WorldWideScience

Sample records for acidobacteria provide insight

  1. Acidobacteria

    NARCIS (Netherlands)

    Dedysh, S.N.; Sinninghe Damsté, J.S.

    2018-01-01

    Acidobacteria are one of the globally distributed and highly diverse phyla of the domain Bacteria. These microorganisms inhabit a wide variety of terrestrial and aquatic habitats and are particularly abundant in acidic soils, peatlands and mineral iron-rich environments. Owing to the difficulties in

  2. Genomic insights into the Acidobacteria reveal strategies for their success in terrestrial environments

    Science.gov (United States)

    Trojan, Daniela; Roux, Simon; Herbold, Craig; Rattei, Thomas; Woebken, Dagmar

    2018-01-01

    Summary Members of the phylum Acidobacteria are abundant and ubiquitous across soils. We performed a large‐scale comparative genome analysis spanning subdivisions 1, 3, 4, 6, 8 and 23 (n = 24) with the goal to identify features to help explain their prevalence in soils and understand their ecophysiology. Our analysis revealed that bacteriophage integration events along with transposable and mobile elements influenced the structure and plasticity of these genomes. Low‐ and high‐affinity respiratory oxygen reductases were detected in multiple genomes, suggesting the capacity for growing across different oxygen gradients. Among many genomes, the capacity to use a diverse collection of carbohydrates, as well as inorganic and organic nitrogen sources (such as via extracellular peptidases), was detected – both advantageous traits in environments with fluctuating nutrient environments. We also identified multiple soil acidobacteria with the potential to scavenge atmospheric concentrations of H2, now encompassing mesophilic soil strains within the subdivision 1 and 3, in addition to a previously identified thermophilic strain in subdivision 4. This large‐scale acidobacteria genome analysis reveal traits that provide genomic, physiological and metabolic versatility, presumably allowing flexibility and versatility in the challenging and fluctuating soil environment. PMID:29327410

  3. Peatland Acidobacteria with a dissimilatory sulfur metabolism.

    Science.gov (United States)

    Hausmann, Bela; Pelikan, Claus; Herbold, Craig W; Köstlbacher, Stephan; Albertsen, Mads; Eichorst, Stephanie A; Glavina Del Rio, Tijana; Huemer, Martin; Nielsen, Per H; Rattei, Thomas; Stingl, Ulrich; Tringe, Susannah G; Trojan, Daniela; Wentrup, Cecilia; Woebken, Dagmar; Pester, Michael; Loy, Alexander

    2018-02-23

    Sulfur-cycling microorganisms impact organic matter decomposition in wetlands and consequently greenhouse gas emissions from these globally relevant environments. However, their identities and physiological properties are largely unknown. By applying a functional metagenomics approach to an acidic peatland, we recovered draft genomes of seven novel Acidobacteria species with the potential for dissimilatory sulfite (dsrAB, dsrC, dsrD, dsrN, dsrT, dsrMKJOP) or sulfate respiration (sat, aprBA, qmoABC plus dsr genes). Surprisingly, the genomes also encoded DsrL, which so far was only found in sulfur-oxidizing microorganisms. Metatranscriptome analysis demonstrated expression of acidobacterial sulfur-metabolism genes in native peat soil and their upregulation in diverse anoxic microcosms. This indicated an active sulfate respiration pathway, which, however, might also operate in reverse for dissimilatory sulfur oxidation or disproportionation as proposed for the sulfur-oxidizing Desulfurivibrio alkaliphilus. Acidobacteria that only harbored genes for sulfite reduction additionally encoded enzymes that liberate sulfite from organosulfonates, which suggested organic sulfur compounds as complementary energy sources. Further metabolic potentials included polysaccharide hydrolysis and sugar utilization, aerobic respiration, several fermentative capabilities, and hydrogen oxidation. Our findings extend both, the known physiological and genetic properties of Acidobacteria and the known taxonomic diversity of microorganisms with a DsrAB-based sulfur metabolism, and highlight new fundamental niches for facultative anaerobic Acidobacteria in wetlands based on exploitation of inorganic and organic sulfur molecules for energy conservation.

  4. Acidobacteria form a coherent but highly diverse group within the bacterial domain: evidence from environmental genomics

    DEFF Research Database (Denmark)

    Quaiser, Achim; Ochsenreiter, Torsten; Lanz, Christa

    2003-01-01

    fragments differed between 2.3% and 19.9% and were placed into two different subgroups of Acidobacteria (groups III and V). Although partial co-linearity was found between genomic fragments, the gene content around the rRNA operons was generally not conserved. Phylogenetic reconstructions with orthologues......Acidobacteria have been established as a novel phylum of Bacteria that is consistently detected in many different habitats around the globe by 16S rDNA-based molecular surveys. The phylogenetic diversity, ubiquity and abundance of this group, particularly in soil habitats, suggest an important...... palustris and Bradyrhizobium japonicum, including a conserved two-component system. Phylogenetic analysis of the putative response regulator confirmed that this similarity between Rhizobiales and Acidobacteria might be due to a horizontal gene transfer. In total, our data give first insight into the genome...

  5. Can Economics Provide Insights into Trust Infrastructure?

    Science.gov (United States)

    Vishik, Claire

    Many security technologies require infrastructure for authentication, verification, and other processes. In many cases, viable and innovative security technologies are never adopted on a large scale because the necessary infrastructure is slow to emerge. Analyses of such technologies typically focus on their technical flaws, and research emphasizes innovative approaches to stronger implementation of the core features. However, an observation can be made that in many cases the success of adoption pattern depends on non-technical issues rather than technology-lack of economic incentives, difficulties in finding initial investment, inadequate government support. While a growing body of research is dedicated to economics of security and privacy in general, few theoretical studies in this area have been completed, and even fewer that look at the economics of “trust infrastructure” beyond simple “cost of ownership” models. This exploratory paper takes a look at some approaches in theoretical economics to determine if they can provide useful insights into security infrastructure technologies and architectures that have the best chance to be adopted. We attempt to discover if models used in theoretical economics can help inform technology developers of the optimal business models that offer a better chance for quick infrastructure deployment.

  6. The complex jujube genome provides insights into fruit tree biology.

    Science.gov (United States)

    Liu, Meng-Jun; Zhao, Jin; Cai, Qing-Le; Liu, Guo-Cheng; Wang, Jiu-Rui; Zhao, Zhi-Hui; Liu, Ping; Dai, Li; Yan, Guijun; Wang, Wen-Jiang; Li, Xian-Song; Chen, Yan; Sun, Yu-Dong; Liu, Zhi-Guo; Lin, Min-Juan; Xiao, Jing; Chen, Ying-Ying; Li, Xiao-Feng; Wu, Bin; Ma, Yong; Jian, Jian-Bo; Yang, Wei; Yuan, Zan; Sun, Xue-Chao; Wei, Yan-Li; Yu, Li-Li; Zhang, Chi; Liao, Sheng-Guang; He, Rong-Jun; Guang, Xuan-Min; Wang, Zhuo; Zhang, Yue-Yang; Luo, Long-Hai

    2014-10-28

    The jujube (Ziziphus jujuba Mill.), a member of family Rhamnaceae, is a major dry fruit and a traditional herbal medicine for more than one billion people. Here we present a high-quality sequence for the complex jujube genome, the first genome sequence of Rhamnaceae, using an integrated strategy. The final assembly spans 437.65 Mb (98.6% of the estimated) with 321.45 Mb anchored to the 12 pseudo-chromosomes and contains 32,808 genes. The jujube genome has undergone frequent inter-chromosome fusions and segmental duplications, but no recent whole-genome duplication. Further analyses of the jujube-specific genes and transcriptome data from 15 tissues reveal the molecular mechanisms underlying some specific properties of the jujube. Its high vitamin C content can be attributed to a unique high level expression of genes involved in both biosynthesis and regeneration. Our study provides insights into jujube-specific biology and valuable genomic resources for the improvement of Rhamnaceae plants and other fruit trees.

  7. Comparative genomics provide insights into evolution of trichoderma nutrition style.

    Science.gov (United States)

    Xie, Bin-Bin; Qin, Qi-Long; Shi, Mei; Chen, Lei-Lei; Shu, Yan-Li; Luo, Yan; Wang, Xiao-Wei; Rong, Jin-Cheng; Gong, Zhi-Ting; Li, Dan; Sun, Cai-Yun; Liu, Gui-Ming; Dong, Xiao-Wei; Pang, Xiu-Hua; Huang, Feng; Liu, Weifeng; Chen, Xiu-Lan; Zhou, Bai-Cheng; Zhang, Yu-Zhong; Song, Xiao-Yan

    2014-02-01

    Saprotrophy on plant biomass is a recently developed nutrition strategy for Trichoderma. However, the physiology and evolution of this new nutrition strategy is still elusive. We report the deep sequencing and analysis of the genome of Trichoderma longibrachiatum, an efficient cellulase producer. The 31.7-Mb genome, smallest among the sequenced Trichoderma species, encodes fewer nutrition-related genes than saprotrophic T. reesei (Tr), including glycoside hydrolases and nonribosomal peptide synthetase-polyketide synthase. Homology and phylogenetic analyses suggest that a large number of nutrition-related genes, including GH18 chitinases, β-1,3/1,6-glucanases, cellulolytic enzymes, and hemicellulolytic enzymes, were lost in the common ancestor of T. longibrachiatum (Tl) and Tr. dN/dS (ω) calculation indicates that all the nutrition-related genes analyzed are under purifying selection. Cellulolytic enzymes, the key enzymes for saprotrophy on plant biomass, are under stronger purifying selection pressure in Tl and Tr than in mycoparasitic species, suggesting that development of the nutrition strategy of saprotrophy on plant biomass has increased the selection pressure. In addition, aspartic proteases, serine proteases, and metalloproteases are subject to stronger purifying selection pressure in Tl and Tr, suggesting that these enzymes may also play important roles in the nutrition. This study provides insights into the physiology and evolution of the nutrition strategy of Trichoderma.

  8. Can tobacco dependence provide insights into other drug addictions?

    Directory of Open Access Journals (Sweden)

    Joseph R. DiFranza

    2016-10-01

    Full Text Available Abstract Within the field of addiction research, individuals tend to operate within silos of knowledge focused on specific drug classes. The discovery that tobacco dependence develops in a progression of stages and that the latency to the onset of withdrawal symptoms after the last use of tobacco changes over time have provided insights into how tobacco dependence develops that might be applied to the study of other drugs. As physical dependence on tobacco develops, it progresses through previously unrecognized clinical stages of wanting, craving and needing. The latency to withdrawal is a measure of the asymptomatic phase of withdrawal, extending from the last use of tobacco to the emergence of withdrawal symptoms. Symptomatic withdrawal is characterized by a wanting phase, a craving phase, and a needing phase. The intensity of the desire to smoke that is triggered by withdrawal correlates with brain activity in addiction circuits. With repeated tobacco use, the latency to withdrawal shrinks from as long as several weeks to as short as several minutes. The shortening of the asymptomatic phase of withdrawal drives an escalation of smoking, first in terms of the number of smoking days/month until daily smoking commences, then in terms of cigarettes smoked/day. The discoveries of the stages of physical dependence and the latency to withdrawal raises the question, does physical dependence develop in stages with other drugs? Is the latency to withdrawal for other substances measured in weeks at the onset of dependence? Does it shorten over time? The research methods that uncovered how tobacco dependence emerges might be fruitfully applied to the investigation of other addictions.

  9. Eggshell Porosity Provides Insight on Evolution of Nesting in Dinosaurs.

    Directory of Open Access Journals (Sweden)

    Kohei Tanaka

    Full Text Available Knowledge about the types of nests built by dinosaurs can provide insight into the evolution of nesting and reproductive behaviors among archosaurs. However, the low preservation potential of their nesting materials and nesting structures means that most information can only be gleaned indirectly through comparison with extant archosaurs. Two general nest types are recognized among living archosaurs: 1 covered nests, in which eggs are incubated while fully covered by nesting material (as in crocodylians and megapodes, and 2 open nests, in which eggs are exposed in the nest and brooded (as in most birds. Previously, dinosaur nest types had been inferred by estimating the water vapor conductance (i.e., diffusive capacity of their eggs, based on the premise that high conductance corresponds to covered nests and low conductance to open nests. However, a lack of statistical rigor and inconsistencies in this method render its application problematic and its validity questionable. As an alternative we propose a statistically rigorous approach to infer nest type based on large datasets of eggshell porosity and egg mass compiled for over 120 extant archosaur species and 29 archosaur extinct taxa/ootaxa. The presence of a strong correlation between eggshell porosity and nest type among extant archosaurs indicates that eggshell porosity can be used as a proxy for nest type, and thus discriminant analyses can help predict nest type in extinct taxa. Our results suggest that: 1 covered nests are likely the primitive condition for dinosaurs (and probably archosaurs, and 2 open nests first evolved among non-avian theropods more derived than Lourinhanosaurus and were likely widespread in non-avian maniraptorans, well before the appearance of birds. Although taphonomic evidence suggests that basal open nesters (i.e., oviraptorosaurs and troodontids were potentially the first dinosaurs to brood their clutches, they still partially buried their eggs in sediment

  10. Eggshell Porosity Provides Insight on Evolution of Nesting in Dinosaurs.

    Science.gov (United States)

    Tanaka, Kohei; Zelenitsky, Darla K; Therrien, François

    2015-01-01

    Knowledge about the types of nests built by dinosaurs can provide insight into the evolution of nesting and reproductive behaviors among archosaurs. However, the low preservation potential of their nesting materials and nesting structures means that most information can only be gleaned indirectly through comparison with extant archosaurs. Two general nest types are recognized among living archosaurs: 1) covered nests, in which eggs are incubated while fully covered by nesting material (as in crocodylians and megapodes), and 2) open nests, in which eggs are exposed in the nest and brooded (as in most birds). Previously, dinosaur nest types had been inferred by estimating the water vapor conductance (i.e., diffusive capacity) of their eggs, based on the premise that high conductance corresponds to covered nests and low conductance to open nests. However, a lack of statistical rigor and inconsistencies in this method render its application problematic and its validity questionable. As an alternative we propose a statistically rigorous approach to infer nest type based on large datasets of eggshell porosity and egg mass compiled for over 120 extant archosaur species and 29 archosaur extinct taxa/ootaxa. The presence of a strong correlation between eggshell porosity and nest type among extant archosaurs indicates that eggshell porosity can be used as a proxy for nest type, and thus discriminant analyses can help predict nest type in extinct taxa. Our results suggest that: 1) covered nests are likely the primitive condition for dinosaurs (and probably archosaurs), and 2) open nests first evolved among non-avian theropods more derived than Lourinhanosaurus and were likely widespread in non-avian maniraptorans, well before the appearance of birds. Although taphonomic evidence suggests that basal open nesters (i.e., oviraptorosaurs and troodontids) were potentially the first dinosaurs to brood their clutches, they still partially buried their eggs in sediment. Open nests

  11. High Resolution Insights into Snow Distribution Provided by Drone Photogrammetry

    Science.gov (United States)

    Redpath, T.; Sirguey, P. J.; Cullen, N. J.; Fitzsimons, S.

    2017-12-01

    accumulation and ablation, snow depth maps provide geostatistically robust insights into seasonal snow processes, with unprecedented detail. Such data may enhance understanding of physical processes controlling spatial and temporal distribution of seasonal snow, and their relative importance at varying spatial and temporal scales.

  12. Social network analysis provides insights into African swine fever epidemiology.

    Science.gov (United States)

    Lichoti, Jacqueline Kasiiti; Davies, Jocelyn; Kitala, Philip M; Githigia, Samuel M; Okoth, Edward; Maru, Yiheyis; Bukachi, Salome A; Bishop, Richard P

    2016-04-01

    Pig movements play a significant role in the spread of economically important infectious diseases such as the African swine fever. Characterization of movement networks between pig farms and through other types of farm and household enterprises that are involved in pig value chains can provide useful information on the role that different participants in the networks play in pathogen transmission. Analysis of social networks that underpin these pig movements can reveal pathways that are important in the transmission of disease, trade in commodities, the dissemination of information and the influence of behavioural norms. We assessed pig movements among pig keeping households within West Kenya and East Uganda and across the shared Kenya-Uganda border in the study region, to gain insight into within-country and trans-boundary pig movements. Villages were sampled using a randomized cluster design. Data were collected through interviews in 2012 and 2013 from 683 smallholder pig-keeping households in 34 villages. NodeXL software was used to describe pig movement networks at village level. The pig movement and trade networks were localized and based on close social networks involving family ties, friendships and relationships with neighbours. Pig movement network modularity ranged from 0.2 to 0.5 and exhibited good community structure within the network implying an easy flow of knowledge and adoption of new attitudes and beliefs, but also promoting an enhanced rate of disease transmission. The average path length of 5 defined using NodeXL, indicated that disease could easily reach every node in a cluster. Cross-border boar service between Uganda and Kenya was also recorded. Unmonitored trade in both directions was prevalent. While most pig transactions in the absence of disease, were at a small scale (sales during ASF outbreaks were to traders or other farmers from outside the sellers' village at a range of >10km. The close social relationships between actors in pig

  13. Numerical Experiments Providing New Insights into Plasma Focus Fusion Devices

    Directory of Open Access Journals (Sweden)

    Sing Lee

    2010-04-01

    Full Text Available Recent extensive and systematic numerical experiments have uncovered new insights into plasma focus fusion devices including the following: (1 a plasma current limitation effect, as device static inductance is reduced towards very small values; (2 scaling laws of neutron yield and soft x-ray yield as functions of storage energies and currents; (3 a global scaling law for neutron yield as a function of storage energy combining experimental and numerical data showing that scaling deterioration has probably been interpreted as neutron ‘saturation’; and (4 a fundamental cause of neutron ‘saturation’. The ground-breaking insights thus gained may completely change the directions of plasma focus fusion research.

  14. Induced seismicity provides insight into why earthquake ruptures stop

    KAUST Repository

    Galis, Martin

    2017-12-21

    Injection-induced earthquakes pose a serious seismic hazard but also offer an opportunity to gain insight into earthquake physics. Currently used models relating the maximum magnitude of injection-induced earthquakes to injection parameters do not incorporate rupture physics. We develop theoretical estimates, validated by simulations, of the size of ruptures induced by localized pore-pressure perturbations and propagating on prestressed faults. Our model accounts for ruptures growing beyond the perturbed area and distinguishes self-arrested from runaway ruptures. We develop a theoretical scaling relation between the largest magnitude of self-arrested earthquakes and the injected volume and find it consistent with observed maximum magnitudes of injection-induced earthquakes over a broad range of injected volumes, suggesting that, although runaway ruptures are possible, most injection-induced events so far have been self-arrested ruptures.

  15. Athena: Providing Insight into the History of the Universe

    Science.gov (United States)

    Murphy, Gloria A.

    2010-01-01

    The American Institute for Aeronautics and Astronautics has provided a Request for Proposal which calls for a manned mission to a Near-Earth Object. It is the goal of Team COLBERT to respond to their request by providing a reusable system that can be implemented as a solid stepping stone for future manned trips to Mars and beyond. Despite Team COLBERT consisting of only students in Aerospace Engineering, in order to achieve this feat, the team must employ the use of Systems Engineering. Tools and processes from Systems Engineering will provide quantitative and semi-quantitative tools for making design decisions and evaluating items such as budgets and schedules. This paper will provide an in-depth look at some of the Systems Engineering processes employed and will step through the design process of a Human Asteroid Exploration System.

  16. Military Medics Insight into Providing Womens Health Services

    Science.gov (United States)

    2015-12-22

    determining a patient’s preference in a provider rather than gender (Buck & Littleton, 2014). Medics, particularly male medics, were keenly aware of...KS, Littleton HL. (2014). Stereotyped beliefs about male and female OB-GYNS: relationship to provider choice and patient satisfaction. Journal of...health care resource during deployment. Male and female IDCs felt obligated to educate women about how to conduct themselves on ship. In a

  17. Habitat characteristics provide insights of carbon storage in seagrass meadows

    KAUST Repository

    Mazarrasa, Inés

    2018-02-17

    Seagrass meadows provide multiple ecosystem services, yet they are among the most threatened ecosystems on earth. Because of their role as carbon sinks, protection and restoration of seagrass meadows contribute to climate change mitigation. Blue Carbon strategies aim to enhance CO2 sequestration and avoid greenhouse gasses emissions through the management of coastal vegetated ecosystems, including seagrass meadows. The implementation of Blue Carbon strategies requires a good understanding of the habitat characteristics that influence Corg sequestration. Here, we review the existing knowledge on Blue Carbon research in seagrass meadows to identify the key habitat characteristics that influence Corg sequestration in seagrass meadows, those factors that threaten this function and those with unclear effects. We demonstrate that not all seagrass habitats have the same potential, identify research priorities and describe the implications of the results found for the implementation and development of efficient Blue Carbon strategies based on seagrass meadows.

  18. Habitat characteristics provide insights of carbon storage in seagrass meadows.

    Science.gov (United States)

    Mazarrasa, Inés; Samper-Villarreal, Jimena; Serrano, Oscar; Lavery, Paul S; Lovelock, Catherine E; Marbà, Núria; Duarte, Carlos M; Cortés, Jorge

    2018-02-16

    Seagrass meadows provide multiple ecosystem services, yet they are among the most threatened ecosystems on earth. Because of their role as carbon sinks, protection and restoration of seagrass meadows contribute to climate change mitigation. Blue Carbon strategies aim to enhance CO 2 sequestration and avoid greenhouse gasses emissions through the management of coastal vegetated ecosystems, including seagrass meadows. The implementation of Blue Carbon strategies requires a good understanding of the habitat characteristics that influence C org sequestration. Here, we review the existing knowledge on Blue Carbon research in seagrass meadows to identify the key habitat characteristics that influence C org sequestration in seagrass meadows, those factors that threaten this function and those with unclear effects. We demonstrate that not all seagrass habitats have the same potential, identify research priorities and describe the implications of the results found for the implementation and development of efficient Blue Carbon strategies based on seagrass meadows. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Plasmodium vivax Biology: Insights Provided by Genomics, Transcriptomics and Proteomics

    Science.gov (United States)

    Bourgard, Catarina; Albrecht, Letusa; Kayano, Ana C. A. V.; Sunnerhagen, Per; Costa, Fabio T. M.

    2018-01-01

    During the last decade, the vast omics field has revolutionized biological research, especially the genomics, transcriptomics and proteomics branches, as technological tools become available to the field researcher and allow difficult question-driven studies to be addressed. Parasitology has greatly benefited from next generation sequencing (NGS) projects, which have resulted in a broadened comprehension of basic parasite molecular biology, ecology and epidemiology. Malariology is one example where application of this technology has greatly contributed to a better understanding of Plasmodium spp. biology and host-parasite interactions. Among the several parasite species that cause human malaria, the neglected Plasmodium vivax presents great research challenges, as in vitro culturing is not yet feasible and functional assays are heavily limited. Therefore, there are gaps in our P. vivax biology knowledge that affect decisions for control policies aiming to eradicate vivax malaria in the near future. In this review, we provide a snapshot of key discoveries already achieved in P. vivax sequencing projects, focusing on developments, hurdles, and limitations currently faced by the research community, as well as perspectives on future vivax malaria research. PMID:29473024

  20. The genome of Laccaria bicolor provides insights into mycorrhizal symbiosis

    Energy Technology Data Exchange (ETDEWEB)

    Martin, F.; Aerts, A.; Ahren, D.; Brun, A.; Danchin, E. G. J.; Duchaussoy, F.; Gibon, J.; Kohler, A.; Lindquist, E.; Peresa, V.; Salamov, A.; Shapiro, H. J.; Wuyts, J.; Blaudez, D.; Buee, M.; Brokstein, P.; Canback, B.; Cohen, D.; Courty, P. E.; Coutinho, P. M.; Delaruelle, C.; Detter, J. C.; Deveau, A.; DiFazio, S.; Duplessis, S.; Fraissinet-Tachet, L.; Lucic, E.; Frey-Klett, P.; Fourrey, C.; Feussner, I.; Gay, G.; Grimwood, J.; Hoegger, P. J.; Jain, P.; Kilaru, S.; Labbe, J.; Lin, Y. C.; Legue, V.; Le Tacon, F.; Marmeisse, R.; Melayah, D.; Montanini, B.; Muratet, M.; Nehls, U.; Niculita-Hirzel, H.; Secq, M. P. Oudot-Le; Peter, M.; Quesneville, H.; Rajashekar, B.; Reich, M.; Rouhier, N.; Schmutz, J.; Yin, T.; Chalot, M.; Henrissat, B.; Kues, U.; Lucas, S.; Van de Peer, Y.; Podila, G. K.; Polle, A.; Pukkila, P. J.; Richardson, P. M.; Rouze, P.; Sanders, I. R.; Stajich, J. E.; Tunlid, A.; Tuskan, G.; Grigoriev, I. V.

    2007-08-10

    Mycorrhizal symbioses the union of roots and soil fungi are universal in terrestrial ecosystems and may have been fundamental to land colonization by plants 1, 2. Boreal, temperate and montane forests all depend on ectomycorrhizae1. Identification of the primary factors that regulate symbiotic development and metabolic activity will therefore open the door to understanding the role of ectomycorrhizae in plant development and physiology, allowing the full ecological significance of this symbiosis to be explored. Here we report the genome sequence of the ectomycorrhizal basidiomycete Laccaria bicolor (Fig. 1) and highlight gene sets involved in rhizosphere colonization and symbiosis. This 65-megabase genome assembly contains 20,000 predicted protein-encoding genes and a very large number of transposons and repeated sequences. We detected unexpected genomic features, most notably a battery of effector-type small secreted proteins (SSPs) with unknown function, several of which are only expressed in symbiotic tissues. The most highly expressed SSP accumulates in the proliferating hyphae colonizing the host root. The ectomycorrhizae-specific SSPs probably have a decisive role in the establishment of the symbiosis. The unexpected observation that the genome of L. bicolor lacks carbohydrate-active enzymes involved in degradation of plant cell walls, but maintains the ability to degrade non-plant cell wall polysaccharides, reveals the dual saprotrophic and biotrophic lifestyle of the mycorrhizal fungus that enables it to grow within both soil and living plant roots. The predicted gene inventory of the L. bicolor genome, therefore, points to previously unknown mechanisms of symbiosis operating in biotrophic mycorrhizal fungi. The availability of this genome provides an unparalleled opportunity to develop a deeper understanding of the processes by which symbionts interact with plants within their ecosystem to perform vital functions in the carbon and nitrogen cycles that are

  1. Differential response of Acidobacteria subgroups to forest-to-pasture conversion and their biogeographic patterns in the western Brazilian Amazon

    Directory of Open Access Journals (Sweden)

    Acacio Aparecido Navarrete

    2015-12-01

    Full Text Available Members of the phylum Acidobacteria are among the most abundant soil bacteria on Earth, but little is known about their response to environmental changes. We asked how the relative abundance and biogeographic patterning of this phylum and its subgroups responded to forest-to-pasture conversion in soils of the western Brazilian Amazon. Pyrosequencing of 16S rRNA genes was employed to assess the abundance and composition of the Acidobacteria community across 54 soil samples taken using a spatially nested sampling scheme at the landscape level. Numerically, Acidobacteria represented 20% of the total bacterial community in forest soils and 11% in pasture soils. Overall, 15 different Acidobacteria subgroups of the current 26 subgroups were detected, with Acidobacteria subgroups 1, 3, 5, and 6 accounting together for 87% of the total Acidobacteria community in forest soils and 75% in pasture soils. Concomitant with changes in soil chemistry after forest-to-pasture conversion - particularly an increase in properties linked to soil acidity and nutrient availability - we observed an increase in the relative abundances of Acidobacteria subgroups 4, 10, 17, and 18, and a decrease in the relative abundances of other Acidobacteria subgroups in pasture relative to forest soils. The composition of the total Acidobacteria community as well as the most abundant Acidobacteria subgroups (1, 3, 5, and 6 was significantly more similar in composition across space in pasture soils than in forest soils. These results suggest that preponderant responses of Acidobacteria subgroups, especially subgroups 1, 3, 4, 5, and 6, to forest-to-pasture conversion effects in soils could be used to define management-indicators of agricultural practices in the Amazon Basin. These acidobacterial responses are at least in part through alterations on acidity- and nutrient-related properties of the Amazon soils.

  2. Differential Response of Acidobacteria Subgroups to Forest-to-Pasture Conversion and Their Biogeographic Patterns in the Western Brazilian Amazon

    Science.gov (United States)

    Navarrete, Acacio A.; Venturini, Andressa M.; Meyer, Kyle M.; Klein, Ann M.; Tiedje, James M.; Bohannan, Brendan J. M.; Nüsslein, Klaus; Tsai, Siu M.; Rodrigues, Jorge L. M.

    2015-01-01

    Members of the phylum Acidobacteria are among the most abundant soil bacteria on Earth, but little is known about their response to environmental changes. We asked how the relative abundance and biogeographic patterning of this phylum and its subgroups responded to forest-to-pasture conversion in soils of the western Brazilian Amazon. Pyrosequencing of 16S rRNA genes was employed to assess the abundance and composition of the Acidobacteria community across 54 soil samples taken using a spatially nested sampling scheme at the landscape level. Numerically, Acidobacteria represented 20% of the total bacterial community in forest soils and 11% in pasture soils. Overall, 15 different Acidobacteria subgroups of the current 26 subgroups were detected, with Acidobacteria subgroups 1, 3, 5, and 6 accounting together for 87% of the total Acidobacteria community in forest soils and 75% in pasture soils. Concomitant with changes in soil chemistry after forest-to-pasture conversion—particularly an increase in properties linked to soil acidity and nutrient availability—we observed an increase in the relative abundances of Acidobacteria subgroups 4, 10, 17, and 18, and a decrease in the relative abundances of other Acidobacteria subgroups in pasture relative to forest soils. The composition of the total Acidobacteria community as well as the most abundant Acidobacteria subgroups (1, 3, 5, and 6) was significantly more similar in composition across space in pasture soils than in forest soils. These results suggest that preponderant responses of Acidobacteria subgroups, especially subgroups 1, 3, 4, 5, and 6, to forest-to-pasture conversion effects in soils could be used to define management-indicators of agricultural practices in the Amazon Basin. These acidobacterial responses are at least in part through alterations on acidity- and nutrient-related properties of the Amazon soils. PMID:26733981

  3. Hydrodeoxygenation by deuterium gas--a powerful way to provide insight into the reaction mechanisms.

    Science.gov (United States)

    Ben, Haoxi; Ferguson, Glen A; Mu, Wei; Pu, Yunqiao; Huang, Fang; Jarvis, Mark; Biddy, Mary; Deng, Yulin; Ragauskas, Arthur J

    2013-11-28

    This study demonstrates the use of isotopic labelling and NMR to study the HDO process. As far as we know, this is the first reported effort to trace the incorporation of hydrogen in the HDO process of lignin pyrolysis oil thereby providing key fundamental insight into its reaction mechanism.

  4. The Clean Energy Manufacturing Analysis Center (CEMAC): Providing Analysis and Insights on Clean Technology Manufacturing

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, Nicholi S [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

    2017-09-28

    The U.S. Department of Energy's Clean Energy Manufacturing Analysis Center (CEMAC) provides objective analysis and up-to-date data on global supply chains and manufacturing of clean energy technologies. Policymakers and industry leaders seek CEMAC insights to inform choices to promote economic growth and the transition to a clean energy economy.

  5. Unexpected Dominance of Elusive Acidobacteria in Early Industrial Soft Coal Slags

    Directory of Open Access Journals (Sweden)

    Carl-Eric Wegner

    2017-06-01

    Full Text Available Acid mine drainage (AMD and mine tailing environments are well-characterized ecosystems known to be dominated by organisms involved in iron- and sulfur-cycling. Here we examined the microbiology of industrial soft coal slags that originate from alum leaching, an ecosystem distantly related to AMD environments. Our study involved geochemical analyses, bacterial community profiling, and shotgun metagenomics. The slags still contained high amounts of alum constituents (aluminum, sulfur, which mediated direct and indirect effects on bacterial community structure. Bacterial groups typically found in AMD systems and mine tailings were not present. Instead, the soft coal slags were dominated by uncharacterized groups of Acidobacteria (DA052 [subdivision 2], KF-JG30-18 [subdivision 13], Actinobacteria (TM214, Alphaproteobacteria (DA111, and Chloroflexi (JG37-AG-4, which have previously been detected primarily in peatlands and uranium waste piles. Shotgun metagenomics allowed us to reconstruct 13 high-quality Acidobacteria draft genomes, of which two genomes could be directly linked to dominating groups (DA052, KF-JG30-18 by recovered 16S rRNA gene sequences. Comparative genomics revealed broad carbon utilization capabilities for these two groups of elusive Acidobacteria, including polysaccharide breakdown (cellulose, xylan and the competence to metabolize C1 compounds (ribulose monophosphate pathway and lignin derivatives (dye-decolorizing peroxidases. Equipped with a broad range of efflux systems for metal cations and xenobiotics, DA052 and KF-JG30-18 may have a competitive advantage over other bacterial groups in this unique habitat.

  6. Do flood risk perceptions provide useful insights for flood risk management? Findings from central Vietnam

    OpenAIRE

    Bubeck, P.; Botzen, W.J.W.; Suu, L.T.T.; Aerts, J.C.J.H.

    2012-01-01

    Following the renewed attention for non-structural flood risk reduction measures implemented at the household level, there has been an increased interest in individual flood risk perceptions. The reason for this is the commonly-made assumption that flood risk perceptions drive the motivation of individuals to undertake flood risk mitigation measures, as well as the public's demand for flood protection, and therefore provide useful insights for flood risk management. This study empirically exa...

  7. Influence of linear alkylbenzene sulfonate (LAS) on the structure of Alphaproteobacteria, Actinobacteria, and Acidobacteria communities in a soil microcosm.

    Science.gov (United States)

    Sánchez-Peinado, M del Mar; González-López, Jesús; Martínez-Toledo, M Victoria; Pozo, Clementina; Rodelas, Belén

    2010-03-01

    diversity. Our results evidence that the Phenylobacterium population represented by band class 7 was favored by the presence of increasing concentrations of LAS in the soil and turned into a dominant population, suggesting its possible ability to use LAS in soil as a source of nutrients. As studies with pure cultures are required to confirm the ability of this population to degrade LAS, isolation strategies are currently under development in our laboratory. The weak effect of LAS on the structure of Actinobacteria and Acidobacteria communities is particularly interesting, as to our knowledge, there are no previous reports regarding the effects of LAS on these bacterial groups in soil. CONCLUSIONS, RECOMMENDATIONS, AND PERSPECTIVES: The Phenylobacterium-related alphaproteobacterial population identified in this work was selectively enriched in LAS polluted soil and is a plausible candidate to play a relevant role in the biotransformation of the surfactant under the conditions tested. The surfactant had no remarkable effects on the Actinobacteria and Acidobacteria fingerprints in soil, even when present at concentrations widely exceeding those reached in soil immediately after sludge application. TGGE fingerprinting provides a reliable and low time-consuming method for the monitoring of the bacterial community structure and dynamics, and we recommend its integration with the biological and chemical analyses usually applied in risk assessment of LAS in the environment.

  8. Multi-omics analysis provides insight to the Ignicoccus hospitalis-Nanoarchaeum equitans association.

    Science.gov (United States)

    Rawle, Rachel A; Hamerly, Timothy; Tripet, Brian P; Giannone, Richard J; Wurch, Louie; Hettich, Robert L; Podar, Mircea; Copié, Valerie; Bothner, Brian

    2017-09-01

    Studies of interspecies interactions are inherently difficult due to the complex mechanisms which enable these relationships. A model system for studying interspecies interactions is the marine hyperthermophiles Ignicoccus hospitalis and Nanoarchaeum equitans. Recent independently-conducted 'omics' analyses have generated insights into the molecular factors modulating this association. However, significant questions remain about the nature of the interactions between these archaea. We jointly analyzed multiple levels of omics datasets obtained from published, independent transcriptomics, proteomics, and metabolomics analyses. DAVID identified functionally-related groups enriched when I. hospitalis is grown alone or in co-culture with N. equitans. Enriched molecular pathways were subsequently visualized using interaction maps generated using STRING. Key findings of our multi-level omics analysis indicated that I. hospitalis provides precursors to N. equitans for energy metabolism. Analysis indicated an overall reduction in diversity of metabolic precursors in the I. hospitalis-N. equitans co-culture, which has been connected to the differential use of ribosomal subunits and was previously unnoticed. We also identified differences in precursors linked to amino acid metabolism, NADH metabolism, and carbon fixation, providing new insights into the metabolic adaptions of I. hospitalis enabling the growth of N. equitans. This multi-omics analysis builds upon previously identified cellular patterns while offering new insights into mechanisms that enable the I. hospitalis-N. equitans association. Our study applies statistical and visualization techniques to a mixed-source omics dataset to yield a more global insight into a complex system, that was not readily discernable from separate omics studies. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Variations upon a theme: Australian lizards provide insights into the endocrine control of vertebrate reproductive cycles.

    Science.gov (United States)

    Jones, Susan M

    2017-04-01

    Australian lizards exhibit a broad array of different reproductive strategies and provide an extraordinary diversity and range of models with which to address fundamental problems in reproductive biology. Studies on lizards have frequently led to new insights into hormonal regulatory pathways or mechanisms of control, but we have detailed knowledge of the reproductive cycle in only a small percentage of known species. This review provides an overview and synthesis of current knowledge of the hormonal control of reproductive cycles in Australian lizards. Agamid lizards have provided useful models with which to test hypotheses about the hormonal regulation of the expression of reproductive behaviors, while research on viviparous skinks is providing insights into the evolution of the endocrine control of gestation. However, in order to better understand the potential risks that environmental factors such as climate change and endocrine disrupting chemicals pose to our fauna, better knowledge is required of the fundamental characteristics of the reproductive cycle in a broader range of lizard species. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Insights provided by Probabilistic Safety Assessment Relating to the Loss of Electrical Sources

    International Nuclear Information System (INIS)

    Lanore, Jeanne-Marie

    2015-01-01

    The loss of electrical sources is generally an important contributor to the risk related to nuclear plants. In particular the external hazards initiating events lead generally to a loss of electrical sources. This importance was underscored by the Fukushima accident. A strength of PSA is to provide insights not only into the causes of the event but also into the potential consequences (core damage prevention, large release prevention, and mitigation) with the corresponding risk impact. PSA could provide a measure of Defence-in-Depth in case of loss of a safety function. The task intends to illustrate the PSA capabilities with outstanding practical examples. The task will rely on a survey of existing PSAs. It will provide a complementary view for ROBELSYS task. The content and status of the task are summarized in 2 slides

  11. Sequencing of the sea lamprey (Petromyzon marinus) genome provides insights into vertebrate evolution

    Science.gov (United States)

    Smith, Jeramiah J; Kuraku, Shigehiro; Holt, Carson; Sauka-Spengler, Tatjana; Jiang, Ning; Campbell, Michael S; Yandell, Mark D; Manousaki, Tereza; Meyer, Axel; Bloom, Ona E; Morgan, Jennifer R; Buxbaum, Joseph D; Sachidanandam, Ravi; Sims, Carrie; Garruss, Alexander S; Cook, Malcolm; Krumlauf, Robb; Wiedemann, Leanne M; Sower, Stacia A; Decatur, Wayne A; Hall, Jeffrey A; Amemiya, Chris T; Saha, Nil R; Buckley, Katherine M; Rast, Jonathan P; Das, Sabyasachi; Hirano, Masayuki; McCurley, Nathanael; Guo, Peng; Rohner, Nicolas; Tabin, Clifford J; Piccinelli, Paul; Elgar, Greg; Ruffier, Magali; Aken, Bronwen L; Searle, Stephen MJ; Muffato, Matthieu; Pignatelli, Miguel; Herrero, Javier; Jones, Matthew; Brown, C Titus; Chung-Davidson, Yu-Wen; Nanlohy, Kaben G; Libants, Scot V; Yeh, Chu-Yin; McCauley, David W; Langeland, James A; Pancer, Zeev; Fritzsch, Bernd; de Jong, Pieter J; Zhu, Baoli; Fulton, Lucinda L; Theising, Brenda; Flicek, Paul; Bronner, Marianne E; Warren, Wesley C; Clifton, Sandra W; Wilson, Richard K; Li, Weiming

    2013-01-01

    Lampreys are representatives of an ancient vertebrate lineage that diverged from our own ~500 million years ago. By virtue of this deeply shared ancestry, the sea lamprey (P. marinus) genome is uniquely poised to provide insight into the ancestry of vertebrate genomes and the underlying principles of vertebrate biology. Here, we present the first lamprey whole-genome sequence and assembly. We note challenges faced owing to its high content of repetitive elements and GC bases, as well as the absence of broad-scale sequence information from closely related species. Analyses of the assembly indicate that two whole-genome duplications likely occurred before the divergence of ancestral lamprey and gnathostome lineages. Moreover, the results help define key evolutionary events within vertebrate lineages, including the origin of myelin-associated proteins and the development of appendages. The lamprey genome provides an important resource for reconstructing vertebrate origins and the evolutionary events that have shaped the genomes of extant organisms. PMID:23435085

  12. Structure of the Hantavirus Nucleoprotein Provides Insights into the Mechanism of RNA Encapsidation

    Directory of Open Access Journals (Sweden)

    Daniel Olal

    2016-03-01

    Full Text Available Hantaviruses are etiological agents of life-threatening hemorrhagic fever with renal syndrome and hantavirus cardiopulmonary syndrome. The nucleoprotein (N of hantavirus is essential for viral transcription and replication, thus representing an attractive target for therapeutic intervention. We have determined the crystal structure of hantavirus N to 3.2 Å resolution. The structure reveals a two-lobed, mostly α-helical structure that is distantly related to that of orthobunyavirus Ns. A basic RNA binding pocket is located at the intersection between the two lobes. We provide evidence that oligomerization is mediated by amino- and C-terminal arms that bind to the adjacent monomers. Based on these findings, we suggest a model for the oligomeric ribonucleoprotein (RNP complex. Our structure provides mechanistic insights into RNA encapsidation in the genus Hantavirus and constitutes a template for drug discovery efforts aimed at combating hantavirus infections.

  13. Enhancing the Thermal Resistance of a Novel Acidobacteria-Derived Phytase by Engineering of Disulfide Bridges.

    Science.gov (United States)

    Tan, Hao; Miao, Renyun; Liu, Tianhai; Cao, Xuelian; Wu, Xiang; Xie, Liyuan; Huang, Zhongqian; Peng, Weihong; Gan, Bingcheng

    2016-10-28

    A novel phytase of Acidobacteria was identified from a soil metagenome, cloned, overexpressed, and purified. It has low sequence similarity (phytases. At the optimum pH (2.5), the phytase shows an activity level of 1,792 μmol/min/mg at physiological temperature (37°C) and could retain 92% residual activity after 30 min, indicating the phytase is acidophilic and acidostable. However the phytase shows poor stability at high temperatures. To improve its thermal resistance, the enzyme was redesigned using Disulfide by Design 2.0, introducing four additional disulfide bridges. The half-life time of the engineered phytase at 60°C and 80°C, respectively, is 3.0× and 2.8× longer than the wild-type, and its activity and acidostability are not significantly affected.

  14. Integrative Analyses of De Novo Mutations Provide Deeper Biological Insights into Autism Spectrum Disorder

    Directory of Open Access Journals (Sweden)

    Atsushi Takata

    2018-01-01

    Full Text Available Recent studies have established important roles of de novo mutations (DNMs in autism spectrum disorders (ASDs. Here, we analyze DNMs in 262 ASD probands of Japanese origin and confirm the “de novo paradigm” of ASDs across ethnicities. Based on this consistency, we combine the lists of damaging DNMs in our and published ASD cohorts (total number of trios, 4,244 and perform integrative bioinformatics analyses. Besides replicating the findings of previous studies, our analyses highlight ATP-binding genes and fetal cerebellar/striatal circuits. Analysis of individual genes identified 61 genes enriched for damaging DNMs, including ten genes for which our dataset now contributes to statistical significance. Screening of compounds altering the expression of genes hit by damaging DNMs reveals a global downregulating effect of valproic acid, a known risk factor for ASDs, whereas cardiac glycosides upregulate these genes. Collectively, our integrative approach provides deeper biological and potential medical insights into ASDs.

  15. Complementation studies with the novel "Bungowannah" virus provide new insights in the compatibility of pestivirus proteins.

    Science.gov (United States)

    Richter, Maria; Reimann, Ilona; Wegelt, Anne; Kirkland, Peter D; Beer, Martin

    2011-09-30

    In recent years several atypical pestiviruses have been described. Bungowannah virus is the most divergent virus in this group. Therefore, heterologous complementation was used to clarify the phylogenetic relationship and to analyze the exchangeability of genome regions encoding structural proteins. Using a BVDV type 1 backbone, chimeric constructs with substituted envelope proteins E(rns), E1 and E2, were investigated. While all constructs replicated autonomously, infectious high titer chimeric virus could only be observed after exchanging the complete E1-E2 encoding region. The complementation of E1 and E2 alone resulted only in replicons. Complementation of BVDV-E(rns) was only efficient if Bungowannah virus-E(rns) was expressed from a bicistronic construct. Our data provide new insights in the compatibility of pestivirus proteins and demonstrate that heterologous complementation could be useful to characterize new pestiviruses. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. Whole genome analysis of Leptospira licerasiae provides insight into leptospiral evolution and pathogenicity.

    Directory of Open Access Journals (Sweden)

    Jessica N Ricaldi

    Full Text Available The whole genome analysis of two strains of the first intermediately pathogenic leptospiral species to be sequenced (Leptospira licerasiae strains VAR010 and MMD0835 provides insight into their pathogenic potential and deepens our understanding of leptospiral evolution. Comparative analysis of eight leptospiral genomes shows the existence of a core leptospiral genome comprising 1547 genes and 452 conserved genes restricted to infectious species (including L. licerasiae that are likely to be pathogenicity-related. Comparisons of the functional content of the genomes suggests that L. licerasiae retains several proteins related to nitrogen, amino acid and carbohydrate metabolism which might help to explain why these Leptospira grow well in artificial media compared with pathogenic species. L. licerasiae strains VAR010(T and MMD0835 possess two prophage elements. While one element is circular and shares homology with LE1 of L. biflexa, the second is cryptic and homologous to a previously identified but unnamed region in L. interrogans serovars Copenhageni and Lai. We also report a unique O-antigen locus in L. licerasiae comprised of a 6-gene cluster that is unexpectedly short compared with L. interrogans in which analogous regions may include >90 such genes. Sequence homology searches suggest that these genes were acquired by lateral gene transfer (LGT. Furthermore, seven putative genomic islands ranging in size from 5 to 36 kb are present also suggestive of antecedent LGT. How Leptospira become naturally competent remains to be determined, but considering the phylogenetic origins of the genes comprising the O-antigen cluster and other putative laterally transferred genes, L. licerasiae must be able to exchange genetic material with non-invasive environmental bacteria. The data presented here demonstrate that L. licerasiae is genetically more closely related to pathogenic than to saprophytic Leptospira and provide insight into the genomic bases for

  17. Structure of sulfamidase provides insight into the molecular pathology of mucopolysaccharidosis IIIA

    International Nuclear Information System (INIS)

    Sidhu, Navdeep S.; Schreiber, Kathrin; Pröpper, Kevin; Becker, Stefan; Usón, Isabel; Sheldrick, George M.; Gärtner, Jutta; Krätzner, Ralph; Steinfeld, Robert

    2014-01-01

    Mucopolysaccharidosis IIIA is a fatal neurodegenerative disease that typically manifests itself in childhood and is caused by mutations in the gene for the lysosomal enzyme sulfamidase. The first structure of this enzyme is presented, which provides insight into the molecular basis of disease-causing mutations, and the enzymatic mechanism is proposed. Mucopolysaccharidosis type IIIA (Sanfilippo A syndrome), a fatal childhood-onset neurodegenerative disease with mild facial, visceral and skeletal abnormalities, is caused by an inherited deficiency of the enzyme N-sulfoglucosamine sulfohydrolase (SGSH; sulfamidase). More than 100 mutations in the SGSH gene have been found to reduce or eliminate its enzymatic activity. However, the molecular understanding of the effect of these mutations has been confined by a lack of structural data for this enzyme. Here, the crystal structure of glycosylated SGSH is presented at 2 Å resolution. Despite the low sequence identity between this unique N-sulfatase and the group of O-sulfatases, they share a similar overall fold and active-site architecture, including a catalytic formylglycine, a divalent metal-binding site and a sulfate-binding site. However, a highly conserved lysine in O-sulfatases is replaced in SGSH by an arginine (Arg282) that is positioned to bind the N-linked sulfate substrate. The structure also provides insight into the diverse effects of pathogenic mutations on SGSH function in mucopolysaccharidosis type IIIA and convincing evidence for the molecular consequences of many missense mutations. Further, the molecular characterization of SGSH mutations will lay the groundwork for the development of structure-based drug design for this devastating neurodegenerative disorder

  18. Structure of sulfamidase provides insight into the molecular pathology of mucopolysaccharidosis IIIA

    Energy Technology Data Exchange (ETDEWEB)

    Sidhu, Navdeep S. [University of Göttingen, Robert-Koch-Strasse 40, 37075 Göttingen (Germany); University of Göttingen, Tammannstrasse 4, 37077 Göttingen (Germany); Schreiber, Kathrin [University of Göttingen, Robert-Koch-Strasse 40, 37075 Göttingen (Germany); Pröpper, Kevin [University of Göttingen, Tammannstrasse 4, 37077 Göttingen (Germany); Becker, Stefan [Max Planck Institute for Biophysical Chemistry, Am Fassberg 11, 37077 Göttingen (Germany); Usón, Isabel [Instituto de Biologia Molecular de Barcelona (IBMB–CSIC), Barcelona Science Park, Baldiri Reixach 15, 08028 Barcelona (Spain); Institucio Catalana de Recerca i Estudis Avancats (ICREA), (Spain); Sheldrick, George M. [University of Göttingen, Tammannstrasse 4, 37077 Göttingen (Germany); Gärtner, Jutta; Krätzner, Ralph, E-mail: rkraetz@gwdg.de; Steinfeld, Robert, E-mail: rkraetz@gwdg.de [University of Göttingen, Robert-Koch-Strasse 40, 37075 Göttingen (Germany)

    2014-05-01

    Mucopolysaccharidosis IIIA is a fatal neurodegenerative disease that typically manifests itself in childhood and is caused by mutations in the gene for the lysosomal enzyme sulfamidase. The first structure of this enzyme is presented, which provides insight into the molecular basis of disease-causing mutations, and the enzymatic mechanism is proposed. Mucopolysaccharidosis type IIIA (Sanfilippo A syndrome), a fatal childhood-onset neurodegenerative disease with mild facial, visceral and skeletal abnormalities, is caused by an inherited deficiency of the enzyme N-sulfoglucosamine sulfohydrolase (SGSH; sulfamidase). More than 100 mutations in the SGSH gene have been found to reduce or eliminate its enzymatic activity. However, the molecular understanding of the effect of these mutations has been confined by a lack of structural data for this enzyme. Here, the crystal structure of glycosylated SGSH is presented at 2 Å resolution. Despite the low sequence identity between this unique N-sulfatase and the group of O-sulfatases, they share a similar overall fold and active-site architecture, including a catalytic formylglycine, a divalent metal-binding site and a sulfate-binding site. However, a highly conserved lysine in O-sulfatases is replaced in SGSH by an arginine (Arg282) that is positioned to bind the N-linked sulfate substrate. The structure also provides insight into the diverse effects of pathogenic mutations on SGSH function in mucopolysaccharidosis type IIIA and convincing evidence for the molecular consequences of many missense mutations. Further, the molecular characterization of SGSH mutations will lay the groundwork for the development of structure-based drug design for this devastating neurodegenerative disorder.

  19. Functional screening of abundant bacteria from acidic forest soil indicates the metabolic potential of Acidobacteria subdivision 1 for polysaccharide decomposition

    Czech Academy of Sciences Publication Activity Database

    Lladó, Salvador; Žifčáková, Lucia; Větrovský, Tomáš; Eichlerová, Ivana; Baldrian, Petr

    2016-01-01

    Roč. 52, č. 2 (2016), s. 251-260 ISSN 0178-2762 R&D Projects: GA ČR(CZ) GP14-09040P EU Projects: European Commission(CZ) FP7ITN no.289949 Institutional support: RVO:61388971 Keywords : Coniferous forest * Bacterial ecology * Acidobacteria Subject RIV: EE - Microbiology, Virology Impact factor: 3.683, year: 2016

  20. Population densities of indigenous Acidobacteria change in the presence of plant growth promoting rhizobacteria (PGPR) in rhizosphere.

    Science.gov (United States)

    Kalam, Sadaf; Das, Subha Narayan; Basu, Anirban; Podile, Appa Rao

    2017-05-01

    Rhizosphere microbial community has diverse metabolic capabilities and plays a crucial role in maintaining plant health. Oligotrophic plant growth promoting rhizobacteria (PGPR), along with difficult-to-culture microbial fractions, might be involved synergistically in microbe-microbe and plant-microbe interactions in the rhizosphere. Among the difficult-to-culture microbial fractions, Acidobacteria constitutes the most dominant phylum thriving in rhizospheric soils. We selected effective PGPR for tomato and black gram and studied their effect on population densities of acidobacterial members. Three facultatively oligotrophic PGPR were identified through 16S rRNA gene sequencing as Sphingobacterium sp. (P3), Variovorax sp. (P4), and Roseomonas sp. (A2); the latter being a new report of PGPR. In presence of selected PGPR strains, the changes in population densities of Acidobacteria were monitored in metagenomic DNA extracted from bulk and rhizospheric soils of tomato and black gram using real time qPCR. A gradual increase in equivalent cell numbers of Acidobacteria members was observed over time along with a simultaneous increase in plant growth promotion by test PGPR. We report characterization of three effective PGPR strains and their effects on indigenous, underexplored difficult-to-culture phylum-Acidobacteria. We suggest that putative interactions between these two bacterial groups thriving in rhizospheric soils could be beneficial for plant growth. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Acidicapsa borealis gen. nov., sp. nov. and Acidicapsa ligni sp. nov., subdivision 1 Acidobacteria from Sphagnum peat and decaying wood

    NARCIS (Netherlands)

    Kulichevskaya, I.S.; Kostina, L.A.; Valášková, V.; Rijpstra, I.C.; Sinninghe Damsté, J.S.; De Boer, W.; Dedysh, S.N.

    2012-01-01

    Two strains of subdivision 1 Acidobacteria, namely the pink-pigmented bacterium KA1T and the colorless isolate WH120T, were obtained from acidic Sphagnum peat and wood under decay by the white-rot fungus Hyploma fasciculare, respectively. Cells of these isolates are Gram-negative, non-motile, short

  2. Acidicapsa borealis gen. nov., sp nov and Acidicapsa ligni sp nov., subdivision 1 Acidobacteria from Sphagnum peat and decaying wood

    Czech Academy of Sciences Publication Activity Database

    Kulichevskaya, I.; Kostina, L. A.; Valášková, Vendula; Rijpstra, W. I.; Damste, J. S. S.; de Boer, W.; Dedysh, S. N.

    2012-01-01

    Roč. 62, č. 7 (2012), s. 1512-1520 ISSN 1466-5026 Institutional research plan: CEZ:AV0Z50200510 Keywords : PHYLUM ACIDOBACTERIA * ENVIRONMENT * SOIL Subject RIV: EE - Microbiology, Virology Impact factor: 2.112, year: 2012

  3. Hyper-dry conditions provide new insights into the cause of extreme floods after wildfire

    Science.gov (United States)

    Moody, John A.; Ebel, Brian A.

    2012-01-01

    A catastrophic wildfire in the foothills of the Rocky Mountains near Boulder, Colorado provided a unique opportunity to investigate soil conditions immediately after a wildfire and before alteration by rainfall. Measurements of near-surface (θ; and matric suction, ψ), rainfall, and wind velocity were started 8 days after the wildfire began. These measurements established that hyper-dryconditions (θ 3 cm-3; ψ > ~ 3 x 105 cm) existed and provided an in-situ retention curve for these conditions. These conditions exacerbate the effects of water repellency (natural and fire-induced) and limit the effectiveness of capillarity and gravity driven infiltration into fire-affected soils. The important consequence is that given hyper-dryconditions, the critical rewetting process before the first rain is restricted to the diffusion–adsorption of water-vapor. This process typically has a time scale of days to weeks (especially when the hydrologic effects of the ash layer are included) that is longer than the typical time scale (minutes to hours) of some rainstorms, such that under hyper-dryconditions essentially no rain infiltrates. The existence of hyper-dryconditions provides insight into why, frequently during the first rain storm after a wildfire, nearly all rainfall becomes runoff causing extremefloods and debris flows.

  4. Molecular fossils in modern genomes provide physiological and geochemical insights to the ancient earth (Invited)

    Science.gov (United States)

    Dupont, C.; Caetano-Anolles, G.

    2010-12-01

    The genomes of extant organisms are ultimately derived from ancient life, thus theoretically contain insight to ancient physiology, ecology, and environments. In particular, metalloenzymes may be particularly insightful. The fundamental chemistry of trace elements dictates the molecular speciation and reactivity both within cells and the environment at large. Using protein structure and comparative genomics, we elucidate several major influences this chemistry has had upon biology. All of life exhibits the same proteome size-dependent scaling for the number of metal-binding proteins within a proteome. This fundamental evolutionary constant shows that the selection of one element occurs at the exclusion of another, with the eschewal of Fe for Zn and Ca being a defining feature of eukaryotic pro- teomes. Early life lacked both the structures required to control intracellular metal concentrations and the metal-binding proteins that catalyze electron transport and redox transformations. The development of protein structures for metal homeostasis coincided with the emergence of metal-specific structures, which predomi- nantly bound metals abundant in the Archean ocean. Potentially, this promoted the diversification of emerging lineages of Archaea and Bacteria through the establishment of biogeochemical cycles. In contrast, structures binding Cu and Zn evolved much later, pro- viding further evidence that environmental availability influenced the selection of the elements. The late evolving Zn-binding proteins are fundamental to eukaryotic cellular biology, and Zn bioavailabil- ity may have been a limiting factor in eukaryotic evolution. The results presented here provide an evolutionary timeline based on genomic characteristics, and key hypotheses can be tested by alternative geochemical methods.

  5. Tackling wicked problems: how theories of agency can provide new insights.

    Science.gov (United States)

    Varpio, Lara; Aschenbrener, Carol; Bates, Joanna

    2017-04-01

    This paper reviews why and how theories of agency can be used as analytical lenses to help health professions education (HPE) scholars address our community's wicked problems. Wicked problems are those that resist clear problem statements, defy traditional analysis approaches, and refuse definitive resolution (e.g. student remediation, assessments of professionalism, etc.). We illustrate how theories of agency can provide new insights into such challenges by examining the application of these theories to one particular wicked problem in HPE: interprofessional education (IPE). After searching the HPE literature and finding that theories of agency had received little attention, we borrowed techniques from narrative literature reviews to search databases indexing a broad scope of disciplines (i.e. ERIC, Web of Science, Scopus, MEDLINE and PubMed) for publications (1994-2014) that: (i) examined agency, or (ii) incorporated an agency-informed analytical perspective. The lead author identified the theories of agency used in these articles, and reviewed the texts on agency cited therein and the original sources of each theory. We identified 10 theories of agency that we considered to be applicable to HPE's wicked problems. To select a subset of theories for presentation in this paper, we discussed each theory in relation to some of HPE's wicked problems. Through debate and reflection, we unanimously agreed on the applicability of a subset of theories for illuminating HPE's wicked problems. This subset is described in this paper. We present four theories of agency: Butler's post-structural formulation; Giddens' sociological formulation; cultural historical activity theory's formulation, and Bandura's social cognitive psychology formulation. We introduce each theory and apply each to the challenges of engaging in IPE. Theories of agency can inform HPE scholarship in novel and generative ways. Each theory offers new insights into the roots of wicked problems and means for

  6. New technologies provide insights into genetic basis of psychiatric disorders and explain their co-morbidity.

    Science.gov (United States)

    Rudan, Igor

    2010-06-01

    The completion of Human Genome Project and the "HapMap" project was followed by translational activities from companies within the private sector. This led to the introduction of genome-wide scans based on hundreds of thousands of single nucleotide polymorphysms (SNP). These scans were based on common genetic variants in human populations. This new and powerful technology was then applied to the existing DNA-based datasets with information on psychiatric disorders. As a result, an unprecedented amount of novel scientific insights related to the underlying biology and genetics of psychiatric disorders was obtained. The dominant design of these studies, so called "genome-wide association studies" (GWAS), used statistical methods which minimized the risk of false positive reports and provided much greater power to detect genotype-phenotype associations. All findings were entirely data-driven rather than hypothesis-driven, which often made it difficult for researchers to understand or interpret the findings. Interestingly, this work in genetics is indicating how non-specific some genes are for psychiatric disorders, having associations in common for schizophrenia, bipolar disorder and autism. This suggests that the earlier stages of psychiatric disorders may be multi-valent and that early detection, coupled with a clearer understanding of the environmental factors, may allow prevention. At the present time, the rich "harvest" from GWAS still has very limited power to predict the variation in psychiatric disease status at individual level, typically explaining less than 5% of the total risk variance. The most recent studies of common genetic variation implicated the role of major histocompatibility complex in schizophrenia and other disorders. They also provided molecular evidence for a substantial polygenic component to the risk of psychiatric diseases, involving thousands of common alleles of very small effect. The studies of structural genetic variation, such as copy

  7. The sea cucumber genome provides insights into morphological evolution and visceral regeneration.

    Science.gov (United States)

    Zhang, Xiaojun; Sun, Lina; Yuan, Jianbo; Sun, Yamin; Gao, Yi; Zhang, Libin; Li, Shihao; Dai, Hui; Hamel, Jean-François; Liu, Chengzhang; Yu, Yang; Liu, Shilin; Lin, Wenchao; Guo, Kaimin; Jin, Songjun; Xu, Peng; Storey, Kenneth B; Huan, Pin; Zhang, Tao; Zhou, Yi; Zhang, Jiquan; Lin, Chenggang; Li, Xiaoni; Xing, Lili; Huo, Da; Sun, Mingzhe; Wang, Lei; Mercier, Annie; Li, Fuhua; Yang, Hongsheng; Xiang, Jianhai

    2017-10-01

    Apart from sharing common ancestry with chordates, sea cucumbers exhibit a unique morphology and exceptional regenerative capacity. Here we present the complete genome sequence of an economically important sea cucumber, A. japonicus, generated using Illumina and PacBio platforms, to achieve an assembly of approximately 805 Mb (contig N50 of 190 Kb and scaffold N50 of 486 Kb), with 30,350 protein-coding genes and high continuity. We used this resource to explore key genetic mechanisms behind the unique biological characters of sea cucumbers. Phylogenetic and comparative genomic analyses revealed the presence of marker genes associated with notochord and gill slits, suggesting that these chordate features were present in ancestral echinoderms. The unique shape and weak mineralization of the sea cucumber adult body were also preliminarily explained by the contraction of biomineralization genes. Genome, transcriptome, and proteome analyses of organ regrowth after induced evisceration provided insight into the molecular underpinnings of visceral regeneration, including a specific tandem-duplicated prostatic secretory protein of 94 amino acids (PSP94)-like gene family and a significantly expanded fibrinogen-related protein (FREP) gene family. This high-quality genome resource will provide a useful framework for future research into biological processes and evolution in deuterostomes, including remarkable regenerative abilities that could have medical applications. Moreover, the multiomics data will be of prime value for commercial sea cucumber breeding programs.

  8. Human acid sphingomyelinase structures provide insight to molecular basis of Niemann–Pick disease

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Yan-Feng; Metcalf, Matthew C.; Garman, Scott C.; Edmunds, Tim; Qiu, Huawei; Wei, Ronnie R. (Sanofi Aventis); (UMASS, Amherst)

    2016-10-26

    Acid sphingomyelinase (ASM) hydrolyzes sphingomyelin to ceramide and phosphocholine, essential components of myelin in neurons. Genetic alterations in ASM lead to ASM deficiency (ASMD) and have been linked to Niemann–Pick disease types A and B. Olipudase alfa, a recombinant form of human ASM, is being developed as enzyme replacement therapy to treat the non-neurological manifestations of ASMD. Here we present the human ASM holoenzyme and product bound structures encompassing all of the functional domains. The catalytic domain has a metallophosphatase fold, and two zinc ions and one reaction product phosphocholine are identified in a histidine-rich active site. The structures reveal the underlying catalytic mechanism, in which two zinc ions activate a water molecule for nucleophilic attack of the phosphodiester bond. Docking of sphingomyelin provides a model that allows insight into the selectivity of the enzyme and how the ASM domains collaborate to complete hydrolysis. Mapping of known mutations provides a basic understanding on correlations between enzyme dysfunction and phenotypes observed in ASMD patients.

  9. Dynamic transcriptional profiling provides insights into tuberous root development in Rehmannia glutinosa

    Directory of Open Access Journals (Sweden)

    Peng eSun

    2015-06-01

    Full Text Available Rehmannia glutinosa, a herb of the Scrophulariaceae family, is widely cultivated in the Northern part of China. The tuberous root has well known medicinal properties; however, yield and quality are threatened by abiotic and biotic stresses. Understanding the molecular process of tuberous root development may help identify novel targets for its control. In the present study, we used Illumina sequencing and de novo assembly strategies to obtain a reference transcriptome that is relevant to tuberous root development. We then conducted RNA-seq quantification analysis to determine gene expression profiles of the adventitious root (AR, thickening adventitious root (TAR, and the developing tuberous root (DTR. Expression profiling identified a total of 6,974 differentially expressed unigenes during root developmental. Bioinformatics analysis and gene expression profiling revealed changes in phenylpropanoid biosynthesis, starch and sucrose metabolism, and plant hormone biosynthesis during root development. Moreover, we identified and allocated putative functions to the genes involved in tuberous root development, including genes related to major carbohydrate metabolism, hormone metabolism, and transcription regulation. The present study provides the initial description of gene expression profiles of AR, TAR, and DTR, which facilitates identification of genes of interest. Moreover, our work provides insights into the molecular mechanisms underlying tuberous root development and may assist in the design and development of improved breeding schemes for different R. glutinosa varieties through genetic manipulation.

  10. The sea cucumber genome provides insights into morphological evolution and visceral regeneration.

    Directory of Open Access Journals (Sweden)

    Xiaojun Zhang

    2017-10-01

    Full Text Available Apart from sharing common ancestry with chordates, sea cucumbers exhibit a unique morphology and exceptional regenerative capacity. Here we present the complete genome sequence of an economically important sea cucumber, A. japonicus, generated using Illumina and PacBio platforms, to achieve an assembly of approximately 805 Mb (contig N50 of 190 Kb and scaffold N50 of 486 Kb, with 30,350 protein-coding genes and high continuity. We used this resource to explore key genetic mechanisms behind the unique biological characters of sea cucumbers. Phylogenetic and comparative genomic analyses revealed the presence of marker genes associated with notochord and gill slits, suggesting that these chordate features were present in ancestral echinoderms. The unique shape and weak mineralization of the sea cucumber adult body were also preliminarily explained by the contraction of biomineralization genes. Genome, transcriptome, and proteome analyses of organ regrowth after induced evisceration provided insight into the molecular underpinnings of visceral regeneration, including a specific tandem-duplicated prostatic secretory protein of 94 amino acids (PSP94-like gene family and a significantly expanded fibrinogen-related protein (FREP gene family. This high-quality genome resource will provide a useful framework for future research into biological processes and evolution in deuterostomes, including remarkable regenerative abilities that could have medical applications. Moreover, the multiomics data will be of prime value for commercial sea cucumber breeding programs.

  11. Deep transcriptome sequencing provides new insights into the structural and functional organization of the wheat genome.

    Science.gov (United States)

    Pingault, Lise; Choulet, Frédéric; Alberti, Adriana; Glover, Natasha; Wincker, Patrick; Feuillet, Catherine; Paux, Etienne

    2015-02-10

    Because of its size, allohexaploid nature, and high repeat content, the bread wheat genome is a good model to study the impact of the genome structure on gene organization, function, and regulation. However, because of the lack of a reference genome sequence, such studies have long been hampered and our knowledge of the wheat gene space is still limited. The access to the reference sequence of the wheat chromosome 3B provided us with an opportunity to study the wheat transcriptome and its relationships to genome and gene structure at a level that has never been reached before. By combining this sequence with RNA-seq data, we construct a fine transcriptome map of the chromosome 3B. More than 8,800 transcription sites are identified, that are distributed throughout the entire chromosome. Expression level, expression breadth, alternative splicing as well as several structural features of genes, including transcript length, number of exons, and cumulative intron length are investigated. Our analysis reveals a non-monotonic relationship between gene expression and structure and leads to the hypothesis that gene structure is determined by its function, whereas gene expression is subject to energetic cost. Moreover, we observe a recombination-based partitioning at the gene structure and function level. Our analysis provides new insights into the relationships between gene and genome structure and function. It reveals mechanisms conserved with other plant species as well as superimposed evolutionary forces that shaped the wheat gene space, likely participating in wheat adaptation.

  12. Transcriptome Analysis of Manganese-deficient Chlamydomonas reinhardtii Provides Insight on the Chlorophyll Biosynthesis Pathway

    Energy Technology Data Exchange (ETDEWEB)

    Lockhart, Ainsley; Zvenigorodsky, Natasha; Pedraza, Mary Ann; Lindquist, Erika

    2011-08-11

    The biosynthesis of chlorophyll and other tetrapyrroles is a vital but poorly understood process. Recent genomic advances with the unicellular green algae Chlamydomonas reinhardtii have created opportunity to more closely examine the mechanisms of the chlorophyll biosynthesis pathway via transcriptome analysis. Manganese is a nutrient of interest for complex reactions because of its multiple stable oxidation states and role in molecular oxygen coordination. C. reinhardtii was cultured in Manganese-deplete Tris-acetate-phosphate (TAP) media for 24 hours and used to create cDNA libraries for sequencing using Illumina TruSeq technology. Transcriptome analysis provided intriguing insight on possible regulatory mechanisms in the pathway. Evidence supports similarities of GTR (Glutamyl-tRNA synthase) to its Chlorella vulgaris homolog in terms of Mn requirements. Data was also suggestive of Mn-related compensatory up-regulation for pathway proteins CHLH1 (Manganese Chelatase), GUN4 (Magnesium chelatase activating protein), and POR1 (Light-dependent protochlorophyllide reductase). Intriguingly, data suggests possible reciprocal expression of oxygen dependent CPX1 (coproporphyrinogen III oxidase) and oxygen independent CPX2. Further analysis using RT-PCR could provide compelling evidence for several novel regulatory mechanisms in the chlorophyll biosynthesis pathway.

  13. Comparative transcriptome analysis provides new insights into erect and prostrate growth in bermudagrass (Cynodon dactylon L.).

    Science.gov (United States)

    Zhang, Bing; Xiao, Xiaolin; Zong, Junqin; Chen, Jingbo; Li, Jianjian; Guo, Hailin; Liu, Jianxiu

    2017-12-01

    Bermudagrass (Cynodon dactylon L.) is a prominent warm-season turf and forage grass species with multiple applications. In most C. dactylon cultivars and accessions, erect-growing stems (shoot) and prostrate-growing stems (stolon) often coexist. These two types of stems are both formed through tillering but grow in two directions with different tiller angles. Elucidating the mechanism of tiller angle regulation in bermudagrass could provide important clues to breed cultivars with different plant architectural features for diverse usage. In this study, we compared the stem internode transcriptome of two bermudagrass wild accessions with extremely different tiller angles and stem growth directions. A total of 2088 and 12,141 unigenes were preferentially expressed in prostrate-growing wild accession C792 and erect-growing wild accession C793, respectively. Kyoto Encyclopedia of Genes and Genomes (KEGG) Orthology-based Annotation System (KOBAS) analyses further indicated that light- and gravity-responsive genes were enriched in accession C792, whereas lignin synthesis-related genes were enriched in accession C793, which well explains the difference in lignification of vascular bundles and mechanical tissues in the two accessions. These results not only expand our understanding of the genetic control of tiller angle and stem growth direction in bermudagrass but also provide insight for future molecular breeding of C. dactylon and other turfgrass species with different plant architectures. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  14. The pomegranate (Punica granatum L.) genome provides insights into fruit quality and ovule developmental biology.

    Science.gov (United States)

    Yuan, Zhaohe; Fang, Yanming; Zhang, Taikui; Fei, Zhangjun; Han, Fengming; Liu, Cuiyu; Liu, Min; Xiao, Wei; Zhang, Wenjing; Wu, Shan; Zhang, Mengwei; Ju, Youhui; Xu, Huili; Dai, He; Liu, Yujun; Chen, Yanhui; Wang, Lili; Zhou, Jianqing; Guan, Dian; Yan, Ming; Xia, Yanhua; Huang, Xianbin; Liu, Dongyuan; Wei, Hongmin; Zheng, Hongkun

    2017-12-22

    Pomegranate (Punica granatum L.) has an ancient cultivation history and has become an emerging profitable fruit crop due to its attractive features such as the bright red appearance and the high abundance of medicinally valuable ellagitannin-based compounds in its peel and aril. However, the limited genomic resources have restricted further elucidation of genetics and evolution of these interesting traits. Here, we report a 274-Mb high-quality draft pomegranate genome sequence, which covers approximately 81.5% of the estimated 336-Mb genome, consists of 2177 scaffolds with an N50 size of 1.7 Mb and contains 30 903 genes. Phylogenomic analysis supported that pomegranate belongs to the Lythraceae family rather than the monogeneric Punicaceae family, and comparative analyses showed that pomegranate and Eucalyptus grandis share the paleotetraploidy event. Integrated genomic and transcriptomic analyses provided insights into the molecular mechanisms underlying the biosynthesis of ellagitannin-based compounds, the colour formation in both peels and arils during pomegranate fruit development, and the unique ovule development processes that are characteristic of pomegranate. This genome sequence provides an important resource to expand our understanding of some unique biological processes and to facilitate both comparative biology studies and crop breeding. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  15. Structures of parasite calreticulins provide insights into their flexibility and dual carbohydrate/peptide-binding properties.

    Science.gov (United States)

    Moreau, Christophe; Cioci, Gianluca; Iannello, Marina; Laffly, Emmanuelle; Chouquet, Anne; Ferreira, Arturo; Thielens, Nicole M; Gaboriaud, Christine

    2016-11-01

    Calreticulin (CRT) is a multifaceted protein, initially discovered as an endoplasmic reticulum (ER) chaperone protein, that is essential in calcium metabolism. Various implications in cancer, early development and immunology have been discovered more recently for CRT, as well as its role as a dominant 'eat-me' prophagocytic signal. Intriguingly, cell-surface exposure/secretion of CRT is among the infective strategies used by parasites such as Trypanosoma cruzi , Entamoeba histolytica , Taenia solium , Leishmania donovani and Schistosoma mansoni . Because of the inherent flexibility of CRTs, their analysis by X-ray crystallography requires the design of recombinant constructs suitable for crystallization, and thus only the structures of two very similar mammalian CRT lectin domains are known. With the X-ray structures of two distant parasite CRTs, insights into species structural determinants that might be harnessed to fight against the parasites without affecting the functions of the host CRT are now provided. Moreover, although the hypothesis that CRT can exhibit both open and closed conformations has been proposed in relation to its chaperone function, only the open conformation has so far been observed in crystal structures. The first evidence is now provided of a complex conformational transition with the junction reoriented towards P-domain closure. SAXS experiments also provided additional information about the flexibility of T. cruzi CRT in solution, thus complementing crystallographic data on the open conformation. Finally, regarding the conserved lectin-domain structure and chaperone function, evidence is provided of its dual carbohydrate/protein specificity and a new scheme is proposed to interpret such unusual substrate-binding properties. These fascinating features are fully consistent with previous experimental observations, as discussed considering the broad spectrum of CRT sequence conservations and differences.

  16. Structures of parasite calreticulins provide insights into their flexibility and dual carbohydrate/peptide-binding properties

    Directory of Open Access Journals (Sweden)

    Christophe Moreau

    2016-11-01

    Full Text Available Calreticulin (CRT is a multifaceted protein, initially discovered as an endoplasmic reticulum (ER chaperone protein, that is essential in calcium metabolism. Various implications in cancer, early development and immunology have been discovered more recently for CRT, as well as its role as a dominant `eat-me' prophagocytic signal. Intriguingly, cell-surface exposure/secretion of CRT is among the infective strategies used by parasites such as Trypanosoma cruzi, Entamoeba histolytica, Taenia solium, Leishmania donovani and Schistosoma mansoni. Because of the inherent flexibility of CRTs, their analysis by X-ray crystallography requires the design of recombinant constructs suitable for crystallization, and thus only the structures of two very similar mammalian CRT lectin domains are known. With the X-ray structures of two distant parasite CRTs, insights into species structural determinants that might be harnessed to fight against the parasites without affecting the functions of the host CRT are now provided. Moreover, although the hypothesis that CRT can exhibit both open and closed conformations has been proposed in relation to its chaperone function, only the open conformation has so far been observed in crystal structures. The first evidence is now provided of a complex conformational transition with the junction reoriented towards P-domain closure. SAXS experiments also provided additional information about the flexibility of T. cruzi CRT in solution, thus complementing crystallographic data on the open conformation. Finally, regarding the conserved lectin-domain structure and chaperone function, evidence is provided of its dual carbohydrate/protein specificity and a new scheme is proposed to interpret such unusual substrate-binding properties. These fascinating features are fully consistent with previous experimental observations, as discussed considering the broad spectrum of CRT sequence conservations and differences.

  17. Obsessive compulsive disorder networks: positron emission tomography and neuropsychology provide new insights.

    Directory of Open Access Journals (Sweden)

    Bruno Millet

    Full Text Available BACKGROUND: Deep brain stimulation has shed new light on the central role of the prefrontal cortex (PFC in obsessive compulsive disorder (OCD. We explored this structure from a functional perspective, synchronizing neuroimaging and cognitive measures. METHODS AND FINDINGS: This case-control cross-sectional study compared 15 OCD patients without comorbidities and not currently on serotonin reuptake inhibitors or cognitive behavioural therapy with 15 healthy controls (matched for age, sex and education level on resting-state (18FDG-PET scans and a neuropsychological battery assessing executive functions. We looked for correlations between metabolic modifications and impaired neuropsychological scores. Modifications in glucose metabolism were found in frontal regions (orbitofrontal cortex and dorsolateral cortices, the cingulate gyrus, insula and parietal gyrus. Neuropsychological differences between patients and controls, which were subtle, were correlated with the metabolism of the prefrontal, parietal, and temporal cortices. CONCLUSION: As expected, we confirmed previous reports of a PFC dysfunction in OCD patients, and established a correlation with cognitive deficits. Other regions outside the prefrontal cortex, including the dorsoparietal cortex and the insula, also appeared to be implicated in the pathophysiology of OCD, providing fresh insights on the complexity of OCD syndromes.

  18. Obsessive Compulsive Disorder Networks: Positron Emission Tomography and Neuropsychology Provide New Insights

    Science.gov (United States)

    Millet, Bruno; Dondaine, Thibaut; Reymann, Jean-Michel; Bourguignon, Aurélie; Naudet, Florian; Jaafari, Nematollah; Drapier, Dominique; Turmel, Valérie; Mesbah, Habiba; Vérin, Marc; Le Jeune, Florence

    2013-01-01

    Background Deep brain stimulation has shed new light on the central role of the prefrontal cortex (PFC) in obsessive compulsive disorder (OCD). We explored this structure from a functional perspective, synchronizing neuroimaging and cognitive measures. Methods and Findings This case-control cross-sectional study compared 15 OCD patients without comorbidities and not currently on serotonin reuptake inhibitors or cognitive behavioural therapy with 15 healthy controls (matched for age, sex and education level) on resting-state 18FDG-PET scans and a neuropsychological battery assessing executive functions. We looked for correlations between metabolic modifications and impaired neuropsychological scores. Modifications in glucose metabolism were found in frontal regions (orbitofrontal cortex and dorsolateral cortices), the cingulate gyrus, insula and parietal gyrus. Neuropsychological differences between patients and controls, which were subtle, were correlated with the metabolism of the prefrontal, parietal, and temporal cortices. Conclusion As expected, we confirmed previous reports of a PFC dysfunction in OCD patients, and established a correlation with cognitive deficits. Other regions outside the prefrontal cortex, including the dorsoparietal cortex and the insula, also appeared to be implicated in the pathophysiology of OCD, providing fresh insights on the complexity of OCD syndromes. PMID:23326403

  19. Discovery of extremely halophilic, methyl-reducing euryarchaea provides insights into the evolutionary origin of methanogenesis

    Science.gov (United States)

    Sorokin, Dimitry Y.; Makarova, Kira S.; Abbas, Ben; Ferrer, Manuel; Golyshin, Peter N.; Galinski, Erwin A.; Ciordia, Sergio; Mena, María Carmen; Merkel, Alexander Y.; Wolf, Yuri I.; van Loosdrecht, Mark C.M.; Koonin, Eugene V.

    2017-01-01

    Methanogenic archaea are major players in the global carbon cycle and in the biotechnology of anaerobic digestion. The phylum Euryarchaeota includes diverse groups of methanogens that are interspersed with non-methanogenic lineages. So far methanogens inhabiting hypersaline environments have been identified only within the order Methanosarcinales. We report the discovery of a deep phylogenetic lineage of extremophilic methanogens in hypersaline lakes, and present analysis of two nearly complete genomes from this group. Within the phylum Euryarchaeota, these isolates form a separate, class-level lineage “Methanonatronarchaeia” that is most closely related to the class Halobacteria. Similar to the Halobacteria, “Methanonatronarchaeia” are extremely halophilic and do not accumulate organic osmoprotectants. The high intracellular concentration of potassium implies that “Methanonatronarchaeia” employ the “salt-in” osmoprotection strategy. These methanogens are heterotrophic methyl-reducers that utilize C1-methylated compounds as electron acceptors and formate or hydrogen as electron donors. The genomes contain an incomplete and apparently inactivated set of genes encoding the upper branch of methyl group oxidation to CO2 as well as membrane-bound heterosulfide reductase and cytochromes. These features differentiates “Methanonatronarchaeia” from all known methyl-reducing methanogens. The discovery of extremely halophilic, methyl-reducing methanogens related to haloarchaea provides insights into the origin of methanogenesis and shows that the strategies employed by methanogens to thrive in salt-saturating conditions are not limited to the classical methylotrophic pathway. PMID:28555626

  20. Metatranscriptome Analysis of Fig Flowers Provides Insights into Potential Mechanisms for Mutualism Stability and Gall Induction.

    Directory of Open Access Journals (Sweden)

    Ellen O Martinson

    Full Text Available A striking property of the mutualism between figs and their pollinating wasps is that wasps consistently oviposit in the inner flowers of the fig syconium, which develop into galls that house developing larvae. Wasps typically do not use the outer ring of flowers, which develop into seeds. To better understand differences between gall and seed flowers, we used a metatranscriptomic approach to analyze eukaryotic gene expression within fig flowers at the time of oviposition choice and early gall development. Consistent with the unbeatable seed hypothesis, we found significant differences in gene expression between gall- and seed flowers in receptive syconia prior to oviposition. In particular, transcripts assigned to flavonoids and carbohydrate metabolism were significantly up-regulated in gall flowers relative to seed flowers. In response to oviposition, gall flowers significantly up-regulated the expression of chalcone synthase, which previously has been connected to gall formation in other plants. We propose several genes encoding proteins with signal peptides or associations with venom of other Hymenoptera as candidate genes for gall initiation or growth. This study simultaneously evaluates the gene expression profile of both mutualistic partners in a plant-insect mutualism and provides insight into a possible stability mechanism in the ancient fig-fig wasp association.

  1. Comparative proteomic analysis provides insight into 10-hydroxy-2-decenoic acid biosynthesis in honey bee workers.

    Science.gov (United States)

    Yang, Xiao-Hui; Yang, Shi-Fa; Wang, Rui-Ming

    2017-07-01

    10-Hydroxy-2-decenoic acid (10-HDA) is the major compound produced from the mandibular glands (MGs) of honey bee workers. However, little information is available on the molecular mechanisms of 10-HDA biosynthesis. In our study, based on investigating the 10-HDA secretion pattern and the morphological characteristics of MGs from honey bee workers of different ages, a comparative proteomic analysis was performed in the MGs of workers with different 10-HDA production. In total, 59 up-regulated protein species representing 45 unique proteins were identified in high 10-HDA-producing workers by 2-DE-MALDI-TOF/TOF MS. These proteins were involved in carbohydrate/energy metabolism, fatty acid metabolism, protein metabolism and folding, antioxidation, cytoskeleton, development and cell signaling. Proteins related to fatty acid metabolism, including fatty acid synthase and β-oxidation enzymes, are potentially crucial proteins involved in 10-HDA biosynthesis pathway. And RNA interference (RNAi) results demonstrated that knockdown of electron transfer flavoprotein subunit beta (ETF-β), one of the protein related to fatty acid metabolism, decreased 10-HDA production of worker bees, suggesting that ETF-β was necessary for 10-HDA biosynthesis. This study reveals the characteristics of MGs of worker bees at different developmental stages and proteins associated with 10-HDA biosynthesis, which provides the first insight into the molecular mechanism of 10-HDA biosynthesis.

  2. Crystal structure of the Epithiospecifier Protein, ESP from Arabidopsis thaliana provides insights into its product specificity.

    Science.gov (United States)

    Zhang, Weiwei; Wang, Wenhe; Liu, Zihe; Xie, Yongchao; Wang, Hao; Mu, Yajuan; Huang, Yao; Feng, Yue

    2016-09-16

    Specifier proteins are important components of the glucosinolate-myrosinase system, which mediate plant defense against herbivory and pathogen attacks. Upon tissue disruption, glucosinolates are hydrolyzed to instable aglucones by myrosinases, and then aglucones will rearrange to form defensive isothiocyanates. Specifier proteins can redirect this reaction to form other products, such as simple nitriles, epithionitriles and organic thiocyanates instead of isothiocyanates based on the side chain structure of glucosinolate and the type of the specifier proteins. Nevertheless, the molecular mechanism underlying the different product spectrums of various specifier proteins was not fully understood. Here in this study, we solved the crystal structure of the Epithiospecifier Protein, ESP from Arabidopsis thaliana (AtESP) at 2.3 Å resolution. Structural comparisons with the previously solved structure of thiocyanate forming protein, TFP from Thlaspi arvense (TaTFP) reveal that AtESP shows a dimerization pattern different from TaTFP. Moreover, AtESP harbors a slightly larger active site pocket than TaTFP and several residues around the active site are different between the two proteins, which might account for the different product spectrums of the two proteins. Together, our structural study provides important insights into the molecular mechanisms of specifier proteins and shed light on the basis of their different product spectrums. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. A six-gene phylogeny provides new insights into choanoflagellate evolution.

    Science.gov (United States)

    Carr, Martin; Richter, Daniel J; Fozouni, Parinaz; Smith, Timothy J; Jeuck, Alexandra; Leadbeater, Barry S C; Nitsche, Frank

    2017-02-01

    Recent studies have shown that molecular phylogenies of the choanoflagellates (Class Choanoflagellatea) are in disagreement with their traditional taxonomy, based on morphology, and that Choanoflagellatea requires considerable taxonomic revision. Furthermore, phylogenies suggest that the morphological and ecological evolution of the group is more complex than has previously been recognized. Here we address the taxonomy of the major choanoflagellate order Craspedida, by erecting four new genera. The new genera are shown to be morphologically, ecologically and phylogenetically distinct from other choanoflagellate taxa. Furthermore, we name five novel craspedid species, as well as formally describe ten species that have been shown to be either misidentified or require taxonomic revision. Our revised phylogeny, including 18 new species and sequence data for two additional genes, provides insights into the morphological and ecological evolution of the choanoflagellates. We examine the distribution within choanoflagellates of these two additional genes, EF-1A and EFL, closely related translation GTPases which are required for protein synthesis. Mapping the presence and absence of these genes onto the phylogeny highlights multiple events of gene loss within the choanoflagellates. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Genome-wide investigation of transcription factors provides insights into transcriptional regulation in Plutella xylostella.

    Science.gov (United States)

    Zhao, Qian; Ma, Dongna; Huang, Yuping; He, Weiyi; Li, Yiying; Vasseur, Liette; You, Minsheng

    2018-04-01

    Transcription factors (TFs), which play a vital role in regulating gene expression, are prevalent in all organisms and characterization of them may provide important clues for understanding regulation in vivo. The present study reports a genome-wide investigation of TFs in the diamondback moth, Plutella xylostella (L.), a worldwide pest of crucifers. A total of 940 TFs distributed among 133 families were identified. Phylogenetic analysis of insect species showed that some of these families were found to have expanded during the evolution of P. xylostella or Lepidoptera. RNA-seq analysis showed that some of the TF families, such as zinc fingers, homeobox, bZIP, bHLH, and MADF_DNA_bdg genes, were highly expressed in certain tissues including midgut, salivary glands, fat body, and hemocytes, with an obvious sex-biased expression pattern. In addition, a number of TFs showed significant differences in expression between insecticide susceptible and resistant strains, suggesting that these TFs play a role in regulating genes related to insecticide resistance. Finally, we identified an expansion of the HOX cluster in Lepidoptera, which might be related to Lepidoptera-specific evolution. Knockout of this cluster using CRISPR/Cas9 showed that the egg cannot hatch, indicating that this cluster may be related to egg development and maturation. This is the first comprehensive study on identifying and characterizing TFs in P. xylostella. Our results suggest that some TF families are expanded in the P. xylostella genome, and these TFs may have important biological roles in growth, development, sexual dimorphism, and resistance to insecticides. The present work provides a solid foundation for understanding regulation via TFs in P. xylostella and insights into the evolution of the P. xylostella genome.

  5. Modeling fMRI signals can provide insights into neural processing in the cerebral cortex.

    Science.gov (United States)

    Vanni, Simo; Sharifian, Fariba; Heikkinen, Hanna; Vigário, Ricardo

    2015-08-01

    Every stimulus or task activates multiple areas in the mammalian cortex. These distributed activations can be measured with functional magnetic resonance imaging (fMRI), which has the best spatial resolution among the noninvasive brain imaging methods. Unfortunately, the relationship between the fMRI activations and distributed cortical processing has remained unclear, both because the coupling between neural and fMRI activations has remained poorly understood and because fMRI voxels are too large to directly sense the local neural events. To get an idea of the local processing given the macroscopic data, we need models to simulate the neural activity and to provide output that can be compared with fMRI data. Such models can describe neural mechanisms as mathematical functions between input and output in a specific system, with little correspondence to physiological mechanisms. Alternatively, models can be biomimetic, including biological details with straightforward correspondence to experimental data. After careful balancing between complexity, computational efficiency, and realism, a biomimetic simulation should be able to provide insight into how biological structures or functions contribute to actual data processing as well as to promote theory-driven neuroscience experiments. This review analyzes the requirements for validating system-level computational models with fMRI. In particular, we study mesoscopic biomimetic models, which include a limited set of details from real-life networks and enable system-level simulations of neural mass action. In addition, we discuss how recent developments in neurophysiology and biophysics may significantly advance the modelling of fMRI signals. Copyright © 2015 the American Physiological Society.

  6. Macroscale patterns in body size of intertidal crustaceans provide insights on climate change effects

    Science.gov (United States)

    Dugan, Jenifer E.; Hubbard, David M.; Contreras, Heraldo; Duarte, Cristian; Acuña, Emilio; Schoeman, David S.

    2017-01-01

    Predicting responses of coastal ecosystems to altered sea surface temperatures (SST) associated with global climate change, requires knowledge of demographic responses of individual species. Body size is an excellent metric because it scales strongly with growth and fecundity for many ectotherms. These attributes can underpin demographic as well as community and ecosystem level processes, providing valuable insights for responses of vulnerable coastal ecosystems to changing climate. We investigated contemporary macroscale patterns in body size among widely distributed crustaceans that comprise the majority of intertidal abundance and biomass of sandy beach ecosystems of the eastern Pacific coasts of Chile and California, USA. We focused on ecologically important species representing different tidal zones, trophic guilds and developmental modes, including a high-shore macroalga-consuming talitrid amphipod (Orchestoidea tuberculata), two mid-shore scavenging cirolanid isopods (Excirolana braziliensis and E. hirsuticauda), and a low-shore suspension-feeding hippid crab (Emerita analoga) with an amphitropical distribution. Significant latitudinal patterns in body sizes were observed for all species in Chile (21° - 42°S), with similar but steeper patterns in Emerita analoga, in California (32°- 41°N). Sea surface temperature was a strong predictor of body size (-4% to -35% °C-1) in all species. Beach characteristics were subsidiary predictors of body size. Alterations in ocean temperatures of even a few degrees associated with global climate change are likely to affect body sizes of important intertidal ectotherms, with consequences for population demography, life history, community structure, trophic interactions, food-webs, and indirect effects such as ecosystem function. The consistency of results for body size and temperature across species with different life histories, feeding modes, ecological roles, and microhabitats inhabiting a single widespread coastal

  7. Genome-wide analysis of Pax8 binding provides new insights into thyroid functions

    Directory of Open Access Journals (Sweden)

    Ruiz-Llorente Sergio

    2012-04-01

    Full Text Available Abstract Background The transcription factor Pax8 is essential for the differentiation of thyroid cells. However, there are few data on genes transcriptionally regulated by Pax8 other than thyroid-related genes. To better understand the role of Pax8 in the biology of thyroid cells, we obtained transcriptional profiles of Pax8-silenced PCCl3 thyroid cells using whole genome expression arrays and integrated these signals with global cis-regulatory sequencing studies performed by ChIP-Seq analysis Results Exhaustive analysis of Pax8 immunoprecipitated peaks demonstrated preferential binding to intragenic regions and CpG-enriched islands, which suggests a role of Pax8 in transcriptional regulation of orphan CpG regions. In addition, ChIP-Seq allowed us to identify Pax8 partners, including proteins involved in tertiary DNA structure (CTCF and chromatin remodeling (Sp1, and these direct transcriptional interactions were confirmed in vivo. Moreover, both factors modulate Pax8-dependent transcriptional activation of the sodium iodide symporter (Nis gene promoter. We ultimately combined putative and novel Pax8 binding sites with actual target gene expression regulation to define Pax8-dependent genes. Functional classification suggests that Pax8-regulated genes may be directly involved in important processes of thyroid cell function such as cell proliferation and differentiation, apoptosis, cell polarity, motion and adhesion, and a plethora of DNA/protein-related processes. Conclusion Our study provides novel insights into the role of Pax8 in thyroid biology, exerted through transcriptional regulation of important genes involved in critical thyrocyte processes. In addition, we found new transcriptional partners of Pax8, which functionally cooperate with Pax8 in the regulation of thyroid gene transcription. Besides, our data demonstrate preferential location of Pax8 in non-promoter CpG regions. These data point to an orphan CpG island-mediated mechanism

  8. Comparative proteomic analysis provides new insights into cadmium accumulation in rice grain under cadmium stress

    Energy Technology Data Exchange (ETDEWEB)

    Xue, Dawei, E-mail: dwxue@hznu.edu.cn [College of Life and Environmental Sciences, Hangzhou Normal University, Hangzhou 310036 (China); State Key Laboratory of Rice Biology, China National Rice Research Institute, Hangzhou 310006 (China); Jiang, Hua [State Key Laboratory Breeding Base for Zhejiang Sustainable Pest and Disease Control, Zhejiang Academy of Agricultural Science, Hangzhou 310021 (China); Deng, Xiangxiong; Zhang, Xiaoqin [College of Life and Environmental Sciences, Hangzhou Normal University, Hangzhou 310036 (China); Wang, Hua [State Key Laboratory Breeding Base for Zhejiang Sustainable Pest and Disease Control, Zhejiang Academy of Agricultural Science, Hangzhou 310021 (China); Xu, Xiangbin [College of Life and Environmental Sciences, Hangzhou Normal University, Hangzhou 310036 (China); Hu, Jiang; Zeng, Dali [State Key Laboratory of Rice Biology, China National Rice Research Institute, Hangzhou 310006 (China); Guo, Longbiao, E-mail: guolongbiao@caas.cn [State Key Laboratory of Rice Biology, China National Rice Research Institute, Hangzhou 310006 (China); Qian, Qian, E-mail: qianqian188@hotmail.com [College of Life and Environmental Sciences, Hangzhou Normal University, Hangzhou 310036 (China); State Key Laboratory of Rice Biology, China National Rice Research Institute, Hangzhou 310006 (China)

    2014-09-15

    Graphical abstract: - Highlights: • Cd is the most toxic heavy metal and is a major pollutant in rice grains. • The mechanism of Cd accumulation in rice grains has not been well demonstrated. • Proteomics analysis is carried out and the verification is implemented by QPCR. • Proteins associated with ROS and photosynthesis showed large variation in expression. - Abstract: Rice is one of the most important staple crops. During the growth season, rice plants are inevitably subjected to numerous stresses, among which heavy metal stress represented by cadmium contamination not only hindering the yield of rice but also affecting the food safety by Cd accumulating in rice grains. The mechanism of Cd accumulation in rice grains has not been well elucidated. In this study, we compare the proteomic difference between two genotypes with different Cd accumulation ability in grains. Verification of differentially expressed protein-encoding genes was analyzing by quantitative PCR (QPCR) and reanalysis of microarray expression data. Forty-seven proteins in total were successfully identified through proteomic screening. GO and KEGG enrichment analysis showed Cd accumulation triggered stress-related pathways in the cells, and strongly affecting metabolic pathways. Many proteins associated with nutrient reservoir and starch-related enzyme were identified in this study suggesting that a considerably damage on grain quality was caused. The results also implied stress response was initiated by the abnormal cells and the transmission of signals may mediated by reactive oxygen species (ROS). Our research will provide new insights into Cd accumulation in rice grain under Cd stress.

  9. Canine CNGA3 Gene Mutations Provide Novel Insights into Human Achromatopsia-Associated Channelopathies and Treatment.

    Directory of Open Access Journals (Sweden)

    Naoto Tanaka

    Full Text Available Cyclic nucleotide-gated (CNG ion channels are key mediators underlying signal transduction in retinal and olfactory receptors. Genetic defects in CNGA3 and CNGB3, encoding two structurally related subunits of cone CNG channels, lead to achromatopsia (ACHM. ACHM is a congenital, autosomal recessive retinal disorder that manifests by cone photoreceptor dysfunction, severely reduced visual acuity, impaired or complete color blindness and photophobia. Here, we report the first canine models for CNGA3-associated channelopathy caused by R424W or V644del mutations in the canine CNGA3 ortholog that accurately mimic the clinical and molecular features of human CNGA3-associated ACHM. These two spontaneous mutations exposed CNGA3 residues essential for the preservation of channel function and biogenesis. The CNGA3-R424W results in complete loss of cone function in vivo and channel activity confirmed by in vitro electrophysiology. Structural modeling and molecular dynamics (MD simulations revealed R424-E306 salt bridge formation and its disruption with the R424W mutant. Reversal of charges in a CNGA3-R424E-E306R double mutant channel rescued cGMP-activated currents uncovering new insights into channel gating. The CNGA3-V644del affects the C-terminal leucine zipper (CLZ domain destabilizing intersubunit interactions of the coiled-coil complex in the MD simulations; the in vitro experiments showed incompetent trimeric CNGA3 subunit assembly consistent with abnormal biogenesis of in vivo channels. These newly characterized large animal models not only provide a valuable system for studying cone-specific CNG channel function in health and disease, but also represent prime candidates for proof-of-concept studies of CNGA3 gene replacement therapy for ACHM patients.

  10. X-ray structure reveals a new class and provides insight into evolution of alkaline phosphatases.

    Directory of Open Access Journals (Sweden)

    Subhash C Bihani

    Full Text Available The alkaline phosphatase (AP is a bi-metalloenzyme of potential applications in biotechnology and bioremediation, in which phosphate monoesters are nonspecifically hydrolysed under alkaline conditions to yield inorganic phosphate. The hydrolysis occurs through an enzyme intermediate in which the catalytic residue is phosphorylated. The reaction, which also requires a third metal ion, is proposed to proceed through a mechanism of in-line displacement involving a trigonal bipyramidal transition state. Stabilizing the transition state by bidentate hydrogen bonding has been suggested to be the reason for conservation of an arginine residue in the active site. We report here the first crystal structure of alkaline phosphatase purified from the bacterium Sphingomonas. sp. Strain BSAR-1 (SPAP. The crystal structure reveals many differences from other APs: 1 the catalytic residue is a threonine instead of serine, 2 there is no third metal ion binding pocket, and 3 the arginine residue forming bidentate hydrogen bonding is deleted in SPAP. A lysine and an aspargine residue, recruited together for the first time into the active site, bind the substrate phosphoryl group in a manner not observed before in any other AP. These and other structural features suggest that SPAP represents a new class of APs. Because of its direct contact with the substrate phosphoryl group, the lysine residue is proposed to play a significant role in catalysis. The structure is consistent with a mechanism of in-line displacement via a trigonal bipyramidal transition state. The structure provides important insights into evolutionary relationships between members of AP superfamily.

  11. 3D-structured illumination microscopy provides novel insight into architecture of human centrosomes

    Directory of Open Access Journals (Sweden)

    Katharina F. Sonnen

    2012-08-01

    Centrioles are essential for the formation of cilia and flagella. They also form the core of the centrosome, which organizes microtubule arrays important for cell shape, polarity, motility and division. Here, we have used super-resolution 3D-structured illumination microscopy to analyse the spatial relationship of 18 centriole and pericentriolar matrix (PCM components of human centrosomes at different cell cycle stages. During mitosis, PCM proteins formed extended networks with interspersed γ-Tubulin. During interphase, most proteins were arranged at specific distances from the walls of centrioles, resulting in ring staining, often with discernible density masses. Through use of site-specific antibodies, we found the C-terminus of Cep152 to be closer to centrioles than the N-terminus, illustrating the power of 3D-SIM to study protein disposition. Appendage proteins showed rings with multiple density masses, and the number of these masses was strongly reduced during mitosis. At the proximal end of centrioles, Sas-6 formed a dot at the site of daughter centriole assembly, consistent with its role in cartwheel formation. Plk4 and STIL co-localized with Sas-6, but Cep135 was associated mostly with mother centrioles. Remarkably, Plk4 formed a dot on the surface of the mother centriole before Sas-6 staining became detectable, indicating that Plk4 constitutes an early marker for the site of nascent centriole formation. Our study provides novel insights into the architecture of human centrosomes and illustrates the power of super-resolution microscopy in revealing the relative localization of centriole and PCM proteins in unprecedented detail.

  12. Newly evolved introns in human retrogenes provide novel insights into their evolutionary roles

    Directory of Open Access Journals (Sweden)

    Kang Li-Fang

    2012-07-01

    Full Text Available Abstract Background Retrogenes generally do not contain introns. However, in some instances, retrogenes may recruit internal exonic sequences as introns, which is known as intronization. A retrogene that undergoes intronization is a good model with which to investigate the origin of introns. Nevertheless, previously, only two cases in vertebrates have been reported. Results In this study, we systematically screened the human (Homo sapiens genome for retrogenes that evolved introns and analyzed their patterns in structure, expression and origin. In total, we identified nine intron-containing retrogenes. Alignment of pairs of retrogenes and their parents indicated that, in addition to intronization (five cases, retrogenes also may have gained introns by insertion of external sequences into the genes (one case or reversal of the orientation of transcription (three cases. Interestingly, many intronizations were promoted not by base substitutions but by cryptic splice sites, which were silent in the parental genes but active in the retrogenes. We also observed that the majority of introns generated by intronization did not involve frameshifts. Conclusions Intron gains in retrogenes are not as rare as previously thought. Furthermore, diverse mechanisms may lead to intron creation in retrogenes. The activation of cryptic splice sites in the intronization of retrogenes may be triggered by the change of gene structure after retroposition. A high percentage of non-frameshift introns in retrogenes may be because non-frameshift introns do not dramatically affect host proteins. Introns generated by intronization in human retrogenes are generally young, which is consistent with previous findings for Caenorhabditis elegans. Our results provide novel insights into the evolutionary role of introns.

  13. Proteomic analysis of FUS interacting proteins provides insights into FUS function and its role in ALS.

    Science.gov (United States)

    Kamelgarn, Marisa; Chen, Jing; Kuang, Lisha; Arenas, Alexandra; Zhai, Jianjun; Zhu, Haining; Gal, Jozsef

    2016-10-01

    Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disease. Mutations in the Fused in Sarcoma/Translocated in Liposarcoma (FUS/TLS) gene cause a subset of familial ALS cases and are also implicated in sporadic ALS. FUS is typically localized to the nucleus. The ALS-related FUS mutations cause cytoplasmic mis-localization and the formation of stress granule-like structures. Abnormal cytoplasmic FUS localization was also found in a subset of frontotemporal dementia (FTLD) cases without FUS mutations. To better understand the function of FUS, we performed wild-type and mutant FUS pull-downs followed by proteomic identification of the interacting proteins. The FUS interacting partners we identified are involved in multiple pathways, including chromosomal organization, transcription, RNA splicing, RNA transport, localized translation, and stress response. FUS interacted with hnRNPA1 and Matrin-3, RNA binding proteins whose mutations were also reported to cause familial ALS, suggesting that hnRNPA1 and Matrin-3 may play common pathogenic roles with FUS. The FUS interactions displayed varied RNA dependence. Numerous FUS interacting partners that we identified are components of exosomes. We found that FUS itself was present in exosomes, suggesting that the secretion of FUS might contribute to the cell-to-cell spreading of FUS pathology. FUS interacting proteins were sequestered into the cytoplasmic mutant FUS inclusions that could lead to their mis-regulation or loss of function, contributing to ALS pathogenesis. Our results provide insights into the physiological functions of FUS as well as important pathways where mutant FUS can interfere with cellular processes and potentially contribute to the pathogenesis of ALS. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Vitiligo blood transcriptomics provides new insights into disease mechanisms and identifies potential novel therapeutic targets.

    Science.gov (United States)

    Dey-Rao, Rama; Sinha, Animesh A

    2017-01-28

    Significant gaps remain regarding the pathomechanisms underlying the autoimmune response in vitiligo (VL), where the loss of self-tolerance leads to the targeted killing of melanocytes. Specifically, there is incomplete information regarding alterations in the systemic environment that are relevant to the disease state. We undertook a genome-wide profiling approach to examine gene expression in the peripheral blood of VL patients and healthy controls in the context of our previously published VL-skin gene expression profile. We used several in silico bioinformatics-based analyses to provide new insights into disease mechanisms and suggest novel targets for future therapy. Unsupervised clustering methods of the VL-blood dataset demonstrate a "disease-state"-specific set of co-expressed genes. Ontology enrichment analysis of 99 differentially expressed genes (DEGs) uncovers a down-regulated immune/inflammatory response, B-Cell antigen receptor (BCR) pathways, apoptosis and catabolic processes in VL-blood. There is evidence for both type I and II interferon (IFN) playing a role in VL pathogenesis. We used interactome analysis to identify several key blood associated transcriptional factors (TFs) from within (STAT1, STAT6 and NF-kB), as well as "hidden" (CREB1, MYC, IRF4, IRF1, and TP53) from the dataset that potentially affect disease pathogenesis. The TFs overlap with our reported lesional-skin transcriptional circuitry, underscoring their potential importance to the disease. We also identify a shared VL-blood and -skin transcriptional "hot spot" that maps to chromosome 6, and includes three VL-blood dysregulated genes (PSMB8, PSMB9 and TAP1) described as potential VL-associated genetic susceptibility loci. Finally, we provide bioinformatics-based support for prioritizing dysregulated genes in VL-blood or skin as potential therapeutic targets. We examined the VL-blood transcriptome in context with our (previously published) VL-skin transcriptional profile to address

  15. Quantitative Hydraulic Models Of Early Land Plants Provide Insight Into Middle Paleozoic Terrestrial Paleoenvironmental Conditions

    Science.gov (United States)

    Wilson, J. P.; Fischer, W. W.

    2010-12-01

    Fossil plants provide useful proxies of Earth’s climate because plants are closely connected, through physiology and morphology, to the environments in which they lived. Recent advances in quantitative hydraulic models of plant water transport provide new insight into the history of climate by allowing fossils to speak directly to environmental conditions based on preserved internal anatomy. We report results of a quantitative hydraulic model applied to one of the earliest terrestrial plants preserved in three dimensions, the ~396 million-year-old vascular plant Asteroxylon mackei. This model combines equations describing the rate of fluid flow through plant tissues with detailed observations of plant anatomy; this allows quantitative estimates of two critical aspects of plant function. First and foremost, results from these models quantify the supply of water to evaporative surfaces; second, results describe the ability of plant vascular systems to resist tensile damage from extreme environmental events, such as drought or frost. This approach permits quantitative comparisons of functional aspects of Asteroxylon with other extinct and extant plants, informs the quality of plant-based environmental proxies, and provides concrete data that can be input into climate models. Results indicate that despite their small size, water transport cells in Asteroxylon could supply a large volume of water to the plant's leaves--even greater than cells from some later-evolved seed plants. The smallest Asteroxylon tracheids have conductivities exceeding 0.015 m^2 / MPa * s, whereas Paleozoic conifer tracheids do not reach this threshold until they are three times wider. However, this increase in conductivity came at the cost of little to no adaptations for transport safety, placing the plant’s vegetative organs in jeopardy during drought events. Analysis of the thickness-to-span ratio of Asteroxylon’s tracheids suggests that environmental conditions of reduced relative

  16. Multiple Problem-Solving Strategies Provide Insight into Students' Understanding of Open-Ended Linear Programming Problems

    Science.gov (United States)

    Sole, Marla A.

    2016-01-01

    Open-ended questions that can be solved using different strategies help students learn and integrate content, and provide teachers with greater insights into students' unique capabilities and levels of understanding. This article provides a problem that was modified to allow for multiple approaches. Students tended to employ high-powered, complex,…

  17. An integrated Biophysical CGE model to provide Sustainable Development Goal insights

    Science.gov (United States)

    Sanchez, Marko; Cicowiez, Martin; Howells, Mark; Zepeda, Eduardo

    2016-04-01

    Future projected changes in the energy system will inevitably result in changes to the level of appropriation of environmental resources, particularly land and water, and this will have wider implications for environmental sustainability, and may affect other sectors of the economy. An integrated climate, land, energy and water (CLEW) system will provide useful insights, particularly with regard to the environmental sustainability. However, it will require adequate integration with other tools to detect economic impacts and broaden the scope for policy analysis. A computable general equilibrium (CGE) model is a well suited tool to channel impacts, as detected in a CLEW analysis, onto all sectors of the economy, and evaluate trade-offs and synergies, including those of possible policy responses. This paper will show an application of such integration in a single-country CGE model with the following key characteristics. Climate is partly exogenous (as proxied by temperature and rainfall) and partly endogenous (as proxied by emissions generated by different sectors) and has an impact on endogenous variables such as land productivity and labor productivity. Land is a factor of production used in agricultural and forestry activities which can be of various types if land use alternatives (e.g., deforestation) are to be considered. Energy is an input to the production process of all economic sectors and a consumption good for households. Because it is possible to allow for substitution among different energy sources (e.g. renewable vs non-renewable) in the generation of electricity, the production process of energy products can consider the use of natural resources such as oil and water. Water, data permitting, can be considered as an input into the production process of agricultural sectors, which is particularly relevant in case of irrigation. It can also be considered as a determinant of total factor productivity in hydro-power generation. The integration of a CLEW

  18. Large-scale GWAS identifies multiple loci for hand grip strength providing biological insights into muscular fitness

    DEFF Research Database (Denmark)

    Willems, Sara M; Wright, Daniel J.; Day, Felix R

    2017-01-01

    with involvement of psychomotor impairment (PEX14, LRPPRC and KANSL1). Mendelian randomization analyses are consistent with a causal effect of higher genetically predicted grip strength on lower fracture risk. In conclusion, our findings provide new biological insight into the mechanistic underpinnings of grip...... strength and the causal role of muscular strength in age-related morbidities and mortality....

  19. Flow-mediated dilation: can new approaches provide greater mechanistic insight into vascular dysfunction in preeclampsia and other diseases?

    Science.gov (United States)

    Weissgerber, Tracey L

    2014-11-01

    Endothelial dysfunction is a key feature of preeclampsia and may contribute to increased cardiovascular disease risk years after pregnancy. Flow-mediated dilation (FMD) is a non-invasive endothelial function test that predicts cardiovascular event risk. New protocols allow researchers to measure three components of the FMD response: FMD, low flow-mediated constriction, and shear stimulus. This review encourages researchers to think beyond "low FMD" by examining how these three components may provide additional insights into the mechanisms and location of vascular dysfunction. The review then examines what FMD studies reveal about vascular dysfunction in preeclampsia while highlighting opportunities to gain greater mechanistic insight from new protocols. Studies using traditional protocols show that FMD is low in mid-pregnancy prior to preeclampsia, at diagnosis, and for 3 years post-partum. However, FMD returns to normal by 10 years post-partum. Studies using new protocols are needed to gain more mechanistic insight.

  20. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation

    Science.gov (United States)

    2016-02-11

    unlimited. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation The views, opinions and...into Dynamics and Regulation of Yeast Translation Report Title Ribosome-footprint profiling provides genome-wide snapshots of translation, but...tend to slow translation. With the improved mRNA measurements, the variation attributable to translational control in exponentially growing yeast was

  1. Spider genomes provide insight into composition and evolution of venom and silk

    Science.gov (United States)

    Sanggaard, Kristian W.; Bechsgaard, Jesper S.; Fang, Xiaodong; Duan, Jinjie; Dyrlund, Thomas F.; Gupta, Vikas; Jiang, Xuanting; Cheng, Ling; Fan, Dingding; Feng, Yue; Han, Lijuan; Huang, Zhiyong; Wu, Zongze; Liao, Li; Settepani, Virginia; Thøgersen, Ida B.; Vanthournout, Bram; Wang, Tobias; Zhu, Yabing; Funch, Peter; Enghild, Jan J.; Schauser, Leif; Andersen, Stig U.; Villesen, Palle; Schierup, Mikkel H; Bilde, Trine; Wang, Jun

    2014-01-01

    Spiders are ecologically important predators with complex venom and extraordinarily tough silk that enables capture of large prey. Here we present the assembled genome of the social velvet spider and a draft assembly of the tarantula genome that represent two major taxonomic groups of spiders. The spider genomes are large with short exons and long introns, reminiscent of mammalian genomes. Phylogenetic analyses place spiders and ticks as sister groups supporting polyphyly of the Acari. Complex sets of venom and silk genes/proteins are identified. We find that venom genes evolved by sequential duplication, and that the toxic effect of venom is most likely activated by proteases present in the venom. The set of silk genes reveals a highly dynamic gene evolution, new types of silk genes and proteins, and a novel use of aciniform silk. These insights create new opportunities for pharmacological applications of venom and biomaterial applications of silk. PMID:24801114

  2. Structural studies of Pseudomonas and Chromobacterium ω-aminotransferases provide insights into their differing substrate specificity

    International Nuclear Information System (INIS)

    Sayer, Christopher; Isupov, Michail N.; Westlake, Aaron; Littlechild, Jennifer A.

    2013-01-01

    The X-ray structures of two ω-aminotransferases from P. aeruginosa and C. violaceum in complex with an inhibitor offer the first detailed insight into the structural basis of the substrate specificity of these industrially important enzymes. The crystal structures and inhibitor complexes of two industrially important ω-aminotransferase enzymes from Pseudomonas aeruginosa and Chromobacterium violaceum have been determined in order to understand the differences in their substrate specificity. The two enzymes share 30% sequence identity and use the same amino acceptor, pyruvate; however, the Pseudomonas enzyme shows activity towards the amino donor β-alanine, whilst the Chromobacterium enzyme does not. Both enzymes show activity towards S-α-methylbenzylamine (MBA), with the Chromobacterium enzyme having a broader substrate range. The crystal structure of the P. aeruginosa enzyme has been solved in the holo form and with the inhibitor gabaculine bound. The C. violaceum enzyme has been solved in the apo and holo forms and with gabaculine bound. The structures of the holo forms of both enzymes are quite similar. There is little conformational difference observed between the inhibitor complex and the holoenzyme for the P. aeruginosa aminotransferase. In comparison, the crystal structure of the C. violaceum gabaculine complex shows significant structural rearrangements from the structures of both the apo and holo forms of the enzyme. It appears that the different rigidity of the protein scaffold contributes to the substrate specificity observed for the two ω-aminotransferases

  3. The elite cross-country skier provides unique insights into human exercise physiology.

    Science.gov (United States)

    Holmberg, H-C

    2015-12-01

    Successful cross-country skiing, one of the most demanding of endurance sports, involves considerable physiological challenges posed by the combined upper- and lower-body effort of varying intensity and duration, on hilly terrain, often at moderate altitude and in a cold environment. Over the years, this unique sport has helped physiologists gain novel insights into the limits of human performance and regulatory capacity. There is a long-standing tradition of researchers in this field working together with coaches and athletes to improve training routines, monitor progress, and refine skiing techniques. This review summarizes research on elite cross-country skiers, with special emphasis on the studies initiated by Professor Bengt Saltin. He often employed exercise as a means to learn more about the human body, successfully engaging elite endurance athletes to improve our understanding of the demands, characteristics, and specific effects associated with different types of exercise. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. The correlation between gelatin macroscale differences and nanoparticle properties: providing insight into biopolymer variability.

    Science.gov (United States)

    Stevenson, André T; Jankus, Danny J; Tarshis, Max A; Whittington, Abby R

    2018-05-21

    From therapeutic delivery to sustainable packaging, manipulation of biopolymers into nanostructures imparts biocompatibility to numerous materials with minimal environmental pollution during processing. While biopolymers are appealing natural based materials, the lack of nanoparticle (NP) physicochemical consistency has decreased their nanoscale translation into actual products. Insights regarding the macroscale and nanoscale property variation of gelatin, one of the most common biopolymers already utilized in its bulk form, are presented. Novel correlations between macroscale and nanoscale properties were made by characterizing similar gelatin rigidities obtained from different manufacturers. Samples with significant differences in clarity, indicating sample purity, obtained the largest deviations in NP diameter. Furthermore, a statistically significant positive correlation between macroscale molecular weight dispersity and NP diameter was determined. New theoretical calculations proposing the limited number of gelatin chains that can aggregate and subsequently get crosslinked for NP formation were presented as one possible reason to substantiate the correlation analysis. NP charge and crosslinking extent were also related to diameter. Lower gelatin sample molecular weight dispersities produced statistically smaller average diameters (<75 nm), and higher average electrostatic charges (∼30 mV) and crosslinking extents (∼95%), which were independent of gelatin rigidity, conclusions not shown in the literature. This study demonstrates that the molecular weight composition of the starting material is one significant factor affecting gelatin nanoscale properties and must be characterized prior to NP preparation. Identifying gelatin macroscale and nanoscale correlations offers a route toward greater physicochemical property control and reproducibility of new NP formulations for translation to industry.

  5. Human listeners provide insights into echo features used by dolphins (Tursiops truncatus) to discriminate among objects.

    Science.gov (United States)

    Delong, Caroline M; Au, Whitlow W L; Harley, Heidi E; Roitblat, Herbert L; Pytka, Lisa

    2007-08-01

    Echolocating bottlenose dolphins (Tursiops truncatus) discriminate between objects on the basis of the echoes reflected by the objects. However, it is not clear which echo features are important for object discrimination. To gain insight into the salient features, the authors had a dolphin perform a match-to-sample task and then presented human listeners with echoes from the same objects used in the dolphin's task. In 2 experiments, human listeners performed as well or better than the dolphin at discriminating objects, and they reported the salient acoustic cues. The error patterns of the humans and the dolphin were compared to determine which acoustic features were likely to have been used by the dolphin. The results indicate that the dolphin did not appear to use overall echo amplitude, but that it attended to the pattern of changes in the echoes across different object orientations. Human listeners can quickly identify salient combinations of echo features that permit object discrimination, which can be used to generate hypotheses that can be tested using dolphins as subjects.

  6. Phylogenetic analyses provide insights into the historical biogeography and evolution of Brachyrhaphis fishes.

    Science.gov (United States)

    Ingley, Spencer J; Reina, Ruth G; Bermingham, Eldredge; Johnson, Jerald B

    2015-08-01

    The livebearing fish genus Brachyrhaphis (Poeciliidae) has become an increasingly important model in evolution and ecology research, yet the phylogeny of this group is not well understood, nor has it been examined thoroughly using modern phylogenetic methods. Here, we present the first comprehensive phylogenetic analysis of Brachyrhaphis by using four molecular markers (3mtDNA, 1nucDNA) to infer relationships among species in this genus. We tested the validity of this genus as a monophyletic group using extensive outgroup sampling based on recent phylogenetic hypotheses of Poeciliidae. We also tested the validity of recently described species of Brachyrhaphis that are part of the B. episcopi complex in Panama. Finally, we examined the impact of historical events on diversification of Brachyrhaphis, and made predictions regarding the role of different ecological environments on evolutionary diversification where known historical events apparently fail to explain speciation. Based on our results, we reject the monophyly of Brachyrhaphis, and question the validity of two recently described species (B. hessfeldi and B. roswithae). Historical biogeography of Brachyrhaphis generally agrees with patterns found in other freshwater taxa in Lower Central America, which show that geological barriers frequently predict speciation. Specifically, we find evidence in support of an 'island' model of Lower Central American formation, which posits that the nascent isthmus was partitioned by several marine connections before linking North and South America. In some cases where historic events (e.g., vicariance) fail to explain allopatric species breaks in Brachyrhaphis, ecological processes (e.g., divergent predation environments) offer additional insight into our understanding of phylogenetic diversification in this group. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Measures of phylogenetic differentiation provide robust and complementary insights into microbial communities.

    Science.gov (United States)

    Parks, Donovan H; Beiko, Robert G

    2013-01-01

    High-throughput sequencing techniques have made large-scale spatial and temporal surveys of microbial communities routine. Gaining insight into microbial diversity requires methods for effectively analyzing and visualizing these extensive data sets. Phylogenetic β-diversity measures address this challenge by allowing the relationship between large numbers of environmental samples to be explored using standard multivariate analysis techniques. Despite the success and widespread use of phylogenetic β-diversity measures, an extensive comparative analysis of these measures has not been performed. Here, we compare 39 measures of phylogenetic β diversity in order to establish the relative similarity of these measures along with key properties and performance characteristics. While many measures are highly correlated, those commonly used within microbial ecology were found to be distinct from those popular within classical ecology, and from the recently recommended Gower and Canberra measures. Many of the measures are surprisingly robust to different rootings of the gene tree, the choice of similarity threshold used to define operational taxonomic units, and the presence of outlying basal lineages. Measures differ considerably in their sensitivity to rare organisms, and the effectiveness of measures can vary substantially under alternative models of differentiation. Consequently, the depth of sequencing required to reveal underlying patterns of relationships between environmental samples depends on the selected measure. Our results demonstrate that using complementary measures of phylogenetic β diversity can further our understanding of how communities are phylogenetically differentiated. Open-source software implementing the phylogenetic β-diversity measures evaluated in this manuscript is available at http://kiwi.cs.dal.ca/Software/ExpressBetaDiversity.

  8. Comparison of the Internal Dynamics of Metalloproteases Provides New Insights on Their Function and Evolution.

    Directory of Open Access Journals (Sweden)

    Henrique F Carvalho

    Full Text Available Metalloproteases have evolved in a vast number of biological systems, being one of the most diverse types of proteases and presenting a wide range of folds and catalytic metal ions. Given the increasing understanding of protein internal dynamics and its role in enzyme function, we are interested in assessing how the structural heterogeneity of metalloproteases translates into their dynamics. Therefore, the dynamical profile of the clan MA type protein thermolysin, derived from an Elastic Network Model of protein structure, was evaluated against those obtained from a set of experimental structures and molecular dynamics simulation trajectories. A close correspondence was obtained between modes derived from the coarse-grained model and the subspace of functionally-relevant motions observed experimentally, the later being shown to be encoded in the internal dynamics of the protein. This prompted the use of dynamics-based comparison methods that employ such coarse-grained models in a representative set of clan members, allowing for its quantitative description in terms of structural and dynamical variability. Although members show structural similarity, they nonetheless present distinct dynamical profiles, with no apparent correlation between structural and dynamical relatedness. However, previously unnoticed dynamical similarity was found between the relevant members Carboxypeptidase Pfu, Leishmanolysin, and Botulinum Neurotoxin Type A, despite sharing no structural similarity. Inspection of the respective alignments shows that dynamical similarity has a functional basis, namely the need for maintaining proper intermolecular interactions with the respective substrates. These results suggest that distinct selective pressure mechanisms act on metalloproteases at structural and dynamical levels through the course of their evolution. This work shows how new insights on metalloprotease function and evolution can be assessed with comparison schemes that

  9. Temperature-modulated DSC provides new insight about nickel-titanium wire transformations.

    Science.gov (United States)

    Brantley, William A; Iijima, Masahiro; Grentzer, Thomas H

    2003-10-01

    Differential scanning calorimetry (DSC) is a well-known method for investigating phase transformations in nickel-titanium orthodontic wires; the microstructural phases and phase transformations in these wires have central importance for their clinical performance. The purpose of this study was to use the more recently developed technique of temperature-modulated DSC (TMDSC) to gain insight into transformations in 3 nickel-titanium orthodontic wires: Neo Sentalloy (GAC International, Islandia, NY), 35 degrees C Copper Ni-Ti (Ormco, Glendora, Calif) and Nitinol SE (3M Unitek, Monrovia, Calif). In the oral environment, the first 2 superelastic wires have shape memory, and the third wire has superelastic behavior but not shape memory. All wires had cross-section dimensions of 0.016 x 0.022 in. Archwires in the as-received condition and after bending 135 degrees were cut into 5 or 6 segments for test specimens. TMDSC analyses (Model 2910 DSC, TA Instruments, Wilmington, Del) were conducted between -125 degrees C and 100 degrees C, using a linear heating and cooling rate of 2 degrees C per min, an oscillation amplitude of 0.318 degrees C with a period of 60 seconds, and helium as the purge gas. For all 3 wire alloys, strong low-temperature martensitic transformations, resolved on the nonreversing heat-flow curves, were not present on the reversing heat-flow curves, and bending appeared to increase the enthalpy change for these peaks in some cases. For Neo Sentalloy, TMDSC showed that transformation between martensitic and austenitic nickel-titanium, suggested as occurring directly in the forward and reverse directions by conventional DSC, was instead a 2-step process involving the R-phase. Two-step transformations in the forward and reverse directions were also found for 35 degrees C Copper Ni-Ti and Nitinol SE. The TMDSC results show that structural transformations in these wires are complex. Some possible clinical implications of these observations are discussed.

  10. User experiences with clinical social franchising: qualitative insights from providers and clients in Ghana and Kenya.

    Science.gov (United States)

    Sieverding, Maia; Briegleb, Christina; Montagu, Dominic

    2015-02-01

    Clinical social franchising is a rapidly growing delivery model in private healthcare markets in low- and middle-income countries. Despite this growth, little is known about providers' perceptions of the benefits and challenges of social franchising or clients' reasons for choosing franchised facilities over other healthcare options. We examine these questions in the context of three social franchise networks in Ghana and Kenya. We conducted in-depth interviews with a purposive sample of providers from the BlueStar Ghana, and Amua and Tunza networks in Kenya. We also conducted qualitative exit interviews with female clients who were leaving franchised facilities after a visit for a reproductive or child health reason. The total sample consists of 47 providers and 47 clients across the three networks. Providers perceived the main benefits of participation in a social franchise network to be training opportunities and access to a consistent supply of low-cost family planning commodities; few providers mentioned branding as a benefit of participation. Although most providers said that client flows for franchised services increased after joining the network, they did not associate this with improved finances for their facility. Clients overwhelmingly cited the quality of the client-provider relationship as their main motivation for attending the franchise facility. Recognition of the franchise brand was low among clients who were exiting a franchised facility. The most important benefit of social franchise programs to both providers and their clients may have more to do with training on business practices, patient counseling and customer service, than with subsidies, technical input, branding or clinical support. This finding may lead to a reconsideration of how franchise programs interact with both their member clinics and the larger health-seeking communities they serve.

  11. New data from Virginia Tech Transportation Institute provides insight into cell phone use and driving distraction

    OpenAIRE

    Box, Sherri

    2009-01-01

    Several large-scale, naturalistic driving studies -- using sophisticated cameras and instrumentation in participants' personal vehicles -- conducted by the Virginia Tech Transportation Institute (VTTI), provide a clear picture of driver distraction and cell phone use under real-world driving conditions, according to the institute.

  12. The impact of the business cycle on service providers : Insights from international tourism

    NARCIS (Netherlands)

    Dekimpe, Marnik; Peers, Yuri; van Heerde, H.J.

    For service providers, it is essential to understand how their business is affected by the macroeconomy. This is especially pressing for the tourism sector, the world’s largest export service, because the number of incoming visitors is likely to be strongly determined by the business cycles in the

  13. Mudskipper genomes provide insights into the terrestrial adaptation of amphibious fishes.

    Science.gov (United States)

    You, Xinxin; Bian, Chao; Zan, Qijie; Xu, Xun; Liu, Xin; Chen, Jieming; Wang, Jintu; Qiu, Ying; Li, Wujiao; Zhang, Xinhui; Sun, Ying; Chen, Shixi; Hong, Wanshu; Li, Yuxiang; Cheng, Shifeng; Fan, Guangyi; Shi, Chengcheng; Liang, Jie; Tom Tang, Y; Yang, Chengye; Ruan, Zhiqiang; Bai, Jie; Peng, Chao; Mu, Qian; Lu, Jun; Fan, Mingjun; Yang, Shuang; Huang, Zhiyong; Jiang, Xuanting; Fang, Xiaodong; Zhang, Guojie; Zhang, Yong; Polgar, Gianluca; Yu, Hui; Li, Jia; Liu, Zhongjian; Zhang, Guoqiang; Ravi, Vydianathan; Coon, Steven L; Wang, Jian; Yang, Huanming; Venkatesh, Byrappa; Wang, Jun; Shi, Qiong

    2014-12-02

    Mudskippers are amphibious fishes that have developed morphological and physiological adaptations to match their unique lifestyles. Here we perform whole-genome sequencing of four representative mudskippers to elucidate the molecular mechanisms underlying these adaptations. We discover an expansion of innate immune system genes in the mudskippers that may provide defence against terrestrial pathogens. Several genes of the ammonia excretion pathway in the gills have experienced positive selection, suggesting their important roles in mudskippers' tolerance to environmental ammonia. Some vision-related genes are differentially lost or mutated, illustrating genomic changes associated with aerial vision. Transcriptomic analyses of mudskippers exposed to air highlight regulatory pathways that are up- or down-regulated in response to hypoxia. The present study provides a valuable resource for understanding the molecular mechanisms underlying water-to-land transition of vertebrates.

  14. Precision Neutron Time-of-Flight Detectors Provide Insight into NIF Implosion Dynamics

    Science.gov (United States)

    Schlossberg, David; Eckart, M. J.; Grim, G. P.; Hartouni, E. P.; Hatarik, R.; Moore, A. S.; Waltz, C. S.

    2017-10-01

    During inertial confinement fusion, higher-order moments of neutron time-of-flight (nToF) spectra can provide essential information for optimizing implosions. The nToF diagnostic suite at the National Ignition Facility (NIF) was recently upgraded to include novel, quartz Cherenkov detectors. These detectors exploit the rapid Cherenkov radiation process, in contrast with conventional scintillator decay times, to provide high temporal-precision measurements that support higher-order moment analyses. Preliminary measurements have been made on the NIF during several implosions and initial results are presented here. Measured line-of-sight asymmetries, for example in ion temperatures, will be discussed. Finally, advanced detector optimization is shown to advance accessible physics, with possibilities for energy discrimination, gamma source identification, and further reduction in quartz response times. Work performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under contract DE-AC52-07NA27344.

  15. Stable isotopes provide insight into population structure and segregation in eastern North Atlantic sperm whales

    DEFF Research Database (Denmark)

    Borrell, Asunción; Velásquez Vacca, Adriana; Pinela, Ana M.

    2013-01-01

    In pelagic species inhabiting large oceans, genetic differentiation tends to be mild and populations devoid of structure. However, large cetaceans have provided many examples of structuring. Here we investigate whether the sperm whale, a pelagic species with large population sizes and reputedly......, use of habitat and/or migratory destinations are dissimilar between whales from the two regions and suggest that the North Atlantic population of sperm whales is more structured than traditionally accepted....

  16. User experiences with clinical social franchising: qualitative insights from providers and clients in Ghana and Kenya

    OpenAIRE

    Sieverding, Maia; Briegleb, Christina; Montagu, Dominic

    2015-01-01

    Background Clinical social franchising is a rapidly growing delivery model in private healthcare markets in low- and middle-income countries. Despite this growth, little is known about providers? perceptions of the benefits and challenges of social franchising or clients? reasons for choosing franchised facilities over other healthcare options. We examine these questions in the context of three social franchise networks in Ghana and Kenya. Methods We conducted in-depth interviews with a purpo...

  17. Stable isotopes provide new insights into vestimentiferan physiological ecology at Gulf of Mexico cold seeps

    Science.gov (United States)

    Becker, Erin Leigh; Macko, Stephen A.; Lee, Raymond W.; Fisher, Charles R.

    2011-02-01

    On the otherwise low-biomass seafloor of the Gulf of Mexico (GoM) continental slope, natural oil and gas seeps are oases of local primary production that support lush animal communities. Hundreds of seep communities have been documented on the continental slope, and nutrition derived from seeps could be an important link in the overall GoM food web. Here, we present a uniquely large and cohesive data set of δ13C, δ15N, and δ34S compositions of the vestimentiferan tubeworms Escarpia laminata and Lamellibrachia sp. 1, which dominate biomass at GoM seeps and provide habitat for hundreds of other species. Our sampling design encompassed an entire region of the GoM lower slope, allowing us for the first time to assess spatial variability in isotope compositions and to robustly address long-standing hypotheses about how vestimentiferans acquire and cycle nutrients over their long lifespan (200+ years). Tissue δ13C values provided strong evidence that larger adult vestimentiferans use their buried roots to take up dissolved inorganic carbon from sediment pore water, while very small individuals use their plume to take up carbon dioxide from the seawater. δ34S values were extremely variable among individuals of the same species within one location (<1 m2 area), indicating high variability in the inorganic sulfur pools on a very small spatial scale. This finding supports the hypothesis that vestimentiferans use their roots to cycle sulfate and sulfide between their symbionts and free-living consortia of sulfate-reducing archaea in the sediment. Finally, consistent differences in δ15N between two cooccurring vestimentiferan species provided the first strong evidence for partitioning of inorganic resources, which has significant implications for the ecology and evolution of this taxonomic group.

  18. Quantitative measures of walking and strength provide insight into brain corticospinal tract pathology in multiple sclerosis

    Directory of Open Access Journals (Sweden)

    Nora E Fritz

    2017-01-01

    Quantitative measures of strength and walking are associated with brain corticospinal tract pathology. The addition of these quantitative measures to basic clinical information explains more of the variance in corticospinal tract fractional anisotropy and magnetization transfer ratio than the basic clinical information alone. Outcome measurement for multiple sclerosis clinical trials has been notoriously challenging; the use of quantitative measures of strength and walking along with tract-specific imaging methods may improve our ability to monitor disease change over time, with intervention, and provide needed guidelines for developing more effective targeted rehabilitation strategies.

  19. Can administrative data provide insights into the mental health of Indigenous Queenslanders?

    Science.gov (United States)

    Kisely, Steve; Pais, Joanne

    2011-07-01

    The Australian Government has provided $20 million to establish the Population Health Research Network (PHRN), with representation from all States and Territories to facilitate population health research through data linkage. Health LinQ is part of the Queensland node involving four Queensland universities, Queensland Health and the Australian e-Health Research Centre. This paper reviews the potential for using administrative databases to study the mental health experience of Indigenous Queenslanders. Researchers can define cohorts for study within the administrative data or link them to their own data. Robust protocols preserve confidentiality so that researchers only receive anonymized data. Indigenous status can be defined either through place of residence or through the recording of Indigenous status in datasets such as the Queensland Hospital Admitted Patient Data Collection. Available data include hospital morbidity, mental health data and mortality. Indigenous status is correctly identified in about 89% of cases with variation by definition used. Administrative data provide researchers and decision makers with accessible, cost-effective information without the intrusion and cost of additional data collection. These techniques are especially useful in studying regional, rural and remote populations where access may be difficult.

  20. Atomic Force Microscopy Provides New Mechanistic Insights into the Pathogenesis of Pemphigus

    Directory of Open Access Journals (Sweden)

    Franziska Vielmuth

    2018-03-01

    Full Text Available Autoantibodies binding to the extracellular domains of desmoglein (Dsg 3 and 1 are critical in the pathogenesis of pemphigus by mechanisms leading to impaired function of desmosomes and blister formation in the epidermis and mucous membranes. Desmosomes are highly organized protein complexes which provide strong intercellular adhesion. Desmosomal cadherins such as Dsgs, proteins of the cadherin superfamily which interact via their extracellular domains in Ca2+-dependent manner, are the transmembrane adhesion molecules clustered within desmosomes. Investigations on pemphigus cover a wide range of experimental approaches including biophysical methods. Especially atomic force microscopy (AFM has recently been applied increasingly because it allows the analysis of native materials such as cultured cells and tissues under near-physiological conditions. AFM provides information about the mechanical properties of the sample together with detailed interaction analyses of adhesion molecules. With AFM, it was recently demonstrated that autoantibodies directly inhibit Dsg interactions on the surface of living keratinocytes, a phenomenon which has long been considered the main mechanism causing loss of cell cohesion in pemphigus. In addition, AFM allows to study how signaling pathways altered in pemphigus control binding properties of Dsgs. More general, AFM and other biophysical studies recently revealed the importance of keratin filaments for regulation of Dsg binding and keratinocyte mechanical properties. In this mini-review, we reevaluate AFM studies in pemphigus and keratinocyte research, recapitulate what is known about the interaction mechanisms of desmosomal cadherins and discuss the advantages and limitations of AFM in these regards.

  1. Whole-genome sequencing of cultivated and wild peppers provides insights into Capsicum domestication and specialization

    Science.gov (United States)

    Qin, Cheng; Yu, Changshui; Shen, Yaou; Fang, Xiaodong; Chen, Lang; Min, Jiumeng; Cheng, Jiaowen; Zhao, Shancen; Xu, Meng; Luo, Yong; Yang, Yulan; Wu, Zhiming; Mao, Likai; Wu, Haiyang; Ling-Hu, Changying; Zhou, Huangkai; Lin, Haijian; González-Morales, Sandra; Trejo-Saavedra, Diana L.; Tian, Hao; Tang, Xin; Zhao, Maojun; Huang, Zhiyong; Zhou, Anwei; Yao, Xiaoming; Cui, Junjie; Li, Wenqi; Chen, Zhe; Feng, Yongqiang; Niu, Yongchao; Bi, Shimin; Yang, Xiuwei; Li, Weipeng; Cai, Huimin; Luo, Xirong; Montes-Hernández, Salvador; Leyva-González, Marco A.; Xiong, Zhiqiang; He, Xiujing; Bai, Lijun; Tan, Shu; Tang, Xiangqun; Liu, Dan; Liu, Jinwen; Zhang, Shangxing; Chen, Maoshan; Zhang, Lu; Zhang, Li; Zhang, Yinchao; Liao, Weiqin; Zhang, Yan; Wang, Min; Lv, Xiaodan; Wen, Bo; Liu, Hongjun; Luan, Hemi; Zhang, Yonggang; Yang, Shuang; Wang, Xiaodian; Xu, Jiaohui; Li, Xueqin; Li, Shuaicheng; Wang, Junyi; Palloix, Alain; Bosland, Paul W.; Li, Yingrui; Krogh, Anders; Rivera-Bustamante, Rafael F.; Herrera-Estrella, Luis; Yin, Ye; Yu, Jiping; Hu, Kailin; Zhang, Zhiming

    2014-01-01

    As an economic crop, pepper satisfies people’s spicy taste and has medicinal uses worldwide. To gain a better understanding of Capsicum evolution, domestication, and specialization, we present here the genome sequence of the cultivated pepper Zunla-1 (C. annuum L.) and its wild progenitor Chiltepin (C. annuum var. glabriusculum). We estimate that the pepper genome expanded ∼0.3 Mya (with respect to the genome of other Solanaceae) by a rapid amplification of retrotransposons elements, resulting in a genome comprised of ∼81% repetitive sequences. Approximately 79% of 3.48-Gb scaffolds containing 34,476 protein-coding genes were anchored to chromosomes by a high-density genetic map. Comparison of cultivated and wild pepper genomes with 20 resequencing accessions revealed molecular footprints of artificial selection, providing us with a list of candidate domestication genes. We also found that dosage compensation effect of tandem duplication genes probably contributed to the pungent diversification in pepper. The Capsicum reference genome provides crucial information for the study of not only the evolution of the pepper genome but also, the Solanaceae family, and it will facilitate the establishment of more effective pepper breeding programs. PMID:24591624

  2. NRC test results and operations experience provide insights for a new gate valve stem force correlation

    International Nuclear Information System (INIS)

    Watkins, John C.; Steele, Robert Jr.; DeWall, Kevin G.; Weidenhamer, G.H.; Rothberg, O.O.

    1994-01-01

    This paper presents the results of testing sponsored by the NRC to assess valve and motor operator performance under varying pressure and fluid conditions. This effort included an examination of the methods used by the industry to predict the required stem force of a valve, and research to provide guidelines for the extrapolation of in situ test results to design basis conditions.Years ago, when most of these valves were originally installed, the industry used a set of equations to determine analytically that the valves' motor-operators were large enough and the control switches were set high enough to close the valves at their design basis conditions. Our research has identified several inconsistencies with the industry's existing gate valve stem force equation and has challenged the overly simplistic assumptions inherent in its use. This paper discusses the development of the INEL correlation, which serves as the basis for a method to bound the stem force necessary to close flexwedge gate valves whose operational characteristics have been shown to be predictable. As utilities undertake to provide assurance of their valves' operability, this ability to predict analytically the required stem force is especially important for valves that cannot be tested at design basis conditions. For such valves, the results of tests conducted at less severe conditions can be used with the INEL correlation to make the necessary prediction. ((orig.))

  3. New technological developments provide deep-sea sediment density flow insights: the Monterey Coordinated Canyon Experiment

    Science.gov (United States)

    O'Reilly, T. C.; Kieft, B.; Chaffey, M. R.; Wolfson-Schwehr, M.; Herlien, R.; Bird, L.; Klimov, D.; Paull, C. K.; Gwiazda, R.; Lundsten, E. M.; Anderson, K.; Caress, D. W.; Sumner, E. J.; Simmons, S.; Parsons, D. R.; Talling, P.; Rosenberger, K. J.; Xu, J.; Maier, K. L.; Gales, J. A.

    2017-12-01

    The Monterey Coordinated Canyon Experiment (CCE) deployed an array of instruments along the Monterey Canyon floor to characterize the structure, velocity and frequency of sediment flows. CCE utilized novel technologies developed at MBARI to capture sediment flow data in unprecedented detail. 1. The Seafloor Instrument Node (SIN) at 1850 meters depth housed 3 ADCPs at 3 different frequencies, CTD, current meter, oxygen optode, fluorometer/backscatter sensor, and logged data at 10 second intervals or faster. The SIN included an acoustic modem for communication with shore through a Wave Glider relay, and provided high-resolution measurements of three flow events during three successive deployments over 1.5 years. 2. Beachball-sized Benthic Event Detectors (BEDs) were deployed on or under the seafloor to measure the characteristics of sediment density flows. Each BED recorded data from a pressure sensor and a 3-axis accelerometer and gyro to characterize motions during transport events (e.g. tumble vs rotation). An acoustic modem capable of operating through more than a meter of sediment enabled communications with a ship or autonomous surface vehicle. Multiple BEDs were deployed at various depths in the canyon during CCE, detecting and measuring many transport events; one BED moved 9 km down canyon in 50 minutes during one event. 3. Wave Glider Hot Spot (HS), equipped with acoustic and RF modems, acted as data relay between SIN, BEDs and shore, and acoustically located BEDs after sediment density flows.. In some cases HS relayed BED motion data to shore within a few hours of the event. HS provided an acoustic console to the SIN, allowing shore-based users to check SIN health and status, perform maintenance, etc. 4. Mapping operations were conducted 4 times at the SIN site to quantify depositional and erosional patterns, utilizing a prototype ultra-high-resolution mapping system on the ROV Doc Ricketts. The system consists of a 400-kHz Reson 7125 multibeam sonar, a 3

  4. The Rosa genome provides new insights into the domestication of modern roses.

    Science.gov (United States)

    Raymond, Olivier; Gouzy, Jérôme; Just, Jérémy; Badouin, Hélène; Verdenaud, Marion; Lemainque, Arnaud; Vergne, Philippe; Moja, Sandrine; Choisne, Nathalie; Pont, Caroline; Carrère, Sébastien; Caissard, Jean-Claude; Couloux, Arnaud; Cottret, Ludovic; Aury, Jean-Marc; Szécsi, Judit; Latrasse, David; Madoui, Mohammed-Amin; François, Léa; Fu, Xiaopeng; Yang, Shu-Hua; Dubois, Annick; Piola, Florence; Larrieu, Antoine; Perez, Magali; Labadie, Karine; Perrier, Lauriane; Govetto, Benjamin; Labrousse, Yoan; Villand, Priscilla; Bardoux, Claudia; Boltz, Véronique; Lopez-Roques, Céline; Heitzler, Pascal; Vernoux, Teva; Vandenbussche, Michiel; Quesneville, Hadi; Boualem, Adnane; Bendahmane, Abdelhafid; Liu, Chang; Le Bris, Manuel; Salse, Jérôme; Baudino, Sylvie; Benhamed, Moussa; Wincker, Patrick; Bendahmane, Mohammed

    2018-06-01

    Roses have high cultural and economic importance as ornamental plants and in the perfume industry. We report the rose whole-genome sequencing and assembly and resequencing of major genotypes that contributed to rose domestication. We generated a homozygous genotype from a heterozygous diploid modern rose progenitor, Rosa chinensis 'Old Blush'. Using single-molecule real-time sequencing and a meta-assembly approach, we obtained one of the most comprehensive plant genomes to date. Diversity analyses highlighted the mosaic origin of 'La France', one of the first hybrids combining the growth vigor of European species and the recurrent blooming of Chinese species. Genomic segments of Chinese ancestry identified new candidate genes for recurrent blooming. Reconstructing regulatory and secondary metabolism pathways allowed us to propose a model of interconnected regulation of scent and flower color. This genome provides a foundation for understanding the mechanisms governing rose traits and should accelerate improvement in roses, Rosaceae and ornamentals.

  5. Molecular taxonomy provides new insights into anopheles species of the neotropical arribalzagia series.

    Directory of Open Access Journals (Sweden)

    Giovan F Gómez

    Full Text Available Phylogenetic analysis of partial mitochondrial cytochrome oxidase c subunit I (COI and nuclear internal transcribed spacer 2 (ITS2 sequences were used to evaluate initial identification and to investigate phylogenetic relationships of seven Anopheles morphospecies of the Arribalzagia Series from Colombia. Phylogenetic trees recovered highly supported clades for An. punctimaculas.s., An. calderoni, An. malefactor s.l., An. neomaculipalpus, An. apicimacula s.l., An. mattogrossensis and An. peryassui. This study provides the first molecular confirmation of An. malefactorfrom Colombia and discovered conflicting patterns of divergence for the molecular markers among specimens from northeast and northern Colombia suggesting the presence of two previously unrecognized Molecular Operational Taxonomic Units (MOTUs. Furthermore, two highly differentiated An. apicimacula MOTUs previously found in Panama were detected. Overall, the combined molecular dataset facilitated the detection of known and new Colombian evolutionary lineages, and constitutes the baseline for future research on their bionomics, ecology and potential role as malaria vectors.

  6. Barriers to Providing Health Education During Primary Care Visits at Community Health Centers: Clinical Staff Insights.

    Science.gov (United States)

    Alicea-Planas, Jessica; Pose, Alix; Smith, Linda

    2016-04-01

    The rapid increase of diverse patients living in the US has created a different set of needs in healthcare, with the persistence of health disparities continuing to challenge the current system. Chronic disease management has been discussed as a way to improve health outcomes, with quality patient education being a key component. Using a community based participatory research framework, this study utilized a web-based survey and explored clinical staff perceptions of barriers to providing patient education during primary care visits. With a response rate of nearly 42 %, appointment time allotment seemed to be one of the most critical factors related to the delivery of health education and should be considered key. The importance of team-based care and staff training were also significant. Various suggestions were made in order to improve the delivery of quality patient education at community health centers located in underserved areas.

  7. The ASCO Oncology Composite Provider Utilization File: New Data, New Insights.

    Science.gov (United States)

    Barr, Thomas R; Towle, Elaine L; Barr, Thomas R; Towle, Elaine L

    2016-01-01

    As we seek to understand the changing practice environment in oncology, the need for accurate information about demand for services, distribution of the delivery system in this sector of the health economy, and other practice trends is apparent. In this article, we present analysis of the sector using one of the public use files from the Centers for Medicare & Medicaid Services in combination with other publicly available data. Medicare data are particularly useful for this analysis because cancer is associated with aging and Medicare is the primary payer in the United States for patients older than age 65. As a result, nearly all oncologists who serve adult populations are represented in these data. By combining publicly available datasets into what we call the ASCO Provider Utilization File,we can investigate a wide range of supply, demand, and practice issues. We calculate the average work performed per physician, observe regional differences in work production,and quantify the downside risk and upside potential associated with the provision of chemotherapy drugs. Comparing the supply of oncologists by state with physician work relative value units and with estimates of cancer incidence by state reveals intriguing differences in the distribution of physicians and the demand for oncology services. In addition, our analysis demonstrates significant downside practice risk associated with the provision of drug therapy to Medicare beneficiaries. The economic risk associated with the purchase and delivery of chemotherapy is of particular concern as pressure for value increases. This article provides a description of a new dataset and interesting observations from these data.

  8. Ancient DNA provides new insight into the maternal lineages and domestication of Chinese donkeys.

    Science.gov (United States)

    Han, Lu; Zhu, Songbiao; Ning, Chao; Cai, Dawei; Wang, Kai; Chen, Quanjia; Hu, Songmei; Yang, Junkai; Shao, Jing; Zhu, Hong; Zhou, Hui

    2014-11-30

    The donkey (Equus asinus) is an important domestic animal that provides a reliable source of protein and method of transportation for many human populations. However, the process of domestication and the dispersal routes of the Chinese donkey are still unclear, as donkey remains are sparse in the archaeological record and often confused with horse remains. To explore the maternal origins and dispersal route of Chinese donkeys, both mitochondrial DNA D-loop and cytochrome b gene fragments of 21 suspected donkey remains from four archaeological sites in China were amplified and sequenced. Molecular methods of species identification show that 17 specimens were donkeys and three samples had the maternal genetic signature of horses. One sample that dates to about 20,000 years before present failed to amplify. In this study, the phylogenetic analysis reveals that ancient Chinese donkeys have high mitochondrial DNA diversity and two distinct mitochondrial maternal lineages, known as the Somali and Nubian lineages. These results indicate that the maternal origin of Chinese domestic donkeys was probably related to the African wild ass, which includes the Nubian wild ass (Equus africanus africanus) and the Somali wild ass (Equus africanus somaliensis). Combined with historical records, the results of this study implied that domestic donkeys spread into west and north China before the emergence of the Han dynasty. The number of Chinese domestic donkeys had increased primarily to meet demand for the expansion of trade, and they were likely used as commodities or for shipping goods along the Silk Road during the Tang Dynasty, when the Silk Road reached its golden age. This study is the first to provide valuable ancient animal DNA evidence for early trade between African and Asian populations. The ancient DNA analysis of Chinese donkeys also sheds light on the dynamic process of the maternal origin, domestication, and dispersal route of ancient Chinese donkeys.

  9. Genomic and proteomic analyses of the fungus Arthrobotrys oligospora provide insights into nematode-trap formation.

    Science.gov (United States)

    Yang, Jinkui; Wang, Lei; Ji, Xinglai; Feng, Yun; Li, Xiaomin; Zou, Chenggang; Xu, Jianping; Ren, Yan; Mi, Qili; Wu, Junli; Liu, Shuqun; Liu, Yu; Huang, Xiaowei; Wang, Haiyan; Niu, Xuemei; Li, Juan; Liang, Lianming; Luo, Yanlu; Ji, Kaifang; Zhou, Wei; Yu, Zefen; Li, Guohong; Liu, Yajun; Li, Lei; Qiao, Min; Feng, Lu; Zhang, Ke-Qin

    2011-09-01

    Nematode-trapping fungi are "carnivorous" and attack their hosts using specialized trapping devices. The morphological development of these traps is the key indicator of their switch from saprophytic to predacious lifestyles. Here, the genome of the nematode-trapping fungus Arthrobotrys oligospora Fres. (ATCC24927) was reported. The genome contains 40.07 Mb assembled sequence with 11,479 predicted genes. Comparative analysis showed that A. oligospora shared many more genes with pathogenic fungi than with non-pathogenic fungi. Specifically, compared to several sequenced ascomycete fungi, the A. oligospora genome has a larger number of pathogenicity-related genes in the subtilisin, cellulase, cellobiohydrolase, and pectinesterase gene families. Searching against the pathogen-host interaction gene database identified 398 homologous genes involved in pathogenicity in other fungi. The analysis of repetitive sequences provided evidence for repeat-induced point mutations in A. oligospora. Proteomic and quantitative PCR (qPCR) analyses revealed that 90 genes were significantly up-regulated at the early stage of trap-formation by nematode extracts and most of these genes were involved in translation, amino acid metabolism, carbohydrate metabolism, cell wall and membrane biogenesis. Based on the combined genomic, proteomic and qPCR data, a model for the formation of nematode trapping device in this fungus was proposed. In this model, multiple fungal signal transduction pathways are activated by its nematode prey to further regulate downstream genes associated with diverse cellular processes such as energy metabolism, biosynthesis of the cell wall and adhesive proteins, cell division, glycerol accumulation and peroxisome biogenesis. This study will facilitate the identification of pathogenicity-related genes and provide a broad foundation for understanding the molecular and evolutionary mechanisms underlying fungi-nematodes interactions.

  10. Rheo-NMR - how nuclear magnetic resonance is providing new insight regarding complex fluid rheology

    International Nuclear Information System (INIS)

    Callaghan, P.T.

    2000-01-01

    Over the past five decades, NMR has revolutionised chemistry, and has found widespread application in condensed matter physics, in molecular biology, in medicine and in food technology. Most recently NMR has made a significant impact in chemical engineering, where it is being extensively used for the non-invasive study of dispersion and flow in porous media. One of the most recent applications of NMR in materials science concerns its use in the study of the mechanical properties of complex fluids. This particular aspect of NMR has been extensively developed in research carried out at Massey University in New Zealand. In this short article, some of the ideas behind this work and the applications which have resulted, will be described. These examples provide a glimpse of possible applications of Nuclear Magnetic Resonance to the study of complex fluid rheology. While this is a very new field of research in which only a handful of groups presently participate, the potential exists for a substantial increase in Rheo-NMR research activity. Systems studied to date include polymer melts and semi-dilute solutions, thermotropic and lyotropic liquid crystals and liquid crystalline polymers, micellar solutions, food materials and colloidal suspensions. Rheo-NMR suffers in a number of respects by comparison with optical methods. It is expensive, it is difficult to use, it suffers from poor signal-to-noise ratios and the effective interpretation of spectra often depends on familiarity with the nuclear spin Hamiltonian and the associated effects of spin dynamics. Nonetheless NMR offers some unique advantages, including the ability to work with opaque materials, the ability to combine velocimetry with localised spectroscopy, and the ability to access a wide range of molecular properties relating to organisation, orientation and dynamics. Rheo-NMR has been able to provide a direct window on a variety of behaviours, including slip, shear-thinning, shear banding, yield stress

  11. Historical ecology provides new insights for ecosystem management: Eastern Baltic cod case study

    DEFF Research Database (Denmark)

    MacKenzie, Brian; Ojaveer, Henn; Eero, Margit

    2011-01-01

    A recent historical marine ecological case study (cod in the eastern Baltic Sea) is used to show how long-term data and knowledge of fluctuations can contribute to revisions of fishery management policy. The case study first developed new longer analytical time series of spawner biomass and recru......A recent historical marine ecological case study (cod in the eastern Baltic Sea) is used to show how long-term data and knowledge of fluctuations can contribute to revisions of fishery management policy. The case study first developed new longer analytical time series of spawner biomass...... catch data from the late 1500s to early 1600s also contributed new perspectives to cod population dynamics under alternative ecosystem forcings. These new perspectives have contributed, and will likely continue to contribute to new management policies (e.g., revision of fishery management reference...... points), which should lead to higher sustainability of the population and fishery yields, and improved overall ecosystem health. These perspectives will likely continue to provide baseline information as ICES and the EU develop new policies based on maximum sustainable yield concepts....

  12. Heterochronic truncation of odontogenesis in theropod dinosaurs provides insight into the macroevolution of avian beaks

    Science.gov (United States)

    Stiegler, Josef; Wu, Ping; Chuong, Cheng-Ming; Hu, Dongyu; Balanoff, Amy; Zhou, Yachun; Xu, Xing

    2017-01-01

    Beaks are innovative structures characterizing numerous tetrapod lineages, including birds, but little is known about how developmental processes influenced the macroevolution of these important structures. Here we provide evidence of ontogenetic vestigialization of alveoli in two lineages of theropod dinosaurs and show that these are transitional phenotypes in the evolution of beaks. One of the smallest known caenagnathid oviraptorosaurs and a small specimen of the Early Cretaceous bird Sapeornis both possess shallow, empty vestiges of dentary alveoli. In both individuals, the system of vestiges connects via foramina with a dorsally closed canal homologous to alveoli. Similar morphologies are present in Limusaurus, a beaked theropod that becomes edentulous during ontogeny; and an analysis of neontological and paleontological evidence shows that ontogenetic reduction of the dentition is a relatively common phenomenon in vertebrate evolution. Based on these lines of evidence, we propose that progressively earlier postnatal and embryonic truncation of odontogenesis corresponds with expansion of rostral keratin associated with the caruncle, and these progenesis and peramorphosis heterochronies combine to drive the evolution of edentulous beaks in nonavian theropods and birds. Following initial apomorphic expansion of rostral keratinized epithelia in perinatal toothed theropods, beaks appear to inhibit odontogenesis as they grow postnatally, resulting in a sequence of common morphologies. This sequence is shifted earlier in development through phylogeny until dentition is absent at hatching, and odontogenesis is inhibited by beak formation in ovo. PMID:28973883

  13. Heterochronic truncation of odontogenesis in theropod dinosaurs provides insight into the macroevolution of avian beaks.

    Science.gov (United States)

    Wang, Shuo; Stiegler, Josef; Wu, Ping; Chuong, Cheng-Ming; Hu, Dongyu; Balanoff, Amy; Zhou, Yachun; Xu, Xing

    2017-10-10

    Beaks are innovative structures characterizing numerous tetrapod lineages, including birds, but little is known about how developmental processes influenced the macroevolution of these important structures. Here we provide evidence of ontogenetic vestigialization of alveoli in two lineages of theropod dinosaurs and show that these are transitional phenotypes in the evolution of beaks. One of the smallest known caenagnathid oviraptorosaurs and a small specimen of the Early Cretaceous bird Sapeornis both possess shallow, empty vestiges of dentary alveoli. In both individuals, the system of vestiges connects via foramina with a dorsally closed canal homologous to alveoli. Similar morphologies are present in Limusaurus , a beaked theropod that becomes edentulous during ontogeny; and an analysis of neontological and paleontological evidence shows that ontogenetic reduction of the dentition is a relatively common phenomenon in vertebrate evolution. Based on these lines of evidence, we propose that progressively earlier postnatal and embryonic truncation of odontogenesis corresponds with expansion of rostral keratin associated with the caruncle, and these progenesis and peramorphosis heterochronies combine to drive the evolution of edentulous beaks in nonavian theropods and birds. Following initial apomorphic expansion of rostral keratinized epithelia in perinatal toothed theropods, beaks appear to inhibit odontogenesis as they grow postnatally, resulting in a sequence of common morphologies. This sequence is shifted earlier in development through phylogeny until dentition is absent at hatching, and odontogenesis is inhibited by beak formation in ovo .

  14. Comparative exome sequencing of metastatic lesions provides insights into the mutational progression of melanoma

    Directory of Open Access Journals (Sweden)

    Gartner Jared J

    2012-09-01

    Full Text Available Abstract Background Metastasis is characterized by spreading of neoplastic cells to an organ other than where they originated and is the predominant cause of death among cancer patients. This holds true for melanoma, whose incidence is increasing more rapidly than any other cancer and once disseminated has few therapeutic options. Here we performed whole exome sequencing of two sets of matched normal and metastatic tumor DNAs. Results Using stringent criteria, we evaluated the similarities and differences between the lesions. We find that in both cases, 96% of the single nucleotide variants are shared between the two metastases indicating that clonal populations gave rise to the distant metastases. Analysis of copy number variation patterns of both metastatic sets revealed a trend similar to that seen with our single nucleotide variants. Analysis of pathway enrichment on tumor sets shows commonly mutated pathways enriched between individual sets of metastases and all metastases combined. Conclusions These data provide a proof-of-concept suggesting that individual metastases may have sufficient similarity for successful targeting of driver mutations.

  15. Molecular underpinnings of prefrontal cortex development in rodents provide insights into the etiology of neurodevelopmental disorders.

    Science.gov (United States)

    Schubert, D; Martens, G J M; Kolk, S M

    2015-07-01

    The prefrontal cortex (PFC), seat of the highest-order cognitive functions, constitutes a conglomerate of highly specialized brain areas and has been implicated to have a role in the onset and installation of various neurodevelopmental disorders. The development of a properly functioning PFC is directed by transcription factors, guidance cues and other regulatory molecules and requires the intricate and temporal orchestration of a number of developmental processes. Disturbance or failure of any of these processes causing neurodevelopmental abnormalities within the PFC may contribute to several of the cognitive deficits seen in patients with neurodevelopmental disorders. In this review, we elaborate on the specific processes underlying prefrontal development, such as induction and patterning of the prefrontal area, proliferation, migration and axonal guidance of medial prefrontal progenitors, and their eventual efferent and afferent connections. We furthermore integrate for the first time the available knowledge from genome-wide studies that have revealed genes linked to neurodevelopmental disorders with experimental molecular evidence in rodents. The integrated data suggest that the pathogenic variants in the neurodevelopmental disorder-associated genes induce prefrontal cytoarchitectonical impairments. This enhances our understanding of the molecular mechanisms of prefrontal (mis)development underlying the four major neurodevelopmental disorders in humans, that is, intellectual disability, autism spectrum disorders, attention deficit hyperactivity disorder and schizophrenia, and may thus provide clues for the development of novel therapies.

  16. Analyses of pig genomes provide insight into porcine demography and evolution

    Science.gov (United States)

    Groenen, Martien A. M.; Archibald, Alan L.; Uenishi, Hirohide; Tuggle, Christopher K.; Takeuchi, Yasuhiro; Rothschild, Max F.; Rogel-Gaillard, Claire; Park, Chankyu; Milan, Denis; Megens, Hendrik-Jan; Li, Shengting; Larkin, Denis M.; Kim, Heebal; Frantz, Laurent A. F.; Caccamo, Mario; Ahn, Hyeonju; Aken, Bronwen L.; Anselmo, Anna; Anthon, Christian; Auvil, Loretta; Badaoui, Bouabid; Beattie, Craig W.; Bendixen, Christian; Berman, Daniel; Blecha, Frank; Blomberg, Jonas; Bolund, Lars; Bosse, Mirte; Botti, Sara; Bujie, Zhan; Bystrom, Megan; Capitanu, Boris; Silva, Denise Carvalho; Chardon, Patrick; Chen, Celine; Cheng, Ryan; Choi, Sang-Haeng; Chow, William; Clark, Richard C.; Clee, Christopher; Crooijmans, Richard P. M. A.; Dawson, Harry D.; Dehais, Patrice; De Sapio, Fioravante; Dibbits, Bert; Drou, Nizar; Du, Zhi-Qiang; Eversole, Kellye; Fadista, João; Fairley, Susan; Faraut, Thomas; Faulkner, Geoffrey J.; Fowler, Katie E.; Fredholm, Merete; Fritz, Eric; Gilbert, James G. R.; Giuffra, Elisabetta; Gorodkin, Jan; Griffin, Darren K.; Harrow, Jennifer L.; Hayward, Alexander; Howe, Kerstin; Hu, Zhi-Liang; Humphray, Sean J.; Hunt, Toby; Hornshøj, Henrik; Jeon, Jin-Tae; Jern, Patric; Jones, Matthew; Jurka, Jerzy; Kanamori, Hiroyuki; Kapetanovic, Ronan; Kim, Jaebum; Kim, Jae-Hwan; Kim, Kyu-Won; Kim, Tae-Hun; Larson, Greger; Lee, Kyooyeol; Lee, Kyung-Tai; Leggett, Richard; Lewin, Harris A.; Li, Yingrui; Liu, Wansheng; Loveland, Jane E.; Lu, Yao; Lunney, Joan K.; Ma, Jian; Madsen, Ole; Mann, Katherine; Matthews, Lucy; McLaren, Stuart; Morozumi, Takeya; Murtaugh, Michael P.; Narayan, Jitendra; Nguyen, Dinh Truong; Ni, Peixiang; Oh, Song-Jung; Onteru, Suneel; Panitz, Frank; Park, Eung-Woo; Park, Hong-Seog; Pascal, Geraldine; Paudel, Yogesh; Perez-Enciso, Miguel; Ramirez-Gonzalez, Ricardo; Reecy, James M.; Zas, Sandra Rodriguez; Rohrer, Gary A.; Rund, Lauretta; Sang, Yongming; Schachtschneider, Kyle; Schraiber, Joshua G.; Schwartz, John; Scobie, Linda; Scott, Carol; Searle, Stephen; Servin, Bertrand; Southey, Bruce R.; Sperber, Goran; Stadler, Peter; Sweedler, Jonathan V.; Tafer, Hakim; Thomsen, Bo; Wali, Rashmi; Wang, Jian; Wang, Jun; White, Simon; Xu, Xun; Yerle, Martine; Zhang, Guojie; Zhang, Jianguo; Zhang, Jie; Zhao, Shuhong; Rogers, Jane; Churcher, Carol; Schook, Lawrence B.

    2013-01-01

    For 10,000 years pigs and humans have shared a close and complex relationship. From domestication to modern breeding practices, humans have shaped the genomes of domestic pigs. Here we present the assembly and analysis of the genome sequence of a female domestic Duroc pig (Sus scrofa) and a comparison with the genomes of wild and domestic pigs from Europe and Asia. Wild pigs emerged in South East Asia and subsequently spread across Eurasia. Our results reveal a deep phylogenetic split between European and Asian wild boars ~1 million years ago, and a selective sweep analysis indicates selection on genes involved in RNA processing and regulation. Genes associated with immune response and olfaction exhibit fast evolution. Pigs have the largest repertoire of functional olfactory receptor genes, reflecting the importance of smell in this scavenging animal. The pig genome sequence provides an important resource for further improvements of this important livestock species, and our identification of many putative disease-causing variants extends the potential of the pig as a biomedical model. PMID:23151582

  17. Visualizing the Immune System: Providing Key Insights into HIV/SIV Infections

    Directory of Open Access Journals (Sweden)

    Jacob D. Estes

    2018-03-01

    Full Text Available Immunological inductive tissues, such as secondary lymphoid organs, are composed of distinct anatomical microenvironments for the generation of immune responses to pathogens and immunogens. These microenvironments are characterized by the compartmentalization of highly specialized immune and stromal cell populations, as well as the presence of a complex network of soluble factors and chemokines that direct the intra-tissue trafficking of naïve and effector cell populations. Imaging platforms have provided critical contextual information regarding the molecular and cellular interactions that orchestrate the spatial microanatomy of relevant cells and the development of immune responses against pathogens. Particularly in HIV/SIV disease, imaging technologies are of great importance in the investigation of the local interplay between the virus and host cells, with respect to understanding viral dynamics and persistence, immune responses (i.e., adaptive and innate inflammatory responses, tissue structure and pathologies, and changes to the surrounding milieu and function of immune cells. Merging imaging platforms with other cutting-edge technologies could lead to novel findings regarding the phenotype, function, and molecular signatures of particular immune cell targets, further promoting the development of new antiviral treatments and vaccination strategies.

  18. The genome sequence of the wild tomato Solanum pimpinellifolium provides insights into salinity tolerance

    KAUST Repository

    Razali, Rozaimi; Bougouffa, Salim; Morton, Mitchell J. L.; Lightfoot, Damien; Alam, Intikhab; Essack, Magbubah; Arold, Stefan T.; Kamau, Allan; Schmö ckel, Sandra M.; Pailles, Yveline; Shahid, Mohammed; Michell, Craig; Al-Babili, Salim; Ho, Yung Shwen; Tester, Mark A.; Bajic, Vladimir B.; Negrã o, Só nia

    2017-01-01

    Solanum pimpinellifolium, a wild relative of cultivated tomato, offers a wealth of breeding potential for several desirable traits such as tolerance to abiotic and biotic stresses. Here, we report the genome and annotation of S. pimpinellifolium LA0480. The LA0480 genome size (811 Mb) and the number of annotated genes (25,970) are within the range observed for other sequenced tomato species. We developed and utilized the Dragon Eukaryotic Analyses Platform (DEAP) to functionally annotate the LA0480 protein-coding genes. Additionally, we used DEAP to compare protein function between S. pimpinellifolium and cultivated tomato. Our data suggest enrichment in genes involved in biotic and abiotic stress responses. Moreover, we present phenotypic data from one field experiment that demonstrate a greater salinity tolerance for fruit- and yield-related traits in S. pimpinellifolium compared with cultivated tomato. To understand the genomic basis for these differences in S. pimpinellifolium and S. lycopersicum, we analyzed 15 genes that have previously been shown to mediate salinity tolerance in plants. We show that S. pimpinellifolium has a higher copy number of the inositol-3-phosphate synthase and phosphatase genes, which are both key enzymes in the production of inositol and its derivatives. Moreover, our analysis indicates that changes occurring in the inositol phosphate pathway may contribute to the observed higher salinity tolerance in LA0480. Altogether, our work provides essential resources to understand and unlock the genetic and breeding potential of S. pimpinellifolium, and to discover the genomic basis underlying its environmental robustness.

  19. Chlorophyll fluorescence lifetime imaging provides new insight into the chlorosis induced by plant virus infection.

    Science.gov (United States)

    Lei, Rong; Jiang, Hongshan; Hu, Fan; Yan, Jin; Zhu, Shuifang

    2017-02-01

    Leaf chlorosis induced by plant virus infection has a short fluorescence lifetime, which reflects damaged photosynthetic complexes and degraded chloroplasts. Plant viruses often induce chlorosis and necrosis, which are intimately related to photosynthetic functions. Chlorophyll fluorescence lifetime measurement is a valuable noninvasive tool for analyzing photosynthetic processes and is a sensitive indicator of the environment surrounding the fluorescent molecules. In this study, our central goal was to explore the effect of viral infection on photosynthesis by employing chlorophyll fluorescence lifetime imaging (FLIM), steady-state fluorescence, non-photochemical quenching (NPQ), transmission electron microscopy (TEM), and pigment analysis. The data indicated that the chlorophyll fluorescence lifetime of chlorotic leaves was significantly shorter than that of healthy control leaves, and the fitted short lifetime component of chlorophyll fluorescence of chlorotic leaves was dominant. This dominant short lifetime component may result from damage to the structure of thylakoid, which was confirmed by TEM. The NPQ value of chlorotic leaves was slightly higher than that of healthy green leaves, which can be explained by increased neoxanthin, lutein and violaxanthin content relative to chlorophyll a. The difference in NPQ is slight, but FLIM can provide simple and direct characterization of PSII structure and photosynthetic function. Therefore, this technique shows great potential as a simple and rapid method for studying mechanisms of plant virus infection.

  20. Ancient DNA from Nubian and Somali wild ass provides insights into donkey ancestry and domestication.

    Science.gov (United States)

    Kimura, Birgitta; Marshall, Fiona B; Chen, Shanyuan; Rosenbom, Sónia; Moehlman, Patricia D; Tuross, Noreen; Sabin, Richard C; Peters, Joris; Barich, Barbara; Yohannes, Hagos; Kebede, Fanuel; Teclai, Redae; Beja-Pereira, Albano; Mulligan, Connie J

    2011-01-07

    Genetic data from extant donkeys (Equus asinus) have revealed two distinct mitochondrial DNA haplogroups, suggestive of two separate domestication events in northeast Africa about 5000 years ago. Without distinct phylogeographic structure in domestic donkey haplogroups and with little information on the genetic makeup of the ancestral African wild ass, however, it has been difficult to identify wild ancestors and geographical origins for the domestic mitochondrial clades. Our analysis of ancient archaeological and historic museum samples provides the first genetic information on the historic Nubian wild ass (Equus africanus africanus), Somali wild ass (Equus africanus somaliensis) and ancient donkey. The results demonstrate that the Nubian wild ass was an ancestor of the first donkey haplogroup. In contrast, the Somali wild ass has considerable mitochondrial divergence from the Nubian wild ass and domestic donkeys. These findings resolve the long-standing issue of the role of the Nubian wild ass in the domestication of the donkey, but raise new questions regarding the second ancestor for the donkey. Our results illustrate the complexity of animal domestication, and have conservation implications for critically endangered Nubian and Somali wild ass.

  1. Transgenerational endpoints provide increased sensitivity and insight into multigenerational responses of Lymnaea stagnalis exposed to cadmium.

    Science.gov (United States)

    Reátegui-Zirena, Evelyn G; Fidder, Bridgette N; Olson, Adric D; Dawson, Daniel E; Bilbo, Thomas R; Salice, Christopher J

    2017-05-01

    Ecotoxicology provides data to inform environmental management. Many testing protocols do not consider offspring fitness and toxicant sensitivity. Cadmium (Cd) is a well-studied and ubiquitous toxicant but little is known about the effects on offspring of exposed parents (transgenerational effects). This study had three objectives: to identify endpoints related to offspring performance; to determine whether parental effects would manifest as a change in Cd tolerance in offspring and how parental exposure duration influenced the manifestation of parental effects. Adult snails were exposed to Cd 0, 25, 50, 100, 200 and 400 μg Cd/L for eight weeks. There were effects on adult endpoints (e.g., growth, reproduction) but only at the highest concentrations (>100 μg/L). Alternatively, we observed significant transgenerational effects at all Cd concentrations. Surprisingly, we found increased Cd tolerance in hatchlings from all parental Cd exposure concentrations even though eggs and hatchlings were in Cd-free conditions for 6 weeks. Explicit consideration of offspring performance adds value to current toxicity testing protocols. Parental exposure duration has important implications for offspring effects and that contaminant concentrations that are not directly toxic to parents can cause transgenerational changes in resistance that have significant implications for toxicity testing and adaptive responses. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. In vitro analysis of RQC activities provides insights into the mechanism and function of CAT tailing

    Science.gov (United States)

    Osuna, Beatriz A; Howard, Conor J; KC, Subheksha; Frost, Adam; Weinberg, David E

    2017-01-01

    Ribosomes can stall during translation due to defects in the mRNA template or translation machinery, leading to the production of incomplete proteins. The Ribosome-associated Quality control Complex (RQC) engages stalled ribosomes and targets nascent polypeptides for proteasomal degradation. However, how each RQC component contributes to this process remains unclear. Here we demonstrate that key RQC activities—Ltn1p-dependent ubiquitination and Rqc2p-mediated Carboxy-terminal Alanine and Threonine (CAT) tail elongation—can be recapitulated in vitro with a yeast cell-free system. Using this approach, we determined that CAT tailing is mechanistically distinct from canonical translation, that Ltn1p-mediated ubiquitination depends on the poorly characterized RQC component Rqc1p, and that the process of CAT tailing enables robust ubiquitination of the nascent polypeptide. These findings establish a novel system to study the RQC and provide a framework for understanding how RQC factors coordinate their activities to facilitate clearance of incompletely synthesized proteins. DOI: http://dx.doi.org/10.7554/eLife.27949.001 PMID:28718767

  3. Comparative proteomics in alkaptonuria provides insights into inflammation and oxidative stress.

    Science.gov (United States)

    Braconi, Daniela; Bernardini, Giulia; Paffetti, Alessandro; Millucci, Lia; Geminiani, Michela; Laschi, Marcella; Frediani, Bruno; Marzocchi, Barbara; Santucci, Annalisa

    2016-12-01

    Alkaptonuria (AKU) is an ultra-rare inborn error of metabolism associated with a defective catabolism of phenylalanine and tyrosine leading to increased systemic levels of homogentisic acid (HGA). Excess HGA is partly excreted in the urine, partly accumulated within the body and deposited onto connective tissues under the form of an ochronotic pigment, leading to a range of clinical manifestations. No clear genotype/phenotype correlation was found in AKU, and today there is the urgent need to identify biomarkers able to monitor AKU progression and evaluate response to treatment. With this aim, we provided the first proteomic study on serum and plasma samples from alkaptonuric individuals showing pathological SAA, CRP and Advanced Oxidation Protein Products (AOPP) levels. Interesting similarities with proteomic studies on other rheumatic diseases were highlighted together with proteome alterations supporting the existence of oxidative stress and inflammation in AKU. Potential candidate biomarkers to assess disease severity, monitor disease progression and evaluate response to treatment were identified as well. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. A Comprehensive Genome Survey Provides Novel Insights into Bile Salt Hydrolase (BSH in Lactobacillaceae

    Directory of Open Access Journals (Sweden)

    Lifeng Liang

    2018-05-01

    Full Text Available Bile salt hydrolase (BSH is a well-known enzyme that has been commonly characterized in probiotic bacteria, as it has cholesterol-lowering effects. However, its molecular investigations are scarce. Here, we build a local database of BSH sequences from Lactobacillaceae (BSH–SDL, and phylogenetic analysis and homology searches were employed to elucidate their comparability and distinctiveness among species. Evolutionary study demonstrates that BSH sequences in BSH–SDL are divided into five groups, named BSH A, B, C, D and E here, which can be the genetic basis for BSH classification and nomenclature. Sequence analysis suggests the differences between BSH-active and BSH-inactive proteins clearly, especially on site 82. In addition, a total of 551 BSHs from 107 species are identified from 451 genomes of 158 Lactobacillaceae species. Interestingly, those bacteria carrying various copies of BSH A or B can be predicted to be potential cholesterol-lowering probiotics, based on the results of phylogenetic analysis and the subtypes that those previously reported BSH-active probiotics possess. In summary, this study elaborates the molecular basis of BSH in Lactobacillaceae systematically, and provides a novel methodology as well as a consistent standard for the identification of the BSH subtype. We believe that high-throughput screening can be efficiently applied to the selection of promising candidate BSH-active probiotics, which will advance the development of healthcare products in cholesterol metabolism.

  5. The Medicago Genome Provides Insight into the Evolution of Rhizobial Symbioses

    Science.gov (United States)

    Young, Nevin D.; Debellé, Frédéric; Oldroyd, Giles E. D.; Geurts, Rene; Cannon, Steven B.; Udvardi, Michael K.; Benedito, Vagner A.; Mayer, Klaus F. X.; Gouzy, Jérôme; Schoof, Heiko; Van de Peer, Yves; Proost, Sebastian; Cook, Douglas R.; Meyers, Blake C.; Spannagl, Manuel; Cheung, Foo; De Mita, Stéphane; Krishnakumar, Vivek; Gundlach, Heidrun; Zhou, Shiguo; Mudge, Joann; Bharti, Arvind K.; Murray, Jeremy D.; Naoumkina, Marina A.; Rosen, Benjamin; Silverstein, Kevin A. T.; Tang, Haibao; Rombauts, Stephane; Zhao, Patrick X.; Zhou, Peng; Barbe, Valérie; Bardou, Philippe; Bechner, Michael; Bellec, Arnaud; Berger, Anne; Bergès, Hélène; Bidwell, Shelby; Bisseling, Ton; Choisne, Nathalie; Couloux, Arnaud; Denny, Roxanne; Deshpande, Shweta; Dai, Xinbin; Doyle, Jeff; Dudez, Anne-Marie; Farmer, Andrew D.; Fouteau, Stéphanie; Franken, Carolien; Gibelin, Chrystel; Gish, John; Goldstein, Steven; González, Alvaro J.; Green, Pamela J.; Hallab, Asis; Hartog, Marijke; Hua, Axin; Humphray, Sean; Jeong, Dong-Hoon; Jing, Yi; Jöcker, Anika; Kenton, Steve M.; Kim, Dong-Jin; Klee, Kathrin; Lai, Hongshing; Lang, Chunting; Lin, Shaoping; Macmil, Simone L; Magdelenat, Ghislaine; Matthews, Lucy; McCorrison, Jamison; Monaghan, Erin L.; Mun, Jeong-Hwan; Najar, Fares Z.; Nicholson, Christine; Noirot, Céline; O’Bleness, Majesta; Paule, Charles R.; Poulain, Julie; Prion, Florent; Qin, Baifang; Qu, Chunmei; Retzel, Ernest F.; Riddle, Claire; Sallet, Erika; Samain, Sylvie; Samson, Nicolas; Sanders, Iryna; Saurat, Olivier; Scarpelli, Claude; Schiex, Thomas; Segurens, Béatrice; Severin, Andrew J.; Sherrier, D. Janine; Shi, Ruihua; Sims, Sarah; Singer, Susan R.; Sinharoy, Senjuti; Sterck, Lieven; Viollet, Agnès; Wang, Bing-Bing; Wang, Keqin; Wang, Mingyi; Wang, Xiaohong; Warfsmann, Jens; Weissenbach, Jean; White, Doug D.; White, Jim D.; Wiley, Graham B.; Wincker, Patrick; Xing, Yanbo; Yang, Limei; Yao, Ziyun; Ying, Fu; Zhai, Jixian; Zhou, Liping; Zuber, Antoine; Dénarié, Jean; Dixon, Richard A.; May, Gregory D.; Schwartz, David C.; Rogers, Jane; Quétier, Francis; Town, Christopher D.; Roe, Bruce A.

    2011-01-01

    Legumes (Fabaceae or Leguminosae) are unique among cultivated plants for their ability to carry out endosymbiotic nitrogen fixation with rhizobial bacteria, a process that takes place in a specialized structure known as the nodule. Legumes belong to one of the two main groups of eurosids, the Fabidae, which includes most species capable of endosymbiotic nitrogen fixation 1. Legumes comprise several evolutionary lineages derived from a common ancestor 60 million years ago (Mya). Papilionoids are the largest clade, dating nearly to the origin of legumes and containing most cultivated species 2. Medicago truncatula (Mt) is a long-established model for the study of legume biology. Here we describe the draft sequence of the Mt euchromatin based on a recently completed BAC-assembly supplemented with Illumina-shotgun sequence, together capturing ~94% of all Mt genes. A whole-genome duplication (WGD) approximately 58 Mya played a major role in shaping the Mt genome and thereby contributed to the evolution of endosymbiotic nitrogen fixation. Subsequent to the WGD, the Mt genome experienced higher levels of rearrangement than two other sequenced legumes, Glycine max (Gm) and Lotus japonicus (Lj). Mt is a close relative of alfalfa (M. sativa), a widely cultivated crop with limited genomics tools and complex autotetraploid genetics. As such, the Mt genome sequence provides significant opportunities to expand alfalfa’s genomic toolbox. PMID:22089132

  6. Crystal Structure of the Herpesvirus Nuclear Egress Complex Provides Insights into Inner Nuclear Membrane Remodeling

    Directory of Open Access Journals (Sweden)

    Tzviya Zeev-Ben-Mordehai

    2015-12-01

    Full Text Available Although nucleo-cytoplasmic transport is typically mediated through nuclear pore complexes, herpesvirus capsids exit the nucleus via a unique vesicular pathway. Together, the conserved herpesvirus proteins pUL31 and pUL34 form the heterodimeric nuclear egress complex (NEC, which, in turn, mediates the formation of tight-fitting membrane vesicles around capsids at the inner nuclear membrane. Here, we present the crystal structure of the pseudorabies virus NEC. The structure revealed that a zinc finger motif in pUL31 and an extensive interaction network between the two proteins stabilize the complex. Comprehensive mutational analyses, characterized both in situ and in vitro, indicated that the interaction network is not redundant but rather complementary. Fitting of the NEC crystal structure into the recently determined cryoEM-derived hexagonal lattice, formed in situ by pUL31 and pUL34, provided details on the molecular basis of NEC coat formation and inner nuclear membrane remodeling.

  7. A recovery principle provides insight into auxin pattern control in the Arabidopsis root

    Science.gov (United States)

    Moore, Simon; Liu, Junli; Zhang, Xiaoxian; Lindsey, Keith

    2017-01-01

    Regulated auxin patterning provides a key mechanism for controlling root growth and development. We have developed a data-driven mechanistic model using realistic root geometry and formulated a principle to theoretically investigate quantitative auxin pattern recovery following auxin transport perturbation. This principle reveals that auxin patterning is potentially controlled by multiple combinations of interlinked levels and localisation of influx and efflux carriers. We demonstrate that (1) when efflux carriers maintain polarity but change levels, maintaining the same auxin pattern requires non-uniform and polar distribution of influx carriers; (2) the emergence of the same auxin pattern, from different levels of influx carriers with the same nonpolar localisation, requires simultaneous modulation of efflux carrier level and polarity; and (3) multiple patterns of influx and efflux carriers for maintaining an auxin pattern do not have spatially proportional correlation. This reveals that auxin pattern formation requires coordination between influx and efflux carriers. We further show that the model makes various predictions that can be experimentally validated. PMID:28220889

  8. The genome sequence of the wild tomato Solanum pimpinellifolium provides insights into salinity tolerance

    KAUST Repository

    Razali, Rozaimi

    2017-11-14

    Solanum pimpinellifolium, a wild relative of cultivated tomato, offers a wealth of breeding potential for several desirable traits such as tolerance to abiotic and biotic stresses. Here, we report the genome and annotation of S. pimpinellifolium LA0480. The LA0480 genome size (811 Mb) and the number of annotated genes (25,970) are within the range observed for other sequenced tomato species. We developed and utilized the Dragon Eukaryotic Analyses Platform (DEAP) to functionally annotate the LA0480 protein-coding genes. Additionally, we used DEAP to compare protein function between S. pimpinellifolium and cultivated tomato. Our data suggest enrichment in genes involved in biotic and abiotic stress responses. Moreover, we present phenotypic data from one field experiment that demonstrate a greater salinity tolerance for fruit- and yield-related traits in S. pimpinellifolium compared with cultivated tomato. To understand the genomic basis for these differences in S. pimpinellifolium and S. lycopersicum, we analyzed 15 genes that have previously been shown to mediate salinity tolerance in plants. We show that S. pimpinellifolium has a higher copy number of the inositol-3-phosphate synthase and phosphatase genes, which are both key enzymes in the production of inositol and its derivatives. Moreover, our analysis indicates that changes occurring in the inositol phosphate pathway may contribute to the observed higher salinity tolerance in LA0480. Altogether, our work provides essential resources to understand and unlock the genetic and breeding potential of S. pimpinellifolium, and to discover the genomic basis underlying its environmental robustness.

  9. Directed evolution of a model primordial enzyme provides insights into the development of the genetic code.

    Directory of Open Access Journals (Sweden)

    Manuel M Müller

    Full Text Available The contemporary proteinogenic repertoire contains 20 amino acids with diverse functional groups and side chain geometries. Primordial proteins, in contrast, were presumably constructed from a subset of these building blocks. Subsequent expansion of the proteinogenic alphabet would have enhanced their capabilities, fostering the metabolic prowess and organismal fitness of early living systems. While the addition of amino acids bearing innovative functional groups directly enhances the chemical repertoire of proteomes, the inclusion of chemically redundant monomers is difficult to rationalize. Here, we studied how a simplified chorismate mutase evolves upon expanding its amino acid alphabet from nine to potentially 20 letters. Continuous evolution provided an enhanced enzyme variant that has only two point mutations, both of which extend the alphabet and jointly improve protein stability by >4 kcal/mol and catalytic activity tenfold. The same, seemingly innocuous substitutions (Ile→Thr, Leu→Val occurred in several independent evolutionary trajectories. The increase in fitness they confer indicates that building blocks with very similar side chain structures are highly beneficial for fine-tuning protein structure and function.

  10. Weird mammals provide insights into the evolution of mammalian sex chromosomes and dosage compensation.

    Science.gov (United States)

    Graves, Jennifer A Marshall

    2015-12-01

    The deep divergence of mammalian groups 166 and 190 million years ago (MYA) provide genetic variation to explore the evolution of DNA sequence, gene arrangement and regulation of gene expression in mammals. With encouragement from the founder of the field, Mary Lyon, techniques in cytogenetics and molecular biology were progressively adapted to characterize the sex chromosomes of kangaroos and other marsupials, platypus and echidna-and weird rodent species. Comparative gene mapping reveals the process of sex chromosome evolution from their inception 190 MYA (they are autosomal in platypus) to their inevitable end (the Y has disappeared in two rodent lineages). Our X and Y are relatively young, getting their start with the evolution of the sex-determining SRY gene, which triggered progressive degradation of the Y chromosome. Even more recently, sex chromosomes of placental mammals fused with an autosomal region which now makes up most of the Y. Exploration of gene activity patterns over four decades showed that dosage compensation via X-chromosome inactivation is unique to therian mammals, and that this whole chromosome control process is different in marsupials and absent in monotremes and reptiles, and birds. These differences can be exploited to deduce how mammalian sex chromosomes and epigenetic silencing evolved.

  11. De Novo Assembly and Comparative Transcriptome Analysis Provide Insight into Lysine Biosynthesis in Toona sinensis Roem.

    Science.gov (United States)

    Zhang, Xia; Song, Zhenqiao; Liu, Tian; Guo, Linlin; Li, Xingfeng

    2016-01-01

    Toona sinensis Roem is a popular leafy vegetable in Chinese cuisine and is also used as a traditional Chinese medicine. In this study, leaf samples were collected from the same plant on two development stages and then used for high-throughput Illumina RNA-sequencing (RNA-Seq). 125,884 transcripts and 54,628 unigenes were obtained through de novo assembly. A total of 25,570 could be annotated with known biological functions, which indicated that the T. sinensis leaves and shoots were undergoing multiple developmental processes especially for active metabolic processes. Analysis of differentially expressed unigenes between the two libraries showed that the lysine biosynthesis was an enriched KEGG pathway, and candidate genes involved in the lysine biosynthesis pathway in T. sinensis leaves and shoots were identified. Our results provide a primary analysis of the gene expression files of T. sinensis leaf and shoot on different development stages and afford a valuable resource for genetic and genomic research on plant lysine biosynthesis.

  12. Plasmodium cynomolgi genome sequences provide insight into Plasmodium vivax and the monkey malaria clade.

    Science.gov (United States)

    Tachibana, Shin-Ichiro; Sullivan, Steven A; Kawai, Satoru; Nakamura, Shota; Kim, Hyunjae R; Goto, Naohisa; Arisue, Nobuko; Palacpac, Nirianne M Q; Honma, Hajime; Yagi, Masanori; Tougan, Takahiro; Katakai, Yuko; Kaneko, Osamu; Mita, Toshihiro; Kita, Kiyoshi; Yasutomi, Yasuhiro; Sutton, Patrick L; Shakhbatyan, Rimma; Horii, Toshihiro; Yasunaga, Teruo; Barnwell, John W; Escalante, Ananias A; Carlton, Jane M; Tanabe, Kazuyuki

    2012-09-01

    P. cynomolgi, a malaria-causing parasite of Asian Old World monkeys, is the sister taxon of P. vivax, the most prevalent malaria-causing species in humans outside of Africa. Because P. cynomolgi shares many phenotypic, biological and genetic characteristics with P. vivax, we generated draft genome sequences for three P. cynomolgi strains and performed genomic analysis comparing them with the P. vivax genome, as well as with the genome of a third previously sequenced simian parasite, Plasmodium knowlesi. Here, we show that genomes of the monkey malaria clade can be characterized by copy-number variants (CNVs) in multigene families involved in evasion of the human immune system and invasion of host erythrocytes. We identify genome-wide SNPs, microsatellites and CNVs in the P. cynomolgi genome, providing a map of genetic variation that can be used to map parasite traits and study parasite populations. The sequencing of the P. cynomolgi genome is a critical step in developing a model system for P. vivax research and in counteracting the neglect of P. vivax.

  13. RNA-Sequencing of Primary Retinoblastoma Tumors Provides New Insights and Challenges Into Tumor Development

    Directory of Open Access Journals (Sweden)

    Sailaja V. Elchuri

    2018-05-01

    Full Text Available Retinoblastoma is rare tumor of the retina caused by the homozygous loss of the Retinoblastoma 1 tumor suppressor gene (RB1. Loss of the RB1 protein, pRB, results in de-regulated activity of the E2F transcription factors, chromatin changes and developmental defects leading to tumor development. Extensive microarray profiles of these tumors have enabled the identification of genes sensitive to pRB disruption, however, this technology has a number of limitations in the RNA profiles that they generate. The advent of RNA-sequencing has enabled the global profiling of all of the RNA within the cell including both coding and non-coding features and the detection of aberrant RNA processing events. In this perspective, we focus on discussing how RNA-sequencing of rare Retinoblastoma tumors will build on existing data and open up new area’s to improve our understanding of the biology of these tumors. In particular, we discuss how the RB-research field may be to use this data to determine how RB1 loss results in the expression of; non-coding RNAs, causes aberrant RNA processing events and how a deeper analysis of metabolic RNA changes can be utilized to model tumor specific shifts in metabolism. Each section discusses new opportunities and challenges associated with these types of analyses and aims to provide an honest assessment of how understanding these different processes may contribute to the treatment of Retinoblastoma.

  14. Systems analysis of transcriptional data provides insights into muscle's biological response to botulinum toxin.

    Science.gov (United States)

    Mukund, Kavitha; Mathewson, Margie; Minamoto, Viviane; Ward, Samuel R; Subramaniam, Shankar; Lieber, Richard L

    2014-11-01

    This study provides global transcriptomic profiling and analysis of botulinum toxin A (BoNT-A)-treated muscle over a 1-year period. Microarray analysis was performed on rat tibialis anterior muscles from 4 groups (n = 4/group) at 1, 4, 12, and 52 weeks after BoNT-A injection compared with saline-injected rats at 12 weeks. Dramatic transcriptional adaptation occurred at 1 week with a paradoxical increase in expression of slow and immature isoforms, activation of genes in competing pathways of repair and atrophy, impaired mitochondrial biogenesis, and increased metal ion imbalance. Adaptations of the basal lamina and fibrillar extracellular matrix (ECM) occurred by 4 weeks. The muscle transcriptome returned to its unperturbed state 12 weeks after injection. Acute transcriptional adaptations resemble denervated muscle with some subtle differences, but resolved more quickly compared with denervation. Overall, gene expression across time correlates with the generally accepted BoNT-A time course and suggests that the direct action of BoNT-A in skeletal muscle is relatively rapid. © 2014 Wiley Periodicals, Inc.

  15. Metabolomic Analysis Provides Insights on Paraquat-Induced Parkinson-Like Symptoms in Drosophila melanogaster.

    Science.gov (United States)

    Shukla, Arvind Kumar; Ratnasekhar, Ch; Pragya, Prakash; Chaouhan, Hitesh Singh; Patel, Devendra Kumar; Chowdhuri, Debapratim Kar; Mudiam, Mohana Krishna Reddy

    2016-01-01

    Paraquat (PQ) exposure causes degeneration of the dopaminergic neurons in an exposed organism while altered metabolism has a role in various neurodegenerative disorders. Therefore, the study presented here was conceived to depict the role of altered metabolism in PQ-induced Parkinson-like symptoms and to explore Drosophila as a potential model organism for such studies. Metabolic profile was generated in control and in flies that were fed PQ (5, 10, and 20 mM) in the diet for 12 and 24 h concurrent with assessment of indices of oxidative stress, dopaminergic neurodegeneration, and behavioral alteration. PQ was found to significantly alter 24 metabolites belonging to different biological pathways along with significant alterations in the above indices. In addition, PQ attenuated brain dopamine content in the exposed organism. The study demonstrates that PQ-induced alteration in the metabolites leads to oxidative stress and neurodegeneration in the exposed organism along with movement disorder, a phenotype typical of Parkinson-like symptoms. The study is relevant in the context of Drosophila and humans because similar alteration in the metabolic pathways has been observed in both PQ-exposed Drosophila and in postmortem samples of patients with Parkinsonism. Furthermore, this study provides advocacy towards the applicability of Drosophila as an alternate model organism for pre-screening of environmental chemicals for their neurodegenerative potential with altered metabolism.

  16. Clustering of Pan- and Core-genome of Lactobacillus provides Novel Evolutionary Insights for Differentiation.

    Science.gov (United States)

    Inglin, Raffael C; Meile, Leo; Stevens, Marc J A

    2018-04-24

    Bacterial taxonomy aims to classify bacteria based on true evolutionary events and relies on a polyphasic approach that includes phenotypic, genotypic and chemotaxonomic analyses. Until now, complete genomes are largely ignored in taxonomy. The genus Lactobacillus consists of 173 species and many genomes are available to study taxonomy and evolutionary events. We analyzed and clustered 98 completely sequenced genomes of the genus Lactobacillus and 234 draft genomes of 5 different Lactobacillus species, i.e. L. reuteri, L. delbrueckii, L. plantarum, L. rhamnosus and L. helveticus. The core-genome of the genus Lactobacillus contains 266 genes and the pan-genome 20'800 genes. Clustering of the Lactobacillus pan- and core-genome resulted in two highly similar trees. This shows that evolutionary history is traceable in the core-genome and that clustering of the core-genome is sufficient to explore relationships. Clustering of core- and pan-genomes at species' level resulted in similar trees as well. Detailed analyses of the core-genomes showed that the functional class "genetic information processing" is conserved in the core-genome but that "signaling and cellular processes" is not. The latter class encodes functions that are involved in environmental interactions. Evolution of lactobacilli seems therefore directed by the environment. The type species L. delbrueckii was analyzed in detail and its pan-genome based tree contained two major clades whose members contained different genes yet identical functions. In addition, evidence for horizontal gene transfer between strains of L. delbrueckii, L. plantarum, and L. rhamnosus, and between species of the genus Lactobacillus is presented. Our data provide evidence for evolution of some lactobacilli according to a parapatric-like model for species differentiation. Core-genome trees are useful to detect evolutionary relationships in lactobacilli and might be useful in taxonomic analyses. Lactobacillus' evolution is directed

  17. SSR marker variations in Brassica species provide insight into the origin and evolution of Brassica amphidiploids.

    Science.gov (United States)

    Thakur, Ajay Kumar; Singh, Kunwar Harendra; Singh, Lal; Nanjundan, Joghee; Khan, Yasin Jeshima; Singh, Dhiraj

    2018-01-01

    Oilseed Brassica represents an important group of oilseed crops with a long history of evolution and cultivation. To understand the origin and evolution of Brassica amphidiploids, simple sequence repeat (SSR) markers were used to unravel genetic variations in three diploids and three amphidiploid Brassica species of U's triangle along with Eruca sativa as an outlier. Of 124 Brassica-derived SSR loci assayed, 100% cross-transferability was obtained for B. juncea and three subspecies of B. rapa , while lowest cross-transferability (91.93%) was obtained for Eruca sativa . The average % age of cross-transferability across all the seven species was 98.15%. The number of alleles detected at each locus ranged from one to six with an average of 3.41 alleles per primer pair. Neighbor-Joining-based dendrogram divided all the 40 accessions into two main groups composed of B. juncea / B. nigra/B. rapa and B. carinata/B. napus/B. oleracea . C-genome of oilseed Brassica species remained relatively more conserved than A- and B-genome. A- genome present in B. juncea and B. napus seems distinct from each other and hence provides great opportunity for generating diversity through synthesizing amphidiploids from different sources of A- genome. B. juncea had least intra-specific distance indicating narrow genetic base. B. rapa appears to be more primitive species from which other two diploid species might have evolved. The SSR marker set developed in this study will assist in DNA fingerprinting of various Brassica species cultivars, evaluating the genetic diversity in Brassica germplasm, genome mapping and construction of linkage maps, gene tagging and various other genomics-related studies in Brassica species. Further, the evolutionary relationship established among various Brassica species would assist in formulating suitable breeding strategies for widening the genetic base of Brassica amphidiploids by exploiting the genetic diversity present in diploid progenitor gene pools.

  18. Wing shape of four new bee fossils (Hymenoptera: Anthophila provides insights to bee evolution.

    Directory of Open Access Journals (Sweden)

    Manuel Dehon

    Full Text Available Bees (Anthophila are one of the major groups of angiosperm-pollinating insects and accordingly are widely studied in both basic and applied research, for which it is essential to have a clear understanding of their phylogeny, and evolutionary history. Direct evidence of bee evolutionary history has been hindered by a dearth of available fossils needed to determine the timing and tempo of their diversification, as well as episodes of extinction. Here we describe four new compression fossils of bees from three different deposits (Miocene of la Cerdanya, Spain; Oligocene of Céreste, France; and Eocene of the Green River Formation, U.S.A.. We assess the similarity of the forewing shape of the new fossils with extant and fossil taxa using geometric morphometrics analyses. Predictive discriminant analyses show that three fossils share similar forewing shapes with the Apidae [one of uncertain tribal placement and perhaps near Euglossini, one definitive bumble bee (Bombini, and one digger bee (Anthophorini], while one fossil is more similar to the Andrenidae. The corbiculate fossils are described as Euglossopteryx biesmeijeri De Meulemeester, Michez, & Engel, gen. nov. sp. nov. (type species of Euglossopteryx Dehon & Engel, n. gen. and Bombus cerdanyensis Dehon, De Meulemeester, & Engel, sp. nov. They provide new information on the distribution and timing of particular corbiculate groups, most notably the extension into North America of possible Eocene-Oligocene cooling-induced extinctions. Protohabropoda pauli De Meulemeester & Michez, gen. nov. sp. nov. (type species of Protohabropoda Dehon & Engel, n. gen. reinforces previous hypotheses of anthophorine evolution in terms of ecological shifts by the Oligocene from tropical to mesic or xeric habitats. Lastly, a new fossil of the Andreninae, Andrena antoinei Michez & De Meulemeester, sp. nov., further documents the presence of the today widespread genus Andrena Fabricius in the Late Oligocene of France.

  19. Wing shape of four new bee fossils (Hymenoptera: Anthophila) provides insights to bee evolution.

    Science.gov (United States)

    Dehon, Manuel; Michez, Denis; Nel, André; Engel, Michael S; De Meulemeester, Thibaut

    2014-01-01

    Bees (Anthophila) are one of the major groups of angiosperm-pollinating insects and accordingly are widely studied in both basic and applied research, for which it is essential to have a clear understanding of their phylogeny, and evolutionary history. Direct evidence of bee evolutionary history has been hindered by a dearth of available fossils needed to determine the timing and tempo of their diversification, as well as episodes of extinction. Here we describe four new compression fossils of bees from three different deposits (Miocene of la Cerdanya, Spain; Oligocene of Céreste, France; and Eocene of the Green River Formation, U.S.A.). We assess the similarity of the forewing shape of the new fossils with extant and fossil taxa using geometric morphometrics analyses. Predictive discriminant analyses show that three fossils share similar forewing shapes with the Apidae [one of uncertain tribal placement and perhaps near Euglossini, one definitive bumble bee (Bombini), and one digger bee (Anthophorini)], while one fossil is more similar to the Andrenidae. The corbiculate fossils are described as Euglossopteryx biesmeijeri De Meulemeester, Michez, & Engel, gen. nov. sp. nov. (type species of Euglossopteryx Dehon & Engel, n. gen.) and Bombus cerdanyensis Dehon, De Meulemeester, & Engel, sp. nov. They provide new information on the distribution and timing of particular corbiculate groups, most notably the extension into North America of possible Eocene-Oligocene cooling-induced extinctions. Protohabropoda pauli De Meulemeester & Michez, gen. nov. sp. nov. (type species of Protohabropoda Dehon & Engel, n. gen.) reinforces previous hypotheses of anthophorine evolution in terms of ecological shifts by the Oligocene from tropical to mesic or xeric habitats. Lastly, a new fossil of the Andreninae, Andrena antoinei Michez & De Meulemeester, sp. nov., further documents the presence of the today widespread genus Andrena Fabricius in the Late Oligocene of France.

  20. Echidna venom gland transcriptome provides insights into the evolution of monotreme venom.

    Directory of Open Access Journals (Sweden)

    Emily S W Wong

    Full Text Available Monotremes (echidna and platypus are egg-laying mammals. One of their most unique characteristic is that males have venom/crural glands that are seasonally active. Male platypuses produce venom during the breeding season, delivered via spurs, to aid in competition against other males. Echidnas are not able to erect their spurs, but a milky secretion is produced by the gland during the breeding season. The function and molecular composition of echidna venom is as yet unknown. Hence, we compared the deeply sequenced transcriptome of an in-season echidna crural gland to that of a platypus and searched for putative venom genes to provide clues into the function of echidna venom and the evolutionary history of monotreme venom. We found that the echidna venom gland transcriptome was markedly different from the platypus with no correlation between the top 50 most highly expressed genes. Four peptides found in the venom of the platypus were detected in the echidna transcriptome. However, these genes were not highly expressed in echidna, suggesting that they are the remnants of the evolutionary history of the ancestral venom gland. Gene ontology terms associated with the top 100 most highly expressed genes in echidna, showed functional terms associated with steroidal and fatty acid production, suggesting that echidna "venom" may play a role in scent communication during the breeding season. The loss of the ability to erect the spur and other unknown evolutionary forces acting in the echidna lineage resulted in the gradual decay of venom components and the evolution of a new role for the crural gland.

  1. Hierarchical partitioning of metazoan protein conservation profiles provides new functional insights.

    Directory of Open Access Journals (Sweden)

    Jonathan Witztum

    Full Text Available The availability of many complete, annotated proteomes enables the systematic study of the relationships between protein conservation and functionality. We explore this question based solely on the presence or absence of protein homologues (a.k.a. conservation profiles. We study 18 metazoans, from two distinct points of view: the human's and the fly's. Using the GOrilla gene ontology (GO analysis tool, we explore functional enrichment of the "universal proteins", those with homologues in all 17 other species, and of the "non-universal proteins". A large number of GO terms are strongly enriched in both human and fly universal proteins. Most of these functions are known to be essential. A smaller number of GO terms, exhibiting markedly different properties, are enriched in both human and fly non-universal proteins. We further explore the non-universal proteins, whose conservation profiles are consistent with the "tree of life" (TOL consistent, as well as the TOL inconsistent proteins. Finally, we applied Quantum Clustering to the conservation profiles of the TOL consistent proteins. Each cluster is strongly associated with one or a small number of specific monophyletic clades in the tree of life. The proteins in many of these clusters exhibit strong functional enrichment associated with the "life style" of the related clades. Most previous approaches for studying function and conservation are "bottom up", studying protein families one by one, and separately assessing the conservation of each. By way of contrast, our approach is "top down". We globally partition the set of all proteins hierarchically, as described above, and then identify protein families enriched within different subdivisions. While supporting previous findings, our approach also provides a tool for discovering novel relations between protein conservation profiles, functionality, and evolutionary history as represented by the tree of life.

  2. Multidimensional proteomics analysis of amniotic fluid to provide insight into the mechanisms of idiopathic preterm birth.

    Directory of Open Access Journals (Sweden)

    Irina A Buhimschi

    2008-04-01

    Full Text Available Though recent advancement in proteomics has provided a novel perspective on several distinct pathogenetic mechanisms leading to preterm birth (inflammation, bleeding, the etiology of most preterm births still remains elusive. We conducted a multidimensional proteomic analysis of the amniotic fluid to identify pathways related to preterm birth in the absence of inflammation or bleeding.A proteomic fingerprint was generated from fresh amniotic fluid using surface-enhanced laser desorbtion ionization time of flight (SELDI-TOF mass spectrometry in a total of 286 consecutive samples retrieved from women who presented with signs or symptoms of preterm labor or preterm premature rupture of the membranes. Inflammation and/or bleeding proteomic patterns were detected in 32% (92/286 of the SELDI tracings. In the remaining tracings, a hierarchical algorithm was applied based on descriptors quantifying similarity/dissimilarity among proteomic fingerprints. This allowed identification of a novel profile (Q-profile based on the presence of 5 SELDI peaks in the 10-12.5 kDa mass area. Women displaying the Q-profile (mean+/-SD, gestational age: 25+/-4 weeks, n = 40 were more likely to deliver preterm despite expectant management in the context of intact membranes and normal amniotic fluid clinical results. Utilizing identification-centered proteomics techniques (fluorescence two-dimensional differential gel electrophoresis, robotic tryptic digestion and mass spectrometry coupled with Protein ANalysis THrough Evolutionary Relationships (PANTHER ontological classifications, we determined that in amniotic fluids with Q-profile the differentially expressed proteins are primarily involved in non-inflammatory biological processes such as protein metabolism, signal transduction and transport.Proteomic profiling of amniotic fluid coupled with non-hierarchical bioinformatics algorithms identified a subgroup of patients at risk for preterm birth in the absence of intra

  3. Molecular modeling of human neutral sphingomyelinase provides insight into its molecular interactions.

    Science.gov (United States)

    Dinesh; Goswami, Angshumala; Suresh, Panneer Selvam; Thirunavukkarasu, Chinnasamy; Weiergräber, Oliver H; Kumar, Muthuvel Suresh

    2011-01-01

    The neutral sphingomyelinase (N-SMase) is considered a major candidate for mediating the stress-induced production of ceramide, and it plays an important role in cell-cycle arrest, apoptosis, inflammation, and eukaryotic stress responses. Recent studies have identified a small region at the very N-terminus of the 55 kDa tumour necrosis factor receptor (TNF-R55), designated the neutral sphingomyelinase activating domain (NSD) that is responsible for the TNF-induced activation of N-SMase. There is no direct association between TNF-R55 NSD and N-SMase; instead, a protein named factor associated with N-SMase activation (FAN) has been reported to couple the TNF-R55 NSD to N-SMase. Since the three-dimensional fold of N-SMase is still unknown, we have modeled the structure using the protein fold recognition and threading method. Moreover, we propose models for the TNF-R55 NSD as well as the FAN protein in order to study the structural basis of N-SMase activation and regulation. Protein-protein interaction studies suggest that FAN is crucially involved in mediating TNF-induced activation of the N-SMase pathway, which in turn regulates mitogenic and proinflammatory responses. Inhibition of N-SMase may lead to reduction of ceramide levels and hence may provide a novel therapeutic strategy for inflammation and autoimmune diseases. Molecular dynamics (MD) simulations were performed to check the stability of the predicted model and protein-protein complex; indeed, stable RMS deviations were obtained throughout the simulation. Furthermore, in silico docking of low molecular mass ligands into the active site of N-SMase suggests that His135, Glu48, Asp177, and Asn179 residues play crucial roles in this interaction. Based on our results, these ligands are proposed to be potent and selective N-SMase inhibitors, which may ultimately prove useful as lead compounds for drug development.

  4. Transcriptome analysis of Crossostephium chinensis provides insight into the molecular basis of salinity stress responses.

    Directory of Open Access Journals (Sweden)

    Haiyan Yang

    Full Text Available Soil salinization is becoming a limitation to the utilization of ornamental plants worldwide. Crossostephium chinensis (Linnaeus Makino is often cultivated along the southeast coast of China for its desirable ornamental qualities and high salt tolerance. However, little is known about the genomic background of the salt tolerance mechanism in C. chinensis. In the present study, we used Illumina paired-end sequencing to systematically investigate leaf transcriptomes derived from C. chinensis seedlings grown under normal conditions and under salt stress. A total of 105,473,004 bp of reads were assembled into 163,046 unigenes, of which 65,839 (40.38% of the total and 54,342 (33.32% of the total were aligned in Swiss-Prot and Nr protein, respectively. A total of 11,331 (6.95% differentially expressed genes (DEGs were identified among three comparisons, including 2,239 in 'ST3 vs ST0', 5,880 in 'ST9 vs ST3' and 9,718 in 'ST9 vs ST0', and they were generally classified into 26 Gene Ontology terms and 58 Kyoto Encyclopedia of Genes and Genomes (KEGG pathway terms. Many genes encoding important transcription factors (e.g., WRKY, MYB, and AP2/EREBP and proteins involved in starch and sucrose metabolism, arginine and proline metabolism, plant hormone signal transduction, amino acid biosynthesis, plant-pathogen interactions and carbohydrate metabolism, among others, were substantially up-regulated under salt stress. These genes represent important candidates for studying the salt-response mechanism and molecular biology of C. chinensis and its relatives. Our findings provide a genomic sequence resource for functional genetic assignments in C. chinensis. These transcriptome datasets will help elucidate the molecular mechanisms responsible for salt-stress tolerance in C. chinensis and facilitate the breeding of new stress-tolerant cultivars for high-saline areas using this valuable genetic resource.

  5. Pathway analysis of GWAS provides new insights into genetic susceptibility to 3 inflammatory diseases.

    Directory of Open Access Journals (Sweden)

    Hariklia Eleftherohorinou

    2009-11-01

    Full Text Available Although the introduction of genome-wide association studies (GWAS have greatly increased the number of genes associated with common diseases, only a small proportion of the predicted genetic contribution has so far been elucidated. Studying the cumulative variation of polymorphisms in multiple genes acting in functional pathways may provide a complementary approach to the more common single SNP association approach in understanding genetic determinants of common disease. We developed a novel pathway-based method to assess the combined contribution of multiple genetic variants acting within canonical biological pathways and applied it to data from 14,000 UK individuals with 7 common diseases. We tested inflammatory pathways for association with Crohn's disease (CD, rheumatoid arthritis (RA and type 1 diabetes (T1D with 4 non-inflammatory diseases as controls. Using a variable selection algorithm, we identified variants responsible for the pathway association and evaluated their use for disease prediction using a 10 fold cross-validation framework in order to calculate out-of-sample area under the Receiver Operating Curve (AUC. The generalisability of these predictive models was tested on an independent birth cohort from Northern Finland. Multiple canonical inflammatory pathways showed highly significant associations (p 10(-3-10(-20 with CD, T1D and RA. Variable selection identified on average a set of 205 SNPs (149 genes for T1D, 350 SNPs (189 genes for RA and 493 SNPs (277 genes for CD. The pattern of polymorphisms at these SNPS were found to be highly predictive of T1D (91% AUC and RA (85% AUC, and weakly predictive of CD (60% AUC. The predictive ability of the T1D model (without any parameter refitting had good predictive ability (79% AUC in the Finnish cohort. Our analysis suggests that genetic contribution to common inflammatory diseases operates through multiple genes interacting in functional pathways.

  6. Comparative transcriptomic analysis provides insights into antibacterial mechanisms of Branchiostoma belcheri under Vibrio parahaemolyticus infection.

    Science.gov (United States)

    Zhang, Qi-Lin; Zhu, Qian-Hua; Liang, Ming-Zhong; Wang, Feng; Guo, Jun; Deng, Xian-Yu; Chen, Jun-Yuan; Wang, Yu-Jun; Lin, Lian-Bing

    2018-05-01

    Amphioxus, a basal chordate, is widely considered to be an existing proxy of the invertebrate ancestor of vertebrates, and it exhibits susceptibility to various pathogen infections and pathogenic mimic challenges. Here, in order to understand more clearly its antibacterial mechanisms, we analyzed the ribosomal RNA (rRNA)-depleted transcriptome of Chinese amphioxus (Branchiostoma belcheri) infected with Vibrio parahaemolyticus (V. p.) via next-generation deep sequencing technology (RNA-seq). We identified a total of 3214 differentially expressed genes (DEGs) by comparing V. p.-infected and control transcriptome libraries, including 2219 significantly up-regulated and 995 significantly down-regulated DEGs in V. p.-infected amphioxus. The DEGs with the top 10 most dramatic expression fold changes after V. p. infection, as well as 53 immune-related DEGs (IRDs) belonging to four primary categories of innate immunity were analyzed further. Through gene ontology (GO) and pathway enrichment analysis, DEGs were found to be primarily related to immune processes, apoptosis, catabolic and metabolic processes, binding and enzyme activity, while pathways involving bacterial infection, immune signaling, immune response, cancer, and apoptosis were overrepresented. We validated the RNA-seq results by detecting the expression levels of 10 IRDs using qRT-PCR, and we surveyed the dynamic variation in gene expression for these IRDs at 0, 6, 12, 24, and 48 h after V. p. Subsequently, according to the RNA-seq results, the presence of a primitive Toll-like receptor (TLR)-mediated antibacterial immune signaling pathway was predicted in B. belcheri. This study provides valuable information regarding antibacterial immunity for further research into the evolution of immunity in vertebrates and broadens our understanding of the innate immune response against bacterial invasion in amphioxus. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. Inferences from the historical distribution of wild and domesticated maize provide ecological and evolutionary insight.

    Directory of Open Access Journals (Sweden)

    Matthew B Hufford

    Full Text Available The species Zea mays includes both domesticated maize (ssp. mays and its closest wild relatives known as the teosintes. While genetic and archaeological studies have provided a well-established history of Z. mays evolution, there is currently minimal description of its current and past distribution. Here, we implemented species distribution modeling using paleoclimatic models of the last interglacial (LI; ∼135,000 BP and the last glacial maximum (LGM; ∼21,000 BP to hindcast the distribution of Zea mays subspecies over time and to revisit current knowledge of its phylogeography and evolutionary history.Using a large occurrence data set and the distribution modeling MaxEnt algorithm, we obtained robust present and past species distributions of the two widely distributed teosinte subspecies (ssps. parviglumis and mexicana revealing almost perfect complementarity, stable through time, of their occupied distributions. We also investigated the present distributions of primitive maize landraces, which overlapped but were broader than those of the teosintes. Our data reinforced the idea that little historical gene flow has occurred between teosinte subspecies, but maize has served as a genetic bridge between them. We observed an expansion of teosinte habitat from the LI, consistent with population genetic data. Finally, we identified locations potentially serving as refugia for the teosintes throughout epochs of climate change and sites that should be targeted in future collections.The restricted and highly contrasting ecological niches of the wild teosintes differ substantially from domesticated maize. Variables determining the distributions of these taxa can inform future considerations of local adaptation and the impacts of climate change. Our assessment of the changing distributions of Zea mays taxa over time offers a unique glimpse into the history of maize, highlighting a strategy for the study of domestication that may prove useful for other

  8. Andrographis paniculata transcriptome provides molecular insights into tissue-specific accumulation of medicinal diterpenes.

    Science.gov (United States)

    Garg, Anchal; Agrawal, Lalit; Misra, Rajesh Chandra; Sharma, Shubha; Ghosh, Sumit

    2015-09-02

    Kalmegh (Andrographis paniculata) has been widely exploited in traditional medicine for the treatment of infectious diseases and health disorders. Ent-labdane-related diterpene (ent-LRD) specialized (i.e., secondary) metabolites of kalmegh such as andrographolide, neoandrographolide and 14-deoxy-11,12-didehydroandrographolide, are known for variety of pharmacological activities. However, due to the lack of genomic and transcriptomic information, underlying molecular basis of ent-LRDs biosynthesis has remained largely unknown. To identify candidate genes of the ent-LRD biosynthetic pathway, we performed comparative transcriptome analysis using leaf and root tissues that differentially accumulate ent-LRDs. De novo assembly of Illumina HiSeq2000 platform-generated paired-end sequencing reads resulted into 69,011 leaf and 64,244 root transcripts which were assembled into a total of 84,628 unique transcripts. Annotation of these transcripts to the Uniprot, Kyoto Encyclopedia of Genes and Genomes (KEGG) and Carbohydrate-Active Enzymes (CAZy) databases identified candidate transcripts of the ent-LRD biosynthetic pathway. These included transcripts that encode enzymes of the plastidial 2C-methyl-D-erythritol-4-phosphate pathway which provides C5 isoprenoid precursors for the ent-LRDs biosynthesis, geranylgeranyl diphosphate synthase, class II diterpene synthase (diTPS), cytochrome P450 monooxygenase and glycosyltransferase. Three class II diTPSs (ApCPS1, ApCPS2 and ApCPS3) that showed distinct tissue-specific expression profiles and are phylogenetically related to the dicotyledon ent-copalyl diphosphate synthases, are identified. ApCPS1, ApCPS2 and ApCPS3 encode for 832-, 817- and 797- amino acids proteins of 55-63 % identity, respectively. Spatio-temporal patterns of transcripts and ent-LRDs accumulation are consistent with the involvement of ApCPS1 in general (i.e., primary) metabolism for the biosynthesis of phytohormone gibberellin, ApCPS2 in leaf specialized ent

  9. The Epigenome of Schistosoma mansoni Provides Insight about How Cercariae Poise Transcription until Infection

    Science.gov (United States)

    Freitag, Michael; Parrinello, Hugues; Groth, Marco; Emans, Rémi; Cosseau, Céline; Grunau, Christoph

    2015-01-01

    Background Chromatin structure can control gene expression and can define specific transcription states. For example, bivalent methylation of histone H3K4 and H3K27 is linked to poised transcription in vertebrate embryonic stem cells (ESC). It allows them to rapidly engage specific developmental pathways. We reasoned that non-vertebrate metazoans that encounter a similar developmental constraint (i.e. to quickly start development into a new phenotype) might use a similar system. Schistosomes are parasitic platyhelminthes that are characterized by passage through two hosts: a mollusk as intermediate host and humans or rodents as definitive host. During its development, the parasite undergoes drastic changes, most notable immediately after infection of the definitive host, i.e. during the transition from the free-swimming cercariae into adult worms. Methodology/Principal Findings We used Chromatin Immunoprecipitation followed by massive parallel sequencing (ChIP-Seq) to analyze genome-wide chromatin structure of S. mansoni on the level of histone modifications (H3K4me3, H3K27me3, H3K9me3, and H3K9ac) in cercariae, schistosomula and adults (available at http://genome.univ-perp.fr). We saw striking differences in chromatin structure between the developmental stages, but most importantly we found that cercariae possess a specific combination of marks at the transcription start sites (TSS) that has similarities to a structure found in ESC. We demonstrate that in cercariae no transcription occurs, and we provide evidences that cercariae do not possess large numbers of canonical stem cells. Conclusions/Significance We describe here a broad view on the epigenome of a metazoan parasite. Most notably, we find bivalent histone H3 methylation in cercariae. Methylation of H3K27 is removed during transformation into schistosomula (and stays absent in adults) and transcription is activated. In addition, shifts of H3K9 methylation and acetylation occur towards upstream and

  10. The Epigenome of Schistosoma mansoni Provides Insight about How Cercariae Poise Transcription until Infection.

    Directory of Open Access Journals (Sweden)

    David Roquis

    Full Text Available Chromatin structure can control gene expression and can define specific transcription states. For example, bivalent methylation of histone H3K4 and H3K27 is linked to poised transcription in vertebrate embryonic stem cells (ESC. It allows them to rapidly engage specific developmental pathways. We reasoned that non-vertebrate metazoans that encounter a similar developmental constraint (i.e. to quickly start development into a new phenotype might use a similar system. Schistosomes are parasitic platyhelminthes that are characterized by passage through two hosts: a mollusk as intermediate host and humans or rodents as definitive host. During its development, the parasite undergoes drastic changes, most notable immediately after infection of the definitive host, i.e. during the transition from the free-swimming cercariae into adult worms.We used Chromatin Immunoprecipitation followed by massive parallel sequencing (ChIP-Seq to analyze genome-wide chromatin structure of S. mansoni on the level of histone modifications (H3K4me3, H3K27me3, H3K9me3, and H3K9ac in cercariae, schistosomula and adults (available at http://genome.univ-perp.fr. We saw striking differences in chromatin structure between the developmental stages, but most importantly we found that cercariae possess a specific combination of marks at the transcription start sites (TSS that has similarities to a structure found in ESC. We demonstrate that in cercariae no transcription occurs, and we provide evidences that cercariae do not possess large numbers of canonical stem cells.We describe here a broad view on the epigenome of a metazoan parasite. Most notably, we find bivalent histone H3 methylation in cercariae. Methylation of H3K27 is removed during transformation into schistosomula (and stays absent in adults and transcription is activated. In addition, shifts of H3K9 methylation and acetylation occur towards upstream and downstream of the transcriptional start site (TSS. We conclude

  11. Comprehensive transcriptome analysis provides new insights into nutritional strategies and phylogenetic relationships of chrysophytes

    Directory of Open Access Journals (Sweden)

    Daniela Beisser

    2017-01-01

    based on ribosomal RNA and orthologous genes. Finally, we make functionally annotated reference transcriptomes of each strain available to the community, significantly enhancing publicly available data on Chrysophyceae. Conclusions Our study is the first comprehensive transcriptomic characterisation of a diverse set of Chrysophyceaen strains. In addition, we showcase the possibility of inferring phylogenies from assembled transcriptomes using an alignment-free approach. The raw and functionally annotated data we provide will prove beneficial for further examination of the diversity within this taxon. Our molecular characterisation of different trophic modes presents a first such example.

  12. Economic Insights into Providing Access to Improved Groundwater Sources in Remote, Low-Resource Areas

    Science.gov (United States)

    Abramson, A.; Lazarovitch, N.; Adar, E.

    2013-12-01

    Groundwater is often the most or only feasible drinking water source in remote, low-resource areas. Yet the economics of its development have not been systematically outlined. We applied CBARWI (Cost-Benefit Analysis for Remote Water Improvements), a recently developed Decision Support System, to investigate the economic, physical and management factors related to the costs and benefits of non-networked groundwater supply in remote areas. Synthetic profiles of community water services (n = 17,962), defined across 14 parameters' values and ranges relevant to remote areas, were imputed into the decision framework, and the parameter effects on economic outcomes were investigated through regression analysis (Table 1). Several approaches were included for financing the improvements, after Abramson et al, 2011: willingness-to -pay (WTP), -borrow (WTB) and -work (WTW) in community irrigation (';water-for-work'). We found that low-cost groundwater development approaches are almost 7 times more cost-effective than conventional boreholes fitted with handpumps. The costs of electric, submersible borehole pumps are comparable only when providing expanded water supplies, and off-grid communities pay significantly more for such expansions. In our model, new source construction is less cost-effective than improvement of existing wells, but necessary for expanding access to isolated households. The financing approach significantly impacts the feasibility of demand-driven cost recovery; in our investigation, benefit exceeds cost in 16, 32 and 48% of water service configurations financed by WTP, WTB and WTW, respectively. Regressions of total cost (R2 = 0.723) and net benefit under WTW (R2 = 0.829) along with analysis of output distributions indicate that parameters determining the profitability of irrigation are different from those determining costs and other measures of net benefit. These findings suggest that the cost-benefit outcomes associated with groundwater-based water

  13. In situ tagging technique for fishes provides insight into growth and movement of invasive lionfish.

    Science.gov (United States)

    Akins, John L; Morris, James A; Green, Stephanie J

    2014-10-01

    's mass. Our study offers a novel in situ tagging technique that can be used to provide critical information on fish site fidelity, movement patterns, and growth in cases where ex situ tagging is not feasible.

  14. Insights to Meteorites and Impact Processes provided by Advanced EBSD Analysis

    Science.gov (United States)

    Palasse, Laurie; Berlin, Jana; Goran, Daniel; Tagle, Roald; Hamers, Maartje; Assis Fernandes, Vera; Deutsch, Alexander; Schulte, Peter; Salge, Tobias

    2013-04-01

    . For Chicxulub, the brecciated impact melt rock from borehole Yaxcopoil-1 (Unit 5, 861.72 m) [3] reveals that the ballen microstructure is only semi-amorphous and cross cuts a fine grained recrystallised microstructure. (C) CB chondrite Gujba: EDS and EBSD data were acquired simultaneously to study chemical and physical interactions between preexisting metal particles and the invading silicate-rich impact melt matrix. Metal particles appear to have different thermal histories. Some of them consist of many small grains (average diameter ~10 µm), which have a similar orientation when they are surrounded by arcuate Fe,Cr-sulfides. [4]. Acknowledgements: P. Claeys, R.H. Jones, ICDP and the Museum of Natural History Berlin for providing samples. References: [1] T. Salge (2007) PhD thesis, Humboldt Universität zu Berlin, 130p. [2] A. P. Jones et al. (2000) Lect. Notes in Earth Sciences 91: 343-361. [3] M. J. Nelson et al. (2012) GCA 86: 1-20. [4]. J. Berlin et al. (2013) 44th LPSC # 2439

  15. Insights Into Care Providers' Understandings of Life Story Work With Persons With Dementia: Findings From a Qualitative Study.

    Science.gov (United States)

    Berendonk, Charlotte; Caine, Vera

    2017-08-01

    In Germany, life story work, an approach which acknowledges humans as narrative beings and honors biographies, is required by health authorities to be integrated in care provided in nursing homes. Insufficient attention to life story work could place residents at risk of dehumanization, particularly residents with dementia, who depend on support of others to tell and make meaning of their life experiences. We conducted a qualitative study to gain insights into care providers' perceptions and practices of life story work with persons with dementia. Thirty-six care providers in 7 nursing homes participated in semistructured interviews or group discussions. We derived subjective theories (individual understandings) of care providers and higher-order concept patterns following the principles and processes of grounded theory. We found a great variation in participants' understandings of life story work. Some participants were unsure if and how life story work impacts persons with dementia. Starting points for improving the integration of life story work into practice are discussed. We conclude that care providers need a better understanding of life story work as a nursing intervention. The importance of the notion of humans as narrative beings and the multiple ways in which we story our lives as well as embody life stories needs to be further developed. Knowledge is required about the practical and systemic challenges of integrating life story work in the care of persons with dementia.

  16. 13,16-Dimethyl octacosanedioic acid (iso-diabolic acid), a common membrane-spanning lipid of Acidobacteria subdivisions 1 and 3

    NARCIS (Netherlands)

    Sinninghe Damsté, J.S.; Rijpstra, W.I.C.; Hopmans, E.C.; Weijers, J.W.H.; Foesel, B.U.; Overmann, J.; Dedysh, S.N.

    2011-01-01

    The distribution of membrane lipids of 17 different strains representing 13 species of subdivisions 1 and 3 of the phylum Acidobacteria, a highly diverse phylum of the Bacteria, were examined by hydrolysis and gas chromatography-mass spectrometry (MS) and by high-performance liquid

  17. A proteomic approach provides new insights into the control of soil-borne plant pathogens by Bacillus species.

    Directory of Open Access Journals (Sweden)

    Omür Baysal

    Full Text Available Beneficial microorganisms (also known as biopesticides are considered to be one of the most promising methods for more rational and safe crop management practices. We used Bacillus strains EU07, QST713 and FZB24, and investigated their inhibitory effect on Fusarium. Bacterial cell cultures, cell-free supernatants and volatiles displayed varying degrees of suppressive effect. Proteomic analysis of secreted proteins from EU07 and FZB24 revealed the presence of lytic enzymes, cellulases, proteases, 1,4-β-glucanase and hydrolases, all of which contribute to degradation of the pathogen cell wall. Further proteomic investigations showed that proteins involved in metabolism, protein folding, protein degradation, translation, recognition and signal transduction cascade play an important role in the control of Fusarium oxysporum. Our findings provide new knowledge on the mechanism of action of Bacillus species and insight into biocontrol mechanisms.

  18. Uranium sorption to natural substrates-insights provided by isotope exchange, selective extraction and surface complexation modelling approaches

    International Nuclear Information System (INIS)

    Waite, T.D.; Payne T.E.; Davis, J.A.

    1993-01-01

    An extensive experimental program has been conducted over the last three years into the interaction of U(VI) with both single oxides and clays and complex natural substrates from the weathered zone in the vicinity of a uranium ore body in northern Australia. While iron oxides have frequently been considered to account for much of the uptake on such natural substrates, the results of laboratory open-quotes pH edgeclose quotes studies and of isotope exchange and selective extraction studies suggest that other phases must also play a significant role in controlling the partitioning of U(VI) between solid and solution phases. Supporting studies on kaolinite, the dominant clay in this system, provide insight into the most appropriate method of modelling the interaction of U(VI) with these natural substrates. The problems still remaining in adequately describing sorption of radionuclides and trace elements to complex natural substrates are discussed

  19. Characterization of hairless (Hr) and FGF5 genes provides insights into the molecular basis of hair loss in cetaceans.

    Science.gov (United States)

    Chen, Zhuo; Wang, Zhengfei; Xu, Shixia; Zhou, Kaiya; Yang, Guang

    2013-02-09

    Hair is one of the main distinguishing characteristics of mammals and it has many important biological functions. Cetaceans originated from terrestrial mammals and they have evolved a series of adaptations to aquatic environments, which are of evolutionary significance. However, the molecular mechanisms underlying their aquatic adaptations have not been well explored. This study provided insights into the evolution of hair loss during the transition from land to water by investigating and comparing two essential regulators of hair follicle development and hair follicle cycling, i.e., the Hairless (Hr) and FGF5 genes, in representative cetaceans and their terrestrial relatives. The full open reading frame sequences of the Hr and FGF5 genes were characterized in seven cetaceans. The sequence characteristics and evolutionary analyses suggested the functional loss of the Hr gene in cetaceans, which supports the loss of hair during their full adaptation to aquatic habitats. By contrast, positive selection for the FGF5 gene was found in cetaceans where a series of positively selected amino acid residues were identified. This is the first study to investigate the molecular basis of the hair loss in cetaceans. Our investigation of Hr and FGF5, two indispensable regulators of the hair cycle, provide some new insights into the molecular basis of hair loss in cetaceans. The results suggest that positive selection for the FGF5 gene might have promoted the termination of hair growth and early entry into the catagen stage of hair follicle cycling. Consequently, the hair follicle cycle was disrupted and the hair was lost completely due to the loss of the Hr gene function in cetaceans. This suggests that cetaceans have evolved an effective and complex mechanism for hair loss.

  20. A Comparative Genomic Survey Provides Novel Insights into Molecular Evolution of l-Aromatic Amino Acid Decarboxylase in Vertebrates

    Directory of Open Access Journals (Sweden)

    Yanping Li

    2018-04-01

    Full Text Available Melatonin is a pleiotropic molecule with various important physiological roles in vertebrates. l-aromatic amino acid decarboxylase (AAAD is the second enzyme for melatonin synthesis. By far, a clear-cut gene function of AAAD in the biosynthesis of melatonin has been unclear in vertebrates. Here, we provide novel insights into the evolution of AAAD based on 77 vertebrate genomes. According to our genome-wide alignments, we extracted a total of 151 aaad nucleotide sequences. A phylogenetic tree was constructed on the basis of these sequences and corresponding protein alignments, indicating that tetrapods and diploid bony fish genomes contained one aaad gene and a new aaad-like gene, which formed a novel AAAD family. However, in tetraploid teleosts, there were two copies of the aaad gene due to whole genome duplication. A subsequent synteny analysis investigated 81 aaad sequences and revealed their collinearity and systematic evolution. Interestingly, we discovered that platypus (Ornithorhynchus anatinus, Atlantic cod (Guadus morhua, Mexican tetra (Astyanax mexicanus, and a Sinocyclocheilus cavefish (S. anshuiensis have long evolutionary branches in the phylogenetic topology. We also performed pseudogene identification and selection pressure analysis; however, the results revealed a deletion of 37 amino acids in Atlantic cod and premature stop codons in the cave-restricted S. anshuiensis and A. mexicanus, suggesting weakening or disappearing rhythms in these cavefishes. Selective pressure analysis of aaad between platypus and other tetrapods showed that rates of nonsynonymous (Ka and synonymous (Ks substitutions were higher when comparing the platypus to other representative tetrapods, indicating that, in this semiaquatic mammal, the aaad gene experienced selection during the process of evolution. In summary, our current work provides novel insights into aaad genes in vertebrates from a genome-wide view.

  1. Silver vanadium diphosphate Ag2VP2O8: Electrochemistry and characterization of reduced material providing mechanistic insights

    International Nuclear Information System (INIS)

    Takeuchi, Esther S.; Lee, Chia-Ying; Cheng, Po-Jen; Menard, Melissa C.; Marschilok, Amy C.; Takeuchi, Kenneth J.

    2013-01-01

    Silver vanadium phosphorous oxides (Ag w V x P y O z ) are notable battery cathode materials due to their high energy density and demonstrated ability to form in-situ Ag metal nanostructured electrically conductive networks within the cathode. While analogous silver vanadium diphosphate materials have been prepared, electrochemical evaluations of these diphosphate based materials have been limited. We report here the first electrochemical study of a silver vanadium diphosphate, Ag 2 VP 2 O 8 , where the structural differences associated with phosphorous oxides versus diphosphates profoundly affect the associated electrochemistry. Reminiscent of Ag 2 VO 2 PO 4 reduction, in-situ formation of silver metal nanoparticles was observed with reduction of Ag 2 VP 2 O 8 . However, counter to Ag 2 VO 2 PO 4 reduction, Ag 2 VP 2 O 8 demonstrates a significant decrease in conductivity upon continued electrochemical reduction. Structural analysis contrasting the crystallography of the parent Ag 2 VP 2 O 8 with that of the proposed Li 2 VP 2 O 8 reduction product is employed to gain insight into the observed electrochemical reduction behavior, where the structural rigidity associated with the diphosphate anion may be associated with the observed particle fracturing upon deep electrochemical reduction. Further, the diphosphate anion structure may be associated with the high thermal stability of the partially reduced Ag 2 VP 2 O 8 materials, which bodes well for enhanced safety of batteries incorporating this material. - Graphical abstract: Structure and galvanostatic intermittent titration-type test data for silver vanadium diphosphate, Ag 2 VP 2 O 8 . Highlights: ► First electrochemical study of a silver vanadium diphosphate, Ag 2 VP 2 O 8 . ► In-situ formation of Ag 0 nanoparticles was observed upon electrochemical reduction. ► Structural analysis used to provide insight of the electrochemical behavior

  2. Physical mapping and BAC-end sequence analysis provide initial insights into the flax (Linum usitatissimum L. genome

    Directory of Open Access Journals (Sweden)

    Cloutier Sylvie

    2011-05-01

    Full Text Available Abstract Background Flax (Linum usitatissimum L. is an important source of oil rich in omega-3 fatty acids, which have proven health benefits and utility as an industrial raw material. Flax seeds also contain lignans which are associated with reducing the risk of certain types of cancer. Its bast fibres have broad industrial applications. However, genomic tools needed for molecular breeding were non existent. Hence a project, Total Utilization Flax GENomics (TUFGEN was initiated. We report here the first genome-wide physical map of flax and the generation and analysis of BAC-end sequences (BES from 43,776 clones, providing initial insights into the genome. Results The physical map consists of 416 contigs spanning ~368 Mb, assembled from 32,025 fingerprints, representing roughly 54.5% to 99.4% of the estimated haploid genome (370-675 Mb. The N50 size of the contigs was estimated to be ~1,494 kb. The longest contig was ~5,562 kb comprising 437 clones. There were 96 contigs containing more than 100 clones. Approximately 54.6 Mb representing 8-14.8% of the genome was obtained from 80,337 BES. Annotation revealed that a large part of the genome consists of ribosomal DNA (~13.8%, followed by known transposable elements at 6.1%. Furthermore, ~7.4% of sequence was identified to harbour novel repeat elements. Homology searches against flax-ESTs and NCBI-ESTs suggested that ~5.6% of the transcriptome is unique to flax. A total of 4064 putative genomic SSRs were identified and are being developed as novel markers for their use in molecular breeding. Conclusion The first genome-wide physical map of flax constructed with BAC clones provides a framework for accessing target loci with economic importance for marker development and positional cloning. Analysis of the BES has provided insights into the uniqueness of the flax genome. Compared to other plant genomes, the proportion of rDNA was found to be very high whereas the proportion of known transposable

  3. Physical mapping and BAC-end sequence analysis provide initial insights into the flax (Linum usitatissimum L.) genome.

    Science.gov (United States)

    Ragupathy, Raja; Rathinavelu, Rajkumar; Cloutier, Sylvie

    2011-05-09

    Flax (Linum usitatissimum L.) is an important source of oil rich in omega-3 fatty acids, which have proven health benefits and utility as an industrial raw material. Flax seeds also contain lignans which are associated with reducing the risk of certain types of cancer. Its bast fibres have broad industrial applications. However, genomic tools needed for molecular breeding were non existent. Hence a project, Total Utilization Flax GENomics (TUFGEN) was initiated. We report here the first genome-wide physical map of flax and the generation and analysis of BAC-end sequences (BES) from 43,776 clones, providing initial insights into the genome. The physical map consists of 416 contigs spanning ~368 Mb, assembled from 32,025 fingerprints, representing roughly 54.5% to 99.4% of the estimated haploid genome (370-675 Mb). The N50 size of the contigs was estimated to be ~1,494 kb. The longest contig was ~5,562 kb comprising 437 clones. There were 96 contigs containing more than 100 clones. Approximately 54.6 Mb representing 8-14.8% of the genome was obtained from 80,337 BES. Annotation revealed that a large part of the genome consists of ribosomal DNA (~13.8%), followed by known transposable elements at 6.1%. Furthermore, ~7.4% of sequence was identified to harbour novel repeat elements. Homology searches against flax-ESTs and NCBI-ESTs suggested that ~5.6% of the transcriptome is unique to flax. A total of 4064 putative genomic SSRs were identified and are being developed as novel markers for their use in molecular breeding. The first genome-wide physical map of flax constructed with BAC clones provides a framework for accessing target loci with economic importance for marker development and positional cloning. Analysis of the BES has provided insights into the uniqueness of the flax genome. Compared to other plant genomes, the proportion of rDNA was found to be very high whereas the proportion of known transposable elements was low. The SSRs identified from BES will be

  4. The biological and structural characterization of Mycobacterium tuberculosis UvrA provides novel insights into its mechanism of action.

    Science.gov (United States)

    Rossi, Franca; Khanduja, Jasbeer Singh; Bortoluzzi, Alessio; Houghton, Joanna; Sander, Peter; Güthlein, Carolin; Davis, Elaine O; Springer, Burkhard; Böttger, Erik C; Relini, Annalisa; Penco, Amanda; Muniyappa, K; Rizzi, Menico

    2011-09-01

    Mycobacterium tuberculosis is an extremely well adapted intracellular human pathogen that is exposed to multiple DNA damaging chemical assaults originating from the host defence mechanisms. As a consequence, this bacterium is thought to possess highly efficient DNA repair machineries, the nucleotide excision repair (NER) system amongst these. Although NER is of central importance to DNA repair in M. tuberculosis, our understanding of the processes in this species is limited. The conserved UvrABC endonuclease represents the multi-enzymatic core in bacterial NER, where the UvrA ATPase provides the DNA lesion-sensing function. The herein reported genetic analysis demonstrates that M. tuberculosis UvrA is important for the repair of nitrosative and oxidative DNA damage. Moreover, our biochemical and structural characterization of recombinant M. tuberculosis UvrA contributes new insights into its mechanism of action. In particular, the structural investigation reveals an unprecedented conformation of the UvrB-binding domain that we propose to be of functional relevance. Taken together, our data suggest UvrA as a potential target for the development of novel anti-tubercular agents and provide a biochemical framework for the identification of small-molecule inhibitors interfering with the NER activity in M. tuberculosis.

  5. NEW INSIGHT INTO THE SOLAR SYSTEM’S TRANSITION DISK PHASE PROVIDED BY THE METAL-RICH CARBONACEOUS CHONDRITE ISHEYEVO

    International Nuclear Information System (INIS)

    Morris, Melissa A.; Garvie, Laurence A. J.; Knauth, L. Paul

    2015-01-01

    Many aspects of planet formation are controlled by the amount of gas remaining in the natal protoplanetary disks (PPDs). Infrared observations show that PPDs undergo a transition stage at several megayears, during which gas densities are reduced. Our Solar System would have experienced such a stage. However, there is currently no data that provides insight into this crucial time in our PPD’s evolution. We show that the Isheyevo meteorite contains the first definitive evidence for a transition disk stage in our Solar System. Isheyevo belongs to a class of metal-rich meteorites whose components have been dated at almost 5 Myr after formation of Ca, Al-rich inclusions, and exhibits unique sedimentary layers that imply formation through gentle sedimentation. We show that such layering can occur via the gentle sweep-up of material found in the impact plume resulting from the collision of two planetesimals. Such sweep-up requires gas densities consistent with observed transition disks (10 −12 –10 −11 g cm −3 ). As such, Isheyevo presents the first evidence of our own transition disk and provides new constraints on the evolution of our solar nebula

  6. NEW INSIGHT INTO THE SOLAR SYSTEM’S TRANSITION DISK PHASE PROVIDED BY THE METAL-RICH CARBONACEOUS CHONDRITE ISHEYEVO

    Energy Technology Data Exchange (ETDEWEB)

    Morris, Melissa A. [State University of New York, Cortland, NY 13045 (United States); Garvie, Laurence A. J. [Center for Meteorite Studies, Arizona State University, Tempe, AZ 85287 (United States); Knauth, L. Paul, E-mail: melissa.morris@cortland.edu [School of Earth and Space Exploration, Arizona State University, Tempe, AZ 85287 (United States)

    2015-03-10

    Many aspects of planet formation are controlled by the amount of gas remaining in the natal protoplanetary disks (PPDs). Infrared observations show that PPDs undergo a transition stage at several megayears, during which gas densities are reduced. Our Solar System would have experienced such a stage. However, there is currently no data that provides insight into this crucial time in our PPD’s evolution. We show that the Isheyevo meteorite contains the first definitive evidence for a transition disk stage in our Solar System. Isheyevo belongs to a class of metal-rich meteorites whose components have been dated at almost 5 Myr after formation of Ca, Al-rich inclusions, and exhibits unique sedimentary layers that imply formation through gentle sedimentation. We show that such layering can occur via the gentle sweep-up of material found in the impact plume resulting from the collision of two planetesimals. Such sweep-up requires gas densities consistent with observed transition disks (10{sup −12}–10{sup −11} g cm{sup −3}). As such, Isheyevo presents the first evidence of our own transition disk and provides new constraints on the evolution of our solar nebula.

  7. The Jujube Genome Provides Insights into Genome Evolution and the Domestication of Sweetness/Acidity Taste in Fruit Trees.

    Directory of Open Access Journals (Sweden)

    Jian Huang

    2016-12-01

    Full Text Available Jujube (Ziziphus jujuba Mill. belongs to the Rhamnaceae family and is a popular fruit tree species with immense economic and nutritional value. Here, we report a draft genome of the dry jujube cultivar 'Junzao' and the genome resequencing of 31 geographically diverse accessions of cultivated and wild jujubes (Ziziphus jujuba var. spinosa. Comparative analysis revealed that the genome of 'Dongzao', a fresh jujube, was ~86.5 Mb larger than that of the 'Junzao', partially due to the recent insertions of transposable elements in the 'Dongzao' genome. We constructed eight proto-chromosomes of the common ancestor of Rhamnaceae and Rosaceae, two sister families in the order Rosales, and elucidated the evolutionary processes that have shaped the genome structures of modern jujubes. Population structure analysis revealed the complex genetic background of jujubes resulting from extensive hybridizations between jujube and its wild relatives. Notably, several key genes that control fruit organic acid metabolism and sugar content were identified in the selective sweep regions. We also identified S-locus genes controlling gametophytic self-incompatibility and investigated haplotype patterns of the S locus in the jujube genomes, which would provide a guideline for parent selection for jujube crossbreeding. This study provides valuable genomic resources for jujube improvement, and offers insights into jujube genome evolution and its population structure and domestication.

  8. The Jujube Genome Provides Insights into Genome Evolution and the Domestication of Sweetness/Acidity Taste in Fruit Trees.

    Science.gov (United States)

    Huang, Jian; Zhang, Chunmei; Zhao, Xing; Fei, Zhangjun; Wan, KangKang; Zhang, Zhong; Pang, Xiaoming; Yin, Xiao; Bai, Yang; Sun, Xiaoqing; Gao, Lizhi; Li, Ruiqiang; Zhang, Jinbo; Li, Xingang

    2016-12-01

    Jujube (Ziziphus jujuba Mill.) belongs to the Rhamnaceae family and is a popular fruit tree species with immense economic and nutritional value. Here, we report a draft genome of the dry jujube cultivar 'Junzao' and the genome resequencing of 31 geographically diverse accessions of cultivated and wild jujubes (Ziziphus jujuba var. spinosa). Comparative analysis revealed that the genome of 'Dongzao', a fresh jujube, was ~86.5 Mb larger than that of the 'Junzao', partially due to the recent insertions of transposable elements in the 'Dongzao' genome. We constructed eight proto-chromosomes of the common ancestor of Rhamnaceae and Rosaceae, two sister families in the order Rosales, and elucidated the evolutionary processes that have shaped the genome structures of modern jujubes. Population structure analysis revealed the complex genetic background of jujubes resulting from extensive hybridizations between jujube and its wild relatives. Notably, several key genes that control fruit organic acid metabolism and sugar content were identified in the selective sweep regions. We also identified S-locus genes controlling gametophytic self-incompatibility and investigated haplotype patterns of the S locus in the jujube genomes, which would provide a guideline for parent selection for jujube crossbreeding. This study provides valuable genomic resources for jujube improvement, and offers insights into jujube genome evolution and its population structure and domestication.

  9. Taxonomic and functional diversity provides insight into microbial pathways and stress responses in the saline Qinghai Lake, China.

    Directory of Open Access Journals (Sweden)

    Qiuyuan Huang

    Full Text Available Microbe-mediated biogeochemical cycles contribute to the global climate system and have sensitive responses and feedbacks to environmental stress caused by climate change. Yet, little is known about the effects of microbial biodiversity (i.e., taxonmic and functional diversity on biogeochemical cycles in ecosytems that are highly sensitive to climate change. One such sensitive ecosystem is Qinghai Lake, a high-elevation (3196 m saline (1.4% lake located on the Tibetan Plateau, China. This study provides baseline information on the microbial taxonomic and functional diversity as well as the associated stress response genes. Illumina metagenomic and metatranscriptomic datasets were generated from lake water samples collected at two sites (B and E. Autotrophic Cyanobacteria dominated the DNA samples, while heterotrophic Proteobacteria dominated the RNA samples at both sites. Photoheterotrophic Loktanella was also present at both sites. Photosystem II was the most active pathway at site B; while, oxidative phosphorylation was most active at site E. Organisms that expressed photosystem II or oxidative phosphorylation also expressed genes involved in photoprotection and oxidative stress, respectively. Assimilatory pathways associated with the nitrogen cycle were dominant at both sites. Results also indicate a positive relationship between functional diversity and the number of stress response genes. This study provides insight into the stress resilience of microbial metabolic pathways supported by greater taxonomic diversity, which may affect the microbial community response to climate change.

  10. Mechanisms of cell death in canine parvovirus-infected cells provide intuitive insights to developing nanotools for medicine

    Directory of Open Access Journals (Sweden)

    Jonna Nykky

    2010-06-01

    Full Text Available Jonna Nykky, Jenni E Tuusa, Sanna Kirjavainen, Matti Vuento, Leona GilbertNanoscience Center and Department of Biological and Environmental Science, University of Jyväskylä, FinlandAbstract: Viruses have great potential as nanotools in medicine for gene transfer, targeted gene delivery, and oncolytic cancer virotherapy. Here we have studied cell death mechanisms of canine parvovirus (CPV to increase the knowledge on the CPV life cycle in order to facilitate the development of better parvovirus vectors. Morphological studies of CPV-infected Norden laboratory feline kidney (NLFK cells and canine fibroma cells (A72 displayed characteristic apoptotic events. Apoptosis was further confirmed by activation of caspases and cellular DNA damage. However, results from annexin V-propidium iodide (PI labeling and membrane polarization assays indicated disruption of the plasma membrane uncommon to apoptosis. These results provide evidence that secondary necrosis followed apoptosis. In addition, two human cancer cell lines were found to be infected by CPV. This necrotic event over apoptotic cell death and infection in human cells provide insightful information when developing CPV as a nanotool for cancer treatments.Keywords: canine parvovirus, apoptosis, necrosis, nanoparticle, virotherapy

  11. A Flexible Binding Site Architecture Provides New Insights into CcpA Global Regulation in Gram-Positive Bacteria.

    Science.gov (United States)

    Yang, Yunpeng; Zhang, Lu; Huang, He; Yang, Chen; Yang, Sheng; Gu, Yang; Jiang, Weihong

    2017-01-24

    Catabolite control protein A (CcpA) is the master regulator in Gram-positive bacteria that mediates carbon catabolite repression (CCR) and carbon catabolite activation (CCA), two fundamental regulatory mechanisms that enable competitive advantages in carbon catabolism. It is generally regarded that CcpA exerts its regulatory role by binding to a typical 14- to 16-nucleotide (nt) consensus site that is called a catabolite response element (cre) within the target regions. However, here we report a previously unknown noncanonical flexible architecture of the CcpA-binding site in solventogenic clostridia, providing new mechanistic insights into catabolite regulation. This novel CcpA-binding site, named cre var , has a unique architecture that consists of two inverted repeats and an intervening spacer, all of which are variable in nucleotide composition and length, except for a 6-bp core palindromic sequence (TGTAAA/TTTACA). It was found that the length of the intervening spacer of cre var can affect CcpA binding affinity, and moreover, the core palindromic sequence of cre var is the key structure for regulation. Such a variable architecture of cre var shows potential importance for CcpA's diverse and fine regulation. A total of 103 potential cre var sites were discovered in solventogenic Clostridium acetobutylicum, of which 42 sites were picked out for electrophoretic mobility shift assays (EMSAs), and 30 sites were confirmed to be bound by CcpA. These 30 cre var sites are associated with 27 genes involved in many important pathways. Also of significance, the cre var sites are found to be widespread and function in a great number of taxonomically different Gram-positive bacteria, including pathogens, suggesting their global role in Gram-positive bacteria. In Gram-positive bacteria, the global regulator CcpA controls a large number of important physiological and metabolic processes. Although a typical consensus CcpA-binding site, cre, has been identified, it remains

  12. De novo Sequencing and Analysis of Lemongrass Transcriptome Provides First Insights into the Essential Oil Biosynthesis of Aromatic Grasses

    Directory of Open Access Journals (Sweden)

    Seema Meena

    2016-07-01

    Full Text Available Aromatic grasses of the genus Cymbopogon (Poaceae family represent unique group of plants that produce diverse composition of monoterpene rich essential oils, which have great value in flavour, fragrance, cosmetic and aromatherapy industries. Despite the commercial importance of these natural aromatic oils, their biosynthesis at the molecular level remains unexplored. As the first step towards understanding the essential oil biosynthesis, we performed de novo transcriptome assembly and analysis of C. flexuosus (lemongrass by employing Illumina sequencing. Mining of transcriptome data and subsequent phylogenetic analysis led to identification of terpene synthases (TPS, pyrophosphatases (PPase, alcohol dehydrogenases (ADH, aldo-keto reductases (AKR, carotenoid cleavage dioxygenases (CCD, alcohol acetyltransferases (AAT and aldehyde dehydrogenases (ALDH, which are potentially involved in essential oil biosynthesis. Comparative essential oil profiling and mRNA expression analysis in three Cymbopogon species (C. flexuosus, aldehyde type; C. martinii, alcohol type; and C. winterianus, intermediate type with varying essential oil composition indicated the involvement of identified candidate genes in the formation of alcohols, aldehydes and acetates. Molecular modeling and docking further supported the role of identified enzymes in aroma formation in Cymbopogon. Also, simple sequence repeats (SSRs were found in the transcriptome with many linked to terpene pathway genes including the genes potentially involved in aroma biosynthesis. This work provides the first insights into the essential oil biosynthesis of aromatic grasses, and the identified candidate genes and markers can be a great resource for biotechnological and molecular breeding approaches to modulate the essential oil composition.

  13. Fluid mechanics in dentinal microtubules provides mechanistic insights into the difference between hot and cold dental pain.

    Science.gov (United States)

    Lin, Min; Luo, Zheng Yuan; Bai, Bo Feng; Xu, Feng; Lu, Tian Jian

    2011-03-23

    Dental thermal pain is a significant health problem in daily life and dentistry. There is a long-standing question regarding the phenomenon that cold stimulation evokes sharper and more shooting pain sensations than hot stimulation. This phenomenon, however, outlives the well-known hydrodynamic theory used to explain dental thermal pain mechanism. Here, we present a mathematical model based on the hypothesis that hot or cold stimulation-induced different directions of dentinal fluid flow and the corresponding odontoblast movements in dentinal microtubules contribute to different dental pain responses. We coupled a computational fluid dynamics model, describing the fluid mechanics in dentinal microtubules, with a modified Hodgkin-Huxley model, describing the discharge behavior of intradental neuron. The simulated results agreed well with existing experimental measurements. We thence demonstrated theoretically that intradental mechano-sensitive nociceptors are not "equally sensitive" to inward (into the pulp) and outward (away from the pulp) fluid flows, providing mechanistic insights into the difference between hot and cold dental pain. The model developed here could enable better diagnosis in endodontics which requires an understanding of pulpal histology, neurology and physiology, as well as their dynamic response to the thermal stimulation used in dental practices.

  14. A multidisciplinary approach providing new insight into fruit flesh browning physiology in apple (Malus x domestica Borkh.).

    Science.gov (United States)

    Di Guardo, Mario; Tadiello, Alice; Farneti, Brian; Lorenz, Giorgia; Masuero, Domenico; Vrhovsek, Urska; Costa, Guglielmo; Velasco, Riccardo; Costa, Fabrizio

    2013-01-01

    In terms of the quality of minimally processed fruit, flesh browning is fundamentally important in the development of an aesthetically unpleasant appearance, with consequent off-flavours. The development of browning depends on the enzymatic action of the polyphenol oxidase (PPO). In the 'Golden Delicious' apple genome ten PPO genes were initially identified and located on three main chromosomes (2, 5 and 10). Of these genes, one element in particular, here called Md-PPO, located on chromosome 10, was further investigated and genetically mapped in two apple progenies ('Fuji x Pink Lady' and 'Golden Delicious x Braeburn'). Both linkage maps, made up of 481 and 608 markers respectively, were then employed to find QTL regions associated with fruit flesh browning, allowing the detection of 25 QTLs related to several browning parameters. These were distributed over six linkage groups with LOD values spanning from 3.08 to 4.99 and showed a rate of phenotypic variance from 26.1 to 38.6%. Anchoring of these intervals to the apple genome led to the identification of several genes involved in polyphenol synthesis and cell wall metabolism. Finally, the expression profile of two specific candidate genes, up and downstream of the polyphenolic pathway, namely phenylalanine ammonia lyase (PAL) and polyphenol oxidase (PPO), provided insight into flesh browning physiology. Md-PPO was further analyzed and two haplotypes were characterised and associated with fruit flesh browning in apple.

  15. Molecular details of secretory phospholipase A2 from flax (Linum usitatissimum L.) provide insight into its structure and function.

    Science.gov (United States)

    Gupta, Payal; Dash, Prasanta K

    2017-09-11

    Secretory phospholipase A 2 (sPLA 2 ) are low molecular weight proteins (12-18 kDa) involved in a suite of plant cellular processes imparting growth and development. With myriad roles in physiological and biochemical processes in plants, detailed analysis of sPLA 2 in flax/linseed is meagre. The present work, first in flax, embodies cloning, expression, purification and molecular characterisation of two distinct sPLA 2 s (I and II) from flax. PLA 2 activity of the cloned sPLA 2 s were biochemically assayed authenticating them as bona fide phospholipase A 2 . Physiochemical properties of both the sPLA 2 s revealed they are thermostable proteins requiring di-valent cations for optimum activity.While, structural analysis of both the proteins revealed deviations in the amino acid sequence at C- & N-terminal regions; hydropathic study revealed LusPLA 2 I as a hydrophobic protein and LusPLA 2 II as a hydrophilic protein. Structural analysis of flax sPLA 2 s revealed that secondary structure of both the proteins are dominated by α-helix followed by random coils. Modular superimposition of LusPLA 2 isoforms with rice sPLA 2 confirmed monomeric structural preservation among plant phospholipase A 2 and provided insight into structure of folded flax sPLA 2 s.

  16. A Multidisciplinary Approach Providing New Insight into Fruit Flesh Browning Physiology in Apple (Malus x domestica Borkh.)

    Science.gov (United States)

    Farneti, Brian; Lorenz, Giorgia; Masuero, Domenico; Vrhovsek, Urska; Costa, Guglielmo; Velasco, Riccardo; Costa, Fabrizio

    2013-01-01

    In terms of the quality of minimally processed fruit, flesh browning is fundamentally important in the development of an aesthetically unpleasant appearance, with consequent off-flavours. The development of browning depends on the enzymatic action of the polyphenol oxidase (PPO). In the ‘Golden Delicious’ apple genome ten PPO genes were initially identified and located on three main chromosomes (2, 5 and 10). Of these genes, one element in particular, here called Md-PPO, located on chromosome 10, was further investigated and genetically mapped in two apple progenies (‘Fuji x Pink Lady’ and ‘Golden Delicious x Braeburn’). Both linkage maps, made up of 481 and 608 markers respectively, were then employed to find QTL regions associated with fruit flesh browning, allowing the detection of 25 QTLs related to several browning parameters. These were distributed over six linkage groups with LOD values spanning from 3.08 to 4.99 and showed a rate of phenotypic variance from 26.1 to 38.6%. Anchoring of these intervals to the apple genome led to the identification of several genes involved in polyphenol synthesis and cell wall metabolism. Finally, the expression profile of two specific candidate genes, up and downstream of the polyphenolic pathway, namely phenylalanine ammonia lyase (PAL) and polyphenol oxidase (PPO), provided insight into flesh browning physiology. Md-PPO was further analyzed and two haplotypes were characterised and associated with fruit flesh browning in apple. PMID:24205065

  17. A Genomic Survey of SCPP Family Genes in Fishes Provides Novel Insights into the Evolution of Fish Scales.

    Science.gov (United States)

    Lv, Yunyun; Kawasaki, Kazuhiko; Li, Jia; Li, Yanping; Bian, Chao; Huang, Yu; You, Xinxin; Shi, Qiong

    2017-11-16

    The family of secretory calcium-binding phosphoproteins (SCPPs) have been considered vital to skeletal tissue mineralization. However, most previous SCPP studies focused on phylogenetically distant animals but not on those closely related species. Here we provide novel insights into the coevolution of SCPP genes and fish scales in 10 species from Otophysi . According to their scale phenotypes, these fishes can be divided into three groups, i.e., scaled, sparsely scaled, and scaleless. We identified homologous SCPP genes in the genomes of these species and revealed an absence of some SCPP members in some genomes, suggesting an uneven evolutionary history of SCPP genes in fishes. In addition, most of these SCPP genes, with the exception of SPP1 , individually form one or two gene cluster(s) on each corresponding genome. Furthermore, we constructed phylogenetic trees using maximum likelihood method to estimate their evolution. The phylogenetic topology mostly supports two subclasses in some species, such as Cyprinus carpio , Sinocyclocheilus anshuiensis , S. grahamin , and S. rhinocerous , but not in the other examined fishes. By comparing the gene structures of recently reported candidate genes, SCPP1 and SCPP5 , for determining scale phenotypes, we found that the hypothesis is suitable for Astyanax mexicanus , but denied by S. anshuiensis , even though they are both sparsely scaled for cave adaptation. Thus, we conclude that, although different fish species display similar scale phenotypes, the underlying genetic changes however might be diverse. In summary, this paper accelerates the recognition of the SCPP family in teleosts for potential scale evolution.

  18. De Novo Sequencing and Analysis of Lemongrass Transcriptome Provide First Insights into the Essential Oil Biosynthesis of Aromatic Grasses.

    Science.gov (United States)

    Meena, Seema; Kumar, Sarma R; Venkata Rao, D K; Dwivedi, Varun; Shilpashree, H B; Rastogi, Shubhra; Shasany, Ajit K; Nagegowda, Dinesh A

    2016-01-01

    Aromatic grasses of the genus Cymbopogon (Poaceae family) represent unique group of plants that produce diverse composition of monoterpene rich essential oils, which have great value in flavor, fragrance, cosmetic, and aromatherapy industries. Despite the commercial importance of these natural aromatic oils, their biosynthesis at the molecular level remains unexplored. As the first step toward understanding the essential oil biosynthesis, we performed de novo transcriptome assembly and analysis of C. flexuosus (lemongrass) by employing Illumina sequencing. Mining of transcriptome data and subsequent phylogenetic analysis led to identification of terpene synthases, pyrophosphatases, alcohol dehydrogenases, aldo-keto reductases, carotenoid cleavage dioxygenases, alcohol acetyltransferases, and aldehyde dehydrogenases, which are potentially involved in essential oil biosynthesis. Comparative essential oil profiling and mRNA expression analysis in three Cymbopogon species (C. flexuosus, aldehyde type; C. martinii, alcohol type; and C. winterianus, intermediate type) with varying essential oil composition indicated the involvement of identified candidate genes in the formation of alcohols, aldehydes, and acetates. Molecular modeling and docking further supported the role of identified protein sequences in aroma formation in Cymbopogon. Also, simple sequence repeats were found in the transcriptome with many linked to terpene pathway genes including the genes potentially involved in aroma biosynthesis. This work provides the first insights into the essential oil biosynthesis of aromatic grasses, and the identified candidate genes and markers can be a great resource for biotechnological and molecular breeding approaches to modulate the essential oil composition.

  19. Post-donation telephonic interview of blood donors providing an insight into delayed adverse reactions: First attempt in India.

    Science.gov (United States)

    Tiwari, Aseem K; Aggarwal, Geet; Dara, Ravi C; Arora, Dinesh; Srivastava, Khushboo; Raina, Vimarsh

    2017-04-01

    Blood donor experiences both immediate adverse reactions (IAR) and delayed adverse reactions (DAR). With limited published data available on the incidence of DAR, a study was conducted to estimate incidence and profile of DAR through telephonic interview. Study was conducted over a 45-day period for consecutive volunteer whole blood donations at tertiary care hospital. Donors were divided into first-time, repeat and regular and were monitored for IAR. They were given written copy of post-donation advice. Donors were contacted telephonically three weeks post-donation and enquired about general wellbeing and specific DAR in accordance with a standard n international (International Society of Blood Transfusion) standard format. Donors participated in the study of which 1.6% donors experienced an IAR. Much larger number reported DAR (10.3% vs.1.6% pdonors (age donors (>50 years). First time (12.3%) and repeat donors (13.5%) had similar frequency of DAR but were lower among regular donors (6.7%). DARs are more common than IAR and are of different profile. Post-donation interview has provided an insight into donor experiences and can be used as a valuable tool in donor hemovigilance. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Independent Analysis of the Flagellum Surface and Matrix Proteomes Provides Insight into Flagellum Signaling in Mammalian-infectious Trypanosoma brucei*

    Science.gov (United States)

    Oberholzer, Michael; Langousis, Gerasimos; Nguyen, HoangKim T.; Saada, Edwin A.; Shimogawa, Michelle M.; Jonsson, Zophonias O.; Nguyen, Steven M.; Wohlschlegel, James A.; Hill, Kent L.

    2011-01-01

    The flagellum of African trypanosomes is an essential and multifunctional organelle that functions in motility, cell morphogenesis, and host-parasite interaction. Previous studies of the trypanosome flagellum have been limited by the inability to purify flagella without first removing the flagellar membrane. This limitation is particularly relevant in the context of studying flagellum signaling, as signaling requires surface-exposed proteins in the flagellar membrane and soluble signaling proteins in the flagellar matrix. Here we employ a combination of genetic and mechanical approaches to purify intact flagella from the African trypanosome, Trypanosoma brucei, in its mammalian-infectious stage. We combined flagellum purification with affinity-purification of surface-exposed proteins to conduct independent proteomic analyses of the flagellum surface and matrix fractions. The proteins identified encompass a broad range of molecular functionalities, including many predicted to function in signaling. Immunofluorescence and RNA interference studies demonstrate flagellum localization and function for proteins identified and provide insight into mechanisms of flagellum attachment and motility. The flagellum surface proteome includes many T. brucei-specific proteins and is enriched for proteins up-regulated in the mammalian-infectious stage of the parasite life-cycle. The combined results indicate that the flagellum surface presents a diverse and dynamic host-parasite interface that is well-suited for host-parasite signaling. PMID:21685506

  1. De Novo Sequencing and Analysis of Lemongrass Transcriptome Provide First Insights into the Essential Oil Biosynthesis of Aromatic Grasses

    Science.gov (United States)

    Meena, Seema; Kumar, Sarma R.; Venkata Rao, D. K.; Dwivedi, Varun; Shilpashree, H. B.; Rastogi, Shubhra; Shasany, Ajit K.; Nagegowda, Dinesh A.

    2016-01-01

    Aromatic grasses of the genus Cymbopogon (Poaceae family) represent unique group of plants that produce diverse composition of monoterpene rich essential oils, which have great value in flavor, fragrance, cosmetic, and aromatherapy industries. Despite the commercial importance of these natural aromatic oils, their biosynthesis at the molecular level remains unexplored. As the first step toward understanding the essential oil biosynthesis, we performed de novo transcriptome assembly and analysis of C. flexuosus (lemongrass) by employing Illumina sequencing. Mining of transcriptome data and subsequent phylogenetic analysis led to identification of terpene synthases, pyrophosphatases, alcohol dehydrogenases, aldo-keto reductases, carotenoid cleavage dioxygenases, alcohol acetyltransferases, and aldehyde dehydrogenases, which are potentially involved in essential oil biosynthesis. Comparative essential oil profiling and mRNA expression analysis in three Cymbopogon species (C. flexuosus, aldehyde type; C. martinii, alcohol type; and C. winterianus, intermediate type) with varying essential oil composition indicated the involvement of identified candidate genes in the formation of alcohols, aldehydes, and acetates. Molecular modeling and docking further supported the role of identified protein sequences in aroma formation in Cymbopogon. Also, simple sequence repeats were found in the transcriptome with many linked to terpene pathway genes including the genes potentially involved in aroma biosynthesis. This work provides the first insights into the essential oil biosynthesis of aromatic grasses, and the identified candidate genes and markers can be a great resource for biotechnological and molecular breeding approaches to modulate the essential oil composition. PMID:27516768

  2. Transcriptomic analyses on muscle tissues of Litopenaeus vannamei provide the first profile insight into the response to low temperature stress.

    Directory of Open Access Journals (Sweden)

    Wen Huang

    Full Text Available The Pacific white shrimp (Litopenaeus vannamei is an important cultured crustacean species worldwide. However, little is known about the molecular mechanism of this species involved in the response to cold stress. In this study, four separate RNA-Seq libraries of L. vannamei were generated from 13°C stress and control temperature. Total 29,662 of Unigenes and overall of 19,619 annotated genes were obtained. Three comparisons were carried out among the four libraries, in which 72 of the top 20% of differentially-expressed genes were obtained, 15 GO and 5 KEGG temperature-sensitive pathways were fished out. Catalytic activity (GO: 0003824 and Metabolic pathways (ko01100 were the most annotated GO and KEGG pathways in response to cold stress, respectively. In addition, Calcium, MAPK cascade, Transcription factor and Serine/threonine-protein kinase signal pathway were picked out and clustered. Serine/threonine-protein kinase signal pathway might play more important roles in cold adaptation, while other three signal pathway were not widely transcribed. Our results had summarized the differentially-expressed genes and suggested the major important signaling pathways and related genes. These findings provide the first profile insight into the molecular basis of L. vannamei response to cold stress.

  3. Analysis of the Phlebiopsis gigantea Genome, Transcriptome and Secretome Provides Insight into Its Pioneer Colonization Strategies of Wood

    Science.gov (United States)

    Hori, Chiaki; Ishida, Takuya; Igarashi, Kiyohiko; Samejima, Masahiro; Suzuki, Hitoshi; Master, Emma; Ferreira, Patricia; Ruiz-Dueñas, Francisco J.; Held, Benjamin; Canessa, Paulo; Larrondo, Luis F.; Schmoll, Monika; Druzhinina, Irina S.; Kubicek, Christian P.; Gaskell, Jill A.; Kersten, Phil; St. John, Franz; Glasner, Jeremy; Sabat, Grzegorz; Splinter BonDurant, Sandra; Syed, Khajamohiddin; Yadav, Jagjit; Mgbeahuruike, Anthony C.; Kovalchuk, Andriy; Asiegbu, Fred O.; Lackner, Gerald; Hoffmeister, Dirk; Rencoret, Jorge; Gutiérrez, Ana; Sun, Hui; Lindquist, Erika; Barry, Kerrie; Riley, Robert; Grigoriev, Igor V.; Henrissat, Bernard; Kües, Ursula; Berka, Randy M.; Martínez, Angel T.; Covert, Sarah F.; Blanchette, Robert A.; Cullen, Daniel

    2014-01-01

    Collectively classified as white-rot fungi, certain basidiomycetes efficiently degrade the major structural polymers of wood cell walls. A small subset of these Agaricomycetes, exemplified by Phlebiopsis gigantea, is capable of colonizing freshly exposed conifer sapwood despite its high content of extractives, which retards the establishment of other fungal species. The mechanism(s) by which P. gigantea tolerates and metabolizes resinous compounds have not been explored. Here, we report the annotated P. gigantea genome and compare profiles of its transcriptome and secretome when cultured on fresh-cut versus solvent-extracted loblolly pine wood. The P. gigantea genome contains a conventional repertoire of hydrolase genes involved in cellulose/hemicellulose degradation, whose patterns of expression were relatively unperturbed by the absence of extractives. The expression of genes typically ascribed to lignin degradation was also largely unaffected. In contrast, genes likely involved in the transformation and detoxification of wood extractives were highly induced in its presence. Their products included an ABC transporter, lipases, cytochrome P450s, glutathione S-transferase and aldehyde dehydrogenase. Other regulated genes of unknown function and several constitutively expressed genes are also likely involved in P. gigantea's extractives metabolism. These results contribute to our fundamental understanding of pioneer colonization of conifer wood and provide insight into the diverse chemistries employed by fungi in carbon cycling processes. PMID:25474575

  4. Simulations of CYP51A from Aspergillus fumigatus in a model bilayer provide insights into triazole drug resistance.

    Science.gov (United States)

    Nash, Anthony; Rhodes, Johanna

    2018-04-01

    Azole antifungal drugs target CYP51A in Aspergillus fumigatus by binding with the active site of the protein, blocking ergosterol biosynthesis. Resistance to azole antifungal drugs is now common, with a leucine to histidine amino acid substitution at position 98 the most frequent, predominantly conferring resistance to itraconazole, although cross-resistance has been reported in conjunction with other mutations. In this study, we create a homology model of CYP51A using a recently published crystal structure of the paralog protein CYP51B. The derived structures, wild type, and L98H mutant are positioned within a lipid membrane bilayer and subjected to molecular dynamics simulations in order improve the accuracy of both models. The structural analysis from our simulations suggests a decrease in active site surface from the formation of hydrogen bonds between the histidine substitution and neighboring polar side chains, potentially preventing the binding of azole drugs. This study yields a biologically relevant structure and set of dynamics of the A. fumigatus Lanosterol 14 alpha-demethylase enzyme and provides further insight into azole antifungal drug resistance.

  5. Studies of the aggregation of mutant proteins in vitro provide insights into the genetics of amyloid diseases.

    Science.gov (United States)

    Chiti, Fabrizio; Calamai, Martino; Taddei, Niccolo; Stefani, Massimo; Ramponi, Giampietro; Dobson, Christopher M

    2002-12-10

    Protein aggregation and the formation of highly insoluble amyloid structures is associated with a range of debilitating human conditions, which include Alzheimer's disease, Parkinson's disease, and the Creutzfeldt-Jakob disease. Muscle acylphosphatase (AcP) has already provided significant insights into mutational changes that modulate amyloid formation. In the present paper, we have used this system to investigate the effects of mutations that modify the charge state of a protein without affecting significantly the hydrophobicity or secondary structural propensities of the polypeptide chain. A highly significant inverse correlation was found to exist between the rates of aggregation of the protein variants under denaturing conditions and their overall net charge. This result indicates that aggregation is generally favored by mutations that bring the net charge of the protein closer to neutrality. In light of this finding, we have analyzed natural mutations associated with familial forms of amyloid diseases that involve alteration of the net charge of the proteins or protein fragments associated with the diseases. Sixteen mutations have been identified for which the mechanism of action that causes the pathological condition is not yet known or fully understood. Remarkably, 14 of these 16 mutations cause the net charge of the corresponding peptide or protein that converts into amyloid deposits to be reduced. This result suggests that charge has been a key parameter in molecular evolution to ensure the avoidance of protein aggregation and identifies reduction of the net charge as an important determinant in at least some forms of protein deposition diseases.

  6. Providing guidance for genomics-based cancer treatment decisions: insights from stakeholder engagement for post-prostatectomy radiation therapy.

    Science.gov (United States)

    Abe, James; Lobo, Jennifer M; Trifiletti, Daniel M; Showalter, Timothy N

    2017-08-24

    Despite the emergence of genomics-based risk prediction tools in oncology, there is not yet an established framework for communication of test results to cancer patients to support shared decision-making. We report findings from a stakeholder engagement program that aimed to develop a framework for using Markov models with individualized model inputs, including genomics-based estimates of cancer recurrence probability, to generate personalized decision aids for prostate cancer patients faced with radiation therapy treatment decisions after prostatectomy. We engaged a total of 22 stakeholders, including: prostate cancer patients, urological surgeons, radiation oncologists, genomic testing industry representatives, and biomedical informatics faculty. Slides were at each meeting to provide background information regarding the analytical framework. Participants were invited to provide feedback during the meeting, including revising the overall project aims. Stakeholder meeting content was reviewed and summarized by stakeholder group and by theme. The majority of stakeholder suggestions focused on aspects of decision aid design and formatting. Stakeholders were enthusiastic about the potential value of using decision analysis modeling with personalized model inputs for cancer recurrence risk, as well as competing risks from age and comorbidities, to generate a patient-centered tool to assist decision-making. Stakeholders did not view privacy considerations as a major barrier to the proposed decision aid program. A common theme was that decision aids should be portable across multiple platforms (electronic and paper), should allow for interaction by the user to adjust model inputs iteratively, and available to patients both before and during consult appointments. Emphasis was placed on the challenge of explaining the model's composite result of quality-adjusted life years. A range of stakeholders provided valuable insights regarding the design of a personalized decision

  7. Discovery of cyclotides in the fabaceae plant family provides new insights into the cyclization, evolution, and distribution of circular proteins.

    Science.gov (United States)

    Poth, Aaron G; Colgrave, Michelle L; Philip, Reynold; Kerenga, Bomai; Daly, Norelle L; Anderson, Marilyn A; Craik, David J

    2011-04-15

    Cyclotides are plant proteins whose defining structural features are a head-to-tail cyclized backbone and three interlocking disulfide bonds, which in combination are known as a cyclic cystine knot. This unique structural motif confers cyclotides with exceptional resistance to proteolysis. Their endogenous function is thought to be as plant defense agents, associated with their insecticidal and larval growth-inhibitory properties. However, in addition, an array of pharmaceutically relevant biological activities has been ascribed to cyclotides, including anti-HIV, anthelmintic, uterotonic, and antimicrobial effects. So far, >150 cyclotides have been elucidated from members of the Rubiaceae, Violaceae, and Cucurbitaceae plant families, but their wider distribution among other plant families remains unclear. Clitoria ternatea (Butterfly pea) is a member of plant family Fabaceae and through its usage in traditional medicine to aid childbirth bears similarity to Oldenlandia affinis, from which many cyclotides have been isolated. Using a combination of nanospray and matrix-assisted laser desorption ionization-time-of-flight (MALDI-TOF) analyses, we examined seed extracts of C. ternatea and discovered cyclotides in the Fabaceae, the third-largest family of flowering plants. We characterized 12 novel cyclotides, thus expanding knowledge of cyclotide distribution and evolution within the plant kingdom. The discovery of cyclotides containing novel sequence motifs near the in planta cyclization site has provided new insights into cyclotide biosynthesis. In particular, MS analyses of the novel cyclotides from C. ternatea suggest that Asn to Asp variants at the cyclization site are more common than previously recognized. Moreover, this study provides impetus for the examination of other economically and agriculturally significant species within Fabaceae, now the largest plant family from which cyclotides have been described.

  8. Centromeric DNA characterization in the model grass Brachypodium distachyon provides insights on the evolution of the genus.

    Science.gov (United States)

    Li, Yinjia; Zuo, Sheng; Zhang, Zhiliang; Li, Zhanjie; Han, Jinlei; Chu, Zhaoqing; Hasterok, Robert; Wang, Kai

    2018-03-01

    Brachypodium distachyon is a well-established model monocot plant, and its small and compact genome has been used as an accurate reference for the much larger and often polyploid genomes of cereals such as Avena sativa (oats), Hordeum vulgare (barley) and Triticum aestivum (wheat). Centromeres are indispensable functional units of chromosomes and they play a core role in genome polyploidization events during evolution. As the Brachypodium genus contains about 20 species that differ significantly in terms of their basic chromosome numbers, genome size, ploidy levels and life strategies, studying their centromeres may provide important insight into the structure and evolution of the genome in this interesting and important genus. In this study, we isolated the centromeric DNA of the B. distachyon reference line Bd21 and characterized its composition via the chromatin immunoprecipitation of the nucleosomes that contain the centromere-specific histone CENH3. We revealed that the centromeres of Bd21 have the features of typical multicellular eukaryotic centromeres. Strikingly, these centromeres contain relatively few centromeric satellite DNAs; in particular, the centromere of chromosome 5 (Bd5) consists of only ~40 kb. Moreover, the centromeric retrotransposons in B. distachyon (CRBds) are evolutionarily young. These transposable elements are located both within and adjacent to the CENH3 binding domains, and have similar compositions. Moreover, based on the presence of CRBds in the centromeres, the species in this study can be grouped into two distinct lineages. This may provide new evidence regarding the phylogenetic relationships within the Brachypodium genus. © 2018 The Authors The Plant Journal © 2018 John Wiley & Sons Ltd.

  9. Whole Genome Sequencing of Mycobacterium africanum Strains from Mali Provides Insights into the Mechanisms of Geographic Restriction.

    Science.gov (United States)

    Winglee, Kathryn; Manson McGuire, Abigail; Maiga, Mamoudou; Abeel, Thomas; Shea, Terrance; Desjardins, Christopher A; Diarra, Bassirou; Baya, Bocar; Sanogo, Moumine; Diallo, Souleymane; Earl, Ashlee M; Bishai, William R

    2016-01-01

    Mycobacterium africanum, made up of lineages 5 and 6 within the Mycobacterium tuberculosis complex (MTC), causes up to half of all tuberculosis cases in West Africa, but is rarely found outside of this region. The reasons for this geographical restriction remain unknown. Possible reasons include a geographically restricted animal reservoir, a unique preference for hosts of West African ethnicity, and an inability to compete with other lineages outside of West Africa. These latter two hypotheses could be caused by loss of fitness or altered interactions with the host immune system. We sequenced 92 MTC clinical isolates from Mali, including two lineage 5 and 24 lineage 6 strains. Our genome sequencing assembly, alignment, phylogeny and average nucleotide identity analyses enabled us to identify features that typify lineages 5 and 6 and made clear that these lineages do not constitute a distinct species within the MTC. We found that in Mali, lineage 6 and lineage 4 strains have similar levels of diversity and evolve drug resistance through similar mechanisms. In the process, we identified a putative novel streptomycin resistance mutation. In addition, we found evidence of person-to-person transmission of lineage 6 isolates and showed that lineage 6 is not enriched for mutations in virulence-associated genes. This is the largest collection of lineage 5 and 6 whole genome sequences to date, and our assembly and alignment data provide valuable insights into what distinguishes these lineages from other MTC lineages. Lineages 5 and 6 do not appear to be geographically restricted due to an inability to transmit between West African hosts or to an elevated number of mutations in virulence-associated genes. However, lineage-specific mutations, such as mutations in cell wall structure, secretion systems and cofactor biosynthesis, provide alternative mechanisms that may lead to host specificity.

  10. Supplementary Material for: Mycobacterium tuberculosis whole genome sequencing and protein structure modelling provides insights into anti-tuberculosis drug resistance

    KAUST Repository

    Phelan, Jody

    2016-01-01

    Abstract Background Combating the spread of drug resistant tuberculosis is a global health priority. Whole genome association studies are being applied to identify genetic determinants of resistance to anti-tuberculosis drugs. Protein structure and interaction modelling are used to understand the functional effects of putative mutations and provide insight into the molecular mechanisms leading to resistance. Methods To investigate the potential utility of these approaches, we analysed the genomes of 144 Mycobacterium tuberculosis clinical isolates from The Special Programme for Research and Training in Tropical Diseases (TDR) collection sourced from 20 countries in four continents. A genome-wide approach was applied to 127 isolates to identify polymorphisms associated with minimum inhibitory concentrations for first-line anti-tuberculosis drugs. In addition, the effect of identified candidate mutations on protein stability and interactions was assessed quantitatively with well-established computational methods. Results The analysis revealed that mutations in the genes rpoB (rifampicin), katG (isoniazid), inhA-promoter (isoniazid), rpsL (streptomycin) and embB (ethambutol) were responsible for the majority of resistance observed. A subset of the mutations identified in rpoB and katG were predicted to affect protein stability. Further, a strong direct correlation was observed between the minimum inhibitory concentration values and the distance of the mutated residues in the three-dimensional structures of rpoB and katG to their respective drugs binding sites. Conclusions Using the TDR resource, we demonstrate the usefulness of whole genome association and convergent evolution approaches to detect known and potentially novel mutations associated with drug resistance. Further, protein structural modelling could provide a means of predicting the impact of polymorphisms on drug efficacy in the absence of phenotypic data. These approaches could ultimately lead to novel

  11. Mycobacterium tuberculosis whole genome sequencing and protein structure modelling provides insights into anti-tuberculosis drug resistance

    KAUST Repository

    Phelan, Jody

    2016-03-23

    Background Combating the spread of drug resistant tuberculosis is a global health priority. Whole genome association studies are being applied to identify genetic determinants of resistance to anti-tuberculosis drugs. Protein structure and interaction modelling are used to understand the functional effects of putative mutations and provide insight into the molecular mechanisms leading to resistance. Methods To investigate the potential utility of these approaches, we analysed the genomes of 144 Mycobacterium tuberculosis clinical isolates from The Special Programme for Research and Training in Tropical Diseases (TDR) collection sourced from 20 countries in four continents. A genome-wide approach was applied to 127 isolates to identify polymorphisms associated with minimum inhibitory concentrations for first-line anti-tuberculosis drugs. In addition, the effect of identified candidate mutations on protein stability and interactions was assessed quantitatively with well-established computational methods. Results The analysis revealed that mutations in the genes rpoB (rifampicin), katG (isoniazid), inhA-promoter (isoniazid), rpsL (streptomycin) and embB (ethambutol) were responsible for the majority of resistance observed. A subset of the mutations identified in rpoB and katG were predicted to affect protein stability. Further, a strong direct correlation was observed between the minimum inhibitory concentration values and the distance of the mutated residues in the three-dimensional structures of rpoB and katG to their respective drugs binding sites. Conclusions Using the TDR resource, we demonstrate the usefulness of whole genome association and convergent evolution approaches to detect known and potentially novel mutations associated with drug resistance. Further, protein structural modelling could provide a means of predicting the impact of polymorphisms on drug efficacy in the absence of phenotypic data. These approaches could ultimately lead to novel resistance

  12. The state of multiple sclerosis: current insight into the patient/health care provider relationship, treatment challenges, and satisfaction

    Directory of Open Access Journals (Sweden)

    Tintoré M

    2016-12-01

    Full Text Available Mar Tintoré,1 Maggie Alexander,2 Kathleen Costello,3 Martin Duddy,4 David E Jones,5 Nancy Law,6 Gilmore O’Neill,7 Antonio Uccelli,8 Robert Weissert,9 Sibyl Wray10 1Multiple Sclerosis Centre of Catalonia, Hospital Vall d’Hebron, Barcelona, Spain; 2European Multiple Sclerosis Platform, Brussels, Belgium; 3National Multiple Sclerosis Society, Denver, CO, USA; 4Royal Victoria Infirmary, Newcastle-upon-Tyne, UK; 5Department of Neurology, University of Virginia, Charlottesville, VA, USA; 6Nancy Law Consulting LLC, Parker, CO, USA; 7Biogen, Cambridge, MA, USA; 8Centre of Excellence for Biomedical Research, University of Genoa, Genoa, Italy; 9Department of Neurology, University of Regensburg, Regensburg, Germany; 10Hope Neurology Multiple Sclerosis Center, Knoxville, TN, USA Background: Managing multiple sclerosis (MS treatment presents challenges for both patients and health care professionals. Effective communication between patients with MS and their neurologist is important for improving clinical outcomes and quality of life. Methods: A closed-ended online market research survey was used to assess the current state of MS care from the perspective of both patients with MS (≥18 years of age and neurologists who treat MS from Europe and the US and to gain insight into perceptions of treatment expectations/goals, treatment decisions, treatment challenges, communication, and satisfaction with care, based on current clinical practice. Results: A total of 900 neurologists and 982 patients completed the survey, of whom 46% self-identified as having remitting-relapsing MS, 29% secondary progressive MS, and 11% primary progressive MS. Overall, patients felt satisfied with their disease-modifying therapy (DMT; satisfaction related to comfort in speaking with their neurologist and participation in their DMT decision-making process. Patients who self-identified as having relapsing-remitting MS were more likely to be very satisfied with their treatment

  13. A holistic evolutionary and structural study of flaviviridae provides insights into the function and inhibition of HCV helicase

    Directory of Open Access Journals (Sweden)

    Dimitrios Vlachakis

    2013-05-01

    Full Text Available Viral RNA helicases are involved in duplex unwinding during the RNA replication of the virus. It is suggested that these helicases represent very promising antiviral targets. Viruses of the flaviviridae family are the causative agents of many common and devastating diseases, including hepatitis, yellow fever and dengue fever. As there is currently no available anti-Flaviviridae therapy, there is urgent need for the development of efficient anti-viral pharmaceutical strategies. Herein, we report the complete phylogenetic analysis across flaviviridae alongside a more in-depth evolutionary study that revealed a series of conserved and invariant amino acids that are predicted to be key to the function of the helicase. Structural molecular modelling analysis revealed the strategic significance of these residues based on their relative positioning on the 3D structures of the helicase enzymes, which may be used as pharmacological targets. We previously reported a novel series of highly potent HCV helicase inhibitors, and we now re-assess their antiviral potential using the 3D structural model of the invariant helicase residues. It was found that the most active compound of the series, compound C4, exhibited an IC50 in the submicromolar range, whereas its stereoisomer (compound C12 was completely inactive. Useful insights were obtained from molecular modelling and conformational search studies via molecular dynamics simulations. C12 tends to bend and lock in an almost “U” shape conformation, failing to establish vital interactions with the active site of HCV. On the contrary, C4 spends most of its conformational time in a straight, more rigid formation that allows it to successfully block the passage of the oligonucleotide in the ssRNA channel of the HCV helicase. This study paves the way and provides the necessary framework for the in-depth analysis required to enable the future design of new and potent anti-viral agents.

  14. A Flexible Binding Site Architecture Provides New Insights into CcpA Global Regulation in Gram-Positive Bacteria

    Directory of Open Access Journals (Sweden)

    Yunpeng Yang

    2017-01-01

    Full Text Available Catabolite control protein A (CcpA is the master regulator in Gram-positive bacteria that mediates carbon catabolite repression (CCR and carbon catabolite activation (CCA, two fundamental regulatory mechanisms that enable competitive advantages in carbon catabolism. It is generally regarded that CcpA exerts its regulatory role by binding to a typical 14- to 16-nucleotide (nt consensus site that is called a catabolite response element (cre within the target regions. However, here we report a previously unknown noncanonical flexible architecture of the CcpA-binding site in solventogenic clostridia, providing new mechanistic insights into catabolite regulation. This novel CcpA-binding site, named crevar, has a unique architecture that consists of two inverted repeats and an intervening spacer, all of which are variable in nucleotide composition and length, except for a 6-bp core palindromic sequence (TGTAAA/TTTACA. It was found that the length of the intervening spacer of crevar can affect CcpA binding affinity, and moreover, the core palindromic sequence of crevar is the key structure for regulation. Such a variable architecture of crevar shows potential importance for CcpA’s diverse and fine regulation. A total of 103 potential crevar sites were discovered in solventogenic Clostridium acetobutylicum, of which 42 sites were picked out for electrophoretic mobility shift assays (EMSAs, and 30 sites were confirmed to be bound by CcpA. These 30 crevar sites are associated with 27 genes involved in many important pathways. Also of significance, the crevar sites are found to be widespread and function in a great number of taxonomically different Gram-positive bacteria, including pathogens, suggesting their global role in Gram-positive bacteria.

  15. Comparative proteomic study on Brassica hexaploid and its parents provides new insights into the effects of polyploidization.

    Science.gov (United States)

    Shen, Yanyue; Zhang, Yu; Zou, Jun; Meng, Jinling; Wang, Jianbo

    2015-01-01

    Polyploidy has played an important role in promoting plant evolution through genomic merging and doubling. Although genomic and transcriptomic changes have been observed in polyploids, the effects of polyploidization on proteomic divergence are poorly understood. In this study, we reported quantitative analysis of proteomic changes in leaves of Brassica hexaploid and its parents using isobaric tags for relative and absolute quantitation (iTRAQ) coupled with mass spectrometry. A total of 2044 reproducible proteins were quantified by at least two unique peptides. We detected 452 proteins differentially expressed between Brassica hexaploid and its parents, and 100 proteins were non-additively expressed in Brassica hexaploid, which suggested a trend of non-additive protein regulation following genomic merger and doubling. Functional categories of cellular component biogenesis, immune system process, and response to stimulus, were significantly enriched in non-additive proteins, probably providing a driving force for variation and adaptation in allopolyploids. In particular, majority of the total 452 differentially expressed proteins showed expression level dominance of one parental expression, and there was an expression level dominance bias toward the tetraploid progenitor. In addition, the percentage of differentially expressed proteins that matched previously reported differentially genes were relatively low. This study aimed to get new insights into the effects of polyploidization on proteomic divergence. Using iTRAQ LC-MS/MS technology, we identified 452 differentially expressed proteins between allopolyploid and its parents which involved in response to stimulus, multi-organism process, and immune system process, much more than previous studies using 2-DE coupled with mass spectrometry technology. Therefore, our manuscript represents the most comprehensive analysis of protein profiles in allopolyploid and its parents, which will lead to a better understanding of

  16. The relationship of transverse sinus stenosis to bony groove dimensions provides an insight into the aetiology of idiopathic intracranial hypertension

    Energy Technology Data Exchange (ETDEWEB)

    Connor, S.E.J.; Stewart, V.R.; O' Flynn, E.A.M. [King' s College Hospital, Neuroradiology Department, Ruskin Wing, London (United Kingdom); Siddiqui, M.A. [Southern General Hospital, Institute of Neurological Sciences, Glasgow (United Kingdom)

    2008-12-15

    Transverse sinus tapered narrowings are frequently identified in patients with idiopathic intracranial hypertension (IIH); however, it remains unclear whether they are primary stenoses or whether they occur secondary to raised cerebrospinal fluid pressure. Computed tomographic venography demonstrates both the morphology of the venous system and the adjacent bony grooves so it may provide an insight into the aetiology of these transverse sinus stenoses. Tapered transverse sinus narrowings (>50%) were studied in 19 patients without IIH and 14 patients with IIH. Computed tomography vascular studies were reviewed and the dimensions of the venous sinuses and bony grooves at the sites of maximum and minimum transverse sinus area dimensions were recorded. There was demonstrated to be a strong correlation of bony groove height with venous sinus height at the largest portions of the transverse sinus in both IIH patients and non-IIH subjects as well as at the transverse sinus narrowing in non-IIH subjects. There was a discordant relationship between bony groove height and venous sinus height at the site of transverse sinus stenoses in IIH patients. In 5/23 IIH transverse sinus stenoses, the bony groove height was proportionate to that seen in non-IIH subjects. There were a further 8/23 cases where the small or absent sinus was associated with an absent bony groove. Transverse sinus tapered narrowings in subjects without IIH and in the majority of patients with IIH were associated with proportionately small or absent grooves, and these are postulated to be primary or fixed. Some patients with IIH demonstrate tapered transverse sinus stenoses with disproportionately large bony grooves, suggesting a secondary or acquired narrowing. This implies a varied aetiology for the transverse sinus stenoses of IIH. (orig.)

  17. Molecular characterization of Babesia peircei and Babesia ugwidiensis provides insight into the evolution and host specificity of avian piroplasmids

    Directory of Open Access Journals (Sweden)

    Michael J. Yabsley

    2017-12-01

    Full Text Available There are 16 recognized species of avian-infecting Babesia spp. (Piroplasmida: Babesiidae. While the classification of piroplasmids has been historically based on morphological differences, geographic isolation and presumed host and/or vector specificities, recent studies employing gene sequence analysis have provided insight into their phylogenetic relationships and host distribution and specificity. In this study, we analyzed the sequences of the 18S rRNA gene and ITS-1 and ITS-2 regions of two Babesia species from South African seabirds: Babesia peircei from African penguins (Spheniscus demersus and Babesia ugwidiensis from Bank and Cape cormorants (Phalacrocorax neglectus and P. capensis, respectively. Our results show that avian Babesia spp. are not monophyletic, with at least three distinct phylogenetic groups. B. peircei and B. ugwidiensis are closely related, and fall within the same phylogenetic group as B. ardeae (from herons Ardea cinerea, B. poelea (from boobies Sula spp. and B. uriae (from murres Uria aalge. The validity of B. peircei and B. ugwidiensis as separate species is corroborated by both morphological and genetic evidence. On the other hand, our results indicate that B. poelea might be a synonym of B. peircei, which in turn would be a host generalist that infects seabirds from multiple orders. Further studies combining morphological and molecular methods are warranted to clarify the taxonomy, phylogeny and host distribution of avian piroplasmids. Keywords: Africa, Babesia, Piroplasmida, Phalacrocoracidae, Spheniscidae, Tick-borne pathogen

  18. The state of multiple sclerosis: current insight into the patient/health care provider relationship, treatment challenges, and satisfaction

    Science.gov (United States)

    Tintoré, Mar; Alexander, Maggie; Costello, Kathleen; Duddy, Martin; Jones, David E; Law, Nancy; O’Neill, Gilmore; Uccelli, Antonio; Weissert, Robert; Wray, Sibyl

    2017-01-01

    Background Managing multiple sclerosis (MS) treatment presents challenges for both patients and health care professionals. Effective communication between patients with MS and their neurologist is important for improving clinical outcomes and quality of life. Methods A closed-ended online market research survey was used to assess the current state of MS care from the perspective of both patients with MS (≥18 years of age) and neurologists who treat MS from Europe and the US and to gain insight into perceptions of treatment expectations/goals, treatment decisions, treatment challenges, communication, and satisfaction with care, based on current clinical practice. Results A total of 900 neurologists and 982 patients completed the survey, of whom 46% self-identified as having remitting-relapsing MS, 29% secondary progressive MS, and 11% primary progressive MS. Overall, patients felt satisfied with their disease-modifying therapy (DMT); satisfaction related to comfort in speaking with their neurologist and participation in their DMT decision-making process. Patients who self-identified as having relapsing-remitting MS were more likely to be very satisfied with their treatment. Top challenges identified by patients in managing their DMT were cost, side effects/tolerability of treatment, and uncertainty if treatment was working. Half of the patients reported skipping doses, but only 68% told their health care provider that they did so. Conclusion Several important differences in perception were identified between patients and neurologists concerning treatment selection, satisfaction, expectations, goals, and comfort discussing symptoms, as well as treatment challenges and skipped doses. The study results emphasize that patient/neurologist communication and patient input into the treatment decision-making process likely influence patient satisfaction with treatment. PMID:28053511

  19. The state of multiple sclerosis: current insight into the patient/health care provider relationship, treatment challenges, and satisfaction.

    Science.gov (United States)

    Tintoré, Mar; Alexander, Maggie; Costello, Kathleen; Duddy, Martin; Jones, David E; Law, Nancy; O'Neill, Gilmore; Uccelli, Antonio; Weissert, Robert; Wray, Sibyl

    2017-01-01

    Managing multiple sclerosis (MS) treatment presents challenges for both patients and health care professionals. Effective communication between patients with MS and their neurologist is important for improving clinical outcomes and quality of life. A closed-ended online market research survey was used to assess the current state of MS care from the perspective of both patients with MS (≥18 years of age) and neurologists who treat MS from Europe and the US and to gain insight into perceptions of treatment expectations/goals, treatment decisions, treatment challenges, communication, and satisfaction with care, based on current clinical practice. A total of 900 neurologists and 982 patients completed the survey, of whom 46% self-identified as having remitting-relapsing MS, 29% secondary progressive MS, and 11% primary progressive MS. Overall, patients felt satisfied with their disease-modifying therapy (DMT); satisfaction related to comfort in speaking with their neurologist and participation in their DMT decision-making process. Patients who self-identified as having relapsing-remitting MS were more likely to be very satisfied with their treatment. Top challenges identified by patients in managing their DMT were cost, side effects/tolerability of treatment, and uncertainty if treatment was working. Half of the patients reported skipping doses, but only 68% told their health care provider that they did so. Several important differences in perception were identified between patients and neurologists concerning treatment selection, satisfaction, expectations, goals, and comfort discussing symptoms, as well as treatment challenges and skipped doses. The study results emphasize that patient/neurologist communication and patient input into the treatment decision-making process likely influence patient satisfaction with treatment.

  20. Comparative transcriptional profiling provides insights into the evolution and development of the zygomorphic flower of Vicia sativa (Papilionoideae.

    Directory of Open Access Journals (Sweden)

    Zhipeng Liu

    Full Text Available BACKGROUND: Vicia sativa (the common vetch possesses a predominant zygomorphic flower and belongs to the subfamily Papilionoideae, which is related to Arabidopsis thaliana in the eurosid II clade of the core eudicots. Each vetch flower consists of 21 concentrically arranged organs: the outermost five sepals, then five petals and ten stamens, and a single carpel in the center. METHODOLOGY/PRINCIPAL FINDINGS: We explored the floral transcriptome to examine a genome-scale genetic model of the zygomorphic flower of vetch. mRNA was obtained from an equal mixture of six floral organs, leaves and roots. De novo assembly of the vetch transcriptome using Illumina paired-end technology produced 71,553 unigenes with an average length of 511 bp. We then compared the expression changes in the 71,553 unigenes in the eight independent organs through RNA-Seq Quantification analysis. We predominantly analyzed gene expression patterns specific to each floral organ and combinations of floral organs that corresponded to the traditional ABC model domains. Comparative analyses were performed in the floral transcriptomes of vetch and Arabidopsis, and genomes of vetch and Medicago truncatula. CONCLUSIONS/SIGNIFICANCE: Our comparative analysis of vetch and Arabidopsis showed that the vetch flowers conform to a strict ABC model. We analyzed the evolution and expression of the TCP gene family in vetch at a whole-genome level, and several unigenes specific to three different vetch petals, which might offer some clues toward elucidating the molecular mechanisms underlying floral zygomorphy. Our results provide the first insights into the genome-scale molecular regulatory network that controls the evolution and development of the zygomorphic flower in Papilionoideae.

  1. The relationship of transverse sinus stenosis to bony groove dimensions provides an insight into the aetiology of idiopathic intracranial hypertension

    International Nuclear Information System (INIS)

    Connor, S.E.J.; Stewart, V.R.; O'Flynn, E.A.M.; Siddiqui, M.A.

    2008-01-01

    Transverse sinus tapered narrowings are frequently identified in patients with idiopathic intracranial hypertension (IIH); however, it remains unclear whether they are primary stenoses or whether they occur secondary to raised cerebrospinal fluid pressure. Computed tomographic venography demonstrates both the morphology of the venous system and the adjacent bony grooves so it may provide an insight into the aetiology of these transverse sinus stenoses. Tapered transverse sinus narrowings (>50%) were studied in 19 patients without IIH and 14 patients with IIH. Computed tomography vascular studies were reviewed and the dimensions of the venous sinuses and bony grooves at the sites of maximum and minimum transverse sinus area dimensions were recorded. There was demonstrated to be a strong correlation of bony groove height with venous sinus height at the largest portions of the transverse sinus in both IIH patients and non-IIH subjects as well as at the transverse sinus narrowing in non-IIH subjects. There was a discordant relationship between bony groove height and venous sinus height at the site of transverse sinus stenoses in IIH patients. In 5/23 IIH transverse sinus stenoses, the bony groove height was proportionate to that seen in non-IIH subjects. There were a further 8/23 cases where the small or absent sinus was associated with an absent bony groove. Transverse sinus tapered narrowings in subjects without IIH and in the majority of patients with IIH were associated with proportionately small or absent grooves, and these are postulated to be primary or fixed. Some patients with IIH demonstrate tapered transverse sinus stenoses with disproportionately large bony grooves, suggesting a secondary or acquired narrowing. This implies a varied aetiology for the transverse sinus stenoses of IIH. (orig.)

  2. Integrated application of transcriptomics and metabolomics provides insights into glycogen content regulation in the Pacific oyster Crassostrea gigas.

    Science.gov (United States)

    Li, Busu; Song, Kai; Meng, Jie; Li, Li; Zhang, Guofan

    2017-09-11

    stress. These findings will not only provide insights into the molecular mechanisms underlying oyster quality, but also promote research into the molecular breeding of oysters.

  3. Community proteomics provides functional insight into polyhydroxyalkanoate production by a mixed microbial culture cultivated on fermented dairy manure.

    Science.gov (United States)

    Hanson, Andrea J; Guho, Nicholas M; Paszczynski, Andrzej J; Coats, Erik R

    2016-09-01

    Polyhydroxyalkanoates (PHAs) are bio-based, biodegradable polyesters that can be produced from organic-rich waste streams using mixed microbial cultures (MMCs). To maximize PHA production, MMCs are enriched for bacteria with a high polymer storage capacity through the application of aerobic dynamic feeding (ADF) in a sequencing batch reactor (SBR), which consequently induces a feast-famine metabolic response. Though the feast-famine response is generally understood empirically at a macro-level, the molecular level is less refined. The objective of this study was to investigate the microbial community composition and proteome profile of an enriched MMC cultivated on fermented dairy manure. The enriched MMC exhibited a feast-famine response and was capable of producing up to 40 % (wt. basis) PHA in a fed-batch reactor. High-throughput 16S rRNA gene sequencing revealed a microbial community dominated by Meganema, a known PHA-producing genus not often observed in high abundance in enrichment SBRs. The application of the proteomic methods two-dimensional electrophoresis and LC-MS/MS revealed PHA synthesis, energy generation, and protein synthesis prominently occurring during the feast phase, corroborating bulk solution variable observations and theoretical expectations. During the famine phase, nutrient transport, acyl-CoA metabolism, additional energy generation, and housekeeping functions were more pronounced, informing previously under-determined MMC functionality under famine conditions. During fed-batch PHA production, acetyl-CoA acetyltransferase and PHA granule-bound phasin proteins were in increased abundance relative to the SBR, supporting the higher PHA content observed. Collectively, the results provide unique microbial community structural and functional insight into feast-famine PHA production from waste feedstocks using MMCs.

  4. Magnetotelluric 2D Modelling Provides Insight on the Structural Characteristics of the Guadalajara (Mexico) Triple Junction Domains

    Science.gov (United States)

    Arboleda Zapata, M. D. J., Sr.; Arzate-Flores, J.; Guevara Betancourt, R. E., Sr.

    2017-12-01

    The Jalisco Block is a continental microplate produced by the extension along three large structures: the Tepic-Zacoalco rift (TZR), the Colima rift (CR) and the Chapala rift that converge in a triple junction 50 km southwest of Guadalajara, Mexico, with orientation NW-SE, N-S, and E-W respectively. The present study focuses on investigating the deep structure of the north Colima and eastern Zacoalco grabens close to the Guadalajara triple junction (GTJ). This is a first study of its type that provide insight on the grabens structures and crustal characteristics underneath. We measured along two magnetotellurics (MT) profiles that cut perpendicularly the TZR (profile ZAC), and the northern CR (profile SAY) comprising a total of 24 broad band MT soundings. The ZAC profile has 11 stations and has a NE orientation, and the SAY profile has 14 station aligned E-W. Standard processing and editing procedures were completed, and distortion analysis was applied to the data set in order to define the dimensionality and electric strike of the separated profiles. Static shift was corrected using geology information to distinguish the different types of soundings and later averaging for those soundings located over the same lithology. The Bahr dimensionality parameters showed that the medium is mainly 3D for the SAY profile and 2D for the ZAC profile; furthermore, the regional geoelectric strike azimuth calculated with Bahr methodology were -4° and -48° respectively, with good concordance with the main surface structures. The tipper analysis permitted validated these results, as the real induction vectors were nearly perpendicular to main fault structures. All soundings were rotated to the respective regional strike and a 2D simultaneous inversion of the transverse electric (TE) mode, the transvers magnetic (TM) mode and the Tipper was completed. The RMS fitting error yield 3.2% for ZAC profile and 3.7% for SAY profile. Both profiles show a shallow conductive zone at north of

  5. Unique genome organization of non-mammalian papillomaviruses provides insights into the evolution of viral early proteins.

    Science.gov (United States)

    Van Doorslaer, Koenraad; Ruoppolo, Valeria; Schmidt, Annie; Lescroël, Amelie; Jongsomjit, Dennis; Elrod, Megan; Kraberger, Simona; Stainton, Daisy; Dugger, Katie M; Ballard, Grant; Ainley, David G; Varsani, Arvind

    2017-07-01

    estimated the divergence time between Northern fulmar-associated papillomavirus and the other Sauropsid papillomaviruses be to around 250 million years ago, during the Paleozoic-Mesozoic transition and our analysis dates the root of the papillomavirus tree between 400 and 600 million years ago. Our analysis shows evidence for niche adaptation and that these non-mammalian viruses have highly divergent E6 and E7 proteins, providing insights into the evolution of the early viral (onco-)proteins.

  6. Unique genome organization of non-mammalian papillomaviruses provides insights into the evolution of viral early proteins

    Science.gov (United States)

    Van Doorslaer, Koenraad; Ruoppolo, Valeria; Schmidt, Annie; Lescroël, Amelie; Jongsomjit, Dennis; Elrod, Megan; Kraberger, Simona; Stainton, Daisy; Dugger, Katie M.; Ballard, Grant; Ainley, David G.; Varsani, Arvind

    2017-01-01

    divergence time between Northern fulmar-associated papillomavirus and the other Sauropsid papillomaviruses be to around 250 million years ago, during the Paleozoic-Mesozoic transition and our analysis dates the root of the papillomavirus tree between 400 and 600 million years ago. Our analysis shows evidence for niche adaptation and that these non-mammalian viruses have highly divergent E6 and E7 proteins, providing insights into the evolution of the early viral (onco-)proteins.

  7. Acidicapsa borealis gen. nov., sp. nov. and Acidicapsa ligni sp. nov., subdivision 1 Acidobacteria from Sphagnum peat and decaying wood.

    Science.gov (United States)

    Kulichevskaya, Irina S; Kostina, Lilia A; Valásková, Vendula; Rijpstra, W Irene C; Damsté, Jaap S Sinninghe; de Boer, Wietse; Dedysh, Svetlana N

    2012-07-01

    Two strains of subdivision 1 Acidobacteria, a pink-pigmented bacterium KA1(T) and a colourless isolate WH120(T), were obtained from acidic Sphagnum peat and wood under decay by the white-rot fungus Hyploma fasciculare, respectively. Cells of these isolates were Gram-negative-staining, non-motile, short rods, which were covered by large polysaccharide capsules and occurred singly, in pairs, or in short chains. Strains KA1(T) and WH120(T) were strictly aerobic mesophiles that grew between 10 and 33 °C, with an optimum at 22-28 °C. Both isolates developed under acidic conditions, but strain WH120(T) was more acidophilic (pH growth range 3.5-6.4; optimum, 4.0-4.5) than strain KA1(T) (pH growth range 3.5-7.3; optimum , 5.0-5.5). The preferred growth substrates were sugars. In addition, the wood-derived isolate WH120(T) grew on oxalate, lactate and xylan, while the peat-inhabiting acidobacterium strain KA1(T) utilized galacturonate, glucuronate and pectin. The major fatty acids were iso-C(15:0) and iso-C(17:1)ω8c; the cells also contained significant amounts of 13,16-dimethyl octacosanedioic acid. The quinone was MK-8. The DNA G+C contents of strains KA1(T) and WH120(T) were 54.1 and 51.7 mol%, respectively. Strains KA1(T) and WH120(T) displayed 97.8% 16S rRNA gene sequence similarity to each other. The closest recognized relatives were Acidobacterium capsulatum and Telmatobacter bradus (93.4-94.3% 16S rRNA gene sequence similarity). These species differed from strains KA1(T) and WH120(T) by their ability to grow under anoxic conditions, the absence of capsules, presence of cell motility and differing fatty acid composition. Based on these differences, the two new isolates are proposed as representing a novel genus, Acidicapsa gen. nov., and two novel species. Acidicapsa borealis gen. nov., sp. nov. is the type species for the new genus with strain KA1(T) (=DSM 23886(T)=LMG 25897(T)=VKM B-2678(T)) as the type strain. The name Acidicapsa ligni sp. nov. is proposed for

  8. Genome-Wide Association Identifies Nine Common Variants Associated With Fasting Proinsulin Levels and Provides New Insights Into the Pathophysiology of Type 2 Diabetes

    NARCIS (Netherlands)

    Strawbridge, Rona J.; Dupuis, Josee; Prokopenko, Inga; Barker, Adam; Ahlqvist, Emma; Rybin, Denis; Petrie, John R.; Travers, Mary E.; Bouatia-Naji, Nabila; Dimas, Antigone S.; Nica, Alexandra; Wheeler, Eleanor; Chen, Han; Voight, Benjamin F.; Taneera, Jalal; Kanoni, Stavroula; Peden, John F.; Turrini, Fabiola; Gustafsson, Stefan; Zabena, Carina; Almgren, Peter; Barker, David J. P.; Barnes, Daniel; Dennison, Elaine M.; Eriksson, Johan G.; Eriksson, Per; Eury, Elodie; Folkersen, Lasse; Fox, Caroline S.; Frayling, Timothy M.; Goel, Anuj; Gu, Harvest F.; Horikoshi, Momoko; Isomaa, Bo; Jackson, Anne U.; Jameson, Karen A.; Kajantie, Eero; Kerr-Conte, Julie; Kuulasmaa, Teemu; Kuusisto, Johanna; Loos, Ruth J. F.; Luan, Jian'an; Makrilakis, Konstantinos; Manning, Alisa K.; Teresa Martinez-Larrad, Maria; Narisu, Narisu; Mannila, Maria Nastase; Ohrvik, John; Osmond, Clive; Pascoe, Laura

    2011-01-01

    OBJECTIVE-Proinsulin is a precursor of mature insulin and C-peptide. Higher circulating proinsulin levels are associated with impaired beta-cell function, raised glucose levels, insulin resistance, and type 2 diabetes (T2D). Studies of the insulin processing pathway could provide new insights about

  9. Genome-wide association identifies nine common variants associated with fasting proinsulin levels and provides new insights into the pathophysiology of type 2 diabetes

    NARCIS (Netherlands)

    Strawbridge, R.J.; Dupuis, J.; Prokopenko, I.; Barker, A.; Ahlqvist, E.; Rybin, D.; Petrie, J.R.; Travers, M.E.; Bouatia-Naji, N.; Dimas, A.S.; Nica, A.; Wheeler, E.; Chen, H.; Voight, B.F.; Taneera, J.; Kanoni, S.; Peden, J.F.; Turrini, F.; Gustafsson, S.; Zabena, C.; Almgren, P.; Barker, D.J.; Barnes, D.; Dennison, E.M.; Eriksson, J.G.; Eriksson, P.; Eury, E.; Folkersen, L.; Fox, C.S.; Frayling, T.M.; Goel, A.; Gu, H.F.; Horikoshi, M.; Isomaa, B.; Jackson, A.U.; Jameson, K.A.; Kajantie, E.; Kerr-Conte, J.; Kuulasmaa, T.; Kuusisto, J.; Loos, R.J.; Luan, J.; Makrilakis, K.; Manning, A.K.; Martinez-Larrad, M.T.; Narisu, N.; Nastase Mannila, M.; Ohrvik, J.; Osmond, C.; Pascoe, L.; Payne, F.; Sayer, A.A.; Sennblad, B.; Silveira, A.; Stancakova, A.; Stirrups, K.; Swift, A.J.; Syvanen, A.C.; Tuomi, T.; Hooft, F. van 't; Walker, M.; Weedon, M.N.; Xie, W.; Zethelius, B.; Ongen, H.; Malarstig, A.; Hopewell, J.C.; Saleheen, D.; Chambers, J.; Parish, S.; Danesh, J.; Kooner, J.; Ostenson, C.G.; Lind, L.; Cooper, C.C.; Serrano-Rios, M.; Ferrannini, E.; Forsen, T.J.; Clarke, R.; Franzosi, M.G.; Seedorf, U.; Watkins, H.; Froguel, P.; Johnson, P.; Deloukas, P.; Collins, F.S.; Laakso, M.; Dermitzakis, E.T.; Boehnke, M.; McCarthy, M.I.; Wareham, N.J.; Groop, L.; Pattou, F.; Gloyn, A.L.; Dedoussis, G.V.; Lyssenko, V.; Meigs, J.B.; Barroso, I.; Watanabe, R.M.; Heijer, M. den; Kiemeney, L.A.L.M.; et al.,

    2011-01-01

    OBJECTIVE: Proinsulin is a precursor of mature insulin and C-peptide. Higher circulating proinsulin levels are associated with impaired beta-cell function, raised glucose levels, insulin resistance, and type 2 diabetes (T2D). Studies of the insulin processing pathway could provide new insights about

  10. Genome-wide association identifies nine common variants associated with fasting proinsulin levels and provides new insights into the pathophysiology of type 2 diabetes

    NARCIS (Netherlands)

    Strawbridge, Rona J.; Dupuis, Josée; Prokopenko, Inga; Barker, Adam; Ahlqvist, Emma; Rybin, Denis; Petrie, John R.; Travers, Mary E.; Bouatia-Naji, Nabila; Dimas, Antigone S.; Nica, Alexandra; Wheeler, Eleanor; Chen, Han; Voight, Benjamin F.; Taneera, Jalal; Kanoni, Stavroula; Peden, John F.; Turrini, Fabiola; Gustafsson, Stefan; Zabena, Carina; Almgren, Peter; Barker, David J. P.; Barnes, Daniel; Dennison, Elaine M.; Eriksson, Johan G.; Eriksson, Per; Eury, Elodie; Folkersen, Lasse; Fox, Caroline S.; Frayling, Timothy M.; Goel, Anuj; Gu, Harvest F.; Horikoshi, Momoko; Isomaa, Bo; Jackson, Anne U.; Jameson, Karen A.; Kajantie, Eero; Kerr-Conte, Julie; Kuulasmaa, Teemu; Kuusisto, Johanna; Loos, Ruth J. F.; Luan, Jian'an; Makrilakis, Konstantinos; Manning, Alisa K.; Martínez-Larrad, María Teresa; Narisu, Narisu; Nastase Mannila, Maria; Boekholdt, S. Matthijs; Kastelein, John J. P.; Rosendaal, Frits R.

    2011-01-01

    Proinsulin is a precursor of mature insulin and C-peptide. Higher circulating proinsulin levels are associated with impaired β-cell function, raised glucose levels, insulin resistance, and type 2 diabetes (T2D). Studies of the insulin processing pathway could provide new insights about T2D

  11. Targeted gene panels and microbiota analysis provide insight into the effects of effects of alternative production diet formulations on channel catfish nutritional physiology

    Science.gov (United States)

    The present research evaluated targeted gene panels and microbiota analysis to provide greater insight into the effects of alternatively-sourced dietary ingredients on production indices, gut health, changes in the gut microbiota and genes involved in the regulation of appetite, growth, metabolism, ...

  12. The Asian arowana (Scleropages formosus) genome provides new insights into the evolution of an early lineage of teleosts

    DEFF Research Database (Denmark)

    Bian, Chao; Hu, Yinchang; Ravi, Vydianathan

    2016-01-01

    five Hox clusters. Differential gene expression among three varieties provides insights into the genetic basis of colour variation. A potential heterogametic sex chromosome is identified in the female arowana karyotype, suggesting that the sex is determined by a ZW/ZZ sex chromosomal system. The high...

  13. Long, paired A'A/Pahoehoe flows of Mauna Loa: Volcanological significance and insights they provide into volcano plumbing systems

    Science.gov (United States)

    Rowland, Scott K.; Walker, George P. L.

    1987-01-01

    The long lava flows of Mauna Loa, Hawaii have been cited as Earth's closed analogs to the large Martian flows. It is therefore important to understand the flow mechanics and characteristics of the Mauna Loa flows and to make use of these in an attempt to gain insights into Martian eruptive processes. Two fundamentally different kinds of long lava flows can be distinguished on Hawaiian volcanoes as in Martian flows. The two kinds may have identical initial viscosities, chemical compositions, flow lengths, and flow volumes, but their flow mechanisms and thermal energy budgets are radically different. One travels a distance set by the discharge rate as envisaged by Walker and Wadge, and the other travels a distance set mainly by the eruption duration and ground slope. In the Mauna Loa lavas, yield strength becomes an important flow morphology control only in the distal part of a'a lavas. The occurrence of paired flows on Mauna Loa yields insights into the internal plumbing systems of the volcano, and it is significant that all of the volume of the a'a flow must be stored in a magma chamber before eruption, while none of the volume of the pahoehoe needs to be so stored. Differentiation between the two kinds of flows on images of Martian volcanoes is possible and hence an improved understanding of these huge structures is acquired.

  14. Long, paired A'A/Pahoehoe flows of Mauna Loa: Volcanological significance and insights they provide into volcano plumbing systems

    International Nuclear Information System (INIS)

    Rowland, S.K.; Walker, G.P.L.

    1987-01-01

    The long lava flows of Mauna Loa, Hawaii have been cited as Earth's closed analogs to the large Martian flows. It is therefore important to understand the flow mechanics and characteristics of the Mauna Loa flows and to make use of these in an attempt to gain insights into Martian eruptive processes. Two fundamentally different kinds of long lava flows can be distinguished on Hawaiian volcanoes as in Martian flows. The two kinds may have identical initial viscosities, chemical compositions, flow lengths, and flow volumes, but their flow mechanisms and thermal energy budgets are radically different. One travels a distance set by the discharge rate as envisaged by Walker and Wadge, and the other travels a distance set mainly by the eruption duration and ground slope. In the Mauna Loa lavas, yield strength becomes an important flow morphology control only in the distal part of a'a lavas. The occurrence of paired flows on Mauna Loa yields insights into the internal plumbing systems of the volcano, and it is significant that all of the volume of the a'a flow must be stored in a magma chamber before eruption, while none of the volume of the pahoehoe needs to be so stored. Differentiation between the two kinds of flows on images of Martian volcanoes is possible and hence an improved understanding of these huge structures is acquired

  15. Comparison of the Incorporation of DHA in Circulatory and Neural Tissue When Provided as Triacylglycerol (TAG), Monoacylglycerol (MAG) or Phospholipids (PL) Provides New Insight into Fatty Acid Bioavailability.

    Science.gov (United States)

    Destaillats, Frédéric; Oliveira, Manuel; Bastic Schmid, Viktoria; Masserey-Elmelegy, Isabelle; Giuffrida, Francesca; Thakkar, Sagar K; Dupuis, Lénaïck; Gosoniu, Maria Laura; Cruz-Hernandez, Cristina

    2018-05-15

    Phospholipids (PL) or partial acylglycerols such as sn -1(3)-monoacylglycerol (MAG) are potent dietary carriers of long-chain polyunsaturated fatty acids (LC-PUFA) and have been reported to provide superior bioavailability when compared to conventional triacylglycerol (TAG). The main objective of the present study was to compare the incorporation of docosahexaenoic acid (DHA) in plasma, erythrocytes, retina and brain tissues in adult rats when provided as PL (PL-DHA) and MAG (MAG-DHA). Conventional dietary DHA oil containing TAG (TAG-DHA) as well as control chow diet were used to evaluate the potency of the two alternative DHA carriers over a 60-day feeding period. Fatty acid profiles were determined in erythrocytes and plasma lipids at time 0, 7, 14, 28, 35 and 49 days of the experimental period and in retina, cortex, hypothalamus, and hippocampus at 60 days. The assessment of the longitudinal evolution of DHA in erythrocyte and plasma lipids suggest that PL-DHA and MAG-DHA are efficient carriers of dietary DHA when compared to conventional DHA oil (TAG-DHA). Under these experimental conditions, both PL-DHA and MAG-DHA led to higher incorporations of DHA erythrocytes lipids compared to TAG-DHA group. After 60 days of supplementation, statistically significant increase in DHA level incorporated in neural tissues analyzed were observed in the DHA groups compared with the control. The mechanism explaining hypothetically the difference observed in circulatory lipids is discussed.

  16. Genome-wide trans-ancestry meta-analysis provides insight into the genetic architecture of type 2 diabetes susceptibility

    DEFF Research Database (Denmark)

    Mahajan, Anubha; Go, Min Jin; Zhang, Weihua

    2014-01-01

    To further understanding of the genetic basis of type 2 diabetes (T2D) susceptibility, we aggregated published meta-analyses of genome-wide association studies (GWAS), including 26,488 cases and 83,964 controls of European, east Asian, south Asian and Mexican and Mexican American ancestry. We obs...... and characterization of complex trait loci and emphasize an exciting opportunity to extend insight into the genetic architecture and pathogenesis of human diseases across populations of diverse ancestry....... observed a significant excess in the directional consistency of T2D risk alleles across ancestry groups, even at SNPs demonstrating only weak evidence of association. By following up the strongest signals of association from the trans-ethnic meta-analysis in an additional 21,491 cases and 55,647 controls...

  17. Genomic and secondary metabolite analyses of Streptomyces sp. 2AW provide insight into the evolution of the cycloheximide pathway

    Directory of Open Access Journals (Sweden)

    Elizabeth eStulberg

    2016-05-01

    Full Text Available The dearth of new antibiotics in the face of widespread antimicrobial resistance makes developing innovative strategies for discovering new antibiotics critical for the future management of infectious disease. Understanding the genetics and evolution of antibiotic producers will help guide the discovery and bioengineering of novel antibiotics. We discovered an isolate in Alaskan boreal forest soil that had broad antimicrobial activity. We elucidated the corresponding antimicrobial natural products and sequenced the genome of this isolate, designated Streptomyces sp. 2AW. This strain illustrates the chemical virtuosity typical of the Streptomyces genus, producing cycloheximide as well as two other biosynthetically unrelated antibiotics, neutramycin and hygromycin A. Combining bioinformatic and chemical analyses, we identified the gene clusters responsible for antibiotic production. Interestingly, 2AW appears dissimilar from other cycloheximide producers in that the gene encoding the polyketide synthase resides on a separate part of the chromosome from the genes responsible for tailoring cycloheximide-specific modifications. This gene arrangement and our phylogenetic analyses of the gene products suggest that 2AW holds an evolutionarily ancestral lineage of the cycloheximide pathway. Our analyses support the hypothesis that the 2AW glutaramide gene cluster is basal to the lineage wherein cycloheximide production diverged from other glutarimide antibiotics. This study illustrates the power of combining modern biochemical and genomic analyses to gain insight into the evolution of antibiotic-producing microorganisms.

  18. Structural and mutational analysis of Escherichia coli AlkB provides insight into substrate specificity and DNA damage searching.

    Directory of Open Access Journals (Sweden)

    Paul J Holland

    Full Text Available BACKGROUND: In Escherichia coli, cytotoxic DNA methyl lesions on the N1 position of purines and N3 position of pyrimidines are primarily repaired by the 2-oxoglutarate (2-OG iron(II dependent dioxygenase, AlkB. AlkB repairs 1-methyladenine (1-meA and 3-methylcytosine (3-meC lesions, but it also repairs 1-methylguanine (1-meG and 3-methylthymine (3-meT at a much less efficient rate. How the AlkB enzyme is able to locate and identify methylated bases in ssDNA has remained an open question. METHODOLOGY/PRINCIPAL FINDINGS: We determined the crystal structures of the E. coli AlkB protein holoenzyme and the AlkB-ssDNA complex containing a 1-meG lesion. We coupled this to site-directed mutagenesis of amino acids in and around the active site, and tested the effects of these mutations on the ability of the protein to bind both damaged and undamaged DNA, as well as catalyze repair of a methylated substrate. CONCLUSIONS/SIGNIFICANCE: A comparison of our substrate-bound AlkB-ssDNA complex with our unliganded holoenzyme reveals conformational changes of residues within the active site that are important for binding damaged bases. Site-directed mutagenesis of these residues reveals novel insight into their roles in DNA damage recognition and repair. Our data support a model that the AlkB protein utilizes at least two distinct conformations in searching and binding methylated bases within DNA: a "searching" mode and "repair" mode. Moreover, we are able to functionally separate these modes through mutagenesis of residues that affect one or the other binding state. Finally, our mutagenesis experiments show that amino acid D135 of AlkB participates in both substrate specificity and catalysis.

  19. Genome-wide association identifies nine common variants associated with fasting proinsulin levels and provides new insights into the pathophysiology of type 2 diabetes

    OpenAIRE

    Strawbridge, Rona; Dupuis, Josée; Prokopenko, Inga; Barker, Adam; Ahlqvist, Emma; Rybin, Denis; Petrie, John; Bouatia-Naji, Nabila; Dimas, Antigone; Wheeler, Eleanor; Chen, Han; Voight, Benjamin; Taneera, Jalal; Kanoni, Stavroula; Peden, John

    2011-01-01

    textabstractOBJECTIVE - Proinsulin is a precursor of mature insulin and C-peptide. Higher circulating proinsulin levels are associated with impaired b-cell function, raised glucose levels, insulin resistance, and type 2 diabetes (T2D). Studies of the insulin processing pathway could provide new insights about T2D pathophysiology. RESEARCH DESIGN AND METHODS - We have conducted a meta-analysis of genome-wide association tests of ;2.5 million genotyped or imputed single nucleotide polymorphisms...

  20. Synchrotron imaging of dentition provides insights into the biology of Hesperornis and Ichthyornis, the "last" toothed birds

    NARCIS (Netherlands)

    Dumont, Maïtena; Tafforeau, Paul; Bertin, Thomas; Bhullar, Bhart-Anjan; Field, Daniel; Schulp, Anne; Strilisky, Brandon; Thivichon-Prince, Béatrice; Viriot, Laurent; Louchart, Antoine

    2016-01-01

    Background: The dentitions of extinct organisms can provide pivotal information regarding their phylogenetic position, as well as paleobiology, diet, development, and growth. Extant birds are edentulous (toothless), but their closest relatives among stem birds, the Cretaceous Hesperornithiformes and

  1. Assessment of urinary concentrations of hepcidin provides novel insight into disturbances in iron homeostasis during malarial infection

    NARCIS (Netherlands)

    Mast, de Q.; Nadjm, B.; Reyburn, H.; Kemna, E.H.J.M.; Amos, B.; Laarakkers, C.M.M.; Silalye, S.; Verhoef, H.; Sauerwein, R.W.; Swinkels, D.W.; Ven, van der A.J.A.M.

    2009-01-01

    Disturbances in iron homeostasis are frequently observed in individuals with malaria. To study the effect of malaria and its treatment on iron homeostasis and to provide a mechanistic explanation for observed alterations in iron distribution, we studied the course of the iron regulatory hormone

  2. Strengthening diabetes retinopathy services in India: Qualitative insights into providers' perspectives: The India 11-city 9-state study

    Directory of Open Access Journals (Sweden)

    Nanda Kishore Kannuri

    2016-01-01

    Full Text Available Context: There is a lack of evidence on the subjective aspects of the provider perspective regarding diabetes and its complications in India. Objectives: The study was undertaken to understand the providers' perspective on the delivery of health services for diabetes and its complications, specifically the eye complications in India. Settings and Design: Hospitals providing diabetic services in government and private sectors were selected in 11 of the largest cities in India, based on geographical distribution and size. Methods: Fifty-nine semi-structured interviews conducted with physicians providing diabetes care were analyzed all interviews were recorded, transcribed, and translated. Nvivo 10 software was used to code the transcripts. Thematic analysis was conducted to analyze the data. Results: The results are presented as key themes: “Challenges in managing diabetes patients,” “Current patient management practices,” and “Strengthening diabetic retinopathy (DR services at the health systems level.” Diabetes affects people early across the social classes. Self-management was identified as an important prerequisite in controlling diabetes and its complications. Awareness level of hospital staff on DR was low. Advances in medical technology have an important role in effective management of DR. A team approach is required to provide comprehensive diabetic care. Conclusions: Sight-threatening DR is an impending public health challenge that needs a concerted effort to tackle it. A streamlined, multi-dimensional approach where all the stakeholders cooperate is important to strengthening services dealing with DR in the existing health care setup.

  3. Comparative transcriptome analysis of two oysters, Crassostrea gigas and Crassostrea hongkongensis provides insights into adaptation to hypo-osmotic conditions.

    Directory of Open Access Journals (Sweden)

    Xuelin Zhao

    Full Text Available Environmental salinity creates a key barrier to limit the distribution of most aquatic organisms. Adaptation to osmotic fluctuation is believed to be a factor facilitating species diversification. Adaptive evolution often involves beneficial mutations at more than one locus. Bivalves hold great interest, with numerous species living in waters, as osmoconformers, who maintain the osmotic pressure balance mostly by free amino acids. In this study, 107,076,589 reads from two groups of Crassostrea hongkongensis were produced and the assembled into 130,629 contigs. Transcripts putatively involved in stress-response, innate immunity and cell processes were identified according to Gene ontology and KEGG pathway analyses. Comparing with the transcriptome of C. gigas to characterize the diversity of transcripts between species with osmotic divergence, we identified 182,806 high-quality single nucleotide polymorphisms (SNPs for C. hongkongensis, and 196,779 SNPs for C. gigas. Comparison of 11,602 pairs of putative orthologs allowed for identification of 14 protein-coding genes that experienced strong positive selection (Ka/Ks>1. In addition, 45 genes that may show signs of moderate positive selection (1 ≥ Ka/Ks>0.5 were also identified. Based on Ks ratios and divergence time between the two species published previously, we estimated a neutral transcriptome-wide substitution mutation rate of 1.39 × 10(-9 per site per year. Several genes were differentially expressed across the control and treated groups of each species. This is the first time to sequence the transcriptome of C. hongkongensis and provide the most comprehensive transcriptomic resource available for it. The increasing amount of transcriptome data on Crassostrea provides an excellent resource for phylogenetic analysis. A large number of SNPs identified in this work are expected to provide valuable resources for future marker and genotyping assay development. The analysis of natural

  4. Fruit Flies Provide New Insights in Low-Radiation Background Biology at the INFN Underground Gran Sasso National Laboratory (LNGS).

    Science.gov (United States)

    Morciano, Patrizia; Cipressa, Francesca; Porrazzo, Antonella; Esposito, Giuseppe; Tabocchini, Maria Antonella; Cenci, Giovanni

    2018-06-04

    Deep underground laboratories (DULs) were originally created to host particle, astroparticle or nuclear physics experiments requiring a low-background environment with vastly reduced levels of cosmic-ray particle interference. More recently, the range of science projects requiring an underground experiment site has greatly expanded, thus leading to the recognition of DULs as truly multidisciplinary science sites that host important studies in several fields, including geology, geophysics, climate and environmental sciences, technology/instrumentation development and biology. So far, underground biology experiments are ongoing or planned in a few of the currently operating DULs. Among these DULs is the Gran Sasso National Laboratory (LNGS), where the majority of radiobiological data have been collected. Here we provide a summary of the current scenario of DULs around the world, as well as the specific features of the LNGS and a summary of the results we obtained so far, together with other findings collected in different underground laboratories. In particular, we focus on the recent results from our studies of Drosophila melanogaster, which provide the first evidence of the influence of the radiation environment on life span, fertility and response to genotoxic stress at the organism level. Given the increasing interest in this field and the establishment of new projects, it is possible that in the near future more DULs will serve as sites of radiobiology experiments, thus providing further relevant biological information at extremely low-dose-rate radiation. Underground experiments can be nicely complemented with above-ground studies at increasing dose rate. A systematic study performed in different exposure scenarios provides a potential opportunity to address important radiation protection questions, such as the dose/dose-rate relationship for cancer and non-cancer risk, the possible existence of dose/dose-rate threshold(s) for different biological systems and

  5. Molecular Signatures for the PVC Clade (Planctomycetes, Verrucomicrobia, Chlamydiae and Lentisphaerae of Bacteria Provide Insights into their Evolutionary Relationships

    Directory of Open Access Journals (Sweden)

    Radhey S. Gupta

    2012-09-01

    Full Text Available The PVC superphylum is an amalgamation of species from the phyla Planctomycetes, Verrucomicrobia and Chlamydiae, along with the Lentisphaerae, Poribacteria and two other candidate divisions. The diverse species of this superphylum lack any significant marker that differentiates them from other bacteria. Recently, genome sequences for 37 species covering all of the main PVC groups of bacteria have become available. We have used these sequences to construct a phylogenetic tree based upon concatenated sequences for 16 proteins and identify molecular signatures in protein sequences that are specific for the species from these phyla or those providing molecular links among them. Of the useful molecular markers identified in the present work, 6 conserved signature indels (CSIs in the proteins Cyt c oxidase, UvrD helicase, urease and a helicase-domain containing protein are specific for the species from the Verrucomicrobia phylum; three other CSIs in an ABC transporter protein, cobyrinic acid ac-diamide synthase and SpoVG protein are specific for the Planctomycetes species. Additionally, a 3 aa insert in the RpoB protein is uniquely present in all sequenced Chlamydiae, Verrucomicrobia and Lentisphaerae species, providing evidence for the shared ancestry of the species from these three phyla. Lastly, we have also identified a conserved protein of unknown function that is exclusively found in all sequenced species from the phyla Chlamydiae, Verrucomicrobia, Lentisphaerae and Planctomycetes suggesting a specific linkage among them. The absence of this protein in Poribacteria, which branches separately from other members of the PVC clade, indicates that it is not specifically related to the PVC clade of bacteria. The molecular markers described here in addition to clarifying the evolutionary relationships among the PVC clade of bacteria also provide novel tools for their identification and for genetic and biochemical studies on these organisms.

  6. Geochemistry and travertine dating provide new insights into the hydrogeology of the Great Artesian Basin, South Australia

    International Nuclear Information System (INIS)

    Love, A.J.; Rousseau-Gueutin, P.; Priestley, S.; Keppel, M.; Shand, P.; Karlstrom, K.; Crossey, L.; Wholing, D.; Fulton, S.

    2013-01-01

    While of great national and societal significance, and importance in its own right, the Great Artesian Basin of Australia is an iconic example of a continental scale artesian groundwater system. New geochemical, hydrological, and neo-tectonic data suggests that existing models that involve recharge in eastern Australia, relatively simple flow paths and discharge in springs in the western margin require modification. New geochemical data indicate a small volume flux of deeply derived (endogenic) fluids mixing into the aquifer system at a continental scale. Neotectonic data indicates active tectonism today that provides a fluid pathway through faults for the deeply sourced endogenic fluids to discharge in GAB travertine depositing springs. (authors)

  7. Herbarium records are reliable sources of phenological change driven by climate and provide novel insights into species' phenological cueing mechanisms.

    Science.gov (United States)

    Davis, Charles C; Willis, Charles G; Connolly, Bryan; Kelly, Courtland; Ellison, Aaron M

    2015-10-01

    Climate change has resulted in major changes in the phenology of some species but not others. Long-term field observational records provide the best assessment of these changes, but geographic and taxonomic biases limit their utility. Plant specimens in herbaria have been hypothesized to provide a wealth of additional data for studying phenological responses to climatic change. However, no study to our knowledge has comprehensively addressed whether herbarium data are accurate measures of phenological response and thus applicable to addressing such questions. We compared flowering phenology determined from field observations (years 1852-1858, 1875, 1878-1908, 2003-2006, 2011-2013) and herbarium records (1852-2013) of 20 species from New England, United States. Earliest flowering date estimated from herbarium records faithfully reflected field observations of first flowering date and substantially increased the sampling range across climatic conditions. Additionally, although most species demonstrated a response to interannual temperature variation, long-term temporal changes in phenological response were not detectable. Our findings support the use of herbarium records for understanding plant phenological responses to changes in temperature, and also importantly establish a new use of herbarium collections: inferring primary phenological cueing mechanisms of individual species (e.g., temperature, winter chilling, photoperiod). These latter data are lacking from most investigations of phenological change, but are vital for understanding differential responses of individual species to ongoing climate change. © 2015 Botanical Society of America.

  8. Genome-level comparisons provide insight into the phylogeny and metabolic diversity of species within the genus Lactococcus.

    Science.gov (United States)

    Yu, Jie; Song, Yuqin; Ren, Yan; Qing, Yanting; Liu, Wenjun; Sun, Zhihong

    2017-11-03

    The genomic diversity of different species within the genus Lactococcus and the relationships between genomic differentiation and environmental factors remain unclear. In this study, type isolates of ten Lactococcus species/subspecies were sequenced to assess their genomic characteristics, metabolic diversity, and phylogenetic relationships. The total genome sizes varied between 1.99 (Lactococcus plantarum) and 2.46 megabases (Mb; L. lactis subsp. lactis), and the G + C content ranged from 34.81 (L. lactis subsp. hordniae) to 39.67% (L. raffinolactis) with an average value of 37.02%. Analysis of genome dynamics indicated that the genus Lactococcus has an open pan-genome, while the core genome size decreased with sequential addition at the genus and species group levels. A phylogenetic dendrogram based on the concatenated amino acid sequences of 643 core genes was largely consistent with the phylogenetic tree obtained by 16S ribosomal RNA (rRNA) genes, but it provided a more robust phylogenetic resolution than the 16S rRNA gene-based analysis. Comparative genomics indicated that species in the genus Lactococcus had high degrees of diversity in genome size, gene content, and carbohydrate metabolism. This may be important for the specific adaptations that allow different Lactococcus species to survive in different environments. These results provide a quantitative basis for understanding the genomic and metabolic diversity within the genus Lactococcus, laying the foundation for future studies on taxonomy and functional genomics.

  9. Chromosome-level genome map provides insights into diverse defense mechanisms in the medicinal fungus Ganoderma sinense

    Science.gov (United States)

    Zhu, Yingjie; Xu, Jiang; Sun, Chao; Zhou, Shiguo; Xu, Haibin; Nelson, David R.; Qian, Jun; Song, Jingyuan; Luo, Hongmei; Xiang, Li; Li, Ying; Xu, Zhichao; Ji, Aijia; Wang, Lizhi; Lu, Shanfa; Hayward, Alice; Sun, Wei; Li, Xiwen; Schwartz, David C.; Wang, Yitao; Chen, Shilin

    2015-01-01

    Fungi have evolved powerful genomic and chemical defense systems to protect themselves against genetic destabilization and other organisms. However, the precise molecular basis involved in fungal defense remain largely unknown in Basidiomycetes. Here the complete genome sequence, as well as DNA methylation patterns and small RNA transcriptomes, was analyzed to provide a holistic overview of secondary metabolism and defense processes in the model medicinal fungus, Ganoderma sinense. We reported the 48.96 Mb genome sequence of G. sinense, consisting of 12 chromosomes and encoding 15,688 genes. More than thirty gene clusters involved in the biosynthesis of secondary metabolites, as well as a large array of genes responsible for their transport and regulation were highlighted. In addition, components of genome defense mechanisms, namely repeat-induced point mutation (RIP), DNA methylation and small RNA-mediated gene silencing, were revealed in G. sinense. Systematic bioinformatic investigation of the genome and methylome suggested that RIP and DNA methylation combinatorially maintain G. sinense genome stability by inactivating invasive genetic material and transposable elements. The elucidation of the G. sinense genome and epigenome provides an unparalleled opportunity to advance our understanding of secondary metabolism and fungal defense mechanisms. PMID:26046933

  10. Large scale genotype comparison of human papillomavirus E2-host interaction networks provides new insights for e2 molecular functions.

    Directory of Open Access Journals (Sweden)

    Mandy Muller

    Full Text Available Human Papillomaviruses (HPV cause widespread infections in humans, resulting in latent infections or diseases ranging from benign hyperplasia to cancers. HPV-induced pathologies result from complex interplays between viral proteins and the host proteome. Given the major public health concern due to HPV-associated cancers, most studies have focused on the early proteins expressed by HPV genotypes with high oncogenic potential (designated high-risk HPV or HR-HPV. To advance the global understanding of HPV pathogenesis, we mapped the virus/host interaction networks of the E2 regulatory protein from 12 genotypes representative of the range of HPV pathogenicity. Large-scale identification of E2-interaction partners was performed by yeast two-hybrid screenings of a HaCaT cDNA library. Based on a high-confidence scoring scheme, a subset of these partners was then validated for pair-wise interaction in mammalian cells with the whole range of the 12 E2 proteins, allowing a comparative interaction analysis. Hierarchical clustering of E2-host interaction profiles mostly recapitulated HPV phylogeny and provides clues to the involvement of E2 in HPV infection. A set of cellular proteins could thus be identified discriminating, among the mucosal HPV, E2 proteins of HR-HPV 16 or 18 from the non-oncogenic genital HPV. The study of the interaction networks revealed a preferential hijacking of highly connected cellular proteins and the targeting of several functional families. These include transcription regulation, regulation of apoptosis, RNA processing, ubiquitination and intracellular trafficking. The present work provides an overview of E2 biological functions across multiple HPV genotypes.

  11. Standardized Profiling of The Membrane-Enriched Proteome of Mouse Dorsal Root Ganglia (DRG) Provides Novel Insights Into Chronic Pain.

    Science.gov (United States)

    Rouwette, Tom; Sondermann, Julia; Avenali, Luca; Gomez-Varela, David; Schmidt, Manuela

    2016-06-01

    Chronic pain is a complex disease with limited treatment options. Several profiling efforts have been employed with the aim to dissect its molecular underpinnings. However, generated results are often inconsistent and nonoverlapping, which is largely because of inherent technical constraints. Emerging data-independent acquisition (DIA)-mass spectrometry (MS) has the potential to provide unbiased, reproducible and quantitative proteome maps - a prerequisite for standardization among experiments. Here, we designed a DIA-based proteomics workflow to profile changes in the abundance of dorsal root ganglia (DRG) proteins in two mouse models of chronic pain, inflammatory and neuropathic. We generated a DRG-specific spectral library containing 3067 DRG proteins, which enables their standardized quantification by means of DIA-MS in any laboratory. Using this resource, we profiled 2526 DRG proteins in each biological replicate of both chronic pain models and respective controls with unprecedented reproducibility. We detected numerous differentially regulated proteins, the majority of which exhibited pain model-specificity. Our approach recapitulates known biology and discovers dozens of proteins that have not been characterized in the somatosensory system before. Functional validation experiments and analysis of mouse pain behaviors demonstrate that indeed meaningful protein alterations were discovered. These results illustrate how the application of DIA-MS can open new avenues to achieve the long-awaited standardization in the molecular dissection of pathologies of the somatosensory system. Therefore, our findings provide a valuable framework to qualitatively extend our understanding of chronic pain and somatosensation. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Implementation of physiological fluids to provide insight into the characterization, fate, and biological interactions of silver nanoparticles

    Science.gov (United States)

    Breitner, Emily K.; Burns, Katherine E.; Hussain, Saber M.; Comfort, Kristen K.

    2018-06-01

    Silver nanoparticles (AgNPs) are being increasingly utilized in consumer and medical applications. However, there remains conflicting reports on their safety, which are evaluated through a combination of in vitro and in vivo exposure models. These discrepancies may arise, in part, due to the inherent differences between cell-based and animal systems. It is well established that nanotoxicological effects are highly dependent on the unique physicochemical properties and behavior of the particle set, including size, surface chemistry, agglomeration, and ionic dissolution. However, recent studies have identified that these properties vary as a function of exposure environment; providing a rationale for the contradictory results between in vitro and in vivo assessments. Artificial physiological fluids are emerging as a powerful tool as they allow for the characterization of NPs in an environment which they would likely encounter in vivo, in addition to having the experimental advantages of flexibility and consistency. Here, we demonstrated that the utilization of artificial fluids provided a mechanism to assess AgNP behavior and induced bioresponses in environments that they would likely encounter in vivo. AgNPs were introduced within an alveolar-based exposure model, which included alveolar epithelial (A549) cells incubated within artificial alveolar fluid (AF). Additionally, the particles underwent extensive characterization within both AF and lysosomal fluid, which the AgNPs would encounter following cellular internalization. Following incubation in physiological environments AgNP properties were significantly modified versus a traditional media environment, including alterations to both extent of agglomeration and rate of ionic dissolution. Moreover, when A549s were exposed to AgNPs in AF, the cells displayed lower cytotoxicity and stress rates, corresponding to a fluid-dependent drop in silver ion production. This work highlights the need for enhanced in vitro

  13. Large scale genotype comparison of human papillomavirus E2-host interaction networks provides new insights for e2 molecular functions.

    Science.gov (United States)

    Muller, Mandy; Jacob, Yves; Jones, Louis; Weiss, Amélie; Brino, Laurent; Chantier, Thibault; Lotteau, Vincent; Favre, Michel; Demeret, Caroline

    2012-01-01

    Human Papillomaviruses (HPV) cause widespread infections in humans, resulting in latent infections or diseases ranging from benign hyperplasia to cancers. HPV-induced pathologies result from complex interplays between viral proteins and the host proteome. Given the major public health concern due to HPV-associated cancers, most studies have focused on the early proteins expressed by HPV genotypes with high oncogenic potential (designated high-risk HPV or HR-HPV). To advance the global understanding of HPV pathogenesis, we mapped the virus/host interaction networks of the E2 regulatory protein from 12 genotypes representative of the range of HPV pathogenicity. Large-scale identification of E2-interaction partners was performed by yeast two-hybrid screenings of a HaCaT cDNA library. Based on a high-confidence scoring scheme, a subset of these partners was then validated for pair-wise interaction in mammalian cells with the whole range of the 12 E2 proteins, allowing a comparative interaction analysis. Hierarchical clustering of E2-host interaction profiles mostly recapitulated HPV phylogeny and provides clues to the involvement of E2 in HPV infection. A set of cellular proteins could thus be identified discriminating, among the mucosal HPV, E2 proteins of HR-HPV 16 or 18 from the non-oncogenic genital HPV. The study of the interaction networks revealed a preferential hijacking of highly connected cellular proteins and the targeting of several functional families. These include transcription regulation, regulation of apoptosis, RNA processing, ubiquitination and intracellular trafficking. The present work provides an overview of E2 biological functions across multiple HPV genotypes.

  14. Dissecting the chloroplast proteome of chickpea (Cicer arietinum L.) provides new insights into classical and non-classical functions.

    Science.gov (United States)

    Lande, Nilesh Vikram; Subba, Pratigya; Barua, Pragya; Gayen, Dipak; Keshava Prasad, T S; Chakraborty, Subhra; Chakraborty, Niranjan

    2017-08-08

    Chloroplast, the energy organelle unique to plant cells, is a dynamic entity which integrates an array of metabolic pathways and serves as first level for energy conversion for the entire ecological hierarchy. Increasing amount of sequence data and evolution of mass spectrometric approaches has opened up new avenues for opportune exploration of the global proteome of this organelle. In our study, we aimed at generation of a comprehensive catalogue of chloroplast proteins in a grain legume, chickpea and provided a reference proteome map. To accurately assign the identified proteins, purity of chloroplast-enriched fraction was stringently monitored by multiple chemical and immunological indexes, besides pigment and enzyme analyses. The proteome analysis led to the identification of 2451 proteins, including 27 isoforms, which include predicted and novel chloroplast constituents. The identified proteins were validated through their sequence analysis. Extensive sequence based localization prediction revealed more than 50% proteins to be chloroplast resident by at least two different algorithms. Chromosomal distribution of identified proteins across nuclear and chloroplast genome unveiled the presence of 55 chloroplast encoded gene. In depth comparison of our dataset with the non-redundant set of chloroplast proteins identified so far across other species revealed novel as well as overlapping candidates. Pulses add large amount of nitrogen to the soil and has very low water footprint and therefore, contributes to fortification of sustainable agriculture. Chickpea is one of the earliest cultivated legumes and serves as an energy and protein source for humans and animals. Chloroplasts are the unique organelles which conduct photosynthesis. Investigation on chloroplast proteome is of particular significance, especially to plant biologists, as it would allow a better understanding of chloroplast function in plants. Generation of a saturated proteome map would not only

  15. The Structure of a Sugar Transporter of the Glucose EIIC Superfamily Provides Insight into the Elevator Mechanism of Membrane Transport.

    Science.gov (United States)

    McCoy, Jason G; Ren, Zhenning; Stanevich, Vitali; Lee, Jumin; Mitra, Sharmistha; Levin, Elena J; Poget, Sebastien; Quick, Matthias; Im, Wonpil; Zhou, Ming

    2016-06-07

    The phosphoenolpyruvate:carbohydrate phosphotransferase systems are found in bacteria, where they play central roles in sugar uptake and regulation of cellular uptake processes. Little is known about how the membrane-embedded components (EIICs) selectively mediate the passage of carbohydrates across the membrane. Here we report the functional characterization and 2.55-Å resolution structure of a maltose transporter, bcMalT, belonging to the glucose superfamily of EIIC transporters. bcMalT crystallized in an outward-facing occluded conformation, in contrast to the structure of another glucose superfamily EIIC, bcChbC, which crystallized in an inward-facing occluded conformation. The structures differ in the position of a structurally conserved substrate-binding domain that is suggested to play a central role in sugar transport. In addition, molecular dynamics simulations suggest a potential pathway for substrate entry from the periplasm into the bcMalT substrate-binding site. These results provide a mechanistic framework for understanding substrate recognition and translocation for the glucose superfamily EIIC transporters. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Crystal structure of the bacterial luciferase/flavin complex provides insight into the function of the beta subunit.

    Science.gov (United States)

    Campbell, Zachary T; Weichsel, Andrzej; Montfort, William R; Baldwin, Thomas O

    2009-07-07

    Bacterial luciferase from Vibrio harveyi is a heterodimer composed of a catalytic alpha subunit and a homologous but noncatalytic beta subunit. Despite decades of enzymological investigation, structural evidence defining the active center has been elusive. We report here the crystal structure of V. harveyi luciferase bound to flavin mononucleotide (FMN) at 2.3 A. The isoalloxazine ring is coordinated by an unusual cis-Ala-Ala peptide bond. The reactive sulfhydryl group of Cys106 projects toward position C-4a, the site of flavin oxygenation. This structure also provides the first data specifying the conformations of a mobile loop that is crystallographically disordered in both prior crystal structures [(1995) Biochemistry 34, 6581-6586; (1996) J. Biol. Chem. 271, 21956 21968]. This loop appears to be a boundary between solvent and the active center. Within this portion of the protein, a single contact was observed between Phe272 of the alpha subunit, not seen in the previous structures, and Tyr151 of the beta subunit. Substitutions at position 151 on the beta subunit caused reductions in activity and total quantum yield. Several of these mutants were found to have decreased affinity for reduced flavin mononucleotide (FMNH(2)). These findings partially address the long-standing question of how the beta subunit stabilizes the active conformation of the alpha subunit, thereby participating in the catalytic mechanism.

  17. Transcriptomic Profiles of Brain Provide Insights into Molecular Mechanism of Feed Conversion Efficiency in Crucian Carp (Carassius auratus)

    Science.gov (United States)

    Pang, Meixia; Luo, Weiwei; Yu, Xiaomu; Zhou, Ying; Tong, Jingou

    2018-01-01

    Feed efficiency is an economically crucial trait for cultured animals, however, progress has been scarcely made in the genetic analyses of feed conversion efficiency (FCE) in fish because of the difficulties in measurement of trait phenotypes. In the present investigation, we present the first application of RNA sequencing (RNA-Seq) combined with differentially expressed genes (DEGs) analysis for identification of functional determinants related to FCE at the gene level in an aquaculture fish, crucian carp (Carassius auratus). Brain tissues of six crucian carp with extreme FCE performances were subjected to transcriptome analysis. A total of 544,612 unigenes with a mean size of 644.38 bp were obtained from Low- and High-FCE groups, and 246 DEGs that may be involved in FCE traits were identified in these two groups. qPCR confirmed that genes previously identified as up- or down-regulated by RNA-Seq were effectively up- or down-regulated under the studied conditions. Thirteen key genes, whose functions are associated with metabolism (Dgkk, Mgst3 and Guk1b), signal transduction (Vdnccsa1b, Tgfα, Nr4a1 and Tacr2) and growth (Endog, Crebrtc2, Myh7, Myh1, Myh14 and Igfbp7) were identified according to GO (Gene Ontology) and KEGG (Kyoto Encyclopedia of Genes and Genomes) annotations. Our novel findings provide useful pathway information and candidate genes for future studies of genetic mechanisms underlying FCE in crucian carp. PMID:29538345

  18. Quantitative Phosphoproteomic Analysis Provides Insight into the Response to Short-Term Drought Stress in Ammopiptanthus mongolicus Roots

    Directory of Open Access Journals (Sweden)

    Huigai Sun

    2017-10-01

    Full Text Available Drought is one of the major abiotic stresses that negatively affects plant growth and development. Ammopiptanthus mongolicus is an ecologically important shrub in the mid-Asia desert region and used as a model for abiotic tolerance research in trees. Protein phosphorylation participates in the regulation of various biological processes, however, phosphorylation events associated with drought stress signaling and response in plants is still limited. Here, we conducted a quantitative phosphoproteomic analysis of the response of A. mongolicus roots to short-term drought stress. Data are available via the iProx database with project ID IPX0000971000. In total, 7841 phosphorylation sites were found from the 2019 identified phosphopeptides, corresponding to 1060 phosphoproteins. Drought stress results in significant changes in the abundance of 103 phosphopeptides, corresponding to 90 differentially-phosphorylated phosphoproteins (DPPs. Motif-x analysis identified two motifs, including [pSP] and [RXXpS], from these DPPs. Functional enrichment and protein-protein interaction analysis showed that the DPPs were mainly involved in signal transduction and transcriptional regulation, osmotic adjustment, stress response and defense, RNA splicing and transport, protein synthesis, folding and degradation, and epigenetic regulation. These drought-corresponsive phosphoproteins, and the related signaling and metabolic pathways probably play important roles in drought stress signaling and response in A. mongolicus roots. Our results provide new information for understanding the molecular mechanism of the abiotic stress response in plants at the posttranslational level.

  19. Characterization of Arabidopsis FPS isozymes and FPS gene expression analysis provide insight into the biosynthesis of isoprenoid precursors in seeds.

    Science.gov (United States)

    Keim, Verónica; Manzano, David; Fernández, Francisco J; Closa, Marta; Andrade, Paola; Caudepón, Daniel; Bortolotti, Cristina; Vega, M Cristina; Arró, Montserrat; Ferrer, Albert

    2012-01-01

    Arabidopsis thaliana contains two genes encoding farnesyl diphosphate (FPP) synthase (FPS), the prenyl diphoshate synthase that catalyzes the synthesis of FPP from isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP). In this study, we provide evidence that the two Arabidopsis short FPS isozymes FPS1S and FPS2 localize to the cytosol. Both enzymes were expressed in E. coli, purified and biochemically characterized. Despite FPS1S and FPS2 share more than 90% amino acid sequence identity, FPS2 was found to be more efficient as a catalyst, more sensitive to the inhibitory effect of NaCl, and more resistant to thermal inactivation than FPS1S. Homology modelling for FPS1S and FPS2 and analysis of the amino acid differences between the two enzymes revealed an increase in surface polarity and a greater capacity to form surface salt bridges of FPS2 compared to FPS1S. These factors most likely account for the enhanced thermostability of FPS2. Expression analysis of FPS::GUS genes in seeds showed that FPS1 and FPS2 display complementary patterns of expression particularly at late stages of seed development, which suggests that Arabidopsis seeds have two spatially segregated sources of FPP. Functional complementation studies of the Arabidopsis fps2 knockout mutant seed phenotypes demonstrated that under normal conditions FPS1S and FPS2 are functionally interchangeable. A putative role for FPS2 in maintaining seed germination capacity under adverse environmental conditions is discussed.

  20. Oxidoreductases provide a more generic response to metallic stressors (Cu and Cd) than hydrolases in soil fungi: new ecotoxicological insights.

    Science.gov (United States)

    Lebrun, Jérémie D; Demont-Caulet, Nathalie; Cheviron, Nathalie; Laval, Karine; Trinsoutrot-Gattin, Isabelle; Mougin, Christian

    2016-02-01

    The present study investigates the effect of metals on the secretion of enzymes from 12 fungal strains maintained in liquid cultures. Hydrolases (acid phosphatase, β-glucosidase, β-galactosidase, and N-acetyl-β-glucosaminidase) and ligninolytic oxidoreductases (laccase, Mn, and lignin peroxidases) activities, as well as biomass production, were measured in culture fluids from fungi exposed to Cu or Cd. Our results showed that all fungi secreted most of the selected hydrolases and that about 50% of them produced a partial oxidative system in the absence of metals. Then, exposure of fungi to metals led to the decrease in biomass production. At the enzymatic level, Cu and Cd modified the secretion profiles of soil fungi. The response of hydrolases to metals was contrasted and complex and depended on metal, enzyme, and fungal strain considered. By contrast, the metals always stimulated the activity of ligninolytic oxidoreductases in fungal strains. In some of them, oxidoreductases were specifically produced following metal exposure. Fungal oxidoreductases provide a more generic response than hydrolases, constituting thus a physiological basis for their use as biomarkers of metal exposure in soils.

  1. Comparative Proteomic Analysis of the Graft Unions in Hickory (Carya cathayensis Provides Insights into Response Mechanisms to Grafting Process

    Directory of Open Access Journals (Sweden)

    Daoliang Yan

    2017-04-01

    Full Text Available Hickory (Carya cathayensis, a tree with high nutritional and economic value, is widely cultivated in China. Grafting greatly reduces the juvenile phase length and makes the large scale cultivation of hickory possible. To reveal the response mechanisms of this species to grafting, we employed a proteomics-based approach to identify differentially expressed proteins in the graft unions during the grafting process. Our study identified 3723 proteins, of which 2518 were quantified. A total of 710 differentially expressed proteins (DEPs were quantified and these were involved in various molecular functional and biological processes. Among these DEPs, 341 were up-regulated and 369 were down-regulated at 7 days after grafting compared with the control. Four auxin-related proteins were down-regulated, which was in agreement with the transcription levels of their encoding genes. The Kyoto Encyclopedia of Genes and Genomes (KEGG analysis showed that the ‘Flavonoid biosynthesis’ pathway and ‘starch and sucrose metabolism’ were both significantly up-regulated. Interestingly, five flavonoid biosynthesis-related proteins, a flavanone 3-hyfroxylase, a cinnamate 4-hydroxylase, a dihydroflavonol-4-reductase, a chalcone synthase, and a chalcone isomerase, were significantly up-regulated. Further experiments verified a significant increase in the total flavonoid contents in scions, which suggests that graft union formation may activate flavonoid biosynthesis to increase the content of a series of downstream secondary metabolites. This comprehensive analysis provides fundamental information on the candidate proteins and secondary metabolism pathways involved in the grafting process for hickory.

  2. Complete genome sequence analysis of the fish pathogen Flavobacterium columnare provides insights into antibiotic resistance and pathogenicity related genes.

    Science.gov (United States)

    Zhang, Yulei; Zhao, Lijuan; Chen, Wenjie; Huang, Yunmao; Yang, Ling; Sarathbabu, V; Wu, Zaohe; Li, Jun; Nie, Pin; Lin, Li

    2017-10-01

    We analyzed here the complete genome sequences of a highly virulent Flavobacterium columnare Pf1 strain isolated in our laboratory. The complete genome consists of a 3,171,081 bp circular DNA with 2784 predicted protein-coding genes. Among these, 286 genes were predicted as antibiotic resistance genes, including 32 RND-type efflux pump related genes which were associated with the export of aminoglycosides, indicating inducible aminoglycosides resistances in F. columnare. On the other hand, 328 genes were predicted as pathogenicity related genes which could be classified as virulence factors, gliding motility proteins, adhesins, and many putative secreted proteases. These genes were probably involved in the colonization, invasion and destruction of fish tissues during the infection of F. columnare. Apparently, our obtained complete genome sequences provide the basis for the explanation of the interactions between the F. columnare and the infected fish. The predicted antibiotic resistance and pathogenicity related genes will shed a new light on the development of more efficient preventional strategies against the infection of F. columnare, which is a major worldwide fish pathogen. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. The structure of arabidopsis thaliana OST1 provides insights into the kinase regulation mechanism in response to osmotic stress

    KAUST Repository

    Yunta, Cristina

    2011-11-01

    SnRK [SNF1 (sucrose non-fermenting-1)-related protein kinase] 2.6 [open stomata 1 (OST1)] is well characterized at molecular and physiological levels to control stomata closure in response to water-deficit stress. OST1 is a member of a family of 10 protein kinases from Arabidopsis thaliana (SnRK2) that integrates abscisic acid (ABA)-dependent and ABA-independent signals to coordinate the cell response to osmotic stress. A subgroup of protein phosphatases type 2C binds OST1 and keeps the kinase dephosphorylated and inactive. Activation of OST1 relies on the ABA-dependent inhibition of the protein phosphatases type 2C and the subsequent self-phosphorylation of the kinase. The OST1 ABA-independent activation depends on a short sequence motif that is conserved among all the members of the SnRK2 family. However, little is known about the molecular mechanism underlying this regulation. The crystallographic structure of OST1 shows that ABA-independent regulation motif stabilizes the conformation of the kinase catalytically essential α C helix, and it provides the basis of the ABA-independent regulation mechanism for the SnRK2 family of protein kinases. © 2011 Elsevier Ltd. All rights reserved.

  4. The structure of arabidopsis thaliana OST1 provides insights into the kinase regulation mechanism in response to osmotic stress

    KAUST Repository

    Yunta, Cristina; Martí nez-Ripoll, Martí n; Zhu, Jian-Kang; Albert, Armando

    2011-01-01

    SnRK [SNF1 (sucrose non-fermenting-1)-related protein kinase] 2.6 [open stomata 1 (OST1)] is well characterized at molecular and physiological levels to control stomata closure in response to water-deficit stress. OST1 is a member of a family of 10 protein kinases from Arabidopsis thaliana (SnRK2) that integrates abscisic acid (ABA)-dependent and ABA-independent signals to coordinate the cell response to osmotic stress. A subgroup of protein phosphatases type 2C binds OST1 and keeps the kinase dephosphorylated and inactive. Activation of OST1 relies on the ABA-dependent inhibition of the protein phosphatases type 2C and the subsequent self-phosphorylation of the kinase. The OST1 ABA-independent activation depends on a short sequence motif that is conserved among all the members of the SnRK2 family. However, little is known about the molecular mechanism underlying this regulation. The crystallographic structure of OST1 shows that ABA-independent regulation motif stabilizes the conformation of the kinase catalytically essential α C helix, and it provides the basis of the ABA-independent regulation mechanism for the SnRK2 family of protein kinases. © 2011 Elsevier Ltd. All rights reserved.

  5. Tobacco and alcohol sponsorship of sporting events provide insights about how food and beverage sponsorship may affect children's health.

    Science.gov (United States)

    Kelly, Bridget; Baur, Louise A; Bauman, Adrian E; King, Lesley

    2011-08-01

    Determining children's exposure to food and beverage company sponsorship, and the effect of this exposure, is important in establishing the extent to which there may be health and societal consequences. This paper aimed to provide preliminary evidence on the scope and potential effects on children of unhealthy food and beverage sponsorship. A review of published literature and media and marketing reports was conducted to determine the types of food and beverage sponsorship campaigns that children are exposed to, and the effect of corporate sponsorship (including tobacco and alcohol) on children and adolescents. A large range of food and beverage sponsorship activities, in Australia and internationally, were identified for both school and sport settings. In particular, food and beverage companies have attempted to develop a marketing presence at all levels of professional and community sport. No information was identified measuring the effect of food and beverage company sponsorship on children and adolescents. However, empirical evidence from consumer studies relating to tobacco and alcohol sponsorship has repeatedly demonstrated that sponsorship has an impact on children's product recall and product-related attitudes and behavioural intentions. While there is no available research on the direct effect of food and beverage sponsorship, the demonstrated effects of tobacco and alcohol sponsorship on children's product awareness, preferences and consumption are likely to be applicable to food companies.

  6. Transcriptome analysis provides insights into hepatic responses to moderate heat stress in the rainbow trout (Oncorhynchus mykiss).

    Science.gov (United States)

    Li, Yongjuan; Huang, Jinqiang; Liu, Zhe; Zhou, Yanjing; Xia, Binpeng; Wang, Yongjie; Kang, Yujun; Wang, Jianfu

    2017-07-01

    The rainbow trout is an economically important fish in the world. The limited stress tolerance of this species to high summer-like temperatures usually leads to mass mortality and great economic loss. However, there is limited information on the mechanisms underlying moderate heat responses in the liver of the rainbow trout. Here, we performed transcriptome profiling of rainbow trout liver under moderate heat stress by using the Hiseq™ 4000 sequencing platform. More than 277 million clean reads were obtained from 6 libraries and aligned against the rainbow trout genome. A total of 128 unique transcripts were differentially expressed in the liver under heat-stress and control conditions, many heat shock protein genes for thermoregulation and some novel genes involved in heat stress were identified. Nine of the differently expressed genes were further validated by qRT-PCR. Gene ontology and Kyoto Encyclopedia of Genes and Genomes analyses revealed that several pathways, including those for protein metabolism, energy metabolism, and immune system, were influenced by heat stress. Moreover, an important protein-processing pathway in the endoplasmic reticulum (ER) was identified, and the key role of ER-associated degradation and function of calpain as an upstream regulator of apoptosis were confirmed under heat stress. The results of this study provide a comprehensive overview of heat stress-induced transcriptional patterns in rainbow trout liver and would be particularly useful for further studies on the molecular mechanisms underlying responses to heat stress in this species. Copyright © 2017. Published by Elsevier B.V.

  7. Time-resolved studies define the nature of toxic IAPP intermediates, providing insight for anti-amyloidosis therapeutics

    Science.gov (United States)

    Abedini, Andisheh; Plesner, Annette; Cao, Ping; Ridgway, Zachary; Zhang, Jinghua; Tu, Ling-Hsien; Middleton, Chris T; Chao, Brian; Sartori, Daniel J; Meng, Fanling; Wang, Hui; Wong, Amy G; Zanni, Martin T; Verchere, C Bruce; Raleigh, Daniel P; Schmidt, Ann Marie

    2016-01-01

    Islet amyloidosis by IAPP contributes to pancreatic β-cell death in diabetes, but the nature of toxic IAPP species remains elusive. Using concurrent time-resolved biophysical and biological measurements, we define the toxic species produced during IAPP amyloid formation and link their properties to induction of rat INS-1 β-cell and murine islet toxicity. These globally flexible, low order oligomers upregulate pro-inflammatory markers and induce reactive oxygen species. They do not bind 1-anilnonaphthalene-8-sulphonic acid and lack extensive β-sheet structure. Aromatic interactions modulate, but are not required for toxicity. Not all IAPP oligomers are toxic; toxicity depends on their partially structured conformational states. Some anti-amyloid agents paradoxically prolong cytotoxicity by prolonging the lifetime of the toxic species. The data highlight the distinguishing properties of toxic IAPP oligomers and the common features that they share with toxic species reported for other amyloidogenic polypeptides, providing information for rational drug design to treat IAPP induced β-cell death. DOI: http://dx.doi.org/10.7554/eLife.12977.001 PMID:27213520

  8. Novel Parvoviruses from Wild and Domestic Animals in Brazil Provide New Insights into Parvovirus Distribution and Diversity

    Directory of Open Access Journals (Sweden)

    William Marciel de Souza

    2018-03-01

    Full Text Available Parvoviruses (family Parvoviridae are small, single-stranded DNA viruses. Many parvoviral pathogens of medical, veterinary and ecological importance have been identified. In this study, we used high-throughput sequencing (HTS to investigate the diversity of parvoviruses infecting wild and domestic animals in Brazil. We identified 21 parvovirus sequences (including twelve nearly complete genomes and nine partial genomes in samples derived from rodents, bats, opossums, birds and cattle in Pernambuco, São Paulo, Paraná and Rio Grande do Sul states. These sequences were investigated using phylogenetic and distance-based approaches and were thereby classified into eight parvovirus species (six of which have not been described previously, representing six distinct genera in the subfamily Parvovirinae. Our findings extend the known biogeographic range of previously characterized parvovirus species and the known host range of three parvovirus genera (Dependovirus, Aveparvovirus and Tetraparvovirus. Moreover, our investigation provides a window into the ecological dynamics of parvovirus infections in vertebrates, revealing that many parvovirus genera contain well-defined sub-lineages that circulate widely throughout the world within particular taxonomic groups of hosts.

  9. Transcriptomic Profiles of Brain Provide Insights into Molecular Mechanism of Feed Conversion Efficiency in Crucian Carp (Carassius auratus

    Directory of Open Access Journals (Sweden)

    Meixia Pang

    2018-03-01

    Full Text Available Feed efficiency is an economically crucial trait for cultured animals, however, progress has been scarcely made in the genetic analyses of feed conversion efficiency (FCE in fish because of the difficulties in measurement of trait phenotypes. In the present investigation, we present the first application of RNA sequencing (RNA-Seq combined with differentially expressed genes (DEGs analysis for identification of functional determinants related to FCE at the gene level in an aquaculture fish, crucian carp (Carassius auratus. Brain tissues of six crucian carp with extreme FCE performances were subjected to transcriptome analysis. A total of 544,612 unigenes with a mean size of 644.38 bp were obtained from Low- and High-FCE groups, and 246 DEGs that may be involved in FCE traits were identified in these two groups. qPCR confirmed that genes previously identified as up- or down-regulated by RNA-Seq were effectively up- or down-regulated under the studied conditions. Thirteen key genes, whose functions are associated with metabolism (Dgkk, Mgst3 and Guk1b, signal transduction (Vdnccsa1b, Tgfα, Nr4a1 and Tacr2 and growth (Endog, Crebrtc2, Myh7, Myh1, Myh14 and Igfbp7 were identified according to GO (Gene Ontology and KEGG (Kyoto Encyclopedia of Genes and Genomes annotations. Our novel findings provide useful pathway information and candidate genes for future studies of genetic mechanisms underlying FCE in crucian carp.

  10. Characterization of Arabidopsis FPS isozymes and FPS gene expression analysis provide insight into the biosynthesis of isoprenoid precursors in seeds.

    Directory of Open Access Journals (Sweden)

    Verónica Keim

    Full Text Available Arabidopsis thaliana contains two genes encoding farnesyl diphosphate (FPP synthase (FPS, the prenyl diphoshate synthase that catalyzes the synthesis of FPP from isopentenyl diphosphate (IPP and dimethylallyl diphosphate (DMAPP. In this study, we provide evidence that the two Arabidopsis short FPS isozymes FPS1S and FPS2 localize to the cytosol. Both enzymes were expressed in E. coli, purified and biochemically characterized. Despite FPS1S and FPS2 share more than 90% amino acid sequence identity, FPS2 was found to be more efficient as a catalyst, more sensitive to the inhibitory effect of NaCl, and more resistant to thermal inactivation than FPS1S. Homology modelling for FPS1S and FPS2 and analysis of the amino acid differences between the two enzymes revealed an increase in surface polarity and a greater capacity to form surface salt bridges of FPS2 compared to FPS1S. These factors most likely account for the enhanced thermostability of FPS2. Expression analysis of FPS::GUS genes in seeds showed that FPS1 and FPS2 display complementary patterns of expression particularly at late stages of seed development, which suggests that Arabidopsis seeds have two spatially segregated sources of FPP. Functional complementation studies of the Arabidopsis fps2 knockout mutant seed phenotypes demonstrated that under normal conditions FPS1S and FPS2 are functionally interchangeable. A putative role for FPS2 in maintaining seed germination capacity under adverse environmental conditions is discussed.

  11. Germ warfare in a microbial mat community: CRISPRs provide insights into the co-evolution of host and viral genomes.

    Directory of Open Access Journals (Sweden)

    John F Heidelberg

    Full Text Available CRISPR arrays and associated cas genes are widespread in bacteria and archaea and confer acquired resistance to viruses. To examine viral immunity in the context of naturally evolving microbial populations we analyzed genomic data from two thermophilic Synechococcus isolates (Syn OS-A and Syn OS-B' as well as a prokaryotic metagenome and viral metagenome derived from microbial mats in hotsprings at Yellowstone National Park. Two distinct CRISPR types, distinguished by the repeat sequence, are found in both the Syn OS-A and Syn OS-B' genomes. The genome of Syn OS-A contains a third CRISPR type with a distinct repeat sequence, which is not found in Syn OS-B', but appears to be shared with other microorganisms that inhabit the mat. The CRISPR repeats identified in the microbial metagenome are highly conserved, while the spacer sequences (hereafter referred to as "viritopes" to emphasize their critical role in viral immunity were mostly unique and had no high identity matches when searched against GenBank. Searching the viritopes against the viral metagenome, however, yielded several matches with high similarity some of which were within a gene identified as a likely viral lysozyme/lysin protein. Analysis of viral metagenome sequences corresponding to this lysozyme/lysin protein revealed several mutations all of which translate into silent or conservative mutations which are unlikely to affect protein function, but may help the virus evade the host CRISPR resistance mechanism. These results demonstrate the varied challenges presented by a natural virus population, and support the notion that the CRISPR/viritope system must be able to adapt quickly to provide host immunity. The ability of metagenomics to track population-level variation in viritope sequences allows for a culture-independent method for evaluating the fast co-evolution of host and viral genomes and its consequence on the structuring of complex microbial communities.

  12. Sixteen kiwi (Apteryx spp) transcriptomes provide a wealth of genetic markers and insight into sex chromosome evolution in birds.

    Science.gov (United States)

    Ramstad, Kristina M; Miller, Hilary C; Kolle, Gabriel

    2016-05-26

    here will provide a rich resource for polymorphic marker development and studies of adaptation of these highly unusual and endangered birds.

  13. Transcriptome changes in Eriocheir sinensis megalopae after desalination provide insights into osmoregulation and stress adaption in larvae.

    Directory of Open Access Journals (Sweden)

    Min Hui

    Full Text Available Eriocheir sinensis, an extremely invasive alien crab species, has important economic value in China. It encounters different salinities during its life cycle, and at the megalopal stage it faces a turning point regarding the salinity in its environment. We applied RNA sequencing to E. sinensis megalopae before (MB and after (MA desalination, resulting in the discovery of 21,042 unigenes and 908 differentially expressed genes (DEGs, 4.32% of the unigenes. The DEGs primarily belonged to the Gene Ontology groups "Energy metabolism," "Oxidoreductase activity," "Translation," "Transport," "Metabolism," and "Stress response." In total, 33 DEGs related to transport processes were found, including 12 proton pump genes, three ATP-binding cassettes (ABCs, 13 solute carrier (SLC family members, two sweet sugar transporter (ST family members and three other substance transporters. Mitochondrial genes as well as genes involved in the tricarboxylic acid cycle, glycolytic pathway, or β-oxidation pathway, which can generate energy in the form of ATP, were typically up-regulated in MA. 11 unigenes related to amino acid metabolism and a large number of genes related to protein synthesis were differentially expressed in MB and MA, indicating that E. sinensis possibly adjusts its concentration of free amino acid osmolytes for hyper-osmoregulation. Additionally, 33 salinity and oxidative stress induced genes were found to be differentially expressed, such as the LEA2, HSPs, GST and coagulation factor genes. Notably, LEA2 is an extremely hydrophilic protein that responds to desiccation and reported for the first time in crabs. Therefore, we suppose that when the environment is hypo-osmotic, the megalopae might compensate for ion loss via hyper-osmoregulation by consuming more energy, accompanied by a series of stress induced adaptions. This study provides the first genome-wide transcriptome analysis of E. sinensis megalopae for studying its osmoregulation and stress

  14. Venom-related transcripts from Bothrops jararaca tissues provide novel molecular insights into the production and evolution of snake venom.

    Science.gov (United States)

    Junqueira-de-Azevedo, Inácio L M; Bastos, Carolina Mancini Val; Ho, Paulo Lee; Luna, Milene Schmidt; Yamanouye, Norma; Casewell, Nicholas R

    2015-03-01

    Attempts to reconstruct the evolutionary history of snake toxins in the context of their co-option to the venom gland rarely account for nonvenom snake genes that are paralogous to toxins, and which therefore represent important connectors to ancestral genes. In order to reevaluate this process, we conducted a comparative transcriptomic survey on body tissues from a venomous snake. A nonredundant set of 33,000 unigenes (assembled transcripts of reference genes) was independently assembled from six organs of the medically important viperid snake Bothrops jararaca, providing a reference list of 82 full-length toxins from the venom gland and specific products from other tissues, such as pancreatic digestive enzymes. Unigenes were then screened for nontoxin transcripts paralogous to toxins revealing 1) low level coexpression of approximately 20% of toxin genes (e.g., bradykinin-potentiating peptide, C-type lectin, snake venom metalloproteinase, snake venom nerve growth factor) in body tissues, 2) the identity of the closest paralogs to toxin genes in eight classes of toxins, 3) the location and level of paralog expression, indicating that, in general, co-expression occurs in a higher number of tissues and at lower levels than observed for toxin genes, and 4) strong evidence of a toxin gene reverting back to selective expression in a body tissue. In addition, our differential gene expression analyses identify specific cellular processes that make the venom gland a highly specialized secretory tissue. Our results demonstrate that the evolution and production of venom in snakes is a complex process that can only be understood in the context of comparative data from other snake tissues, including the identification of genes paralogous to venom toxins. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. 40,000-Year-Old Individual from Asia Provides Insight into Early Population Structure in Eurasia.

    Science.gov (United States)

    Yang, Melinda A; Gao, Xing; Theunert, Christoph; Tong, Haowen; Aximu-Petri, Ayinuer; Nickel, Birgit; Slatkin, Montgomery; Meyer, Matthias; Pääbo, Svante; Kelso, Janet; Fu, Qiaomei

    2017-10-23

    By at least 45,000 years before present, anatomically modern humans had spread across Eurasia [1-3], but it is not well known how diverse these early populations were and whether they contributed substantially to later people or represent early modern human expansions into Eurasia that left no surviving descendants today. Analyses of genome-wide data from several ancient individuals from Western Eurasia and Siberia have shown that some of these individuals have relationships to present-day Europeans [4, 5] while others did not contribute to present-day Eurasian populations [3, 6]. As contributions from Upper Paleolithic populations in Eastern Eurasia to present-day humans and their relationship to other early Eurasians is not clear, we generated genome-wide data from a 40,000-year-old individual from Tianyuan Cave, China, [1, 7] to study his relationship to ancient and present-day humans. We find that he is more related to present-day and ancient Asians than he is to Europeans, but he shares more alleles with a 35,000-year-old European individual than he shares with other ancient Europeans, indicating that the separation between early Europeans and early Asians was not a single population split. We also find that the Tianyuan individual shares more alleles with some Native American groups in South America than with Native Americans elsewhere, providing further support for population substructure in Asia [8] and suggesting that this persisted from 40,000 years ago until the colonization of the Americas. Our study of the Tianyuan individual highlights the complex migration and subdivision of early human populations in Eurasia. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Genomic analysis of the Kiwifruit pathogen Pseudomonas syringae pv. actinidiae provides insight into the origins of an emergent plant disease.

    Directory of Open Access Journals (Sweden)

    Honour C McCann

    Full Text Available The origins of crop diseases are linked to domestication of plants. Most crops were domesticated centuries--even millennia--ago, thus limiting opportunity to understand the concomitant emergence of disease. Kiwifruit (Actinidia spp. is an exception: domestication began in the 1930s with outbreaks of canker disease caused by P. syringae pv. actinidiae (Psa first recorded in the 1980s. Based on SNP analyses of two circularized and 34 draft genomes, we show that Psa is comprised of distinct clades exhibiting negligible within-clade diversity, consistent with disease arising by independent samplings from a source population. Three clades correspond to their geographical source of isolation; a fourth, encompassing the Psa-V lineage responsible for the 2008 outbreak, is now globally distributed. Psa has an overall clonal population structure, however, genomes carry a marked signature of within-pathovar recombination. SNP analysis of Psa-V reveals hundreds of polymorphisms; however, most reside within PPHGI-1-like conjugative elements whose evolution is unlinked to the core genome. Removal of SNPs due to recombination yields an uninformative (star-like phylogeny consistent with diversification of Psa-V from a single clone within the last ten years. Growth assays provide evidence of cultivar specificity, with rapid systemic movement of Psa-V in Actinidia chinensis. Genomic comparisons show a dynamic genome with evidence of positive selection on type III effectors and other candidate virulence genes. Each clade has highly varied complements of accessory genes encoding effectors and toxins with evidence of gain and loss via multiple genetic routes. Genes with orthologs in vascular pathogens were found exclusively within Psa-V. Our analyses capture a pathogen in the early stages of emergence from a predicted source population associated with wild Actinidia species. In addition to candidate genes as targets for resistance breeding programs, our findings

  17. A transcriptomic analysis of bermudagrass (Cynodon dactylon) provides novel insights into the basis of low temperature tolerance.

    Science.gov (United States)

    Chen, Liang; Fan, Jibiao; Hu, Longxing; Hu, Zhengrong; Xie, Yan; Zhang, Yingzi; Lou, Yanhong; Nevo, Eviatar; Fu, Jinmin

    2015-09-11

    Cold stress is regarded as a key factor limiting widespread use for bermudagrass (Cynodon dactylon). Therefore, to improve cold tolerance for bermudagrass, it is urgent to understand molecular mechanisms of bermudagrass response to cold stress. However, our knowledge about the molecular responses of this species to cold stress is largely unknown. The objective of this study was to characterize the transcriptomic response to low temperature in bermudagrass by using RNA-Seq platform. Ten cDNA libraries were generated from RNA samples of leaves from five different treatments in the cold-resistant (R) and the cold-sensitive (S) genotypes, including 4 °C cold acclimation (CA) for 24 h and 48 h, freezing (-5 °C) treatments for 4 h with or without prior CA, and controls. When subjected to cold acclimation, global gene expressions were initiated more quickly in the R genotype than those in the S genotype. The R genotype activated gene expression more effectively in response to freezing temperature after 48 h CA than the S genotype. The differentially expressed genes were identified as low temperature sensing and signaling-related genes, functional proteins and transcription factors, many of which were specifically or predominantly expressed in the R genotype under cold treatments, implying that these genes play important roles in the enhanced cold hardiness of bermudagrass. KEGG pathway enrichment analysis for DEGs revealed that photosynthesis, nitrogen metabolism and carbon fixation pathways play key roles in bermudagrass response to cold stress. The results of this study may contribute to our understanding the molecular mechanism underlying the responses of bermudagrass to cold stress, and also provide important clues for further study and in-depth characterization of cold-resistance breeding candidate genes in bermudagrass.

  18. A mollusk VDR/PXR/CAR-like (NR1J) nuclear receptor provides insight into ancient detoxification mechanisms

    Energy Technology Data Exchange (ETDEWEB)

    Cruzeiro, Catarina, E-mail: catarinarcruzeiro@hotmail.com [ICBAS - Institute of Biomedical Sciences Abel Salazar, U. Porto - University of Porto (Portugal); CIIMAR/CIMAR - Interdisciplinary Center of Marine and Environmental Research, U. Porto (Portugal); Lopes-Marques, Mónica, E-mail: monicaslm@hotmail.com [ICBAS - Institute of Biomedical Sciences Abel Salazar, U. Porto - University of Porto (Portugal); CIIMAR/CIMAR - Interdisciplinary Center of Marine and Environmental Research, U. Porto (Portugal); Ruivo, Raquel, E-mail: ruivo.raquel@gmail.com [CIIMAR/CIMAR - Interdisciplinary Center of Marine and Environmental Research, U. Porto (Portugal); Rodrigues-Oliveira, Nádia, E-mail: nadia.oliveira@ciimar.up.pt [CIIMAR/CIMAR - Interdisciplinary Center of Marine and Environmental Research, U. Porto (Portugal); Santos, Miguel M., E-mail: santos@ciimar.up.pt [CIIMAR/CIMAR - Interdisciplinary Center of Marine and Environmental Research, U. Porto (Portugal); FCUP - Faculty of Sciences, Department of Biology, U. Porto (Portugal); Rocha, Maria João, E-mail: mjsrocha@netcabo.pt [ICBAS - Institute of Biomedical Sciences Abel Salazar, U. Porto - University of Porto (Portugal); CIIMAR/CIMAR - Interdisciplinary Center of Marine and Environmental Research, U. Porto (Portugal); Rocha, Eduardo, E-mail: erocha@icbas.up.pt [ICBAS - Institute of Biomedical Sciences Abel Salazar, U. Porto - University of Porto (Portugal); CIIMAR/CIMAR - Interdisciplinary Center of Marine and Environmental Research, U. Porto (Portugal); Castro, L. Filipe C., E-mail: filipe.castro@ciimar.up.pt [CIIMAR/CIMAR - Interdisciplinary Center of Marine and Environmental Research, U. Porto (Portugal); FCUP - Faculty of Sciences, Department of Biology, U. Porto (Portugal)

    2016-05-15

    Highlights: • A nuclear receptor orthologue of the NR1J group is isolated from a mollusc. • The molluscan NR1J transactivates gene expression upon exposure to okadaic acid but not a pesticide, esfenvarelate and triclosan. • Lineage specific gene duplications and gene loss have occurred in the NR1J of protostomes with likely impacts on detoxification mechanisms. - Abstract: The origin and diversification of the metazoan endocrine systems represents a fundamental research issue in biology. Nuclear receptors are critical components of these systems. A particular group named VDR/PXR/CAR (NR1I/J) is central in the mediation of detoxification responses. While orthologues have been thoroughly characterized in vertebrates, a sparse representation is currently available for invertebrates. Here, we provide the first isolation and characterization of a lophotrochozoan protostome VDR/PXR/CAR nuclear receptor (NR1J), in the estuarine bivalve the peppery furrow shell (Scrobicularia plana). Using a reporter gene assay, we evaluated the xenobiotic receptor plasticity comparing the human PXR with the S. plana NR1Jβ. Our results show that the molluscan receptor responds to a natural toxin (okadaic acid) in a similar fashion to that reported for other invertebrates. In contrast, the pesticide esfenvalerate displayed a unique response, since it down regulated transactivation at higher concentrations, while for triclosan no response was observed. Additionally, we uncovered lineage specific gene duplications and gene loss in the gene group encoding NRs in protostomes with likely impacts on the complexity of detoxification mechanisms across different phyla. Our findings pave the way for the development of multi-specific sensor tools to screen xenobiotic compounds acting via the NR1I/J group.

  19. Closed-flow column experiments—Insights into solute transport provided by a damped oscillating breakthrough behavior

    Science.gov (United States)

    Ritschel, Thomas; Totsche, Kai Uwe

    2016-03-01

    Transport studies that employ column experiments in closed-flow mode complement classical approaches by providing new characteristic features observed in the solute breakthrough and equilibrium between liquid and solid phase. Specific to the closed-flow mode is the recirculation of the effluent to the inflow via a mixing vessel. Depending on the ratio of volumes of mixing vessel and water-filled pore space, a damped oscillating solute concentration emerges in the effluent and mixing vessel. The oscillation characteristics, e.g., frequency, amplitude, and damping, allow for the investigation of solute transport in a similar fashion as known for classical open-flow column experiments. However, the closed loop conserves substances released during transport within the system. In this way, solute and porous medium can equilibrate with respect to physicochemical conditions. With this paper, the features emerging in the breakthrough curves of saturated column experiments run in closed-flow mode and methods of evaluation are illustrated under experimental boundary conditions forcing the appearance of oscillations. We demonstrate that the effective pore water volume and the pumping rate can be determined from a conservative tracer breakthrough curve uniquely. In this way, external preconditioning of the material, e.g., drying, can be avoided. A reactive breakthrough experiment revealed a significant increase in the pore water pH value as a consequence of the closed loop. These results highlight the specific impact of the closed mass balance. Furthermore, the basis for the modeling of closed-flow experiments is given by the derivation of constitutive equations and numerical implementation, validated with the presented experiments.

  20. Structure of the extracellular portion of CD46 provides insights into its interactions with complement proteins and pathogens.

    Directory of Open Access Journals (Sweden)

    B David Persson

    2010-09-01

    Full Text Available The human membrane cofactor protein (MCP, CD46 is a central component of the innate immune system. CD46 protects autologous cells from complement attack by binding to complement proteins C3b and C4b and serving as a cofactor for their cleavage. Recent data show that CD46 also plays a role in mediating acquired immune responses, and in triggering autophagy. In addition to these physiologic functions, a significant number of pathogens, including select adenoviruses, measles virus, human herpes virus 6 (HHV-6, Streptococci, and Neisseria, use CD46 as a cell attachment receptor. We have determined the crystal structure of the extracellular region of CD46 in complex with the human adenovirus type 11 fiber knob. Extracellular CD46 comprises four short consensus repeats (SCR1-SCR4 that form an elongated structure resembling a hockey stick, with a long shaft and a short blade. Domains SCR1, SCR2 and SCR3 are arranged in a nearly linear fashion. Unexpectedly, however, the structure reveals a profound bend between domains SCR3 and SCR4, which has implications for the interactions with ligands as well as the orientation of the protein at the cell surface. This bend can be attributed to an insertion of five hydrophobic residues in a SCR3 surface loop. Residues in this loop have been implicated in interactions with complement, indicating that the bend participates in binding to C3b and C4b. The structure provides an accurate framework for mapping all known ligand binding sites onto the surface of CD46, thereby advancing an understanding of how CD46 acts as a receptor for pathogens and physiologic ligands of the immune system.

  1. A mollusk VDR/PXR/CAR-like (NR1J) nuclear receptor provides insight into ancient detoxification mechanisms

    International Nuclear Information System (INIS)

    Cruzeiro, Catarina; Lopes-Marques, Mónica; Ruivo, Raquel; Rodrigues-Oliveira, Nádia; Santos, Miguel M.; Rocha, Maria João; Rocha, Eduardo; Castro, L. Filipe C.

    2016-01-01

    Highlights: • A nuclear receptor orthologue of the NR1J group is isolated from a mollusc. • The molluscan NR1J transactivates gene expression upon exposure to okadaic acid but not a pesticide, esfenvarelate and triclosan. • Lineage specific gene duplications and gene loss have occurred in the NR1J of protostomes with likely impacts on detoxification mechanisms. - Abstract: The origin and diversification of the metazoan endocrine systems represents a fundamental research issue in biology. Nuclear receptors are critical components of these systems. A particular group named VDR/PXR/CAR (NR1I/J) is central in the mediation of detoxification responses. While orthologues have been thoroughly characterized in vertebrates, a sparse representation is currently available for invertebrates. Here, we provide the first isolation and characterization of a lophotrochozoan protostome VDR/PXR/CAR nuclear receptor (NR1J), in the estuarine bivalve the peppery furrow shell (Scrobicularia plana). Using a reporter gene assay, we evaluated the xenobiotic receptor plasticity comparing the human PXR with the S. plana NR1Jβ. Our results show that the molluscan receptor responds to a natural toxin (okadaic acid) in a similar fashion to that reported for other invertebrates. In contrast, the pesticide esfenvalerate displayed a unique response, since it down regulated transactivation at higher concentrations, while for triclosan no response was observed. Additionally, we uncovered lineage specific gene duplications and gene loss in the gene group encoding NRs in protostomes with likely impacts on the complexity of detoxification mechanisms across different phyla. Our findings pave the way for the development of multi-specific sensor tools to screen xenobiotic compounds acting via the NR1I/J group.

  2. Vertical microbial community variability of carbonate-based cones may provide insight into ancient conical stromatolite formation

    Science.gov (United States)

    Bradley, James; Daille, Leslie; Trivedi, Christopher; Bojanowski, Caitlin; Nunn, Heather; Stamps, Blake; Johnson, Hope; Stevenson, Bradley; Berelson, Will; Corsetti, Frank; Spear, John

    2016-04-01

    Stromatolite morphogenesis is poorly understood, and the process by which microbial mats become mineralized is a primary question in microbialite formation. Ancient conical stromatolites are primarily carbonate-based whereas the few modern analogues in hot springs are either non-mineralized or mineralized by silica. A team from the 2015 International GeoBiology Course investigated carbonate-rich microbial cones from near Little Hot Creek (LHC), Long Valley Caldera, California, to investigate how conical stromatolites might form in a hot spring carbonate system. The cones rise up from a layered microbial mat on the east side of a 45° C pool with very low flow that is super-saturated with respect to CaCO3. Cone structures are 8-30 mm in height, are rigid and do not deform when removed from the pool. Morphological characterization through environmental scanning electronic microscopy revealed that the cone structure is maintained by a matrix of intertwining microbial filaments around carbonate grains. This matrix gives rise to cone-filaments that are arranged vertically or horizontally, and provides further stability to the cone. Preliminary 16S rRNA gene analysis indicated variability of community composition between different vertical levels of the cone. The cone tip had comparatively greater abundance of filamentous cyanobacteria including Leptolingbya, Phormidium and Isosphaera and fewer heterotrophs (e.g. Chloroflexi) compared to the cone bottom. This supports the hypothesis that cone formation may depend on the differential abundance of the microbial community and their potential functional roles. Metagenomic analyses of the cones revealed potential genes related to chemotaxis and motility. Specifically, a genomic bin identified as a member of the genus Isosphaera contained an hmp chemotaxis operon implicated in gliding motility in the cyanobacterium Nostoc punctiforme. Isosphaera is a Planctomycete shown to have phototactic capabilities, and may play a role in

  3. Dead Sea pollen provides new insights into the paleoenvironment of the southern Levant during MIS 6-5

    Science.gov (United States)

    Chen, Chunzhu; Litt, Thomas

    2018-05-01

    The paleoclimate of the southern Levant, especially during the last interglacial (LIG), is still under debate. Reliable paleovegetation information for this period, as independent evidence to the paleoenvironment, was still missing. In this study, we present a high-resolution pollen record encompassing 147-89 ka from the Dead Sea deep drilling core 5017-1A. The sediment profile is marked by alternations of laminated marl deposits and thick massive halite, indicating lake-level fluctuations. The pollen record suggests that steppe and desert components predominated in the Dead Sea surroundings during the whole investigated interval. The late penultimate glacial (147.3-130.9 ka) and early last glacial (115.5-89.1 ka) were cool and relatively dry, with sub-humid conditions confined to the mountains that sustained moderate amounts of deciduous oaks. Prior to the LIG optimum, a prevalence of desert components and a concomitant increase in frost-sensitive pistachio trees demonstrate the occurrence of an arid initial warming phase (130.9-124.2 ka). The LIG optimum (124.2 ka-115.5 ka) was initiated by an abrupt grass expansion that was followed by a rapid spread of woodlands in the mountains due to increased moisture availability. The remarkable sclerophyllous expansion points to a strong seasonal moisture deficit. These results contradict previous Dead Sea lake-level investigations that suggested pluvial glacials and a warm, dry LIG in the southern Levant. Prominent discrepancies between vegetation and Dead Sea lake stands are also registered at 128-115 ka, and the potential causes are discussed. In particular, while the pollen spectra mirror increased effective moisture during the LIG optimum, the massive halite deposition is indicative of an extremely low lake level. Given that the climate amelioration triggered the migration of early modern humans to the southern Levant, we speculate that the diverse ecosystems in the region provided great potential for their residence

  4. Alternating gender incongruity: a new neuropsychiatric syndrome providing insight into the dynamic plasticity of brain-sex.

    Science.gov (United States)

    Case, Laura K; Ramachandran, Vilayanur S

    2012-05-01

    , which we are currently exploring. Second, we base our hypotheses on ancient and modern associations between the left and right hemispheres and the male and female genders. By providing a case of sharp brain-sex shifts within individuals, we believe that the study of AGI could prove illuminating to scientific understanding of gender, body representation, and the nature of self. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. Molecular Phylogeny and Dating of Forsythieae (Oleaceae) Provide Insight into the Miocene History of Eurasian Temperate Shrubs.

    Science.gov (United States)

    Ha, Young-Ho; Kim, Changkyun; Choi, Kyung; Kim, Joo-Hwan

    2018-01-01

    Tribe Forsythieae (Oleaceae), containing two genera ( Abeliophyllum and Forsythia ) and 13 species, is economically important plants used as ornamentals and in traditional medicine. This tribe species occur primarily in mountainous regions of Eurasia with the highest species diversity in East Asia. Here, we examine 11 complete chloroplast genome and nuclear cycloidea2 ( cyc2 ) DNA sequences of 10 Forsythia species and Abeliophyllum distichum using Illumina platform to provide the phylogeny and biogeographic history of the tribe. The chloroplast genomes of the 11 Forsythieae species are highly conserved, except for a deletion of about 400 bp in the accD - psaI region detected only in Abeliophyllum . Within Forsythieae species, analysis of repetitive sequences revealed a total of 51 repeats comprising 26 forward repeats, 22 palindromic repeats, and 3 reverse repeats. Of those, 19 repeats were common and 32 were unique to one or more Forsythieae species. Our phylogenetic analyses supported the monophyly of Forsythia and its sister group is Abeliophyllum using the concatenated dataset of 78 chloroplast genes. Within Forsythia , Forsythia likiangensis and F. giraldiana were basal lineages followed by F. europaea ; the three species are characterized by minutely serrate or entire leaf margins. The remaining species, which are distributed in East Asia, formed two major clades. One clade included F. ovata , F. velutina , and F. japonica ; they are morphologically supported by broadly ovate leaves. Another clade of F. suspensa , F. saxatilis , F. viridissima , and F. koreana characterized by lanceolate leaves (except F. suspensa which have broad ovate leaves). Although cyc2 phylogeny is largely congruent to chloroplast genome phylogeny, we find the discordance between two phylogenies in the position of F. ovata suggesting that introgression of the chloroplast genome from one species into the nuclear background of another by interspecific hybridization in East Asian

  6. Molecular Phylogeny and Dating of Forsythieae (Oleaceae Provide Insight into the Miocene History of Eurasian Temperate Shrubs

    Directory of Open Access Journals (Sweden)

    Young-Ho Ha

    2018-02-01

    Full Text Available Tribe Forsythieae (Oleaceae, containing two genera (Abeliophyllum and Forsythia and 13 species, is economically important plants used as ornamentals and in traditional medicine. This tribe species occur primarily in mountainous regions of Eurasia with the highest species diversity in East Asia. Here, we examine 11 complete chloroplast genome and nuclear cycloidea2 (cyc2 DNA sequences of 10 Forsythia species and Abeliophyllum distichum using Illumina platform to provide the phylogeny and biogeographic history of the tribe. The chloroplast genomes of the 11 Forsythieae species are highly conserved, except for a deletion of about 400 bp in the accD–psaI region detected only in Abeliophyllum. Within Forsythieae species, analysis of repetitive sequences revealed a total of 51 repeats comprising 26 forward repeats, 22 palindromic repeats, and 3 reverse repeats. Of those, 19 repeats were common and 32 were unique to one or more Forsythieae species. Our phylogenetic analyses supported the monophyly of Forsythia and its sister group is Abeliophyllum using the concatenated dataset of 78 chloroplast genes. Within Forsythia, Forsythia likiangensis and F. giraldiana were basal lineages followed by F. europaea; the three species are characterized by minutely serrate or entire leaf margins. The remaining species, which are distributed in East Asia, formed two major clades. One clade included F. ovata, F. velutina, and F. japonica; they are morphologically supported by broadly ovate leaves. Another clade of F. suspensa, F. saxatilis, F. viridissima, and F. koreana characterized by lanceolate leaves (except F. suspensa which have broad ovate leaves. Although cyc2 phylogeny is largely congruent to chloroplast genome phylogeny, we find the discordance between two phylogenies in the position of F. ovata suggesting that introgression of the chloroplast genome from one species into the nuclear background of another by interspecific hybridization in East Asian

  7. Geophysical insights on the GIA process provided by high-quality constraints from peripheral regions: An outlook on perspectives from North America and from the Mediterranean basin

    Science.gov (United States)

    Roy, K.; Peltier, W. R.

    2017-12-01

    Our understanding of the Earth-Ice-Ocean interactions that have accompanied the large glaciation-deglaciation process characteristic of the last half of the Pleistocene has benefited significantly from the development of high-quality models of the Glacial Isostatic Adjustment (GIA) process. These models provide fundamental insight on the large changes in sea level and land ice cover over this time period, as well as key constraints on the viscosity structure of the Earth's interior. Their development has benefited from the recent availability of high-quality constraints from regions of forebulge collapse. In particular, over North America, the joint use of high-quality sea level data from the U.S. East coast, together with the vast network of precise space-geodetic observations of crustal motion existing over most of the interior of the continent, has led to the latest ICE-7G_NA (VM7) model (Roy & Peltier, GJI, 2017). In this paper, exciting opportunities provided by such high-quality observations related to the GIA process will be discussed, not only in the context of the continuing effort to refine global models of this phenomenon, but also in terms of the fundamental insight they may provide on outstanding issues in high-pressure geophysics, paleoclimatology or hydrogeology. Specific examples where such high-quality observations can be used (either separately, or using a combination of independent sources) will be presented, focusing particularly on constraints from the North American continent and from the Mediterranean basin. This work will demonstrate that, given the high-quality of currently available constraints on the GIA process, considerable further geophysical insight can be obtained based upon the use of spherically-symmetric models of the viscosity structure of the planet.

  8. Transcriptomes and expression profiling of deep-sea corals from the Red Sea provide insight into the biology of azooxanthellate corals

    KAUST Repository

    Yum, Lauren

    2017-07-19

    Despite the importance of deep-sea corals, our current understanding of their ecology and evolution is limited due to difficulties in sampling and studying deep-sea environments. Moreover, a recent re-evaluation of habitat limitations has been suggested after characterization of deep-sea corals in the Red Sea, where they live at temperatures of above 20 °C at low oxygen concentrations. To gain further insight into the biology of deep-sea corals, we produced reference transcriptomes and studied gene expression of three deep-sea coral species from the Red Sea, i.e. Dendrophyllia sp., Eguchipsammia fistula, and Rhizotrochus typus. Our analyses suggest that deep-sea coral employ mitochondrial hypometabolism and anaerobic glycolysis to manage low oxygen conditions present in the Red Sea. Notably, we found expression of genes related to surface cilia motion that presumably enhance small particle transport rates in the oligotrophic deep-sea environment. This is the first study to characterize transcriptomes and in situ gene expression for deep-sea corals. Our work offers several mechanisms by which deep-sea corals might cope with the distinct environmental conditions present in the Red Sea As such, our data provide direction for future research and further insight to organismal response of deep-sea coral to environmental change and ocean warming.

  9. Transcriptomes and expression profiling of deep-sea corals from the Red Sea provide insight into the biology of azooxanthellate corals.

    Science.gov (United States)

    Yum, Lauren K; Baumgarten, Sebastian; Röthig, Till; Roder, Cornelia; Roik, Anna; Michell, Craig; Voolstra, Christian R

    2017-07-25

    Despite the importance of deep-sea corals, our current understanding of their ecology and evolution is limited due to difficulties in sampling and studying deep-sea environments. Moreover, a recent re-evaluation of habitat limitations has been suggested after characterization of deep-sea corals in the Red Sea, where they live at temperatures of above 20 °C at low oxygen concentrations. To gain further insight into the biology of deep-sea corals, we produced reference transcriptomes and studied gene expression of three deep-sea coral species from the Red Sea, i.e. Dendrophyllia sp., Eguchipsammia fistula, and Rhizotrochus typus. Our analyses suggest that deep-sea coral employ mitochondrial hypometabolism and anaerobic glycolysis to manage low oxygen conditions present in the Red Sea. Notably, we found expression of genes related to surface cilia motion that presumably enhance small particle transport rates in the oligotrophic deep-sea environment. This is the first study to characterize transcriptomes and in situ gene expression for deep-sea corals. Our work offers several mechanisms by which deep-sea corals might cope with the distinct environmental conditions present in the Red Sea As such, our data provide direction for future research and further insight to organismal response of deep-sea coral to environmental change and ocean warming.

  10. Transcriptomes and expression profiling of deep-sea corals from the Red Sea provide insight into the biology of azooxanthellate corals

    KAUST Repository

    Yum, Lauren; Baumgarten, Sebastian; Rö thig, Till; Roder, Cornelia; Roik, Anna Krystyna; Michell, Craig; Voolstra, Christian R.

    2017-01-01

    Despite the importance of deep-sea corals, our current understanding of their ecology and evolution is limited due to difficulties in sampling and studying deep-sea environments. Moreover, a recent re-evaluation of habitat limitations has been suggested after characterization of deep-sea corals in the Red Sea, where they live at temperatures of above 20 °C at low oxygen concentrations. To gain further insight into the biology of deep-sea corals, we produced reference transcriptomes and studied gene expression of three deep-sea coral species from the Red Sea, i.e. Dendrophyllia sp., Eguchipsammia fistula, and Rhizotrochus typus. Our analyses suggest that deep-sea coral employ mitochondrial hypometabolism and anaerobic glycolysis to manage low oxygen conditions present in the Red Sea. Notably, we found expression of genes related to surface cilia motion that presumably enhance small particle transport rates in the oligotrophic deep-sea environment. This is the first study to characterize transcriptomes and in situ gene expression for deep-sea corals. Our work offers several mechanisms by which deep-sea corals might cope with the distinct environmental conditions present in the Red Sea As such, our data provide direction for future research and further insight to organismal response of deep-sea coral to environmental change and ocean warming.

  11. Correlation of proteome-wide changes with social immunity behaviors provides insight into resistance to the parasitic mite, Varroa destructor, in the honey bee (Apis mellifera).

    Science.gov (United States)

    Parker, Robert; Guarna, M Marta; Melathopoulos, Andony P; Moon, Kyung-Mee; White, Rick; Huxter, Elizabeth; Pernal, Stephen F; Foster, Leonard J

    2012-06-29

    Disease is a major factor driving the evolution of many organisms. In honey bees, selection for social behavioral responses is the primary adaptive process facilitating disease resistance. One such process, hygienic behavior, enables bees to resist multiple diseases, including the damaging parasitic mite Varroa destructor. The genetic elements and biochemical factors that drive the expression of these adaptations are currently unknown. Proteomics provides a tool to identify proteins that control behavioral processes, and these proteins can be used as biomarkers to aid identification of disease tolerant colonies. We sampled a large cohort of commercial queen lineages, recording overall mite infestation, hygiene, and the specific hygienic response to V. destructor. We performed proteome-wide correlation analyses in larval integument and adult antennae, identifying several proteins highly predictive of behavior and reduced hive infestation. In the larva, response to wounding was identified as a key adaptive process leading to reduced infestation, and chitin biosynthesis and immune responses appear to represent important disease resistant adaptations. The speed of hygienic behavior may be underpinned by changes in the antenna proteome, and chemosensory and neurological processes could also provide specificity for detection of V. destructor in antennae. Our results provide, for the first time, some insight into how complex behavioural adaptations manifest in the proteome of honey bees. The most important biochemical correlations provide clues as to the underlying molecular mechanisms of social and innate immunity of honey bees. Such changes are indicative of potential divergence in processes controlling the hive-worker maturation.

  12. High-frequency DOC and nitrate measurements provide new insights into their export and their relationships to rainfall-runoff processes

    Science.gov (United States)

    Schwab, Michael; Klaus, Julian; Pfister, Laurent; Weiler, Markus

    2015-04-01

    Over the past decades, stream sampling protocols for environmental tracers were often limited by logistical and technological constraints. Long-term sampling programs would typically rely on weekly sampling campaigns, while high-frequency sampling would remain restricted to a few days or hours at best. We stipulate that the currently predominant sampling protocols are too coarse to capture and understand the full amplitude of rainfall-runoff processes and its relation to water quality fluctuations. Weekly sampling protocols are not suited to get insights into the hydrological system during high flow conditions. Likewise, high frequency measurements of a few isolated events do not allow grasping inter-event variability in contributions and processes. Our working hypothesis is based on the potential of a new generation of field-deployable instruments for measuring environmental tracers at high temporal frequencies over an extended period. With this new generation of instruments we expect to gain new insights into rainfall-runoff dynamics, both at intra- and inter-event scales. Here, we present the results of one year of DOC and nitrate measurements with the field deployable UV-Vis spectrometer spectro::lyser (scan Messtechnik GmbH). The instrument measures the absorption spectrum from 220 to 720 nm in situ and at high frequencies and derives DOC and nitrate concentrations. The measurements were carried out at 15 minutes intervals in the Weierbach catchment (0.47 km2) in Luxemburg. This fully forested catchment is characterized by cambisol soils and fractured schist as underlying bedrock. The time series of DOC and nitrate give insights into the high frequency dynamics of stream water. Peaks in DOC concentrations are closely linked to discharge peaks that occur during or right after a rainfall event. Those first discharge peaks can be linked to fast near surface runoff processes and are responsible for a remarkable amount of DOC export. A special characterisation of

  13. Ancient duplications and functional divergence in the interferon regulatory factors of vertebrates provide insights into the evolution of vertebrate immune systems.

    Science.gov (United States)

    Du, Kang; Zhong, Zaixuan; Fang, Chengchi; Dai, Wei; Shen, Yanjun; Gan, Xiaoni; He, Shunping

    2018-04-01

    Interferon regulatory factors (IRFs) were first discovered as transcription factors that regulate the transcription of human interferon (IFN)-β. Increasing evidence shows that they might be important players involved in Adaptive immune system (AIS) evolution. Although numbers of IRFs have been identified in chordates, the evolutionary history and functional diversity of this gene family during the early evolution of vertebrates have remained obscure. Using IRF HMM profile and HMMER searches, we identified 148 IRFs in 11 vertebrates and 4 protochordates. For them, we reconstructed the phylogenetic relationships, determined the synteny conservation, investigated the profile of natural selection, and analyzed the expression patterns in four "living fossil" vertebrates: lamprey, elephant shark, coelacanth and bichir. The results from phylogeny and synteny analysis imply that vertebrate IRFs evolved from three predecessors, instead of four as suggested in a previous study, as results from an ancient duplication followed by special expansions and lost during the vertebrate evolution. The profile of natural selection and expression reveals functional dynamics during the process. Together, they suggest that the 2nd whole-genome duplication (2WGD) provided raw materials for innovation in the IRF family, and that the birth of type-I IFN might be an important factor inducing the establishment of IRF-mediated immune networks. As a member involved in the AIS evolution, IRF provide insights into the process and mechanism involved in the complexity and novelties of vertebrate immune systems. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  14. A high-quality genome assembly of quinoa provides insights into the molecular basis of salt bladder-based salinity tolerance and the exceptional nutritional value

    Science.gov (United States)

    Zou, Changsong; Chen, Aojun; Xiao, Lihong; Muller, Heike M; Ache, Peter; Haberer, Georg; Zhang, Meiling; Jia, Wei; Deng, Ping; Huang, Ru; Lang, Daniel; Li, Feng; Zhan, Dongliang; Wu, Xiangyun; Zhang, Hui; Bohm, Jennifer; Liu, Renyi; Shabala, Sergey; Hedrich, Rainer; Zhu, Jian-Kang; Zhang, Heng

    2017-01-01

    Chenopodium quinoa is a halophytic pseudocereal crop that is being cultivated in an ever-growing number of countries. Because quinoa is highly resistant to multiple abiotic stresses and its seed has a better nutritional value than any other major cereals, it is regarded as a future crop to ensure global food security. We generated a high-quality genome draft using an inbred line of the quinoa cultivar Real. The quinoa genome experienced one recent genome duplication about 4.3 million years ago, likely reflecting the genome fusion of two Chenopodium parents, in addition to the γ paleohexaploidization reported for most eudicots. The genome is highly repetitive (64.5% repeat content) and contains 54 438 protein-coding genes and 192 microRNA genes, with more than 99.3% having orthologous genes from glycophylic species. Stress tolerance in quinoa is associated with the expansion of genes involved in ion and nutrient transport, ABA homeostasis and signaling, and enhanced basal-level ABA responses. Epidermal salt bladder cells exhibit similar characteristics as trichomes, with a significantly higher expression of genes related to energy import and ABA biosynthesis compared with the leaf lamina. The quinoa genome sequence provides insights into its exceptional nutritional value and the evolution of halophytes, enabling the identification of genes involved in salinity tolerance, and providing the basis for molecular breeding in quinoa. PMID:28994416

  15. A comprehensive comparison of four species of Onchidiidae provides insights on the morphological and molecular adaptations of invertebrates from shallow seas to wetlands

    Science.gov (United States)

    Wang, Dongfeng; Li, Jie; Liu, Xin; Wu, Xin

    2018-01-01

    The Onchidiidae family is ideal for studying the evolution of marine invertebrate species from sea to wetland environments. However, comparative studies of Onchidiidae species are rare. A total of 40 samples were collected from four species (10 specimens per onchidiid), and their histological and molecular differences were systematically evaluated to elucidate the morphological foundations underlying the adaptations of these species. A histological analysis was performed to compare the structures of respiratory organs (gill, lung sac, dorsal skin) among onchidiids, and transcriptome sequencing of four representative onchidiids was performed to investigate the molecular mechanisms associated with their respective habitats. Twenty-six SNP markers of Onchidium reevesii revealed some DNA polymorphisms determining visible traits. Non-muscle myosin heavy chain II (NMHC II) and myosin heavy chain (MyHC), which play essential roles in amphibian developmental processes, were found to be differentially expressed in different onchidiids and tissues. The species with higher terrestrial ability and increased integrated expression of Os-MHC (NMHC II gene) and the MyHC gene, illustrating that the expression levels of these genes were associated with the evolutionary degree. This study provides a comprehensive analysis of the adaptions of a diverse and widespread group of invertebrates, the Onchidiidae. Some onchidiids can breathe well through gills and skin when under seawater, and some can breathe well through lung sacs and skin when in wetlands. A histological comparison of respiratory organs and the relative expression levels of two genes provided insights into the adaptions of onchidiids that allowed their transition from shallow seas to wetlands. This work provides a valuable reference and might encourage further study. PMID:29698429

  16. iTRAQ and RNA-Seq Analyses Provide New Insights into Regulation Mechanism of Symbiotic Germination of Dendrobium officinale Seeds (Orchidaceae).

    Science.gov (United States)

    Chen, Juan; Liu, Si Si; Kohler, Annegret; Yan, Bo; Luo, Hong Mei; Chen, Xiao Mei; Guo, Shun Xing

    2017-06-02

    Mycorrhizal fungi colonize orchid seeds and induce germination. This so-called symbiotic germination is a critical developmental process in the lifecycle of all orchid species. However, the molecular changes that occur during orchid seed symbiotic germination remain largely unknown. To better understand the molecular mechanism of orchid seed germination, we performed a comparative transcriptomic and proteomic analysis of the Chinese traditional medicinal orchid Dendrobium officinale to explore the change in protein expression at the different developmental stages during asymbiotic and symbiotic germination and identify the key proteins that regulate the symbiotic germination of orchid seeds. Among 2256 identified plant proteins, 308 were differentially expressed across three developmental stages during asymbiotic and symbiotic germination, and 229 were differentially expressed during symbiotic germination compared to asymbiotic development. Of these, 32 proteins were coup-regulated at both the proteomic and transcriptomic levels during symbiotic germination compared to asymbiotic germination. Our results suggest that symbiotic germination of D. officinale seeds shares a common signaling pathway with asymbiotic germination during the early germination stage. However, compared to asymbiotic germination, fungal colonization of orchid seeds appears to induce higher and earlier expression of some key proteins involved in lipid and carbohydrate metabolism and thus improves the efficiency of utilization of stored substances present in the embryo. This study provides new insight into the molecular basis of orchid seed germination.

  17. Ninety-nine de novo assembled genomes from the moose (Alces alces) rumen microbiome provide new insights into microbial plant biomass degradation

    Science.gov (United States)

    Svartström, Olov; Alneberg, Johannes; Terrapon, Nicolas; Lombard, Vincent; de Bruijn, Ino; Malmsten, Jonas; Dalin, Ann-Marie; Muller, Emilie E.L.; Shah, Pranjul; Wilmes, Paul; Henrissat, Bernard; Aspeborg, Henrik; Andersson, Anders F.

    2017-01-01

    The moose (Alces alces) is a ruminant that harvests energy from fiber-rich lignocellulose material through carbohydrate-active enzymes (CAZymes) produced by its rumen microbes. We applied shotgun metagenomics to rumen contents from six moose to obtain insights into this microbiome. Following binning, 99 metagenome-assembled genomes (MAGs) belonging to eleven prokaryotic phyla were reconstructed and characterized based on phylogeny and CAZyme profile. The taxonomy of these MAGs reflected the overall composition of the metagenome, with dominance of the phyla Bacteroidetes and Firmicutes. Unlike in other ruminants, Spirochaetes constituted a significant proportion of the community and our analyses indicate that the corresponding strains are primarily pectin digesters. Pectin-degrading genes were also common in MAGs of Ruminococcus, Fibrobacteres and Bacteroidetes, and were overall overrepresented in the moose microbiome compared to other ruminants. Phylogenomic analyses revealed several clades within the Bacteriodetes without previously characterized genomes. Several of these MAGs encoded a large numbers of dockerins, a module usually associated with cellulosomes. The Bacteroidetes dockerins were often linked to CAZymes and sometimes encoded inside polysaccharide utilization loci (PULs), which has never been reported before. The almost one hundred CAZyme-annotated genomes reconstructed in this study provides an in-depth view of an efficient lignocellulose-degrading microbiome and prospects for developing enzyme technology for biorefineries. PMID:28731473

  18. Genome-wide characterization of differentially expressed genes provides insights into regulatory network of heat stress response in radish (Raphanus sativus L.).

    Science.gov (United States)

    Wang, Ronghua; Mei, Yi; Xu, Liang; Zhu, Xianwen; Wang, Yan; Guo, Jun; Liu, Liwang

    2018-03-01

    Heat stress (HS) causes detrimental effects on plant morphology, physiology, and biochemistry that lead to drastic reduction in plant biomass production and economic yield worldwide. To date, little is known about HS-responsive genes involved in thermotolerance mechanism in radish. In this study, a total of 6600 differentially expressed genes (DEGs) from the control and Heat24 cDNA libraries of radish were isolated by high-throughput sequencing. With Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, some genes including MAPK, DREB, ERF, AP2, GST, Hsf, and Hsp were predominantly assigned in signal transductions, metabolic pathways, and biosynthesis and abiotic stress-responsive pathways. These pathways played significant roles in reducing stress-induced damages and enhancing heat tolerance in radish. Expression patterns of 24 candidate genes were validated by reverse-transcription quantitative PCR (RT-qPCR). Based mainly on the analysis of DEGs combining with the previous miRNAs analysis, the schematic model of HS-responsive regulatory network was proposed. To counter the effects of HS, a rapid response of the plasma membrane leads to the opening of specific calcium channels and cytoskeletal reorganization, after which HS-responsive genes are activated to repair damaged proteins and ultimately facilitate further enhancement of thermotolerance in radish. These results could provide fundamental insight into the regulatory network underlying heat tolerance in radish and facilitate further genetic manipulation of thermotolerance in root vegetable crops.

  19. Whole genome sequencing of a banana wild relative Musa itinerans provides insights into lineage-specific diversification of the Musa genus.

    Science.gov (United States)

    Wu, Wei; Yang, Yu-Lan; He, Wei-Ming; Rouard, Mathieu; Li, Wei-Ming; Xu, Meng; Roux, Nicolas; Ge, Xue-Jun

    2016-08-17

    Crop wild relatives are valuable resources for future genetic improvement. Here, we report the de novo genome assembly of Musa itinerans, a disease-resistant wild banana relative in subtropical China. The assembled genome size was 462.1 Mb, covering 75.2% of the genome (615.2Mb) and containing 32, 456 predicted protein-coding genes. Since the approximate divergence around 5.8 million years ago, the genomes of Musa itinerans and Musa acuminata have shown conserved collinearity. Gene family expansions and contractions enrichment analysis revealed that some pathways were associated with phenotypic or physiological innovations. These include a transition from wood to herbaceous in the ancestral Musaceae, intensification of cold and drought tolerances, and reduced diseases resistance genes for subtropical marginally distributed Musa species. Prevalent purifying selection and transposed duplications were found to facilitate the diversification of NBS-encoding gene families for two Musa species. The population genome history analysis of M. itinerans revealed that the fluctuated population sizes were caused by the Pleistocene climate oscillations, and that the formation of Qiongzhou Strait might facilitate the population downsizing on the isolated Hainan Island about 10.3 Kya. The qualified assembly of the M. itinerans genome provides deep insights into the lineage-specific diversification and also valuable resources for future banana breeding.

  20. Deletion of thyrotropin receptor residue Asp403 in a hyperfunctioning thyroid nodule provides insight into the role of the ectodomain in ligand-induced receptor activation.

    Science.gov (United States)

    Nishihara, E; Chen, C-R; Mizutori-Sasai, Y; Ito, M; Kubota, S; Amino, N; Miyauchi, A; Rapoport, B

    2012-01-01

    Somatic mutations of the TSH receptor (TSHR) gene are the main cause of autonomously functioning thyroid nodules. Except for mutations in ectodomain residue S281, all of the numerous reported activating mutations are in the TSHR membrane-spanning region. Here, we describe a patient with a toxic adenoma with a novel heterozygous somatic mutation caused by deletion of ectodomain residue Asp403 (Del-D403). Subsequent in vitro functional studies of the Del-D403 TSHR mutation demonstrated greatly increased ligand-independent constitutive activity, 8-fold above that of the wild-type TSHR. TSH stimulation had little further effect, indicating that the mutation produced near maximal activation of the receptor. In summary, we report only the second TSHR ectodomain activating mutation (and the first ectodomain deletion mutation) responsible for development of a thyroid toxic adenoma. Because Del-D403 causes near maximal activation, our finding provides novel insight into TSHR structure and function; residue D403 is more likely to be involved in the ligand-mediated activating pathway than in the ectodomain inverse agonist property.

  1. Genome-scale metabolic modeling to provide insight into the production of storage compounds during feast-famine cycles of activated sludge.

    Science.gov (United States)

    Tajparast, Mohammad; Frigon, Dominic

    2013-01-01

    Studying storage metabolism during feast-famine cycles of activated sludge treatment systems provides profound insight in terms of both operational issues (e.g., foaming and bulking) and process optimization for the production of value added by-products (e.g., bioplastics). We examined the storage metabolism (including poly-β-hydroxybutyrate [PHB], glycogen, and triacylglycerols [TAGs]) during feast-famine cycles using two genome-scale metabolic models: Rhodococcus jostii RHA1 (iMT1174) and Escherichia coli K-12 (iAF1260) for growth on glucose, acetate, and succinate. The goal was to develop the proper objective function (OF) for the prediction of the main storage compound produced in activated sludge for given feast-famine cycle conditions. For the flux balance analysis, combinations of three OFs were tested. For all of them, the main OF was to maximize growth rates. Two additional sub-OFs were used: (1) minimization of biochemical fluxes, and (2) minimization of metabolic adjustments (MoMA) between the feast and famine periods. All (sub-)OFs predicted identical substrate-storage associations for the feast-famine growth of the above-mentioned metabolic models on a given substrate when glucose and acetate were set as sole carbon sources (i.e., glucose-glycogen and acetate-PHB), in agreement with experimental observations. However, in the case of succinate as substrate, the predictions depended on the network structure of the metabolic models such that the E. coli model predicted glycogen accumulation and the R. jostii model predicted PHB accumulation. While the accumulation of both PHB and glycogen was observed experimentally, PHB showed higher dynamics during an activated sludge feast-famine growth cycle with succinate as substrate. These results suggest that new modeling insights between metabolic predictions and population ecology will be necessary to properly predict metabolisms likely to emerge within the niches of activated sludge communities. Nonetheless

  2. Dilution of 10Be in detrital quartz by earthquake-induced landslides: Implications for determining denudation rates and potential to provide insights into landslide sediment dynamics

    Science.gov (United States)

    West, A. Joshua; Hetzel, Ralf; Li, Gen; Jin, Zhangdong; Zhang, Fei; Hilton, Robert G.; Densmore, Alexander L.

    2014-06-01

    hydrological gauging, respectively. Such information could provide new insight into sediment transfer, with implications for secondary sediment-related hazards and for understanding the removal of mass from mountains.

  3. Transcriptome analysis of skin fibroblasts with dominant negative COL3A1 mutations provides molecular insights into the etiopathology of vascular Ehlers-Danlos syndrome.

    Science.gov (United States)

    Chiarelli, Nicola; Carini, Giulia; Zoppi, Nicoletta; Ritelli, Marco; Colombi, Marina

    2018-01-01

    Vascular Ehlers-Danlos syndrome (vEDS) is a dominantly inherited connective tissue disorder caused by mutations in the COL3A1 gene that encodes type III collagen (COLLIII), which is the major expressed collagen in blood vessels and hollow organs. The majority of disease-causing variants in COL3A1 are glycine substitutions and in-frame splice mutations in the triple helix domain that through a dominant negative effect are associated with the severe clinical spectrum potentially lethal of vEDS, characterized by fragility of soft connective tissues with arterial and organ ruptures. To shed lights into molecular mechanisms underlying vEDS, we performed gene expression profiling in cultured skin fibroblasts from three patients with different structural COL3A1 mutations. Transcriptome analysis revealed significant changes in the expression levels of several genes involved in maintenance of cell redox and endoplasmic reticulum (ER) homeostasis, COLLs folding and extracellular matrix (ECM) organization, formation of the proteasome complex, and cell cycle regulation. Protein analyses showed that aberrant COLLIII expression is associated with the disassembly of many structural ECM constituents, such as fibrillins, EMILINs, and elastin, as well as with the reduction of the proteoglycans perlecan, decorin, and versican, all playing an important role in the vascular system. Furthermore, the altered distribution of the ER marker protein disulfide isomerase PDI and the strong reduction of the COLLs-modifying enzyme FKBP22 are consistent with the disturbance of ER-related homeostasis and COLLs biosynthesis and post-translational modifications, indicated by microarray analysis. Our findings add new insights into the pathophysiology of this severe vascular disorder, since they provide a picture of the gene expression changes in vEDS skin fibroblasts and highlight that dominant negative mutations in COL3A1 also affect post-translational modifications and deposition into the ECM of

  4. Transcriptome analysis of skin fibroblasts with dominant negative COL3A1 mutations provides molecular insights into the etiopathology of vascular Ehlers-Danlos syndrome.

    Directory of Open Access Journals (Sweden)

    Nicola Chiarelli

    Full Text Available Vascular Ehlers-Danlos syndrome (vEDS is a dominantly inherited connective tissue disorder caused by mutations in the COL3A1 gene that encodes type III collagen (COLLIII, which is the major expressed collagen in blood vessels and hollow organs. The majority of disease-causing variants in COL3A1 are glycine substitutions and in-frame splice mutations in the triple helix domain that through a dominant negative effect are associated with the severe clinical spectrum potentially lethal of vEDS, characterized by fragility of soft connective tissues with arterial and organ ruptures. To shed lights into molecular mechanisms underlying vEDS, we performed gene expression profiling in cultured skin fibroblasts from three patients with different structural COL3A1 mutations. Transcriptome analysis revealed significant changes in the expression levels of several genes involved in maintenance of cell redox and endoplasmic reticulum (ER homeostasis, COLLs folding and extracellular matrix (ECM organization, formation of the proteasome complex, and cell cycle regulation. Protein analyses showed that aberrant COLLIII expression is associated with the disassembly of many structural ECM constituents, such as fibrillins, EMILINs, and elastin, as well as with the reduction of the proteoglycans perlecan, decorin, and versican, all playing an important role in the vascular system. Furthermore, the altered distribution of the ER marker protein disulfide isomerase PDI and the strong reduction of the COLLs-modifying enzyme FKBP22 are consistent with the disturbance of ER-related homeostasis and COLLs biosynthesis and post-translational modifications, indicated by microarray analysis. Our findings add new insights into the pathophysiology of this severe vascular disorder, since they provide a picture of the gene expression changes in vEDS skin fibroblasts and highlight that dominant negative mutations in COL3A1 also affect post-translational modifications and deposition

  5. Investigation of bacterial communities within the digestive organs of the hydrothermal vent shrimp Rimicaris exoculata provide insights into holobiont geographic clustering.

    Directory of Open Access Journals (Sweden)

    Dominique A Cowart

    Full Text Available Prokaryotic communities forming symbiotic relationships with the vent shrimp, Rimicaris exoculata, are well studied components of hydrothermal ecosystems at the Mid-Atlantic Ridge (MAR. Despite the tight link between host and symbiont, the observed lack of spatial genetic structure seen in R. exoculata contrasts with the geographic differentiation detected in specific bacterial ectosymbionts. The geographic clustering of bacterial lineages within a seemingly panmictic host suggests either the presence of finer scale restriction to gene flow not yet detected in the host, horizontal transmission (environmental selection of its endosymbionts as a consequence of unique vent geochemistry, or vertically transmitted endosymbionts that exhibit genetic differentiation. To identify which hypothesis best fits, we tested whether bacterial assemblages exhibit differentiation across sites or host populations by performing a 16S rRNA metabarcoding survey on R. exoculata digestive prokaryote samples (n = 31 taken from three geochemically distinct vents across MAR: Rainbow, Trans-Atlantic Geotraverse (TAG and Logatchev. Analysis of communities across two organs (digestive tract, stomach, three molt colors (white, red, black and three life stages (eggs, juveniles, adults also provided insights into symbiont transmission mode. Examining both whole communities and operational taxonomic units (OTUs confirmed the presence of three main epibionts: Epsilonproteobacteria, Mollicutes and Deferribacteres. With these findings, we identified a clear pattern of geographic segregation by vent in OTUs assigned to Epsilonproteobacteria. Additionally, we detected evidence for differentiation among all communities associated to vents and life stages. Overall, results suggest a combination of environmental selection and vertical inheritance of some of the symbiotic lineages.

  6. Expression and phylogenetic analyses of the Gel/Gas proteins of Tuber melanosporum provide insights into the function and evolution of glucan remodeling enzymes in fungi.

    Science.gov (United States)

    Sillo, Fabiano; Gissi, Carmela; Chignoli, Daniele; Ragni, Enrico; Popolo, Laura; Balestrini, Raffaella

    2013-04-01

    The β(1,3)-glucanosyltransferases of the GH72 family are redundant enzymes that are essential for the formation and dynamic remodeling of the fungal wall during different stages of the life cycle. Four putative genes encoding glycosylphosphatidylinositol (GPI)-anchored β(1,3)-glucanosyltransferases, designated TmelGEL1, TmelGEL2, TmelGEL4 and TmelGAS4, have been annotated in the genome of Tuber melanosporum, an ectomycorrhizal fungus that also produces a hypogeous fruiting body (FB) of great commercial value (black truffle). This work focuses on the characterization and expression of this multigene family by taking advantage of a laser microdissection (LMD) technology that has been used to separate two distinct compartments in the FB, the hyphae and the asci containing the ascospores. Of the four genes, TmelGEL1 was the most up-regulated in the FB compared to the free-living mycelium. Inside the FB, the expression of TmelGEL1 was restricted to the hyphal compartment. A phylogenetic analysis of the Gel/Gas protein family of T. melanosporum was also carried out. A total of 237 GH72 proteins from 51 Ascomycotina and 3 Basidiomycota (outgroup) species were analyzed. The resulting tree provides insight into the evolution of the T. melanosporum proteins and identifies new GH72 paralogs/subfamilies. Moreover, it represents a starting point to formulate new hypotheses on the significance of the striking GH72 gene redundancy in fungal biology. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Yeast Interspecies Comparative Proteomics Reveals Divergence in Expression Profiles and Provides Insights into Proteome Resource Allocation and Evolutionary Roles of Gene Duplication*

    Science.gov (United States)

    Kito, Keiji; Ito, Haruka; Nohara, Takehiro; Ohnishi, Mihoko; Ishibashi, Yuko; Takeda, Daisuke

    2016-01-01

    nonoptimal culture conditions but also provide valuable insights into intriguing biological principles, including the balance of proteome resource allocation and the role of gene duplication in evolutionary history. PMID:26560065

  8. A Rickettsia Genome Overrun by Mobile Genetic Elements Provides Insight into the Acquisition of Genes Characteristic of an Obligate Intracellular Lifestyle

    Science.gov (United States)

    Joardar, Vinita; Williams, Kelly P.; Driscoll, Timothy; Hostetler, Jessica B.; Nordberg, Eric; Shukla, Maulik; Walenz, Brian; Hill, Catherine A.; Nene, Vishvanath M.; Azad, Abdu F.; Sobral, Bruno W.; Caler, Elisabet

    2012-01-01

    We present the draft genome for the Rickettsia endosymbiont of Ixodes scapularis (REIS), a symbiont of the deer tick vector of Lyme disease in North America. Among Rickettsia species (Alphaproteobacteria: Rickettsiales), REIS has the largest genome sequenced to date (>2 Mb) and contains 2,309 genes across the chromosome and four plasmids (pREIS1 to pREIS4). The most remarkable finding within the REIS genome is the extraordinary proliferation of mobile genetic elements (MGEs), which contributes to a limited synteny with other Rickettsia genomes. In particular, an integrative conjugative element named RAGE (for Rickettsiales amplified genetic element), previously identified in scrub typhus rickettsiae (Orientia tsutsugamushi) genomes, is present on both the REIS chromosome and plasmids. Unlike the pseudogene-laden RAGEs of O. tsutsugamushi, REIS encodes nine conserved RAGEs that include F-like type IV secretion systems similar to that of the tra genes encoded in the Rickettsia bellii and R. massiliae genomes. An unparalleled abundance of encoded transposases (>650) relative to genome size, together with the RAGEs and other MGEs, comprise ∼35% of the total genome, making REIS one of the most plastic and repetitive bacterial genomes sequenced to date. We present evidence that conserved rickettsial genes associated with an intracellular lifestyle were acquired via MGEs, especially the RAGE, through a continuum of genomic invasions. Robust phylogeny estimation suggests REIS is ancestral to the virulent spotted fever group of rickettsiae. As REIS is not known to invade vertebrate cells and has no known pathogenic effects on I. scapularis, its genome sequence provides insight on the origin of mechanisms of rickettsial pathogenicity. PMID:22056929

  9. Plantation forestry under global warming: hybrid poplars with improved thermotolerance provide new insights on the in vivo function of small heat shock protein chaperones.

    Science.gov (United States)

    Merino, Irene; Contreras, Angela; Jing, Zhong-Ping; Gallardo, Fernando; Cánovas, Francisco M; Gómez, Luis

    2014-02-01

    Climate-driven heat stress is a key factor affecting forest plantation yields. While its effects are expected to worsen during this century, breeding more tolerant genotypes has proven elusive. We report here a substantial and durable increase in the thermotolerance of hybrid poplar (Populus tremula×Populus alba) through overexpression of a major small heat shock protein (sHSP) with convenient features. Experimental evidence was obtained linking protective effects in the transgenic events with the unique chaperone activity of sHSPs. In addition, significant positive correlations were observed between phenotype strength and heterologous sHSP accumulation. The remarkable baseline levels of transgene product (up to 1.8% of total leaf protein) have not been reported in analogous studies with herbaceous species. As judged by protein analyses, such an accumulation is not matched either by endogenous sHSPs in both heat-stressed poplar plants and field-grown adult trees. Quantitative real time-polymerase chain reaction analyses supported these observations and allowed us to identify the poplar members most responsive to heat stress. Interestingly, sHSP overaccumulation was not associated with pleiotropic effects that might decrease yields. The poplar lines developed here also outperformed controls under in vitro and ex vitro culture conditions (callus biomass, shoot production, and ex vitro survival), even in the absence of thermal stress. These results reinforce the feasibility of improving valuable genotypes for plantation forestry, a field where in vitro recalcitrance, long breeding cycles, and other practical factors constrain conventional genetic approaches. They also provide new insights into the biological functions of the least understood family of heat shock protein chaperones.

  10. Transcriptome-based gene profiling provides novel insights into the characteristics of radish root response to Cr stress with next-generation sequencing

    Directory of Open Access Journals (Sweden)

    Yang eXie

    2015-03-01

    Full Text Available Radish (Raphanus sativus L. is an important worldwide root vegetable crop with high nutrient values and is adversely affected by non-essential heavy metals including chromium (Cr. Little is known about the molecular mechanism underlying Cr stress response in radish. In this study, RNA-Seq technique was employed to identify differentially expressed genes (DEGs under Cr stress. Based on de novo transcriptome assembly, there were 30,676 unigenes representing 60,881 transcripts isolated from radish root under Cr stress. Differential gene analysis revealed that 2,985 uingenes were significantly differentially expressed between Cr-free (CK and Cr-treated (Cr600 libraries, among which 1,424 were up-regulated and 1,561 down-regulated. Gene ontology (GO analysis revealed that these DEGs were mainly involved in primary metabolic process, response to abiotic stimulus, cellular metabolic process and small molecule metabolic process. Kyoto encyclopedia of genes and genomes (KEGG enrichment analysis showed that the DEGs were mainly involved in protein processing in endoplasmic reticulum, starch and sucrose metabolism, amino acid metabolism, glutathione metabolism, drug and xenobiotics by cytochrome P450 metabolism. RT-qPCR analysis showed that the expression patterns of 12 randomly selected DEGs were highly accordant with the results from RNA-seq. Furthermore, many candidate genes including signaling protein kinases, transcription factors and metal transporters, chelate compound biosynthesis and antioxidant system, were involved in defense and detoxification mechanisms of Cr stress response regulatory networks. These results would provide novel insight into molecular mechanism underlying plant responsiveness to Cr stress and facilitate further genetic manipulation on Cr uptake and accumulation in radish.

  11. Analysis of DNA binding by human factor xeroderma pigmentosum complementation group A (XPA) provides insight into its interactions with nucleotide excision repair substrates.

    Science.gov (United States)

    Sugitani, Norie; Voehler, Markus W; Roh, Michelle S; Topolska-Woś, Agnieszka M; Chazin, Walter J

    2017-10-13

    Xeroderma pigmentosum (XP) complementation group A (XPA) is an essential scaffolding protein in the multiprotein nucleotide excision repair (NER) machinery. The interaction of XPA with DNA is a core function of this protein; a number of mutations in the DNA-binding domain (DBD) are associated with XP disease. Although structures of the central globular domain of human XPA and data on binding of DNA substrates have been reported, the structural basis for XPA's DNA-binding activity remains unknown. X-ray crystal structures of the central globular domain of yeast XPA (Rad14) with lesion-containing DNA duplexes have provided valuable insights, but the DNA substrates used for this study do not correspond to the substrates of XPA as it functions within the NER machinery. To better understand the DNA-binding activity of human XPA in NER, we used NMR to investigate the interaction of its DBD with a range of DNA substrates. We found that XPA binds different single-stranded/double-stranded junction DNA substrates with a common surface. Comparisons of our NMR-based mapping of binding residues with the previously reported Rad14-DNA crystal structures revealed similarities and differences in substrate binding between XPA and Rad14. This includes direct evidence for DNA contacts to the residues extending C-terminally from the globular core, which are lacking in the Rad14 construct. Moreover, mutation of the XPA residue corresponding to Phe-262 in Rad14, previously reported as being critical for DNA binding, had only a moderate effect on the DNA-binding activity of XPA. The DNA-binding properties of several disease-associated mutations in the DBD were investigated. These results suggest that for XPA mutants exhibiting altered DNA-binding properties, a correlation exists between the extent of reduction in DNA-binding affinity and the severity of symptoms in XP patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Conventional and phenomics characterization provides insight into the diversity and relationships of hypervariable scarlet (Solanum aethiopicum L. and gboma (S. macrocarpon L. eggplant complexes

    Directory of Open Access Journals (Sweden)

    Mariola ePlazas

    2014-07-01

    Full Text Available Scarlet (Solanum aethiopicum and gboma (S. macrocarpon eggplants are major vegetable crops in sub-Saharan Africa. Together with their respective wild ancestors (S. anguivi and S. dasyphyllum and intermediate cultivated-wild forms they constitute the so-called scarlet and gboma eggplant complexes. We used conventional descriptors and the high-throughput phenomics tool Tomato Analyzer for characterizing 63 accessions of the scarlet eggplant complex, including the four S. aethiopicum cultivar groups (Aculeatum, Gilo, Kumba, and Shum, Intermediate S. aethiopicum-S. anguivi forms, and S. anguivi, and 12 cultivated and wild accessions of the gboma eggplant complex. A large diversity was found between both complexes, showing that they are very well differentiated from each other. Within the scarlet eggplant complex, many significant differences were also found among cultivar groups, but more differences were found for fruit traits evaluated with Tomato Analyzer than with conventional descriptors. In particular, Tomato Analyzer phenomics characterization was useful for distinguishing small fruited groups (Shum, Intermediate, and S. anguivi, as well as groups for which few or no significant differences were observed for plant traits. Multivariate principal components analysis (PCA separated well all groups, except the Intermediate group which plotted between S. anguivi and small fruited S. aethiopicum accessions. For the gboma eggplant complex, S. dasyphyllum was clearly distinguished from S. macrocarpon and an important diversity was found in the latter. The results have shown that both complexes are hypervariable and have provided insight into their diversity and relationships. The information obtained has important implications for the conservation and management of genetic resources as well as for the selection and breeding of both scarlet and gboma eggplants.

  13. Integrated RNA- and protein profiling of fermentation and respiration in diploid budding yeast provides insight into nutrient control of cell growth and development.

    Science.gov (United States)

    Becker, Emmanuelle; Liu, Yuchen; Lardenois, Aurélie; Walther, Thomas; Horecka, Joe; Stuparevic, Igor; Law, Michael J; Lavigne, Régis; Evrard, Bertrand; Demougin, Philippe; Riffle, Michael; Strich, Randy; Davis, Ronald W; Pineau, Charles; Primig, Michael

    2015-04-24

    Diploid budding yeast undergoes rapid mitosis when it ferments glucose, and in the presence of a non-fermentable carbon source and the absence of a nitrogen source it triggers sporulation. Rich medium with acetate is a commonly used pre-sporulation medium, but our understanding of the molecular events underlying the acetate-driven transition from mitosis to meiosis is still incomplete. We identified 263 proteins for which mRNA and protein synthesis are linked or uncoupled in fermenting and respiring cells. Using motif predictions, interaction data and RNA profiling we find among them 28 likely targets for Ume6, a subunit of the conserved Rpd3/Sin3 histone deacetylase-complex regulating genes involved in metabolism, stress response and meiosis. Finally, we identify 14 genes for which both RNA and proteins are detected exclusively in respiring cells but not in fermenting cells in our sample set, including CSM4, SPR1, SPS4 and RIM4, which were thought to be meiosis-specific. Our work reveals intertwined transcriptional and post-transcriptional control mechanisms acting when a MATa/α strain responds to nutritional signals, and provides molecular clues how the carbon source primes yeast cells for entering meiosis. Our integrated genomics study provides insight into the interplay between the transcriptome and the proteome in diploid yeast cells undergoing vegetative growth in the presence of glucose (fermentation) or acetate (respiration). Furthermore, it reveals novel target genes involved in these processes for Ume6, the DNA binding subunit of the conserved histone deacetylase Rpd3 and the co-repressor Sin3. We have combined data from an RNA profiling experiment using tiling arrays that cover the entire yeast genome, and a large-scale protein detection analysis based on mass spectrometry in diploid MATa/α cells. This distinguishes our study from most others in the field-which investigate haploid yeast strains-because only diploid cells can undergo meiotic development

  14. In_sight : Using Existing Wi-Fi networks to Provide Information on Occupancy and Exploitation of Educational Facilities using at Delft University of Technology

    NARCIS (Netherlands)

    van der Spek, S.C.; Verbree, E.; Meijers, B.M.; Bot, F.J.; Braaksma, H.H.; Braggaar, R.C.; Ligtvoet, B.R.; Staats, B.R.; Gartner, G.; Huang, H.

    2016-01-01

    The distribution of people in buildings, the occupancy of lecture-, work- and study places and the accessibility of facilities are essential information at university campuses who have to cope with limited and even shrinking budgets and huge, rising real estate costs. Only little insight is gained

  15. Transcriptome analysis of the Holly mangrove Acanthus ilicifolius and its terrestrial relative, Acanthus leucostachyus, provides insights into adaptation to intertidal zones.

    Science.gov (United States)

    Yang, Yuchen; Yang, Shuhuan; Li, Jianfang; Deng, Yunfei; Zhang, Zhang; Xu, Shaohua; Guo, Wuxia; Zhong, Cairong; Zhou, Renchao; Shi, Suhua

    2015-08-14

    environments and may contribute to speciation in Acanthus. We characterized the transcriptomes of one mangrove species of Acanthus, A. ilicifolius, and its terrestrial relative, A. leucostachyus, and provided insights into the origin of the mangrove Acanthus species and their adaptive evolution to abiotic stresses in intertidal environments.

  16. Analysis of chitin-binding proteins from Manduca sexta provides new insights into evolution of peritrophin A-type chitin-binding domains in insects.

    Science.gov (United States)

    Tetreau, Guillaume; Dittmer, Neal T; Cao, Xiaolong; Agrawal, Sinu; Chen, Yun-Ru; Muthukrishnan, Subbaratnam; Haobo, Jiang; Blissard, Gary W; Kanost, Michael R; Wang, Ping

    2015-07-01

    together in the phylogenetic tree. For chitinases and chitin deacetylases, most of phylogenetic analysis performed with the CBD sequences resulted in similar clustering to the one obtained by using catalytic domain sequences alone, suggesting that CBDs were incorporated into these enzymes and evolved in tandem with the catalytic domains before the diversification of different insect orders. Based on these results, the evolution of CBDs in insect CBPs is discussed to provide a new insight into the CBD sequence structure and diversity, and their evolution and expression in insects. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Transcriptome analysis of the Spodoptera frugiperda ascovirus in vivo provides insights into how its apoptosis inhibitors and caspase promote increased synthesis of viral vesicles and virion progeny.

    Science.gov (United States)

    Zaghloul, Heba; Hice, Robert; Arensburger, Peter; Federici, Brian A

    2017-09-27

    that continue to produce virions. Our transcriptome analysis of genome expression in vivo by the Spodoptera frugiperda ascovirus shows that inhibitors of apoptosis are expressed first enabling viral replication to proceed, after which the SfAV-1a caspase is synthesized, leading to viral vesicle synthesis and subsequent extensive production of progeny virions. Moreover, we detected numerous bicistronic and tricistronic mRNA messages in the ascovirus transcriptome, implying ascoviruses use other non-canonical translational mechanisms such as Internal Ribosome Entry Site (IRES). These results provide the first insights into the molecular biology of a unique coordinated gene expression pattern in which cell architecture is markedly modified, more than in any other known eukaryotic virus, to promote viral reproduction and transmission. Copyright © 2017 American Society for Microbiology.

  18. A genome-wide transcriptome map of pistachio (Pistacia vera L.) provides novel insights into salinity-related genes and marker discovery.

    Science.gov (United States)

    Moazzzam Jazi, Maryam; Seyedi, Seyed Mahdi; Ebrahimie, Esmaeil; Ebrahimi, Mansour; De Moro, Gianluca; Botanga, Christopher

    2017-08-17

    Pistachio (Pistacia vera L.) is one of the most important commercial nut crops worldwide. It is a salt-tolerant and long-lived tree, with the largest cultivation area in Iran. Climate change and subsequent increased soil salt content have adversely affected the pistachio yield in recent years. However, the lack of genomic/global transcriptomic sequences on P. vera impedes comprehensive researches at the molecular level. Hence, whole transcriptome sequencing is required to gain insight into functional genes and pathways in response to salt stress. RNA sequencing of a pooled sample representing 24 different tissues of two pistachio cultivars with contrasting salinity tolerance under control and salt treatment by Illumina Hiseq 2000 platform resulted in 368,953,262 clean 100 bp paired-ends reads (90 Gb). Following creating several assemblies and assessing their quality from multiple perspectives, we found that using the annotation-based metrics together with the length-based parameters allows an improved assessment of the transcriptome assembly quality, compared to the solely use of the length-based parameters. The generated assembly by Trinity was adopted for functional annotation and subsequent analyses. In total, 29,119 contigs annotated against all of five public databases, including NR, UniProt, TAIR10, KOG and InterProScan. Among 279 KEGG pathways supported by our assembly, we further examined the pathways involved in the plant hormone biosynthesis and signaling as well as those to be contributed to secondary metabolite biosynthesis due to their importance under salinity stress. In total, 11,337 SSRs were also identified, which the most abundant being dinucleotide repeats. Besides, 13,097 transcripts as candidate stress-responsive genes were identified. Expression of some of these genes experimentally validated through quantitative real-time PCR (qRT-PCR) that further confirmed the accuracy of the assembly. From this analysis, the contrasting expression pattern

  19. Transcriptomes and expression profiling of deep-sea corals from the Red Sea provide insight into the biology of azooxanthellate corals

    OpenAIRE

    Yum, L. K.; Baumgarten, S.; Röthig, T.; Roder, C.; Roik, Anna; Michell, C.; Voolstra, C. R.

    2017-01-01

    Despite the importance of deep-sea corals, our current understanding of their ecology and evolution is limited due to difficulties in sampling and studying deep-sea environments. Moreover, a recent re-evaluation of habitat limitations has been suggested after characterization of deep-sea corals in the Red Sea, where they live at temperatures of above 20??C at low oxygen concentrations. To gain further insight into the biology of deep-sea corals, we produced reference transcriptomes and studie...

  20. Electron-beam-induced current measurements with applied bias provide insight to locally resolved acceptor concentrations at p-n junctions

    Directory of Open Access Journals (Sweden)

    D. Abou-Ras

    2015-07-01

    Full Text Available Electron-beam-induced current (EBIC measurements have been employed for the investigation of the local electrical properties existing at various types of electrical junctions during the past decades. In the standard configuration, the device under investigation is analyzed under short-circuit conditions. Further insight into the function of the electrical junction can be obtained when applying a bias voltage. The present work gives insight into how EBIC measurements at applied bias can be conducted at the submicrometer level, at the example of CuInSe2 solar cells. From the EBIC profiles acquired across ZnO/CdS/CuInSe2/Mo stacks exhibiting p-n junctions with different net doping densities in the CuInSe2 layers, values for the width of the space-charge region, w, were extracted. For all net doping densities, these values decreased with increasing applied voltage. Assuming a linear relationship between w2 and the applied voltage, the resulting net doping densities agreed well with the ones obtained by means of capacitance-voltage measurements.

  1. Perceptions of medical students and their mentors in a specialised programme designed to provide insight into non-traditional career paths

    Science.gov (United States)

    Josephson, Anna; Stenfors-Hayes, Terese

    2011-01-01

    Objectives This pilot study explores the perceptions of medical students and their individual mentors who advised them in a specialised programme where students gained insight into non-tradition career paths. Methods Twelve medical students in years 3-6 at Karolinska Institutet, Sweden were recruited to the Prominentia mentor programme where they were individually paired with mentors who met with them to discuss and advise them on non-traditional career paths. Application letters of students to join the programme as well as electronically distributed questionnaires and semi-structured interviews were used to assess the perceptions of mentors and students to the programme. Both the questionnaire and the interview transcripts were thematised using content analysis. Results In terms of expectations and requests, the application letters showed that all students specified their career goals and the type of mentor they desired. Whereas mentors in general had fewer requests and some had no specific demands. In light of perceived effects, all mentors felt they discussed future careers with their students and the majority of students responded the same way, with some interesting deviations. Most discussed topics during meetings were: future career, medical education, combinations of private life and work, and work environment. Conclusions This pilot study revealed that students appreciated receiving inspiration and seeing career path opportunities outside academic medicine as well as receiving support in personal and professional development and guidance about the students’ role as a doctor. However, discrepancies were found regarding how mentors and students respectively perceived the mentor programme.

  2. Biochemical and genetic analyses of the oomycete Pythium insidiosum provide new insights into clinical identification and urease-based evolution of metabolism-related traits

    Directory of Open Access Journals (Sweden)

    Theerapong Krajaejun

    2018-06-01

    biochemical characteristics and drew new insights into clinical identification and urease-related evolution of P. insidiosum.

  3. Digestive enzyme activities in the guts of bonnethead sharks (Sphyrna tiburo) provide insight into their digestive strategy and evidence for microbial digestion in their hindguts.

    Science.gov (United States)

    Jhaveri, Parth; Papastamatiou, Yannis P; German, Donovan P

    2015-11-01

    Few investigations have studied digestive enzyme activities in the alimentary tracts of sharks to gain insight into how these organisms digest their meals. In this study, we examined the activity levels of proteases, carbohydrases, and lipase in the pancreas, and along the anterior intestine, spiral intestine, and colon of the bonnethead shark, Sphyrna tiburo. We then interpreted our data in the context of a rate-yield continuum to discern this shark's digestive strategy. Our data show anticipated decreasing patterns in the activities of pancreatic enzymes moving posteriorly along the gut, but also show mid spiral intestine peaks in aminopeptidase and lipase activities, which support the spiral intestine as the main site of absorption in bonnetheads. Interestingly, we observed spikes in the activity levels of N-acetyl-β-D-glucosaminidase and β-glucosidase in the bonnethead colon, and these chitin- and cellulose-degrading enzymes, respectively, are likely of microbial origin in this distal gut region. Taken in the context of intake and relatively long transit times of food through the gut, the colonic spikes in N-acetyl-β-D-glucosaminidase and β-glucosidase activities suggest that bonnetheads take a yield-maximizing strategy to the digestive process, with some reliance on microbial digestion in their hindguts. This is one of the first studies to examine digestive enzyme activities along the gut of any shark, and importantly, the data match with previous observations that sharks take an extended time to digest their meals (consistent with a yield-maximizing digestive strategy) and that the spiral intestine is the primary site of absorption in sharks. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Gene expression profiles in human and mouse primary cells provide new insights into the differential actions of vitamin D3 metabolites.

    Directory of Open Access Journals (Sweden)

    Pentti Tuohimaa

    Full Text Available 1α,25-Dihydroxyvitamin D3 (1α,25(OH2D3 had earlier been regarded as the only active hormone. The newly identified actions of 25-hydroxyvitamin D3 (25(OHD3 and 24R,25-dihydroxyvitamin D3 (24R,25(OH2D3 broadened the vitamin D3 endocrine system, however, the current data are fragmented and a systematic understanding is lacking. Here we performed the first systematic study of global gene expression to clarify their similarities and differences. Three metabolites at physiologically comparable levels were utilized to treat human and mouse fibroblasts prior to DNA microarray analyses. Human primary prostate stromal P29SN cells (hP29SN, which convert 25(OHD3 into 1α,25(OH2D3 by 1α-hydroxylase (encoded by the gene CYP27B1, displayed regulation of 164, 171, and 175 genes by treatment with 1α,25(OH2D3, 25(OHD3, and 24R,25(OH2D3, respectively. Mouse primary Cyp27b1 knockout fibroblasts (mCyp27b1 (-/-, which lack 1α-hydroxylation, displayed regulation of 619, 469, and 66 genes using the same respective treatments. The number of shared genes regulated by two metabolites is much lower in hP29SN than in mCyp27b1 (-/-. By using DAVID Functional Annotation Bioinformatics Microarray Analysis tools and Ingenuity Pathways Analysis, we identified the agonistic regulation of calcium homeostasis and bone remodeling between 1α,25(OH2D3 and 25(OHD3 and unique non-classical actions of each metabolite in physiological and pathological processes, including cell cycle, keratinocyte differentiation, amyotrophic lateral sclerosis signaling, gene transcription, immunomodulation, epigenetics, cell differentiation, and membrane protein expression. In conclusion, there are three distinct vitamin D3 hormones with clearly different biological activities. This study presents a new conceptual insight into the vitamin D3 endocrine system, which may guide the strategic use of vitamin D3 in disease prevention and treatment.

  5. Genome-wide association identifies nine common variants associated with fasting proinsulin levels and provides new insights into the pathophysiology of type 2 diabetes

    NARCIS (Netherlands)

    R.J. Strawbridge (Rona); J. Dupuis (Josée); I. Prokopenko (Inga); A.M. Barker (Adam); E. Ahlqvist (Emma); D. Rybin (Denis); J.R. Petrie (John); N. Bouatia-Naji (Nabila); A.S. Dimas (Antigone); E. Wheeler (Eleanor); H. Chen (Han); B.F. Voight (Benjamin); J. Taneera (Jalal); S. Kanoni (Stavroula); J. Peden (John); F. Turrini (Fabiola); S. Gustafsson (Stefan); C. Zabena (Carina); P. Almgren (Peter); G.V. Dedoussis (George); D. Barnes (Daniel); E.M. Dennison (Elaine); K. Hagen (Knut); P. Eriksson (Per); E. Eury (Elodie); L. Folkersen (Lasse); C.S. Fox (Caroline); T.M. Frayling (Timothy); A. Goel (Anuj); M. Horikoshi (Momoko); B. Isomaa (Bo); A.U. Jackson (Anne); K. Jameson (Karen); E. Kajantie (Eero); J. Kerr-Conte (Julie); L. Groop (Leif); J. Kuusisto (Johanna); R.J.F. Loos (Ruth); J. Luan; K. Makrilakis (Konstantinos); A.K. Manning (Alisa); M.T. Martinez-Larrad (Maria Teresa); N. Narisu (Narisu); J. Öhrvik (John); C. Osmond (Clive); L. Pascoe (Laura); F. Payne (Felicity); A.A. Sayer; B. Sennblad (Bengt); C. Cooper (Charles); K. Stirrups (Kathy); A.J. Swift (Amy); A.C. Syvänen; T. Tuomi (Tiinamaija); F. van't Hooft (Ferdinand); M. Walker (Mark); M.N. Weedon (Michael); W. Xie (Weijia); B. Zethelius (Björn); L.J. Scott (Laura); V. Steinthorsdottir (Valgerdur); A.P. Morris (Andrew); C. Dina (Christian); R.P. Welch (Ryan); E. Zeggini (Eleftheria); C. Huth (Cornelia); Y.S. Aulchenko (Yurii); G. Thorleifsson (Gudmar); L.J. McCulloch (Laura); T. Ferreira (Teresa); H. Grallert (Harald); N. Amin (Najaf); G. Wu (Guanming); C.J. Willer (Cristen); S. Raychaudhuri (Soumya); S.A. McCarroll (Steven); O.M. Hofmann (Oliver); L. Qi (Lu); A.V. Segrè (Ayellet); M. van Hoek (Mandy); P. Navarro (Pau); K.G. Ardlie (Kristin); B. Balkau (Beverley); N. Narisu (Narisu); A.J. Bennett (Amanda); R. Blagieva (Roza); E.A. Boerwinkle (Eric); L.L. Bonnycastle (Lori); K.B. Boström (Kristina Bengtsson); B. Bravenboer (Bert); S. Bumpstead (Suzannah); N.P. Burtt (Noël); G. Charpentier (Guillaume); P.S. Chines (Peter); M. Cornelis (Marilyn); D.J. Couper (David); G. Crawford (Gabe); A.S.F. Doney (Alex); K.S. Elliott (Katherine); A.L. Elliott (Amanda); M.R. Erdos (Michael); C.S. Franklin (Christopher); M. Ganser (Martha); C. Gieger (Christian); N. Grarup (Niels); T. Green (Todd); S. Griffin (Simon); C.J. Groves (Christopher); C. Guiducci (Candace); S. Hadjadj (Samy); N. Hassanali (Neelam); C. Herder (Christian); T. Jorgensen (Torben); W.H.L. Kao (Wen); N. Klopp (Norman); A. Kong (Augustine); P. Kraft (Peter); T. Lauritzen (Torsten); M. Li (Man); A. Lieverse (Aloysius); M.N. Weedon (Michael); V. Lyssenko (Valeriya); M. Marre (Michel); T. Meitinger (Thomas); K. Midthjell (Kristian); M.A. Morken (Mario); P. Nilsson (Peter); K.R. Owen (Katharine); J.R.B. Perry (John); A.K. Petersen; C. Platou (Carl); C. Proença (Christine); W. Rathmann (Wolfgang); R.R. Frants (Rune); G. Rocheleau (Ghislain); M. Roden (Michael); M.J. Sampson (Michael); R. Saxena (Richa); B.M. Shields (Beverley); P. Shrader (Peter); T. Sparsø (Thomas); K. Strassburger (Klaus); H.M. Stringham (Heather); Q. Sun (Qi); B. Thorand (Barbara); J. Tichet (Jean); T.W. van Haeften (Timon); T.W. van Herpt (Thijs); J.V. van Vliet-Ostaptchouk (Jana); G.B. Walters (Bragi); C. Wijmenga (Cisca); S. Cauchi (Stephane); A.L. Gloyn (Anna); U. Gyllensten (Ulf); T. Hansen (T.); W.A. Hide (Winston); G.A. Hitman (Graham); A. Hofman (Albert); K. Hveem (Kristian); M. Laakso (Markku); K.L. Mohlke (Karen L.); A.D. Morris (Andrew); C.N.A. Palmer (Colin); L.D. Stein (Lincoln); J. Tuomilehto (Jaakko); A.G. Uitterlinden (André); R.M. Watanabe (Richard); G.R. Abecasis (Gonçalo); B.O. Boehm (Bernhard); H. Campbell (Harry); M.J. Daly (Mark); A.T. Hattersley (Andrew); F.B. Hu (Frank B.); J.B. Meigs (James); J.S. Pankow (James); O. Pedersen (Oluf); I. Barroso (Inês); L. Groop (Leif); R. Sladek (Rob); U. Thorsteinsdottir (Unnur); J.F. Wilson (James F.); T. Illig (Thomas); P. Froguel (Philippe); C.M. van Duijn (Cock); J-A. Zwart (John-Anker); D. Altshuler (David); M. Boehnke (Michael); M.I. McCarthy (Mark I.); E.K. Speliotes (Elizabeth); S.I. Berndt (Sonja); K.L. Monda (Keri); H.L. Allen; R. Mägi (Reedik); J.C. Randall (Joshua); S. Vedantam (Sailaja); T.W. Winkler (Thomas W.); T. Workalemahu (Tsegaselassie); I.M. Heid (Iris); A.R. Wood (Andrew); R.J. Weyant (Robert); K. Estrada Gil (Karol); L. Liang (Liming); J. Nemesh (James); J.H. Park; T.O. Kilpeläinen (Tuomas); J. Yang (Jian); M.F. Feitosa (Mary Furlan); Z. Kutalik (Zoltán); I. Prokopenko (Inga); W. Rathmann (Wolfgang); A.V. Smith; J.H. Zhao; K.K.H. Aben (Katja); D. Absher (Devin); A.L. Dixon (Anna); B.M. Shields (Beverley); N.L. Glazer (Nicole); N.L. Heard-Costa (Nancy); V. Hoesel (Volker); J.J. Hottenga (Jouke Jan); B. Thorand (Barbara); C. Lamina (Claudia); S. Li (Shengxu); R.M. van Dam (Rob); R.H. Myers (Richard); M.J. Peters (Marjolein); M. Preuss (Michael); S. Ripatti (Samuli); F. Rivadeneira Ramirez (Fernando); C. Sandholt (Camilla); N. Timpson (Nicholas); J.P. Tyrer (Jonathan); S. van Wingerden (Sophie); C.C. White (Charles); F. Wiklund (Fredrik); D.I. Chasman (Daniel); R.W. Lawrence (Robert); N. Pellikka (Niina); J. Shi (Jianxin); E. Thiering (Elisabeth); H. Alavere (Helene); M.T.S. Alibrandi (Maria); A.M. Arnold (Alice); T. Aspelund (Thor); I. Rudan (Igor); E.J.G. Sijbrands (Eric); S.M. Bergmann (Sven); H. Biebermann (Heike); A.I.F. Blakemore (Alexandra); T. Boes (Tanja); S.R. Bornstein (Stefan R.); G.R. Abecasis (Gonçalo); B.O. Boehm (Bernhard); F. Busonero; C. Cavalcanti-Proença (Christine); F.B. Hu (Frank); C.-M. Chen (Chih-Mei); R. Clarke (Robert); J. Connell (John); I.N.M. Day (Ian N.M.); J. Duan (Jubao); R. Elosua (Roberto); G. Eiriksdottir (Gudny); T. Illig (Thomas); S.B. Felix (Stephan); P. Fischer-Posovszky (Pamela); A.R. Folsom (Aaron); N. Friedrich (Nele); M. Fu (Mao); S. Gaget (Stefan); P.V. Gejman (Pablo); E.J. Geus (Eeco); A.P. Gjesing (Anette); P. Goyette (Philippe); J. Gräsler (Jürgen); A.S. Havulinna (Aki); C. Hayward (Caroline); A.C. Heath (Andrew C.); C. Hengstenberg (Christian); A.A. Hicks (Andrew); A. Hinney (Anke); G. Homuth (Georg); J. Hui (Jennie); W. Igl (Wilmar); K.B. Jacobs (Kevin); I. Jarick (Ivonne); E. Jewell (Eelizabeth); U. John (Ulrich); P. Jousilahti (Pekka); A. Jula (Antti); M. Kaakinen (Marika); L. Kaplan (Lee); S. Kathiresan (Sekar); J. Kettunen (Johannes); J. Yang (Joanna); J.W. Knowles (Joshua); T. Esko (Tõnu); I.R. König (Inke); S. Koskinen (Seppo); P. Kovacs (Peter); S. Raychaudhuri (Soumya); J. Laitinen (Jaana); O. Lantieri (Olivier); C. Lanzani (Chiara); L.J. Launer (Lenore); C. Lecoeur (Cécile); T. Lehtimäki (Terho); G. Lettre (Guillaume); J. Liu (Jianjun); M.L. Lokki; M. Lorentzon (Mattias); M.E. Goddard (Michael); B. Ludwig (Barbara); P. Manunta (Paolo); D. Marek (Diana); N.G. Martin (Nicholas); T. Johnson (Toby); B. McKnight (Barbara); O. Melander (Olle); D. Meyre (David); G.W. Montgomery (Grant); R. Mulic (Rosanda); J.S. Ngwa; M. Nelis (Mari); M.J. Neville (Matthew); D.R. Nyholt (Dale); C.J. O'Donnell (Christopher); L.J. Scott (Laura); B.A. Oostra (Ben); G. Pare (Guillame); A.N. Parker (Alex); I. Pichler (Irene); K.H. Pietilainen (Kirsi Hannele); C.P. Platou (Carl); O. Polasek (Ozren); M.N. Cooper (Matthew); S. Rafelt (Suzanne); O.T. Raitakari (Olli T.); N.W. Rayner (Nigel William); M. Ridderstråle (Martin); J. Shi (Jianxin); E. Thiering (Eelisabeth); V. Salomaa (Veikko); M.S. Sandhu (Manjinder); S. Sanna (Serena); J. Saramies (Jouko); M.J. Savolainen (Markku); A. Scherag (Andre); S. Schipf (Sabine); Y. Ben-Shlomo; H. Schunkert (Heribert); K. Silander (Kaisa); J. Sinisalo (Juha); D.S. Siscovick (David); J.H. Smit (Jan); N. Soranzo (Nicole); S.R. Bornstein (Stefan); J. Stephens (Jonathan); T.A. Buchanan (Thomas); M.L. Tammesoo; J.-C. Tardif (Jean-Claude); F.P. Cappuccio (Francesco); T.M. Teslovich (Tanya M.); J.R. Thompson (John); B. Thomson (Brian); A. Tönjes (Anke); R. Clarke; L. Coin (Lachlan); V. Vatin (Vincent); I.N.M. Day (Ian); M. den Heijer (Martin); S. Ebrahim (Shanil); L. Waite (Lindsay); H. Wallaschofski (Henri); E. Widen (Elisabeth); S. Wiegand (Susanna); S.H. Wild (Sarah); G.A.H.M. Willemsen (Gonneke); J.C.M. Witteman (Jacqueline); J. Xu (Jianfeng); L. Zgaga (Lina); J.P. Beilby (John); I.S. Farooqi (I. Sadaf); J. Hebebrand (Johannes); H.V. Huikuri (Heikki); A. James (Alan); M. Kähönen (Mika); F. Macciardi (Fabio); M.S. Nieminen (Markku); C. Ohlsson (Claes); V. Gudnason (Vilmundur); P.M. Ridker (Paul); M. Stumvoll (Michael); J.S. Beckmann (Jacques); D.I. Boomsma (Dorret); M. Caulfield (Mark); S.J. Chanock (Stephen); L.A. Cupples (Adrienne); G.D. Smith; J. Erdmann (Jeanette); H. Grönberg (Henrik); P. Hall (Per); T.B. Harris (Tamara); R.B. Hayes (Richard); J. Heinrich (Joachim); M.-R. Jarvelin (Marjo-Riitta); J. Kaprio (Jaakko); K.T. Khaw; L.A.L.M. Kiemeney (Bart); H. Krude; D.A. Lawlor (Debbie); A. Metspalu (Andres); W.H. Ouwehand (Willem); B.W.J.H. Penninx; A. Peters (Annette); T. Quertermous (Thomas); T. Reinehr (Thomas); A. Rissanen (Aila); N.J. Samani (Nilesh); P.E.H. Schwarz (Peter); A.R. Shuldiner (Alan); T.D. Spector (Timothy); M. Uda (Manuela); Wabitsch, M. (Martin); G. Waeber (Gérard); A.F. Wright (Alan); M.C. Zillikens (Carola); N. Chatterjee (Nilanjan); T. Lehtimäki (Terho); J. Liu (Jianjun); T.L. Assimes (Themistocles); I.B. Borecki (Ingrid); P. Deloukas (Panagiotis); L. Groop (Leif); T. Haritunians (Talin); R.C. Kaplan (Robert); L. Peltonen (Leena Johanna); D.P. Strachan (David); H.E. Wichmann (Heinz Erich); K.E. North (Kari); J.N. Hirschhorn (Joel); E. Ingelsson (Erik); G.W. Montgomery (Grant); L. Parts (Leopold); D. Glass (Daniel); J. Nisbet (James); A. Barrett (Angela); M. Sekowska (Magdalena); M.E. Travers (Mary); S.C. Potter (Simon); E. Grundberg (Elin); S. O'Rahilly (Stephen); A.K. Hedman (Asa); V. Bataille (Veronique); J.T. Bell (Jordana); G. Surdulescu (Gabriela); M. Perola (Markus); F.O. Nestle (Frank); J. Min (Josine); A. Wilk (Alicja); C.J. Hammond (Christopher J.); T.-P. Yang (Tsun-Po); O. Raitakari (Olli); R. Durbin (Richard); K.R. Ahmadi (Kourosh); H. Holm (Hilma); A.F. Stewart (Alexandre F.); M. Barbalic (maja); Z. Aherrahrou (Zouhair); H. Allayee (Hooman); S.S. Anand (Sonia); K. Andersen (Karl); S. Schreiber (Stefan); D. Ardissino (Diego); T.A. Barnes (Timothy); D.M. Becker (Diane); L.C. Becker (Lewis); K. Berger (Klaus); J.C. Bis (Joshua); S.M. Boekholdt (Matthijs); P.S. Braund (Peter); M.S. Burnett; I. Buysschaert (Ian); J.F. Carlquist (John); L. Chen (Li); S. Cichon (Sven); V. Codd (Veryan); R.W. Davies (Robert); G.V. Dedoussis (George); A. Dehghan (Abbas); S. Demissie (Serkalem); P. Diemert (Patrick); R. Do (Ron); A. Doering (Angela); S. Eifert (Sandra); N.E. El Mokhtari (Nour Eddine); S.G. Ellis (Stephen); S.E. Epstein (Stephen); U. de Faire (Ulf); M. Fischer (Marcus); J. Freyer (Jennifer); B. Gigante (Bruna); D. Girelli (Domenico); D.R. Witte (Deniel); J.R. Gulcher (Jeffrey); E. Halperin (Eran); N. Hammond (Naomi); S.L. Hazen (Stanley); A. Ziegler (Andreas); G.T. Jones (Gregory); J.W. Jukema (Jan Wouter); I.S. Farooqi (Sadaf); J.J.P. Kastelein (John); R. Laaksonen (Reijo); D. Lambrechts (Diether); D.F. Levinson (Douglas); X. Li (Xiaohui); W. Lieb (Wolfgang); C. Loley (Christina); A.J. Lotery (Andrew); P.M. Mannucci (Pier); S. Maouche (Seraya); J.S. Beckmann (Jacques); H. Boeing (Heiner); C. Meisinger (Christa); V. Mooser (Vincent); T. Morgan (Thomas); F.S. Collins (Francis); J.B. Muhlestein (Joseph); T. Munzel (Thomas); K. Musunuru (Kiran); J. Nahrstaedt (Janja); C.P. Nelson (Christopher P.); M.M. Nöthen (Markus); R.S. Patel (Riyaz); F. Peyvandi (Flora); R.B. Hayes (Richard); A.A. Quyyumi (Arshed); D.J. Rader (Daniel); L.S. Rallidis (Loukianos); F. Karpe (Fredrik); J. Kaprio (Jaakko); M.L. Sampietro (Maria Lourdes); M.S. Sandhu (Manjinder); E.E. Schadt (Eric); A. Schäfer (Arne); A. Schillert (Arne); S.M. Schwartz (Stephen); P. Munroe (Patricia); S. Sivapalaratnam (Suthesh); A.V. Smith (Albert Vernon); J.D. Snoep (Jaapjan); J.A. Spertus (John); K. Stark (Klaus); M. Stoll (Monika); W. Tang (W.); S. Tennstedt (Stephanie); G. Thorgeirsson (Gudmundur); A.R. Shuldiner (Alan); A.M. van Rij (Andre); N.J. Wareham (Nick); G.A. Wells (George); P.S. Wild (Philipp); C. Willenborg (Christina); B.J. Wright (Benjamin); T. Zeller (Tanja); F. Cambien (François); A.H. Goodall (Alison); W. März (Winfried); S. Blankenberg (Stefan); R. Roberts (Robert); R. McPherson (Ruth); J. Hopewell; P.M. Visscher (Peter); A. Offer (Alison); L. Bowman; P. Sleight (Peter); R. Peto (R.); F.S. Collins (Francis); J.C. Chambers (John C.); N. Ahmed (Nabeel); J.R. O´Connell; P. Donnelly (Peter); J.S. Kooner (Jaspal); N.J. Samani (Nilesh); J. Scott (James); J.S. Sehmi (Joban); W. Zhang (Weihua); R.J. Strawbridge (Rona); Sabater-Lleal, M. (Maria); A. Mälarstig (Anders); M.-L. Hellénius (Mai-Lis); G. Olsson; S. Rust (Stephan); G. Assmann (Gerd); U. Seedorf (Udo); G. Tognoni; M. Franzosi; P. Linksted (Pamela); H. Ongen (Halit); T. Kyriakou (Theodosios); M. Farrall (Martin); A. Rasheed (Asif); M.A. Zaidi (Aghar); N. Shah (Nisha); M. Samuel (Maria); C.B. Mallick (Chandana Basu); M. Azhar (Muhammad); K.S. Zaman (Khan Shah); M. Ishaq (Muhammad); A. Gardezi (Ali); C.J. Hammond (Christopher); R. Frossard; J. Danesh (John); J.C. Chambers (John); J.S. Kooner (Jaspal S.); C.-G. Östenson (Claes-Göran); K.T. Zondervan (Krina); M. Serrano-Ríos (Manuel); E. Ferrannini (Ele); T. Forsen (Tom); M.I. McCarthy (Mark); G.V. Dedoussis (George); C. Langenberg (Claudia); A. Hamsten (Anders); J.C. Florez (Jose)

    2011-01-01

    textabstractOBJECTIVE - Proinsulin is a precursor of mature insulin and C-peptide. Higher circulating proinsulin levels are associated with impaired b-cell function, raised glucose levels, insulin resistance, and type 2 diabetes (T2D). Studies of the insulin processing pathway could provide new

  6. The Turn the Tables Technique (T[cube]): A Program Activity to Provide Group Facilitators Insight into Teen Sexual Behaviors and Beliefs

    Science.gov (United States)

    Sclafane, Jamie Heather; Merves, Marni Loiacono; Rivera, Angelic; Long, Laura; Wilson, Ken; Bauman, Laurie J.

    2012-01-01

    The Turn the Tables Technique (T[cube]) is an activity designed to provide group facilitators who lead HIV/STI prevention and sexual health promotion programs with detailed and current information on teenagers' sexual behaviors and beliefs. This information can be used throughout a program to tailor content. Included is a detailed lesson plan of…

  7. High Resolution Crystal Structures of Streptococcus pneumoniae Nicotinamidase with Trapped Intermediates Provide Insights into Catalytic Mechanism and Inhibition by Aldehydes∥,‡

    Science.gov (United States)

    French, Jarrod B.; Cen, Yana; Sauve, Anthony A.; Ealick, Steven E.

    2010-01-01

    Nicotinamidases are salvage enzymes that convert nicotinamide to nicotinic acid. These enzymes are essential for the recycling of nicotinamide into NAD+ in most prokaryotes, most single cell and multicellular eukaryotes, but not in mammals. The significance of these enzymes for nicotinamide salvage and for NAD+ homeostasis has increased interest in nicotinamidases as possible antibiotic targets. Nicotinamidases are also regulators of intracellular nicotinamide concentrations, thereby regulating signaling of downstream NAD+ consuming enzymes, such as the NAD+-dependent deacetylases (sirtuins). Here, we report several high resolution crystal structures of the nicotinamidase from Streptococcus pneumoniae (SpNic) in unliganded and ligand-bound forms. The structure of the C136S mutant in complex with nicotinamide provides details about substrate binding while a trapped nicotinoyl-thioester complexed with SpNic reveals the structure of the proposed thioester reaction intermediate. Examination of the active site of SpNic reveals several important features including a metal ion that coordinates the substrate and the catalytically relevant water molecule, and an oxyanion hole which both orients the substrate and offsets the negative charge that builds up during catalysis. Structures of this enzyme with bound nicotinaldehyde inhibitors elucidate the mechanism of inhibition and provide further details about the catalytic mechanism. In addition, we provide a biochemical analysis of the identity and role of the metal ion that orients the ligand in the active site and activates the water molecule responsible for hydrolysis of the substrate. These data provide structural evidence for several proposed reaction intermediates and allow for a more complete understanding of the catalytic mechanism of this enzyme. PMID:20853856

  8. High-resolution crystal structures of Streptococcus pneumoniae nicotinamidase with trapped intermediates provide insights into the catalytic mechanism and inhibition by aldehydes .

    Science.gov (United States)

    French, Jarrod B; Cen, Yana; Sauve, Anthony A; Ealick, Steven E

    2010-10-12

    Nicotinamidases are salvage enzymes that convert nicotinamide to nicotinic acid. These enzymes are essential for the recycling of nicotinamide into NAD(+) in most prokaryotes and most single-cell and multicellular eukaryotes, but not in mammals. The significance of these enzymes for nicotinamide salvage and for NAD(+) homeostasis has stimulated interest in nicotinamidases as possible antibiotic targets. Nicotinamidases are also regulators of intracellular nicotinamide concentrations, thereby regulating signaling of downstream NAD(+)-consuming enzymes, such as the NAD(+)-dependent deacetylases (sirtuins). Here, we report several high-resolution crystal structures of the nicotinamidase from Streptococcus pneumoniae (SpNic) in unliganded and ligand-bound forms. The structure of the C136S mutant in complex with nicotinamide provides details about substrate binding, while a trapped nicotinoyl thioester in a complex with SpNic reveals the structure of the proposed thioester reaction intermediate. Examination of the active site of SpNic reveals several important features, including a metal ion that coordinates the substrate and the catalytically relevant water molecule and an oxyanion hole that both orients the substrate and offsets the negative charge that builds up during catalysis. Structures of this enzyme with bound nicotinaldehyde inhibitors elucidate the mechanism of inhibition and provide further details about the catalytic mechanism. In addition, we provide a biochemical analysis of the identity and role of the metal ion that orients the ligand in the active site and activates the water molecule responsible for hydrolysis of the substrate. These data provide structural evidence of several proposed reaction intermediates and allow for a more complete understanding of the catalytic mechanism of this enzyme.

  9. High-Resolution Crystal Structures of Streptococcus pneumoniae Nicotinamidase with Trapped Intermediates Provide Insights into the Catalytic Mechanism and Inhibition by Aldehydes

    Energy Technology Data Exchange (ETDEWEB)

    French, Jarrod B.; Cen, Yana; Sauve, Anthony A.; Ealick, Steven E. (Cornell); (Weill-Med)

    2010-11-11

    Nicotinamidases are salvage enzymes that convert nicotinamide to nicotinic acid. These enzymes are essential for the recycling of nicotinamide into NAD{sup +} in most prokaryotes and most single-cell and multicellular eukaryotes, but not in mammals. The significance of these enzymes for nicotinamide salvage and for NAD{sup +} homeostasis has stimulated interest in nicotinamidases as possible antibiotic targets. Nicotinamidases are also regulators of intracellular nicotinamide concentrations, thereby regulating signaling of downstream NAD{sup +}-consuming enzymes, such as the NAD{sup +}-dependent deacetylases (sirtuins). Here, we report several high-resolution crystal structures of the nicotinamidase from Streptococcus pneumoniae (SpNic) in unliganded and ligand-bound forms. The structure of the C136S mutant in complex with nicotinamide provides details about substrate binding, while a trapped nicotinoyl thioester in a complex with SpNic reveals the structure of the proposed thioester reaction intermediate. Examination of the active site of SpNic reveals several important features, including a metal ion that coordinates the substrate and the catalytically relevant water molecule and an oxyanion hole that both orients the substrate and offsets the negative charge that builds up during catalysis. Structures of this enzyme with bound nicotinaldehyde inhibitors elucidate the mechanism of inhibition and provide further details about the catalytic mechanism. In addition, we provide a biochemical analysis of the identity and role of the metal ion that orients the ligand in the active site and activates the water molecule responsible for hydrolysis of the substrate. These data provide structural evidence of several proposed reaction intermediates and allow for a more complete understanding of the catalytic mechanism of this enzyme.

  10. Process assessment associated to microbial community response provides insight on possible mechanism of waste activated sludge digestion under typical chemical pretreatments

    DEFF Research Database (Denmark)

    Zhou, Aijuan; Zhang, Jiaguang; Varrone, Cristiano

    2017-01-01

    was dominated by microorganisms that anaerobically hydrolyze organics to acids, while that in NaOH and SDS was mainly associated to biogas production. This study proved that the overall performance of WAS digestion was substantially depended on the initial chemical pretreatments, which in turn influenced...... and was related to the microbial community structures. Although the economic advantage might not be clear yet, the findings obtained in this work may provide a scientific basis for the potential implementation of chemicals for WAS treatment....

  11. Genomic regression of claw keratin, taste receptor and light-associated genes provides insights into biology and evolutionary origins of snakes.

    Science.gov (United States)

    Emerling, Christopher A

    2017-10-01

    Regressive evolution of anatomical traits often corresponds with the regression of genomic loci underlying such characters. As such, studying patterns of gene loss can be instrumental in addressing questions of gene function, resolving conflicting results from anatomical studies, and understanding the evolutionary history of clades. The evolutionary origins of snakes involved the regression of a number of anatomical traits, including limbs, taste buds and the visual system, and by analyzing serpent genomes, I was able to test three hypotheses associated with the regression of these features. The first concerns two keratins that are putatively specific to claws. Both genes that encode these keratins are pseudogenized/deleted in snake genomes, providing additional evidence of claw-specificity. The second hypothesis is that snakes lack taste buds, an issue complicated by conflicting results in the literature. I found evidence that different snakes have lost one or more taste receptors, but all snakes examined retained at least one gustatory channel. The final hypothesis addressed is that the earliest snakes were adapted to a dim light niche. I found evidence of deleted and pseudogenized genes with light-associated functions in snakes, demonstrating a pattern of gene loss similar to other dim light-adapted clades. Molecular dating estimates suggest that dim light adaptation preceded the loss of limbs, providing some bearing on interpretations of the ecological origins of snakes. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. The crystal structure of galactitol-1-phosphate 5-dehydrogenase from Escherichia coli K12 provides insights into its anomalous behavior on IMAC processes.

    Science.gov (United States)

    Esteban-Torres, María; Alvarez, Yanaisis; Acebrón, Iván; de las Rivas, Blanca; Muñoz, Rosario; Kohring, Gert-Wieland; Roa, Ana María; Sobrino, Mónica; Mancheño, José M

    2012-09-21

    Endogenous galactitol-1-phosphate 5-dehydrogenase (GPDH) (EC 1.1.1.251) from Escherichia coli spontaneously interacts with Ni(2+)-NTA matrices becoming a potential contaminant for recombinant, target His-tagged proteins. Purified recombinant, untagged GPDH (rGPDH) converted galactitol into tagatose, and d-tagatose-6-phosphate into galactitol-1-phosphate, in a Zn(2+)- and NAD(H)-dependent manner and readily crystallized what has permitted to solve its crystal structure. In contrast, N-terminally His-tagged GPDH was marginally stable and readily aggregated. The structure of rGPDH revealed metal-binding sites characteristic from the medium-chain dehydrogenase/reductase protein superfamily which may explain its ability to interact with immobilized metals. The structure also provides clues on the harmful effects of the N-terminal His-tag. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  13. Gibberellic Acid-Induced Aleurone Layers Responding to Heat Shock or Tunicamycin Provide Insight into the N-Glycoproteome, Protein Secretion, and Endoplasmic Reticulum Stress

    DEFF Research Database (Denmark)

    Barba Espin, Gregorio; Dedvisitsakul, Plaipol; Hägglund, Per

    2014-01-01

    respond to gibberellic acid by secreting an array of proteins and provide a unique system for the analysis of plant protein secretion. Perturbation of protein secretion in gibberellic acid-induced aleurone layers by two independent mechanisms, heat shock and tunicamycin treatment, demonstrated overlapping...... and secretion, such as calreticulin, protein disulfide isomerase, proteasome subunits, and isopentenyl diphosphate isomerase. Sixteen heat shock proteins in 29 spots showed diverse responses to the treatments, with only a minority increasing in response to heat shock. The majority, all of which were small heat...... shock proteins, decreased in heat-shocked aleurone layers. Additionally, glycopeptide enrichment and N-glycosylation analysis identified 73 glycosylation sites in 65 aleurone layer proteins, with 53 of the glycoproteins found in extracellular fractions and 36 found in intracellular fractions...

  14. Genome and secretome analyses provide insights into keratin decomposition by novel proteases from the non-pathogenic fungus Onygena corvina

    DEFF Research Database (Denmark)

    Huang, Yuhong; Kamp Busk, Peter; Herbst, Florian Alexander

    2015-01-01

    , the proteases secreted by O. corvina are interesting in view of their potential relevance for industrial decomposition of keratinaceous wastes. We sequenced and assembled the genome of O. corvina and used a method called peptide pattern recognition to identify 73 different proteases. Comparative genome analysis...... broth was fractionated by ion exchange chromatography to isolate active fractions with five novel proteases belonging to three protease families (S8, M28, and M3). Enzyme blends composed of three of these five proteases, one from each family, showed high degree of degradation of keratin in vitro....... A blend of novel proteases, such as those we discovered, could possibly find a use for degrading keratinaceous wastes and provide proteins, peptides, and amino acids as valuable ingredients for animal feed....

  15. Physiologically-based pharmacokinetic modeling of tamoxifen and its metabolites in women of different CYP2D6 phenotypes provides new insight into the tamoxifen mass balance

    Directory of Open Access Journals (Sweden)

    Kristin eDickschen

    2012-05-01

    Full Text Available Tamoxifen is a first-line endocrine agent in the mechanism-based treatment of estrogen receptor positive (ER+ mammary carcinoma and applied to breast cancer patients all over the world. Endoxifen is a secondary and highly active metabolite of tamoxifen that is formed among others by the polymorphic cytochrome P450 2D6 (CYP2D6. It is widely accepted that CYP2D6 poor metabolizers (PM exert a pronounced decrease in endoxifen steady-state plasma concentrations compared to CYP2D6 extensive metabolizers (EM. Nevertheless, an in-depth understanding of the chain of cause and effect between CYP2D6 genotype, endoxifen steady-state plasma concentration, and subsequent tamoxifen treatment benefit still remains to be evolved.In this context, physiologically-based pharmacokinetic (PBPK-modeling provides a useful tool to mechanistically investigate the impact of CYP2D6 phenotype on endoxifen formation in female breast cancer patients undergoing tamoxifen therapy.It has long been thought that only a minor percentage of endoxifen is formed via 4-hydroxytamoxifen. However, the current investigation supports very recently published data that postulates a contribution of 4-hydroxytamoxifen above 20 % to total endoxifen formation. The developed PBPK-model describes tamoxifen PK in rats and humans. Moreover, tamoxifen metabolism in dependence of CYP2D6 phenotype in populations of European female individuals is well described, thus providing a good basis to further investigate the linkage of PK, mode of action, and treatment outcome in dependence of factors such as phenotype, ethnicity or co-treatment with CYP2D6 inhibitors.

  16. Structural and Biochemical Characterization of Spa47 Provides Mechanistic Insight into Type III Secretion System ATPase Activation and Shigella Virulence Regulation.

    Science.gov (United States)

    Burgess, Jamie L; Burgess, R Alan; Morales, Yalemi; Bouvang, Jenna M; Johnson, Sean J; Dickenson, Nicholas E

    2016-12-09

    Like many Gram-negative pathogens, Shigella rely on a complex type III secretion system (T3SS) to inject effector proteins into host cells, take over host functions, and ultimately establish infection. Despite these critical roles, the energetics and regulatory mechanisms controlling the T3SS and pathogen virulence remain largely unclear. In this study, we present a series of high resolution crystal structures of Spa47 and use the structures to model an activated Spa47 oligomer, finding that ATP hydrolysis may be supported by specific side chain contributions from adjacent protomers within the complex. Follow-up mutagenesis experiments targeting the predicted active site residues validate the oligomeric model and determined that each of the tested residues are essential for Spa47 ATPase activity, although they are not directly responsible for stable oligomer formation. Although N-terminal domain truncation was necessary for crystal formation, it resulted in strictly monomeric Spa47 that is unable to hydrolyze ATP, despite maintaining the canonical ATPase core structure and active site residues. Coupled with studies of ATPase inactive full-length Spa47 point mutants, we find that Spa47 oligomerization and ATP hydrolysis are needed for complete T3SS apparatus formation, a proper translocator secretion profile, and Shigella virulence. This work represents the first structure-function characterization of Spa47, uniquely complementing the multitude of included Shigella T3SS phenotype assays and providing a more complete understanding of T3SS ATPase-mediated pathogen virulence. Additionally, these findings provide a strong platform for follow-up studies evaluating regulation of Spa47 oligomerization in vivo as a much needed means of treating and perhaps preventing shigellosis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Close but no cigar: Spatial precision deficits following medial temporal lobe lesions provide novel insight into theoretical models of navigation and memory.

    Science.gov (United States)

    Kolarik, Branden S; Baer, Trevor; Shahlaie, Kiarash; Yonelinas, Andrew P; Ekstrom, Arne D

    2018-01-01

    Increasing evidence suggests that the human hippocampus contributes to a range of different behaviors, including episodic memory, language, short-term memory, and navigation. A novel theoretical framework, the Precision and Binding Model, accounts for these phenomenon by describing a role for the hippocampus in high-resolution, complex binding. Other theories like Cognitive Map Theory, in contrast, predict a specific role for the hippocampus in allocentric navigation, while Declarative Memory Theory predicts a specific role in delay-dependent conscious memory. Navigation provides a unique venue for testing these predictions, with past results from research with humans providing inconsistent findings regarding the role of the human hippocampus in spatial navigation. Here, we tested five patients with lesions primarily restricted to the hippocampus and those extending out into the surrounding medial temporal lobe cortex on a virtual water maze task. Consistent with the Precision and Binding Model, we found partially intact allocentric memory in all patients, with impairments in the spatial precision of their searches for a hidden target. We found similar impairments at both immediate and delayed testing. Our findings are consistent with the Precision and Binding Model of hippocampal function, arguing for its role across domains in high-resolution, complex binding. Remembering goal locations in one's environment is a critical skill for survival. How this information is represented in the brain is still not fully understood, but is believed to rely in some capacity on structures in the medial temporal lobe. Contradictory findings from studies of both humans and animals have been difficult to reconcile with regard to the role of the MTL, specifically the hippocampus. By assessing impairments observed during navigation to a goal in patients with medial temporal lobe damage we can better understand the role these structures play in such behavior. Utilizing virtual reality

  18. The NMR solution structure of Mycobacterium tuberculosis F-ATP synthase subunit ε provides new insight into energy coupling inside the rotary engine.

    Science.gov (United States)

    Joon, Shin; Ragunathan, Priya; Sundararaman, Lavanya; Nartey, Wilson; Kundu, Subhashri; Manimekalai, Malathy S S; Bogdanović, Nebojša; Dick, Thomas; Grüber, Gerhard

    2018-03-01

    Mycobacterium tuberculosis (Mt) F 1 F 0 ATP synthase (α 3 :β 3 :γ:δ:ε:a:b:b':c 9 ) is essential for the viability of growing and nongrowing persister cells of the pathogen. Here, we present the first NMR solution structure of Mtε, revealing an N-terminal β-barrel domain (NTD) and a C-terminal domain (CTD) composed of a helix-loop-helix with helix 1 and -2 being shorter compared to their counterparts in other bacteria. The C-terminal amino acids are oriented toward the NTD, forming a domain-domain interface between the NTD and CTD. The Mtε structure provides a novel mechanistic model of coupling c-ring- and ε rotation via a patch of hydrophobic residues in the NTD and residues of the CTD to the bottom of the catalytic α 3 β 3 -headpiece. To test our model, genome site-directed mutagenesis was employed to introduce amino acid changes in these two parts of the epsilon subunit. Inverted vesicle assays show that these mutations caused an increase in ATP hydrolysis activity and a reduction in ATP synthesis. The structural and enzymatic data are discussed in light of the transition mechanism of a compact and extended state of Mtε, which provides the inhibitory effects of this coupling subunit inside the rotary engine. Finally, the employment of these data with molecular docking shed light into the second binding site of the drug Bedaquiline. Structural data are available in the PDB under the accession number 5YIO. © 2018 Federation of European Biochemical Societies.

  19. Structural and Biochemical Characterization of Spa47 Provides Mechanistic Insight into Type III Secretion System ATPase Activation and Shigella Virulence Regulation*

    Science.gov (United States)

    Burgess, Jamie L.; Burgess, R. Alan; Morales, Yalemi; Bouvang, Jenna M.; Johnson, Sean J.; Dickenson, Nicholas E.

    2016-01-01

    Like many Gram-negative pathogens, Shigella rely on a complex type III secretion system (T3SS) to inject effector proteins into host cells, take over host functions, and ultimately establish infection. Despite these critical roles, the energetics and regulatory mechanisms controlling the T3SS and pathogen virulence remain largely unclear. In this study, we present a series of high resolution crystal structures of Spa47 and use the structures to model an activated Spa47 oligomer, finding that ATP hydrolysis may be supported by specific side chain contributions from adjacent protomers within the complex. Follow-up mutagenesis experiments targeting the predicted active site residues validate the oligomeric model and determined that each of the tested residues are essential for Spa47 ATPase activity, although they are not directly responsible for stable oligomer formation. Although N-terminal domain truncation was necessary for crystal formation, it resulted in strictly monomeric Spa47 that is unable to hydrolyze ATP, despite maintaining the canonical ATPase core structure and active site residues. Coupled with studies of ATPase inactive full-length Spa47 point mutants, we find that Spa47 oligomerization and ATP hydrolysis are needed for complete T3SS apparatus formation, a proper translocator secretion profile, and Shigella virulence. This work represents the first structure-function characterization of Spa47, uniquely complementing the multitude of included Shigella T3SS phenotype assays and providing a more complete understanding of T3SS ATPase-mediated pathogen virulence. Additionally, these findings provide a strong platform for follow-up studies evaluating regulation of Spa47 oligomerization in vivo as a much needed means of treating and perhaps preventing shigellosis. PMID:27770024

  20. Genome-wide identification of Jatropha curcas aquaporin genes and the comparative analysis provides insights into the gene family expansion and evolution in Hevea brasiliensis

    Directory of Open Access Journals (Sweden)

    Zhi eZou

    2016-03-01

    Full Text Available Aquaporins (AQPs are channel-forming integral membrane proteins that transport water and other small solutes across biological membranes. Despite the vital role of AQPs, to date, little is known in physic nut (Jatropha curcas L., Euphorbiaceae, an important non-edible oilseed crop with great potential for the production of biodiesel. In this study, 32 AQP genes were identified from the physic nut genome and the family number is relatively small in comparison to 51 in another Euphorbiaceae plant, rubber tree (Hevea brasiliensis Muell. Arg.. Based on the phylogenetic analysis, the JcAQPs were assigned to five subfamilies, i.e., 9 plasma membrane intrinsic proteins (PIPs, 9 tonoplast intrinsic proteins (TIPs, 8 NOD26-like intrinsic proteins (NIPs, 2 X intrinsic proteins (XIPs and 4 small basic intrinsic proteins (SIPs. Like rubber tree and other plant species, functional prediction based on the aromatic/arginine selectivity filter, Froger’s positions and specificity-determining positions showed a remarkable difference in substrate specificity among subfamilies of JcAQPs. Genome-wide comparative analysis revealed the specific expansion of PIP and TIP subfamilies in rubber tree and the specific gene loss of the XIP subfamily in physic nut. Furthermore, by analyzing deep transcriptome sequencing data, the expression evolution especially the expression divergence of duplicated HbAQP genes was also investigated and discussed. Results obtained from this study not only provide valuable information for future functional analysis and utilization of Jc/HbAQP genes, but also provide a useful reference to survey the gene family expansion and evolution in Euphorbiaceae plants and other plant species.

  1. Processes of local alcohol policy-making in England: Does the theory of policy transfer provide useful insights into public health decision-making?

    Science.gov (United States)

    Gavens, Lucy; Holmes, John; Buykx, Penny; de Vocht, Frank; Egan, Matt; Grace, Daniel; Lock, Karen; Mooney, John D; Brennan, Alan

    2017-06-13

    Recent years have seen a rise in new and innovative policies to reduce alcohol consumption and related harm in England, which can be implemented by local, as opposed to national, policy-makers. The aim of this paper is to explore the processes that underpin the adoption of these alcohol policies within local authorities. In particular, it aims to assess whether the concept of policy transfer (i.e. a process through which knowledge about policies in one place is used in the development of policies in another time or place) provides a useful model for understanding local alcohol policy-making. Qualitative data generated through in-depth interviews and focus groups from five case study sites across England were used to explore stakeholder experiences of alcohol policy transfer between local authorities. The purposive sample of policy actors included representatives from the police, trading standards, public health, licensing, and commissioning. Thematic analysis was used inductively to identify key features in the data. Themes from the policy transfer literature identified in the data were: policy copying, emulating, hybridization, and inspiration. Participants described a multitude of ways in which learning was shared between places, ranging from formal academic evaluation to opportunistic conversations in informal settings. Participants also described facilitators and constraints to policy transfer, such as the historical policy context and the local cultural, economic, and bureaucratic context, which influenced whether or not a policy that was perceived to work in one place might be transferred successfully to another context. Theories of policy transfer provide a promising framework for characterising processes of local alcohol policy-making in England, extending beyond debates regarding evidence-informed policy to account for a much wider range of considerations. Applying a policy transfer lens enables us to move beyond simple (but still important) questions of

  2. De novo transcriptome assembly of a Chinese locoweed (Oxytropis ochrocephala species provides insights into genes associated with drought, salinity and cold tolerance

    Directory of Open Access Journals (Sweden)

    Wei eHe

    2015-12-01

    Full Text Available Background: Locoweeds (toxic Oxytropis and Astraglus species, containing the toxic agent swainsonine, pose serious threats to animal husbandry on grasslands in both China and the US. Some locoweeds have evolved adaptations in order to resist various stress conditions such as drought, salt and cold. As a result they replace other plants in their communities and become an ecological problem. Currently very limited genetic information of locoweeds is available and this hinders our understanding in the molecular basis of their environmental plasticity, and the interaction between locoweeds and their symbiotic swainsonine producing endophytes. Next-generation sequencing provides a means of obtaining transcriptomic sequences in a timely manner, which is particularly useful for non-model plants. In this study, we performed transcriptome sequencing of Oxytropis ochrocephala plants followed by a de nove assembly. Our primary aim was to provide an enriched pool of genetic sequences of an Oxytropis sp. for further locoweed research. Results: Transcriptomes of four different O. ochrocephala samples, from control (CK plants, and those that had experienced either drought (20% PEG, salt (150 mM NaCl or cold (4 °C stress were sequenced using an Illumina Hiseq 2000 platform. From 232,209,506 clean reads 23,220,950,600 (~23 G nucleotides, 182,430 transcripts and 88,942 unigenes were retrieved, with an N50 value of 1,237. Differential expression analysis revealed putative genes encoding heat shock proteins (HSPs and late embryogenesis abundant (LEA proteins, enzymes in secondary metabolite and plant hormone biosyntheses, and transcription factors which are involved in stress tolerance in O. ochrocephala. In order to validate our sequencing results, we further analyzed the expression profiles of nine genes by quantitative real-time PCR. Finally, we discuss the possible mechanism of O. ochrocephala’s adaptations to stress environment. Conclusion: Our

  3. Tree rings provide a new class of phenotypes for genetic associations that foster insights into adaptation of conifers to climate change.

    Science.gov (United States)

    Housset, Johann M; Nadeau, Simon; Isabel, Nathalie; Depardieu, Claire; Duchesne, Isabelle; Lenz, Patrick; Girardin, Martin P

    2018-04-01

    Local adaptation in tree species has been documented through a long history of common garden experiments where functional traits (height, bud phenology) are used as proxies for fitness. However, the ability to identify genes or genomic regions related to adaptation to climate requires the evaluation of traits that precisely reflect how and when climate exerts selective constraints. We combine dendroecology with association genetics to establish a link between genotypes, phenotypes and interannual climatic fluctuations. We illustrate this approach by examining individual tree responses embedded in the annual rings of 233 Pinus strobus trees growing in a common garden experiment representing 38 populations from the majority of its range. We found that interannual variability in growth was affected by low temperatures during spring and autumn, and by summer heat and drought. Among-population variation in climatic sensitivity was significantly correlated with the mean annual temperature of the provenance, suggesting local adaptation. Genotype-phenotype associations using these new tree-ring phenotypes validated nine candidate genes identified in a previous genetic-environment association study. Combining dendroecology with association genetics allowed us to assess tree vulnerability to past climate at fine temporal scales and provides avenues for future genomic studies on functional adaptation in forest trees. © 2018 The Authors. New Phytologist © 2018 New Phytologist Trust.

  4. Microbial community composition of deep-sea corals from the Red Sea provides insight into functional adaption to a unique environment.

    Science.gov (United States)

    Röthig, Till; Yum, Lauren K; Kremb, Stephan G; Roik, Anna; Voolstra, Christian R

    2017-03-17

    Microbes associated with deep-sea corals remain poorly studied. The lack of symbiotic algae suggests that associated microbes may play a fundamental role in maintaining a viable coral host via acquisition and recycling of nutrients. Here we employed 16 S rRNA gene sequencing to study bacterial communities of three deep-sea scleractinian corals from the Red Sea, Dendrophyllia sp., Eguchipsammia fistula, and Rhizotrochus typus. We found diverse, species-specific microbiomes, distinct from the surrounding seawater. Microbiomes were comprised of few abundant bacteria, which constituted the majority of sequences (up to 58% depending on the coral species). In addition, we found a high diversity of rare bacteria (taxa at 90% of all bacteria). Interestingly, we identified anaerobic bacteria, potentially providing metabolic functions at low oxygen conditions, as well as bacteria harboring the potential to degrade crude oil components. Considering the presence of oil and gas fields in the Red Sea, these bacteria may unlock this carbon source for the coral host. In conclusion, the prevailing environmental conditions of the deep Red Sea (>20 °C, <2 mg oxygen L -1 ) may require distinct functional adaptations, and our data suggest that bacterial communities may contribute to coral functioning in this challenging environment.

  5. High-Throughput Sequencing and Linkage Mapping of a Clownfish Genome Provide Insights on the Distribution of Molecular Players Involved in Sex Change.

    Science.gov (United States)

    Casas, Laura; Saenz-Agudelo, Pablo; Irigoien, Xabier

    2018-03-06

    Clownfishes are an excellent model system for investigating the genetic mechanism governing hermaphroditism and socially-controlled sex change in their natural environment because they are broadly distributed and strongly site-attached. Genomic tools, such as genetic linkage maps, allow fine-mapping of loci involved in molecular pathways underlying these reproductive processes. In this study, a high-density genetic map of Amphiprion bicinctus was constructed with 3146 RAD markers in a full-sib family organized in 24 robust linkage groups which correspond to the haploid chromosome number of the species. The length of the map was 4294.71 cM, with an average marker interval of 1.38 cM. The clownfish linkage map showed various levels of conserved synteny and collinearity with the genomes of Asian and European seabass, Nile tilapia and stickleback. The map provided a platform to investigate the genomic position of genes with differential expression during sex change in A. bicinctus. This study aims to bridge the gap of genome-scale information for this iconic group of species to facilitate the study of the main gene regulatory networks governing social sex change and gonadal restructuring in protandrous hermaphrodites.

  6. Small RNA Transcriptome of Hibiscus Syriacus Provides Insights into the Potential Influence of microRNAs in Flower Development and Terpene Synthesis.

    Science.gov (United States)

    Kim, Taewook; Park, June Hyun; Lee, Sang-Gil; Kim, Soyoung; Kim, Jihyun; Lee, Jungho; Shin, Chanseok

    2017-08-01

    MicroRNAs (miRNAs) are essential small RNA molecules that regulate the expression of target mRNAs in plants and animals. Here, we aimed to identify miRNAs and their putative targets in Hibiscus syriacus , the national flower of South Korea. We employed high-throughput sequencing of small RNAs obtained from four different tissues ( i.e. , leaf, root, flower, and ovary) and identified 33 conserved and 30 novel miRNA families, many of which showed differential tissue-specific expressions. In addition, we computationally predicted novel targets of miRNAs and validated some of them using 5' rapid amplification of cDNA ends analysis. One of the validated novel targets of miR477 was a terpene synthase, the primary gene involved in the formation of disease-resistant terpene metabolites such as sterols and phytoalexins. In addition, a predicted target of conserved miRNAs, miR396, is SHORT VEGETATIVE PHASE , which is involved in flower initiation and is duplicated in H. syriacus . Collectively, this study provides the first reliable draft of the H. syriacus miRNA transcriptome that should constitute a basis for understanding the biological roles of miRNAs in H. syriacus.

  7. Gene expression correlated with delay in shell formation in larval Pacific oysters (Crassostrea gigas) exposed to experimental ocean acidification provides insights into shell formation mechanisms.

    Science.gov (United States)

    De Wit, Pierre; Durland, Evan; Ventura, Alexander; Langdon, Chris J

    2018-02-22

    Despite recent work to characterize gene expression changes associated with larval development in oysters, the mechanism by which the larval shell is first formed is still largely unknown. In Crassostrea gigas, this shell forms within the first 24 h post fertilization, and it has been demonstrated that changes in water chemistry can cause delays in shell formation, shell deformations and higher mortality rates. In this study, we use the delay in shell formation associated with exposure to CO 2 -acidified seawater to identify genes correlated with initial shell deposition. By fitting linear models to gene expression data in ambient and low aragonite saturation treatments, we are able to isolate 37 annotated genes correlated with initial larval shell formation, which can be categorized into 1) ion transporters, 2) shell matrix proteins and 3) protease inhibitors. Clustering of the gene expression data into co-expression networks further supports the result of the linear models, and also implies an important role of dynein motor proteins as transporters of cellular components during the initial shell formation process. Using an RNA-Seq approach with high temporal resolution allows us to identify a conceptual model for how oyster larval calcification is initiated. This work provides a foundation for further studies on how genetic variation in these identified genes could affect fitness of oyster populations subjected to future environmental changes, such as ocean acidification.

  8. Microbial community composition of deep-sea corals from the Red Sea provides insight into functional adaption to a unique environment

    KAUST Repository

    Röthig, Till

    2017-03-17

    Microbes associated with deep-sea corals remain poorly studied. The lack of symbiotic algae suggests that associated microbes may play a fundamental role in maintaining a viable coral host via acquisition and recycling of nutrients. Here we employed 16 S rRNA gene sequencing to study bacterial communities of three deep-sea scleractinian corals from the Red Sea, Dendrophyllia sp., Eguchipsammia fistula, and Rhizotrochus typus. We found diverse, species-specific microbiomes, distinct from the surrounding seawater. Microbiomes were comprised of few abundant bacteria, which constituted the majority of sequences (up to 58% depending on the coral species). In addition, we found a high diversity of rare bacteria (taxa at <1% abundance comprised >90% of all bacteria). Interestingly, we identified anaerobic bacteria, potentially providing metabolic functions at low oxygen conditions, as well as bacteria harboring the potential to degrade crude oil components. Considering the presence of oil and gas fields in the Red Sea, these bacteria may unlock this carbon source for the coral host. In conclusion, the prevailing environmental conditions of the deep Red Sea (>20 °C, <2 mg oxygen L−1) may require distinct functional adaptations, and our data suggest that bacterial communities may contribute to coral functioning in this challenging environment.

  9. RNA-seq Transcriptional Profiling of an Arbuscular Mycorrhiza Provides Insights into Regulated and Coordinated Gene Expression in Lotus japonicus and Rhizophagus irregularis.

    Science.gov (United States)

    Handa, Yoshihiro; Nishide, Hiroyo; Takeda, Naoya; Suzuki, Yutaka; Kawaguchi, Masayoshi; Saito, Katsuharu

    2015-08-01

    Gene expression during arbuscular mycorrhizal development is highly orchestrated in both plants and arbuscular mycorrhizal fungi. To elucidate the gene expression profiles of the symbiotic association, we performed a digital gene expression analysis of Lotus japonicus and Rhizophagus irregularis using a HiSeq 2000 next-generation sequencer with a Cufflinks assembly and de novo transcriptome assembly. There were 3,641 genes differentially expressed during arbuscular mycorrhizal development in L. japonicus, approximately 80% of which were up-regulated. The up-regulated genes included secreted proteins, transporters, proteins involved in lipid and amino acid metabolism, ribosomes and histones. We also detected many genes that were differentially expressed in small-secreted peptides and transcription factors, which may be involved in signal transduction or transcription regulation during symbiosis. Co-regulated genes between arbuscular mycorrhizal and root nodule symbiosis were not particularly abundant, but transcripts encoding for membrane traffic-related proteins, transporters and iron transport-related proteins were found to be highly co-up-regulated. In transcripts of arbuscular mycorrhizal fungi, expansion of cytochrome P450 was observed, which may contribute to various metabolic pathways required to accommodate roots and soil. The comprehensive gene expression data of both plants and arbuscular mycorrhizal fungi provide a powerful platform for investigating the functional and molecular mechanisms underlying arbuscular mycorrhizal symbiosis. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  10. Comparative genomics of phylogenetically diverse unicellular eukaryotes provide new insights into the genetic basis for the evolution of the programmed cell death machinery.

    Science.gov (United States)

    Nedelcu, Aurora M

    2009-03-01

    Programmed cell death (PCD) represents a significant component of normal growth and development in multicellular organisms. Recently, PCD-like processes have been reported in single-celled eukaryotes, implying that some components of the PCD machinery existed early in eukaryotic evolution. This study provides a comparative analysis of PCD-related sequences across more than 50 unicellular genera from four eukaryotic supergroups: Unikonts, Excavata, Chromalveolata, and Plantae. A complex set of PCD-related sequences that correspond to domains or proteins associated with all main functional classes--from ligands and receptors to executors of PCD--was found in many unicellular lineages. Several PCD domains and proteins previously thought to be restricted to animals or land plants are also present in unicellular species. Noteworthy, the yeast, Saccharomyces cerevisiae--used as an experimental model system for PCD research, has a rather reduced set of PCD-related sequences relative to other unicellular species. The phylogenetic distribution of the PCD-related sequences identified in unicellular lineages suggests that the genetic basis for the evolution of the complex PCD machinery present in extant multicellular lineages has been established early in the evolution of eukaryotes. The shaping of the PCD machinery in multicellular lineages involved the duplication, co-option, recruitment, and shuffling of domains already present in their unicellular ancestors.

  11. The synthesis map is a multidimensional educational tool that provides insight into students' mental models and promotes students' synthetic knowledge generation.

    Science.gov (United States)

    Ortega, Ryan A; Brame, Cynthia J

    2015-01-01

    Concept mapping was developed as a method of displaying and organizing hierarchical knowledge structures. Using the new, multidimensional presentation software Prezi, we have developed a new teaching technique designed to engage higher-level skills in the cognitive domain. This tool, synthesis mapping, is a natural evolution of concept mapping, which utilizes embedding to layer information within concepts. Prezi's zooming user interface lets the author of the presentation use both depth as well as distance to show connections between data, ideas, and concepts. Students in the class Biology of Cancer created synthesis maps to illustrate their knowledge of tumorigenesis. Students used multiple organizational schemes to build their maps. We present an analysis of student work, placing special emphasis on organization within student maps and how the organization of knowledge structures in student maps can reveal strengths and weaknesses in student understanding or instruction. We also provide a discussion of best practices for instructors who would like to implement synthesis mapping in their classrooms. © 2015 R. A. Ortega and C. J. Brame et al. CBE—Life Sciences Education © 2015 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  12. The Synthesis Map Is a Multidimensional Educational Tool That Provides Insight into Students’ Mental Models and Promotes Students’ Synthetic Knowledge Generation

    Science.gov (United States)

    Ortega, Ryan A.; Brame, Cynthia J.

    2015-01-01

    Concept mapping was developed as a method of displaying and organizing hierarchical knowledge structures. Using the new, multidimensional presentation software Prezi, we have developed a new teaching technique designed to engage higher-level skills in the cognitive domain. This tool, synthesis mapping, is a natural evolution of concept mapping, which utilizes embedding to layer information within concepts. Prezi’s zooming user interface lets the author of the presentation use both depth as well as distance to show connections between data, ideas, and concepts. Students in the class Biology of Cancer created synthesis maps to illustrate their knowledge of tumorigenesis. Students used multiple organizational schemes to build their maps. We present an analysis of student work, placing special emphasis on organization within student maps and how the organization of knowledge structures in student maps can reveal strengths and weaknesses in student understanding or instruction. We also provide a discussion of best practices for instructors who would like to implement synthesis mapping in their classrooms. PMID:25917385

  13. High-Throughput Sequencing and Linkage Mapping of a Clownfish Genome Provide Insights on the Distribution of Molecular Players Involved in Sex Change

    KAUST Repository

    Casas, Laura

    2018-02-28

    Clownfishes are an excellent model system for investigating the genetic mechanism governing hermaphroditism and socially-controlled sex change in their natural environment because they are broadly distributed and strongly site-attached. Genomic tools, such as genetic linkage maps, allow fine-mapping of loci involved in molecular pathways underlying these reproductive processes. In this study, a high-density genetic map of Amphiprion bicinctus was constructed with 3146 RAD markers in a full-sib family organized in 24 robust linkage groups which correspond to the haploid chromosome number of the species. The length of the map was 4294.71 cM, with an average marker interval of 1.38 cM. The clownfish linkage map showed various levels of conserved synteny and collinearity with the genomes of Asian and European seabass, Nile tilapia and stickleback. The map provided a platform to investigate the genomic position of genes with differential expression during sex change in A. bicinctus. This study aims to bridge the gap of genome-scale information for this iconic group of species to facilitate the study of the main gene regulatory networks governing social sex change and gonadal restructuring in protandrous hermaphrodites.

  14. Tissue-specific transcriptomic profiling provides new insights into the reproductive ecology and biology of the iconic seagrass species Posidonia oceanica.

    Science.gov (United States)

    Entrambasaguas, Laura; Jahnke, Marlene; Biffali, Elio; Borra, Marco; Sanges, Remo; Marín-Guirao, Lázaro; Procaccini, Gabriele

    2017-10-01

    Seagrasses form extensive meadows in shallow coastal waters and are among the world's most productive ecosystems. Seagrasses can produce both clonally and sexually, and flowering has long been considered infrequent, but important for maintaining genetically diverse stands. Here we investigate the molecular mechanisms involved in flowering of the seagrass Posidonia oceanica, an iconic species endemic to the Mediterranean. We generated a de novo transcriptome of this non-model species for leaf, male and female flower tissue of three individuals, and present molecular evidence for genes that may be involved in the flowering process and on the reproductive biology of the species. We present evidence that suggests that P. oceanica exhibits a strategy of protogyny, where the female part of the hermaphroditic flower develops before the male part, in order to avoid self-fertilization. We found photosynthetic genes to be up-regulated in the female flower tissues, indicating that this may be capable of photosynthesis. Finally, we detected a number of interesting genes, previously known to be involved in flowering pathways responding to light and temperature cues and in pathways involved in anthocyanin and exine synthesis. This first comparative transcriptomic approach of leaf, male and female tissue provides a basis for functional genomics research on flower development in P. oceanica and other seagrass species. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. A Unique Set of the Burkholderia Collagen-Like Proteins Provides Insight into Pathogenesis, Genome Evolution and Niche Adaptation, and Infection Detection.

    Science.gov (United States)

    Bachert, Beth A; Choi, Soo J; Snyder, Anna K; Rio, Rita V M; Durney, Brandon C; Holland, Lisa A; Amemiya, Kei; Welkos, Susan L; Bozue, Joel A; Cote, Christopher K; Berisio, Rita; Lukomski, Slawomir

    2015-01-01

    Burkholderia pseudomallei and Burkholderia mallei, classified as category B priority pathogens, are significant human and animal pathogens that are highly infectious and broad-spectrum antibiotic resistant. Currently, the pathogenicity mechanisms utilized by Burkholderia are not fully understood, and correct diagnosis of B. pseudomallei and B. mallei infection remains a challenge due to limited detection methods. Here, we provide a comprehensive analysis of a set of 13 novel Burkholderia collagen-like proteins (Bucl) that were identified among B. pseudomallei and B. mallei select agents. We infer that several Bucl proteins participate in pathogenesis based on their noncollagenous domains that are associated with the components of a type III secretion apparatus and membrane transport systems. Homology modeling of the outer membrane efflux domain of Bucl8 points to a role in multi-drug resistance. We determined that bucl genes are widespread in B. pseudomallei and B. mallei; Fischer's exact test and Cramer's V2 values indicate that the majority of bucl genes are highly associated with these pathogenic species versus nonpathogenic B. thailandensis. We designed a bucl-based quantitative PCR assay which was able to detect B. pseudomallei infection in a mouse with a detection limit of 50 CFU. Finally, chromosomal mapping and phylogenetic analysis of bucl loci revealed considerable genomic plasticity and adaptation of Burkholderia spp. to host and environmental niches. In this study, we identified a large set of phylogenetically unrelated bucl genes commonly found in Burkholderia select agents, encoding predicted pathogenicity factors, detection targets, and vaccine candidates.

  16. Fasciola hepatica: a light and electron microscope study of the ovary and of the development of oocytes within eggs in the uterus provides an insight into reproductive strategy.

    Science.gov (United States)

    Hanna, R E B; Moffett, D; Forster, F I; Trudgett, A G; Brennan, G P; Fairweather, I

    2016-05-15

    The ultrastructure of the ovary of Fasciola hepatica collected from field-infected sheep, was compared with that of flukes from laboratory-infected rats harbouring the Oberon or the Cullompton fluke isolate. At the periphery of the ovarian tubules, in all flukes, interstitial tissue was identified that appears to provide physical support and facilitate the metabolism of the germinal-line cells. Oogonia undergo mitotic division to maintain the cell population and to produce oocytes. Early oocytes feature conspicuous synaptonemal complexes in the nucleoplasm, and these become less evident as the oocytes grow in size, move towards the core of the ovarian tubule, and synthesise osmiophilic bodies. The latter may represent cortical granules, and serve to block polyspermy. The identity of the synaptonemal complexes was confirmed by immunocytochemical labelling of synaptonemal proteins. The occurrence of synaptonemal complexes in the oocytes of all fluke types examined indicates that pairing of bivalent chromosomes, with the potential for genetic recombination and chiasmata formation, is a feature of the triploid aspermic parthenogenetic Cullompton flukes, as well as of the wild-type out-breeding field-derived and Oberon isolate flukes. In oocytes within shelled eggs in the proximal uterus of all flukes, condensed chromosomes align at meiotic metaphase plates. Following the reduction division, two equal pronuclei appear in each oocyte in the distal uterus. On the basis of these observations, a mechanism of facultative parthenogenesis for F. hepatica is proposed that accommodates the survival and clonal expansion of triploid aspermic isolates. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Genome-wide characterization of long intergenic non-coding RNAs (lincRNAs) provides new insight into viral diseases in honey bees Apis cerana and Apis mellifera.

    Science.gov (United States)

    Jayakodi, Murukarthick; Jung, Je Won; Park, Doori; Ahn, Young-Joon; Lee, Sang-Choon; Shin, Sang-Yoon; Shin, Chanseok; Yang, Tae-Jin; Kwon, Hyung Wook

    2015-09-04

    Long non-coding RNAs (lncRNAs) are a class of RNAs that do not encode proteins. Recently, lncRNAs have gained special attention for their roles in various biological process and diseases. In an attempt to identify long intergenic non-coding RNAs (lincRNAs) and their possible involvement in honey bee development and diseases, we analyzed RNA-seq datasets generated from Asian honey bee (Apis cerana) and western honey bee (Apis mellifera). We identified 2470 lincRNAs with an average length of 1011 bp from A. cerana and 1514 lincRNAs with an average length of 790 bp in A. mellifera. Comparative analysis revealed that 5 % of the total lincRNAs derived from both species are unique in each species. Our comparative digital gene expression analysis revealed a high degree of tissue-specific expression among the seven major tissues of honey bee, different from mRNA expression patterns. A total of 863 (57 %) and 464 (18 %) lincRNAs showed tissue-dependent expression in A. mellifera and A. cerana, respectively, most preferentially in ovary and fat body tissues. Importantly, we identified 11 lincRNAs that are specifically regulated upon viral infection in honey bees, and 10 of them appear to play roles during infection with various viruses. This study provides the first comprehensive set of lincRNAs for honey bees and opens the door to discover lincRNAs associated with biological and hormone signaling pathways as well as various diseases of honey bee.

  18. Comparative Genomics of the Dual-Obligate Symbionts from the Treehopper, Entylia carinata (Hemiptera: Membracidae), Provide Insight into the Origins and Evolution of an Ancient Symbiosis.

    Science.gov (United States)

    Mao, Meng; Yang, Xiushuai; Poff, Kirsten; Bennett, Gordon

    2017-06-01

    Insect species in the Auchenorrhyncha suborder (Hemiptera) maintain ancient obligate symbioses with bacteria that provide essential amino acids (EAAs) deficient in their plant-sap diets. Molecular studies have revealed that two complementary symbiont lineages, "Candidatus Sulcia muelleri" and a betaproteobacterium ("Ca. Zinderia insecticola" in spittlebugs [Cercopoidea] and "Ca. Nasuia deltocephalinicola" in leafhoppers [Cicadellidae]) may have persisted in the suborder since its origin ∼300 Ma. However, investigation of how this pair has co-evolved on a genomic level is limited to only a few host lineages. We sequenced the complete genomes of Sulcia and a betaproteobacterium from the treehopper, Entylia carinata (Membracidae: ENCA), as the first representative from this species-rich group. It also offers the opportunity to compare symbiont evolution across a major insect group, the Membracoidea (leafhoppers + treehoppers). Genomic analyses show that the betaproteobacteria in ENCA is a member of the Nasuia lineage. Both symbionts have larger genomes (Sulcia = 218 kb and Nasuia = 144 kb) than related lineages in Deltocephalinae leafhoppers, retaining genes involved in basic cellular functions and information processing. Nasuia-ENCA further exhibits few unique gene losses, suggesting that its parent lineage in the common ancestor to the Membracoidea was already highly reduced. Sulcia-ENCA has lost the abilities to synthesize menaquinone cofactor and to complete the synthesis of the branched-chain EAAs. Both capabilities are conserved in other Sulcia lineages sequenced from across the Auchenorrhyncha. Finally, metagenomic sequencing recovered the partial genome of an Arsenophonus symbiont, although it infects only 20% of individuals indicating a facultative role. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  19. An active site mutant of Escherichia coli cyclopropane fatty acid synthase forms new non-natural fatty acids providing insights on the mechanism of the enzymatic reaction.

    Science.gov (United States)

    E, Guangqi; Drujon, Thierry; Correia, Isabelle; Ploux, Olivier; Guianvarc'h, Dominique

    2013-12-01

    We have produced and purified an active site mutant of the Escherichia coli cyclopropane fatty acid synthase (CFAS) by replacing the strictly conserved G236 within cyclopropane synthases, by a glutamate residue, which corresponds to E146 of the homologous mycolic acid methyltransferase, Hma, producing hydroxymethyl mycolic acids. The G236E CFAS mutant had less than 1% of the in vitro activity of the wild type enzyme. We expressed the G236E CFAS mutant in an E. coli (DE3) strain in which the chromosomal cfa gene had been deleted. After extraction of phospholipids and conversion into the corresponding fatty acid methyl esters (FAMEs), we observed the formation of cyclopropanated FAMEs suggesting that the mutant retained some of the normal activity in vivo. However, we also observed the formation of new C17 methyl-branched unsaturated FAMEs whose structures were determined using GC/MS and NMR analyses. The double bond was located at different positions 8, 9 or 10, and the methyl group at position 10 or 9. Thus, this new FAMEs are likely arising from a 16:1 acyl chain of a phospholipid that had been transformed by the G236E CFAS mutant in vivo. The reaction catalyzed by this G236E CFAS mutant thus starts by the methylation of the unsaturated acyl chain at position 10 or 9 yielding a carbocation at position 9 or 10 respectively. It follows then two competing steps, a normal cyclopropanation or hydride shift/elimination events giving different combinations of alkenes. This study not only provides further evidence that cyclopropane synthases (CSs) form a carbocationic intermediate but also opens the way to CSs engineering for the synthesis of non-natural fatty acids. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  20. Whole-Genome Sequencing and Comparative Genome Analysis Provided Insight into the Predatory Features and Genetic Diversity of Two Bdellovibrio Species Isolated from Soil

    Directory of Open Access Journals (Sweden)

    Omotayo Opemipo Oyedara

    2018-01-01

    Full Text Available Bdellovibrio spp. are predatory bacteria with great potential as antimicrobial agents. Studies have shown that members of the genus Bdellovibrio exhibit peculiar characteristics that influence their ecological adaptations. In this study, whole genomes of two different Bdellovibrio spp. designated SKB1291214 and SSB218315 isolated from soil were sequenced. The core genes shared by all the Bdellovibrio spp. considered for the pangenome analysis including the epibiotic B. exovorus were 795. The number of unique genes identified in Bdellovibrio spp. SKB1291214, SSB218315, W, and B. exovorus JJS was 1343, 113, 857, and 1572, respectively. These unique genes encode hydrolytic, chemotaxis, and transporter proteins which might be useful for predation in the Bdellovibrio strains. Furthermore, the two Bdellovibrio strains exhibited differences based on the % GC content, amino acid identity, and 16S rRNA gene sequence. The 16S rRNA gene sequence of Bdellovibrio sp. SKB1291214 shared 99% identity with that of an uncultured Bdellovibrio sp. clone 12L 106 (a pairwise distance of 0.008 and 95–97% identity (a pairwise distance of 0.043 with that of other culturable terrestrial Bdellovibrio spp., including strain SSB218315. In Bdellovibrio sp. SKB1291214, 174 bp sequence was inserted at the host interaction (hit locus region usually attributed to prey attachment, invasion, and development of host independent Bdellovibrio phenotypes. Also, a gene equivalent to Bd0108 in B. bacteriovorus HD100 was not conserved in Bdellovibrio sp. SKB1291214. The results of this study provided information on the genetic characteristics and diversity of the genus Bdellovibrio that can contribute to their successful applications as a biocontrol agent.

  1. Single Cell Analysis Linking Ribosomal (r)DNA and rRNA Copy Numbers to Cell Size and Growth Rate Provides Insights into Molecular Protistan Ecology.

    Science.gov (United States)

    Fu, Rao; Gong, Jun

    2017-11-01

    Ribosomal (r)RNA and rDNA have been golden molecular markers in microbial ecology. However, it remains poorly understood how ribotype copy number (CN)-based characteristics are linked with diversity, abundance, and activity of protist populations and communities observed at organismal levels. Here, we applied a single-cell approach to quantify ribotype CNs in two ciliate species reared at different temperatures. We found that in actively growing cells, the per-cell rDNA and rRNA CNs scaled with cell volume (CV) to 0.44 and 0.58 powers, respectively. The modeled rDNA and rRNA concentrations thus appear to be much higher in smaller than in larger cells. The observed rRNA:rDNA ratio scaled with CV 0.14 . The maximum growth rate could be well predicted by a combination of per-cell ribotype CN and temperature. Our empirical data and modeling on single-cell ribotype scaling are in agreement with both the metabolic theory of ecology and the growth rate hypothesis, providing a quantitative framework for linking cellular rDNA and rRNA CNs with body size, growth (activity), and biomass stoichiometry. This study also demonstrates that the expression rate of rRNA genes is constrained by cell size, and favors biomass rather than abundance-based interpretation of quantitative ribotype data in population and community ecology of protists. © 2017 The Authors. Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.

  2. Tectonic Inversion Along the Algerian and Ligurian Margins: On the Insight Provided By Latest Seismic Processing Techniques Applied to Recent and Vintage 2D Offshore Multichannel Seismic Data

    Science.gov (United States)

    Schenini, L.; Beslier, M. O.; Sage, F.; Badji, R.; Galibert, P. Y.; Lepretre, A.; Dessa, J. X.; Aidi, C.; Watremez, L.

    2014-12-01

    Recent studies on the Algerian and the North-Ligurian margins in the Western Mediterranean have evidenced inversion-related superficial structures, such as folds and asymmetric sedimentary perched basins whose geometry hints at deep compressive structures dipping towards the continent. Deep seismic imaging of these margins is difficult due to steep slope and superficial multiples, and, in the Mediterranean context, to the highly diffractive Messinian evaporitic series in the basin. During the Algerian-French SPIRAL survey (2009, R/V Atalante), 2D marine multi-channel seismic (MCS) reflection data were collected along the Algerian Margin using a 4.5 km, 360 channel digital streamer and a 3040 cu. in. air-gun array. An advanced processing workflow has been laid out using Geocluster CGG software, which includes noise attenuation, 2D SRME multiple attenuation, surface consistent deconvolution, Kirchhoff pre-stack time migration. This processing produces satisfactory seismic images of the whole sedimentary cover, and of southward dipping reflectors in the acoustic basement along the central part of the margin offshore Great Kabylia, that are interpreted as inversion-related blind thrusts as part of flat-ramp systems. We applied this successful processing workflow to old 2D marine MCS data acquired on the North-Ligurian Margin (Malis survey, 1995, R/V Le Nadir), using a 2.5 km, 96 channel streamer and a 1140 cu. in. air-gun array. Particular attention was paid to multiple attenuation in adapting our workflow. The resulting reprocessed seismic images, interpreted with a coincident velocity model obtained by wide-angle data tomography, provide (1) enhanced imaging of the sedimentary cover down to the top of the acoustic basement, including the base of the Messinian evaporites and the sub-salt Miocene series, which appear to be tectonized as far as in the mid-basin, and (2) new evidence of deep crustal structures in the margin which the initial processing had failed to

  3. Age-related changes of healthy bone marrow cell signaling in response to growth factors provide insight into low risk MDS.

    Science.gov (United States)

    Kornblau, Steven M; Cohen, Aileen C; Soper, David; Huang, Ying-Wen; Cesano, Alessandra

    2014-11-01

    Single Cell Network Profiling (SCNP) is a multiparametric flow cytometry-based assay that quantifiably and simultaneously measures changes in intracellular signaling proteins in response to in vitro extracellular modulators at the single cell level. Myelodysplastic syndrome (MDS) is a heterogeneous clonal disorder of hematopoietic stem cells that occurs in elderly subjects and is characterized by dysplasia and ineffective hematopoiesis. The functional responsiveness of MDS bone marrow (BM) hematopoietic cells, including functionally distinct myeloid and erythroid precursor subsets, to hematopoietic growth factors (HGF) and the relationship of modulated signaling to disease characteristics is poorly understood. SCNP was used first to examine the effects of age on erythropoietin (EPO) and granulocyte colony stimulating factor (GCSF)-induced signaling in myeloid, nucleated red blood cells (nRBC), and CD34 expressing cell subsets in healthy BM (n = 15). SCNP was then used to map functional signaling profiles in low risk (LR) MDS (n = 7) for comparison to signaling in samples from healthy donors and to probe signaling associations within clinically defined subgroups. In healthy BM samples, signaling responses to HGF were quite homogeneous (i.e., tightly regulated) with age-dependent effects observed in response to EPO but not to GCSF. Despite the relatively small number of samples assayed in the study, LR MDS could be classified into distinct subgroups based on both cell subset frequency and signaling profiles. As a correlate of underlying genetic abnormalities, signal transduction analyses may provide a functional and potentially clinically relevant classification of MDS. Further evaluation in a larger cohort is warranted. © 2013 Clinical Cytometry Society.

  4. Genome Analysis of the First Extensively Drug-Resistant (XDR Mycobacterium tuberculosis in Malaysia Provides Insights into the Genetic Basis of Its Biology and Drug Resistance.

    Directory of Open Access Journals (Sweden)

    Chee Sian Kuan

    Full Text Available The outbreak of extensively drug-resistant tuberculosis (XDR-TB has become an increasing problem in many TB-burdened countries. The underlying drug resistance mechanisms, including the genetic variation favored by selective pressure in the resistant population, are partially understood. Recently, the first case of XDR-TB was reported in Malaysia. However, the detailed genotype family and mechanisms of the formation of multiple drugs resistance are unknown. We sequenced the whole genome of the UM 1072388579 strain with a 2-kb insert-size library and combined with that from previously sequenced 500-bp-insert paired-end reads to produce an improved sequence with maximal sequencing coverage across the genome. In silico spoligotyping and phylogenetic analyses demonstrated that UM 1072388579 strain belongs to an ancestral-like, non-Beijing clade of East Asia lineage. This is supported by the presence of a number of lineage-specific markers, including fadD28, embA, nuoD and pks7. Polymorphism analysis showed that the drug-susceptibility profile is correlated with the pattern of resistance mutations. Mutations in drug-efflux pumps and the cell wall biogenesis pathway such as mmpL, pks and fadD genes may play an important role in survival and adaptation of this strain to its surrounding environment. In this work, fifty-seven putative promoter SNPs were identified. Among them, we identified a novel SNP located at -4 T allele of TetR/acrR promoter as an informative marker to recognize strains of East Asian lineage. Our work indicates that the UM 1072388579 harbors both classical and uncommon SNPs that allow it to escape from inhibition by many antibiotics. This study provides a strong foundation to dissect the biology and underlying resistance mechanisms of the first reported XDR M. tuberculosis in Malaysia.

  5. Identification of a New Antimicrobial Resistance Gene Provides Fresh Insights Into Pleuromutilin Resistance in Brachyspira hyodysenteriae, Aetiological Agent of Swine Dysentery

    Directory of Open Access Journals (Sweden)

    Roderick M. Card

    2018-06-01

    that tva(A contributed to development of tiamulin resistance in vivo in a manner consistent with that seen experimentally in vitro. The in vitro studies further showed that tva(A broadened the mutant selection window and raised the mutant prevention concentration above reported in vivo antibiotic concentrations obtained when administered at certain doses. We show how the identification and characterisation of tva(A, a new marker for pleuromutilin resistance, provides evidence to inform treatment regimes and reduce the development of resistance to this class of highly important antimicrobial agents.

  6. Sequencing, De Novo Assembly, and Annotation of the Transcriptome of the Endangered Freshwater Pearl Bivalve, Cristaria plicata, Provides Novel Insights into Functional Genes and Marker Discovery.

    Directory of Open Access Journals (Sweden)

    Bharat Bhusan Patnaik

    . The transcriptome provides a comprehensive sequence resource for the conservation of genetic information in this species and enrichment of the genetic database. The development of molecular markers will assist in the genetic improvement of C. plicata.

  7. Genome-Wide Association Study and Transcriptome Analysis Provide New Insights into the White/Red Earlobe Color Formation in Chicken.

    Science.gov (United States)

    Luo, Wei; Xu, Jiguo; Li, Zhenhui; Xu, Haiping; Lin, Shudai; Wang, Jiaying; Ouyang, Hongjia; Nie, Qinghua; Zhang, Xiquan

    2018-04-25

    Earlobe color is a typical external trait in chicken. There are some previous studies showing that the chicken white/red earlobe color is a polygenic and sex-linked trait in some breeds, but its molecular genetic and histological mechanisms still remain unclear. We herein utilized histological section, genome-wide association study (GWAS) and RNA-seq, further to investigate the potential histological and molecular genetic mechanisms of white/red earlobe formation in Qiangyuan Partridge chicken (QYP). through histological section analysis, we found the dermal papillary layer of red earlobes had many more blood vessels than that of white earlobes. And we identified a total of 44 SNPs from Chromosome 1, 2, 3, 4, 9, 10, 11, 13, 19, 20, 23 and Z, that was significantly associated with the chicken white/red earlobe color from GWAS, along with 73 significantly associated genes obtained (e.g., PIK3CB, B4GALT1 and TP63), supporting the fact that the white/red earlobe color was also polygenic and sex-linked in QYP. Importantly, PIK3CB and B4GALT1 are both involved in the biological process of angiogenesis, which may directly give rise to the chicken white earlobe formation through regulating blood vessel density in chicken earlobe. Additionally, through contrast of RNA-seq profiles between white earlobe skins and red earlobe skins, we further identified TP63 and CDH1 differentially expressed. Combined with the existing knowledge of TP63 in epithelial development and tumor angiogenesis, we propose that down-regulated TP63 in white earlobes may play roles in thickening the skin and decreasing the vessel numbers in dermal papillary layer, thereby contributing to the white earlobe formation via paling the redness of the skin in QYP, but the specific mechanism remains to be further clarified. our findings advance the existing understanding of the white earlobe formation, as well as provide new clues to understand the molecular mechanism of chicken white/red earlobe color

  8. First genome-wide association study in an Australian aboriginal population provides insights into genetic risk factors for body mass index and type 2 diabetes.

    Directory of Open Access Journals (Sweden)

    Denise Anderson

    Full Text Available A body mass index (BMI >22kg/m2 is a risk factor for type 2 diabetes (T2D in Aboriginal Australians. To identify loci associated with BMI and T2D we undertook a genome-wide association study using 1,075,436 quality-controlled single nucleotide polymorphisms (SNPs genotyped (Illumina 2.5M Duo Beadchip in 402 individuals in extended pedigrees from a Western Australian Aboriginal community. Imputation using the thousand genomes (1000G reference panel extended the analysis to 6,724,284 post quality-control autosomal SNPs. No associations achieved genome-wide significance, commonly accepted as P45,000 years ago. The top hit (rs10868204 Pgenotyped = 1.50x10-6; rs11140653 Pimputed_1000G = 2.90x10-7 for BMI lies 5' of NTRK2, the type 2 neurotrophic tyrosine kinase receptor for brain-derived neurotrophic factor (BDNF that regulates energy balance downstream of melanocortin-4 receptor (MC4R. PIK3C2G (rs12816270 Pgenotyped = 8.06x10-6; rs10841048 Pimputed_1000G = 6.28x10-7 was associated with BMI, but not with T2D as reported elsewhere. BMI also associated with CNTNAP2 (rs6960319 Pgenotyped = 4.65x10-5; rs13225016 Pimputed_1000G = 6.57x10-5, previously identified as the strongest gene-by-environment interaction for BMI in African-Americans. The top hit (rs11240074 Pgenotyped = 5.59x10-6, Pimputed_1000G = 5.73x10-6 for T2D lies 5' of BCL9 that, along with TCF7L2, promotes beta-catenin's transcriptional activity in the WNT signaling pathway. Additional hits occurred in genes affecting pancreatic (KCNJ6, KCNA1 and/or GABA (GABRR1, KCNA1 functions. Notable associations observed for genes previously identified at genome-wide significance in other populations included MC4R (Pgenotyped = 4.49x10-4 for BMI and IGF2BP2 Pimputed_1000G = 2.55x10-6 for T2D. Our results may provide novel functional leads in understanding disease pathogenesis in this Australian Aboriginal population.

  9. RNA-Seq analysis of Gtf2ird1 knockout epidermal tissue provides potential insights into molecular mechanisms underpinning Williams-Beuren syndrome.

    Science.gov (United States)

    Corley, Susan M; Canales, Cesar P; Carmona-Mora, Paulina; Mendoza-Reinosa, Veronica; Beverdam, Annemiek; Hardeman, Edna C; Wilkins, Marc R; Palmer, Stephen J

    2016-06-13

    mouse model. We have noted that a number of the dysregulated genes have known roles in brain development as well as epidermal differentiation and maintenance. Therefore, this study provides clues as to the underlying mechanisms that may be involved in the broader profile of WBS.

  10. Channelrhodopsins provide a breakthrough insight into strategies ...

    Indian Academy of Sciences (India)

    2009-12-31

    Dec 31, 2009 ... order or purpose, e.g. for transient or long-term gene ex- pression according to the ..... tion of vision. In the near future, channelrhodopsins might ... Japanese Retinitis Pigmentosa Society; and Suzuken Memorial. Foundation.

  11. Coupling of MIC-3 overexpression with the chromosomes 11 and 14 root-knot nematode (RKN) (Meloidogyne incognita) resistance QTLs provides insights into the regulation of the RKN resistance response in Upland cotton (Gossypium hirsutum).

    Science.gov (United States)

    Wubben, Martin J; Callahan, Franklin E; Jenkins, Johnie N; Deng, Dewayne D

    2016-09-01

    Genetic analysis of MIC-3 transgene with RKN resistance QTLs provides insight into the resistance regulatory mechanism and provides a framework for testing additional hypotheses. Resistance to root-knot nematode (RKN) (Meloidogyne incognita) in Upland cotton (Gossypium hirsutum) is mediated by two major quantitative trait loci (QTL) located on chromosomes 11 and 14. The MIC-3 (Meloidogyne Induced Cotton3) protein accumulates specifically within the immature galls of RKN-resistant plants that possess these QTLs. Recently, we showed that MIC-3 overexpression in an RKN-susceptible cotton genotype suppressed RKN egg production but not RKN-induced root galling. In this study, the MIC-3 overexpression construct T-DNA in the single-copy transgenic line '14-7-1' was converted into a codominant molecular marker that allowed the marker assisted selection of F2:3 cotton lines, derived from a cross between 14-7-1 and M-240 RNR, having all possible combinations of the chromosomes 11 and 14 QTLs with and without the MIC-3 overexpression construct. Root-knot nematode reproduction (eggs g(-1) root) and severity of RKN-induced root galling were assessed in these lines. We discovered that the addition of MIC-3 overexpression suppressed RKN reproduction in lines lacking both resistance QTLs and in lines having only the chromosome 14 QTL, suggesting an additive effect of the MIC-3 construct with this QTL. In contrast, MIC-3 overexpression did not improve resistance in lines having the single chromosome 11 QTL or in lines having both resistance QTLs, suggesting an epistatic interaction between the chromosome 11 QTL and the MIC-3 construct. Overexpression of MIC-3 did not affect the severity of RKN-induced root galling regardless of QTL genotype. These data provide new insights into the relative order of action of the chromosomes 11 and 14 QTLs and their potential roles in regulating MIC-3 expression as part of the RKN resistance response.

  12. Genome-wide comparative analysis reveals similar types of NBS genes in hybrid Citrus sinensis genome and original Citrus clementine genome and provides new insights into non-TIR NBS genes.

    Directory of Open Access Journals (Sweden)

    Yunsheng Wang

    Full Text Available In this study, we identified and compared nucleotide-binding site (NBS domain-containing genes from three Citrus genomes (C. clementina, C. sinensis from USA and C. sinensis from China. Phylogenetic analysis of all Citrus NBS genes across these three genomes revealed that there are three approximately evenly numbered groups: one group contains the Toll-Interleukin receptor (TIR domain and two different Non-TIR groups in which most of proteins contain the Coiled Coil (CC domain. Motif analysis confirmed that the two groups of CC-containing NBS genes are from different evolutionary origins. We partitioned NBS genes into clades using NBS domain sequence distances and found most clades include NBS genes from all three Citrus genomes. This suggests that three Citrus genomes have similar numbers and types of NBS genes. We also mapped the re-sequenced reads of three pomelo and three mandarin genomes onto the C. sinensis genome. We found that most NBS genes of the hybrid C. sinensis genome have corresponding homologous genes in both pomelo and mandarin genomes. The homologous NBS genes in pomelo and mandarin suggest that the parental species of C. sinensis may contain similar types of NBS genes. This explains why the hybrid C. sinensis and original C. clementina have similar types of NBS genes in this study. Furthermore, we found that sequence variation amongst Citrus NBS genes were shaped by multiple independent and shared accelerated mutation accumulation events among different groups of NBS genes and in different Citrus genomes. Our comparative analyses yield valuable insight into the structure, organization and evolution of NBS genes in Citrus genomes. Furthermore, our comprehensive analysis showed that the non-TIR NBS genes can be divided into two groups that come from different evolutionary origins. This provides new insights into non-TIR genes, which have not received much attention.

  13. Use of focused acoustics for cell disruption to provide ultra scale-down insights of microbial homogenization and its bioprocess impact--recovery of antibody fragments from rec E. coli.

    Science.gov (United States)

    Li, Qiang; Aucamp, Jean P; Tang, Alison; Chatel, Alex; Hoare, Mike

    2012-08-01

    An ultra scale-down (USD) device that provides insight of how industrial homogenization impacts bioprocess performance is desirable in the biopharmaceutical industry, especially at the early stage of process development where only a small quantity of material is available. In this work, we assess the effectiveness of focused acoustics as the basis of an USD cell disruption method to mimic and study high-pressure, step-wise homogenization of rec Escherichia coli cells for the recovery of an intracellular protein, antibody fragment (Fab'). The release of both Fab' and of overall protein follows first-order reaction kinetics with respect to time of exposure to focused acoustics. The rate constant is directly proportional to applied electrical power input per unit volume. For nearly total protein or Fab' release (>99%), the key physical properties of the disruptate produced by focused acoustics, such as cell debris particle size distribution and apparent viscosity show good agreement with those for homogenates produced by high-pressure homogenization operated to give the same fractional release. The only key difference is observed for partial disruption of cells where focused acoustics yields a disruptate of lower viscosity than homogenization, evidently due to a greater extent of polynucleic acids degradation. Verification of this USD approach to cell disruption by high-pressure homogenization is achieved using USD centrifugation to demonstrate the same sedimentation characteristics of disruptates prepared using both the scaled-down focused acoustic and the pilot-scale homogenization methods for the same fraction of protein release. Copyright © 2012 Wiley Periodicals, Inc.

  14. Hyperons: Insights into baryon structures

    International Nuclear Information System (INIS)

    Lach, J.

    1991-08-01

    The baryon octet is composed mainly of hyperons. Modern high energy hyperon beams provide a tool for the study of hyperon static properties and interactions. Experiments with these beams have provided new insights into hyperon rare decays, magnetic moments, and interactions. These experiments provide us with insights into the strong, weak, and electromagnetic structure of the baryons. 65 refs., 45 figs., 5 tabs

  15. Global China Insights

    NARCIS (Netherlands)

    Segers, Rien; Fischer, Ingrid

    Journal in which the Groningen Confucius Institute (GCI) shares different perspectives on China and provides insights into China from as many different aspects as possible. GCI aims to provide a full view of real China to the readers as well as featuring international and comprehensive perspectives,

  16. Global China Insights

    NARCIS (Netherlands)

    Segers, Rien; Havinga, Marieke; Fischer, Ingrid

    2013-01-01

    Journal in which the Groningen Confucius Institute (GCI) shares different perspectives on China and provides insights into China from as many different aspects as possible. GCI aims to provide a full view of real China to the readers as well as featuring international and comprehensive perspectives,

  17. A modification to the SCAR (Sequence Characterized Amplified Region method provides phylogenetic insights within Ceratozamia (Zamiaceae Una modificación al método SCAR (Sequence Characterized Amplified Region aporta entendimiento filogenético en Ceratozamia (Zamiaceae

    Directory of Open Access Journals (Sweden)

    Dolores González

    2012-12-01

    Full Text Available Phylogenetic relationships among closely related plant species are still problematic. DNA intergenic regions often are insufficiently variable to provide desired resolution or support. In this study, a modification to the Sequence Characterized Amplified Region (SCAR method was used to find polymorphic loci for phylogenetic analyses within Ceratozamia. RAPD markers were first used to detect variation in 5 species. Then, equal length fragments found in 2 or more species were excised from the gel, purified and digested with frequent cutter restriction enzymes for isolating both ends, which have the same primer site. Digested fragments were sequenced with the RAPD primer. Variable sequences were used to design specific primers for amplifying and sequencing in all species for phylogenetic analyses. Our results confirmed the previously known high genome sequence resemblance within this genus that contrasts with its high morphological variation. Only 7 parsimony informative characters were found with this approach. Nonetheless, the Digested-SCAR (D-SCAR method provided some phylogenetic insights. Four main clades consistent with distribution ranges of the species were detected. The approach presented here was effective to solve some relationships within the genus and can potentially be implemented in other organisms to find polymorphic loci for phylogenetic studies at any taxonomic level.Las relaciones filogenéticas entre especies de plantas cercanamente relacionadas es aún problemático. Las regiones intergénicas del ADN son a menudo insuficientemente variables para proveer los niveles de resolución y soporte deseados. En este estudio, se usó una modificación al método Sequence Characterized Amplified Region (SCAR para encontrar loci polimórficos para análisis filogenéticos en Ceratozamia. Primero se usaron marcadores RAPD para detectar variación en 5 especies; luego, se cortaron del gel los fragmentos de la misma longitud en 2 o m

  18. Africa Insight

    African Journals Online (AJOL)

    Africa Insight is a quarterly, peer-reviewed journal of the Africa Institute of South Africa. It is accredited by the South African National Department of Higher Education and Training (DHET) and is indexed in the International Bibliography of Social Science (IBSS). It is a multi-disciplinary journal primarily focusing on African ...

  19. World energy insight 2011

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2011-11-15

    The World Energy Insight 2011 is the official publication of the World Energy Council. It includes interviews, articles and case studies from a distinguished panel of World Energy Council Officers, CEOs, government ministers, academics and opinion formers from all areas of the energy sector and provides perspectives from around the globe. Government, industry and NGO's offer both policy and technology perspectives. The insights within this publication add to the work that WEC is doing to provide the forum for energy leaders, along with the on-going WEC studies and programmes on Energy Policies, 2050 Energy Scenarios, Energy Resources & Technologies, Energy for Urban Innovation, Rules Of Energy Trade and Global Energy Access.

  20. Medicare Provider Data - Hospice Providers

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Hospice Utilization and Payment Public Use File provides information on services provided to Medicare beneficiaries by hospice providers. The Hospice PUF...

  1. World energy insight 2011

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2011-11-15

    The World Energy Insight 2011 is the official publication of the World Energy Council. It includes interviews, articles and case studies from a distinguished panel of World Energy Council Officers, CEOs, government ministers, academics and opinion formers from all areas of the energy sector and provides perspectives from around the globe. Government, industry and NGO's offer both policy and technology perspectives. The insights within this publication add to the work that WEC is doing to provide the forum for energy leaders, along with the on-going WEC studies and programmes on Energy Policies, 2050 Energy Scenarios, Energy Resources & Technologies, Energy for Urban Innovation, Rules Of Energy Trade and Global Energy Access.

  2. 'I am treated well if I adhere to my HIV medication': putting patient-provider interactions in context through insights from qualitative research in five sub-Saharan African countries.

    Science.gov (United States)

    Ondenge, Ken; Renju, Jenny; Bonnington, Oliver; Moshabela, Mosa; Wamoyi, Joyce; Nyamukapa, Constance; Seeley, Janet; Wringe, Alison; Skovdal, Morten

    2017-07-01

    The nature of patient-provider interactions and communication is widely documented to significantly impact on patient experiences, treatment adherence and health outcomes. Yet little is known about the broader contextual factors and dynamics that shape patient-provider interactions in high HIV prevalence and limited-resource settings. Drawing on qualitative research from five sub-Saharan African countries, we seek to unpack local dynamics that serve to hinder or facilitate productive patient-provider interactions. This qualitative study, conducted in Kisumu (Kenya), Kisesa (Tanzania), Manicaland (Zimbabwe), Karonga (Malawi) and uMkhanyakude (South Africa), draws upon 278 in-depth interviews with purposively sampled people living with HIV with different diagnosis and treatment histories, 29 family members of people who died due to HIV and 38 HIV healthcare workers. Data were collected using topic guides that explored patient testing and antiretroviral therapy treatment journeys. Thematic analysis was conducted, aided by NVivo V.8.0 software. Our analysis revealed an array of inter-related contextual factors and power dynamics shaping patient-provider interactions. These included (1) participants' perceptions of roles and identities of 'self' and 'other'; (2) conformity or resistance to the 'rules of HIV service engagement' and a 'patient-persona'; (3) the influence of significant others' views on service provision; and (4) resources in health services. We observed that these four factors/dynamics were located in the wider context of conceptualisations of power, autonomy and structure. Patient-provider interaction is complex, multidimensional and deeply embedded in wider social dynamics. Multiple contextual domains shape patient-provider interactions in the context of HIV in sub-Saharan Africa. Interventions to improve patient experiences and treatment adherence through enhanced interactions need to go beyond the existing focus on patient-provider communication

  3. Transitioning HIV-infected adolescents to adult care at 14 clinics across the United States: using adolescent and adult providers' insights to create multi-level solutions to address transition barriers.

    Science.gov (United States)

    Philbin, Morgan M; Tanner, Amanda E; Chambers, Brittany D; Ma, Alice; Ware, Samuella; Lee, Sonia; Fortenberry, J Dennis; The Adolescent Trials Network

    2017-10-01

    HIV-infected adolescents have disproportionately low rates of care retention and viral suppression. Approximately half disengage from care while transitioning to adult clinics, in part due to fragmented care systems and lack of streamlined protocols. We conducted 58 qualitative interviews with social service and health care providers across 14 Adolescent Trials Network clinics (n = 28) and 20 adult clinics that receive transitioning adolescents (n = 30) from August 2015-June 2016. We used the constant comparative approach to examine processes, barriers, and facilitators of adult care transition. Transition barriers coalesced around three levels. Structural: insurance eligibility, transportation, and HIV-related stigma; Clinical: inter-clinic communication, differences in care cultures, and resource/personnel limitations; and Individual: adolescents' transition readiness and developmental capacity. Staff-initiated solutions (e.g., grant-funded transportation) were often unsustainable and applied individual-level solutions to structural-level barriers. Comprehensive initiatives, which develop collaborative policies and protocols that support providers' ability to match the solution and barrier level (i.e., structural-to-structural), are sorely needed. These initiatives should also support local systematic planning to facilitate inter-clinic structures and communication. Such approaches will help HIV-infected adolescents transition to adult care and improve long-term health outcomes.

  4. The intrinsically disordered structural platform of the plant defence hub protein RPM1-interacting protein 4 provides insights into its mode of action in the host-pathogen interface and evolution of the nitrate-induced domain protein family.

    Science.gov (United States)

    Sun, Xiaolin; Greenwood, David R; Templeton, Matthew D; Libich, David S; McGhie, Tony K; Xue, Bin; Yoon, Minsoo; Cui, Wei; Kirk, Christopher A; Jones, William T; Uversky, Vladimir N; Rikkerink, Erik H A

    2014-09-01

    Arabidopsis thaliana (At) RPM1-interacting protein 4 (RIN4), targeted by many defence-suppressing bacterial type III effectors and monitored by several resistance proteins, regulates plant immune responses to pathogen-associated molecular patterns and type III effectors. Little is known about the overall protein structure of AtRIN4, especially in its unbound form, and the relevance of structure to its diverse biological functions. AtRIN4 contains two nitrate-induced (NOI) domains and is a member of the NOI family. Using experimental and bioinformatic approaches, we demonstrate that the unbound AtRIN4 is intrinsically disordered under physiological conditions. The intrinsically disordered polypeptide chain of AtRIN4 is interspersed with molecular recognition features (MoRFs) and anchor-identified long-binding regions, potentially allowing it to undergo disorder-to-order transitions upon binding to partner(s). A poly-l-proline II structure, often responsible for protein recognition, is also identified in AtRIN4. By performing bioinformatics analyses on RIN4 homologues from different plant species and the NOI proteins from Arabidopsis, we infer the conservation of intrinsic disorder, MoRFs and long-binding regions of AtRIN4 in other plant species and the NOI family. Intrinsic disorder and MoRFs could provide RIN4 proteins with the binding promiscuity and plasticity required to act as hubs in a pivotal position within plant defence signalling cascades. © 2014 FEBS.

  5. Crystal structure of the cytoplasmic phosphatase and tensin homolog (PTEN)-like region of Ciona intestinalis voltage-sensing phosphatase provides insight into substrate specificity and redox regulation of the phosphoinositide phosphatase activity.

    Science.gov (United States)

    Matsuda, Makoto; Takeshita, Kohei; Kurokawa, Tatsuki; Sakata, Souhei; Suzuki, Mamoru; Yamashita, Eiki; Okamura, Yasushi; Nakagawa, Atsushi

    2011-07-01

    Ciona intestinalis voltage-sensing phosphatase (Ci-VSP) has a transmembrane voltage sensor domain and a cytoplasmic region sharing similarity to the phosphatase and tensin homolog (PTEN). It dephosphorylates phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 3,4,5-trisphosphate upon membrane depolarization. The cytoplasmic region is composed of a phosphatase domain and a putative membrane interaction domain, C2. Here we determined the crystal structures of the Ci-VSP cytoplasmic region in three distinct constructs, wild-type (248-576), wild-type (236-576), and G365A mutant (248-576). The crystal structure of WT-236 and G365A-248 had the disulfide bond between the catalytic residue Cys-363 and the adjacent residue Cys-310. On the other hand, the disulfide bond was not present in the crystal structure of WT-248. These suggest the possibility that Ci-VSP is regulated by reactive oxygen species as found in PTEN. These structures also revealed that the conformation of the TI loop in the active site of the Ci-VSP cytoplasmic region was distinct from the corresponding region of PTEN; Ci-VSP has glutamic acid (Glu-411) in the TI loop, orienting toward the center of active site pocket. Mutation of Glu-411 led to acquirement of increased activity toward phosphatidylinositol 3,5-bisphosphate, suggesting that this site is required for determining substrate specificity. Our results provide the basic information of the enzymatic mechanism of Ci-VSP.

  6. Structural and In Vivo Studies on Trehalose-6-Phosphate Synthase from Pathogenic Fungi Provide Insights into Its Catalytic Mechanism, Biological Necessity, and Potential for Novel Antifungal Drug Design

    Energy Technology Data Exchange (ETDEWEB)

    Miao, Yi; Tenor, Jennifer L.; Toffaletti, Dena L.; Maskarinec, Stacey A.; Liu, Jiuyu; Lee, Richard E.; Perfect, John R.; Brennan, Richard G.; Hendrickson, Wayne A.

    2017-07-25

    mammals, and thus, the two enzymes that carry out trehalose biosynthesis, namely, trehalose-6-phosphate synthase (Tps1) and trehalose-6-phosphate phosphatase (Tps2), are prominent targets for antifungal intervention. Here, we report the first eukaryotic Tps1 structures from the pathogenic fungiCandida albicansandAspergillus fumigatusin complex with substrates, substrate analogues, and inhibitors. These structures reveal key protein-substrate interactions, providing atomic-level scaffolds for structure-guided drug design of novel antifungals that target Tps1.

  7. Mathematical modeling and comparison of protein size distribution in different plant, animal, fungal and microbial species reveals a negative correlation between protein size and protein number, thus providing insight into the evolution of proteomes

    Directory of Open Access Journals (Sweden)

    Tiessen Axel

    2012-02-01

    Full Text Available Abstract Background The sizes of proteins are relevant to their biochemical structure and for their biological function. The statistical distribution of protein lengths across a diverse set of taxa can provide hints about the evolution of proteomes. Results Using the full genomic sequences of over 1,302 prokaryotic and 140 eukaryotic species two datasets containing 1.2 and 6.1 million proteins were generated and analyzed statistically. The lengthwise distribution of proteins can be roughly described with a gamma type or log-normal model, depending on the species. However the shape parameter of the gamma model has not a fixed value of 2, as previously suggested, but varies between 1.5 and 3 in different species. A gamma model with unrestricted shape parameter described best the distributions in ~48% of the species, whereas the log-normal distribution described better the observed protein sizes in 42% of the species. The gamma restricted function and the sum of exponentials distribution had a better fitting in only ~5% of the species. Eukaryotic proteins have an average size of 472 aa, whereas bacterial (320 aa and archaeal (283 aa proteins are significantly smaller (33-40% on average. Average protein sizes in different phylogenetic groups were: Alveolata (628 aa, Amoebozoa (533 aa, Fornicata (543 aa, Placozoa (453 aa, Eumetazoa (486 aa, Fungi (487 aa, Stramenopila (486 aa, Viridiplantae (392 aa. Amino acid composition is biased according to protein size. Protein length correlated negatively with %C, %M, %K, %F, %R, %W, %Y and positively with %D, %E, %Q, %S and %T. Prokaryotic proteins had a different protein size bias for %E, %G, %K and %M as compared to eukaryotes. Conclusions Mathematical modeling of protein length empirical distributions can be used to asses the quality of small ORFs annotation in genomic releases (detection of too many false positive small ORFs. There is a negative correlation between average protein size and total number of

  8. Tissue-Specific Floral Transcriptome Analysis of the Sexually Deceptive Orchid Chiloglottis trapeziformis Provides Insights into the Biosynthesis and Regulation of Its Unique UV-B Dependent Floral Volatile, Chiloglottone 1

    Directory of Open Access Journals (Sweden)

    Darren C. J. Wong

    2017-07-01

    pathways (e.g., AP2/ERF given a strong co-regulation with FA biosynthesis/β-oxidation genes. Possible alternative biosynthetic routes for precursors (e.g., aldehyde dehydrogenases were also indicated. Our comprehensive study constitutes the first step toward understanding the biosynthetic pathways involved in chiloglottone 1 production in Chiloglottis trapeziformis – supporting the roles of FA metabolism in planta, gene duplication as a potential source of new genes, and co-regulation of novel pathway genes in a tissue-specific manner. This study also provides a new and valuable resource for future discovery and comparative studies in plant specialized metabolism of other orchids and non-model plants.

  9. An ancestral human genetic variant linked to an ancient disease: A novel association of FMO2 polymorphisms with tuberculosis (TB in Ethiopian populations provides new insight into the differential ethno-geographic distribution of FMO2*1.

    Directory of Open Access Journals (Sweden)

    Ephrem Mekonnen

    with distinct genetic variants underlying the TB-progression pathway. The results were robust for population stratification. Haplotype-based tests confirmed the SNP-based results with a single haplotype bearing the ancestral-and-functional FMO2*1 "C" allele ("AGCTCTACAATCCCCTCGTTGCGC" explaining the overall association (haplotype-specific-p = 0.000103. Strikingly, not only was FMO2*1 nominally associated with reduced risk to "Active TB" (p = 0.0118, OR = 0.496 but it also does not co-segregate with the 5'-3' flanking top high-TB-risk alleles. The study provides an evidence for the existence of an evolutionary adaptation to an ancient disease based on an ancestral genetic variant acting in a haplotypic framework in Ethiopian populations.

  10. DNA markers provide insight about common lime in historicalplantings

    DEFF Research Database (Denmark)

    Hansen, Ole Kim; Thomsen, Pernille; Rasmussen, Christine Waage

    2014-01-01

    As part of the restoration process of an avenue of common lime (Tilia × europaea) from 1760 in the Royal Danish Gardens, all remaining trees were genotyped with DNA markers before they were felled. As such, information about the nature of the plant material (clonal versus non-clonal) and mode...... of propagation was obtained, revealing that a single clone constituted 92% of the remaining trees (106 out of 115). Five trees were of another clone, while the remaining four trees had unique genotypes. Mode of clonal propagation was most likely layering since the genotype of the crown and the roots...... of a subsample of the trees had the same genotype. Trees from four other locations with historical avenues/plantings from the 17th century were also genotyped. The two clones registered in the first location were also found at the other four locations. Of 76 trees from the other historical avenues...

  11. The Gender Pay Gap: Can Behavioral Economics Provide Useful Insights?

    OpenAIRE

    Heilman, Renata M.; Kusev, Petko

    2017-01-01

    People are faced with numerous decisions every day. Whether we must choose our outfit for the day, which cell phone brand to buy, what college to attend, to buy a car or house insurance, or even when or to whom to get married, decisions are a permanent presence in our daily activities. Behavioral economics is a multi-disciplinary field of study investigating how people make judgments and decisions (Camerer and Loewenstein, 2004; Heilman, 2014). Even though, from a historic point of view, beha...

  12. Weird mammals provide insights into the evolution of mammalian ...

    Indian Academy of Sciences (India)

    2015-11-13

    Nov 13, 2015 ... because of the action of the male-dominant testis determining gene SRY. ... finding that the fusion point corresponds to the centromere of the elephant X .... extreme as first thought, since we now know that paternal inactivation ...

  13. Psychological Autopsy Provides Insight into Gifted Adolescent Suicide.

    Science.gov (United States)

    Cross, Tracy

    1996-01-01

    This article highlights findings of a study on the suicides of three academically talented male adolescents. Results of the psychological autopsies are reported in terms of commonalities with adolescent suicide in the general population; commonalities among the three cases related to their giftedness; and themes emerging across the cases,…

  14. Obesity paradox in cancer: new insights provided by body composition.

    Science.gov (United States)

    Gonzalez, Maria Cristina; Pastore, Carla A; Orlandi, Silvana P; Heymsfield, Steven B

    2014-05-01

    Obesity, defined by body mass index (BMI), appears to have a paradoxical protective effect in several chronic diseases. We investigated the obesity paradox in cancer patients by using body composition. The study was an observational study of 175 cancer patients assessed before chemotherapy. Obesity was defined as BMI (in kg/m(2)) ≥30 or fat mass index (FMI; fat mass divided by the square of height) ≥5.2 (men) and ≥8.2 (women) measured by using a bioelectrical impedance analysis. Low muscle mass (sarcopenia) was defined as fat-free mass index (fat-free mass divided by the square of height) cancer patients only when obesity is defined by BMI. Patients with sarcopenic obesity had the poorest prognosis. Cancer patients with high mortality risk can be identified by a body-composition assessment.

  15. Habitat characteristics provide insights of carbon storage in seagrass meadows

    KAUST Repository

    Mazarrasa, Iné s; Samper-Villarreal, Jimena; Serrano, Oscar; Lavery, Paul S.; Lovelock, Catherine E.; Marbà , Nú ria; Duarte, Carlos M.; Corté s, Jorge

    2018-01-01

    Carbon strategies aim to enhance CO2 sequestration and avoid greenhouse gasses emissions through the management of coastal vegetated ecosystems, including seagrass meadows. The implementation of Blue Carbon strategies requires a good understanding

  16. Induced seismicity provides insight into why earthquake ruptures stop

    KAUST Repository

    Galis, Martin; Ampuero, Jean Paul; Mai, Paul Martin; Cappa, Fré dé ric

    2017-01-01

    the perturbed area and distinguishes self-arrested from runaway ruptures. We develop a theoretical scaling relation between the largest magnitude of self-arrested earthquakes and the injected volume and find it consistent with observed maximum magnitudes

  17. Acoustics Provide Insight in the Neonatal Brain and Cerebral Perfusion

    NARCIS (Netherlands)

    M.M.A. Raets (Marlou)

    2014-01-01

    markdownabstract__Abstract__ The incidence of preterm birth is increasing. Preterm infants are all infants born before 37 weeks of gestation. The incidence of preterm birth in the Netherlands is 7.8% of all deliveries, with 1.4% very preterm infants (below 32 weeks of gestation). Advances in

  18. Rare kidney tumor provides insight on metabolic changes

    Science.gov (United States)

    Researchers in The Cancer Genome Atlas (TCGA) Network have uncovered a number of new findings about the biology and development of a rare form of kidney cancer. They found that the disease – chromophobe renal cell carcinoma – stems in part from alteratio

  19. Human Performance on Insight Problem Solving: A Review

    Science.gov (United States)

    Chu, Yun; MacGregor, James N.

    2011-01-01

    The article provides a review of recent research on insight problem-solving performance. We discuss what insight problems are, the different types of classic and newer insight problems, and how we can classify them. We also explain some of the other aspects that affect insight performance, such as hints, analogs, training, thinking aloud, and…

  20. Insights on STEM Careers

    Energy Technology Data Exchange (ETDEWEB)

    Wendelberger, Joanne Roth [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2014-11-05

    This presentation will provide career advice for individuals seeking to go beyond just having a job to building a successful career in the areas of Science, Technology, Engineering, and Mathematics. Careful planning can be used to turn a job into a springboard for professional advancement and personal satisfaction. Topics to be addressed include setting priorities, understanding career ladders, making tough choices, overcoming stereotypes and assumptions by others, networking, developing a professional identify, and balancing a career with family and other personal responsibilities. Insights on the transition from individual technical work to leadership will also be provided. The author will draw upon experiences gained in academic, industrial, and government laboratory settings, as well as extensive professional service and community involvement.

  1. Proofs that Develop Insight

    Science.gov (United States)

    Weber, Keith

    2010-01-01

    Many mathematics educators have noted that mathematicians do not only read proofs to gain conviction but also to obtain insight. The goal of this article is to discuss what this insight is from mathematicians' perspective. Based on interviews with nine research-active mathematicians, two sources of insight are discussed. The first is reading a…

  2. Why healthcare providers merge.

    Science.gov (United States)

    Postma, Jeroen; Roos, Anne-Fleur

    2016-04-01

    In many OECD countries, healthcare sectors have become increasingly concentrated as a result of mergers. However, detailed empirical insight into why healthcare providers merge is lacking. Also, we know little about the influence of national healthcare policies on mergers. We fill this gap in the literature by conducting a survey study on mergers among 848 Dutch healthcare executives, of which 35% responded (resulting in a study sample of 239 executives). A total of 65% of the respondents was involved in at least one merger between 2005 and 2012. During this period, Dutch healthcare providers faced a number of policy changes, including increasing competition, more pressure from purchasers, growing financial risks, de-institutionalisation of long-term care and decentralisation of healthcare services to municipalities. Our empirical study shows that healthcare providers predominantly merge to improve the provision of healthcare services and to strengthen their market position. Also efficiency and financial reasons are important drivers of merger activity in healthcare. We find that motives for merger are related to changes in health policies, in particular to the increasing pressure from competitors, insurers and municipalities.

  3. Engaging Citizens In Discussions of Coastal Climate ChangeTwo examples of place-based research that engaged community members will be presented. Lessons learned in how to engage community members and working with high school students and hands-on learning across generations can provide insights into social and ecosystem change will be shared.

    Science.gov (United States)

    Kruger, L. E.; Johnson, A. C.

    2017-12-01

    By engaging community members as research partners, people become not just the subject of the story, they become storytellers as well. Participatory community-based research that engages community residents in gathering and sharing their lived experiences is instrumental in connecting people to each other and their forests and forest science and helpful when confronted by change. Two examples of place-based research that engaged community members as researchers will be presented. What factors led to collaborative outcomes that integrated citizen-informed knowledge with scientific knowledge? What lessons were learned in how best to engage community members? How did working with high school students draw even hesitant members of the community to participate? By strengthening bonds between students and their communities, both natural and social environments, we can provide young people with opportunities to better understand how they fit into the greater community and their natural environment. Hands-on learning that explores experiences in nature across generations can benefit communities, especially youth, and can provide insights into social and ecosystem change.

  4. Genetic correlates of insight in schizophrenia.

    Science.gov (United States)

    Xavier, Rose Mary; Vorderstrasse, Allison; Keefe, Richard S E; Dungan, Jennifer R

    2018-05-01

    Insight in schizophrenia is clinically important as it is associated with several adverse outcomes. Genetic contributions to insight are unknown. We examined genetic contributions to insight by investigating if polygenic risk scores (PRS) and candidate regions were associated with insight. Schizophrenia case-only analysis of the Clinical Antipsychotics Trials of Intervention Effectiveness trial. Schizophrenia PRS was constructed using Psychiatric Genomics Consortium (PGC) leave-one out GWAS as discovery data set. For candidate regions, we selected 105 schizophrenia-associated autosomal loci and 11 schizophrenia-related oligodendrocyte genes. We used regressions to examine PRS associations and set-based testing for candidate analysis. We examined data from 730 subjects. Best-fit PRS at p-threshold of 1e-07 was associated with total insight (R 2 =0.005, P=0.05, empirical P=0.054) and treatment insight (R 2 =0.005, P=0.048, empirical P=0.048). For models that controlled for neurocognition, PRS significantly predicted treatment insight but at higher p-thresholds (0.1 to 0.5) but did not survive correction. Patients with highest polygenic burden had 5.9 times increased risk for poor insight compared to patients with lowest burden. PRS explained 3.2% (P=0.002, empirical P=0.011) of variance in poor insight. Set-based analyses identified two variants associated with poor insight- rs320703, an intergenic variant (within-set P=6e-04, FDR P=0.046) and rs1479165 in SOX2-OT (within-set P=9e-04, FDR P=0.046). To the best of our knowledge, this is the first study examining genetic basis of insight. We provide evidence for genetic contributions to impaired insight. Relevance of findings and necessity for replication are discussed. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. In Search of Insight.

    Science.gov (United States)

    Kaplan, Craig A.; Simon, Herbert A.

    1990-01-01

    Attaining the insight needed to solve the Mutilated Checkerboard problem, which requires discovery of an effective problem representation (EPR), is described. Performance on insight problems can be predicted from the availability of generators and constraints in the search for an EPR. Data for 23 undergraduates were analyzed. (TJH)

  6. Microbial Insights into Shifting Methane Production Potential in Thawing Permafrost

    Science.gov (United States)

    Crossen, K.; Wilson, R.; Raab, N.; Neumann, R.; Chanton, J.; Saleska, S. R.; Rich, V. I.

    2017-12-01

    Permafrost, which stores 50% of global soil carbon, is thawing rapidly due to climate change, and resident microbes are contributing to changing carbon gas emissions. Predictions of the fate of carbon in these regions is poorly constrained; however, improved, careful mapping of microbial community members influencing CO2 and CH4 emissions will help clarify the system response to continued change. In order to more fully understand connections between the microbial communities, major geochemical transformations, and CO2 and CH4 emissions, peat cores were collected from the active layers of three permafrost habitats spanning a thaw gradient (collapsed palsa, bog, and fen) at Stordalen Mire, Abisko, Sweden. Anaerobic incubations of shallow and deep subsamples from these sites were performed, with time-course characterization of the changes in microbial communities, peat geochemistry, and carbon gas production. The latter were profiled with 16S rRNA amplicon sequencing, and targeted metagenomes. The communities within each habitat and depth were statistically distinct, and changed significantly over the course of the incubations. Acidobacteria was consistently the dominant bacterial phylum in all three habitat types. With increased thaw, the relative abundance of Actinobacteria tended to decrease, while Chloroflexi and Bacteroidetes increased with thaw. The relative abundance of methanogens increased with thaw and with depth within each habitat. Over time in the incubations, the richness of the communities tended to decrease. Homoacetogenesis (CO2 + H2 -> CH3COOH) has been documented in other peatlands, and homoacetogens can influence CH4 production by interacting with methanogens, competing with hydrogenotrophs while providing substrate for acetoclasts. Modelling of microbial reaction networks suggests potential for highest homoacetogenesis rates in the collapsed palsa, which also contains the highest relative abundances of lineages taxonomically affiliated with known

  7. Dreaming and insight

    Science.gov (United States)

    Edwards, Christopher L.; Ruby, Perrine M.; Malinowski, Josie E.; Bennett, Paul D.; Blagrove, Mark T.

    2013-01-01

    This paper addresses claims that dreams can be a source of personal insight. Whereas there has been anecdotal backing for such claims, there is now tangential support from findings of the facilitative effect of sleep on cognitive insight, and of REM sleep in particular on emotional memory consolidation. Furthermore, the presence in dreams of metaphorical representations of waking life indicates the possibility of novel insight as an emergent feature of such metaphorical mappings. In order to assess whether personal insight can occur as a result of the consideration of dream content, 11 dream group discussion sessions were conducted which followed the Ullman Dream Appreciation technique, one session for each of 11 participants (10 females, 1 male; mean age = 19.2 years). Self-ratings of deepened self-perception and personal gains from participation in the group sessions showed that the Ullman technique is an effective procedure for establishing connections between dream content and recent waking life experiences, although wake life sources were found for only 14% of dream report text. The mean Exploration-Insight score on the Gains from Dream Interpretation questionnaire was very high and comparable to outcomes from the well-established Hill (1996) therapist-led dream interpretation method. This score was associated between-subjects with pre-group positive Attitude Toward Dreams (ATD). The need to distinguish “aha” experiences as a result of discovering a waking life source for part of a dream, from “aha” experiences of personal insight as a result of considering dream content, is discussed. Difficulties are described in designing a control condition to which the dream report condition can be compared. PMID:24550849

  8. OpenGL Insights

    CERN Document Server

    Cozzi, Patrick

    2012-01-01

    Get Real-World Insight from Experienced Professionals in the OpenGL Community With OpenGL, OpenGL ES, and WebGL, real-time rendering is becoming available everywhere, from AAA games to mobile phones to web pages. Assembling contributions from experienced developers, vendors, researchers, and educators, OpenGL Insights presents real-world techniques for intermediate and advanced OpenGL, OpenGL ES, and WebGL developers. Go Beyond the Basics The book thoroughly covers a range of topics, including OpenGL 4.2 and recent extensions. It explains how to optimize for mobile devices, explores the design

  9. Novice Academic Librarians Provide Insight into Choosing Their Careers, Graduate School Education, and First Years on the Job. A Review of: Sare, L., Bales, S., & Neville, B. (2012. New academic librarians and their perceptions of the profession. portal: Libraries and the Academy, 12(2, 179-203. doi: 10.1353/pla.2012.0017

    Directory of Open Access Journals (Sweden)

    Carol D. Howe

    2012-12-01

    profession solid, safe, and/or noble. They had further explored librarianship to determine its compatibility with their personal characteristics. Such personal reflection had led participants to graduate school where they gained a real understanding of librarianship. The participants had not generally found graduate school to be academically challenging. They had also valued practical over theoretical instruction. Once in the workplace, the participants noted the value of continuing education to strengthen the skills they had learned in graduate school. Participants benefitted the most from informal mentoring and on-the-job training, i.e. “learning by doing” (p. 192. As novice librarians, the participants had learned to feel their way around their job expectations and note the differences between their responsibilities and those of paraprofessionals in the library. As the novice librarians further defined their work, they had also learned that academic librarianship is the sum of many parts, including collaboration with peers. In evaluating their work, the participants noted that they had come to distinguish “real” academic library work, that which uses their expertise and helps society, from “other” work such as clerical work (pp. 195-196. The sixth and final category was “(reimagining the future.” Most of the participants predicted having advanced as academic librarians in the next five years but were otherwise unsure about what their futures would hold.Conclusion – The researchers made a number of valuable observations in their work with novice librarians. As the step of deciding upon a career seemed to be a murky quest, they thought it would be helpful to analyze public opinion of librarianship and use that information to offset misperceptions about what librarians do. This might help those considering librarianship to make informed and conscious decisions.The study data also provided insight into graduate school. The fact that the participants did not

  10. Africa Insight: Submissions

    African Journals Online (AJOL)

    Author Guidelines. Africa Insight is a quarterly, peer-reviewed journal of the Africa Institute of South Africa (AISA). It is accredited by the Department of Higher ... Abstract: All articles should be accompanied by an abstract of between 100 and 125 words stating the main research problem, major findings and conclusion(s).

  11. [Poor insight and psychosis].

    Science.gov (United States)

    Giotakos, O

    2017-01-01

    A variety of phenomena might be considered as reflecting impaired insight in psychosis, like failure to recognize signs, symptoms or disease, failure to derive appropriate cognitive representations, despite recognition of the disease, and misattribution of the source or cause of the disease. The unawareness of tardive dyskinesia symptoms in schizophrenic patients points that self-awareness deficits in schizophrenia may be domain specific. Poor insight is an independent phenomenological and a prevalent feature in psychotic disorders in general, and in schizophrenia in particular, but we don't know yet if delusions in schizophrenia are the result of an entirely normal attempt to account for abnormal perceptual experiences or a product of abnormal experience but of normal reasoning. The theoretical approaches regarding impaired insight include the disturbed perceptual input, the impaired linkage between thought and emotion and the breakdown of the process of self-monitoring and error checking. The inability to distinguish between internally and externally generated mental events has been described by the metarepresentation theory. This theory includes the awareness of ones' goals, which leads to disorders of willed action, the awareness of intention, which leads to movement disorders, and the awareness of intentions of others, which leads to paranoid delusions. The theory of metarepresentation implies mainly output mechanisms, like the frontal cortex, while the input mechanism implies posterior brain systems, including the parietal lobe. There are many similarities between the disturbances of awareness seen in schizophrenia and those seen as a result of known neurological impairment. Neuropsychological models of impaired insight typically attribute the disturbance to any of a variety of core deficits in the processing of information. In this respect, lack of insight is on conceptual par with alogia, apraxia or aphasia in reflecting disturbed cognitive processing. In

  12. The politics of insight

    OpenAIRE

    Salvi, Carola; Cristofori, Irene; Grafman, Jordan; Beeman, Mark

    2016-01-01

    Previous studies showed that liberals and conservatives differ in cognitive style. Liberals are more flexible, and tolerant of complexity and novelty, whereas conservatives are more rigid, are more resistant to change, and prefer clear answers. We administered a set of compound remote associate problems, a task extensively used to differentiate problem-solving styles (via insight or analysis). Using this task, several researches have proven that self-reports, which differentiate between insig...

  13. HPC Insights, Fall 2011

    Science.gov (United States)

    2011-01-01

    Power 6 ( Davinci ) systems. We have also made use of the Air Force Research Laboratory DSRC Altix (Hawk) and the Engineer Research and Development...the design and development of high performance gas turbine combustion systems both as a pretest analysis tool to predict static and dynamic...application while gaining insight into MATLAB’s value as an engineering tool . I would like to thank the MHPCC and the Akamai Workforce Initiative

  14. The politics of insight.

    Science.gov (United States)

    Salvi, Carola; Cristofori, Irene; Grafman, Jordan; Beeman, Mark

    2016-01-01

    Previous studies showed that liberals and conservatives differ in cognitive style. Liberals are more flexible, and tolerant of complexity and novelty, whereas conservatives are more rigid, are more resistant to change, and prefer clear answers. We administered a set of compound remote associate problems, a task extensively used to differentiate problem-solving styles (via insight or analysis). Using this task, several researches have proven that self-reports, which differentiate between insight and analytic problem-solving, are reliable and are associated with two different neural circuits. In our research we found that participants self-identifying with distinct political orientations demonstrated differences in problem-solving strategy. Liberals solved significantly more problems via insight instead of in a step-by-step analytic fashion. Our findings extend previous observations that self-identified political orientations reflect differences in cognitive styles. More specifically, we show that type of political orientation is associated with problem-solving strategy. The data converge with previous neurobehavioural and cognitive studies indicating a link between cognitive style and the psychological mechanisms that mediate political beliefs.

  15. The politics of insight

    Science.gov (United States)

    Salvi, Carola; Cristofori, Irene; Grafman, Jordan; Beeman, Mark

    2016-01-01

    Previous studies showed that liberals and conservatives differ in cognitive style. Liberals are more flexible, and tolerant of complexity and novelty, whereas conservatives are more rigid, are more resistant to change, and prefer clear answers. We administered a set of compound remote associate problems, a task extensively used to differentiate problem-solving styles (via insight or analysis). Using this task, several researches have proven that self-reports, which differentiate between insight and analytic problem-solving, are reliable and are associated with two different neural circuits. In our research we found that participants self-identifying with distinct political orientations demonstrated differences in problem-solving strategy. Liberals solved significantly more problems via insight instead of in a step-by-step analytic fashion. Our findings extend previous observations that self-identified political orientations reflect differences in cognitive styles. More specifically, we show that type of political orientation is associated with problem-solving strategy. The data converge with previous neurobehavioural and cognitive studies indicating a link between cognitive style and the psychological mechanisms that mediate political beliefs. PMID:26810954

  16. Therapy Provider Phase Information

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Therapy Provider Phase Information dataset is a tool for providers to search by their National Provider Identifier (NPI) number to determine their phase for...

  17. Twitter for travel medicine providers.

    Science.gov (United States)

    Mills, Deborah J; Kohl, Sarah E

    2016-03-01

    Travel medicine practitioners, perhaps more so than medical practitioners working in other areas of medicine, require a constant flow of information to stay up-to-date, and provide best practice information and care to their patients. Many travel medicine providers are unaware of the popularity and potential of the Twitter platform. Twitter use among our travellers, as well as by physicians and health providers, is growing exponentially. There is a rapidly expanding body of published literature on this information tool. This review provides a brief overview of the ways Twitter is being used by health practitioners, the advantages that are peculiar to Twitter as a platform of social media, and how the interested practitioner can get started. Some key points about the dark side of Twitter are highlighted, as well as the potential benefits of using Twitter as a way to disseminate accurate medical information to the public. This article will help readers develop an increased understanding of Twitter as a tool for extracting useful facts and insights from the ever increasing volume of health information. © International Society of Travel Medicine, 2016. All rights reserved. Published by Oxford University Press. For permissions, please e-mail: journals.permissions@oup.com.

  18. What are System Dynamics Insights?

    OpenAIRE

    Stave, K.; Zimmermann, N. S.; Kim, H.

    2016-01-01

    This paper explores the concept of system dynamics insights. In our field, the term “insight” is generally understood to mean dynamic insight, that is, a deep understanding about the relationship between structure and behavior. We argue this is only one aspect of the range of insights possible from system dynamics activities, and describe a broader range of potential system dynamics insights. We also propose an initial framework for discussion that relates different types of system dynamics a...

  19. New insights into insight: Neurophysiological correlates of the difference between the intrinsic "aha" and the extrinsic "oh yes" moment.

    Science.gov (United States)

    Rothmaler, Katrin; Nigbur, Roland; Ivanova, Galina

    2017-01-27

    Insight refers to a situation in which a problem solver immediately changes his understanding of a problem situation. This representational change can either be triggered by external stimuli, like a hint or the solution itself, or by internal solution attempts. In the present paper, the differences and similarities between these two phenomena, namely "extrinsic" and "intrinsic" insight, are examined. To this end, electroencephalogram (EEG) is recorded while subjects either recognize or generate solutions to German verbal compound remote associate problems (CRA). Based on previous studies, we compare the alpha power prior to insightful solution recognition with the alpha power prior to insightful solution generation. Results show that intrinsic insights are preceded by an increase in alpha power at right parietal electrodes, while extrinsic insights are preceded by a respective decrease. These results can be interpreted in two ways. In consistency with other studies, the increase in alpha power before intrinsic insights can be interpreted as an increased internal focus of attention. Accordingly, the decrease in alpha power before extrinsic insights may be associated with a more externally oriented focus of attention. Alternatively, the increase in alpha power prior to intrinsic insights can be interpreted as an active inhibition of solution-related information, while the alpha power decrease prior to extrinsic insights may reflect its activation. Regardless of the interpretation, the results provide strong evidence that extrinsic and intrinsic insight differ on the behavioral as well as the neurophysiological level. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Some new insights into collimator design

    International Nuclear Information System (INIS)

    Metz, C.E.; Atkins, F.B.; Tsui, B.M.W.; Beck, R.N.

    1978-01-01

    Relationships among collimator design parameters, physical properties of the resulting images, and human observer performance are discussed. The insight provided by these relationships hopefully will prove useful to the individual who must design or select a collimator for a particular imaging task

  1. Vitamin B12: advances and insights

    DEFF Research Database (Denmark)

    individuals in critical life phases. This book has been written by experts who documented latest developments in the field. It is written for individuals looking for in depth knowledge of the nutritional, chemistry, biochemistry, health and medical relevance of the vitamin. The book provides insights...

  2. Developmental Social Cognitive Neuroscience: Insights from Deafness

    Science.gov (United States)

    Corina, David; Singleton, Jenny

    2009-01-01

    The condition of deafness presents a developmental context that provides insight into the biological, cultural, and linguistic factors underlying the development of neural systems that impact social cognition. Studies of visual attention, behavioral regulation, language development, and face and human action perception are discussed. Visually…

  3. Medical service provider networks.

    Science.gov (United States)

    Mougeot, Michel; Naegelen, Florence

    2018-05-17

    In many countries, health insurers or health plans choose to contract either with any willing providers or with preferred providers. We compare these mechanisms when two medical services are imperfect substitutes in demand and are supplied by two different firms. In both cases, the reimbursement is higher when patients select the in-network provider(s). We show that these mechanisms yield lower prices, lower providers' and insurer's profits, and lower expense than in the uniform-reimbursement case. Whatever the degree of product differentiation, a not-for-profit insurer should prefer selective contracting and select a reimbursement such that the out-of-pocket expense is null. Although all providers join the network under any-willing-provider contracting in the absence of third-party payment, an asymmetric equilibrium may exist when this billing arrangement is implemented. Copyright © 2018 John Wiley & Sons, Ltd.

  4. Insight in seasonal affective disorder.

    Science.gov (United States)

    Ghaemi, S N; Sachs, G S; Baldassano, C F; Truman, C J

    1997-01-01

    Lack of insight complicates the evaluation and treatment of patients with psychotic and affective disorders. No studies of insight in seasonal affective disorder (SAD) have been reported. Thirty patients with SAD diagnosed by the Structured Clinical Interview for DSM-III-R but no other axis I conditions were treated short-term with light-therapy. Insight was measured with the Scale to Assess Unawareness of Mental Disorder (SUMD) as modified by the authors to assess the self-report of insight into depressive symptoms. Increasing scores (1 to 5) indicated increasing unawareness of illness (i.e., less insight). SAD patients displayed a moderate amount of insight when depressed (mean SUMD score, 2.5). When recovered, they showed no significant change in insight into past depressive symptoms (mean SUMD score, 2.8). Greater insight into current depressive symptoms correlated with more depressive symptoms on the Hamilton Rating Scale for Depression score ([HRSD] r = .35, P depressive symptoms that does not change after recovery, a result in agreement with studies of insight in psychosis and mania. Further, in SAD, increased severity of illness may be associated with increased insight into depressive symptoms, consistent with the hypothesis of depressive realism.

  5. Osho - Insights on sex.

    Science.gov (United States)

    Nagaraj, Anil Kumar Mysore

    2013-01-01

    Sex is a mysterious phenomenon, which has puzzled even great sages. Human beings have researched and mastered the biology of sex. But that is not all. Sex needs to be understood from the spiritual perspective too. The vision of Osho is an enlightening experience in this regard. Out of the thousands of lectures, five lectures on sex made Osho most notorious. Born into a Jain family of Madhya Pradesh, Rajneesh, who later wanted himself to be called Osho, is a great master. He has spoken volumes on a wide range of topics ranging from sex to super-consciousness. His contributions in the area of sex are based on the principles of "Tantra" which has its origin from Buddhism. This article focuses on his life and insights on sex, which if understood properly, can be a stepping stone for enlightenment.

  6. Outsourcing/Offshoring Insights

    DEFF Research Database (Denmark)

    Tate, Wendy; Bals, Lydia

    2017-01-01

    Findings: Both the geographical and governance dimensions are part of the rightshoring decision which is an important conceptual foundation for this special issue, as it invited insightful pieces on all of these phenomena (e.g. outsourcing, insourcing, offshoring, reshoring), acknowledging...... for future research out of the six papers are summarized in Table III. There is ample opportunity to further shed light on these suggestions as well as to cover parts of the “rightshoring” framework presented, that remain less covered here (e.g. insourcing and/or reshoring). Practical implications: The array...... of potential “rightshoring” options fosters clarity about the phenomena studied and their implications. The main practical implications of the six papers are summarized in Table II. Originality/value: The overall conceptual framework highlights the positioning of the final papers included into the special...

  7. Providing free autopoweroff plugs

    DEFF Research Database (Denmark)

    Jensen, Carsten Lynge; Hansen, Lars Gårn; Fjordbak, Troels

    2012-01-01

    Experimental evidence of the effect of providing households with cheap energy saving technology is sparse. We present results from a field experiment in which autopoweroff plugs were provided free of charge to randomly selected households. We use propensity score matching to find treatment effects...

  8. Personal Perspectives on Providing Services to Foster Youth

    Science.gov (United States)

    Whitman, Kenyon L.

    2018-01-01

    Utilizing an academic capital framework and student perspectives, this chapter provides insight into the ways that programs and services can help students develop the skills needed to succeed in college.

  9. Insights from Human/Mouse genome comparisons

    Energy Technology Data Exchange (ETDEWEB)

    Pennacchio, Len A.

    2003-03-30

    Large-scale public genomic sequencing efforts have provided a wealth of vertebrate sequence data poised to provide insights into mammalian biology. These include deep genomic sequence coverage of human, mouse, rat, zebrafish, and two pufferfish (Fugu rubripes and Tetraodon nigroviridis) (Aparicio et al. 2002; Lander et al. 2001; Venter et al. 2001; Waterston et al. 2002). In addition, a high-priority has been placed on determining the genomic sequence of chimpanzee, dog, cow, frog, and chicken (Boguski 2002). While only recently available, whole genome sequence data have provided the unique opportunity to globally compare complete genome contents. Furthermore, the shared evolutionary ancestry of vertebrate species has allowed the development of comparative genomic approaches to identify ancient conserved sequences with functionality. Accordingly, this review focuses on the initial comparison of available mammalian genomes and describes various insights derived from such analysis.

  10. Insights into business student's book

    CERN Document Server

    Lannon, Michael; Trappe, Tonya

    1993-01-01

    With Challenging reading and listening texts from a range of authentic business sources, New Insights into Business will really engage your students. The thorough language and vocabulary syllabus together with the strong focus on business skills development gives students everything they need to function effectively in the workplace. New Insights into Business is a self-contained course and is also an ideal follow-on to First Insights into Business.

  11. Insight in schizophrenia: a review.

    Science.gov (United States)

    Dam, Jesper

    2006-01-01

    The issue of insight in schizophrenia must be assumed to be one of the most important aspects of the clinical examination. Comprehensive studies have shown that between 50% and 80% of all patients suffering from schizophrenia do not believe that they have a disorder. In recent years, poor insight in schizophrenia has been the subject of increasing interest, as manifested in a number of studies discussed in the present review. Some of these studies focus on insight correlated to various parameters such as psychopathology, neuropsychology, clinical relevance and compliance. Other studies refer to more theoretical implications, among these the issue of defining the concept of insight: whether insight can be seen as a "primary" phenomenon in schizophrenia, and whether insight may be graduated, dimensioned or increased. Several authors have developed rating scales in an attempt to obtain a measure for the degree or dimension of insight. Here, the range of parameters employed gives an excellent impression of the complexity of the concept of insight. In the concluding discussion, a phenomenological aspect is brought in, in an attempt to place the concept of insight in relation to disturbances of the self in schizophrenia and to primary symptoms in schizophrenia, amongst these autism.

  12. Credential Service Provider (CSP)

    Data.gov (United States)

    Department of Veterans Affairs — Provides a VA operated Level 1 and Level 2 credential for individuals who require access to VA applications, yet cannot obtain a credential from another VA accepted...

  13. MAX Provider Characteristics

    Data.gov (United States)

    U.S. Department of Health & Human Services — The MAX Provider Characteristics (PC) File Implementation Report describes the design, implementation, and results of the MAXPC prototype, which was based on three...

  14. Insight into nucleon structure from generalized parton distributions

    International Nuclear Information System (INIS)

    J.W. Negele; R.C. Brower; P. Dreher; R. Edwards; G. Fleming; Ph. Hagler; Th. Lippert; A.V.Pochinsky; D.B. Renner; D. Richards; K. Schilling; W. Schroers

    2004-01-01

    The lowest three moments of generalized parton distributions are calculated in full QCD and provide new insight into the behavior of nucleon electromagnetic form factors, the origin of the nucleon spin, and the transverse structure of the nucleon

  15. Insights into PRA methodologies

    International Nuclear Information System (INIS)

    Gallagher, D.; Lofgren, E.; Atefi, B.; Liner, R.; Blond, R.; Amico, P.

    1984-08-01

    Probabilistic Risk Assessments (PRAs) for six nuclear power plants were examined to gain insight into how the choice of analytical methods can affect the results of PRAs. The PRA sreflectope considered was limited to internally initiated accidents sequences through core melt. For twenty methodological topic areas, a baseline or minimal methodology was specified. The choice of methods for each topic in the six PRAs was characterized in terms of the incremental level of effort above the baseline. A higher level of effort generally reflects a higher level of detail or a higher degree of sophistication in the analytical approach to a particular topic area. The impact on results was measured in terms of how additional effort beyond the baseline level changed the relative importance and ordering of dominant accident sequences compared to what would have been observed had methods corresponding to the baseline level of effort been employed. This measure of impact is a more useful indicator of how methods affect perceptions of plant vulnerabilities than changes in core melt frequency would be. However, the change in core melt frequency was used as a secondary measure of impact for nine topics where availability of information permitted. Results are presented primarily in the form of effort-impact matrices for each of the twenty topic areas. A suggested effort-impact profile for future PRAs is presented

  16. Grigor Narekatsi's astronomical insights

    Science.gov (United States)

    Poghosyan, Samvel

    2015-07-01

    What stand out in the solid system of Gr. Narekatsi's naturalistic views are his astronomical insights on the material nature of light, its high speed and the Sun being composed of "material air". Especially surprising and fascinating are his views on stars and their clusters. What astronomers, including great Armenian academician V. Ambartsumian (scattering of stellar associations), would understand and prove with much difficulty thousand years later, Narekatsi predicted in the 10th century: "Stars appear and disappear untimely", "You who gather and scatter the speechless constellations, like a flock of sheep". Gr. Narekatsti's reformative views were manifested in all the spheres of the 10th century social life; he is a reformer of church life, great language constructor, innovator in literature and music, freethinker in philosophy and science. His ideology is the reflection of the 10th century Armenian Renaissance. During the 9th-10th centuries, great masses of Armenians, forced to migrate to the Balkans, took with them and spread reformative ideas. The forefather of the western science, which originated in the period of Reformation, is considered to be the great philosopher Nicholas of Cusa. The study of Gr. Narekatsti's logic and naturalistic views enables us to claim that Gr. Narekatsti is the great grandfather of European science.

  17. O insight em psiquiatria

    Directory of Open Access Journals (Sweden)

    Ana Margarida P. Cardoso

    2008-12-01

    Full Text Available O sinal de que algo está a acontecer contribui para que o paciente reconheça que alguma coisa de estranho se está a passar consigo. Este reconhecimento faz com que o sujeito possa desempenhar uma função activa e seja um elemento colaborante do seu processo de recuperação. Cada doença apresenta, contudo, diferentes sintomas, uma vez que cada doença psiquiátrica consiste em diferentes perturbações com diversos efeitos sobre o funcionamento mental. Desta maneira, o fenómeno do insight que é registado em cada doença é diferente e expressa-se sob diferentes formas, não somente devido às manifestações clínicas da doença mas também devido às características individuais do sujeito.

  18. Provider software buyer's guide.

    Science.gov (United States)

    1994-03-01

    To help long term care providers find new ways to improve quality of care and efficiency, Provider magazine presents the fourth annual listing of software firms marketing computer programs for all areas of nursing facility operations. On the following five pages, more than 80 software firms display their wares, with programs such as minimum data set and care planning, dietary, accounting and financials, case mix, and medication administration records. The guide also charts compatible hardware, integration ability, telephone numbers, company contacts, and easy-to-use reader service numbers.

  19. Characteristics of Kodak Insight, an F-speed intraoral film.

    Science.gov (United States)

    Ludlow, J B; Platin, E; Mol, A

    2001-01-01

    This study reports film speed, contrast, exposure latitude, resolution, and response to processing solution depletion of Kodak Insight intraoral film. Densitometric curves were generated by using International Standards Organization protocol. Additional curves were generated for Ultra-speed, Ektaspeed Plus, and Insight films developed in progressively depleted processing solutions. Eight observers viewed images of a resolution test tool for maximum resolution assessment. Images of an aluminum step-wedge were reviewed to determine useful exposure latitude. Insight's sensitivity in fresh automatic processor solutions places it in the F-speed group. An average gradient of 1.8 was found with all film types. Insight provided 93% of the useful exposure latitude of Ektaspeed Plus film. Insight maintained contrast in progressively depleted processing solutions. Like Ektaspeed Plus, Insight was able to resolve at least 20 line-pairs per millimeter. Under International Standards Organization conditions, Insight required only 77% of the exposure of Ektaspeed Plus film. Insight film provided stable contrast in depleted processing solutions.

  20. Cognitive insight: A systematic review.

    Science.gov (United States)

    Van Camp, L S C; Sabbe, B G C; Oldenburg, J F E

    2017-07-01

    Cognitive insight is the ability to re-evaluate thoughts and beliefs in order to make thoughtful conclusions. It differs from clinical insight, as it focuses on more general metacognitive processes. Therefore, it could be relevant to diverse disorders and non-clinical subjects. There is a growing body of research on cognitive insight in individuals with and without psychosis. This review has summarised the current state of the art regarding this topic. We conclude that while cognitive insight in its current form seems valid for use in individuals with psychosis, it is less so for individuals without psychosis. Additionally, higher cognitive insight not always leads to better psychological functioning. For instance, higher levels of self-reflection are often associated with depressive mood. We therefore recommend the sub-components of cognitive insight to be studied separately. Also, it is unclear what position cognitive insight takes within the spectrum of metacognitive processes and how it relates to other self-related concepts that have been defined previously in literature. Combining future and past research on cognitive insight and its analogue concepts will help in the formation of a uniform definition that fits all subjects discussed here. Copyright © 2017. Published by Elsevier Ltd.

  1. What HERA may provide?

    Energy Technology Data Exchange (ETDEWEB)

    Jung, Hannes [DESY, Hamburg (Germany); De Roeck, Albert [CERN, Genf (Switzerland); Bartles, Jochen [Univ. Hamburg (DE). Institut fuer Theoretische Physik II] (and others)

    2008-09-15

    More than 100 people participated in a discussion session at the DIS08 workshop on the topic What HERA may provide. A summary of the discussion with a structured outlook and list of desirable measurements and theory calculations is given. (orig.)

  2. What HERA may provide?

    International Nuclear Information System (INIS)

    Jung, Hannes; De Roeck, Albert; Bartles, Jochen

    2008-09-01

    More than 100 people participated in a discussion session at the DIS08 workshop on the topic What HERA may provide. A summary of the discussion with a structured outlook and list of desirable measurements and theory calculations is given. (orig.)

  3. Provider of Services File

    Data.gov (United States)

    U.S. Department of Health & Human Services — The POS file consists of two data files, one for CLIA labs and one for 18 other provider types. The file names are CLIA and OTHER. If downloading the file, note it...

  4. Building Service Provider Capabilities

    DEFF Research Database (Denmark)

    Brandl, Kristin; Jaura, Manya; Ørberg Jensen, Peter D.

    2015-01-01

    In this paper we study whether and how the interaction between clients and the service providers contributes to the development of capabilities in service provider firms. In situations where such a contribution occurs, we analyze how different types of activities in the production process...... process. We find that clients influence the development of human capital capabilities and management capabilities in reciprocally produced services. While in sequential produced services clients influence the development of organizational capital capabilities and management capital capabilities....... of the services, such as sequential or reciprocal task activities, influence the development of different types of capabilities. We study five cases of offshore-outsourced knowledge-intensive business services that are distinguished according to their reciprocal or sequential task activities in their production...

  5. Providing x-rays

    International Nuclear Information System (INIS)

    Mallozzi, P.J.; Epstein, H.M.

    1985-01-01

    This invention provides an apparatus for providing x-rays to an object that may be in an ordinary environment such as air at approximately atmospheric pressure. The apparatus comprises: means (typically a laser beam) for directing energy onto a target to produce x-rays of a selected spectrum and intensity at the target; a fluid-tight enclosure around the target; means for maintaining the pressure in the first enclosure substantially below atmospheric pressure; a fluid-tight second enclosure adjoining the first enclosure, the common wall portion having an opening large enough to permit x-rays to pass through but small enough to allow the pressure reducing means to evacuate gas from the first enclosure at least as fast as it enters through the opening; the second enclosure filled with a gas that is highly transparent to x-rays; the wall of the second enclosure to which the x-rays travel having a portion that is highly transparent to x-rays (usually a beryllium or plastic foil), so that the object to which the x-rays are to be provided may be located outside the second enclosure and adjacent thereto and thus receive the x-rays substantially unimpeded by air or other intervening matter. The apparatus is particularly suited to obtaining EXAFS (extended x-ray fine structure spectroscopy) data on a material

  6. PROVIDING WOMEN, KEPT MEN

    Science.gov (United States)

    Mojola, Sanyu A

    2014-01-01

    This paper draws on ethnographic and interview based fieldwork to explore accounts of intimate relationships between widowed women and poor young men that emerged in the wake of economic crisis and a devastating HIV epidemic among the Luo ethnic group in Western Kenya. I show how the cooptation of widow inheritance practices in the wake of an overwhelming number of widows as well as economic crisis resulted in widows becoming providing women and poor young men becoming kept men. I illustrate how widows in this setting, by performing a set of practices central to what it meant to be a man in this society – pursuing and providing for their partners - were effectively doing masculinity. I will also show how young men, rather than being feminized by being kept, deployed other sets of practices to prove their masculinity and live in a manner congruent with cultural ideals. I argue that ultimately, women’s practice of masculinity in large part seemed to serve patriarchal ends. It not only facilitated the fulfillment of patriarchal expectations of femininity – to being inherited – but also served, in the end, to provide a material base for young men’s deployment of legitimizing and culturally valued sets of masculine practice. PMID:25489121

  7. The Association of DRD2 with Insight Problem Solving.

    Science.gov (United States)

    Zhang, Shun; Zhang, Jinghuan

    2016-01-01

    Although the insight phenomenon has attracted great attention from psychologists, it is still largely unknown whether its variation in well-functioning human adults has a genetic basis. Several lines of evidence suggest that genes involved in dopamine (DA) transmission might be potential candidates. The present study explored for the first time the association of dopamine D2 receptor gene ( DRD2 ) with insight problem solving. Fifteen single-nucleotide polymorphisms (SNPs) covering DRD2 were genotyped in 425 unrelated healthy Chinese undergraduates, and were further tested for association with insight problem solving. Both single SNP and haplotype analysis revealed several associations of DRD2 SNPs and haplotypes with insight problem solving. In conclusion, the present study provides the first evidence for the involvement of DRD2 in insight problem solving, future studies are necessary to validate these findings.

  8. Providing Compassion through Flow

    Directory of Open Access Journals (Sweden)

    Lydia Royeen

    2015-07-01

    Full Text Available Meg Kral, MS, OTR/L, CLT, is the cover artist for the Summer 2015 issue of The Open Journal of Occupational Therapy. Her untitled piece of art is an oil painting and is a re-creation of a photograph taken while on vacation. Meg is currently supervisor of outpatient services at Rush University Medical Center. She is lymphedema certified and has a specific interest in breast cancer lymphedema. Art and occupational therapy serve similar purposes for Meg: both provide a sense of flow. She values the outcomes, whether it is a piece of art or improved functional status

  9. Research Insights About Risk Governance

    Directory of Open Access Journals (Sweden)

    Therese R. Viscelli

    2016-11-01

    Full Text Available In recent years, expectations for increased risk governance have been placed explicitly on boards of directors. In response, boards are being held responsible for not only understanding and approving management’s risk management processes, but they are also being held responsible for assessing the risks identified by those processes as part of overseeing management’s pursuit of value. These increasing responsibilities have led a number of organizations to adopt enterprise risk management (ERM as a holistic approach to risk management that extends beyond traditional silo-based risk management techniques. As boards, often through their audit committee, consider management’s implementation of ERM as part of the board’s risk oversight, a number of questions emerge that can be informed by academic research related to ERM. This article summarizes findings from ERM research to provide insights related to the board’s risk governance responsibilities. We also identify a number of research questions that warrant further analysis by governance scholars. It is our hope that this article will spawn varying types of research about ERM and corporate governance.

  10. Functional Insights from Structural Genomics

    Energy Technology Data Exchange (ETDEWEB)

    Forouhar,F.; Kuzin, A.; Seetharaman, J.; Lee, I.; Zhou, W.; Abashidze, M.; Chen, Y.; Montelione, G.; Tong, L.; et al

    2007-01-01

    Structural genomics efforts have produced structural information, either directly or by modeling, for thousands of proteins over the past few years. While many of these proteins have known functions, a large percentage of them have not been characterized at the functional level. The structural information has provided valuable functional insights on some of these proteins, through careful structural analyses, serendipity, and structure-guided functional screening. Some of the success stories based on structures solved at the Northeast Structural Genomics Consortium (NESG) are reported here. These include a novel methyl salicylate esterase with important role in plant innate immunity, a novel RNA methyltransferase (H. influenzae yggJ (HI0303)), a novel spermidine/spermine N-acetyltransferase (B. subtilis PaiA), a novel methyltransferase or AdoMet binding protein (A. fulgidus AF{_}0241), an ATP:cob(I)alamin adenosyltransferase (B. subtilis YvqK), a novel carboxysome pore (E. coli EutN), a proline racemase homolog with a disrupted active site (B. melitensis BME11586), an FMN-dependent enzyme (S. pneumoniae SP{_}1951), and a 12-stranded {beta}-barrel with a novel fold (V. parahaemolyticus VPA1032).

  11. Insight and illness perception in Mexican patients with psychosis.

    Science.gov (United States)

    Gómez-de-Regil, Lizzette

    2015-03-01

    Insight and illness perception are two concepts of interest in the study of factors related to clinical outcome in patients with psychosis. Insight implies a risk of emotional distress for the patient. Illness perceptions, regardless of their accuracy, might be favorable or not to illness. Literature provides evidence of significant correlates of these factors with clinical outcome, but they are rarely included in a single study. 1) assessing insight and illness perception in a sample of Mexican patients who have experienced psychosis and, 2) analyzing how insight and illness perception relate to each other and how they relate to clinical status (i.e., positive, negative, and general psychopathology, depression, and anxiety). Sixty-one participants (55.7% females) were recruited from a public psychiatric hospital; insight and illness perceptions were assessed with the SUMD and the Brief-IPQ, respectively. Clinical status was assessed with the PANSS, CDS and BAI scales. Participants showed good insight, favorable illness perceptions for the cognitive and comprehension dimensions, but unfavorable for the emotional dimension. Clinical status of sample was characterized by mild symptoms. Poor insight related to positive symptoms and general psychopathology. Cognitive and emotional perceptions of illness were significantly associated to most clinical status parameters, whereas comprehension showed no significant results. The study not only replicates the significant association on insight and illness perception with clinical outcome, but shows how their patterns of interactions are different, reinforcing the idea that they are two distinct factors worthy of being habitually acknowledged in research and clinical practice.

  12. Energy providers: customer expectations

    International Nuclear Information System (INIS)

    Pridham, N.F.

    1997-01-01

    The deregulation of the gas and electric power industries, and how it will impact on customer service and pricing rates was discussed. This paper described the present situation, reviewed core competencies, and outlined future expectations. The bottom line is that major energy consumers are very conscious of energy costs and go to great lengths to keep them under control. At the same time, solutions proposed to reduce energy costs must benefit all classes of consumers, be they industrial, commercial, institutional or residential. Deregulation and competition at an accelerated pace is the most likely answer. This may be forced by external forces such as foreign energy providers who are eager to enter the Canadian energy market. It is also likely that the competition and convergence between gas and electricity is just the beginning, and may well be overshadowed by other deregulated industries as they determine their core competencies

  13. Newer insights in teledermatology practice

    Directory of Open Access Journals (Sweden)

    Garehatty Rudrappa Kanthraj

    2011-01-01

    Full Text Available The study and practice of dermatology care using interactive audio, visual, and data communications from a distance is called teledermatology. A teledermatology practice (TP provides teleconsultation as well tele-education. Initially, dermatologists used videoconference. Convenience, cost-effectiveness and easy application of the practice made "store and forward" to emerge as a basic teledermatology tool. The advent of newer technologies like third generation (3G and fourth generation (4G mobile teledermatology (MT and dermatologists′ interest to adopt tertiary TP to pool expert (second opinion to address difficult-to-manage cases (DMCs has resulted in a rapid change in TP. Online discussion groups (ODGs, author-based second opinion teledermatology (AST, or a combination of both are the types of tertiary TP. This article analyzes the feasibility studies and provides latest insight into TP with a revised classification to plan and allocate budget and apply appropriate technology. Using the acronym CAP-HAT, which represents five important factors like case, approach, purpose, health care professionals, and technology, one can frame a TP. Store-and-forward teledermatology (SAFT is used to address routine cases (spotters. Chronic cases need frequent follow-up care. Leg ulcer and localized vitiligo need MT while psoriasis and leprosy require SAFT. Pigmented skin lesions require MT for triage and combination of teledermoscopy, telepathology, and teledermatology for diagnosis. A self-practising dermatologist and national health care system dermatologist use SAFT for routine cases and a combination of ASTwith an ODG to address a DMC. A TP alone or in combination with face-to-face consultation delivers quality care.

  14. Parental insightfulness: retrospect and prospect.

    Science.gov (United States)

    Koren-Karie, Nina; Oppenheim, David

    2018-06-01

    We open this introductory paper to the special issue with the theoretical and clinical roots of the insightfulness concept. Next, the Insightfulness Assessment (IA) is presented, followed by a review of key empirical findings supporting the IA. The central points in the papers in this special issue are reviewed next. These include the use of the IA with parents of children ranging in age from infancy to adolescence, its applicability outside the parent-child relationship (e.g. insightfulness toward a close friend), its use with high-risk mothers, and the usefulness of insightfulness both as a continuous and a categorical measure. The clinical applications of the IA are discussed, and we close with future directions for IA research.

  15. Insight in the outside

    NARCIS (Netherlands)

    Brongersma, H.H.; Ridder, de M.; Gildenpfennig, A.; Viitanen, M.M.

    2003-01-01

    Modern low energy ion scattering (LEIS) can provide new information on the atomic composition of both outermost surface and sub-surface layers. The wide scope of new possibilities is illustrated with results on ceramics, polymers and ultra-thin layers. Most of the results presented are difficult or

  16. What HERA May Provide?

    Energy Technology Data Exchange (ETDEWEB)

    Jung, Hannes; /DESY; De Roeck, Albert; /CERN; Bartels, Jochen; /Hamburg U., Inst. Theor. Phys. II; Behnke, Olaf; Blumlein, Johannes; /DESY; Brodsky, Stanley; /SLAC /Durham U., IPPP; Cooper-Sarkar, Amanda; /Oxford U.; Deak, Michal; /DESY; Devenish, Robin; /Oxford U.; Diehl, Markus; /DESY; Gehrmann, Thomas; /Zurich U.; Grindhammer, Guenter; /Munich, Max Planck Inst.; Gustafson, Gosta; /CERN /Lund U., Dept. Theor. Phys.; Khoze, Valery; /Durham U., IPPP; Knutsson, Albert; /DESY; Klein, Max; /Liverpool U.; Krauss, Frank; /Durham U., IPPP; Kutak, Krzysztof; /DESY; Laenen, Eric; /NIKHEF, Amsterdam; Lonnblad, Leif; /Lund U., Dept. Theor. Phys.; Motyka, Leszek; /Hamburg U., Inst. Theor. Phys. II /Birmingham U. /Southern Methodist U. /DESY /Piemonte Orientale U., Novara /CERN /Paris, LPTHE /Hamburg U. /Penn State U.

    2011-11-10

    More than 100 people participated in a discussion session at the DIS08 workshop on the topic What HERA may provide. A summary of the discussion with a structured outlook and list of desirable measurements and theory calculations is given. The HERA accelerator and the HERA experiments H1, HERMES and ZEUS stopped running in the end of June 2007. This was after 15 years of very successful operation since the first collisions in 1992. A total luminosity of {approx} 500 pb{sup -1} has been accumulated by each of the collider experiments H1 and ZEUS. During the years the increasingly better understood and upgraded detectors and HERA accelerator have contributed significantly to this success. The physics program remains in full swing and plenty of new results were presented at DIS08 which are approaching the anticipated final precision, fulfilling and exceeding the physics plans and the previsions of the upgrade program. Most of the analyses presented at DIS08 were still based on the so called HERA I data sample, i.e. data taken until 2000, before the shutdown for the luminosity upgrade. This sample has an integrated luminosity of {approx} 100 pb{sup -1}, and the four times larger statistics sample from HERA II is still in the process of being analyzed.

  17. Franchise Business Model: Theoretical Insights

    OpenAIRE

    Levickaitė, Rasa; Reimeris, Ramojus

    2010-01-01

    The article is based on literature review, theoretical insights, and deals with the topic of franchise business model. The objective of the paper is to analyse peculiarities of franchise business model and its developing conditions in Lithuania. The aim of the paper is to make an overview on franchise business model and its environment in Lithuanian business context. The overview is based on international and local theoretical insights. In terms of practical meaning, this article should be re...

  18. Insights into teaching mathematics

    CERN Document Server

    Orton, Anthony

    2004-01-01

    Providing essential guidance and background information about teaching mathematics, this book is intended particularly for teachers who do not regard themselves as specialists in mathematics. It deals with issues of learning and teaching, including the delivery of content and the place of problems and investigations. Difficulties which pupils encounter in connection with language and symbols form important sections of the overall discussion of how to enhance learning. The curriculum is considered in brief under the headings of number, algebra, shape and space, and data handling, and special at

  19. Optimization : insights and applications

    CERN Document Server

    Brinkhuis, Jan

    2005-01-01

    This self-contained textbook is an informal introduction to optimization through the use of numerous illustrations and applications. The focus is on analytically solving optimization problems with a finite number of continuous variables. In addition, the authors provide introductions to classical and modern numerical methods of optimization and to dynamic optimization. The book's overarching point is that most problems may be solved by the direct application of the theorems of Fermat, Lagrange, and Weierstrass. The authors show how the intuition for each of the theoretical results can be s

  20. Full page insight

    DEFF Research Database (Denmark)

    Cortsen, Rikke Platz

    2014-01-01

    Alan Moore and his collaborating artists often manipulate time and space by drawing upon the formal elements of comics and making alternative constellations. This article looks at an element that is used frequently in comics of all kinds – the full page – and discusses how it helps shape spatio......, something that it shares with the full page in comics. Through an analysis of several full pages from Moore titles like Swamp Thing, From Hell, Watchmen and Promethea, it is made clear why the full page provides an apt vehicle for an apocalypse in comics....

  1. Photosynthesis within Mars' volcanic craters?: Insights from Cerro Negro Volcano, Nicaragua

    Science.gov (United States)

    Rogers, K. L.; Hynek, B. M.; McCollom, T. M.

    2011-12-01

    Discrete locales of sulfate-rich bedrocks exist on Mars and in many cases represent the products of acid-sulfate alteration of martian basalt. In some places, the products have been attributed to hydrothermal processes from local volcanism. In order to evaluate the habitability of such an environment, we are investigating the geochemical and biological composition of active fumaroles at Cerro Negro Volcano, Nicaragua, where fresh basaltic cinders similar in composition to martian basalts are altered by acidic, sulfur-bearing gases. Temperatures at active fumaroles can reach as high as 400°C and the pH of the steam ranges from Cyanobacteria and Ktedonobacteria, however Actinobacteria, alpha-Proteobacteria and Acidobacteria were also identified. Many of the cyanobacterial sequences were similar to those of the eukaryotic Cyanidiales, red algae that inhabit acidic, geothermal environments. Many of sequences related to Ktedonobacteria and Actinobacteria have also been found in acid mine drainage environments. The Archaeal community was far less diverse, with sequences matching those of unclassified Desulfurococcales and unclassified Thermoprotei. These sequences were more distant from isolated species than the bacterial sequences. Similar bacterial and archaeal communities have been found in hot spring environments in Yellowstone National Park, Greenland, Iceland, New Zealand and Costa Rica. Some of Mars' volcanoes were active for billions of years and by analogy to Cerro Negro, may have hosted photosynthetic organisms that could have been preserved in alteration mineral assemblages. Even on a generally cold and dry Mars, volcanic craters likely provided long-lived warm and wet conditions and should be a key target for future exploration assessing habitability.

  2. Metagenomic insights into anaerobic metabolism along an Arctic peat soil profile.

    Directory of Open Access Journals (Sweden)

    David A Lipson

    Full Text Available A metagenomic analysis was performed on a soil profile from a wet tundra site in northern Alaska. The goal was to link existing biogeochemical knowledge of the system with the organisms and genes responsible for the relevant metabolic pathways. We specifically investigated how the importance of iron (Fe oxides and humic substances (HS as terminal electron acceptors in this ecosystem is expressed genetically, and how respiratory and fermentative processes varied with soil depth into the active layer and into the upper permafrost. Overall, the metagenomes reflected a microbial community enriched in a diverse range of anaerobic pathways, with a preponderance of known Fe reducing species at all depths in the profile. The abundance of sequences associated with anaerobic metabolic processes generally increased with depth, while aerobic cytochrome c oxidases decreased. Methanogenesis genes and methanogen genomes followed the pattern of CH4 fluxes: they increased steeply with depth into the active layer, but declined somewhat over the transition zone between the lower active layer and the upper permafrost. The latter was relatively enriched in fermentative and anaerobic respiratory pathways. A survey of decaheme cytochromes (MtrA, MtrC and their homologs revealed that this is a promising approach to identifying potential reducers of Fe(III or HS, and indicated a possible role for Acidobacteria as Fe reducers in these soils. Methanogens appear to coexist in the same layers, though in lower abundance, with Fe reducing bacteria and other potential competitors, including acetogens. These observations provide a rich set of hypotheses for further targeted study.

  3. Access to finance from different finance provider types

    NARCIS (Netherlands)

    Wulandari, Eliana; Meuwissen, Miranda P.M.; Karmana, Maman H.; Oude Lansink, Alfons G.J.M.

    2017-01-01

    Analysing farmer knowledge of the requirements of finance providers can provide valuable insights to policy makers about ways to improve farmers’ access to finance. This study compares farmer knowledge of the requirements to obtain finance with the actual requirements set by different finance

  4. Risk insights from seismic margin reviews

    International Nuclear Information System (INIS)

    Budnitz, R.J.

    1990-01-01

    This paper discusses the information that has been derived from the three seismic-margin reviews conducted so far, and the information that is potentially available from using the seismic-margin method more generally. There are two different methodologies for conducting seismic margin reviews of nuclear power plants, one developed under NRC sponsorship and one developed under sponsorship of the Electric Power Research Institute. Both methodologies will be covered in this paper. The paper begins with a summary of the steps necessary to complete a margin review, and will then outline the key technical difficulties that need to be addressed. After this introduction, the paper covers the safety and operational insights derived from the three seismic-margin reviews already completed: the NRC-sponsored review at Maine Yankee; the EPRI-sponsored review at Catawba; and the joint EPRI/NRC/utility effort at Hatch. The emphasis is on engineering insights, with attention to the aspects of the reviews that are easiest to perform and that provide the most readily available insights

  5. 2016 Mars Insight Mission Design and Navigation

    Science.gov (United States)

    Abilleira, Fernando; Frauenholz, Ray; Fujii, Ken; Wallace, Mark; You, Tung-Han

    2014-01-01

    Scheduled for a launch in the 2016 Earth to Mars opportunity, the Interior Exploration using Seismic Investigations, Geodesy, and Heat Transport (InSight) Mission will arrive to Mars in late September 2016 with the primary objective of placing a science lander on the surface of the Red Planet followed by the deployment of two science instruments to investigate the fundamental processes of terrestrial planet formation and evolution. In order to achieve a successful landing, the InSight Project has selected a launch/arrival strategy that satisfies the following key and driving requirements: (1) Deliver a total launch mass of 727 kg, (2) target a nominal landing site with a cumulative Delta V99 less than 30 m/s, and (3) approach EDL with a V-infinity upper limit of 3.941 km/s and (4) an entry flight-path angle (EFPA) of -12.5 +/- 0.26 deg, 3-sigma; the InSight trajectories have been designed such that they (5) provide UHF-band communications via Direct-To-Earth and MRO from Entry through landing plus 60 s, (6) with injection aimpoints biased away from Mars such that the probability of the launch vehicle upper stage impacting Mars is less than 1.0 X 10(exp 4) for fifty years after launch, and (7) non-nominal impact probabilities due to failure during the Cruise phase less than 1.0 X 10(exp 2).

  6. How to Detect Insight Moments in Problem Solving Experiments

    Directory of Open Access Journals (Sweden)

    Ruben E. Laukkonen

    2018-03-01

    Full Text Available Arguably, it is not possible to study insight moments during problem solving without being able to accurately detect when they occur (Bowden and Jung-Beeman, 2007. Despite over a century of research on the insight moment, there is surprisingly little consensus on the best way to measure them in real-time experiments. There have also been no attempts to evaluate whether the different ways of measuring insight converge. Indeed, if it turns out that the popular measures of insight diverge, then this may indicate that researchers who have used one method may have been measuring a different phenomenon to those who have used another method. We compare the strengths and weaknesses of the two most commonly cited ways of measuring insight: The feelings-of-warmth measure adapted from Metcalfe and Wiebe (1987, and the self-report measure adapted from Bowden and Jung-Beeman (2007. We find little empirical agreement between the two measures, and conclude that the self-report measure of Aha! is superior both methodologically and theoretically, and provides a better representation of what is commonly regarded as insight. We go on to describe and recommend a novel visceral measure of insight using a dynamometer as described in Creswell et al. (2016.

  7. How to Detect Insight Moments in Problem Solving Experiments.

    Science.gov (United States)

    Laukkonen, Ruben E; Tangen, Jason M

    2018-01-01

    Arguably, it is not possible to study insight moments during problem solving without being able to accurately detect when they occur (Bowden and Jung-Beeman, 2007). Despite over a century of research on the insight moment, there is surprisingly little consensus on the best way to measure them in real-time experiments. There have also been no attempts to evaluate whether the different ways of measuring insight converge. Indeed, if it turns out that the popular measures of insight diverge , then this may indicate that researchers who have used one method may have been measuring a different phenomenon to those who have used another method. We compare the strengths and weaknesses of the two most commonly cited ways of measuring insight: The feelings-of-warmth measure adapted from Metcalfe and Wiebe (1987), and the self-report measure adapted from Bowden and Jung-Beeman (2007). We find little empirical agreement between the two measures, and conclude that the self-report measure of Aha! is superior both methodologically and theoretically, and provides a better representation of what is commonly regarded as insight. We go on to describe and recommend a novel visceral measure of insight using a dynamometer as described in Creswell et al. (2016).

  8. Insight into nicotine addiction

    Directory of Open Access Journals (Sweden)

    Sahil Handa

    2017-01-01

    Full Text Available The emergence of the epidemic of nicotine addiction in India and other nations is a global public health tragedy of untoward proportions. Smoking or chewing tobacco can seriously affect general, as well as oral health. Smoking-caused disease is a consequence of exposure to toxins in tobacco smoke and addiction to nicotine is the proximate cause of these diseases. This article focuses on nicotine as a determinant of addiction to tobacco and the pharmacologic effects of nicotine that sustain cigarette smoking. The pharmacologic reasons for nicotine use are an enhancement of mood, either directly or through relief of withdrawal symptoms and augmentation of mental or physical functions. Tobacco cessation is necessary to reduce morbidity and mortality related to tobacco use. Strategies for tobacco cessation involves 5A's and 5R's approach and pharmacotherapy. Dental professionals play an important role in helping patients to quit tobacco at the community and national levels, to promote tobacco prevention and control nicotine addiction. Dentists are in a unique position to educate and motivate patients concerning the hazards of tobacco to their oral and systemic health, and to provide intervention programs as a part of routine patient care.

  9. Proteomics Insights into Autophagy.

    Science.gov (United States)

    Cudjoe, Emmanuel K; Saleh, Tareq; Hawkridge, Adam M; Gewirtz, David A

    2017-10-01

    Autophagy, a conserved cellular process by which cells recycle their contents either to maintain basal homeostasis or in response to external stimuli, has for the past two decades become one of the most studied physiological processes in cell biology. The 2016 Nobel Prize in Medicine and Biology awarded to Dr. Ohsumi Yoshinori, one of the first scientists to characterize this cellular mechanism, attests to its importance. The induction and consequent completion of the process of autophagy results in wide ranging changes to the cellular proteome as well as the secretome. MS-based proteomics affords the ability to measure, in an unbiased manner, the ubiquitous changes that occur when autophagy is initiated and progresses in the cell. The continuous improvements and advances in mass spectrometers, especially relating to ionization sources and detectors, coupled with advances in proteomics experimental design, has made it possible to study autophagy, among other process, in great detail. Innovative labeling strategies and protein separation techniques as well as complementary methods including immuno-capture/blotting/staining have been used in proteomics studies to provide more specific protein identification. In this review, we will discuss recent advances in proteomics studies focused on autophagy. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Perception and Information Behaviour of Institutional Repository End-Users Provides Valuable Insight for Future Development. A Review of: St. Jean, B., Rieh, S. Y., Yakel, E., & Markey, K. (2011. Unheard voices: Institutional repository end-users. College & Research Libraries, 72(1, 21-42.

    Directory of Open Access Journals (Sweden)

    Lisa Shen

    2012-06-01

    source, which placed most IRs in a less favorable light.Additionally, researchers noted conflicting assumptions made by interviewees about IRs in the evaluation process for their content. Some interviewees believed all the content of an IR has been vetted through an approval process, while others distrusted all IR content that was not peer-reviewed.To what extent are end-users willing to return to an IR or recommend it to their peers?The great majority of interviews indicated they were likely to use IRs again in the future, and nearly all indicated they would recommend IRs to their peers. However, most interviewees did not know of any people using IRs. The few interviewees who did often knew of IR contributors rather than end-users.How do IRs fit into end-users’ information seeking behavior?Many interviewees noted that IRs provided them with content that was not commonly available through traditional publishing channels, including conference papers and dissertations. Others felt IRs made content available more quickly than other information sources. However, the results also suggested that most interviewees did not include IRs in their routine research process.Conclusion – This study identified current end-users’ perceptions of IRs and highlighted several areas for future IR development. Areas of improvement for IRs included intensifying publicity efforts; increasing content recruitment; making content recruitment policies more transparent; and improving appearance and navigation functionalities. The findings also suggested new directions for IR marketing, such as emphasizing on the networking and collaborating benefits of using IR.

  11. Insights in Public Health

    Science.gov (United States)

    Taira, Deborah; Sentell, Tetine; Albright, Cheryl; Lansidell, Doug; Nakagawa, Kazuma; Seto, Todd; Stevens, Joel Mark

    2017-01-01

    Hypertension is one of the leading causes of death and disability worldwide. Blood pressure reduction and control are associated with reduced risk of stroke and cardiovascular disease. To achieve optimal reduction and control, reliable and valid methods for blood pressure measurement are needed. Office based measurements can result in ‘white coat’ hypertension, which is when a patient's blood pressure in a clinical setting is higher than in other settings, or ‘masked’ hypertension, which occurs when a patient's blood pressure is normal in a clinical setting, but elevated outside the clinical setting. In 2015, the US Preventative Services Task Force recommended Ambulatory Blood Pressure Monitoring (ABPM) as the “best method” for measuring blood pressure, endorsing its use both for confirming the diagnosis of hypertension and for excluding ‘white coat’ hypertension. ABPM is a safe, painless and non-invasive test wherein patients wear a small digital blood pressure machine attached to a belt around their body and connected to a cuff around their upper arm that enables multiple automated blood pressure measurements at designated intervals (typically every 15 to 30 minutes) throughout the day and night for a specified period (eg, 24 hours). Patients can go about their typical daily activities wearing the device as much as possible, except when they are bathing, showering, or engaging in heavy exercise. Given the importance of blood pressure monitoring and control to population public health, this article provides details on the relevance and challenges of blood pressure measurement broadly then describes ABPM generally and specifically in the Hawai‘i context. PMID:29164016

  12. Understanding Insight in the Context of Q

    Science.gov (United States)

    Coghlan, David

    2012-01-01

    In Revans' learning formula, L = P + Q, Q represents "questioning insight", by which Revans means that insight comes out of the process of questioning programmed knowledge (P) in the light of experience. We typically focus on the content of an insight rather than on the act of insight. Drawing primarily on the work of Bernard Lonergan this paper…

  13. Approaching the Distinction between Intuition and Insight.

    Science.gov (United States)

    Zhang, Zhonglu; Lei, Yi; Li, Hong

    2016-01-01

    Intuition and insight share similar cognitive and neural basis. Though, there are still some essential differences between the two. Here in this short review, we discriminated between intuition, and insight in two aspects. First, intuition, and insight are toward different aspects of information processing. Whereas intuition involves judgment about "yes or no," insight is related to "what" is the solution. Second, tacit knowledge play different roles in between intuition and insight. On the one hand, tacit knowledge is conducive to intuitive judgment. On the other hand, tacit knowledge may first impede but later facilitate insight occurrence. Furthermore, we share theoretical, and methodological views on how to access the distinction between intuition and insight.

  14. Insight in psychosis: Metacognitive processes and treatment

    OpenAIRE

    de Vos, Annerieke

    2016-01-01

    Insight is impaired in 50- 80% of the patients with schizophrenia. Annerieke de Vos working at GGZ Drenthe and the University Medical Hospital Groningen, aimed to elucidate which processes underlie impaired insight and tried to improve insight in patients by targeting these processes. On September 21st she will defend her thesis entitled: "Insight in psychosis. Metacognitive processes and treatment.". Patients with impaired insight may fail to recognize that things in life are not going well ...

  15. Comparative Analysis of Bat Genomes Provides Insight into the Evolution of Flight and Immunity

    DEFF Research Database (Denmark)

    Zhang, Guojie; Cowled, Christopher; Shi, Zhengli

    2013-01-01

    Bats are the only mammals capable of sustained flight and are notorious reservoir hosts for some of the world's most highly pathogenic viruses, including Nipah, Hendra, Ebola, and severe acute respiratory syndrome (SARS). To identify genetic changes associated with the development of bat-specific......Bats are the only mammals capable of sustained flight and are notorious reservoir hosts for some of the world's most highly pathogenic viruses, including Nipah, Hendra, Ebola, and severe acute respiratory syndrome (SARS). To identify genetic changes associated with the development of bat...

  16. Kinetics of viral shedding provide insights into the epidemiology of viral hemorrhagic septicemia in Pacific herring

    Science.gov (United States)

    Hershberger, Paul K.; Gregg, Jacob L.; Winton, James R.; Grady, Courtney; Collins, Rachael

    2010-01-01

    Losses from infectious diseases are an important component of natural mortality among marine fish species, but factors controlling the ecology of these diseases and their potential responses to anthropogenic changes are poorly understood. We used viral hemorrhagic septicemia virus (VHSV) and a laboratory stock of Pacific herring Clupea pallasii to investigate the kinetics of viral shedding and its effect on disease transmission and host mortality. Outbreaks of acute disease, accompanied by mortality and viral shedding, were initiated after waterborne exposure of herring to concentrations of VHSV as low as 101 plaque-forming units (pfu) ml–1. Shed virus in flow-through tanks was first detected 4 to 5 d post-exposure, peaked after 6 to 10 d, and was no longer detected after 16 d. Shedding rates, calculated from density, flow and waterborne virus titer reached 1.8 to 5.0 × 108 pfu fish–1 d–1. Onset of viral shedding was dose-dependent and preceded initial mortality by 2 d. At 21 d, cumulative mortality in treatment groups ranged from 81 to 100% and was dependent not on challenge dose, but on the kinetics and level of viral shedding by infected fish in the tank. Possible consequences of the viral shedding and disease kinetics are discussed in the context of epizootic initiation and perpetuation among populations of wild Pacific herring.

  17. Renal blood flow dynamics in inbred rat strains provides insight into autoregulation.

    Science.gov (United States)

    A Mitrou, Nicholas G; Cupples, William A

    2014-01-01

    Renal autoregulation maintains stable renal blood flow in the face of constantly fluctuating blood pressure. Autoregulation is also the only mechanism that protects the delicate glomerular capillaries when blood pressure increases. In order to understand autoregulation, the renal blood flow response to changing blood pressure is studied. The steadystate response of blood flow is informative, but limits investigation of the individual mechanisms of autoregulation. The dynamics of autoregulation can be probed with transfer function analysis. The frequency-domain analysis of autoregulation allows investigators to probe the relative activity of each mechanism of autoregulation. We discuss the methodology and interpretation of transfer function analysis. Autoregulation is routinely studied in the rat, of which there are many inbred strains. There are multiple strains of rat that are either selected or inbred as models of human pathology. We discuss relevant characteristics of Brown Norway, Spontaneously hypertensive, Dahl, and Fawn-Hooded hypertensive rats and explore differences among these strains in blood pressure, dynamic autoregulation, and susceptibility to hypertensive renal injury. Finally we show that the use of transfer function analysis in these rat strains has contributed to our understanding of the physiology and pathophysiology of autoregulation and hypertensive renal disease.Interestingly all these strains demonstrate effective tubuloglomerular feedback suggesting that this mechanism is not sufficient for effective autoregulation. In contrast, obligatory or conditional failure of the myogenic mechanism suggests that this component is both necessary and sufficient for autoregulation.

  18. Analyzing Arabidopsis thaliana root proteome provides insights into the molecular bases of enantioselective imazethapyr toxicity

    Science.gov (United States)

    Qian, Haifeng; Lu, Haiping; Ding, Haiyan; Lavoie, Michel; Li, Yali; Liu, Weiping; Fu, Zhengwei

    2015-07-01

    Imazethapyr (IM) is a widely used chiral herbicide that inhibits the synthesis of branched-chain amino acids (BCAAs). IM is thought to exert its toxic effects on amino acid synthesis mainly through inhibition of acetolactate synthase activity, but little is known about the potential effects of IM on other key biochemical pathways. Here, we exposed the model plant Arabidospsis thaliana to trace S- and R-IM enantiomer concentrations and examined IM toxicity effects on the root proteome using iTRAQ. Conventional analyses of root carbohydrates, organic acids, and enzyme activities were also performed. We discovered several previously unknown key biochemical pathways targeted by IM in Arabidospsis. 1,322 and 987 proteins were differentially expressed in response to R- and S-IM treatments, respectively. Bioinformatics and physiological analyses suggested that IM reduced the BCAA tissue content not only by strongly suppressing BCAA synthesis but also by increasing BCAA catabolism. IM also affected sugar and starch metabolism, changed the composition of root cell walls, increased citrate production and exudation, and affected the microbial community structure of the rhizosphere. The present study shed new light on the multiple toxicity mechanisms of a selective herbicide on a model plant.

  19. Correlative Microscopy of Vitreous Sections Provides Insights into BAR-Domain Organization In Situ.

    Science.gov (United States)

    Bharat, Tanmay A M; Hoffmann, Patrick C; Kukulski, Wanda

    2018-04-10

    Electron microscopy imaging of macromolecular complexes in their native cellular context is limited by the inherent difficulty to acquire high-resolution tomographic data from thick cells and to specifically identify elusive structures within crowded cellular environments. Here, we combined cryo-fluorescence microscopy with electron cryo-tomography of vitreous sections into a coherent correlative microscopy workflow, ideal for detection and structural analysis of elusive protein assemblies in situ. We used this workflow to address an open question on BAR-domain coating of yeast plasma membrane compartments known as eisosomes. BAR domains can sense or induce membrane curvature, and form scaffold-like membrane coats in vitro. Our results demonstrate that in cells, the BAR protein Pil1 localizes to eisosomes of varying membrane curvature. Sub-tomogram analysis revealed a dense protein coat on curved eisosomes, which was not present on shallow eisosomes, indicating that while BAR domains can assemble at shallow membranes in vivo, scaffold formation is tightly coupled to curvature generation. Copyright © 2018 MRC Laboratory of Molecular Biology. Published by Elsevier Ltd.. All rights reserved.

  20. Sequential imaging of intraneural sciatic nerve endometriosis provides insight into symptoms of cyclical sciatica.

    Science.gov (United States)

    Capek, Stepan; Amrami, Kimberly K; Howe, Benjamin M; Collins, Mark S; Sandroni, Paola; Cheville, John C; Spinner, Robert J

    2016-03-01

    Endometriosis of the nerve often remains an elusive diagnosis. We report the first case of intraneural lumbosacral plexus endometriosis with sequential imaging at different phases of the menstrual cycle: during the luteal phase and menstruation. Compared to the first examination, the examination performed during the patient's period revealed the lumbosacral plexus larger and hyperintense on T2-weighted imaging. The intraneural endometriosis cyst was also larger and showed recent hemorrhage. Additionally, this case represents another example of perineural spread of endometriosis from the uterus to the lumbosacral plexus along the autonomic nerves and then distally to the sciatic nerve and proximally to the spinal nerves.

  1. Atomic bomb made in Germany. Geo-radar measurements provide new insights

    International Nuclear Information System (INIS)

    Hauk, Rolf-Guenter; Focken, Christel

    2017-01-01

    The authors describe new geo radar measurements In Jonastal and discuss the results in relation to rumors on German efforts to build an atomic bond during the Second World War. The book includes available documentation on German and American research and technological activities (Manhattan project).

  2. Whole-genome sequencing of giant pandas provides insights into demographic history and local adaptation

    DEFF Research Database (Denmark)

    Zhao, Shancen; Zheng, Pingping; Dong, Shanshan

    2013-01-01

    The panda lineage dates back to the late Miocene and ultimately leads to only one extant specie