- and heart-type actins and were named LvActinCT and LvActinHT, respectively. 10 cDNAs belong to the slow-type skeletal muscle actins, and 18 belong to the fast-type skeletal muscle actins; they were designated LvActinSSK and LvActinFSK, respectively. Some muscle actin genes formed gene clusters in the genome. Multiple alternative transcription starts sites (ATSSs) were found for LvActinCT1. Based on the early developmental expression profile, almost all LvActins were highly expressed between the early limb bud and post-larval stages. Using LvActinSSK5 as probes, slow-type muscle was localized in pleopod muscle and superficial ventral muscle. We also found three actin genes that were down-regulated in the hemocytes of white spot syndrome virus (WSSV)- and Vibrio parahaemolyticus-infected L. vannamei. This study provides valuable information on the actin gene structure of shrimp, furthers our understanding of the shrimp muscle system and helps us develop strategies for disease control and sustainable shrimp farming.

  10. Mapping of the Mouse Actin Capping Protein Beta Subunit Gene

    Directory of Open Access Journals (Sweden)

    Cooper John A

    2000-07-01

    Full Text Available Abstract Background Capping protein (CP, a heterodimer of α and β subunits, is found in all eukaryotes. CP binds to the barbed ends of actin filaments in vitro and controls actin assembly and cell motility in vivo. Vertebrates have three isoforms of CPβ produced by alternatively splicing from one gene; lower organisms have one gene and one isoform. Results We isolated genomic clones corresponding to the β subunit of mouse CP and identified its chromosomal location by interspecies backcross mapping. Conclusions The CPβ gene (Cappb1 mapped to Chromosome 4 between Cdc42 and D4Mit312. Three mouse mutations, snubnose, curly tail, and cribriform degeneration, map in the vicinity of the β gene.

  11. Prolactin promotes breast cancer cell migration through actin cytoskeleton remodeling

    Directory of Open Access Journals (Sweden)

    Priscilla Ludovico da Silva

    2015-12-01

    Full Text Available The role of prolactin on breast cancer development and progression is debated. Breast cancer progression largely depends on cell movement and on the ability to remodel the actin cytoskeleton. In this process, actin-binding proteins are requested to achieve fibrillar actin de-polymerization and relocation at the cell membrane. Kinases such as focal adhesion kinase (FAK are later required to form actin/vinculin-enriched structures called focal adhesion complexes, which mediate firm adhesion to the extracellular matrix. These controllers are regulated by c-Src, which forms multiprotein signaling complexes with membrane receptors and is regulated by a number of hormones, including prolactin. We here show that breast cancer cells exposed to prolactin display an elevated c-Src expression and phosphorylation. In parallel, increased moesin and FAK expression and phosphorylation are found. These molecular changes are associated to relocation to the plasma membrane of cytoskeletal actin fibers and to increased horizontal cell movement. In conclusion, prolactin regulates actin remodeling and enhances breast cancer cell movement. This finding broadens the understanding of prolactin actions on breast cancer cells, highlighting new pathways that may be relevant to on breast cancer progression.

  12. The Pacific White Shrimp β-actin Promoter: Functional Properties and the Potential Application for Transduction System Using Recombinant Baculovirus.

    Science.gov (United States)

    Shi, Yingli; Xiang, Jianhai; Zhou, Guangzhou; Ron, Tetsuzan Benny; Tong, Hsin-I; Kang, Wen; Sun, Si; Lu, Yuanan

    2016-06-01

    A newly isolated Pacific white shrimp (Litopenaeus vannamei) beta-actin promoter SbaP and its derivative compact construct SbaP (ENX) have recently been demonstrated to promote ectopic gene expression in vitro and in vivo. To further explore the potential transduction application, this newly isolated shrimp promoter SbaP was comparatively tested with cytomegalovirus (CMV), simian virus 40 (SV40), polyhedrin (Polh), and white spot syndrome virus immediate early gene 1 (WSSV ie1) four constitutive promoters and a beta-actin promoter (TbaP) from tilapia fish to characterize its promoting function in eight different cell lines. Luciferase quantitation assays revealed that SbaP can drive luciferase gene expression in all eight cell lines including sf21 (insect), PAC2 (zebrafish), EPC (carp), CHSE-214 (chinook salmon), GSTEF (green sea turtle), MS-1 (monk seal), 293T (human), and HeLa (human), but at different levels. Comparative analysis revealed that the promoting activity of SbaP was lower (≤10-fold) than CMV but higher (2-20 folds) than Polh in most of these cell lines tested. Whereas, SbaP mediated luciferase expression in sf21 cells was over 20-fold higher than CMV, SV40, Polh, and TbaP promoter. Compared to the SbaP, SbaP (ENX), which was constructed on the basis of SbaP by deletion of two "negative" regulatory elements, exhibited no significant change of promoting activity in EPC and PAC2 cells, but a 5 and 16 % lower promoting effect in 293T and HeLa cells, respectively. Additionally, a recombinant baculovirus was constructed under the control of SbaP (ENX), and efficient promoter activity of newly generated baculoviral vector was detected both in vitro of infected sf21 cells and in vivo of injected indicator shrimp. These results warrant the potential application of SbaP, particularly SbaP (ENX) in ectopic gene expression in future.

  13. EZH2-mediated α-actin methylation needs lncRNA TUG1, and promotes the cortex cytoskeleton formation in VSMCs.

    Science.gov (United States)

    Chen, Rong; Kong, Peng; Zhang, Fan; Shu, Ya-Nan; Nie, Xi; Dong, Li-Hua; Lin, Yan-Ling; Xie, Xiao-Li; Zhao, Li-Li; Zhang, Xiang-Jian; Han, Mei

    2017-06-15

    Recent studies have revealed that long non-coding RNAs (lncRNAs) participate in vascular homeostasis and pathophysiological conditions development. But still very few literatures elucidate the regulatory mechanism of non-coding RNAs in this biological process. Here we identified lncRNA taurine up-regulated gene 1 (TUG1) in rat vascular smooth muscle cells (VSMCs), and got 4612bp nucleotide sequence. The expression level of TUG1 RNA was increased in synthetic VSMCs by real-time PCR analysis. Meanwhile, the expression of enhancer of zeste homolog 2 (EZH2) (TUG1 binding protein) increased in cytoplasm of VSMCs under the same conditions. Immunofluoresce analysis displayed the colocalization of EZH2 with α-actin in cytoplasm and F-actin in cell edge ruffles. This leads us to hypothesize the existence of cytoplasmic TUG1/EZH2/α-actin complex. Using RNA pull down assay, we found that TUG1 interacted with both EZH2 and α-actin. Disruption of TUG1 abolished the interaction of EZH2 with α-actin, and accelerated depolymerization of F-actin in VSMCs. Based on EZH2 methyltransferase activity and the potential methylation sites in α-actin structure, we revealed that α-actin was lysine-methylated. Furthermore, the methylation of α-actin was inhibited by knockdown of TUG1. In conclusion, these findings partly suggested that EZH2-mediated methylation of α-actin may be dependent on TUG1, and thereby promotes cortex F-actin polymerization in synthetic VSMCs. Copyright © 2017. Published by Elsevier B.V.

  14. Actin gene identification from selected medicinal plants for their use as internal controls for gene expression studies

    International Nuclear Information System (INIS)

    Mufti, F.U.D.; Banaras, S.

    2015-01-01

    Internal control genes are the constitutive genes which maintain the basic cellular functions and regularly express in both normal and stressed conditions in living organisms. They are used in normalization of gene expression studies in comparative analysis of target genes, as their expression remains comparatively unchanged in all varied conditions. Among internal control genes, actin is considered as a candidate gene for expression studies due to its vital role in shaping cytoskeleton and plant physiology. Unfortunately most of such knowledge is limited to only model plants or crops, not much is known about important medicinal plants. Therefore, we selected seven important medicinal wild plants for molecular identification of actin gene. We used gene specific primers designed from the conserved regions of several known orthologues or homologues of actin genes from other plants. The amplified products of 370-380 bp were sequenced and submitted to GeneBank after their confirmation using different bioinformatics tools. All the novel partial sequences of putative actin genes were submitted to GeneBank (Parthenium hysterophorus (KJ774023), Fagonia indica (KJ774024), Rhazya stricta (KJ774025), Whithania coagulans (KJ774026), Capparis decidua (KJ774027), Verbena officinalis (KJ774028) and Aerva javanica (KJ774029)). The comparisons of these partial sequences by Basic Local Alignment Search Tool (BLAST) and phylogenetic trees demonstrated high similarity with known actin genes of other plants. Our findings illustrated highly conserved nature of actin gene among these selected plants. These novel partial fragments of actin genes from these wild medicinal plants can be used as internal controls for future gene expression studies of these important plants after precise validations of their stable expression in such plants. (author)

  15. Endophilin A1 Promotes Actin Polymerization in Dendritic Spines Required for Synaptic Potentiation

    Directory of Open Access Journals (Sweden)

    Yanrui Yang

    2018-05-01

    Full Text Available Endophilin A1 is a member of the N-BAR domain-containing endophilin A protein family that is involved in membrane dynamics and trafficking. At the presynaptic terminal, endophilin As participate in synaptic vesicle recycling and autophagosome formation. By gene knockout studies, here we report that postsynaptic endophilin A1 functions in synaptic plasticity. Ablation of endophilin A1 in the hippocampal CA1 region of mature mouse brain impairs long-term spatial and contextual fear memory. Its loss in CA1 neurons postsynaptic of the Schaffer collateral pathway causes impairment in their AMPA-type glutamate receptor-mediated synaptic transmission and long-term potentiation. In KO neurons, defects in the structural and functional plasticity of dendritic spines can be rescued by overexpression of endophilin A1 but not A2 or A3. Further, endophilin A1 promotes actin polymerization in dendritic spines during synaptic potentiation. These findings reveal a physiological role of endophilin A1 distinct from that of other endophilin As at the postsynaptic site.

  16. Molecular analysis of an actin gene, CarACT1, from chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Peng, Hui; Cheng, Huiying; Yu, Xingwang; Shi, Qinghua; Zhang, Hua; Li, Jiangui; Ma, Hao

    2010-02-01

    Actins are ubiquitous and highly conserved proteins that play key roles in cell formation and cellular activities. In this study, an actin gene was isolated from chickpea for the first time and designated as CarACT1 (for Cicer arietinum L. actin gene 1; Genbank accession no. EU529707). It encoded a putative protein with 377 amino acids and contained five exons and four introns within genomic DNA sequence. CarACT1 was localized in cytoplasm and showed high similarity to other well known actins from various species. Reverse transcription-polymerase chain reaction (RT-PCR) assay proved that CarACT1 transcripts were ubiquitously accumulated in all major organs, such as seedling roots, stems, leaves, flowers, young pods, and seeds, as well as in diverse developmental stages, such as leaf senescence, seed development and germination. Our results suggested that CarACT1 is an actin gene with physiological functions and may be served as a potential reference gene for transcription level of interesting genes in chickpea.

  17. Disruption of the actin cytoskeleton results in the promotion of gravitropism in inflorescence stems and hypocotyls of Arabidopsis

    Science.gov (United States)

    Yamamoto, Kazuyoshi; Kiss, John Z.

    2002-01-01

    The actin cytoskeleton is hypothesized to play a major role in gravity perception and transduction mechanisms in roots of plants. To determine whether actin microfilaments (MFs) are involved in these processes in stem-like organs, we studied gravitropism in Arabidopsis inflorescence stems and hypocotyls. Localization studies using Alexa Fluor-phalloidin in conjugation with confocal microscopy demonstrated a longitudinally and transversely oriented actin MF network in endodermal cells of stems and hypocotyls. Latrunculin B (Lat-B) treatment of hypocotyls caused depolymerization of actin MFs in endodermal cells and a significant reduction of hypocotyl growth rates. Actin MFs in Lat-B-treated inflorescence stems also were disrupted, but growth rates were not affected. Despite disruption of the actin cytoskeleton in these two organs, Lat-B-treated stems and hypocotyls exhibited a promotion of gravitropic curvature in response to reorientation. In contrast, Lat-B reduced gravitropic curvature in roots but also reduced the growth rate. Thus, in contrast to prevailing hypotheses, our results suggest that actin MFs are not a necessary component of gravitropism in inflorescence stems and hypocotyls. Furthermore, this is the first study to demonstrate a prominent actin MF network in endodermal cells in the putative gravity-perceiving cells in stems.

  18. RickA expression is not sufficient to promote actin-based motility of Rickettsia raoultii.

    Directory of Open Access Journals (Sweden)

    Premanand Balraj

    Full Text Available BACKGROUND: Rickettsia raoultii is a novel Rickettsia species recently isolated from Dermacentor ticks and classified within the spotted fever group (SFG. The inability of R. raoultii to spread within L929 cells suggests that this bacterium is unable to polymerize host cell actin, a property exhibited by all SFG rickettsiae except R. peacocki. This result led us to investigate if RickA, the protein thought to generate actin nucleation, was expressed within this rickettsia species. METHODOLOGY/PRINCIPAL FINDINGS: Amplification and sequencing of R. raoultii rickA showed that this gene encoded a putative 565 amino acid protein highly homologous to those found in other rickettsiae. Using immunofluorescence assays, we determined that the motility pattern (i.e. microcolonies or cell-to-cell spreading of R. raoultii was different depending on the host cell line in which the bacteria replicated. In contrast, under the same experimental conditions, R. conorii shares the same phenotype both in L929 and in Vero cells. Transmission electron microscopy analysis of infected cells showed that non-motile bacteria were free in the cytosol instead of enclosed in a vacuole. Moreover, western-blot analysis demonstrated that the defect of R. raoultii actin-based motility within L929 cells was not related to lower expression of RickA. CONCLUSION/SIGNIFICANCE: These results, together with previously published data about R. typhi, strongly suggest that another factor, apart from RickA, may be involved with be responsible for actin-based motility in bacteria from the Rickettsia genus.

  19. MRP-1/CD9 gene transduction regulates the actin cytoskeleton through the downregulation of WAVE2.

    Science.gov (United States)

    Huang, C-L; Ueno, M; Liu, D; Masuya, D; Nakano, J; Yokomise, H; Nakagawa, T; Miyake, M

    2006-10-19

    Motility-related protein-1 (MRP-1/CD9) is involved in cell motility. We studied the change in the actin cytoskeleton, and the expression of actin-related protein (Arp) 2 and Arp3 and the Wiskott-Aldrich syndrome protein (WASP) family according to MRP-1/CD9 gene transduction into HT1080 cells. The frequency of cells with lamellipodia was significantly lower in MRP-1/CD9-transfected HT1080 cells than in control HT1080 cells (PMRP-1/CD9 gene transduction affected the subcellular localization of Arp2 and Arp3 proteins. Furthermore, MRP-1/CD9 gene transduction induced a downregulation of WAVE2 expression (PMRP-1/CD9 monoclonal antibody inhibited downregulation of WAVE2 in MRP-1/CD9-transfected HT1080 cells (PMRP-1/CD9 gene transduction. Furthermore, downregulation of WAVE2 by transfection of WAVE2-specific small interfering RNA (siRNA) mimicked the morphological effects of MRP-1/CD9 gene transduction and suppressed cell motility. However, transfection of each siRNA for Wnt1, Wnt2b1 or Wnt5a did not affect WAVE2 expression. Transfection of WAVE2-specific siRNA also did not affect expressions of these Wnts. These results indicate that MRP-1/CD9 regulates the actin cytoskeleton by downregulating of the WAVE2, through the Wnt-independent signal pathway.

  20. Molecular typing of the actin gene of Trichomonas vaginalis isolates by PCR-RFLP in Iran.

    Science.gov (United States)

    Momeni, Zohreh; Sadraei, Javid; Kazemi, Bahram; Dalimi, Abdolhossein

    2015-12-01

    Trichomonas vaginalis is a human urogenital pathogen that causes trichomoniasis, the most common nonviral, parasitic sexually transmitted infection in the world. At present, little is known regarding the degree of strain variability of T. vaginalis. A classification method for T. vaginalis strains would be a useful tool in the study of the epidemiology, drug resistance, pathogenesis and transmission of T. vaginalis. Eight different types of actin genes have been identified by PCR-RFLP in T. vaginalis; the purpose of this study is to determine the genotypes of this parasite in Karaj city, Iran. Forty-five clinical T. vaginalis isolates from vaginal secretions and urine sediment were collected from Karaj city from 2012 through 2014. DNA was extracted and the actin gene was amplified by nested-PCR; all samples were positive. To determine the genetic differences, sequencing on seven samples was conducted. Then, all PCR products were digested with HindII, MseI, and RsaI restriction enzymes. Of 45 isolates, 23 samples (51.1%) were of actin genotype G, 11 samples (24.4%) of genotype E, six samples (13.3%) of genotype H, three samples (6.6%) of genotype I, and two samples (4.4%) were mixed genotypes of G and E. Genetic diversity of T. vaginalis isolates is notable. The actin genotype G may be the dominant genotype in Karaj city, Iran. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Mapping of the mouse actin capping protein {alpha} subunit genes and pseudogenes

    Energy Technology Data Exchange (ETDEWEB)

    Hart, M.C.; Korshunova, Y.O.; Cooper, J.A. [Washington Univ. School of Medicine, St. Louis, MO (United States)

    1997-02-01

    Capping protein (CP), a heterodimer of {alpha} and {beta} subunits, is found in all eukaryotes. CP binds to the barbed ends of actin filaments in vitro and controls actin assembly and cell motility in vivo. Vertebrates have three {alpha} isoforms ({alpha}1, {alpha}2, {alpha}3) produced from different genes, whereas lower organisms have only one gene and one isoform. We isolated genomic clones corresponding to the a subunits of mouse CP and found three {alpha}1 genes, two of which are pseudogenes, and a single gene for both {alpha}2 and {alpha}3. Their chromosomal locations were identified by interspecies backcross mapping. The {alpha}1 gene (Cappa1) mapped to Chromosome 3 between D3Mit11 and D3Mit13. The {alpha}1 pseudogenes (Cappa1-ps1 and Cappa1-ps2) mapped to Chromosomes 1 and 9, respectively. The {alpha}2 gene (Cappa2) mapped to Chromosome 6 near Ptn. The {alpha}3 gene (Cappa3) also mapped to Chromosome 6, approximately 68 cM distal from Cappa2 near Kras2. One mouse mutation, de, maps in the vicinity of the {alpha}1 gene. No known mouse mutations map to regions near the {alpha}2 or {alpha}3 genes. 29 refs., 3 figs., 1 tab.

  2. Low-intensity infrared lasers alter actin gene expression in skin and muscle tissue

    International Nuclear Information System (INIS)

    Fonseca, A S; Mencalha, A L; Campos, V M A; Ferreira-Machado, S C; Peregrino, A A F; Magalhães, L A G; Geller, M; Paoli, F

    2013-01-01

    The biostimulative effect of low-intensity lasers is the basis for treatment of diseases in soft tissues. However, data about the influence of biostimulative lasers on gene expression are still scarce. The aim of this work was to evaluate the effects of low-intensity infrared lasers on the expression of actin mRNA in skin and muscle tissue. Skin and muscle tissue of Wistar rats was exposed to low-intensity infrared laser radiation at different fluences and frequencies. One and 24 hours after laser exposure, tissue samples were withdrawn for total RNA extraction, cDNA synthesis and evaluation of actin gene expression by quantitative polymerase chain reaction. The data obtained show that laser radiation alters the expression of actin mRNA differently in skin and muscle tissue of Wistar rats depending of the fluence, frequency and time after exposure. The results could be useful for laser dosimetry, as well as to justify the therapeutic protocols for treatment of diseases of skin and muscle tissues based on low-intensity infrared laser radiation. (paper)

  3. Cell stress promotes the association of phosphorylated HspB1 with F-actin.

    Directory of Open Access Journals (Sweden)

    Joseph P Clarke

    Full Text Available Previous studies have suggested that the small heat shock protein, HspB1, has a direct influence on the dynamics of cytoskeletal elements, in particular, filamentous actin (F-actin polymerization. In this study we have assessed the influence of HspB1 phosphorylation on its interaction(s with F-actin. We first determined the distribution of endogenous non-phosphorylated HspB1, phosphorylated HspB1 and F-actin in neuroendocrine PC12 cells by immunocytochemistry and confocal microscopy. We then investigated a potential direct interaction between HspB1 with F-actin by precipitating F-actin directly with biotinylated phalloidin followed by Western analyses; the reverse immunoprecipitation of HspB1 was also carried out. The phosphorylation influence of HspB1 in this interaction was investigated by using pharmacologic inhibition of p38 MAPK. In control cells, HspB1 interacts with F-actin as a predominantly non-phosphorylated protein, but subsequent to stress there is a redistribution of HspB1 to the cytoskeletal fraction and a significantly increased association of pHspB1 with F-actin. Our data demonstrate HspB1 is found in a complex with F-actin both in phosphorylated and non-phosphorylated forms, with an increased association of pHspB1 with F-actin after heat stress. Overall, our study combines both cellular and biochemical approaches to show cellular localization and direct demonstration of an interaction between endogenous HspB1 and F-actin using methodolgy that specifically isolates F-actin.

  4. Cytoskeletal actin genes function downstream of HNF-3beta in ascidian notochord development.

    Science.gov (United States)

    Jeffery, W R; Ewing, N; Machula, J; Olsen, C L; Swalla, B J

    1998-11-01

    We have examined the expression and regulation of cytoskeletal actin genes in ascidians with tailed (Molgula oculata) and tailless larvae (Molgula occulta). Four cDNA clones were isolated representing two pairs of orthologous cytoskeletal actin genes (CA1 and CA2), which encode proteins differing by five amino acids in the tailed and tailless species. The CA1 and CA2 genes are present in one or two copies, although several related genes may also be present in both species. Maternal CA1 and CA2 mRNA is present in small oocytes but transcript levels later decline, suggesting a role in early oogenesis. In the tailed species, embryonic CA1 and CA2 mRNAs first appear in the presumptive mesenchyme and muscle cells during gastrulation, subsequently accumulate in the presumptive notochord cells, and can be detected in these tissues through the tadpole stage. CA1 mRNAs accumulate initially in the same tissues in the tailless species but subsequently disappear, in concert with the arrest of notochord and tail development. In contrast, CA2 mRNAs were not detected in embryos of the tailless species. Fertilization of eggs of the tailless species with sperm of the tailed species, which restores the notochord and the tail, also results in the upregulation of CA1 and CA2 gene expression in hybrid embryos. Antisense oligodeoxynucleotide experiments suggest that CA1 and CA2 expression in the notochord, but not in the muscle cells, is dependent on prior expression of Mocc FHI, an ascidian HNF-3beta-like gene. The expression of the CA1 and CA2 genes in the notochord in the tailed species, downregulation in the tailless species, upregulation in interspecific hybrids, and dependence on HNF-3beta activity is consistent with a role of these genes in development of the ascidian notochord.

  5. Molecular typing of Trichomonas vaginalis isolates by actin gene sequence analysis and carriage of T. vaginalis viruses.

    Science.gov (United States)

    Masha, Simon C; Cools, Piet; Crucitti, Tania; Sanders, Eduard J; Vaneechoutte, Mario

    2017-10-30

    The protozoan parasite Trichomonas vaginalis is the most common non-viral, sexually transmitted pathogen. Although T. vaginalis is highly prevalent among women in Kenya, there is lack of data regarding genetic diversity of isolates currently in circulation in Kenya. Typing was performed on 22 clinical isolates of T. vaginalis collected from women attending the antenatal care clinic at Kilifi County Hospital, Kenya, in 2015. Genotyping followed a previously proposed restriction fragment length polymorphism (RFLP) scheme, which involved in silico cleavage of the amplified actin gene by HindII, MseI and RsaI restriction enzymes. Phylogenetic analysis of all the sequences was performed to confirm the results obtained by RFLP-analysis and to assess the diversity within the RFLP genotypes. Additionally, we determined carriage of the four different types of Trichomonas vaginalis viruses (TVVs) by polymerase chain reaction. In silico RFLP-analysis revealed five actin genotypes; 50.0% of the isolates were of actin genotype E, 27.3% of actin genotype N, 13.6% of actin genotype G and 4.5% of actin genotypes I and P. Phylogenetic analysis was in agreement with the RFLP-analysis, with the different actin genotypes clustering together. Prevalence of TVVs was 43.5% (95% confidence interval, CI: 23.2-65.5). TVV1 was the most prevalent, present in 39.1% of the strains and 90% of the T. vaginalis isolates which harbored TVVs had more than one type of TVV. None of the isolates of actin genotype E harbored any TVV. The presence of five actin genotypes in our study suggests notable diversity among T. vaginalis isolates occurring among pregnant women in Kilifi, Kenya. Isolates of the most prevalent actin genotype E lacked TVVs. We found no association between T. vaginalis genotype, carriage of TVVs and symptoms. Further studies with higher number of strains should be conducted in order to corroborate these results.

  6. Molecular typing of Trichomonas vaginalis isolates by actin gene sequence analysis and carriage of T. vaginalis viruses

    Directory of Open Access Journals (Sweden)

    Simon C. Masha

    2017-10-01

    Full Text Available Abstract Background The protozoan parasite Trichomonas vaginalis is the most common non-viral, sexually transmitted pathogen. Although T. vaginalis is highly prevalent among women in Kenya, there is lack of data regarding genetic diversity of isolates currently in circulation in Kenya. Methods Typing was performed on 22 clinical isolates of T. vaginalis collected from women attending the antenatal care clinic at Kilifi County Hospital, Kenya, in 2015. Genotyping followed a previously proposed restriction fragment length polymorphism (RFLP scheme, which involved in silico cleavage of the amplified actin gene by HindII, MseI and RsaI restriction enzymes. Phylogenetic analysis of all the sequences was performed to confirm the results obtained by RFLP-analysis and to assess the diversity within the RFLP genotypes. Additionally, we determined carriage of the four different types of Trichomonas vaginalis viruses (TVVs by polymerase chain reaction. Results In silico RFLP-analysis revealed five actin genotypes; 50.0% of the isolates were of actin genotype E, 27.3% of actin genotype N, 13.6% of actin genotype G and 4.5% of actin genotypes I and P. Phylogenetic analysis was in agreement with the RFLP-analysis, with the different actin genotypes clustering together. Prevalence of TVVs was 43.5% (95% confidence interval, CI: 23.2–65.5. TVV1 was the most prevalent, present in 39.1% of the strains and 90% of the T. vaginalis isolates which harbored TVVs had more than one type of TVV. None of the isolates of actin genotype E harbored any TVV. Conclusion The presence of five actin genotypes in our study suggests notable diversity among T. vaginalis isolates occurring among pregnant women in Kilifi, Kenya. Isolates of the most prevalent actin genotype E lacked TVVs. We found no association between T. vaginalis genotype, carriage of TVVs and symptoms. Further studies with higher number of strains should be conducted in order to corroborate these results.

  7. Reduced myelin basic protein and actin-related gene expression in visual cortex in schizophrenia.

    Science.gov (United States)

    Matthews, Paul R; Eastwood, Sharon L; Harrison, Paul J

    2012-01-01

    Most brain gene expression studies of schizophrenia have been conducted in the frontal cortex or hippocampus. The extent to which alterations occur in other cortical regions is not well established. We investigated primary visual cortex (Brodmann area 17) from the Stanley Neuropathology Consortium collection of tissue from 60 subjects with schizophrenia, bipolar disorder, major depression, or controls. We first carried out a preliminary array screen of pooled RNA, and then used RT-PCR to quantify five mRNAs which the array identified as differentially expressed in schizophrenia (myelin basic protein [MBP], myelin-oligodendrocyte glycoprotein [MOG], β-actin [ACTB], thymosin β-10 [TB10], and superior cervical ganglion-10 [SCG10]). Reduced mRNA levels were confirmed by RT-PCR for MBP, ACTB and TB10. The MBP reduction was limited to transcripts containing exon 2. ACTB and TB10 mRNAs were also decreased in bipolar disorder. None of the transcripts were altered in subjects with major depression. Reduced MBP mRNA in schizophrenia replicates findings in other brain regions and is consistent with oligodendrocyte involvement in the disorder. The decreases in expression of ACTB, and the actin-binding protein gene TB10, suggest changes in cytoskeletal organisation. The findings confirm that the primary visual cortex shows molecular alterations in schizophrenia and extend the evidence for a widespread, rather than focal, cortical pathophysiology.

  8. Actin is closely associated with RNA polymerase II and involved in activation of gene transcription

    International Nuclear Information System (INIS)

    Zhu Xiaojuan; Zeng Xianlu; Huang Baiqu; Hao, Shui

    2004-01-01

    Biochemical and morphological studies have demonstrated the presence of actin in the nucleus of different eukaryotic cells, whereas its role remains unclear. In this work, we studied the interaction and the functional relationship between nuclear actin and RNA polymerase II (RNAP II). The immunofluorescence study demonstrated a clear co-localization of nuclear actin with RNAP II in HeLa cells. Meanwhile, actin can be immunoprecipitated by anti-RNAP II antibody, indicating that they could interact with each other. Treatment of cells with α-amanitin induced the formation of actin bundle network in the nucleoplasm. Blocking of the formation of filamentous actin (F-actin) by cytochalasin B modified the distribution of actin. Although the actin content remained unchanged in resting and concanavalinA stimulated mouse lymphocytes, the actin content in the nuclei showed a progressive increase after stimulation. Furthermore, the antibody against actin blocked RNA synthesis in a eukaryotic in vitro transcription system. These observations implicate that nuclear actin interacts with RNAP II and may have function on the RNAP II-mediated transcription

  9. Genome-wide identification, phylogenetic classification, and exon-intron structure characterisation of the tubulin and actin genes in flax (Linum usitatissimum).

    Science.gov (United States)

    Pydiura, Nikolay; Pirko, Yaroslav; Galinousky, Dmitry; Postovoitova, Anastasiia; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav

    2018-06-08

    Flax (Linum usitatissimum L.) is a valuable food and fiber crop cultivated for its quality fiber and seed oil. α-, β-, γ-tubulins and actins are the main structural proteins of the cytoskeleton. α- and γ-tubulin and actin genes have not been characterized yet in the flax genome. In this study, we have identified 6 α-tubulin genes, 13 β-tubulin genes, 2 γ-tubulin genes, and 15 actin genes in the flax genome and analysed the phylogenetic relationships between flax and A. thaliana tubulin and actin genes. Six α-tubulin genes are represented by 3 paralogous pairs, among 13 β-tubulin genes 7 different isotypes can be distinguished, 6 of which are encoded by two paralogous genes each. γ-tubulin is represented by a paralogous pair of genes one of which may be not functional. Fifteen actin genes represent 7 paralogous pairs - 7 actin isotypes and a sequentially duplicated copy of one of the genes of one of the isotypes. Exon-intron structure analysis has shown intron length polymorphism within the β-tubulin genes and intron number variation among the α-tubulin gene: 3 or 4 introns are found in two or four genes, respectively. Intron positioning occurs at conservative sites, as observed in numerous other plant species. Flax actin genes show both intron length polymorphisms and variation in the number of intron that may be 2 or 3. These data will be useful to support further studies on the specificity, functioning, regulation and evolution of the flax cytoskeleton proteins. This article is protected by copyright. All rights reserved.

  10. Actinic keratosis

    Science.gov (United States)

    Solar keratosis; Sun-induced skin changes - keratosis; Keratosis - actinic (solar); Skin lesion - actinic keratosis ... Actinic keratosis is caused by exposure to sunlight. You are more likely to develop it if you: Have fair ...

  11. The adaptor molecule Nck localizes the WAVE complex to promote actin polymerization during CEACAM3-mediated phagocytosis of bacteria.

    Directory of Open Access Journals (Sweden)

    Stefan Pils

    Full Text Available BACKGROUND: CEACAM3 is a granulocyte receptor mediating the opsonin-independent recognition and phagocytosis of human-restricted CEACAM-binding bacteria. CEACAM3 function depends on an intracellular immunoreceptor tyrosine-based activation motif (ITAM-like sequence that is tyrosine phosphorylated by Src family kinases upon receptor engagement. The phosphorylated ITAM-like sequence triggers GTP-loading of Rac by directly associating with the guanine nucleotide exchange factor (GEF Vav. Rac stimulation in turn is critical for actin cytoskeleton rearrangements that generate lamellipodial protrusions and lead to bacterial uptake. PRINCIPAL FINDINGS: In our present study we provide biochemical and microscopic evidence that the adaptor proteins Nck1 and Nck2, but not CrkL, Grb2 or SLP-76, bind to tyrosine phosphorylated CEACAM3. The association is phosphorylation-dependent and requires the Nck SH2 domain. Overexpression of the isolated Nck1 SH2 domain, RNAi-mediated knock-down of Nck1, or genetic deletion of Nck1 and Nck2 interfere with CEACAM3-mediated bacterial internalization and with the formation of lamellipodial protrusions. Nck is constitutively associated with WAVE2 and directs the actin nucleation promoting WAVE complex to tyrosine phosphorylated CEACAM3. In turn, dominant-negative WAVE2 as well as shRNA-mediated knock-down of WAVE2 or the WAVE-complex component Nap1 reduce internalization of bacteria. CONCLUSIONS: Our results provide novel mechanistic insight into CEACAM3-initiated phagocytosis. We suggest that the CEACAM3 ITAM-like sequence is optimized to co-ordinate a minimal set of cellular factors needed to efficiently trigger actin-based lamellipodial protrusions and rapid pathogen engulfment.

  12. Grapevine fatty acid hydroperoxide lyase generates actin-disrupting volatiles and promotes defence-related cell death

    Science.gov (United States)

    Wang, Hao; Claudel, Patricia; Riemann, Michael; Hause, Bettina; Hugueney, Philippe; Nick, Peter

    2018-01-01

    Abstract Fatty acid hydroperoxides can generate short-chained volatile aldehydes that may participate in plant defence. A grapevine hydroperoxide lyase (VvHPL1) clustering to the CYP74B class was functionally characterized with respect to a role in defence. In grapevine leaves, transcripts of this gene accumulated rapidly to high abundance in response to wounding. Cellular functions of VvHPL1 were investigated upon heterologous expression in tobacco BY-2 cells. A C-terminal green fluorescent protein (GFP) fusion of VvHPL1 was located in plastids. The overexpression lines were found to respond to salinity stress or the bacterial elicitor harpin by increasing cell death. This signal-dependent mortality response was mitigated either by addition of exogenous jasmonic acid or by treatment with diphenyleneiodonium (DPI), an inhibitor of NADPH oxidases. By feeding different substrates to recombinantly expressed enzyme, VvHPL1 could also be functionally classified as true 13-HPL. The cognate products generated by this 13-HPL were cis-3-hexenal and trans-2-hexenal. Using a GFP-tagged actin marker line, one of these isomeric products, cis-3-hexenal, was found specifically to elicit a rapid disintegration of actin filaments. This response was not only observed in the heterologous system (tobacco BY-2), but also in a grapevine cell strain expressing this marker, as well as in leaf discs from an actin marker grape used as a homologous system. These results are discussed in the context of a role for VvHPL1 in a lipoxygenase-dependent signalling pathway triggering cell death-related defence that bifurcates from jasmonate-dependent basal immunity. PMID:29659985

  13. The ubiquitin C-terminal hydrolase UCH-L1 promotes bacterial invasion by altering the dynamics of the actin cytoskeleton

    DEFF Research Database (Denmark)

    Basseres, Eugene; Coppotelli, Giuseppe; Pfirrmann, Thorsten

    2010-01-01

    Invasion of eukaryotic target cells by pathogenic bacteria requires extensive remodelling of the membrane and actin cytoskeleton. Here we show that the remodelling process is regulated by the ubiquitin C-terminal hydrolase UCH-L1 that promotes the invasion of epithelial cells by Listeria monocyto......Invasion of eukaryotic target cells by pathogenic bacteria requires extensive remodelling of the membrane and actin cytoskeleton. Here we show that the remodelling process is regulated by the ubiquitin C-terminal hydrolase UCH-L1 that promotes the invasion of epithelial cells by Listeria...... of downstream ERK1/2- and AKT-dependent signalling in response to the natural ligand Hepatocyte Growth Factor (HGF). The regulation of cytoskeleton dynamics was further confirmed by the induction of actin stress fibres in HeLa expressing the active enzyme but not the catalytic mutant UCH-L1(C90S...

  14. Platelet rich plasma promotes skeletal muscle cell migration in association with up-regulation of FAK, paxillin, and F-Actin formation.

    Science.gov (United States)

    Tsai, Wen-Chung; Yu, Tung-Yang; Lin, Li-Ping; Lin, Mioa-Sui; Tsai, Ting-Ta; Pang, Jong-Hwei S

    2017-11-01

    Platelet rich plasma (PRP) contains various cytokines and growth factors which may be beneficial to the healing process of injured muscle. The aim of this study was to investigate the effect and molecular mechanism of PRP on migration of skeletal muscle cells. Skeletal muscle cells intrinsic to Sprague-Dawley rats were treated with PRP. The cell migration was evaluated by transwell filter migration assay and electric cell-substrate impedance sensing. The spreading of cells was evaluated microscopically. The formation of filamentous actin (F-actin) cytoskeleton was assessed by immunofluorescence staining. The protein expressions of paxillin and focal adhesion kinase (FAK) were assessed by Western blot analysis. Transfection of paxillin small-interfering RNA (siRNAs) to muscle cells was performed to validate the role of paxillin in PRP-mediated promotion of cell migration. Dose-dependently PRP promotes migration of and spreading and muscle cells. Protein expressions of paxillin and FAK were up-regulated dose-dependently. F-actin formation was also enhanced by PRP treatment. Furthermore, the knockdown of paxillin expression impaired the effect of PRP to promote cell migration. It was concluded that PRP promoting migration of muscle cells is associated with up-regulation of proteins expression of paxillin and FAK as well as increasing F-actin formation. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:2506-2512, 2017. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  15. Molecular karyotype and chromosomal localization of genes encoding ß-tubulin, cysteine proteinase, hsp 70 and actin in Trypanosoma rangeli

    Directory of Open Access Journals (Sweden)

    CB Toaldo

    2001-01-01

    Full Text Available The molecular karyotype of nine Trypanosoma rangeli strains was analyzed by contour-clamped homogeneous electric field electrophoresis, followed by the chromosomal localization of ß-tubulin, cysteine proteinase, 70 kDa heat shock protein (hsp 70 and actin genes. The T. rangeli strains were isolated from either insects or mammals from El Salvador, Honduras, Venezuela, Colombia, Panama and southern Brazil. Also, T. cruzi CL-Brener clone was included for comparison. Despite the great similarity observed among strains from Brazil, the molecular karyotype of all T. rangeli strains analyzed revealed extensive chromosome polymorphism. In addition, it was possible to distinguish T. rangeli from T. cruzi by the chromosomal DNA electrophoresis pattern. The localization of ß-tubulin genes revealed differences among T. rangeli strains and confirmed the similarity between the isolates from Brazil. Hybridization assays using probes directed to the cysteine proteinase, hsp 70 and actin genes discriminated T. rangeli from T. cruzi, proving that these genes are useful molecular markers for the differential diagnosis between these two species. Numerical analysis based on the molecular karyotype data revealed a high degree of polymorphism among T. rangeli strains isolated from southern Brazil and strains isolated from Central and the northern South America. The T. cruzi reference strain was not clustered with any T. rangeli strain.

  16. Histones bundle F-actin filaments and affect actin structure.

    Directory of Open Access Journals (Sweden)

    Edna Blotnick

    Full Text Available Histones are small polycationic proteins complexed with DNA located in the cell nucleus. Upon apoptosis they are secreted from the cells and react with extracellular polyanionic compounds. Actin which is a polyanionic protein, is also secreted from necrotic cells and interacts with histones. We showed that both histone mixture (histone type III and the recombinant H2A histone bundles F-actin, increases the viscosity of the F-actin containing solution and polymerizes G-actin. The histone-actin bundles are relatively insensitive to increase of ionic strength, unlike other polycation, histatin, lysozyme, spermine and LL-37 induced F-actin bundles. The histone-actin bundles dissociate completely only in the presence of 300-400 mM NaCl. DNA, which competes with F-actin for histones, disassembles histone induced actin bundles. DNase1, which depolymerizes F- to G-actin, actively unbundles the H2A histone induced but slightly affects the histone mixture induced actin bundles. Cofilin decreases the amount of F-actin sedimented by low speed centrifugation, increases light scattering and viscosity of F-actin-histone mixture containing solutions and forms star like superstructures by copolymerizing G-actin with H2A histone. The results indicate that histones are tightly attached to F-actin by strong electrostatic and hydrophobic forces. Since both histones and F-actin are present in the sputum of patients with cystic fibrosis, therefore, the formation of the stable histone-actin bundles can contribute to the pathology of this disease by increasing the viscosity of the sputum. The actin-histone interaction in the nucleus might affect gene expression.

  17. Histones bundle F-actin filaments and affect actin structure.

    Science.gov (United States)

    Blotnick, Edna; Sol, Asaf; Muhlrad, Andras

    2017-01-01

    Histones are small polycationic proteins complexed with DNA located in the cell nucleus. Upon apoptosis they are secreted from the cells and react with extracellular polyanionic compounds. Actin which is a polyanionic protein, is also secreted from necrotic cells and interacts with histones. We showed that both histone mixture (histone type III) and the recombinant H2A histone bundles F-actin, increases the viscosity of the F-actin containing solution and polymerizes G-actin. The histone-actin bundles are relatively insensitive to increase of ionic strength, unlike other polycation, histatin, lysozyme, spermine and LL-37 induced F-actin bundles. The histone-actin bundles dissociate completely only in the presence of 300-400 mM NaCl. DNA, which competes with F-actin for histones, disassembles histone induced actin bundles. DNase1, which depolymerizes F- to G-actin, actively unbundles the H2A histone induced but slightly affects the histone mixture induced actin bundles. Cofilin decreases the amount of F-actin sedimented by low speed centrifugation, increases light scattering and viscosity of F-actin-histone mixture containing solutions and forms star like superstructures by copolymerizing G-actin with H2A histone. The results indicate that histones are tightly attached to F-actin by strong electrostatic and hydrophobic forces. Since both histones and F-actin are present in the sputum of patients with cystic fibrosis, therefore, the formation of the stable histone-actin bundles can contribute to the pathology of this disease by increasing the viscosity of the sputum. The actin-histone interaction in the nucleus might affect gene expression.

  18. Prevalence and phenotypes of congenital myopathy due to α-actin 1 gene mutations

    DEFF Research Database (Denmark)

    Witting, Nanna; Werlauff, Ulla; Duno, Morten

    2016-01-01

    airway pressure. Limb flexor/extensor muscles and upper and lower extremities were affected equally. Pronounced neck flexor weakness was noted. CONCLUSIONS: Congenital myopathy caused by ACTA1 mutations is fatal in infancy in most cases. This study shows that the prevalence of α-actin myopathy in older...... patients with congenital myopathy is not negligible and that phenotypes can be quite mild....

  19. Genomic loss of tumor suppressor miRNA-204 promotes cancer cell migration and invasion by activating AKT/mTOR/Rac1 signaling and actin reorganization.

    Directory of Open Access Journals (Sweden)

    J Saadi Imam

    Full Text Available Increasing evidence suggests that chromosomal regions containing microRNAs are functionally important in cancers. Here, we show that genomic loci encoding miR-204 are frequently lost in multiple cancers, including ovarian cancers, pediatric renal tumors, and breast cancers. MiR-204 shows drastically reduced expression in several cancers and acts as a potent tumor suppressor, inhibiting tumor metastasis in vivo when systemically delivered. We demonstrated that miR-204 exerts its function by targeting genes involved in tumorigenesis including brain-derived neurotrophic factor (BDNF, a neurotrophin family member which is known to promote tumor angiogenesis and invasiveness. Analysis of primary tumors shows that increased expression of BDNF or its receptor tropomyosin-related kinase B (TrkB parallel a markedly reduced expression of miR-204. Our results reveal that loss of miR-204 results in BDNF overexpression and subsequent activation of the small GTPase Rac1 and actin reorganization through the AKT/mTOR signaling pathway leading to cancer cell migration and invasion. These results suggest that microdeletion of genomic loci containing miR-204 is directly linked with the deregulation of key oncogenic pathways that provide crucial stimulus for tumor growth and metastasis. Our findings provide a strong rationale for manipulating miR-204 levels therapeutically to suppress tumor metastasis.

  20. Clarin-1, encoded by the Usher Syndrome III causative gene, forms a membranous microdomain: possible role of clarin-1 in organizing the actin cytoskeleton.

    Science.gov (United States)

    Tian, Guilian; Zhou, Yun; Hajkova, Dagmar; Miyagi, Masaru; Dinculescu, Astra; Hauswirth, William W; Palczewski, Krzysztof; Geng, Ruishuang; Alagramam, Kumar N; Isosomppi, Juha; Sankila, Eeva-Marja; Flannery, John G; Imanishi, Yoshikazu

    2009-07-10

    Clarin-1 is the protein product encoded by the gene mutated in Usher syndrome III. Although the molecular function of clarin-1 is unknown, its primary structure predicts four transmembrane domains similar to a large family of membrane proteins that include tetraspanins. Here we investigated the role of clarin-1 by using heterologous expression and in vivo model systems. When expressed in HEK293 cells, clarin-1 localized to the plasma membrane and concentrated in low density compartments distinct from lipid rafts. Clarin-1 reorganized actin filament structures and induced lamellipodia. This actin-reorganizing function was absent in the modified protein encoded by the most prevalent North American Usher syndrome III mutation, the N48K form of clarin-1 deficient in N-linked glycosylation. Proteomics analyses revealed a number of clarin-1-interacting proteins involved in cell-cell adhesion, focal adhesions, cell migration, tight junctions, and regulation of the actin cytoskeleton. Consistent with the hypothesized role of clarin-1 in actin organization, F-actin-enriched stereocilia of auditory hair cells evidenced structural disorganization in Clrn1(-/-) mice. These observations suggest a possible role for clarin-1 in the regulation and homeostasis of actin filaments, and link clarin-1 to the interactive network of Usher syndrome gene products.

  1. Molecular evolution of the actin-like MreB protein gene family in wall-less bacteria.

    Science.gov (United States)

    Ku, Chuan; Lo, Wen-Sui; Kuo, Chih-Horng

    2014-04-18

    The mreB gene family encodes actin-like proteins that determine cell shape by directing cell wall synthesis and often exists in one to three copies in the genomes of non-spherical bacteria. Intriguingly, while most wall-less bacteria do not have this gene, five to seven mreB homologs are found in Spiroplasma and Haloplasma, which are both characterized by cell contractility. To investigate the molecular evolution of this gene family in wall-less bacteria, we sampled the available genome sequences from these two genera and other related lineages for comparative analysis. The gene phylogenies indicated that the mreB homologs in Haloplasma are more closely related to those in Firmicutes, whereas those in Spiroplasma form a separate clade. This finding suggests that the gene family expansions in these two lineages are the results of independent ancient duplications. Moreover, the Spiroplasma mreB homologs can be classified into five clades, of which the genomic positions are largely conserved. The inference of gene gains and losses suggests that there has been an overall trend to retain only one homolog from each of the five mreB clades in the evolutionary history of Spiroplasma. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Simultaneous Expression of GUS and Actin Genes by Using the Multiplex RT-PCR and Multiplex Gold Nanoparticle Probes.

    Science.gov (United States)

    Ghazi, Yaser; Vaseghi, Akbar; Ahmadi, Sepideh; Haddadi, Fatemeh

    2018-04-23

    Gene expression analysis is considered to be extremely important in many different biological researches. DNA-based diagnostic test, which contributes to DNA identification, has higher specificity, cost, and speed than some biochemical and molecular methods. In this study, we try to use the novel nano technology approach with Multiplex RT-PCR and Gold nano particular probes (GNPs-probes) in order to get gene expression in Curcumas melons. We used Agrobacterium tumefactions for gene transfer and GUS reporter gene as a reporter. After cDNA synthesis, Multiplex PCR and Multiplex RT-PCR techniques were used. Finally, probes were designed for RNA of GUS and Actin genes, and then the analysis of the gene expression using the probes attached to GNPs was carried out and the color changes in the GNPs were applied. In the following, probes hybridization was checked with DNA between 400 to 700 nm wavelengths and the highest rate was observed in the 550 to 650 nm. The results show that the simultaneous use of GNP-attached detectors and Multiplex RT-PCRcan reduce time and costmore considerably than somelaboratory methods for gene expiration investigation. Additionally, it can be seen thatthere is an increase in sensitivity and specificity of our investigation. Based on our findings, this can bea novel study doneusingMultiplex RT-PCRand unmodified AuNPs for gene transfer and expression detection to plants. We can claim that this assay has a remarkable advantage including rapid, cost-effectiveness, specificity and accuracy to detect transfer and expression genes in plants. Also,we can use this technique from other gene expressionsin many different biology samples.

  3. Capture of microtubule plus-ends at the actin cortex promotes axophilic neuronal migration by enhancing microtubule tension in the leading process.

    Science.gov (United States)

    Hutchins, B Ian; Wray, Susan

    2014-01-01

    Microtubules are a critical part of neuronal polarity and leading process extension, thus microtubule movement plays an important role in neuronal migration. However, the dynamics of microtubules during the forward movement of the nucleus into the leading process (nucleokinesis) is unclear and may be dependent on the cell type and mode of migration used. In particular, little is known about cytoskeletal changes during axophilic migration, commonly used in anteroposterior neuronal migration. We recently showed that leading process actin flow in migrating GnRH neurons is controlled by a signaling cascade involving IP3 receptors, CaMKK, AMPK, and RhoA. In the present study, microtubule dynamics were examined in GnRH neurons. Failure of the migration of these cells leads to the neuroendocrine disorder Kallmann Syndrome. Microtubules translocated forward along the leading process shaft during migration, but reversed direction and moved toward the nucleus when migration stalled. Blocking calcium release through IP3 receptors halted migration and induced the same reversal of microtubule translocation, while blocking cortical actin flow prevented microtubules from translocating toward the distal leading process. Super-resolution imaging revealed that microtubule plus-end tips are captured at the actin cortex through calcium-dependent mechanisms. This work shows that cortical actin flow draws the microtubule network forward through calcium-dependent capture in order to promote nucleokinesis, revealing a novel mechanism engaged by migrating neurons to facilitate movement.

  4. CF2 represses Actin 88F gene expression and maintains filament balance during indirect flight muscle development in Drosophila.

    Directory of Open Access Journals (Sweden)

    Kathleen M Gajewski

    2010-05-01

    Full Text Available The zinc finger protein CF2 is a characterized activator of muscle structural genes in the body wall muscles of the Drosophila larva. To investigate the function of CF2 in the indirect flight muscle (IFM, we examined the phenotypes of flies bearing five homozygous viable mutations. The gross structure of the IFM was not affected, but the stronger hypomorphic alleles caused an increase of up to 1.5X in the diameter of the myofibrils. This size increase did not cause any disruption of the hexameric arrangement of thick and thin filaments. RT-PCR analysis revealed an increase in the transcription of several structural genes. Ectopic overexpression of CF2 in the developing IFM disrupts muscle formation. While our results indicate a role for CF2 as a direct negative regulator of the thin filament protein gene Actin 88F (Act88F, effects on levels of transcripts of myosin heavy chain (mhc appear to be indirect. This role is in direct contrast to that described in the larval muscles, where CF2 activates structural gene expression. The variation in myofibril phenotypes of CF2 mutants suggest the CF2 may have separate functions in fine-tuning expression of structural genes to insure proper filament stoichiometry, and monitoring and/or controlling the final myofibril size.

  5. Reorganization of the actin cytoskeleton via transcriptional regulation of cytoskeletal/focal adhesion genes by myocardin-related transcription factors (MRTFs/MAL/MKLs)

    International Nuclear Information System (INIS)

    Morita, Tsuyoshi; Mayanagi, Taira; Sobue, Kenji

    2007-01-01

    RhoA is a crucial regulator of stress fiber and focal adhesion formation through the activation of actin nucleation and polymerization. It also regulates the nuclear translocation of myocardin-related transcription factor-A and -B (MRTF-A/B, MAL or MKL 1/2), which are co-activators of serum response factor (SRF). In dominant-negative MRTF-A (DN-MRTF-A)-expressing NIH 3T3 cell lines, the expressions of several cytoskeletal/focal adhesion genes were down-regulated, and the formation of stress fiber and focal adhesion was severely diminished. MRTF-A/B-knockdown cells also exhibited such cytoskeletal defects. In reporter assays, both RhoA and MRTF-A enhanced promoter activities of these genes in a CArG-box-dependent manner, and DN-MRTF-A inhibited the RhoA-mediated activation of these promoters. In dominant-negative RhoA (RhoA-N19)-expressing NIH 3T3 cell lines, the nuclear translocation of MRTF-A/B was predominantly prevented, resulting in the reduced expression of cytoskeletal/focal adhesion proteins. Further, constitutive-active MRTF-A/B increased the expression of endogenous cytoskeletal/focal adhesion proteins, and thereby rescued the defective phenotype of stress fibers and focal adhesions in RhoA-N19 expressing cells. These results indicate that MRTF-A/B act as pivotal mediators of stress fiber and focal adhesion formation via the transcriptional regulation of a subset of cytoskeletal/focal adhesion genes

  6. Duodenal ulcer promoting gene of Helicobacter pylori.

    Science.gov (United States)

    Lu, Hong; Hsu, Ping-I; Graham, David Y; Yamaoka, Yoshio

    2005-04-01

    Identification of a disease-specific H pylori virulence factors predictive of the outcome of infection remains unachieved. We used the polymerase chain reaction and Southern blot to compare the presence of 14 vir homologue genes with clinical presentation of H pylori infection, mucosal histology, and mucosal interleukin (IL)-8 levels. We examined 500 H pylori strains from East Asia and South America, including 120 with gastritis, 140 with duodenal ulcer (DU), 110 with gastric ulcer (GU), and 130 with gastric cancer. Only 1 gene that encompassed both jhp0917 and jhp0918 called dupA (duodenal ulcer promoting gene) was associated with a specific clinical outcome. dupA was present in 42% of DU vs. 21% of gastritis (adjusted odds ratio [OR] = 3.1, 95% confidence interval [CI]: 1.7-5.7). Its presence was also associated with more intense antral neutrophil infiltration and IL-8 levels and was a marker for protection against gastric atrophy, intestinal metaplasia, and gastric cancer (OR for gastric cancer = 0.42, 95% CI: 0.2-0.9 compared with gastritis). In vitro studies in gastric epithelial cells using dupA -deleted and -complemented mutants showed that the dupA plays roles in IL-8 production, in activation of transcription factors responsible for IL-8 promoter activity, and in increased survivability at low pH. dupA is a novel marker associated with an increased risk for DU and reduced risk for gastric atrophy and cancer. Its association with DU-promoting and -protective effects against atrophy/cancer was evident in both Asian and Western countries.

  7. Cortactin involvement in the keratinocyte growth factor and fibroblast growth factor 10 promotion of migration and cortical actin assembly in human keratinocytes

    International Nuclear Information System (INIS)

    Ceccarelli, Simona; Cardinali, Giorgia; Aspite, Nicaela; Picardo, Mauro; Marchese, Cinzia; Torrisi, Maria Rosaria; Mancini, Patrizia

    2007-01-01

    Keratinocyte growth factor (KGF/FGF7) and fibroblast growth factor 10 (FGF10/KGF2) regulate keratinocyte proliferation and differentiation by binding to the tyrosine kinase KGF receptor (KGFR). KGF induces keratinocyte motility and cytoskeletal rearrangement, whereas a direct role of FGF10 on keratinocyte migration is not clearly established. Here we analyzed the motogenic activity of FGF10 and KGF on human keratinocytes. Migration assays and immunofluorescence of actin cytoskeleton revealed that FGF10 is less efficient than KGF in promoting migration and exerts a delayed effect in inducing lamellipodia and ruffles formation. Both growth factors promoted phosphorylation and subsequent membrane translocation of cortactin, an F-actin binding protein involved in cell migration; however, FGF10-induced cortactin phosphorylation was reduced, more transient and delayed with respect to that promoted by KGF. Cortactin phosphorylation induced by both growth factors was Src-dependent, while its membrane translocation and cell migration were blocked by either Src and PI3K inhibitors, suggesting that both pathways are involved in KGF- and FGF10-dependent motility. Furthermore, siRNA-mediated downregulation of cortactin inhibited KGF- and FGF10-induced migration. These results indicate that cortactin is involved in keratinocyte migration promoted by both KGF and FGF10

  8. The FAK–Arp2/3 interaction promotes leading edge advance and haptosensing by coupling nascent adhesions to lamellipodia actin

    Science.gov (United States)

    Swaminathan, Vinay; Fischer, R. S.; Waterman, Clare M.

    2016-01-01

    Cell migration is initiated in response to biochemical or physical cues in the environment that promote actin-mediated lamellipodial protrusion followed by the formation of nascent integrin adhesions (NAs) within the protrusion to drive leading edge advance. Although FAK is known to be required for cell migration through effects on focal adhesions, its role in NA formation and lamellipodial dynamics is unclear. Live-cell microscopy of FAK−/− cells with expression of phosphorylation deficient or a FERM-domain mutant deficient in Arp2/3 binding revealed a requirement for FAK in promoting the dense formation, transient stabilization, and timely turnover of NA within lamellipodia to couple actin-driven protrusion to adhesion and advance of the leading edge. Phosphorylation on Y397 of FAK promotes dense NA formation but is dispensable for transient NA stabilization and leading edge advance. In contrast, transient NA stabilization and advance of the cell edge requires FAK–Arp2/3 interaction, which promotes Arp2/3 localization to NA and reduces FAK activity. Haptosensing of extracellular matrix (ECM) concentration during migration requires the interaction between FAK and Arp2/3, whereas FAK phosphorylation modulates mechanosensing of ECM stiffness during spreading. Taken together, our results show that mechanistically separable functions of FAK in NA are required for cells to distinguish distinct properties of their environment during migration. PMID:26842895

  9. Parathyroid hormone promotes the disassembly of cytoskeletal actin and myosin in cultured osteoblastic cells: Mediation by cyclic AMP

    International Nuclear Information System (INIS)

    Egan, J.J.; Gronowicz, G.; Rodan, G.A.

    1991-01-01

    Parathyroid hormone (PTH) alters the shape of osteoblastic cells both in vivo and in vitro. In this study, we examined the effect of PTH on cytoskeletal actin and myosin, estimated by polyacrylamide gel electrophoresis of Triton X-100 (1%) nonextractable proteins. After 2-5 minutes, PTH caused a rapid and transient decrease of 50-60% in polymerized actin and myosin associated with the Triton X-100 nonextractable cytoskeleton. Polymerized actin returned to control levels by 30 min. The PTH effect was dose-dependent with an IC50 of about 1 nM, and was partially inhibited by the (3-34) PTH antagonist. PTH caused a rapid transient rise in cyclic AMP (cAMP) in these cells that peaked at 4 min, while the nadir in cytoskeletal actin and myosin was recorded around 5 min. The intracellular calcium chelator Quin-2/AM (10 microM) also decreased cytoskeletal actin and myosin, to the same extent as did PTH (100 nM). To distinguish between cAMP elevation and Ca++ reduction as mediators of PTH action, we measured the phosphorylation of the 20 kD (PI 4.9) myosin light chain in cells preincubated with [32P]-orthophosphate. The phosphorylation of this protein decreased within 2-3 min after PTH addition and returned to control levels after 5 min. The calcium ionophore A-23187 did not antagonize this PTH effect. Visualization of microfilaments with rhodamine-conjugated phalloidin showed that PTH altered the cytoskeleton by decreasing the number of stress fibers. These changes in the cytoskeleton paralleled changes in the shape of the cells from a spread configuration to a stellate form with retracting processes. The above findings indicate that the alteration in osteoblast shape produced by PTH involve relatively rapid and transient changes in cytoskeletal organization that appear to be mediated by cAMP

  10. Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

    Science.gov (United States)

    Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

    2011-09-01

    Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

  11. Isolating Barley ( Hordeum vulgare L.) B1 Hordein Gene Promoter ...

    African Journals Online (AJOL)

    Promoters play the most important role in determining the temporal and spatial expression pattern and transcript level of a gene. Some strong constitutive promoters, such as cauliflower mosaic virus 35s promoter, are widely used in plant genetic engineering research. However, the expression levels of the foreign genes in ...

  12. Actinic keratosis

    DEFF Research Database (Denmark)

    Erlendsson, Andrés M; Egekvist, Henrik; Lorentzen, Henrik F.

    2016-01-01

    Objectives: The incidence of actinic keratosis (AK) is increasing, and several treatment options are available. The aim of this study was to describe clinical characteristics and treatment patterns in patients with AK treated by Danish dermatologists. Methods: A multicenter, non-interventional, c......Objectives: The incidence of actinic keratosis (AK) is increasing, and several treatment options are available. The aim of this study was to describe clinical characteristics and treatment patterns in patients with AK treated by Danish dermatologists. Methods: A multicenter, non...... and currently suspected in 9.4% of AK-affected anatomical regions. Lesions of AK were located primarily on the face (38.6%), scalp (12.8%), and hands (11.2%). Actinic keratosis commonly presented with multiple AK lesions (38.6%) and field cancerization (38.5%). The treatments used most frequently were...

  13. Comprehensive phylogenetic reconstruction of amoebozoa based on concatenated analyses of SSU-rDNA and actin genes.

    Directory of Open Access Journals (Sweden)

    Daniel J G Lahr

    Full Text Available Evolutionary relationships within Amoebozoa have been the subject of controversy for two reasons: 1 paucity of morphological characters in traditional surveys and 2 haphazard taxonomic sampling in modern molecular reconstructions. These along with other factors have prevented the erection of a definitive system that resolves confidently both higher and lower-level relationships. Additionally, the recent recognition that many protosteloid amoebae are in fact scattered throughout the Amoebozoa suggests that phylogenetic reconstructions have been excluding an extensive and integral group of organisms. Here we provide a comprehensive phylogenetic reconstruction based on 139 taxa using molecular information from both SSU-rDNA and actin genes. We provide molecular data for 13 of those taxa, 12 of which had not been previously characterized. We explored the dataset extensively by generating 18 alternative reconstructions that assess the effect of missing data, long-branched taxa, unstable taxa, fast evolving sites and inclusion of environmental sequences. We compared reconstructions with each other as well as against previously published phylogenies. Our analyses show that many of the morphologically established lower-level relationships (defined here as relationships roughly equivalent to Order level or below are congruent with molecular data. However, the data are insufficient to corroborate or reject the large majority of proposed higher-level relationships (above the Order-level, with the exception of Tubulinea, Archamoebae and Myxogastrea, which are consistently recovered. Moreover, contrary to previous expectations, the inclusion of available environmental sequences does not significantly improve the Amoebozoa reconstruction. This is probably because key amoebozoan taxa are not easily amplified by environmental sequencing methodology due to high rates of molecular evolution and regular occurrence of large indels and introns. Finally, in an effort

  14. Comprehensive phylogenetic reconstruction of amoebozoa based on concatenated analyses of SSU-rDNA and actin genes.

    Science.gov (United States)

    Lahr, Daniel J G; Grant, Jessica; Nguyen, Truc; Lin, Jian Hua; Katz, Laura A

    2011-01-01

    Evolutionary relationships within Amoebozoa have been the subject of controversy for two reasons: 1) paucity of morphological characters in traditional surveys and 2) haphazard taxonomic sampling in modern molecular reconstructions. These along with other factors have prevented the erection of a definitive system that resolves confidently both higher and lower-level relationships. Additionally, the recent recognition that many protosteloid amoebae are in fact scattered throughout the Amoebozoa suggests that phylogenetic reconstructions have been excluding an extensive and integral group of organisms. Here we provide a comprehensive phylogenetic reconstruction based on 139 taxa using molecular information from both SSU-rDNA and actin genes. We provide molecular data for 13 of those taxa, 12 of which had not been previously characterized. We explored the dataset extensively by generating 18 alternative reconstructions that assess the effect of missing data, long-branched taxa, unstable taxa, fast evolving sites and inclusion of environmental sequences. We compared reconstructions with each other as well as against previously published phylogenies. Our analyses show that many of the morphologically established lower-level relationships (defined here as relationships roughly equivalent to Order level or below) are congruent with molecular data. However, the data are insufficient to corroborate or reject the large majority of proposed higher-level relationships (above the Order-level), with the exception of Tubulinea, Archamoebae and Myxogastrea, which are consistently recovered. Moreover, contrary to previous expectations, the inclusion of available environmental sequences does not significantly improve the Amoebozoa reconstruction. This is probably because key amoebozoan taxa are not easily amplified by environmental sequencing methodology due to high rates of molecular evolution and regular occurrence of large indels and introns. Finally, in an effort to facilitate

  15. Insulators form gene loops by interacting with promoters in Drosophila.

    Science.gov (United States)

    Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

    2011-09-01

    Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.

  16. Unconventional actin conformations localize on intermediate filaments in mitosis

    International Nuclear Information System (INIS)

    Hubert, Thomas; Vandekerckhove, Joel; Gettemans, Jan

    2011-01-01

    Research highlights: → Unconventional actin conformations colocalize with vimentin on a cage-like structure in metaphase HEK 293T cells. → These conformations are detected with the anti-actin antibodies 1C7 ('lower dimer') and 2G2 ('nuclear actin'), but not C4 (monomeric actin). → Mitotic unconventional actin cables are independent of filamentous actin or microtubules. → Unconventional actin colocalizes with vimentin on a nocodazole-induced perinuclear dense mass of cables. -- Abstract: Different structural conformations of actin have been identified in cells and shown to reside in distinct subcellular locations of cells. In this report, we describe the localization of actin on a cage-like structure in metaphase HEK 293T cells. Actin was detected with the anti-actin antibodies 1C7 and 2G2, but not with the anti-actin antibody C4. Actin contained in this structure is independent of microtubules and actin filaments, and colocalizes with vimentin. Taking advantage of intermediate filament collapse into a perinuclear dense mass of cables when microtubules are depolymerized, we were able to relocalize actin to such structures. We hypothesize that phosphorylation of intermediate filaments at mitosis entry triggers the recruitment of different actin conformations to mitotic intermediate filaments. Storage and partition of the nuclear actin and antiparallel 'lower dimer' actin conformations between daughter cells possibly contribute to gene transcription and transient actin filament dynamics at G1 entry.

  17. Bacterial Actins.

    Science.gov (United States)

    Izoré, Thierry; van den Ent, Fusinita

    2017-01-01

    A diverse set of protein polymers, structurally related to actin filaments contributes to the organization of bacterial cells as cytomotive or cytoskeletal filaments. This chapter describes actin homologs encoded by bacterial chromosomes. MamK filaments, unique to magnetotactic bacteria, help establishing magnetic biological compasses by interacting with magnetosomes. Magnetosomes are intracellular membrane invaginations containing biomineralized crystals of iron oxide that are positioned by MamK along the long-axis of the cell. FtsA is widespread across bacteria and it is one of the earliest components of the divisome to arrive at midcell, where it anchors the cell division machinery to the membrane. FtsA binds directly to FtsZ filaments and to the membrane through its C-terminus. FtsA shows altered domain architecture when compared to the canonical actin fold. FtsA's subdomain 1C replaces subdomain 1B of other members of the actin family and is located on the opposite side of the molecule. Nevertheless, when FtsA assembles into protofilaments, the protofilament structure is preserved, as subdomain 1C replaces subdomain IB of the following subunit in a canonical actin filament. MreB has an essential role in shape-maintenance of most rod-shaped bacteria. Unusually, MreB filaments assemble from two protofilaments in a flat and antiparallel arrangement. This non-polar architecture implies that both MreB filament ends are structurally identical. MreB filaments bind directly to membranes where they interact with both cytosolic and membrane proteins, thereby forming a key component of the elongasome. MreB filaments in cells are short and dynamic, moving around the long axis of rod-shaped cells, sensing curvature of the membrane and being implicated in peptidoglycan synthesis.

  18. Monophasic Pulsed 200-μA Current Promotes Galvanotaxis With Polarization of Actin Filament and Integrin α2β1 in Human Dermal Fibroblasts.

    Science.gov (United States)

    Uemura, Mikiko; Maeshige, Noriaki; Koga, Yuka; Ishikawa-Aoyama, Michiko; Miyoshi, Makoto; Sugimoto, Masaharu; Terashi, Hiroto; Usami, Makoto

    2016-01-01

    The monophasic pulsed microcurrent is used to promote wound healing, and galvanotaxis regulation has been reported as one of the active mechanisms in the promotion of tissue repair with monophasic pulsed microcurrent. However, the optimum monophasic pulsed microcurrent parameters and intracellular changes caused by the monophasic pulsed microcurrent have not been elucidated in human dermal fibroblasts. The purpose of this study was to investigate the optimum intensity for promoting galvanotaxis and the effects of electrical stimulation on integrin α2β1 and actin filaments in human dermal fibroblasts. Human dermal fibroblasts were treated with the monophasic pulsed microcurrent of 0, 100, 200, or 300 μA for 8 hours, and cell migration and cell viability were measured 24 hours after starting monophasic pulsed microcurrent stimulation. Polarization of integrin α2β1 and lamellipodia formation were detected by immunofluorescent staining 10 minutes after starting monophasic pulsed microcurrent stimulation. The migration toward the cathode was significantly higher in the cells treated with the 200-μA monophasic pulsed microcurrent than in the controls (P microcurrent did not alter the migration ratio. The electrostimulus of 200 μA also promoted integrin α2β1 polarization and lamellipodia formation at the cathode edge (P microcurrent intensity to promote migration toward the cathode, and this intensity could regulate polarization of migration-related intracellular factors in human dermal fibroblasts.

  19. Precise regulation of gene expression dynamics favors complex promoter architectures.

    Directory of Open Access Journals (Sweden)

    Dirk Müller

    2009-01-01

    Full Text Available Promoters process signals through recruitment of transcription factors and RNA polymerase, and dynamic changes in promoter activity constitute a major noise source in gene expression. However, it is barely understood how complex promoter architectures determine key features of promoter dynamics. Here, we employ prototypical promoters of yeast ribosomal protein genes as well as simplified versions thereof to analyze the relations among promoter design, complexity, and function. These promoters combine the action of a general regulatory factor with that of specific transcription factors, a common motif of many eukaryotic promoters. By comprehensively analyzing stationary and dynamic promoter properties, this model-based approach enables us to pinpoint the structural characteristics underlying the observed behavior. Functional tradeoffs impose constraints on the promoter architecture of ribosomal protein genes. We find that a stable scaffold in the natural design results in low transcriptional noise and strong co-regulation of target genes in the presence of gene silencing. This configuration also exhibits superior shut-off properties, and it can serve as a tunable switch in living cells. Model validation with independent experimental data suggests that the models are sufficiently realistic. When combined, our results offer a mechanistic explanation for why specific factors are associated with low protein noise in vivo. Many of these findings hold for a broad range of model parameters and likely apply to other eukaryotic promoters of similar structure.

  20. Actin isoform and alpha 1B-adrenoceptor gene expression in aortic and coronary smooth muscle is influenced by cyclical stretch.

    Science.gov (United States)

    Lundberg, M S; Sadhu, D N; Grumman, V E; Chilian, W M; Ramos, K S

    1995-09-01

    The occurrence of vascular domains with specific biological and pharmacological characteristics suggests that smooth muscle cells in different arteries may respond differentially to a wide range of environmental stimuli. To determine if some of these vessel-specific differences may be attributable to mechano-sensitive gene regulation, the influence of cyclical stretch on the expression of actin isoform and alpha 1B-adrenoceptor genes was examined in aortic and coronary smooth muscle cells. Cells were seeded on an elastin substrate and subjected to maximal stretching (24% elongation) and relaxation cycles at a frequency of 120 cycles/min in a Flexercell strain unit for 72 h. Total RNA was extracted and hybridized to radiolabeled cDNA probes to assess gene expression. Stretch caused a greater reduction of actin isoform mRNA levels in aortic smooth muscle cells as compared to cells from the coronary artery. Steady-state mRNA levels of alpha 1B-adrenoceptor were also decreased by cyclical stretch in both cell types but the magnitude of the response was greater in coronary smooth muscle cells. No changes in alpha 1B-adrenoceptor or beta/gamma-actin steady-state mRNA levels were observed in H4IIE cells, a nonvascular, immortalized cell line. The relative gene expression of heat shock protein 70 was not influenced by the cyclic stretch regimen in any of these cell types. These results suggest that stretch may participate in the regulation of gene expression in vascular smooth muscle cells and that this response exhibits some degree of cell-specificity.

  1. Archaeal promoter architecture and mechanism of gene activation

    DEFF Research Database (Denmark)

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang

    2011-01-01

    element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked...... mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression....

  2. Formin' actin in the nucleus.

    Science.gov (United States)

    Baarlink, Christian; Grosse, Robert

    2014-01-01

    Many if not most proteins can, under certain conditions, change cellular compartments, such as, for example, shuttling from the cytoplasm to the nucleus. Thus, many proteins may exert functions in various and very different subcellular locations, depending on the signaling context. A large amount of actin regulatory proteins has been detected in the mammalian cell nucleus, although their potential roles are much debated and are just beginning to emerge. Recently, members of the formin family of actin nucleators were also reported to dynamically localize to the nuclear environment. Here we discuss our findings that specific diaphanous-related formins can promote nuclear actin assembly in a signal-dependent manner.

  3. Synthetic promoter libraries- tuning of gene expression

    DEFF Research Database (Denmark)

    Hammer, Karin; Mijakovic, Ivan; Jensen, Peter Ruhdal

    2006-01-01

    knockout and strong overexpression. However, applications such as metabolic optimization and control analysis necessitate a continuous set of expression levels with only slight increments in strength to cover a specific window around the wildtype expression level of the studied gene; this requirement can......The study of gene function often requires changing the expression of a gene and evaluating the consequences. In principle, the expression of any given gene can be modulated in a quasi-continuum of discrete expression levels but the traditional approaches are usually limited to two extremes: gene...

  4. Heterozygous de novo and inherited mutations in the smooth muscle actin (ACTG2 gene underlie megacystis-microcolon-intestinal hypoperistalsis syndrome.

    Directory of Open Access Journals (Sweden)

    Michael F Wangler

    2014-03-01

    Full Text Available Megacystis-microcolon-intestinal hypoperistalsis syndrome (MMIHS is a rare disorder of enteric smooth muscle function affecting the intestine and bladder. Patients with this severe phenotype are dependent on total parenteral nutrition and urinary catheterization. The cause of this syndrome has remained a mystery since Berdon's initial description in 1976. No genes have been clearly linked to MMIHS. We used whole-exome sequencing for gene discovery followed by targeted Sanger sequencing in a cohort of patients with MMIHS and intestinal pseudo-obstruction. We identified heterozygous ACTG2 missense variants in 15 unrelated subjects, ten being apparent de novo mutations. Ten unique variants were detected, of which six affected CpG dinucleotides and resulted in missense mutations at arginine residues, perhaps related to biased usage of CpG containing codons within actin genes. We also found some of the same heterozygous mutations that we observed as apparent de novo mutations in MMIHS segregating in families with intestinal pseudo-obstruction, suggesting that ACTG2 is responsible for a spectrum of smooth muscle disease. ACTG2 encodes γ2 enteric actin and is the first gene to be clearly associated with MMIHS, suggesting an important role for contractile proteins in enteric smooth muscle disease.

  5. Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data

    DEFF Research Database (Denmark)

    Kannan, Soumya; Sams, Thomas; Maury, Jérôme

    2018-01-01

    activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system......Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds......, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter...

  6. Changes in actin dynamics are involved in salicylic acid signaling pathway.

    Science.gov (United States)

    Matoušková, Jindřiška; Janda, Martin; Fišer, Radovan; Sašek, Vladimír; Kocourková, Daniela; Burketová, Lenka; Dušková, Jiřina; Martinec, Jan; Valentová, Olga

    2014-06-01

    Changes in actin cytoskeleton dynamics are one of the crucial players in many physiological as well as non-physiological processes in plant cells. Positioning of actin filament arrays is necessary for successful establishment of primary lines of defense toward pathogen attack, depolymerization leads very often to the enhanced susceptibility to the invading pathogen. On the other hand it was also shown that the disruption of actin cytoskeleton leads to the induction of defense response leading to the expression of PATHOGENESIS RELATED proteins (PR). In this study we show that pharmacological actin depolymerization leads to the specific induction of genes in salicylic acid pathway but not that involved in jasmonic acid signaling. Life imaging of leafs of Arabidopsis thaliana with GFP-tagged fimbrin (GFP-fABD2) treated with 1 mM salicylic acid revealed rapid disruption of actin filaments resembling the pattern viewed after treatment with 200 nM latrunculin B. The effect of salicylic acid on actin filament fragmentation was prevented by exogenous addition of phosphatidic acid, which binds to the capping protein and thus promotes actin polymerization. The quantitative evaluation of actin filament dynamics is also presented. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  7. Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data.

    Science.gov (United States)

    Kannan, Soumya; Sams, Thomas; Maury, Jérôme; Workman, Christopher T

    2018-03-16

    Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system of ordinary differential equations for estimating dynamic promoter activity for promoters that change their activity in response to the environment that is robust to noise and changes in growth rate. Our approach, inference of dynamic promoter activity (PromAct), improves on existing methods by more accurately inferring known promoter activity profiles. This method is also capable of estimating the correct scale of promoter activity and can be applied to quantitative data sets to estimate quantitative rates.

  8. Firefly luciferase gene contains a cryptic promoter

    Czech Academy of Sciences Publication Activity Database

    Vopálenský, V.; Mašek, T.; Horváth, Ondřej; Vicenová, B.; Mokrejš, M.; Pospíšek, M.

    2008-01-01

    Roč. 14, č. 9 (2008), s. 1720-1729 ISSN 1355-8382 Grant - others:GAČR(CZ) GA204/03/1487; GAČR(CZ) GA301/07/0607; Mšk(CZ) LC06066 Program:LC Institutional research plan: CEZ:AV0Z50520514 Keywords : luciferase * cryptic promoter * hepatitis C virus Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.018, year: 2008

  9. The immunomodulatory gene products of myxoma virus

    Indian Academy of Sciences (India)

    Unknown

    273. Keywords. Gene products; myxoma virus; Oryctolagus cuniculus; poxvirus; skin lesions ...... these data is that these viral proteins do not promote class .... Cudmore S, Reckmann I and Way M 1997 Viral manipulations of the actin ...

  10. The actinome of Dictyostelium discoideum in comparison to actins and actin-related proteins from other organisms.

    Directory of Open Access Journals (Sweden)

    Jayabalan M Joseph

    Full Text Available Actin belongs to the most abundant proteins in eukaryotic cells which harbor usually many conventional actin isoforms as well as actin-related proteins (Arps. To get an overview over the sometimes confusing multitude of actins and Arps, we analyzed the Dictyostelium discoideum actinome in detail and compared it with the genomes from other model organisms. The D. discoideum actinome comprises 41 actins and actin-related proteins. The genome contains 17 actin genes which most likely arose from consecutive gene duplications, are all active, in some cases developmentally regulated and coding for identical proteins (Act8-group. According to published data, the actin fraction in a D. discoideum cell consists of more than 95% of these Act8-type proteins. The other 16 actin isoforms contain a conventional actin motif profile as well but differ in their protein sequences. Seven actin genes are potential pseudogenes. A homology search of the human genome using the most typical D. discoideum actin (Act8 as query sequence finds the major actin isoforms such as cytoplasmic beta-actin as best hit. This suggests that the Act8-group represents a nearly perfect actin throughout evolution. Interestingly, limited data from D. fasciculatum, a more ancient member among the social amoebae, show different relationships between conventional actins. The Act8-type isoform is most conserved throughout evolution. Modeling of the putative structures suggests that the majority of the actin-related proteins is functionally unrelated to canonical actin. The data suggest that the other actin variants are not necessary for the cytoskeleton itself but rather regulators of its dynamical features or subunits in larger protein complexes.

  11. The actin multigene family of Paramecium tetraurelia

    Directory of Open Access Journals (Sweden)

    Wagner Erika

    2007-03-01

    Full Text Available Abstract Background A Paramecium tetraurelia pilot genome project, the subsequent sequencing of a Megabase chromosome as well as the Paramecium genome project aimed at gaining insight into the genome of Paramecium. These cells display a most elaborate membrane trafficking system, with distinct, predictable pathways in which actin could participate. Previously we had localized actin in Paramecium; however, none of the efforts so far could proof the occurrence of actin in the cleavage furrow of a dividing cell, despite the fact that actin is unequivocally involved in cell division. This gave a first hint that Paramecium may possess actin isoforms with unusual characteristics. The genome project gave us the chance to search the whole Paramecium genome, and, thus, to identify and characterize probably all actin isoforms in Paramecium. Results The ciliated protozoan, P. tetraurelia, contains an actin multigene family with at least 30 members encoding actin, actin-related and actin-like proteins. They group into twelve subfamilies; a large subfamily with 10 genes, seven pairs and one trio with > 82% amino acid identity, as well as three single genes. The different subfamilies are very distinct from each other. In comparison to actins in other organisms, P. tetraurelia actins are highly divergent, with identities topping 80% and falling to 30%. We analyzed their structure on nucleotide level regarding the number and position of introns. On amino acid level, we scanned the sequences for the presence of actin consensus regions, for amino acids of the intermonomer interface in filaments, for residues contributing to ATP binding, and for known binding sites for myosin and actin-specific drugs. Several of those characteristics are lacking in several subfamilies. The divergence of P. tetraurelia actins and actin-related proteins between different P. tetraurelia subfamilies as well as with sequences of other organisms is well represented in a phylogenetic

  12. Duplication in the microtubule-actin cross-linking factor 1 gene causes a novel neuromuscular condition

    DEFF Research Database (Denmark)

    Jørgensen, Louise H; Mosbech, Mai-Britt; Færgeman, Nils J

    2014-01-01

    Spectrins and plakins are important communicators linking cytoskeletal components to each other and to cellular junctions. Microtubule-actin cross-linking factor 1 (MACF1) belongs to the spectraplakin family and is involved in control of microtubule dynamics. Complete knock out of MACF1 in mice...... muscles and diminished motor skills, with heterogeneous presentation among the affected family members. To corroborate these findings we used RNA interference to knock down the VAB-10 locus containing the MACF1 homologue in C. elegans, and we could show that this also causes movement disturbances...

  13. The Infection of Cucumber (Cucumis sativus L. Roots by Meloidogyne incognita Alters the Expression of Actin-Depolymerizing Factor (ADF Genes, Particularly in Association with Giant Cell Formation

    Directory of Open Access Journals (Sweden)

    Bin Liu

    2016-09-01

    Full Text Available Cucumber (Cucumis sativus L. is threatened by substantial yield losses due to the south root-knot nematode (Meloidogyne incognita. However, understanding of the molecular mechanisms underlying the process of nematode infection is still limited. In this study, we found that M. incognita infection affected the structure of cells in cucumber roots and treatment of the cytoskeleton inhibitor (cytochalasin D reduced root-knot nematode (RKN parasitism. It is known that Actin-Depolymerizing Factor (ADF affects cell structure, as well as the organization of the cytoskeleton. To address the hypothesis that nematode-induced abnormal cell structures and cytoskeletal rearrangements might be mediated by the ADF genes, we identified and characterized eight cucumber ADF (CsADF genes. Phylogenetic analysis showed that the cucumber ADF gene family is grouped into four ancient subclasses. Expression analysis revealed that CsADF1, CsADF2-1, CsADF2-2, CsADF2-3 (Subclass I and CsADF6 (Subclass III have higher transcript levels than CsADF7-1, CsADF7-2 (Subclass II genes and CsADF5 (Subclass IV in roots. Members of subclass I genes (CsADF1, CsADF2-1, CsADF2-2 and CsADF2-3, with the exception of CsADF2-1, exhibited a induction of expression in roots 14 days after their inoculation (DAI with nematodes. However, the expression of subclass II genes (CsADF7-1 and CsADF7-2 showed no significant change after inoculation. The transcript levels of CsADF6 (Subclass III showed a specific induction at 21 DAI, while CsADF5 (Subclass IV was weakly expressed in roots, but was strongly up-regulated as early as 7 DAI. In addition, treatment of roots with cytochalasin D caused an approximately two-fold down-regulation of the CsADF genes in the treated plants. These results suggest that CsADF gene mediated actin dynamics are associated with structural changes in roots as a consequence of M. incognita infection.

  14. Increased actin polymerization and stabilization interferes with neuronal function and survival in the AMPKγ mutant Loechrig.

    Directory of Open Access Journals (Sweden)

    Mandy Cook

    Full Text Available loechrig (loe mutant flies are characterized by progressive neuronal degeneration, behavioral deficits, and early death. The mutation is due to a P-element insertion in the gene for the γ-subunit of the trimeric AMP-activated protein kinase (AMPK complex, whereby the insertion affects only one of several alternative transcripts encoding a unique neuronal isoform. AMPK is a cellular energy sensor that regulates a plethora of signaling pathways, including cholesterol and isoprenoid synthesis via its downstream target hydroxy-methylglutaryl (HMG-CoA reductase. We recently showed that loe interferes with isoprenoid synthesis and increases the prenylation and thereby activation of RhoA. During development, RhoA plays an important role in neuronal outgrowth by activating a signaling cascade that regulates actin dynamics. Here we show that the effect of loe/AMPKγ on RhoA prenylation leads to a hyperactivation of this signaling pathway, causing increased phosphorylation of the actin depolymerizating factor cofilin and accumulation of filamentous actin. Furthermore, our results show that the resulting cytoskeletal changes in loe interfere with neuronal growth and disrupt axonal integrity. Surprisingly, these phenotypes were enhanced by expressing the Slingshot (SSH phosphatase, which during development promotes actin depolymerization by dephosphorylating cofilin. However, our studies suggest that in the adult SSH promotes actin polymerization, supporting in vitro studies using human SSH1 that suggested that SSH can also stabilize and bundle filamentous actin. Together with the observed increase in SSH levels in the loe mutant, our experiments suggest that in mature neurons SSH may function as a stabilization factor for filamentous actin instead of promoting actin depolymerization.

  15. Structural Basis of Actin Filament Nucleation by Tandem W Domains

    Science.gov (United States)

    Chen, Xiaorui; Ni, Fengyun; Tian, Xia; Kondrashkina, Elena; Wang, Qinghua; Ma, Jianpeng

    2013-01-01

    SUMMARY Spontaneous nucleation of actin is very inefficient in cells. To overcome this barrier, cells have evolved a set of actin filament nucleators to promote rapid nucleation and polymerization in response to specific stimuli. However, the molecular mechanism of actin nucleation remains poorly understood. This is hindered largely by the fact that actin nucleus, once formed, rapidly polymerizes into filament, thus making it impossible to capture stable multisubunit actin nucleus. Here, we report an effective double-mutant strategy to stabilize actin nucleus by preventing further polymerization. Employing this strategy, we solved the crystal structure of AMPPNP-actin in complex with the first two tandem W domains of Cordon-bleu (Cobl), a potent actin filament nucleator. Further sequence comparison and functional studies suggest that the nucleation mechanism of Cobl is probably shared by the p53 cofactor JMY, but not Spire. Moreover, the double-mutant strategy opens the way for atomic mechanistic study of actin nucleation and polymerization. PMID:23727244

  16. A novel BDNF gene promoter directs expression to skeletal muscle

    Directory of Open Access Journals (Sweden)

    Heinrich Gerhard

    2003-06-01

    Full Text Available Abstract Background Cell-specific expression of the gene that encodes brain-derived neurotrophic factor (BDNF is required for the normal development of peripheral sensory neurons and efficient synaptic transmission in the mature central and peripheral nervous system. The control of BDNF gene expression involves multiple tissue and cell-specific promoters that are differentially regulated. The molecular mechanisms that are responsible for tissue and cell-specific expression of these promoters are still incompletely understood. Results The cloning and analysis of three additional zebrafish (Danio rerio BDNF gene exons and two associated promoters, is reported. Among them are two exons that generate a novel tripartite mature transcript. The exons were located on the transcription unit, whose overall organization was determined by cloning, Southern blot hybridization and sequence analysis, and compared with the pufferfish (Fugu rubripes and mammalian BDNF loci, revealing a conserved but more compact organization. Structural and functional analysis of the exons, their adjacent promoters and 5' flanks, showed that they are expressed cell-specifically. The promoter associated with the 5' exon of the tripartite transcript is GC-rich, TATA-less and the 5' flank adjacent to it contains multiple Sp1, Mef2, and AP1 elements. A fusion gene containing the promoter and 1.5 KB of 5' flank is directed exclusively to skeletal muscle of transiently transfected embryos. The second promoter, whose associated 5' exon contains a 25-nucleotide segment of identity with a mammalian BDNF gene exon, was transiently expressed in yolk of the early embryo. RT-PCR analysis of total RNA from whole juvenile fish and adult female skeletal muscle revealed tissue-specific expression of the 5' exons but the novel exon could not be detected even after two rounds of nested PCR. Conclusion The zebrafish BDNF gene is as complex as the mammalian gene yet much more compact. Its exons are

  17. Integrins in cell migration – the actin connection

    OpenAIRE

    Vicente-Manzanares, Miguel; Choi, Colin Kiwon; Horwitz, Alan Rick

    2008-01-01

    The connection between integrins and actin is driving the field of cell migration in new directions. Integrins and actin are coupled through a physical linkage, which provides traction for migration. Recent studies show the importance of this linkage in regulating adhesion organization and development. Actin polymerization orchestrates adhesion assembly near the leading edge of a migrating cell, and the dynamic cross-linking of actin filaments promotes adhesion maturat...

  18. Mechanosensitive promoter region in the human HB-GAM gene

    DEFF Research Database (Denmark)

    Liedert, Astrid; Kassem, Moustapha; Claes, Lutz

    2009-01-01

    Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...

  19. DNA methylation of PTEN gene promoter region is not correlated ...

    African Journals Online (AJOL)

    Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for inactivation of PTEN in a ...

  20. Interleukin-10 gene promoter polymorphism as a potential host ...

    African Journals Online (AJOL)

    10) gene have been associated with altered levels of circulating IL-10, a Th2 cytokine that plays a key role in the pathogenesis of TB. We analyzed the frequencies of IL-10 promoter polymorphisms in 82 TB patients and 99 healthy Pakistani ...

  1. Interleukin 10 gene promoter polymorphism and risk of diffuse large ...

    African Journals Online (AJOL)

    Purpose: Given the importance of understanding the genetic variations involved in the pathogenesis of non-Hodgkin's lymphoma (NHL), this work was designed to study the impact of IL-10 (1082 G/A; rs1800896 and 819 C/T; rs1800871) gene promoter polymorphism on susceptibility of Egyptians to diffuse large B cell ...

  2. Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters.

    Science.gov (United States)

    Mishra, Avinash; Tanna, Bhakti

    2017-01-01

    Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile , and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters ( NHX, SOS, HKT, VTPase ), ion channels (Cl - , Ca 2+ , aquaporins), antioxidant encoding genes ( APX, CAT, GST, BADH, SOD ) and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes). It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.

  3. Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters

    Directory of Open Access Journals (Sweden)

    Avinash Mishra

    2017-05-01

    Full Text Available Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile, and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters (NHX, SOS, HKT, VTPase, ion channels (Cl−, Ca2+, aquaporins, antioxidant encoding genes (APX, CAT, GST, BADH, SOD and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes. It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.

  4. The human oxytocin gene promoter is regulated by estrogens.

    Science.gov (United States)

    Richard, S; Zingg, H H

    1990-04-15

    Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be

  5. Promoter DNA hypermethylation and gene repression in undifferentiated Arabidopsis cells.

    Directory of Open Access Journals (Sweden)

    María Berdasco

    Full Text Available Maintaining and acquiring the pluripotent cell state in plants is critical to tissue regeneration and vegetative multiplication. Histone-based epigenetic mechanisms are important for regulating this undifferentiated state. Here we report the use of genetic and pharmacological experimental approaches to show that Arabidopsis cell suspensions and calluses specifically repress some genes as a result of promoter DNA hypermethylation. We found that promoters of the MAPK12, GSTU10 and BXL1 genes become hypermethylated in callus cells and that hypermethylation also affects the TTG1, GSTF5, SUVH8, fimbrin and CCD7 genes in cell suspensions. Promoter hypermethylation in undifferentiated cells was associated with histone hypoacetylation and primarily occurred at CpG sites. Accordingly, we found that the process specifically depends on MET1 and DRM2 methyltransferases, as demonstrated with DNA methyltransferase mutants. Our results suggest that promoter DNA methylation may be another important epigenetic mechanism for the establishment and/or maintenance of the undifferentiated state in plant cells.

  6. Diclofenac Topical (actinic keratosis)

    Science.gov (United States)

    ... topical gel (Solaraze) is used to treat actinic keratosis (flat, scaly growths on the skin caused by ... The way diclofenac gel works to treat actinic keratosis is not known.Diclofenac is also available as ...

  7. Genes that cooperate with tumor promoters in transformation

    International Nuclear Information System (INIS)

    Colburn, N.H.; Smith, B.M.

    1988-01-01

    Tumor-promoting phorbol esters, like growth factors, elicit pleiotropic responses involving biochemical pathways that lead to different biological responses. Genetic variant cell lines that are resistant to mitogenic, differentiation, or transformation responses to tumor promoters have been valuable tools for understanding the molecular bases of these responses. Studies using the mouse epidermal JB6 cell lines that are sensitive or resistant to tumor promoter-induced transformation have yielded new understanding of genetic and signal transduction events involved in neoplastic transformation. The isolation and characterization of cloned mouse promotion sensitivity genes pro-1 and pro-2 is reviewed. A new activity of pro-1 has been identified: when transfected into human cancer prone basal cell nevus syndrome fibroblasts but not normal fibroblasts mouse pro-1 confers lifespan extension of these cells. Recently, we have found tat a pro-1 homolog from a library of nasopharyngeal carcinoma, but not the homolog from a normal human library, is activated for transferring promotion sensitivity. The many genetic variants for responses to tumor promoters have also proved valuable for signal transduction studies. JPB P- cells fail to show the 12-O-tetradecanoyl-phorbol-13-acetate (TPA)-induced syntheses of two proteins of 15 and 16 kD seen in P+ cells. P-, P+, and TPA transformed cells show a progressive decrease in both basal and TPA-inducible levels of a protein kinase C substrate of 80 kD. P- cells are relatively resistant both to anchorage-independent transformation and to a protein band shift induced by the calcium analog lanthanum. It appears that one or more calcium-binding proteins and one or more pro genes may be critical determinants of tumor promoter-induced neoplastic transformation

  8. Gene activation regresses atherosclerosis, promotes health, and enhances longevity

    Directory of Open Access Journals (Sweden)

    Luoma Pauli V

    2010-07-01

    Full Text Available Abstract Background Lifestyle factors and pharmacological compounds activate genetic mechanisms that influence the development of atherosclerotic and other diseases. This article reviews studies on natural and pharmacological gene activation that promotes health and enhances longevity. Results Living habits including healthy diet and regular physical activity, and pharmacotherapy, upregulate genes encoding enzymes and apolipoprotein and ATP-binding cassette transporters, acting in metabolic processes that promote health and increase survival. Cytochrome P450-enzymes, physiological factors in maintaining cholesterol homeostasis, generate oxysterols for the elimination of surplus cholesterol. Hepatic CTP:phosphocholine cytidylyltransferase-α is an important regulator of plasma HDL-C level. Gene-activators produce plasma lipoprotein profile, high HDL-C, HDL2-C and HDL-C/cholesterol ratio, which is typical of low risk of atherosclerotic disease, and also of exceptional longevity together with reduced prevalence of cardiovascular, metabolic and other diseases. High HDL contributes to protection against inflammation, oxidation and thrombosis, and associates with good cognitive function in very old people. Avoiding unhealthy stress and managing it properly promotes health and increases life expectancy. Conclusions Healthy living habits and gene-activating xenobiotics upregulate mechanisms that produce lipoprotein pattern typical of very old people and enhance longevity. Lipoprotein metabolism and large HDL2 associate with the process of living a very long life. Major future goals for health promotion are the improving of commitment to both wise lifestyle choices and drug therapy, and further the developing of new and more effective and well tolerated drugs and treatments.

  9. Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters

    Science.gov (United States)

    2016-08-01

    levels, and in some cases be useful in early stage disease or watchful waiting, and in other cases castration resistant prostate cancer (CRPC...dependent kinase inhibitor p21 gene through an androgen response element in the proximal promoter. Molecular endocrinology 13, 376 (Mar, 1999). 9...analyses and in mouse xenograft experiments, as planned. We will also continue to probe the molecular mechanism by which dox elicits these differential

  10. The altered promoter methylation of oxytocin receptor gene in autism.

    Science.gov (United States)

    Elagoz Yuksel, Mine; Yuceturk, Betul; Karatas, Omer Faruk; Ozen, Mustafa; Dogangun, Burak

    Autism spectrum disorder (ASD) is one of the lifelong existing disorders. Abnormal methylation status of gene promoters of oxytonergic system has been implicated as among the etiologic factors of ASDs. We, therefore, investigated the methylation frequency of oxytocin receptor gene (OXTR) promoter from peripheral blood samples of children with autistic features. Our sample includes 66 children in total (22-94 months); 27 children with ASDs according to the DSM-IV-TR and the Childhood Autism Rating Scale (CARS) and 39 children who do not have any autistic like symptoms as the healthy control group. We investigated the DNA methylation status of OXTR promoter by methylation specific enzymatic digestion of genomic DNA and polymerase chain reaction. A significant relationship has been found between ASDs and healthy controls for the reduction of methylation frequency of the regions MT1 and MT3 of OXTR. We could not find any association in the methylation frequency of MT2 and MT4 regions of OXTR. Although our findings indicate high frequency of OXTR promoter hypomethylation in ASDs, there is need for independent replication of the results for a bigger sample set. We expect that future studies with the inclusion of larger, more homogeneous samples will attempt to disentangle the causes of ASDs.

  11. Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.

    Directory of Open Access Journals (Sweden)

    Patrick O McGowan

    Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.

  12. Molecular Cloning of a cDNA Encoding for Taenia solium TATA-Box Binding Protein 1 (TsTBP1) and Study of Its Interactions with the TATA-Box of Actin 5 and Typical 2-Cys Peroxiredoxin Genes.

    Science.gov (United States)

    Rodríguez-Lima, Oscar; García-Gutierrez, Ponciano; Jiménez, Lucía; Zarain-Herzberg, Ángel; Lazzarini, Roberto; Landa, Abraham

    2015-01-01

    TATA-box binding protein (TBP) is an essential regulatory transcription factor for the TATA-box and TATA-box-less gene promoters. We report the cloning and characterization of a full-length cDNA that encodes a Taenia solium TATA-box binding protein 1 (TsTBP1). Deduced amino acid composition from its nucleotide sequence revealed that encodes a protein of 238 residues with a predicted molecular weight of 26.7 kDa, and a theoretical pI of 10.6. The NH2-terminal domain shows no conservation when compared with to pig and human TBP1s. However, it shows high conservation in size and amino acid identity with taeniids TBP1s. In contrast, the TsTBP1 COOH-terminal domain is highly conserved among organisms, and contains the amino acids involved in interactions with the TATA-box, as well as with TFIIA and TFIIB. In silico TsTBP1 modeling reveals that the COOH-terminal domain forms the classical saddle structure of the TBP family, with one α-helix at the end, not present in pig and human. Native TsTBP1 was detected in T. solium cysticerci´s nuclear extract by western blot using rabbit antibodies generated against two synthetic peptides located in the NH2 and COOH-terminal domains of TsTBP1. These antibodies, through immunofluorescence technique, identified the TBP1 in the nucleus of cells that form the bladder wall of cysticerci of Taenia crassiceps, an organism close related to T. solium. Electrophoretic mobility shift assays using nuclear extracts from T. solium cysticerci and antibodies against the NH2-terminal domain of TsTBP1 showed the interaction of native TsTBP1 with the TATA-box present in T. solium actin 5 (pAT5) and 2-Cys peroxiredoxin (Ts2-CysPrx) gene promoters; in contrast, when antibodies against the anti-COOH-terminal domain of TsTBP1 were used, they inhibited the binding of TsTBP1 to the TATA-box of the pAT5 promoter gene.

  13. Aberrant gene promoter methylation associated with sporadic multiple colorectal cancer.

    Directory of Open Access Journals (Sweden)

    Victoria Gonzalo

    Full Text Available BACKGROUND: Colorectal cancer (CRC multiplicity has been mainly related to polyposis and non-polyposis hereditary syndromes. In sporadic CRC, aberrant gene promoter methylation has been shown to play a key role in carcinogenesis, although little is known about its involvement in multiplicity. To assess the effect of methylation in tumor multiplicity in sporadic CRC, hypermethylation of key tumor suppressor genes was evaluated in patients with both multiple and solitary tumors, as a proof-of-concept of an underlying epigenetic defect. METHODOLOGY/PRINCIPAL FINDINGS: We examined a total of 47 synchronous/metachronous primary CRC from 41 patients, and 41 gender, age (5-year intervals and tumor location-paired patients with solitary tumors. Exclusion criteria were polyposis syndromes, Lynch syndrome and inflammatory bowel disease. DNA methylation at the promoter region of the MGMT, CDKN2A, SFRP1, TMEFF2, HS3ST2 (3OST2, RASSF1A and GATA4 genes was evaluated by quantitative methylation specific PCR in both tumor and corresponding normal appearing colorectal mucosa samples. Overall, patients with multiple lesions exhibited a higher degree of methylation in tumor samples than those with solitary tumors regarding all evaluated genes. After adjusting for age and gender, binomial logistic regression analysis identified methylation of MGMT2 (OR, 1.48; 95% CI, 1.10 to 1.97; p = 0.008 and RASSF1A (OR, 2.04; 95% CI, 1.01 to 4.13; p = 0.047 as variables independently associated with tumor multiplicity, being the risk related to methylation of any of these two genes 4.57 (95% CI, 1.53 to 13.61; p = 0.006. Moreover, in six patients in whom both tumors were available, we found a correlation in the methylation levels of MGMT2 (r = 0.64, p = 0.17, SFRP1 (r = 0.83, 0.06, HPP1 (r = 0.64, p = 0.17, 3OST2 (r = 0.83, p = 0.06 and GATA4 (r = 0.6, p = 0.24. Methylation in normal appearing colorectal mucosa from patients with multiple and solitary CRC showed no relevant

  14. HIV infection of T cells: actin-in and actin-out.

    Science.gov (United States)

    Liu, Yin; Belkina, Natalya V; Shaw, Stephen

    2009-04-14

    Three studies shed light on the decade-old observation that the actin cytoskeleton is hijacked to facilitate entry of HIV into its target cells. Polymerization of actin is required to assemble high concentrations of CD4 and CXCR4 at the plasma membrane, which promote viral binding and entry in both the simple model of infection by free virus and the more physiologically relevant route of infection through the virological synapse. Three types of actin-interacting proteins-filamin, ezrin/radixin/moesin (ERM), and cofilin-are now shown to play critical roles in this process. Filamin binds to both CD4 and CXCR4 in a manner promoted by signaling of the HIV gp120 glycoprotein. ERM proteins attach actin filaments to the membrane and may promote polymerization of actin. Early in the process of viral entry, cofilin is inactivated, which is proposed to facilitate the early assembly of actin filaments, but cofilin is reported to be activated soon thereafter to facilitate postentry events. This complex role of cofilin may help to reconcile the paradox that actin polymerization promotes initial binding and fusion steps but inhibits some subsequent early postentry events.

  15. Promoter Methylation Analysis of IDH Genes in Human Gliomas

    International Nuclear Information System (INIS)

    Flanagan, Simon; Lee, Maggie; Li, Cheryl C. Y.; Suter, Catherine M.; Buckland, Michael E.

    2012-01-01

    Mutations in isocitrate dehydrogenase (IDH)-1 or -2 are found in the majority of WHO grade II and III astrocytomas and oligodendrogliomas, and secondary glioblastomas. Almost all described mutations are heterozygous missense mutations affecting a conserved arginine residue in the substrate binding site of IDH1 (R132) or IDH2 (R172). But the exact mechanism of IDH mutations in neoplasia is not understood. It has been proposed that IDH mutations impart a “toxic gain-of-function” to the mutant protein, however a dominant-negative effect of mutant IDH has also been described, implying that IDH may function as a tumor suppressor gene. As most, if not all, tumor suppressor genes are inactivated by epigenetic silencing, in a wide variety of tumors, we asked if IDH1 or IDH2 carry the epigenetic signature of a tumor suppressor by assessing cytosine methylation at their promoters. Methylation was quantified in 68 human brain tumors, including both IDH-mutant and IDH wildtype, by bisulfite pyrosequencing. In all tumors examined, CpG methylation levels were less than 8%. Our data demonstrate that inactivation of IDH function through promoter hypermethylation is not common in human gliomas and other brain tumors. These findings do not support a tumor suppressor role for IDH genes in human gliomas.

  16. Intrinsically bent DNA in replication origins and gene promoters.

    Science.gov (United States)

    Gimenes, F; Takeda, K I; Fiorini, A; Gouveia, F S; Fernandez, M A

    2008-06-24

    Intrinsically bent DNA is an alternative conformation of the DNA molecule caused by the presence of dA/dT tracts, 2 to 6 bp long, in a helical turn phase DNA or with multiple intervals of 10 to 11 bp. Other than flexibility, intrinsic bending sites induce DNA curvature in particular chromosome regions such as replication origins and promoters. Intrinsically bent DNA sites are important in initiating DNA replication, and are sometimes found near to regions associated with the nuclear matrix. Many methods have been developed to localize bent sites, for example, circular permutation, computational analysis, and atomic force microscopy. This review discusses intrinsically bent DNA sites associated with replication origins and gene promoter regions in prokaryote and eukaryote cells. We also describe methods for identifying bent DNA sites for circular permutation and computational analysis.

  17. Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.

    Science.gov (United States)

    Meng, C X; Wei, W; Su, Z- L; Qin, S

    2006-10-01

    Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.

  18. Polycation induced actin bundles

    OpenAIRE

    Muhlrad, Andras; Grintsevich, Elena E.; Reisler, Emil

    2011-01-01

    Three polycations, polylysine, the polyamine spermine and the polycationic protein lysozyme were used to study the formation, structure, ionic strength sensitivity and dissociation of polycation-induced actin bundles. Bundles form fast, simultaneously with the polymerization of MgATP-G-actins, upon addition of polycations to solutions of actins at low ionic strength conditions. This indicates that nuclei and/or nascent filaments bundle due to attractive, electrostatic effect of polycations an...

  19. A synthetic mechano-growth factor E peptide promotes rat tenocyte migration by lessening cell stiffness and increasing F-actin formation via the FAK-ERK1/2 signaling pathway

    International Nuclear Information System (INIS)

    Zhang, Bingyu; Luo, Qing; Mao, Xinjian; Xu, Baiyao; Yang, Li; Ju, Yang; Song, Guanbin

    2014-01-01

    Tendon injuries are common in sports and are frequent reasons for orthopedic consultations. The management of damaged tendons is one of the most challenging problems in orthopedics. Mechano-growth factor (MGF), a recently discovered growth repair factor, plays positive roles in tissue repair through the improvement of cell proliferation and migration and the protection of cells against injury-induced apoptosis. However, it remains unclear whether MGF has the potential to accelerate tendon repair. We used a scratch wound assay in this study to demonstrate that MGF-C25E (a synthetic mechano-growth factor E peptide) promotes the migration of rat tenocytes and that this promotion is accompanied by an elevation in the expression of the following signaling molecules: focal adhesion kinase (FAK) and extracellular signal regulated kinase1/2 (ERK1/2). Inhibitors of the FAK and ERK1/2 pathways inhibited the MGF-C25E-induced tenocyte migration, indicating that MGF-C25E promotes tenocyte migration through the FAK-ERK1/2 signaling pathway. The analysis of the mechanical properties showed that the Young's modulus of tenocytes was decreased through treatment of MGF-C25E, and an obvious formation of pseudopodia and F-actin was observed in MGF-C25E-treated tenocytes. The inhibition of the FAK or ERK1/2 signals restored the decrease in Young's modulus and inhibited the formation of pseudopodia and F-actin. Overall, our study demonstrated that MGF-C25E promotes rat tenocyte migration by lessening cell stiffness and increasing pseudopodia formation via the FAK-ERK1/2 signaling pathway. - Highlights: • Mechano-growth factor E peptide (MGF-C25E) promotes migration of rat tenocytes. • MGF-C25E activates the FAK-ERK1/2 pathway in rat tenocytes. • MGF-C25E induces the actin remodeling and the formation of pseudopodia, and decreases the stiffness in rat tenocytes. • MGF-C25E promotes tenocyte migration via altering stiffness and forming pseudopodia by the activation of the

  20. A synthetic mechano-growth factor E peptide promotes rat tenocyte migration by lessening cell stiffness and increasing F-actin formation via the FAK-ERK1/2 signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Bingyu [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Luo, Qing, E-mail: qing.luo@cqu.edu.cn [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Mao, Xinjian [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Xu, Baiyao [Department of Mechanical Science and Engineering, Nagoya University, Nagoya 464-8603 (Japan); Yang, Li [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Ju, Yang [Department of Mechanical Science and Engineering, Nagoya University, Nagoya 464-8603 (Japan); Song, Guanbin, E-mail: song@cqu.edu.cn [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China)

    2014-03-10

    Tendon injuries are common in sports and are frequent reasons for orthopedic consultations. The management of damaged tendons is one of the most challenging problems in orthopedics. Mechano-growth factor (MGF), a recently discovered growth repair factor, plays positive roles in tissue repair through the improvement of cell proliferation and migration and the protection of cells against injury-induced apoptosis. However, it remains unclear whether MGF has the potential to accelerate tendon repair. We used a scratch wound assay in this study to demonstrate that MGF-C25E (a synthetic mechano-growth factor E peptide) promotes the migration of rat tenocytes and that this promotion is accompanied by an elevation in the expression of the following signaling molecules: focal adhesion kinase (FAK) and extracellular signal regulated kinase1/2 (ERK1/2). Inhibitors of the FAK and ERK1/2 pathways inhibited the MGF-C25E-induced tenocyte migration, indicating that MGF-C25E promotes tenocyte migration through the FAK-ERK1/2 signaling pathway. The analysis of the mechanical properties showed that the Young's modulus of tenocytes was decreased through treatment of MGF-C25E, and an obvious formation of pseudopodia and F-actin was observed in MGF-C25E-treated tenocytes. The inhibition of the FAK or ERK1/2 signals restored the decrease in Young's modulus and inhibited the formation of pseudopodia and F-actin. Overall, our study demonstrated that MGF-C25E promotes rat tenocyte migration by lessening cell stiffness and increasing pseudopodia formation via the FAK-ERK1/2 signaling pathway. - Highlights: • Mechano-growth factor E peptide (MGF-C25E) promotes migration of rat tenocytes. • MGF-C25E activates the FAK-ERK1/2 pathway in rat tenocytes. • MGF-C25E induces the actin remodeling and the formation of pseudopodia, and decreases the stiffness in rat tenocytes. • MGF-C25E promotes tenocyte migration via altering stiffness and forming pseudopodia by the activation of the

  1. Senataxin Mutation Reveals How R-Loops Promote Transcription by Blocking DNA Methylation at Gene Promoters.

    Science.gov (United States)

    Grunseich, Christopher; Wang, Isabel X; Watts, Jason A; Burdick, Joshua T; Guber, Robert D; Zhu, Zhengwei; Bruzel, Alan; Lanman, Tyler; Chen, Kelian; Schindler, Alice B; Edwards, Nancy; Ray-Chaudhury, Abhik; Yao, Jianhua; Lehky, Tanya; Piszczek, Grzegorz; Crain, Barbara; Fischbeck, Kenneth H; Cheung, Vivian G

    2018-02-01

    R-loops are three-stranded nucleic acid structures found abundantly and yet often viewed as by-products of transcription. Studying cells from patients with a motor neuron disease (amyotrophic lateral sclerosis 4 [ALS4]) caused by a mutation in senataxin, we uncovered how R-loops promote transcription. In ALS4 patients, the senataxin mutation depletes R-loops with a consequent effect on gene expression. With fewer R-loops in ALS4 cells, the expression of BAMBI, a negative regulator of transforming growth factor β (TGF-β), is reduced; that then leads to the activation of the TGF-β pathway. We uncovered that genome-wide R-loops influence promoter methylation of over 1,200 human genes. DNA methyl-transferase 1 favors binding to double-stranded DNA over R-loops. Thus, in forming R-loops, nascent RNA blocks DNA methylation and promotes further transcription. Hence, our results show that nucleic acid structures, in addition to sequences, influence the binding and activity of regulatory proteins. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Genetic recombination is targeted towards gene promoter regions in dogs.

    Science.gov (United States)

    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R

    2013-01-01

    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.

  3. Heterologous gene expression driven by carbonic anhydrase gene promoter in Dunaliella salina

    Science.gov (United States)

    Yurong, Chai; Yumin, Lu; Tianyun, Wang; Weihong, Hou; Lexun, Xue

    2006-12-01

    Dunaliella salina, a halotolerant unicellular green alga without a rigid cell wall, can live in salinities ranging from 0.05 to 5 mol/L NaCl. These features of D. salina make it an ideal host for the production of antibodies, oral vaccine, and commercially valuable polypeptides. To produce high level of heterologous proteins from D. salina, highly efficient promoters are required to drive expression of target genes under controlled condition. In the present study, we cloned a 5' franking region of 1.4 kb from the carbonic anhydrase ( CAH) gene of D. salina by genomic walking and PCR. The fragment was ligated to the pMD18-T vector and characterized. Sequence analysis indicated that this region contained conserved motifs, including a TATA- like box and CAAT-box. Tandem (GT)n repeats that had a potential role of transcriptional control, were also found in this region. The transcription start site (TSS) of the CAH gene was determined by 5' RACE and nested PCR method. Transformation assays showed that the 1.4 kb fragment was able to drive expression of the selectable bar (bialaphos resistance) gene when the fusion was transformed into D. salina by biolistics. Northern blotting hybridizations showed that the bar transcript was most abundant in cells grown in 2 mol/L NaCl, and less abundant in 0.5 mol/L NaCl, indicating that expression of the bar gene was induced at high salinity. These results suggest the potential use of the CAH gene promoter to induce the expression of heterologous genes in D. salina under varied salt condition.

  4. IL6 gene promoter polymorphisms and type 2 diabetes

    DEFF Research Database (Denmark)

    Huth, Cornelia; Heid, Iris M; Vollmert, Caren

    2006-01-01

    Several lines of evidence indicate a causal role of the cytokine interleukin (IL)-6 in the development of type 2 diabetes in humans. Two common polymorphisms in the promoter of the IL-6 encoding gene IL6, -174G>C (rs1800795) and -573G>C (rs1800796), have been investigated for association with type...... 2 diabetes in numerous studies but with results that have been largely equivocal. To clarify the relationship between the two IL6 variants and type 2 diabetes, we analyzed individual data on >20,000 participants from 21 published and unpublished studies. Collected data represent eight different...... countries, making this the largest association analysis for type 2 diabetes reported to date. The GC and CC genotypes of IL6 -174G>C were associated with a decreased risk of type 2 diabetes (odds ratio 0.91, P = 0.037), corresponding to a risk modification of nearly 9%. No evidence for association was found...

  5. Genome-wide analysis of regions similar to promoters of histone genes

    KAUST Repository

    Chowdhary, Rajesh

    2010-05-28

    Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that

  6. Cooperative binding of transcription factors promotes bimodal gene expression response.

    Directory of Open Access Journals (Sweden)

    Pablo S Gutierrez

    Full Text Available In the present work we extend and analyze the scope of our recently proposed stochastic model for transcriptional regulation, which considers an arbitrarily complex cis-regulatory system using only elementary reactions. Previously, we determined the role of cooperativity on the intrinsic fluctuations of gene expression for activating transcriptional switches, by means of master equation formalism and computer simulation. This model allowed us to distinguish between two cooperative binding mechanisms and, even though the mean expression levels were not affected differently by the acting mechanism, we showed that the associated fluctuations were different. In the present generalized model we include other regulatory functions in addition to those associated to an activator switch. Namely, we introduce repressive regulatory functions and two theoretical mechanisms that account for the biphasic response that some cis-regulatory systems show to the transcription factor concentration. We have also extended our previous master equation formalism in order to include protein production by stochastic translation of mRNA. Furthermore, we examine the graded/binary scenarios in the context of the interaction energy between transcription factors. In this sense, this is the first report to show that the cooperative binding of transcription factors to DNA promotes the "all-or-none" phenomenon observed in eukaryotic systems. In addition, we confirm that gene expression fluctuation levels associated with one of two cooperative binding mechanism never exceed the fluctuation levels of the other.

  7. Altered gene-expression profile in rat plasma and promoted body ...

    African Journals Online (AJOL)

    Altered gene-expression profile in rat plasma and promoted body and brain development ... The study was aimed to explore how the prenatal EE impacts affect the ... positively promote the body and nervous system development of offspring, ...

  8. Development of chimeric gene promoters responsive to hypoxia and ionizing radiation

    International Nuclear Information System (INIS)

    Zheng Aiqing; Yu Jinming

    2004-01-01

    The authors describe two systems that make use of gene-directed enzyme prodrug therapy, regulated by radiation or hypoxic-responsive promoters. The use of treatment-, condition- or tumor-specific promoters to control gene-directed enzyme prodrug therapy is one such method for targeting gene expression to the tumor. The development of such strategies that achieve tumor targeted expression of genes via selective promoters will enable improved specificity and targeting thereby addressing one of the major limitations of cancer gene therapy

  9. The H3K4me3/2 histone demethylase RBR-2 controls axon guidance by repressing the actin-remodeling gene wsp-1

    DEFF Research Database (Denmark)

    Mariani, Luca; Lussi, Yvonne C.; Vandamme, Julien

    2016-01-01

    . Here, we show that RBR-2, the sole homolog of the KDM5 family of H3K4me3/2 demethylases in Caenorhabditis elegans, ensures correct axon guidance by controlling the expression of the actin regulator wsp-1. Loss of rbr-2 results in increased levels of H3K4me3 at the transcriptional start site of wsp-1...

  10. ABERRANT METHYLATION OF THE PROMOTER OF APC, CDH13 AND MGMT GENES IN COLORECTAL CANCER PATIENTS

    Directory of Open Access Journals (Sweden)

    O. I. Kit

    2016-01-01

    Full Text Available Aberrant methylation of gene promoter regions is the main epigenetic change characterizing colorectal cancer. Methylation levels of 42 CpG-sites of promoter regions of the MGMT, APC and CDH13 genes in colorectal cancer were studied in comparison with methylation levels of the adjacent normal tissue in 25 patients. Pyrosequencing showed an increase in methylation levels of promoter regions of the MGMT, APC and CDH13 genes in tumor samples by 3 to 5 times. These tumor samples were screened for activating SNP-mutations in the KRAS (40 %, NRAS (0 % and BRAF (0 % oncogenes. SNP-mutations in the KRAS gene were accompanied by hypermethylation of one or more promoters of the studied genes. Association of this epigenetic index with tumor metastasis was proved. The data on an increase in methylation of the promoter regions of oncosupressor genes can be used as sensitive prognostic markers of progression and metastasis of colorectal cancer.

  11. Monophasic Pulsed 200-?A Current Promotes Galvanotaxis With Polarization of Actin Filament and Integrin ?2?1 in Human Dermal Fibroblasts

    OpenAIRE

    Uemura, Mikiko; Maeshige, Noriaki; Koga, Yuka; Ishikawa-Aoyama, Michiko; Miyoshi, Makoto; Sugimoto, Masaharu; Terashi, Hiroto; Usami, Makoto

    2016-01-01

    Objective: The monophasic pulsed microcurrent is used to promote wound healing, and galvanotaxis regulation has been reported as one of the active mechanisms in the promotion of tissue repair with monophasic pulsed microcurrent. However, the optimum monophasic pulsed microcurrent parameters and intracellular changes caused by the monophasic pulsed microcurrent have not been elucidated in human dermal fibroblasts. The purpose of this study was to investigate the optimum intensity for promoting...

  12. A nucleator arms race: cellular control of actin assembly.

    Science.gov (United States)

    Campellone, Kenneth G; Welch, Matthew D

    2010-04-01

    For over a decade, the actin-related protein 2/3 (ARP2/3) complex, a handful of nucleation-promoting factors and formins were the only molecules known to directly nucleate actin filament formation de novo. However, the past several years have seen a surge in the discovery of mammalian proteins with roles in actin nucleation and dynamics. Newly recognized nucleation-promoting factors, such as WASP and SCAR homologue (WASH), WASP homologue associated with actin, membranes and microtubules (WHAMM), and junction-mediating regulatory protein (JMY), stimulate ARP2/3 activity at distinct cellular locations. Formin nucleators with additional biochemical and cellular activities have also been uncovered. Finally, the Spire, cordon-bleu and leiomodin nucleators have revealed new ways of overcoming the kinetic barriers to actin polymerization.

  13. Viral promoters can initiate expression of toxin genes introduced into Escherichia coli

    Directory of Open Access Journals (Sweden)

    Jacob Daniela

    2005-06-01

    Full Text Available Abstract Background The expression of recombinant proteins in eukaryotic cells requires the fusion of the coding region to a promoter functional in the eukaryotic cell line. Viral promoters are very often used for this purpose. The preceding cloning procedures are usually performed in Escherichia coli and it is therefore of interest if the foreign promoter results in an expression of the gene in bacteria. In the case molecules toxic for humans are to be expressed, this knowledge is indispensable for the specification of safety measures. Results We selected five frequently used viral promoters and quantified their activity in E. coli with a reporter system. Only the promoter from the thymidine kinase gene from HSV1 showed no activity, while the polyhedrin promoter from baculovirus, the early immediate CMV promoter, the early SV40 promoter and the 5' LTR promoter from HIV-1 directed gene expression in E. coli. The determination of transcription start sites in the immediate early CMV promoter and the polyhedrin promoter confirmed the existence of bacterial -10 and -35 consensus sequences. The importance of this heterologous gene expression for safety considerations was further supported by analysing fusions between the aforementioned promoters and a promoter-less cytotoxin gene. Conclusion According to our results a high percentage of viral promoters have the ability of initiating gene expression in E. coli. The degree of such heterologous gene expression can be sufficient for the expression of toxin genes and must therefore be considered when defining safety measures for the handling of corresponding genetically modified organisms.

  14. Actinic keratosis among seafarers.

    Science.gov (United States)

    Oldenburg, M; Kuechmeister, B; Ohnemus, U; Baur, X; Moll, I

    2013-11-01

    The aim of this study was to assess the prevalence of UV-induced actinic keratosis and further skin lesions. A newly developed questionnaire about lifetime UV radiation exposure was completed by 514 seafarers. An experienced dermatologist inspected the whole-body skin status of all participants. The questionnaire revealed a pre-employment UV radiation exposure in 104 seafarers, sunbed use in 26 subjects and a median work-related UV radiation exposure at sea of 20 years. The diagnosis of actinic keratoses was made in 94 seafarers and the clinical diagnosis of skin cancers in 48 seafarers (28 basal cell carcinoma, 11 squamous cell carcinoma, 9 malignant melanoma). After age standardisation according to a European reference population, the male European seafarers in this study had a 1.80-fold increased risk of actinic keratosis. Actinic keratoses [OR 1.03 (1.01-1.05)] and squamous cell carcinoma [OR 1.07 (1.01-1.13)] were related to the duration of seafaring time in years. A significant association was also found between actinic keratosis/squamous cell carcinoma and sunlight exposure during home leave [OR 1.67 (1.03-2.81) and OR 6.19 (1.18-32.40)]. Furthermore, the engine room personnel-especially the technical officers-were at higher risk of developing actinic keratosis. Due to the high prevalence of actinic keratosis especially among older seafarers with fair skin, with longer duration of seafaring employment at sea and with higher UV exposure during home leave, more intensive advice should be given on sun protection both at sea and ashore.

  15. Polycation induced actin bundles.

    Science.gov (United States)

    Muhlrad, Andras; Grintsevich, Elena E; Reisler, Emil

    2011-04-01

    Three polycations, polylysine, the polyamine spermine and the polycationic protein lysozyme were used to study the formation, structure, ionic strength sensitivity and dissociation of polycation-induced actin bundles. Bundles form fast, simultaneously with the polymerization of MgATP-G-actins, upon the addition of polycations to solutions of actins at low ionic strength conditions. This indicates that nuclei and/or nascent filaments bundle due to attractive, electrostatic effect of polycations and the neutralization of repulsive interactions of negative charges on actin. The attractive forces between the filaments are strong, as shown by the low (in nanomolar range) critical concentration of their bundling at low ionic strength. These bundles are sensitive to ionic strength and disassemble partially in 100 mM NaCl, but both the dissociation and ionic strength sensitivity can be countered by higher polycation concentrations. Cys374 residues of actin monomers residing on neighboring filaments in the bundles can be cross-linked by the short span (5.4Å) MTS-1 (1,1-methanedyl bismethanethiosulfonate) cross-linker, which indicates a tight packing of filaments in the bundles. The interfilament cross-links, which connect monomers located on oppositely oriented filaments, prevent disassembly of bundles at high ionic strength. Cofilin and the polysaccharide polyanion heparin disassemble lysozyme induced actin bundles more effectively than the polylysine-induced bundles. The actin-lysozyme bundles are pathologically significant as both proteins are found in the pulmonary airways of cystic fibrosis patients. Their bundles contribute to the formation of viscous mucus, which is the main cause of breathing difficulties and eventual death in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters

    Directory of Open Access Journals (Sweden)

    Gagniuc Paul

    2012-09-01

    Full Text Available Abstract Background The main function of gene promoters appears to be the integration of different gene products in their biological pathways in order to maintain homeostasis. Generally, promoters have been classified in two major classes, namely TATA and CpG. Nevertheless, many genes using the same combinatorial formation of transcription factors have different gene expression patterns. Accordingly, we tried to ask ourselves some fundamental questions: Why certain genes have an overall predisposition for higher gene expression levels than others? What causes such a predisposition? Is there a structural relationship of these sequences in different tissues? Is there a strong phylogenetic relationship between promoters of closely related species? Results In order to gain valuable insights into different promoter regions, we obtained a series of image-based patterns which allowed us to identify 10 generic classes of promoters. A comprehensive analysis was undertaken for promoter sequences from Arabidopsis thaliana, Drosophila melanogaster, Homo sapiens and Oryza sativa, and a more extensive analysis of tissue-specific promoters in humans. We observed a clear preference for these species to use certain classes of promoters for specific biological processes. Moreover, in humans, we found that different tissues use distinct classes of promoters, reflecting an emerging promoter network. Depending on the tissue type, comparisons made between these classes of promoters reveal a complementarity between their patterns whereas some other classes of promoters have been observed to occur in competition. Furthermore, we also noticed the existence of some transitional states between these classes of promoters that may explain certain evolutionary mechanisms, which suggest a possible predisposition for specific levels of gene expression and perhaps for a different number of factors responsible for triggering gene expression. Our conclusions are based on

  17. DNA entropy reveals a significant difference in complexity between housekeeping and tissue specific gene promoters.

    Science.gov (United States)

    Thomas, David; Finan, Chris; Newport, Melanie J; Jones, Susan

    2015-10-01

    The complexity of DNA can be quantified using estimates of entropy. Variation in DNA complexity is expected between the promoters of genes with different transcriptional mechanisms; namely housekeeping (HK) and tissue specific (TS). The former are transcribed constitutively to maintain general cellular functions, and the latter are transcribed in restricted tissue and cells types for specific molecular events. It is known that promoter features in the human genome are related to tissue specificity, but this has been difficult to quantify on a genomic scale. If entropy effectively quantifies DNA complexity, calculating the entropies of HK and TS gene promoters as profiles may reveal significant differences. Entropy profiles were calculated for a total dataset of 12,003 human gene promoters and for 501 housekeeping (HK) and 587 tissue specific (TS) human gene promoters. The mean profiles show the TS promoters have a significantly lower entropy (pentropy distributions for the 3 datasets show that promoter entropies could be used to identify novel HK genes. Functional features comprise DNA sequence patterns that are non-random and hence they have lower entropies. The lower entropy of TS gene promoters can be explained by a higher density of positive and negative regulatory elements, required for genes with complex spatial and temporary expression. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. HOX Gene Promoter Prediction and Inter-genomic Comparison: An Evo-Devo Study

    Directory of Open Access Journals (Sweden)

    Marla A. Endriga

    2010-10-01

    Full Text Available Homeobox genes direct the anterior-posterior axis of the body plan in eukaryotic organisms. Promoter regions upstream of the Hox genes jumpstart the transcription process. CpG islands found within the promoter regions can cause silencing of these promoters. The locations of the promoter regions and the CpG islands of Homeo sapiens sapiens (human, Pan troglodytes (chimpanzee, Mus musculus (mouse, and Rattus norvegicus (brown rat are compared and related to the possible influence on the specification of the mammalian body plan. The sequence of each gene in Hox clusters A-D of the mammals considered were retrieved from Ensembl and locations of promoter regions and CpG islands predicted using Exon Finder. The predicted promoter sequences were confirmed via BLAST and verified against the Eukaryotic Promoter Database. The significance of the locations was determined using the Kruskal-Wallis test. Among the four clusters, only promoter locations in cluster B showed significant difference. HOX B genes have been linked with the control of genes that direct the development of axial morphology, particularly of the vertebral column bones. The magnitude of variation among the body plans of closely-related species can thus be partially attributed to the promoter kind, location and number, and gene inactivation via CpG methylation.

  19. Tumor Restrictive Suicide Gene Therapy for Glioma Controlled by the FOS Promoter.

    Directory of Open Access Journals (Sweden)

    Jianqing Pan

    Full Text Available Effective suicide gene delivery and expression are crucial to achieving successful effects in gene therapy. An ideal tumor-specific promoter expresses therapeutic genes in tumor cells with minimal normal tissue expression. We compared the activity of the FOS (FBJ murine osteosarcoma viral oncogene homolog promoter with five alternative tumor-specific promoters in glioma cells and non-malignant astrocytes. The FOS promoter caused significantly higher transcriptional activity in glioma cell lines than all alternative promoters with the exception of CMV. The FOS promoter showed 13.9%, 32.4%, and 70.8% of the transcriptional activity of CMV in three glioma cell lines (U87, U251, and U373. Importantly, however, the FOS promoter showed only 1.6% of the transcriptional activity of CMV in normal astrocytes. We also tested the biologic activity of recombinant adenovirus containing the suicide gene herpes simplex virus thymidine kinase (HSV-tk driven by the FOS promoter, including selective killing efficacy in vitro and tumor inhibition rate in vivo. Adenoviral-mediated delivery of the HSV-tk gene controlled by the FOS promoter conferred a cytotoxic effect on human glioma cells in vitro and in vivo. This study suggests that use of the FOS-tk adenovirus system is a promising strategy for glioma-specific gene therapy but still much left for improvement.

  20. Positional bias of general and tissue-specific regulatory motifs in mouse gene promoters

    Directory of Open Access Journals (Sweden)

    Farré Domènec

    2007-12-01

    Full Text Available Abstract Background The arrangement of regulatory motifs in gene promoters, or promoter architecture, is the result of mutation and selection processes that have operated over many millions of years. In mammals, tissue-specific transcriptional regulation is related to the presence of specific protein-interacting DNA motifs in gene promoters. However, little is known about the relative location and spacing of these motifs. To fill this gap, we have performed a systematic search for motifs that show significant bias at specific promoter locations in a large collection of housekeeping and tissue-specific genes. Results We observe that promoters driving housekeeping gene expression are enriched in particular motifs with strong positional bias, such as YY1, which are of little relevance in promoters driving tissue-specific expression. We also identify a large number of motifs that show positional bias in genes expressed in a highly tissue-specific manner. They include well-known tissue-specific motifs, such as HNF1 and HNF4 motifs in liver, kidney and small intestine, or RFX motifs in testis, as well as many potentially novel regulatory motifs. Based on this analysis, we provide predictions for 559 tissue-specific motifs in mouse gene promoters. Conclusion The study shows that motif positional bias is an important feature of mammalian proximal promoters and that it affects both general and tissue-specific motifs. Motif positional constraints define very distinct promoter architectures depending on breadth of expression and type of tissue.

  1. Actin, actin-binding proteins, and actin-related proteins in the nucleus.

    Science.gov (United States)

    Kristó, Ildikó; Bajusz, Izabella; Bajusz, Csaba; Borkúti, Péter; Vilmos, Péter

    2016-04-01

    Extensive research in the past decade has significantly broadened our view about the role actin plays in the life of the cell and added novel aspects to actin research. One of these new aspects is the discovery of the existence of nuclear actin which became evident only recently. Nuclear activities including transcriptional activation in the case of all three RNA polymerases, editing and nuclear export of mRNAs, and chromatin remodeling all depend on actin. It also became clear that there is a fine-tuned equilibrium between cytoplasmic and nuclear actin pools and that this balance is ensured by an export-import system dedicated to actin. After over half a century of research on conventional actin and its organizing partners in the cytoplasm, it was also an unexpected finding that the nucleus contains more than 30 actin-binding proteins and new classes of actin-related proteins which are not able to form filaments but had evolved nuclear-specific functions. The actin-binding and actin-related proteins in the nucleus have been linked to RNA transcription and processing, nuclear transport, and chromatin remodeling. In this paper, we attempt to provide an overview of the wide range of information that is now available about actin, actin-binding, and actin-related proteins in the nucleus.

  2. The progress of tumor gene-radiotherapy induced by Egr-1 promoter

    International Nuclear Information System (INIS)

    Guo Rui; Li Biao

    2010-01-01

    The promoter of early growth response gene-1 (Egr-1) is a cis-acting element of Egr-1, and its activity is regulated by inducers such as ionizing radiation, free radical. In designated gene-radiotherapy system, radiation combined with therapeutic gene (such as tumor necrosis factor-α gene, suicide gene) can spatially and temporally regulate therapeutic gene expression in the irradiated field, produced a marked effect, while little systemic toxicities were observed. The combination of radiotherapy and gene therapy is promising in tumor therapy. (authors)

  3. Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

    International Nuclear Information System (INIS)

    Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van

    2003-01-01

    The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29

  4. Initiation of DNA replication requires actin dynamics and formin activity.

    Science.gov (United States)

    Parisis, Nikolaos; Krasinska, Liliana; Harker, Bethany; Urbach, Serge; Rossignol, Michel; Camasses, Alain; Dewar, James; Morin, Nathalie; Fisher, Daniel

    2017-11-02

    Nuclear actin regulates transcriptional programmes in a manner dependent on its levels and polymerisation state. This dynamics is determined by the balance of nucleocytoplasmic shuttling, formin- and redox-dependent filament polymerisation. Here, using Xenopus egg extracts and human somatic cells, we show that actin dynamics and formins are essential for DNA replication. In proliferating cells, formin inhibition abolishes nuclear transport and initiation of DNA replication, as well as general transcription. In replicating nuclei from transcriptionally silent Xenopus egg extracts, we identified numerous actin regulators, and disruption of actin dynamics abrogates nuclear transport, preventing NLS (nuclear localisation signal)-cargo release from RanGTP-importin complexes. Nuclear formin activity is further required to promote loading of cyclin-dependent kinase (CDK) and proliferating cell nuclear antigen (PCNA) onto chromatin, as well as initiation and elongation of DNA replication. Therefore, actin dynamics and formins control DNA replication by multiple direct and indirect mechanisms. © 2017 The Authors.

  5. Two Functionally Distinct Sources of Actin Monomers Supply the Leading Edge of Lamellipodia

    Science.gov (United States)

    Vitriol, Eric A.; McMillen, Laura M.; Kapustina, Maryna; Gomez, Shawn M.; Vavylonis, Dimitrios; Zheng, James Q.

    2015-01-01

    Summary Lamellipodia, the sheet-like protrusions of motile cells, consist of networks of actin filaments (F-actin) regulated by the ordered assembly from and disassembly into actin monomers (G-actin). Traditionally, G-actin is thought to exist as a homogeneous pool. Here, we show that there are two functionally and molecularly distinct sources of G-actin that supply lamellipodial actin networks. G-actin originating from the cytosolic pool requires the monomer binding protein thymosin β4 (Tβ4) for optimal leading edge localization, is targeted to formins, and is responsible for creating an elevated G/F-actin ratio that promotes membrane protrusion. The second source of G-actin comes from recycled lamellipodia F-actin. Recycling occurs independently of Tβ4 and appears to regulate lamellipodia homeostasis. Tβ4-bound G-actin specifically localizes to the leading edge because it doesn’t interact with Arp2/3-mediated polymerization sites found throughout the lamellipodia. These findings demonstrate that actin networks can be constructed from multiple sources of monomers with discrete spatiotemporal functions. PMID:25865895

  6. Effect of TNFα on activities of different promoters of human apolipoprotein A-I gene

    International Nuclear Information System (INIS)

    Orlov, Sergey V.; Mogilenko, Denis A.; Shavva, Vladimir S.; Dizhe, Ella B.; Ignatovich, Irina A.; Perevozchikov, Andrej P.

    2010-01-01

    Research highlights: → TNFα stimulates the distal alternative promoter of human apoA-I gene. → TNFα acts by weakening of promoter competition within apoA-I gene (promoter switching). → MEK1/2 and nuclear receptors PPARα and LXRs take part in apoA-I promoter switching. -- Abstract: Human apolipoprotein A-I (ApoA-I) is a major structural and functional protein component of high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by pro-inflammatory cytokines such as IL-1β and TNFα. Recently, two novel additional (alternative) promoters for human apoA-I gene have been identified. Nothing is known about the role of alternative promoters in TNFα-mediated downregulation of apoA-I gene. In this article we report for the first time about the different effects of TNFα on two alternative promoters of human apoA-I gene. Stimulation of HepG2 cells by TNFα leads to activation of the distal alternative apoA-I promoter and downregulation of the proximal alternative and the canonical apoA-I promoters. This effect is mediated by weakening of the promoter competition within human apoA-I 5'-regulatory region (apoA-I promoter switching) in the cells treated by TNFα. The MEK1/2-ERK1/2 cascade and nuclear receptors PPARα and LXRs are important for TNFα-mediated apoA-I promoter switching.

  7. Evolutionary Transition of Promoter and Gene Body DNA Methylation across Invertebrate-Vertebrate Boundary.

    Science.gov (United States)

    Keller, Thomas E; Han, Priscilla; Yi, Soojin V

    2016-04-01

    Genomes of invertebrates and vertebrates exhibit highly divergent patterns of DNA methylation. Invertebrate genomes tend to be sparsely methylated, and DNA methylation is mostly targeted to a subset of transcription units (gene bodies). In a drastic contrast, vertebrate genomes are generally globally and heavily methylated, punctuated by the limited local hypo-methylation of putative regulatory regions such as promoters. These genomic differences also translate into functional differences in DNA methylation and gene regulation. Although promoter DNA methylation is an important regulatory component of vertebrate gene expression, its role in invertebrate gene regulation has been little explored. Instead, gene body DNA methylation is associated with expression of invertebrate genes. However, the evolutionary steps leading to the differentiation of invertebrate and vertebrate genomic DNA methylation remain unresolved. Here we analyzed experimentally determined DNA methylation maps of several species across the invertebrate-vertebrate boundary, to elucidate how vertebrate gene methylation has evolved. We show that, in contrast to the prevailing idea, a substantial number of promoters in an invertebrate basal chordate Ciona intestinalis are methylated. Moreover, gene expression data indicate significant, epigenomic context-dependent associations between promoter methylation and expression in C. intestinalis. However, there is no evidence that promoter methylation in invertebrate chordate has been evolutionarily maintained across the invertebrate-vertebrate boundary. Rather, body-methylated invertebrate genes preferentially obtain hypo-methylated promoters among vertebrates. Conversely, promoter methylation is preferentially found in lineage- and tissue-specific vertebrate genes. These results provide important insights into the evolutionary origin of epigenetic regulation of vertebrate gene expression. © The Author(s) 2015. Published by Oxford University Press on behalf

  8. The Bacterial Actin MamK

    Science.gov (United States)

    Ozyamak, Ertan; Kollman, Justin; Agard, David A.; Komeili, Arash

    2013-01-01

    It is now recognized that actin-like proteins are widespread in bacteria and, in contrast to eukaryotic actins, are highly diverse in sequence and function. The bacterial actin, MamK, represents a clade, primarily found in magnetotactic bacteria, that is involved in the proper organization of subcellular organelles, termed magnetosomes. We have previously shown that MamK from Magnetospirillum magneticum AMB-1 (AMB-1) forms dynamic filaments in vivo. To gain further insights into the molecular mechanisms that underlie MamK dynamics and function, we have now studied the in vitro properties of MamK. We demonstrate that MamK is an ATPase that, in the presence of ATP, assembles rapidly into filaments that disassemble once ATP is depleted. The mutation of a conserved active site residue (E143A) abolishes ATPase activity of MamK but not its ability to form filaments. Filament disassembly depends on both ATPase activity and potassium levels, the latter of which results in the organization of MamK filaments into bundles. These data are consistent with observations indicating that accessory factors are required to promote filament disassembly and for spatial organization of filaments in vivo. We also used cryo-electron microscopy to obtain a high resolution structure of MamK filaments. MamK adopts a two-stranded helical filament architecture, but unlike eukaryotic actin and other actin-like filaments, subunits in MamK strands are unstaggered giving rise to a unique filament architecture. Beyond extending our knowledge of the properties and function of MamK in magnetotactic bacteria, this study emphasizes the functional and structural diversity of bacterial actins in general. PMID:23204522

  9. Morphodynamics of the Actin-Rich Cytoskeleton in Entamoeba histolytica

    Directory of Open Access Journals (Sweden)

    Maria Manich

    2018-05-01

    Full Text Available Entamoeba histolytica is the anaerobic protozoan parasite responsible for human amoebiasis, the third most deadly parasitic disease worldwide. This highly motile eukaryotic cell invades human tissues and constitutes an excellent experimental model of cell motility and cell shape deformation. The absence of extranuclear microtubules in Entamoeba histolytica means that the actin-rich cytoskeleton takes on a crucial role in not only amoebic motility but also other processes sustaining pathogenesis, such as the phagocytosis of human cells and the parasite's resistance of host immune responses. Actin is highly conserved among eukaryotes, although diverse isoforms exist in almost all organisms studied to date. However, E. histolytica has a single actin protein, the structure of which differs significantly from those of its human homologs. Here, we studied the expression, structure and dynamics of actin in E. histolytica. We used molecular and cellular approaches to evaluate actin gene expression during intestinal invasion by E. histolytica trophozoites. Based on a three-dimensional structural bioinformatics analysis, we characterized protein domains differences between amoebic actin and human actin. Fine-tuned molecular dynamics simulations enabled us to examine protein motion and refine the three-dimensional structures of both actins, including elements potentially accounting for differences changes in the affinity properties of amoebic actin and deoxyribonuclease I. The dynamic, multifunctional nature of the amoebic cytoskeleton prompted us to examine the pleiotropic forms of actin structures within live E. histolytica cells; we observed the cortical cytoskeleton, stress fibers, “dot-like” structures, adhesion plates, and macropinosomes. In line with these data, a proteomics study of actin-binding proteins highlighted the Arp2/3 protein complex as a crucial element for the development of macropinosomes and adhesion plaques.

  10. Identities among actin-encoding cDNAs of the Nile tilapia (Oreochromis niloticus and other eukaryote species revealed by nucleotide and amino acid sequence analyses

    Directory of Open Access Journals (Sweden)

    Andréia B. Poletto

    2008-01-01

    Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.

  11. Apatite-mediated actin dynamics in resorbing osteoclasts.

    Science.gov (United States)

    Saltel, Frédéric; Destaing, Olivier; Bard, Frédéric; Eichert, Diane; Jurdic, Pierre

    2004-12-01

    The actin cytoskeleton is essential for osteoclasts main function, bone resorption. Two different organizations of actin have been described in osteoclasts, the podosomes belt corresponding to numerous F-actin columns arranged at the cell periphery, and the sealing zone defined as a unique large band of actin. To compare the role of these two different actin organizations, we imaged osteoclasts on various substrata: glass, dentin, and apatite. Using primary osteoclasts expressing GFP-actin, we found that podosome belts and sealing zones, both very dynamic actin structures, were present in mature osteoclasts; podosome belts were observed only in spread osteoclasts adhering onto glass, whereas sealing zone were seen in apico-basal polarized osteoclasts adherent on mineralized matrix. Dynamic observations of several resorption cycles of osteoclasts seeded on apatite revealed that 1) podosomes do not fuse together to form the sealing zone; 2) osteoclasts alternate successive stationary polarized resorption phases with a sealing zone and migration, nonresorption phases without any specific actin structure; and 3) apatite itself promotes sealing zone formation though c-src and Rho signaling. Finally, our work suggests that apatite-mediated sealing zone formation is dependent on both c-src and Rho whereas apico-basal polarization requires only Rho.

  12. Comparative analysis of ADS gene promoter in seven Artemisia ...

    Indian Academy of Sciences (India)

    2014-12-23

    Dec 23, 2014 ... antimalarial drugs from plants that were used in traditional. Chinese medicine ...... ogy of eukaryotic promoter prediction-a review. Comput. Chem. ... Main J. J. 2006 Antiviral effect of artemisinin from Artemisia annua against a ...

  13. A novel binary T-vector with the GFP reporter gene for promoter characterization.

    Directory of Open Access Journals (Sweden)

    Shu-Ye Jiang

    Full Text Available Several strategies have been developed to clone PCR fragments into desired vectors. However, most of commercially available T-vectors are not binary vectors and cannot be directly used for Agrobacterium-mediated plant genetic transformation. In this study, a novel binary T-vector was constructed by integrating two AhdI restriction sites into the backbone vector pCAMBIA 1300. The T-vector also contains a GFP reporter gene and thus, can be used to analyze promoter activity by monitoring the reporter gene. On the other hand, identification and characterization of various promoters not only benefit the functional annotation of their genes but also provide alternative candidates to be used to drive interesting genes for plant genetic improvement by transgenesis. More than 1,000 putative pollen-specific rice genes have been identified in a genome-wide level. Among them, 67 highly expressed genes were further characterized. One of the pollen-specific genes LOC_Os10g35930 was further surveyed in its expression patterns with more details by quantitative real-time reverse-transcription PCR (qRT-PCR analysis. Finally, its promoter activity was further investigated by analyzing transgenic rice plants carrying the promoter::GFP cassette, which was constructed from the newly developed T-vector. The reporter GFP gene expression in these transgenic plants showed that the promoter was active only in mature but not in germinated pollens.

  14. The evolution of compositionally and functionally distinct actin filaments.

    Science.gov (United States)

    Gunning, Peter W; Ghoshdastider, Umesh; Whitaker, Shane; Popp, David; Robinson, Robert C

    2015-06-01

    The actin filament is astonishingly well conserved across a diverse set of eukaryotic species. It has essentially remained unchanged in the billion years that separate yeast, Arabidopsis and man. In contrast, bacterial actin-like proteins have diverged to the extreme, and many of them are not readily identified from sequence-based homology searches. Here, we present phylogenetic analyses that point to an evolutionary drive to diversify actin filament composition across kingdoms. Bacteria use a one-filament-one-function system to create distinct filament systems within a single cell. In contrast, eukaryotic actin is a universal force provider in a wide range of processes. In plants, there has been an expansion of the number of closely related actin genes, whereas in fungi and metazoa diversification in tropomyosins has increased the compositional variety in actin filament systems. Both mechanisms dictate the subset of actin-binding proteins that interact with each filament type, leading to specialization in function. In this Hypothesis, we thus propose that different mechanisms were selected in bacteria, plants and metazoa, which achieved actin filament compositional variation leading to the expansion of their functional diversity. © 2015. Published by The Company of Biologists Ltd.

  15. Transcriptional analysis of heterologous gene expression using the endogenous sD promoter from Bacillus halodurans

    CSIR Research Space (South Africa)

    Crampton, Michael C

    2010-07-01

    Full Text Available This presentation focused on the transcriptional analysis of heterologous gene expression using the endogenous sD promoter from Bacillus halodurans. It concludes to a successful implementation of a high throughput mRNA sandwich hybridisation...

  16. Crosstalk between Rac1-mediated actin regulation and ROS production.

    Science.gov (United States)

    Acevedo, Alejandro; González-Billault, Christian

    2018-02-20

    The small RhoGTPase Rac1 is implicated in a variety of events related to actin cytoskeleton rearrangement. Remarkably, another event that is completely different from those related to actin regulation has the same relevance; the Rac1-mediated production of reactive oxygen species (ROS) through NADPH oxidases (NOX). Each outcome involves different Rac1 downstream effectors; on one hand, events related to the actin cytoskeleton require Rac1 to bind to WAVEs proteins and PAKs that ultimately promote actin branching and turnover, on the other, NOX-derived ROS production demands active Rac1 to be bound to a cytosolic activator of NOX. How Rac1-mediated signaling ends up promoting actin-related events, NOX-derived ROS, or both is poorly understood. Rac1 regulators, including scaffold proteins, are known to exert tight control over its functions. Hence, evidence of Rac1 regulatory events leading to both actin remodeling and NOX-mediated ROS generation are discussed. Moreover, cellular functions linked to physiological and pathological conditions that exhibit crosstalk between Rac1 outcomes are analyzed, while plausible roles in neuronal functions (and dysfunctions) are highlighted. Together, discussed evidence shed light on cellular mechanisms which requires Rac1 to direct either actin- and/or ROS-related events, helping to understand crucial roles of Rac1 dual functionality. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Science.gov (United States)

    Fauteux, François; Strömvik, Martina V

    2009-01-01

    Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs

  18. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Directory of Open Access Journals (Sweden)

    Fauteux François

    2009-10-01

    Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination

  19. Promoter polymorphisms in genes involved in porcine myogenesis influence their transcriptional activity.

    Science.gov (United States)

    Bongiorni, Silvia; Tilesi, Francesca; Bicorgna, Silvia; Iacoponi, Francesca; Willems, Daniela; Gargani, Maria; D'Andrea, MariaSilvia; Pilla, Fabio; Valentini, Alessio

    2014-11-07

    Success of meat production and selection for improvement of meat quality is among the primary aims in animal production. Meat quality traits are economically important in swine; however, the underlying genetic nature is very complex. Therefore, an improved pork production strongly depends on identifying and studying how genetic variations contribute to modulate gene expression. Promoters are key regions in gene modulation as they harbour several binding motifs to transcription regulatory factors. Therefore, polymorphisms in these regions are likely to deeply affect RNA levels and consequently protein synthesis. In this study, we report the identification of single nucleotide polymorphisms (SNPs) in promoter regions of candidate genes involved in development, cellular differentiation and muscle growth in Sus scrofa. We identified SNPs in the promoter regions of genes belonging to the Myogenic Regulatory Factors (MRF) gene family (the Myogenic Differentiation gene, MYOD1) and to Growth and Differentiation Factors (GDF) gene family (Myostatin gene, MSTN, GDF8), in Casertana and Large White breeds. The purpose of this study was to investigate if polymorphisms in the promoters could affect the transcriptional activity of these genes. With this aim, we evaluated in vitro the functional activity of the luciferase reporter gene luc2 activity, driven by two constructs carrying different promoter haplotypes. We tested the effects of the G302A (U12574) transition on the promoter efficiency in MYOD1 gene. We ascertained a difference in transcription efficiency for the two variants. A stronger activity of the A-carrying construct is more evident in C2C12. The luciferase expression driven by the MYOD1-A allelic variant displayed a 3.8-fold increased transcriptional activity. We investigated the activity of two haplotype variants (AY527152) in the promoter of GDF8 gene. The haploptype-1 (A435-A447-A879) up-regulated the expression of the reporter gene by a two-fold increase, and

  20. Identification, isolation and evaluation of a constitutive sucrose phosphate synthase gene promoter from tomato

    International Nuclear Information System (INIS)

    Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.

    2017-01-01

    Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)

  1. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Science.gov (United States)

    Meier, Daniel; Schindler, Detlev

    2011-01-01

    The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  2. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Directory of Open Access Journals (Sweden)

    Daniel Meier

    Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  3. Approach of combined cancer gene therapy and radiation: response of promoters to ionizing radiation

    International Nuclear Information System (INIS)

    Anstett, A.

    2005-09-01

    Gene therapy is an emerging cancer treatment modality. We are interested in developing a radiation-inducible gene therapy system to sensitize the tumor vasculature to the effects of ionizing radiation (IR) treatment. An expression system based on irradiation-inducible promoters will drive the expression of anti-tumor genes in the tumor vasculature. Solid tumors are dependent on angio genesis, a process in which new blood vessels are formed from the pre-existing vasculature. Vascular endothelial cells are un transformed and genetically stable, thus avoiding the problem of resistance to the treatments. Vascular endothelial cells may therefore represent a suitable target for this therapeutic gene therapy strategy.The identification of IR-inducible promoters native to endothelial cells was performed by gene expression profiling using cDNA micro array technology. We describe the genes modified by clinically relevant doses of IR. The extension to high doses aimed at studying the effects of total radiation delivery to the tumor. The radio-inductiveness of the genes selected for promoter study was confirmed by RT-PCR. Analysis of the activity of promoters in response to IR was also assessed in a reporter plasmid. We found that authentic promoters cloned onto a plasmid are not suitable for cancer gene therapy due to their low induction after IR. In contrast, synthetic promoters containing repeated sequence-specific binding sites for IR-activated transcription factors such as NF-κB are potential candidates for gene therapy. The activity of five tandemly repeated TGGGGACTTTCCGC elements for NF-κB binding in a luciferase reporter was increased in a dose-dependent manner. Interestingly, the response to fractionated low doses was improved in comparison to the total single dose. Thus, we put present evidence that a synthetic promoter for NF-κB specific binding may have application in the radio-therapeutic treatment of cancer. (author)

  4. Control of phenylalanine ammonia-lyase gene promoters from pea by UV radiation

    International Nuclear Information System (INIS)

    Pluskota, W.E.; Michalczyk, D.J.; Gorecki, R.J.

    2005-01-01

    The gene fusion system was used to study UV light-control of PS PAL1 and PS PAL2 genes encoding phenylalanine ammonia-lyase of pea. The induction of pea PAL promoters was analysed in transgenic tobacco plants. Binary plasmids (derivatives of pBI101.2 vector) containing 5' regulatory fragments of PS PAL1 and PS PAL2 linked to reporter genes (GUS, LUC) were constructed. The analyses were performed with the use of single constructs (containing one variant of PS PAL promoter and one reporter gene) and dual constructs (containing both PS PAL1 and PS PAL2 promoters connected with different reporter genes). The use of dual constructs enabled the evaluation of both PS PAL promoters activity in the same plant. The analyses of in vitro grown plants have shown that both PAL promoters are strongly induced in leaves subjected to UV radiation. In some cases, the UV-stimulated expression exceeded the exposed areas. This phenomenon was observed more often in the leaves of plants containing the PS PAL1::GUS than PS PAL2::GUS construct. Removal of boxes 2, 4, 5 from PS PAL1 promoter and deletion of its 5' end region (-339 to -1394) decreases the level of gene expression but does not eliminate its responsiveness to UV

  5. Type 1 plaminogen activator inhibitor gene: Functional analysis and glucocorticoid regulation of its promoter

    International Nuclear Information System (INIS)

    Van Zonneveld, A.J.; Curriden, S.A.; Loskutoff, D.J.

    1988-01-01

    Plasminogen activator inhibitor type 1 is an important component of the fibrinolytic system and its biosynthesis is subject to complex regulation. To study this regulation at the level of transcription, the authors have identified and sequenced the promoter of the human plasminogen activator inhibitor type 1 gene. Nuclease protection experiments were performed by using endothelial cell mRNA and the transcription initiation (cap) site was established. Sequence analysis of the 5' flanking region of the gene revealed a perfect TATA box at position -28 to position -23, the conserved distance from the cap site. Comparative functional studies with the firefly luciferase gene as a reporter gene showed that fragments derived from this 5' flanking region exhibited high promoter activity when transfected into bovine aortic endothelial cells and mouse Ltk - fibroblasts but were inactive when introduced into HeLa cells. These studies indicate that the fragments contain the plasminogen activator inhibitor type 1 promoter and that it is expressed in a tissue-specific manner. Although the fragments were also silent in rat FTO2B hepatoma cells, their promoter activity could be induced up to 40-fold with the synthetic glucocorticoid dexamethasone. Promoter deletion mapping experiments and studies involving the fusion of promoter fragments to a heterologous gene indicated that dexamethasone induction is mediated by a glucocorticoid responsive element with enhancer-like properties located within the region between nucleotides -305 and +75 of the plasminogen activator inhibitor type 1 gene

  6. The Mouse Solitary Odorant Receptor Gene Promoters as Models for the Study of Odorant Receptor Gene Choice.

    Directory of Open Access Journals (Sweden)

    Andrea Degl'Innocenti

    Full Text Available In vertebrates, several anatomical regions located within the nasal cavity mediate olfaction. Among these, the main olfactory epithelium detects most conventional odorants. Olfactory sensory neurons, provided with cilia exposed to the air, detect volatile chemicals via an extremely large family of seven-transmembrane chemoreceptors named odorant receptors. Their genes are expressed in a monogenic and monoallelic fashion: a single allele of a single odorant receptor gene is transcribed in a given mature neuron, through a still uncharacterized molecular mechanism known as odorant receptor gene choice.Odorant receptor genes are typically arranged in genomic clusters, but a few are isolated (we call them solitary from the others within a region broader than 1 Mb upstream and downstream with respect to their transcript's coordinates. The study of clustered genes is problematic, because of redundancy and ambiguities in their regulatory elements: we propose to use the solitary genes as simplified models to understand odorant receptor gene choice.Here we define number and identity of the solitary genes in the mouse genome (C57BL/6J, and assess the conservation of the solitary status in some mammalian orthologs. Furthermore, we locate their putative promoters, predict their homeodomain binding sites (commonly present in the promoters of odorant receptor genes and compare candidate promoter sequences with those of wild-caught mice. We also provide expression data from histological sections.In the mouse genome there are eight intact solitary genes: Olfr19 (M12, Olfr49, Olfr266, Olfr267, Olfr370, Olfr371, Olfr466, Olfr1402; five are conserved as solitary in rat. These genes are all expressed in the main olfactory epithelium of three-day-old mice. The C57BL/6J candidate promoter of Olfr370 has considerably varied compared to its wild-type counterpart. Within the putative promoter for Olfr266 a homeodomain binding site is predicted. As a whole, our findings

  7. The CMV early enhancer/chicken beta actin (CAG) promoter can be used to drive transgene expression during the differentiation of murine embryonic stem cells into vascular progenitors

    DEFF Research Database (Denmark)

    Alexopoulou, Annika N; Couchman, John R; Whiteford, James

    2008-01-01

    BACKGROUND: Mouse embryonic stem cells cultured in vitro have the ability to differentiate into cells of the three germ layers as well as germ cells. The differentiation mimics early developmental events, including vasculogenesis and early angiogenesis and several differentiation systems are being...... used to identify factors that are important during the formation of the vascular system. Embryonic stem cells are difficult to transfect, while downregulation of promoter activity upon selection of stable transfectants has been reported, rendering the study of proteins by overexpression difficult....... RESULTS: CCE mouse embryonic stem cells were differentiated on collagen type IV for 4-5 days, Flk1+ mesodermal cells were sorted and replated either on collagen type IV in the presence of VEGFA to give rise to endothelial cells and smooth muscle cells or in collagen type I gels for the formation...

  8. Chronic Actinic Dermatitis

    Directory of Open Access Journals (Sweden)

    Bengü Çevirgen Cemil

    2017-06-01

    Full Text Available Chronic actinic dermatitis (CAD is characterized by persistent eczema-like lesions, mainly on sun-exposed sites, induced by ultraviolet B, sometimes ultraviolet A, and occasionally visible light. CAD is a rare photodermatitis. It is often associated with contact allergens including airborne allergens such as fragrances, plant antigens and topical medications. A 62 year old farmer is applied with eczematous lesions restricted to sun-exposed areas. Clinical findings and histopathologic features were consistent with the diagnosis of chronic actinic dermatitis. The patient also had contact allergy to multiple allergens. We present this case to emphasize the significance of patch test on CAD treatment and the success of topical tacrolimus and azathioprine.

  9. Engineered promoters enable constant gene expression at any copy number in bacteria.

    Science.gov (United States)

    Segall-Shapiro, Thomas H; Sontag, Eduardo D; Voigt, Christopher A

    2018-04-01

    The internal environment of growing cells is variable and dynamic, making it difficult to introduce reliable parts, such as promoters, for genetic engineering. Here, we applied control-theoretic ideas to design promoters that maintained constant levels of expression at any copy number. Theory predicts that independence to copy number can be achieved by using an incoherent feedforward loop (iFFL) if the negative regulation is perfectly non-cooperative. We engineered iFFLs into Escherichia coli promoters using transcription-activator-like effectors (TALEs). These promoters had near-identical expression in different genome locations and plasmids, even when their copy number was perturbed by genomic mutations or changes in growth medium composition. We applied the stabilized promoters to show that a three-gene metabolic pathway to produce deoxychromoviridans could retain function without re-tuning when the stabilized-promoter-driven genes were moved from a plasmid into the genome.

  10. Functional analysis of a novel human serotonin transporter gene promoter in immortalized raphe cells

    DEFF Research Database (Denmark)

    Mortensen, O V; Thomassen, M; Larsen, M B

    1999-01-01

    were found to possess the additional 379 bp fragment. The integrity of the promoter was furthermore confirmed by genomic Southern blotting. The promoter activity was analyzed by reporter gene assays in neuronal and non-neuronal serotonergic cell lines. In immortalized serotonergic raphe neurons, RN46A...

  11. Actinic reticuloid. Diagnostics

    Directory of Open Access Journals (Sweden)

    E. V. Sokolovskiy

    2016-01-01

    Full Text Available This article is about the case of actinic reticuloid - the rare dermatosis which clinical presentation is similar to atopic dermatitis, T-cell lymphoma. Good treatment effect was obtained by long cycles (2 cycles for 3 months of hydroxychloroquine and sun protective therapy included sunscreens SPF 50, nicotinic acid, sun-safe clothes which blocked ultraviolet radiation without any glucocorticosteroid drugs and cytostatic treatment.

  12. The MARVEL domain protein Nce102 regulates actin organization and invasive growth of Candida albicans.

    Science.gov (United States)

    Douglas, Lois M; Wang, Hong X; Konopka, James B

    2013-11-26

    Invasive growth of the fungal pathogen Candida albicans into tissues promotes disseminated infections in humans. The plasma membrane is essential for pathogenesis because this important barrier mediates morphogenesis and invasive growth, as well as secretion of virulence factors, cell wall synthesis, nutrient import, and other processes. Previous studies showed that the Sur7 tetraspan protein that localizes to MCC (membrane compartment occupied by Can1)/eisosome subdomains of the plasma membrane regulates a broad range of key functions, including cell wall synthesis, morphogenesis, and resistance to copper. Therefore, a distinct tetraspan protein found in MCC/eisosomes, Nce102, was investigated. Nce102 belongs to the MARVEL domain protein family, which is implicated in regulating membrane structure and function. Deletion of NCE102 did not cause the broad defects seen in sur7Δ cells. Instead, the nce102Δ mutant displayed a unique phenotype in that it was defective in forming hyphae and invading low concentrations of agar but could invade well in higher agar concentrations. This phenotype was likely due to a defect in actin organization that was observed by phalloidin staining. In support of this, the invasive growth defect of a bni1Δ mutant that mislocalizes actin due to lack of the Bni1 formin was also reversed at high agar concentrations. This suggests that a denser matrix provides a signal that compensates for the actin defects. The nce102Δ mutant displayed decreased virulence and formed abnormal hyphae in mice. These studies identify novel ways that Nce102 and the physical environment surrounding C. albicans regulate morphogenesis and pathogenesis. The plasma membrane promotes virulence of the human fungal pathogen Candida albicans by acting as a protective barrier around the cell and mediating dynamic activities, such as morphogenesis, cell wall synthesis, secretion of virulence factors, and nutrient uptake. To better understand how the plasma membrane

  13. Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.

    2009-07-01

    The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 kaccase gene contains a putative site for xenobiotics (XRE). (Author)

  14. Computational design and application of endogenous promoters for transcriptionally targeted gene therapy for rheumatoid arthritis.

    NARCIS (Netherlands)

    Geurts, J.; Joosten, L.A.B.; Takahashi, N.; Arntz, O.J.; Gluck, A.; Bennink, M.B.; Berg, W.B. van den; Loo, F.A.J. van de

    2009-01-01

    The promoter regions of genes that are differentially regulated in the synovial membrane during the course of rheumatoid arthritis (RA) represent attractive candidates for application in transcriptionally targeted gene therapy. In this study, we applied an unbiased computational approach to define

  15. Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

    International Nuclear Information System (INIS)

    Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.

    2009-01-01

    The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 laccase gene contains a putative site for xenobiotics (XRE). (Author)

  16. The promoter for a variant surface glycoprotein gene expression site in Trypanosoma brucei

    NARCIS (Netherlands)

    Zomerdijk, J. C.; Ouellette, M.; ten Asbroek, A. L.; Kieft, R.; Bommer, A. M.; Clayton, C. E.; Borst, P.

    1990-01-01

    The variant-specific surface glycoprotein (VSG) gene 221 of Trypanosoma brucei is transcribed as part of a 60 kb expression site (ES). We have identified the promoter controlling this multigene transcription unit by the use of 221 chromosome-enriched DNA libraries and VSG gene 221 expression site

  17. Comparative analysis of ADS gene promoter in seven Artemisia ...

    Indian Academy of Sciences (India)

    ... were more in the high artemisinin producer species, A. annua, than the other species. We have reported that the light-responsive elements, W-box, CAAT-box, 5′-UTR py-rich stretch, TATA-box sequence and tandem repeat sequences have been identified as important factors in the increased expression of ADS gene.

  18. Functional characterisation of filamentous actin probe expression in neuronal cells.

    Directory of Open Access Journals (Sweden)

    Shrujna Patel

    Full Text Available Genetically encoded filamentous actin probes, Lifeact, Utrophin and F-tractin, are used as tools to label the actin cytoskeleton. Recent evidence in several different cell types indicates that these probes can cause changes in filamentous actin dynamics, altering cell morphology and function. Although these probes are commonly used to visualise actin dynamics in neurons, their effects on axonal and dendritic morphology has not been systematically characterised. In this study, we quantitatively analysed the effect of Lifeact, Utrophin and F-tractin on neuronal morphogenesis in primary hippocampal neurons. Our data show that the expression of actin-tracking probes significantly impacts on axonal and dendrite growth these neurons. Lifeact-GFP expression, under the control of a pBABE promoter, caused a significant decrease in total axon length, while another Lifeact-GFP expression, under the control of a CAG promoter, decreased the length and complexity of dendritic trees. Utr261-EGFP resulted in increased dendritic branching but Utr230-EGFP only accumulated in cell soma, without labelling any neurites. Lifeact-7-mEGFP and F-tractin-EGFP in a pEGFP-C1 vector, under the control of a CMV promoter, caused only minor changes in neuronal morphology as detected by Sholl analysis. The results of this study demonstrate the effects that filamentous actin tracking probes can have on the axonal and dendritic compartments of neuronal cells and emphasise the care that must be taken when interpreting data from experiments using these probes.

  19. A cII-dependent promoter is located within the Q gene of bacteriophage lambda.

    OpenAIRE

    Hoopes, B C; McClure, W R

    1985-01-01

    We have found a cII-dependent promoter, PaQ, within the Q gene of bacteriophage lambda. Transcription experiments and abortive initiation assays performed in vitro showed that the promoter strength and the cII affinity of PaQ were comparable to the other cII-dependent lambda promoters, PE and PI. The location and leftward direction of PaQ suggests a possible role in the delay of lambda late-gene expression by cII protein, a phenomenon that has been called cII-dependent inhibition. We have con...

  20. Characteristic differences between the promoters of intron-containing and intronless ribosomal protein genes in yeast

    Directory of Open Access Journals (Sweden)

    Vingron Martin

    2008-10-01

    Full Text Available Abstract Background More than two thirds of the highly expressed ribosomal protein (RP genes in Saccharomyces cerevisiae contain introns, which is in sharp contrast to the genome-wide five percent intron-containing genes. It is well established that introns carry regulatory sequences and that the transcription of RP genes is extensively and coordinately regulated. Here we test the hypotheses that introns are innately associated with heavily transcribed genes and that introns of RP genes contribute regulatory TF binding sequences. Moreover, we investigate whether promoter features are significantly different between intron-containing and intronless RP genes. Results We find that directly measured transcription rates tend to be lower for intron-containing compared to intronless RP genes. We do not observe any specifically enriched sequence motifs in the introns of RP genes other than those of the branch point and the two splice sites. Comparing the promoters of intron-containing and intronless RP genes, we detect differences in number and position of Rap1-binding and IFHL motifs. Moreover, the analysis of the length distribution and the folding free energies suggest that, at least in a sub-population of RP genes, the 5' untranslated sequences are optimized for regulatory function. Conclusion Our results argue against the direct involvement of introns in the regulation of transcription of highly expressed genes. Moreover, systematic differences in motif distributions suggest that RP transcription factors may act differently on intron-containing and intronless gene promoters. Thus, our findings contribute to the decoding of the RP promoter architecture and may fuel the discussion on the evolution of introns.

  1. Tissue specific promoters improve the localization of radiation-inducible gene expression

    International Nuclear Information System (INIS)

    Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph

    1996-01-01

    Purpose: Site-specific activation of gene expression can be achieved by the use of a promoter that is induced by physical agents such as x-rays. The purpose of the present study was to determine whether site-specific activation of gene therapy can also be achieved within the vascular endothelium by use of radiation-inducible promoters. We studied induction of promoter-reporter gene constructs using previously identified radiation-promoters from c-jun, c-fos, Egr-1, ICAM-1, ELAM-1 after transfection into in the vascular endothelium. Methods: The following radiation-inducible genetic constructs were created: The ELAM-1 promoter fragment was cloned into pOGH to obtain the pE-sel(-587 +35)GH reporter construct. The ICAM-1 promoter fragment (-1162/+1) was cloned upstream of the CAT coding region of the pCAT-plasmid (Promega) after removal of the SV40 promoter by Bgl2/Stu1 digestion to create the pBS-CAT plasmid. The 132 to +170 bp segment of the 5' untranslated region of the c-jun promoter was cloned to the CAT reporter gene to create the -132/+170 cjun-CAT. The Egr-1 promoter fragment (-425/+75) was cloned upstream of the CAT coding region to create the pE425-CAT plasmid. Tandem repeats of the AP-1 binding site were cloned upstream of the CAT coding region (3 xTRE-CAT). Tandem repeats of the Egr binding site (EBS) were cloned upstream of the CAT coding region (EBS-CAT). Human vascular endothelial cells from both large vessel and small vessel origin (HUVEC and HMEC), as well as human tumor cell lines were transfected with plasmids -132/+170 cjun-CAT, pE425-CAT, 3 xTRE-CAT, EBS-CAT, pE-sel-GH and pBS-CAT by use of liposomes. Humor tumor cell lines included SQ20B (squamous), RIT3 (sarcoma), and HL525 (leukemia). Each plasmid was cotransfected with a plasmid containing a CMV promoter linked to the LacZ gene (1 μg). Transfected cells were treated with mock irradiation or x-rays. Cell extracts were assayed for reporter gene expression. Results: Radiation-induced gene

  2. Role of promoter element in c-mpl gene expression induced by TPO.

    Science.gov (United States)

    Sunohara, Masataka; Morikawa, Shigeru; Fuse, Akira; Sato, Iwao

    2013-01-01

    Thrombopoietin (TPO) and its receptor, c-Mpl, play the crucial role for the development of megakaryocyte and considered to regulate megakaryocytopoiesis. Previously we reported that TPO increased the c-mpl promoter activity determined by a transient expression system using a vector containing the luciferase gene as a reporter and the expression of the c-mpl gene is modulated by transcription through a protein kinase C (PKC)-dependent pathway in the megakaryoblastic cells. In this research, to elucidate the required elements in c-mpl promoter, the promoter activity of the deletion constructs and site-directed mutagenesis were measured by a transient transfection assay system. Destruction of -77GATA in c-mpl promoter decreased the activity by 22.8%. Our study elucidated that -77GATA involved in TPO-induced c-mpl gene expression in a human megakaryoblastic cell line, CMK.

  3. The application of powerful promoters to enhance gene expression in industrial microorganisms.

    Science.gov (United States)

    Zhou, Shenghu; Du, Guocheng; Kang, Zhen; Li, Jianghua; Chen, Jian; Li, Huazhong; Zhou, Jingwen

    2017-02-01

    Production of useful chemicals by industrial microorganisms has been attracting more and more attention. Microorganisms screened from their natural environment usually suffer from low productivity, low stress resistance, and accumulation of by-products. In order to overcome these disadvantages, rational engineering of microorganisms to achieve specific industrial goals has become routine. Rapid development of metabolic engineering and synthetic biology strategies provide novel methods to improve the performance of industrial microorganisms. Rational regulation of gene expression by specific promoters is essential to engineer industrial microorganisms for high-efficiency production of target chemicals. Identification, modification, and application of suitable promoters could provide powerful switches at the transcriptional level for fine-tuning of a single gene or a group of genes, which are essential for the reconstruction of pathways. In this review, the characteristics of promoters from eukaryotic, prokaryotic, and archaea microorganisms are briefly introduced. Identification of promoters based on both traditional biochemical and systems biology routes are summarized. Besides rational modification, de novo design of promoters to achieve gradient, dynamic, and logic gate regulation are also introduced. Furthermore, flexible application of static and dynamic promoters for the rational engineering of industrial microorganisms is highlighted. From the perspective of powerful promoters in industrial microorganisms, this review will provide an extensive description of how to regulate gene expression in industrial microorganisms to achieve more useful goals.

  4. A Gly65Val substitution in an actin, GhACT_LI1, disrupts cell polarity and membrane anchoring of F-actin resulting in dwarf, lintless Li1 cotton plants

    Science.gov (United States)

    Actin polymerizes to form the cytoskeleton and organize polar growth in all eukaryotic cells. Species with numerous actin genes are especially useful for the dissection of actin molecular function due to redundancy and neofunctionalization. Here, we investigated the role of a cotton (Gossypium hi...

  5. Identification of learning and memory genes in canine; promoter investigation and determining the selective pressure.

    Science.gov (United States)

    Seifi Moroudi, Reihane; Masoudi, Ali Akbar; Vaez Torshizi, Rasoul; Zandi, Mohammad

    2014-12-01

    One of the important behaviors of dogs is trainability which is affected by learning and memory genes. These kinds of the genes have not yet been identified in dogs. In the current research, these genes were found in animal models by mining the biological data and scientific literatures. The proteins of these genes were obtained from the UniProt database in dogs and humans. Not all homologous proteins perform similar functions, thus comparison of these proteins was studied in terms of protein families, domains, biological processes, molecular functions, and cellular location of metabolic pathways in Interpro, KEGG, Quick Go and Psort databases. The results showed that some of these proteins have the same performance in the rat or mouse, dog, and human. It is anticipated that the protein of these genes may be effective in learning and memory in dogs. Then, the expression pattern of the recognized genes was investigated in the dog hippocampus using the existing information in the GEO profile. The results showed that BDNF, TAC1 and CCK genes are expressed in the dog hippocampus, therefore, these genes could be strong candidates associated with learning and memory in dogs. Subsequently, due to the importance of the promoter regions in gene function, this region was investigated in the above genes. Analysis of the promoter indicated that the HNF-4 site of BDNF gene and the transcription start site of CCK gene is exposed to methylation. Phylogenetic analysis of protein sequences of these genes showed high similarity in each of these three genes among the studied species. The dN/dS ratio for BDNF, TAC1 and CCK genes indicates a purifying selection during the evolution of the genes.

  6. A strategy of gene overexpression based on tandem repetitive promoters in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Li Mingji

    2012-02-01

    Full Text Available Abstract Background For metabolic engineering, many rate-limiting steps may exist in the pathways of accumulating the target metabolites. Increasing copy number of the desired genes in these pathways is a general method to solve the problem, for example, the employment of the multi-copy plasmid-based expression system. However, this method may bring genetic instability, structural instability and metabolic burden to the host, while integrating of the desired gene into the chromosome may cause inadequate transcription or expression. In this study, we developed a strategy for obtaining gene overexpression by engineering promoter clusters consisted of multiple core-tac-promoters (MCPtacs in tandem. Results Through a uniquely designed in vitro assembling process, a series of promoter clusters were constructed. The transcription strength of these promoter clusters showed a stepwise enhancement with the increase of tandem repeats number until it reached the critical value of five. Application of the MCPtacs promoter clusters in polyhydroxybutyrate (PHB production proved that it was efficient. Integration of the phaCAB genes with the 5CPtacs promoter cluster resulted in an engineered E.coli that can accumulate 23.7% PHB of the cell dry weight in batch cultivation. Conclusions The transcription strength of the MCPtacs promoter cluster can be greatly improved by increasing the tandem repeats number of the core-tac-promoter. By integrating the desired gene together with the MCPtacs promoter cluster into the chromosome of E. coli, we can achieve high and stale overexpression with only a small size. This strategy has an application potential in many fields and can be extended to other bacteria.

  7. Actin filaments as tension sensors.

    Science.gov (United States)

    Galkin, Vitold E; Orlova, Albina; Egelman, Edward H

    2012-02-07

    The field of mechanobiology has witnessed an explosive growth over the past several years as interest has greatly increased in understanding how mechanical forces are transduced by cells and how cells migrate, adhere and generate traction. Actin, a highly abundant and anomalously conserved protein, plays a large role in forming the dynamic cytoskeleton that is so essential for cell form, motility and mechanosensitivity. While the actin filament (F-actin) has been viewed as dynamic in terms of polymerization and depolymerization, new results suggest that F-actin itself may function as a highly dynamic tension sensor. This property may help explain the unusual conservation of actin's sequence, as well as shed further light on actin's essential role in structures from sarcomeres to stress fibers. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.

    Science.gov (United States)

    Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A

    1993-12-01

    Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.

  9. Isolation and characterization of an ubiquitin extension protein gene (JcUEP) promoter from Jatropha curcas.

    Science.gov (United States)

    Tao, Yan-Bin; He, Liang-Liang; Niu, Long-Jian; Xu, Zeng-Fu

    2015-04-01

    The JcUEP promoter is active constitutively in the bio-fuel plant Jatropha curcas , and is an alternative to the widely used CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha. Well-characterized promoters are required for transgenic breeding of Jatropha curcas, a biofuel feedstock with great potential for production of bio-diesel and bio-jet fuel. In this study, an ubiquitin extension protein gene from Jatropha, designated JcUEP, was identified to be ubiquitously expressed. Thus, we isolated a 1.2 kb fragment of the 5' flanking region of JcUEP and evaluated its activity as a constitutive promoter in Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. As expected, histochemical GUS assay showed that the JcUEP promoter was active in all Arabidopsis and Jatropha tissues tested. We also compared the activity of the JcUEP promoter with that of the cauliflower mosaic virus 35S (CaMV35S) promoter, a well-characterized constitutive promoter conferring strong transgene expression in dicot species, in various tissues of Jatropha. In a fluorometric GUS assay, the two promoters showed similar activities in stems, mature leaves and female flowers; while the CaMV35S promoter was more effective than the JcUEP promoter in other tissues, especially young leaves and inflorescences. In addition, the JcUEP promoter retained its activity under stress conditions in low temperature, high salt, dehydration and exogenous ABA treatments. These results suggest that the plant-derived JcUEP promoter could be an alternative to the CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha and other plants.

  10. Promoter sequence of 3-phosphoglycerate kinase gene 1 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2002-10-15

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  11. Promoter sequence of 3-phosphoglycerate kinase gene 2 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2003-03-04

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  12. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

    OpenAIRE

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibite...

  13. Low-Dose Radiation Induces Genes Promoting Cell Survival

    International Nuclear Information System (INIS)

    Liu, Shu-Zheng; Chen, Dong; Mu, Ying

    1999-01-01

    Apoptosis is an important process controlling homeostasis of the body. It is influenced by stimuli constantly arising from the external and internal environment of the organism. It is well known that radiation could induce apoptosis of cells in vitro and in vivo. However, the dose-effect relationship of apoptosis extending to the low-dose range has scarcely been studied. Here, the molecular basis of the phenomenon is explored by examining the changes in expression of some of the proapoptotic and antiapoptotic genes

  14. Regional differences in gene expression and promoter usage in aged human brains

    KAUST Repository

    Pardo, Luba M.

    2013-02-19

    To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.

  15. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  16. Effect of external and internal factors on the expression of reporter genes driven by the N resistance gene promoter.

    Science.gov (United States)

    Kathiria, Palak; Sidler, Corinne; Woycicki, Rafal; Yao, Youli; Kovalchuk, Igor

    2013-07-01

    The role of resistance (R) genes in plant pathogen interaction has been studied extensively due to its economical impact on agriculture. Interaction between tobacco mosaic virus (TMV) and the N protein from tobacco is one of the most widely used models to understand various aspects of pathogen resistance. The transcription activity governed by N gene promoter is one of the least understood elements of the model. In this study, the N gene promoter was cloned and fused with two different reporter genes, one encoding β-glucuronidase (N::GUS) and another, luciferase (N::LUC). Tobacco plants transformed with the N::GUS or N::LUC reporter constructs were screened for homozygosity and stable expression. Histochemical analysis of N::GUS tobacco plants revealed that the expression is organ specific and developmentally regulated. Whereas two week old plants expressed GUS in midveins only, 6-wk-old plants also expressed GUS in leaf lamella. Roots did not show GUS expression at any time during development. Experiments to address effects of external stress were performed using N::LUC tobacco plants. These experiments showed that N gene promoter expression was suppressed when plants were exposed to high but not low temperatures. Expression was also upregulated in response to TMV, but no changes were observed in plants treated with SA.

  17. Biphasic interactions between a cationic dendrimer and actin.

    Science.gov (United States)

    Ruenraroengsak, Pakatip; Florence, Alexander T

    2010-12-01

    Gene delivery systems face the problem not only of the route toward the cell and tissues in question, but also of the molecularly crowded environment of both the cytoplasm and the nucleus itself. One of the physical barriers in the cytoplasm for diffusing nanoparticles is an actin network. Here, we describe the finding that a self-fluorescent sixth generation cationic dendrimer (6 nm in diameter) interacts reversibly and possibly electrostatically with actin filaments in vitro. Not only does this interaction slow the diffusion of the dendrimer but it also affects actin polymerization in a biphasic manner. At low concentrations the dendrimer behaves like a G-binding actin protein, retarding actin polymerization, whereas at high concentrations the dendrimer acts as a nucleating protein accelerating the polymerization. Thus in vivo the diffusion of a dendrimer carrier such as this has both physical and chemical elements: by decreasing polymerization it might accelerate its own transport, and by enhancing actin polymerization retard it. This finding suggests that such a dendrimer may have a role as an anticancer agent through its inhibitory effect on actin polymerization.

  18. Promoter Hypermethylation of the ATM Gene as a Novel Biomarker for Breast Cancer

    Science.gov (United States)

    Begam, Nasrin; Jamil, Kaiser; Raju, Suryanarayana G

    2017-11-26

    Background: Breast cancer may be induced by activation of protooncogenes to oncogenes and in many cases inactivation of tumor suppressor genes. Ataxia telangiectasia mutated (ATM) is an important tumor suppressor gene which plays central roles in the maintenance of genomic integrity by activating cell cycle checkpoints and promoting repair of double-strand breaks of DNA. In breast cancer, decrease ATM expression correlates with a poor outcome; however, the molecular mechanisms underlying downregulation are still unclear. Promoter hypermethylation may contribute in downregulation. Hence the present investigation was designed to evaluate promoter methylation and expression of the ATM gene in breast cancer cases, and to determine links with clinical and demographic manifestations, in a South Indian population. Methods: Tumor biopsy samples were collected from 50 pathologically confirmed sporadic breast cancer cases. DNA was isolated from tumor and adjacent non-tumorous regions, and sodium bisulfite conversion and methylation-specific PCR were performed using MS-PCR primers for the ATM promoter region. In addition, ATM mRNA expression was also analyzed for all samples using real-time PCR. Results: Fifty eight percent (58%) of cancer tissue samples showed promoter hypermethylation for the ATM gene, in contrast to only 4.44% of normal tissues (p= 0.0001). Furthermore, ATM promoter methylation was positively associated with age (p = 0.01), tumor size (p=0.045) and advanced stage of disease i.e. stages III and IV (p =0.019). An association between promoter hypermethylation and lower expression of ATM mRNA was also found (p=0.035). Conclusion: We report for the first time that promoter hypermethylation of ATM gene may be useful as a potential new biomarker for breast cancer, especially in the relatively young patients. Creative Commons Attribution License

  19. G-actin sequestering protein thymosin-β4 regulates the activity of myocardin-related transcription factor.

    Science.gov (United States)

    Morita, Tsuyoshi; Hayashi, Ken'ichiro

    2013-08-02

    Myocardin-related transcription factors (MRTFs) are robust coactivators of serum response factor (SRF). MRTFs contain three copies of the RPEL motif at their N-terminus, and they bind to monomeric globular actin (G-actin). Previous studies illustrate that G-actin binding inhibits MRTF activity by preventing the MRTFs nuclear accumulation. In the living cells, the majority of G-actin is sequestered by G-actin binding proteins that prevent spontaneous actin polymerization. Here, we demonstrate that the most abundant G-actin sequestering protein thymosin-β4 (Tβ4) was involved in the regulation of subcellular localization and activity of MRTF-A. Tβ4 competed with MRTF-A for G-actin binding; thus, interfering with G-actin-MRTF-A complex formation. Tβ4 overexpression induced the MRTF-A nuclear accumulation and activation of MRTF-SRF signaling. The activation rate of MRTF-A by the Tβ4 mutant L17A, whose affinity for G-actin is very low, was lower than that by wild-type Tβ4. In contrast, the β-actin mutant 3DA, which has a lower affinity for Tβ4, more effectively suppressed MRTF-A activity than wild-type β-actin. Furthermore, ectopic Tβ4 increased the endogenous expression of SRF-dependent actin cytoskeletal genes. Thus, Tβ4 is an important MRTF regulator that controls the G-actin-MRTFs interaction. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs

    International Nuclear Information System (INIS)

    Kurayoshi, Kenta; Ozono, Eiko; Iwanaga, Ritsuko; Bradford, Andrew P.; Komori, Hideyuki; Ohtani, Kiyoshi

    2014-01-01

    Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter

  1. Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs

    Energy Technology Data Exchange (ETDEWEB)

    Kurayoshi, Kenta [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan); Ozono, Eiko [Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary, University of London, John Vane Science Centre, Charterhouse Square, London EC1M 6BQ (United Kingdom); Iwanaga, Ritsuko; Bradford, Andrew P. [Department of Obstetrics and Gynecology, University of Colorado School of Medicine, Anschutz Medical Campus, 12800 East 19th Avenue, Aurora, CO 80045 (United States); Komori, Hideyuki [Center for Stem Cell Biology, Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109 (United States); Ohtani, Kiyoshi, E-mail: btm88939@kwansei.ac.jp [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan)

    2014-07-18

    Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter

  2. Four inducible promoters for controlled gene expression in the oleaginous yeast Rhodotorula toruloides

    Directory of Open Access Journals (Sweden)

    Alexander Michael Bedford Johns

    2016-10-01

    Full Text Available Rhodotorula (Rhodosporidium toruloides is an oleaginous yeast with great biotechnological potential, capable of accumulating lipid up to 70 % of its dry biomass, and of carotenoid biosynthesis. However, few molecular genetic tools are available for manipulation of this basidiomycete yeast and its high genomic GC content can make routine cloning difficult. We have developed plasmid vectors for transformation of R. toruloides which include elements for Saccharomyces cerevisiae in-yeast assembly; this method is robust to the assembly of GC-rich DNA and of large plasmids. Using such vectors we screened for controllable promoters, and identified inducible promoters from the genes NAR1, ICL1, CTR3 and MET16. These four promoters have independent induction/repression conditions and exhibit different levels and rates of induction in R. toruloides, making them appropriate for controllable transgene expression in different experimental situations. Nested deletions were used to identify regulatory regions in the four promoters, and to delimit the minimal inducible promoters, which are as small as 200 bp for the NAR1 promoter. The NAR1 promoter shows very tight regulation under repressed conditions as determined both by an EGFP reporter gene and by conditional rescue of a leu2 mutant. These new tools facilitate molecular genetic manipulation and controllable gene expression in R. toruloides.

  3. Characterization of promoter sequence of toll-like receptor genes in Vechur cattle

    Directory of Open Access Journals (Sweden)

    R. Lakshmi

    2016-06-01

    Full Text Available Aim: To analyze the promoter sequence of toll-like receptor (TLR genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases.

  4. The conserved Tarp actin binding domain is important for chlamydial invasion.

    Directory of Open Access Journals (Sweden)

    Travis J Jewett

    2010-07-01

    Full Text Available The translocated actin recruiting phosphoprotein (Tarp is conserved among all pathogenic chlamydial species. Previous reports identified single C. trachomatis Tarp actin binding and proline rich domains required for Tarp mediated actin nucleation. A peptide antiserum specific for the Tarp actin binding domain was generated and inhibited actin polymerization in vitro and C. trachomatis entry in vivo, indicating an essential role for Tarp in chlamydial pathogenesis. Sequence analysis of Tarp orthologs from additional chlamydial species and C. trachomatis serovars indicated multiple putative actin binding sites. In order to determine whether the identified actin binding domains are functionally conserved, GST-Tarp fusions from multiple chlamydial species were examined for their ability to bind and nucleate actin. Chlamydial Tarps harbored variable numbers of actin binding sites and promoted actin nucleation as determined by in vitro polymerization assays. Our findings indicate that Tarp mediated actin binding and nucleation is a conserved feature among diverse chlamydial species and this function plays a critical role in bacterial invasion of host cells.

  5. Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

    Science.gov (United States)

    Amirhaeri, S; Wohlrab, F; Wells, R D

    1995-02-17

    The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

  6. Identifying Growth Conditions for Nicotiana benthimiana Resulting in Predictable Gene Expression of Promoter-Gus Fusion

    Science.gov (United States)

    Sandoval, V.; Barton, K.; Longhurst, A.

    2012-12-01

    Revoluta (Rev) is a transcription factor that establishes leaf polarity inArabidopsis thaliana. Through previous work in Dr. Barton's Lab, it is known that Revoluta binds to the ZPR3 promoter, thus activating the ZPR3 gene product inArabidopsis thaliana. Using this knowledge, two separate DNA constructs were made, one carrying revgene and in the other, the ZPR3 promoter fussed with the GUS gene. When inoculated in Nicotiana benthimiana (tobacco), the pMDC32 plasmid produces the Rev protein. Rev binds to the ZPR3 promoter thereby activating the transcription of the GUS gene, which can only be expressed in the presence of Rev. When GUS protein comes in contact with X-Gluc it produce the blue stain seen (See Figure 1). In the past, variability has been seen of GUS expression on tobacco therefore we hypothesized that changing the growing conditions and leaf age might improve how well it's expressed.

  7. Characterization of the distal promoter of the human pyruvate carboxylase gene in pancreatic beta cells.

    Directory of Open Access Journals (Sweden)

    Ansaya Thonpho

    Full Text Available Pyruvate carboxylase (PC is an enzyme that plays a crucial role in many biosynthetic pathways in various tissues including glucose-stimulated insulin secretion. In the present study, we identify promoter usage of the human PC gene in pancreatic beta cells. The data show that in the human, two alternative promoters, proximal and distal, are responsible for the production of multiple mRNA isoforms as in the rat and mouse. RT-PCR analysis performed with cDNA prepared from human liver and islets showed that the distal promoter, but not the proximal promoter, of the human PC gene is active in pancreatic beta cells. A 1108 bp fragment of the human PC distal promoter was cloned and analyzed. It contains no TATA box but possesses two CCAAT boxes, and other putative transcription factor binding sites, similar to those of the distal promoter of rat PC gene. To localize the positive regulatory region in the human PC distal promoter, 5'-truncated and the 25-bp and 15-bp internal deletion mutants of the human PC distal promoter were generated and used in transient transfections in INS-1 832/13 insulinoma and HEK293T (kidney cell lines. The results indicated that positions -340 to -315 of the human PC distal promoter serve as (an activator element(s for cell-specific transcription factor, while the CCAAT box at -71/-67, a binding site for nuclear factor Y (NF-Y, as well as a GC box at -54/-39 of the human PC distal promoter act as activator sequences for basal transcription.

  8. Functional dissection of a napin gene promoter: identification of promoter elements required for embryo and endosperm-specific transcription.

    Science.gov (United States)

    Ellerström, M; Stålberg, K; Ezcurra, I; Rask, L

    1996-12-01

    The promoter region (-309 to +44) of the Brassica napus storage protein gene napA was studied in transgenic tobacco by successive 5' as well as internal deletions fused to the reporter gene GUS (beta-glucuronidase). The expression in the two main tissues of the seed, the endosperm and the embryo, was shown to be differentially regulated. This tissue-specific regulation within the seed was found to affect the developmental expression during seed development. The region between -309 to -152, which has a large effect on quantitative expression, was shown to harbour four elements regulating embryo and one regulating endosperm expression. This region also displayed enhancer activity. Deletion of eight bp from position -152 to position -144 totally abolished the activity of the napA promoter. This deletion disrupted a cis element with similarity to an ABA-responsive element (ABRE) overlapping with an E-box, demonstrating its crucial importance for quantitative expression. An internal deletion of the region -133 to -120, resulted in increased activity in both leaves and endosperm and a decreased activity in the embryo. Within this region, a cis element similar to the (CA)n element, found in other storage protein promoters, was identified. This suggest that the (CA)n element is important for conferring seed specificity by serving both as an activator and a repressor element.

  9. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  10. NGX6 gene mediated by promoter methylation as a potential molecular marker in colorectal cancer

    Directory of Open Access Journals (Sweden)

    Shen Shourong

    2010-04-01

    Full Text Available Abstract Background Nasopharyngeal carcinoma associated gene 6 (NGX6 is down-regulated in most colon cancer cell lines and tumor tissues when compared with their normal tissue samples. As a novel suppress tumor gene, it could inhibit colon cancer cell growth and cell cycle progression. However, little is known about the transcriptional mechanisms controlling NGX6 gene expression. Recent findings suggest that epigenetic inactivation of multiple tumor suppressor genes plays an important role in the tumorigenesis of colorectal carcinoma (CRC. In this study, we explored the role of DNA methylation in regulation of NGX6 transcription. Methods In the present study, we cloned the NGX6 promoter with characteristics of a CpG island by luciferase reporter assay. Then, the CpG methylation status around the NGX6 promoter region in colon cancer cell lines and colorectal tumor tissues was examined by methylation-specific PCR and bisulfite DNA sequencing. Finally, 5-Aza-2'-deoxycytidine (5-Aza-dC treatment was used to confirm the correlation between NGX6 promoter methylation and its gene inactivation. Results The sequence spanning positions -157 to +276 was identified as the NGX6 promoter, in which no canonical TATA boxes were found, while two CAAT boxes and GC boxes were discovered. Methylation status was observed more frequently in 40 colorectal cancer samples than in 40 adjacent normal mucosa samples (18/40 versus 7/40; P Conclusions Down-regulation of NGX6 gene is related to the promoter methylation. DNA methylation of NGX6 promoter might be a potential molecular marker for diagnosis or prognosis, or serve as a therapeutic target.

  11. Relationship between promoter methylation & tissue expression of MGMT gene in ovarian cancer

    Directory of Open Access Journals (Sweden)

    V Shilpa

    2014-01-01

    Full Text Available Background & objectives: Epigenetic alterations, in addition to multiple gene abnormalities, are involved in the genesis and progression of human cancers. Aberrant methylation of CpG islands within promoter regions is associated with transcriptional inactivation of various tumour suppressor genes. O 6 -methyguanine-DNA methyltransferase (MGMT is a DNA repair gene that removes mutagenic and cytotoxic adducts from the O 6 -position of guanine induced by alkylating agents. MGMT promoter hypermethylation and reduced expression has been found in some primary human carcinomas. We studied DNA methylation of CpG islands of the MGMT gene and its relation with MGMT protein expression in human epithelial ovarian carcinoma. Methods: A total of 88 epithelial ovarian cancer (EOC tissue samples, 14 low malignant potential (LMP tumours and 20 benign ovarian tissue samples were analysed for MGMT promoter methylation by nested methylation-specific polymerase chain reaction (MSP after bisulphite modification of DNA. A subset of 64 EOC samples, 10 LMP and benign tumours and five normal ovarian tissue samples were analysed for protein expression by immunohistochemistry. Results: The methylation frequencies of the MGMT gene promoter were found to be 29.5, 28.6 and 20 per cent for EOC samples, LMP tumours and benign cases, respectively. Positive protein expression was observed in 93.8 per cent of EOC and 100 per cent in LMP, benign tumours and normal ovarian tissue samples. Promoter hypermethylation with loss of protein expression was seen only in one case of EOC. Interpretation & conclusions: Our results suggest that MGMT promoter hypermethylation does not always reflect gene expression.

  12. Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.

    Science.gov (United States)

    He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y

    2013-09-04

    To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.

  13. Gene Expression in Class 2 Integrons Is SOS-Independent and Involves Two Pc Promoters.

    Science.gov (United States)

    Jové, Thomas; Da Re, Sandra; Tabesse, Aurore; Gassama-Sow, Amy; Ploy, Marie-Cécile

    2017-01-01

    Integrons are powerful bacterial genetic elements that permit the expression and dissemination of antibiotic-resistance gene cassettes. They contain a promoter Pc that allows the expression of gene cassettes captured through site-specific recombination catalyzed by IntI, the integron-encoded integrase. Class 1 and 2 integrons are found in both clinical and environmental settings. The regulation of intI and of Pc promoters has been extensively studied in class 1 integrons and the regulatory role of the SOS response on intI expression has been shown. Here we investigated class 2 integrons. We characterized the P intI2 promoter and showed that intI2 expression is not regulated via the SOS response. We also showed that, unlike class 1 integrons, class 2 integrons possess not one but two active Pc promoters that are located within the attI2 region that seem to contribute equally to gene cassette expression. Class 2 integrons mostly encode an inactive truncated integrase, but the rare class 2 integrons that encode an active integrase are associated with less efficient Pc2 promoter variants. We propose an evolutionary model for class 2 integrons in which the absence of repression of the integrase gene expression led to mutations resulting in either inactive integrase or Pc variants of weaker activity, thereby reducing the potential fitness cost of these integrons.

  14. Association of polymorphisms of interleukin-18 gene promoter region with polycystic ovary syndrome in chinese population

    Directory of Open Access Journals (Sweden)

    Li Mei-zhi

    2010-10-01

    Full Text Available Abstract Background Recent research shows that polycystic ovary syndrome (PCOS may have an association with low-grade chronic inflammation, and that PCOS may induce an increase in serum interleukin-18 (IL-18 levels. Methods To investigate the polymorphisms of the IL-18 gene promoters with PCOS, two single nucleotide polymorphisms (SNPs in the promoter of the IL-18 gene (at positions -607C/A and -137G/C in 118 Chinese women with PCOS and 79 controls were evaluated using polymerase chain reaction (PCR. Results No significant differences were found in the genotype distribution, allele frequency and haplotype frequency between the PCOS and control groups. Further analysis demonstrated a relationship between IL-18 gene promoter polymorphisms and PCOS insulin resistance (IR. Regarding the -137 allele frequency, G and C allele frequencies were 93.5% and 6.5%, respectively, in the PCOS with IR patients; G and C allele frequencies were 85.4% and 14.6%, respectively, in PCOS patients without IR (chi2 = 3.601, P = 0.048. Conclusions The presence of a polymorphism in the IL-18 gene was found to have no correlation with the occurrence of PCOS. Carriage of the C allele at position -137 in the promoter of the IL-18 gene may play a protective role from the development of PCOS IR.

  15. Light-regulated promoters for tunable, temporal, and affordable control of fungal gene expression.

    Science.gov (United States)

    Fuller, Kevin K; Dunlap, Jay C; Loros, Jennifer J

    2018-05-01

    Regulatable promoters are important genetic tools, particularly for assigning function to essential and redundant genes. They can also be used to control the expression of enzymes that influence metabolic flux or protein secretion, thereby optimizing product yield in bioindustry. This review will focus on regulatable systems for use in filamentous fungi, an important group of organisms whose members include key research models, devastating pathogens of plants and animals, and exploitable cell factories. Though we will begin by cataloging those promoters that are controlled by nutritional or chemical means, our primary focus will rest on those who can be controlled by a literal flip-of-the-switch: promoters of light-regulated genes. The vvd promoter of Neurospora will first serve as a paradigm for how light-driven systems can provide tight, robust, tunable, and temporal control of either autologous or heterologous fungal proteins. We will then discuss a theoretical approach to, and practical considerations for, the development of such promoters in other species. To this end, we have compiled genes from six previously published light-regulated transcriptomic studies to guide the search for suitable photoregulatable promoters in your fungus of interest.

  16. Functional characterization of Pol III U6 promoters for gene knockdown and knockout in Plutella xylostella.

    Science.gov (United States)

    Huang, Yuping; Wang, Yajun; Zeng, Baosheng; Liu, Zhaoxia; Xu, Xuejiao; Meng, Qian; Huang, Yongping; Yang, Guang; Vasseur, Liette; Gurr, Geoff M; You, Minsheng

    2017-10-01

    RNA polymerase type III (Pol-III) promoters such as U6 are commonly used to express small RNAs, including short hairpin RNAs (shRNAs) and single guide RNAs (sgRNAs). Functional U6 promoters are widely used in CRISPR systems, and their characterization can facilitate genome editing of non-model organisms. In the present study, six U6 small nuclear RNA (snRNA) promoters containing two conserved elements of a proximal sequence element (PSEA) and a TATA box, were identified and characterized in the diamondback moth (Plutella xylostella) genome. Relative efficiency of the U6 promoters to express shRNA induced EGFP knockdown was tested in a P. xylostella cell line, revealing that the PxU6:3 promoter had the strongest expression effect. Further work with the PxU6:3 promoter showed its efficacy in EGFP knockout using CRISPR/Cas9 system in the cells. The expression plasmids with versatile Pxabd-A gene specific sgRNA driven by the PxU6:3 promoter, combined with Cas9 mRNA, could induce mutagenesis at specific genomic loci in vivo. The phenotypes induced by sgRNA expression plasmids were similar to those done in vitro transcription sgRNAs. A plasmid with two tandem arranged PxU6:3:sgRNA expression cassettes targeting Pxabd-A loci was generated, which caused a 28,856 bp fragment deletion, suggesting that the multi-sgRNA expression plasmid can be used for multi-targeting. Our work indicates that U6 snRNA promoters can be used for functional studies of genes with the approach of reverse genetics in P. xylostella. These essential promoters also provide valuable potential for CRISPR-derived gene drive as a tactic for population control in this globally significant pest. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Quantitative Analyses of Core Promoters Enable Precise Engineering of Regulated Gene Expression in Mammalian Cells

    Science.gov (United States)

    Ede, Christopher; Chen, Ximin; Lin, Meng-Yin; Chen, Yvonne Y.

    2016-01-01

    Inducible transcription systems play a crucial role in a wide array of synthetic biology circuits. However, the majority of inducible promoters are constructed from a limited set of tried-and-true promoter parts, which are susceptible to common shortcomings such as high basal expression levels (i.e., leakiness). To expand the toolbox for regulated mammalian gene expression and facilitate the construction of mammalian genetic circuits with precise functionality, we quantitatively characterized a panel of eight core promoters, including sequences with mammalian, viral, and synthetic origins. We demonstrate that this selection of core promoters can provide a wide range of basal gene expression levels and achieve a gradient of fold-inductions spanning two orders of magnitude. Furthermore, commonly used parts such as minimal CMV and minimal SV40 promoters were shown to achieve robust gene expression upon induction, but also suffer from high levels of leakiness. In contrast, a synthetic promoter, YB_TATA, was shown to combine low basal expression with high transcription rate in the induced state to achieve significantly higher fold-induction ratios compared to all other promoters tested. These behaviors remain consistent when the promoters are coupled to different genetic outputs and different response elements, as well as across different host-cell types and DNA copy numbers. We apply this quantitative understanding of core promoter properties to the successful engineering of human T cells that respond to antigen stimulation via chimeric antigen receptor signaling specifically under hypoxic environments. Results presented in this study can facilitate the design and calibration of future mammalian synthetic biology systems capable of precisely programmed functionality. PMID:26883397

  18. Spermatogenesis-related ring finger gene ZNF230 promoter: identification and functional analysis

    DEFF Research Database (Denmark)

    Xu, Wenming; Zhang, Sizhong; Qiu, Weimin

    2009-01-01

    reporter Plasmids. Overexpression and site-directed mutation test were used to characterize the cis-element. The results showed ZNF230 gene promoter to be GC rich and not contain a TATA box. Deletion analysis of the 5'-flanking region of ZNF230 in HEK293 cells indicated that the sequence encompassing from...... nt -131 to +152 has a basal transcriptional activity. Site-directed mutation test and mithramycin A treatment demonstrated that the ZNF230 promoter contained a functional Sp1 site. Overexpression of the Sox5 protein activated the promoter activity. A 312-bp fragment surrounding the transcription...

  19. Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

    Science.gov (United States)

    Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

    2017-12-19

    WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

  20. Novel strong tissue specific promoter for gene expression in human germ cells

    Directory of Open Access Journals (Sweden)

    Kuzmin Denis

    2010-08-01

    Full Text Available Abstract Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102, where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter. To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1, whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293. In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X. The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12, and an important role - in the rest two cell lines.

  1. Feedback Interactions of Polymerized Actin with the Cell Membrane: Waves, Pulses, and Oscillations

    Science.gov (United States)

    Carlsson, Anders

    Polymerized filaments of the protein actin have crucial functions in cell migration, and in bending the cell membrane to drive endocytosis or the formation of protrusions. The nucleation and polymerization of actin filaments are controlled by upstream agents in the cell membrane, including nucleation-promoting factors (NPFs) that activate the Arp2/3 complex to form new branches on pre-existing filaments. But polymerized actin (F-actin) also feeds back on the assembly of NPFs. We explore the effects of the resulting feedback loop of F-actin and NPFs on two phenomena: actin pulses that drive endocytosis in yeast, and actin waves traveling along the membrane of several cell types. In our model of endocytosis in yeast, the actin network is grown explicitly in three dimensions, exerts a negative feedback interaction on localized patch of NPFs in the membrane, and bends the membrane by exerting a distribution of forces. This model explains observed actin and NPF pulse dynamics, and the effects of several interventions including i) NPF mutations, ii) inhibition of actin polymerization, and iii) deletion of a protein that allows F-actin to bend the cell membrane. The model predicts that mutation of the active region of an NPF will enhance the accumulation of that NPF, and we confirm this prediction by quantitative fluorescence microscopy. For actin waves, we treat a similar model, with NPFs distributed over a larger region of the cell membrane. This model naturally generates actin waves, and predicts a transition from wave behavior to spatially localized oscillations when NPFs are confined to a small region. We also predict a transition from waves to static polarization as the negative-feedback coupling between F-actin and the NPFs is reduced. Supported by NIGMS Grant R01 GM107667.

  2. Promoter Analysis Reveals Globally Differential Regulation of Human Long Non-Coding RNA and Protein-Coding Genes

    KAUST Repository

    Alam, Tanvir; Medvedeva, Yulia A.; Jia, Hui; Brown, James B.; Lipovich, Leonard; Bajic, Vladimir B.

    2014-01-01

    raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted

  3. MGMT DNA repair gene promoter/enhancer haplotypes alter transcription factor binding and gene expression.

    Science.gov (United States)

    Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z

    2016-10-01

    The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.

  4. Identification of cis-acting regulatory elements in the human oxytocin gene promoter.

    Science.gov (United States)

    Richard, S; Zingg, H H

    1991-12-01

    The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT

  5. A comparative analysis of constitutive promoters located in adeno-associated viral vectors.

    Directory of Open Access Journals (Sweden)

    Lkhagvasuren Damdindorj

    Full Text Available The properties of constitutive promoters within adeno-associated viral (AAV vectors have not yet been fully characterized. In this study, AAV vectors, in which enhanced GFP expression was directed by one of the six constitutive promoters (human β-actin, human elongation factor-1α, chicken β-actin combined with cytomegalovirus early enhancer, cytomegalovirus (CMV, simian virus 40, and herpes simplex virus thymidine kinase, were constructed and introduced into the HCT116, DLD-1, HT-1080, and MCF-10A cell lines. Quantification of GFP signals in infected cells demonstrated that the CMV promoter produced the highest GFP expression in the six promoters and maintained relatively high GFP expression for up to eight weeks after infection of HCT116, DLD-1, and HT-1080. Exogenous human CDKN2A gene expression was also introduced into DLD-1 and MCF-10A in a similar pattern by using AAV vectors bearing the human β-actin and the CMV promoters. The six constitutive promoters were subsequently placed upstream of the neomycin resistance gene within AAV vectors, and HCT116, DLD-1, and HT-1080 were infected with the resulting vectors. Of the six promoters, the CMV promoter produced the largest number of G418-resistant colonies in all three cell lines. Because AAV vectors have been frequently used as a platform to construct targeting vectors that permit gene editing in human cell lines, we lastly infected the three cell lines with AAV-based targeting vectors against the human PIGA gene in which one of the six promoters regulate the neomycin resistance gene. This assay revealed that the CMV promoter led to the lowest PIGA gene targeting efficiency in the investigated promoters. These results provide a clue to the identification of constitutive promoters suitable to express exogenous genes with AAV vectors, as well as those helpful to conduct efficient gene targeting using AAV-based targeting vectors in human cell lines.

  6. Transgelin is a TGFβ-inducible gene that regulates osteoblastic and adipogenic differentiation of human skeletal stem cells through actin cytoskeleston organization

    DEFF Research Database (Denmark)

    Elsafadi, E; Manikandan, M; Dawud, R. A.

    2016-01-01

    Regenerative medicine is a novel approach for treating conditions in which enhanced bone regeneration is required. We identified transgelin (TAGLN), a transforming growth factor beta (TGFβ)-inducible gene, as an upregulated gene during in vitro osteoblastic and adipocytic differentiation of human......MSC by regulating cytoskeleton organization. Targeting TAGLN is a plausible approach to enrich for committed hMSC cells needed for regenerative medicine application....... bone marrow-derived stromal (skeletal) stem cells (hMSC). siRNA-mediated gene silencing of TAGLN impaired lineage differentiation into osteoblasts and adipocytes but enhanced cell proliferation. Additional functional studies revealed that TAGLN deficiency impaired hMSC cell motility and in vitro...... transwell cell migration. On the other hand, TAGLN overexpression reduced hMSC cell proliferation, but enhanced cell migration, osteoblastic and adipocytic differentiation, and in vivo bone formation. In addition, deficiency or overexpression of TAGLN in hMSC was associated with significant changes...

  7. A study of the frequency of methylation of gene promoter regions in ...

    Indian Academy of Sciences (India)

    2013-04-02

    Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.

  8. Characterization of the promoter and upstream activating sequence from the Pseudomonas alcaligenes lipase gene

    NARCIS (Netherlands)

    Cox, M; Gerritse, G; Dankmeyer, L; Quax, W.J.

    2001-01-01

    Pseudomonas alcaligenes secretes a lipase with a high pH optimum, which has interesting properties for application in detergents. The expression of the lipase is strongly dependent on the presence of lipids in the growth medium such as soybean oil. The promoter of the gene was characterized and

  9. Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

    NARCIS (Netherlands)

    Nalcacioglu, R.; Marks, H.; Vlak, J.M.; Demirbag, Z.; Oers, van M.M.

    2003-01-01

    The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an

  10. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk

    2016-09-01

    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  11. Cardiac-Specific Gene Expression Facilitated by an Enhanced Myosin Light Chain Promoter

    Directory of Open Access Journals (Sweden)

    Wolfgang Boecker

    2004-04-01

    Full Text Available Background: Adenoviral gene transfer has been shown to be effective in cardiac myocytes in vitro and in vivo. A major limitation of myocardial gene therapy is the extracardiac transgene expression. Methods: To minimize extracardiac gene expression, we have constructed a tissue-specific promoter for cardiac gene transfer, namely, the 250-bp fragment of the myosin light chain-2v (MLC-2v gene, which is known to be expressed in a tissue-specific manner in ventricular myocardium followed by a luciferase (luc reporter gene (Ad.4 × MLC250.Luc. Rat cardiomyocytes, liver and kidney cells were infected with Ad.4 × MLC.Luc or control vectors. For in vivo testing, Ad.4 × MLC250.Luc was injected into the myocardium or in the liver of rats. Kinetics of promoter activity were monitored over 8 days using a cooled CCD camera. Results: In vitro: By infecting hepatic versus cardiomyocyte cells, we found that the promoter specificity ratio (luc activity in cardiomyocytes per liver cells was 20.4 versus 0.9 (Ad.4 × MLC250.Luc vs. Ad.CMV. In vivo: Ad.4 × MLC250.Luc significantly reduced luc activity in liver (38.4-fold, lung (16.1-fold, and kidney (21.8-fold versus Ad.CMV (p = .01; whereas activity in the heart was only 3.8-fold decreased. The gene expression rate of cardiomyocytes versus hepatocytes was 7:1 (Ad.4 × MLC.Luc versus 1:1.4 (Ad.CMV.Luc. Discussion: This new vector may be useful to validate therapeutic approaches in animal disease models and offers the perspective for selective expression of therapeutic genes in the diseased heart.

  12. Medicago truncatula SOC1 Genes Are Up-regulated by Environmental Cues That Promote Flowering

    Directory of Open Access Journals (Sweden)

    Jared B. Fudge

    2018-04-01

    Full Text Available Like Arabidopsis thaliana, the flowering of the legume Medicago truncatula is promoted by long day (LD photoperiod and vernalization. However, there are differences in the molecular mechanisms involved, with orthologs of two key Arabidopsis thaliana regulators, FLOWERING LOCUS C (FLC and CONSTANS (CO, being absent or not having a role in flowering time function in Medicago. In Arabidopsis, the MADS-box transcription factor gene, SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (AtSOC1, plays a key role in integrating the photoperiodic and vernalization pathways. In this study, we set out to investigate whether the Medicago SOC1 genes play a role in regulating flowering time. Three Medicago SOC1 genes were identified and characterized (MtSOC1a–MtSOC1c. All three MtSOC1 genes, when heterologously expressed, were able to promote earlier flowering of the late-flowering Arabidopsis soc1-2 mutant. The three MtSOC1 genes have different patterns of expression. However, consistent with a potential role in flowering time regulation, all three MtSOC1 genes are expressed in the shoot apex and are up-regulated in the shoot apex of plants in response to LD photoperiods and vernalization. The up-regulation of MtSOC1 genes was reduced in Medicago fta1-1 mutants, indicating that they are downstream of MtFTa1. Insertion mutant alleles of Medicago soc1b do not flower late, suggestive of functional redundancy among Medicago SOC1 genes in promoting flowering.

  13. The artificial zinc finger coding gene 'Jazz' binds the utrophin promoter and activates transcription.

    Science.gov (United States)

    Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C

    2000-06-01

    Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.

  14. Highly specific expression of luciferase gene in lungs of naive nude mice directed by prostate-specific antigen promoter

    International Nuclear Information System (INIS)

    Li Hongwei; Li Jinzhong; Helm, Gregory A.; Pan Dongfeng

    2005-01-01

    PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10 9 PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of the luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases

  15. Interventions for actinic keratoses.

    Science.gov (United States)

    Gupta, Aditya K; Paquet, Maryse; Villanueva, Elmer; Brintnell, William

    2012-12-12

    Actinic keratoses are a skin disease caused by long-term sun exposure, and their lesions have the potential to develop into squamous cell carcinoma. Treatments for actinic keratoses are sought for cosmetic reasons, for the relief of associated symptoms, or for the prevention of skin cancer development. Detectable lesions are often associated with alteration of the surrounding skin (field) where subclinical lesions might be present. The interventions available for the treatment of actinic keratoses include individual lesion-based (e.g. cryotherapy) or field-directed (e.g. topical) treatments. These might vary in terms of efficacy, safety, and cosmetic outcomes. To assess the effects of topical, oral, mechanical, and chemical interventions for actinic keratosis. We searched the following databases up to March 2011: the Cochrane Skin Group Specialised Register, CENTRAL in The Cochrane Library, MEDLINE (from 2005), EMBASE (from 2010), and LILACS (from 1982). We also searched trials registers, conference proceedings, and grey literature sources. Randomised controlled trials (RCTs) comparing the treatment of actinic keratoses with either placebo, vehicle, or another active therapy. At least two authors independently abstracted data, which included adverse events, and assessed the quality of evidence. We performed meta-analysis to calculate a weighted treatment effect across trials, and we expressed the results as risk ratios (RR) and 95% confidence intervals (CI) for dichotomous outcomes (e.g. participant complete clearance rates), and mean difference (MD) and 95% CI for continuous outcomes (e.g. mean reduction in lesion counts). We included 83 RCTs in this review, with a total of 10,036 participants. The RCTs covered 18 topical treatments, 1 oral treatment, 2 mechanical interventions, and 3 chemical interventions, including photodynamic therapy (PDT). Most of the studies lacked descriptions of some methodological details, such as the generation of the randomisation

  16. Identification of distal silencing elements in the murine interferon-A11 gene promoter.

    Science.gov (United States)

    Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G

    1996-08-01

    The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction.

  17. CpG promoter methylation of the ALKBH3 alkylation repair gene in breast cancer.

    Science.gov (United States)

    Stefansson, Olafur Andri; Hermanowicz, Stefan; van der Horst, Jasper; Hilmarsdottir, Holmfridur; Staszczak, Zuzanna; Jonasson, Jon Gunnlaugur; Tryggvadottir, Laufey; Gudjonsson, Thorkell; Sigurdsson, Stefan

    2017-07-05

    DNA repair of alkylation damage is defective in various cancers. This occurs through somatically acquired inactivation of the MGMT gene in various cancer types, including breast cancers. In addition to MGMT, the two E. coli AlkB homologs ALKBH2 and ALKBH3 have also been linked to direct reversal of alkylation damage. However, it is currently unknown whether ALKBH2 or ALKBH3 are found inactivated in cancer. Methylome datasets (GSE52865, GSE20713, GSE69914), available through Omnibus, were used to determine whether ALKBH2 or ALKBH3 are found inactivated by CpG promoter methylation. TCGA dataset enabled us to then assess the impact of CpG promoter methylation on mRNA expression for both ALKBH2 and ALKBH3. DNA methylation analysis for the ALKBH3 promoter region was carried out by pyrosequencing (PyroMark Q24) in 265 primary breast tumours and 30 proximal normal breast tissue samples along with 8 breast-derived cell lines. ALKBH3 mRNA and protein expression were analysed in cell lines using RT-PCR and Western blotting, respectively. DNA alkylation damage assay was carried out in cell lines based on immunofluorescence and confocal imaging. Data on clinical parameters and survival outcomes in patients were obtained and assessed in relation to ALKBH3 promoter methylation. The ALKBH3 gene, but not ALKBH2, undergoes CpG promoter methylation and transcriptional silencing in breast cancer. We developed a quantitative alkylation DNA damage assay based on immunofluorescence and confocal imaging revealing higher levels of alkylation damage in association with epigenetic inactivation of the ALKBH3 gene (P = 0.029). In our cohort of 265 primary breast cancer, we found 72 cases showing aberrantly high CpG promoter methylation over the ALKBH3 promoter (27%; 72 out of 265). We further show that increasingly higher degree of ALKBH3 promoter methylation is associated with reduced breast-cancer specific survival times in patients. In this analysis, ALKBH3 promoter methylation at >20

  18. Lack of death receptor 4 (DR4) expression through gene promoter methylation in gastric carcinoma.

    Science.gov (United States)

    Lee, Kyung Hwa; Lim, Sang Woo; Kim, Ho Gun; Kim, Dong Yi; Ryu, Seong Yeob; Joo, Jae Kyun; Kim, Jung Chul; Lee, Jae Hyuk

    2009-07-01

    To determine the underlying mechanism for the differential expression, the extent of promoter methylation in tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-related genes acting downstream of TRAIL was examined in early and advanced gastric carcinomas. The extent of promoter methylation in the DR4, DR5, DcR1, DcR2, and CASP8 genes was quantified using bisulfite modification and methylation-specific polymerase chain reaction. The promoters for DcR1, DcR2, and CASP8 were largely unmethylated in early gastric carcinoma, advanced gastric carcinoma, and controls, with no significant difference among them. Protein levels of DR4, DcR1, and DcR2 as revealed by immunohistochemistry correlated with the extent of the respective promoter methylation (P < 0.05 in all cases). Hypomethylation, rather than hypermethylation, of the DR4 promoter was noted in invasive gastric malignancies, with statistical significance (P = 0.003). The promoter methylation status of TRAIL receptors in gastric carcinoma may have clinical implications for improving therapeutic strategies in patients with gastric carcinoma.

  19. Profilin as a regulator of the membrane-actin cytoskeleton interface in plant cells

    Directory of Open Access Journals (Sweden)

    Tiantian eSun

    2013-12-01

    Full Text Available Membrane structures and cytoskeleton dynamics are intimately inter-connected in the eukaryotic cell. Recently, the molecular mechanisms operating at this interface have been progressively addressed. Many experiments have revealed that the actin cytoskeleton can interact with membranes through various discrete membrane domains. The actin-binding protein, profilin has been proven to inhibit actin polymerization and to promote F-actin elongation. This is dependent on many factors, such as the profilin/G-actin ratio and the ionic environment of the cell. Additionally, profilin has specific domains that interact with phosphoinositides and poly-L-proline rich proteins; theoretically, this gives profilin the opportunity to interact with membranes, and a large number of experiments have confirmed this possibility. In this article, we summarize recent findings in plant cells, and discuss the evidence of the connections among actin cytoskeleton, profilin and biomembranes through direct or indirect relationships.

  20. Phylogeny and origin of 82 zygomycetes from all 54 genera of the Mucorales and Mortierellales based on combined analysis of actin and translation elongation factor EF-1alpha genes.

    Science.gov (United States)

    Voigt, K; Wöstemeyer, J

    2001-05-30

    True fungi (Eumycota) are heterotrophic eukaryotic microorganisms encompassing ascomycetes, basidiomycetes, chytridiomycetes and zygomycetes. The natural systematics of the latter group, Zygomycota, are very poorly understood due to the lack of distinguishing morphological characters. We have determined sequences for the nuclear-encoded genes actin (act) from 82 zygomycetes representing all 54 currently recognized genera from the two zygomycetous orders Mucorales and Mortierellales. We also determined sequences for translation elongation factor EF-1alpha (tef) from 16 zygomycetes (total of 96,837 bp). Phylogenetic analysis in the context of available sequence data (total 2,062 nucleotide positions per species) revealed that current classification schemes for the mucoralean fungi are highly unnatural at the family and, to a large extent, at the genus level. The data clearly indicate a deep, ancient and distinct dichotomy of the orders Mucorales and Mortierellales, which are recognized only in some zygomycete systems. Yet at the same time the data show that two genera - Umbelopsis and Micromucor - previously placed within the Mortierellales on the basis of their weakly developed columella (a morphological structure of the sporangiophore well-developed within all Mucorales) are in fact members of the Mucorales. Phylogenetic analyses of the encoded amino acid sequences in the context of homologues from eukaryotes and archaebacterial outgroups indicate that the Eumycota studied here are a natural group but provide little or no support for the monophyly of either zygomycetes, ascomycetes or basidiomycetes. The data clearly indicate that a complete revision of zygomycete natural systematics is necessary.

  1. A database of annotated promoters of genes associated with common respiratory and related diseases

    KAUST Repository

    Chowdhary, Rajesh; Tan, Sinlam; Pavesi, Giulio; Jin, Gg; Dong, Difeng; Mathur, Sameer K.; Burkart, Arthur; Narang, Vipin; Glurich, Ingrid E.; Raby, Benjamin A.; Weiss, Scott T.; Limsoon, Wong; Liu, Jun; Bajic, Vladimir B.

    2012-01-01

    Many genes have been implicated in the pathogenesis of common respiratory and related diseases (RRDs), yet the underlying mechanisms are largely unknown. Differential gene expression patterns in diseased and healthy individuals suggest that RRDs affect or are affected by modified transcription regulation programs. It is thus crucial to characterize implicated genes in terms of transcriptional regulation. For this purpose, we conducted a promoter analysis of genes associated with 11 common RRDs including allergic rhinitis, asthma, bronchiectasis, bronchiolitis, bronchitis, chronic obstructive pulmonary disease, cystic fibrosis, emphysema, eczema, psoriasis, and urticaria, many of which are thought to be genetically related. The objective of the present study was to obtain deeper insight into the transcriptional regulation of these disease-associated genes by annotating their promoter regions with transcription factors (TFs) and TF binding sites (TFBSs). We discovered many TFs that are significantly enriched in the target disease groups including associations that have been documented in the literature. We also identified a number of putative TFs/TFBSs that appear to be novel. The results of our analysis are provided in an online database that is freely accessible to researchers at http://www.respiratorygenomics.com. Promoter-associated TFBS information and related genomic features, such as histone modification sites, microsatellites, CpG islands, and SNPs, are graphically summarized in the database. Users can compare and contrast underlying mechanisms of specific RRDs relative to candidate genes, TFs, gene ontology terms, micro-RNAs, and biological pathways for the conduct of metaanalyses. This database represents a novel, useful resource for RRD researchers. Copyright © 2012 by the American Thoracic Society.

  2. A database of annotated promoters of genes associated with common respiratory and related diseases

    KAUST Repository

    Chowdhary, Rajesh

    2012-07-01

    Many genes have been implicated in the pathogenesis of common respiratory and related diseases (RRDs), yet the underlying mechanisms are largely unknown. Differential gene expression patterns in diseased and healthy individuals suggest that RRDs affect or are affected by modified transcription regulation programs. It is thus crucial to characterize implicated genes in terms of transcriptional regulation. For this purpose, we conducted a promoter analysis of genes associated with 11 common RRDs including allergic rhinitis, asthma, bronchiectasis, bronchiolitis, bronchitis, chronic obstructive pulmonary disease, cystic fibrosis, emphysema, eczema, psoriasis, and urticaria, many of which are thought to be genetically related. The objective of the present study was to obtain deeper insight into the transcriptional regulation of these disease-associated genes by annotating their promoter regions with transcription factors (TFs) and TF binding sites (TFBSs). We discovered many TFs that are significantly enriched in the target disease groups including associations that have been documented in the literature. We also identified a number of putative TFs/TFBSs that appear to be novel. The results of our analysis are provided in an online database that is freely accessible to researchers at http://www.respiratorygenomics.com. Promoter-associated TFBS information and related genomic features, such as histone modification sites, microsatellites, CpG islands, and SNPs, are graphically summarized in the database. Users can compare and contrast underlying mechanisms of specific RRDs relative to candidate genes, TFs, gene ontology terms, micro-RNAs, and biological pathways for the conduct of metaanalyses. This database represents a novel, useful resource for RRD researchers. Copyright © 2012 by the American Thoracic Society.

  3. Human sex hormone-binding globulin gene expression- multiple promoters and complex alternative splicing

    Directory of Open Access Journals (Sweden)

    Rosner William

    2009-05-01

    Full Text Available Abstract Background Human sex hormone-binding globulin (SHBG regulates free sex steroid concentrations in plasma and modulates rapid, membrane based steroid signaling. SHBG is encoded by an eight exon-long transcript whose expression is regulated by a downstream promoter (PL. The SHBG gene was previously shown to express a second major transcript of unknown function, derived from an upstream promoter (PT, and two minor transcripts. Results We report that transcriptional expression of the human SHBG gene is far more complex than previously described. PL and PT direct the expression of at least six independent transcripts each, resulting from alternative splicing of exons 4, 5, 6, and/or 7. We mapped two transcriptional start sites downstream of PL and PT, and present evidence for a third SHBG gene promoter (PN within the neighboring FXR2 gene; PN regulates the expression of at least seven independent SHBG gene transcripts, each possessing a novel, 164-nt first exon (1N. Transcriptional expression patterns were generated for human prostate, breast, testis, liver, and brain, and the LNCaP, MCF-7, and HepG2 cell lines. Each expresses the SHBG transcript, albeit in varying abundance. Alternative splicing was more pronounced in the cancer cell lines. PL- PT- and PN-derived transcripts were most abundant in liver, testis, and prostate, respectively. Initial findings reveal the existence of a smaller immunoreactive SHBG species in LNCaP, MCF-7, and HepG2 cells. Conclusion These results extend our understanding of human SHBG gene transcription, and raise new and important questions regarding the role of novel alternatively spliced transcripts, their function in hormonally responsive tissues including the breast and prostate, and the role that aberrant SHBG gene expression may play in cancer.

  4. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)

    2006-03-31

    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

  5. Inhibiting actin depolymerization enhances osteoblast differentiation and bone formation in human stromal stem cells

    DEFF Research Database (Denmark)

    Chen, Li; Shi, Kaikai; Frary, Charles

    2015-01-01

    Remodeling of the actin cytoskeleton through actin dynamics is involved in a number of biological processes, but its role in human stromal (skeletal) stem cells (hMSCs) differentiation is poorly understood. In the present study, we demonstrated that stabilizing actin filaments by inhibiting gene...... expression of the two main actin depolymerizing factors (ADFs): Cofilin 1 (CFL1) and Destrin (DSTN) in hMSCs, enhanced cell viability and differentiation into osteoblastic cells (OB) in vitro, as well as heterotopic bone formation in vivo. Similarly, treating hMSC with Phalloidin, which is known to stabilize...... polymerized actin filaments, increased hMSCs viability and OB differentiation. Conversely, Cytocholasin D, an inhibitor of actin polymerization, reduced cell viability and inhibited OB differentiation of hMSC. At a molecular level, preventing Cofilin phosphorylation through inhibition of LIM domain kinase 1...

  6. MITEs in the promoters of effector genes allow prediction of novel virulence genes in Fusarium oxysporum

    NARCIS (Netherlands)

    Schmidt, S.M.; Houterman, P.M.; Schreiver, I.; Ma, L.; Amyotte, S.; Chellappan, B.; Boeren, S.; Takken, F.L.W.; Rep, M.

    2013-01-01

    Background The plant-pathogenic fungus Fusarium oxysporum f.sp.lycopersici (Fol) has accessory, lineage-specific (LS) chromosomes that can be transferred horizontally between strains. A single LS chromosome in the Fol4287 reference strain harbors all known Fol effector genes. Transfer of this

  7. Chemotaxis and Actin Oscillations

    Science.gov (United States)

    Bodenschatz, Eberhard; Hsu, Hsin-Fang; Negrete, Jose; Beta, Carsten; Pumir, Alain; Gholami, Azam; Tarantola, Marco; Westendorf, Christian; Zykov, Vladimir

    Recently, self-oscillations of the cytoskeletal actin have been observed in Dictyostelium, a model system for studying chemotaxis. Here we report experimental results on the self-oscillation mechanism and the role of regulatory proteins and myosin II. We stimulate cells rapidly and periodically by using photo un-caging of the chemoattractant in a micro-fluidic device and measured the cellular responses. We found that the response amplitude grows with stimulation strength only in a very narrow region of stimulation, after which the response amplitude reaches a plateau. Moreover, the frequency-response is not constant but rather varies with the strength of external stimuli. To understand the underlying mechanism, we analyzed the polymerization and de-polymerization time in the single cell level. Despite of the large cell-to-cell variability, we found that the polymerization time is independent of external stimuli and the de-polymerization time is prolonged as the stimulation strength increases. Our conclusions will be summarized and the role of noise in the signaling network will be discussed. German Science Foundation CRC 937.

  8. Transactivation of the proximal promoter of human oxytocin gene by TR4 orphan receptor

    International Nuclear Information System (INIS)

    Wang, C.-P.; Lee, Y.-F.; Chang, C.; Lee, H.-J.

    2006-01-01

    The human testicular receptor 4 (TR4) shares structural homology with members of the nuclear receptor superfamily. Some other members of this superfamily were able to regulate the transcriptional activity of the human oxytocin (OXT) promoter by binding to the first DR0 regulatory site. However, little investigation was conducted systematically in the study of the second dDR4 site of OXT proximal promoter, and the relationship between the first and the second sites of OXT promoter. Here, we demonstrated for the first time that TR4 could increase the proximal promoter activity of the human OXT gene via DR0, dDR4, and OXT (both DR0 and dDR4) elements, respectively. TR4 might induce OXT gene expression through the OXT element in a dose-dependent manner. However, there is no synergistic effect between DR0 and dDR4 elements during TR4 transactivation. Taken together, these results suggested that TR4 should be one of important regulators of OXT gene expression

  9. Cloning and characterization of the human integrin β6 gene promoter.

    Directory of Open Access Journals (Sweden)

    Mingyan Xu

    Full Text Available The integrin β6 (ITGB6 gene, which encodes the limiting subunit of the integrin αvβ6 heterodimer, plays an important role in wound healing and carcinogenesis. The mechanism underlying ITGB6 regulation, including the identification of DNA elements and cognate transcription factors responsible for basic transcription of human ITGB6 gene, remains unknown. This report describes the cloning and characterization of the human ITGB6 promoter. Using 5'-RACE (rapid amplification of cDNA ends analysis, the transcriptional initiation site was identified. Promoter deletion analysis identified and functionally validated a TATA box located in the region -24 to -18 base pairs upstream of the ITGB6 promoter. The regulatory elements for transcription of the ITGB6 gene were predominantly located -289 to -150 from the ITGB6 promoter and contained putative binding sites for transcription factors such as STAT3 and C/EBPα. Using chromatin immunoprecipitation assays, this study has demonstrated, for the first time, that transcription factors STAT3 and C/EBPα are involved in the positive regulation of ITGB6 transcription in oral squamous cell carcinoma cells. These findings have important implications for unraveling the mechanism of abnormal ITGB6 activation in tissue remodeling and tumorigenesis.

  10. The enrichment of TATA box and the scarcity of depleted proximal nucleosome in the promoters of duplicated yeast genes.

    Science.gov (United States)

    Kim, Yuseob; Lee, Jang H; Babbitt, Gregory A

    2010-01-01

    Population genetic theory of gene duplication suggests that the preservation of duplicate copies requires functional divergence upon duplication. Genes that can be readily modified to produce new gene expression patterns may thus be duplicated often. In yeast, genes exhibit dichotomous expression patterns based on their promoter architectures. The expression of genes that contain TATA box or occupied proximal nucleosome (OPN) tends to be variable and respond to external signals. On the other hand, genes without TATA box or with depleted proximal nucleosome (DPN) are expressed constitutively. We find that recent duplicates in the yeast genome are heavily biased to be TATA box containing genes and not to be DPN genes. This suggests that variably expressed genes, due to the functional organization in their promoters, have higher duplicability than constitutively expressed genes.

  11. Ring closure in actin polymers

    Energy Technology Data Exchange (ETDEWEB)

    Sinha, Supurna, E-mail: supurna@rri.res.in [Raman Research Institute, Bangalore 560080 (India); Chattopadhyay, Sebanti [Doon University, Dehradun 248001 (India)

    2017-03-18

    We present an analysis for the ring closure probability of semiflexible polymers within the pure bend Worm Like Chain (WLC) model. The ring closure probability predicted from our analysis can be tested against fluorescent actin cyclization experiments. We also discuss the effect of ring closure on bend angle fluctuations in actin polymers. - Highlights: • Ring closure of biopolymers. • Worm like chain model. • Predictions for experiments.

  12. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    Directory of Open Access Journals (Sweden)

    Shan Xin

    Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

  13. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    Science.gov (United States)

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  14. Characterization and functional analysis of the Paralichthys olivaceus prdm1 gene promoter.

    Science.gov (United States)

    Li, Peizhen; Wang, Bo; Cao, Dandan; Liu, Yuezhong; Zhang, Quanqi; Wang, Xubo

    2017-10-01

    PR domain containing protein 1 (Prdm1) is a transcriptional repressor identified in various species and plays multiple important roles in immune response and embryonic development. However, little is known about the transcriptional regulation of the prdm1 gene. This study aims to characterize the promoter of Paralichthys olivaceus prdm1 (Po-prdm1) gene and determine the regulatory mechanism of Po-prdm1 expression. A 2000bp-long 5'-flanking region (translation initiation site designated as +1) of the Po-prdm1 gene was isolated and characterized. The regulatory elements in this fragment were then investigated and many putative transcription factor (TF) binding sites involved in immunity and multiple tissue development were identified. A 5'-deletion analysis was then conducted, and the ability of the deletion mutants to promote luciferase and green fluorescent protein (GFP) expression in a flounder gill cell line was examined. The results revealed that the minimal promoter is located in the region between -446 and -13bp, and the region between -1415 and -13bp enhanced the promoter activity. Site-directed mutation analysis was subsequently performed on the putative regulatory elements sites, and the results indicated that FOXP1, MSX and BCL6 binding sites play negative functional roles in the regulation of the Po-prdm1 expression in FG cells. In vivo analysis demonstrated that a GFP reporter gene containing 1.4kb-long promoter fragment (-1415/-13) was expressed in the head and trunk muscle fibres of transient transgenic zebrafish embryos. Our study provided the basic information for the exploration of Po-prdm1 regulation and expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

    International Nuclear Information System (INIS)

    Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.

    2003-01-01

    Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

  16. c-Myc activates BRCA1 gene expression through distal promoter elements in breast cancer cells

    International Nuclear Information System (INIS)

    Chen, Yinghua; Xu, Jinhua; Borowicz, Stanley; Collins, Cindy; Huo, Dezheng; Olopade, Olufunmilayo I

    2011-01-01

    The BRCA1 gene plays an important role in the maintenance of genomic stability. BRCA1 inactivation contributes to breast cancer tumorigenesis. An increasing number of transcription factors have been shown to regulate BRCA1 expression. c-Myc can act as a transcriptional activator, regulating up to 15% of all genes in the human genome and results from a high throughput screen suggest that BRCA1 is one of its targets. In this report, we used cultured breast cancer cells to examine the mechanisms of transcriptional activation of BRCA1 by c-Myc. c-Myc was depleted using c-Myc-specific siRNAs in cultured breast cancer cells. BRCA1 mRNA expression and BRCA1 protein expression were determined by quantitative RT-PCR and western blot, respectively and BRCA1 promoter activities were examined under these conditions. DNA sequence analysis was conducted to search for high similarity to E boxes in the BRCA1 promoter region. The association of c-Myc with the BRCA1 promoter in vivo was tested by a chromatin immunoprecipitation assay. We investigated the function of the c-Myc binding site in the BRCA1 promoter region by a promoter assay with nucleotide substitutions in the putative E boxes. BRCA1-dependent DNA repair activities were measured by a GFP-reporter assay. Depletion of c-Myc was found to be correlated with reduced expression levels of BRCA1 mRNA and BRCA1 protein. Depletion of c-Myc decreased BRCA1 promoter activity, while ectopically expressed c-Myc increased BRCA1 promoter activity. In the distal BRCA1 promoter, DNA sequence analysis revealed two tandem clusters with high similarity, and each cluster contained a possible c-Myc binding site. c-Myc bound to these regions in vivo. Nucleotide substitutions in the c-Myc binding sites in these regions abrogated c-Myc-dependent promoter activation. Furthermore, breast cancer cells with reduced BRCA1 expression due to depletion of c-Myc exhibited impaired DNA repair activity. The distal BRCA1 promoter region is associated with c

  17. Mechanism of selective recruitment of RNA polymerases II and III to snRNA gene promoters.

    Science.gov (United States)

    Dergai, Oleksandr; Cousin, Pascal; Gouge, Jerome; Satia, Karishma; Praz, Viviane; Kuhlman, Tracy; Lhôte, Philippe; Vannini, Alessandro; Hernandez, Nouria

    2018-05-01

    RNA polymerase II (Pol II) small nuclear RNA (snRNA) promoters and type 3 Pol III promoters have highly similar structures; both contain an interchangeable enhancer and "proximal sequence element" (PSE), which recruits the SNAP complex (SNAPc). The main distinguishing feature is the presence, in the type 3 promoters only, of a TATA box, which determines Pol III specificity. To understand the mechanism by which the absence or presence of a TATA box results in specific Pol recruitment, we examined how SNAPc and general transcription factors required for Pol II or Pol III transcription of SNAPc-dependent genes (i.e., TATA-box-binding protein [TBP], TFIIB, and TFIIA for Pol II transcription and TBP and BRF2 for Pol III transcription) assemble to ensure specific Pol recruitment. TFIIB and BRF2 could each, in a mutually exclusive fashion, be recruited to SNAPc. In contrast, TBP-TFIIB and TBP-BRF2 complexes were not recruited unless a TATA box was present, which allowed selective and efficient recruitment of the TBP-BRF2 complex. Thus, TBP both prevented BRF2 recruitment to Pol II promoters and enhanced BRF2 recruitment to Pol III promoters. On Pol II promoters, TBP recruitment was separate from TFIIB recruitment and enhanced by TFIIA. Our results provide a model for specific Pol recruitment at SNAPc-dependent promoters. © 2018 Dergai et al.; Published by Cold Spring Harbor Laboratory Press.

  18. Boolean gates on actin filaments

    International Nuclear Information System (INIS)

    Siccardi, Stefano; Tuszynski, Jack A.; Adamatzky, Andrew

    2016-01-01

    Actin is a globular protein which forms long polar filaments in the eukaryotic cytoskeleton. Actin networks play a key role in cell mechanics and cell motility. They have also been implicated in information transmission and processing, memory and learning in neuronal cells. The actin filaments have been shown to support propagation of voltage pulses. Here we apply a coupled nonlinear transmission line model of actin filaments to study interactions between voltage pulses. To represent digital information we assign a logical TRUTH value to the presence of a voltage pulse in a given location of the actin filament, and FALSE to the pulse's absence, so that information flows along the filament with pulse transmission. When two pulses, representing Boolean values of input variables, interact, then they can facilitate or inhibit further propagation of each other. We explore this phenomenon to construct Boolean logical gates and a one-bit half-adder with interacting voltage pulses. We discuss implications of these findings on cellular process and technological applications. - Highlights: • We simulate interaction between voltage pulses using on actin filaments. • We use a coupled nonlinear transmission line model. • We design Boolean logical gates via interactions between the voltage pulses. • We construct one-bit half-adder with interacting voltage pulses.

  19. Boolean gates on actin filaments

    Energy Technology Data Exchange (ETDEWEB)

    Siccardi, Stefano, E-mail: ssiccardi@2ssas.it [The Unconventional Computing Centre, University of the West of England, Bristol (United Kingdom); Tuszynski, Jack A., E-mail: jackt@ualberta.ca [Department of Oncology, University of Alberta, Edmonton, Alberta (Canada); Adamatzky, Andrew, E-mail: andrew.adamatzky@uwe.ac.uk [The Unconventional Computing Centre, University of the West of England, Bristol (United Kingdom)

    2016-01-08

    Actin is a globular protein which forms long polar filaments in the eukaryotic cytoskeleton. Actin networks play a key role in cell mechanics and cell motility. They have also been implicated in information transmission and processing, memory and learning in neuronal cells. The actin filaments have been shown to support propagation of voltage pulses. Here we apply a coupled nonlinear transmission line model of actin filaments to study interactions between voltage pulses. To represent digital information we assign a logical TRUTH value to the presence of a voltage pulse in a given location of the actin filament, and FALSE to the pulse's absence, so that information flows along the filament with pulse transmission. When two pulses, representing Boolean values of input variables, interact, then they can facilitate or inhibit further propagation of each other. We explore this phenomenon to construct Boolean logical gates and a one-bit half-adder with interacting voltage pulses. We discuss implications of these findings on cellular process and technological applications. - Highlights: • We simulate interaction between voltage pulses using on actin filaments. • We use a coupled nonlinear transmission line model. • We design Boolean logical gates via interactions between the voltage pulses. • We construct one-bit half-adder with interacting voltage pulses.

  20. Inactivation of promoter 1B of APC causes partial gene silencing: evidence for a significant role of the promoter in regulation and causative of familial adenomatous polyposis

    DEFF Research Database (Denmark)

    Rohlin, A; Engwall, Y; Fritzell, K

    2011-01-01

    inactivation of promoter 1B is disease causing in FAP; (ii) expression of transcripts from promoter 1B is generated at considerable higher levels compared with 1A, demonstrating a hitherto unknown importance of 1B; (iii) adenoma formation in FAP, caused by impaired function of promoter 1B, does not require......Familial adenomatous polyposis (FAP) is caused by germline mutations in the adenomatous polyposis coli (APC) gene. Two promoters, 1A and 1B, have been recognized in APC, and 1B is thought to have a minor role in the regulation of the gene. We have identified a novel deletion encompassing half...... of this promoter in the largest family (Family 1) of the Swedish Polyposis Registry. The mutation leads to an imbalance in allele-specific expression of APC, and transcription from promoter 1B was highly impaired in both normal colorectal mucosa and blood from mutation carriers. To establish the significance...

  1. hTERT promoter mediating gene therapy in laryngeal squamous carcinomas cells in vitro

    International Nuclear Information System (INIS)

    Liao Zhengkai; Zhou Yunfeng; Zhou Fuxiang; Luo Zhiguo; Xiong Jie; Bao Jie; Xie Conghua; Liu Shiquan

    2007-01-01

    Objective: To investigate the relationship among hTERT promoter activity, hTERT mRNA expression, and telomerase activity (TA) in laryngeal squamous carcinomas cell lines, and to evaluate the usefulness of hTERT promoter mediated gene therapy. Methods: After plasmids pGL3-hTERTp were transfected, hTEBT promoter activity, hTERT mRNA expression and TA were determined by luciferase assay, RT-PCR and TRAP-PCR-ELISA, respectively. Plasmid phTERTp-HRP was constructed and transfected, HRP expression was determined by RT-PCR and competent peroxidase activity was confirmed by enzyme activity assay. The cytotoxicity and radiosensitivity of phTERTp-HRP/IAA were determined by clonogenic assay. Results: The relative levels of hTERT promoter activity, hTERT mRNA expression and TA in Hep2R cells were 1.37-fold, 1.43-fold and 1.81-fold compared with Hep2R cells, hTERT promoter activity was closely associated with hTERT mRNA expression and TA levels (P SF 2 ) was 1.24 (Hep2R cells) and 1.20 (Hep 2cells), the parameter a of with or without IAA incubation were 0.090, 0.020 (Hep2R)and 0.099, 0.042 (Hep2). Conclusions: hTERT promoter is applicable in mediating gene therapy in different radiosensitive laryngeal squamous carcinomas cells. hTERTp-HRP/IAA gene therapy may be a promising supplementary method for radiotherapy of laryngeal squamous-cell carcinomas. (authors)

  2. Methylation of class II transactivator gene promoter IV is not associated with susceptibility to Multiple Sclerosis

    Directory of Open Access Journals (Sweden)

    Lincoln Matthew R

    2008-07-01

    Full Text Available Abstract Background Multiple sclerosis (MS is a complex trait in which alleles at or near the class II loci HLA-DRB1 and HLA-DQB1 contribute significantly to genetic risk. The MHC class II transactivator (MHC2TA is the master controller of expression of class II genes, and methylation of the promoter of this gene has been previously been shown to alter its function. In this study we sought to assess whether or not methylation of the MHC2TA promoter pIV could contribute to MS disease aetiology. Methods In DNA from peripheral blood mononuclear cells from a sample of 50 monozygotic disease discordant MS twins the MHC2TA promoter IV was sequenced and analysed by methylation specific PCR. Results No methylation or sequence variation of the MHC2TA promoter pIV was found. Conclusion The results of this study cannot support the notion that methylation of the pIV promoter of MHC2TA contributes to MS disease risk, although tissue and timing specific epigenetic modifications cannot be ruled out.

  3. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  4. MGMT, GATA6, CD81, DR4, and CASP8 gene promoter methylation in glioblastoma

    Directory of Open Access Journals (Sweden)

    Skiriute Daina

    2012-06-01

    Full Text Available Abstract Background Methylation of promoter region is the major mechanism affecting gene expression in tumors. Recent methylome studies of brain tumors revealed a list of new epigenetically modified genes. Our aim was to study promoter methylation of newly identified epigenetically silenced genes together with already known epigenetic markers and evaluate its separate and concomitant role in glioblastoma genesis and patient outcome. Methods The methylation status of MGMT, CD81, GATA6, DR4, and CASP8 in 76 patients with primary glioblastomas was investigated. Methylation-specific PCR reaction was performed using bisulfite treated DNA. Evaluating glioblastoma patient survival time after operation, patient data and gene methylation effect on survival was estimated using survival analysis. Results The overwhelming majority (97.3% of tumors were methylated in at least one of five genes tested. In glioblastoma specimens gene methylation was observed as follows: MGMT in 51.3%, GATA6 in 68.4%, CD81 in 46.1%, DR4 in 41.3% and CASP8 in 56.8% of tumors. Methylation of MGMT was associated with younger patient age (p CASP8 with older (p MGMT methylation was significantly more frequent event in patient group who survived longer than 36 months after operation (p CASP8 was more frequent in patients who survived shorter than 36 months (p MGMT, GATA6 and CASP8 as independent predictors for glioblastoma patient outcome (p MGMT and GATA6 were independent predictors for patient survival in younger patients’ group, while there were no significant associations observed in older patients’ group when adjusted for therapy. Conclusions High methylation frequency of tested genes shows heterogeneity of glioblastoma epigenome and the importance of MGMT, GATA6 and CASP8 genes methylation in glioblastoma patient outcome.

  5. Two distinct promoters drive transcription of the human D1A dopamine receptor gene.

    Science.gov (United States)

    Lee, S H; Minowa, M T; Mouradian, M M

    1996-10-11

    The human D1A dopamine receptor gene has a GC-rich, TATA-less promoter located upstream of a small, noncoding exon 1, which is separated from the coding exon 2 by a 116-base pair (bp)-long intron. Serial 3'-deletions of the 5'-noncoding region of this gene, including the intron and 5'-end of exon 2, resulted in 80 and 40% decrease in transcriptional activity of the upstream promoter in two D1A-expressing neuroblastoma cell lines, SK-N-MC and NS20Y, respectively. To investigate the function of this region, the intron and 245 bp at the 5'-end of exon 2 were investigated. Transient expression analyses using various chloramphenicol acetyltransferase constructs showed that the transcriptional activity of the intron is higher than that of the upstream promoter by 12-fold in SK-N-MC cells and by 5.5-fold in NS20Y cells in an orientation-dependent manner, indicating that the D1A intron is a strong promoter. Primer extension and ribonuclease protection assays revealed that transcription driven by the intron promoter is initiated at the junction of intron and exon 2 and at a cluster of nucleotides located 50 bp downstream from this junction. The same transcription start sites are utilized by the chloramphenicol acetyltransferase constructs employed in transfections as well as by the D1A gene expressed within the human caudate. The relative abundance of D1A transcripts originating from the upstream promoter compared with those transcribed from the intron promoter is 1.5-2.9 times in SK-N-MC cells and 2 times in the human caudate. Transcript stability studies in SK-N-MC cells revealed that longer D1A mRNA molecules containing exon 1 are degraded 1.8 times faster than shorter transcripts lacking exon 1. Although gel mobility shift assay could not detect DNA-protein interaction at the D1A intron, competitive co-transfection using the intron as competitor confirmed the presence of trans-acting factors at the intron. These data taken together indicate that the human D1A gene has

  6. Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.

    Science.gov (United States)

    Steinacher, Arno; Bates, Declan G; Akman, Ozgur E; Soyer, Orkun S

    2016-01-01

    Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability) under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest an explanation for

  7. Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.

    Directory of Open Access Journals (Sweden)

    Arno Steinacher

    Full Text Available Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest

  8. Transcriptional factor DLX3 promotes the gene expression of enamel matrix proteins during amelogenesis.

    Science.gov (United States)

    Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun

    2015-01-01

    Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.

  9. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

    Science.gov (United States)

    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

    2014-01-10

    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  10. CAGE-defined promoter regions of the genes implicated in Rett Syndrome

    DEFF Research Database (Denmark)

    Vitezic, Morana; Bertin, Nicolas; Andersson, Robin

    2014-01-01

    BACKGROUND: Mutations in three functionally diverse genes cause Rett Syndrome. Although the functions of Forkhead box G1 (FOXG1), Methyl CpG binding protein 2 (MECP2) and Cyclin-dependent kinase-like 5 (CDKL5) have been studied individually, not much is known about their relation to each other...... reveal the predominantly used transcription start sites (TSSs) for each gene including novel transcription start sites for FOXG1. We show that FOXG1 expression is poorly correlated with the expression of MECP2 and CDKL5. We identify promoter shapes for each TSS, the predicted location of enhancers...

  11. Correlation between the methylation of APC gene promoter and colon cancer.

    Science.gov (United States)

    Li, Bing-Qiang; Liu, Peng-Peng; Zhang, Cai-Hua

    2017-08-01

    The present study was planned to explore the correlation between the methylation of APC (adenomatous polyposis coli) and colon carcinogenesis. Colon cancer tissues and tumor-adjacent normal tissues of 60 colon cancer patients (who received surgical operation in our hospital from January 2012 to December 2014) were collected. SW1116 cells in human colon cancer tissues were selected for culturing. 5-aza-2c-deoxycytidine (5-aza-dC) was utilized as an inhibitor of the methylation for APC gene. Methylation specific PCR (MSP) was utilized for detection of APC methylation in SW1116 cells. The MTT and Transwell assays were performed to detect the effect of the methylation of APC gene on the proliferation and invasive abilities of SW1116 cells. The correlation between the methylation of APC gene and pathological parameters of colon cancer patients was analyzed. MSP results revealed that 41 cases (68.33%) showed methylation of APC gene in colon cancer tissues. No methylation of APC gene was found in tumor-adjacent normal tissues. 5-aza-dC was able to inhibit the methylation of APC gene in SW1116 cells. APC gene methylation was correlated with tumor size, differentiation degree, lymph node metastasis and Dukes staging. In conclusion, the levels of the methylation of APC in colon cancer tissues and SW1116 cells are relatively high. The methylation of APC promoted the proliferation and invasion abilities of SW1116 cells. Furthermore, methylation is correlated with a variety of clinicopathological features of colon cancer patients.

  12. Actin and myosin contribute to mammalian mitochondrial DNA maintenance

    Science.gov (United States)

    Reyes, A.; He, J.; Mao, C. C.; Bailey, L. J.; Di Re, M.; Sembongi, H.; Kazak, L.; Dzionek, K.; Holmes, J. B.; Cluett, T. J.; Harbour, M. E.; Fearnley, I. M.; Crouch, R. J.; Conti, M. A.; Adelstein, R. S.; Walker, J. E.; Holt, I. J.

    2011-01-01

    Mitochondrial DNA maintenance and segregation are dependent on the actin cytoskeleton in budding yeast. We found two cytoskeletal proteins among six proteins tightly associated with rat liver mitochondrial DNA: non-muscle myosin heavy chain IIA and β-actin. In human cells, transient gene silencing of MYH9 (encoding non-muscle myosin heavy chain IIA), or the closely related MYH10 gene (encoding non-muscle myosin heavy chain IIB), altered the topology and increased the copy number of mitochondrial DNA; and the latter effect was enhanced when both genes were targeted simultaneously. In contrast, genetic ablation of non-muscle myosin IIB was associated with a 60% decrease in mitochondrial DNA copy number in mouse embryonic fibroblasts, compared to control cells. Gene silencing of β-actin also affected mitochondrial DNA copy number and organization. Protease-protection experiments and iodixanol gradient analysis suggest some β-actin and non-muscle myosin heavy chain IIA reside within human mitochondria and confirm that they are associated with mitochondrial DNA. Collectively, these results strongly implicate the actomyosin cytoskeleton in mammalian mitochondrial DNA maintenance. PMID:21398640

  13. Dissection of a locus on mouse chromosome 5 reveals arthritis promoting and inhibitory genes

    DEFF Research Database (Denmark)

    Lindvall, Therese; Karlsson, Jenny; Holmdahl, Rikard

    2009-01-01

    with Eae39 congenic- and sub-interval congenic mice, carrying RIIIS/J genes on the B10.RIII genetic background, revealed three loci within Eae39 that control disease and anti-collagen antibody titers. Two of the loci promoted disease and the third locus was protecting from collagen induced arthritis...... development. By further breeding of mice with small congenic fragments, we identified a 3.2 Megabasepair (Mbp) interval that regulates disease. CONCLUSIONS: Disease promoting- and protecting genes within the Eae39 locus on mouse chromosome 5, control susceptibility to collagen induced arthritis. A disease......-protecting locus in the telomeric part of Eae39 results in lower anti-collagen antibody responses. The study shows the importance of breeding sub-congenic mouse strains to reveal genetic effects on complex diseases....

  14. Characterization and regulation of the bovine stearoyl-CoA desaturase gene promoter

    International Nuclear Information System (INIS)

    Keating, Aileen F.; Kennelly, John J.; Zhao Fengqi

    2006-01-01

    The bovine stearoyl-CoA desaturase (Scd) gene plays an important role in the bovine mammary gland where substrates such as stearic and vaccenic acids are converted to oleic acid and conjugated linoleic acid (CLA), respectively. Up to 90% of the CLA in bovine milk is formed due to the action of this enzyme in the mammary gland. The areas of the bovine promoter of importance in regulating this key enzyme were examined and an area of 36 bp in length was identified as having a critical role in transcriptional activation and is designated the Scd transcriptional enhancer element (STE). Electrophoretic mobility shift assay detected three binding complexes on this area in Mac-T cell nuclear extracts. Treatment of cells with CLA caused a significant reduction in transcriptional activity, with this effect being mediated through the STE region. The bovine Scd gene promoter was up-regulated by insulin and down-regulated by oleic acid

  15. Pairwise comparisons of ten porcine tissues identify differential transcriptional regulation at the gene, isoform, promoter and transcription start site level

    DEFF Research Database (Denmark)

    Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal

    2013-01-01

    , isoform, and transcription start site (TSS), and promoter level showed that several of the genes differed at all four levels. Interestingly, these genes were mainly annotated to the "electron transport chain" and neuronal differentiation, emphasizing that "tissue important" genes are regulated at several...

  16. Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors

    Directory of Open Access Journals (Sweden)

    Oliveira Jorge

    2007-07-01

    Full Text Available Abstract Background Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. Methods A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC, 13 papillary (pRCC, 10 chromophobe (chRCC, and 10 oncocytomas and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Results Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007, PTGS2 (p = 0.002, and RASSF1A (p = 0.0001. CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively, whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004. RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035. In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031 and nuclear grade (p = 0.022, respectively. Conclusion The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses.

  17. Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors

    International Nuclear Information System (INIS)

    Costa, Vera L; Henrique, Rui; Ribeiro, Franclim R; Pinto, Mafalda; Oliveira, Jorge; Lobo, Francisco; Teixeira, Manuel R; Jerónimo, Carmen

    2007-01-01

    Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP) in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC), 13 papillary (pRCC), 10 chromophobe (chRCC), and 10 oncocytomas) and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007), PTGS2 (p = 0.002), and RASSF1A (p = 0.0001). CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively), whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004). RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035). In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031) and nuclear grade (p = 0.022), respectively. The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses

  18. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.

    2012-12-01

    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  19. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.

    2012-01-01

    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  20. Characteristics of lentiviral vectors harboring the proximal promoter of the vav proto-oncogene: a weak and efficient promoter for gene therapy.

    Science.gov (United States)

    Almarza, Elena; Río, Paula; Meza, Nestor W; Aldea, Montserrat; Agirre, Xabier; Guenechea, Guillermo; Segovia, José C; Bueren, Juan A

    2007-08-01

    Recent published data have shown the efficacy of gene therapy treatments of certain monogenic diseases. Risks of insertional oncogenesis, however, indicate the necessity of developing new vectors with weaker or cell-restricted promoters to minimize the trans-activation activity of integrated proviruses. We have inserted the proximal promoter of the vav proto-oncogene into self-inactivating lentiviral vectors (vav-LVs) and investigated the expression pattern and therapeutic efficacy of these vectors. Compared with other LVs frequently used in gene therapy, vav-LVs mediated a weak, though homogeneous and stable, expression in in vitro-cultured cells. Transplantation experiments using transduced mouse bone marrow and human CD34(+) cells confirmed the stable activity of the promoter in vivo. To investigate whether the weak activity of this promoter was compatible with a therapeutic effect, a LV expressing the Fanconi anemia A (FANCA) gene was constructed (vav-FANCA LV). Although this vector induced a low expression of FANCA, compared to the expression induced by a LV harboring the spleen focus-forming virus (SFFV) promoter, the two vectors corrected the phenotype of cells from a patient with FA-A with the same efficacy. We propose that self-inactivating vectors harboring weak promoters, such as the vav promoter, will improve the safety of gene therapy and will be of particular interest for the treatment of diseases where a high expression of the transgene is not required.

  1. Enhanced gravitropism of roots with a disrupted cap actin cytoskeleton

    Science.gov (United States)

    Hou, Guichuan; Mohamalawari, Deepti R.; Blancaflor, Elison B.

    2003-01-01

    The actin cytoskeleton has been proposed to be a major player in plant gravitropism. However, understanding the role of actin in this process is far from complete. To address this problem, we conducted an analysis of the effect of Latrunculin B (Lat B), a potent actin-disrupting drug, on root gravitropism using various parameters that included detailed curvature kinetics, estimation of gravitropic sensitivity, and monitoring of curvature development after extended clinorotation. Lat B treatment resulted in a promotion of root curvature after a 90 degrees reorientation in three plant species tested. More significantly, the sensitivity of maize (Zea mays) roots to gravity was enhanced after actin disruption, as determined from a comparison of presentation time of Lat B-treated versus untreated roots. A short 10-min gravistimulus followed by extended rotation on a 1-rpm clinostat resulted in extensive gravitropic responses, manifested as curvature that often exceeded 90 degrees. Application of Lat B to the cap or elongation zone of maize roots resulted in the disruption of the actin cytoskeleton, which was confined to the area of localized Lat B application. Only roots with Lat B applied to the cap displayed the strong curvature responses after extended clinorotation. Our study demonstrates that disrupting the actin cytoskeleton in the cap leads to the persistence of a signal established by a previous gravistimulus. Therefore, actin could function in root gravitropism by providing a mechanism to regulate the proliferation of a gravitropic signal originating from the cap to allow the root to attain its correct orientation or set point angle.

  2. Transgelin gene is frequently downregulated by promoter DNA hypermethylation in breast cancer.

    Science.gov (United States)

    Sayar, Nilufer; Karahan, Gurbet; Konu, Ozlen; Bozkurt, Betul; Bozdogan, Onder; Yulug, Isik G

    2015-01-01

    CpG hypermethylation in gene promoters is a frequent mechanism of tumor suppressor gene silencing in various types of cancers. It usually occurs at early steps of cancer progression and can be detected easily, giving rise to development of promising biomarkers for both detection and progression of cancer, including breast cancer. 5-aza-2'-deoxycytidine (AZA) is a DNA demethylating and anti-cancer agent resulting in induction of genes suppressed via DNA hypermethylation. Using microarray expression profiling of AZA- or DMSO-treated breast cancer and non-tumorigenic breast (NTB) cells, we identified for the first time TAGLN gene as a target of DNA hypermethylation in breast cancer. TAGLN expression was significantly and frequently downregulated via promoter DNA hypermethylation in breast cancer cells compared to NTB cells, and also in 13/21 (61.9 %) of breast tumors compared to matched normal tissues. Analyses of public microarray methylation data showed that TAGLN was also hypermethylated in 63.02 % of tumors compared to normal tissues; relapse-free survival of patients was worse with higher TAGLN methylation; and methylation levels could discriminate between tumors and healthy tissues with 83.14 % sensitivity and 100 % specificity. Additionally, qRT-PCR and immunohistochemistry experiments showed that TAGLN expression was significantly downregulated in two more independent sets of breast tumors compared to normal tissues and was lower in tumors with poor prognosis. Colony formation was increased in TAGLN silenced NTB cells, while decreased in overexpressing BC cells. TAGLN gene is frequently downregulated by DNA hypermethylation, and TAGLN promoter methylation profiles could serve as a future diagnostic biomarker, with possible clinical impact regarding the prognosis in breast cancer.

  3. Association of Interleukin-10 gene promoter polymorphisms with obstructive sleep apnea.

    Science.gov (United States)

    Özdaş, Sibel; Özdaş, Talih; Acar, Mustafa; Erbek, Selim S; Köseoğlu, Sabri; Göktürk, Gökhan; Izbirak, Afife

    2016-05-01

    Interleukin-10 (IL) is an anti-inflammatory cytokine that regulates normal sleep patterns, and recent studies have reported that it is a potential useful biomarker to identify presence and severity of sleep apnea syndrome (OSAS). Promoter polymorphisms of IL-10 gene have been associated with altered expression levels, which contributes to OSAS. The aim of this study was to determine the prevalence of -1082 G/A, -819 C/T, and -592 C/A promoter polymorphisms of IL-10 gene in individuals with OSAS and controls. An open-label study was performed in the Otorhinolaryngology and Sleep Disorders Outpatient Clinics. One hundred four cases with OSAS were included as the study group, and 78 individuals without OSAS were included as the controls. DNAs were extracted from peripheral blood leukocytes, and the sites that encompassed those polymorphisms were identified by DNA sequencing analyses. Data were analyzed with SNPStats and multifactor dimensionality reduction (MDR) software. The prevalence of OSAS was higher in males in the study group when compared to controls (P = 0.0003). The IL-10-1082 G/A, -819 C/T, and -592 C/A SNPs, and their minor alleles were associated with a significantly increased risk for OSAS compared to the controls (P ˂ 0.05 for all). Furthermore, ATA haplotype frequency was significantly higher in the study group compared to the control group, but the GCC haplotype frequency was lower (P = 0.0001 and P = 0.0001). As indicated in MDR analysis, combinations of IL-10 gene were associated with OSAS in single-, double-, and triple-locus analyses. The prevalences of the IL-10 gene promoter polymorphisms were different in OSAS patients and the controls in Turkish population. IL-10 gene polymorphisms may lead to altered inflammatory cascade, which might contribute to OSAS. Further studies on larger cohorts are needed to validate our findings.

  4. Promotion of growth by Coenzyme Q10 is linked to gene expression in C. elegans.

    Science.gov (United States)

    Fischer, Alexandra; Niklowitz, Petra; Menke, Thomas; Döring, Frank

    2014-10-03

    Coenzyme Q (CoQ, ubiquinone) is an essential component of the respiratory chain, a cofactor of pyrimidine biosynthesis and acts as an antioxidant in extra mitochondrial membranes. More recently CoQ has been identified as a modulator of apoptosis, inflammation and gene expression. CoQ deficient Caenorhabditis elegans clk-1 mutants show several phenotypes including a delayed postembryonic growth. Using wild type and two clk-1 mutants, here we established an experimental set-up to study the consequences of endogenous CoQ deficiency or exogenous CoQ supply on gene expression and growth. We found that a deficiency of endogenous CoQ synthesis down-regulates a cluster of genes that are important for growth (i.e., RNA polymerase II, eukaryotic initiation factor) and up-regulates oxidation reactions (i.e., cytochrome P450, superoxide dismutase) and protein interactions (i.e., F-Box proteins). Exogenous CoQ supply partially restores the expression of these genes as well as the growth retardation of CoQ deficient clk-1 mutants. On the other hand exogenous CoQ supply does not alter the expression of a further sub-set of genes. These genes are involved in metabolism (i.e., succinate dehydrogenase complex), cell signalling or synthesis of lectins. Thus, our work provides a comprehensive overview of genes which can be modulated in their expression by endogenous or exogenous CoQ. As growth retardation in CoQ deficiency is linked to the gene expression profile we suggest that CoQ promotes growth via gene expression. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Promoter Hypermethylation of the EMP3 Gene in a Series of 229 Human Gliomas

    Directory of Open Access Journals (Sweden)

    Marta Mellai

    2013-01-01

    Full Text Available The epithelial membrane protein 3 (EMP3 is a candidate tumor suppressor gene in the critical region 19q13.3 for several solid tumors, including tumors of the nervous systems. The aim of this study was to investigate the EMP3 promoter hypermethylation status in a series of 229 astrocytic and oligodendroglial tumors and in 16 GBM cell lines. The analysis was performed by methylation-specific PCR and capillary electrophoresis. Furthermore, the EMP3 expression at protein level was evaluated by immunohistochemistry and Western blotting analysis. Associations of EMP3 hypermethylation with total 1p/19q codeletion, MGMT promoter hypermethylation, IDH1/IDH2 and TP53 mutations, and EGFR amplification were studied, as well as its prognostic significance. The EMP3 promoter hypermethylation has been found in 39.5% of gliomas. It prevailed in low-grade tumors, especially in gliomas with an oligodendroglial component, and in sGBMs upon pGBMs. In oligodendroglial tumors, it was strongly associated with both IDH1/IDH2 mutations and total 1p/19q codeletion and inversely with EGFR gene amplification. No association was found with MGMT hypermethylation and TP53 mutations. In the whole series, the EMP3 hypermethylation status correlated with 19q13.3 loss and lack of EMP3 expression at protein level. A favorable prognostic significance on overall survival of the EMP3 promoter hypermethylation was found in patients with oligodendroglial tumors.

  6. The association of the metalloproteinase-3 gene promoter polymorphisms and the middle cerebral artery stenosis.

    Science.gov (United States)

    Fu, Chunli; Xing, Yingqi; Song, Xiaonan

    2011-04-01

    To investigate the association of single nucleotide polymorphism in the matrix metalloproteinase-3 (MMP3) gene promoter with the susceptibility to the middle cerebral artery stenosis. A case-control study was performed by determining the genotype of MMP3 gene promoter region using polymerase chain reaction-restriction fragment length polymorphism in 119 patients with middle cerebral artery stenosis documented by transcranial Doppler compared to 92 control patients. The frequencies of 5A and 6A alleles in MMP3 promoter region were 16.0 and 84.0% respectively in case group compared to 15.8 and 84.2% in control group with no significant difference between the two groups (P > 0.05). No significant difference was also observed in the distribution of genotypes 5A/5A,5A/6A, and 6A/6A between middle cerebral artery stenosis and control groups. Compared to 5A/5A + 5A/6A genotypes,the 6A/6A genotype did not significantly modify the risk of developing the middle cerebral artery stenosis. The MMP3-1171 dupA promoter polymorphisms are not valuable markers of susceptibility of the middle cerebral artery stenosis in this sample of population studied.

  7. Quantitative Methylation Profiles for Multiple Tumor Suppressor Gene Promoters in Salivary Gland Tumors

    Science.gov (United States)

    Durr, Megan L.; Mydlarz, Wojciech K.; Shao, Chunbo; Zahurak, Marianna L.; Chuang, Alice Y.; Hoque, Mohammad O.; Westra, William H.; Liegeois, Nanette J.; Califano, Joseph A.; Sidransky, David; Ha, Patrick K.

    2010-01-01

    Background Methylation profiling of tumor suppressor gene (TSGs) promoters is quickly becoming a powerful diagnostic tool for the early detection, prognosis, and even prediction of clinical response to treatment. Few studies address this in salivary gland tumors (SGTs); hence the promoter methylation profile of various TSGs was quantitatively assessed in primary SGT tissue to determine if tumor-specific alterations could be detected. Methodology DNA isolated from 78 tumor and 17 normal parotid gland specimens was assayed for promoter methylation status of 19 TSGs by fluorescence-based, quantitative methylation-specific PCR (qMSP). The data were utilized in a binary fashion as well as quantitatively (using a methylation quotient) allowing for better profiling and interpretation of results. Principal Findings The average number of methylation events across the studied genes was highest in salivary duct carcinoma (SDC), with a methylation value of 9.6, compared to the normal 4.5 (ptrend for increasing methylation in APC, Mint 1, PGP9.5, RAR-β, and Timp3. Conclusions/Significance Screening promoter methylation profiles in SGTs showed considerable heterogeneity. The methylation status of certain markers was surprisingly high in even normal salivary tissue, confirming the need for such controls. Several TSGs were found to be associated with malignant SGTs, especially SDC. Further study is needed to evaluate the potential use of these associations in the detection, prognosis, and therapeutic outcome of these rare tumors. PMID:20520817

  8. Identification of the MUC2 Promoter as a Strong Promoter for Intestinal Gene Expression through Generation of Transgenic Quail Expressing GFP in Gut Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Rachel M. Woodfint

    2017-01-01

    Full Text Available Identification of tissue- and stage-specific gene promoters is valuable for delineating the functional roles of specific genes in genetically engineered animals. Here, through the comparison of gene expression in different tissues by analysis of a microarray database, the intestinal specificity of mucin 2 (MUC2 expression was identified in mice and humans, and further confirmed in chickens by RT-PCR (reverse transcription-PCR analysis. An analysis of cis-acting elements in avian MUC2 gene promoters revealed conservation of binding sites, within a 2.9 kb proximal promoter region, for transcription factors such as caudal type homeobox 2 (CDX2, GATA binding protein 4 (GATA4, hepatocyte nuclear factor 4 α (HNF4A, and transcription factor 4 (TCF4 that are important for maintaining intestinal homeostasis and functional integrity. By generating transgenic quail, we demonstrated that the 2.9 kb chicken MUC2 promoter could drive green fluorescent protein (GFP reporter expression exclusively in the small intestine, large intestine, and ceca. Fluorescence image analysis further revealed GFP expression in intestine epithelial cells. The GFP expression was barely detectable in the embryonic intestine, but increased during post-hatch development. The spatiotemporal expression pattern of the reporter gene confirmed that the 2.9 kb MUC2 promoter could retain the regulatory element to drive expression of target genes in intestinal tissues after hatching. This new transgene expression system, using the MUC2 promoter, will provide a new method of overexpressing target genes to study gene function in the avian intestine.

  9. Cooperative and non-cooperative conformational changes of F-actin induced by cofilin

    Energy Technology Data Exchange (ETDEWEB)

    Aihara, Tomoki; Oda, Toshiro, E-mail: toda@spring8.or.jp

    2013-05-31

    Highlights: •Mobility of MTSL attached to C374 in F-actin became high upon addition of cofilin. •Change of motility of MTSL attached to C374 with cofilin-binding was cooperative. •Mobility of MTSL attached to V43C in F-actin became high upon addition of cofilin. •Change of motility of MTSL attached to V43C with cofilin-binding was linear. -- Abstract: Cofilin is an actin-binding protein that promotes F-actin depolymerization. It is well-known that cofilin-coated F-actin is more twisted than naked F-actin, and that the protomer is more tilted. However, the means by which the local changes induced by the binding of individual cofilin proteins proceed to the global conformational changes of the whole F-actin molecule remain unknown. Here we investigated the cofilin-induced changes in several parts of F-actin, through site-directed spin-label electron paramagnetic resonance spectroscopy analyses of recombinant actins containing single reactive cysteines. We found that the global, cooperative conformational changes induced by cofilin-binding, which were detected by the spin-label attached to the Cys374 residue, occurred without the detachment of the D-loop in subdomain 2 from the neighboring protomer. The two processes of local and global changes do not necessarily proceed in sequence.

  10. Genomic organization and promoter cloning of the human X11α gene APBA1.

    LENUS (Irish Health Repository)

    Chai, Ka-Ho

    2012-05-01

    X11α is a brain specific multi-modular protein that interacts with the Alzheimer\\'s disease amyloid precursor protein (APP). Aggregation of amyloid-β peptide (Aβ), an APP cleavage product, is believed to be central to the pathogenesis of Alzheimer\\'s disease. Recently, overexpression of X11α has been shown to reduce Aβ generation and to ameliorate memory deficit in a transgenic mouse model of Alzheimer\\'s disease. Therefore, manipulating the expression level of X11α may provide a novel route for the treatment of Alzheimer\\'s disease. Human X11α is encoded by the gene APBA1. As evidence suggests that X11α expression can be regulated at transcription level, we have determined the gene structure and cloned the promoter of APBA1. APBA1 spans over 244 kb on chromosome 9 and is composed of 13 exons and has multiple transcription start sites. A putative APBA1 promoter has been identified upstream of exon 1 and functional analysis revealed that this is highly active in neurons. By deletion analysis, the minimal promoter was found to be located between -224 and +14, a GC-rich region that contains a functional Sp3 binding site. In neurons, overexpression of Sp3 stimulates the APBA1 promoter while an Sp3 inhibitor suppresses the promoter activity. Moreover, inhibition of Sp3 reduces endogenous X11α expression and promotes the generation of Aβ. Our findings reveal that Sp3 play an essential role in APBA1 transcription.

  11. Over-expression of Gene FaASR Promotes Strawberry Fruit Coloring

    Directory of Open Access Journals (Sweden)

    Liu Zhongjie

    2015-11-01

    Full Text Available Fruit development and ripening is a complicate process. Although much progress has been made on the ripenig process, the molecular mechamism of fruit development is not yet clear. In this study, we used ‘Sweet Charlie’ strawberry as test materials, based on cloning the strawberries ASR homologous gene, we carried out the bioinformatics and temporal expression analysis of FaASR, by manipulating ASR gene expression level in strawberry fruit, we tested the changes of physiological indicators, including sugar, ABA, pigments content, and fruit firmness, as well as phenotypic changes. In addition, we measured the expression changes of some anthocyanin-related gene, such as CHS and UFGT, by which we revealed the regulation mechanisms of ASR gene over strawberry fruit ripening. Strawberry ASR contained a typical domain of ABA/WDS that was related to fruit ripening and stress-resistance, and ASR gene over-expression could promote strawberry fruit coloring, endogenous ABA and sucrose accumulation, fruit softening, and induced the transcription levels of anthocyanin-related genes CHS and UFGT. The present study will further reveal the molecular mechanisms of information transmission in fruit development, and will also play an important foundation for future molecular improvement of strawberries breeding.

  12. Methylation of Promoter Regions of Genes of the Human Intrauterine Renin Angiotensin System and Their Expression

    Directory of Open Access Journals (Sweden)

    Shane D. Sykes

    2015-01-01

    Full Text Available The intrauterine renin angiotensin system (RAS is implicated in placentation and labour onset. Here we investigate whether promoter methylation of RAS genes changes with gestation or labour and if it affects gene expression. Early gestation amnion and placenta were studied, as were term amnion, decidua, and placenta collected before labour (at elective caesarean section or after spontaneous labour and delivery. The expression and degree of methylation of the prorenin receptor (ATP6AP2, angiotensin converting enzyme (ACE, angiotensin II type 1 receptor (AGTR1, and two proteases that can activate prorenin (kallikrein, KLK1, and cathepsin D, CTSD were measured by qPCR and a DNA methylation array. There was no effect of gestation or labour on the methylation of RAS genes and CTSD. Amnion and decidua displayed strong correlations between the percent hypermethylation of RAS genes and CTSD, suggestive of global methylation. There were no correlations between the degree of methylation and mRNA abundance of any genes studied. KLK1 was the most methylated gene and the proportion of hypermethylated KLK1 alleles was lower in placenta than decidua. The presence of intermediate methylated alleles of KLK1 in early gestation placenta and in amnion after labour suggests that KLK1 methylation is uniquely dynamic in these tissues.

  13. Actin depolymerization enhances adipogenic differentiation in human stromal stem cells

    Directory of Open Access Journals (Sweden)

    Li Chen

    2018-05-01

    Full Text Available Human stromal stem cells (hMSCs differentiate into adipocytes that play a role in skeletal tissue homeostasis and whole body energy metabolism. During adipocyte differentiation, hMSCs exhibit significant changes in cell morphology suggesting changes in cytoskeletal organization. Here, we examined the effect of direct modulation of actin microfilament dynamics on adipocyte differentiation. Stabilizing actin filaments in hMSCs by siRNA-mediated knock down of the two main actin depolymerizing factors (ADFs: Cofilin 1 (CFL1 and Destrin (DSTN or treating the cells by Phalloidin reduced adipocyte differentiation as evidenced by decreased number of mature adipocytes and decreased adipocyte specific gene expression (ADIPOQ, LPL, PPARG, FABP4. In contrast, disruption of actin cytoskeleton by Cytochalasin D enhanced adipocyte differentiation. Follow up studies revealed that the effects of CFL1 on adipocyte differentiation depended on the activity of LIM domain kinase 1 (LIMK1 which is the major upstream kinase of CFL1. Inhibiting LIMK by its specific chemical inhibitor LIMKi inhibited the phosphorylation of CFL1 and actin polymerization, and enhanced the adipocyte differentiation. Moreover, treating hMSCs by Cytochalasin D inhibited ERK and Smad2 signaling and this was associated with enhanced adipocyte differentiation. On the other hand, Phalloidin enhanced ERK and Smad2 signaling, but inhibited adipocyte differentiation which was rescued by ERK specific chemical inhibitor U0126. Our data provide a link between restructuring of hMSCs cytoskeleton and hMSCs lineage commitment and differentiation. Keywords: Actin cytoskeleton, Actin depolymerizing factors, Adipocyte differentiation, Human stromal stem cells

  14. Structure of the gene for human β2-adrenergic receptor: expression and promoter characterization

    International Nuclear Information System (INIS)

    Emorine, L.J.; Marullo, S.; Delavier-Klutchko, C.; Kaveri, S.V.; Durieu-Trautmann, O.; Strosberg, A.D.

    1987-01-01

    The genomic gene coding for the human β 2 -adrenergic receptor (β 2 AR) from A431 epidermoid cells has been isolated. Transfection of the gene into eukaryotic cells restores a fully active receptor/GTP-binding protein/adenylate cyclase complex with β 2 AR properties. Southern blot analyses with β 2 AR-specific probes show that a single β 2 AR gene is common to various human tissues and that its flanking sequences are highly conserved among humans and between man and rabbit, mouse, and hamster. Functional significance of these regions is supported by the presence of a promoter region (including mRNA cap sites, two TATA boxes, a CAAT box, and three G + C-rich regions that resemble binding sites for transcription factor Sp1) 200-300 base pairs 5' to the translation initiation codon. In the 3' flanking region, sequences homologous to glucocorticoid-response elements might be responsible for the increased expression of the β 2 AR gene observed after treatment of the transfected cells with hydrocortisone. In addition, 5' to the promoter region, an open reading frame encodes a 251-residue polypeptide that displays striking homologies with protein kinases and other nucleotide-binding proteins

  15. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  16. Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

    Science.gov (United States)

    Wyszyńska-Koko, J; Kurył, J

    2004-01-01

    MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

  17. All-Round Manipulation of the Actin Cytoskeleton by HIV.

    Science.gov (United States)

    Ospina Stella, Alberto; Turville, Stuart

    2018-02-05

    While significant progress has been made in terms of human immunodeficiency virus (HIV) therapy, treatment does not represent a cure and remains inaccessible to many people living with HIV. Continued mechanistic research into the viral life cycle and its intersection with many aspects of cellular biology are not only fundamental in the continued fight against HIV, but also provide many key observations of the workings of our immune system. Decades of HIV research have testified to the integral role of the actin cytoskeleton in both establishing and spreading the infection. Here, we review how the virus uses different strategies to manipulate cellular actin networks and increase the efficiency of various stages of its life cycle. While some HIV proteins seem able to bind to actin filaments directly, subversion of the cytoskeleton occurs indirectly by exploiting the power of actin regulatory proteins, which are corrupted at multiple levels. Furthermore, this manipulation is not restricted to a discrete class of proteins, but rather extends throughout all layers of the cytoskeleton. We discuss prominent examples of actin regulators that are exploited, neutralized or hijacked by the virus, and address how their coordinated deregulation can lead to changes in cellular behavior that promote viral spreading.

  18. Multiple roles for the actin cytoskeleton during regulated exocytosis

    Science.gov (United States)

    Porat-Shliom, Natalie; Milberg, Oleg; Masedunskas, Andrius; Weigert, Roberto

    2014-01-01

    Regulated exocytosis is the main mechanism utilized by specialized secretory cells to deliver molecules to the cell surface by virtue of membranous containers (i.e. secretory vesicles). The process involves a series of highly coordinated and sequential steps, which include the biogenesis of the vesicles, their delivery to the cell periphery, their fusion with the plasma membrane and the release of their content into the extracellular space. Each of these steps is regulated by the actin cytoskeleton. In this review, we summarize the current knowledge regarding the involvement of actin and its associated molecules during each of the exocytic steps in vertebrates, and suggest that the overall role of the actin cytoskeleton during regulated exocytosis is linked to the architecture and the physiology of the secretory cells under examination. Specifically, in neurons, neuroendocrine, endocrine, and hematopoietic cells, which contain small secretory vesicles that undergo rapid exocytosis (on the order of milliseconds), the actin cytoskeleton plays a role in pre-fusion events, where it acts primarily as a functional barrier and facilitates docking. In exocrine and other secretory cells, which contain large secretory vesicles that undergo slow exocytosis (seconds to minutes), the actin cytoskeleton plays a role in post-fusion events, where it regulates the dynamics of the fusion pore, facilitates the integration of the vesicles into the plasma membrane, provides structural support, and promotes the expulsion of large cargo molecules. PMID:22986507

  19. Dual effect of pseudorabies virus growth factor (PRGF) displayed on actin cytoskeleton.

    Science.gov (United States)

    Urbancíková, M; Vozárová, G; Lesko, J; Golais, F

    1999-10-01

    Pseudorabies virus growth factor (PRGF) was shown to possess transforming activity as well as transformation repressing activity in in vitro systems. In order to better understand these phenomena we studied actin cytoskeleton and its alterations induced by PRGF using normal human fibroblasts VH-10 and transformed cell line HeLa. For specific detection of filamentous actin cells were stained with phalloidin conjugated with fluorescein isothiocyanate (FITC)-phalloidin. PRGF was applied to VH-10 cells for various length of time from 10 min up to 48 h. The effect was very fast and changes in actin filament composition could be detected already after 10 min. In comparison to untreated cells the staining of treated cells was more diffuse and a number of actin microfilaments in individual stress fibers became reduced. After 30 min thick short actin bundles appeared in the perinuclear region. A 24-h exposure resulted in a large reduction of actin bundles. After additional 24 h a partial restoration of actin cytoskeleton in cells was observed. In transformed HeLa cells PRGF induced opposite process than in normal cells: the number of filamentous actin structures increased. We hypothesise that PRGF may act as a transcription-like factor and may initiate changes in gene expression which consequently result in actin cytoskeleton alterations.

  20. Plant vegetative and animal cytoplasmic actins share functional competence for spatial development with protists.

    Science.gov (United States)

    Kandasamy, Muthugapatti K; McKinney, Elizabeth C; Roy, Eileen; Meagher, Richard B

    2012-05-01

    Actin is an essential multifunctional protein encoded by two distinct ancient classes of genes in animals (cytoplasmic and muscle) and plants (vegetative and reproductive). The prevailing view is that each class of actin variants is functionally distinct. However, we propose that the vegetative plant and cytoplasmic animal variants have conserved functional competence for spatial development inherited from an ancestral protist actin sequence. To test this idea, we ectopically expressed animal and protist actins in Arabidopsis thaliana double vegetative actin mutants that are dramatically altered in cell and organ morphologies. We found that expression of cytoplasmic actins from humans and even a highly divergent invertebrate Ciona intestinalis qualitatively and quantitatively suppressed the root cell polarity and organ defects of act8 act7 mutants and moderately suppressed the root-hairless phenotype of act2 act8 mutants. By contrast, human muscle actins were unable to support prominently any aspect of plant development. Furthermore, actins from three protists representing Choanozoa, Archamoeba, and green algae efficiently suppressed all the phenotypes of both the plant mutants. Remarkably, these data imply that actin's competence to carry out a complex suite of processes essential for multicellular development was already fully developed in single-celled protists and evolved nonprogressively from protists to plants and animals.

  1. Effectiveness of hCMV, mEF1a and mAct promoters on driving of foreign gene expression in transgenic zebrafish

    Directory of Open Access Journals (Sweden)

    . Alimuddin

    2007-01-01

    Full Text Available Highly unsaturated fatty acids (HUFA, especially eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA have long been recognized for its beneficial effect for human health and development.   The D6 fatty acid desaturase is generally considered to be the rate-limiting factor in HUFA biosynthesis.  Here, as the first step of study, we conducted experiment to select an appropriate construct that allows higher expression levels of masu salmon (Oncorhynchus masou D6-desaturase gene in zebrafish (Danio rerio in order to increase its activity for synthesizing EPA/DHA.  Salmon D6-desaturase cDNA (sD6 was separately ligated with human cytomegalovirus (hCMV, medaka elongation factor 1a (mEF1a and medaka b-actin (mAct promoters.  The resulted construct was designated as hCMV-sD6, mEF1a-sD6 and mAct-sD6, respectively.  Each of the constructs in circular DNA form was microinjected into 1-cell stage embryos at a concentration of 30mg/ml. Transgenic individuals were identified by polymerase chain reaction (PCR and their expression levels were analyzed by reverse transcription PCR.  The first (F1 and second (F2 generation was produced by crossing the transgenic founder F0 and F1, respectively, with wild-type fish.  The results showed that the highest transient gene expression level was obtained from the mAct-D6 construct, followed respectively by EF1a-D6 and hCMV-D6 construct. The transmission rate of transgene into F1 generation was 4.2%-44.1%, and into F2 was followed the Mendellian segregation pattern.   Expression of transgene in F2 generation was varied between strains regarding as the mosaics of F0 fish.  Now, a transgenic system to study the modification of fatty acid biosynthesis pathways in fish was established.  Further investigations are to produce fish containing higher levels of EPA and DHA. Keywords: desaturase, nutraceutical fatty acid, transgenic, zebrafish, masu salmon   Abstrak Promoter merupakan regulator yang menentukan

  2. The F-Actin Binding Protein Cortactin Regulates the Dynamics of the Exocytotic Fusion Pore through its SH3 Domain

    Science.gov (United States)

    González-Jamett, Arlek M.; Guerra, María J.; Olivares, María J.; Haro-Acuña, Valentina; Baéz-Matus, Ximena; Vásquez-Navarrete, Jacqueline; Momboisse, Fanny; Martinez-Quiles, Narcisa; Cárdenas, Ana M.

    2017-01-01

    Upon cell stimulation, the network of cortical actin filaments is rearranged to facilitate the neurosecretory process. This actin rearrangement includes both disruption of the preexisting actin network and de novo actin polymerization. However, the mechanism by which a Ca2+ signal elicits the formation of new actin filaments remains uncertain. Cortactin, an actin-binding protein that promotes actin polymerization in synergy with the nucleation promoting factor N-WASP, could play a key role in this mechanism. We addressed this hypothesis by analyzing de novo actin polymerization and exocytosis in bovine adrenal chromaffin cells expressing different cortactin or N-WASP domains, or cortactin mutants that fail to interact with proline-rich domain (PRD)-containing proteins, including N-WASP, or to be phosphorylated by Ca2+-dependent kinases, such as ERK1/2 and Src. Our results show that the activation of nicotinic receptors in chromaffin cells promotes cortactin translocation to the cell cortex, where it colocalizes with actin filaments. We further found that, in association with PRD-containing proteins, cortactin contributes to the Ca2+-dependent formation of F-actin, and regulates fusion pore dynamics and the number of exocytotic events induced by activation of nicotinic receptors. However, whereas the actions of cortactin on the fusion pore dynamics seems to depend on the availability of monomeric actin and its phosphorylation by ERK1/2 and Src kinases, cortactin regulates the extent of exocytosis by a mechanism independent of actin polymerization. Together our findings point out a role for cortactin as a critical modulator of actin filament formation and exocytosis in neuroendocrine cells. PMID:28522963

  3. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  4. Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

    Energy Technology Data Exchange (ETDEWEB)

    Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others

    1994-09-01

    The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

  5. Bacterial Actins? An Evolutionary Perspective

    Science.gov (United States)

    Doolittle, Russell F.; York, Amanda L.

    2003-01-01

    According to the conventional wisdom, the existence of a cytoskeleton in eukaryotes and its absence in prokaryotes constitute a fundamental divide between the two domains of life. An integral part of the dogma is that a cytoskeleton enabled an early eukaryote to feed upon prokaryotes, a consequence of which was the occasional endosymbiosis and the eventual evolution of organelles. Two recent papers present compelling evidence that actin, one of the principal components of a cytoskeleton, has a homolog in Bacteria that behaves in many ways like eukaryotic actin. Sequence comparisons reveml that eukaryotic actin and the bacterial homolog (mreB protein), unlike many other proteins common to eukaryotes and Bacteria, have very different and more highly extended evolutionary histories.

  6. Promoter characterization and genomic organization of the human X11β gene APBA2.

    LENUS (Irish Health Repository)

    Hao, Yan

    2012-02-15

    Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.

  7. Actin depolymerization enhances adipogenic differentiation in human stromal stem cells.

    Science.gov (United States)

    Chen, Li; Hu, Huimin; Qiu, Weimin; Shi, Kaikai; Kassem, Moustapha

    2018-05-01

    Human stromal stem cells (hMSCs) differentiate into adipocytes that play a role in skeletal tissue homeostasis and whole body energy metabolism. During adipocyte differentiation, hMSCs exhibit significant changes in cell morphology suggesting changes in cytoskeletal organization. Here, we examined the effect of direct modulation of actin microfilament dynamics on adipocyte differentiation. Stabilizing actin filaments in hMSCs by siRNA-mediated knock down of the two main actin depolymerizing factors (ADFs): Cofilin 1 (CFL1) and Destrin (DSTN) or treating the cells by Phalloidin reduced adipocyte differentiation as evidenced by decreased number of mature adipocytes and decreased adipocyte specific gene expression (ADIPOQ, LPL, PPARG, FABP4). In contrast, disruption of actin cytoskeleton by Cytochalasin D enhanced adipocyte differentiation. Follow up studies revealed that the effects of CFL1 on adipocyte differentiation depended on the activity of LIM domain kinase 1 (LIMK1) which is the major upstream kinase of CFL1. Inhibiting LIMK by its specific chemical inhibitor LIMKi inhibited the phosphorylation of CFL1 and actin polymerization, and enhanced the adipocyte differentiation. Moreover, treating hMSCs by Cytochalasin D inhibited ERK and Smad2 signaling and this was associated with enhanced adipocyte differentiation. On the other hand, Phalloidin enhanced ERK and Smad2 signaling, but inhibited adipocyte differentiation which was rescued by ERK specific chemical inhibitor U0126. Our data provide a link between restructuring of hMSCs cytoskeleton and hMSCs lineage commitment and differentiation. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. COX-2 gene expression in colon cancer tissue related to regulating factors and promoter methylation status

    International Nuclear Information System (INIS)

    Asting, Annika Gustafsson; Carén, Helena; Andersson, Marianne; Lönnroth, Christina; Lagerstedt, Kristina; Lundholm, Kent

    2011-01-01

    Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4) showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3) were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue

  9. COX-2 gene expression in colon cancer tissue related to regulating factors and promoter methylation status

    Directory of Open Access Journals (Sweden)

    Lagerstedt Kristina

    2011-06-01

    Full Text Available Abstract Background Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Method Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Results Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4 showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3 were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Conclusions Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue.

  10. Specific expression of bioluminescence reporter gene in cardiomyocyte regulated by tissue specific promoter

    Energy Technology Data Exchange (ETDEWEB)

    Nguyen, Vu Hong; Tae, Seong Ho; Le, Nguyen Uyen Chi; Min, Jung Joon [Chonnam National University Medical School, Gwangju (Korea, Republic of)

    2007-07-01

    As the human heart is not capable of regenerating the great numbers of cardiac cells that are lost after myocardial infarction, impaired cardiac function is the inevitable result of ischemic disease. Recently, human embryonic stem cells (hESCs) have gained popularity as a potentially ideal cell candidate for tissue regeneration. In particular, hESCs are capable of cardiac lineage-specific differentiation and confer improvement of cardiac function following transplantation into animal models. Although such data are encouraging, the specific strategy for in vivo and non-invasive detection of differentiated cardiac lineage is still limited. Therefore, in the present study, we established the gene construction in which the optical reporter gene Firefly luciferase was controlled by Myosin Heavy Chain promoter for specific expressing in heart cells. The vector consisting of - MHC promoter and a firefly luciferase coding sequence flanked by full-length bovine growth hormone (BGH) 3'-polyadenylation sequence based on pcDNA3.1- vector backbone. To test the specific transcription of this promoter in g of MHC-Fluc or CMV-Flue (for control) plasmid DNA in myocardial tissue, 20 phosphate-buffered saline was directly injected into mouse myocardium through a midline sternotomy and liver. After 1 week of injection, MHC-Fluc expression was detected from heart region which was observed under cooled CCD camera of in vivo imaging system but not from liver. In control group injected with CMV-Flue, the bioluminescence was detected from all these organs. The expression of Flue under control of Myosin Heavy Chain promoter may become a suitable optical reporter gene for stem cell-derived cardiac lineage differentiation study.

  11. Association of a Human FABP1 Gene Promoter Region Polymorphism with Altered Serum Triglyceride Levels.

    Directory of Open Access Journals (Sweden)

    Xian-E Peng

    Full Text Available Liver fatty acid-binding protein (L-FABP, also known as fatty acid-binding protein 1 (FABP1, is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182 from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032.Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05. The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01. In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003, while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014. Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans.

  12. Plutella xylostella granulovirus late gene promoter activity in the context of the Autographa californica multiple nucleopolyhedrovirus genome.

    Science.gov (United States)

    Ren, He-Lin; Hu, Yuan; Guo, Ya-Jun; Li, Lu-Lin

    2016-06-01

    Within Baculoviridae, little is known about the molecular mechanisms of replication in betabaculoviruses, despite extensive studies in alphabaculoviruses. In this study, the promoters of nine late genes of the betabaculovirus Plutella xylostella granulovirus (PlxyGV) were cloned into a transient expression vector and the alphabaculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) genome, and compared with homologous late gene promoters of AcMNPV in Sf9 cells. In transient expression assays, all PlxyGV late promoters were activated in cells transfected with the individual reporter plasmids together with an AcMNPV bacmid. In infected cells, reporter gene expression levels with the promoters of PlxyGV e18 and AcMNPV vp39 and gp41 were significantly higher than those of the corresponding AcMNPV or PlxyGV promoters, which had fewer late promoter motifs. Observed expression levels were lower for the PlxyGV p6.9, pk1, gran, p10a, and p10b promoters than for the corresponding AcMNPV promoters, despite equal numbers of late promoter motifs, indicating that species-specific elements contained in some late promoters were favored by the native viral RNA polymerases for optimal transcription. The 8-nt sequence TAAATAAG encompassing the ATAAG motif was conserved in the AcMNPV polh, p10, and pk1 promoters. The 5-nt sequence CAATT located 4 or 5 nt upstream of the T/ATAAG motif was conserved in the promoters of PlxyGV gran, p10c, and pk1. The results of this study demonstrated that PlxyGV late gene promoters could be effectively activated by the RNA polymerase from AcMNPV, implying that late gene expression systems are regulated by similar mechanisms in alphabaculoviruses and betabaculoviruses.

  13. Dendritic Actin Cytoskeleton: Structure, Functions, and Regulations

    Directory of Open Access Journals (Sweden)

    Anja Konietzny

    2017-05-01

    Full Text Available Actin is a versatile and ubiquitous cytoskeletal protein that plays a major role in both the establishment and the maintenance of neuronal polarity. For a long time, the most prominent roles that were attributed to actin in neurons were the movement of growth cones, polarized cargo sorting at the axon initial segment, and the dynamic plasticity of dendritic spines, since those compartments contain large accumulations of actin filaments (F-actin that can be readily visualized using electron- and fluorescence microscopy. With the development of super-resolution microscopy in the past few years, previously unknown structures of the actin cytoskeleton have been uncovered: a periodic lattice consisting of actin and spectrin seems to pervade not only the whole axon, but also dendrites and even the necks of dendritic spines. Apart from that striking feature, patches of F-actin and deep actin filament bundles have been described along the lengths of neurites. So far, research has been focused on the specific roles of actin in the axon, while it is becoming more and more apparent that in the dendrite, actin is not only confined to dendritic spines, but serves many additional and important functions. In this review, we focus on recent developments regarding the role of actin in dendrite morphology, the regulation of actin dynamics by internal and external factors, and the role of F-actin in dendritic protein trafficking.

  14. Integration of molecular biology tools for identifying promoters and genes abundantly expressed in flowers of Oncidium Gower Ramsey

    Directory of Open Access Journals (Sweden)

    Tung Shu-Yun

    2011-04-01

    Full Text Available Abstract Background Orchids comprise one of the largest families of flowering plants and generate commercially important flowers. However, model plants, such as Arabidopsis thaliana do not contain all plant genes, and agronomic and horticulturally important genera and species must be individually studied. Results Several molecular biology tools were used to isolate flower-specific gene promoters from Oncidium 'Gower Ramsey' (Onc. GR. A cDNA library of reproductive tissues was used to construct a microarray in order to compare gene expression in flowers and leaves. Five genes were highly expressed in flower tissues, and the subcellular locations of the corresponding proteins were identified using lip transient transformation with fluorescent protein-fusion constructs. BAC clones of the 5 genes, together with 7 previously published flower- and reproductive growth-specific genes in Onc. GR, were identified for cloning of their promoter regions. Interestingly, 3 of the 5 novel flower-abundant genes were putative trypsin inhibitor (TI genes (OnTI1, OnTI2 and OnTI3, which were tandemly duplicated in the same BAC clone. Their promoters were identified using transient GUS reporter gene transformation and stable A. thaliana transformation analyses. Conclusions By combining cDNA microarray, BAC library, and bombardment assay techniques, we successfully identified flower-directed orchid genes and promoters.

  15. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  16. Distinguishing the Transcription Regulation Patterns in Promoters of Human Genes with Different Function or Evolutionary Age

    KAUST Repository

    Alam, Tanvir

    2012-07-01

    Distinguishing transcription regulatory patterns of different gene groups is a common problem in various bioinformatics studies. In this work we developed a methodology to deal with such a problem based on machine learning techniques. We applied our method to two biologically important problems related to detecting a difference in transcription regulation of: a/ protein-coding and long non-coding RNAs (lncRNAs) in human, as well as b/ a difference between primate-specific and non-primate-specific long non-coding RNAs. Our method is capable to classify RNAs using various regulatory features of genes that transcribe into these RNAs, such as nucleotide frequencies, transcription factor binding sites, de novo sequence motifs, CpG islands, repetitive elements, histone modification marks, and others. Ten-fold cross-validation tests suggest that our model can distinguish protein-coding and non-coding RNAs with accuracy above 80%. Twenty-fold cross-validation tests suggest that our model can distinguish primate-specific from non-primate-specific promoters of lncRNAs with accuracy above 80%. Consequently, we can hypothesize that transcription of the groups of genes mentioned above are regulated by different mechanisms. Feature selection techniques allowed us to reduce the number of features significantly while keeping the accuracy around 80%. Consequently, we can conclude that selected features play significant role in transcription regulation of coding and non-coding genes, as well as primate-specific and non-primate-specific lncRNA genes.

  17. Aquilegia B gene homologs promote petaloidy of the sepals and maintenance of the C domain boundary

    Directory of Open Access Journals (Sweden)

    Bharti Sharma

    2017-11-01

    Full Text Available Abstract The model Aquilegia coerulea x “Origami” possesses several interesting floral features, including petaloid sepals that are morphologically distinct from the true petals and a broad domain containing many whorls of stamens. We undertook the current study in an effort to understand the former trait, but additionally uncovered data that inform on the latter. The Aquilegia B gene homolog AqPI is shown to contribute to the production of anthocyanin in the first whorl sepals, although it has no major role in their morphology. Surprisingly, knockdown of AqPI in Aquilegia coerulea x “Origami” also reveals a role for the B class genes in maintaining the expression of the C gene homolog AqAG1 in the outer whorls of stamens. These findings suggest that the transference of pollinator function to the first whorl sepals included a non-homeotic recruitment of the B class genes to promote aspects of petaloidy. They also confirm results in several other Ranunculales that have revealed an unexpected regulatory connection between the B and C class genes.

  18. Functional evolution in the plant SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL gene family

    Directory of Open Access Journals (Sweden)

    Jill Christine Preston

    2013-04-01

    Full Text Available The SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL family of transcription factors is functionally diverse, controlling a number of fundamental aspects of plant growth and development, including vegetative phase change, flowering time, branching, and leaf initiation rate. In natural plant populations, variation in flowering time and shoot architecture have major consequences for fitness. Likewise, in crop species, variation in branching and developmental rate impact biomass and yield. Thus, studies aimed at dissecting how the various functions are partitioned among different SPL genes in diverse plant lineages are key to providing insight into the genetic basis of local adaptation and have already garnered attention by crop breeders. Here we use phylogenetic reconstruction to reveal nine major SPL gene lineages, each of which is described in terms of function and diversification. To assess evidence for ancestral and derived functions within each SPL gene lineage, we use ancestral character state reconstructions. Our analyses suggest an emerging pattern of sub-functionalization, neo-functionalization, and possible convergent evolution following both ancient and recent gene duplication. Based on these analyses we suggest future avenues of research that may prove fruitful for elucidating the importance of SPL gene evolution in plant growth and development.

  19. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  20. Hypermethylation of gene promoters in peripheral blood leukocytes in humans long term after radiation exposure

    Energy Technology Data Exchange (ETDEWEB)

    Kuzmina, Nina S., E-mail: nin-kuzmin@youndex.ru; Lapteva, Nellya Sh.; Rubanovich, Alexander V.

    2016-04-15

    Some human genes known to undergo age-related promoter hypermethylation. These epigenetic modifications are similar to those occurring in the course of certain diseases, e.g. some types of cancer, which in turn may also associate with age. Given external genotoxic factors may additionally contribute to hypermethylation, this study was designed to analyzes, using methylation-sensitive polymerase chain reaction (PCR), the CpG island hypermethylation in RASSF1A, CDKN2A (including p16/INK4A and p14/ARF) and GSTP1 promoters in peripheral blood leukocytes of individuals exposed to ionizing radiation long time ago. One hundred and twenty-four irradiated subjects (24–77 years old at sampling: 83 Chernobyl Nuclear Power Plant clean-up workers, 21 nuclear workers, 20 residents of territories with radioactive contamination) and 208 unirradiated volunteers (19–77 years old at sampling) were enrolled. In addition, 74 non-exposed offspring (2–51 years old at sampling) born to irradiated parents were examined. The frequency of individuals displaying promoter methylation of at least one gene in exposed group was significantly higher as compared to the control group (OR=5.44, 95% CI=2.62–11.76, p=3.9×10{sup −7}). No significant difference was found between the frequency of subjects with the revealed promoter methylation in the group of offspring born to irradiated parents and in the control group. The increase in the number of methylated loci of RASSF1A and p14/ARF was associated with age (β=0.242; p=1.7×10{sup −5}). In contrast, hypermethylation of p16/INK4A and GSTP1 genes correlated with the fact of radiation exposure only (β=0.290; p=1.7×10{sup −7}). The latter finding demonstrates that methylation changes in blood leukocytes of healthy subjects exposed to radiation resemble those reported in human malignancies. Additional studies are required to identify the dose-response of epigenetic markers specifically associating with radiation-induced premature aging

  1. Hypermethylation of gene promoters in peripheral blood leukocytes in humans long term after radiation exposure

    International Nuclear Information System (INIS)

    Kuzmina, Nina S.; Lapteva, Nellya Sh.; Rubanovich, Alexander V.

    2016-01-01

    Some human genes known to undergo age-related promoter hypermethylation. These epigenetic modifications are similar to those occurring in the course of certain diseases, e.g. some types of cancer, which in turn may also associate with age. Given external genotoxic factors may additionally contribute to hypermethylation, this study was designed to analyzes, using methylation-sensitive polymerase chain reaction (PCR), the CpG island hypermethylation in RASSF1A, CDKN2A (including p16/INK4A and p14/ARF) and GSTP1 promoters in peripheral blood leukocytes of individuals exposed to ionizing radiation long time ago. One hundred and twenty-four irradiated subjects (24–77 years old at sampling: 83 Chernobyl Nuclear Power Plant clean-up workers, 21 nuclear workers, 20 residents of territories with radioactive contamination) and 208 unirradiated volunteers (19–77 years old at sampling) were enrolled. In addition, 74 non-exposed offspring (2–51 years old at sampling) born to irradiated parents were examined. The frequency of individuals displaying promoter methylation of at least one gene in exposed group was significantly higher as compared to the control group (OR=5.44, 95% CI=2.62–11.76, p=3.9×10 −7 ). No significant difference was found between the frequency of subjects with the revealed promoter methylation in the group of offspring born to irradiated parents and in the control group. The increase in the number of methylated loci of RASSF1A and p14/ARF was associated with age (β=0.242; p=1.7×10 −5 ). In contrast, hypermethylation of p16/INK4A and GSTP1 genes correlated with the fact of radiation exposure only (β=0.290; p=1.7×10 −7 ). The latter finding demonstrates that methylation changes in blood leukocytes of healthy subjects exposed to radiation resemble those reported in human malignancies. Additional studies are required to identify the dose-response of epigenetic markers specifically associating with radiation-induced premature aging and/or with

  2. Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

    Science.gov (United States)

    Butler, Nathaniel M; Hannapel, David J

    2012-12-01

    Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

  3. Transcriptional factor DLX3 promotes the gene expression of enamel matrix proteins during amelogenesis.

    Directory of Open Access Journals (Sweden)

    Zhichun Zhang

    Full Text Available Mutation of distal-less homeobox 3 (DLX3 is responsible for human tricho-dento-osseous syndrome (TDO with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.

  4. Glucose metabolism in pigs expressing human genes under an insulin promoter.

    Science.gov (United States)

    Wijkstrom, Martin; Bottino, Rita; Iwase, Hayoto; Hara, Hidetaka; Ekser, Burcin; van der Windt, Dirk; Long, Cassandra; Toledo, Frederico G S; Phelps, Carol J; Trucco, Massimo; Cooper, David K C; Ayares, David

    2015-01-01

    Xenotransplantation of porcine islets can reverse diabetes in non-human primates. The remaining hurdles for clinical application include safe and effective T-cell-directed immunosuppression, but protection against the innate immune system and coagulation dysfunction may be more difficult to achieve. Islet-targeted genetic manipulation of islet-source pigs represents a powerful tool to protect against graft loss. However, whether these genetic alterations would impair islet function is unknown. On a background of α1,3-galactosyltransferase gene-knockout (GTKO)/human (h)CD46, additional genes (hCD39, human tissue factor pathway inhibitor, porcine CTLA4-Ig) were inserted in different combinations under an insulin promoter to promote expression in islets (confirmed by immunofluorescence). Seven pigs were tested for baseline and glucose/arginine-challenged levels of glucose, insulin, C-peptide, and glucagon. This preliminary study did not show definite evidence of β-cell deficiencies, even when three transgenes were expressed under the insulin promoter. Of seven animals, all were normoglycemic at fasting, and five of seven had normal glucose disposal rates after challenge. All animals exhibited insulin, C-peptide, and glucagon responses to both glucose and arginine challenge; however, significant interindividual variation was observed. Multiple islet-targeted transgenic expression was not associated with an overtly detrimental effect on islet function, suggesting that complex genetic constructs designed for islet protection warrants further testing in islet xenotransplantation models. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Association of the Resistin Gene Promoter Region Polymorphism with Kawasaki Disease in Chinese Children

    Directory of Open Access Journals (Sweden)

    Ruixi Liu

    2012-01-01

    Full Text Available Objectives. The −420C>G polymorphism located in the resistin gene (RETN promoter has recently been suggested to play a potential role in proinflammatory conditions and cardiovascular disease. This study investigated the association of the RETN promoter polymorphism with Kawasaki disease (KD and its clinical parameters in Chinese children. Methods. We compared patients with complete KD to incomplete KD children. Genotyping of the RETN promoter polymorphism was performed using MassARRAY system, and serum resistin levels were estimated using the sandwich enzyme immunoassay method. Results. There was no significant difference in RETN (−420C>G genotypes between KD and control groups. However, the frequency of the G allele was higher in iKD patients than in cKD children due to a significantly increased frequency of the GG genotypes. Serum levels of resistin were significantly higher in KD patients than in controls regardless of the presence of coronary artery lesions (CALs. Conclusion. The present findings suggest that while resistin may play a role in the pathogenesis of KD, there is no apparent association between CAL and the RETN (−420C>G gene polymorphism in KD children. However, the diagnosis of iKD is challenging but can be supported by the presence of the G allele and the GG genotypes.

  6. ADAM33 gene silencing by promoter hypermethylation as a molecular marker in breast invasive lobular carcinoma

    Directory of Open Access Journals (Sweden)

    de Souza Emanuel M

    2009-03-01

    Full Text Available Abstract Background ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. Methods First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP. Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. Results The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM; tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC was 76.2% compared with 25.5% in invasive ductal carcinoma

  7. ADAM33 gene silencing by promoter hypermethylation as a molecular marker in breast invasive lobular carcinoma

    International Nuclear Information System (INIS)

    Seniski, Gerusa G; Zanata, Silvio M; Costa, Fabrício F; Klassen, Giseli; Camargo, Anamaria A; Ierardi, Daniela F; Ramos, Edneia AS; Grochoski, Mariana; Ribeiro, Enilze SF; Cavalli, Iglenir J; Pedrosa, Fabio O; Souza, Emanuel M de

    2009-01-01

    ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR) treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP). Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR) demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM); tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC) was 76.2% compared with 25.5% in invasive ductal carcinoma (IDC), and this difference was

  8. The role of ghrelin and ghrelin-receptor gene variants and promoter activity in type 2 diabetes.

    Science.gov (United States)

    Garcia, Edwin A; King, Peter; Sidhu, Kally; Ohgusu, Hideko; Walley, Andrew; Lecoeur, Cecile; Gueorguiev, Maria; Khalaf, Sahira; Davies, Derek; Grossman, Ashley B; Kojima, Masayasu; Petersenn, Stephan; Froguel, Phillipe; Korbonits, Márta

    2009-08-01

    Ghrelin and its receptor play an important role in glucose metabolism and energy homeostasis, and therefore they are functional candidates for genes carrying susceptibility alleles for type 2 diabetes. We assessed common genetic variation of the ghrelin (GHRL; five single nucleotide polymorphisms (SNP)) and the ghrelin-receptor (GHSR) genes (four SNPs) in 610 Caucasian patients with type 2 diabetes and 820 controls. In addition, promoter reporter assays were conducted to model the regulatory regions of both genes. Neither GHRL nor GHSR gene SNPs were associated with type 2 diabetes. One of the ghrelin haplotypes showed a marginal protective role in type 2 diabetes. We observed profound differences in the regulation of the GHRL gene according to promoter sequence variants. There are three different GHRL promoter haplotypes represented in the studied cohort causing up to 45% difference in the level of gene expression, while the promoter region of GHSR gene is primarily represented by a single haplotype. The GHRL and GHSR gene variants are not associated with type 2 diabetes, although GHRL promoter variants have significantly different activities.

  9. Relationship of interleukin-1B gene promoter region polymorphism with Helicobacter pylori infection and gastritis.

    Science.gov (United States)

    Ramis, Ivy Bastos; Vianna, Júlia Silveira; Halicki, Priscila Cristina Bartolomeu; Lara, Caroline; Tadiotto, Thássia Fernanda; da Silva Maciel, João Batista; Gonçalves, Carla Vitola; von Groll, Andrea; Dellagostin, Odir Antônio; da Silva, Pedro Eduardo Almeida

    2015-09-29

    Helicobacter pylori infection is associated with gastritis, peptic ulcer disease and gastric carcinoma. The severity of damage is determined by the interplay between environmental/behavioral factors, bacterial pathogenicity genes and host genetic polymorphisms that can influence the secretion levels of inflammatory cytokines. Accordingly, this study aimed to identify polymorphisms in the IL-1B and IL-1RN genes and their associations with H. pylori infection, cagA gene of H. pylori, and gastroduodenal diseases. Gastric biopsy samples from 151 patients infected with H. pylori and 76 uninfected individuals were analyzed. H. pylori infection was diagnosed by histology and PCR. Polymorphisms at positions -511, -31 and +3954 of the IL-1B gene were detected by PCR-RFLP, and an analysis of the VNTR polymorphism of the IL-1RN gene was performed by PCR. It was observed that the presence of the T/T genotype at position -511 and the C/C genotype at position -31 were associated with H. pylori infection and with an increased risk of gastritis in H. pylori-positive patients. Additionally, strains from patients H. pylori-positive carrying the cagA gene was significantly related with the T/T genotype at position -511 of IL-1B.  No association of polymorphisms at position +3954 of IL-1B and in the IL-1RN with H. pylori infection and with risk of severe gastric diseases was found. We demonstrated that polymorphisms in the promoter region of the IL-1B gene (at positions -511 and -31) are associated with an enhanced risk of H. pylori infection as well as gastritis in H. pylori-positive patients.

  10. Variants in the dopamine-4-receptor gene promoter are not associated with sensation seeking in skiers.

    Directory of Open Access Journals (Sweden)

    Cynthia J Thomson

    Full Text Available Sensation seeking is a personality trait that has been associated with disinhibited behaviours including substance use and gambling, but also with high-risk sport practices including skydiving, paragliding, and downhill skiing. Twin studies have shown that sensation seeking is moderately heritable, and candidate genes encoding components involved in dopaminergic transmission have been investigated as contributing to this type of behaviour. To determine whether variants in the regulatory regions of the dopamine-4-receptor gene (DRD4 influenced sport-specific sensation seeking, we analyzed five polymorphisms (-1106T/C, -906T/C, -809G/A, -291C/T, 120-bp duplication in the promoter region of the gene in a cohort of skiers and snowboarders (n = 599 that represented a broad range of sensation seeking behaviours. We grouped subjects by genotype at each of the five loci and compared impulsive sensation seeking and domain-specific (skiing sensation seeking between groups. There were no significant associations between genotype(s and general or domain-specific sensation seeking in the skiers and snowboarders, suggesting that while DRD4 has previously been implicated in sensation seeking, the promoter variants investigated in this study do not contribute to sensation seeking in this athlete population.

  11. Variants in the dopamine-4-receptor gene promoter are not associated with sensation seeking in skiers.

    Science.gov (United States)

    Thomson, Cynthia J; Rajala, Amelia K; Carlson, Scott R; Rupert, Jim L

    2014-01-01

    Sensation seeking is a personality trait that has been associated with disinhibited behaviours including substance use and gambling, but also with high-risk sport practices including skydiving, paragliding, and downhill skiing. Twin studies have shown that sensation seeking is moderately heritable, and candidate genes encoding components involved in dopaminergic transmission have been investigated as contributing to this type of behaviour. To determine whether variants in the regulatory regions of the dopamine-4-receptor gene (DRD4) influenced sport-specific sensation seeking, we analyzed five polymorphisms (-1106T/C, -906T/C, -809G/A, -291C/T, 120-bp duplication) in the promoter region of the gene in a cohort of skiers and snowboarders (n = 599) that represented a broad range of sensation seeking behaviours. We grouped subjects by genotype at each of the five loci and compared impulsive sensation seeking and domain-specific (skiing) sensation seeking between groups. There were no significant associations between genotype(s) and general or domain-specific sensation seeking in the skiers and snowboarders, suggesting that while DRD4 has previously been implicated in sensation seeking, the promoter variants investigated in this study do not contribute to sensation seeking in this athlete population.

  12. Identification and functional characterisation of the promoter of the calcium sensor gene CBL1 from the xerophyte Ammopiptanthus mongolicus

    Directory of Open Access Journals (Sweden)

    Yin Weilun

    2010-01-01

    Full Text Available Abstract Background CBL1 is a calcium sensor that regulates drought, cold and salt signals in Arabidopsis. Overexpression of CBL1 gene in Arabidopsis and in Ammopiptanthus mongolicus showed different tolerant activities. We are interested in understanding the molecular mechanism of the upstream region of the CBL1 gene of A. mongolicus (AmCBL1. We investigated and characterized the promoter of the AmCBL1 gene, for promoters play a very important role in regulating gene expression in eukaryotes. Results A 1683-bp 5' flanking region was isolated from A. mongolicus. The sequence was identified as AmCBL1 promoter. Analysis of the promoter sequence indicated a 690-bp intron and some basic cis-acting elements were related to various environmental stresses and plant hormones. To identify the functional region of the AmCBL1 promoter, five plant expression vectors fused with the GUS (β-glucuronidase gene, driven by series deleted fragments of AmCBL1 promoter at different lengths from -1659, -1414, -1048, -296 to -167 bp relative to the transcriptional start site were constructed and transformed into Nicotiana tabacum L. cv. 89. Functional properties of each promoter segment were examined by GUS staining and fluorescence quantitative analyses using at least three single-copy PCR-positive plants of transgenic tobacco, treated with various environmental stresses and plant hormones for different times. We demonstrated that the AmCBL1 promoter was a vascular-specific and multiple-stress-inducible promoter. Our results further imply that the promoter fragment B1S3 possessed sufficient essential cis-acting elements, accounting for vascular-specific and stress-induced expression patterns. It may also indicate that for response to some stresses certain cis-elements are required in tissues outside the region of the B1S3 construct. Conclusions To help resolve uncertainties about the upstream regulatory mechanism of the CBL1 gene in desert plants, we suggest that

  13. Actin and Endocytosis in Budding Yeast

    Science.gov (United States)

    Goode, Bruce L.; Eskin, Julian A.; Wendland, Beverly

    2015-01-01

    Endocytosis, the process whereby the plasma membrane invaginates to form vesicles, is essential for bringing many substances into the cell and for membrane turnover. The mechanism driving clathrin-mediated endocytosis (CME) involves > 50 different protein components assembling at a single location on the plasma membrane in a temporally ordered and hierarchal pathway. These proteins perform precisely choreographed steps that promote receptor recognition and clustering, membrane remodeling, and force-generating actin-filament assembly and turnover to drive membrane invagination and vesicle scission. Many critical aspects of the CME mechanism are conserved from yeast to mammals and were first elucidated in yeast, demonstrating that it is a powerful system for studying endocytosis. In this review, we describe our current mechanistic understanding of each step in the process of yeast CME, and the essential roles played by actin polymerization at these sites, while providing a historical perspective of how the landscape has changed since the preceding version of the YeastBook was published 17 years ago (1997). Finally, we discuss the key unresolved issues and where future studies might be headed. PMID:25657349

  14. Geometrical Determinants of Neuronal Actin Waves

    OpenAIRE

    Tomba, Caterina; Bra?ni, C?line; Bugnicourt, Ghislain; Cohen, Floriane; Friedrich, Benjamin M.; Gov, Nir S.; Villard, Catherine

    2017-01-01

    Hippocampal neurons produce in their early stages of growth propagative, actin-rich dynamical structures called actin waves. The directional motion of actin waves from the soma to the tip of neuronal extensions has been associated with net forward growth, and ultimately with the specification of neurites into axon and dendrites. Here, geometrical cues are used to control actin wave dynamics by constraining neurons on adhesive stripes of various widths. A key observable, the average time betwe...

  15. Case for diagnosis. Actinic prurigo.

    Science.gov (United States)

    Daldon, Patricia Erica Christofoletti; Pascini, Mirella; Correa, Mariane

    2010-01-01

    A 13-year-old black boy had pruritic papular and nodular lesions on his forearms associated to edema of the lower lip, photophobia, conjunctivitis and pterygium. Skin biopsy of the lower lip revealed acanthosis, spongiosis with dermal perivascular mononuclear cell infiltration composed by lymphocytes, plasma cells and eosinophils consistent with actinic prurigo. Lesions improved considerably with the use of thalidomide 100mg/ day.

  16. Characterization and functional analyses of the human G protein-coupled receptor kinase 4 gene promoter.

    Science.gov (United States)

    Hasenkamp, Sandra; Telgmann, Ralph; Staessen, Jan A; Hagedorn, Claudia; Dördelmann, Corinna; Bek, Martin; Brand-Herrmann, Stefan-Martin; Brand, Eva

    2008-10-01

    The G protein-coupled receptor kinase 4 is involved in renal sodium handling and blood pressure regulation. Missense variants have already been tested functionally and are associated with hypertension, but no data on promoter analyses are yet available. We scanned 94 hypertensive white subjects for genetic variation and performed promoter reporter gene analyses in HEK293T, COS7, and SaOs-2 cells. Transient transfections with various full lengths and wild-type deletion constructs revealed that 1851 bp of the flanking region and 275 bp of the 5'-untranslated region were sufficient for transcriptional activities and composed a powerful cis-active element in the distal 293 bp. The -1702T and +2T alleles resulted in drastic general reductions of promoter function, whereas an activity increasing effect of +268C was cell type specific. Electrophoretic mobility-shift assay, supershift, and cotransfection analyses of transcription factor binding sites predicted in silico (Alibaba2.1/Transfac7) resulted in allele-specific binding patterns of nuclear proteins and identified the participation of CCAAT/enhancer-binding protein transcription factor family members. The G protein-coupled receptor kinase 4 core promoter resides in the first 1851 bp upstream of its transcription start site. The 4 identified genetic variants within this region exert allele-specific impact on both cell type- and stimulation-dependent transcription and may affect the expression balance of renal G protein-coupled receptor kinase 4.

  17. CypA, a gene downstream of HIF-1α, promotes the development of PDAC.

    Directory of Open Access Journals (Sweden)

    Huan Zhang

    Full Text Available Hypoxia-inducible factor-1α (HIF-1α is a highly important transcription factor involved in cell metabolism. HIF-1α promotes glycolysis and inhibits of mitochondrial respiration in pancreatic ductal adenocarcinoma (PDAC. In response to tumor hypoxia, cyclophilin A (CypA is over-expressed in various cancer types, and is associated with cell apoptosis, tumor invasion, metastasis, and chemoresistance in PDAC. In this study, we showed that both HIF-1α and CypA expression were significantly associated with lymph node metastasis and tumor stage. The expression of CypA was correlated with HIF-1α. Moreover, the mRNA and protein expression of CypA markedly decreased or increased following the suppression or over-expression of HIF-1α in vitro. Chromatin immunoprecipitation analysis showed that HIF-1α could directly bind to the hypoxia response element (HRE in the CypA promoter regions and regulated CypA expression. Consistent with other studies, HIF-1α and CypA promoted PDAC cell proliferation and invasion, and suppressed apoptosis in vitro. Furthermore, we proved the combination effect of 2-methoxyestradiol and cyclosporin A both in vitro and in vivo. These results suggested that,CypA, a gene downstream of HIF-1α, could promote the development of PDAC. Thus, CypA might serve as a potential therapeutic target for PDAC.

  18. Promoter Methylation and mRNA Expression of Response Gene to Complement 32 in Breast Carcinoma

    International Nuclear Information System (INIS)

    Nasab, E. E.; Nasab, E. E.; Hashemi, M.; Rafighdoost, F.

    2016-01-01

    Response gene to complement 32 (RGC32), induced by activation of complements, has been characterized as a cell cycle regulator; however, its role in carcinogenesis is still controversial. In the present study we compared RGC32 promoter methylation patterns and mRNA expression in breast cancerous tissues and adjacent normal tissues. Materials and Methods. Sixty-three breast cancer tissues and 63 adjacent non neoplastic tissues were included in our study. Design. Nested methylation-specific polymerase chain reaction (Nested-MSP) and quantitative PCR (qPCR) were used to determine RGC32 promoter methylation status and its mRNA expression levels, respectively. Results. RGC32 methylation pattern was not different between breast cancerous tissue and adjacent non neoplastic tissue (OR=2.30, 95% CI=0.95-5.54). However, qPCR analysis displayed higher levels of RGC32 mRNA in breast cancerous tissues than in noncancerous tissues (1.073 versus 0.959; P=0.001), irrespective of the promoter methylation status. The expression levels and promoter methylation of RGC32 were not correlated with any of patients’ clinical characteristics (P>0.05).

  19. Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.

    Science.gov (United States)

    Tencomnao, T; Yu, R K; Kapitonov, D

    2001-02-16

    UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.

  20. Inhibitory effect of Survivin promoter-regulated oncolytic adenovirus carrying P53 gene against gallbladder cancer.

    Science.gov (United States)

    Liu, Chen; Sun, Bin; An, Ni; Tan, Weifeng; Cao, Lu; Luo, Xiangji; Yu, Yong; Feng, Feiling; Li, Bin; Wu, Mengchao; Su, Changqing; Jiang, Xiaoqing

    2011-12-01

    Gene therapy has become an important strategy for treatment of malignancies, but problems remains concerning the low gene transferring efficiency, poor transgene expression and limited targeting specific tumors, which have greatly hampered the clinical application of tumor gene therapy. Gallbladder cancer is characterized by rapid progress, poor prognosis, and aberrantly high expression of Survivin. In the present study, we used a human tumor-specific Survivin promoter-regulated oncolytic adenovirus vector carrying P53 gene, whose anti-cancer effect has been widely confirmed, to construct a wide spectrum, specific, safe, effective gene-viral therapy system, AdSurp-P53. Examining expression of enhanced green fluorecent protein (EGFP), E1A and the target gene P53 in the oncolytic adenovirus system validated that Survivin promoter-regulated oncolytic adenovirus had high proliferation activity and high P53 expression in Survivin-positive gallbladder cancer cells. Our in vitro cytotoxicity experiment demonstrated that AdSurp-P53 possessed a stronger cytotoxic effect against gallbladder cancer cells and hepatic cancer cells. The survival rate of EH-GB1 cells was lower than 40% after infection of AdSurp-P53 at multiplicity of infection (MOI) = 1 pfu/cell, while the rate was higher than 90% after infection of Ad-P53 at the same MOI, demonstrating that AdSurp-P53 has a potent cytotoxicity against EH-GB1 cells. The tumor growth was greatly inhibited in nude mice bearing EH-GB1 xenografts when the total dose of AdSurp-P53 was 1 × 10(9) pfu, and terminal dUTP nick end-labeling (TUNEL) revealed that the apoptotic rate of cancer cells was (33.4 ± 8.4)%. This oncolytic adenovirus system overcomes the long-standing shortcomings of gene therapy: poor transgene expression and targeting of only specific tumors, with its therapeutic effect better than the traditional Ad-P53 therapy regimen already on market; our system might be used for patients with advanced gallbladder cancer and

  1. Gene promoter methylation and DNA repair capacity in monozygotic twins with discordant smoking habits.

    Science.gov (United States)

    Ottini, Laura; Rizzolo, Piera; Siniscalchi, Ester; Zijno, Andrea; Silvestri, Valentina; Crebelli, Riccardo; Marcon, Francesca

    2015-02-01

    The influence of DNA repair capacity, plasma nutrients and tobacco smoke exposure on DNA methylation was investigated in blood cells of twenty-one couples of monozygotic twins with discordant smoking habits. All study subjects had previously been characterized for mutagen sensitivity with challenge assays with ionizing radiation in peripheral blood lymphocytes. Plasma levels of folic acid, vitamin B12 and homocysteine were also available from a previous investigation. In this work DNA methylation in the promoter region of a panel of ten genes involved in cell cycle control, differentiation, apoptosis and DNA repair (p16, FHIT, RAR, CDH1, DAPK1, hTERT, RASSF1A, MGMT, BRCA1 and PALB2) was assessed in the same batches of cells isolated for previous studies, using the methylation-sensitive high-resolution melting technique. Fairly similar profiles of gene promoter methylation were observed within co-twins compared to unrelated subjects (p= 1.23 × 10(-7)), with no significant difference related to smoking habits (p = 0.23). In a regression analysis the methylation index of study subjects, used as synthetic descriptor of overall promoter methylation, displayed a significant inverse correlation with radiation-induced micronuclei (p = 0.021) and plasma folic acid level (p = 0.007) both in smokers and in non-smokers. The observed association between repair of radiation-induced DNA damage and promoter methylation suggests the involvement of the DNA repair machinery in DNA modification. Data also highlight the possible modulating effect of folate deficiency on DNA methylation and the strong influence of familiarity on the individual epigenetic profile. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Quantitative global and gene-specific promoter methylation in relation to biological properties of neuroblastomas

    Directory of Open Access Journals (Sweden)

    Kiss Nimrod B

    2012-09-01

    Full Text Available Abstract Background In this study we aimed to quantify tumor suppressor gene (TSG promoter methylation densities levels in primary neuroblastoma tumors and cell lines. A subset of these TSGs is associated with a CpG island methylator phenotype (CIMP in other tumor types. Methods The study panel consisted of 38 primary tumors, 7 established cell lines and 4 healthy references. Promoter methylation was determined by bisulphate Pyrosequencing for 14 TSGs; and LINE-1 repeat element methylation was used as an indicator of global methylation levels. Results Overall mean TSG Z-scores were significantly increased in cases with adverse outcome, but were unrelated to global LINE-1 methylation. CIMP with hypermethylation of three or more gene promoters was observed in 6/38 tumors and 7/7 cell lines. Hypermethylation of one or more TSG (comprising TSGs BLU, CASP8, DCR2, CDH1, RASSF1A and RASSF2 was evident in 30/38 tumors. By contrast only very low levels of promoter methylation were recorded for APC, DAPK1, NORE1A, P14, P16, TP73, PTEN and RARB. Similar involvements of methylation instability were revealed between cell line models and neuroblastoma tumors. Separate analysis of two proposed CASP8 regulatory regions revealed frequent and significant involvement of CpG sites between exon 4 and 5, but modest involvement of the exon 1 region. Conclusions/significance The results highlight the involvement of TSG methylation instability in neuroblastoma tumors and cell lines using quantitative methods, support the use of DNA methylation analyses as a prognostic tool for this tumor type, and underscore the relevance of developing demethylating therapies for its treatment.

  3. [Inactivation of PMS2 gene by promoter methylation in nasopharyngeal carcinoma].

    Science.gov (United States)

    Ni, H F; Jiang, B; Zhou, Z; Li, Y; Yuan, X Y; Cao, X L; Huang, G W

    2016-11-23

    Objective: To investigate the inactivation of PMS2 gene mediated by promoter methylation and its regulatory mechanism in nasopharyngeal carcinoma (NPC). Methods: Fifty-four NPC tissues, 16 normal nasopharyngeal epithelia (NNE), 5 NPC cell lines (CNE1, CNE2, TWO3, HNE1 and HONE1) and 1 normal nasopharyngeal epithelial cell line (NP69) were collected.Methylation-specific PCR (MSP) was used to detect the PMS2 promoter methylation, semi-quantitative reverse transcription PCR (qRT-PCR) was applied to determine its mRNA expression, and immunohistochemistry (IHC) was used to detect the protein expression of PMS2. The expressions of PMS2 mRNA in CNE1 and CNE2 cells before and after treated with methyltransferase inhibitor 5-aza-2-deoxycytidine were analyzed by qRT-PCR. The impact of methylation and demethylation on the mRNA expression of PMS2, and the association of mRNA and protein expression of PMS2 with clinicopathological features of nasopharyngeal cancer were analyzed. Results: Methylation of PMS2 gene was detected in all of the five NPC cell lines, but not in normal nasopharyngeal epithelial NP69 cells. The methylation rate of PMS2 gene in NPC tissues was 63% (34/54), significantly higher than that of the normal nasopharyngeal epithelia (0/16, P PMS2 mRNA and protein were significantly down-regulated in the 54 NPC tissues when compared with those in the 16 NNE tissues ( P PMS2 mRNA was restored in the CNE1 and CNE2 cells.However, the expressions of PMS2 mRNA and protein were not significantly correlated with patients' age, gender, TNM stage, histopathologic type or lymph node metastasis ( P >0.05 for all). Conclusions: Promoter methylation-mediated inactivation of PMS2 gene participates in carcinogenesis and development of NPC. PMS2 may be a candidate tumor suppressor in the treatment for patients with inactivation of PMS2 promoter methylation.

  4. The role of germline promoters and I exons in cytokine-induced gene-specific class switch recombination.

    Science.gov (United States)

    Dunnick, Wesley A; Shi, Jian; Holden, Victoria; Fontaine, Clinton; Collins, John T

    2011-01-01

    Germline transcription precedes class switch recombination (CSR). The promoter regions and I exons of these germline transcripts include binding sites for activation- and cytokine-induced transcription factors, and the promoter regions/I exons are essential for CSR. Therefore, it is a strong hypothesis that the promoter/I exons regions are responsible for much of cytokine-regulated, gene-specific CSR. We tested this hypothesis by swapping the germline promoter and I exons for the murine γ1 and γ2a H chain genes in a transgene of the entire H chain C-region locus. We found that the promoter/I exon for γ1 germline transcripts can direct robust IL-4-induced recombination to the γ2a gene. In contrast, the promoter/I exon for the γ2a germline transcripts works poorly in the context of the γ1 H chain gene, resulting in expression of γ1 H chains that is level. Nevertheless, the small amount of recombination to the chimeric γ1 gene is induced by IFN-γ. These results suggest that cytokine regulation of CSR, but not the magnitude of CSR, is regulated by the promoter/I exons.

  5. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    International Nuclear Information System (INIS)

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-01-01

    Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  6. Hydrogel Design for Supporting Neurite Outgrowth and Promoting Gene Delivery to Maximize Neurite Extension

    Science.gov (United States)

    Shepard, Jaclyn A.; Stevans, Alyson C.; Holland, Samantha; Wang, Christine E.; Shikanov, Ariella; Shea, Lonnie D.

    2012-01-01

    Hydrogels capable of gene delivery provide a combinatorial approach for nerve regeneration, with the hydrogel supporting neurite outgrowth and gene delivery inducing the expression of inductive factors. This report investigates the design of hydrogels that balance the requirements for supporting neurite growth with those requirements for promoting gene delivery. Enzymatically-degradable PEG hydrogels encapsulating dorsal root ganglia explants, fibroblasts, and lipoplexes encoding nerve growth factor were gelled within channels that can physically guide neurite outgrowth. Transfection of fibroblasts increased with increasing concentration of Arg-Gly-Asp (RGD) cell adhesion sites and decreasing PEG content. The neurite length increased with increasing RGD concentration within 10% PEG hydrogels, yet was maximal within 7.5% PEG hydrogels at intermediate RGD levels. Delivering lipoplexes within the gel produced longer neurites than culture in NGF-supplemented media or co-culture with cells exposed to DNA prior to encapsulation. Hydrogels designed to support neurite outgrowth and deliver gene therapy vectors locally may ultimately be employed to address multiple barriers that limit regeneration. PMID:22038654

  7. TFPI-2 is a putative tumor suppressor gene frequently inactivated by promoter hypermethylation in nasopharyngeal carcinoma

    International Nuclear Information System (INIS)

    Wang, Shumin; Ma, Ning; Murata, Mariko; Huang, Guangwu; Zhang, Zhe; Xiao, Xue; Zhou, Xiaoying; Huang, Tingting; Du, Chunping; Yu, Nana; Mo, Yingxi; Lin, Longde; Zhang, Jinyan

    2010-01-01

    Epigenetic silencing of tumor suppressor genes play important roles in NPC tumorgenesis. Tissue factor pathway inhibitor-2 (TFPI-2), is a protease inhibitor. Recently, TFPI-2 was suggested to be a tumor suppressor gene involved in tumorigenesis and metastasis in some cancers. In this study, we investigated whether TFPI-2 was inactivated epigenetically in nasopharyngeal carcinoma (NPC). Transcriptional expression levels of TFPI-2 was evaluated by RT-PCR. Methylation status were investigated by methylation specific PCR and bisulfate genomic sequencing. The role of TFPI-2 as a tumor suppressor gene in NPC was addressed by re-introducing TFPI-2 expression into the NPC cell line CNE2. TFPI-2 mRNA transcription was inactivated in NPC cell lines. TFPI-2 was aberrantly methylated in 66.7% (4/6) NPC cell lines and 88.6% (62/70) of NPC primary tumors, but not in normal nasopharyngeal epithelia. TFPI-2 expression could be restored in NPC cells after demethylation treatment. Ectopic expression of TFPI-2 in NPC cells induced apoptosis and inhibited cell proliferation, colony formation and cell migration. Epigenetic inactivation of TFPI-2 by promoter hypermethylation is a frequent and tumor specific event in NPC. TFPI-2 might be considering as a putative tumor suppressor gene in NPC

  8. Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene

    International Nuclear Information System (INIS)

    Mavrothalassitis, G.J.; Watson, D.K.; Papas, T.S.

    1990-01-01

    The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical TATA and CAAT elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1,400 base pairs (bp) upstream from the first major transcription initiation site. A G+C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with TATA-less promoters

  9. G-actin sequestering protein thymosin-β4 regulates the activity of myocardin-related transcription factor

    International Nuclear Information System (INIS)

    Morita, Tsuyoshi; Hayashi, Ken’ichiro

    2013-01-01

    Highlights: •Tβ4 competed with MRTF-A for G-actin binding. •Tβ4 activated the MRTF–SRF signaling pathway. •Tβ4 increased the endogenous expression of SRF-dependent genes. -- Abstract: Myocardin-related transcription factors (MRTFs) are robust coactivators of serum response factor (SRF). MRTFs contain three copies of the RPEL motif at their N-terminus, and they bind to monomeric globular actin (G-actin). Previous studies illustrate that G-actin binding inhibits MRTF activity by preventing the MRTFs nuclear accumulation. In the living cells, the majority of G-actin is sequestered by G-actin binding proteins that prevent spontaneous actin polymerization. Here, we demonstrate that the most abundant G-actin sequestering protein thymosin-β4 (Tβ4) was involved in the regulation of subcellular localization and activity of MRTF-A. Tβ4 competed with MRTF-A for G-actin binding; thus, interfering with G-actin–MRTF-A complex formation. Tβ4 overexpression induced the MRTF-A nuclear accumulation and activation of MRTF–SRF signaling. The activation rate of MRTF-A by the Tβ4 mutant L17A, whose affinity for G-actin is very low, was lower than that by wild-type Tβ4. In contrast, the β-actin mutant 3DA, which has a lower affinity for Tβ4, more effectively suppressed MRTF-A activity than wild-type β-actin. Furthermore, ectopic Tβ4 increased the endogenous expression of SRF-dependent actin cytoskeletal genes. Thus, Tβ4 is an important MRTF regulator that controls the G-actin–MRTFs interaction

  10. G-actin sequestering protein thymosin-β4 regulates the activity of myocardin-related transcription factor

    Energy Technology Data Exchange (ETDEWEB)

    Morita, Tsuyoshi, E-mail: tsuyo@nbiochem.med.osaka-u.ac.jp; Hayashi, Ken’ichiro

    2013-08-02

    Highlights: •Tβ4 competed with MRTF-A for G-actin binding. •Tβ4 activated the MRTF–SRF signaling pathway. •Tβ4 increased the endogenous expression of SRF-dependent genes. -- Abstract: Myocardin-related transcription factors (MRTFs) are robust coactivators of serum response factor (SRF). MRTFs contain three copies of the RPEL motif at their N-terminus, and they bind to monomeric globular actin (G-actin). Previous studies illustrate that G-actin binding inhibits MRTF activity by preventing the MRTFs nuclear accumulation. In the living cells, the majority of G-actin is sequestered by G-actin binding proteins that prevent spontaneous actin polymerization. Here, we demonstrate that the most abundant G-actin sequestering protein thymosin-β4 (Tβ4) was involved in the regulation of subcellular localization and activity of MRTF-A. Tβ4 competed with MRTF-A for G-actin binding; thus, interfering with G-actin–MRTF-A complex formation. Tβ4 overexpression induced the MRTF-A nuclear accumulation and activation of MRTF–SRF signaling. The activation rate of MRTF-A by the Tβ4 mutant L17A, whose affinity for G-actin is very low, was lower than that by wild-type Tβ4. In contrast, the β-actin mutant 3DA, which has a lower affinity for Tβ4, more effectively suppressed MRTF-A activity than wild-type β-actin. Furthermore, ectopic Tβ4 increased the endogenous expression of SRF-dependent actin cytoskeletal genes. Thus, Tβ4 is an important MRTF regulator that controls the G-actin–MRTFs interaction.

  11. Cloning and characterization of the promoter of the 9-cis-epoxycarotenoid dioxygenase gene in Arachis hypogaea L.

    Science.gov (United States)

    Liang, Jianhua; Yang, Lixia; Chen, Xiong; Li, Ling; Guo, Dongliang; Li, Haihang; Zhang, Biyu

    2009-09-01

    We cloned the promoter of the 9-cis-epoxycarotenoid dioxygenase gene from Arachis hypogaea L. beta-Glucuronidase (GUS) histochemical staining and GUS activity assay indicated that the activity of the promoter was exhibited predominantly in the leaves and enhanced by water and NaCl stresses, and by application of abscisic acid (ABA) and salicylic acid (SA) in transgenic Arabidopsis. Moreover, two novel ABRE-like (abscisic acid response element) elements were identified in the promoter region.

  12. Axon initial segment cytoskeleton comprises a multiprotein submembranous coat containing sparse actin filaments

    Science.gov (United States)

    Jones, Steven L.; Korobova, Farida

    2014-01-01

    The axon initial segment (AIS) of differentiated neurons regulates action potential initiation and axon–dendritic polarity. The latter function depends on actin dynamics, but actin structure and functions at the AIS remain unclear. Using platinum replica electron microscopy (PREM), we have characterized the architecture of the AIS cytoskeleton in mature and developing hippocampal neurons. The AIS cytoskeleton assembly begins with bundling of microtubules and culminates in formation of a dense, fibrillar–globular coat over microtubule bundles. Immunogold PREM revealed that the coat contains a network of known AIS proteins, including ankyrin G, spectrin βIV, neurofascin, neuronal cell adhesion molecule, voltage-gated sodium channels, and actin filaments. Contrary to existing models, we find neither polarized actin arrays, nor dense actin meshworks in the AIS. Instead, the AIS contains two populations of sparse actin filaments: short, stable filaments and slightly longer dynamic filaments. We propose that stable actin filaments play a structural role for formation of the AIS diffusion barrier, whereas dynamic actin may promote AIS coat remodeling. PMID:24711503

  13. Development of a flexible and potent hypoxia-inducible promoter for tumor-targeted gene expression in attenuated Salmonella

    NARCIS (Netherlands)

    Mengesha, Asferd; Dubois, Ludwig; Lambin, Philippe; Landuyt, Willy; Chiu, Roland K; Wouters, Bradly G; Theys, Jan

    To increase the potential of attenuated Salmonella as gene delivery vectors for cancer treatment, we developed a hypoxia-inducible promoter system to limit gene expression specifically to the tumor. This approach is envisaged to not only increase tumor specificity, but also to target those cells

  14. Transcriptional coactivator NT-PGC-1α promotes gluconeogenic gene expression and enhances hepatic gluconeogenesis.

    Science.gov (United States)

    Chang, Ji Suk; Jun, Hee-Jin; Park, Minsung

    2016-10-01

    The transcriptional coactivator PGC-1α plays a central role in hepatic gluconeogenesis. We previously reported that alternative splicing of the PGC-1α gene produces an additional transcript encoding the truncated protein NT-PGC-1α NT-PGC-1α is co-expressed with PGC-1α and highly induced by fasting in the liver. NT-PGC-1α regulates tissue-specific metabolism, but its role in the liver has not been investigated. Thus, the objective of this study was to determine the role of hepatic NT-PGC-1α in the regulation of gluconeogenesis. Adenovirus-mediated expression of NT-PGC-1α in primary hepatocytes strongly stimulated the expression of key gluconeogenic enzyme genes (PEPCK and G6Pase), leading to increased glucose production. To further understand NT-PGC-1α function in hepatic gluconeogenesis in vivo, we took advantage of a previously reported FL-PGC-1α -/- mouse line that lacks full-length PGC-1α (FL-PGC-1α) but retains a slightly shorter and functionally equivalent form of NT-PGC-1α (NT-PGC-1α 254 ). In FL-PGC-1α -/- mice, NT-PGC-1α 254 was induced by fasting in the liver and recruited to the promoters of PEPCK and G6Pase genes. The enrichment of NT-PGC-1α 254 at the promoters was closely associated with fasting-induced increase in PEPCK and G6Pase gene expression and efficient production of glucose from pyruvate during a pyruvate tolerance test in FL-PGC-1α -/- mice. Moreover, FL-PGC-1α -/- primary hepatocytes showed a significant increase in gluconeogenic gene expression and glucose production after treatment with dexamethasone and forskolin, suggesting that NT-PGC-1α 254 is sufficient to stimulate the gluconeogenic program in the absence of FL-PGC-1α Collectively, our findings highlight the role of hepatic NT-PGC-1α in stimulating gluconeogenic gene expression and glucose production. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  15. Disrupting the cortical actin cytoskeleton points to two distinct mechanisms of yeast [PSI+] prion formation

    Science.gov (United States)

    Speldewinde, Shaun H.; Tuite, Mick F.

    2017-01-01

    Mammalian and fungal prions arise de novo; however, the mechanism is poorly understood in molecular terms. One strong possibility is that oxidative damage to the non-prion form of a protein may be an important trigger influencing the formation of its heritable prion conformation. We have examined the oxidative stress-induced formation of the yeast [PSI+] prion, which is the altered conformation of the Sup35 translation termination factor. We used tandem affinity purification (TAP) and mass spectrometry to identify the proteins which associate with Sup35 in a tsa1 tsa2 antioxidant mutant to address the mechanism by which Sup35 forms the [PSI+] prion during oxidative stress conditions. This analysis identified several components of the cortical actin cytoskeleton including the Abp1 actin nucleation promoting factor, and we show that deletion of the ABP1 gene abrogates oxidant-induced [PSI+] prion formation. The frequency of spontaneous [PSI+] prion formation can be increased by overexpression of Sup35 since the excess Sup35 increases the probability of forming prion seeds. In contrast to oxidant-induced [PSI+] prion formation, overexpression-induced [PSI+] prion formation was only modestly affected in an abp1 mutant. Furthermore, treating yeast cells with latrunculin A to disrupt the formation of actin cables and patches abrogated oxidant-induced, but not overexpression-induced [PSI+] prion formation, suggesting a mechanistic difference in prion formation. [PIN+], the prion form of Rnq1, localizes to the IPOD (insoluble protein deposit) and is thought to influence the aggregation of other proteins. We show Sup35 becomes oxidized and aggregates during oxidative stress conditions, but does not co-localize with Rnq1 in an abp1 mutant which may account for the reduced frequency of [PSI+] prion formation. PMID:28369054

  16. Characterization of promoter of EgPAL1, a novel PAL gene from the oil palm Elaeis guineensis Jacq.

    Science.gov (United States)

    Yusuf, Chong Yu Lok; Abdullah, Janna Ong; Shaharuddin, Noor Azmi; Abu Seman, Idris; Abdullah, Mohd Puad

    2018-02-01

    The oil palm EgPAL1 gene promoter and its regulatory region were functional as a promoter in the heterologous system of Arabidopsis according to the cis-acting elements present in that region. The promoter was developmentally regulated, vascular tissue specific and responsive to water stress agents. Phenylalanine ammonia lyase (PAL, EC 4.3.1.24) is the key enzyme of the phenylpropanoid pathway which plays important roles in plant development and adaptation. To date, there is no report on the study of PAL from oil palm (Elaeis guineensis), an economically important oil crop. In this study, the 5' regulatory sequence of a highly divergent oil palm PAL gene (EgPAL1) was isolated and fused with GUS in Arabidopsis to create two transgenic plants carrying the minimal promoter with (2302 bp) and without its regulatory elements (139 bp). The regulatory sequence contained cis-acting elements known to be important for plant development and stress response including the AC-II element for lignin biosynthesis and several stress responsive elements. The promoter and its regulatory region were fully functional in Arabidopsis. Its activities were characterised by two common fundamental features of PAL which are responsive to plant internal developmental programme and external factors. The promoter was developmentally regulated in certain organs; highly active in young organs but less active or inactive in mature organs. The presence of the AC elements and global activity of the EgPAL1 promoter in all organs resembled the property of lignin-related genes. The existence of the MBS element and enhancement of the promoter activity by PEG reflected the behaviour of drought-responsive genes. Our findings provide a platform for evaluating oil palm gene promoters in the heterologous system of Arabidopsis and give insights into the activities of EgPAL1 promoter in oil palm.

  17. Effects of F/G-actin ratio and actin turn-over rate on NADPH oxidase activity in microglia

    DEFF Research Database (Denmark)

    Rasmussen, Izabela; Pedersen, Line Hjortshøj; Byg, Luise

    2010-01-01

    Most in vivo studies that have addressed the role of actin dynamics in NADPH oxidase function in phagocytes have used toxins to modulate the polymerization state of actin and mostly effects on actin has been evaluated by end point measurements of filamentous actin, which says little about actin d...... dynamics, and without consideration for the subcellular distribution of the perturbed actin cytoskeleton....

  18. In silico analysis and DHPLC screening strategy identifies novel apoptotic gene targets of aberrant promoter hypermethylation in prostate cancer.

    LENUS (Irish Health Repository)

    Murphy, Therese M

    2011-01-01

    Aberrant DNA methylation has been implicated as a key survival mechanism in cancer, whereby promoter hypermethylation silences genes essential for many cellular processes including apoptosis. Limited data is available on the methylation profile of apoptotic genes in prostate cancer (CaP). The aim of this study was to profile methylation of apoptotic-related genes in CaP using denaturing high performance liquid chromatography (DHPLC).

  19. ΔNp73 enhances promoter activity of TGF-β induced genes.

    Directory of Open Access Journals (Sweden)

    Maarten Niemantsverdriet

    Full Text Available The p53 homolog p73 is frequently overexpressed in cancers. Especially the transactivation domain truncated isoform ΔNp73 has oncogenic properties and its upregulation is associated with poor patient survival. It has been shown that ΔNp73 has an inhibitory effect on the transactivation capacity of p53 and other p73 isoforms. Here, we confirm this finding but surprisingly find that ΔNp73 may also stimulate the expression of TGF-β signaling targets. Promoter-reporter analysis indicated that the presence of Smad Binding Elements (SBE in the promoter is sufficient for stimulation of gene expression by ΔNp73. TGF-β signaling was less efficient in ΔNp73 downregulated cells, whereas tetracycline induced ΔNp73 increased expression of endogenous TGF-β regulated genes PAI-1 and Col1a1. Pull-down assays with SBE DNA suggest that ΔNp73 enhances smad3/4 binding to SBEs, thereby stimulating TGF-β signaling. Chromatin immunoprecipitation assays confirmed a direct interaction between ΔNp73 and SBE. Given the role of TGF-β signaling in carcinogenesis, tumor invasion and metastasis via targets like PAI-1 and Col1a1, our data suggest a model on how this effect of ΔNp73 could be a contributing factor in cancer progression.

  20. A glycolytic metabolon in Saccharomyces cerevisiae is stabilized by F-actin.

    Science.gov (United States)

    Araiza-Olivera, Daniela; Chiquete-Felix, Natalia; Rosas-Lemus, Mónica; Sampedro, José G; Peña, Antonio; Mujica, Adela; Uribe-Carvajal, Salvador

    2013-08-01

    In the Saccharomyces cerevisiae glycolytic pathway, 11 enzymes catalyze the stepwise conversion of glucose to two molecules of ethanol plus two CO₂ molecules. In the highly crowded cytoplasm, this pathway would be very inefficient if it were dependent on substrate/enzyme diffusion. Therefore, the existence of a multi-enzymatic glycolytic complex has been suggested. This complex probably uses the cytoskeleton to stabilize the interaction of the various enzymes. Here, the role of filamentous actin (F-actin) in stabilization of a putative glycolytic metabolon is reported. Experiments were performed in isolated enzyme/actin mixtures, cytoplasmic extracts and permeabilized yeast cells. Polymerization of actin was promoted using phalloidin or inhibited using cytochalasin D or latrunculin. The polymeric filamentous F-actin, but not the monomeric globular G-actin, stabilized both the interaction of isolated glycolytic pathway enzyme mixtures and the whole fermentation pathway, leading to higher fermentation activity. The associated complexes were resistant against inhibition as a result of viscosity (promoted by the disaccharide trehalose) or inactivation (using specific enzyme antibodies). In S. cerevisiae, a glycolytic metabolon appear to assemble in association with F-actin. In this complex, fermentation activity is enhanced and enzymes are partially protected against inhibition by trehalose or by antibodies. © 2013 FEBS.

  1. Promotion of Metastasis-associated Gene Expression in Survived PANC-1 Cells Following Trichostatin A Treatment.

    Science.gov (United States)

    Chen, Zongjing; Yang, Yunxiu; Liu, Biao; Wang, Benquan; Sun, Meng; Zhang, Ling; Chen, Bicheng; You, Heyi; Zhou, Mengtao

    2015-01-01

    Histone deacetylase inhibitors represent a promising class of potential anticancer agents for the treatment of human malignancies. In this study, the effects of trichostatin A (TSA) on apoptosis, metastasis-associated gene expression, and activation of the Notch pathway in human pancreatic cancer cell lines were investigated. After treatment with TSA, cell viability and apoptosis were evaluated using the MTT [3-(4,5-dimethylthia-zol-2-yl)-2,5-diphenyltetrazolium bromide] assay, Hoechst 33258 staining, and flow cytometry. Moreover, RT-PCR and western blot analyses were performed to measure the expression levels of apoptosis-associated genes (Bcl-2, Bax, and caspase-3), metastasis-associated genes (E-cadherin, vimentin, and matrix metalloproteinases), and Notch pathway activation (Notch intracellular domain, NICD). The levels of matrix metalloproteinase 2 and NICD were also semi-quantified by immunoassay. Following treatment with TSA for 24 h, PANC-1, SW1990, and MIATACA-2 cells exhibited cell death. The MTT assay revealed that TSA significantly decreased cell viability in a dose-dependent manner in PANC-1 cells. The Hoechst 33258 staining and flow cytometry results evidenced a significant increase in PANC-1 cell apoptosis following TSA treatment. The expression levels of Bax and caspase-3 were increased significantly, whereas Bcl-2 was down-regulated after TSA treatment. In the PANC-1 cells that survived after TSA treatment, the expression levels of vimentin, E-cadherin, and MMP genes were altered by the promotion of potential metastasis and increased expression of NICD. TSA can induce apoptosis of pancreatic cancer cells. In addition, the up-regulation of metastasis-related genes and the activation of the Notch pathway in the survived PANC-1 cells may be associated with a too-low level of TSA or resistance to TSA.

  2. The Helicobacter pylori duodenal ulcer promoting gene, dupA in China

    Directory of Open Access Journals (Sweden)

    Liu Wenzhong

    2008-10-01

    Full Text Available Abstract Background The prevalence of H. pylori is as high as 60–70% in Chinese population. Although duodenal ulcer and gastric cancer are both caused by H. pylori, they are at opposite ends of the spectrum and as such are considered mutually exclusive. Duodenal ulcer promoting (dupA gene was reported to be associated with duodenal ulcer development. The aim of this study was to determine the prevalence of dupA gene of Helicobacter pylori in patients with various gastroduodenal diseases and to explore the association between the gene and other virulence factors. Methods H. pylori were isolated from gastric biopsies of patients with chronic gastritis, duodenal ulcer (DU, gastric ulcer (GU, or non-cardia gastric carcinoma. The dupA, cagA, vacA, iceA and babA2 genotypes were determined by polymerase chain reaction. Histological features of gastric mucosal biopsy specimens were graded based on the scoring system proposed by the updated Sydney system. IL-1β polymorphism was investigated using restriction fragment length polymorphism. Results Isolates from 360 patients including 133 with chronic gastritis, 101 with DU, 47 with GU, and 79 with non-cardia gastric carcinoma were examined. The dupA gene was detected in 35.3% (127/360 and the prevalence DU patients was significantly greater than that in gastric cancer or GU patients (45.5% vs. 24.1% and 23.4%, P dupA-positive strains had higher scores for chronic inflammation compared to those with dupA-negative strains (2.36 vs. 2.24, p = 0.058. The presence of dupA was not associated with the cagA, vacA, iceA and babA 2 genotypes or with IL-1β polymorphisms. Conclusion In China the prevalence of dupA gene was highest in DU and inversely related to GU and gastric cancer.

  3. The Helicobacter pylori duodenal ulcer promoting gene, dupA in China.

    Science.gov (United States)

    Zhang, Zhiyu; Zheng, Qing; Chen, Xiaoyu; Xiao, Shudong; Liu, Wenzhong; Lu, Hong

    2008-10-25

    The prevalence of H. pylori is as high as 60-70% in Chinese population. Although duodenal ulcer and gastric cancer are both caused by H. pylori, they are at opposite ends of the spectrum and as such are considered mutually exclusive. Duodenal ulcer promoting (dupA) gene was reported to be associated with duodenal ulcer development. The aim of this study was to determine the prevalence of dupA gene of Helicobacter pylori in patients with various gastroduodenal diseases and to explore the association between the gene and other virulence factors. H. pylori were isolated from gastric biopsies of patients with chronic gastritis, duodenal ulcer (DU), gastric ulcer (GU), or non-cardia gastric carcinoma. The dupA, cagA, vacA, iceA and babA2 genotypes were determined by polymerase chain reaction. Histological features of gastric mucosal biopsy specimens were graded based on the scoring system proposed by the updated Sydney system. IL-1beta polymorphism was investigated using restriction fragment length polymorphism. Isolates from 360 patients including 133 with chronic gastritis, 101 with DU, 47 with GU, and 79 with non-cardia gastric carcinoma were examined. The dupA gene was detected in 35.3% (127/360) and the prevalence DU patients was significantly greater than that in gastric cancer or GU patients (45.5% vs. 24.1% and 23.4%, P dupA-positive strains had higher scores for chronic inflammation compared to those with dupA-negative strains (2.36 vs. 2.24, p = 0.058). The presence of dupA was not associated with the cagA, vacA, iceA and babA 2 genotypes or with IL-1beta polymorphisms. In China the prevalence of dupA gene was highest in DU and inversely related to GU and gastric cancer.

  4. Methylation state of the EDA gene promoter in Chinese X-linked hypohidrotic ectodermal dysplasia carriers.

    Directory of Open Access Journals (Sweden)

    Wei Yin

    Full Text Available Hypodontia, hypohidrosis, sparse hair and characteristic faces are the main characters of X-linked hypohidrotic ectodermal dysplasia (XLHED which is caused by genetic ectodysplasin A (EDA deficiency. Heterozygous female carriers tend to have mild to moderate XLHED phenotype, even though 30% of them present no obvious symptom.A large Chinese XLHED family was reported and the entire coding region and exon-intron boundaries of EDA gene were sequenced. To elucidate the mechanism for carriers' tempered phenotype, we analyzed the methylation level on four sites of the promoter of EDA by the pyrosequencing system.A known frameshift mutation (c.573-574 insT was found in this pedigree. Combined with the pedigrees we reported before, 120 samples comprised of 23 carrier females from 11 families and 97 healthy females were analyzed for the methylation state of EDA promoter. Within 95% confidence interval (CI, 18 (78.26% carriers were hypermethylated at these 4 sites.Chinese XLHED carriers often have a hypermethylated EDA promoter.

  5. The Silencing of RECK Gene is Associated with Promoter Hypermethylation and Poor Survival in Hepatocellular Carcinoma

    Science.gov (United States)

    Zhang, Changsong; Ling, Yang; Zhang, Chenghui; Xu, Yun; Gao, Lu; Li, Rong; Zhu, Jing; Fan, Lieying; Wei, Lixin

    2012-01-01

    Background: To evaluate the promoter methylation status of RECK gene and mRNA expression in patients with hepatocellular carcinoma (HCC). Methods: We analyzed RECK methylation by MSP, and RECK mRNA by real-time PCR in 74 HCC. The liver cell lines (7721, Chang and Hep-G2) were treated with 5-Aza-CdR and TSA. Results: RECK mRNA were lower in HCC tissues (Mean -∆Ct = -3.29) than that in Non-Hcc tissues (Mean -∆Ct = -2.42). Expression of RECK was elevated in only 24 (32.43%) of the 74 HCC patients but decreased (-∆∆Ct=0.5) (Mean -∆∆Ct = -1.75) than those with demethylation (∆MI<0.5) (Mean -∆∆Ct = 0.05), and there is a decreased tendency for RECK mRNA in HCC patients with promoter hypermethylation (p = 0.002). There was a significantly correlation found between RECK mRNA and poor survival after surgery. After treated by 5-Aza-CdR and TSA, we found that RECK mRNA induced different changes in 7721, Chang and Hep-G2 cells. And RECK demethylation also induced by epigenetic inhibitors. Conclusion: The results suggested that the hypermethylation may lead to promoter silencing of RECK mRNA and associated with poor survival in HCC. PMID:22419890

  6. Linkage mapping of candidate genes for induce resistance and growth promotion by trichoderma koningiopsis (th003) in tomato solanum lycopersicum

    International Nuclear Information System (INIS)

    Simbaqueba, Jaime; Cotes, Alba Marina; Barrero, Luz Stella

    2011-01-01

    Induced systemic resistance (ISR) is a mechanism by which plants enhance defenses against any stress condition. ISR and growth promotion are enhanced when tomato (Solanum lycopersicum) is inoculated with several strains of Trichoderma ssp. this study aims to genetically map tomato candidate genes involved in ISR and growth promotion induced by the Colombian native isolate Trichoderma koningiopsis th003. Forty-nine candidate genes previously identified on tomato plants treated with th003 and T. hamatum T382 strains were evaluated for polymorphisms and 16 of them were integrated on the highly saturated genetic linkage map named TOMATO EXPEN 2000. The location of six unigenes was similar to the location of resistance gene analogs (RGAS), defense related ests and resistance QTLs previously reported, suggesting new possible candidates for these quantitative trait loci (QTL) regions. The candidate gene-markers may be used for future ISR or growth promotion assisted selection in tomato.

  7. Analysis of tomato gene promoters activated in syncytia induced in tomato and potato hairy roots by Globodera rostochiensis.

    Science.gov (United States)

    Wiśniewska, A; Dąbrowska-Bronk, J; Szafrański, K; Fudali, S; Święcicka, M; Czarny, M; Wilkowska, A; Morgiewicz, K; Matusiak, J; Sobczak, M; Filipecki, M

    2013-06-01

    The potato cyst nematode (Globodera rostochiensis) induces feeding sites (syncytia) in tomato and potato roots. In a previous study, 135 tomato genes up-regulated during G. rostochiensis migration and syncytium development were identified. Five genes (CYP97A29, DFR, FLS, NIK and PMEI) were chosen for further study to examine their roles in plant-nematode interactions. The promoters of these genes were isolated and potential cis regulatory elements in their sequences were characterized using bioinformatics tools. Promoter fusions with the β-glucuronidase gene were constructed and introduced into tomato and potato genomes via transformation with Agrobacterium rhizogenes to produce hairy roots. The analysed promoters displayed different activity patterns in nematode-infected and uninfected transgenic hairy roots.

  8. Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

    Science.gov (United States)

    Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

    1998-06-01

    Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

  9. Light response and potential interacting proteins of a grape flavonoid 3'-hydroxylase gene promoter.

    Science.gov (United States)

    Sun, Run-Ze; Pan, Qiu-Hong; Duan, Chang-Qing; Wang, Jun

    2015-12-01

    Flavonoid 3'-hydroxylase (F3'H), a member of cytochrome P450 protein family, introduces B-ring hydroxyl group in the 3' position of the flavonoid. In this study, the cDNA sequence of a F3'H gene (VviF3'H), which contains an open reading frame of 1530 bp encoding a polypeptide of 509 amino acids, was cloned and characterized from Vitis vinifera L. cv. Cabernet Sauvignon. VviF3'H showed high homology to known F3'H genes, especially F3'Hs from the V. vinifera reference genome (Pinot Noir) and lotus. Expression profiling analysis using real-time PCR revealed that VviF3'H was ubiquitously expressed in all tested tissues including berries, leaves, flowers, roots, stems and tendrils, suggesting its important physiological role in plant growth and development. Moreover, the transcript level of VviF3'H gene in grape berries was relatively higher at early developmental stages and gradually decreased during véraison, and then increased in the mature phase. In addition, the promoter of VviF3'H was isolated by using TAIL-PCR. Yeast one-hybrid screening of the Cabernet Sauvignon cDNA library and subsequent in vivo/vitro validations revealed the interaction between VviF3'H promoter and several transcription factors, including members of HD-Zip, NAC, MYB and EIN families. A transcriptional regulation mechanism of VviF3'H expression is proposed for the first time. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  10. Molecular Characterization of SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL Gene Family in Betula luminifera

    Directory of Open Access Journals (Sweden)

    Xiu-Yun Li

    2018-05-01

    Full Text Available As a major family of plant-specific transcription factors, SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL genes play vital regulatory roles in plant growth, development and stress responses. In this study, 18 SPL genes were identified and cloned from Betula luminifera. Two zinc finger-like structures and a nuclear location signal (NLS segments were existed in the SBP domains of all BlSPLs. Phylogenetic analysis showed that these genes were clustered into nine groups (group I-IX. The intron/exon structure and motif composition were highly conserved within the same group. 12 of the 18 BlSPLs were experimentally verified as the targets of miR156, and two cleavage sites were detected in these miR156-targeted BlSPL genes. Many putative cis-elements, associated with light, stresses and phytohormones response, were identified in the promoter regions of BlSPLs, suggesting that BlSPL genes are probably involved in important physiological processes and developmental events. Tissue-specific expression analysis showed that miR156-targeted BlSPLs exhibited a more differential expression pattern, while most miR156-nontargeted BlSPLs tended to be constitutively expressed, suggesting the distinct roles of miR156-targeted and nontargeted BlSPLs in development and growth of B. luminifera. Further expression analysis revealed that miR156-targeted BlSPLs were dramatically up-regulated with age, whereas mature BlmiR156 level was apparently declined with age, indicating that miR156/SPL module plays important roles in vegetative phase change of B. luminifera. Moreover, yeast two-hybrid assay indicated that several miR156-targeted and nontargeted BlSPLs could interact with two DELLA proteins (BlRGA and BlRGL, which suggests that certain BlSPLs take part in the GA regulated processes through protein interaction with DELLA proteins. All these results provide an important basis for further exploring the biological functions of BlSPLs in B. luminifera.

  11. USP7 Attenuates Hepatic Gluconeogenesis Through Modulation of FoxO1 Gene Promoter Occupancy

    Science.gov (United States)

    Hall, Jessica A.; Tabata, Mitsuhisa; Rodgers, Joseph T.

    2014-01-01

    Hepatic forkhead protein FoxO1 is a key component of systemic glucose homeostasis via its ability to regulate the transcription of rate-limiting enzymes in gluconeogenesis. Important in the regulation of FoxO1 transcriptional activity are the modifying/demodifying enzymes that lead to posttranslational modification. Here, we demonstrate the functional interaction and regulation of FoxO1 by herpesvirus-associated ubiquitin-specific protease 7 (USP7; also known as herpesvirus-associated ubiquitin-specific protease, HAUSP), a deubiquitinating enzyme. We show that USP7-mediated mono-deubiquitination of FoxO1 results in suppression of FoxO1 transcriptional activity through decreased FoxO1 occupancy on the promoters of gluconeogenic genes. Knockdown of USP7 in primary hepatocytes leads to increased expression of FoxO1-target gluconeogenic genes and elevated glucose production. Consistent with this, USP7 gain-of-function suppresses the fasting/cAMP-induced activation of gluconeogenic genes in hepatocyte cells and in mouse liver, resulting in decreased hepatic glucose production. Notably, we show that the effects of USP7 on hepatic glucose metabolism depend on FoxO1. Together, these results place FoxO1 under the intimate regulation of deubiquitination and glucose metabolic control with important implication in diseases such as diabetes. PMID:24694308

  12. Negative regulation of human parathyroid hormone gene promoter by vitamin D3 through nuclear factor Y

    International Nuclear Information System (INIS)

    Jaeaeskelaeinen, T.; Huhtakangas, J.; Maeenpaeae, P.H.

    2005-01-01

    The negative regulation of the human parathyroid hormone (PTH) gene by biologically active vitamin D 3 (1,25-dihydroxyvitamin D 3 ; 1,25(OH) 2 D 3 ) was studied in rat pituitary GH4C1 cells, which express factors needed for the negative regulation. We report here that NF-Y binds to sequences downstream of the site previously reported to bind the vitamin D receptor (VDR). Additional binding sites for NF-Y reside in the near vicinity and were shown to be important for full activity of the PTH gene promoter. VDR and NF-Y were shown to exhibit mutually exclusive binding to the VDRE region. According to our results, sequestration of binding partners for NF-Y by VDR also affects transcription through a NF-Y consensus binding element in GH4C1 but not in ROS17/2.8 cells. These results indicate that 1,25(OH) 2 D 3 may affect transcription of the human PTH gene both by competitive binding of VDR and NF-Y, and by modulating transcriptional activity of NF-Y

  13. Computational modeling identifies key gene regulatory interactions underlying phenobarbital-mediated tumor promotion

    Science.gov (United States)

    Luisier, Raphaëlle; Unterberger, Elif B.; Goodman, Jay I.; Schwarz, Michael; Moggs, Jonathan; Terranova, Rémi; van Nimwegen, Erik

    2014-01-01

    Gene regulatory interactions underlying the early stages of non-genotoxic carcinogenesis are poorly understood. Here, we have identified key candidate regulators of phenobarbital (PB)-mediated mouse liver tumorigenesis, a well-characterized model of non-genotoxic carcinogenesis, by applying a new computational modeling approach to a comprehensive collection of in vivo gene expression studies. We have combined our previously developed motif activity response analysis (MARA), which models gene expression patterns in terms of computationally predicted transcription factor binding sites with singular value decomposition (SVD) of the inferred motif activities, to disentangle the roles that different transcriptional regulators play in specific biological pathways of tumor promotion. Furthermore, transgenic mouse models enabled us to identify which of these regulatory activities was downstream of constitutive androstane receptor and β-catenin signaling, both crucial components of PB-mediated liver tumorigenesis. We propose novel roles for E2F and ZFP161 in PB-mediated hepatocyte proliferation and suggest that PB-mediated suppression of ESR1 activity contributes to the development of a tumor-prone environment. Our study shows that combining MARA with SVD allows for automated identification of independent transcription regulatory programs within a complex in vivo tissue environment and provides novel mechanistic insights into PB-mediated hepatocarcinogenesis. PMID:24464994

  14. Bovine glycomacropeptide promotes the growth of Bifidobacterium longum ssp. infantis and modulates its gene expression.

    Science.gov (United States)

    O'Riordan, N; O'Callaghan, J; Buttò, L F; Kilcoyne, M; Joshi, L; Hickey, R M

    2018-05-23

    Bovine milk glycomacropeptide (GMP) is derived from κ-casein, with exclusively o-linked glycosylation. Glycomacropeptide promoted the growth of Bifidobacterium longum ssp. infantis in a concentration-dependent manner, and this activity was lost following periodate treatment of the GMP (GMP-P), which disables biological recognition of the conjugated oligosaccharides. Transcriptional analysis of B. longum ssp. infantis following exposure to GMP revealed a substantial response to GMP relative to bacteria treated with GMP-P, with a greater number of differentially expressed transcripts and larger fold changes versus the control. Therefore, stimulation of B. longum ssp. infantis growth by GMP is intrinsically linked to the peptide's O-linked glycosylation. The pool of differentially expressed transcripts included 2 glycoside hydrolase (family 25) genes, which were substantially upregulated following exposure to GMP, but not GMP-P. These GH25 genes were present in duplicated genomic islands that also contained genes encoding fibronectin type III binding domain proteins and numerous phage-related proteins, all of which were also upregulated. Homologs of this genomic arrangement were present in other Bifidobacterium species, which suggest it may be a conserved domain for the utilization of glycosylated peptides. This study provides insights into the molecular basis for the prebiotic effect of bovine milk GMP on B. longum ssp. infantis. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  15. Klotho gene silencing promotes pathology in the mdx mouse model of Duchenne muscular dystrophy

    Science.gov (United States)

    Wehling-Henricks, Michelle; Li, Zhenzhi; Lindsey, Catherine; Wang, Ying; Welc, Steven S.; Ramos, Julian N.; Khanlou, Négar; Kuro-o, Makoto; Tidball, James G.

    2016-01-01

    Duchenne muscular dystrophy (DMD) is a lethal muscle disease involving progressive loss of muscle regenerative capacity and increased fibrosis. We tested whether epigenetic silencing of the klotho gene occurs in the mdx mouse model of DMD and whether klotho silencing is an important feature of the disease. Our findings show that klotho undergoes muscle-specific silencing at the acute onset of mdx pathology. Klotho experiences increased methylation of CpG sites in its promoter region, which is associated with gene silencing, and increases in a repressive histone mark, H3K9me2. Expression of a klotho transgene in mdx mice restored their longevity, reduced muscle wasting, improved function and greatly increased the pool of muscle-resident stem cells required for regeneration. Reductions of fibrosis in late, progressive stages of the mdx pathology achieved by transgene expression were paralleled by reduced expression of Wnt target genes (axin-2), transforming growth factor-beta (TGF-β1) and collagens types 1 and 3, indicating that Klotho inhibition of the profibrotic Wnt/TGFβ axis underlies its anti-fibrotic effect in aging, dystrophic muscle. Thus, epigenetic silencing of klotho during muscular dystrophy contributes substantially to lost regenerative capacity and increased fibrosis of dystrophic muscle during late progressive stages of the disease. PMID:27154199

  16. Deletion of the Imprinted Gene Grb10 Promotes Hematopoietic Stem Cell Self-Renewal and Regeneration.

    Science.gov (United States)

    Yan, Xiao; Himburg, Heather A; Pohl, Katherine; Quarmyne, Mamle; Tran, Evelyn; Zhang, Yurun; Fang, Tiancheng; Kan, Jenny; Chao, Nelson J; Zhao, Liman; Doan, Phuong L; Chute, John P

    2016-11-01

    Imprinted genes are differentially expressed by adult stem cells, but their functions in regulating adult stem cell fate are incompletely understood. Here we show that growth factor receptor-bound protein 10 (Grb10), an imprinted gene, regulates hematopoietic stem cell (HSC) self-renewal and regeneration. Deletion of the maternal allele of Grb10 in mice (Grb10 m/+ mice) substantially increased HSC long-term repopulating capacity, as compared to that of Grb10 +/+ mice. After total body irradiation (TBI), Grb10 m/+ mice demonstrated accelerated HSC regeneration and hematopoietic reconstitution, as compared to Grb10 +/+ mice. Grb10-deficient HSCs displayed increased proliferation after competitive transplantation or TBI, commensurate with upregulation of CDK4 and Cyclin E. Furthermore, the enhanced HSC regeneration observed in Grb10-deficient mice was dependent on activation of the Akt/mTORC1 pathway. This study reveals a function for the imprinted gene Grb10 in regulating HSC self-renewal and regeneration and suggests that the inhibition of Grb10 can promote hematopoietic regeneration in vivo. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Promoter Analysis Reveals Globally Differential Regulation of Human Long Non-Coding RNA and Protein-Coding Genes

    KAUST Repository

    Alam, Tanvir

    2014-10-02

    Transcriptional regulation of protein-coding genes is increasingly well-understood on a global scale, yet no comparable information exists for long non-coding RNA (lncRNA) genes, which were recently recognized to be as numerous as protein-coding genes in mammalian genomes. We performed a genome-wide comparative analysis of the promoters of human lncRNA and protein-coding genes, finding global differences in specific genetic and epigenetic features relevant to transcriptional regulation. These two groups of genes are hence subject to separate transcriptional regulatory programs, including distinct transcription factor (TF) proteins that significantly favor lncRNA, rather than coding-gene, promoters. We report a specific signature of promoter-proximal transcriptional regulation of lncRNA genes, including several distinct transcription factor binding sites (TFBS). Experimental DNase I hypersensitive site profiles are consistent with active configurations of these lncRNA TFBS sets in diverse human cell types. TFBS ChIP-seq datasets confirm the binding events that we predicted using computational approaches for a subset of factors. For several TFs known to be directly regulated by lncRNAs, we find that their putative TFBSs are enriched at lncRNA promoters, suggesting that the TFs and the lncRNAs may participate in a bidirectional feedback loop regulatory network. Accordingly, cells may be able to modulate lncRNA expression levels independently of mRNA levels via distinct regulatory pathways. Our results also raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted in the future.

  18. Histone Deacetylase 7 Promotes Toll-like Receptor 4-dependent Proinflammatory Gene Expression in Macrophages*

    Science.gov (United States)

    Shakespear, Melanie R.; Hohenhaus, Daniel M.; Kelly, Greg M.; Kamal, Nabilah A.; Gupta, Praveer; Labzin, Larisa I.; Schroder, Kate; Garceau, Valerie; Barbero, Sheila; Iyer, Abishek; Hume, David A.; Reid, Robert C.; Irvine, Katharine M.; Fairlie, David P.; Sweet, Matthew J.

    2013-01-01

    Broad-spectrum inhibitors of histone deacetylases (HDACs) constrain Toll-like receptor (TLR)-inducible production of key proinflammatory mediators. Here we investigated HDAC-dependent inflammatory responses in mouse macrophages. Of the classical Hdacs, Hdac7 was expressed at elevated levels in inflammatory macrophages (thioglycollate-elicited peritoneal macrophages) as compared with bone marrow-derived macrophages and the RAW264 cell line. Overexpression of a specific, alternatively spliced isoform of Hdac7 lacking the N-terminal 22 amino acids (Hdac7-u), but not the Refseq Hdac7 (Hdac7-s), promoted LPS-inducible expression of Hdac-dependent genes (Edn1, Il-12p40, and Il-6) in RAW264 cells. A novel class IIa-selective HDAC inhibitor reduced recombinant human HDAC7 enzyme activity as well as TLR-induced production of inflammatory mediators in thioglycollate-elicited peritoneal macrophages. Both LPS and Hdac7-u up-regulated the activity of the Edn1 promoter in an HDAC-dependent fashion in RAW264 cells. A hypoxia-inducible factor (HIF) 1 binding site in this promoter was required for HDAC-dependent TLR-inducible promoter activity and for Hdac7- and HIF-1α-mediated trans-activation. Coimmunoprecipitation assays showed that both Hdac7-u and Hdac7-s interacted with HIF-1α, whereas only Hdac7-s interacted with the transcriptional repressor CtBP1. Thus, Hdac7-u positively regulates HIF-1α-dependent TLR signaling in macrophages, whereas an interaction with CtBP1 likely prevents Hdac7-s from exerting this effect. Hdac7 may represent a potential inflammatory disease target. PMID:23853092

  19. Histone deacetylase 7 promotes Toll-like receptor 4-dependent proinflammatory gene expression in macrophages.

    Science.gov (United States)

    Shakespear, Melanie R; Hohenhaus, Daniel M; Kelly, Greg M; Kamal, Nabilah A; Gupta, Praveer; Labzin, Larisa I; Schroder, Kate; Garceau, Valerie; Barbero, Sheila; Iyer, Abishek; Hume, David A; Reid, Robert C; Irvine, Katharine M; Fairlie, David P; Sweet, Matthew J

    2013-08-30

    Broad-spectrum inhibitors of histone deacetylases (HDACs) constrain Toll-like receptor (TLR)-inducible production of key proinflammatory mediators. Here we investigated HDAC-dependent inflammatory responses in mouse macrophages. Of the classical Hdacs, Hdac7 was expressed at elevated levels in inflammatory macrophages (thioglycollate-elicited peritoneal macrophages) as compared with bone marrow-derived macrophages and the RAW264 cell line. Overexpression of a specific, alternatively spliced isoform of Hdac7 lacking the N-terminal 22 amino acids (Hdac7-u), but not the Refseq Hdac7 (Hdac7-s), promoted LPS-inducible expression of Hdac-dependent genes (Edn1, Il-12p40, and Il-6) in RAW264 cells. A novel class IIa-selective HDAC inhibitor reduced recombinant human HDAC7 enzyme activity as well as TLR-induced production of inflammatory mediators in thioglycollate-elicited peritoneal macrophages. Both LPS and Hdac7-u up-regulated the activity of the Edn1 promoter in an HDAC-dependent fashion in RAW264 cells. A hypoxia-inducible factor (HIF) 1 binding site in this promoter was required for HDAC-dependent TLR-inducible promoter activity and for Hdac7- and HIF-1α-mediated trans-activation. Coimmunoprecipitation assays showed that both Hdac7-u and Hdac7-s interacted with HIF-1α, whereas only Hdac7-s interacted with the transcriptional repressor CtBP1. Thus, Hdac7-u positively regulates HIF-1α-dependent TLR signaling in macrophages, whereas an interaction with CtBP1 likely prevents Hdac7-s from exerting this effect. Hdac7 may represent a potential inflammatory disease target.

  20. Association between promoter polymorphisms of OPN gene and cancer risk: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Liu JW

    2015-12-01

    Full Text Available Jingwei Liu,1–2 Caiyun He,1–2 Quan Yuan,1–2 Zhenning Wang,1–2 Chengzhong Xing,1–2 Yuan Yuan1–2 1Tumor Etiology and Screening Department of Cancer Institute and General Surgery, The First Affiliated Hospital of China Medical University, 2Key Laboratory of Cancer Etiology and Prevention, China Medical University, Liaoning Provincial Education Department, Shenyang, People’s Republic of China Background: Results of the association between polymorphisms of osteopontin (OPN gene promoter region and risk of cancer were inconclusive. The aim of this meta-analysis was to elucidate whether OPN promoter polymorphisms were associated with cancer risk.Methods: Electronic databases including PubMed, Web of Science, and Chinese National Knowledge Infrastructure were systematically searched. Odd ratios (ORs and their 95% confidential interval (CI were used to assess the strength of association between OPN promoter polymorphisms and cancer risks.Results: Nine studies were finally included in this meta-analysis. For OPN rs17524488 polymorphism, carriers of GG or -/G genotype were significantly associated with increased cancer risk compared with wild-type -/- carriers, respectively (GG vs -/-: OR =1.40, 95% CI =1.03–1.91, P=0.033; -/G vs -/-: OR =1.22, 95% CI =1.07–1.40, P=0.002. Additionally, G allele was significantly associated with increased cancer risk compared with (- allele (OR =1.21, 95% CI =1.04–1.40, P=0.016. However, no significant association was observed of OPN rs11730582 polymorphism and cancer risk (CC vs TT: OR =0.98, 95% CI =0.49–1.97, P=0.964; CT vs TT: OR =0.88, 95% CI =0.54–1.43, P=0.610.Conclusion: Carriers of GG or -/G genotype of OPN promoter rs17524488 (-156-/G polymorphism might be associated with increased risk of cancer compared with wild-type -/- carriers, respectively. However, no significant association was observed between OPN promoter rs11730582 (-443C/T polymorphism and risk of cancer. Keywords: OPN

  1. Actin-Dependent Alterations of Dendritic Spine Morphology in Shankopathies

    Directory of Open Access Journals (Sweden)

    Tasnuva Sarowar

    2016-01-01

    Full Text Available Shank proteins (Shank1, Shank2, and Shank3 act as scaffolding molecules in the postsynaptic density of many excitatory neurons. Mutations in SHANK genes, in particular SHANK2 and SHANK3, lead to autism spectrum disorders (ASD in both human and mouse models. Shank3 proteins are made of several domains—the Shank/ProSAP N-terminal (SPN domain, ankyrin repeats, SH3 domain, PDZ domain, a proline-rich region, and the sterile alpha motif (SAM domain. Via various binding partners of these domains, Shank3 is able to bind and interact with a wide range of proteins including modulators of small GTPases such as RICH2, a RhoGAP protein, and βPIX, a RhoGEF protein for Rac1 and Cdc42, actin binding proteins and actin modulators. Dysregulation of all isoforms of Shank proteins, but especially Shank3, leads to alterations in spine morphogenesis, shape, and activity of the synapse via altering actin dynamics. Therefore, here, we highlight the role of Shank proteins as modulators of small GTPases and, ultimately, actin dynamics, as found in multiple in vitro and in vivo models. The failure to mediate this regulatory role might present a shared mechanism in the pathophysiology of autism-associated mutations, which leads to dysregulation of spine morphogenesis and synaptic signaling.

  2. Promoter demethylation of Keap1 gene in human diabetic cataractous lenses

    Energy Technology Data Exchange (ETDEWEB)

    Palsamy, Periyasamy [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States); Ayaki, Masahiko [Shizuoka National Hospital, Saitama (Japan); Elanchezhian, Rajan [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States); Shinohara, Toshimichi, E-mail: tshinohara@unmc.edu [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States)

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer We found significant Keap1 promoter demethylation in diabetic cataractous lenses. Black-Right-Pointing-Pointer Demethylation of Keap1 gene upregulated the expression of Keap1 mRNA and protein. Black-Right-Pointing-Pointer Elevated levels of Keap1 are known to decrease the levels of Nrf2. Black-Right-Pointing-Pointer Thereby, the levels of antioxidant enzymes are suppressed by decreased Nrf2 level. -- Abstract: Age-related cataracts (ARCs) are the major cause of visual impairments worldwide, and diabetic adults tend to have an earlier onset of ARCs. Although age is the strongest risk factor for cataracts, little is known how age plays a role in the development of ARCs. It is known that oxidative stress in the lens increases with age and more so in the lenses of diabetics. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. We hypothesized that hyperglycemia will lead to a dysfunction of the Nrf2-dependent antioxidative protection in the lens of diabetics. We studied the methylation status of the CpG islands in 15 clear and 21 diabetic cataractous lenses. Our results showed significant levels of demethylated DNA in the Keap1 promoter in the cataractous lenses from diabetic patients. In contrast, highly methylated DNA was found in the clear lens and tumorized human lens epithelial cell (HLEC) lines (SRA01/04). HLECs treated with a demethylation agent, 5-aza-2 Prime deoxycytidine (5-Aza), had a 10-fold higher levels of Keap1 mRNA, 3-fold increased levels of Keap1 protein, produced higher levels of ROS, and increased cell death. Our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which

  3. Promoter demethylation of Keap1 gene in human diabetic cataractous lenses

    International Nuclear Information System (INIS)

    Palsamy, Periyasamy; Ayaki, Masahiko; Elanchezhian, Rajan; Shinohara, Toshimichi

    2012-01-01

    Highlights: ► We found significant Keap1 promoter demethylation in diabetic cataractous lenses. ► Demethylation of Keap1 gene upregulated the expression of Keap1 mRNA and protein. ► Elevated levels of Keap1 are known to decrease the levels of Nrf2. ► Thereby, the levels of antioxidant enzymes are suppressed by decreased Nrf2 level. -- Abstract: Age-related cataracts (ARCs) are the major cause of visual impairments worldwide, and diabetic adults tend to have an earlier onset of ARCs. Although age is the strongest risk factor for cataracts, little is known how age plays a role in the development of ARCs. It is known that oxidative stress in the lens increases with age and more so in the lenses of diabetics. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. We hypothesized that hyperglycemia will lead to a dysfunction of the Nrf2-dependent antioxidative protection in the lens of diabetics. We studied the methylation status of the CpG islands in 15 clear and 21 diabetic cataractous lenses. Our results showed significant levels of demethylated DNA in the Keap1 promoter in the cataractous lenses from diabetic patients. In contrast, highly methylated DNA was found in the clear lens and tumorized human lens epithelial cell (HLEC) lines (SRA01/04). HLECs treated with a demethylation agent, 5-aza-2′deoxycytidine (5-Aza), had a 10-fold higher levels of Keap1 mRNA, 3-fold increased levels of Keap1 protein, produced higher levels of ROS, and increased cell death. Our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which then increases the targeting of Nrf2 for proteosomal degradation. Decreased Nrf2 activity represses the

  4. Study on the binding sites of radiosensitivity associated transcription factor in the promoter region of Ier5 gene

    International Nuclear Information System (INIS)

    Cui Wei; Yin Lingling; Dong Lingyue

    2012-01-01

    Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)

  5. Mesoscopic model of actin-based propulsion.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available Two theoretical models dominate current understanding of actin-based propulsion: microscopic polymerization ratchet model predicts that growing and writhing actin filaments generate forces and movements, while macroscopic elastic propulsion model suggests that deformation and stress of growing actin gel are responsible for the propulsion. We examine both experimentally and computationally the 2D movement of ellipsoidal beads propelled by actin tails and show that neither of the two models can explain the observed bistability of the orientation of the beads. To explain the data, we develop a 2D hybrid mesoscopic model by reconciling these two models such that individual actin filaments undergoing nucleation, elongation, attachment, detachment and capping are embedded into the boundary of a node-spring viscoelastic network representing the macroscopic actin gel. Stochastic simulations of this 'in silico' actin network show that the combined effects of the macroscopic elastic deformation and microscopic ratchets can explain the observed bistable orientation of the actin-propelled ellipsoidal beads. To test the theory further, we analyze observed distribution of the curvatures of the trajectories and show that the hybrid model's predictions fit the data. Finally, we demonstrate that the model can explain both concave-up and concave-down force-velocity relations for growing actin networks depending on the characteristic time scale and network recoil. To summarize, we propose that both microscopic polymerization ratchets and macroscopic stresses of the deformable actin network are responsible for the force and movement generation.

  6. Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

    Science.gov (United States)

    Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

    2014-08-01

    Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

  7. Cloning and functional analysis of the promoters that upregulate carotenogenic gene expression during flower development in Gentiana lutea.

    Science.gov (United States)

    Zhu, Changfu; Yang, Qingjie; Ni, Xiuzhen; Bai, Chao; Sheng, Yanmin; Shi, Lianxuan; Capell, Teresa; Sandmann, Gerhard; Christou, Paul

    2014-04-01

    Over the last two decades, many carotenogenic genes have been cloned and used to generate metabolically engineered plants producing higher levels of carotenoids. However, comparatively little is known about the regulation of endogenous carotenogenic genes in higher plants, and this restricts our ability to predict how engineered plants will perform in terms of carotenoid content and composition. During petal development in the Great Yellow Gentian (Gentiana lutea), carotenoid accumulation, the formation of chromoplasts and the upregulation of several carotenogenic genes are temporally coordinated. We investigated the regulatory mechanisms responsible for this coordinated expression by isolating five G. lutea carotenogenic gene (GlPDS, GlZDS, GlLYCB, GlBCH and GlLYCE) promoters by inverse polymerase chain reaction (PCR). Each promoter was sufficient for developmentally regulated expression of the gusA reporter gene following transient expression in tomato (Solanum lycopersicum cv. Micro-Tom). Interestingly, the GlLYCB and GlBCH promoters drove high levels of gusA expression in chromoplast-containing mature green fruits, but low levels in chloroplast-containing immature green fruits, indicating a strict correlation between promoter activity, tomato fruit development and chromoplast differentiation. As well as core promoter elements such as TATA and CAAT boxes, all five promoters together with previously characterized GlZEP promoter contained three common cis-regulatory motifs involved in the response to methyl jasmonate (CGTCA) and ethylene (ATCTA), and required for endosperm expression (Skn-1_motif, GTCAT). These shared common cis-acting elements may represent binding sites for transcription factors responsible for co-regulation. Our data provide insight into the regulatory basis of the coordinated upregulation of carotenogenic gene expression during flower development in G. lutea. © 2013 Scandinavian Plant Physiology Society.

  8. Mediator subunit MED1 is a T3-dependent and T3-independent coactivator on the thyrotropin β gene promoter

    Energy Technology Data Exchange (ETDEWEB)

    Matsui, Keiji; Oda, Kasumi; Mizuta, Shumpei; Ishino, Ruri; Urahama, Norinaga; Hasegawa, Natsumi [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Roeder, Robert G. [Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Ito, Mitsuhiro, E-mail: itomi@med.kobe-u.ac.jp [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Department of Family and Community Medicine, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 654-0142 (Japan); Consolidated Research Institute for Advanced Science and Medical Care, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 159-8555 (Japan)

    2013-10-11

    Highlights: •MED1 is a bona fide T3-dependent coactivator on TSHB promoter. •Mice with LxxLL-mutant MED1 have attenuated TSHβ mRNA and thyroid hormone levels. •MED1 activates TSHB promoter T3-dependently in cultured cells. •T3-dependent MED1 action is enhanced when SRC1/SRC2 or HDAC2 is downregulated. •MED1 is also a T3-independent GATA2/Pit1 coactivator on TSHB promoter. -- Abstract: The MED1 subunit of the Mediator transcriptional coregulator complex is a nuclear receptor-specific coactivator. A negative feedback mechanism of thyroid-stimulating hormone (TSH, or thyrotropin) expression in the thyrotroph in the presence of triiodothyronine (T3) is employed by liganded thyroid hormone receptor β (TRβ) on the TSHβ gene promoter, where conventional histone-modifying coactivators act as corepressors. We now provide evidence that MED1 is a ligand-dependent positive cofactor on this promoter. TSHβ gene transcription was attenuated in MED1 mutant mice in which the nuclear receptor-binding ability of MED1 was specifically disrupted. MED1 stimulated GATA2- and Pit1-mediated TSHβ gene promoter activity in a ligand-independent manner in cultured cells. MED1 also stimulated transcription from the TSHβ gene promoter in a T3-dependent manner. The transcription was further enhanced when the T3-dependent corepressors SRC1, SRC2, and HDAC2 were downregulated. Hence, MED1 is a T3-dependent and -independent coactivator on the TSHβ gene promoter.

  9. Regulated expression of the human cytomegalovirus pp65 gene: Octamer sequence in the promoter is required for activation by viral gene products

    International Nuclear Information System (INIS)

    Depto, A.S.; Stenberg, R.M.

    1989-01-01

    To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection of the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene

  10. Evaluation of promoter methylation status of MLH1 gene in Iranian patients with colorectal tumors and adenoma polyps.

    Science.gov (United States)

    Zarandi, Ashkan; Irani, Shiva; Savabkar, Sanaz; Chaleshi, Vahid; Ghavideldarestani, Maryam; Mirfakhraie, Reza; Khodadoostan, Mahsa; Nazemalhosseini-Mojarad, Ehsan; Asadzadeh Aghdaei, Hamid

    2017-01-01

    The aim of this study was to evaluate the methylation status of the promoter region of MLH1 gene in colorectal cancer (CRC) and its precursor lesions as well as elucidate its association with various clinicopathological characteristics among Iranian population. Epigenetic silencing of mismatch repair genes, such as MLH1 , by methylation of CpG islands of their promoter region has been proved to be an important mechanism in colorectal carcinogenesis. Fifty colorectal cancer and polyp tissue samples including 13 Primary colorectal tumor and 37 Adenoma polyp samples were enrolled in this study. Methylation-specific polymerase chain reaction (MSP) was performed to find the frequency of MLH1 Promoter Methylation. Promoter methylation of MLH1 gene was detected in 5 out of 13 tumor tissues and 4 out of 37 adenoma polyp. The frequency of MLH1 methylation in tumor samples was significantly higher compared to that in polyp tissues (P= 0.026). No significant association was observed between MLH1 promoter methylation and clinicopathological characteristics of the patients. The frequency of  MLH1  promoter methylation in CRC and colon polyp was 18%. Our findings indicated that methylation of MLH1 promoter region alone cannot be considered as a biomarker for early detection of CRC.

  11. Expression of Nanog gene promotes NIH3T3 cell proliferation

    International Nuclear Information System (INIS)

    Zhang Jingyu; Wang Xia; Chen Bing; Suo Guangli; Zhao Yanhong; Duan Ziyuan; Dai Jianwu

    2005-01-01

    Cells are the functional elements in tissue engineering and regenerative medicine. A large number of cells are usually needed for these purposes. However, there are numbers of limitations for in vitro cell proliferation. Nanog is an important self-renewal determinant in embryonic stem cells. However, it remains unknown whether Nanog will influence the cell cycle and cell proliferation of mature cells. In this study, we expressed Nanog in NIH3T3 cells and showed that expression of Nanog in NIH3T3 promoted cells to enter into S phase and enhanced cell proliferation. This suggests that Nanog gene might function in a similar fashion in mature cells as in ES cells. In addition, it may provide an approach for in vitro cell expansion

  12. Horizontal gene transfer promoted evolution of the ability to propagate under anaerobic conditions in yeasts

    DEFF Research Database (Denmark)

    Gojkovic, Zoran; Knecht, Wolfgang; Warneboldt, J.

    2004-01-01

    The ability to propagate under anaerobic conditions is an essential and unique trait of brewer's or baker's yeast (Saccharomyces cervisiae). To understand the evolution of facultative anaerobiosis we studied the dependence of de novo pyrimidine biosynthesis, more precisely the fourth enzymic...... activity catalysed by dihydroorotate dehydrogenase (DHODase), on the enzymes of the respiratory chain in several yeast species. While the majority of yeasts possess a mitochondrial DHODase, Saccharomyces cerevisiae has a cytoplasmatic enzyme, whose activity is independent of the presence of oxygen. From....... We show that these two S. kluyveri enzymes, and their coding genes, differ in their dependence on the presence of oxygen. Only the cytoplasmic DHODase promotes growth in the absence of oxygen. Apparently a Saccharomyces yeast progenitor which had a eukaryotic-like mitochondrial DHODase acquired...

  13. DNA methylation dynamics in the rat EGF gene promoter after partial hepatectomy

    Directory of Open Access Journals (Sweden)

    Deming Li

    2014-06-01

    Full Text Available Epidermal growth factor (EGF, a multifunctional growth factor, is a regulator in a wide variety of physiological processes. EGF plays an important role in the regulation of liver regeneration. This study was aimed at investigating the methylation level of EGF gene throughout liver regeneration. DNA of liver tissue from control rats and partial hepatectomy (PH rats at 10 time points was extracted and a 354 bp fragment including 10 CpG sites from the transcription start was amplified after DNA was modified by sodium bisulfate. The result of sequencing suggested that methylation ratio of four CpG sites was found to be significantly changed when PH group was compared to control group, in particular two of them were extremely striking. mRNA expression of EGF was down-regulated in total during liver regeneration. We think that the rat EGF promoter region is regulated by variation in DNA methylation during liver regeneration.

  14. LL-37 induces polymerization and bundling of actin and affects actin structure.

    Directory of Open Access Journals (Sweden)

    Asaf Sol

    Full Text Available Actin exists as a monomer (G-actin which can be polymerized to filaments F-actin that under the influence of actin-binding proteins and polycations bundle and contribute to the formation of the cytoskeleton. Bundled actin from lysed cells increases the viscosity of sputum in lungs of cystic fibrosis patients. The human host defense peptide LL-37 was previously shown to induce actin bundling and was thus hypothesized to contribute to the pathogenicity of this disease. In this work, interactions between actin and the cationic LL-37 were studied by optical, proteolytic and surface plasmon resonance methods and compared to those obtained with scrambled LL-37 and with the cationic protein lysozyme. We show that LL-37 binds strongly to CaATP-G-actin while scrambled LL-37 does not. While LL-37, at superstoichiometric LL-37/actin concentrations polymerizes MgATP-G-actin, at lower non-polymerizing concentrations LL-37 inhibits actin polymerization by MgCl(2 or NaCl. LL-37 bundles Mg-F-actin filaments both at low and physiological ionic strength when in equimolar or higher concentrations than those of actin. The LL-37 induced bundles are significantly less sensitive to increase in ionic strength than those induced by scrambled LL-37 and lysozyme. LL-37 in concentrations lower than those needed for actin polymerization or bundling, accelerates cleavage of both monomer and polymer actin by subtilisin. Our results indicate that the LL-37-actin interaction is partially electrostatic and partially hydrophobic and that a specific actin binding sequence in the peptide is responsible for the hydrophobic interaction. LL-37-induced bundles, which may contribute to the accumulation of sputum in cystic fibrosis, are dissociated very efficiently by DNase-1 and also by cofilin.

  15. Actin grips: circular actin-rich cytoskeletal structures that mediate the wrapping of polymeric microfibers by endothelial cells.

    Science.gov (United States)

    Jones, Desiree; Park, DoYoung; Anghelina, Mirela; Pécot, Thierry; Machiraju, Raghu; Xue, Ruipeng; Lannutti, John J; Thomas, Jessica; Cole, Sara L; Moldovan, Leni; Moldovan, Nicanor I

    2015-06-01

    Interaction of endothelial-lineage cells with three-dimensional substrates was much less studied than that with flat culture surfaces. We investigated the in vitro attachment of both mature endothelial cells (ECs) and of less differentiated EC colony-forming cells to poly-ε-capro-lactone (PCL) fibers with diameters in 5-20 μm range ('scaffold microfibers', SMFs). We found that notwithstanding the poor intrinsic adhesiveness to PCL, both cell types completely wrapped the SMFs after long-term cultivation, thus attaining a cylindrical morphology. In this system, both EC types grew vigorously for more than a week and became increasingly more differentiated, as shown by multiplexed gene expression. Three-dimensional reconstructions from multiphoton confocal microscopy images using custom software showed that the filamentous (F) actin bundles took a conspicuous ring-like organization around the SMFs. Unlike the classical F-actin-containing stress fibers, these rings were not associated with either focal adhesions or intermediate filaments. We also demonstrated that plasma membrane boundaries adjacent to these circular cytoskeletal structures were tightly yet dynamically apposed to the SMFs, for which reason we suggest to call them 'actin grips'. In conclusion, we describe a particular form of F-actin assembly with relevance for cytoskeletal organization in response to biomaterials, for endothelial-specific cell behavior in vitro and in vivo, and for tissue engineering. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

    Directory of Open Access Journals (Sweden)

    Yasuhito Ohsaka

    2010-01-01

    Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

  17. Dragon (repulsive guidance molecule b, RGMb) is a novel gene that promotes colorectal cancer growth.

    Science.gov (United States)

    Shi, Ying; Chen, Guo-Bin; Huang, Xiao-Xiao; Xiao, Chuan-Xing; Wang, Huan-Huan; Li, Ye-Sen; Zhang, Jin-Fang; Li, Shao; Xia, Yin; Ren, Jian-Lin; Guleng, Bayasi

    2015-08-21

    Colorectal cancer (CRC) is one of the most commonly diagnosed cancers and a major cause of cancer death. However, the molecular mechanisms underlying CRC initiation, growth and metastasis are poorly understood. Dragon (RGMb), a member of the repulsive guidance molecule (RGM) family, has been recently identified as a co-receptor for bone morphogenetic protein (BMP) signaling, but the role of Dragon in CRC development is undefined. Here, we show that Dragon expression was increased in colon cancer tissues compared to control tissues in CAC mouse model and in human patients. Dragon promoted proliferation of CT26.WT and CMT93 colon cancer cells and accelerated tumor growth in the xenograft mouse model. Dragon's action on colon cancer development was mediated via the BMP4-Smad1/5/8 and Erk1/2 pathways. Therefore, our results have revealed that Dragon is a novel gene that promotes CRC growth through the BMP pathway. Dragon may be exploited as a potential therapeutic target for CRC treatment.

  18. PROMOTER POLYMORPHISM OF IL-1β GENE IN PATIENTS WITH A HISTORY OF ACUTE MYOCARDIAL INFARCTION

    Directory of Open Access Journals (Sweden)

    A. V. Shevchenko

    2010-01-01

    Full Text Available We have performed analysis of associations between IL-1β gene promoter polymorphism (-511C/T and -31 T/C variants, and conventional cardiovascular risk factors in the patients living in the West Siberia who had previously a history of myocardial infarction (MI. We are shown a strong linkage disequilibrium between IL-1β -31C/T (rs1143627, and IL-1β-511T/C (rs16944. Significant differences in frequency distributions of some compound genotypes were observed between healthy and patients with a history of MI. E.g., frequency of IL-1β-31CC/-511CT genotype was detected in 5.5 % of healthy population, while being absent among MI patients. A frequency of IL-1β (-31/-511 CC/CT genotype showed significant differences between MI patients under 55 years, as compared to healthy persons. Hence, the analyzed IL-1β promoter polymorphisms may be considered as an additional constitutional factor predisposing for vascular alterations.

  19. Cloning and functional analysis of promoters of three GnRH genes in a cichlid

    International Nuclear Information System (INIS)

    Kitahashi, Takashi; Sato, Hideki; Sakuma, Yasuo; Parhar, Ishwar S.

    2005-01-01

    Mechanisms regulating gonadotropin-releasing hormone (GnRH) types, a key molecule for reproductive physiology, remain unclear. In the present study, we cloned the promoters of GnRH1, GnRH2, and GnRH3 genes in the tilapia, Oreochromis niloticus; and found putative binding sites for glucocorticoid receptors, Sp1, C/EBP, GATA, and Oct-1, but not for androgen receptors in all three GnRH promoters using computer analysis. The presence of binding sites for progesterone receptors in GnRH1, estrogen receptors in GnRH1 and GnRH2, and thyroid hormone receptors in GnRH1 and GnRH3 suggests direct action of steroid hormones on GnRH types. Our observation of SOX and LINE-like sequences exclusively in GnRH1, COUP in GnRH2, and retinoid X receptors in GnRH3 suggests their role in sexual differentiation, midbrain segmentation, and visual cue integration, respectively. Thus, the characteristic binding sites for nuclear receptors and transcription factors support the notion that each GnRH type is regulated differently and has distinct physiological roles

  20. Stanniocalcin-2 is a HIF-1 target gene that promotes cell proliferation in hypoxia

    Energy Technology Data Exchange (ETDEWEB)

    Law, Alice Y.S. [Department of Biology, Hong Kong Baptist University, Kowloon Tong (Hong Kong); Wong, Chris K.C., E-mail: ckcwong@hkbu.edu.hk [Department of Biology, Hong Kong Baptist University, Kowloon Tong (Hong Kong)

    2010-02-01

    Stanniocalcin-2 (STC2), the paralog of STC1, has been suggested as a novel target of oxidative stress response to protect cells from apoptosis. The expression of STC2 has been reported to be highly correlated with human cancer development. In this study, we reported that STC2 is a HIF-1 target gene and is involved in the regulation of cell proliferation. STC2 was shown to be up-regulated in different breast and ovarian cancer cells, following exposure to hypoxia. Using ovarian cancer cells (SKOV3), the underlying mechanism of HIF-1 mediated STC2 gene transactivation was characterized. Hypoxia-induced STC2 expression was found to be HIF-1{alpha} dependent and required the recruitment of p300 and HDAC7. Using STC2 promoter deletion constructs and site-directed mutagenesis, two authentic consensus HIF-1 binding sites were identified. Under hypoxic condition, the silencing of STC2 reduced while the overexpression of STC2 increased the levels of phosphorylated retinoblastoma and cyclin D in both SKOV3 and MCF7 cells. The change in cell cycle proteins correlated with the data of the serial cell counts. The results indicated that cell proliferation was reduced in STC2-silenced cells but was increased in STC2-overexpressing hypoxic cells. Solid tumor progression is usually associated with hypoxia. The identification and functional analysis of STC2 up-regulation by hypoxia, a feature of the tumor microenvironment, sheds light on a possible role for STC2 in tumors.

  1. Human heme oxygenase-1 gene transfer lowers blood pressure and promotes growth in spontaneously hypertensive rats.

    Science.gov (United States)

    Sabaawy, H E; Zhang, F; Nguyen, X; ElHosseiny, A; Nasjletti, A; Schwartzman, M; Dennery, P; Kappas, A; Abraham, N G

    2001-08-01

    Heme oxygenase (HO) catalyzes the conversion of heme to biliverdin, with release of free iron and carbon monoxide. Both heme and carbon monoxide have been implicated in the regulation of vascular tone. A retroviral vector containing human HO-1 cDNA (LSN-HHO-1) was constructed and subjected to purification and concentration of the viral particles to achieve 5x10(9) to 1x10(10) colony-forming units per milliliter. The ability of concentrated infectious viral particles to express human HO-1 (HHO-1) in vivo was tested. A single intracardiac injection of the concentrated infectious viral particles (expressing HHO-1) to 5-day-old spontaneously hypertensive rats resulted in functional expression of the HHO-1 gene and attenuation of the development of hypertension. Rats expressing HHO-1 showed a significant decrease in urinary excretion of a vasoconstrictor arachidonic acid metabolite and a reduction in myogenic responses to increased intraluminal pressure in isolated arterioles. Unexpectedly, HHO-1 chimeric rats showed a simultaneous significant proportionate increase in somatic growth. Thus, delivery of HHO-1 gene by retroviral vector attenuates the development of hypertension and promotes body growth in spontaneously hypertensive rats.

  2. Gain of DNA methylation is enhanced in the absence of CTCF at the human retinoblastoma gene promoter

    International Nuclear Information System (INIS)

    Dávalos-Salas, Mercedes; Furlan-Magaril, Mayra; González-Buendía, Edgar; Valdes-Quezada, Christian; Ayala-Ortega, Erandi; Recillas-Targa, Félix

    2011-01-01

    Long-term gene silencing throughout cell division is generally achieved by DNA methylation and other epigenetic processes. Aberrant DNA methylation is now widely recognized to be associated with cancer and other human diseases. Here we addressed the contribution of the multifunctional nuclear factor CTCF to the epigenetic regulation of the human retinoblastoma (Rb) gene promoter in different tumoral cell lines. To assess the DNA methylation status of the Rb promoter, genomic DNA from stably transfected human erythroleukemic K562 cells expressing a GFP reporter transgene was transformed with sodium bisulfite, and then PCR-amplified with modified primers and sequenced. Single- and multi-copy integrants with the CTCF binding site mutated were isolated and characterized by Southern blotting. Silenced transgenes were reactivated using 5-aza-2'-deoxycytidine and Trichostatin-A, and their expression was monitored by fluorescent cytometry. Rb gene expression and protein abundance were assessed by RT-PCR and Western blotting in three different glioma cell lines, and DNA methylation of the promoter region was determined by sodium bisulfite sequencing, together with CTCF dissociation and methyl-CpG-binding protein incorporation by chromatin immunoprecipitation assays. We found that the inability of CTCF to bind to the Rb promoter causes a dramatic loss of gene expression and a progressive gain of DNA methylation. This study indicates that CTCF plays an important role in maintaining the Rb promoter in an optimal chromatin configuration. The absence of CTCF induces a rapid epigenetic silencing through a progressive gain of DNA methylation. Consequently, CTCF can now be seen as one of the epigenetic components that allows the proper configuration of tumor suppressor gene promoters. Its aberrant dissociation can then predispose key genes in cancer cells to acquire DNA methylation and epigenetic silencing

  3. Probing friction in actin-based motility

    International Nuclear Information System (INIS)

    Marcy, Yann; Joanny, Jean-Francois; Prost, Jacques; Sykes, Cecile

    2007-01-01

    Actin dynamics are responsible for cell protrusion and certain intracellular movements. The transient attachment of the actin filaments to a moving surface generates a friction force that resists the movement. We probe here the dynamics of these attachments by inducing a stick-slip behavior via micromanipulation of a growing actin comet. We show that general principles of adhesion and friction can explain our observations

  4. Cytoskeletal actin dynamics shape a ramifying actin network underpinning immunological synapse formation

    DEFF Research Database (Denmark)

    Fritzsche, Marco; Fernandes, Ricardo A.; Chang, Veronica T.

    2017-01-01

    optical microscopes to analyze resting and activated T cells, we show that, following contact formation with activating surfaces, these cells sequentially rearrange their cortical actin across the entire cell, creating a previously unreported ramifying actin network above the immunological synapse...

  5. Abhydrolase domain containing 2, an androgen target gene, promotes prostate cancer cell proliferation and migration.

    Science.gov (United States)

    Obinata, Daisuke; Takada, Shogo; Takayama, Ken-ichi; Urano, Tomohiko; Ito, Akiko; Ashikari, Daisaku; Fujiwara, Kyoko; Yamada, Yuta; Murata, Taro; Kumagai, Jinpei; Fujimura, Tetsuya; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Homma, Yukio; Takahashi, Satoru; Inoue, Satoshi

    2016-04-01

    The androgen receptor (AR) plays a key role in the development of prostate cancer. AR signalling mediates the expression of androgen-responsive genes, which are involved in prostate cancer development and progression. Our previous chromatin immunoprecipitation study showed that the region of abhydrolase domain containing 2 (ABHD2) includes a functional androgen receptor binding site. In this study, we demonstrated that ABHD2 is a novel androgen-responsive gene that is overexpressed in human prostate cancer tissues. The expression levels of ABHD2 in androgen-sensitive cells were evaluated by quantitative reverse transcription polymerase chain reaction and western-blot analyses. LNCaP and VCaP cells with ABHD2 overexpression or short interfering RNA (siRNA) knockdown were used for functional analyses. ABHD2 expression was examined in clinical samples of prostate cancer by immunohistochemistry. We showed that ABHD2 expression is increased by androgen in LNCaP and VCaP cells. This androgen-induced ABHD2 expression was diminished by bicalutamide. While stable expression of ABHD2 affected the enhancement of LNCaP cell proliferation and migration, siRNA-mediated ABHD2 knockdown suppressed cell proliferation and migration. In addition, the siRNA treatment significantly repressed the tumour growth derived from LNCaP cells in athymic mice. Immunohistochemical analysis of ABHD2 expression in tumour specimens showed a positive correlation of ABHD2 immunoreactivity with high Gleason score and pathological N stage. Moreover, patients with high immunoreactivity of ABHD2 showed low cancer-specific survival rates and a resistance to docetaxel-based chemotherapy. ABHD2 is a novel androgen-regulated gene that can promote prostate cancer growth and resistance to chemotherapy, and is a novel target for diagnosis and treatment of prostate cancer. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Ancestral TCDD exposure promotes epigenetic transgenerational inheritance of imprinted gene Igf2: Methylation status and DNMTs

    International Nuclear Information System (INIS)

    Ma, Jing; Chen, Xi; Liu, Yanan; Xie, Qunhui; Sun, Yawen; Chen, Jingshan; Leng, Ling; Yan, Huan; Zhao, Bin; Tang, Naijun

    2015-01-01

    Ancestral TCDD exposure could induce epigenetic transgenerational phenotypes, which may be mediated in part by imprinted gene inheritance. The aim of our study was to evaluate the transgenerational effects of ancestral TCDD exposure on the imprinted gene insulin-like growth factor-2 (Igf2) in rat somatic tissue. TCDD was administered daily by oral gavage to groups of F0 pregnant SD rats at dose levels of 0 (control), 200 or 800 ng/kg bw during gestation day 8–14. Animal transgenerational model of ancestral exposure to TCDD was carefully built, avoiding sibling inbreeding. Hepatic Igf2 expression of the TCDD male progeny was decreased concomitantly with hepatic damage and increased activities of serum hepatic enzymes both in the F1 and F3 generation. Imprinted Control Region (ICR) of Igf2 manifested a hypermethylated pattern, whereas methylation status in the Differentially Methylated Region 2 (DMR2) showed a hypomethylated manner in the F1 generation. These epigenetic alterations in these two regions maintained similar trends in the F3 generation. Meanwhile, the expressions of DNA methyltransferases (DNMT1, DNMT3A and DNMT3B) changed in a non-monotonic manner both in the F1 and F3 generation. This study provides evidence that ancestral TCDD exposure may promote epigenetic transgenerational alterations of imprinted gene Igf2 in adult somatic tissue. - Highlights: • Ancestral TCDD exposure induces epigenetic transgenerational inheritance. • Ancestral TCDD exposure affects methylation status in ICR and DMR2 region of Igf2. • DNMTs play a role in TCDD induced epigenetic transgenerational changes of Igf2.

  7. Induction of interferon-stimulated genes by IRF3 promotes replication of Toxoplasma gondii.

    Science.gov (United States)

    Majumdar, Tanmay; Chattopadhyay, Saurabh; Ozhegov, Evgeny; Dhar, Jayeeta; Goswami, Ramansu; Sen, Ganes C; Barik, Sailen

    2015-03-01

    Innate immunity is the first line of defense against microbial insult. The transcription factor, IRF3, is needed by mammalian cells to mount innate immune responses against many microbes, especially viruses. IRF3 remains inactive in the cytoplasm of uninfected cells; upon virus infection, it gets phosphorylated and then translocates to the nucleus, where it binds to the promoters of antiviral genes and induces their expression. Such genes include type I interferons (IFNs) as well as Interferon Stimulated Genes (ISGs). IRF3-/- cells support enhanced replication of many viruses and therefore, the corresponding mice are highly susceptible to viral pathogenesis. Here, we provide evidence for an unexpected pro-microbial role of IRF3: the replication of the protozoan parasite, Toxoplasma gondii, was significantly impaired in IRF3-/- cells. In exploring whether the transcriptional activity of IRF3 was important for its pro-parasitic function, we found that ISGs induced by parasite-activated IRF3 were indeed essential, whereas type I interferons were not important. To delineate the signaling pathway that activates IRF3 in response to parasite infection, we used genetically modified human and mouse cells. The pro-parasitic signaling pathway, which we termed PISA (Parasite-IRF3 Signaling Activation), activated IRF3 without any involvement of the Toll-like receptor or RIG-I-like receptor pathways, thereby ruling out a role of parasite-derived RNA species in activating PISA. Instead, PISA needed the presence of cGAS, STING, TBK1 and IRF3, indicating the necessity of DNA-triggered signaling. To evaluate the physiological significance of our in vitro findings, IRF3-/- mice were challenged with parasite infection and their morbidity and mortality were measured. Unlike WT mice, the IRF3-/- mice did not support replication of the parasite and were resistant to pathogenesis caused by it. Our results revealed a new paradigm in which the antiviral host factor, IRF3, plays a cell

  8. Mutational analysis of the promoter and the coding region of the 5-HT1A gene

    Energy Technology Data Exchange (ETDEWEB)

    Erdmann, J.; Noethen, M.M.; Shimron-Abarbanell, D. [Univ. of Bonn (Germany)] [and others

    1994-09-01

    Disturbances of serotonergic pathways have been implicated in many neuropsychiatric disorders. Serotonin (5HT) receptors can be subdivided into at least three major families (5HT1, 5HT2, and 5HT3). Five human 5HT1 receptor subtypes have been cloned, namely 1A, 1D{alpha}, 1D{beta}, 1E, and 1F. Of these, the 5HT1A receptor is the best characterized subtype. In the present study we sought to identify genetic variation in the 5HT1A receptor gene which through alteration of protein function or level of expression might contribute to the genetics of neuropsychiatric diseases. The coding region and the 5{prime} promoter region of the 5HT1A gene from 159 unrelated subjects (45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 controls) were analyzed using SSCA. SSCA revealed the presence of two mutations both located in the coding region of the 5HT1A receptor gene. The first mutation is a rare silent C{r_arrow}T substitution at nucleotide position 549. The second mutation is characterized by a base pair substitution (A{r_arrow}G) at the first position of codon 28 and results in an amino acid exchange (Ile{r_arrow}Val). Since Val28 was found only in a single schizophrenic patient and in none of the other patients or controls, we decided to extend our samples and to use a restriction assay for screening a further 74 schizophrenic, 95 bipolar affective, and 49 patients with Tourette`s syndrome, as well as 185 controls, for the presence of the mutation. In total, the mutation was found in 2 schizophrenic patients, in 3 bipolars, in 1 Tourette patient, and in 5 controls. To our knowledge the Ile-28-Val substitution reported here is the first natural occuring molecular variant which has been identified for a serotonin receptor so far.

  9. Ancestral TCDD exposure promotes epigenetic transgenerational inheritance of imprinted gene Igf2: Methylation status and DNMTs

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Jing; Chen, Xi; Liu, Yanan [Department of Occupational and Environmental Health, School of Public Health, Tianjin Medical University, Tianjin 300070 (China); Xie, Qunhui [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085 (China); Sun, Yawen; Chen, Jingshan; Leng, Ling; Yan, Huan [Department of Occupational and Environmental Health, School of Public Health, Tianjin Medical University, Tianjin 300070 (China); Zhao, Bin, E-mail: binzhao@rcees.ac.cn [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085 (China); Tang, Naijun, E-mail: tangnaijun@tijmu.edu.cn [Department of Occupational and Environmental Health, School of Public Health, Tianjin Medical University, Tianjin 300070 (China)

    2015-12-01

    Ancestral TCDD exposure could induce epigenetic transgenerational phenotypes, which may be mediated in part by imprinted gene inheritance. The aim of our study was to evaluate the transgenerational effects of ancestral TCDD exposure on the imprinted gene insulin-like growth factor-2 (Igf2) in rat somatic tissue. TCDD was administered daily by oral gavage to groups of F0 pregnant SD rats at dose levels of 0 (control), 200 or 800 ng/kg bw during gestation day 8–14. Animal transgenerational model of ancestral exposure to TCDD was carefully built, avoiding sibling inbreeding. Hepatic Igf2 expression of the TCDD male progeny was decreased concomitantly with hepatic damage and increased activities of serum hepatic enzymes both in the F1 and F3 generation. Imprinted Control Region (ICR) of Igf2 manifested a hypermethylated pattern, whereas methylation status in the Differentially Methylated Region 2 (DMR2) showed a hypomethylated manner in the F1 generation. These epigenetic alterations in these two regions maintained similar trends in the F3 generation. Meanwhile, the expressions of DNA methyltransferases (DNMT1, DNMT3A and DNMT3B) changed in a non-monotonic manner both in the F1 and F3 generation. This study provides evidence that ancestral TCDD exposure may promote epigenetic transgenerational alterations of imprinted gene Igf2 in adult somatic tissue. - Highlights: • Ancestral TCDD exposure induces epigenetic transgenerational inheritance. • Ancestral TCDD exposure affects methylation status in ICR and DMR2 region of Igf2. • DNMTs play a role in TCDD induced epigenetic transgenerational changes of Igf2.

  10. Differential methylation at the RELN gene promoter in temporal cortex from autistic and typically developing post-puberal subjects.

    Science.gov (United States)

    Lintas, Carla; Sacco, Roberto; Persico, Antonio M

    2016-01-01

    Reelin plays a pivotal role in neurodevelopment and in post-natal synaptic plasticity and has been implicated in the pathogenesis of autism spectrum disorder (ASD). The reelin (RELN) gene expression is significantly decreased in ASD, both in the brain and peripherally. Methylation at the RELN gene promoter is largely triggered at puberty, and hypermethylation has been found in post-mortem brains of schizophrenic and bipolar patients. In this study, we assessed RELN gene methylation status in post-mortem temporocortical tissue samples (BA41/42 or 22) of six pairs of post-puberal individuals with ASD and typically developing subjects, matched for sex (male:female, M:F = 5:1), age, and post-mortem interval. ASD patients display a significantly higher number of methylated CpG islands and heavier methylation in the 5' region of the RELN gene promoter, spanning from -458 to -223 bp, whereas controls have more methylated CpG positions and greater extent of methylation at the 3' promoter region, spanning from -222 to +1 bp. The most upstream promoter region (-458 to -364 bp) is methylated only in ASD brains, while the most downstream region (-131 to +1 bp) is methylated exclusively in control brains. Within this general framework, three different methylation patterns are discernible, each correlated with different extents of reduction in reelin gene expression among ASD individuals compared to controls. The methylation pattern is different in ASD and control post-mortem brains. ASD-specific CpG positions, located in the most upstream gene promoter region, may exert a functional role potentially conferring ASD risk by blunting RELN gene expression.

  11. The Relationship between FHIT Gene Promoter Methylation and Lung Cancer Risk: 
a Meta-analysis

    Directory of Open Access Journals (Sweden)

    Yichang SUN

    2014-03-01

    Full Text Available Background and objective Tumor-suppressor gene promoter DNA methylation in tumor cells is associated with its reduced expression. FHIT (fragile histindine triad was one of the important tumor suppressor genes which was found hypermethylated in the promoter region in most of tumors. The aim of this study is to evaluate the relationship between FIHT gene promother methylation and lung cancer risk by meta-analysis. Methods By searching Pubmed, CNKI and Wanfang, the open published articles related to FHIT gene promoter methylation and lung carcinoma risk were collected. The odds ratio (OR and range of FHIT gene of cancer tissue of lung cancer patients compared with normal lung tissue, plasma and the bronchial lavage fluid were pooled by statistical software Stata 11.0. Results Eleven studies were finally included in this meta-analysis. The median methylation rate were Pmedian=40.0% (0-68.3%, Pmedian=8.7% (0-35.0%, Pmedian=33.3% (17.1%-38.3% and Pmedian=35.9% (31.1%-50.8% in cancer tissue, NLT, BALF and plasm respectively. The pooled results showed the methylation rate in tumor tissue was much higer than that of NLT OR=5.82 (95%CI: 3.74-9.06, P0.05 and plasma OR=1.41 (95%CI: 0.90-2.20, P>0.05. Conclusion Hypermethylation of FHIT gene promoter region was found more frequent in cancer tissue than that of NLT which may demonstrated association between lung cancer risk and FHIT gene promoter methylation.

  12. Geometrical Determinants of Neuronal Actin Waves.

    Science.gov (United States)

    Tomba, Caterina; Braïni, Céline; Bugnicourt, Ghislain; Cohen, Floriane; Friedrich, Benjamin M; Gov, Nir S; Villard, Catherine

    2017-01-01

    Hippocampal neurons produce in their early stages of growth propagative, actin-rich dynamical structures called actin waves. The directional motion of actin waves from the soma to the tip of neuronal extensions has been associated with net forward growth, and ultimately with the specification of neurites into axon and dendrites. Here, geometrical cues are used to control actin wave dynamics by constraining neurons on adhesive stripes of various widths. A key observable, the average time between the production of consecutive actin waves, or mean inter-wave interval (IWI), was identified. It scales with the neurite width, and more precisely with the width of the proximal segment close to the soma. In addition, the IWI is independent of the total number of neurites. These two results suggest a mechanistic model of actin wave production, by which the material conveyed by actin waves is assembled in the soma until it reaches the threshold leading to the initiation and propagation of a new actin wave. Based on these observations, we formulate a predictive theoretical description of actin wave-driven neuronal growth and polarization, which consistently accounts for different sets of experiments.

  13. Combination of heavy-ion radiotherapy and p53-gene therapy by radio- and hypoxia-sensitizing promoter for glioma

    International Nuclear Information System (INIS)

    Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie

    2006-01-01

    In this study we have started to investigate the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing E 9ns-2 /cytomegalovirus (CMV) chimeric promoter (Scott et al: 2003) in p53-gene therapy. Our study in the first year, however, suggested the uselessness of E 9ns-2 /CMV chimeric promoter. Then we applied E 9ns-2 /Epo5/CMV-radio and hypoxia-sensitizing chimeric promoter to amplify p53 gene exopression. P53 gene with E 9ns2 /Epo5/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 1 Gy of high linear energy transfer (LET)-carbon ion beam or low-LET X-ray under various hypoxic conditions. The result suggested the possible role of 1 Gy of high LET-carbon ion beam as a ''useful trigger'' to enhance a selective anti-tumor effect toward glioma under hypoxic condition through amplification of p53 gene expression. (author)

  14. THE ABERRANT PROMOTER HYPERMETHYLATION PATTERN OF THE ANTI - ANGIOGENIC TSP1 GENE IN EPITHELIAL OVARIAN CARCINOMA: AN INDIAN STUDY

    Directory of Open Access Journals (Sweden)

    Ramesh

    2015-06-01

    Full Text Available PURPOSE: The promoter hypermethylation patterns of Thrombospodin - 1 gene in 50 EOC patients were studied and the methylation pattern was correlated with various clinic pathological parameters. METHODS: The promoter hypermethylation pattern of the TSP - 1 gene was assessed using nested PCR and Methylation specific PCR. STATISTICAL ANALYSIS: All the available data was statistically analyzed using the Chi square test or Fisher Exact Test on the SPSS software version 22.0 and a value <0.0 5 was considered statistically significant. RESULTS: Forty of the fifty ovarian carcinoma samples reported positive for methylation corresponding to a methylation frequency of 80%. A methylation frequency of 89.2%, 83.3% and 42.8% was observed in malignant , Low malignant potential (borderline and benign sample cohorts. CONCLUSION: From the results drawn from this study, it clearly shows that the anti angiogenic protein TSP - 1 is extensively hypermethylated in ovarian carcinoma and that it accumulates over t he progression of the disease from benign to malignant. As previous reports suggest that there is no evidence of mutation of this gene, promoter hypermethylation may be a crucial factor for the down regulation of the gene. Further by clubbing together the promoter hypermethylation pattern of TSP - 1 gene with hypermethylation patterns of other TSG may provide a better insight into the application of using methylation profiles of TSG as a biomarker in the detection of ovarian carcinoma.

  15. Espins and the actin cytoskeleton of hair cell stereocilia and sensory cell microvilli

    Science.gov (United States)

    Sekerková, Gabriella; Zheng, Lili; Loomis, Patricia A.; Mugnaini, Enrico; Bartles, James R.

    2008-01-01

    The espins are novel actin-bundling proteins that are produced in multiple isoforms from a single gene. They are present at high concentration in the parallel actin bundle of hair cell stereocilia and are the target of deafness mutations in mice and humans. Espins are also enriched in the microvilli of taste receptor cells, solitary chemoreceptor cells, vomeronasal sensory neurons and Merkel cells, suggesting that espins play important roles in the microvillar projections of vertebrate sensory cells. Espins are potent actin-bundling proteins that are not inhibited by Ca2+. In cells, they efficiently elongate parallel actin bundles and, thereby, help determine the steady-state length of microvilli and stereocilia. Espins bind actin monomer via their WH2 domain and can assemble actin bundles in cells. Certain espin isoforms can also bind phosphatidylinositol 4,5-bisphosphate, profilins or SH3 proteins. These biological activities distinguish espins from other actin-bundling proteins and may make them well-suited to sensory cells. PMID:16909209

  16. Pharmacological treatment of actinic keratosis

    Directory of Open Access Journals (Sweden)

    Ewa Zwierzyńska

    2016-09-01

    Full Text Available Actinic keratosis (AK is a disease characterized by hyperkeratotic lesions on skin damaged by ultraviolet. radiation. These lesions may progress to squamous cell or basal cell carcinoma. Currently pharmacotherapy and different surgical procedures are used in AK therapy. The most common treatment options are 5-fluorouracil, imiquimod, diclofenac, ingenol mebutate, and first and third generation retinoids (retinol, adapalene, tazarotene. Furthermore, research is being carried out in order to test new medications including nicotinamide, resiquimod, piroxicam, potassium dobesilate and oleogel based on a triterpene extract (betulin, betulinic acid. Recently, the preventive effect of acetylsalicylic acid and celecoxib has also been investigated.

  17. Genomic instability in human actinic keratosis and squamous cell carcinoma

    Science.gov (United States)

    Cabral, Luciana Sanches; Neto, Cyro Festa; Sanches, José A; Ruiz, Itamar R G

    2011-01-01

    OBJECTIVE: To compare the repetitive DNA patterns of human actinic keratoses and squamous cell carcinomas to determine the genetic alterations that are associated with malignant transformation. INTRODUCTION: Cancer cells are prone to genomic instability, which is often due to DNA polymerase slippage during the replication of repetitive DNA and to mutations in the DNA repair genes. The progression of benign actinic keratoses to malignant squamous cell carcinomas has been proposed by several authors. MATERIAL AND METHODS: Eight actinic keratoses and 24 squamous cell carcinomas (SCC), which were pair-matched to adjacent skin tissues and/or leucocytes, were studied. The presence of microsatellite instability (MSI) and the loss of heterozygosity (LOH) in chromosomes 6 and 9 were investigated using nine PCR primer pairs. Random Amplified Polymorphic DNA patterns were also evaluated using eight primers. RESULTS: MSI was detected in two (D6S251, D9S50) of the eight actinic keratosis patients. Among the 8 patients who had squamous cell carcinoma-I and provided informative results, a single patient exhibited two LOH (D6S251, D9S287) and two instances of MSI (D9S180, D9S280). Two LOH and one example of MSI (D6S251) were detected in three out of the 10 patients with squamous cell carcinoma-II. Among the four patients with squamous cell carcinoma-III, one patient displayed three MSIs (D6S251, D6S252, and D9S180) and another patient exhibited an MSI (D9S280). The altered random amplified polymorphic DNA ranged from 70% actinic keratoses, 76% squamous cell carcinoma-I, and 90% squamous cell carcinoma-II, to 100% squamous cell carcinoma-III. DISCUSSION: The increased levels of alterations in the microsatellites, particularly in D6S251, and the random amplified polymorphic DNA fingerprints were statistically significant in squamous cell carcinomas, compared with actinic keratoses. CONCLUSION: The overall alterations that were observed in the repetitive DNA of actinic keratoses and

  18. Generation and evaluation of an IPTG-regulated version of Vav-gene promoter for mouse transgenesis.

    Directory of Open Access Journals (Sweden)

    Francesca Grespi

    2011-03-01

    Full Text Available Different bacteria-derived systems for regulatable gene expression have been developed for the use in mammalian cells and some were also successfully adopted for in vivo use in vertebrate model organisms. However, certain limitations apply to most of these systems, including leakiness of transgene expression, inefficient transgene silencing or activation, as well as limited tissue accessibility of transgene-inducers or their unfavourable pharmacokinetics. In this study, we evaluated the suitability of the lac-operon/lac-repressor (lacO/lacI system for the regulation of the well-established Vav-gene promoter that allows inducible transgene expression in different haematopoietic lineages in mice. Using the fluorescence marker protein Venus as a reporter, we observed that the lacO/lacI system could be amended to modulate transgene-expression in haematopoietic cells. However, reporter expression was not uniform and the lacO elements introduced into the Vav-gene promoter only conferred limited repression and reversion of lacI-mediated gene silencing after administration of IPTG. Although further optimization of the system is required, the lacO-modified version of the Vav-gene promoter may be adopted as a tool where low basal gene-expression and limited transient induction of protein expression are desired, e.g. for the activation of oncogenes or transgenes that act in a dominant-negative manner.

  19. Paralogous SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) genes differentially regulate leaf initiation and reproductive phase change in petunia.

    Science.gov (United States)

    Preston, Jill C; Jorgensen, Stacy A; Orozco, Rebecca; Hileman, Lena C

    2016-02-01

    Duplicated petunia clade-VI SPL genes differentially promote the timing of inflorescence and flower development, and leaf initiation rate. The timing of plant reproduction relative to favorable environmental conditions is a critical component of plant fitness, and is often associated with variation in plant architecture and habit. Recent studies have shown that overexpression of the microRNA miR156 in distantly related annual species results in plants with perennial characteristics, including late flowering, weak apical dominance, and abundant leaf production. These phenotypes are largely mediated through the negative regulation of a subset of genes belonging to the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) family of transcription factors. In order to determine how and to what extent paralogous SPL genes have partitioned their roles in plant growth and development, we functionally characterized petunia clade-VI SPL genes under different environmental conditions. Our results demonstrate that PhSBP1and PhSBP2 differentially promote discrete stages of the reproductive transition, and that PhSBP1, and possibly PhCNR, accelerates leaf initiation rate. In contrast to the closest homologs in annual Arabidopsis thaliana and Mimulus guttatus, PhSBP1 and PhSBP2 transcription is not mediated by the gibberellic acid pathway, but is positively correlated with photoperiod and developmental age. The developmental functions of clade-VI SPL genes have, thus, evolved following both gene duplication and speciation within the core eudicots, likely through differential regulation and incomplete sub-functionalization.

  20. Modulating ectopic gene expression levels by using retroviral vectors equipped with synthetic promoters

    OpenAIRE

    Ferreira, Joshua P.; Peacock, Ryan W. S.; Lawhorn, Ingrid E. B.; Wang, Clifford L.

    2011-01-01

    The human cytomegalovirus and elongation factor 1α promoters are constitutive promoters commonly employed by mammalian expression vectors. These promoters generally produce high levels of expression in many types of cells and tissues. To generate a library of synthetic promoters capable of generating a range of low, intermediate, and high expression levels, the TATA and CAAT box elements of these promoters were mutated. Other promoter variants were also generated by random mutagenesis. Evalua...

  1. Mena–GRASP65 interaction couples actin polymerization to Golgi ribbon linking

    Science.gov (United States)

    Tang, Danming; Zhang, Xiaoyan; Huang, Shijiao; Yuan, Hebao; Li, Jie; Wang, Yanzhuang

    2016-01-01

    In mammalian cells, the Golgi reassembly stacking protein 65 (GRASP65) has been implicated in both Golgi stacking and ribbon linking by forming trans-oligomers through the N-terminal GRASP domain. Because the GRASP domain is globular and relatively small, but the gaps between stacks are large and heterogeneous, it remains puzzling how GRASP65 physically links Golgi stacks into a ribbon. To explore the possibility that other proteins may help GRASP65 in ribbon linking, we used biochemical methods and identified the actin elongation factor Mena as a novel GRASP65-binding protein. Mena is recruited onto the Golgi membranes through interaction with GRASP65. Depleting Mena or disrupting actin polymerization resulted in Golgi fragmentation. In cells, Mena and actin were required for Golgi ribbon formation after nocodazole washout; in vitro, Mena and microfilaments enhanced GRASP65 oligomerization and Golgi membrane fusion. Thus Mena interacts with GRASP65 to promote local actin polymerization, which facilitates Golgi ribbon linking. PMID:26538023

  2. Mediator, TATA-binding Protein, and RNA Polymerase II Contribute to Low Histone Occupancy at Active Gene Promoters in Yeast*

    Science.gov (United States)

    Ansari, Suraiya A.; Paul, Emily; Sommer, Sebastian; Lieleg, Corinna; He, Qiye; Daly, Alexandre Z.; Rode, Kara A.; Barber, Wesley T.; Ellis, Laura C.; LaPorta, Erika; Orzechowski, Amanda M.; Taylor, Emily; Reeb, Tanner; Wong, Jason; Korber, Philipp; Morse, Randall H.

    2014-01-01

    Transcription by RNA polymerase II (Pol II) in eukaryotes requires the Mediator complex, and often involves chromatin remodeling and histone eviction at active promoters. Here we address the role of Mediator in recruitment of the Swi/Snf chromatin remodeling complex and its role, along with components of the preinitiation complex (PIC), in histone eviction at inducible and constitutively active promoters in the budding yeast Saccharomyces cerevisiae. We show that recruitment of the Swi/Snf chromatin remodeling complex to the induced CHA1 promoter, as well as its association with several constitutively active promoters, depends on the Mediator complex but is independent of Mediator at the induced MET2 and MET6 genes. Although transcriptional activation and histone eviction at CHA1 depends on Swi/Snf, Swi/Snf recruitment is not sufficient for histone eviction at the induced CHA1 promoter. Loss of Swi/Snf activity does not affect histone occupancy of several constitutively active promoters; in contrast, higher histone occupancy is seen at these promoters in Mediator and PIC component mutants. We propose that an initial activator-dependent, nucleosome remodeling step allows PIC components to outcompete histones for occupancy of promoter sequences. We also observe reduced promoter association of Mediator and TATA-binding protein in a Pol II (rpb1-1) mutant, indicating mutually cooperative binding of these components of the transcription machinery and indicating that it is the PIC as a whole whose binding results in stable histone eviction. PMID:24727477

  3. Pairwise comparisons of ten porcine tissues identify differential transcriptional regulation at the gene, isoform, promoter and transcription start site level

    International Nuclear Information System (INIS)

    Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal; Thomsen, Bo; Larsen, Knud; Hedegaard, Jakob; Bendixen, Christian; Madsen, Lone Bruhn

    2013-01-01

    Highlights: •Transcriptome sequencing yielded 223 mill porcine RNA-seq reads, and 59,000 transcribed locations. •Establishment of unique transcription profiles for ten porcine tissues including four brain tissues. •Comparison of transcription profiles at gene, isoform, promoter and transcription start site level. •Highlights a high level of regulation of neuro-related genes at both gene, isoform, and TSS level. •Our results emphasize the pig as a valuable animal model with respect to human biological issues. -- Abstract: The transcriptome is the absolute set of transcripts in a tissue or cell at the time of sampling. In this study RNA-Seq is employed to enable the differential analysis of the transcriptome profile for ten porcine tissues in order to evaluate differences between the tissues at the gene and isoform expression level, together with an analysis of variation in transcription start sites, promoter usage, and splicing. Totally, 223 million RNA fragments were sequenced leading to the identification of 59,930 transcribed gene locations and 290,936 transcript variants using Cufflinks with similarity to approximately 13,899 annotated human genes. Pairwise analysis of tissues for differential expression at the gene level showed that the smallest differences were between tissues originating from the porcine brain. Interestingly, the relative level of differential expression at the isoform level did generally not vary between tissue contrasts. Furthermore, analysis of differential promoter usage between tissues, revealed a proportionally higher variation between cerebellum (CBE) versus frontal cortex and cerebellum versus hypothalamus (HYP) than in the remaining comparisons. In addition, the comparison of differential transcription start sites showed that the number of these sites is generally increased in comparisons including hypothalamus in contrast to other pairwise assessments. A comprehensive analysis of one of the tissue contrasts, i

  4. Expression of P. falciparum var Genes Involves Exchange of the Histone Variant H2A.Z at the Promoter

    Science.gov (United States)

    Petter, Michaela; Lee, Chin Chin; Byrne, Timothy J.; Boysen, Katja E.; Volz, Jennifer; Ralph, Stuart A.; Cowman, Alan F.; Brown, Graham V.; Duffy, Michael F.

    2011-01-01

    Plasmodium falciparum employs antigenic variation to evade the human immune response by switching the expression of different variant surface antigens encoded by the var gene family. Epigenetic mechanisms including histone modifications and sub-nuclear compartmentalization contribute to transcriptional regulation in the malaria parasite, in particular to control antigenic variation. Another mechanism of epigenetic control is the exchange of canonical histones with alternative variants to generate functionally specialized chromatin domains. Here we demonstrate that the alternative histone PfH2A.Z is associated with the epigenetic regulation of var genes. In many eukaryotic organisms the histone variant H2A.Z mediates an open chromatin structure at promoters and facilitates diverse levels of regulation, including transcriptional activation. Throughout the asexual, intraerythrocytic lifecycle of P. falciparum we found that the P. falciparum ortholog of H2A.Z (PfH2A.Z) colocalizes with histone modifications that are characteristic of transcriptionally-permissive euchromatin, but not with markers of heterochromatin. Consistent with this finding, antibodies to PfH2A.Z co-precipitate the permissive modification H3K4me3. By chromatin-immunoprecipitation we show that PfH2A.Z is enriched in nucleosomes around the transcription start site (TSS) in both transcriptionally active and silent stage-specific genes. In var genes, however, PfH2A.Z is enriched at the TSS only during active transcription in ring stage parasites. Thus, in contrast to other genes, temporal var gene regulation involves histone variant exchange at promoter nucleosomes. Sir2 histone deacetylases are important for var gene silencing and their yeast ortholog antagonises H2A.Z function in subtelomeric yeast genes. In immature P. falciparum parasites lacking Sir2A or Sir2B high var transcription levels correlate with enrichment of PfH2A.Z at the TSS. As Sir2A knock out parasites mature the var genes are

  5. Actin depolymerization enhances adipogenic differentiation in human stromal stem cells

    DEFF Research Database (Denmark)

    Chen, Li; Hu, Huimin; Qiu, Weimin

    2018-01-01

    Human stromal stem cells (hMSCs) differentiate into adipocytes that play a role in skeletal tissue homeostasis and whole body energy metabolism. During adipocyte differentiation, hMSCs exhibit significant changes in cell morphology suggesting changes in cytoskeletal organization. Here, we examined...... differentiation as evidenced by decreased number of mature adipocytes and decreased adipocyte specific gene expression (ADIPOQ, LPL, PPARG, FABP4). In contrast, disruption of actin cytoskeleton by Cytochalasin D enhanced adipocyte differentiation. Follow up studies revealed that the effects of CFL1 on adipocyte...... differentiation depended on the activity of LIM domain kinase 1 (LIMK1) which is the major upstream kinase of CFL1. Inhibiting LIMK by its specific chemical inhibitor LIMKi inhibited the phosphorylation of CFL1 and actin polymerization, and enhanced the adipocyte differentiation. Moreover, treating h...

  6. Primary structure and promoter analysis of leghemoglobin genes of the stem-nodulated tropical legume Sesbania rostrata: conserved coding sequences, cis-elements and trans-acting factors

    DEFF Research Database (Denmark)

    Metz, B A; Welters, P; Hoffmann, H J

    1988-01-01

    The primary structure of a leghemoglobin (lb) gene from the stem-nodulated, tropical legume Sesbania rostrata and two lb gene promoter regions was analysed. The S. rostrata lb gene structure and Lb amino acid composition were found to be highly conserved with previously described lb genes and Lb ...

  7. Valsartan Promoting Atherosclerotic Plaque Stabilization by Upregulating Renalase: A Potential-Related Gene of Atherosclerosis.

    Science.gov (United States)

    Zhou, Mingxue; Ma, Chao; Liu, Weihong; Liu, Hongxu; Wang, Ning; Kang, Qunfu; Li, Ping

    2015-09-01

    Renalase is a protein that can regulate sympathetic nerve activity by metabolizing catecholamines, while redundant catecholamines are thought to contribute to atherosclerosis (As). Catecholamine release can be facilitated by angiotensin (Ang) II by binding to Ang II type 1 (AT1) receptors. Valsartan, a special AT1 antagonist, can dilate blood vessels and reduce blood pressure, but it remained unclear whether valsartan can promote the stability of atherosclerotic plaque by affecting renalase. This study examined the tissue distribution of renalase in ApoE(-/-) mice fed with a high-fat diet and the effect of valsartan on expression of renalase. ApoE(-/-) mice were fed with a high-fat diet for 13 or 26 weeks. As a control, 10 C57BL mice were fed with a standard chow diet. After 13 weeks on the high-fat diet, the ApoE(-/-) mice were randomized (10 mice/group) and treated with valsartan, simvastatin, or distilled water (control group) for an additional 13 weeks accompanied by a high-fat diet. Knockout of ApoE caused a dramatic increase in expression of renalase in mice adipose tissue. With the disturbance of lipid metabolism induced by a high-fat diet, renalase expression decreased in the liver. Renalase can be expressed in smooth muscle cells and M2 macrophages in atherosclerotic plaque, and its expression gradually decreases in the fibrous cap during the transition from stable to vulnerable atherosclerotic plaque. Valsartan, an AT1 receptor antagonist, promotes the stabilization of atherosclerotic plaque by increasing the levels of renalase in serum and the expression of renalase in the fibrous cap of atherosclerotic plaque. It also reduces triglyceride levels in serum and increases the expression of renalase in the liver. Renalase may be a potential-related gene of lipid metabolism and As, and it may be the possible molecular target of valsartan to help stabilize atherosclerotic plaque. © The Author(s) 2015.

  8. Comparative genome analysis reveals a conserved family of actin-like proteins in apicomplexan parasites

    Directory of Open Access Journals (Sweden)

    Sibley L David

    2005-12-01

    Full Text Available Abstract Background The phylum Apicomplexa is an early-branching eukaryotic lineage that contains a number of important human and animal pathogens. Their complex life cycles and unique cytoskeletal features distinguish them from other model eukaryotes. Apicomplexans rely on actin-based motility for cell invasion, yet the regulation of this system remains largely unknown. Consequently, we focused our efforts on identifying actin-related proteins in the recently completed genomes of Toxoplasma gondii, Plasmodium spp., Cryptosporidium spp., and Theileria spp. Results Comparative genomic and phylogenetic studies of apicomplexan genomes reveals that most contain only a single conventional actin and yet they each have 8–10 additional actin-related proteins. Among these are a highly conserved Arp1 protein (likely part of a conserved dynactin complex, and Arp4 and Arp6 homologues (subunits of the chromatin-remodeling machinery. In contrast, apicomplexans lack canonical Arp2 or Arp3 proteins, suggesting they lost the Arp2/3 actin polymerization complex on their evolutionary path towards intracellular parasitism. Seven of these actin-like proteins (ALPs are novel to apicomplexans. They show no phylogenetic associations to the known Arp groups and likely serve functions specific to this important group of intracellular parasites. Conclusion The large diversity of actin-like proteins in apicomplexans suggests that the actin protein family has diverged to fulfill various roles in the unique biology of intracellular parasites. Conserved Arps likely participate in vesicular transport and gene expression, while apicomplexan-specific ALPs may control unique biological traits such as actin-based gliding motility.

  9. Contribution of the Pmra Promoter to Expression of Genes in the Escherichia coli mra Cluster of Cell Envelope Biosynthesis and Cell Division Genes

    Science.gov (United States)

    Mengin-Lecreulx, Dominique; Ayala, Juan; Bouhss, Ahmed; van Heijenoort, Jean; Parquet, Claudine; Hara, Hiroshi

    1998-01-01

    Recently, a promoter for the essential gene ftsI, which encodes penicillin-binding protein 3 of Escherichia coli, was precisely localized 1.9 kb upstream from this gene, at the beginning of the mra cluster of cell division and cell envelope biosynthesis genes (H. Hara, S. Yasuda, K. Horiuchi, and J. T. Park, J. Bacteriol. 179:5802–5811, 1997). Disruption of this promoter (Pmra) on the chromosome and its replacement by the lac promoter (Pmra::Plac) led to isopropyl-β-d-thiogalactopyranoside (IPTG)-dependent cells that lysed in the absence of inducer, a defect which was complemented only when the whole region from Pmra to ftsW, the fifth gene downstream from ftsI, was provided in trans on a plasmid. In the present work, the levels of various proteins involved in peptidoglycan synthesis and cell division were precisely determined in cells in which Pmra::Plac promoter expression was repressed or fully induced. It was confirmed that the Pmra promoter is required for expression of the first nine genes of the mra cluster: mraZ (orfC), mraW (orfB), ftsL (mraR), ftsI, murE, murF, mraY, murD, and ftsW. Interestingly, three- to sixfold-decreased levels of MurG and MurC enzymes were observed in uninduced Pmra::Plac cells. This was correlated with an accumulation of the nucleotide precursors UDP–N-acetylglucosamine and UDP–N-acetylmuramic acid, substrates of these enzymes, and with a depletion of the pool of UDP–N-acetylmuramyl pentapeptide, resulting in decreased cell wall peptidoglycan synthesis. Moreover, the expression of ftsZ, the penultimate gene from this cluster, was significantly reduced when Pmra expression was repressed. It was concluded that the transcription of the genes located downstream from ftsW in the mra cluster, from murG to ftsZ, is also mainly (but not exclusively) dependent on the Pmra promoter. PMID:9721276

  10. Combination of Heavy-ion radiotherapy and p53-gene therapy by radio-sensitizing promoter for glioma

    International Nuclear Information System (INIS)

    Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie

    2005-01-01

    In this study we have investigated the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing promoter-E9ns-2/CMV chimeric promoter (Scott et al:2003) in p53-gene therapy. First, EGFP reporter gene with E9ns-2/CMV chimeric promoter was transfected in C6 rat glioma cell-line and the transfected-cell bulk was irradiated at dose of 3, 5, 10 Gy respectively with charged carbon particle (290 MeV/nucleon). The light upregulation of EGFP was observed in 24 hours after 5 Gy irradiation. On the basis of this result, p53 gene with E9ns-2/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 5 Gy. There was, however, no obvious p53-upregulation at any time-point, so far. Further investigation is needed to clarify the appropriate experimental system. (author)

  11. Cell cycle regulation of the cyclin A gene promoter is mediated by a variant E2F site

    DEFF Research Database (Denmark)

    Schulze, A; Zerfass, K; Spitkovsky, D

    1995-01-01

    Cyclin A is involved in the control of S phase and mitosis in mammalian cells. Expression of the cyclin A gene in nontransformed cells is characterized by repression of its promoter during the G1 phase of the cell cycle and its induction at S-phase entry. We show that this mode of regulation...

  12. Key tumor suppressor genes inactivated by "greater promoter" methylation and somatic mutations in head and neck cancer

    NARCIS (Netherlands)

    Guerrero-Preston, Rafael; Michailidi, Christina; Marchionni, Luigi; Pickering, Curtis R.; Frederick, Mitchell J.; Myers, Jeffrey N.; Yegnasubramanian, Srinivasan; Hadar, Tal; Noordhuis, Maartje G.; Zizkova, Veronika; Fertig, Elana; Agrawal, Nishant; Westra, William; Koch, Wayne; Califano, Joseph; Velculescu, Victor E.; Sidransky, David

    Tumor suppressor genes (TSGs) are commonly inactivated by somatic mutation and/or promoter methylation; yet, recent high-throughput genomic studies have not identified key TSGs inactivated by both mechanisms. We pursued an integrated molecular analysis based on methylation binding domain sequencing

  13. Association of a Monoamine Oxidase-A Gene Promoter Polymorphism with ADHD and Anxiety in Boys with Autism Spectrum Disorder

    Science.gov (United States)

    Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.

    2009-01-01

    The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned…

  14. Clinical Utility of promoter methylation of the tumor suppressor genes DKK3, and RASSF1A in breast cancer patients

    Directory of Open Access Journals (Sweden)

    Marwa H. Saied

    2018-04-01

    Full Text Available Background: DNA methylation is the commonest known epigenetic change that results in silencing of tumor suppressor genes. Promoter methylation of tumor suppressor genes has the potential for early detection of breast cancer. Aim: Aim is to examine the potential usefulness of blood based methylation specific polymerase chain reaction (MSP of methylated DKK3 and RASSF1A genes in early detection of breast cancer. Method: Methylation status of DKK3 and RASSF1 was investigated in forty breast cancer patients, twenty fibroadenoma patients and twenty healthy ladies as control group using MSP. Results: Methylation of DKK3 promoter was found in 22.5% of breast cancer patients, while DKK3 methylation was absent in both fibroadenoma patients and control group. Similarly, methylation of RASSF1 promoter was found in 17.5% of breast cancer patients and in none of fibroadenoma and control group. Conclusion: Promoter methylation of DKK3 and RASSF1 was found in breast cancer patients while absent in control group suggesting that tumorspecific methylation of the two genes (DKK3 and RASSF1A might be a valuable biomarker for the early detection of breast cancer. Keywords: DNA methylation, Breast cancer, DKK3, RASSF1

  15. A compact dual promoter adeno-associated viral vector for efficient delivery of two genes to dorsal root ganglion neurons

    NARCIS (Netherlands)

    Fagoe, N D; Eggers, R; Verhaagen, J; Mason, M R J

    Adeno-associated viral (AAV) vectors based on serotype 5 are an efficient means to target dorsal root ganglia (DRG) to study gene function in the primary sensory neurons of the peripheral nervous system. In this study, we have developed a compact AAV dual promoter vector composed of the

  16. Exploring the potential of the glycerol-3-phosphate dehydrogenase 2 (GPD2) promoter for recombinant gene expression in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Knudsen, Jan Dines; Johanson, Ted; Eliasson Lantz, Anna

    2015-01-01

    A control point for keeping redox homeostasis in Saccharomyces cerevisiae during fermentative growth is the dynamic regulation of transcription for the glycerol-3-phosphate dehydrogenase 2 (GPD2) gene. In this study, the possibility to steer the activity of the GPD2 promoter was investigated by p...

  17. Tissue-specific production of limonene in Camelina sativa with the Arabidopsis promoters of genes BANYULS and FRUITFULL

    NARCIS (Netherlands)

    Borghi, Monica; Xie, De Yu

    2016-01-01

    Main conclusion: Arabidopsis promoters of genesBANYULSandFRUITFULLare transcribed in Camelina. They triggered the transcription oflimonene synthaseand induced higher limonene production in seeds and fruits thanCaMV 35Spromoter.Camelina sativa (Camelina) is an oilseed crop of relevance for the

  18. DNA Methyltransferase 3B Gene Promoter and Interleukin-1 Receptor Antagonist Polymorphisms in Childhood Immune Thrombocytopenia

    Directory of Open Access Journals (Sweden)

    Margarita Pesmatzoglou

    2012-01-01

    Full Text Available Primary immune thrombocytopenia (ITP is one of the most common blood diseases as well as the commonest acquired bleeding disorder in childhood. Although the etiology of ITP is unclear, in the pathogenesis of the disease, both environmental and genetic factors including polymorphisms of TNF-a, IL-10, and IL-4 genes have been suggested to be involved. In this study, we investigated the rs2424913 single-nucleotide polymorphism (SNP (C46359T in DNA methyltransferase 3B (DNMT3B gene promoter and the VNTR polymorphism of IL-1 receptor antagonist (IL-1 Ra intron-2 in 32 children (17 boys with the diagnosis of ITP and 64 healthy individuals. No significant differences were found in the genotype distribution of DNMT3B polymorphism between the children with ITP and the control group, whereas the frequency of allele T appeared significantly increased in children with ITP (P = 0.03, OR = 2, 95% CI: 1.06–3.94. In case of IL-1 Ra polymorphism, children with ITP had a significantly higher frequency of genotype I/II, compared to control group (P = 0.043, OR = 2.60, 95% CI: 1.02–6.50. Moreover, genotype I/I as well as allele I was overrepresented in the control group, suggesting that allele I may have a decreased risk for development of ITP. Our findings suggest that rs2424913 DNMT3B SNP as well as IL-1 Ra VNTR polymorphism may contribute to the susceptibility to ITP.

  19. Mapping of cis-regulatory sites in the promoter of testis-specific stellate genes of Drosophila melanogaster.

    Science.gov (United States)

    Olenkina, O M; Egorova, K S; Aravin, A A; Naumova, N M; Gvozdev, V A; Olenina, L V

    2012-11-01

    Tandem Stellate genes organized into two clusters in heterochromatin and euchromatin of the X-chromosome are part of the Ste-Su(Ste) genetic system required for maintenance of male fertility and reproduction of Drosophila melanogaster. Stellate genes encode a regulatory subunit of protein kinase CK2 and are the main targets of germline-specific piRNA-silencing; their derepression leads to appearance of protein crystals in spermatocytes, meiotic disturbances, and male sterility. A short promoter region of 134 bp appears to be sufficient for testis-specific transcription of Stellate, and it contains three closely located cis-regulatory elements called E-boxes. By using reporter analysis, we confirmed a strong functionality of the E-boxes in the Stellate promoter for in vivo transcription. Using selective mutagenesis, we have shown that the presence of the central E-box 2 is preferable to maintain a high-level testis-specific transcription of the reporter gene under the Stellate promoter. The Stellate promoter provides transcription even in heterochromatin, and corresponding mRNAs are translated with the generation of full-size protein products in case of disturbances in the piRNA-silencing process. We have also shown for the first time that the activity of the Stellate promoter is determined by chromatin context of the X-chromosome in male germinal cells, and it increases at about twofold when relocating in autosomes.

  20. Opposite Smad and chicken ovalbumin upstream promoter transcription factor inputs in the regulation of the collagen VII gene promoter by transforming growth factor-beta.

    Science.gov (United States)

    Calonge, María Julia; Seoane, Joan; Massagué, Joan

    2004-05-28

    A critical component of the epidermal basement membrane, collagen type VII, is produced by keratinocytes and fibroblasts, and its production is stimulated by the cytokine transforming growth factor-beta (TGF-beta). The gene, COL7A1, is activated by TGF-beta via Smad transcription factors in cooperation with AP1. Here we report a previously unsuspected level of complexity in this regulatory process. We provide evidence that TGF-beta may activate the COL7A1 promoter by two distinct inputs operating through a common region of the promoter. One input is provided by TGF-beta-induced Smad complexes via two Smad binding elements that function redundantly depending on the cell type. The second input is provided by relieving the COL7A1 promoter from chicken ovalbumin upstream promoter transcription factor (COUP-TF)-mediated transcriptional repression. We identified COUP-TFI and -TFII as factors that bind to the TGF-beta-responsive region of the COL7A1 promoter in an expression library screening. COUP-TFs bind to a site between the two Smad binding elements independently of Smad or AP1 and repress the basal and TGF-beta-stimulated activities of this promoter. We provide evidence that endogenous COUP-TF activity represses the COL7A1 promoter. Furthermore, we show that TGF-beta addition causes a rapid and profound down-regulation of COUP-TF expression in keratinocytes and fibroblasts. The results suggest that TGF-beta signaling may exert tight control over COL7A1 by offsetting the balance between opposing Smad and COUP-TFs.

  1. Loss of the NKX3.1 tumorsuppressor promotes the TMPRSS2-ERG fusion gene expression in prostate cancer

    International Nuclear Information System (INIS)

    Thangapazham, Rajesh; Saenz, Francisco; Katta, Shilpa; Mohamed, Ahmed A; Tan, Shyh-Han; Petrovics, Gyorgy; Srivastava, Shiv; Dobi, Albert

    2014-01-01

    In normal prostate epithelium the TMPRSS2 gene encoding a type II serine protease is directly regulated by male hormones through the androgen receptor. In prostate cancer ERG protooncogene frequently gains hormonal control by seizing gene regulatory elements of TMPRSS2 through genomic fusion events. Although, the androgenic activation of TMPRSS2 gene has been established, little is known about other elements that may interact with TMPRSS2 promoter sequences to modulate ERG expression in TMPRSS2-ERG gene fusion context. Comparative genomic analyses of the TMPRSS2 promoter upstream sequences and pathway analyses were performed by the Genomatix Software. NKX3.1 and ERG genes expressions were evaluated by immunoblot or by quantitative Real-Time PCR (qRT-PCR) assays in response to siRNA knockdown or heterologous expression. QRT-PCR assay was used for monitoring the gene expression levels of NKX3.1-regulated genes. Transcriptional regulatory function of NKX3.1 was assessed by luciferase assay. Recruitment of NKX3.1 to its cognate elements was monitored by Chromatin Immunoprecipitation assay. Comparative analysis of the TMPRSS2 promoter upstream sequences among different species revealed the conservation of binding sites for the androgen inducible NKX3.1 tumor suppressor. Defects of NKX3.1, such as, allelic loss, haploinsufficiency, attenuated expression or decreased protein stability represent established pathways in prostate tumorigenesis. We found that NKX3.1 directly binds to TMPRSS2 upstream sequences and negatively regulates the expression of the ERG protooncogene through the TMPRSS2-ERG gene fusion. These observations imply that the frequently noted loss-of-function of NKX3.1 cooperates with the activation of TMPRSS2-ERG fusions in prostate tumorigenesis

  2. Thymosin β10 expression driven by the human TERT promoter induces ovarian cancer-specific apoptosis through ROS production.

    Directory of Open Access Journals (Sweden)

    Young-Chae Kim

    Full Text Available Thymosin β(10 (Tβ(10 regulates actin dynamics as a cytoplasm G-actin sequestering protein. Previously, we have shown that Tβ(10 diminishes tumor growth, angiogenesis, and proliferation by disrupting actin and by inhibiting Ras. However, little is known about its mechanism of action and biological function. In the present study, we establish a new gene therapy model using a genetically modified adenovirus, referred to as Ad.TERT.Tβ(10, that can overexpress the Tβ(10 gene in cancer cells. This was accomplished by replacing the native Tβ(10 gene promoter with the human TERT promoter in Ad.TERT.Tβ(10. We investigated the cancer suppression activity of Tβ(10 and found that Ad.TERT.Tβ(10 strikingly induced cancer-specific expression of Tβ(10 as well as apoptosis in a co-culture model of human primary ovarian cancer cells and normal fibroblasts. Additionally, Ad.TERT.Tβ(10 decreased mitochondrial membrane potential and increased reactive oxygen species (ROS production. These effects were amplified by co-treatment with anticancer drugs, such as paclitaxel and cisplatin. These findings indicate that the rise in ROS production due to actin disruption by Tβ(10 overexpression increases apoptosis of human ovarian cancer cells. Indeed, the cancer-specific overexpression of Tβ(10 by Ad.TERT.Tβ(10 could be a valuable anti-cancer therapeutic for the treatment of ovarian cancer without toxicity to normal cells.

  3. Dynamic Regulation of Sarcomeric Actin Filaments in Striated Muscle

    OpenAIRE

    Ono, Shoichiro

    2010-01-01

    In striated muscle, the actin cytoskeleton is differentiated into myofibrils. Actin and myosin filaments are organized in sarcomeres and specialized for producing contractile forces. Regular arrangement of actin filaments with uniform length and polarity is critical for the contractile function. However, the mechanisms of assembly and maintenance of sarcomeric actin filaments in striated muscle are not completely understood. Live imaging of actin in striated muscle has revealed that actin sub...

  4. Actin expression in some Platyhelminthe species.

    Science.gov (United States)

    Fagotti, A; Panara, F; Di Rosa, I; Simoncelli, F; Gabbiani, G; Pascolini, R

    1994-10-01

    Actin expression in some Platyhelminthe species was demonstrated by western-blotting and immunocytochemical analysis using two distinct anti-actin antibodies: the anti-total actin that reacts against all actin isoforms of higher vertebrates and the anti-alpha SM-1 that recognizes the alpha-smooth muscle (alpha SM) isotype of endothermic vertebrates (Skalli et al., 1986). Western-blotting experiments showed that all species tested, including some free-living Platyhelminthes (Tricladida and Rhabdocoela) and the parasitic Fasciola hepatica, were stained by anti-total actin antibody while only Dugesidae and Dendrocoelidae showed a positive immunoreactivity against anti-alpha SM-1. These results were confirmed by cytochemical immunolocalization using both avidin biotin conjugated peroxidase reaction on paraffin sections, and immunogold staining on Lowicryl 4KM embedded specimens. Our findings may contribute to the understanding of Platyhelminthes phylogeny.

  5. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

    Directory of Open Access Journals (Sweden)

    Tatsuya eKon

    2014-11-01

    Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.

  6. The cardiac calsequestrin gene transcription is modulated at the promoter by NFAT and MEF-2 transcription factors.

    Directory of Open Access Journals (Sweden)

    Rafael Estrada-Avilés

    Full Text Available Calsequestrin-2 (CASQ2 is the main Ca2+-binding protein inside the sarcoplasmic reticulum of cardiomyocytes. Previously, we demonstrated that MEF-2 and SRF binding sites within the human CASQ2 gene (hCASQ2 promoter region are functional in neonatal cardiomyocytes. In this work, we investigated if the calcineurin/NFAT pathway regulates hCASQ2 expression in neonatal cardiomyocytes. The inhibition of NFAT dephosphorylation with CsA or INCA-6, reduced both the luciferase activity of hCASQ2 promoter constructs (-3102/+176 bp and -288/+176 bp and the CASQ2 mRNA levels in neonatal rat cardiomyocytes. Additionally, NFATc1 and NFATc3 over-expressing neonatal cardiomyocytes showed a 2-3-fold increase in luciferase activity of both hCASQ2 promoter constructs, which was prevented by CsA treatment. Site-directed mutagenesis of the -133 bp MEF-2 binding site prevented trans-activation of hCASQ2 promoter constructs induced by NFAT overexpression. Chromatin Immunoprecipitation (ChIP assays revealed NFAT and MEF-2 enrichment within the -288 bp to +76 bp of the hCASQ2 gene promoter. Besides, a direct interaction between NFAT and MEF-2 proteins was demonstrated by protein co-immunoprecipitation experiments. Taken together, these data demonstrate that NFAT interacts with MEF-2 bound to the -133 bp binding site at the hCASQ2 gene promoter. In conclusion, in this work, we demonstrate that the Ca2+-calcineurin/NFAT pathway modulates the transcription of the hCASQ2 gene in neonatal cardiomyocytes.

  7. DNMT 1 maintains hypermethylation of CAG promoter specific region and prevents expression of exogenous gene in fat-1 transgenic sheep.

    Science.gov (United States)

    Yang, Chunrong; Shang, Xueying; Cheng, Lei; Yang, Lei; Liu, Xuefei; Bai, Chunling; Wei, Zhuying; Hua, Jinlian; Li, Guangpeng

    2017-01-01

    Methylation is an important issue in gene expression regulation and also in the fields of genetics and reproduction. In this study, we created fat-1 transgenic sheep, investigated the fine-mapping and the modulatory mechanisms of promoter methylation. Sheep fetal fibroblasts were transfected by pCAG-fat1-IRES-EGFP. Monoclonal cell line was screened as nuclear donor and carried out nuclear transfer (441 transgenic cloned embryos, 52 synchronism recipient sheep). Six offsprings were obtained. Expressions of exogenous genes fat-1 and EGFP were detectable in 10 examined tissues and upregulated omega-3 fatty acid content. Interestingly, more or less EGFP negative cells were detectable in the positive transgenic fetal skin cells. EGFP negative and positive cells were sorted by flow cytometry, and their methylation status in the whole promoter region (1701 nt) were investigated by bisulphate sequencing. The fine-mapping of methylation in CAG promoter were proposed. The results suggested that exogenous gene expression was determined by the methylation status from 721-1346 nt and modulated by methylation levels at 101, 108 and 115 nt sites in CAG promoter. To clarify the regulatory mechanism of methylation, examination of four DNA methyltransferases (DNMTs) demonstrated that hypermethylation of CAG promoter is mainly maintained by DNMT 1 in EGFP negative cells. Furthermore, investigation of the cell surface antigen CD34, CD45 and CD166 indicated that EGFP positive and negative cells belong to different types. The present study systematically clarified methylation status of CAG promoter in transgenic sheep and regulatory mechanism, which will provide research strategies for gene expression regulation in transgenic animals.

  8. Spatially and Temporally Regulated NRF2 Gene Therapy Using Mcp-1 Promoter in Retinal Ganglion Cell Injury

    Directory of Open Access Journals (Sweden)

    Kosuke Fujita

    2017-06-01

    Full Text Available Retinal ganglion cell degeneration triggered by axonal injury is believed to underlie many ocular diseases, including glaucoma and optic neuritis. In these diseases, retinal ganglion cells are affected unevenly, both spatially and temporally, such that healthy and unhealthy cells coexist in different patterns at different time points. Herein, we describe a temporally and spatially regulated adeno-associated virus gene therapy aiming to reduce undesired off-target effects on healthy retinal neurons. The Mcp-1 promoter previously shown to be activated in stressed retinal ganglion cells following murine optic nerve injury was combined with the neuroprotective intracellular transcription factor Nrf2. In this model, Mcp-1 promoter-driven NRF2 expression targeting only stressed retinal ganglion cells showed efficacy equivalent to non-selective cytomegalovirus promoter-driven therapy for preventing cell death. However, cytomegalovirus promoter-mediated NRF2 transcription induced cellular stress responses and death of Brn3A-positive uninjured retinal ganglion cells. Such undesired effects were reduced substantially by adopting the Mcp-1 promoter. Combining a stress-responsive promoter and intracellular therapeutic gene is a versatile approach for specifically targeting cells at risk of degeneration. This strategy may be applicable to numerous chronic ocular and non-ocular conditions.

  9. Significant association between polymorphism of the erythropoietin gene promoter and myelodysplastic syndrome

    Directory of Open Access Journals (Sweden)

    O'Brien Susan

    2010-11-01

    Full Text Available Abstract Background Myelodysplastic syndrome (MDS may be induced by certain mutagenic environmental or chemotherapeutic toxins; however, the role of susceptibility genes remains unclear. The G/G genotype of the single-nucleotide polymorphism (SNP rs1617640 in the erythropoietin (EPO promoter has been shown to be associated with decreased EPO expression. We examined the association of rs1617640 genotype with MDS. Methods We genotyped the EPO rS1617640 SNP in 189 patients with MDS, 257 with acute myeloid leukemia (AML, 106 with acute lymphoblastic leukemia, 97 with chronic lymphocytic leukemia, 353 with chronic myeloid leukemia, and 95 healthy controls. Results The G/G genotype was significantly more common in MDS patients (47/187; 25.1% than in controls (6/95; 6.3% or in patients with other leukemias (101/813; 12.4% (all P P = 0.03. Time to neutrophils recovery after therapy was significantly longer in MDS patients with the G/G genotype (P = 0.02. Conclusions These findings suggest a strong association between the rs1617640 G/G genotype and MDS. Further studies are warranted to investigate the utility of screening for this marker in individuals exposed to environmental toxins or chemotherapy.

  10. Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, S; Drusiani, E; Battini, R; Fregni, M

    1988-01-11

    Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

  11. Promoter Methylation and BDNF and DAT1 Gene Expression Profiles in Patients with Drug Addiction.

    Science.gov (United States)

    Kordi-Tamandani, Dor Mohammad; Tajoddini, Shahrad; Salimi, Farzaneh

    2015-01-01

    Drug addiction is a brain disorder that has negative consequences for individuals and society. Addictions are chronic relapsing diseases of the brain that are caused by direct drug-induced effects and persevering neuroadaptations at the epigenetic, neuropeptide and neurotransmitter levels. Because the dopaminergic system has a significant role in drug abuse, the purpose of this study was to analyze the methylation and expression profile of brain-derived neurotrophic factor (BDNF) and dopamine transporter (DAT1) genes in individuals with drug addiction. BDNF and DAT1 promoter methylation were investigated with a methylation-specific polymerase chain reaction (PCR) technique in blood samples from 75 individuals with drug addiction and 65 healthy controls. The expression levels of BDNF and DAT1 were assessed in 12 mRNA samples from the blood of patients and compared to the samples of healthy controls (n = 12) with real-time quantitative reverse transcription PCR. No significant differences were found in the methylation of BDNF and DAT1 between patients and controls, but the relative levels of expression of BDNF and DAT1 mRNA differed significantly in the patients compared to controls (p drug addiction.

  12. Association between a promoter dopamine D2 receptor gene variant and the personality trait detachment.

    Science.gov (United States)

    Jönsson, Erik G; Cichon, Sven; Gustavsson, J Petter; Grünhage, Frank; Forslund, Kaj; Mattila-Evenden, Marja; Rylander, Gunnar; Asberg, Marie; Farde, Lars; Propping, Peter; Nöthen, Markus M

    2003-04-01

    Personality traits have shown considerable heritable components. Striatal dopamine D(2) receptor density, as determined by positron-emission tomography, has been associated with detached personality, as assessed by the Karolinska Scales of Personality. A putative functional promoter polymorphism in the dopamine D(2) receptor gene (DRD2), -141C ins/del, has been associated with dopamine D(2) receptor density. In this study healthy subjects (n = 235) who filled in at least one of several personality questionnaires (Karolinska Scales of Personality, Swedish Universities Scales of Personality, Health-relevant Five-factor Personality Inventory, and Temperament and Character Inventory) were analyzed with regard to the DRD2 -141C ins/del variant. There was an association (p =.001) between the DRD2 -141C ins/del variant and Karolinska Scales of Personality Detachment scale, indicating higher scores in subjects with the -141C del variant. There were also associations between the DRD2 -141C ins/del variant and a number of Karolinska Scales of Personality and Swedish Universities Scales of Personality Neuroticism-related scales, but of these only Swedish Universities Scales of Personality Lack of Assertiveness scale (p =.001) survived correction for multiple testing. These results add further support for the involvement of dopamine D(2) receptor in certain personality traits. The results should be treated with caution until replicated.

  13. Upregulated Expression of a Unique Gene by Hepatitis B x Antigen Promotes Hepatocellular Growth and Tumorigenesis

    Directory of Open Access Journals (Sweden)

    Zhaorui Lian

    2003-05-01

    Full Text Available Hepatitis B x antigen (HBxAg is a trans-activating protein that may be involved in hepatocarcinogenesis, although few natural effectors of HBxAg that participate in this process have been identified. To identify additional effectors, whole cell RNA isolated from HBxAg-positive and HBxAg-negative HepG2 cells were compared by polymerase chain reaction select cDNA subtraction, and one clone, upregulated gene, clone 11 (URG11, was chosen for further characterization. Elevated levels of URG11 mRNA and protein were observed in HBxAg-positive compared to HBxAg-negative HepG2 cells. Costaining was observed in infected liver (P<.01. URG11 stimulated cell growth in culture (P<.01, anchorage-independent growth in soft agar (P<.001, and accelerated tumor formation (P<.01, and yielded larger tumors (P<.02 in SCID mice injected subcutaneously with HepG2 cells. These data suggest that URG11 is a natural effector of HBxAg that may promote the development of hepatocellular carcinoma.

  14. Mono-(2-Ethylhexyl Phthalate Promotes Pro-Labor Gene Expression in the Human Placenta.

    Directory of Open Access Journals (Sweden)

    Ximi K Wang

    Full Text Available Women exposed to phthalates during pregnancy are at increased risk for delivering preterm, but the mechanism behind this relationship is unknown. Placental corticotropin-releasing hormone (CRH and cyclooxygenase-2 (COX-2 are key mediators of parturition and are regulated by the non-canonical NF-kB (RelB/p52 signaling pathway. In this study, we demonstrate that one of the major phthalate metabolites, mono-(2-ethylhexyl-phthalate (MEHP, increased CRH and COX-2 mRNA and protein abundance in a dose-dependent manner in primary cultures of cytotrophoblast. This was coupled with an increase in nuclear import of RelB/p52 and its association with the CRH and COX-2 promoters. Silencing of NF-kB inducing kinase, a central signaling component of the non-canonical NF-kB pathway, blocked MEHP-induced upregulation of CRH and COX-2. These results suggest a potential mechanism mediated by RelB/p52 by which phthalates could prematurely induce pro-labor gene activity and lead to preterm birth.

  15. Pseudogene PHBP1 promotes esophageal squamous cell carcinoma proliferation by increasing its cognate gene PHB expression.

    Science.gov (United States)

    Feng, Feiyue; Qiu, Bin; Zang, Ruochuan; Song, Peng; Gao, Shugeng

    2017-04-25

    Natural antisense transcripts (NATs) as one of the most diverse classes of long noncoding RNAs (lncRNAs), have been demonstrated involved in fundamental biological processes in human. Here, we reported that human prohibitin gene pseudogene 1 (PHBP1) was upregulated in ESCC, and increased PHBP1 expression in ESCC was associated with clinical advanced stage. Functional experiments showed that PHBP1 knockdown inhibited ESCC cells proliferation, colony formation and xenograft tumor growth in vitro and in vivo by causing cell-cycle arrest at the G1-G0 phase. Mechanisms analysis revealed that PHBP1 transcript as an antisense transcript of PHB is partially complementary to PHB mRNA and formed an RNA-RNA hybrid with PHB, consequently inducing an increase of PHB expression at both the mRNA and protein levels. Furthermore, PHBP1 expression is strongly correlated with PHB expression in ESCC tissues. Collectively, this study elucidates an important role of PHBP1 in promoting ESCC partly via increasing PHB expression.

  16. Co-expression of interleukin 12 enhances antitumor effects of a novel chimeric promoter-mediated suicide gene therapy in an immunocompetent mouse model

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Yu, E-mail: xuyu1001@gmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Liu, Zhengchun, E-mail: l135027@126.com [Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Kong, Haiyan, E-mail: suppleant@163.com [Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Sun, Wenjie, E-mail: wendy11240325@163.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Liao, Zhengkai, E-mail: fastbeta@gmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Zhou, Fuxiang, E-mail: happyzhoufx@sina.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Xie, Conghua, E-mail: chxie_65@hotmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); and others

    2011-09-09

    Highlights: {yields} A novel chimeric promoter consisting of CArG element and hTERT promoter was developed. {yields} The promoter was characterized with radiation-inducibility and tumor-specificity. {yields} Suicide gene system driven by the promoter showed remarkable cytotoxicity in vitro. {yields} Co-expression of IL12 enhanced the promoter mediated suicide gene therapy in vivo. -- Abstract: The human telomerase reverse transcriptase (hTERT) promoter has been widely used in target gene therapy of cancer. However, low transcriptional activity limited its clinical application. Here, we designed a novel dual radiation-inducible and tumor-specific promoter system consisting of CArG elements and the hTERT promoter, resulting in increased expression of reporter genes after gamma-irradiation. Therapeutic and side effects of adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic (IAA) system downstream of the chimeric promoter were evaluated in mice bearing Lewis lung carcinoma, combining with or without adenovirus-mediated interleukin 12 (IL12) gene driven by the cytomegalovirus promoter. The combination treatment showed more effective suppression of tumor growth than those with single agent alone, being associated with pronounced intratumoral T-lymphocyte infiltration and minor side effects. Our results suggest that the combination treatment with HRP/IAA system driven by the novel chimeric promoter and the co-expression of IL12 might be an effective and safe target gene therapy strategy of cancer.

  17. Co-expression of interleukin 12 enhances antitumor effects of a novel chimeric promoter-mediated suicide gene therapy in an immunocompetent mouse model

    International Nuclear Information System (INIS)

    Xu, Yu; Liu, Zhengchun; Kong, Haiyan; Sun, Wenjie; Liao, Zhengkai; Zhou, Fuxiang; Xie, Conghua

    2011-01-01

    Highlights: → A novel chimeric promoter consisting of CArG element and hTERT promoter was developed. → The promoter was characterized with radiation-inducibility and tumor-specificity. → Suicide gene system driven by the promoter showed remarkable cytotoxicity in vitro. → Co-expression of IL12 enhanced the promoter mediated suicide gene therapy in vivo. -- Abstract: The human telomerase reverse transcriptase (hTERT) promoter has been widely used in target gene therapy of cancer. However, low transcriptional activity limited its clinical application. Here, we designed a novel dual radiation-inducible and tumor-specific promoter system consisting of CArG elements and the hTERT promoter, resulting in increased expression of reporter genes after gamma-irradiation. Therapeutic and side effects of adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic (IAA) system downstream of the chimeric promoter were evaluated in mice bearing Lewis lung carcinoma, combining with or without adenovirus-mediated interleukin 12 (IL12) gene driven by the cytomegalovirus promoter. The combination treatment showed more effective suppression of tumor growth than those with single agent alone, being associated with pronounced intratumoral T-lymphocyte infiltration and minor side effects. Our results suggest that the combination treatment with HRP/IAA system driven by the novel chimeric promoter and the co-expression of IL12 might be an effective and safe target gene therapy strategy of cancer.

  18. Design and evaluation of Actichip, a thematic microarray for the study of the actin cytoskeleton

    Science.gov (United States)

    Muller, Jean; Mehlen, André; Vetter, Guillaume; Yatskou, Mikalai; Muller, Arnaud; Chalmel, Frédéric; Poch, Olivier; Friederich, Evelyne; Vallar, Laurent

    2007-01-01

    Background The actin cytoskeleton plays a crucial role in supporting and regulating numerous cellular processes. Mutations or alterations in the expression levels affecting the actin cytoskeleton system or related regulatory mechanisms are often associated with complex diseases such as cancer. Understanding how qualitative or quantitative changes in expression of the set of actin cytoskeleton genes are integrated to control actin dynamics and organisation is currently a challenge and should provide insights in identifying potential targets for drug discovery. Here we report the development of a dedicated microarray, the Actichip, containing 60-mer oligonucleotide probes for 327 genes selected for transcriptome analysis of the human actin cytoskeleton. Results Genomic data and sequence analysis features were retrieved from GenBank and stored in an integrative database called Actinome. From these data, probes were designed using a home-made program (CADO4MI) allowing sequence refinement and improved probe specificity by combining the complementary information recovered from the UniGene and RefSeq databases. Actichip performance was analysed by hybridisation with RNAs extracted from epithelial MCF-7 cells and human skeletal muscle. Using thoroughly standardised procedures, we obtained microarray images with excellent quality resulting in high data reproducibility. Actichip displayed a large dynamic range extending over three logs with a limit of sensitivity between one and ten copies of transcript per cell. The array allowed accurate detection of small changes in gene expression and reliable classification of samples based on the expression profiles of tissue-specific genes. When compared to two other oligonucleotide microarray platforms, Actichip showed similar sensitivity and concordant expression ratios. Moreover, Actichip was able to discriminate the highly similar actin isoforms whereas the two other platforms did not. Conclusion Our data demonstrate that

  19. Nonsense and missense mutation of mitochondrial ND6 gene promotes cell migration and invasion in human lung adenocarcinoma

    International Nuclear Information System (INIS)

    Yuan, Yang; Wang, Weixing; Li, Huizhong; Yu, Yongwei; Tao, Jin; Huang, Shengdong; Zeng, Zhiyong

    2015-01-01

    Previous study showed that mitochondrial ND6 (mitND6) gene missense mutation resulted in NADH dehydrogenase deficiency and was associated with tumor metastasis in several mouse tumor cell lines. In the present study, we investigated the possible role of mitND6 gene nonsense and missense mutations in the metastasis of human lung adenocarcinoma. The presence of mitND6 gene mutations was screened by DNA sequencing of tumor tissues from 87 primary lung adenocarcinoma patients and the correlation of the mutations with the clinical features was analyzed. In addition, we constructed cytoplasmic hybrid cells with denucleared primary lung adenocarcinoma cell as the mitochondria donor and mitochondria depleted lung adenocarcinoma A549 cell as the nuclear donor. Using these cells, we studied the effects of mitND6 gene nonsense and missense mutations on cell migration and invasion through wounding healing and matrigel-coated transwell assay. The effects of mitND6 gene mutations on NADH dehydrogenase activity and ROS production were analyzed by spectrophotometry and flow cytometry. mitND6 gene nonsense and missense mutations were detected in 11 of 87 lung adenocarcinoma specimens and was correlated with the clinical features including age, pathological grade, tumor stage, lymph node metastasis and survival rate. Moreover, A549 cell containing mitND6 gene nonsense and missense mutation exhibited significantly lower activity of NADH dehydrogenase, higher level of ROS, higher capacity of cell migration and invasion, and higher pAKT and pERK1/ERK2 expression level than cells with the wild type mitND6 gene. In addition, NADH dehydrogenase inhibitor rotenone was found to significantly promote the migration and invasion of A549 cells. Our data suggest that mitND6 gene nonsense and missense mutation might promote cell migration and invasion in lung adenocarcinoma, probably by NADH dehydrogenase deficiency induced over-production of ROS

  20. Kras gene mutation and RASSF1A, FHIT and MGMT gene promoter hypermethylation: indicators of tumor staging and metastasis in adenocarcinomatous sporadic colorectal cancer in Indian population.

    Directory of Open Access Journals (Sweden)

    Rupal Sinha

    Full Text Available Colorectal cancer (CRC development involves underlying modifications at genetic/epigenetic level. This study evaluated the role of Kras gene mutation and RASSF1A, FHIT and MGMT gene promoter hypermethylation together/independently in sporadic CRC in Indian population and correlation with clinicopathological variables of the disease.One hundred and twenty four consecutive surgically resected tissues (62 tumor and equal number of normal adjacent controls of primary sporadic CRC were included and patient details including demographic characteristics, lifestyle/food or drinking habits, clinical and histopathological profiles were recorded. Polymerase chain reaction - Restriction fragment length polymorphism and direct sequencing for Kras gene mutation and Methylation Specific-PCR for RASSF1A, FHIT and MGMT genes was performed.Kras gene mutation at codon 12 & 13 and methylated RASSF1A, FHIT and MGMT gene was observed in 47%, 19%, 47%, 37% and 47% cases, respectively. Alcohol intake and smoking were significantly associated with presence of Kras mutation (codon 12 and MGMT methylation (p-value <0.049. Tumor stage and metastasis correlated with presence of mutant Kras codon 12 (p-values 0.018, 0.044 and methylated RASSF1A (p-values 0.034, 0.044, FHIT (p-values 0.001, 0.047 and MGMT (p-values 0.018, 0.044 genes. Combinatorial effect of gene mutation/methylation was also observed (p-value <0.025. Overall, tumor stage 3, moderately differentiated tumors, presence of lymphatic invasion and absence of metastasis was more frequently observed in tumors with mutated Kras and/or methylated RASSF1A, FHIT and MGMT genes.Synergistic interrelationship between these genes in sporadic CRC may be used as diagnostic/prognostic markers in assessing the overall pathological status of CRC.

  1. Analysis of tandem repeat units of the promoter of capsanthin/capsorubin synthase (Ccs) gene in pepper fruit.

    Science.gov (United States)

    Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui

    2017-07-01

    Capsanthin/capsorubin synthase ( Ccs ) gene is a key