WorldWideScience

Sample records for acid synthesis characterisation

  1. Structural Characterisation of FabG from Yersinia pestis, a Key Component of Bacterial Fatty Acid Synthesis.

    Science.gov (United States)

    Nanson, Jeffrey D; Forwood, Jade K

    2015-01-01

    Ketoacyl-acyl carrier protein reductases (FabG) are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP) linked thioesters within the bacterial type II fatty acid synthesis (FASII) pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI) has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR) family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG), the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections.

  2. Structural Characterisation of FabG from Yersinia pestis, a Key Component of Bacterial Fatty Acid Synthesis.

    Directory of Open Access Journals (Sweden)

    Jeffrey D Nanson

    Full Text Available Ketoacyl-acyl carrier protein reductases (FabG are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP linked thioesters within the bacterial type II fatty acid synthesis (FASII pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG, the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections.

  3. Synthesis, characterisation, nuclease and cytotoxic activity of ...

    Indian Academy of Sciences (India)

    GULZAR A BHAT

    2018-02-07

    Feb 7, 2018 ... Synthesis, characterisation, nuclease and cytotoxic activity of phosphate-free and phosphate-containing copper. 4 -(N-methylpyridinium)-2,2 :6 ,2 terpyridine complexes. GULZAR A BHATa, RAIHANA MAQBOOLb and RAMASWAMY MURUGAVELa,∗. aDepartment of Chemistry, Indian Institute of ...

  4. Ferrite nanoparticles: Synthesis, characterisation and applications in electronic device

    International Nuclear Information System (INIS)

    Kefeni, Kebede K.; Msagati, Titus A.M.; Mamba, Bhekie B.

    2017-01-01

    Highlights: • Available synthesis methods of ferrite nanoparticles (FNPs) are briefly reviewed. • Summary of the advantage and limitation of FNPs synthesis techniques are presented. • The existing most common FNPs characterisation techniques are briefly reviewed. • Major application areas of FNPs in electronic materials are reviewed. - Abstract: Ferrite nanoparticles (FNPs) have attracted a great interest due to their wide applications in several areas such as biomedical, wastewater treatment, catalyst and electronic device. This review focuses on the synthesis, characterisation and application of FNPs in electronic device with more emphasis on the recently published works. The most commonly used synthesis techniques along with their advantages and limitations are discussed. The available characterisation techniques and their application in electronic materials such as sensors and biosensors, energy storage, microwave device, electromagnetic interference shielding and high-density recording media are briefly reviewed.

  5. Ferrite nanoparticles: Synthesis, characterisation and applications in electronic device

    Energy Technology Data Exchange (ETDEWEB)

    Kefeni, Kebede K., E-mail: kkefeni@gmail.com; Msagati, Titus A.M.; Mamba, Bhekie B.

    2017-01-15

    Highlights: • Available synthesis methods of ferrite nanoparticles (FNPs) are briefly reviewed. • Summary of the advantage and limitation of FNPs synthesis techniques are presented. • The existing most common FNPs characterisation techniques are briefly reviewed. • Major application areas of FNPs in electronic materials are reviewed. - Abstract: Ferrite nanoparticles (FNPs) have attracted a great interest due to their wide applications in several areas such as biomedical, wastewater treatment, catalyst and electronic device. This review focuses on the synthesis, characterisation and application of FNPs in electronic device with more emphasis on the recently published works. The most commonly used synthesis techniques along with their advantages and limitations are discussed. The available characterisation techniques and their application in electronic materials such as sensors and biosensors, energy storage, microwave device, electromagnetic interference shielding and high-density recording media are briefly reviewed.

  6. Synthesis and characterisation of quinoline functionalised ...

    African Journals Online (AJOL)

    A series of quinoline based imidazolium salts were prepared and characterised as nucleophilic heterocyclic carbene (NHC) ligand precursors. The symmetrically saturated imidazolium salt prepared by ring closure of achiral tetradentate diquinolyl-diamine with triethyl orthoformate is a tridentate ligand and can function as ...

  7. Synthesis and characterisation of doxorubicin-loaded functionalised ...

    African Journals Online (AJOL)

    Synthesis and characterisation of doxorubicin-loaded functionalised cobalt ferrite nanoparticles and their in vitro anti-tumour activity under an AC-magnetic field. ... morphology of the uncoated and XG-coated CFNPs was established using scanning electron microscopy (SEM), atomic force microscopy (AFM) and dynamic ...

  8. synthesis, characterisation and antimicrobial activities of cobalt(ii)

    African Journals Online (AJOL)

    Preferred Customer

    *Corresponding author. E-mail: agwara29@yahoo.com; Tel. 237 798 75425. SYNTHESIS, CHARACTERISATION AND ANTIMICROBIAL ACTIVITIES OF. COBALT(II), COPPER(II) AND ZINC(II) MIXED-LIGAND COMPLEXES. CONTAINING 1,10-PHENANTHROLINE AND 2,2'-BIPYRIDINE. M.O. Agwara1*, P.T. Ndifon1, N.B. ...

  9. Hydrothermal synthesis and characterisation of amine-templated ...

    African Journals Online (AJOL)

    Hydrothermal synthesis and characterisation of amine-templated metal phosphate framework. ... The complexes were thermally stable up to 3000C, after which the organic components starts decomposing. The solubility test in a wide spectrum of solvents (at room temperature) showed that the complexes were insoluble in ...

  10. synthesis and characterisation of octahydroacridine based ...

    African Journals Online (AJOL)

    DR. AMINU

    refluxing of mesityl imidazole and 4-chlorooctahydroacridine in THF at 90 oC in a pressure tube for two week allowing the synthesis of a ... 2002], it was of interest to form a ligand that would have increased hemilability as well as a ... atmosphere of dry argon or in nitrogen glove box. Glassware were dried overnight in an ...

  11. Synthesis and Characterisation of Aluminophosphate Molecular Sieves

    Energy Technology Data Exchange (ETDEWEB)

    Halvorsen, E.N.

    1996-02-01

    Catalysts are very important in petrochemical processes. One of the properties that make crystalline, microporous materials attractive for catalytic purposes is their well-defined structure and ability to act as shape selective catalysts. This doctoral thesis presents the synthesis and characterization of a number of crystalline, microporous aluminophosphates and silicoaluminophosphates. 99 refs., 50 figs., 12 tabs.

  12. Synthesis and characterisation of new laser dyes

    International Nuclear Information System (INIS)

    Scala-Valero, Claudine

    1997-01-01

    Rhodamines are very efficient laser dyes for the red part of the visible spectrum: their fluorescence quantum efficiencies are about hundred per cent. However, their conversion efficiencies in dye amplifier are about fifty per cent, due to the presence of S n electronic level which is responsible of the re-absorption of a part of photons. In this research thesis, the author aims at trying to move this S n level out of the stimulated emission bandwidth. Models have been developed to propose new structures derived from rhodamines and theoretically possessing the desired properties. The so-recommended molecules have then been synthesised and characterised in terms of absorption and fluorescence spectra, of quantum efficiency, and of fluorescence lifetime. Two modifications are proposed for the rhodamine 6G structure, either by grafting methyl substitutes, or by grafting variously substituted amines. The searched result is obtained with the second modification [fr

  13. Hydrothermal synthesis and characterisation of new ...

    Indian Academy of Sciences (India)

    Unknown

    It is clear, from the nonhydrogen atom content of the asymmetric unit, that one of the four acidic protons of methylenediphosphonic acid must have been retained for charge neutrality and, therefore, the composition determined from single crystal X-ray diffraction is. Rb[MoO2(O3PCH2PO3H)] (1). The structure of compound 2 ...

  14. Hydrothermal synthesis and characterisation of new ...

    Indian Academy of Sciences (India)

    Unknown

    phates with open framework structures has been a major research activity in the field of porous solids.1,2 Realization of ... the acid chelates the cationic species while its organic part, acting as a pillar and spacer, links the inorganic parts ... structures, layered materials and open three-dimensional frameworks. The design of.

  15. Synthesis and characterisation of technetium-99m labelled ciprofloxacin (Infecton)

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, V.; Choong, K.K.L.; Olma, T.R.; Mieczkowski, S. [Westmead and the New Childrens Hospital, Westmead, NSW (Australia). Department of Nuclear Medicineand Ultrasound and Centre for infectious Diseases and Microbiology laboratory Services

    1998-06-01

    Full text: Infecton is Tc-99m labelled Ciprofloxacin, which is a synthetic carboxyquinolone derivative with broad-spectrum antimicrobial activity. It is a new class of radiopharmaceutical designed for imaging live bacterial infection. Conventional imaging agents such as Tc-99m or In-111 labelled leucocytes are either time-consuming or hazardous due to blood handling. These can be obviated by the use of Infecton which we synthesised by modifying the procedure described by Britton and co-workers (Lancet 1996;..347: 233-235). Bioassay and animal studies have been performed with a view to its use in infection imaging in patients. The first task was to prepare pure ciprofloxacin from its commercially available lactate salt. This was achieved by isoelectric precipitation at pH 8.6 by adding sodium hydroxide to the formulation. The resultant precipitate was washed with 200 mL of water for injection and filtered through a cintered-glass filtering unit. The precipitate was free of lactate and sodium as analysed by Biochem analyser. The UV spectrophotometric analysis showed an absorption peak at 276.3 nm which is close to the theoretical value of 277 nm, thus confirming the purity of the compound. Infecton was synthesised by adding 2 mg of pure ciprofloxacin, 0.4 mg of formimidine sulfinic acid ( non-stannous reducing agent) and 1.0 GBq Tc-99m pertechnetate in a final volume of 1.0 mL saline into a sterile N{sub 2}-filled Amersham vial and boiling the mixture at 100 deg C for 10 min. The purity of the product was 40-45%. It was passed through a DEAE Sephadex A-25 column and eluted with phosphate buffered saline (0.01M, pH 6.9) with a purity of >96%. The preparation was characterised by bioassay (n=3) by adding Infecton to four different broths of bacterial strains viz Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa and MRSA with resultant binding of 50.4, 45.6, 48.5 and 50.3% respectively. The binding was less than 1.0% when either ciprofloxacin or

  16. hydrothermal synthesis and characterisation of amine-templated

    African Journals Online (AJOL)

    PROF EKWUEME

    showed that the complexes were insoluble in water, ethanol, DMF and DMSO. KEYWORDS: Hydrothermal synthesis, metal phosphates, p-aminobenzoic acid, ethylacetoacetate, ethylammonium-. 4-aminobenzoate. INTRODUCTION. One of the major areas of materials science is the development of solid state materials with ...

  17. Levulinic acid in organic synthesis

    International Nuclear Information System (INIS)

    Timokhin, Boris V; Baransky, V A; Eliseeva, G D

    1999-01-01

    Data concerning the methods of synthesis, chemical transformations and application of levulinic acid are analysed and generalised. The wide synthetic potential of levulinic acid, particularly as a key compound in the synthesis of various heterocyclic systems, saturated and unsaturated ketones and diketones, difficultly accessible acids and other compounds is demonstrated. The accessibility of levulinic acid from hexose-containing wood-processing and agricultural wastes is noted. The bibliography includes 260 references.

  18. Synthesis, characterisation and functionalisation of luminescent silica nanoparticles

    International Nuclear Information System (INIS)

    Labéguerie-Egéa, Jessica; McEvoy, Helen M.; McDonagh, Colette

    2011-01-01

    The synthesis of highly monodispersed, homogeneous and stable luminescent silica nanoparticles, synthesized using a process based on the Stöber method is reported here. These particles have been functionalised with the ruthenium and europium complexes: bis (2,2′-bipyridine)-(5-aminophenanthroline) Ru bis (hexafluorophosphate), abbreviated to (Ru(bpy) 2 (phen-5-NH 2 )(PF 6 )), and tris (dibenzoylmethane)-mono (5-aminophenanthroline) europium(III), abbreviated to (Eu:TDMAP). Both dyes have a free amino group available, facilitating the covalent conjugation of the dyes inside the silica matrix. Due to the covalent bond between the dyes and the silica, no dye leaching or nanoparticle diameter modification was observed. The generic and versatile nature of the synthesis process was demonstrated via the synthesis of both europium and ruthenium-functionalised nanoparticles. Following this, the main emphasis of the study was the characterisation of the luminescence of the ruthenium-functionalised silica nanoparticles, in particular, as a function of surface carboxyl or amino group functionalisation. It was demonstrated that the luminescence of the ruthenium dye is highly affected by the ionic environment at the surface of the nanoparticle, and that these effects can be counteracted by encapsulating the ruthenium-functionalised nanoparticles in a plain 15 nm silica layer. Moreover, the ruthenium-functionalised silica nanoparticles showed high relative brightness compared to the free dye in solution and efficient functionalisation with amino or carboxyl groups. Due to their ease of fabrication and attractive characteristics, the ruthenium-functionalised silica nanoparticles described here have the potential to be highly desirable fluorescent labels, particularly, for biological applications.

  19. Acidity titration curves - a versatile tool for the characterisation of acidic mine waste water

    International Nuclear Information System (INIS)

    Fyson, A.

    2000-01-01

    Acidity titrations with NaOH are valuable tools for characterisation of acidic mine waters. - Titrations can be used to estimate metal concentrations. - Titrations can be carried out in the field, minimising changes in water chemistry due to sample handling time and procedure. (orig.)

  20. Synthesis and characterisation of mono-nitrosyl complexes of ruthenium: reactivity of the coordinated nitrosyl

    International Nuclear Information System (INIS)

    Sueur, Stephane

    1977-01-01

    Within the frame of physical-chemical researches on radioactive effluents, their processing and their evolution, and within the perspective of a possible application to the fixing of radioactive ruthenium, this research thesis reports the study of reactions of barbituric acid with nitro-complexes of ruthenium-nitrosyl. First, the synthesis and the complete study of ketoxime complexes of ruthenium II have been performed. A radio-crystallographic study of HRu(H 2 vi) 3 ,4H 2 O allows the crystallisation of this compound and the molecular structure of Ru(H 2 vi) 3 - to be analysed. Nuclear magnetic resonance has been used to study this ion: the 'cis' structure noticed in solid phase remains present in solution. Spectroscopic studies (IR and FIR) have also been performed to further study the structure and of these tris-chelates. Their stoichiometry and titration have also been studied. The same techniques have then been applied to nitrosyl complexes for their synthesis, characterisation and structural study, and finally to the study of reactions of K 2 RuNOCl 5 and Na 2 RuNo(NO 2 ) 4 OH with barbituric acid

  1. Conjugated Fatty Acid Synthesis

    Science.gov (United States)

    Rawat, Richa; Yu, Xiao-Hong; Sweet, Marie; Shanklin, John

    2012-01-01

    Conjugated linolenic acids (CLNs), 18:3 Δ9,11,13, lack the methylene groups found between the double bonds of linolenic acid (18:3 Δ9,12,15). CLNs are produced by conjugase enzymes that are homologs of the oleate desaturases FAD2. The goal of this study was to map the domain(s) within the Momordica charantia conjugase (FADX) responsible for CLN formation. To achieve this, a series of Momordica FADX-Arabidopsis FAD2 chimeras were expressed in the Arabidopsis fad3fae1 mutant, and the transformed seeds were analyzed for the accumulation of CLN. These experiments identified helix 2 and the first histidine box as a determinant of conjugase product partitioning into punicic acid (18:3 Δ9cis,11trans,13cis) or α-eleostearic acid (18:3 Δ9cis,11trans,13trans). This was confirmed by analysis of a FADX mutant containing six substitutions in which the sequence of helix 2 and first histidine box was converted to that of FAD2. Each of the six FAD2 substitutions was individually converted back to the FADX equivalent identifying residues 111 and 115, adjacent to the first histidine box, as key determinants of conjugase product partitioning. Additionally, expression of FADX G111V and FADX G111V/D115E resulted in an approximate doubling of eleostearic acid accumulation to 20.4% and 21.2%, respectively, compared with 9.9% upon expression of the native Momordica FADX. Like the Momordica conjugase, FADX G111V and FADX D115E produced predominantly α-eleostearic acid and little punicic acid, but the FADX G111V/D115E double mutant produced approximately equal amounts of α-eleostearic acid and its isomer, punicic acid, implicating an interactive effect of residues 111 and 115 in punicic acid formation. PMID:22451660

  2. Dibutylphosphoric acid synthesis

    International Nuclear Information System (INIS)

    Elias, H.; Boumaout, R.; Kellou, N.; Amedjkouh, A.; Hamidi, A.

    1995-09-01

    This work consists on the synthesis of dibutylphosphoric acis (DBP) by reaction of butanol with phosphorus pentoxid and on its separation by liquid-liquid extraction. It also deals with the characterization of DBP by some physicochemical analysis methods such as : chromatography, pH-metry and infrared and ultraviolet spectrophotometries. this study showed essentialy, that DBP can be formed in an appreciable amount (55%) when the reaction is realised with butanol/pentoxid molar ratio upper than 3 at temperature of 95 C

  3. Synthesis, characterisation and non-isothermal degradation kinetics ...

    Indian Academy of Sciences (India)

    between MEGDMA and aromatic primary amine leads to. AMA polymerisation. The slope value declared that, 0.31 mol of monomer is required to form 1 mol of the co-polymer. 3.2 UV–visible reflectance study. The above-synthesised polymer was characterised by UV– visible reflectance study. The co-polymer contains both.

  4. Binding Cellulose and Chitosan via Intermolecular Inclusion Interaction: Synthesis and Characterisation of Gel

    Directory of Open Access Journals (Sweden)

    Jiufang Duan

    2015-01-01

    Full Text Available A novel cellulose-chitosan gel was successfully prepared in three steps: (1 ferrocene- (Fc- cellulose with degrees of substitution (DS of 0.5 wt% was synthesised by ferrocenecarboxylic acid and cellulose within dimethylacetamide/lithium chloride (DMAc/LiCl; (2 the β-cyclodextrin (β-CD groups were introduced onto the chitosan chains by reacting chitosan with epichlorohydrin in dimethyl sulphoxide and a DS of 0.35 wt%; (3 thus, the cellulose-chitosan gel was obtained via an intermolecular inclusion interaction of Fc-cellulose and β-CD-chitosan in DMA/LiCl, that is, by an intermolecular inclusion interaction, between the Fc groups of cellulose and the β-CD groups on the chitosan backbone at room temperature. The successful synthesis of Fc-cellulose and β-CD-chitosan was characterised by 13C-NMR spectroscopy. The gel based on β-CD-chitosan and Fc-cellulose was formed under mild conditions which can engender autonomous healing between cut surfaces after 24 hours: the gel cannot self-heal while the cut surfaces were coated with a solution of a competitive guest (adamantane acid. The cellulose-chitosan complex made by this method underwent self-healing. Therefore, this study provided a novel method of expanding the application of chitosan by binding it with another polymer.

  5. Radiation synthesis and characterisation of the network structure of natural/synthetic double-network superabsorbent polymers

    International Nuclear Information System (INIS)

    Şen, Murat; Hayrabolulu, Hande

    2012-01-01

    In this study radiation synthesis and characterisation of the network structure of acrylic acid sodium salt/locust bean gum, (AAcNa/LBG) natural/synthetic double-network super absorbent polymers were investigated. Quartet systems composed of acrylic acid sodium salt/locust bean gum/N,N methylene bis acrylamide/water (AAcNa/LBG/MBAAm/water) were prepared at varying degree of neutralisations (DN) by controlling the DN value of AAc and irradiated with gamma rays at ambient temperature at a very low dose rate. The influences of the DN on the swelling and network properties were examined. It was observed that the DN strongly affected the gelation and super absorption properties of the gels. Molecular weight between crosslinks (M ¯ c ), effective crosslink density (ν e ) and mesh size (ξ) of SAPs were calculated from swelling and shear modules data obtained from compression and oscillatory frequency sweep tests. M ¯ c values obtained from the uniaxial deformation experiments were very close to those obtained from the oscillatory shear experiments excluding the completely neutralised gel system. It was concluded that the uniaxial compression technique could be used for the characterisation of the network structure of a hydrogel as along with the rheological analyses; however, a very precise control of the gel size was also needed. - Highlights: ► Radiation synthesis and characterisation of AAcNa/LBG super absorbent polymers described. ► Influences of the DN on the swelling and network properties were examined. ► Molecular weight between crosslinks and effective crosslink density of SAPs were calculated. ► Suitability of rheology technique for the characterisation of hydrogels were demonstrated.

  6. Isolation and characterisation of lactic acid bacteria from donkey milk.

    Science.gov (United States)

    Soto Del Rio, Maria de Los Dolores; Andrighetto, Christian; Dalmasso, Alessandra; Lombardi, Angiolella; Civera, Tiziana; Bottero, Maria Teresa

    2016-08-01

    During the last years the interest in donkey milk has increased significantly mainly because of its compelling functional elements. Even if the composition and nutritional properties of donkey milk are known, its microbiota is less studied. This Research Communication aimed to provide a comprehensive characterisation of the lactic acid bacteria in raw donkey milk. RAPD-PCR assay combined with 16S rDNA sequencing analysis were used to describe the microbial diversity of several donkey farms in the North West part of Italy. The more frequently detected species were: Lactobacillus paracasei, Lactococcus lactis and Carnobacterium maltaromaticum. Less abundant genera were Leuconostoc, Enterococcus and Streptococcus. The yeast Kluyveromyces marxianus was also isolated. The bacterial and biotype distribution notably diverged among the farms. Several of the found species, not previously detected in donkey milk, could have an important probiotic activity and biotechnological potential. This study represents an important insight to the ample diversity of the microorganisms present in the highly selective ecosystem of raw donkey milk.

  7. Synthesis and Characterisation of Macrocyclic Diamino Chiral Crown Ethers

    Directory of Open Access Journals (Sweden)

    Janet L. Scott

    2004-05-01

    Full Text Available A benign and efficient synthesis of chiral macrocyclic ‘aza-crown’ ethers of varying ring size is reported. The synthesis involves a Schiff base condensation of ether linked dialdehydes of varying chain length and (1R,2R-(–-1,2-diaminocyclohexane under mild conditions to yield the macrocycles, which are subsequently reduced to yield the diamino analogues.

  8. Synthesis of aminoaldonic acids

    DEFF Research Database (Denmark)

    Jørgensen, Christel Thea

    With the aim of synthesising aminoaldonic acids, two 2-acetamido-2-deoxyaldonolactones with D-galacto (6) and D-arabino (11) configuration were prepared from acetylated sugar formazans in analogy with a known procedure. Empolying the same procedure to acetylated sugar phenylhydrazones gave mixtures......,4-lactone, respectively. A 2,3-aziridino-2,3-dideoxypentonamide 70 was also prepared from D-glucono-1,5-lactone. The lactones were converted into methyl 3,4-O-isopropylidene-2-O-sulfonyl esters 42, 50, 62 and 68, which upon treatment with concentrated aqueous ammonia yielded the aziridino compounds...... and 82, respectively. The aminolactone 84 was converted into the corresponding amino sugar 89.With the aim of synthesising substrates for the Pictet-Spengler reaction three 4-aldehydo acetamidodideoxytetronolactones 92, 97 and 103 were prepared by periodate cleavage of the corresponding hexonolactones...

  9. Synthesis and Spectroscopic Characterisation of N-Alkyl Quaternary Ammonium Salts Typical Precursors of Cyanines

    Directory of Open Access Journals (Sweden)

    P. Almeida

    2002-03-01

    Full Text Available The synthesis and spectroscopic characterisation of some representative N-alkylsubstituted quaternary ammonium salts derived from benzothiazole, benzoxazole, benzoselenazole, indole and quinoline are described. These heterocyclic salts, bearing an activated methyl group in the 2-position in relation to the nitrogen atom and N-methyl, -pentyl, -hexyl and -decyl chains, are typical precursors of cyanine dyes.

  10. Synthesis and characterisation of Cu (II), Ni (II), Mn (II), Zn (II) and ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 113; Issue 3. Synthesis and characterisation of Cu(II), Ni(II), Mn(II), Zn(II) and VO(II) Schiff base complexes derived from o-phenylenediamine and acetoacetanilide. N Raman Y Pitchaikani Raja A Kulandaisamy. Inorganic Volume 113 Issue 3 June 2001 pp 183-189 ...

  11. Mechanism of plant-mediated synthesis of silver nanoparticles - A review on biomolecules involved, characterisation and antibacterial activity.

    Science.gov (United States)

    Rajeshkumar, S; Bharath, L V

    2017-08-01

    Engineering a reliable and eco-accommodating methodology for the synthesis of metal nanoparticles is a crucial step in the field of nanotechnology. Plant-mediated synthesis of metal nanoparticles has been developed as a substitute to defeat the limitations of conventional synthesis approaches such as physical and chemical methods. Biomolecules, such as proteins, amino acids, enzymes, flavonoids, and terpenoids from several plant extracts have been used as a stabilising and reducing agents for the synthesis of AgNPs. Regardless of an extensive range of biomolecules assistance in the synthesis procedure, researchers are facing a significant challenge to synthesise stable and geometrically controlled AgNPs. In the past decade, several efforts were made to develop Plant-mediated synthesis methods to produce stable, cost effective and eco-friendly AgNPs. More than hundred different plants extract sources for synthesising AgNPs were described in the last decade by several researchers. Most of the reviews were focused on various plant sources for synthesis, various characterization techniques for characteristic analysis, and antibacterial activity against bacterial. There are many reviews are available for the plant-mediated synthesis of AgNPs as well as antibacterial activity of AgNPs but this is the first review article mainly focused on biomolecules of plants and its various parts and operating conditions involved in the synthesis. Apart from, this review includes the characterisation of AgNPs and antibacterial activity of such nanoparticles with size, shape and method used for this study. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Carbon and oxide nanostructures. Synthesis, characterisation and applications

    Energy Technology Data Exchange (ETDEWEB)

    Yahya, Noorhana [Universiti Teknologi PETRONAS, Tronoh, Perak (Malaysia). Dept. of Fundamental and Applied Sciences

    2010-07-01

    This volume covers all aspects of carbon and oxide based nanostructured materials. The topics include synthesis, characterization and application of carbon-based namely carbon nanotubes, carbon nanofibres, fullerenes, carbon filled composites etc. In addition, metal oxides namely, ZnO, TiO2, Fe2O3, ferrites, garnets etc., for various applications like sensors, solar cells, transformers, antennas, catalysts, batteries, lubricants, are presented. The book also includes the modeling of oxide and carbon based nanomaterials. The book covers the topics: - Synthesis, characterization and application of carbon nanotubes, carbon nanofibres, fullerenes - Synthesis, characterization and application of oxide based nanomaterials. - Nanostructured magnetic and electric materials and their applications. - Nanostructured materials for petro-chemical industry. - Oxide and carbon based thin films for electronics and sustainable energy. - Theory, calculations and modeling of nanostructured materials. (orig.)

  13. Mechanochemical synthesis and characterisation of cocrystals and metal organic compounds.

    Science.gov (United States)

    Tröbs, L; Emmerling, F

    2014-01-01

    The mechanochemical synthesis of two model compounds, a metal organic framework (H2Im)[Bi(1,4-bdc)2] (bdc = benzene dicarboxylate, H2Im = imidazole cation)) and a cocrystal (carbamazepine : indometacin 1 : 1) were followed ex situ using a combination of two analytical methods. Powder X-ray diffraction (XRD) and Raman spectroscopy data were evaluated for the synthesis of the metal organic framework. The XRD measurements and REM images were analysed for the synthesis of the cocrystal. The measurements revealed that both model compounds were synthesised within minutes. The metal organic framework (H2Im)[Bi(1,4-bdc)2] is synthesised via an intermediate structure. The cocrystal carbamazepine : indometacin 1 : 1 is formed within a few seconds. The crystallite size decreases during the further milling treatment.

  14. Synthesis, characterisation and non-isothermal degradation kinetics ...

    Indian Academy of Sciences (India)

    Synthesis of a novel co-polymer made by the addition polymerisation between MEGDMA and 4-AB by aza-Michael addition (AMA) polymerisation method is a fascinating field of research. The present investigationyielded a hazardous metal catalyst-free and toxic solvent-free methodology. The AMA polymerisation was ...

  15. Synthesis, characterisation and non-isothermal degradation kinetics ...

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 39; Issue 7 ... Synthesis of a novel co-polymer made by the addition polymerisation between MEGDMA and 4-AB by aza-Michael addition (AMA) polymerisation method is a ... Among the modelsused, the Kissinger method yielded the lowest degradation kinetics.

  16. synthesis, characterisat the alkyd resins deriv esis, characterisation

    African Journals Online (AJOL)

    userpc

    HO. C. O. R. Monoglyceride. Fig 1:Chemical transformation of vegetable o. MATERIALS AND METHODS. Castor seed oil was purchased from Kasuwa ..... Pp 161-165. Ogunnniyi D.S and Njikang G.N ( 1998 ). Industrial utilization of castor oil: Alkyd resin synthesis and evaluation. J. Nig. Soc.of Chem. Engineers 44-51.

  17. Biobased furandicarboxylic acids (FDCAs): effects of isomeric substitution on polyester synthesis and properties

    NARCIS (Netherlands)

    Thiyagarajan, S.; Vogelzang, W.; Knoop, J.R.I.; Frissen, A.E.; Haveren, van J.; Es, van D.S.

    2014-01-01

    In this study we present the application of different isomers of furandicarboxylic acid, or FDCA, obtained from agro-residues, in polyester synthesis. New polyesters based on 2,4-FDCA and 3,4-FDCA isomers with (linear) diols were thoroughly characterised and compared with their as-synthesised

  18. Radiation synthesis and characterisation of the network structure of natural/synthetic double-network superabsorbent polymers

    Science.gov (United States)

    Şen, Murat; Hayrabolulu, Hande

    2012-09-01

    In this study radiation synthesis and characterisation of the network structure of acrylic acid sodium salt/locust bean gum, (AAcNa/LBG) natural/synthetic double-network super absorbent polymers were investigated. Quartet systems composed of acrylic acid sodium salt/locust bean gum/N,N methylene bis acrylamide/water (AAcNa/LBG/MBAAm/water) were prepared at varying degree of neutralisations (DN) by controlling the DN value of AAc and irradiated with gamma rays at ambient temperature at a very low dose rate. The influences of the DN on the swelling and network properties were examined. It was observed that the DN strongly affected the gelation and super absorption properties of the gels. Molecular weight between crosslinks (M), effective crosslink density (νe) and mesh size (ξ) of SAPs were calculated from swelling and shear modules data obtained from compression and oscillatory frequency sweep tests. M values obtained from the uniaxial deformation experiments were very close to those obtained from the oscillatory shear experiments excluding the completely neutralised gel system. It was concluded that the uniaxial compression technique could be used for the characterisation of the network structure of a hydrogel as along with the rheological analyses; however, a very precise control of the gel size was also needed.

  19. Green synthesis and characterisation of platinum nanoparticles using quail egg yolk

    Science.gov (United States)

    Nadaroglu, Hayrunnisa; Gungor, Azize Alayli; Ince, Selvi; Babagil, Aynur

    2017-02-01

    Nanotechnology is extensively used in all parts today. Therefore, nano synthesis is also significant in all explored areas. The results of studies conducted have revealed that nanoparticle synthesis is performed by using both chemical and physical methods. It is well known that these syntheses are carried out at high charge, pressure and temperature in harsh environments. Therefore, this study investigated green synthesis method that sustains more mild conditions. In this study, quail egg yolk having high vitamin and protein content was prepared for green synthesis reaction and used for the synthesis of platinum nanoparticles in the reaction medium. Reaction situations were optimised as a function of pH, temperature, time and concentration by using quail egg yolk. The results showed that the highest platinum nanoparticles were synthesised at 20 °C and pH 6.0 for 4 h. Also, optimal concentration of metal ions was established as 0.5 mM. The synthesised platinum nanoparticles were characterised by using UV spectrum, X-ray diffraction and scanning electron microscope.

  20. Fatty acid synthesis by spinach chloroplasts, 2

    International Nuclear Information System (INIS)

    Yamada, Mitsuhiro; Nakamura, Yasunori

    1975-01-01

    By incorporation of 3 H 2 O into the fatty acid chain in the presence of unlabelled precursor, we showed that fatty acids are synthesized from PGA, PEP and pyruvate by intact spinach chloroplasts in the light. 13 C-tracer experiments confirmed that 1-C of pyruvate is decarboxylated and 2-C is incorporated into fatty acids by the chloroplasts. The patterns of fatty acids synthesized from PGA and pyruvate were the same as that from acetate. The highest rate of fatty acid synthesis was reached at the physiological concentration of PGA (3 mM) and pyruvate (1 mM). These results indicate the operation of the following path in the chloroplasts in light: PGA→PEP→pyruvate→acetylCoA→fatty acids. Since citrate and OAA were much less active and malate and glyoxylate were inert as precursors for fatty acid synthesis, PEP or pyruvate carboxylation, citrate lyase reaction and malate synthetase reaction are not involved in the formation of acetylCoA and fatty acids. Since pyruvate was much more effective as a substrate for fatty acid synthesis than lactate, acetaldehyde or acetate, direct decarboxylation path is considered to be the primary path from pyruvate to acetylCoA. The insignificant effect of chloroplast-washing on fatty acid synthesis from PGA and pyruvate indicates that the glycolytic path from PGA to pyruvate is associated with the chloroplasts. Since pyruvate was more effectively incorporated into fatty acids than acetylCoA, it is unlikely that pyruvate decarboxylation to acetylCoA is due to mitochondria contaminating the chloroplast preparation. On the basis of measurements of 3 H 2 O incorporation in the light and dark, the activity of fatty acid synthesis in spincah leaves appears to be shared by the activities in chloroplasts (87%) and other organelles (13%). (author)

  1. Development and optimisation of synthesis, characterisation and physical properties of solid materials for strip conductors; purpose oriented synthesis of novel systems. Final report

    International Nuclear Information System (INIS)

    Guenther, W.; Schoellhorn, R.

    1995-06-01

    The project reported is part of studies into the performance of HTSC, and was responsible for the following essential tasks: synthesis, characterisation, and optimisation of oxocuprates of the type (RE)Ba 2 Cu 3 O 7 , examination of the relevant corrosion processes and reactivity of the phases, and synthesis of novel systems guided by special model concepts, applying kinetics-controlled low-temperature synthesis. (orig./MM) [de

  2. Preparation and characterisation of acrylamide/maleic acid hydrogel

    Directory of Open Access Journals (Sweden)

    Klinpituksa, P.

    2005-09-01

    Full Text Available Acrylamide/maleic acid hydrogel, a superabsorbent polymer, was prepared by free radical polymerization in aqueous solution of acrylamide (AAm and maleic acid (MA : monomer and comonomer, respectively. Potassium persulfate and N,N,N’,N’-tetramethylethylenediamine were used as an initiator system. Also, ethylene glycol dimethacrylate (EGDMA and N,N’-methylenebisacrylamide (MBA were used as crosslinkers. Different compositions of acrylamide, maleic acid and crosslinkers were employed. Water swelling, equilibrium water content and swelling power of the hydrogel formed were determined. The result showed that the swelling in water at equilibrium of hydrogels was in the range of 8,420-10,300% and 3,160- 3,560%, equilibrium water content was in the range of 0.9880-0.9902 and 0.9630-0.9727 and swelling power was in the range of 84-103 and 31-36 using 1%EGDMA and 1%MBA as crosslinkers, respectively. The diffusion of water into hydrogel followed non-Fickian character based on swelling power.

  3. Characterisation of boric acid aerosol behaviour and interactions with stainless steel

    International Nuclear Information System (INIS)

    Anderson, A.B.; Beard, A.M.; Bennett, P.J.; Benson, C.G.

    1991-03-01

    Experiments have been conducted to determine the physical characteristics of boric acid aerosol. Aqueous solutions of boric acid (either 200 or 2000 ppm boron) were injected at a controlled rate onto a 304 stainless steel cone held at 1000 o C. The transport and deposition of the resulting aerosol was studied through a system including pipework and a dilution chamber. Work was also undertaken to characterise the interaction between boric acid and stainless steel. Boric acid was vaporized in steam-argon atmospheres at 300 o C and passed over 304 stainless steel coupons held at temperatures between 400 and 1000 o C. (author)

  4. Synthesis of derivatives of tetronic acid and pulvinic acid. Total synthesis of norbadione A

    International Nuclear Information System (INIS)

    Mallinger, A.

    2008-11-01

    When vegetables like mushrooms are contaminated by radioactive caesium 137, this radioactive caesium is associated to norbadione A, a natural pigment present in two mushroom species and which can be used as a caesium decorporation agent or maybe as protection agent against ionizing radiations. Within this perspective, this research report describes the biosynthesis and the structure and properties of the norbadione A and of pulvinic acids (physicochemical properties, anti-oxidizing properties). Then, it presents the various tetronic acids (3-acyl-, 3-alkyl-, 3-alkoxy-, 3-aryl-tetronic acids and non 3-substituted tetronic acids), their synthesis path as they are described in the literature, and presents a new synthesis approach using a tandem reaction (with different esters or hydroxy esters) and the synthesis of tetronic acids. The author also proposes a new synthesis way for methyl pulvinates, and finally reports the work on the development of a total synthesis of the norbadione A

  5. Preparation and characterisation of tamarind 4-hydroxybenzoic acid ...

    African Journals Online (AJOL)

    Mg2+. Ca2+. Concentration (in ppm). 1.12. 0.52. 5.18. 0.69. 0.18. 102.6. 172.9. Other anions (mg/kg) : fluoride = 0.72; sulphate = 468; cyanide = 0.04. Acceptable level of toxic metal ions in water (mg/kg): Fe2+ = 0.1, Cu2+ = 0.05, Zn2+ = 5.0, Pb2+ = 0.1, Cd2+= 0.1. Tamarind 4-hydroxybenzoic acid (THBA) resin sodium salt.

  6. Characterisation of acid pollutant emissions in ceramic tile manufacture

    Directory of Open Access Journals (Sweden)

    Monfort, E.

    2011-08-01

    Full Text Available One of the environmental impacts associated with ceramics manufacture is the air emission of acid compounds stem from the presence of impurities in the raw materials and/or fuels. The present study was undertaken to identify the significant gaseous pollutants of an acid nature, to determine their concentrations, and to obtain the characteristic emission factors in spray dryers and firing kilns. The results show that, in spray dryers, the emission levels of the different acid pollutants are far below the current emission limit values applied in the European Union (EU. In firing kilns, the most significant acid pollutant emissions, compared with the recommended EU emission limit values (ELV-BAT, correspond to HF and HCl emissions, indicating that these emissions need to be corrected by appropriate cleaning systems before such emissions are released into the air. On the other hand, the results indicate that SO2 and NOx emissions in the Castellón industrial ceramic sector lie below the ELV–BAT proposed in the European ceramic industry BREF, owing to the widespread use of natural gas as fuel and of raw materials with reduced sulphur contents.

    Uno de los impactos medioambientales asociado a la fabricación de productos cerámicos es la emisión a la atmósfera de compuestos ácidos debido a la presencia de impurezas en las materias primas y/o combustibles. Los objetivos del presente estudio son: identificar los contaminantes gaseosos de naturaleza ácida significativos, determinar su concentración y obtener factores de emisión de los secaderos por atomización y los hornos de cocción. Los resultados obtenidos, en el caso de los secaderos por atomización, muestran que los niveles de emisión de los diferentes contaminantes ácidos se encuentran alejados de los valores límite de emisiones aplicados actualmente en la Unión Europea (UE. En cuanto a los hornos de cocción, la emisión más significativa de

  7. Extraction and characterisation of aqueous organic acids from natural waters

    International Nuclear Information System (INIS)

    Smith, B.; Moody, P.M.; Higgo, J.J.W.

    1993-01-01

    Humic and fulvic acids were extracted from large volumes of groundwater associated with the Broubster and Needle's Eye natural analogue sites, and the BGS research site at Drigg in Cumbria. Extractions were performed by both batchwise extraction and radial flow chromatography using DEAE-cellulose. Retained humic substances were eluted using NaOH and separated into humic and fulvic components by acidification to pH 1. After separation the humic component was purified by repetitive precipitation and dissolution whilst the fulvic component was purified by absorption chromatography. The resulting humic substances were shown to be of high purity with respect to metallic elements, with less than 1% of available sites being occupied. During elution the association of trace elements with humic substances was monitored and a high degree of association between humic substances, U and the Rare Earth Elements was noted. (author)

  8. Synthesis, characterisation and DFT studies of three Schiff bases derived from histamine

    Science.gov (United States)

    Touafri, Lasnouni; Hellal, Abdelkader; Chafaa, Salah; Khelifa, Abdellah; Kadri, Abdelaziz.

    2017-12-01

    In this paper, we report first, the synthesis and characterisation of three Schiff bases derived from histamine by condensation of histamine with various aldehydes. Then, we present a detailed DFT study based on B3LYP/6-31G(d,p) of geometrical structures and electronic properties of these compounds. The study was extended to the HOMO-LUMO analysis to calculate the energy gap (Δ), Ionisation potential (I), Electron Affinity (A), Global Hardness (η), Chemical Potential (μ), Electrophilicity (ω), Electronegativity (χ) and Polarisability (α). The calculated HOMO and LUMO energy reveals that the charge transfers occurring within the molecule. On the basis of vibration analyses, the thermodynamic properties of the titles compound were also calculated.

  9. Synthesis and characterisation of Cu(II), Ni(II), Mn(II), Zn(II) and VO(II ...

    Indian Academy of Sciences (India)

    Unknown

    Synthesis and characterisation of Cu(II), Ni(II), Mn(II), Zn(II) and VO(II) Schiff base complexes derived from o-phenylenediamine and acetoacetanilide. N RAMAN*, Y PITCHAIKANI RAJA and A KULANDAISAMY. Department of Chemistry, VHNSN College, Virudhunagar 626 001, India e-mail: ra_man@123india.com.

  10. Synthesis of Trishomocubane Amino Acid Derivatives | Govender ...

    African Journals Online (AJOL)

    The synthesis of four novel trishomocubane amino acid derivatives is described. The hydantoin precursor and bis-Boc protected hydantoin (>95% yield) were previously reported. A mild hydrolysis of the bis-Boc hydantoin with lithium hydroxide at room temperature quantitatively yielded the corresponding novel cage amino ...

  11. Synthesis and Characterisation of Calcium Carbonate Aragonite Nanocrystals from Cockle Shell Powder (Anadara granosa

    Directory of Open Access Journals (Sweden)

    Abdullahi Shafiu Kamba

    2013-01-01

    Full Text Available The synthesis of pure calcium carbonate nanocrystals using a high pressure homogeniser (HPH via a microemulsion system produced uniform nanosized particles, which were characterised using transmission electron microscopy (TEM, field-emission scanning electron microscopy (FESEM, X-ray diffraction (XRD, Fourier transform infrared spectroscopy (FTIR, and thermogravimetric analysis (TGA. The identified particles were aragonite polymorphs with a rod shape and were approximately 50 nm in size. The aragonite polymorph of calcium carbonate was prepared from biogenic materials, cockle shells, and exhibited unique characteristics (i.e., a higher density than that of calcite, which makes it biocompatible and potentially suitable for applications in the medical, pharmaceutical, cosmetic, and paint industries. The methods adopted and the nonionic surfactant used in the synthesis of calcium carbonate nanocrystalline aragonite polymorphs were environmentally friendly and can be scaled up for industrial production. The sources are naturally available materials that are by-products of the seafood industry, which offers an opportunity for exploitation in numerous industrial applications.

  12. Synthesis of carbon-13-labeled tetradecanoic acids.

    Science.gov (United States)

    Sparrow, J T; Patel, K M; Morrisett, J D

    1983-07-01

    The synthesis of tetradecanoic acid enriched with 13C at carbons 1, 3, or 6 is described. The label at the carbonyl carbon was introduced by treating 1-bromotridecane with K13CN (90% enriched) to form the 13C-labeled nitrile, which upon hydrolysis yielded the desired acid. The [3-13C]tetradecanoic acid was synthesized by alkylation of diethyl sodio-malonate with [1-13C]1-bromododecane; the acid was obtained upon saponification and decarboxylation. The label at the 6 position was introduced by coupling the appropriately labeled alkylcadmium chloride with the half acid chloride methyl ester of the appropriate dioic acid, giving the corresponding oxo fatty acid ester. Formation of the tosylhydrazone of the oxo-ester followed by reduction with sodium cyanoborohydride gave the labeled methyl tetradecanoate which, upon hydrolysis, yielded the desired tetradecanoic acid. All tetradecanoic acids were identical to unlabeled analogs as evaluated by gas-liquid chromatography and infrared or NMR spectroscopy. These labeled fatty acids were used subsequently to prepare the correspondingly labeled diacyl phosphatidylcholines.

  13. Benzene-free synthesis of adipic acid.

    Science.gov (United States)

    Niu, Wei; Draths, K M; Frost, J W

    2002-01-01

    Strains of Escherichia coli were constructed and evaluated that synthesized cis,cis-muconic acid from D-glucose under fed-batch fermentor conditions. Chemical hydrogenation of the cis,cis-muconic acid in the resulting fermentation broth has also been examined. Biocatalytic synthesis of adipic acid from glucose eliminates two environmental concerns characteristic of industrial adipic acid manufacture: use of carcinogenic benzene and benzene-derived chemicals as feedstocks and generation of nitrous oxide as a byproduct of a nitric acid catalyzed oxidation. While alternative catalytic syntheses that eliminate the use of nitric acid have been developed, most continue to rely on petroleum-derived benzene as the ultimate feedstock. In this study, E. coli WN1/pWN2.248 was developed that synthesized 36.8 g/L of cis,cis-muconic acid in 22% (mol/mol) yield from glucose after 48 h of culturing under fed-batch fermentor conditions. Optimization of microbial cis,cis-muconic acid synthesis required expression of three enzymes not typically found in E. coli. Two copies of the Klebsiella pneumoniae aroZ gene encoding DHS dehydratase were inserted into the E. coli chromosome, while the K. pneumoniae aroY gene encoding PCA decarboxylase and the Acinetobacter calcoaceticus catA gene encoding catechol 1,2-dioxygenase were expressed from an extrachromosomal plasmid. After fed-batch culturing of WN1/pWN2.248 was complete, the cells were removed from the broth, which was treated with activated charcoal and subsequently filtered to remove soluble protein. Hydrogenation of the resulting solution with 10% Pt on carbon (5% mol/mol) at 3400 kPa of H2 pressure for 2.5 h at ambient temperature afforded a 97% (mol/mol) conversion of cis,cis-muconic acid into adipic acid.

  14. Synthesis, characterisation and electrochemical evaluation of reduced graphene oxide modified antimony nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Silwana, Bongiwe; Horst, Charlton van der [Natural Resources and the Environment (NRE), Council for Scientific and Industrial Research (CSIR), Stellenbosch 7600 (South Africa); SensorLab, Department of Chemistry, University of the Western Cape, Bellville 7535 (South Africa); Iwuoha, Emmanuel [SensorLab, Department of Chemistry, University of the Western Cape, Bellville 7535 (South Africa); Somerset, Vernon, E-mail: vsomerset@csir.co.za [Natural Resources and the Environment (NRE), Council for Scientific and Industrial Research (CSIR), Stellenbosch 7600 (South Africa)

    2015-10-01

    This paper demonstrates some aspects on the synthesis and characterisation of nanoparticles of metallic alloys using polyvinyl alcohol as a stabiliser, which combines high surface area and superior hybrid properties. The present experimental design was to synthesise a nanocomposite of reduced graphene oxide and antimony nanoparticles to be used as thin films for macro- and micro-carbon electrodes for enhancing sensing of different toxic metal pollutants in the environment. The synthetic process of reduced graphene oxide was done using the modified Hummers method while antimony pentachloride was reduced with sodium borohydride into nanoparticles of antimony using polyvinyl-alcohol as a stabiliser. The systematic investigation of morphology was done by scanning electron microscopy and high resolution-transmission electron microscope, which revealed the synthesis of a product, consists of reduced graphene oxide antimony nanoparticles. The electrochemical behaviour of the reduced graphene oxide antimony nanoparticles coated on a glassy carbon electrode was performed using voltammetric and impedance techniques. Electrochemical impedance measurements showed that the overall resistance, including the charge–transfer resistance, was smaller with reduced graphene oxide antimony nanoparticles than reduced graphene oxide and antimony nanoparticles, on their own. Evaluation of the reduced graphene oxide antimony nanoparticle sensor in the stripping voltammetry has shown a linear working range for concentration of platinum (II) between 6.0 × 10{sup −6}–5.4 × 10{sup −5} μg L{sup −1} with limit of detection of 6 × 10{sup −6} μg L{sup −1} (signal-to-noise ratio = 3), which is below the World Health Organisation guidelines for freshwater. - Highlights: • Reduced graphene oxide modified antimony nanoparticles were chemically synthesised. • TEM results show rGO-Sb nanoparticles with a diameter range of between 2 and 20 nm. • Impedance results confirm

  15. A new regulatory mechanism for bacterial lipoic acid synthesis

    OpenAIRE

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60?years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physi...

  16. Synthesis and characterisation of substrate-based peptides as inhibitors of histone demethylase KDM4C

    DEFF Research Database (Denmark)

    Nielsen, Simon D; Leurs, Ulrike; Bergner, Magnus

    2016-01-01

    The design and synthesis of modified pentapeptides based on a truncated version of the substrate for KDM4C, a histone lysine demethylase (KDM), and investigation of their inhibitory activity at KDM4C is reported. By modifying the lysine residue corresponding to lysine 9 at histone 3 (H3K9), three...... different series of peptides were designed and synthesized. One series contained N-acylated H3K9 and two series introduced triazoles in this position via click chemistry to enable facile variation of headgroups. As the click reaction is compatible with free amino acids this was performed on an azido...

  17. GREEN SYNTHESIS OF GOLD NANOPARTICLES USING TOONA CILIATA METHANOL BARK EXTRACT AND THEIR CHARACTERISATION

    OpenAIRE

    Kaushik Rajan; Mann Avninder Singh; Sandhu Bharpur Singh; Parihar Vidya Bhushan Singh

    2012-01-01

    In the present study, we identified and justified the use of MeOH extract from Toona ciliata bark as a reducing and capping agent for the ecofriendly synthesis of gold nanoparticles on the basis of modern analytical techniques. The reduction of 1.0 mM aqueous solution of aurochloric acid with 1 ml, 1% w/v aqueous solution of MeOH bark extract from Toona ciliata has resulted in the formation of stabilised Gold Nanoparticles (AuNPs). The synthesised gold particles showed a surface plasmon band ...

  18. Characterisation of fulvic acids by electrospray with quadrupole / time-of-flight mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Plancque, G. [Commissariat a l' Energie Atomique, Centre de Saclay, Direction de l' Energie Nucleaire / DPC / SECR / Lab. de Speciation des Radionucleides et des Molecules, Gif-sur-Yvette (France)

    2004-07-01

    Characterisation of fulvic and humic acids (FA and HA) - synthetic model substances M1 and M42 from FZR, FA and HA Gohy 573 from the Gorleben groundwaters from FZK and purified Aldrich HA from CTU - has been performed using a quadrupole time-of-flight (QTOF) mass spectrometer equipped with an electrospray ionisation interface. The same conclusions as for Mol fulvic acids, previously studied in the laboratory, can be drawn: molecular masses centred around 350 Da, sinusoidal spectral distributions, even and odd integral masses distributions and presence of dimmers (and possible trimmers) in negative-mode experiments have been observed for all humic substances. Tandem mass spectrometry (MS/MS) has also been used and experiments showed losses of 18 Da (H{sub 2}O), 28 Da (CO) and 44 Da (CO{sub 2}) as for Mol FA. No obvious differences, in terms of molecular structure, are observed compared to Mol FA. (orig.)

  19. Physical and structural characterisation of starch/polyester blends with tartaric acid

    International Nuclear Information System (INIS)

    Olivato, J.B.; Müller, C.M.O.; Carvalho, G.M.; Yamashita, F.; Grossmann, M.V.E.

    2014-01-01

    Starch/PBAT blends were produced by reactive extrusion with tartaric acid (TA) as an additive. The effects of TA, glycerol and starch + PBAT on the mechanical, optical and structural properties of the films were evaluated, with formulations based in a constrained mixture design. Tartaric acid acts as a compatibiliser and promotes the acid hydrolysis of starch chains. These two functions explain the observed film resistance and opacity. TA reduced the weight loss in water. Scanning electron microscopy (SEM) images showed that TA reduces the interfacial tension between the polymeric phases, resulting in more homogeneous films. Nuclear magnetic resonance ( 13 C CPMAS) and Fourier transform infrared spectroscopy (FT-IR) suggest that tartaric acid is able to react with the hydroxyl groups of the starch by esterification/transesterification reactions, confirming its role as a compatibiliser. The addition of TA results in materials with better properties that are suitable for use in food packaging. - Highlights: • Tartaric acid (TA) was efficient as compatibiliser of starch/PBAT blends. • Film properties were analysed based on the modelling of the mixture design. • Greater proportions of TA resulted in more opaque and less soluble materials. • Esterification reactions promoted by TA were characterised by FT-IR and 13 C CPMAS NMR. • Compatibilised blends with TA showed better morphological and mechanical properties

  20. Physical and structural characterisation of starch/polyester blends with tartaric acid

    Energy Technology Data Exchange (ETDEWEB)

    Olivato, J.B., E-mail: jubonametti@uel.br [Departamento de Ciência e Tecnologia de Alimentos, Centro de Ciências Agrárias, Universidade Estadual de Londrina, PO Box 6001, 86051-980 Londrina, PR (Brazil); Müller, C.M.O. [Departamento de Ciência e Tecnologia de Alimentos, Centro de Ciências Agrárias, Universidade Estadual de Londrina, PO Box 6001, 86051-980 Londrina, PR (Brazil); Carvalho, G.M. [Departamento de Química, Centro de Ciências Exatas, Universidade Estadual de Londrina, PO Box 6001, 86051-980 Londrina, PR (Brazil); Yamashita, F.; Grossmann, M.V.E. [Departamento de Ciência e Tecnologia de Alimentos, Centro de Ciências Agrárias, Universidade Estadual de Londrina, PO Box 6001, 86051-980 Londrina, PR (Brazil)

    2014-06-01

    Starch/PBAT blends were produced by reactive extrusion with tartaric acid (TA) as an additive. The effects of TA, glycerol and starch + PBAT on the mechanical, optical and structural properties of the films were evaluated, with formulations based in a constrained mixture design. Tartaric acid acts as a compatibiliser and promotes the acid hydrolysis of starch chains. These two functions explain the observed film resistance and opacity. TA reduced the weight loss in water. Scanning electron microscopy (SEM) images showed that TA reduces the interfacial tension between the polymeric phases, resulting in more homogeneous films. Nuclear magnetic resonance ({sup 13}C CPMAS) and Fourier transform infrared spectroscopy (FT-IR) suggest that tartaric acid is able to react with the hydroxyl groups of the starch by esterification/transesterification reactions, confirming its role as a compatibiliser. The addition of TA results in materials with better properties that are suitable for use in food packaging. - Highlights: • Tartaric acid (TA) was efficient as compatibiliser of starch/PBAT blends. • Film properties were analysed based on the modelling of the mixture design. • Greater proportions of TA resulted in more opaque and less soluble materials. • Esterification reactions promoted by TA were characterised by FT-IR and {sup 13}C CPMAS NMR. • Compatibilised blends with TA showed better morphological and mechanical properties.

  1. Synthesis and characterisation of new types of side chain cholesteryl polymers.

    Science.gov (United States)

    Wang, Bin; Du, Haiyan; Zhang, Junhua

    2011-01-01

    A series of cholesterol derivatives have been synthesised via the alkylation reaction of the 3-hydroxyl group with the aliphatic bromide compounds with different chain lengths, namely 3β-alkyloxy-cholesterol. The double bond between the C5 and C6 positions in these cholesterol derivatives was oxidised into epoxy, followed by an epoxy-ring-opening reaction with the treatment with acrylic acid, resulting in a series of 3β-alkyloxy-5α-hydroxy-6β-acryloyloxycholesterol, C(n)OCh (n=1, 2, 4, 6, 8, 10, 12), The acrylate group is connected to the C6 position, which is confirmed by the single crystal structure analysis. The corresponding polymers, PC(n)OCh, were prepared via free radical polymerisation. The structure of monomers and the resulting polymers were characterised with nuclear magnetic resonance (NMR), Fourier transform infrared spectroscopy (FT-IR) and gel permeation chromatography (GPC). The thermal properties of PC(n)OCh were studied using differential scanning calorimetry (DSC) and thermogravimetric analysis (TGA). To determine the secondary structure of polymers, circular dichroism (CD) spectra were performed. It was found that not all monomers produce high-molecular-weight polymers because of steric hindrance. However, all polymers have a helical structure, which can be enhanced by increasing the alkoxy chain length. In addition, increasing the alkoxy chain length decreases the glass transition temperature and increases the decomposition temperature of the polymers. Copyright © 2010 Elsevier Inc. All rights reserved.

  2. Characterisation of a proposed internet synthesis of N,N-dimethyltryptamine using liquid chromatography/electrospray ionisation tandem mass spectrometry.

    Science.gov (United States)

    Martins, Cláudia P B; Freeman, Sally; Alder, John F; Brandt, Simon D

    2009-08-14

    The psychoactive properties of N,N-dimethyltryptamine (DMT) are known to induce altered states of consciousness in humans. These properties attract great interest from clinical, neuroscientific, clandestine and forensic communities. The Breath of Hope Synthesis was reported on an internet website as a convenient two-step methodology for the preparation of DMT. The analytical characterisation of the first stage was the subject of previous publications by the authors and involved the thermal decarboxylation of tryptophan and the formation of tryptamine. The present study reports on the characterisation of the second step of this procedure which was based on the methylation of tryptamine. This employed methyl iodide and benzyltriethylammonium chloride/sodium hydroxide as a phase transfer catalyst. The reaction product was characterised by liquid chromatography/electrospray ionisation tandem mass spectrometry and orthogonal acceleration time-of-flight mass spectrometry. Quantitative evaluation was carried out in positive multiple reaction monitoring mode (MRM), which included synthesis of the identified reaction products. MRM screening of the product did not lead to the detection of DMT. Instead, 11.1% tryptamine starting material, 21.0% N,N,N-trimethyltryptammonium iodide (TMT) and 47.4% 1-N-methyl-TMT were detected. A 0.5% trace of the monomethylated N-methyltryptamine was also detected. This study demonstrated the impact on product purity of doubtful synthetic methodologies discussed on the internet.

  3. The characterisation of molecular boric acid by mass spectrometry and matrix isolation-infrared spectroscopy

    International Nuclear Information System (INIS)

    Ogden, J.S.; Young, N.A.; Bowsher, B.R.

    1987-10-01

    Boric acid (H 3 BO 3 ) is used as a soluble neutron absorber in the coolant of pressurised water reactors and will be an important species in defining the fission product chemistry of severe reactor accidents. Mass spectrometry and matrix isolation-infrared spectroscopy have been used to characterise boric acid in the vapour phase and hence assess the implications of any chemical interactions. Crystalline orthoboric acid vaporises to yield molecular H 3 BO 3 when heated in vacuum to approximately 40 0 C. The infrared spectrum of the vapour species isolated in low-temperature nitrogen matrices shows characteristic absorptions at 3668.5 (E'), 1426.2 (E'), 1009.9 (E'), 675.0 (A''), 513.8 (A'') and 448.9 (E') cm -1 , consistent with C 3h symmetry. These spectral assignments are supported by extensive isotope labelling, and by a partial normal co-ordinate analysis. These data will be used to quantify specific thermodynamic functions and hence assist in determining the magnitude of reactions such as boric acid with caesium iodide. (author)

  4. Reconstruction of diaminopimelic acid biosynthesis allows characterisation of Mycobacterium tuberculosis N-succinyl-L,L-diaminopimelic acid desuccinylase.

    Science.gov (United States)

    Usha, Veeraraghavan; Lloyd, Adrian J; Roper, David I; Dowson, Christopher G; Kozlov, Guennadi; Gehring, Kalle; Chauhan, Smita; Imam, Hasan T; Blindauer, Claudia A; Besra, Gurdyal S

    2016-03-15

    With the increased incidence of tuberculosis (TB) caused by Mycobacterium tuberculosis there is an urgent need for new and better anti-tubercular drugs. N-succinyl-L,L-diaminopimelic acid desuccinylase (DapE) is a key enzyme in the succinylase pathway for the biosynthesis of meso-diaminopimelic acid (meso-DAP) and L-lysine. DapE is a zinc containing metallohydrolase which hydrolyses N-succinyl L,L diaminopimelic acid (L,L-NSDAP) to L,L-diaminopimelic acid (L,L-DAP) and succinate. M. tuberculosis DapE (MtDapE) was cloned, over-expressed and purified as an N-terminal hexahistidine ((His)6) tagged fusion containing one zinc ion per DapE monomer. We redesigned the DAP synthetic pathway to generate L,L-NSDAP and other L,L-NSDAP derivatives and have characterised MtDapE with these substrates. In contrast to its other Gram negative homologues, the MtDapE was insensitive to inhibition by L-captopril which we show is consistent with novel mycobacterial alterations in the binding site of this drug.

  5. Chemistry of Fluorinated Carbon Acids: Synthesis, Physicochemical Properties, and Catalysis.

    Science.gov (United States)

    Yanai, Hikaru

    2015-01-01

    The bis[(trifluoromethyl)sulfonyl]methyl (Tf2CH; Tf=SO2CF3) group is known to be one of the strongest carbon acid functionalities. The acidity of such carbon acids in the gas phase is stronger than that of sulfuric acid. Our recent investigations have demonstrated that this type of carbon acids work as novel acid catalysts. In this paper, recent achievements in carbon acid chemistry by our research group, including synthesis, physicochemical properties, and catalysis, are summarized.

  6. Negishi cross-couplings in the synthesis of amino acids.

    OpenAIRE

    Brittain, W.D.G.; Cobb, S.L.

    2018-01-01

    The Negishi cross-coupling is a powerful C–C bond-forming reaction widely utilised in many areas of organic synthesis. This review details the use of Negishi cross-couplings in the synthesis of unnatural amino acids. The application of this reaction in the preparation of aromatic, heteroaromatic, and, complex amino acid derivatives are reviewed and presented herein.

  7. Synthesis of Biobased Succinonitrile from Glutamic Acid and Glutamine

    NARCIS (Netherlands)

    Lammens, T.M.; Nôtre, Le J.; Franssen, M.C.R.; Scott, E.L.; Sanders, J.P.M.

    2011-01-01

    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the

  8. Protein synthesis in the presence of carbamoyl-amino acids

    International Nuclear Information System (INIS)

    Kraus, L.M.; Stephens, M.C.

    1987-01-01

    The role of exogenous carbamoyl-amino acids in protein biosynthesis has been examined in vitro using a mixture of 14 C amino acids to label newly synthesized protein in human reticulocyte rich (8-18%) peripheral blood. Aliquots of the radiolabeled newly synthesized protein were acid precipitated, washed and the radioactivity measured. Control samples which measured the synthetic capacity of the blood were aliquots of the same blood- 14 C amino acid mixture without added carbamoyl-amino acids or cyanate. N-carbamoyl leucine alone or a 3 N-carbamoyl amino acid mixture of leucine, aspartic acid and tyrosine were used to test inhibition of protein synthesis. Also carbamoyl-amino acids were synthesized using cyanate and Pierce hydrolyzate amino acid calibration standards or the mixture of 14 C amino acids. In this system the carbamoylation of endogenous amino acids by cyanate up to 8 μmol/100μl showed a linear decrease in protein synthesis with time which is inversely related to the cyanate concentration. At greater cyanate levels the inhibition of protein synthesis reaches a plateau. When N-carbamoyl-amino acids only are present there is about a 50% decrease in the 14 C protein at 30 minutes as compared to the synthesis of 14 C protein without N-carbamoyl-amino acids. These results indicate that the presence of carbamoyl-amino acids interferes with protein synthesis

  9. Synthesis, characterization and catalytic activity of oxovanadium (IV) complexes of heterocyclic acid hydrazones

    International Nuclear Information System (INIS)

    Pandey, Manju; Sunaja Devi, K.R.; Sreeja, P.B.

    2014-01-01

    Two acid hydrazones, Furan-2-carbaldehyde nicotinic hydrazone (L 1 ) and Furan-2-carbaldehyde benzhydrazone (L 2 ) have been synthesised and they are characterized by elemental analysis, IR, NMR and UV spectral analysis. Oxovanadium (IV) complexes of these two hydrazones were synthesised and characterised by elemental analysis, IR, UV, EPR, molar conductivity and magnetic susceptibility measurements. Conductivity measurements reveal that the complexes are nonelectrolytes. Spectral data indicates the square pyramidal geometry for the monomeric give coordinated oxovanadium (IV) complexes with the general formula (VO(L)(OCH 3 )). The complex was studied for its catalytic activity and was found to be a good catalyst in quinoxaline synthesis. (author)

  10. High yield synthesis of some phosphonic acid derivatives as surface ...

    African Journals Online (AJOL)

    Efficient synthesis of novel 6-(2-bromo-2-methyl propanoyloxy)hexyl phosphonic acid, dodecane di-phosphonic acid, 6-(thiophene-3-carbonyloxy)hexyl phosphonic acid, octadecyl phosphonic acid and such other derivatives are reported here. These derivatives have a potential application as tethers to nanoparticle ...

  11. Characterisation and application of new carboxylic acid-functionalised ruthenium complexes as dye-sensitisers for solar cells

    DEFF Research Database (Denmark)

    Duprez, Virginie; Biancardo, Matteo; Krebs, Frederik C

    2007-01-01

    A series of ruthenium complexes with and without TiO2, anchoring carboxylic acid groups have been synthesised and characterised using nuclear magnetic resonance (NMR), UV-vis and luminescence. These complexes were adsorbed on thin films of the wide band-gap semiconductor anatase and were tested a...

  12. Chemical characterisation of natural organic substrates for biological mitigation of acid mine drainage.

    Science.gov (United States)

    Gibert, Oriol; de Pablo, Joan; Luis Cortina, José; Ayora, Carlos

    2004-11-01

    The current approach of the biological treatment of acid mine drainage by means of a passive remediation system involves the choice of an appropriate organic substrate as electron donor for sulphate reducers. Nowadays this selection is one of the critical steps in the performance of such treatment, as this depends to a great extent on the degradability of the organic substrate. Thus, a prior characterisation of the organic substrate predicting its biodegradability would be desirable before embarking on an extensive large-scale application. The aim of this study was to correlate the chemical composition (lignin content) of four different natural organic substrates (compost, sheep and poultry manures, oak leaf) and their capacity to sustain bacterial activity in an attempt to predict biodegradation from chemical characterisation. The results showed that the lower the content of lignin in the organic substrate, the higher its biodegradability and capacity for developing bacterial activity. Of the four organic materials, sheep and poultry manures and oak leaf evolved reducing conditions and sustained active sulphidogenesis, which coupled with the decrease in sulphate concentration indicated bacterial activity. Sheep manure was clearly the most successful organic material as electron donor (sulphate removal >99%), followed by poultry manure and oak leaf (sulphate removal of 80%). Compost appeared to be too poor in carbon to promote sulphate-reducing bacteria activity by itself. Column experiments emphasised the importance of considering the residence time as a key factor in the performance of continuous systems. With a residence time of 0.73 days, sheep manure did not promote sulphidogenesis. However, extending residence time to 2.4 and 9.0 days resulted in an increase in the sulphate removal to 18% and 27%, respectively.

  13. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    Science.gov (United States)

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  14. Biochemical characterisation of the esterase activities of wine lactic acid bacteria.

    Science.gov (United States)

    Matthews, Angela; Grbin, Paul R; Jiranek, Vladimir

    2007-11-01

    Esters are an important group of volatile compounds that can contribute to wine flavour. Wine lactic acid bacteria (LAB) have been shown to produce esterases capable of hydrolysing ester substrates. This study aims to characterise the esterase activities of nine LAB strains under important wine conditions, namely, acidic conditions, low temperature (to 10 degrees C) and in the presence of ethanol (2-18% v/v). Esterase substrate specificity was also examined using seven different ester substrates. The bacteria were generally found to have a broad pH activity range, with the majority of strains showing maximum activity close to pH 6.0. Exceptions included an Oenococcus oeni strain that retained most activity even down to a pH of 4.0. Most strains exhibited highest activity across the range 30-40 degrees C. Increasing ethanol concentration stimulated activity in some of the strains. In particular, O. oeni showed an increase in activity up to a maximum ethanol concentration of around 16%. Generally, strains were found to have greater activity towards short-chained esters (C2-C8) compared to long-chained esters (C10-C18). Even though the optimal physicochemical conditions for enzyme activity differed from those found in wine, these findings are of potential importance to oenology because significant activities remained under wine-like conditions.

  15. Vanadium(II)-diamine complexes: synthesis, UV-Visible, infrared, thermogravimetry, magnetochemistry and INDO/S characterisation

    International Nuclear Information System (INIS)

    Niedwieski, Antonio C.; Motta Neto, Joaquim D. da; Wypych, Fernando; Nunes, Fabio S.; Hitchcock, Peter B.; Leigh, G. Jeffery

    2003-01-01

    The synthesis, spectroscopic characterisation and reactivity of a series of vanadium(II) complexes, [VCl 2 (diamine) 2 ] (diamine = dmeda: N,N'-dimethylethane-1,2-diamine, deeda: N,N'-diethylethane-1,2-diamine, tmeda: N,N,N',N-tetramethylmethane-1,2-diamine, dieda: N,N'-diisopropylethane-1,2- diamine, teeda: N,N,N',N'-tetraethylethane-1,2-diamine, dtbeda: N,N'-ditert-butylethane-1,2-diamine and dfeda: N,N'-diphenylethane-1,2-diamine) are reported. Some of these complexes can be converted into the trinuclear cation [V 3 (μ-Cl) 3 (μ 3 -Cl) 2 (diamine) 3 ] + through the reaction with [V 2 (μ-Cl) 3 (thf) 3 ] + under mild conditions. The compounds were characterised by microanalysis, positive ion FAB mass spectrometry, UV-visible and infrared spectroscopies, thermogravimetric analysis and magnetic moment measurements in the solid state. We characterised fully by single-crystal X-ray diffraction analysis the complex [VCl 2 (deeda) 2 ]. The stability of [VCl 2 (diamine) 2 ] as they vary with the different diamines is correlated with crystal field and infrared parameters along with decomposition temperatures and the calculated molecular orbital energies. We also presented a new synthetic route to prepare [V 3 (μ-Cl) 3 (μ 3 -Cl) 2 (diamine) 3 ] + which allows a better control of the reaction pathway, avoiding the formation of undesired redox reaction products. (author)

  16. Synthesis and characterisation of nitrogen poly-heterocyclic molecules using as selective complexing agents of metallic cations

    International Nuclear Information System (INIS)

    Alphonse, F.A.

    2003-12-01

    Separation of actinides (III) from lanthanides (III) is a crucial problem in the reprocessing of used nuclear fuels. Experimental results shown that soft donor extractants such as nitrogen polydentate heterocycles containing a NCCNCCN coordination site are potentials ligands for selective extraction of actinides (III). In those cases, two types of liquid-liquid extractions are employed: synergistic combination with lipophilic acid extractants and direct extraction. On the basis of the Hard and Soft Acids and Bases theory and basicity evaluation, new extractants were defined. We have first studied the synthesis of potential 1,3,5-triazine ligands designed for extraction in synergy with α-bromodecanoic acid. Secondly, we have examined the synthesis of bis-triazinyl-pyridine ligands for direct extraction studies. Extraction tests were carried out and perspectives of synthesis were deducted from those extraction results. (author)

  17. Synthesis of some labelled non-proteinogenic amino acids

    International Nuclear Information System (INIS)

    Adrianens, P.; Vanderhaeghe, H.

    1987-01-01

    The literature on the synthesis of labeled non-proteinogenic amino acids contains approximately 300 papers, whereas syntheses of labeled proteinogenic amino acids are dealt with in some 800-1000 publications. However, most of the methods described in this paper for the synthesis of non-proteinogenic amino acids are also used for the preparation of the essential amino acids addition, the first category also contains β, γ...amino acids, seleno amino acids, N-methyl and α-methyl amino acids and sometimes have atoms or groups which are not present in the protein building blocks. Furthermore the latter group is more easily available so that methods for synthesis of non-proteinogenic amino acids are more needed

  18. SYNTHESIS OF FLAVANONE-6-CARBOXYLIC ACID DERIVATIVES FROM SALICYLIC ACID DERIVATIVE

    OpenAIRE

    Mardjan, Muhammad Idham Darussalam; Ambarwati, Retno; Matsjeh, Sabirin; Wahyuningsih, Tutik Dwi; Haryadi, Winarto

    2012-01-01

    Synthesis of flavanone-6-carboxylic acid derivatives had been conducted via the route of chalcone. The synthesis was carried out from salicylic acid derivative, i.e. 4-hydroxybenzoic acid, via esterification, Fries rearrangement, Claisen-Schmidt condensation and 1,4-nucleophilic addition reactions. Structure elucidation of products was performed using FT-IR, 1H-NMR, GC-MS and UV-Vis spectrometers. Reaction of 4-hydroxybenzoic acid with methanol catalyzed with sulfuric acid produced methyl 4-h...

  19. Characterisation of embroidered 3D electrodes by use of anthraquinone-1,5-disulfonic acid as probe system

    Science.gov (United States)

    Aguiló-Aguayo, Noemí; Bechtold, Thomas

    2014-05-01

    New electrode designs are required for electrochemical applications such as batteries or fuel cells. Embroidered 3D Cu porous electrodes with a geometric surface of 100 cm2 are presented and characterised by means of the anthraquinone-1,5-disfulfonic acid (AQDS2-) redox system in alkaline solution. The electrochemical behaviour of the 3D electrode is established by the comparison of cyclic voltammetry responses using a micro cell and a 100 cm2 plane Cu-plate electrode. Dependencies of the peak currents and peak-to-peak potential separation on scan rate and AQDS2- concentration are studied. The AQDS2- characterisation is also performed by means of spectroelectrochemical experiments.

  20. Electrochemical synthesis and characterisation of hybrid materials polypyrrole/dodecatungstophosphate as protective agents against steel corrosion

    Science.gov (United States)

    Bonastre Cano, Jose Antonio

    hand, this pretreatment should guarantee appropriate conditions in order to obtain a coating with high adhesion on carbon steel. Once studied the better parameters for the synthesis of the hybrid material by cyclic voltammetry, hybrid material is morphological, chemical and electrochemical characterised by the following techniques: Cyclic Voltammetry, Scanning Electron Microscopy, Energy Dispersive X Ray, X Ray Photoelectron Spectroscopy and Electrochemical Impedance Spectroscopy. The hybrid material polypyrrole/PW 12O403-. chemical structure presents Fe oxides and hydroxide within the polypyrrole polycationic matrix. Hybrid material polypyrrol/PW12O403- diminishes the corrosion of carbon steel in NaOH and Porland cement filtering solutions. These cement solutions simulate the pore fluid conditions existing in cured mortar or concrete elements. Fe ion concentration data were determinated in corrosion tests. Voltammetric response of polymeric coatings was evaluated by cyclic voltammetry. Finally, the protection provided by hybrid material polypyrrole/PW 12O403, in oxidised and reduced state, was evaluated on carbon steel electrodes embedded in Portland cement mortars immersed in seawater and submitted to an accelerated carbonation process for 265 days. Polymeric material covered carbon steel electrodes in reduced state suffer a Fe gravimetric loss 15 times lower than the ones of bare electrodes against chlorides attack, due to the effect of physical barrier. Hybrid material covered electrodes in oxidised state after being submitted to a carbonation process suffer a Fe gravimetric loss 2.5 times lower than the ones of bare electrodes, due to galvanic protection provided by hybrid material polypyrrole/PW 12O403- on carbon steel.

  1. Methane Sulphonic Acid is Green Catalyst in Organic Synthesis

    OpenAIRE

    Pramod Kulkarni

    2015-01-01

    Methane sulphonic acid is an alkanesulphonic acid and its chemical formula is CH3SO3H. MSA is a strong acid having pKa= 1.9 and completely ionized in 0.1 M in an aqueous solution and has small affinity to oxidize organic compounds, less corrosive and toxic than other mineral acids. MSA is also biodegradable and not evolve toxic gases. Therefore MSA is considered as green acid. Therefore its use in organic synthesis attracts many chemists to use in organic synthesis. In this review we describe...

  2. Succinct synthesis of saturated hydroxy fatty acids and

    DEFF Research Database (Denmark)

    Kaspersen, Mads Holmgaard; Jenkins, Laura; Dunlop, Julia

    2017-01-01

    Saturated hydroxy fatty acids make up a class of underexplored lipids with potentially interesting biological activities. We report a succinct and general synthetic route to saturated hydroxy fatty acids hydroxylated at position 6 or higher, and exemplify this with the synthesis of hydroxylauric...... acids. All regioisomers of hydroxylauric acids were tested on free fatty acid receptors FFA1, FFA4 and GPR84. The results show that the introduction of a hydroxy group and its position have a high impact on receptor activity....

  3. SYNTHESIS AND CHARACTERISATION OF Ni0.25Co0.75Fe2O4 ...

    African Journals Online (AJOL)

    characterised for their size and structure using X-ray diffraction (XRD), high resolution transmission electron microscopic (HRTEM), selected area electron diffraction (SAED) and scanning electron microscopic (SEM) techniques. KEY WORDS: Ni0.25Co0.75Fe2O4 nanoparticles, XRD, HRTEM, SAED, SEM. INTRODUCTION.

  4. Characterisation of acid-soluble and pepsin-solubilised collagen from frog (Rana nigromaculata) skin.

    Science.gov (United States)

    Zhang, Junjie; Duan, Rui

    2017-08-01

    As the first vertebrates connecting water and land, frogs must have evolved certain specialisations. To find the difference among the collagens from amphibian, fish and mammal animals, acid-soluble collagen (ASC) and pepsin-solubilised collagen (PSC) from frog skin were isolated and characterised. The yield of PSC (19.59%, dry weight) was higher than that of ASC (1.83%, dry weight). The hydroxyproline-to-protein ratio of frog skin was 8.37%, which was higher than that of carp skin ASC (7.83%) but significantly lower than that of calf skin collagen (10.16%), which was in accordance with the living environment of frog. The denaturation temperature of frog skin collagens was approximately 31.5°C. The SDS-PAGE electrophoresis revealed that ASC and PSC were type I collagens. Fourier transform infrared spectroscopy proved that the ASC and PSC retained their helical structures. The results indicated the properties of frog skin collagen were close to those of skin collagen from freshwater fish. The frog skin collagens can potentially be used in biomaterial and other fields. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Synthesis of 2-Diethyl- and 2-Diisopropylaminoethanesulfonic Acids

    National Research Council Canada - National Science Library

    Hsu, Fu-Lian

    1997-01-01

    Methods for the synthesis of 2-diethyl- and diisopropylaminoethanesulfonic acids have been developed by the reaction of the corresponding 2-aminoethyl chloride hydrochloride and sodium sulfite in water at 110 deg C...

  6. CYCLOSPORINE-A BLOCKS BILE-ACID SYNTHESIS IN CULTURED-HEPATOCYTES BY SPECIFIC-INHIBITION OF CHENODEOXYCHOLIC ACID SYNTHESIS

    NARCIS (Netherlands)

    PRINCEN, HMG; WOLTHERS, BG; VONK, RJ; KUIPERS, F

    1991-01-01

    Bile acid synthesis, determined by conversion of [4-C-14]cholesterol into bile acids in rat and human hepatocytes and by measurement of mass production of bile acids in rat hepatocytes, was dose-dependently decreased by cyclosporin A, with 52% (rat) and 45% (human) inhibition at 10-mu-M. The

  7. Synthesis and characterisation of ruthenium carbonyl complexes with cyclometallated ligands derived from senecialdimine

    NARCIS (Netherlands)

    Mul, WP; Elsevier, CJ; Vuurman, MA; Smeets, WJJ; Spek, AL; deBoer, JL

    1997-01-01

    From thermal reactions of Ru-3(CO)(12) with senecialdimine, (CH3)(2)C=CHCH=NR (R = iPr (a), t-Bu (b)), in refluxing heptanes the following complexes have been isolated and characterised: Ru-2(CO)(6)[(CH3)(2)C(H)CC(H)NR] (2a,b), Ru-2(Co)(6)[C(H)C(CH3)C(H)C(H)=NR] (3a,b),

  8. Prebiotic synthesis of carboxylic acids, amino acids and nucleic acid bases from formamide under photochemical conditions⋆

    Science.gov (United States)

    Botta, Lorenzo; Mattia Bizzarri, Bruno; Piccinino, Davide; Fornaro, Teresa; Robert Brucato, John; Saladino, Raffaele

    2017-07-01

    The photochemical transformation of formamide in the presence of a mixture of TiO2 and ZnO metal oxides as catalysts afforded a large panel of molecules of biological relevance, including carboxylic acids, amino acids and nucleic acid bases. The reaction was less effective when performed in the presence of only one mineral, highlighting the role of synergic effects between the photoactive catalysts. Taken together, these results suggest that the synthesis of chemical precursors for both the genetic and the metabolic apparatuses might have occurred in a simple environment, consisting of formamide, photoactive metal oxides and UV-radiation.

  9. Synthesis, characterisation and biological properties of gold(III) compounds with modified bipyridine and bipyridylamine ligands.

    Science.gov (United States)

    Casini, Angela; Diawara, Mariam Celine; Scopelliti, Rosario; Zakeeruddin, Shaik Mohammed; Grätzel, Michael; Dyson, Paul J

    2010-03-07

    Square planar gold(III) complexes that contain functionalised bipyridine ligands of general formula [Au(N--N)Cl(2)][PF(6)] [where N--N = 2,2'-bipyridine, 4,4'-dimethyl-2,2'-bipyridine, 4,4'-dimethoxy-2,2'-bipyridine and 4,4'-diamino-2,2'-bipyridine] have been prepared and characterised by NMR spectroscopy and mass spectrometry. Two of the complexes have also been characterised in the solid state by X-ray crystallography. In addition, a gold(iii) compound bearing a dipyridin-2-ylamine ligand was also prepared and characterised. The complexes were found to undergo hydrolysis under pseudo-physiological conditions. Moreover, the complexes showed moderate to good cytotoxicity in vitro towards the A2780 human ovarian carcinoma cell line and the cisplatin resistant variant A2780cisR. Reactivity studies with biomolecules, such as reducing agents, plasmid DNA and a model protein (ubiquitin) were also performed to provide tentative insights into the mode of action of the complexes.

  10. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    Science.gov (United States)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  11. Rewiring protein synthesis: From natural to synthetic amino acids.

    Science.gov (United States)

    Fan, Yongqiang; Evans, Christopher R; Ling, Jiqiang

    2017-11-01

    The protein synthesis machinery uses 22 natural amino acids as building blocks that faithfully decode the genetic information. Such fidelity is controlled at multiple steps and can be compromised in nature and in the laboratory to rewire protein synthesis with natural and synthetic amino acids. This review summarizes the major quality control mechanisms during protein synthesis, including aminoacyl-tRNA synthetases, elongation factors, and the ribosome. We will discuss evolution and engineering of such components that allow incorporation of natural and synthetic amino acids at positions that deviate from the standard genetic code. The protein synthesis machinery is highly selective, yet not fixed, for the correct amino acids that match the mRNA codons. Ambiguous translation of a codon with multiple amino acids or complete reassignment of a codon with a synthetic amino acid diversifies the proteome. Expanding the genetic code with synthetic amino acids through rewiring protein synthesis has broad applications in synthetic biology and chemical biology. Biochemical, structural, and genetic studies of the translational quality control mechanisms are not only crucial to understand the physiological role of translational fidelity and evolution of the genetic code, but also enable us to better design biological parts to expand the proteomes of synthetic organisms. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Synthesis and characterisation of thorium and uranium cyanoacetates and their coordination compounds (Preprint No. AL.14)

    International Nuclear Information System (INIS)

    Deshpande, S.G.; Vaidya, M.A.; Jain, S.C.

    1989-01-01

    Tetracyanoacetates, M(NCCH 2 COO) 4 (where M=Th or U) and UO 2 (NCCH 2 COO) 2 .H 2 O and their coordination complexes with (CH 3 ) 2 S=0 (DMSO), HCOON(CH 3 ) 2 , (DMF), 1,10-Phenenthrolene (Phen) and 2,2'Bipyridine (Bipy), have been synthesised and characterised by elemental analysis, molecular weight determination, molar conductance measurements, X-ray diffraction and infrared (IR) spectroscopic studies (4000 - 200 cm -1 ). Thermogravimetric analysis of the compounds have been carried out to study the thermal decomposition mode. (author)

  13. Synthesis, characterisation and optical studies of new tetraethyl- rubyrin-graphene oxide covalent adducts

    Science.gov (United States)

    Garg, Kavita; Shanmugam, Ramakrishanan; Ramamurthy, Praveen C.

    2018-02-01

    Tetrathia-rubyrin and graphene oxide (GO) covalent adduct was synthesized, characterised and optical properties were studied. GO-Rubyrin adducts showed fluorescence quenching of rubyrin due to electron or energy transfer from rubyrin to graphene oxide, which also reflected in UV-vis absorbance spectroscopy. The non-linear optical responses were measured through Z scan technique in nano-second regime. The enhanced optical non-linearity was observed after attachment of GO with rubyrin, can be ascribed to the photo-induced electron or energy transfer from the electron rich rubyrin moiety to the electron deficient GO.

  14. Mitochondrial Fatty Acid Synthesis Type II: More than Just Fatty Acids*

    OpenAIRE

    Hiltunen, J. Kalervo; Schonauer, Melissa S.; Autio, Kaija J.; Mittelmeier, Telsa M.; Kastaniotis, Alexander J.; Dieckmann, Carol L.

    2009-01-01

    Eukaryotes harbor a highly conserved mitochondrial pathway for fatty acid synthesis (FAS), which is completely independent of the eukaryotic cytosolic FAS apparatus. The activities of the mitochondrial FAS system are catalyzed by soluble enzymes, and the pathway thus resembles its prokaryotic counterparts. Except for octanoic acid, which is the direct precursor for lipoic acid synthesis, other end products and functions of the mitochondrial FAS pathway are still largel...

  15. Concise synthesis of a novel antifungal agent 4-methoxydecanoic acid

    Directory of Open Access Journals (Sweden)

    Pagudala Narsimha

    2013-12-01

    Full Text Available 4-Methoxy decanoic acid is belongs to a fatty acid family and has a novel anti- fungal activity. The aliphatic molecule has been synthesized in seven steps with an overall yield 41%. The synthesis was started from a commercially available epichloro hydrin and all the reactions were very clean.

  16. Unsaturated fatty acid: Metabolism, synthesis and gene regulation ...

    African Journals Online (AJOL)

    In both plants and animals, unsaturated fatty acids are considered to be essential membrane components. Also they play key roles in many cellular events. The synthesis and metabolism of unsaturated fatty acid are very complex processes, involving a variety of enzymes and regulated pathways. Most recently, research has ...

  17. Synthesis of fatty acid starch esters in supercritical carbon dioxide

    NARCIS (Netherlands)

    Muljana, Henky; van der Knoop, Sjoerd; Keijzer, Danielle; Picchioni, Francesco; Janssen, Leon P. B. M.; Heeres, Hero J.

    2010-01-01

    This manuscript describes an exploratory study on the synthesis of fatty acid/potato starch esters using supercritical carbon dioxide (scCO(2)) as the solvent. The effects of process variables such as pressure (6-25 MPa), temperature (120-150 degrees C) and various basic catalysts and fatty acid

  18. Synthesis, characterisation, cellular uptake and cytotoxicity of functionalised magnetic ruthenium (II) polypyridine complex core-shell nanocomposite.

    Science.gov (United States)

    Kandibanda, Srinivasa Rao; Gundeboina, Narasihmha; Das, Sourav; Sunkara, V Manorama

    2018-01-01

    The development of multifunctional nanoparticles comprising of a magnetic core in conjunction with appropriate molecules with capabilities to impart functionalities like luminescent, specific binding sites to facilitate attachment of moieties. This has attracted increasing attention and enables identification of promising candidates using for applications such as diagnostics and cure through early detection and localized delivery. Many studies have been performed on the synthesis and cellular interactions of core-shell nanoparticles, in which a functional inorganic core is coated with a biocompatible polymer layer that should reduce nonspecific uptake and cytotoxicity Here we report the synthesis and characterisation of multifunctional core-shell magnetic, luminescent nanocomposite (Fe 3 O 4 @SiO 2 @[Ru(Phen) 3 ] 2+ @SiO 2 @NH 2 ). Fe 3 O 4 as core and a luminescent ruthenium (II) complex encapsulated with silica shell, and then it is functionalized by an amine group by APTMS. The magnetic, luminescent, and biological activity of this multifunctional nanocomposite have also been studied to prove the nanocomposite is biocompatible, cellular uptake. The synthesized nanocomposite was completely characterized by X-ray diffraction (XRD), Fourier-transform infrared (FTIR) spectroscopy, transmission electron microscopy (TEM), vibrating sample magnetometer (VSM), and emission spectroscopy. MTT assay and cellular uptake by flow cytometry results proved that magnetic ruthenium (II) polypyridine complex - core shell nanocomposite has biocompatibility, minimum cytotoxicity and internalized inside B16F10 cells and confirms the potential biomedical applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Acetylsalicylic acid: Incoming 150 years of the first synthesis

    OpenAIRE

    Mijin Dušan Ž.; Stanković Milena; Petrović Slobodan D.; Blagojević Milorad

    2002-01-01

    Acetylsalicylic acid is one of the most fascinating and versatile drugs known to medicine, as well as one of the oldest. Acetylsalicylic acid is a drug which is safe, with analgetic, antirheumatic, anti-inflammatory antiplatelet and antithrombotic action. It may be applied not only in clinical practice, but also as prevention. The first known use of an acetylsalicylic acid-like preparation can be traced to ancient Greece. In 1853 Charles Gerhardt published the first synthesis of acetylsalicyl...

  20. Synthesis of [1-14C] palmitic acid

    International Nuclear Information System (INIS)

    Tian Yuan; Han Peizhen; Tian Shuhao

    1997-01-01

    The synthesis of [1- 14 C] palmitic acid via Grignard Reaction is reported. The carbon-C 14 dioxide was liberated by dropping sulfuric acid onto barium carbonate-C 14 . The yield of [1- 14 C] palmitic acid was 44.8%. A radiochemical purity of more than 99.5% was determined by HPLC and the product was proved to be free of impurity by TLC

  1. Non-Noble Metal Oxide Catalysts for Methane Catalytic Combustion: Sonochemical Synthesis and Characterisation.

    Science.gov (United States)

    Jodłowski, Przemysław J; Jędrzejczyk, Roman J; Chlebda, Damian K; Dziedzicka, Anna; Kuterasiński, Łukasz; Gancarczyk, Anna; Sitarz, Maciej

    2017-07-07

    The aim of this study was to obtain nanocrystalline mixed metal-oxide-ZrO₂ catalysts via a sonochemically-induced preparation method. The effect of a stabiliser's addition on the catalyst parameters was investigated by several characterisation methods including X-ray Diffraction (XRD), nitrogen adsorption, X-ray fluorescence (XRF), scanning electron microscopy (SEM) equipped with energy dispersive X-ray spectrometer (EDS), transmission electron microscopy (TEM) and µRaman. The sonochemical preparation method allowed us to manufacture the catalysts with uniformly dispersed metal-oxide nanoparticles at the support surface. The catalytic activity was tested in a methane combustion reaction. The activity of the catalysts prepared by the sonochemical method was higher than that of the reference catalysts prepared by the incipient wetness method without ultrasonic irradiation. The cobalt and chromium mixed zirconia catalysts revealed their high activities, which are comparable with those presented in the literature.

  2. Synthesis and characterisation of chitin from periwinkle (Tympanotonus fusatus (L.)) and snail (Lissachatina fulica (Bowdich)) shells.

    Science.gov (United States)

    Akpan, E I; Gbenebor, O P; Adeosun, S O

    2018-01-01

    This study characterizes chitin extracted from bio-sources of snail and periwinkle using varied combinations of acid and alkali concentrations. A three level factorial design of experiment with alkali and acid concentrations was used. FTIR, XRD and SEM were used to investigate the structural changes after treatments. Results reveal that both alkali and acid concentrations significantly affect the development of the functional groups and their intensities in the extracted chitin. A certain combination of concentration of acid and alkali can be used to obtain chitin with high degree of order (Crystallinity Index (CrI)>0.9) and a degree of de-acetylation (DD>50%). This results in combined high crystallinity and degree of de-acetylation. The study also established that certain combination of acid and alkali concentrations could lead to alpha to beta transformation in chitin structure. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Synthesis of L-2-amino-8-oxodecanoic acid: an amino acid component of apicidins

    OpenAIRE

    Linares de la Morena, María Lourdes; Agejas Chicharro, Francisco Javier; Alajarín Ferrández, Ramón; Vaquero López, Juan José; Álvarez-Builla Gómez, Julio

    2001-01-01

    The synthesis Of L-2-amino-8-oxodecanoic acid (Aoda) is described. This is a rare amino acid component of apicidins, a family of new cyclic tetrapeptides, inhibitors of histone deacetylase. Aoda was synthesised in seven steps from L-glutamic acid along with some derivatives. Universidad de Alcalá Fundación General de la Universidad de Alcalá FEDER

  4. Expeditious Synthesis of Dianionic-Headed 4-Sulfoalkanoic Acid Surfactants.

    Science.gov (United States)

    Jiang, Jianghui; Xu, Jiaxi

    2017-04-16

    4-Sulfoalkanoic acids are a class of important dianionic-headed surfactants. Various 4-sulfoalkanoic acids with straight C8, C10, C12, C14, C16, and C18 chains were synthesized expeditiously through the radical addition of methyl 2-((ethoxycarbonothioyl)thio)acetate to linear terminal olefins and subsequent oxidation with peroxyformic acid. This is a useful and convenient strategy for the synthesis of dianionic-headed surfactants with a carboxylic acid and sulfonic acid functionalities in the head group region.

  5. Synthesis and anticonvulsant activity of novel bicyclic acidic amino acids

    DEFF Research Database (Denmark)

    Conti, Paola; De Amici, Marco; Joppolo Di Ventimiglia, Samuele

    2003-01-01

    Bicyclic acidic amino acids (+/-)-6 and (+/-)-7, which are conformationally constrained homologues of glutamic acid, were prepared via a strategy based on a 1,3-dipolar cycloaddition. The new amino acids were tested toward ionotropic and metabotropic glutamate receptor subtypes; both of them...

  6. Synthesis of High Purity Nonsymmetric Dialkylphosphinic Acid Extractants.

    Science.gov (United States)

    Wang, Junlian; Xie, Meiying; Liu, Xinyu; Xu, Shengming

    2017-10-19

    We present the synthesis of (2,3-dimethylbutyl)(2,4,4'-trimethylpentyl)phosphinic acid as an example to demonstrate a method for the synthesis of high purity nonsymmetric dialkylphosphinic acid extractants. Low toxic sodium hypophosphite was chosen as the phosphorus source to react with olefin A (2,3-dimethyl-1-butene) to generate a monoalkylphosphinic acid intermediate. Amantadine was adopted to remove the dialkylphosphinic acid byproduct, as only the monoalkylphosphinic acid can react with amantadine to form an amantadine∙mono-alkylphosphinic acid salt, while the dialkylphosphinic acid cannot react with amantadine due to its large steric hindrance. The purified monoalkylphosphinic acid was then reacted with olefin B (diisobutylene) to yield nonsymmetric dialkylphosphinic acid (NSDAPA). The unreacted monoalkylphosphinic acid can be easily removed by a simple base-acid post-treatment and other organic impurities can be separated out through the precipitation of the cobalt salt. The structure of the (2,3-dimethylbutyl)(2,4,4'-trimethylpentyl)phosphinic acid was confirmed by 31 P NMR, 1 H NMR, ESI-MS, and FT-IR. The purity was determined by a potentiometric titration method, and the results indicate that the purity can exceed 96%.

  7. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    International Nuclear Information System (INIS)

    Pooler, P.A.; Duane, W.C.

    1988-01-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from [26-14C]cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man

  8. Biobased synthesis of acrylonitrile from glutamic acid

    NARCIS (Netherlands)

    Notre, le J.E.L.; Scott, E.L.; Franssen, M.C.R.; Sanders, J.P.M.

    2011-01-01

    Glutamic acid was transformed into acrylonitrile in a two step procedure involving an oxidative decarboxylation in water to 3-cyanopropanoic acid followed by a decarbonylation-elimination reaction using a palladium catalyst

  9. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    Science.gov (United States)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  10. Synthesis and characterisation of alkaline anionic-exchange membranes for direct alcohol fuel cells

    CSIR Research Space (South Africa)

    Nonjola, P

    2007-12-01

    Full Text Available , but the most important being proton exchange membrane fuel cell (PEMFC), which uses an acidic membrane like Nafion (sulfonated fluorocarbon polymers) as an electrolyte. The use of polymer electrolytes represents an interesting path to pursue...

  11. Rapid hydrothermal flow synthesis and characterisation of carbonate- and silicate-substituted calcium phosphates

    Science.gov (United States)

    Knowles, Jonathan C; Rehman, Ihtesham; Darr, Jawwad A

    2013-01-01

    A range of crystalline and nano-sized carbonate- and silicate-substituted hydroxyapatite has been successfully produced by using continuous hydrothermal flow synthesis technology. Ion-substituted calcium phosphates are better candidates for bone replacement applications (due to improved bioactivity) as compared to phase-pure hydroxyapatite. Urea was used as a carbonate source for synthesising phase pure carbonated hydroxyapatite (CO3-HA) with ≈5 wt% substituted carbonate content (sample 7.5CO3-HA) and it was found that a further increase in urea concentration in solution resulted in biphasic mixtures of carbonate-substituted hydroxyapatite and calcium carbonate. Transmission electron microscopy images revealed that the particle size of hydroxyapatite decreased with increasing urea concentration. Energy-dispersive X-ray spectroscopy result revealed a calcium deficient apatite with Ca:P molar ratio of 1.45 (±0.04) in sample 7.5CO3-HA. For silicate-substituted hydroxyapatite (SiO4-HA) silicon acetate was used as a silicate ion source. It was observed that a substitution threshold of ∼1.1 wt% exists for synthesis of SiO4-HA in the continuous hydrothermal flow synthesis system, which could be due to the decreasing yields with progressive increase in silicon acetate concentration. All the as-precipitated powders (without any additional heat treatments) were analysed using techniques including Transmission electron microscopy, X-ray powder diffraction, Differential scanning calorimetry, Thermogravimetric analysis, Raman spectroscopy and Fourier transform infrared spectroscopy. PMID:22983020

  12. Synthesis, characterisation and application of copper modified brookite titania photocatalyst activated by visible light.

    Science.gov (United States)

    Osei, Prince Bonsu; Lü, Xiaomeng; Xie, Jimin; Jiang, Deli; Chen, Min; Wei, Xiaojun

    2014-09-01

    Brookite titania nanomaterials modified with Copper Nanoparticles (NPs) Cu-TiO2 were prepared in this research. Hydrothermal method was used to prepare Brookite Titania whiles, copper NPs were loaded on its surface by consecutive ion adsorption and photoreduction. The photocatalyst was characterised by Transmission electron microscopy (TEM), X-ray diffraction (XRD), X-ray Photoelectron spectroscopy (XPS), UV-Vis diffuse reflectance Spectrum (UV-vis DRS) and Inductively Coupled Plasma-Atomic Emission spectroscopy (ICP-AES). The photocatalytic activity of the prepared composite was also determined by photodecolorisation of organic pollutants under visible light. Crystal Violet dye (CV) was used as a model organic pollutant. The optimum loading ratio of Cu/Ti which resulted in the best photodecolorisation efficiency was also determined. The results revealed that the sample Cu-TiO2 (Cu/Ti = 2% molar ratio) with copper particle size of 3 nm had the best photocatalytic decolorisation efficiency of 98% after 50 min of irradiation under visible light. The decolorisation efficiency of the sample Cu-TiO2 (2%) was also higher than that of commercial P25 (38%).

  13. Synthesis and characterisation of epoxy resins reinforced with carbon nanotubes and nanofibers.

    Science.gov (United States)

    Prolongo, S G; Gude, M R; Ureña, A

    2009-10-01

    Epoxy nanocomposites were fabricated using two kinds of nanofiller, amino-functionalized multi-walled carbon nanotubes (CNTs) and non-treated long carbon nanofibers (CNFs). The non-cured mixtures were analysed through viscosity measurements. The effect of the nanoreinforcement on the curing process was determined by differential scanning calorimetry. Finally, the characterisation of cured nanocomposites was carried out studying their thermo-mechanical and electrical behaviour. At room temperature, the addition of CNTs causes a viscosity increase of epoxy monomer much more marked than the introduction of CNFs due to their higher specific area. It was probed that in that case exists chemical reaction between amino-functionalized CNTs and the oxirane rings of epoxy monomer. The presence of nanoreinforcement induces a decrease of curing reaction rate and modifies the epoxy conversion reached. The glass transition temperature of the nanocomposites decreases with the contents of CNTs and CNFs added, which could be related to plasticization phenomena of the nanoreinforcements. The storage modulus of epoxy resin significantly increases with the addition of CNTs and CNFs. This augment is higher with amino-functionalized CNTs due, between other reasons, to the stronger interaction with the epoxy matrix. The electrical conductivity is greatly increased with the addition of CNTs and CNFs. In fact, the percolation threshold is lower than 0.25 wt% due to the high aspect ratio of the used nanoreinforcements.

  14. Synthesis, characterisation and anion exchange properties of copper, magnesium, zinc and nickel hydroxy nitrates

    International Nuclear Information System (INIS)

    Biswick, Timothy; Jones, William; Pacula, Aleksandra; Serwicka, Ewa

    2006-01-01

    Anion exchange reactions of four structurally related hydroxy salts, Cu 2 (OH) 3 NO 3 , Mg 2 (OH) 3 NO 3 , Ni 2 (OH) 3 NO 3 and Zn 3 (OH) 4 (NO 3 ) 2 are compared and trends rationalised in terms of the strength of the covalent bond between the nitrate group and the matrix cation. Powder X-ray diffraction (PXRD), Fourier-transform infrared (FTIR) spectroscopy, thermogravimetric analysis (TGA) and elemental analysis are used to characterise the materials. Replacement of the nitrate anions in the zinc and copper salts with benzoate anions is possible although exchange of the zinc salt is accompanied by modification of the layer structure from one where zinc is exclusively six-fold coordinated to a structure where there is both six- and four-fold zinc coordination. Magnesium and nickel hydroxy nitrates, on the other hand, hydrolyse to their respective metal hydroxides. -- Graphical abstract: PXRD patterns of exchange products of (a) Zn 3 (OH) 4 (NO 3 ) 2 (b) Zn 5 (OH) 8 (NO 3 ) 2 .2H 2 O and (c) Cu 2 (OH) 3 NO 3 with benzoate anions

  15. Synthesis of new fatty acids amides from aminolysis of fatty acid methyl esters (FAMEs)

    International Nuclear Information System (INIS)

    Lopes, Carolina R.; Montes D'Oca, Caroline da Ros; Duarte, Rodrigo da C.; Kurz, Marcia H.S.; Primel, Ednei G.; Clementin, Rosilene M.; Villarreyes, Joaquin Ariel M.; Montes D'Oca, Marcelo G.

    2010-01-01

    Recent biochemical and pharmacological studies have led to the characterization of different fatty acid amides as a new family of biologically active lipids. Here, we describe the synthesis of new amides from C16:0, 18:0, 18:1 and 18:1, OH fatty acids (FFA) families with cyclic and acyclic amines and demonstrate for the first time that these compounds produce cytotoxic effects. Application of this method to the synthesis of fatty acid amides was performed using the esters aminolysis as a key step and various carboxylic amides were prepared in good yield from fatty acid methyl esters (FAMEs). (author)

  16. New hydrazones of ferulic acid: synthesis, characterization and biological activity.

    Science.gov (United States)

    Wolszleger, Maria; Stan, Cătălina Daniela; Apotrosoaei, Maria; Vasincu, Ioana; Pânzariu, Andreea; Profire, Lenuţa

    2014-01-01

    The ferulic acid (4-hydroxy-3-methoxy-cinnamic acid) is a phenolic compound with important antioxidant effects and which nowadays is being extensively studied for his potential indications in inflammatory and neurodegenerative diseases, hypertension, atherosclerosis, etc. The synthesis of new ferulic acid compounds with potential antioxidant activity. The synthesis of the designed compounds was performed in several steps: (i) the obtaining of ferulic acid chloride by reacting of ferulic acid with thionyl chloride; (ii) the reaction between the ferulic acid chloride and hydrazine hydrate 98% to obtain the ferulic acid hydrazide; (iii) the condensation of ferrulic acid hydrazide with various benzaldehydes (2-hydroxy/3-hydroxy/4-hydroxy/2-nitro/3-nitro/4-nitro/2-methoxi/ 4-chloro/4-fluoro/4-bromo-benzaldehyde) resulting the correspond- ing hydrazones. The structure of the synthesized compounds was confirmed by FT-IR spectroscopy and the evaluation of antioxidant potential was achieved by determining the total antioxidant capacity and reducing power. In this study new hydrazones of ferulic acid have been synthesized, physic-chemical and spectral characterized. The evaluation of antioxidant potential using in vitro methods showed the favorable influence of the structural modulation on the antioxidant effects of ferulic acid.

  17. Magnetic solid acid catalyst for biodiesel synthesis from waste oil

    International Nuclear Information System (INIS)

    Li, Junqiao; Liang, Xuezheng

    2017-01-01

    Highlights: • A new magnetic solid acid has been synthesized. • A new solid acid showed high activities for biodiesel synthesis from waste oils under mild condition. • A simple magnetic separation and high stability were the key properties of the new catalyst. - Abstract: A new magnetic solid acid catalyst was synthesized by immobilizing an ionic liquid precursor obtained from (3-aminopropyl)trimethoxysilane onto a magnetic core. The magnetic solid acid catalyst has a core–shell structure, and the acid sites on the shell were easily accessible to reactants. The catalytic activities of the magnetic solid acid were investigated by biodiesel synthesis from waste oils. The solid acid exhibited a higher activity than traditional acid catalysts and the ionic liquid precursor. The core–shell structure and magnetic attraction between the particles provided strong ionic interactions, resulting in the high activity and stability. The main characteristics of the magnetic solid acid catalyst were as follows: easily accessible acidic sites, simple magnetic separation and high waste oil utilization.

  18. Acetylsalicylic acid: Incoming 150 years of the first synthesis

    Directory of Open Access Journals (Sweden)

    Mijin Dušan Ž.

    2002-01-01

    Full Text Available Acetylsalicylic acid is one of the most fascinating and versatile drugs known to medicine, as well as one of the oldest. Acetylsalicylic acid is a drug which is safe, with analgetic, antirheumatic, anti-inflammatory antiplatelet and antithrombotic action. It may be applied not only in clinical practice, but also as prevention. The first known use of an acetylsalicylic acid-like preparation can be traced to ancient Greece. In 1853 Charles Gerhardt published the first synthesis of acetylsalicylic acid. Felix Hoffmann, a chemist for Friedrich Bayer, a German dye company obtained a patent on acetylsalicylic acid some 40 years later. Bayer coined the name Aspirin for the new product. The 20 in century was the century in which many researchers in many companies tried to improve the synthesis of acetylsalicylic acid not only in terms of yield but also purity. This paper describes the history, use, mechanism of action, synthesis and production as well as the purification and stability of acetylsalicylic acid.

  19. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    Science.gov (United States)

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  20. Synthesis and characterisation of highly fluorescent core–shell nanoparticles based on Alexa dyes

    International Nuclear Information System (INIS)

    Natte, Kishore; Behnke, Thomas; Orts-Gil, Guillermo; Würth, Christian; Friedrich, Jörg F.; Österle, Werner; Resch-Genger, Ute

    2012-01-01

    Current and future developments in the emerging field of nanobiotechnology are closely linked to the rational design of novel fluorescent nanomaterials, e.g. for biosensing and imaging applications. Here, the synthesis of bright near infrared (NIR)-emissive nanoparticles based on the grafting of silica nanoparticles (SNPs) with 3-aminopropyl triethoxysilane (APTES) followed by covalent attachment of Alexa dyes and their subsequent shielding by an additional silica shell are presented. These nanoparticles were investigated by dynamic light scattering (DLS), transmission electron microscopy (TEM) and fluorescence spectroscopy. TEM studies revealed the monodispersity of the initially prepared and fluorophore-labelled silica particles and the subsequent formation of raspberry-like structures after addition of a silica precursor. Measurements of absolute fluorescence quantum yields of these scattering particle suspensions with an integrating sphere setup demonstrated the influence of dye labelling density-dependent fluorophore aggregation on the signaling behaviour of such nanoparticles.

  1. Pimelic acid, the first precursor of the Bacillus subtilis biotin synthesis pathway, exists as the free acid and is assembled by fatty acid synthesis.

    Science.gov (United States)

    Manandhar, Miglena; Cronan, John E

    2017-05-01

    Biotin synthetic pathways are readily separated into two stages, synthesis of the seven carbon α, ω-dicarboxylic acid pimelate moiety and assembly of the fused heterocyclic rings. The biotin pathway genes responsible for pimelate moiety synthesis vary widely among bacteria whereas the ring synthesis genes are highly conserved. Bacillus subtilis seems to have redundant genes, bioI and bioW, for generation of the pimelate intermediate. Largely consistent with previous genetic studies it was found that deletion of bioW caused a biotin auxotrophic phenotype whereas deletion of bioI did not. BioW is a pimeloyl-CoA synthetase that converts pimelic acid to pimeloyl-CoA. The essentiality of BioW for biotin synthesis indicates that the free form of pimelic acid is an intermediate in biotin synthesis although this is not the case in E. coli. Since the origin of pimelic acid in Bacillus subtilis is unknown, 13 C-NMR studies were carried out to decipher the pathway for its generation. The data provided evidence for the role of free pimelate in biotin synthesis and the involvement of fatty acid synthesis in pimelate production. Cerulenin, an inhibitor of the key fatty acid elongation enzyme, FabF, markedly decreased biotin production by B. subtilis resting cells whereas a strain having a cerulenin-resistant FabF mutant produced more biotin. In addition, supplementation with pimelic acid fully restored biotin production in cerulenin-treated cells. These results indicate that pimelic acid originating from fatty acid synthesis pathway is a bona fide precursor of biotin in B. subtilis. © 2017 John Wiley & Sons Ltd.

  2. Chemical synthesis, characterisation, analytical method development and control to promote exposure assessments and toxicological testing. Highlights from COMPARE

    Energy Technology Data Exchange (ETDEWEB)

    Bergman, Aa.; Malmberg, T.; Weiss, J. [Stockholm Univ. (Sweden). Dept. of Environmental Chemistry

    2004-09-15

    The issue of endocrine disruptor effects in wildlife and humans grow increasingly important during the 1990s'. As part of the focus on endocrine disruptors new contaminants and their metabolites were put forward for studies with endpoints related to hormone disruption. One such large group of chemicals and/or metabolites of neutral semi-persistent or persistent compounds was the substituted phenols, particularly the halogenated phenolic compounds (HPCs). Polychlorobiphenylols (OHPCBs) were reported to be strongly retained in human blood plasma in 1995 and this article was the first study to point out the general retention of several OH-PCBs in the plasma. The metabolic formation of OH-PCBs was well known and the specific blood retention had been reported for at least one PCB congener, 3,3',4,4'-tetrachlorobiphenyl (CB-77) in some previous studies. The identification of OH-PCBs being retained in blood and their specific binding to transthyretin (TTR) has formed much of the basis for two EU R and D programs, first RENCO and now COMPARE. The present report is aimed to highlight some of the results obtained within the COMPARE program mainly dealing with the chemical synthesis, characterisation and analytical aspects of HPCs.

  3. Cyclopentadithiophene–naphthalenediimide polymers; synthesis, characterisation, and n-type semiconducting properties in field-effect transistors and photovoltaic devices

    Energy Technology Data Exchange (ETDEWEB)

    Li, Chun-Han [Department of Chemical Engineering, Frontier Research Center on Fundamental and Applied Sciences of Matters, National Tsing-Hua University, 101, Sec. 2, Kuang-Fu Road, Hsin-Chu 30013, Taiwan (China); Kettle, Jeff [School of Electronics, Bangor University, Dean st., Bangor, Gwynedd, LL57 1UT Wales (United Kingdom); Horie, Masaki, E-mail: mhorie@mx.nthu.edu.tw [Department of Chemical Engineering, Frontier Research Center on Fundamental and Applied Sciences of Matters, National Tsing-Hua University, 101, Sec. 2, Kuang-Fu Road, Hsin-Chu 30013, Taiwan (China)

    2014-04-01

    The synthesis, characterisation, and device performance of a series of cyclopentadithiophene (CPDT)-naphthalenediimide (NDI) donor-acceptor-donor (D-A-D) polymers is reported. The monomers with various alkyl chains are synthesised via direct arylation using palladium complex catalyst. The monomers are then polymerised by oxidative polymerisation using FeCl{sub 3} to provide high molecular weight polymers (M{sub n} = 21,800–76,000). The polymer films show deep-red absorption including near-infrared region up to 1100 nm to give optical bandgap of approximately 1.16 eV. The polymers exhibit only n-type semiconducting properties giving the highest electron mobility of 9 × 10{sup -3} cm{sup 2} V{sup −1} s{sup −1} in organic field-effect transistors (OFETs). Organic photovoltaic (OPV) devices are fabricated from solutions of the polymers as acceptors and poly(3-hexylthiophene) (P3HT) as a donor. - Highlights: • Cyclopentadithiophene–naphthalenediimide oligomers were prepared by direct arylation. • The oligomers were polymerised by oxidative reaction using iron(III)chloride. • The polymer films show deep-red absorption up to 1100 nm with a bandgap of 1.1 eV. • The polymers exhibit only n-type semiconducting properties in OFETs and OPVs.

  4. Modular Regiospecific Synthesis of Nitrated Fatty Acids

    DEFF Research Database (Denmark)

    Hock, Katharina J.; Grimmer, Jennifer; Göbel, Dominik

    2016-01-01

    Endogenous nitrated fatty acids are an important class of signaling molecules. Herein a modular route for the efficient and regiospecific preparation of nitrooleic acids as well as various analogues is described. The approach is based on a simple set of alkyl halides as common building blocks...

  5. Uronic Acids in Oligosaccharide and Glycoconjugate Synthesis

    NARCIS (Netherlands)

    Codee, Jeroen D. C.; Christina, Alphert E.; Walvoort, Marthe T. C.; Overkleeft, Herman S.; Van der Marel, Gijsbert A.; FraserReid, B; Lopez, JC

    2011-01-01

    This chapter describes the assembly of uronic acid containing oligosaccharides and glycoconjugates. Two strategies are available to access these target molecules, namely a pre-glycosylation oxidation approach, in which uronic acid building blocks are used, and a post-glycosylation oxidation

  6. Kynurenic acid synthesis by human glioma

    DEFF Research Database (Denmark)

    Vezzani, A; Gramsbergen, J B; Versari, P

    1990-01-01

    Biopsy material from human gliomas obtained during neurosurgery was used to investigate whether pathological human brain tissue is capable of producing kynurenic acid (KYNA), a natural brain metabolite which can act as an antagonist at excitatory amino acid receptors. Upon in vitro exposure to 40...

  7. Automatic synthesis apparatus for 11C-fatty acids

    International Nuclear Information System (INIS)

    Iida, Shigenori

    1981-01-01

    Such short-lived nuclides as 11 C, 13 N and 15 O for nuclear-medicine diagnosis are produced with the in-house cyclotrons in hospitals. After the production, their compounds are synthesized, and used for diagnosis immediately. Of these nuclides, 11 C with relatively long half-life is the most useful. In the synthesis of its compounds, first the rapid procedure is required. Then, the start from large quantity of radioactivity is frequently carried out to secure the activity sufficient for the imaging of organs. Therefore, the synthesis must be conducted by remote operation for the radiation protection of personnel. The development of an automatic synthesis apparatus for labeled-compounds is made along this line. Taking up the case of 11 C-fatty acids, the following matters are described: synthetic reactions, the synthesis of 11 C-fatty acids, an automatic synthesis apparatus for 11 C-fatty acid made for trial, and applications. (J.P.N.)

  8. Stereoselective synthesis of unsaturated α-amino acids.

    Science.gov (United States)

    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

    2015-06-01

    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.

  9. New catalytic processes for the synthesis of adipic acid

    OpenAIRE

    Raabová, Katerina

    2011-01-01

    The aim of my Ph.D. research was to study the new synthetic ways for the production of adipic acid. Three different pathways were studied: i) oxidation of cyclohexanone with molecular oxygen using Keggin – heteropolycompounds as the catalyst, ii) Baeyer – Villiger oxidation of cyclohexanone with hydrogen peroxide in the presence of two different heterogeneous catalysts, titanium silicalite and silica grafted decatungstate, iii) two step synthesis of adipic acid starting from cyclohexene ...

  10. Comparison of bile acid synthesis determined by isotope dilution versus fecal acidic sterol output in human subjects

    International Nuclear Information System (INIS)

    Duane, W.C.; Holloway, D.E.; Hutton, S.W.; Corcoran, P.J.; Haas, N.A.

    1982-01-01

    Fecal acidic sterol output has been found to be much lower than bile acid synthesis determined by isotope dilution. Because of this confusing discrepancy, we compared these 2 measurements done simultaneously on 13 occasions in 5 normal volunteers. In contrast to previous findings, bile acid synthesis by the Lindstedt isotope dilution method averaged 16.3% lower than synthesis simultaneously determined by fecal acidic sterol output (95% confidence limit for the difference - 22.2 to -10.4%). When one-sample determinations of bile acid pools were substituted for Lindstedt pools, bile acid synthesis by isotope dilution averaged 5.6% higher than synthesis by fecal acidic sterol output (95% confidence limits -4.9 to 16.1%). These data indicate that the 2 methods yield values in reasonably close agreement with one another. If anything, fecal acidic sterol outputs are slightly higher than synthesis by isotope dilution

  11. Succinic Acid Synthesis by Ethanol-Grown Yeasts

    Directory of Open Access Journals (Sweden)

    Svetlana V. Kamzolova

    2009-01-01

    Full Text Available The synthesis of succinic acid in ethanol-containing media has been tested in 32 yeasts of different genera (Debaryomyces, Candida, Pichia, Saccharomyces, Torulopsis. The capability of succinic acid synthesis was revealed in 29 strains, from which two most effective producers were selected. When grown in a fermentor under high aeration in mineral medium with pulsed addition of ethanol, the strain Candida catenulata VKM Y-5 produced succinic acid up to 5.2 g/L with mass yield of 32.6 % and energy yield of 14.8 %; the other strain, Candida zeylanoides VKM Y-2324, excreted 9.4 g/L of succinic acid with mass and energy yields of 39 and 17.8 %, respectively. It was indicated that succinic acid formation in the yeasts was accompanied by the synthesis of considerable amounts of malic acid, which was apparently due to a high activity of the glyoxylate cycle. Growth characteristics of both strains were studied in dependence on the concentrations of ethanol, zinc ions and nitrogen in the medium.

  12. An efficient synthesis of tetramic acid derivatives with extended conjugation from L-Ascorbic Acid

    Directory of Open Access Journals (Sweden)

    Bisht Surendra S

    2006-12-01

    Full Text Available Abstract Background Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L- ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. Results 5,6-O-Isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. Conclusion An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance.

  13. Phenylboronic acid catalysed synthesis of 1, 5-benzodiazepines via ...

    Indian Academy of Sciences (India)

    Phenylboronic acid has been found to be an efficient catalyst for the synthesis of 1,5-benzodiazepine derivatives via cyclocondensation of -phenylenediamine and various ketones in good to excellent yields (82-91%) using acetonitrile as solvent at reflux condition. The remarkable advantages offered by this method are ...

  14. Phenylboronic acid catalysed synthesis of 1,5-benzodiazepines via ...

    Indian Academy of Sciences (India)

    J. Chem. Sci. Vol. 125, No. 4, July 2013, pp. 745–749. c Indian Academy of Sciences. Phenylboronic acid catalysed synthesis of 1,5-benzodiazepines via cyclocondensation of ... active compounds and gaining great consideration in the field of .... thesis of this heterocycles was accomplished by con- densation reaction of ...

  15. Acyl-meldrum's acid in regiospecific synthesis of isotopjcally ...

    African Journals Online (AJOL)

    Acyl-meldrum's acid in regiospecific synthesis of isotopjcally labelled compounds for polyketide biosynthetic studies. Isaiah o. Ndiege, James Staunton. Abstract. Bull. Chem. Soc. Ethiop. 1995, 9(1), 43-49. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT.

  16. Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...

    Indian Academy of Sciences (India)

    The design and synthesis of molecules containing non-interacting Lewis base and Lewis acid groups. [Frustrated Lewis pairs (FLP's)] have received intense attention due to their potential applications in the area of molecular catalysis.1–3. For example,. Stephen's and co-workers have demonstrated that the unquenched ...

  17. Phenylboronic acid catalysed synthesis of 1,5-benzodiazepines via ...

    Indian Academy of Sciences (India)

    Phenylboronic acid has been found to be an efficient catalyst for the synthesis of 1,5-benzodiazepine derivatives via cyclocondensation of -phenylenediamine and various ketones in good to excellent yields (82-91%) using acetonitrile as solvent at reflux condition. The remarkable advantages offered by this method are ...

  18. A novel synthesis of chromone based unnatural -amino acid ...

    Indian Academy of Sciences (India)

    VENU KANDULA

    bromomethyl chromone has been described. Using this method ... inal work on synthesis of unnatural amino acids has been done by O'Donnell22 and ... To a solution of compound 6a (20 g, 147.12 mmol) in DMF. (57 mL, 735.02 mmol) was added ...

  19. Synthesis, stabilisation and characterisation of rhamnolipid-capped ZnS nanoparticles in aqueous medium.

    Science.gov (United States)

    Narayanan, J; Ramji, R; Sahu, H; Gautam, P

    2010-06-01

    Capping agents stabilise the size of the nanoparticles in the range of 1-10 nm. Microbial surfactants as capping agents are beneficial replacements for chemically synthesised ones because of lower toxicity. Rhamnolipids are surfactants produced by Pseudomonas aeruginosa, having high affinity for metal ions. In this study, the authors used rhamnolipids for capping ZnS nanoparticles. The capped particles were stabilised in aqueous environment and its characteristics were studied using Fourier transform infrared spectroscopy (FT-IR), small angle X-ray scattering (SAXS), high resolution transmission electron microscopy (HR-TEM) and ultraviolet-visible spectra, fluorescence spectra. The particle Bohr radius was found to be 4.5 nm both by SAXS and HRTEM, thus proving rhamnolipid to be an effective capping agent for the synthesis of uniform nanoparticles. SAXS study not only reveals the particle size and distribution but also its self-affined agglomeration behaviour. This work is a novel method for stabilising nanoparticles in aqueous condition using biosurfactant.

  20. Synthesis and characterisation of scintillating microspheres made of polystyrene/polycarbonate for 222Rn measurements

    International Nuclear Information System (INIS)

    Pelay, Eduard; Garcia, Jose Francisco; Mitev, Krasimir; Dutsov, Chavdar; Georgiev, Strahil; Tsankov, Ludmil

    2017-01-01

    Several studies have demonstrated that polycarbonate-based polymers have good capacities for the absorption of 222 Rn. Meanwhile, polystyrene polymers are reported to be the most appropriate for developing plastic scintillator materials for the detection of radioactivity. The objective of this work was to develop plastic scintillators in the form of microspheres (PSm) composed of polystyrene and polycarbonate that could be used to measure 222 Rn and improve this performance thanks to the combination of characteristics of both polymers. Our results show that PSm of polystyrene and polycarbonate can be made via the evaporation/extraction method, despite the two polymers not being miscible. From the point of view of the radioactive measurements, we observed that the addition of polycarbonate causes quenching, although it does not significantly affect the detection efficiency for alpha and high-energy beta emitters. From the point of view of 222 Rn absorption, we observed that synthesis of the PSm through the evaporation/extraction method changes the 222 Rn absorption of the raw material. This result demonstrates that the method of production of the polymer and the resulting physical characteristics are a key parameter for its final 222 Rn absorption properties. (author)

  1. Synthesis and ammonolysis of nickel and cobalt tungstates and their characterisation

    Directory of Open Access Journals (Sweden)

    J.L. Rico

    2016-07-01

    Full Text Available The synthesis and characterization of NiW and CoW compounds are herein reported. The NiWO4 and CoWO4 samples, successfully synthesised by the hydrothermal method, were treated under NH3 to obtain the metal nitride. The SEM micrographs show that this transformation is a topotactic process. Tungsten trioxide was also treated under NH3 at similar operating conditions, and used as a reference. High nitrogen contents after ammonolysis were calculated, however, the percentages were below the theoretical values assuming the formation of pure NiWN, CoWN and WN. The XRD pattern indicates that WON is likely formed after ammonolysis of tungsten oxide whereas phase segregation was observed on the nickel and cobalt samples. Furthermore, the reactivity of the nitride samples as function of temperature was measured under argon and the results show that most of the nitrogen is removed from the cobalt and nickel samples whereas it was partially released from the tungsten specimen.

  2. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    Science.gov (United States)

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  3. The Use of Supported Acidic Ionic Liquids in Organic Synthesis

    Directory of Open Access Journals (Sweden)

    Rita Skoda-Földes

    2014-06-01

    Full Text Available Catalysts obtained by the immobilisation of acidic ionic liquids (ILs on solid supports offer several advantages compared to the use of catalytically active ILs themselves. Immobilisation may result in an increase in the number of accessible active sites of the catalyst and a reduction of the amount of the IL required. The ionic liquid films on the carrier surfaces provide a homogeneous environment for catalytic reactions but the catalyst appears macroscopically as a dry solid, so it can simply be separated from the reaction mixture. As another advantage, it can easily be applied in a continuous fixed bed reactor. In the present review the main synthetic strategies towards the preparation of supported Lewis acidic and Brønsted acidic ILs are summarised. The most important characterisation methods and structural features of the supported ionic liquids are presented. Their efficiency in catalytic reactions is discussed with special emphasis on their recyclability.

  4. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    Directory of Open Access Journals (Sweden)

    Akiyoshi Hoshino

    2009-06-01

    Full Text Available Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1 system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source and keto acids (oxylic acid sources. In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin.

  5. Stereoselective synthesis of stable-isotope-labeled amino acids

    International Nuclear Information System (INIS)

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-01-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the α-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids

  6. Flash combustion synthesis and characterisation of nanosized proton conducting Yttria-doped barium cerate

    Energy Technology Data Exchange (ETDEWEB)

    Jacquin, M.; Jing, Y.; Essoumhi, A.; Taillades, G.; Jones, D.J.; Roziere, J. [Montpellier Univ., Montpellier (France). Lab. des Agregats Moleculaires et Materiaux Inorganiques

    2007-10-15

    The high conversion efficiency of proton ceramic fuel cells renders them a promising technology for electric power conversion. They also function in an intermediate temperature range (400 to 600 degrees C) where the problem of thermal ageing can be avoided. This paper presented a newly developed flash combustion method for the preparation of proton conducting yttrium-doped barium cerate nanopowders. This quick, safe and low cost route takes advantage of the exothermic and self-sustaining redox reaction between high oxygen content metal salts and a suitable fuel that acts as a reducing agent. The parameters that influence the reaction product are the type of fuel, the fuel to oxidizer ratio, and the ignition temperature. Use of suitable fuel in combustion syntheses ensures stability of the chemical composition and high quality of products, and produces non-toxic gases. In this study, the flash combustion synthesis method was used to ignite the mixture at 600 degrees C. The resulting fine powder was characterized by transmission and scanning electron microscopy, and X-ray diffraction. The resulting nano-sized crystallites allow for the preparation of fully densified materials with densities up to 98 per cent. Water uptake was examined in compressed and sintered samples of BaCe{sub 0.9}Y{sub 0.1}O{sub 2.95} (BCY10). Bulk and total conductivities were determined with impedance spectroscopy in the range 300 to 600 degrees C. Densified yttria doped barium cerate materials show a bulk conductivity of 2.3 x 10{sup -2} S/cm and a total conductivity of 1.2 x 10{sup -2} S/cm at 500 degrees C. The temperature dependence was close to that of the bulk. It was concluded that flash combustion is an interesting alternative method for preparing proton conducting oxides for intermediate temperature fuel cells. 28 refs., 1 tab., 10 figs.

  7. Synthesis and characterisation of pure C(-A)-S-H phases

    International Nuclear Information System (INIS)

    L'Hopital, E.; Lothenbach, B.; Le Saout, G.; Kulik, D.A.; Scrivener, K.

    2015-01-01

    The construction of nuclear power plants requires huge quantity of cement and the cement production generates about 8% of global man-made CO 2 emissions. One way of reducing the concrete's CO 2 contribution is to lower its CO 2 generation and energy consumption by a partial replacement of clinker with supplementary cementitious materials (SCMs). Common SCMs such as blast furnace slag or fly ash contain more silicon and aluminium than Portland cement, so that the hydrates formed are different than in Portland cements, which might affect the concrete mechanical properties. The most important phase formed during the reaction of Portland cement with water is calcium silicate hydrate, C-S-H. In the presence of SCMs, C-S-H can have different composition compared to C-S-H in Portland cements. The present work focuses on synthesis of pure C(-A)- S-H at a Ca/Si ratio equal to 1 in presence of different quantities of aluminium (Al/Si atomic ratio from 0 to 0.05) to determine the aluminium incorporation in C-S-H. The absence of any other solids and the low aluminium concentrations measured in the solution clearly showed an uptake of aluminium within the C-(A)-S-H phase. The presence of aluminium increased the interlayer distance, indicating an uptake of aluminium in the C-(A)-S-H structure. The uptake of aluminium was more pronounced at higher dissolved aluminium concentrations, consistent with the formation of a solid solution between C-S-H and C-A-S-H. The presence of aluminium led to a decrease of the calcium concentrations, while the silica and aluminium concentrations increased

  8. Synthesis of Uncarbonised Coconut Shell Nanoparticles: Characterisation and Particle Size Determination

    Directory of Open Access Journals (Sweden)

    S.A. Bello

    2015-06-01

    Full Text Available The possibility of using mechanical milling for the synthesis of uncarbonised coconut shell nanoparticles (UCSNPs has been investigated. UCSNPs were synthesized from discarded coconut shells (CSs using top down approach. The sundried CSs were crushed, ground and then sieved using hammer crusher, a two disc grinder and set of sieves with shine shaker respectively. The CS powders retained in the pan below 37 µm sized sieve were milled for 70 hours to obtain UCSNPS. Samples for analysis were taken at 16 and 70 hours. UCSNPs were analyzed using transmission electron microscope (TEM, scanning electron microscope (SEM with attached EDS and Gwyddion software. Samples of UCSNPs obtained at 16 and 70hours show that the deep brown colour of the initial CS powder became fading as the milling hour increased. The size determination from TEM image revealed spherical particles with an average size of 18.23 nm for UCSNPs obtained at 70 hour milling. The EDS spectrographs revealed an increase in the carbon counts with increased milling hours. This is attributable to dryness of the CS powders by the heat generated during the milling process due to absorption of kinetic energy by the CS powders from the milling balls. SEM micrographs revealed UCSNPs in agglomerated networks. The SEM micrograph/Gyweddion particles size determination showed average particles of 170.5 ±3 and 104.9 ±4.1 nm for UCSNPs obtained at 16 and 70 hours respectively. Therefore, production of UCSNPs through mechanical milling using mixture of ceramic balls of different sizes has been established especially when the particles of the sourced/initial CS powders falls below 37 µm.

  9. Synthesis and chirality of amino acids under interstellar conditions.

    Science.gov (United States)

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.

  10. Fatty Acid Synthesis by Indonesian Marine Diatom, Chaetoceros gracilis

    Directory of Open Access Journals (Sweden)

    ALBERTA RIKA PRATIWI

    2009-12-01

    Full Text Available Since the primary storage nutrients in diatoms consist of lipid, they are potential for the industrial fatty acid production. High value fatty acids include arachidonic acid, eicosapentaenoic acid and docosahexaenoic acid. This study aimed to analyze fatty acid synthesis by Chaetoceros gracilis diatom during growth. There was a large increase in lipid yield from 4pg cell−1 mass of lipid per cell at the exponential phase to 283pg cell−1 at stationary phase. The lipid concentrations also increased significantly from the stationary phase to the death phase, but not significantly from the end exponential phase to the stationary phase. The relative percentage of saturated fatty acid (SAFA of the total fatty acid was higher than that of monounsaturated fatty acid (MUFA and polyunsaturated fatty acid (PUFA at all of growth phase. The highest PUFA was found at stationary phase at the same time when SAFA was being the lowest. The majority of SAFA was palmitic acid (24.03–40.35%. MUFA contained significant proportion of oleic acid (19.6–20.9%. Oleic acid, linoleic acid and á-linolenic acid were found at every stage growth. These fatty acids are considered as precursor for production of long chain PUFA-Docosahexaenoic acid (DHA/22:6ù3 through series of desaturation and elongation step with all of desaturase enzyme (Ä8-D, Ä9-D, Ä12-D, Ä15-D, Ä17-D, Ä6-D, Ä5-D, and Ä4-D and elongase enzyme (E.

  11. Photolabile linker for the synthesis of hydroxamic acids

    DEFF Research Database (Denmark)

    2013-01-01

    The present invention relates to a photolabile hydroxamate linker based on the o - nitroveratryl group and its application for multistep solid-phase synthesis and controlled photolytic release of hydroxamic acids. The invention provides a method for producing a solid support comprising...... a hydroxylamine - functionalized photolabile linker, and the so produced hydroxylamine - functionalized photolabile solid support. The invention further provides a method for synthesizing a one-bead-one compound library of hydroxamic acid derivatives on a photolabile linker, as well as a method for screening...... a library of hydroxamic acid derivatives....

  12. Phosphorus promotion and poisoning in zeolite-based materials: synthesis, characterisation and catalysis

    Science.gov (United States)

    van der Bij, Hendrik E.

    2015-01-01

    Phosphorus and microporous aluminosilicates, better known as zeolites, have a unique but poorly understood relationship. For example, phosphatation of the industrially important zeolite H-ZSM-5 is a well-known, relatively inexpensive and seemingly straightforward post-synthetic modification applied by the chemical industry not only to alter its hydrothermal stability and acidity, but also to increase its selectivity towards light olefins in hydrocarbon catalysis. On the other hand, phosphorus poisoning of zeolite-based catalysts, which are used for removing nitrogen oxides from exhaust fuels, poses a problem for their use in diesel engine catalysts. Despite the wide impact of phosphorus–zeolite chemistry, the exact physicochemical processes that take place require a more profound understanding. This review article provides the reader with a comprehensive and state-of-the-art overview of the academic literature, from the first reports in the late 1970s until the most recent studies. In the first part an in-depth analysis is undertaken, which will reveal universal physicochemical and structural effects of phosphorus–zeolite chemistry on the framework structure, accessibility, and strength of acid sites. The second part discusses the hydrothermal stability of zeolites and clarifies the promotional role that phosphorus plays. The third part of the review paper links the structural and physicochemical effects of phosphorus on zeolite materials with their catalytic performance in a variety of catalytic processes, including alkylation of aromatics, catalytic cracking, methanol-to-hydrocarbon processing, dehydration of bioalcohol, and ammonia selective catalytic reduction (SCR) of NOx. Based on these insights, we discuss potential applications and important directions for further research. PMID:26051875

  13. Synthesis and antimicrobial activity of cholic acid hydrazone analogues.

    Science.gov (United States)

    Rasras, Anas J M; Al-Tel, Taleb H; Al-Aboudi, Amal F; Al-Qawasmeh, Raed A

    2010-06-01

    Synthesis and antimicrobial activity of cholic acid analogues 4a-t are reported. The synthesis of 4a-t was accomplished from ethylcholate 2. The hydrazone moiety was introduced via coupling of the cholic acid hydrazide (3) with appropriately functionalized aldehyde utilizing acetic acid as a catalyst. Quiet of interest in relation to the synthesized hydrazones is the formation of two rotamers s-cis.E and s-trans.E. Most compounds showed stronger antimicrobial activity against Gram-positive bacteria than Cefaclor and Cefixime. Compounds 4d, 4i and 4j indicated 15-fold stronger antimicrobial activities against Enterobacter faecalis compared to Cefaclor and Cefixime. Some of the synthesized compounds (e.g. 4a, 4c, 4d, 4i, and 4l) reflected two-folds less activity against Escherichia coli relative to Cefixime. Copyright (c) 2010 Elsevier Masson SAS. All rights reserved.

  14. Transition Metal Catalyzed Synthesis of Carboxylic Acids, Imines, and Biaryls

    DEFF Research Database (Denmark)

    Santilli, Carola; Madsen, Robert

    Dehydrogenative synthesis of carboxylic acids catalyzed by a ruthenium N- heterocycliccarbene complex. A new methodology for the synthesis of carboxylic acids from primary alcohols and hydroxide has been developed. The reaction is catalyzed by the ruthenium N-heterocycliccarbene complex [RuCl2(Ii...... to the carboxylic acids can be explained by the involvement of a competing Cannizzaro reaction. The scope of the dehydrogenation was further extended to linear and branched saturated aliphatic alcohols, although longer reaction times are necessary to ensure complete substrate conversions. The kinetic isotope effect...... the carboxylate.  Manganese catalyzed radical Kumada-type reaction between aryl halidesand aryl Grignard reagents. The reaction between aryl halides and aryl Grignard reagents catalyzed by MnCl2 has been extended to several methyl-substituted aryl iodide reagents byperforming the reaction at 120 ˚C in a microwave...

  15. Boronic Acid Accelerated Three-Component Reaction for the Synthesis of α-Sulfanyl-Substituted Indole-3-acetic Acids.

    Science.gov (United States)

    Das, Amrita; Watanabe, Kenji; Morimoto, Hiroyuki; Ohshima, Takashi

    2017-11-03

    Boronic acid was used to accelerate a three-component reaction of indoles, thiols, and glyoxylic acids for the synthesis of α-sulfanyl-substituted indole-3-acetic acids. Boronic acid catalysis to activate the α-hydroxy group in α-hydroxycarboxylic acid intermediates and intramolecular assistance by free carboxylic acid were the keys to accelerating the product formation.

  16. High yielding synthesis of N-ethyl dehydroamino acids.

    Science.gov (United States)

    Monteiro, Luís S; Suárez, Ana S

    2012-10-01

    Recently we reported the use of a sequence of alkylation and dehydration methodologies to obtain N-ethyl-α, β-dehydroamino acid derivatives. The application of this N-alkylation procedure to several methyl esters of β,β-dibromo and β-bromo, β-substituted dehydroamino acids protected with standard amine protecting groups was subsequently reported. The corresponding N-ethyl, β-bromo dehydroamino acid derivatives were obtained in fair to high yields and some were used as substrates in Suzuki cross-coupling reactions to give N-ethyl, β,β-disubstituted dehydroalanine derivatives. Herein, we further explore N-ethylation of β-halo dehydroamino acid derivatives using triethyloxonium tetrafluoroborate as alkylating agent, but substituting N,N-diisopropylethylamine for potassium tert-butoxide as auxiliary base. In these conditions, for all β-halo dehydroamino acid derivatives, reactions were complete and the N-ethylated derivative could be isolated in high yield. This method was also applied for N-ethylation of non-halogenated dehydroamino acids. Again, with all compounds the reactions were complete and the N-ethyl dehydroamino acid derivatives could be isolated in high yields. Some of these N-ethyl dehydroamino acid methyl ester derivatives were converted in high yields to their corresponding acids and coupled to an amino acid methyl ester to give N-ethyl dehydrodipeptide derivatives in good yields. Thus, this method constitutes a general procedure for high yielding synthesis of N-ethylated dehydroamino acids, which can be further applied in peptide synthesis.

  17. Synthesis and characterization of Trichloroisocyanouric acid ...

    Indian Academy of Sciences (India)

    Abstract. Trichloroisocyanouric acid (TCCA)-functionalized mesoporous silica nanocomposites (SBA/. TCCA) were synthesized and characterized for the acylation of indole. The uniform incorporation of TCCA inside the SBA-15 matrix was confirmed by standard characterization techniques (PXRD, Adsorption studies,. FT-IR ...

  18. Synthesis and Characterization of Oleic Acid Stabilized ...

    African Journals Online (AJOL)

    Oleic acid stabilized magnetite nanocrystals have been synthesized by the organic phase thermal decomposition of iron oleate complex in 1-octadecene for potential application as magnetic resonance imaging (MRI) contrast agent. The synthetic process resulted in 13.5 and 15.1 nm highly monodisperse nanocrystals as ...

  19. Synthesis, characterisation and evaluation of N-mannich bases of 2-substituted Benzimidazole derivatives

    Science.gov (United States)

    Vinoth Kumar, Sekar; Subramanian, Mohan Raj; Chinnaiyan, Santhosh Kumar

    2013-01-01

    Rationale Benzimidazoles and its derivatives represent one of the mainly biological active classes of literature. Aim In this present study aimed to synthesize N-mannich bases derivatives compounds bearing of 2-substituted benzimidazole moiety, in order to investigate their possible biological activity. Method Benzimidazole compounds were prepared from the condensation reaction between ortho phenylene diamine and various acids. Mannich base of newly synthesized Benzimidazole derivatives were synthesized from 2-substituted Benzimidazoles by reacting with secondary amines. The purity of the compounds was ascertained by melting point (m.p) and thin layer chromatography (TLC). Structures of the synthesized compounds were elucidated by spectral data. Antimicrobial assay was performed by microbroth dilution method. Bacterial genomic DNA cleavage was assessed by Agarose gel electrophoresis. Toxicity of the most effective compounds was studied by Brine-shrimp lethality assay. Result Among the synthesized compounds, compound 5E (a) and (b) was establish to be the most potent against all tested microorganisms. This two compounds exhibited complete bacterial DNA cleavage and non-toxic. Conclusion These results suggest that it an interesting compound compared to the current therapeutic agents and are considered to investigate further for the same. PMID:24563595

  20. The optimisation study of tbp synthesis process by phosphoric acid

    International Nuclear Information System (INIS)

    Amedjkouh, A.; Attou, M.; Azzouz, A.; Zaoui, B.

    1995-07-01

    The present work deals with the optimisation study of TBP synthesis process by phosphoric acid. This way of synthesis is more advantageous than POCL3 or P2O5 as phosphatant agents. these latters are toxic and dangerous for the environnement. The optimisation study is based on a series of 16 experiences taking into account the range of variation of the following parameters : temperature, pressure, reagents mole ratio, promoter content. the yield calculation is based on the randomisation of an equation including all parameters. the resolution of this equation gave a 30% TBP molar ratio. this value is in agreement with that of experimental data

  1. Stepwise hydrogeological characterisation utilising a geo-synthesis methodology - A case study from the Mizunami Underground Research Laboratory Project

    International Nuclear Information System (INIS)

    Saegusa, H.; Osawa, H.; Onoe, H.; Ohyama, T.; Takeuchi, R.; Takeuchi, S.

    2009-01-01

    The Mizunami Underground Research Laboratory (MIU) is now under construction by Japan Atomic Energy Agency (JAEA) in the Cretaceous Toki granite in the Tono area of central Japan. One of the main goals of the MIU project, which is a broad scientific study of the deep geological environment as a basis of research and development for geological disposal of nuclear wastes, is to establish comprehensive techniques for the investigation, analysis and assessment of the deep geological environment in fractured crystalline rock. For this purpose, a geo-synthesis methodology has been developed and will be tested in a dry run to determine if it produces the data required for repository design and associated integrated safety assessment modelling. Surface-based hydrogeological characterisation, intended to develop conceptual models of the deep geological environment based on an understanding of the undisturbed conditions before excavation of this URL, was carried out in a stepwise manner. This allows field investigations, construction of geological and hydrogeological models and interpretation of resultant groundwater flow simulations to develop in an iterative manner. Investigations have the goal of obtaining information on factors relevant to repository design, associated construction, operational and postclosure safety assessment, evaluation of the practicality of implementation and environmental impact assessment. Such factors include bulk hydraulic conductivity, the locations and properties of water conducting features, direct and indirect indicators of regional and local flow (e.g. based on chemistry or isotopes), etc. Following evaluation of pre-existing site information, field investigations began with fault mapping. This was followed by reflection seismic and vertical seismic profile surveys. In addition, a large programme of investigations was carried out in boreholes, including cross-hole tomography and hydraulic tests. Such input is utilised for the construction

  2. Synthesis of azido derivatives of mucobromic acid

    Directory of Open Access Journals (Sweden)

    N. Mbebe

    2013-04-01

    Full Text Available Mucobromic acid is a highly reactive multicentered molecule. It was converted to its corresponding but unstable diazido derivative by reaction with two equivalents of sodium azide. The resultant 3,4-diazido-5-hydroxyfuran-2(5H-one was obtained in moderate yield (42% but decomposed readily even at low temperatures. Its more stable analogue 3,4-diazido-5-methoxyfuran-2(5H-one was obtained in excellent yield after reacting 5-methoxy-3,4-dibromofuranone with two equivalents of sodium azide. The 4,5-dibromopyridazinones which are in effect masked mucobromic acid derivatives, underwent nucleophilic substitution reactions with various nucleophiles, including azides and afforded corresponding azidopyridazinones in good yields. The synthesized azido-furanone and pyridazinone derivatives are earmarked for click reactions.DOI: http://dx.doi.org/10.4314/bcse.v27i1.17

  3. Fatty acid effects on fibroblast cholesterol synthesis

    Energy Technology Data Exchange (ETDEWEB)

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  4. A magenta polypyrrole derivatised with Methyl Red azo dye: synthesis and spectroelectrochemical characterisation

    International Nuclear Information System (INIS)

    Almeida, Andresa K.A.; Dias, Jéssica M.M.; Santos, Diego P.; Nogueira, Fred A.R.; Navarro, Marcelo; Tonholo, Josealdo; Lima, Dimas J.P.; Ribeiro, Adriana S.

    2017-01-01

    Highlights: • A pyrrole (Py) derivative functionalised with methyl red (MRPy) was synthesised. • MRPy was polymerised electrochemically in LiClO 4 /CH 3 CN with BFEE. • Electrochromic properties of PMRPy and PPy doped with methyl red (PPy/MR) were compared. • Colour of the PMRPy changes from magenta to yellow depending on the pH. • PMRPy films might be applicable in optoelectronic devices or in pH sensors. - Abstract: A pyrrole derivative bearing 2-(4-dimethylaminophenylazo)benzoic acid, also known as Methyl Red (MR), was prepared by a simple synthetic route, and electropolymerised onto ITO/glass electrodes in (C 4 H 9 ) 4 NBF 4 /CH 3 CN in presence of boron trifluoride diethyl etherate (BFEE). Films of polypyrrole (PPy) and PPy doped with MR (PPy/MR) were also deposited onto ITO/glass in order to compare their electrochromic properties with the films of PPy derivatised with MR. Cyclic voltammogram of the poly[3-(N-pyrrolyl)propyl 2-(4-dimethylaminophenylazo)benzoate] (PMRPy) film displayed a redox pair with anodic peak potential (Epa) at ca. 0.53 V and cathodic peak potential (Epc) at 0.25 V vs. Ag/Ag + , corresponding to the polymer p-doping, whilst the PPy/MR film shows capacitive behaviour with a redox pair in the cathodic region (Epa = −0.36 V and Epc = −0.62 V), similar to the PPy film (Epa = −0.10 V, and Epc = −0.15 V), and an anodic wave in the same potential range of that for PMRPy film. The electrochromic properties of the PMRPy film, such as chromatic contrast (Δ%T = 34.2%), switching time (τ = 10 s) and stability (Δ%T = 15% at the 100th cycle), were enhanced relative to the PPy/MR and PPy films. However, the colour of the PMRPy film changed from yellow (-0.8 V) to magenta (E = 1.0 V) in the first cycle and became light magenta at −0.8 V in the subsequent cycles. PMRPy films were also investigated in phosphate buffer solution (PBS, 2.0 ≤ pH ≤ 9.0) and after exposure to HCl vapour, in which the colour varied from magenta at p

  5. Spectroscopic characterisation of interaction of ferulic acid with aldehyde dehydrogenase (ALDH).

    Science.gov (United States)

    Kolawole, Ayodele O; Agaba, Ruth J; Oluwole, Matthew O

    2017-05-01

    Interaction of a pharmacological important phenolic, ferulic acid, with Aldehyde dehydrogenase (ALDH) at the simulative pH condition, was studied using spectroscopic approach. Ferulic acid caused a decrease in the fluorescence intensity formed from ALDH-ferulic acid complex resulting in mixed inhibition of ALDH activity (IC 50 =30.65μM). The intrinsic quenching was dynamic and induced altered conformation of ALDH and made the protein less compact but might not unfold it. ALDH has two binding sites for ferulic acid at saturating concentrations having association constant of 1.35×10 3 Lmol -1 and a dissociation constant of 9.7×10 7 Lmol -1 at 25°C indicating ALDH-ferulic acid complex formation is more favourable than its dissociation. The interaction was not spontaneous and endothermic and suggests the involvement of hydrophobic interactions with a FRET binding distance of 4.49nm. Change in pH near and far from isoelectric points of ferulic acid did not affect the bonding interaction. Using trehalose as viscosogen, the result from Stoke-Einstein hypothesis showed that ferulic acid-ALDH binding and dissociation equilibrium was diffusion controlled. These results clearly suggest the unique binding properties and lipophilicity influence of ferulic acid. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Is docosahexaenoic acid synthesis from α-linolenic acid sufficient to supply the adult brain?

    Science.gov (United States)

    Domenichiello, Anthony F; Kitson, Alex P; Bazinet, Richard P

    2015-07-01

    Docosahexaenoic acid (DHA) is important for brain function, and can be obtained directly from the diet or synthesized in the body from α-linolenic acid (ALA). Debate exists as to whether DHA synthesized from ALA can provide sufficient DHA for the adult brain, as measures of DHA synthesis from ingested ALA are typically <1% of the oral ALA dose. However, the primary fate of orally administered ALA is β-oxidation and long-term storage in adipose tissue, suggesting that DHA synthesis measures involving oral ALA tracer ingestion may underestimate total DHA synthesis. There is also evidence that DHA synthesized from ALA can meet brain DHA requirements, as animals fed ALA-only diets have brain DHA concentrations similar to DHA-fed animals, and the brain DHA requirement is estimated to be only 2.4-3.8 mg/day in humans. This review summarizes evidence that DHA synthesis from ALA can provide sufficient DHA for the adult brain by examining work in humans and animals involving estimates of DHA synthesis and brain DHA requirements. Also, an update on methods to measure DHA synthesis in humans is presented highlighting a novel approach involving steady-state infusion of stable isotope-labeled ALA that bypasses several limitations of oral tracer ingestion. It is shown that this method produces estimates of DHA synthesis that are at least 3-fold higher than brain uptake rates in rats. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  7. Characterisation of lactic acid bacteria in spontaneously fermented camel milk and selection of strains for fermentation of camel milk

    DEFF Research Database (Denmark)

    Fugl, Angelina June Brandt; Berhe, Tesfemariam; Kiran, Anil

    2017-01-01

    The microbial communities in spontaneously fermented camel milk from Ethiopia were characterised through metagenomic 16S rRNA sequencing and lactic acid bacteria were isolated with the goal of selecting strains suitable as starter cultures. The fermented camel milk microbiota was dominated either...... by Lactobacillales or by Enterobacteriaceae, depending on incubation temperature and the provider of the milk. Strains of species with a potential use as starter cultures i.e., Lactococcus lactis, Lactobacillus plantarum, and Pediococcus acidilactici, were isolated. Fast acidifiers of camel milk have been isolated...... from the species of Lc. lactis, P. acidilactici, and Streptococcus infantarius. Gram-negative and potentially pathogenic microorganisms were frequent in spontaneously fermented camel milk, indicating the need for improved hygiene in Ethiopian camel farms. The profiled microbiota of spontaneously...

  8. Acid-Base Chemistry of White Wine: Analytical Characterisation and Chemical Modelling

    Directory of Open Access Journals (Sweden)

    Enrico Prenesti

    2012-01-01

    Full Text Available A chemical model of the acid-base properties is optimized for each white wine under study, together with the calculation of their ionic strength, taking into account the contributions of all significant ionic species (strong electrolytes and weak one sensitive to the chemical equilibria. Coupling the HPLC-IEC and HPLC-RP methods, we are able to quantify up to 12 carboxylic acids, the most relevant substances responsible of the acid-base equilibria of wine. The analytical concentration of carboxylic acids and of other acid-base active substances was used as input, with the total acidity, for the chemical modelling step of the study based on the contemporary treatment of overlapped protonation equilibria. New protonation constants were refined (L-lactic and succinic acids with respect to our previous investigation on red wines. Attention was paid for mixed solvent (ethanol-water mixture, ionic strength, and temperature to ensure a thermodynamic level to the study. Validation of the chemical model optimized is achieved by way of conductometric measurements and using a synthetic “wine” especially adapted for testing.

  9. Acid-base chemistry of white wine: analytical characterisation and chemical modelling.

    Science.gov (United States)

    Prenesti, Enrico; Berto, Silvia; Toso, Simona; Daniele, Pier Giuseppe

    2012-01-01

    A chemical model of the acid-base properties is optimized for each white wine under study, together with the calculation of their ionic strength, taking into account the contributions of all significant ionic species (strong electrolytes and weak one sensitive to the chemical equilibria). Coupling the HPLC-IEC and HPLC-RP methods, we are able to quantify up to 12 carboxylic acids, the most relevant substances responsible of the acid-base equilibria of wine. The analytical concentration of carboxylic acids and of other acid-base active substances was used as input, with the total acidity, for the chemical modelling step of the study based on the contemporary treatment of overlapped protonation equilibria. New protonation constants were refined (L-lactic and succinic acids) with respect to our previous investigation on red wines. Attention was paid for mixed solvent (ethanol-water mixture), ionic strength, and temperature to ensure a thermodynamic level to the study. Validation of the chemical model optimized is achieved by way of conductometric measurements and using a synthetic "wine" especially adapted for testing.

  10. Acid-Base Chemistry of White Wine: Analytical Characterisation and Chemical Modelling

    Science.gov (United States)

    Prenesti, Enrico; Berto, Silvia; Toso, Simona; Daniele, Pier Giuseppe

    2012-01-01

    A chemical model of the acid-base properties is optimized for each white wine under study, together with the calculation of their ionic strength, taking into account the contributions of all significant ionic species (strong electrolytes and weak one sensitive to the chemical equilibria). Coupling the HPLC-IEC and HPLC-RP methods, we are able to quantify up to 12 carboxylic acids, the most relevant substances responsible of the acid-base equilibria of wine. The analytical concentration of carboxylic acids and of other acid-base active substances was used as input, with the total acidity, for the chemical modelling step of the study based on the contemporary treatment of overlapped protonation equilibria. New protonation constants were refined (L-lactic and succinic acids) with respect to our previous investigation on red wines. Attention was paid for mixed solvent (ethanol-water mixture), ionic strength, and temperature to ensure a thermodynamic level to the study. Validation of the chemical model optimized is achieved by way of conductometric measurements and using a synthetic “wine” especially adapted for testing. PMID:22566762

  11. Reconstruction of diaminopimelic acid biosynthesis allows characterisation of Mycobacterium tuberculosis N-succinyl-L,L-diaminopimelic acid desuccinylase

    OpenAIRE

    Usha, Veeraraghavan; Lloyd, Adrian J.; Roper, David I.; Dowson, Christopher G.; Kozlov, Guennadi; Gehring, Kalle; Chauhan, Smita; Imam, Hasan T.; Blindauer, Claudia A.; Besra, Gurdyal S.

    2016-01-01

    With the increased incidence of tuberculosis (TB) caused by Mycobacterium tuberculosis there is an urgent need for new and better anti-tubercular drugs. N-succinyl-L,L-diaminopimelic acid desuccinylase (DapE) is a key enzyme in the succinylase pathway for the biosynthesis of meso-diaminopimelic acid (meso-DAP) and L-lysine. DapE is a zinc containing metallohydrolase which hydrolyses N-succinyl L,L diaminopimelic acid (L,L-NSDAP) to L,L-diaminopimelic acid (L,L-DAP) and succinate. M. tuberculo...

  12. Synthesis and antifungal activity of new salicylic acid derivatives

    Directory of Open Access Journals (Sweden)

    Wodnicka Alicja

    2017-03-01

    Full Text Available A simple one-step procedure for synthesis of 1-methoxy-1-oxoalkan-2-yl salicylates and 1-methoxy-1-oxoalkan-2-yl 2-[(1-methoxy-1-oxoalkan-2-yloxy]benzoates by reaction of salicylic acid with several methyl 2-bromoalkanoates was developed. The reactions were carried out in N,N-dimethylformamide (DMF in the presence of anhydrous potassium carbonate. Conditions for regioselective synthesis of target compounds were established. The developed procedure could be easily applied in the industrial production process. The new salicylic acid derivatives were obtained with satisfactory yields and were characterized by MS and 1H NMR spectra. The fungicidal activity of the prepared compounds was tested in vitro against seven species of plant pathogenic fungi. The best results were observed for 1-methoxy-1-oxoalkan-2-yl salicylates which showed moderate or good activity against Botrytis cinerea and Rhizoctonia solani.

  13. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    Science.gov (United States)

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-02

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.

  14. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

    Science.gov (United States)

    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-04-01

    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.

  15. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation

    OpenAIRE

    Cádiz, V.; Galià, M.; Ronda, J.C.; Lligadas, G.; Bordons, A.; Esteve-Zarzoso, B.; Lluch, C.

    2014-01-01

    10.1002/mabi.201400017 In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylen...

  16. Synthesis of pure monetite by heterogeneous acid-base reaction

    OpenAIRE

    Luis Carlos Moreno Aldana; Davier Olarte Cárdenas; Edgar Delgado Mejía

    2017-01-01

    Five variations of the monetite (M) synthesis were evaluated modifying the stirring, the phosphoric acid addition rate, the homogeneity and the drying temperature. Products were assessed by means of XRD, FTIR, SEM-EDS analysis and chemical assay of Ca/P (calcium by titration with potassium permanganate and phosphorus by colorimetric assessment of the molybdenum blue complex). X-ray diffraction, infrared spectroscopy and Ca/P ratio indicate that the synthesized phosphate corresponds to pure mo...

  17. Computer Aided Synthesis of Innovative Processes: Renewable Adipic Acid Production

    DEFF Research Database (Denmark)

    Rosengarta, Alessandro; Bertran, Maria-Ona; Manenti, Flavio

    2017-01-01

    A promising biotechnological route for the production of adipic acid from renewables has been evaluated, applying a systematic methodology for process network synthesis and optimization. The method allows organizing in a structured database the available knowledge from different sources...... (preliminary scientific studies, techno-economic process specifications), generating a network of process alternatives and solving it as a MILP. The best processing route provides also an estimate of the production cost of bio-adipic acid at the current state of the art, assessing the sensitivity...

  18. A new regulatory mechanism for bacterial lipoic acid synthesis.

    Science.gov (United States)

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

  19. Lipoteichoic acid synthesis inhibition in combination with antibiotics abrogates growth of multidrug-resistant Enterococcus faecium.

    Science.gov (United States)

    Paganelli, Fernanda L; van de Kamer, Tim; Brouwer, Ellen C; Leavis, Helen L; Woodford, Neil; Bonten, Marc J M; Willems, Rob J L; Hendrickx, Antoni P A

    2017-03-01

    Enterococcus faecium is a multidrug-resistant (MDR) nosocomial pathogen causing significant morbidity in debilitated patients. New antimicrobials are needed to treat antibiotic-resistant E. faecium infections in hospitalised patients. E. faecium incorporates lipoteichoic acid (LTA) (1,3-polyglycerol-phosphate linked to glycolipid) in its cell wall. The small-molecule inhibitor 1771 [2-oxo-2-(5-phenyl-1,3,4-oxadiazol-2-ylamino)ethyl 2-naphtho[2,1-b]furan-1-ylacetate] specifically blocks the activity of Staphylococcus aureus LtaS synthase, which polymerises 1,3-glycerolphosphate into LTA polymers. Here we characterised the effects of the small-molecule inhibitor 1771 on the growth of E. faecium isolates, alone (28 strains) or in combination with the antibiotics vancomycin, daptomycin, ampicillin, gentamicin or linezolid (15 strains), and on biofilm formation (16 strains). Inhibition of LTA synthesis at the surface of the cell by compound 1771 in combination with current antibiotic therapy abrogates enterococcal growth in vitro but does not affect mature E. faecium biofilms. Targeting LTA synthesis may provide new possibilities to treat MDR E. faecium infections. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

  20. Facile Synthesis of Oleanolic Acid Monoglycosides and Diglycosides

    Directory of Open Access Journals (Sweden)

    Mao-Sheng Cheng

    2008-07-01

    Full Text Available Oleanolic acid and its glycosides are important natural products, possessing various attractive biological activities such as antitumor, antivirus and anti-inflammatory properties. In the present work, fifteen oleanolic acid saponins bearing various saccharide moieties, including 3-monoglycoside, 28-monoglycoside and 3,28-diglycoside, were easily synthesized in high yields. Benzyl was chosen as the protective group for the COOH(28 group, instead of commonly used methyl and allyl, to avoid difficulties in the final deprotection. Alkali-promoted condensation of the carboxylic acid with bromoglycosides was found to be more efficient in the synthesis of 28-glycosides. Two approaches were investigated and proved practicable in the preparation of 3,28- diglycosides. This method is suitable for preparing oleanolic acid glycosides with structural diversity for extensive biological evaluation and structure-activity relationship study, and it also apply new idea for the corresponding synthetic methods to the glycoside derivatives of other triterpenoid.

  1. A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.

    Science.gov (United States)

    Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L

    2015-04-01

    The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.

  2. Age-related changes in cyclic phosphatidic acid-induced hyaluronic acid synthesis in human fibroblasts.

    Science.gov (United States)

    Sano, Katsura; Gotoh, Mari; Dodo, Kyoko; Tajima, Noriaki; Shimizu, Yoshibumi; Murakami-Murofushi, Kimiko

    2018-01-01

    Hyaluronic acid is a major component of the extracellular matrix, which is important for skin hydration. As aging brings skin dehydration, we aimed to clarify the mRNA expression of hyaluronic acid-related proteins in human skin fibroblasts from donors of various ages (range 0.7-69 years). Previously, we reported that cyclic phosphatidic acid (cPA), a unique phospholipid mediator, stimulated the expression of HAS2 and increased hyaluronic acid synthesis in human skin fibroblasts (donor age: 3 days). In this study, we measured the mRNA expression of hyaluronic acid-related proteins: hyaluronan synthase (HAS) 1-3, hyaluronidase-1, -2, and hyaluronic acid-binding protein (versican). In addition, we tested whether cPA could increase hyaluronic acid synthesis in skin fibroblasts derived from donors of various ages. The expression of HAS1, 3, hyaluronidase-1, and -2 did not change with aging. However, the mRNA expression of versican decreased with aging. Although it is thought that the amount of hyaluronic acid in the dermis decreases with aging, the mRNA expression of HAS2 was increased. But the amount of hyaluronic acid secreted by fibroblasts did not increase with aging. This suggests that the activity and/or protein expression of HAS2 decrease with aging. Furthermore, we observed that cPA caused the increase of hyaluronic acid synthesis at any age, and this effect was increased with aging. These results suggest that aging made the fibroblasts more sensitive to cPA treatment. Therefore, cPA represents a suitable candidate for the health maintenance and improvement of the skin by increasing the level of hyaluronic acid in the dermis.

  3. Sustainable and Continuous Synthesis of Enantiopure l-Amino Acids by Using a Versatile Immobilised Multienzyme System.

    Science.gov (United States)

    Velasco-Lozano, Susana; da Silva, Eunice S; Llop, Jordi; López-Gallego, Fernando

    2018-02-16

    The enzymatic synthesis of α-amino acids is a sustainable and efficient alternative to chemical processes, through which achieving enantiopure products is difficult. To more address this synthesis efficiently, a hierarchical architecture that irreversibly co-immobilises an amino acid dehydrogenase with polyethyleneimine on porous agarose beads has been designed and fabricated. The cationic polymer acts as an irreversible anchoring layer for the formate dehydrogenase. In this architecture, the two enzymes and polymer colocalise across the whole microstructure of the porous carrier. This multifunctional heterogeneous biocatalyst was kinetically characterised and applied to the enantioselective synthesis of a variety of canonical and noncanonical α-amino acids in both discontinuous (batch) and continuous modes. The co-immobilised bienzymatic system conserves more than 50 % of its initial effectiveness after five batch cycles and 8 days of continuous operation. Additionally, the environmental impact of this process has been semiquantitatively calculated and compared with the state of the art. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Synthesis of the Galactosyl Derivative of Gluconic Acid With the Transglycosylation Activity of β-Galactosidase

    Directory of Open Access Journals (Sweden)

    Aleksandra Wojciechowska

    2017-01-01

    Full Text Available Bionic acids are bioactive compounds demonstrating numerous interesting properties. They are widely produced by chemical or enzymatic oxidation of disaccharides. This paper focuses on the galactosyl derivative of gluconic acid as a result of a new method of bionic acid synthesis which utilises the transglycosylation properties of β-galactosidase and introduces lactose as a substrate. Products obtained in such a process are characterised by different structures (and, potentially, properties than those resulting from traditional oxidation of disaccharides. The aim of this study is to determine the effect of selected parameters (concentration and ratio of substrates, dose of the enzyme, time, pH, presence of salts on the course of the reaction carried out with the enzymatic preparation Lactozym, containing β-galactosidase from Kluyveromyces lactis. Research has shown that increased dry matter content in the baseline solution (up to 50 %, by mass per volume and an addition of NaCl contribute to higher yield. On the other hand, reduced content of the derivative is a result of increased pH from 7.0 to 9.0 and an addition of magnesium and manganese salts. Moreover, exceeding the β-galactosidase dose over approx. 35 000 U per 100 g of lactose also leads to reduced yield of the process. The most favourable molar ratio of sodium gluconate to lactose is 2.225:0.675. Depending on the conditions of the synthesis, the product concentration ranged between 17.3 and 118.3 g/L of the reaction mixture, which corresponded to the mass fraction of 6.64–23.7 % of dry matter. The data obtained as a result of the present study may be useful for designing an industrial process.

  5. Synthesis of Orthogonally Protected Muramic Acid Building Blocks for Solid Phase Peptide Synthesis

    Directory of Open Access Journals (Sweden)

    Kristina Vlahoviček-Kahlina

    2015-07-01

    Full Text Available Muramic acid is found in many peptide natural products containing oligo(polysaccharide moieties. Taking into consideration that the Fmoc methodology is routinely used for solid-phase peptide synthesis, preparation of orthogonally protected muramic acid building blocks for total solid-phase synthesis of these natural products is of particular practical importance. Herein a simple and efficient synthesis of benzyl 2-amino-4,6-O-benzylidene-3-O-[(R-1-carboxyethyl]-2-deoxy-N-9-fluorenylmethyloxycarbonyl-α-D-glucopyranoside (6 from N-acetylglucosamine (1 is described. Important improvements over previous synthetic approaches to glucopyranosides 2 (benzyl 2-acetamido-2-deoxy-α-D-glucopyranoside and 3 (benzyl 2-acetamido-4,6-O-benzylidene-2-deoxy-α-D-glucopyranoside, key building blocks in preparation of 6, include synthesis simplification and efficient isolation and purification. Optically pure (S-2-chloropropionic acid 7 was prepared and introduced to the positon 3-O of sugar moiety to give compound 4 (benzyl 2-acetamido-4,6-O-benzylidene-3-O-[(R-1-carboxyethyl]-2-deoxy-α-D-glucopyranoside with the (R-configuration of the lactyl side-chain in excellent overall yield and optical purity. Deacetylation of amino group gave compound 5 (benzyl 2-amino-4,6-O-benzylidene-3-O-[(R-1-carboxyethyl]-2-deoxy-α-D-glucopyranoside suitable for incorporation of the Fmoc protecting group to give protected muramic acid derivative 6, a useful building block in peptide synthesis.

  6. Characterisation of the 1H and 13C NMR spectra of methylcitric acid

    Science.gov (United States)

    Krawczyk, Hanna; Martyniuk, Tomasz

    2007-06-01

    Methylcitric acid (MCA) was synthesised in Reformatsky reaction (2 RS, 3 RS stereoisomers) and in the nucleophilic addition (2 RS, 3 SR stereoisomers). The stereoselectivity of these reactions was analysed. 1H and 13C NMR spectra of diastereoisomers of methylcitric acid were recorded and interpreted. The values of 1H chemical shifts and 1H- 1H coupling constants were analysed. Proton-decoupled high-resolution 13C NMR spectra of MCA diastereoisomers were measured in a series of dilute water solutions of various acidities. These data may provide a basis for unequivocal determination of the presence of MCA in the urine samples of patients' suffering from propionic acidemia, methylmalonic aciduria, or holocarboxylase synthetase deficiency. NMR spectroscopy enables determination of MCA diastereoisomers in body fluids and can be a complementary and useful diagnostic tool.

  7. SYNTHESIS OF FLAVANONE-6-CARBOXYLIC ACID DERIVATIVES FROM SALICYLIC ACID DERIVATIVE

    Directory of Open Access Journals (Sweden)

    Muhammad Idham Darussalam Mardjan

    2012-02-01

    Full Text Available Synthesis of flavanone-6-carboxylic acid derivatives had been conducted via the route of chalcone. The synthesis was carried out from salicylic acid derivative, i.e. 4-hydroxybenzoic acid, via esterification, Fries rearrangement, Claisen-Schmidt condensation and 1,4-nucleophilic addition reactions. Structure elucidation of products was performed using FT-IR, 1H-NMR, GC-MS and UV-Vis spectrometers. Reaction of 4-hydroxybenzoic acid with methanol catalyzed with sulfuric acid produced methyl 4-hydroxybenzoate in 87% yield. The acid-catalyzed-acetylation of the product using acetic anhydride gave methyl 4-acetoxybenzoate in 75% yield. Furthermore, solvent-free Fries rearrangement of methyl 4-acetoxybenzoate in the presence of AlCl3 produced 3-acetyl-4-hydroxybenzoic acid as the acetophenone derivatives in 67% yield. Then, Claisen-Schmidt condensation of the acetophenone and benzaldehyde derivatives of p-anisaldehyde and veratraldehyde in basic condition gave 2'-hydroxychalcone-5'-carboxylic acid derivatives  in 81 and 71 % yield, respectively. Finally, the ring closure reaction of the chalcone yielded the corresponding flavanone-6-carboxylic acids in 67 and 59% yield, respectively.

  8. Elaboration and characterisation of acids catalyst for the obtention of amines

    International Nuclear Information System (INIS)

    Khemaissia, S.; Zaoui, B.; Nibou, D.

    1997-04-01

    The nuclear energy has shown the interest of aminated substances as solvents for removal and purification. These extractants are generally used in uranium ores treatment processes and several technology fields, specially, in organic and pharmaceutical industries. The present work deals with elaboration and characterization of acidic solid catalyst used in aminated extractants obtaining

  9. Synthesis of a tetrasaccharide fragment of hyaluronic acid having a glucuronic acid at the reducing end

    NARCIS (Netherlands)

    Vliegenthart, J.F.G.; Slaghek, T.M.; Hyppönen, T.K.; Ogawa, T.; Kamerling, J.P.

    1993-01-01

    A stereocontrolled synthesis of a tetrasaccharide fragment of hyaluronic acid, beta-p-methoxyphenyl glycoside of beta-D-GlcNAc-(1¨4)-beta-D-GlcNAc-(1¨3)-beta-D-GlcNAc-(1¨4)-D-GlcA, is presented.

  10. Physio-chemical, microbiological properties of tempoyak and molecular characterisation of lactic acid bacteria isolated from tempoyak.

    Science.gov (United States)

    Chuah, Li-Oon; Shamila-Syuhada, Ahamed Kamal; Liong, Min Tze; Rosma, Ahmad; Thong, Kwai Lin; Rusul, Gulam

    2016-09-01

    This study aims to determine physio-chemical properties of tempoyak, characterise the various indigenous species of lactic acid bacteria (LAB) present at different stages of fermentation and also to determine the survival of selected foodborne pathogens in tempoyak. The predominant microorganisms present in tempoyak were LAB (8.88-10.42 log CFU/g). Fructobacillus durionis and Lactobacillus plantarum were the dominant members of LAB. Other LAB species detected for the first time in tempoyak were a fructophilic strain of Lactobacillus fructivorans, Leuconostoc dextranicum, Lactobacillus collinoides and Lactobacillus paracasei. Heterofermentative Leuconostoc mesenteroides and F. durionis were predominant in the initial stage of fermentation, and as fermentation proceeded, F. durionis remained predominant, but towards the end of fermentation, homofermentative Lb. plantarum became the predominant species. Lactic, acetic and propionic acids were present in concentrations ranging from 0.30 to 9.65, 0.51 to 7.14 and 3.90 to 7.31 mg/g, respectively. Genotyping showed a high degree of diversity among F. durionis and Lb. plantarum isolates, suggesting different sources of LAB. All tested Lb. plantarum and F. durionis (except for one isolate) isolates were multidrug resistant. Salmonella spp., Listeria monocytogenes and Staphylococcus aureus were not detected. However, survival study showed that these pathogens could survive up to 8-12 days. The results aiming at improving the quality and safety of tempoyak. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Functionalisation of mesoporous silica gel with 2-[(phosphonomethyl)-amino]acetic acid functional groups. Characterisation and application

    Science.gov (United States)

    Caldarola, Dario; Mitev, Dimitar P.; Marlin, Lucile; Nesterenko, Ekaterina P.; Paull, Brett; Onida, Barbara; Bruzzoniti, Maria Concetta; Carlo, Rosa Maria De; Sarzanini, Corrado; Nesterenko, Pavel N.

    2014-01-01

    A new complexing adsorbent was prepared by chemical modification of mesoporous silica Kieselgel 60 (dp = 37-63 μm, average pore size 6 nm, specific surface area 425 m2 g-1) with 3-glycidoxypropyltrimethoxysilane and 2-[(phosphonomethyl)amino]acetic acid (PMA), commonly known as glyphosate. The prepared adsorbent was fully characterised using elemental analysis, thermal gravimetric analysis (TGA), acid-base potentiometric titration, Fourier Transform Infrared spectroscopy (FTIR), X-ray photoelectron spectroscopy (XPS), nitrogen adsorption isotherms at 77 K (BET), scanning electron microscopy with energy dispersive X-ray spectroscopy (SEM-EDS). The concentration of bonded PMA groups calculated from the nitrogen content was 0.38 mmol per gram. The adsorption of transition metal ions on PMA functionalised silica (HEPMAS) was studied from aqueous solutions having different pH and the following selectivity was established, Zn(II) < Co(II) < Cd(II) < Mn(II) < Ni(II) < Cu(II). The calculated values of distribution coefficients D for the adsorption of ecotoxic metal ions on HEPMAS are 5.0 × 104, 4.9 × 105 and 2.6 × 104 for Zn(II), Pb(II) and Cd(II), respectively.

  12. Extremely acidic mine lake ecosystems in Lusatia (Germany) : characterisation and development of sustainable, biology-based acidity removal technologies

    International Nuclear Information System (INIS)

    Fyson, A.; Deneke, R.; Nixdorf, B.; Steinberg, C.E.W.

    2003-01-01

    There are approximately 500 infilled open-cast lignite pits in Germany that are extremely acidic because of high concentrations of dissolved metals, mostly iron and aluminium. The mining lakes have pH values of 2.4 to 3.4 and also have high sulphate concentrations. Efforts are being made to neutralize the lakes for recreational purposes. The acidity can be removed from the lakes in an economical and environmentally sustainable manner by flooding through diversion of neutral, nutrient-rich river water. This paper described the living conditions of the acidic mining lakes in the Lausitz region of Germany and summarized the benefits of the controlled eutrophication approach to enhance natural, self-sustaining processes for acid neutralization. Compared to infilling with river water, eutrophication increases lake productivity and removes acidity through sediment bound and water column biologically-mediated processes. The study involved basic research on particle transport in streams and lakes, pelagic food web interactions and submerged macrophyte metabolism. It also looked at the role of wetlands, bacterial interactions at the water-sediment interface, and modelling. It was shown that the addition of phosphorus and carbon to the water column can enhance primary production. Future studies will examine environmentally acceptable treatment strategies that offer an alternative to chemical treatment. 20 refs., 1 tab., 2 figs

  13. Synthesis of derivatives of tetronic acid and pulvinic acid. Total synthesis of norbadione A; Synthese de derives de l'acide tetronique et de l'acide pulvinique. Synthese totale de la norbadione A

    Energy Technology Data Exchange (ETDEWEB)

    Mallinger, A

    2008-11-15

    When vegetables like mushrooms are contaminated by radioactive caesium 137, this radioactive caesium is associated to norbadione A, a natural pigment present in two mushroom species and which can be used as a caesium decorporation agent or maybe as protection agent against ionizing radiations. Within this perspective, this research report describes the biosynthesis and the structure and properties of the norbadione A and of pulvinic acids (physicochemical properties, anti-oxidizing properties). Then, it presents the various tetronic acids (3-acyl-, 3-alkyl-, 3-alkoxy-, 3-aryl-tetronic acids and non 3-substituted tetronic acids), their synthesis path as they are described in the literature, and presents a new synthesis approach using a tandem reaction (with different esters or hydroxy esters) and the synthesis of tetronic acids. The author also proposes a new synthesis way for methyl pulvinates, and finally reports the work on the development of a total synthesis of the norbadione A.

  14. Surface characterisation of ethylene-propylene-diene rubber upon exposure to aqueous acidic solution

    DEFF Research Database (Denmark)

    Mitra, S.; Ghanbari-Siahkali, Afshin; Kingshott, P.

    2006-01-01

    but significantly different with respect to molar mass and the presence of long chain branching. Both rubbers contained 5-ethylidene-2-norbomene (ENB) as diene. Solution cast films of pure EPDM samples were exposed in two different acidic solutions, viz. chromosulphuric (Cr (VI)/H2SO4) and sulphuric acid (H2SO4....... Furthermore, 20% Cr (VI)/H2SO4 also attacked the allylic carbon-hydrogen (C-H) bonds of ENB resulting in more oxygenated species on the surface compared to 20% H2SO4 under identical conditions. Cr (VI) in the 20% Cr (VI)/H2SO4 was found to play an important role in alteration of surface chemistry. Studies...

  15. Characterisation of solution cast cellulose nanofibre – reinforced poly(lactic acid

    Directory of Open Access Journals (Sweden)

    2010-01-01

    Full Text Available Cellulose nanofibres, 20 nm in diameter and 300 nm long, were prepared by acid hydrolysis of flax yarns. Composite films containing 2.5 and 5.0 wt% flax cellulose (FC fibres were prepared by solution casting of mixtures of poly(lactic acid (PLA solution and cellulose nanofibre suspension in chloroform. The resulting composite films and solution cast pure PLA film, with thickness of around 160 m, showed good transparency. For composites with 2.5 and 5.0 wt% FC, the tensile strength increased by 25 and 59% and tensile modulus by 42 and 47%, respectively, compared to pure PLA film. The composite film with 2.5 wt% FC combined high strength and ductility with tensile strength of 24.3 MPa and 70% elongation at break. Flax cellulose appeared to facilitate nucleation and subsequent crystallisation of PLA more effectively in the amorphous composites than in the crystalline composites.

  16. Zeolite deactivation during hydrocarbon reactions: characterisation of coke precursors and acidity, product distribution

    OpenAIRE

    Wang, B.

    2008-01-01

    The catalytic conversion of hydrocarbons over zeolites has been applied in large scale petroleum-refining processes. However, there is always formation and retention of heavy by-products, called coke, which causes catalyst deactivation. This deactivation is due to the poisoning of the acid sites and/or pore blockage. The formation of coke on hydrocarbon processing catalysts is of considerable technological and economic importance and a great deal of work has been carried out to this study. Th...

  17. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    Energy Technology Data Exchange (ETDEWEB)

    Mamani, J.B., E-mail: javierbm@einstein.br [Instituto do Cérebro-InCe, Hospital Israelita Albert Einstein-HIAE, 05651-901 São Paulo (Brazil); Costa-Filho, A.J. [Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto (Brazil); Cornejo, D.R. [Instituto de Física Universidade de São Paulo, USP, São Paulo (Brazil); Vieira, E.D. [Instituto de Física, Universidade Federal de Goiás, Goiânia (Brazil); Gamarra, L.F. [Instituto do Cérebro-InCe, Hospital Israelita Albert Einstein-HIAE, 05651-901 São Paulo (Brazil)

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  18. The first proton sponge-based amino acids: synthesis, acid-base properties and some reactivity.

    Science.gov (United States)

    Ozeryanskii, Valery A; Gorbacheva, Anastasia Yu; Pozharskii, Alexander F; Vlasenko, Marina P; Tereznikov, Alexander Yu; Chernov'yants, Margarita S

    2015-08-21

    The first hybrid base constructed from 1,8-bis(dimethylamino)naphthalene (proton sponge or DMAN) and glycine, N-methyl-N-(8-dimethylamino-1-naphthyl)aminoacetic acid, was synthesised in high yield and its hydrobromide was structurally characterised and used to determine the acid-base properties via potentiometric titration. It was found that the basic strength of the DMAN-glycine base (pKa = 11.57, H2O) is on the level of amidine amino acids like arginine and creatine and its structure, zwitterionic vs. neutral, based on the spectroscopic (IR, NMR, mass) and theoretical (DFT) approaches has a strong preference to the zwitterionic form. Unlike glycine, the DMAN-glycine zwitterion is N-chiral and is hydrolytically cleaved with the loss of glycolic acid on heating in DMSO. This reaction together with the mild decarboxylative conversion of proton sponge-based amino acids into 2,3-dihydroperimidinium salts under air-oxygen was monitored with the help of the DMAN-alanine amino acid. The newly devised amino acids are unique as they combine fluorescence, strongly basic and redox-active properties.

  19. A Novel Approach in Cinnamic Acid Synthesis: Direct Synthesis of Cinnamic Acids from Aromatic Aldehydes and Aliphatic Carboxylic Acids in the Presence of Boron Tribromide

    Directory of Open Access Journals (Sweden)

    M. Onciu

    2005-02-01

    Full Text Available Cinnamic acids have been prepared in moderate to high yields by a new direct synthesis using aromatic aldehydes and aliphatic carboxylic acids, in the presence of boron tribromide as reagent, 4-dimethylaminopyridine (4-DMAP and pyridine (Py as bases and N-methyl-2-pyrolidinone (NMP as solvent, at reflux (180-190°C for 8-12 hours.

  20. Fatty Acid Methyl Esters of Melon Seed Oil: Characterisation for Potential Diesel Fuel Application

    Directory of Open Access Journals (Sweden)

    Paul M. EJIKEME

    2011-06-01

    Full Text Available Fatty acid methyl esters (FAME, biodiesel, are alternative diesel fuels usually obtained from renewable sources, mainly, vegetable and animal oils through transesterification among other processes. Melon seed oil was extracted from melon seeds bought from a local market, degummed and alkali refined using standard methods. FAME of the oil was produced using methanol in the molar ration of 1:6, 1% sodium hydroxide catalyst at the reaction temperature of 60 deg C for the duration of 1h. Results obtained showed that the fatty acid methyl esters had a specific gravity of 0.8786, viscosity of 6.24 centistokes, pH of 7.23, heating value of 36.34 J/g and flash point of 148 deg C. The FAME yield was 87.35% under the reaction conditions that applied. The infrared spectra of both the refined oil and the methyl esters from it, showed peaks at 1721.3cm-1 and 1167.8cm-1 (C=O and C-O stretches large and medium absorbance's for oils and methyl esters. Generally, the fuel properties of the FAME compared with values obtained under the same conditions for conventional petroleum diesel that was sourced from a retail outlet; suggesting that biodiesel from MSO could be used alone or in blends with petrodiesel to power compression ignition (diesel engines.

  1. Folate/NIR 797-conjugated albumin magnetic nanospheres: synthesis, characterisation, and in vitro and in vivo targeting evaluation.

    Science.gov (United States)

    Tang, Qiusha; An, Yanli; Liu, Dongfang; Liu, Peidang; Zhang, Dongsheng

    2014-01-01

    A practical and effective strategy for synthesis of Folate-NIR 797-conjugated Magnetic Albumin Nanospheres (FA-NIR 797-MAN) was developed. For this strategy, Magnetic Albumin Nanospheres (MAN), composed of superparamagnetic iron oxide nanoparticles (SPIONs) and bovine serum albumin (BSA), were covalently conjugated with folic acid (FA) ligands to enhance the targeting capability of the particles to folate receptor (FR) over-expressing tumours. Subsequently, a near-infrared (NIR) fluorescent dye NIR 797 was conjugated with FA-conjugated MAN for in vivo fluorescence imaging. The FA-NIR 797-MAN exhibited low toxicity to a human nasopharyngeal epidermal carcinoma cell line (KB cells). Additionally, in vitro and in vivo evaluation of the dynamic behaviour and targeting ability of FA-NIR 797-MAN to KB tumours validated the highly selective affinity of FA-NIR 797-MAN for FR-positive tumours. In summary, the FA-NIR 797-MAN prepared here exhibited great potential for tumour imaging, since the near-infrared fluorescence contrast agents target cells via FR-mediated endocytosis. The high fluorescence intensity together with the targeting effect makes FA-NIR 797-MAN a promising candidate for imaging, monitoring, and early diagnosis of cancer at the molecular and cellular levels.

  2. Folate/NIR 797-conjugated albumin magnetic nanospheres: synthesis, characterisation, and in vitro and in vivo targeting evaluation.

    Directory of Open Access Journals (Sweden)

    Qiusha Tang

    Full Text Available A practical and effective strategy for synthesis of Folate-NIR 797-conjugated Magnetic Albumin Nanospheres (FA-NIR 797-MAN was developed. For this strategy, Magnetic Albumin Nanospheres (MAN, composed of superparamagnetic iron oxide nanoparticles (SPIONs and bovine serum albumin (BSA, were covalently conjugated with folic acid (FA ligands to enhance the targeting capability of the particles to folate receptor (FR over-expressing tumours. Subsequently, a near-infrared (NIR fluorescent dye NIR 797 was conjugated with FA-conjugated MAN for in vivo fluorescence imaging. The FA-NIR 797-MAN exhibited low toxicity to a human nasopharyngeal epidermal carcinoma cell line (KB cells. Additionally, in vitro and in vivo evaluation of the dynamic behaviour and targeting ability of FA-NIR 797-MAN to KB tumours validated the highly selective affinity of FA-NIR 797-MAN for FR-positive tumours. In summary, the FA-NIR 797-MAN prepared here exhibited great potential for tumour imaging, since the near-infrared fluorescence contrast agents target cells via FR-mediated endocytosis. The high fluorescence intensity together with the targeting effect makes FA-NIR 797-MAN a promising candidate for imaging, monitoring, and early diagnosis of cancer at the molecular and cellular levels.

  3. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis.

    Science.gov (United States)

    Arendt, Kristin L; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M; Tang, Yitai; Cho, Ahryon; Graef, Isabella A; Chen, Lu

    2015-10-20

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca(2+) levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca(2+)-levels to RA synthesis remains unknown. Here we identify the Ca(2+)-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca(2+)-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity.

  4. Fabrication and characterisation of high performance polypyrrole modified microarray sensor for ascorbic acid determination

    Energy Technology Data Exchange (ETDEWEB)

    Samseya, J. [Alagappa University, Karaikudi, Tamil Nadu (India); Srinivasan, R., E-mail: sivarunjan@gmail.com [Central Electro Chemical Research Insititute, Karaikudi, Tamil Nadu (India); Chang, Yu-Tsern; Tsao, Cheng-Wen [Department of Cosmetic Applications, Taoyuan Innovation Institute of Technology, Taiwan (China); Vasantha, V.S. [Madurai Kamaraj University, Madurai, Tamil Nadu (India)

    2013-09-02

    Graphical abstract: -- Highlights: •Gold microelectrode array (Au/MEA) with electrode of 12 μm diameter was fabricated by photolithography technique. •Subsequently, polypyrrole (Ppy) modified gold microarrays sensor (Ppy/Au/MEA) was prepared. •Ppy/Au/MEA used for ascorbic acid determination in the presence of different neurotransmitters. •The micro array exhibited wide linear range, very high sensitivity and very low LOD than the earlier reports. •It was used successfully to test ascorbic acid in different types real samples. -- Abstract: In this study, gold microelectrode array (Au/MEA) with electrode of 12 μm diameter was fabricated by photolithography technique. Subsequently, polypyrrole (Ppy) modified gold microarrays sensor (Ppy/Au/MEA) was prepared by cyclic voltammetry technique. The deposition potential range and number of cycles were optimised in order to get optimum thickness of Ppy film. Scanning Electron Microscope and Atomic Force Microscope investigations reveal that Ppy coating formed at 3 cycles is porous with thickness of 1.5 μm which exhibiting high catalytic current for ascorbic acid (AA) in square wave technique (SWV). In contrast to earlier sensors designs, these Ppy/Au/MEA sensors exhibits lower detection limit (LOD) of 10 nm towards AA at physiological conditions. It also exhibits enhanced sensitivity (2.5 mA cm{sup −2} mM{sup −1}) and long range of linear detection limit from 10 nm to 2.8 mM. In the same way, polypyrrole modified macro Au (Ppy/Au/MA) biosensor was also fabricated and its electro catalytic property towards AA was compared with that of Ppy/Au/MEA. The Ppy/Au/MA exhibits sensitivity of only 0.27 mA cm{sup −2} mM{sup −1}, LOD of 5 μM and linear range of 10 μM to 2.2 mM. Hence, our investigations indicate that the Ppy/Au/MEA could serve as highly sensitive sensor for AA than any of the earlier designs. So, the Ppy/Au/MEA electrode was utilised for determination AA in a wide variety of real samples.

  5. [Synthesis and degradation of hyaluronic acid by bacteria of Streptococcus genus].

    Science.gov (United States)

    Beloded, A V; Samoĭlenko, I I; Tsepilov, R N

    2010-01-01

    Modern data on metabolism of hyaluronic acid by bacteria from Streptococcus genus are presented. Several species of bacteria forming capsule from hyaluronic acid, which is analogous to glycosaminoglycan of vertebrates, are considered. Different aspects of hyaluronic acid synthesis are described: biochemical synthesis pathway, genetic basis, regulation of expression of genes belonging to hyaluronic acid synthesis operon. Biological role and physiologic importance of hyaluronic acid for bacteria, including its role in overcoming immune barrier by pathogenic species, are discussed. Process of depolymerization of hyaluronic acid in presence of hyaluronatlyases secreted by certain streptococci is considered. Characteristic of streptococcal enzyme hyaluronatlyase, its mechanism of catalytic effect, and biological function are presented.

  6. Characterisation of okadaic acid related toxins by liquid chromatography coupled with mass spectrometry.

    Science.gov (United States)

    Paz, Beatriz; Daranas, Antonio H; Cruz, Patricia G; Franco, José M; Pizarro, Gemita; Souto, María L; Norte, Manuel; Fernández, José J

    2007-08-01

    In the Diarrhetic Shellfish Poisoning (DSP) phenomena, the parent toxins, namely okadaic acid (OA) and/or dinophysistoxin-2 (DTX2), are predominantly found esterified. Therefore, a toxicity assessment of a sample can only be performed after an alkaline hydrolysis step in order to recover the parent molecules in their free form. The presence of several OA diol esters has already been confirmed in Prorocentrum lima and Prorocentrum belizeanum cultures. This paper reports on the analysis of OA diol esters using liquid chromatography coupled with mass spectrometry (LC-MS/MS), and establishes a method for their detection and identification based upon their retention times (RT) and the fragmentation patterns of their mass spectra.

  7. Synthesis of pure monetite by heterogeneous acid-base reaction

    Directory of Open Access Journals (Sweden)

    Luis Carlos Moreno Aldana

    2017-01-01

    Full Text Available Five variations of the monetite (M synthesis were evaluated modifying the stirring, the phosphoric acid addition rate, the homogeneity and the drying temperature. Products were assessed by means of XRD, FTIR, SEM-EDS analysis and chemical assay of Ca/P (calcium by titration with potassium permanganate and phosphorus by colorimetric assessment of the molybdenum blue complex. X-ray diffraction, infrared spectroscopy and Ca/P ratio indicate that the synthesized phosphate corresponds to pure monetite. It was found that the most influential factors affecting composition, crystal size and Ca/P were stoichiometry and ballmilling mechanoactivation.

  8. Optimization of Butylphosphate synthesis from O-Phosphoric Acid

    International Nuclear Information System (INIS)

    Amedjkouh, A.; Attou, M.; Azzouz, A.; Zaoui, B.

    1995-07-01

    This work was carried out in order to confirm results of previous work and to enhance the yield of TBP synthesis. This, many reactions have been realised under differents experimental condition (temperature, acid/ alcool molar ratio, pressure and the quantity of promoter agent 'POCL3'). the TBP yield variations as function the experimental parameters, has been expressed, using the 2n factorial plan mathematical model. The experimental results were compared to those given by the theoritical model, and the optimal conditions were then drawn out

  9. Synthesis and characterization of copolyanhydrides of carbohydrate-based galactaric acid and adipic acid.

    Science.gov (United States)

    Mehtiö, Tuomas; Nurmi, Leena; Rämö, Virpi; Mikkonen, Hannu; Harlin, Ali

    2015-01-30

    A series of copolyanhydrides, consisting of 2,3,4,5-tetra-O-acetylgalactaric acid (AGA) and adipic acid (AA) as monomer units, was polymerized. Synthesis of AGA monomer consisted of two steps. First, O-acetylation of galactaric acid secondary hydroxyl groups was performed using acetic anhydride as a reagent. Acetic anhydride was then further used as a reagent in the synthesis of diacetyl mixed anhydride of AGA. Polymerizations were conducted as bulk condensation polymerization at 150 °C. Thermal properties of the copolymers varied depending on monomer composition. Increase in the AGA content had a clear increasing effect on the Tg. A similar increasing effect was observed in Tm. The degree of crystallinity decreased as AGA content increased. There was a slightly lowering tendency in the molecular weights of the obtained polymers when the AGA content in the polymerization mixtures increased. The described synthesis route shows that bio-based aldaric acid monomers are potential candidates for the adjustment of thermal properties of polyanhydrides. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Synthesis and Antiangiogenic Properties of Tetrafluorophthalimido and Tetrafluorobenzamido Barbituric Acids.

    Science.gov (United States)

    Ambrożak, Agnieszka; Steinebach, Christian; Gardner, Erin R; Beedie, Shaunna L; Schnakenburg, Gregor; Figg, William D; Gütschow, Michael

    2016-12-06

    The development of novel thalidomide derivatives as immunomodulatory and anti-angiogenic agents has revived over the last two decades. Herein we report the design and synthesis of three chemotypes of barbituric acids derived from the thalidomide structure: phthalimido-, tetrafluorophthalimido-, and tetrafluorobenzamidobarbituric acids. The latter were obtained by a new tandem reaction, including a ring opening and a decarboxylation of the fluorine-activated phthalamic acid intermediates. Thirty compounds of the three chemotypes were evaluated for their anti-angiogenic properties in an ex vivo assay by measuring the decrease in microvessel outgrowth in rat aortic ring explants. Tetrafluorination of the phthalimide moiety in tetrafluorophthalimidobarbituric acids was essential, as all of the nonfluorinated counterparts lost anti-angiogenic activity. An opening of the five-membered ring and the accompanying increased conformational freedom, in case of the corresponding tetrafluorobenzamidobarbituric acids, was well tolerated. Their activity was retained, although their molecular structures differ in torsional flexibility and possible hydrogen-bond networking, as revealed by comparative X-ray crystallographic analyses. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Lactic acid demineralization of shrimp shell and chitosan synthesis

    Directory of Open Access Journals (Sweden)

    Alewo Opuada AMEH

    2015-05-01

    Full Text Available The use of lactic acid was compared to hydrochloric acid for shrimp shell demineralization in chitosan synthesis. Five different acid concentrations were considered for the study: 1.5M, 3.0M, 4.5M, 6.0M and 7.5M. After demineralization, the shrimp shell were deproteinized and subsequently deacetylated to produce chitosan using sodium hydroxide solution. The synthesized chitosan samples were characterized using solubility, FTIR, SEM, XRD and viscosity. The SEM, FTIR and XRD analysis indicated that chitosan was synthesized with a high degree of deacetylation (83.18±2.11 when lactic acid was used and 84.2±5.00 when HCl was used. The degree of deacetylation and the molecular weight of the chitosan samples were also estimated. ANOVA analysis (at 95% confidence interval indicated that acid type and concentration did not significantly affect the solubility, degree of deacetylation, viscosity and molecular weight of the chitosan within the range considered.

  12. In vitro toxicological characterisation of the S-containing arsenic metabolites thio-dimethylarsinic acid and dimethylarsinic glutathione.

    Science.gov (United States)

    Leffers, Larissa; Unterberg, Marlies; Bartel, Marc; Hoppe, Cornelia; Pieper, Imke; Stertmann, Julia; Ebert, Franziska; Humpf, Hans-Ulrich; Schwerdtle, Tanja

    2013-03-08

    Inorganic arsenic is a well-documented, exposure relevant human carcinogen. A promising starting point to further understand the mechanisms behind inorganic arsenic carcinogenicity might be a formation of reactive, highly toxic metabolites during human arsenic metabolism. This study characterises the toxicity of recently identified S-containing arsenic metabolites in cultured human A549 lung adenocarcinoma epithelium cells. In direct comparison to arsenite, thio-dimethylarsinic acid (thio-DMA(V)) and dimethylarsinic glutathione (DMAG) exerted a 5- to 20-fold stronger cytotoxicity and showed a 2- to 20-fold higher cellular bioavailability, respectively. All three arsenicals disturbed cell cycle progression at cytotoxic concentrations, but failed to increase the level of reactive oxygen and nitrogen species (RONS) in healthy A549 cells. However, a strong disturbance of the oxidative defense system was observed after incubation with absolutely sub-cytotoxic, pico- to nanomolar concentrations of arsenite and thio-DMA(V), respectively. Thus, both GSH and GSSG levels were significantly decreased by up to 40%. Accordingly, RONS levels of oxidatively (H2O2) stressed cells were strongly increased by the arsenicals. Since in vivo RONS are permanently endogenously and exogenously produced, this boost of the existing oxidative stress by arsenite and thio-DMA(V) might contribute to the process of inorganic arsenic induced carcinogenicity. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  13. Functionalisation of mesoporous silica gel with 2-[(phosphonomethyl)-amino]acetic acid functional groups. Characterisation and application

    Energy Technology Data Exchange (ETDEWEB)

    Caldarola, Dario [Department of Applied Science and Technology, Politecnico di Torino, Corso Duca degli Abruzzi 24, 10129 Torino (Italy); Australian Centre for Research on Separation Sciences (ACROSS), University of Tasmania, Hobart, Tasmania 7001 (Australia); Mitev, Dimitar P. [Australian Centre for Research on Separation Sciences (ACROSS), University of Tasmania, Hobart, Tasmania 7001 (Australia); Marlin, Lucile [Ecole Nationale Superieure des Ingenieurs en Arts Chimiques et Technologiquesm, Toulouse (France); Irish Separation Science Cluster, Dublin City University, Dublin (Ireland); Nesterenko, Ekaterina P. [Irish Separation Science Cluster, Dublin City University, Dublin (Ireland); Paull, Brett [Australian Centre for Research on Separation Sciences (ACROSS), University of Tasmania, Hobart, Tasmania 7001 (Australia); Onida, Barbara [Department of Applied Science and Technology, Politecnico di Torino, Corso Duca degli Abruzzi 24, 10129 Torino (Italy); CR-INSTM for Materials with Controlled Porosity (Italy); Bruzzoniti, Maria Concetta; Carlo, Rosa Maria De; Sarzanini, Corrado [Analytical Chemistry Department, University of Torino, Via P. Giuria 5, 10125 Torino (Italy); Nesterenko, Pavel N., E-mail: Pavel.Nesterenko@utas.edu.au [Australian Centre for Research on Separation Sciences (ACROSS), University of Tasmania, Hobart, Tasmania 7001 (Australia)

    2014-01-01

    A new complexing adsorbent was prepared by chemical modification of mesoporous silica Kieselgel 60 (d{sub p} = 37–63 μm, average pore size 6 nm, specific surface area 425 m{sup 2} g{sup −1}) with 3-glycidoxypropyltrimethoxysilane and 2-[(phosphonomethyl)amino]acetic acid (PMA), commonly known as glyphosate. The prepared adsorbent was fully characterised using elemental analysis, thermal gravimetric analysis (TGA), acid–base potentiometric titration, Fourier Transform Infrared spectroscopy (FTIR), X-ray photoelectron spectroscopy (XPS), nitrogen adsorption isotherms at 77 K (BET), scanning electron microscopy with energy dispersive X-ray spectroscopy (SEM-EDS). The concentration of bonded PMA groups calculated from the nitrogen content was 0.38 mmol per gram. The adsorption of transition metal ions on PMA functionalised silica (HEPMAS) was studied from aqueous solutions having different pH and the following selectivity was established, Zn(II) < Co(II) < Cd(II) < Mn(II) < Ni(II) < Cu(II). The calculated values of distribution coefficients D for the adsorption of ecotoxic metal ions on HEPMAS are 5.0 × 10{sup 4}, 4.9 × 10{sup 5} and 2.6 × 10{sup 4} for Zn(II), Pb(II) and Cd(II), respectively.

  14. Genetic and Technological Characterisation of Vineyard- and Winery-Associated Lactic Acid Bacteria

    Directory of Open Access Journals (Sweden)

    Aspasia A. Nisiotou

    2015-01-01

    Full Text Available Vineyard- and winery-associated lactic acid bacteria (LAB from two major PDO regions in Greece, Peza and Nemea, were surveyed. LAB were isolated from grapes, fermenting musts, and winery tanks performing spontaneous malolactic fermentations (MLF. Higher population density and species richness were detected in Nemea than in Peza vineyards and on grapes than in fermenting musts. Pediococcus pentosaceus and Lactobacillus graminis were the most abundant LAB on grapes, while Lactobacillus plantarum dominated in fermenting musts from both regions. No particular structure of Lactobacillus plantarum populations according to the region of origin was observed, and strain distribution seems random. LAB species diversity in winery tanks differed significantly from that in vineyard samples, consisting principally of Oenococcus oeni. Different strains were analysed as per their enological characteristics and the ability to produce biogenic amines (BAs. Winery-associated species showed higher resistance to low pH, ethanol, SO2, and CuSO4 than vineyard-associated isolates. The frequency of BA-producing strains was relatively low but not negligible, considering that certain winery-associated Lactobacillus hilgardii strains were able to produce BAs. Present results show the necessity of controlling the MLF by selected starters in order to avoid BA accumulation in wine.

  15. Synthesis and characterization of carboxylic acid functionalized silicon nanoparticles

    Science.gov (United States)

    Shaner, Ted V.

    Silicon nanoparticles are of great interest in a great number of fields. Silicon nanoparticles show great promise particularly in the field of bioimaging. Carboxylic acid functionalized silicon nanoparticles have the ability to covalently bond to biomolecules through the conjugation of the carboxylic acid to an amine functionalized biomolecule. This thesis explores the synthesis of silicon nanoparticles functionalized by both carboxylic acids and alkenes and their carboxylic acid functionality. Also discussed is the characterization of the silicon nanoparticles by the use of x-ray spectroscopy. Finally, the nature of the Si-H bond that is observed on the surface of the silicon nanoparticles will be investigated using photoassisted exciton mediated hydrosilation reactions. The silicon nanoparticles are synthesized from both carboxylic acids and alkenes. However, the lack of solubility of diacids is a significant barrier to carboxylic acid functionalization by a mixture of monoacids and diacids. A synthesis route to overcome this obstacle is to synthesize silicon nanoparticles with terminal vinyl group. This terminal vinyl group is distal to the surface of the silicon nanoparticle. The conversion of the vinyl group to a carboxylic acid is accomplished by oxidative cleavage using ozonolysis. The carboxylic acid functionalized silicon nanoparticles were then successfully conjugated to amine functionalized DNA strand through an n-hydroxy succinimide ester activation step, which promotes the formation of the amide bond. Conjugation was characterized by TEM and polyacrylamide gel electrophoresis (PAGE). The PAGE results show that the silicon nanoparticle conjugates move slower through the polyacrylamide gel, resulting in a significant separation from the nonconjugated DNA. The silicon nanoparticles were then characterized by the use of x-ray absorption near edge spectroscopy (Xanes) and x-ray photoelectron spectroscopy (XPS) to investigate the bonding and chemical

  16. Synthesis and characterization of acidic mesoporous borosilicate thin films.

    Science.gov (United States)

    Xiu, Tongping; Liu, Qian; Wang, Jiacheng

    2009-02-01

    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc.

  17. Proteasome inhibitor treatment reduced fatty acid, triacylglycerol and cholesterol synthesis.

    Science.gov (United States)

    Oliva, Joan; French, Samuel W; Li, Jun; Bardag-Gorce, Fawzia

    2012-08-01

    In the present study, the beneficial effects of proteasome inhibitor treatment in reducing ethanol-induced steatosis were investigated. A microarray analysis was performed on the liver of rats injected with PS-341 (Bortezomib, Velcade), and the results showed that proteasome inhibitor treatment significantly reduced the mRNA expression of SREBP-1c, and the downstream lipogenic enzymes, such as fatty acid synthase (FAS) and acetyl-CoA carboxylase (ACC), which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ELOVL6, which is responsible for fatty acids long chain elongation, was also significantly downregulated by proteasome inhibitor treatment. Moreover, PS-341 administration significantly reduced the expression of acyl-glycerol-3-phosphate acyltransferase (AGPAT), and diacylglycerol acyltransferase (DGAT), enzyme involved in triacylglycerol (TAG) synthesis. Finally, PS-341 was found to downregulate the enzyme 3-hydroxy-3-methylglutaryl-CoenzymeA synthase (HMG-CoA synthase) that is responsible for cholesterol synthesis. Proteasome inhibitor was also found to play a role in intestinal lipid adsorption because apolipoproteins A (apoA-I, apoAII, apoA-IV and ApoCIII) were downregulated by proteasome inhibitor treatment, especially ApoA-II that is known to be a marker of alcohol consumption. Proteasome inhibitor treatment also decreased apobec-1 complementation factor (ACF) leading to lower level of editing and production of ApoB protein. Moreover apolipoprotein C-III, a major component of chylomicrons was significantly downregulated. However, lipoprotein lipase (Lpl) and High density lipoprotein binding protein (Hdlbp) mRNA levels were increased by proteasome inhibitor treatment. These results suggested that proteasome inhibitor treatment could be used to reduce the alcohol-enhanced lipogenesis and alcohol-induced liver steatosis. A morphologic analysis, performed on the liver of rats fed ethanol for one month and

  18. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    Directory of Open Access Journals (Sweden)

    Tonali eBlanco Ayala

    2015-05-01

    Full Text Available Kynurenic acid (KYNA, an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN by kynurenine aminotransferases (KATs. However, alternative routes, including KYNA formation from D-kynurenine (D-KYN by D-amino acid oxidase (DAAO and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS, have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO- and hydroxyl radicals (OH•, resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 µM each attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO- (25 µM potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO- but not from D-KYN + ONOO-. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO- and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 µM. Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative routes

  19. Cyclic diguanylic acid and cellulose synthesis in Agrobacterium tumefaciens

    International Nuclear Information System (INIS)

    Amikam, D.; Benziman, M.

    1989-01-01

    The occurrence of the novel regulatory nucleotide bis(3',5')-cyclic diguanylic acid (c-di-GMP) and its relation to cellulose biogenesis in the plant pathogen Agrobacterium tumefaciens was studied. c-di-GMP was detected in acid extracts of 32 P-labeled cells grown in various media, and an enzyme responsible for its formation from GTP was found to be present in cell-free preparations. Cellulose synthesis in vivo was quantitatively assessed with [ 14 C]glucose as a tracer. The organism produced cellulose during growth in the absence of plant cells, and this capacity was retained in resting cells. Synthesis of a cellulosic product from UDP-glucose in vitro with membrane preparations was markedly stimulated by c-di-GMP and its precursor GTP and was further enhanced by Ca2+. The calcium effect was attributed to inhibition of a c-di-GMP-degrading enzyme shown to be present in the cellulose synthase-containing membranes

  20. Synthesis of new indolecarboxylic acids related to the plant hormone indoleacetic acid IAA

    Directory of Open Access Journals (Sweden)

    Rosa Flávia A. F. da

    2003-01-01

    Full Text Available The synthesis of 5,6-methylenedioxy-indol-3-yl-methanoic acid 8 and 5,6-methylenedioxy-indol-3-yl-acetic acid 13 is described. Piperonal was employed as starting material, and the construction of the heterocyclic ring based on the Hemetsberger reaction of the corresponding beta-azidostyrene was highly regiospecific. Compound 8 was obtained as a key intermediate towards 13, and a Mannich reaction was used to introduce the required alkyl side chain. The route comprised eight steps giving 13 in 26% overall yield. The formation of the indolic ring via reductive cyclisation of o,beta-dinitrostyrene is also presented.

  1. Asymmetric synthesis of propargylamines as amino acid surrogates in peptidomimetics

    Directory of Open Access Journals (Sweden)

    Matthias Wünsch

    2017-11-01

    Full Text Available The amide moiety of peptides can be replaced for example by a triazole moiety, which is considered to be bioisosteric. Therefore, the carbonyl moiety of an amino acid has to be replaced by an alkyne in order to provide a precursor of such peptidomimetics. As most amino acids have a chiral center at Cα, such amide bond surrogates need a chiral moiety. Here the asymmetric synthesis of a set of 24 N-sulfinyl propargylamines is presented. The condensation of various aldehydes with Ellman’s chiral sulfinamide provides chiral N-sulfinylimines, which were reacted with (trimethylsilylethynyllithium to afford diastereomerically pure N-sulfinyl propargylamines. Diverse functional groups present in the propargylic position resemble the side chain present at the Cα of amino acids. Whereas propargylamines with (cycloalkyl substituents can be prepared in a direct manner, residues with polar functional groups require suitable protective groups. The presence of particular functional groups in the side chain in some cases leads to remarkable side reactions of the alkyne moiety. Thus, electron-withdrawing substituents in the Cα-position facilitate a base induced rearrangement to α,β-unsaturated imines, while azide-substituted propargylamines form triazoles under surprisingly mild conditions. A panel of propargylamines bearing fluoro or chloro substituents, polar functional groups, or basic and acidic functional groups is accessible for the use as precursors of peptidomimetics.

  2. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.

    Directory of Open Access Journals (Sweden)

    Kamran Jawed

    Full Text Available Short-chain fatty acids (SCFAs, such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product.

  3. Characterisation of L-Type Amino Acid Transporter 1 (LAT1 Expression in Human Skeletal Muscle by Immunofluorescent Microscopy

    Directory of Open Access Journals (Sweden)

    Nathan Hodson

    2017-12-01

    Full Text Available The branch chain amino acid leucine is a potent stimulator of protein synthesis in skeletal muscle. Leucine rapidly enters the cell via the L-Type Amino Acid Transporter 1 (LAT1; however, little is known regarding the localisation and distribution of this transporter in human skeletal muscle. Therefore, we applied immunofluorescence staining approaches to visualise LAT1 in wild type (WT and LAT1 muscle-specific knockout (mKO mice, in addition to basal human skeletal muscle samples. LAT1 positive staining was visually greater in WT muscles compared to mKO muscle. In human skeletal muscle, positive LAT1 staining was noted close to the sarcolemmal membrane (dystrophin positive staining, with a greater staining intensity for LAT1 observed in the sarcoplasmic regions of type II fibres (those not stained positively for myosin heavy-chain 1, Type II—25.07 ± 5.93, Type I—13.71 ± 1.98, p < 0.01, suggesting a greater abundance of this protein in these fibres. Finally, we observed association with LAT1 and endothelial nitric oxide synthase (eNOS, suggesting LAT1 association close to the microvasculature. This is the first study to visualise the distribution and localisation of LAT1 in human skeletal muscle. As such, this approach provides a validated experimental platform to study the role and regulation of LAT1 in human skeletal muscle in response to various physiological and pathophysiological models.

  4. Mechanisms of Ascorbic Acid Stimulation of Norepinephrine Synthesis in Neuronal Cells

    OpenAIRE

    May, James M.; Qu, Zhi-chao; Meredith, M. Elizabeth

    2012-01-01

    Ascorbic acid is well known to acutely stimulate norepinephrine synthesis in neurosecretory cells, but it has also been shown over several days to increase tyrosine hydroxylase mRNA and norepinephrine synthesis in cultured neurons. Since tyrosine hydroxylase is the rate-limiting step in catecholamine synthesis, an effect of ascorbate to increase tyrosine hydroxylase protein could contribute to its ability to increase or sustain catecholamine synthesis. Therefore, we evaluated whether tyrosine...

  5. Pd(II)/Bipyridine-Catalyzed Conjugate Addition of Arylboronic Acids to α,β-Unsaturated Carboxylic Acids. Synthesis of β-Quaternary Carbons Substituted Carboxylic Acids.

    Science.gov (United States)

    Liu, Rui; Yang, Zhenyu; Ni, Yuxin; Song, Kaixuan; Shen, Kai; Lin, Shaohui; Pan, Qinmin

    2017-08-04

    Pd(II)/bipyridine-catalyzed conjugate addition of arylboronic acids to α,β-unsaturated carboxylic acids (including β,β-disubstituted acrylic acids) was developed and optimized, which provided a mild and convenient method for the highly challenging synthesis of β-quaternary carbons substituted carboxylic acids.

  6. Characterisation of Lactic Acid Bacteria Isolated from the Gut of Cyprinus carpio That May Be Effective Against Lead Toxicity.

    Science.gov (United States)

    Giri, Sib Sankar; Jun, Jin Woo; Yun, Saekil; Kim, Hyoun Joong; Kim, Sang Guen; Kang, Jeong Woo; Kim, Sang Wha; Han, Se Jin; Park, Se Chang; Sukumaran, V

    2017-12-28

    The present study was conducted to isolate and characterise Pb-resistant lactic acid bacteria (LAB), and thus determine their potential for use as probiotics against Pb toxicity. A total of 107 Pb-resistant LAB strains were isolated from the gut content of Cyprinus carpio, of which 41 were established to be gram-positive and catalase-negative. Investigation of the Pb-binding ability of these isolated LAB identified seven strains (P2, P6, P7, P9, P16, P19 and P22) with comparatively high Pb-binding activities. These were selected for further screening to establish their Pb tolerance, anti-oxidative capacity and in vitro probiotic characteristics. Strain P16 exhibited both the highest Pb-binding and a relatively good antioxidant capacity. Furthermore, P16 displayed a high survival rate during 4 h of exposure to both low-pH (2.5-3.5) conditions and 10.0% fish bile, and a strong capacity to adhere to fish intestinal mucus (62.4%). Furthermore, P16 showed strong antibacterial activities against all tested fish pathogens. Strains P6, P9, P16, P19 and P22 were susceptible to a range of tested antibiotics, but not to vancomycin. Thus, of the isolated lactobacilli, strain P16 exhibited the best Pb-binding ability, a high level of antioxidant activity and satisfactory in vitro probiotic properties. Biochemical and 16S-rRNA gene analyses identified P16 as Lactobacillus reuteri. Thus, the results of the conducted in vitro tests suggest that the fish-associated P16 Lact. reuteri strain is a promising candidate probiotic, which should undergo further investigation to assess its suitability for use in protecting against lead-exposure-induced toxicities in aquaculture.

  7. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.

    Science.gov (United States)

    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P

    2016-04-01

    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    Science.gov (United States)

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  9. ETBE synthesis over silicotungstic acid and tungstophosphoric acid catalysts calcined at different temperatures

    Energy Technology Data Exchange (ETDEWEB)

    Degirmenci, Levent; Oktar, Nuray; Dogu, Gulsen [Department of Chemical Engineering, Gazi University, 06570 Maltepe, Ankara (Turkey)

    2010-07-15

    Vapor phase ethyl tertiary butyl ether synthesis was investigated using heat treated heteropoly acid catalysts, namely silicotungtsic acid (STA) and tungstophosphoric acid-Keggin (TPA-K) and these results were compared with the results obtained with untreated catalysts. ETBE synthesis experiments showed that heat treatment of TPA-K at temperatures over 473 K had caused significant decrease of its catalytic activity. Activity of STA was more stable and deactivation of this catalyst was observed by heat treatment at 673 K and above. Heat treatment at high temperatures caused loss of constitutional water of STA and TPA-K, causing loss of protons, consequently the loss of acidity of the catalysts, resulting deactivation. FT-IR, TGA-DTA and DRIFTS analyses on pyridine-adsorbed catalysts supported the conclusions related to structural changes of STA and TPA-K with heat treatment. Highest ETBE yields were obtained at around 368 K, while at temperatures over 423 K formation of DEE and ethylene were observed due to dehydration of ethanol. (author)

  10. Xanthine oxidase catalyzes the synthesis of retinoic acid.

    Science.gov (United States)

    Taibi, G; Paganini, A; Gueli, M C; Ampola, F; Nicotra, C M

    2001-01-01

    Milk xanthine oxidase (xanthine: oxygen oxidoreductase; XO; EC 1.1.3.22) was found to catalyze the conversion of retinaldehyde to retinoic acid. The ability of XO to synthesize all trans-retinoic acid efficiently was assessed by its turnover number of 31.56 min-1, determined at pH 7.0 with 1 nM XO and all trans-retinaldehyde varying between 0.05 to 2 microM. The determination of both retinoid and purine content in milk was also considered in order to correlate their concentrations with kinetic parameters of retinaldehyde oxidase activity. The velocity of the reaction was dependent on the isomeric form of the substrate, the all trans- and 9-cis-forms being the preferred substrates rather than 13-cis-retinaldehyde. The enzyme was able to oxidize retinaldehyde in the presence of oxygen with NAD or without NAD addition. In this latter condition the catalytic efficiency of the enzyme was higher. The synthesis of retinoic acid was inhibited 87% and 54% by 4 microM and 2 microM allopurinol respectively and inhibited 48% by 10 microM xanthine in enzyme assays performed at 2 microM all trans-retinaldehyde. The Ki value determined for xanthine as an inhibitor of retinaldehyde oxidase activity was 4 microM.

  11. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    Directory of Open Access Journals (Sweden)

    Lei Anping

    2012-03-01

    Full Text Available Abstract Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP, 3-ketoacyl-ACP-synthase (KAS, and acyl-ACP thioesterase (FATA gene expression had significant correlations with monounsaturated FA (MUFA synthesis and polyunsaturated FA (PUFA synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production.

  12. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.

    Science.gov (United States)

    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki

    2007-06-22

    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved.

  13. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    Science.gov (United States)

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Studies on biphenyl disulphonic acid doped polyanilines: Synthesis ...

    Indian Academy of Sciences (India)

    zed protonic acids, such as camphorsulfonic acid, dodecyl- benzene sulfonic acid, para-toluene sulfonic acid, benzene sulfonic acid, sulfanilic acid, sulfamic acid, octyl-benzene sulfonic acid, sulfosalicylic acid or methane sulfonic acid as dopants (Epstein et al 1987; Li et al 1987; Dhawan and Trivedi 1991, 1992; Kobayashi ...

  15. Injury-induced inhibition of small intestinal protein and nucleic acid synthesis

    International Nuclear Information System (INIS)

    Carter, E.A.; Hatz, R.A.; Yarmush, M.L.; Tompkins, R.G.

    1990-01-01

    Small intestinal mucosal weight and nutrient absorption are significantly diminished early after cutaneous thermal injuries. Because these intestinal properties are highly dependent on rates of nucleic acid and protein synthesis, in vivo incorporation of thymidine, uridine, and leucine into small intestinal deoxyribonucleic acid, ribonucleic acid, and proteins were measured. Deoxyribonucleic acid synthesis was markedly decreased with the lowest thymidine incorporation in the jejunum (p less than 0.01); these findings were confirmed by autoradiographic identification of radiolabeled nuclei in the intestinal crypts. Protein synthesis was decreased by 6 h postinjury (p less than 0.01) but had returned to normal by 48 h. Consistent with a decreased rate of protein synthesis, ribonucleic acid synthesis was also decreased 18 h postinjury (p less than 0.01). These decreased deoxyribonucleic acid, ribonucleic acid, and protein synthesis rates are not likely a result of ischemia because in other studies of this injury model, intestinal blood flow was not significantly changed by the burn injury. Potentially, factors initiating the acute inflammatory reaction may directly inhibit nucleic acid and protein synthesis and lead to alterations in nutrient absorption and intestinal barrier function after injury

  16. Synthesis, characterisation and thermal behaviour of solid state compounds of 4-methylbenzylidenepyruvate with some bivalent metal ions

    International Nuclear Information System (INIS)

    Petroni, I.A.; Fertonani, F.L.; Melios, C.B.; Ionashiro, M.

    2003-01-01

    Solid state M-4-Me-BP compounds, where M stands for bivalent Mn, Fe, Co, Ni, Cu, Zn, Pb and 4-Me-BP is 4-methylbenzylidenepyruvate, have been synthesized. Simultaneous thermogravimetry-differential thermal analysis (TG-DTA), differential scanning calorimetry (DSC), X-ray powder diffractometry, infrared spectroscopy, elemental analysis, and complexometry were used to characterise and to study the thermal behaviour of these compounds. The results led to information about the composition, dehydration, thermal stability and thermal decomposition of the isolated complexes

  17. Templated Synthesis of Peptide Nucleic Acids via Sequence-Selective Base-Filling Reactions

    OpenAIRE

    Heemstra, Jennifer M.; Liu, David R.

    2009-01-01

    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either re...

  18. Synthesis and Characterisation of the Europium (III Dimolybdo-Enneatungsto-Silicate Dimer, [Eu(α-SiW9Mo2O392]13−

    Directory of Open Access Journals (Sweden)

    Loïc Parent

    2015-07-01

    Full Text Available The chemistry of polyoxometalates (POMs keeps drawing the attention of researchers, since they constitute a family of discrete molecular entities whose features may be easily modulated. Often considered soluble molecular oxide analogues, POMs possess enormous potential due to a myriad of choices concerning size, shape and chemical composition that may be tailored in order to fine-tune their physico-chemical properties. Thanks to the recent progress in single-crystal X ray diffraction, new POMs exhibiting diverse and unexpected structures have been regularly reported and described. We find it relevant to systematically analyse the different equilibria that govern the formation of POMs, in order to be able to establish reliable synthesis protocols leading to new molecules. In this context, we have been able to synthesise the Eu3+-containing silico-molybdo-tungstic dimer, [Eu(α-SiW9Mo2O392]13−. We describe the synthesis and characterisation of this new species by several physico-chemical methods, such as single-crystal X-ray diffraction, 183W NMR and electrochemistry.

  19. The synthesis and characterisation of MDMA derived from a catalytic oxidation of material isolated from black pepper reveals potential route specific impurities.

    Science.gov (United States)

    Plummer, Christopher M; Breadon, Thomas W; Pearson, James R; Jones, Oliver A H

    2016-05-01

    This work examines the chemical synthesis of 3,4-methylenedioxy-N-methylamphetamine (MDMA) from piperonal prepared via a catalytic ruthenium tetroxide oxidation of piperine extracted from black pepper. A variety of oxidation conditions were experimented with including different solvent systems and co-oxidants. A sample of prepared piperonal was successfully converted into MDMA via 3,4-methylenedioxyphenyl-2-nitropropene (MDP2NP) and 3,4-methylenedioxyphenyl-2-propanone (MDP2P) and the impurities within each product characterised by GC-MS to give a contaminant profile of the synthetic pathway. Interestingly, it was discovered that a chlorinated analogue of piperonal (6-chloropiperonal) was created during the oxidation process by an as yet unknown mechanism. This impurity reacted alongside piperonal to give chlorinated analogues of each precursor, ultimately yielding 2-chloro-4,5-methylenedioxymethamphetamine (6-Cl-MDMA) as an impurity within the MDMA sample. The methodology developed is a simple way to synthesise a substantial amount of precursor material with easy to obtain reagents. The results also show that chlorinated MDMA analogues, previously thought to be deliberately included adulterants, may in fact be route specific impurities with potential application in determining the origin and synthesis method of seized illicit drugs. Copyright © 2016 The Chartered Society of Forensic Sciences. Published by Elsevier Ireland Ltd. All rights reserved.

  20. Reviewing the Tannic Acid Mediated Synthesis of Metal Nanoparticles

    International Nuclear Information System (INIS)

    Ahmad, T.

    2014-01-01

    Metal nanoparticles harbour numerous exceptional physiochemical properties absolutely different from those of bulk metal as a function of their extremely small size and large superficial area to volume. Naked metal nanoparticles are synthesized by various physical and chemical methods. Chemical methods involving metal salt reduction in solution enjoy an extra edge over other protocols owing to their relative facileness and capability of controlling particle size along with the attribute of surface tailoring. Although chemical methods are the easiest, they are marred by the use of hazardous chemicals such as borohydrides. This has led to inclination of scientific community towards eco-friendly agents for the reduction of metal salts to form nanoparticles. Tannic acid, a plant derived polyphenolic compound, is one such agent which embodies characteristics of being harmless and environmentally friendly combined with being a good reducing and stabilizing agent. In this review, first various methods used to prepare metal nanoparticles are highlighted and further tannic acid mediated synthesis of metal nanoparticles is emphasized. This review brings forth the most recent findings on this issue.

  1. Reviewing the Tannic Acid Mediated Synthesis of Metal Nanoparticles

    Directory of Open Access Journals (Sweden)

    Tufail Ahmad

    2014-01-01

    Full Text Available Metal nanoparticles harbour numerous exceptional physiochemical properties absolutely different from those of bulk metal as a function of their extremely small size and large superficial area to volume. Naked metal nanoparticles are synthesized by various physical and chemical methods. Chemical methods involving metal salt reduction in solution enjoy an extra edge over other protocols owing to their relative facileness and capability of controlling particle size along with the attribute of surface tailoring. Although chemical methods are the easiest, they are marred by the use of hazardous chemicals such as borohydrides. This has led to inclination of scientific community towards eco-friendly agents for the reduction of metal salts to form nanoparticles. Tannic acid, a plant derived polyphenolic compound, is one such agent which embodies characteristics of being harmless and environmentally friendly combined with being a good reducing and stabilizing agent. In this review, first various methods used to prepare metal nanoparticles are highlighted and further tannic acid mediated synthesis of metal nanoparticles is emphasized. This review brings forth the most recent findings on this issue.

  2. The synthesis, structures and characterisation of new mixed-ligand manganese and iron complexes with tripodal, tetradentate ligands

    NARCIS (Netherlands)

    van Gorkum, R.; Berding, J.; Mills, A.M.; Kooijman, H.; Tooke, D.M.; Spek, A.L.; Mutikainen, I.; Turpeinen, U.; Reedijk, J.; Bouwman, E.

    2008-01-01

    The preparation of new manganese and iron complexes with the general formula [M(tripod)(anion)] is described, where M = FeIII or MnIII, “tripod” is a dianionic tetradentate tripodal ligand and the anion is a chelating β-diketonate, 8-oxyquinoline or acetate. The synthesis of this type of complexes

  3. Inhibition of fatty acid synthesis in rat hepatocytes by exogenous polyunsaturated fatty acids is caused by lipid peroxidation

    DEFF Research Database (Denmark)

    Mikkelsen, L.; Hansen, Harald S.; Grunnet, N.

    1993-01-01

    Rat hepatocyte long-term cultures were utilized to investigate the impact of different polyunsaturated fatty acids (PUFA) on the insulin-induced de novo fatty acid synthesis in vitro. The addition of 0.5 mM albumin-complexed oleic, linoleic, columbinic, arachidonic, eicosapentaenoic...... by the peroxidized PUFA. Arachidonic acid and eicosapentaenoic acid showed a dose- and time-dependent cytotoxicity. Two other antioxidants: 50 µM a-tocopherol acid succinate and 1 µM N,N'-diphenyl-1,4-phenylenediamine, both proved more efficient than a-tocopherol phosphate. There was a significant correlation...... or docosahexaenoic acid resulted in a marked suppression of fatty acid synthesis. By evaluation of cell viability (determined as the leakage of lactate dehydrogenase (LDH)) it turned our, that the antioxidant used (50 µM a-tocopherol phosphate) had a low antioxidant activity, resulting in cytotoxic effects...

  4. Rational design, synthesis, and pharmacological evaluation of 2-azanorbornane-3-exo,5-endo-dicarboxylic acid

    DEFF Research Database (Denmark)

    Bunch, Lennart; Liljefors, Tommy; Greenwood, Jeremy R

    2003-01-01

    conformationally restricted (S)-glutamic acid (Glu) analogue intended as a mimic of the folded Glu conformation. The synthesis of 1 was completed in its racemic form in eight steps from commercially available starting materials. As a key step, the first facially selective hydroboration of a 5-methylidene[2......The design and synthesis of conformationally restricted analogues of alpha-amino acids is an often used strategy in medicinal chemistry research. Here we present the rational design, synthesis, and pharmacological evaluation of 2-azanorbornane-3-exo,5-endo-dicarboxylic acid (1), a novel...... studies on native 2-amino-3-(3-hydroxy-5-methyl-4-isoxazolyl)propionic acid (AMPA) (IC(50) > 300 microM, [(3)H]AMPA) or kainic acid (IC(50) > 160 microM, [(3)H]kainic acid) receptors nor in binding studies on the cloned iGluR5,6 subtypes (IC(50) > 300 microM, [(3)H]kainic acid)....

  5. Synthesis of zeolite-like crystals by means of sorption of bases on polysilicic acids

    International Nuclear Information System (INIS)

    Belyakova, L.A.; Il'in, V.G.; Peresun'ko, T.F.; Kryuchkova, I.I.; Nejmark, I.E.

    1974-01-01

    Investigation into the sorption of bases on crystalline polysilicic acids is of particular interest from the viewpoint of synthesis of new types of porous zeolite-like materials. A synthesis of polysilicate acids was carried out by treating respective sodium polysilicates with mineral acid solutions. The sorption of alkali metal hydroxides in the neutral and alkaline pH region was studied by the method of potentiometric titration of individual weighed quantities. A marked sorption of alkali metal hydroxides on polysilicic acids starts in the weakly acid and neutral regions and reaches saturation at pHapproximately10.5. The process of ion exchange is accompanied by a change in the crystal structure of polysilicic acids. The sorption of bases on polysilicic acids may be used as a method of synthesis of zeolite-like porous crystals in different cationic forms

  6. Synthesis and Characterisation of Novel Cross Linked Biopolyesters from Olive Oil as Eco-friendly Biodegradable Materials

    Directory of Open Access Journals (Sweden)

    J. Shakina

    2012-01-01

    Full Text Available Novel cross linked biopolyesters were synthesised from naturally available olive oil, oligomeric polytriglyceride fumarate (o-PTF was prepared by glycerolysis of the olive oil followed by condensation with maleic anhydride. The (o-PTF was characterised by spectral (FTIR, UV, NMR and physicochemical properties (specific gravity, viscosity, saponification value, iodine value. The molecular weight of o-PTF was estimated using gel permeation chromatography (GPC. The cross linked biopolyesters were prepared by treating o-PTF of olive with N-vinyl-2-pyrrolidone and vinyl acetate. The cross linked biopolyesters were evaluated for spectral properties (FT IR, cross linked density, thermal properties, mechanical properties and biodegradation. The potential antifungal and anti bacterial activities of the newly prepared biopolyesters were evaluated. The environment degradation was assessed by soil burial test. The outcome of the studies has revealed that the newly prepared cross linked biopolyesters are potential biodegradable material for various consumer application like package materials and agricultural applications.

  7. Synthesis of L-ascorbic acid in the phloem

    Directory of Open Access Journals (Sweden)

    Haupt Sophie

    2003-11-01

    Full Text Available Abstract Background Although plants are the main source of vitamin C in the human diet, we still have a limited understanding of how plants synthesise L-ascorbic acid (AsA and what regulates its concentration in different plant tissues. In particular, the enormous variability in the vitamin C content of storage organs from different plants remains unexplained. Possible sources of AsA in plant storage organs include in situ synthesis and long-distance transport of AsA synthesised in other tissues via the phloem. In this paper we examine a third possibility, that of synthesis within the phloem. Results We provide evidence for the presence of AsA in the phloem sap of a wide range of crop species using aphid stylectomy and histochemical approaches. The activity of almost all the enzymes of the primary AsA biosynthetic pathway were detected in phloem-rich vascular exudates from Cucurbita pepo fruits and AsA biosynthesis was demonstrated in isolated phloem strands from Apium graveolens petioles incubated with a range of precursors (D-glucose, D-mannose, L-galactose and L-galactono-1,4-lactone. Phloem uptake of D-[U-14C]mannose and L-[1-14C]galactose (intermediates of the AsA biosynthetic pathway as well as L-[1-14C]AsA and L-[1-14C]DHA, was observed in Nicotiana benthamiana leaf discs. Conclusions We present the novel finding that active AsA biosynthesis occurs in the phloem. This process must now be considered in the context of mechanisms implicated in whole plant AsA distribution. This work should provoke studies aimed at elucidation of the in vivo substrates for phloem AsA biosynthesis and its contribution to AsA accumulation in plant storage organs.

  8. Synthesis and characterisation of Cu(II), Ni(II), Mn(II), Zn(II) and VO(II ...

    Indian Academy of Sciences (India)

    Unknown

    showed increased activity when administered as metal chelates rather than as organic compounds1, 2 ... 2.1 Synthesis of Schiff base. An ethanolic ... [VOL]. Pale green. 10⋅7 (10⋅4). 63⋅2 (63⋅6) 4⋅8 (4⋅9) 11⋅5 (11⋅4). 1.71. L = AAAPD which show octahedral and square pyramidal geometry respectively. The chelates ...

  9. [Synthesis of phosphonic acid and phosphinic acid derivatives for development of biologically active compounds].

    Science.gov (United States)

    Shibuya, Shiroshi

    2004-11-01

    This paper covers recent publications from our laboratory on the synthesis of a variety of phosphonate and phosphinate derivatives. New methods for the enantioselective synthesis of alpha-hydroxyphosphonates were established by Lewis acid-mediated cleavage of homochiral 1,3-dioxaneacetals with P(OEt)(3) and chiral metal ligand-mediated hydrophosphonylation of aldehydes. Two diastereomers of HPmp derivatives were prepared by an application of these methods. The HPmp derivatives were convered to FPmp derivatives but with low diastereoselectivity. Hydrophosphonylation of alpha-aminoaldehydes afforded threo- and erythro-beta-amino-alpha-hydroxyphosphonates under chelation and nonchelation controlled conditions, respectively. The asymmetric dihydroxylation of alpha, beta-, and beta, gamma-unsaturated phosphonates with AD-mix-alpha and AD-mix-beta reagents gave alpha, beta- and beta, gamma-dihydroxyphosphonates with high enantioselectivity. The method was applied to the kinetic resolution of racemic alpha-oxygetated beta, gamma-unsaturated phosphonates. Treatment of allyloxymethylphosphonates with the base afforded alpha-hydroxyphosphonates via the [2,3]-Wittig reaction. Threo- and erythro-beta-amino-alpha-hydroxyphosphinates were obtained with high diastereoselectivity by phosphinylation of alpha-aminoaldehydes in the presence of (R)- and (S)-ALB, respectively. The phosphinylation of alpha-oxygenated aldehydes afforded the corresponding alpha, beta-dioxygenated phosphinates, but with low diastereoselectivity. Sphingomyelin analogues containing CF(2)PO(OH)(2) were synthesized starting from (S)- and (R)-Garner aldehyde for the purpose of obtaining potent sphyngomyelinase inhibitors. A useful method for the synthesis of alpha, alpha-difluorobenzylphosphonates was established based on the cross coupling reaction of an iodobenzene derivative with ZnCuBr(2)CF(2)PO(OEt)(2). The synthetic utility of ZnCuBr(2)CF(2)PO(OEt)(2) was examined to obtain alpha, alpha

  10. Biosynthesis of Polyunsaturated Fatty Acids in Sea Urchins: Molecular and Functional Characterisation of Three Fatty Acyl Desaturases from Paracentrotus lividus (Lamark 1816).

    Science.gov (United States)

    Kabeya, Naoki; Sanz-Jorquera, Alicia; Carboni, Stefano; Davie, Andrew; Oboh, Angela; Monroig, Oscar

    2017-01-01

    Sea urchins are broadly recognised as a delicacy and their quality as food for humans is highly influenced by their diet. Lipids in general and the long-chain polyunsaturated fatty acids (LC-PUFA) in particular, are essential nutrients that determine not only the nutritional value of sea urchins but also guarantee normal growth and reproduction in captivity. The contribution of endogenous production (biosynthesis) of LC-PUFA in sea urchins remained unknown. Using Paracentrotus lividus as our model species, we aimed to characterise both molecularly and functionally the repertoire of fatty acyl desaturases (Fads), key enzymes in the biosynthesis of LC-PUFA, in sea urchins. Three Fads, namely FadsA, FadsC1 and FadsC2, were characterised. The phylogenetic analyses suggested that the repertoire of Fads within the Echinodermata phylum varies among classes. On one hand, orthologues of the P. lividus FadsA were found in other echinoderm classes including starfishes, brittle stars and sea cucumbers, thus suggesting that this desaturase is virtually present in all echinoderms. Contrarily, the FadsC appears to be sea urchin-specific desaturase. Finally, a further desaturase termed as FadsB exists in starfishes, brittle stars and sea cucumbers, but appears to be missing in sea urchins. The functional characterisation of the P. lividus Fads confirmed that the FadsA was a Δ5 desaturase with activity towards saturated and polyunsaturated fatty acids (FA). Moreover, our experiments confirmed that FadsA plays a role in the biosynthesis of non-methylene interrupted FA, a group of compounds typically found in marine invertebrates. On the other hand, both FadsC desaturases from P. lividus showed Δ8 activity. The present results demonstrate that P. lividus possesses desaturases that account for all the desaturation reactions required to biosynthesis the physiological essential eicosapentaenoic and arachidonic acids through the so-called "Δ8 pathway".

  11. Biosynthesis of Polyunsaturated Fatty Acids in Sea Urchins: Molecular and Functional Characterisation of Three Fatty Acyl Desaturases from Paracentrotus lividus (Lamark 1816.

    Directory of Open Access Journals (Sweden)

    Naoki Kabeya

    Full Text Available Sea urchins are broadly recognised as a delicacy and their quality as food for humans is highly influenced by their diet. Lipids in general and the long-chain polyunsaturated fatty acids (LC-PUFA in particular, are essential nutrients that determine not only the nutritional value of sea urchins but also guarantee normal growth and reproduction in captivity. The contribution of endogenous production (biosynthesis of LC-PUFA in sea urchins remained unknown. Using Paracentrotus lividus as our model species, we aimed to characterise both molecularly and functionally the repertoire of fatty acyl desaturases (Fads, key enzymes in the biosynthesis of LC-PUFA, in sea urchins. Three Fads, namely FadsA, FadsC1 and FadsC2, were characterised. The phylogenetic analyses suggested that the repertoire of Fads within the Echinodermata phylum varies among classes. On one hand, orthologues of the P. lividus FadsA were found in other echinoderm classes including starfishes, brittle stars and sea cucumbers, thus suggesting that this desaturase is virtually present in all echinoderms. Contrarily, the FadsC appears to be sea urchin-specific desaturase. Finally, a further desaturase termed as FadsB exists in starfishes, brittle stars and sea cucumbers, but appears to be missing in sea urchins. The functional characterisation of the P. lividus Fads confirmed that the FadsA was a Δ5 desaturase with activity towards saturated and polyunsaturated fatty acids (FA. Moreover, our experiments confirmed that FadsA plays a role in the biosynthesis of non-methylene interrupted FA, a group of compounds typically found in marine invertebrates. On the other hand, both FadsC desaturases from P. lividus showed Δ8 activity. The present results demonstrate that P. lividus possesses desaturases that account for all the desaturation reactions required to biosynthesis the physiological essential eicosapentaenoic and arachidonic acids through the so-called "Δ8 pathway".

  12. One-Pot Enantiomeric Synthesis of Thiazole-Containing Amino Acids: Total Synthesis of Venturamides A and B.

    Science.gov (United States)

    Liu, Yi; He, Peng; Zhang, Yang; Zhang, Xiangyu; Liu, Jun; Du, Yuguo

    2018-04-06

    An effective one-pot procedure for enantiomerical synthesis of thiazole-containing amino acid (TCAA) has been established via a cascade disulfide cleavage/thiocarbonylation/intramolecular Staudinger reduction/aza-Wittig/oxidation reaction. Starting from the commercially available amino acid building blocks, a number of TCAAs were prepared in good yields and with excellent optical purities. This method bears features of mild reaction conditions, wide substrate adaptability, and good functional group tolerance. The power of this method was also demonstrated through the concise total synthesis of cyclic hexapeptide Venturamides A and B.

  13. Characterisation of acid dyes in forensic fibre analysis by high-performance liquid chromatography using narrow-bore columns and diode array detection.

    Science.gov (United States)

    Laing, D K; Gill, R; Blacklaws, C; Bickley, H M

    1988-06-17

    A gradient elution high-performance liquid chromatographic (HPLC) system with a diode array detector and a short narrow-bore (40 x 1 mm I.D.) column has been used to characterise a number of acid dyes. The resolution and reproducibility of the HPLC system have been evaluated and the detection limits for various dyes have been estimated. Comparisons are made with current methods of fibre dyestuff examination used in forensic science. The system has been applied to the analysis of dye extracted from single fibres. Using diode array detection, both chromatographic and spectral data can be produced in a single operation from casework sized samples.

  14. Redefining the role of de novo fatty acid synthesis in Plasmodium parasites.

    Science.gov (United States)

    Tarun, Alice S; Vaughan, Ashley M; Kappe, Stefan H I

    2009-12-01

    Fatty acids are essential components of membranes, and are also involved in cell signalling. Plasmodium, the parasite that causes malaria, scavenges fatty acids from its hosts. However, Plasmodium also possesses enzymes for a prokaryotic-like de novo fatty acid synthesis pathway, which resides in the apicoplast. Recent research has demonstrated that Plasmodium parasites depend on de novo fatty acid synthesis only for liver-stage development. This finding demonstrates that basic anabolic functions of Plasmodium parasites are not necessary for the growth and replication of every life cycle stage. We discuss the role of fatty acid metabolism in Plasmodium and why we believe that de novo fatty acid synthesis is only required for parasite late liver-stage development.

  15. The Synthesis of cis- and trans-Fused Bicyclic Sugar Amino Acids

    NARCIS (Netherlands)

    Risseeuw, Martijn D.P.; Grotenbreg, Gijsbert M.; Witte, Martin D.; Tuin, Adriaan W.; Leeuwenburgh, Michiel A.; Marel, Gijsbert A. van der; Overkleeft, Herman S.; Overhand, Mark

    2006-01-01

    Four isomeric bicyclic sugar amino acids (SAAs) were prepared from an α-acetylenic-C-glucoside by employing a Petasis olefination and a ring-closing metathesis (RCM) as key steps. The applicability of the resulting SAAs in solid-phase peptide synthesis was demonstrated by the synthesis of a

  16. [3,3]Paracyclophanes as planar chiral scaffolds for the synthesis of new phosphoric acids.

    Science.gov (United States)

    Stemper, Jérémy; Isaac, Kevin; Duret, Véronique; Retailleau, Pascal; Voituriez, Arnaud; Betzer, Jean-François; Marinetti, Angela

    2013-07-11

    Cyclic phosphoric acids displaying planar chiral paracyclophane structures, which include a 1,1'-ferrocenediyl unit, have been designed as a new class of chiral organocatalysts. Their synthesis, optical resolution, structural characterization and preliminary catalytic tests are reported.

  17. A novel synthesis of chromone based unnatural α-amino acid ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 129; Issue 8. A novel synthesis of chromone based unnatural α-amino acid derivatives. VENU KANDULA RAMAKRISHNA GUDIPATI ANINDITA CHATTERJEE MURALIDARAN KALIYAPERUMALA SATYANARAYANA YENNAM MANORANJAN BEHERA. REGULAR ...

  18. Synthesis of carboranyl amino acids, hydantoins, and barbiturates

    International Nuclear Information System (INIS)

    Wyzlic, I.M.; Tjarks, W.; Soloway, A.H.

    1996-01-01

    The syntheses of three novel boronated hydantoins, 5-(o-carboran-1-ylmethyl)hydantoin, 14, the tetraphenylphosphonium salt of 7-(hydantoin-5-ylmethyl)dodecahydro-7,8-dicarba-nido-undecaborate, 15, 5-(o-carboran-1-ylmethyl)-2-thiohydantoin, 16, and two new barbiturates, 5,5-bis(but-2-ynyl)barbiturate, 18, and 5,5-bis[(2-methyl-0-carboran-1-yl)methyl]barbiturate, 20, are described. Hydantoins 14-16 were synthesized from o-carboranylalanine (Car, 13). The detailed synthesis of Car and two other carborane-containing amino acids, O-(o-carboran-1-ylmethyl)tyrosine (CBT, 5a) and p-(o-carboran-1-yl)phenylalanine (CBPA, 5b), presented earlier as a communication, 16 are also described. Hydantoin 14 and barbiturates 18 and 20 were tested for their potential anticonvulsant activity. Initial qualitative screening showed moderate activities for hydantoin 14 and barbiturate 18. Barbiturate 20 had no activity. Compound 14 appeared to be nontoxic at doses of 300 mg/kg (mice, ip) and 50 mg/kg (rats, oral). However, 18 was very toxic under similar conditions

  19. Cetalox and analogues: synthesis via acid-mediated polyene cyclizations.

    Science.gov (United States)

    Snowden, Roger L

    2008-06-01

    Using a novel, acid-mediated cyclization methodology, a direct access to Cetalox ((+/-)-1; a commercially important ambergris-type odorant) and various structurally related didehydro (i.e., 19, 26, and 30) and tetradehydro (i.e., 28 and 37/38) analogues is described. Treatment of either (E,E)-14 or (E)-15 with an excess of FSO(3)H in 2-nitropropane at -90 degrees stereospecifically afforded (+/-)-1 in 40 and 42% yield, respectively. Under similar conditions, cyclization of (E)-18 or 20 furnished 19 in 60 and 64% yield, respectively. Analogously, using an excess of ClSO(3)H in CH(2)Cl(2) at -80 degrees, 26 is formed with high stereoselectivity by cyclization of either (E)-24 or (Z)-25 (52 and 31% yield, resp.); in the same manner, 28 was prepared from 27 (22% yield). The same principle was applied to the synthesis of racemic Superambrox (30), via cyclization of 35, but only with poor selectivity (22%) and low yield (7%). Another approach via cyclization of (E)-40 under solvolysis conditions (excess TFA in CH(2)Cl(2) at -10 degrees) gave a higher yield (15%) with improved selectivity (43%). Finally, cyclization of 34 (1:1 diastereoisomer mixture) afforded 37/38 (10:1) in 27% yield. The qualitative organoleptic properties of 19, 26, 28, 30, and 37/38 (10:1) are briefly discussed.

  20. Radiation-induced synthesis of poly(acrylic acid) nanogels

    Science.gov (United States)

    Matusiak, Malgorzata; Kadlubowski, Slawomir; Ulanski, Piotr

    2018-01-01

    Nanogel is a two-component system of a diameter in the range of tens of nanometers, consisting of an intramolecularly crosslinked polymer chain and solvent, typically water, filling the space between segments of the macromolecule. Microgels are bigger than nanogels and their size range is between 100 nm to 100 μm. One of the methods used for synthesizing nanogels is linking the segments of a single macromolecule with the use of ionizing radiation, by intramolecular recombination of radiation-generated polymer radicals. The main advantage of this technique is absence of monomers, catalysts, surfactants or crosslinking agents. This method is an interesting alternative way of synthesizing polymeric carriers for biomedical applications. The aim of the study was radiation synthesis and characterization of poly(acrylic acid) - PAA - nanogels and microgels. The physico-chemical properties were described by determination of weight-average molecular weight and dimensions (radius of gyration, hydrodynamic radius) of the nanogels and microgels. Influence of polymer concentration and dose on these parameters was analyzed. Adjusting the PAA concentration and absorbed dose, one can control the molecular weight and dimensions of nanogels. The solutions of PAA were irradiated with two sources of ionizing radiation: γ-source and electron accelerator. The former method yields mainly microgels due to prevailing intermolecular crosslinking, while the latter promotes intramolecular recombination of PAA-derived radicals and in consequence formation of nanogels. In the future radiation-synthesized PAA nanogels, after functionalization, will be tested as carriers for delivering radionuclides to the tumor cells.

  1. Synthesis and characterisation of chitosan crosslinked-β-cyclodextrin grafted silylated magnetic nanoparticles for controlled release of Indomethacin

    International Nuclear Information System (INIS)

    Anirudhan, T.S.; Dilu, D.; Sandeep, S.

    2013-01-01

    In this work, a novel hydrogel, chitosan crosslinked β-cyclodextrin grafted silylated magnetic nanoparticle (CTSCD-g-SilylMNP) was synthesised as a drug delivery system onto which Indomethacin (IND) drug was loaded. Characterisation of the drug delivery system was carried out by Tunnelling electron microscopy, Scanning electron microscopy, Fourier transform infrared spectroscopy, X-ray diffraction analysis, Dynamic light scattering and a Vibrating sample magnetometer. Swelling behaviour, in vitro drug release kinetics, and encapsulation efficiency of CTSCD-g-SilylMNP were studied. Swelling behaviour varied according to pH. In vitro release studies revealed that CTSCD-g-SilylMNP demonstrated a swelling and diffusion controlled release. Dependence of pH was also studied. Encapsulation efficiency (EE) at different percentages of drug loadings was studied. The results collectively suggest that the hydrogel has promising application in the field of controlled drug release. The biodegradability also adds to the advantage. - Highlights: • A novel hydrogel chitosan crosslinked β-cyclodextrin grafted silylated magnetic nanoparticles (CTS–CD-g-SilylMNP) were synthesised. • Chitosan would increase the biocompatibility and swellability of the material. • Indomethacin drug was loaded onto CTS–CD-g-SilylMNP. • The swelling behaviour,drug release and encapsulation efficiency of the hydrogel were studied. • CTS–CD-g-SilylMNP can be used as a promising drug delivery system

  2. Synthesis, spectral characterisation, morphology, biological activity and DNA cleavage studies of metal complexes with chromone Schiff base

    Directory of Open Access Journals (Sweden)

    P. Kavitha

    2016-07-01

    Full Text Available Cu(II, Co(II, Ni(II and Zn(II complexes have been synthesized using 3-((pyridine-2-yliminomethyl-4H-chromen-4-one as a ligand derived from 3-formyl chromone and 2-amino pyridine. All the complexes were characterised by analytical, conductivity, IR, electronic, magnetic, ESR, thermal, powder XRD and SEM studies. The analytical data revealed that the metal to ligand molar ratio is 1:2 in all the complexes. Molar conductivity data indicates that all the complexes are neutral in nature. On the basis of magnetic and electronic spectral data, octahedral geometry is proposed for all the complexes. Thermal behaviour of the synthesized complexes indicates the coordinated and lattice water molecules are present in the complexes. The X-ray diffraction data suggest a triclinic system for all compounds. Different surface morphologies were identified from SEM micrographs. All metal complexes exhibit fluorescence. The antimicrobial and nematicidal activity data show that metal complexes are more potent than the parent ligand. The DNA cleavage activity of the ligand and its metal complexes were observed in the presence of H2O2.

  3. Characterisation of Sol-Gel Synthesis of Phase Pure CaTiO3 Nano Powders after Drying

    Science.gov (United States)

    Mallik, P. K.; Biswal, G.; Patnaik, S. C.; Senapati, S. K.

    2015-02-01

    According to a few recent studies, calcium titanate (CT) is a material that is similar to hydroxyapatite in biological properties. However, calcium titanate is not currently being used in the biomedical applications as to hydroxyapatite. The objective is to prepare nano calcium titanate powders from the equimolar solution of calcium oxide, ethanol and Titanium (IV) isopropoxide via sol-gel synthesis. The phase analysis and morphology of powder particles were studied by X-ray diffraction (XRD), while the composition and size of powder particles were determined by Transmission electron microscope (TEM) attached with energy dispersive x-ray spectrometer (EDS). As results, XRD confirm the presence of phase pure crystalline CaTiO3 after drying at 100°C for 24 hours, while TEM analysis confirms about 13 nm sizes of CaTiO3 particles and some agglomerated particle of 20-30 nm. Moreover, EDS analysis indicates that the approximately stoichiometric Ca/Ti ratio 1:1 was obtained in the CaTiO3 powders. Finally, it can be concluded that described sol-gel synthesis could be novel method for the production of nano CaTiO3 particles at lower temperature compared to any other methods of production.

  4. Highly Efficient Procedure for the Synthesis of Fructone Fragrance Using a Novel Carbon based Acid

    Directory of Open Access Journals (Sweden)

    Xuezheng Liang

    2010-08-01

    Full Text Available The novel carbon based acid has been synthesized via one-step hydrothermal carbonization of furaldehyde and hydroxyethylsulfonic acid. A highly efficient procedure for the synthesis of fructone has been developed using the novel carbon based acid. The results showed that the catalyst possessed high activity for the reaction, giving a yield of over 95%. The advantages of high activity, stability, reusability and low cost for a simple synthesis procedure and wide applicability to various diols and β-keto esters make this novel carbon based acid one of the best choices for the reaction.

  5. Regulation of bile acid synthesis in man. Presence of a diurnal rhythm.

    OpenAIRE

    Duane, W C; Levitt, D G; Mueller, S M; Behrens, J C

    1983-01-01

    Regulation of bile acid synthesis in man is incompletely understood, in part because of difficulty in making measurements over short time periods when the enterohepatic circulation is intact. We investigated the possibility of a diurnal rhythm of bile acid synthesis in three human subjects given [26-14C]cholesterol. When this isotope of cholesterol, which is randomly labeled in the 26 and 27 positions, is converted to bile acid, the 14C is released as propionic acid randomly labeled in the 1 ...

  6. Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

    International Nuclear Information System (INIS)

    Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.

    1989-01-01

    We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that in control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis

  7. Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

    Energy Technology Data Exchange (ETDEWEB)

    Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.

    1989-04-01

    We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that in control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.

  8. Early effects of dietary orotic acid upon liver lipid synthesis and bile cholesterol secretion in rats

    International Nuclear Information System (INIS)

    Tokmakjian, S.D.; Haines, D.S.

    1985-01-01

    Dietary orotic acid is known to cause impaired fatty acid synthesis and increased cholesterol synthesis in rats. The authors found that the impaired fatty acid synthesis occurs during the first day of orotic acid feeding and, in studies with albumin-bound [1- 14 C]palmitic acid, an associated decrease in the rate of esterification of this fatty acid into triacylglycerol, phospholipid, and cholesteryl ester was observed. These changes may result from the known decreases in liver levels of adenine nucleotides or, as reported here, from decreased liver CoASH levels in orotic acid-fed rats. The increase in hepatic cholesterol synthesis occurred during the second day of orotic acid feeding. It was detected by increased incorporation of [1,2- 14 C]acetate into cholesterol by liver slices and by a 7-fold increase in HMG-CoA reductase activity. At the same time the biliary output of cholesterol was increased 2-fold and studies using 3 H 2 O revealed that the output of newly synthesized cholesterol in bile was increased 5-fold. The content of cholesteryl ester in hepatic microsomes decreased during orotic acid feeding but free cholesterol was unchanged. The findings are interpreted to suggest that the increased bile cholesterol secretion caused by orotic acid is a result of impaired hepatic cholesterol esterification and that the increase in HMG-CoA reductase activity is a result of diminished negative feedback due to the depleted content of cholesteryl ester in the hepatic microsomes

  9. Abc Amino Acids: Design, Synthesis, and Properties of New Photoelastic Amino Acids

    Energy Technology Data Exchange (ETDEWEB)

    Standaert, Robert F [ORNL; Park, Dr Seung Bum [Seoul National University

    2006-01-01

    Photoisomerizable amino acids provide a direct avenue to the experimental manipulation of bioactive polypeptides, potentially allowing real-time, remote control of biological systems and enabling useful applications in nanobiotechnology. Herein, we report a new class of photoisomerizable amino acids intended to cause pronounced expansion and contraction in the polypeptide backbone, i.e., to be photoelastic. These compounds, termed Abc amino acids, employ a photoisomerizable azobiphenyl chromophore to control the relative disposition of aminomethyl and carboxyl substituents. Molecular modeling of nine Abc isomers led to the identification of one with particularly attractive properties, including the ability to induce contractions up to 13A in the backbone upon transa?cis photoisomerization. This isomer, designated mpAbc, has substituents at meta and para positions on the inner (azo-linked) and outer rings, respectively. An efficient synthesis of Fmoc-protected mpAbc was executed in which the biaryl components were formed via Suzuki couplings and the azo linkage was formed via amine/nitroso condensation; protected forms of three other Abc isomers were prepared similarly. A decapeptide incorporating mpAbc was synthesized by conventional solid-phase methods and displayed characteristic azobenzene photochemical behavior with optimal conversion to the cis isomer at 360 nm and a thermal cisa?trans half life of 100 min. at 80 AoC.

  10. Materials characterisation

    International Nuclear Information System (INIS)

    Azali Muhammad

    2005-01-01

    Various nuclear techniques have been developed and employed by technologies and scientists worldwide to physically and chemically characterise the material particularly those that have applications in industry. These include small angle neutron scattering (SANS), x-ray diffraction (XRD), scanning electron microscope (SEM) and transmission electron microscope (TEM) for the internal structural study of material, whereas, the x-ray fluorescence (XRF) for the chemical analysis, while the Moessbauer spectroscopy for the study on the magnetic properties and structural identity of material. Basic principle and instrumentations of the techniques are discussed in this chapter. Example of their applications in various disciplines particularly in characterisation of industrial materials also described

  11. First synthesis of phosphonobile acids and preliminary studies on their aggregation properties.

    Science.gov (United States)

    Maitra, Uday; Babu, Ponnusamy

    2003-05-01

    The synthesis of three novel phosphonobile acids from natural bile acids is reported. The CMC of phosphonodeoxycholic acid (PDCA) at pH 8.2 was found to be lower than that of the parent deoxycholic acid (DCA). PDCA micelles were also found to have higher microviscosity compared to DCA micelles, suggesting higher hydrophobicity and tighter packing in the interior of PDCA micelles. PDCA aggregated further to form an aqueous gel at pH 4.

  12. Synthesis, characterisation and thermal degradation behaviour of some coordination polymers by using TG–DTG and DTA techniques

    Directory of Open Access Journals (Sweden)

    Ratiram Gomaji Chaudhary

    2015-07-01

    Full Text Available The four chelate polymer complexes commonly called as coordination polymers of Mn(II, Co(II, Ni(II and Cu(II ions with fbpmpc (fbpmpc = fumaroyl bis (paramethoxyphenylcarbamide were synthesized and characterised by elemental analyses, infrared spectroscopy, diffuse reflectance, magnetic moment susceptibility, thermal analysis, X-ray diffraction, electrical conductivity and scanning electron microscopy technique (SEM. SEM investigations of coordination polymers were found in different shapes and sizes, though they are synthesized from a single ligand. Each metal ion is coordinated by a bis (bidentate manner through oxygen atom of the carboxylato group and the nitrogen atom of an amide group of ligand and two aqua ligands by coordinated bond which formed 6-member heterocyclic ring. In the present article, the main aim of research study is to find out the comparative studies of coordination polymers such as thermogravimetry (TG, derivative thermogravimetry (DTG, differential thermal analysis (DTA, electrical conductivity and morphology behaviour. Furthermore, the electrical conductivities of chelating ligand and coordination polymers were determined in the solid state powder form. The electrical conductivities measurements of undoped and doped ligand, coordination polymers were carried out at room temperature by the four probe technique using an electrometer. Thermal degradation studies of the coordination polymers have been carried out from a non-isothermal condition under nitrogen atmosphere at a heating rate of 10 °C min−1. The decomposition steps and thermal stabilities of these complexes were confirmed by thermal analysis techniques (TG/DTG/DTA. The thermal studies inferred the presence of crystallized water in all coordination polymers, whereas coordinated water was found in Ni(II and Cu(II ions.

  13. Optimisation and Characterisation of Lipase-Catalysed Synthesis of a Kojic Monooleate Ester in a Solvent-Free System by Response Surface Methodology.

    Directory of Open Access Journals (Sweden)

    Khairulazhar Jumbri

    Full Text Available Kojic acid is widely used to inhibit the browning effect of tyrosinase in cosmetic and food industries. In this work, synthesis of kojic monooleate ester (KMO was carried out using lipase-catalysed esterification of kojic acid and oleic acid in a solvent-free system. Response Surface Methodology (RSM based on central composite rotatable design (CCRD was used to optimise the main important reaction variables, such as enzyme amount, reaction temperature, substrate molar ratio, and reaction time along with immobilised lipase from Candida Antarctica (Novozym 435 as a biocatalyst. The RSM data indicated that the reaction temperature was less significant in comparison to other factors for the production of a KMO ester. By using this statistical analysis, a quadratic model was developed in order to correlate the preparation variable to the response (reaction yield. The optimum conditions for the enzymatic synthesis of KMO were as follows: an enzyme amount of 2.0 wt%, reaction temperature of 83.69°C, substrate molar ratio of 1:2.37 (mmole kojic acid:oleic acid and a reaction time of 300.0 min. Under these conditions, the actual yield percentage obtained was 42.09%, which is comparably well with the maximum predicted value of 44.46%. Under the optimal conditions, Novozym 435 could be reused for 5 cycles for KMO production percentage yield of at least 40%. The results demonstrated that statistical analysis using RSM can be used efficiently to optimise the production of a KMO ester. Moreover, the optimum conditions obtained can be applied to scale-up the process and minimise the cost.

  14. Synthesis, characterisation and corrosion resistance of TEOS/MPS hybrid sol-gel coatings deposited on the AA2050-T8 alloy

    Directory of Open Access Journals (Sweden)

    Claudia Nieves

    2017-11-01

    Full Text Available The aim of the present work was to synthesize, characterise and evaluate the corrosion resistance of TEOS/MPS hybrid sol-gel coatings applied on the AA2050-T8 aluminium alloy attending to two experimental variables: the sol synthesis conditions (type of solvent and aging time, and the inorganic/hybrid (TEOS/MPS ratio. The aging process was monitored by infrared spectroscopy (FTIR and viscosity measurements. The hybrid coatings were obtained by dip-coating and then characterized by scanning electron microscopy (SEM-EDX. The evaluation of corrosion resistance was performed by anodic potentio dynamic polarization testing in aerated 0.1 M NaCl solution. The results showed that ethanol as solvent promoted better stabilization of the hybrid precursor and favoured polymerization of the methacrylate groups of the MPS precursor. Further, an increase of the TEOS/MPS ratio allowed obtaining more continuous and uniform coatings. Nevertheless, all the hybrid coatings showed a significant increase in corrosion resistance of the AA2050-T8 alloy, being more evident for those synthesized with the TEOS:MPS 80:20 ratio.

  15. Glutamic Acid as Enhancer of Protein Synthesis Kinetics in Hepatocytes from Old Rats.

    Science.gov (United States)

    Brodsky, V Y; Malchenko, L A; Butorina, N N; Lazarev Konchenko, D S; Zvezdina, N D; Dubovaya, T K

    2017-08-01

    Dense cultures of hepatocytes from old rats (~2 years old, body weight 530-610 g) are different from similar cultures of hepatocytes from young rats by the low amplitude of protein synthesis rhythm. Addition of glutamic acid (0.2, 0.4, or 0.6 mg/ml) into the culture medium with hepatocytes of old rats resulted in increase in the oscillation amplitudes of the protein synthesis rhythm to the level of young rats. A similar action of glutamic acid on the protein synthesis kinetics was observed in vivo after feeding old rats with glutamic acid. Inhibition of metabotropic receptors of glutamic acid with α-methyl-4-carboxyphenylglycine (0.01 mg/ml) abolished the effect of glutamic acid. The amplitude of oscillation of the protein synthesis rhythm in a cell population characterizes synchronization of individual oscillations caused by direct cell-cell communications. Hence, glutamic acid, acting as a receptor-dependent transmitter, enhanced direct cell-cell communications of hepatocytes that were decreased with aging. As differentiated from other known membrane signaling factors (gangliosides, norepinephrine, serotonin, dopamine), glutamic acid can penetrate into the brain and thus influence the communications and protein synthesis kinetics that are disturbed with aging not only in hepatocytes, but also in neurons.

  16. Synthesis and vibrational spectroscopic characterisation of nickel (II) propionate tetrahydrate, Ni(CH 3CH 2COO) 2·4H 2O, and its aqueous solution

    Science.gov (United States)

    Bickley, R. I.; Edwards, H. G. M.; Gustar, R.; Rose, S. J.

    1991-08-01

    A two-stage synthesis for nickel(II) propionate is described. A comprehensive Raman and infrared spectroscopic study of propionic acid, nickel propionate, sodium propionate and barium propionate has been made and the vibrational spectra have been assigned. From comparisons of the Raman and infrared spectra of sodium propionate and nickel propionate, it is concluded that nickel (II) propionate dissociates into the propionate ion CH 3CH 2CO 2-, hexa-aquo nickel(II) ions Ni(H 2O) 2+6, and the monopropionato-nickel(II) species (CH 3CH 2COO)Ni +, in aqueous solution.

  17. Amino acid-assisted synthesis of strontium hydroxyapatite bone ...

    Indian Academy of Sciences (India)

    adhesives and for treatment of osteoporosis (Ni et al 2006). The synthesis of strontium hydroxyapatite can be accom- plished by using various methods of synthesis like sol–gel. (Balamurugan et al 2009), solid titrations (Pan et al 2009), wet chemical (Bigi et al 2007) and sol–gel- supercritical fluid drying (SCFD) methods ...

  18. Amino acid-assisted synthesis of strontium hydroxyapatite bone ...

    Indian Academy of Sciences (India)

    Strontium hydroxyapatite, a bioac- tive bone cement, is used in spinal and bone fracture surgery and it is also used in bone replacement, bone fillings, bone adhesives and for treatment of osteoporosis (Ni et al 2006). The synthesis of strontium hydroxyapatite can be accom- plished by using various methods of synthesis like ...

  19. Synthesis of the Demospongic Compounds, (6Z, 11Z-Octadecadienoic Acid and (6Z, 11Z-Eicosadienoic Acid

    Directory of Open Access Journals (Sweden)

    V. R. Mamdapur

    1997-01-01

    Full Text Available A stereoselective synthesis of (6Z, 11Z-octadecadienoic acid (1 and (6Z, 11Z-eicosadienoic acid (2 from easily accessible pentane-1,5-diol (3 is described. Thus, compound 3 on pyranylation and oxidation gave the aldehyde 5 which was converted to the acid 7 by Wittig reaction with a suitable phosphorane. Its depyranylation and oxidation furnished the key aldehyde 9 which upon Wittig reaction with n-heptylidene and n-nonylidene phosphoranes, respectively followed by alkaline hydrolysis afforded the title acids.

  20. High quality aluminium doped zinc oxide target synthesis from nanoparticulate powder and characterisation of sputtered thin films

    Energy Technology Data Exchange (ETDEWEB)

    Isherwood, P.J.M., E-mail: P.J.M.Isherwood@lboro.ac.uk [Centre for Renewable Energy Systems Technology, Loughborough University, Loughborough, Leicestershire LE11 3TU (United Kingdom); Neves, N. [Innovnano, S. A., Rua Coimbra Inovação Parque, IParque Lote 13, 3040-570 Antanhol, Coimbra (Portugal); Bowers, J.W. [Centre for Renewable Energy Systems Technology, Loughborough University, Loughborough, Leicestershire LE11 3TU (United Kingdom); Newbatt, P. [Innovnano, S. A., Rua Coimbra Inovação Parque, IParque Lote 13, 3040-570 Antanhol, Coimbra (Portugal); Walls, J.M. [Centre for Renewable Energy Systems Technology, Loughborough University, Loughborough, Leicestershire LE11 3TU (United Kingdom)

    2014-09-01

    Nanoparticulate aluminium-doped zinc oxide powder was synthesised through detonation and subsequent rapid quenching of metallic precursors. This technique allows for precise compositional control and rapid nanoparticle production. The resulting powder was used to form sputter targets, which were used to deposit thin films by radio frequency sputtering. These films show excellent sheet resistance and transmission values for a wide range of deposition temperatures. Crystal structure analysis shows that crystals in the target have a random orientation, whereas the crystals in the films grow perpendicular to the substrate surface and propagate preferentially along the (002) axis. Higher temperature deposition reduces crystal quality with a corresponding decrease in refractive index and an increase in sheet resistance. Films deposited between room temperature and 300 °C were found to have sheet resistances equivalent to or better than indium tin oxide films for a given average transmission value. - Highlights: • Nanoparticulate AZO powder was used to produce sputter targets. • The powder synthesis technique allows for precise compositional control. • Sputtered films show excellent optical, electronic and structural properties. • High temperature films show reduced electrical and structural quality. • For a given transmission, films show equivalent sheet resistances to ITO.

  1. Docosahexaenoic acid antagonizes the boosting effect of palmitic acid on LPS inflammatory signaling by inhibiting gene transcription and ceramide synthesis.

    Science.gov (United States)

    Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L Ashley; Lopes-Virella, Maria F; Huang, Yan

    2018-01-01

    It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages.

  2. Synthesis and antibacterial evaluation of anziaic acid and analogues as topoisomerase I inhibitors

    OpenAIRE

    Lin, Hao; Annamalai, Thirunavukkarasu; Bansod, Priyanka; Tse-Dinh, Yuk-Ching; Sun, Dianqing

    2013-01-01

    Naturally occurring anziaic acid was very recently reported as a topoisomerase I inhibitor with antibacterial activity. Herein total synthesis of anziaic acid and structural analogues is described and the preliminary structure-activity relationship (SAR) has been developed based on topoisomerase inhibition and whole cell antibacterial activity.

  3. Synthesis and NMR Elucidation of Novel Octa-Amino Acid Resorcin ...

    African Journals Online (AJOL)

    The synthesis of nine novel protected amino acid cavitands is reported. All have four pendant n-undecyl chains and 'headgroups' connected by a two-carbon spacer at eight positions on the aromatic rings. The amino acids employed are glycine, alanine, phenylalanine, leucine, proline, tryptophan, serine, glutamine and ...

  4. Asymmetric Synthesis of (S)-2-Indolinecarboxylic Acid by Combining Biocatalysis and Homogeneous Catalysis

    NARCIS (Netherlands)

    Lange, Ben de; Hyett, David J.; Maas, Peter J.D.; Mink, Daniel; Assema, Friso B.J. van; Sereinig, Natascha; Vries, André H.M. de; Vries, Johannes G. de

    2011-01-01

    (S)-2-Indolinecarboxylic acid, an intermediate for ACE inhibitors, was until recently produced by Fischer indole synthesis and classical resolution in seven steps. However, Perkin condensation to form ortho-chlorocinnamic acid, which is converted to (S)-ortho-chlorophenylalanine using the enzyme

  5. Stereoselective synthesis of a-hydroxy-b-amino acids: the chiral pool approach

    Directory of Open Access Journals (Sweden)

    RADOMIR N. SAICIC

    2004-11-01

    Full Text Available A method for the stereoselective homologation of a-amino acids into syn-a-hydroxy-b-amino acids is described, based on the conversion of stereoisomeric cyanohydrins into trans-oxazolines. The synthetic potential of the method is illustrated in the enantioselective formal synthesis of Bestatin.

  6. Boric acid as a mild and efficient catalyst for one-pot synthesis of 1 ...

    Indian Academy of Sciences (India)

    Multicomponent reaction; amidoalkyl naphthol; boric acid; catalyst; solvent-free synthesis. 1. Introduction. Multicomponent reactions (MCRs), in ... silica-sodium hydrogen sul- phate,14 molybdophosphoric acid (H3[P(Mo3O10)4]),15 ... The solid obtained was collected by filtration and purified by recrystallization from ethanol.

  7. The effect of nalidixic acid, rifampicin and chloramphenicol on the synthesis of phospholipase C in Bacillus cereus

    International Nuclear Information System (INIS)

    Valle, K.J.; Prydz, H.

    1978-01-01

    The effect of nalidixic acid, rifampicin and chloramphenicol on the synthesis of phospholipase C (EC 3.1.4.3) has been studied in washed Bacillus cereus cells resuspended in nutrient broth. In the absence of inhibitors, the synthesis showed a biphasic pattern. No synthesis or release of enzyme was found in the presence of chloramphenicol. When rifampicin was added, phospholipase C synthesis for 10-15 min. Nalidixic acid, at concentrations which inhibited DNA synthesis completely, permitted the synthesis of phospholipase C at the same rate and for a similar length of time as rifampicin. (author)

  8. Radiotracer studies on the synthesis of prorennin and rennin using 14C-amino acids

    International Nuclear Information System (INIS)

    Angelo, I.A.; Ganguli, N.C.

    1976-01-01

    In vivo incorporation of 14 C-amino acids into the prorennin and rennin fractions of the abomasal tissue of the intact animal (i.e. calf) has been investigated by : (1) intravenous injection of the label and subsequent isolation of rennin and prorennin fractions from the excised abomasum and (2) feeding. of milk whey fortified with the label to a fistulated kid and subsequent processing of the abomasal juice for rennet extraction. Prorennin incorporates more radioactivity than rennin. This indicates that abomasal tissue uses blood amino acids for prorennin synthesis, but amino acids fed through dietary channels may not be used for rennin synthesis. (M.G.B.)

  9. Synthesis, structural characterisation and antibacterial activity of Ag{sup +}-doped fluorapatite nanomaterials prepared by neutralization method

    Energy Technology Data Exchange (ETDEWEB)

    Stanić, Vojislav, E-mail: voyo@vinca.rs [University of Belgrade, Vinča Institute of Nuclear Sciences, P.O. Box 522, 11001 Belgrade (Serbia); Radosavljević-Mihajlović, Ana S. [University of Belgrade, Vinča Institute of Nuclear Sciences, P.O. Box 522, 11001 Belgrade (Serbia); Živković-Radovanović, Vukosava [University of Belgrade, Faculty of Chemistry, P.O. Box 51, 11158 Belgrade (Serbia); Nastasijević, Branislav; Marinović-Cincović, Milena; Marković, Jelena P.; Budimir, Milica D. [University of Belgrade, Vinča Institute of Nuclear Sciences, P.O. Box 522, 11001 Belgrade (Serbia)

    2015-05-15

    Graphical abstract: - Highlights: • The neutralization method has been used for synthesis of silver-doped fluorapatite powders. • Particles of silver-doped fluorapatite samples are of nano size and homogenous in composition. • The Ag{sup +}-doped fluorapatite samples showed antibacterial effect against Kllebsiela pneumoniae, Staphylococcus aureus and Micrococcus luteus. • AFM studies showed that silver-doped sample causes considerable morphological changes of tested bacterial cells. - Abstract: Silver doped fluorapatite nanopowders were synthesised by neutralization method, which consists of dissolving Ag{sub 2}O in solution of HF and H{sub 3}PO{sub 4} and addition to suspension of Ca(OH){sub 2}. The powder XRD, SEM and FTIR studies indicated the formation of a fluorapatite nanomaterials with average length of the particles is about 80 nm and a width of about 15 nm. The FTIR studies show that carbonate content in samples is very small and carbonte ions substitute both phosphate and hydroxyl groups in the crystal structure of samples, forming AB-type fluorapatite. Antibacterial studies have demonstrated that all Ag{sup +}-doped fluorapatite samples exhibit bactericidal effect against pathogens: Staphylococcus aureus, Micrococcus luteus and Kllebsiela pneumoniae. Antibacterial activity increased with the increase of Ag{sup +} in the samples. The atomic force microscopy studies revealed extensive damage to the bacterial cell envelops in the presence of Ag{sup +}-doped fluorapatite particles which may lead to their death. The synthesized Ag{sup +}-doped fluorapatite nanomaterials are promising as antibacterial biomaterials in orthopedics and dentistry.

  10. Synthesis and characterisation of novel low temperature ceramic and its implementation as substrate in dual segment CDRA

    Science.gov (United States)

    Kumari, Preeti; Tripathi, Pankaj; Sahu, Bhagirath; Singh, S. P.; Parkash, Om; Kumar, Devendra

    2018-02-01

    Li2O-(2-3x)MgO-(x)Al2O3-P2O5 (LMAP) (x = 0.00-0.08) ceramic system was prepared through solid state synthesis route at different sintering temperatures (800-925 °C). A small addition of Al2O3 (x = 0.02) in LMAP ceramics lowers the sintering temperature by more than 100 °C with good relative density of 94.13%. The sintered samples were characterized in terms of density, apparent porosity, water absorption, crystal structure, micro-structure and microwave dielectric properties. Silver compatibility test is also performed for its use as electrode material in low temperature co-fired ceramic (LTCC) application. To check the performance of the prepared LTCC as substrate, a microstrip-fed aperture-coupled dual segment cylindrical dielectric resonator antenna (DS-CDRA) is designed using LMAP (x = 0.02) ceramic as substrate material and Barium Strontium Titanate with 10 wt% of PbO-BaO-B2O3-SiO2 glass (BSTG) and Teflon as the components of resonating material. The simulation study of the DS-CDRA is performed using the Ansys High Frequency Structure Simulator (HFSS) software. A conductive coating of silver is used on the substrate. The simulated and measured -10 dB reflection coefficient bandwidths of 910 MHz (9.07-9.98 GHz at resonant frequency of 9.49 GHz) and 1080 MHz (8.68-9.76 GHz at resonant frequency of 9.36 GHz), respectively are achieved. The measured results of the fabricated antenna are found in good agreement with the simulation results. The prepared material can find potential applications in radar and radio navigation as well as radio astronomy and military satellite communication.

  11. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    Energy Technology Data Exchange (ETDEWEB)

    Lake, April D. [University of Arizona, Department of Pharmacology and Toxicology, Tucson, AZ 85721 (United States); Novak, Petr [Biology Centre ASCR, Institute of Plant Molecular Biology, Ceske Budejovice 37001 (Czech Republic); Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D. [Pharmaceutical Candidate Optimization, Bristol-Myers Squibb Co., Princeton, NJ 08543 (United States); Lu, Zhenqiang [The Arizona Statistical Consulting Laboratory, University of Arizona, Tucson, AZ 85721 (United States); Lehman-McKeeman, Lois D. [Pharmaceutical Candidate Optimization, Bristol-Myers Squibb Co., Princeton, NJ 08543 (United States); Cherrington, Nathan J., E-mail: cherrington@pharmacy.arizona.edu [University of Arizona, Department of Pharmacology and Toxicology, Tucson, AZ 85721 (United States)

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  12. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    International Nuclear Information System (INIS)

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-01-01

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  13. Biosynthesis of Polyunsaturated Fatty Acids in Octopus vulgaris: Molecular Cloning and Functional Characterisation of a Stearoyl-CoA Desaturase and an Elongation of Very Long-Chain Fatty Acid 4 Protein.

    Science.gov (United States)

    Monroig, Óscar; de Llanos, Rosa; Varó, Inmaculada; Hontoria, Francisco; Tocher, Douglas R; Puig, Sergi; Navarro, Juan C

    2017-03-21

    Polyunsaturated fatty acids (PUFAs) have been acknowledged as essential nutrients for cephalopods but the specific PUFAs that satisfy the physiological requirements are unknown. To expand our previous investigations on characterisation of desaturases and elongases involved in the biosynthesis of PUFAs and hence determine the dietary PUFA requirements in cephalopods, this study aimed to investigate the roles that a stearoyl-CoA desaturase (Scd) and an elongation of very long-chain fatty acid 4 (Elovl4) protein play in the biosynthesis of essential fatty acids (FAs). Our results confirmed the Octopus vulgaris Scd is a ∆9 desaturase with relatively high affinity towards saturated FAs with ≥ C 18 chain lengths. Scd was unable to desaturate 20:1 n- 15 ( ∆5 20:1) suggesting that its role in the biosynthesis of non-methylene interrupted FAs (NMI FAs) is limited to the introduction of the first unsaturation at ∆9 position. Interestingly, the previously characterised ∆5 fatty acyl desaturase was indeed able to convert 20:1 n- 9 ( ∆11 20:1) to ∆5,11 20:2, an NMI FA previously detected in octopus nephridium. Additionally, Elovl4 was able to mediate the production of 24:5 n- 3 and thus can contribute to docosahexaenoic acid (DHA) biosynthesis through the Sprecher pathway. Moreover, the octopus Elovl4 was confirmed to play a key role in the biosynthesis of very long-chain (>C 24 ) PUFAs.

  14. 4-hydroxyphenylacetic acid derivatives of inositol from dandelion (Taraxacum officinale) root characterised using LC-SPE-NMR and LC-MS techniques.

    Science.gov (United States)

    Kenny, O; Smyth, T J; Hewage, C M; Brunton, N P; McLoughlin, P

    2014-02-01

    The combination of hyphenated techniques, LC-SPE-NMR and LC-MS, to isolate and identify minor isomeric compounds from an ethyl acetate fraction of Taraxacum officinale root was employed in this study. Two distinct fractions of 4-hydroxyphenylacetic acid derivatives of inositol were isolated and characterised by spectroscopic methods. The (1)H NMR spectra and MS data revealed two groups of compounds, one of which were derivatives of the di-4-hydroxyphenylacetic acid derivative of the inositol compound tetrahydroxy-5-[2-(4-hydroxyphenyl)acetyl] oxycyclohexyl-2-(4-hydroxyphenyl) acetate, while the other group consisted of similar tri-substituted inositol derivatives. For both fractions the derivatives of inositols vary in the number of 4-hydroxyphenylacetic acid groups present and their position and geometry on the inositol ring. In total, three di-substituted and three tri-substituted 4-hydroxyphenylacetic acid inositol derivates were identified for the first time along with a further two previously reported di-substituted inositol derivatives. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Chemical Synthesis of Uncommon Natural Bile Acids: The 9α-Hydroxy Derivatives of Chenodeoxycholic and Lithocholic Acids.

    Science.gov (United States)

    Iida, Takashi; Namegawa, Kazunari; Nakane, Naoya; Iida, Kyoko; Hofmann, Alan Frederick; Omura, Kaoru

    2016-09-01

    The chemical synthesis of the 9α-hydroxy derivatives of chenodeoxycholic and lithocholic acids is reported. For initiating the synthesis of the 9α-hydroxy derivative of chenodeoxycholic acid, cholic acid was used; for the synthesis of the 9α-hydroxy derivative of lithocholic acid, deoxycholic acid was used. The principal reactions involved were (1) decarbonylation of conjugated 12-oxo-Δ(9(11))-derivatives using in situ generated monochloroalane (AlH2Cl) prepared from LiAlH4 and AlCl3, (2) epoxidation of the deoxygenated Δ(9(11))-enes using m-chloroperbenzoic acid catalyzed by 4,4'-thiobis-(6-tert-butyl-3-methylphenol), (3) subsequent Markovnikov 9α-hydroxylation of the Δ(9(11))-enes with AlH2Cl, and (4) selective oxidation of the primary hydroxyl group at C-24 in the resulting 3α,9α,24-triol and 3α,7α,9α,24-tetrol to the corresponding C-24 carboxylic acids using sodium chlorite (NaClO2) in the presence of a catalytic amount of 2,2,6,6-tetramethylpiperidine 1-oxyl free radical (TEMPO) and sodium hypochlorite (NaOCl). The (1)H- and (13)C-NMR spectra are reported. The 3α,7α,9α-trihydroxy-5β-cholan-24-oic acid has been reported to be present in the bile of the Asian bear, and its 7-deoxy derivative is likely to be a bacterial metabolite. These bile acids are now available as authentic reference standards, permitting their identification in vertebrate bile acids.

  16. Characterisation of the l-Cystine β-Lyase PatB from Phaeobacter inhibens: An Enzyme Involved in the Biosynthesis of the Marine Antibiotic Tropodithietic Acid.

    Science.gov (United States)

    Dickschat, Jeroen S; Rinkel, Jan; Klapschinski, Tim; Petersen, Jörn

    2017-11-16

    The l-cystine β-lyase from Phaeobacter inhibens is involved in the biosynthesis of the sulfur-containing antibiotic tropodithietic acid. The recombinant enzyme was obtained by heterologous expression in Escherichia coli and biochemically characterised by unambiguous chemical identification of the products formed from the substrate l-cystine, investigation of the substrate spectrum, determination of the enzyme kinetics, sequence alignment with closely related homologues and site-directed mutagenesis to identify a highly conserved lysine residue that is critical for functionality. PatB from P. inhibens is a new member of the small group of characterised l-cystine β-lyases and the first example of an enzyme with such an activity that is required for the biosynthesis of an antibiotic. A comparison of PatB to previously reported enzymes with l-cystine β-lyase activity from bacteria and plants is given. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Duodenal prostaglandin synthesis and acid load in health and in duodenal ulcer disease

    International Nuclear Information System (INIS)

    Ahlquist, D.A.; Dozois, R.R.; Zinsmeister, A.R.; Malagelada, J.R.

    1983-01-01

    We sought to test the hypothesis that duodenal ulcer disease results from an imbalance between duodenal acid load, an injurious force, and mucosal prostaglandin generation, a protective factor. Ten patients with duodenal ulcer and 8 healthy controls were studied. The duodenal acid load after an amino acid soup was quantified by a double-marker technique. Mucosal biopsy specimens were taken endoscopically from the duodenal bulb before and after the test meal. Prostaglandin synthesis activity was measured by incubating biopsy homogenates in excess [ 14 C]arachidonic acid. Although mean duodenal acid load was higher in duodenal ulcer, ranges overlapped. Neither the qualitative nor quantitative profile of mucosal prostaglandin synthesis activities differed significantly between test groups. Prostaglandin synthesis activities, however, tended to increase post cibum in controls, but change little or decrease in duodenal ulcer. Only by comparing the responses with a meal of both parameters together (duodenal acid load and the change in prostaglandin synthesis activities) was there complete or nearly complete separation of duodenal ulcer from controls. Greatest discrimination was observed with prostacyclin (6-keto-PGF1 alpha). We conclude that in health, mucosal prostaglandin generation in the duodenum is induced post cibum in relation to duodenal acid load; this may be a physiologic example of adaptive cytoprotection. In duodenal ulcer there may be a defect in such a mechanism

  18. Synthesis, characterisation, and preliminary anti-cancer photodynamic therapeutic in vitro studies of mixed-metal binuclear ruthenium(II)-vanadium(IV) complexes

    Science.gov (United States)

    Taylor, Patrick; Magnusen, Anthony R.; Moffett, Erick T.; Meyer, Kyle; Hong, Yiling; Ramsdale, Stuart E.; Gordon, Michelle; Stubbs, Javelyn; Seymour, Luke A.; Acharya, Dhiraj; Weber, Ralph T.; Smith, Paul F.; Dismukes, G. Charles; Ji, Ping; Menocal, Laura; Bai, Fengwei; Williams, Jennie L.; Cropek, Donald M.; Jarrett, William L.

    2013-01-01

    We report the synthesis and characterisation of mixed-metal binuclear ruthenium(II)-vanadium(IV) complexes, which were used as potential photodynamic therapeutic agents for melanoma cell growth inhibition. The novel complexes, [Ru(pbt)2(phen2DTT)](PF6)2•1.5H2O 1 (where phen2DTT = 1,4-bis(1,10-phenanthrolin-5-ylsulfanyl)butane-2,3-diol and pbt = 2-(2'-pyridyl)benzothiazole) and [Ru(pbt)2(tpphz)](PF6)2•3H2O 2 (where tpphz = tetrapyrido[3,2-a:2′,3′-c:3″,2″-h:2‴,3‴-j]phenazine) were synthesised and characterised. Compound 1 was reacted with [VO(sal-L-tryp)(H2O)] (where sal-L-tryp = N-salicylidene-L-tryptophanate) to produce [Ru(pbt)2(phen2DTT)VO(sal-L-tryp)](PF6)2•5H2O 4; while [VO(sal-L-tryp)(H2O)] was reacted with compound 2 to produce [Ru(pbt)2(tpphz)VO(sal-L-tryp)](PF6)2•6H2O 3. All complexes were characterised by elemental analysis, HRMS, ESI MS, UV-visible absorption, ESR spectroscopy, and cyclic voltammetry, where appropriate. In vitro cell toxicity studies (with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) colorimetric assay) via dark and light reaction conditions were carried out with sodium diaqua-4,4',4”,4”'tetrasulfophthalocyaninecobaltate(II) (Na4[Co(tspc)(H2O)2]), [VO(sal-L-tryp)(phen)]•H2O, and the chloride salts of complexes 3 and 4. Such studies involved A431, human epidermoid carcinoma cells; human amelanotic malignant melanoma cells; and HFF, non-cancerous human skin fibroblast cells. Both chloride salts of complexes 3 and 4 were found to be more toxic to melanoma cells than to non-cancerous fibroblast cells, and preferentially led to apoptosis of the melanoma cells over non-cancerous skin cells. The anti-cancer property of the chloride salts of complexes 3 and 4 was further enhanced when treated cells were exposed to light, while no such effect was observed on non-cancerous skin fibroblast cells. ESR and 51V NMR spectroscopic studies were also used to assess the stability of the chloride salts of

  19. Characterising pharmacological ligands to study the long chain fatty acid receptors GPR40/FFA1 and GPR120/FFA4

    DEFF Research Database (Denmark)

    Milligan, G; Alvarez-Curto, E; Watterson, K R

    2015-01-01

    by the same group of free fatty acids, FFA1 and FFA4 are not closely related and whilst the basis of recognition of fatty acids by FFA1 is similar to that of the short-chain fatty acid receptors FFA2 and FFA3, amino acid residues involved in endogenous ligand recognition by FFA4 are more akin to those......The G protein-coupled receptors FFA1 (previously designated GPR40) and FFA4 (previously GPR120) are both activated by saturated and unsaturated longer-chain free fatty acids. With expression patterns and functions anticipated to directly or indirectly promote insulin secretion, provide homeostatic...... control of blood glucose and improve tissue insulin sensitivity, both receptors are being studied as potential therapeutic targets for the control of type II diabetes. Furthermore, genetic and systems biology studies in both humans and mouse models link FFA4 to diabetes and obesity. Although activated...

  20. Effect of Lauric Acid on Cell Division, Macromolecular Synthesis and Membrane Lipid Organization in Escherichia coli

    OpenAIRE

    Hakobu, Nakamura; Atsushi, Hase; Biological Institute, Faculty of Science, Konan University; Biological Institute, Faculty of Science, Konan University:(Present)Osaka City Institute of Public Health and Environmental Sciences

    1984-01-01

    Lauric acid (1mg/ml) sharply suppressed the cell division of an acrA mutant strain of Escherichia coli K12. However, the wild type acrA+ strain was resistant to the fatty acid. Capric acid and myristic acid were not so toxic. Lauric acid inhibited both DNA and protein synthesis of the acrA mutant strain, with the former being more sensitive than the latter. On the other hand, DNA polymerase activity of toluene-treated cells was stimulated rather than inhibited by the presence of 1mg/ml of lau...

  1. Synthesis and characterisation of Stannate ceramics for application as high performance material; Synthese und Charakterisierung von Stannat-Keramiken fuer die Verwendung als Hochleistungswerkstoff

    Energy Technology Data Exchange (ETDEWEB)

    Mueller, A.

    2003-07-01

    New optimised wet-chemical routes (precipitation, polymerisation and sol-gel) for the production of pure, homogenic and nanocrystalline perovskitic earth alkali stannate powders (Ba- and SrSnO{sub 3}) were investigated. One of the routes was used to synthesise substituted partly new stannate ceramics (Ba{sub 2}YSnO{sub 5.5}, Ba{sub 2}NdSnO{sub 5.5} and nonstoichiometric compositions). The characterisation includes thermal analysis, Fourier transform infrared spectroscopy, x-ray diffraction and quantitative phase analysis. Further, results of impedance spectroscopy on the substituted powders are discussed. Thermal analysis data provide information about the precursor i. e. phase transition, ordering onset and mass changes. FTIR spectroscopy is both used to identify functional groups in the precursor and to compare with starting reagents as well as to investigate the surface behaviour of the calcined powders, i. e. adsorption of CO{sub 2} or water. X-ray diffraction data are used to compare the products in terms of phase purity and identification of additional phases as well as determination of crystallite size and distribution, structural parameters and quantitative phase analysis (target product and additional phases). The synthesis routes are compared and evaluated. The polymerisation and sol-gel-routes provide the best products in terms of material specific parameters. Different impedance spectra of Ba{sub 2}YSnO{sub 5.5}, Ba{sub 2}NdSnO{sub 5.5} and ''nonstoichiometric'' ceramics measured between RT and ca. 600 C are presented and calculated values for the specific conductance are shown. Ba{sub 2}YSnO{sub 5.5} can be applied as good conductive compound, Ba{sub 2}NdSnO{sub 5.5} and nonstoichiometric compositions as possible candidates for a membrane in a SOFC or as sensor material. (orig.)

  2. E'-N-(2,4-dihydroxybenzylidene)nicotinohydrazide and its Metal Complexes: Synthesis, Characterisation and Antitubercular Activity

    International Nuclear Information System (INIS)

    Ogunniran, K. O.; Adekoya, J. A.; Ehi-Eromosele, C.; Ajani, O. O.; Kayode, A.; Narender, T.

    2016-01-01

    Nicotinic acid hydrazide and 2,4-dihydoxylbenzaldehyde were condensed at 20 degree C to form an acylhydrazone (H3L1) with ONO coordination pattern. The structure of the acylhydrazone was elucidated by using CHN analyzer, ESI mass spectrometry, IR, 1H NMR, 13C NMR and 2D NMR such as COSY and HSQC. Thereafter, five novel metal complexes [Mn(II), Fe(II), Pt(II) Zn(II) and Pd(II)] of the hydrazone ligand were synthesized and their structural characterization were achieved by several physicochemical methods namely: elemental analysis, electronic spectra, infrared, EPR, molar conductivity and powder X-ray diffraction studies. An octahedral geometry was suggested for both Pd(II) and Zn(II) complexes while both Mn(II) and Fe(II) complexes conformed with tetrahedral pyramidal. However, Pt(II) complex agreed with tetrahedral geometry. In vitro antitubercular activity study of the ligand and the metal complexes were evaluated against Mycobacterium tuberculosis, H37Rv, by using micro-diluted method. The results obtained revealed that (PtL1) (MIC = 0.56 mg/mL), (ZnL1) (MIC = 0.61 mg/mL), (MnL1) (MIC = 0.71 mg/mL) and (FeL1) (MIC = 0.82 mg/mL), exhibited a significant activity when compared with first line drugs such as isoniazid (INH) (MIC = 0.9 mg/mL). H3L1 exhibited lesser antitubercular activity with MIC value of 1.02 mg/mL. However, the metal complexes displayed higher cytotoxicity but were found to be non-significant different (P > 0.05) to isoniazid drug. (author)

  3. Activity of dietary fatty acids on FFA1 and FFA4 and characterisation of pinolenic acid as a dual FFA1/FFA4 agonist with potential effect against metabolic diseases

    DEFF Research Database (Denmark)

    Christiansen, Elisabeth; Watterson, Kenneth R; Stocker, Claire J

    2015-01-01

    Various foods are associated with effects against metabolic diseases such as insulin resistance and type 2 diabetes; however, their mechanisms of action are mostly unclear. Fatty acids may contribute by acting as precursors of signalling molecules or by direct activity on receptors. The medium......- and long-chain NEFA receptor FFA1 (free fatty acid receptor 1, previously known as GPR40) has been linked to enhancement of glucose-stimulated insulin secretion, whereas FFA4 (free fatty acid receptor 4, previously known as GPR120) has been associated with insulin-sensitising and anti-inflammatory effects......, and both receptors are reported to protect pancreatic islets and promote secretion of appetite and glucose-regulating hormones. Hypothesising that FFA1 and FFA4 mediate therapeutic effects of dietary components, we screened a broad selection of NEFA on FFA1 and FFA4 and characterised active compounds...

  4. Reaction of Hydrazine Hydrate with Oxalic Acid: Synthesis and ...

    African Journals Online (AJOL)

    NICO

    2013-11-28

    hydrazinium (+1)] and N2H6. 2+ [hydrazinium (+2)] ionic salts with mineral as well as carboxylic acids. Hydrazinium. (+1) salts are more common and they can be obtained with a wide variety of acids whereas hydrazinium (+2) ...

  5. Synthesis and role of salicylic acid in wheat varieties with different levels of cadmium tolerance

    International Nuclear Information System (INIS)

    Kovács, Viktória; Gondor, Orsolya K.; Szalai, Gabriella; Darkó, Éva; Majláth, Imre; Janda, Tibor; Pál, Magda

    2014-01-01

    Highlights: • Cd induces the salicylic acid metabolism in wheat. • Salicylic acid is synthesized via benzoic acid and/or ortho-hydroxy-cinnamic acid. • Cd tolerance can be explained by the highly induced glutathione metabolism. • Salicylic acid signalling is correlated with glutathione-related mechanisms. - Abstract: Wheat genotypes with different endogenous SA contents were investigated, in order to reveal how cadmium influences salicylic acid (SA) synthesis, and to find possible relationships between SA and certain protective compounds (members of the antioxidants and the heavy metal detoxification system) and between the SA content and the level of cadmium tolerance. Cadmium exposure induced SA synthesis, especially in the leaves, and it is suggested that the phenyl-propanoid synthesis pathway is responsible for the accumulation of SA observed after cadmium stress. Cadmium influenced the synthesis and activation of protective compounds to varying extents in wheat genotypes with different levels of tolerance; the roots and leaves also responded differently to cadmium stress. Although a direct relationship was not found between the initial SA levels and the degree of cadmium tolerance, the results suggest that the increase in the root SA level during cadmium stress in the Mv varieties could be related with the enhancement of the internal glutathione cycle, thus inducing the antioxidant and metal detoxification systems, which promote Cd stress tolerance in wheat seedlings. The positive correlation between certain SA-related compounds and protective compounds suggests that SA-related signalling may also play a role in the acclimation to heavy metal stress

  6. Synthesis and role of salicylic acid in wheat varieties with different levels of cadmium tolerance

    Energy Technology Data Exchange (ETDEWEB)

    Kovács, Viktória; Gondor, Orsolya K.; Szalai, Gabriella; Darkó, Éva; Majláth, Imre; Janda, Tibor; Pál, Magda, E-mail: pal.magda@agrar.mta.hu

    2014-09-15

    Highlights: • Cd induces the salicylic acid metabolism in wheat. • Salicylic acid is synthesized via benzoic acid and/or ortho-hydroxy-cinnamic acid. • Cd tolerance can be explained by the highly induced glutathione metabolism. • Salicylic acid signalling is correlated with glutathione-related mechanisms. - Abstract: Wheat genotypes with different endogenous SA contents were investigated, in order to reveal how cadmium influences salicylic acid (SA) synthesis, and to find possible relationships between SA and certain protective compounds (members of the antioxidants and the heavy metal detoxification system) and between the SA content and the level of cadmium tolerance. Cadmium exposure induced SA synthesis, especially in the leaves, and it is suggested that the phenyl-propanoid synthesis pathway is responsible for the accumulation of SA observed after cadmium stress. Cadmium influenced the synthesis and activation of protective compounds to varying extents in wheat genotypes with different levels of tolerance; the roots and leaves also responded differently to cadmium stress. Although a direct relationship was not found between the initial SA levels and the degree of cadmium tolerance, the results suggest that the increase in the root SA level during cadmium stress in the Mv varieties could be related with the enhancement of the internal glutathione cycle, thus inducing the antioxidant and metal detoxification systems, which promote Cd stress tolerance in wheat seedlings. The positive correlation between certain SA-related compounds and protective compounds suggests that SA-related signalling may also play a role in the acclimation to heavy metal stress.

  7. Receptor-mediated uptake of low density lipoprotein stimulates bile acid synthesis by cultured rat hepatocytes

    International Nuclear Information System (INIS)

    Junker, L.H.; Davis, R.A.

    1989-01-01

    The cellular mechanisms responsible for the lipoprotein-mediated stimulation of bile acid synthesis in cultured rat hepatocytes were investigated. Adding 280 micrograms/ml of cholesterol in the form of human or rat low density lipoprotein (LDL) to the culture medium increased bile acid synthesis by 1.8- and 1.6-fold, respectively. As a result of the uptake of LDL, the synthesis of [14C]cholesterol from [2-14C]acetate was decreased and cellular cholesteryl ester mass was increased. Further studies demonstrated that rat apoE-free LDL and apoE-rich high density lipoprotein (HDL) both stimulated bile acid synthesis 1.5-fold, as well as inhibited the formation of [14C]cholesterol from [2-14C]acetate. Reductive methylation of LDL blocked the inhibition of cholesterol synthesis, as well as the stimulation of bile acid synthesis, suggesting that these processes require receptor-mediated uptake. To identify the receptors responsible, competitive binding studies using 125I-labeled apoE-free LDL and 125I-labeled apoE-rich HDL were performed. Both apoE-free LDL and apoE-rich HDL displayed an equal ability to compete for binding of the other, suggesting that a receptor or a group of receptors that recognizes both apolipoproteins is involved. Additional studies show that hepatocytes from cholestyramine-treated rats displayed 2.2- and 3.4-fold increases in the binding of apoE-free LDL and apoE-rich HDL, respectively. These data show for the first time that receptor-mediated uptake of LDL by the liver is intimately linked to processes activating bile acid synthesis

  8. Kinetics of Ethyl Acetate Synthesis Catalyzed by Acidic Resins

    Science.gov (United States)

    Antunes, Bruno M.; Cardoso, Simao P.; Silva, Carlos M.; Portugal, Ines

    2011-01-01

    A low-cost experiment to carry out the second-order reversible reaction of acetic acid esterification with ethanol to produce ethyl acetate is presented to illustrate concepts of kinetics and reactor modeling. The reaction is performed in a batch reactor, and the acetic acid concentration is measured by acid-base titration versus time. The…

  9. Synthesis and accumulation of free amino acids during somatic and ...

    African Journals Online (AJOL)

    In ZE, glutamine and asparagine appeared to be fundamental to the process of induction of zygotic embryos. On the other hand, the induction of somatic embryos that appeared require glutamine, gamma-aminobutyric acid (GABA) and glutamic acid. The results suggest the involvement of amino acids in the ontogenesis of ...

  10. Selective synthesis of thiodiglycol dicarboxylic acid esters via p ...

    Indian Academy of Sciences (India)

    The esterification of thiodiglycol and long alkyl-chain carboxylic acids is reported. Reaction of thiodiglycol with carboxylic acid via -TsOH/C-catalysed direct esterification afforded thiodiglycol dicarboxylic acid esters in good yields and chemoselectivity. The use of immobilized -TsOH on activated carbon as catalyst is ...

  11. A Convenient Synthesis of Amino Acid Methyl Esters

    Directory of Open Access Journals (Sweden)

    Yaowu Sha

    2008-05-01

    Full Text Available A series of amino acid methyl ester hydrochlorides were prepared in good toexcellent yields by the room temperature reaction of amino acids with methanol in thepresence of trimethylchlorosilane. This method is not only compatible with natural aminoacids, but also with other aromatic and aliphatic amino acids.

  12. Synthesis and anticancer activity of new isatin-benzoic acid ...

    African Journals Online (AJOL)

    A series of new isatin-benzoic acid conjugates (9a - n) were synthesized via conjugation of isatin (3a) and its derivatives (3b - d, 4, 5 and 6) with 4-amino-5 chloro-2-ethoxybenzoic acid or 4-amino-5-(ethylsulfonyl)-2- methoxybenzoic acid by using chloroacetyl chloride as a bifunctional linker. Compounds 3a - d were ...

  13. Aqueous Microwave-Assisted Solid-Phase Synthesis Using Boc-Amino Acid Nanoparticles

    Directory of Open Access Journals (Sweden)

    Yoshinobu Fukumori

    2013-07-01

    Full Text Available We have previously developed water-based microwave (MW-assisted peptide synthesis using Fmoc-amino acid nanopaticles. It is an organic solvent-free, environmentally friendly method for peptide synthesis. Here we describe water-based MW-assisted solid-phase synthesis using Boc-amino acid nanoparticles. The microwave irradiation allowed rapid solid-phase reaction of nanoparticle reactants on the resin in water. We also demonstrated the syntheses of Leu-enkephalin, Tyr-Gly-Gly-Phe-Leu-OH, and difficult sequence model peptide, Val-Ala-Val-Ala-Gly-OH, using our water-based MW-assisted protocol with Boc-amino acid nanoparticles.

  14. Characterisation of PDO olive oil Chianti Classico by non-selective (UV-visible, NIR and MIR spectroscopy) and selective (fatty acid composition) analytical techniques.

    Science.gov (United States)

    Casale, M; Oliveri, P; Casolino, C; Sinelli, N; Zunin, P; Armanino, C; Forina, M; Lanteri, S

    2012-01-27

    An authentication study of the Italian PDO (protected designation of origin) extra virgin olive oil Chianti Classico was performed; UV-visible (UV-vis), Near-Infrared (NIR) and Mid-Infrared (MIR) spectroscopies were applied to a set of samples representative of the whole Chianti Classico production area. The non-selective signals (fingerprints) provided by the three spectroscopic techniques were utilised both individually and jointly, after fusion of the respective profile vectors, in order to build a model for the Chianti Classico PDO olive oil. Moreover, these results were compared with those obtained by the gas chromatographic determination of the fatty acids composition. In order to characterise the olive oils produced in the Chianti Classico PDO area, UNEQ (unequal class models) and SIMCA (soft independent modelling of class analogy) were employed both on the MIR, NIR and UV-vis spectra, individually and jointly, and on the fatty acid composition. Finally, PLS (partial least square) regression was applied on the UV-vis, NIR and MIR spectra, in order to predict the content of oleic and linoleic acids in the extra virgin olive oils. UNEQ, SIMCA and PLS were performed after selection of the relevant predictors, in order to increase the efficiency of both classification and regression models. The non-selective information obtained from UV-vis, NIR and MIR spectroscopy allowed to build reliable models for checking the authenticity of the Italian PDO extra virgin olive oil Chianti Classico. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. Synthesis, Characterisation, and Evaluation of a Cross-Linked Disulphide Amide-Anhydride-Containing Polymer Based on Cysteine for Colonic Drug Delivery

    Directory of Open Access Journals (Sweden)

    Vuanghao Lim

    2013-12-01

    Full Text Available The use of disulphide polymers, a low redox potential responsive delivery, is one strategy for targeting drugs to the colon so that they are specifically released there. The objective of this study was to synthesise a new cross-linked disulphide-containing polymer based on the amino acid cysteine as a colon drug delivery system and to evaluate the efficiency of the polymers for colon targeted drug delivery under the condition of a low redox potential. The disulphide cross-linked polymers were synthesised via air oxidation of 1,2-ethanedithiol and 3-mercapto-N-2-(3-mercaptopropionamide-3-mercapto propionic anhydride (trithiol monomers using different ratio combinations. Four types of polymers were synthesised: P10, P11, P151, and P15. All compounds synthesised were characterised by NMR, IR, LC-MS, CHNS analysis, Raman spectrometry, SEM-EDX, and elemental mapping. The synthesised polymers were evaluated in chemical reduction studies that were performed in zinc/acetic acid solution. The suitability of each polymer for use in colon-targeted drug delivery was investigated in vitro using simulated conditions. Chemical reduction studies showed that all polymers were reduced after 0.5–1.0 h, but different polymers had different thiol concentrations. The bacterial degradation studies showed that the polymers were biodegraded in the anaerobic colonic bacterial medium. Degradation was most pronounced for polymer P15. This result complements the general consensus that biodegradability depends on the swellability of polymers in an aqueous environment. Overall, these results suggest that the cross-linked disulphide-containing polymers described herein could be used as coatings for drugs delivered to the colon.

  16. The role of tannic acid and sodium citrate in the synthesis of silver nanoparticles

    Science.gov (United States)

    Ranoszek-Soliwoda, Katarzyna; Tomaszewska, Emilia; Socha, Ewelina; Krzyczmonik, Pawel; Ignaczak, Anna; Orlowski, Piotr; Krzyzowska, Małgorzata; Celichowski, Grzegorz; Grobelny, Jaroslaw

    2017-08-01

    We describe herein the significance of a sodium citrate and tannic acid mixture in the synthesis of spherical silver nanoparticles (AgNPs). Monodisperse AgNPs were synthesized via reduction of silver nitrate using a mixture of two chemical agents: sodium citrate and tannic acid. The shape, size and size distribution of silver particles were determined by UV-Vis spectroscopy, dynamic light scattering (DLS) and scanning transmission electron microscopy (STEM). Special attention is given to understanding and experimentally confirming the exact role of the reagents (sodium citrate and tannic acid present in the reaction mixture) in AgNP synthesis. The oxidation and reduction potentials of silver, tannic acid and sodium citrate in their mixtures were determined using cyclic voltammetry. Possible structures of tannic acid and its adducts with citric acid were investigated in aqueous solution by performing computer simulations in conjunction with the semi-empirical PM7 method. The lowest energy structures found from the preliminary conformational search are shown, and the strength of the interaction between the two molecules was calculated. The compounds present on the surface of the AgNPs were identified using FT-IR spectroscopy, and the results are compared with the IR spectrum of tannic acid theoretically calculated using PM6 and PM7 methods. The obtained results clearly indicate that the combined use of sodium citrate and tannic acid produces monodisperse spherical AgNPs, as it allows control of the nucleation, growth and stabilization of the synthesis process. [Figure not available: see fulltext.

  17. Differential effects of 17α-ethinylestradiol on the neutral and acidic pathways of bile salt synthesis in the rat

    NARCIS (Netherlands)

    Koopen, N.R.; Post, S.M.; Wolters, H.; Havinga, R.; Stellaard, F.; Boverhof, R.; Kuipers, F.; Princen, H.M.G.

    1999-01-01

    Effects of 17α-ethinylestradiol (EE) on the neutral and acidic biosynthetic pathways of bile salt (BS) synthesis were evaluated in rats with an intact enterohepatic circulation and in rats with long-term bile diversion to induce BS synthesis. For this purpose, bile salt pool composition, synthesis

  18. Characterisation and biochemical properties of predominant lactic acid bacteria from fermenting cassava for selection as starter cultures

    CSIR Research Space (South Africa)

    Kostinek, M

    2007-03-01

    Full Text Available phase of the fermentation, the fa- cultatively heterofermentative lactobacilli which produce DL- lactate (mostly L. plantarum-group strains) dominated (50%) and even increased (67.5%) towards the end of the fer- mentation. L. plantarum strains... of Food Microbiology 72, 53–62. Schillinger, U., Lücke, F.K., 1987. Identification of lactobacilli from meat and meat products. Food Microbiology 4, 199–208. Shewale, J.G., 1982. Beta-glucosidase—its role in cellulase synthesis and hydrolysis...

  19. Communic Acids: Occurrence, Properties and Use as Chirons for the Synthesis of Bioactive Compounds

    Directory of Open Access Journals (Sweden)

    Alejandro F. Arteaga

    2012-02-01

    Full Text Available Communic acids are diterpenes with labdane skeletons found in many plant species, mainly conifers, predominating in the genus Juniperus (fam. Cupresaceae. In this review we briefly describe their distribution and different biological activities (anti- bacterial, antitumoral, hypolipidemic, relaxing smooth muscle, etc.. This paper also includes a detailed explanation of their use as chiral building blocks for the synthesis of bioactive natural products. Among other uses, communic acids have proven useful as chirons for the synthesis of quassinoids (formal, abietane antioxidants, ambrox and other perfume fixatives, podolactone herbicides, etc., featuring shorter and more efficient processes.

  20. Electroenzymatic strategies for deracemization, stereoinversion and asymmetric synthesis of amino acids

    International Nuclear Information System (INIS)

    Maerkle, Wolfgang; Luetz, Stephan

    2008-01-01

    A combination of a selective enzymatic oxidation with an unselective electrochemical reduction step was applied for deracemization, stereoinversion and asymmetric synthesis of L-leucine (starting from racemic leucine, D-leucine or 4-methyl-2-oxovaleric acid) in a batch reactor. D-Amino acid oxidase (D-AAO) from Trigonopsis variabilis was used as enzyme. Reaction conditions for the electrochemical and enzymatic reactions were investigated separately and finally combined to an electroenzymatic synthesis, yielding 3.5 mmol L -1 d -1 of L-leucine (ee 91%)

  1. Communic acids: occurrence, properties and use as chirons for the synthesis of bioactive compounds.

    Science.gov (United States)

    Barrero, Alejandro F; Herrador, M Mar; Arteaga, Pilar; Arteaga, Jesús F; Arteaga, Alejandro F

    2012-02-06

    Communic acids are diterpenes with labdane skeletons found in many plant species, mainly conifers, predominating in the genus Juniperus (fam. Cupresaceae). In this review we briefly describe their distribution and different biological activities (anti- bacterial, antitumoral, hypolipidemic, relaxing smooth muscle, etc.). This paper also includes a detailed explanation of their use as chiral building blocks for the synthesis of bioactive natural products. Among other uses, communic acids have proven useful as chirons for the synthesis of quassinoids (formal), abietane antioxidants, ambrox and other perfume fixatives, podolactone herbicides, etc., featuring shorter and more efficient processes.

  2. synthesis and optical characterization of acid-doped polyaniline thin ...

    African Journals Online (AJOL)

    HOD

    biological sensors, actuators, micro electronic devices, etc. It is a good material for applications in photocells, transducers, circuit boards, rechargeable batteries, .... with Silver Nanoparticles”, Advances in Materials. Physics and Chemistry,Vol. 2, pp 75-81, 2012. [5] Fernando, J., and Vedhi, C.,“Synthesis, Spectral and.

  3. Triazole-linked glycosyl amino acids and peptides : synthesis

    NARCIS (Netherlands)

    Kuijpers, B.H.M.

    2008-01-01

    Naturally occurring glycosylated peptides play an important role in various biological processes and are therefore interesting lead molecules for the preparation of new therapeutic drugs.Synthesis of these natural glycopeptides is frequently hampered by the sensitivity of the natural glycosidic

  4. Barley polyamine oxidase: Characterisation and analysis of the cofactor and the N-terminal amino acid sequence

    DEFF Research Database (Denmark)

    Radova, A.; Sebela, M.; Galuszka, P.

    2001-01-01

    was further purified to a final homogeneity (by the criteria of isoelectric focusing and SDS-PAGE) using techniques of low pressure chromatography followed by two FPLC steps. The purified yellow enzyme showed visible absorption maxima of a flavoprotein at 380 and 450 nm: the presence of FAD as the cofactor...... was further confirmed by measuring the fluorescence spectra, Barley PAO is an acidic protein (pI 5.4) containing 3% of neutral sugars: its molecular mass determined by SDS-PAGE was 56 kDa, whilst gel permeation chromatography revealed the higher value of 76 kDa. The N-terminal amino acid sequence of barley...

  5. Characterisation of fatty acid, carotenoid, tocopherol/tocotrienol compositions and antioxidant activities in seeds of three Chenopodium quinoa Willd. genotypes.

    Science.gov (United States)

    Tang, Yao; Li, Xihong; Chen, Peter X; Zhang, Bing; Hernandez, Marta; Zhang, Hua; Marcone, Massimo F; Liu, Ronghua; Tsao, Rong

    2015-05-01

    Composition of fatty acids, tocopherols, tocotrienols, and carotenoids, and their contribution to antioxidant activities were investigated in seeds of three coloured quinoa cultivars (white, red and black). The major components and individual compounds were significantly different, and their concentrations were higher in darker seeds (p quinoa had the highest vitamin E followed by red and white quinoas. Carotenoids, mainly trans-lutein (84.7-85.6%) and zeaxanthin were confirmed for the first time in quinoa seeds, and the concentration was also the highest in black seeds. The antioxidant activities of lipophilic extracts were positively correlated with polyunsaturated fatty acids, total carotenoids and total tocopherols. Copyright © 2014. Published by Elsevier Ltd.

  6. Photochemical Synthesis of the Bioconjugate Folic Acid-Gold Nanoparticles

    DEFF Research Database (Denmark)

    León, John Jairo Castillo; Bertel, Linda; Páez-Mozo, Edgar

    2013-01-01

    In this paper we present a rapid and simple onepot method to obtain gold nanoparticles functionalized with folic acid using a photochemistry method. The bioconjugate folic acid-gold nanoparticle was generated in one step using a photo-reduction method, mixing hydrogen tetrachloroaurate with folic...... at 4°C prolongs the stability of folic acid-gold nanoparticle suspensions to up to 26 days. Ultraviolet visible and Fourier transform infrared spectroscopy showed a surface plasmon band of around 534nm and fluorescence spectroscopy exhibited a quenching effect on gold nanoparticles in the fluorescence...... emission of folic acid and thus confirmed the conjugation of folic acid to the surface of gold nanoparticles. In this study we demonstrate the use of a photochemistry method to obtain folic acid-gold nanoparticles in a simple and rapid way without the use of surfactants and long reaction times...

  7. Amino acid starvation has opposite effects on mitochondrial and cytosolic protein synthesis.

    Directory of Open Access Journals (Sweden)

    Mark A Johnson

    Full Text Available Amino acids are essential for cell growth and proliferation for they can serve as precursors of protein synthesis, be remodelled for nucleotide and fat biosynthesis, or be burnt as fuel. Mitochondria are energy producing organelles that additionally play a central role in amino acid homeostasis. One might expect mitochondrial metabolism to be geared towards the production and preservation of amino acids when cells are deprived of an exogenous supply. On the contrary, we find that human cells respond to amino acid starvation by upregulating the amino acid-consuming processes of respiration, protein synthesis, and amino acid catabolism in the mitochondria. The increased utilization of these nutrients in the organelle is not driven primarily by energy demand, as it occurs when glucose is plentiful. Instead it is proposed that the changes in the mitochondrial metabolism complement the repression of cytosolic protein synthesis to restrict cell growth and proliferation when amino acids are limiting. Therefore, stimulating mitochondrial function might offer a means of inhibiting nutrient-demanding anabolism that drives cellular proliferation.

  8. THE ADDITION EFFECT OF SULPHANILIC ACID TO THE SYNTHESIS OF 3,4-METHYLENEDIOXYBENZALDEHYDE

    Directory of Open Access Journals (Sweden)

    Feti Fatimah

    2011-12-01

    Full Text Available It was conducted a research about the addition effect of sulphanilic acid to the synthesis 3,4-methylenedioxybenzaldehyde from the isosafrole using reagents of sodium dichromate, sulphuric acid, and sulphanilic acid. The separation and purification of product were performed using the chromatography column. The purity of the result was tested using thin layer chromatography and determination of the melting point. Furthermore, it was identified its structure using infrared spectrophotometer, 1H and 13C nuclear magnetic resonance spectrometry, and mass spectrometry. The experimental result showed that the percentage yield of 3,4-methylenedioxybenzaldehyde with addition sulphanilic acid was 79.54%.

  9. Synthesis of glycosyl-amino acids of biological interest; Sintese de glicoaminoacidos de interesse biologico

    Energy Technology Data Exchange (ETDEWEB)

    Campo, Vanessa Leiria; Carvalho, Ivone [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Ciencias Farmaceuticas]. E-mail: carronal@usp.br

    2008-07-01

    This work describes the synthesis of the glycosylated amino acids {alpha}GlcNAc-Thr, {beta}GlcNAc-Thr and {alpha}LacNAc-Thr by the glycosylation reaction of the amino acid threonine with the corresponding glycosyl donors {alpha}GlcNAcCl and {alpha}LacN3Cl. The glycosylated amino acids containing the sugar units {alpha}-D-GlcNAc and {alpha}-D-LacNAc O-linked to threonine amino acids are related to O-glycans found in mucins of the parasite Trypanosoma cruzi, while the corresponding {beta}-D-GlcNAc isomer is involved in cellular signaling events. (author)

  10. Synthesis of hyper branched polyol from palm oil oleic acid

    International Nuclear Information System (INIS)

    Mek Zah Salleh; Mohd Hilmi Mahmood

    2010-01-01

    Hyper branched polyol from oleic acid of palm oil has been synthesized by a two-step reaction. Dipentaerythritol was initially reacted with 2, 2-bis (hydroxymethyl) propionic acid in a solution medium aided by p-toluene sulfonic acid as a catalyst. This mixture was then used as core and reacted with the oleic acid. Optimization parameters such as processing temperature and reaction time, and chemical analysis (for example OHV, AV, FTIR, NMR and GPC) of the macromolecule synthesized is presented in this paper. (author)

  11. Characterisation of SalRAB a salicylic acid inducible positively regulated efflux system of Rhizobium leguminosarum bv viciae 3841.

    Directory of Open Access Journals (Sweden)

    Adrian J Tett

    Full Text Available Salicylic acid is an important signalling molecule in plant-microbe defence and symbiosis. We analysed the transcriptional responses of the nitrogen fixing plant symbiont, Rhizobium leguminosarum bv viciae 3841 to salicylic acid. Two MFS-type multicomponent efflux systems were induced in response to salicylic acid, rmrAB and the hitherto undescribed system salRAB. Based on sequence similarity salA and salB encode a membrane fusion and inner membrane protein respectively. salAB are positively regulated by the LysR regulator SalR. Disruption of salA significantly increased the sensitivity of the mutant to salicylic acid, while disruption of rmrA did not. A salA/rmrA double mutation did not have increased sensitivity relative to the salA mutant. Pea plants nodulated by salA or rmrA strains did not have altered nodule number or nitrogen fixation rates, consistent with weak expression of salA in the rhizosphere and in nodule bacteria. However, BLAST analysis revealed seventeen putative efflux systems in Rlv3841 and several of these were highly differentially expressed during rhizosphere colonisation, host infection and bacteroid differentiation. This suggests they have an integral role in symbiosis with host plants.

  12. Preparation and structural characterisation of novel and versatile amphiphilic octenyl succinic anhydride-modified hyaluronic acid derivatives

    DEFF Research Database (Denmark)

    Eenschooten, Corinne Diane; Guillaumie, Fanny; Kontogeorgis, Georgios

    2010-01-01

    The purpose of the present study was to prepare amphiphilic hyaluronic acid (HA) derivatives and to study the influence of a selection of reaction parameters on the degree of substitution (DS) of the derivatives. Octenyl succinic anhydride (OSA)–modified HA (OSA–HA) derivatives were prepared...

  13. Synthesis of a Series of Caffeic Acid Phenethyl Amide (CAPA) Fluorinated Derivatives: Comparison of Cytoprotective Effects to Caffeic Acid Phenethyl Ester (CAPE)

    Science.gov (United States)

    2010-06-11

    Synthesis of a series of caffeic acid phenethyl amide (CAPA) fluorinated derivatives: Comparison of cytoprotective effects to caffeic acid phenethyl...to induce genes with the downstream effect of counter- acting oxidative stress.5,6 Caffeic acid phenethyl ester (CAPE), a plant polyphenolic con... synthesis and investigation of catechol ring-fluorinated derivatives of CAPE with regard to cytoprotective ability against oxidative stress in vitro.14

  14. Effect of Thymine Starvation on Messenger Ribonucleic Acid Synthesis in Escherichia coli

    Science.gov (United States)

    Luzzati, Denise

    1966-01-01

    Luzzati, Denise (Institut de Biologie Physico-Chimique, Paris, France). Effect of thymine starvation on messenger ribonucleic acid synthesis in Escherichia coli. J. Bacteriol. 92:1435–1446. 1966.—During the course of thymine starvation, the rate of synthesis of messenger ribonucleic acid (mRNA, the rapidly labeled fraction of the RNA which decays in the presence of dinitrophenol or which hybridizes with deoxyribonucleic acid) decreases exponentially, in parallel with the viability of the thymine-starved bacteria. The ability of cell-free extracts of starved bacteria to incorporate ribonucleoside triphosphates into RNA was determined; it was found to be inferior to that of extracts from control cells. The analysis of the properties of cell-free extracts of starved cells shows that their decreased RNA polymerase activity is the consequence of a modification of their deoxyribonucleic acid, the ability of which to serve as a template for RNA polymerase decreases during starvation. PMID:5332402

  15. EVALUATION OF THE SYNTHESIS AND STRUCTURE OF NEW AZETIDIN-2-ONES OF FERULIC ACID.

    Science.gov (United States)

    Stan, Cătălina Daniela; Drăgan, Maria; Pânzariu, Andreea; Profire, Lenuţa

    2016-01-01

    To synthesize some new azetidin-2-ones of ferulic acid and to evaluate them from physicochemical and spectral point of view. The synthesis was carried out in several steps: (i) obtaining the ferulic acid chloride; (ii) obtaining the ferulic acid hydrazide with hydrazine hydrate (98%); (iii) condensation of ferulic acid hydrazide with different benzaldehydes (2-hydroxy-/2-nitro-/4-chloro-/4- fluoro-/4-bromo-benzaldehyde) in order to obtain the corresponding hydrazones; (iv) cy- clization of ferulic acid hydrazones with chloroacethyl chloride in freshly distilled toluene medium and in the presence of triethylamine, resulting in the corresponding azetidin-2-ones. Six new azetidin-2-ones of ferulic acid were synthesized. They were characterized in terms of their physicochemical properties and their structure was confirmed by IR and 1H-NMR spectroscopy. Six new azetidin-2-ones of ferulic acid were synthesized, physicochemically characterized and validated spectrally. A

  16. Synthesis of novel carbon/silica composites based strong acid ...

    Indian Academy of Sciences (India)

    hydrophobic acid-catalyzed reactions proceed in poor or with no catalytic activity (Nakajima et al 2009). The novel car- bon/silica composites based solid acid was synthesized for the purpose. However, the new method added the step of impregnating sucrose to the channels of SBA-15, which fur- ther added to the cost for ...

  17. SYNTHESIS OF FATTY ACID ETHYL ESTER FROM CHICKEN FAT ...

    African Journals Online (AJOL)

    eobe

    out using two-step procedures of acid pretreatment by esterification and transesterification of the pretreated oil. step procedures of acid pretreatment .... the transesterification of vegetable oils; however, ethanol was employed in the present .... further refining for use as a biodiesel feedstock. Its properties were established to ...

  18. Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...

    Indian Academy of Sciences (India)

    Permanent link: http://www.ias.ac.in/article/fulltext/jcsc/125/01/0041-0049. Keywords. Ferrocene/Lewis acid; optical rotation; frustrated Lewis pairs; organoborane. Abstract. Optically active Lewis acids and Lewis pairs were synthesized and characterized by multinuclear NMR, UV/Vis spectroscopy and elemental analysis.

  19. Phenazines and natural products; Novel synthesis of saphenic acid

    DEFF Research Database (Denmark)

    Petersen, Lars; Jensen, Knud Jørgen; Nielsen, John

    1999-01-01

    The natural product saphenic acid (6-(1-hydroxyethyl)1-phenazinecarboxylic acid) was synthesized from readily accessible starting materials. The desired product was obtained in an overall yield of 22% for four steps with the key steps being formation of a diphenylamine, followed by cyclization...

  20. Improved synthesis of isostearic acid using zeolite catalysts

    Science.gov (United States)

    Isostearic acids are unique and important biobased products with superior properties. Unfortunately, they are not widely utilized in industry because they are produced as byproducts from a process called clay-catalyzed oligomerization of tall oil fatty acids. Generally, this clay method results in...

  1. Vapour phase synthesis of salol over solid acids via transesterification

    Indian Academy of Sciences (India)

    Administrator

    salicylic acid in phenol is very low, this method requires the use of the latter in higher molar ratios. Hence, the method of transesterification of methyl salicylate with phenol is employed wherein the reac- tants, being mutually soluble in one another, can be mixed in different molar ratios. Also, the solid acid catalysts that have ...

  2. Synthesis and application of dyes derived from Schaeffer's acid on ...

    African Journals Online (AJOL)

    A monoazo dye was synthesized and applied to nylon 6,6 fibers. The effect of heat-set and auxiliary treatment on the absorption of acid dyes by nylon fibers was investigated. The dye was synthesized by the diazotization of primary amine to form a diazonium salt and coupling it to a coupling component (Schaeffer's acid).

  3. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    Energy Technology Data Exchange (ETDEWEB)

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  4. Synthesis, characterisation, stereochemistry and antimicrobial ...

    Indian Academy of Sciences (India)

    convulsant, anti-anxiety, anti- fungal, anti-bacterial, anti-feedant, analgesic, sedative, anti-depressive and hypnotic agents.2–5 Certain deriva- tives viz., lofendazam, clobazam and triflubazam are used for the treatment of anxiety and neuroses including.

  5. Synthesis, characterisation, stereochemistry and antimicrobial ...

    Indian Academy of Sciences (India)

    benzodiazepine also supports boat conformation in the solid state. The antimicrobial activity for -acetyltetrahydro-1,5-benzodiazepines have been carried out. -morpholinoacetyl-2,2,4-trimethyl-1H-1,5-benzodiazepine demonstrated better antibacterial and ...

  6. Gold/acid-co-catalyzed direct microwave-assisted synthesis of fused azaheterocycles from propargylic hydroperoxides.

    Science.gov (United States)

    Alcaide, Benito; Almendros, Pedro; Quirós, M Teresa

    2014-03-17

    The gold-acid-co-catalyzed synthesis of nine series of fused azaheterocycles with structural diversity starting from the same synthons as readily available propargylic hydroperoxides and aromatic amines has been achieved. The overall tandem process consists in a gold-catalyzed hydroperoxide rearrangement/Michael reaction followed by a final acid-catalyzed cyclization. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Synthesis of branched amino acids : isonorstatine, phenylisothreonine, lactacystin analogues, and amino polyols

    OpenAIRE

    Li, Feng

    2007-01-01

    The 1,2-aminoalcohol fragment is found in many natural products and drugs, for example as a central moiety of non-proteinogenic amino acids. It is also an integral part of doxorubicin and daunomycin, which have been used for the treatment of human malignancies. There is, therefore, a particular interest in the synthesis of branched amino hydroxy acids such as isonorstatine, phenylisothreonine, amino polyols and lactacystin derivatives. Norstatine is part of amastatin, an inhibitor of leuc...

  8. Enzymatic synthesis of 11C-pyruvic acid and 11C-L-lactic acid

    International Nuclear Information System (INIS)

    Cohen, M.B.; Spolter, L.; Chang, C.C.; Cook, J.S.; Macdonald, N.S.

    1980-01-01

    L-Lactic acid is formed as the end product of glycolysis under anaerobic conditions in all cells, but this reaction is of special significance in the myocardium. L-Lactic acid is reversibly formed from and is in equilibrium with myocardial pyruvic acid, which is its sole metabolic pathway. 11 C-Pyruvic acid is synthesized from 11 C carbon dioxide using pyruvate-ferredoxin oxidoreductase and coenzymes. The 11 C-pyruvic acid is then converted to 11 -L-lactic acid by lactic acid dehydrogenase. The availability of 11 C-pyruvic acid and 11 C-L-lactic acid will permit the in vivo investigation of lactate metabolism. (author)

  9. Characterisation of neuroprotective efficacy of modified poly-arginine-9 (R9) peptides using a neuronal glutamic acid excitotoxicity model.

    Science.gov (United States)

    Edwards, Adam B; Anderton, Ryan S; Knuckey, Neville W; Meloni, Bruno P

    2017-02-01

    In a recent study, we highlighted the importance of cationic charge and arginine residues for the neuroprotective properties of poly-arginine and arginine-rich peptides. In this study, using cortical neuronal cultures and an in vitro glutamic acid excitotoxicity model, we examined the neuroprotective efficacy of different modifications to the poly-arginine-9 peptide (R9). We compared an unmodified R9 peptide with R9 peptides containing the following modifications: (i) C-terminal amidation (R9-NH2); (ii) N-terminal acetylation (Ac-R9); (iii) C-terminal amidation with N-terminal acetylation (Ac-R9-NH2); and (iv) C-terminal amidation with D-amino acids (R9D-NH2). The three C-terminal amidated peptides (R9-NH2, Ac-R9-NH2, and R9D-NH2) displayed neuroprotective effects greater than the unmodified R9 peptide, while the N-terminal acetylated peptide (Ac-R9) had reduced efficacy. Using the R9-NH2 peptide, neuroprotection could be induced with a 10 min peptide pre-treatment, 1-6 h before glutamic acid insult, or when added to neuronal cultures up to 45 min post-insult. In addition, all peptides were capable of reducing glutamic acid-mediated neuronal intracellular calcium influx, in a manner that reflected their neuroprotective efficacy. This study further highlights the neuroprotective properties of poly-arginine peptides and provides insight into peptide modifications that affect efficacy.

  10. Parallel fluorescent probe synthesis based on the large-scale preparation of BODIPY FL propionic acid.

    Science.gov (United States)

    Katoh, Taisuke; Yoshikawa, Masato; Yamamoto, Takeshi; Arai, Ryosuke; Nii, Noriyuki; Tomata, Yoshihide; Suzuki, Shinkichi; Koyama, Ryoukichi; Negoro, Nobuyuki; Yogo, Takatoshi

    2017-03-01

    We describe a methodology for quick development of fluorescent probes with the desired potency for the target of interest by using a method of parallel synthesis, termed as Parallel Fluorescent Probe Synthesis (Parallel-FPS). BODIPY FL propionic acid 1 is a widely used fluorophore, but it is difficult to prepare a large amount of 1, which hinders its use in parallel synthesis. Optimization of a synthetic scheme enabled us to obtain 50g of 1 in one batch. With this large quantity of 1 in hand, we performed Parallel-FPS of BODIPY FL-labeled ligands for estrogen related receptor-α (ERRα). An initial trial of the parallel synthesis with various linkers provided a potent ligand for ERRα (Reporter IC 50 =80nM), demonstrating the usefulness of Parallel-FPS. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. AMP-activated kinase restricts Rift Valley fever virus infection by inhibiting fatty acid synthesis.

    Directory of Open Access Journals (Sweden)

    Theresa S Moser

    Full Text Available The cell intrinsic innate immune responses provide a first line of defense against viral infection, and often function by targeting cellular pathways usurped by the virus during infection. In particular, many viruses manipulate cellular lipids to form complex structures required for viral replication, many of which are dependent on de novo fatty acid synthesis. We found that the energy regulator AMPK, which potently inhibits fatty acid synthesis, restricts infection of the Bunyavirus, Rift Valley Fever Virus (RVFV, an important re-emerging arthropod-borne human pathogen for which there are no effective vaccines or therapeutics. We show restriction of RVFV both by AMPK and its upstream activator LKB1, indicating an antiviral role for this signaling pathway. Furthermore, we found that AMPK is activated during RVFV infection, leading to the phosphorylation and inhibition of acetyl-CoA carboxylase, the first rate-limiting enzyme in fatty acid synthesis. Activating AMPK pharmacologically both restricted infection and reduced lipid levels. This restriction could be bypassed by treatment with the fatty acid palmitate, demonstrating that AMPK restricts RVFV infection through its inhibition of fatty acid biosynthesis. Lastly, we found that this pathway plays a broad role in antiviral defense since additional viruses from disparate families were also restricted by AMPK and LKB1. Therefore, AMPK is an important component of the cell intrinsic immune response that restricts infection through a novel mechanism involving the inhibition of fatty acid metabolism.

  12. Synthesis and characterization of covalent diphenylalanine nanotube-folic acid conjugates

    DEFF Research Database (Denmark)

    León, John Jairo Castillo; Rindzevicius, Tomas; Wu, Kaiyu

    2014-01-01

    Herein, we describe the synthesis and characterization of a covalent nanoscale assembly formed between diphenylalanine micro/nanotubes (PNT) and folic acid (FA). The conjugate was obtained via chemical functionalization through coupling of amine groups of PNTs and carboxylic groups of FA. The sur......Herein, we describe the synthesis and characterization of a covalent nanoscale assembly formed between diphenylalanine micro/nanotubes (PNT) and folic acid (FA). The conjugate was obtained via chemical functionalization through coupling of amine groups of PNTs and carboxylic groups of FA...... performed on a large area silver-capped (diameter of 62 nm) silicon nanopillars with an approximate height of 400 nm and a width of 200 nm. The results showed that the PNT-FA synthesis procedure preserves the molecular structure of FA. The PNT-FA conjugate presented in this study is a promising candidate...

  13. Easy synthesis of graphene sheets from alfalfa plants by treatment of nitric acid

    International Nuclear Information System (INIS)

    Qu, Jiao; Luo, Chunqiu; Zhang, Qian; Cong, Qiao; Yuan, Xing

    2013-01-01

    Highlights: ► An easy method for synthesis of graphene sheets using alfalfa plants was introduced. ► An novelty formation mechanism of graphene sheets using alfalfa plants was proposed. ► This method exploits a new carbon source and provides a novel idea to synthesize graphene sheets. -- Abstract: This letter focuses on synthesis of graphene sheets from alfalfa plants by treatment of nitric acid. The transmission electron microscopy image (TEM) demonstrates that the graphene sheets are agglomerated and overlapped, the energy dispersive spectrum (EDS) indicates that the products are pure, and the Raman spectrum shows the graphene sheets are well graphitized. In addition, the formation mechanism of the graphene sheets from alfalfa plants by treatment nitric acid is discussed. These findings inspire the search for a new strategy for synthesis of graphene sheets from renewable natural products, and the lower cost of this new process and carbon source may facilitate industrial production

  14. Glutathione synthesis rates after amino acid administration directly after birth in preterm infants

    NARCIS (Netherlands)

    te Braake, Frans W. J.; Schierbeek, Henk; de Groof, Karien; Vermes, Andras; Longini, Mariangela; Buonocore, Giuseppe; van Goudoever, Johannes B.

    2008-01-01

    The availability of glutathione, the main intracellular antioxidant, is compromised in preterm neonates. A possible explanation is the low availability of substrate for synthesis, because many neonatologists are reluctant to administer amino acids in the direct postnatal period for fear of

  15. Facile synthesis of CdS nanocrystals using thioglycolic acid as a ...

    African Journals Online (AJOL)

    A novel method has been developed for the synthesis of CdS nanocrystals (NCs) using thioglycolic acid (TGA) as a sulfur source and stabilizer with the presence of hydrogen peroxide in an aqueous medium. The products were characterized by X-ray powder diffraction (XRD), transmission electron microscopy (TEM) and ...

  16. Methods for the synthesis of tritium-labelled fatty acids and their derivatives, oxylipins and steroids

    International Nuclear Information System (INIS)

    Shevchenko, Valerii P; Nagaev, Igor Yu; Myasoedov, Nikolai F

    1999-01-01

    The achievements in the field of synthesis and application of tritium-labelled oxylipins, steroids, fatty acids, phospho-, sphingo- and other lipids are reviewed. The importance of these studies for the solution of current problems of biochemistry, biology and pharmacology is exemplified in the application of labelled compounds. The bibliography includes 148 references.

  17. A convenient procedure for the solid-phase synthesis of hydroxamic acids on PEGA resins

    DEFF Research Database (Denmark)

    Nandurkar, Nitin Subhash; Petersen, Rico; Qvortrup, Katrine

    2011-01-01

    An efficient method for the solid-phase synthesis of hydroxamic acids is described. The method comprises the nucleophilic displacement of esters immobilized on PEGA resins with hydroxylamine/sodium hydroxide in isopropanol. The hydroxyaminolysis protocol is compatible with a broad range of PEGA...

  18. Synthesis, Characterization, and Saccharide Binding Studies of Bile Acid − Porphyrin Conjugates

    Directory of Open Access Journals (Sweden)

    Vladimír Král

    2007-01-01

    Full Text Available Synthesis and characterization of bile acid-porphyrin conjugates (BAPs are reported. Binding of saccharides with BAPs in aqueous methanol was studied by monitoring changes in the visible absorption spectral of the porphyrin-moieties. Although these studies clearly showed absorbance changes, suggesting quite high if non-selective binding, the mass spectral studies do not unambiguously support these results.

  19. Fluorine-containing 2,4-dioxo acids in the synthesis of heterocyclic compounds

    International Nuclear Information System (INIS)

    Saloutin, Viktor I; Burgart, Yanina V; Chupakhin, Oleg N

    1999-01-01

    The review surveys the data on the synthesis, tautomerism, electronic structures and chemical transformations of 4-polyfluoroalkyl- and 4-pentafluorophenyl-2,4-dioxo acids and their derivatives. The reactions yielding fluorinated heterocyclic compounds and their further conversions are considered. The bibliography includes 86 references.

  20. Mass transfer effects in the H2SO4 catalyzed pivalic acid synthesis

    NARCIS (Netherlands)

    Brilman, D.W.F.; Meesters, N.G.; Swaaij, W.P.M. van; Versteeg, G.F.

    2001-01-01

    The synthesis of carboxylic acids from alkenes, carbon monoxide and water according to the Koch process is usually carried out in a stirred gas–liquid–liquid multiphase reactor. Due to the complex reaction system with fast, equilibrium reactions and fast, irreversible reactions the yield and product

  1. Mass transfer effects in H2SO4 catalyzed pivalic acid synthesis

    NARCIS (Netherlands)

    Brilman, Derk Willem Frederik; Meesters, N.G.; van Swaaij, Willibrordus Petrus Maria; Versteeg, Geert

    2001-01-01

    The synthesis of carboxylic acids from alkenes, carbon monoxide and water according to the Koch process is usually carried out in a stirred gas–liquid–liquid multiphase reactor. Due to the complex reaction system with fast, equilibrium reactions and fast, irreversible reactions the yield and product

  2. Boric acid as a mild and efficient catalyst for one-pot synthesis of 1 ...

    Indian Academy of Sciences (India)

    Abstract. An efficient green chemistry method has been developed for the synthesis of 1-amidoalkyl-2-naphthol derivatives via a one-pot three-component condensation of 2-naphthol, aldehydes and amide in the presence of boric acid as a mild catalyst.

  3. Synthesis of Novel N-9-Substituted Purine Derivatives from Polymer Supported alpha-Amino Acids

    Czech Academy of Sciences Publication Activity Database

    Vanda, D.; Jorda, Radek; Lemrová, B.; Volná, T.; Kryštof, Vladimír; McMaster, C.; Soural, M.

    2015-01-01

    Roč. 17, č. 7 (2015), s. 426-432 ISSN 2156-8952 R&D Projects: GA MŠk(CZ) LO1204; GA MŠk(CZ) LO1304 Institutional support: RVO:61389030 Keywords : alpha-amino acids * solid-phase synthesis * purine derivatives Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.317, year: 2015

  4. Boric acid as a mild and efficient catalyst for one-pot synthesis of 1

    Indian Academy of Sciences (India)

    Abstract. An efficient green chemistry method has been developed for the synthesis of 1-amidoalkyl-2-naphthol derivatives via a one-pot three-component condensation of 2-naphthol, aldehydes and amide in the presence of boric acid as a mild catalyst.

  5. Selectivity Enhancement in methylamine synthesis via postsynthesis modification of bronsted acidic mordenite

    NARCIS (Netherlands)

    Grundling, C.; Gründling, Christian; Mirth, G.C.; Eder-Mirth, Gabriele C.; Lercher, J.A.

    1996-01-01

    Methylamine synthesis from methanol and ammonia over parent and modified Brønsted acidic mordenites is studied byin situinfrared spectroscopy and kinetic analysis to elucidate the role of elementary steps for activity and selectivity.In situinfrared spectroscopy reveals that all methylammonium ions

  6. Kinetic Resolution and Stereoselective Synthesis of 3-Substituted Aspartic Acids by Using Engineered Methylaspartate Ammonia Lyases

    NARCIS (Netherlands)

    Raj, Hans; Szymanski, Wiktor; Villiers, Jandré de; Puthan Veetil, Vinod; Quax, Wim J.; Shimamoto, Keiko; Janssen, Dick B.; Feringa, Ben L.; Poelarends, Gerrit J.

    2013-01-01

    Kinetic resolution and asymmetric synthesis of various valuable 3-substituted aspartic acids, which were obtained in fair to good yields with diastereomeric ratio values of up to >98:2 and enantiomeric excess values of up to >99 %, by using engineered methylaspartate ammonia lyases are described.

  7. Synthesis and pharmacology of 3-hydroxy-delta2-isoxazoline-cyclopentane analogues of glutamic acid

    DEFF Research Database (Denmark)

    Conti, P; De Amici, M; Bräuner-Osborne, Hans

    2002-01-01

    The synthesis and pharmacology of two potential glutamic acid receptor ligands are described. Preparation of the bicyclic 3-hydroxy-delta2-isoxazoline-cyclopentane derivatives (+/-)-7 and (+/-)-8 was accomplished via 1,3-dipolar cycloaddition of bromonitrile oxide to suitably protected 1-amino-cy...

  8. Synthesis and biological evaluation of new salicylate macrolactones from anacardic acids

    Energy Technology Data Exchange (ETDEWEB)

    Logrado, Lucio P.L.; Santos, Maria Lucilia dos [Brasilia Univ., DF (Brazil). Inst. de Quimica. Lab. de Isolamento e Transformacao de Moleculas Organicas]. E-mail: mlsantos@unb.br; Silveira, Damaris [Brasilia Univ., DF (Brazil). Faculdade de Ciencias da Saude; Romeiro, Luiz A.S. [Universidade Catolica de Brasilia, Taguatinga, DF (Brazil). Nucleo de Quimica Bioorganica e Medicinal; Moraes, Manoel O. de; Cavalcanti, Bruno C.; Costa-Lotufo, Leticia V.; Pessoa, Claudia do O [Ceara Univ., Fortaleza, CE (Brazil). Lab. de Oncologia Experimental

    2005-11-15

    onnection with our ongoing investigation in the search for new bioactive compounds using non-isoprenoid phenolic lipids from Anacardium occidentale as starting material, we describe the synthesis and cytotoxicity screening of some novel salicylate macrolactones prepared from anacardic acids, the major constituents of natural cashew nut-shell liquid (CNSL). (author)

  9. Recent advances in the catalytic asymmetric synthesis of β-amino acids

    NARCIS (Netherlands)

    Weiner, Barbara; Szymanski, Wiktor; Janssen, Dick B.; Minnaard, Adriaan J.; Feringa, Ben L.

    2010-01-01

    In this critical review, the progress in catalytic asymmetric synthesis of β-amino acids is discussed, covering the literature since 2002. The review treats transition metal catalysis, organocatalysis and biocatalysis and covers the most important synthetic methods, such as hydrogenation, the

  10. Synthesis of 2,2'-Dipyrryl Ketones from Pyrrole-2-carboxylic Acids with Trifluoroacetic Anhydride

    International Nuclear Information System (INIS)

    Kim, Se Hee; Lim, Jin Woo; Yu, Jin; Kim, Jae Nyoung

    2013-01-01

    An efficient synthesis of 2,2'-dipyrryl ketones has been carried out from pyrrole-2-carboxylic acids using trifluoroacetic anhydride (TFAA). Simultaneous generation of both mixed anhydride and 2-unsubstituted pyrrole, via facile decarboxylation with in-situ generated TFA, made their cross reaction (intermolecular Friedel-Crafts acylation) possible and efficient

  11. Silica sulfuric acid promoted one-pot synthesis of benzo[4,5]imidazo ...

    African Journals Online (AJOL)

    A simple and efficient synthesis of benzo[4,5]imidazo[1,2-a]pyrimidine derivatives has been accomplished by the reaction of 2-aminobenzimidazole, aldehydes and β-dicarbonyl compounds under solvent-free conditions in the presence of silica sulfuric acid. KEY WORDS: Benzo[4,5]imidazo[1,2-a]pyrimidine, Silica sulfuric ...

  12. Silica Sulfuric Acid: An Eco-Friendly and Reusable Catalyst for Synthesis of Benzimidazole Derivatives

    Directory of Open Access Journals (Sweden)

    Bahareh Sadeghi

    2013-01-01

    Full Text Available Silica sulfuric acid (SiO2-OSO3H as an eco-friendly, readily available, and reusable catalyst is applied to benzimidazole derivatives synthesis under reflux in ethanol. The procedure is very simple and the products are isolated with an easy workup in good-to-excellent yields.

  13. An improved solvent-free synthesis of flunixin and 2-(arylamino) nicotinic acid derivatives using boric acid as catalyst.

    Science.gov (United States)

    Yarhosseini, Mahsa; Javanshir, Shahrzad; Dolatkhah, Zahra; Dekamin, Mohammad G

    2017-12-01

    A simple solvent-free protocol for the preparation of flunixin, a potent non-narcotic, non-steroidal anti-inflammatory drugs is reported using boric acid as catalyst. Its salt, flunixin meglumine are then prepared under reflux in EtOH. This sustainable method are then extended for the synthesis of a series of 2-(arylamino) nicotinic acid derivatives. The present protocol combines non-hazardous neat conditions with associated benefits like excellent yield, straightforward workup, and use of readily available and safe catalyst in the absence of any solvent, which are important factors in the pharmaceutical industry. The pathway for catalytic activation of 2-chloronicotic acid with boric acid was also investigated using Gaussian 03 program package.

  14. Synthesis of 5'-deoxy-5'-nucleosideacetic acid derivatives

    Science.gov (United States)

    Harada, Kazuo; Orgel, Leslie E.

    1990-01-01

    Several new 5'-deoxy-5'-nucleosideacetic acid derivatives have been synthesized by the reactions of alkoxycarbonylmethylene triphenylphosphoranes with nucleoside 5'-aldehydes. The oligomerization of adenine derivatives IIa, IIIa, IV, V and guanine derivatives IIc and IIIc in aqueous solution was studied using a water-soluble carbodiimide as a condensing agent. It is found that the saturated acid (IV) tends to cyclize to the lactone, while IIa and unsaturated acids (IIIa and V) oligomerized efficiently, especially in the presence of poly (U) as a template.

  15. Effect of Whole-Body X-Irradiation of the Synthesis of Individual Fatty Acids in Liver Slices from Normal and Fasted Rats

    DEFF Research Database (Denmark)

    Hansen, Heinz Johs. Max; Hansen, Lisbeth Grænge; Faber, M.

    1965-01-01

    (1) Using (2-14C) acetate and (1-14C) butyrate as precursors, rat-liver fatty acids were synthesized in vitro and assayed by paper chromatography. (2) Whole-body x-irradiation induced a change in the synthetic pattern of hepatic fatty acids towards a relatively enhanced synthesis of palmitic acid....... (3) X-irradiation and fasting seem to have opposite effects on fatty-acid synthesis. X-irradiation counteracts the drop in total synthesis and the relatively enhanced synthesis of palmitoleic acid induced by fasting. The relative enhancement of palmitic-acid synthesis mentioned under (2) stands...

  16. Asymmetric synthesis of α-deuterated α-amino acids.

    Science.gov (United States)

    Takeda, Ryosuke; Abe, Hidenori; Shibata, Norio; Moriwaki, Hiroki; Izawa, Kunisuke; Soloshonok, Vadim A

    2017-08-23

    α-Deuterated-α-amino acids represent a very special class of stable isotopically labeled compounds, used in advanced biomedical research. Herein, we disclose a generalized approach for the preparation of α- 2 H-α-amino acids in enantiomerically pure form and with up to 99% deuteration. The reaction chemistry involved in this process is based on the dynamic kinetic resolution of racemates or (S)-(R) interconversion via the formation of intermediate Ni(ii) complexes derived from unprotected amino acids and recyclable tridentate ligands. Operationally convenient conditions, excellent chemical yields, diastereoselectivity and the degree of the deuteration bode well for the wide application of this methodology for the preparation of tailor-made α- 2 H-α-amino acids.

  17. Enzymatic stereoselective synthesis of B-amino acids

    CSIR Research Space (South Africa)

    Chhiba, V

    2014-06-01

    Full Text Available , antimicrobials, and as nonstandard amino acids in therapeutic peptides or peptidomimetics. Access to these compounds can be achieved through diverse synthetic routes with enantioselective steps catalyzed in different ways, including by means of nitrile hydrolysis...

  18. Synthesis and mesomorphic behaviour of lithocholic acid derivatives

    Indian Academy of Sciences (India)

    Unknown

    It was further purified by Soxhlet extraction and recrystallized from acetone and dried under vacuum (yield 56%, m.p. 163°C). 3-(3-Carboxy propio- nyl) lithocholic acid, (II), was prepared in a similar man- ner as (I), except that lithocholic acid was used in place of. LAMe (yield 59⋅3%, m.p. 228°C). 3-acetyl lithocholic.

  19. Synthesis and Antimicrobial Activity of Amino Acids Conjugated Diphenylmethylpiperazine Derivatives

    Directory of Open Access Journals (Sweden)

    K. N. Shivakumara

    2009-01-01

    Full Text Available A series of amino acid conjugated diphenylmethylpiperazine derivatives were synthesized by coupling diphenylmethylpiperazine with different Boc-amino acids using EDCI/HOBt as coupling agent and NMM as base. The synthesized compounds were characterized by 1H-NMR and elemental analysis. The Boc-deblocked derivatives were tested for their antimicrobial activity. We are here reporting that Phe and Trp conjugated diphenylmethylpiperazine showed equally good antibacterial activities as that of conventional antimicrobial drugs.

  20. Crystal growth, structure analysis and characterisation of 2 - (1, 3 - dioxoisoindolin - 2 - yl) acetic acid single crystal

    Energy Technology Data Exchange (ETDEWEB)

    Sankari, R. Siva, E-mail: sivasankari.sh@act.edu.in [Department of Physics, Agni College of Technology, Thalambur, Chennai-603103 (India); Perumal, Rajesh Narayana [Department of Physics, SSN College of Engineering, Kalavakkam, Chennai-603110 (India)

    2014-04-24

    Single crystal of dielectric material 2 - (1, 3 - dioxoisoindolin - 2 - yl) acetic acid has been grown by slow evaporation solution growth method. The grown crystal was harvested in 25 days. The crystal structure was analyzed by Single crystal X - ray diffraction. UV-vis-NIR analysis was performed to examine the optical property of the grown crystal. The thermal property of the grown crystal was studied by thermogravimetric analysis (TGA) and differential thermal analysis (DTA). The dielectric measurements were carried out and the dielectric constant was calculated and plotted at all frequencies.

  1. Characterisation of Fecal Soap Fatty Acids, Calcium Contents, Bacterial Community and Short-Chain Fatty Acids in Sprague Dawley Rats Fed with Different sn-2 Palmitic Triacylglycerols Diets.

    Science.gov (United States)

    Wan, Jianchun; Hu, Songyou; Ni, Kefeng; Chang, Guifang; Sun, Xiangjun; Yu, Liangli

    2016-01-01

    The structure of dietary triacylglycerols is thought to influence fatty acid and calcium absorption, as well as intestinal microbiota population of the host. In the present study, we investigated the impact of palmitic acid (PA) esterified at the sn-2 position on absorption of fatty acid and calcium and composition of intestinal microorganisms in rats fed high-fat diets containing either low sn-2 PA (12.1%), medium sn-2 PA (40.4%) or high sn-2 PA (56.3%), respectively. Fecal fatty acid profiles in the soaps were measured by gas chromatography (GC), while fecal calcium concentration was detected by ICP-MS. The fecal microbial composition was assessed using a 16S rRNA high-throughput sequencing technology and fecal short-chain fatty acids were detected by ion chromatograph. Dietary supplementation with a high sn-2 PA fat significantly reduced total fecal contents of fatty acids soap and calcium compared with the medium or low sn-2 PA fat groups. Diet supplementation with sn-2 PA fat did not change the entire profile of the gut microbiota community at phylum level and the difference at genera level also were minimal in the three treatment groups. However, high sn-2 PA fat diet could potentially improve total short-chain fatty acids content in the feces, suggesting that high dietary sn-2 PA fat might have a beneficial effect on host intestinal health.

  2. Synthesis of non-aggregated nicotinic acid coated magnetite nanorods via hydrothermal technique

    International Nuclear Information System (INIS)

    Attallah, Olivia A.; Girgis, E.; Abdel-Mottaleb, Mohamed M.S.A.

    2016-01-01

    Non-aggregated magnetite nanorods with average diameters of 20–30 nm and lengths of up to 350 nm were synthesized via in situ, template free hydrothermal technique. These nanorods capped with different concentrations (1, 1.5, 2 and 2.5 g) of nicotinic acid (vitamin B3); possessed good magnetic properties and easy dispersion in aqueous solutions. Our new synthesis technique maintained the uniform shape of the nanorods even with increasing the coating material concentration. The effect of nicotinic acid on the shape, particle size, chemical structure and magnetic properties of the prepared nanorods was evaluated using different characterization methods. The length of nanorods increased from 270 nm to 350 nm in nicotinic acid coated nanorods. Goethite and magnetite phases with different ratios were the dominant phases in the coated samples while a pure magnetite phase was observed in the uncoated one. Nicotinic acid coated magnetic nanorods showed a significant decrease in saturation magnetization than uncoated samples (55 emu/g) reaching 4 emu/g in 2.5 g nicotinic acid coated sample. The novel synthesis technique proved its potentiality to prepare coated metal oxides with one dimensional nanostructure which can function effectively in different biological applications. - Highlights: • We synthesize nicotinic acid coated magnetite nanorods via hydrothermal technique • Effect of nicotinic acid concentration on the nanorods properties was significant • Nanorods maintained uniform shape with increased concentration of nicotinic acid • Alterations occurred in particle size, mineral phases and magnetics of coated samples.

  3. Synthesis of non-aggregated nicotinic acid coated magnetite nanorods via hydrothermal technique

    Energy Technology Data Exchange (ETDEWEB)

    Attallah, Olivia A., E-mail: olivia.adly@hu.edu.eg [Center of Nanotechnology, Nile University, 12677 Giza (Egypt); Pharmaceutical Chemistry Department, Heliopolis University, 11777 El Salam, Cairo (Egypt); Girgis, E. [Solid State Physics Department, National Research Center, 12622 Dokki, Giza (Egypt); Advanced Materials and Nanotechnology Lab, CEAS, National Research Center, 12622 Dokki, Giza (Egypt); Abdel-Mottaleb, Mohamed M.S.A. [Center of Nanotechnology, Nile University, 12677 Giza (Egypt)

    2016-02-01

    Non-aggregated magnetite nanorods with average diameters of 20–30 nm and lengths of up to 350 nm were synthesized via in situ, template free hydrothermal technique. These nanorods capped with different concentrations (1, 1.5, 2 and 2.5 g) of nicotinic acid (vitamin B3); possessed good magnetic properties and easy dispersion in aqueous solutions. Our new synthesis technique maintained the uniform shape of the nanorods even with increasing the coating material concentration. The effect of nicotinic acid on the shape, particle size, chemical structure and magnetic properties of the prepared nanorods was evaluated using different characterization methods. The length of nanorods increased from 270 nm to 350 nm in nicotinic acid coated nanorods. Goethite and magnetite phases with different ratios were the dominant phases in the coated samples while a pure magnetite phase was observed in the uncoated one. Nicotinic acid coated magnetic nanorods showed a significant decrease in saturation magnetization than uncoated samples (55 emu/g) reaching 4 emu/g in 2.5 g nicotinic acid coated sample. The novel synthesis technique proved its potentiality to prepare coated metal oxides with one dimensional nanostructure which can function effectively in different biological applications. - Highlights: • We synthesize nicotinic acid coated magnetite nanorods via hydrothermal technique • Effect of nicotinic acid concentration on the nanorods properties was significant • Nanorods maintained uniform shape with increased concentration of nicotinic acid • Alterations occurred in particle size, mineral phases and magnetics of coated samples.

  4. Synthesis, biological distribution and radiation dosimetry of Te-123m analogues of hexadecenoic acid

    International Nuclear Information System (INIS)

    Basmadjian, G.P.; Ice, R.D.; Mills, S.L.

    1982-01-01

    The synthesis and biological distribution of four Te-123m analogues of hexadecenoic acid in rats, rabbits and dogs were described for use as possible myocardial imaging agents. The heart-to-blood ratios ranged from 0.13 for 3-telluranonadecenoic acid in rats at 5 mins to 6.25 for 18-methyl-17-tellura-9-nonadecenoic acid in dogs at 24 hrs. The biological half-life of the Te-123m labelled fatty acids ranged from 26 to 583 hrs in the hearts of the test animals. These Te-123m fatty acids were retained in the heart longer than radioiodinated fatty acids and have acceptable absorbed doses to the various target organs. (U.K.)

  5. Sinapinic and protocatechuic acids found in rapeseed: isolation, characterisation and potential benefits for human health as functional food ingredients

    Directory of Open Access Journals (Sweden)

    Quinn Leah

    2017-12-01

    Full Text Available Rapeseed is one of the world’s major oilseeds, and rapeseed oil is produced by pressing of the seeds. This process results in the production of a low-economic-value by-product, rapeseed meal, which is commonly used as animal feed. Rapeseed meal is rich in bioactive phenolic compounds, including sinapinic acid (SA and protocatechuic acid (PCA. Isolation of these bioactive compounds from a by-product of rapeseed oil production is largely in agreement with the current concept of the circular economy and total utilisation of crop harvest using a biorefinery approach. In this review, current information concerning traditional and novel methods to isolate phenolic compounds – including SA and PCA – from rapeseed meal, along with in vitro and in vivo studies concerning the bioactivity of SA and PCA and their associated health effects, is collated. These health effects include anti-inflammatory, anti-cancer, anti-diabetes activities, along with histone deacetylase inhibition and protective cardiovascular, neurological and hepatic effects. The traditional extraction methods include use of solvents and/or enzymes. However, a need for simpler, more efficient methodologies has led to the development of novel extraction processes, including microwave-assisted, ultrasound-assisted, pulsed electric field and high-voltage electrical discharge extraction processes.

  6. Bile acids exert negative feedback control on bile acid synthesis in cultured pig hepatocytes by suppression of cholesterol 7α-hydroxylase activity

    NARCIS (Netherlands)

    Kwekkeboom, J.; Princen, H.M.G.; Voorthuizen, E.M. van; Kempen, H.J.M.

    1990-01-01

    Feedback regulation of bile acid synthesis by its end products was studied in cultured hepatocytes of young weaned pigs. We previously showed that conversion of exogenous [14C] cholesterol into bile acids was suppressed by addition of bile acids to the culture medium. In the present study, the

  7. Synthesis of N,N-Bis(nonaflyl) Squaric Acid Diamide and its Application to Organic Reactions

    International Nuclear Information System (INIS)

    Cheon, Cheol Hong; Yamamoto, Hisashi

    2010-01-01

    We have developed a new strong Brφnsted acid bearing two nonaflyl groups based on the squaric acid scaffold. The Brφnsted acid 2 showed the almost same reactivity as bistriflyl squaramide 1 in Mukaiyama aldol and Michael reactions of benzaldehyde with silyl enol ether. Moreover, the utility of Brφnsted acid 2 could be expanded to carbonyl ene reaction of rac-citronellal. Further application of this new Brφnsted acid to organic reactions and to flow system reactors is currently underway in our laboratory. Brφnsted acid catalysis is one of the growing fields in modern organic synthesis.1 Although several Brφnsted acids, such as urea/thiourea, TADDOL, and phosphoric acid, have been applied to a variety of organic reactions, other Brφnsted acid scaffolds have been much less explored. Recently, Rawal et al have developed a Brφnsted acid catalyst based on squaric acid moiety and successfully applied it as a catalyst for conjugate addition of 1,3-dicarbonyl compounds to nitroolefins. More recently, we have developed a strong Brφnsted acid derived from squaric acid by introducing a strong electron withdrawing trifluoromethanesulfonyl (Tf) group and applied it to Mukaiyama aldol and Michael reaction of a variety of aldehydes, ketones, and α,β-unsaturated ketones. As a continuing effort to develop strong Brφnsted acids based on the squaric acid scaffold, it was expected that replacement of Tf group with a longer perfluoro-alkanesulfonyl group would be able to tune the physical properties, such as solubilities in organic solvents and fluoro-philicity, without loss of reactivity. Herein, we report the development of a new Brφnsted acid based on the squaric acid scaffold carrying two nonafluorobutanesulfonyl (Nf) groups and the preliminary results of its reactivity to various organic reactions

  8. A simple synthesis of L-[35S]cysteine sulfinic acid

    International Nuclear Information System (INIS)

    Spears, R.M.; Martin, D.L.

    1981-01-01

    The synthesis of L-[ 35 S]cysteine sulfinic acid (L-2-amino-3-[ 35 S]sulfino-propanoic acid) in 65% yield from S-[ 35 S]cystine is described. The procedure was designed for use with milligram quantities of starting material and requires no purification of intermediates. L-[ 35 S]Cystine was converted first to its thiosulfonate. Subsequent reaction of the thiosulfonate with ammonium hydroxide generated L-[ 35 S]cysteine sulfinic acid and L-[ 35 S]cystine as the major products. The L-[ 35 S]cystine was recovered and reprocessed thereby increasing the yield. (author)

  9. A Novel and Highly Regioselective Synthesis of New Carbamoylcarboxylic Acids from Dianhydrides

    OpenAIRE

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A.; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario

    2014-01-01

    A regioselective synthesis has been developed for the preparation of a series of N,N′-disubstituted 4,4′-carbonylbis(carbamoylbenzoic) acids and N,N′-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3′,4,4′-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established ...

  10. Kinetics of acetic acid synthesis from ethanol over a Cu/SiO2 catalyst

    DEFF Research Database (Denmark)

    Voss, Bodil; Schjødt, Niels Christian; Grunwaldt, Jan-Dierk

    2011-01-01

    The dehydrogenation of ethanol via acetaldehyde for the synthesis of acetic acid over a Cu based catalyst in a new process is reported. Specifically, we have studied a Cu on SiO2 catalyst which has shown very high selectivity to acetic acid via acetaldehyde compared to competing condensation routes....... The dehydrogenation experiments were carried out in a flow through lab scale tubular reactor. Based on 71 data sets a power law kinetic expression has been derived for the description of the dehydrogenation of acetaldehyde to acetic acid. The apparent reaction order was 0.89 with respect to water and 0...

  11. Synthesis and applications of silicon-containing alpha-amino acids.

    Science.gov (United States)

    Mortensen, Matthew; Husmann, Ralph; Veri, Elisabetta; Bolm, Carsten

    2009-04-01

    Amino acids serve not only as monomers for proteins and enzymes but also as important players in signal transduction pathways. They belong to the abundant feedstock of the pharmaceutical, food science and agrochemical industries, and some are used as catalysts or ligand components. In recent years, non-proteogenic amino acids have taken on important roles. This tutorial review summarises the progress in the development of strategies to construct silicon-containing alpha-amino acid frameworks and the studies concerned with their structure and activity. It shall be of interest for the synthesis and biosciences communities.

  12. A novel stereospecific synthesis of 14C labeled 1-glutamic acid

    International Nuclear Information System (INIS)

    Wurz, R.E.; Kepner, R.E.; Webb, A.D.

    1989-01-01

    A stereospecific synthesis of 4- 14 C-1-glutamic acid was completed in five steps from sodium 2- 14 C-acetate. The morpholine derived enamine of ethyl pyruvate was reacted with ethyl 2- 14 C-bromoacetate to give after hydrolysis diethyl 4- 14 C-2-oxoglutarate. The 2-oxoglutarate was reacted with hydroxylamine hydrochloride to give diethyl 4-14C-2-hydroxyiminoglutarate which was then reduced with a LiAlH4, (-)-N-methylephedrine and 3,5-dimethylphenol mixture to give 4- 14 C-1-glutamic acid. The 4- 14 C-1-glutamic acid was used in investigations into the biosynthesis of gamma-lactones in sherries

  13. Effect of O-acetylsalicylic acid on lipid synthesis by guinea pig gastric mucosa in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Spohn, M.; McColl, I.

    1987-01-01

    The aim of this work was to investigate the involvement of lipids as possible components of the gastric mucosal barrier by studying the synthesis and secretion of lipids by the epithelial cell lining of gastric mucosa and the effect of salicylate on these processes. O-Acetylsalicylic acid reversibly reduced in vitro incorporation of (U-/sup 14/C) and of DL-(2-/sup 14/C) mevalonic acid into lipids by isolated epithelial cells and by intact mucosa of guinea pig stomach, indicating reversible inhibition of lipid synthesis by the tissue in the presence of the drug. Inhibition of incorporation of both precursors into total lipids, into their fatty acid components, and into cholesterol is demonstrated. 19 refs.

  14. Templated synthesis of peptide nucleic acids via sequence-selective base-filling reactions.

    Science.gov (United States)

    Heemstra, Jennifer M; Liu, David R

    2009-08-19

    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either reductive amination or amine acylation chemistries, we observed efficient and selective addition of each of the four nucleobases to an abasic site in the middle of the PNA strand. We also describe the addition of single nucleobases to the end of a PNA strand through base filling, as well as the tandem addition of two bases to the middle of the PNA strand. These findings represent an experimental foundation for nonenzymatic information transfer through base filling.

  15. Synthesis and characterisation of nitrogen poly-heterocyclic molecules using as selective complexing agents of metallic cations; Synthese et caracterisation de molecules polyheterocycliques azotees utilisables en tant que complexants selectifs de cations metalliques

    Energy Technology Data Exchange (ETDEWEB)

    Alphonse, F.A

    2003-12-15

    Separation of actinides (III) from lanthanides (III) is a crucial problem in the reprocessing of used nuclear fuels. Experimental results shown that soft donor extractants such as nitrogen polydentate heterocycles containing a NCCNCCN coordination site are potentials ligands for selective extraction of actinides (III). In those cases, two types of liquid-liquid extractions are employed: synergistic combination with lipophilic acid extractants and direct extraction. On the basis of the Hard and Soft Acids and Bases theory and basicity evaluation, new extractants were defined. We have first studied the synthesis of potential 1,3,5-triazine ligands designed for extraction in synergy with {alpha}-bromodecanoic acid. Secondly, we have examined the synthesis of bis-triazinyl-pyridine ligands for direct extraction studies. Extraction tests were carried out and perspectives of synthesis were deducted from those extraction results. (author)

  16. Synthesis, antimicrobial evaluation and QSAR studies of gallic acid derivatives

    Directory of Open Access Journals (Sweden)

    Anurag Khatkar

    2017-05-01

    Full Text Available A series of gallic acid derivatives (1–33 was synthesized and characterized by physicochemical and spectral means. The synthesized compounds were evaluated in vitro for their antimicrobial activity against different Gram positive and Gram negative bacterial and fungal strains by the tube dilution method. Results of antimicrobial screening indicated that compound 6 was the most active antimicrobial agent (pMICam = 1.92 μM/mL. The results of QSAR studies demonstrated that antibacterial, antifungal and overall antimicrobial activities of synthesized gallic acid derivatives were governed by the electronic parameters, cosmic total energy (Cos E. and nuclear energy (Nu. E..

  17. Prolinol-based nucleoside phosphonic acids: Synthesis and properties

    Czech Academy of Sciences Publication Activity Database

    Vaněk, Václav; Buděšínský, Miloš; Liboska, Radek; Hurychová, Vladimíra; Rosenberg, Ivan

    -, č. 52 (2008), s. 537-538 ISSN 0261-3166. [Joint Symposium of the International Roundtable on Nucleosides, Nucleotides and Nucleic Acids /18./ and the International Symposium on Nucleic Acid Chemistry /35./. Kyoto, 08.09.2008-12.09.2008] R&D Projects: GA MŠk(CZ) LC06061; GA MŠk(CZ) LC06077; GA MŠk LC512 Institutional research plan: CEZ:AV0Z40550506 Keywords : oligonucleotide phosphonate * nucleoside analogue * pyrrolidine * prolinol Subject RIV: CC - Organic Chemistry

  18. Synthesis and properties of catalysts prepared from silicomolybdovanadium heteropoly acid

    International Nuclear Information System (INIS)

    Chumachenko, N.N.; Tarasova, D.V.; Nikoro, T.A.; Yaroslavtseva, I.V.

    1984-01-01

    Catalytic properties of samples prepared of silicomolybdovanadium heteropoly acid (HPA) have been investigated. The massive catalyst is shown to be comparatively low effective in the reaction of acrolein oxidation to acrylic acid. Impregnation of coarse-dispersed silica gel by the HPA solution results in the formation of active and selective catalyst, whereas low-active catalyst of deep oxidation is formed on the base of high-dispersed silica gel. The obtained data are explained by the formation and stabilization of different forms of vanadium- and molybdenum-containing compounds on the carrier surface

  19. Synthesis and in vitro Cytotoxicity of Novel Ursolic Acid Derivatives

    Directory of Open Access Journals (Sweden)

    Yanqiu Meng

    2010-06-01

    Full Text Available In an effort to improve potential hepatoprotective and anti-tumor activities, eight novel ursolic acid (UA derivatives were designed and synthesized with substitution at positions of C-3, C-11and C-28 of UA. Their structures were confirmed using IR, MS and 1H-NMR and elemental analysis. Their in vitro cytotoxicity against various cancer cell lines (HeLa, SKOV3 and BGC-823 was evaluated by the standard MTT assay. Among them, compound 13 exhibited more potent cytotoxicity than ursolic acid.

  20. Synthesis and complex forming property of phosphor acid derivatives

    International Nuclear Information System (INIS)

    Babaev, B.N.

    2004-01-01

    Full text:With the aim to get new effective and selective extra gents of noble and non-ferrous metals from acid solution and industrial sewage, research of the dependence of 'structure effectiveness' the various phosphor acid derivatives with logical changeable structure (thio phosphor acids, derivatives of dialkoxythiophosphor, O-alkyl-methylphosphon, alkylphenylphosphon, diphenylphosphine acids also 4 methyl-1,3,2 dioxaphosphorinane) which contain different functional groups, the remains of heterocyclic amines and alkaloids, new derivatives of some analytical reagents were synthesized. The structure of synthesized compounds is approved by the results of IR-, PMR-, mass-spectrum analyze. Researching mass-spectrum decay of synthesized phosphor acid derivatives we defined that differing from O-dihexyl-S-propargyl-benzylthio phosphat, mass spectrum decay of O-dialkyl-S-(piperdynobutin-2-il)thio phosphat is characterized by the appearing [M-H] + ions and during the decay ions with high intensiveness are formed. Fragmentation of M + O-alkyl-O-(aminoalkyl)phenylphosphonate proceeds in various directions and characterized with the great number of phosphor containing ions, the possession of the second phenyl radical in the molecule of diphenylphosphon acid derivatives changes the fragmentation of molecular ion of diphenylphosphon acid derivatives. The process of extraction of noble (Au, Ag, Pt, Pd, Os) metals from hydrochloric-sulphur-nitrogen acid medium was analyzed by radioactive indicator's method. It was noticed that structure, strength, conformation of compounds, the temperature, of acid medium (0,1-10 M) and the nature of acids (HCL, H 2 SO 4 , HNO 3 ) could have strong influence to the effectiveness of metal extraction. During the research of metals extraction from pure solutions we can see the followings: 1) There are such substances, which can be used as effective group reagent towards the Au, Ag and Pd. 2) Derivatives with acetylene extract ions of gold from

  1. The promoting effects of geniposidic acid and aucubin in Eucommia ulmoides Oliver leaves on collagen synthesis.

    Science.gov (United States)

    Li, Y; Sato, T; Metori, K; Koike, K; Che, Q M; Takahashi, S

    1998-12-01

    We have reported that collagen synthesis was stimulated by the administration of a hot water extract from the leaves of Eucommia ulmoides OLIVER, Eucommiaceae (Du-Zhong leaves) in false aged model rats. In this paper, we set out to examine the compounds in Du-Zhong leaves that stimulated collagen synthesis in false aged model rats. In experiment 1, a methanol extract of Du-Zhong leaves also stimulated collagen synthesis in aged model rats. An acetone fraction was derived from the methanol extract by silica gel chromatography in experiment 2. The acetone fraction mainly contained iridoides mono-glycosides such as geniposidic acid and aucubin. The administration of geniposidic acid or aucubin stimulated collagen synthesis in aged model rats in experiments 3 and 4 (significance (p<0.05)). The reported pharmacological effects of Du-Zhong leaves, including healing organs and strengthening bone and muscle, are closely related to collagen metabolism. It appears that geniposidic acid and aucubin are the actual compounds in Du-Zhong which caused the effect in our experiments.

  2. Five Decades with Polyunsaturated Fatty Acids: Chemical Synthesis, Enzymatic Formation, Lipid Peroxidation and Its Biological Effects

    Directory of Open Access Journals (Sweden)

    Angel Catalá

    2013-01-01

    Full Text Available I have been involved in research on polyunsaturated fatty acids since 1964 and this review is intended to cover some of the most important aspects of this work. Polyunsaturated fatty acids have followed me during my whole scientific career and I have published a number of studies concerned with different aspects of them such as chemical synthesis, enzymatic formation, metabolism, transport, physical, chemical, and catalytic properties of a reconstructed desaturase system in liposomes, lipid peroxidation, and their effects. The first project I became involved in was the organic synthesis of [1-14C] eicosa-11,14-dienoic acid, with the aim of demonstrating the participation of that compound as a possible intermediary in the biosynthesis of arachidonic acid “in vivo.” From 1966 to 1982, I was involved in several projects that study the metabolism of polyunsaturated fatty acids. In the eighties, we studied fatty acid binding protein. From 1990 up to now, our laboratory has been interested in the lipid peroxidation of biological membranes from various tissues and different species as well as liposomes prepared with phospholipids rich in PUFAs. We tested the effect of many antioxidants such as alpha tocopherol, vitamin A, melatonin and its structural analogues, and conjugated linoleic acid, among others.

  3. Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment

    Science.gov (United States)

    Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.

    2011-01-01

    Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.

  4. Metabolic adaptations during lactogenesis. Fatty acid synthesis in rabbit mammary tissue during pregnancy and lactation

    Science.gov (United States)

    Mellenberger, R. W.; Bauman, D. E.

    1974-01-01

    1. Mammary tissue was obtained from rabbits at various stages of pregnancy and lactation and used for tissue-slice incubations (to measure the rate of fatty acid synthesis and CO2 production) and to determine relevant enzymic activities. A biphasic adaptation in fatty acid synthetic capacity during lactogenesis was noted. 2. The first lactogenic response occurred between day 15 and 24 of pregnancy. Over this period fatty acid synthesis (from acetate) increased 14-fold and the proportions of fatty acids synthesized changed to those characteristic of milk fat (77–86% as C8:0+C10:0 acids). 3. The second lactogenic response occurred post partum as indicated by increased rates of fatty acid synthesis and CO2 production (from acetate and glucose) and increased enzymic activities. 4. Major increases in enzymic activities between mid-pregnancy and lactation were noted for ATP citrate lyase (EC 4.1.3.8), acetyl-CoA synthetase (EC 6.2.1.1), acetyl-CoA carboxylase (EC 6.4.1.2), fatty acid synthetase, glucose 6-phosphate dehydrogenase (EC 1.1.1.49), and 6-phosphogluconate dehydrogenase (EC 1.1.1.44). Smaller increases in activity occurred with glycerol 3-phosphate dehydrogenase (EC 1.1.1.8) and NADP+–isocitrate dehydrogenase (EC 1.1.1.42) and the activity of NADP+–malate dehydrogenase (EC 1.1.1.40) was negligible at all periods tested. 5. During pregnancy and lactation there was a close temporal relationship between fatty acid synthetic capacity and the activities of ATP citrate lyase (r=0.94) and acetyl-CoA carboxylase (r=0.90). PMID:4154742

  5. Effect of nerve growth factor on the synthesis of amino acids in PC12 cells

    International Nuclear Information System (INIS)

    Zielke, H.R.; Tildon, J.T.; Kauffman, F.C.; Baab, P.J.

    1989-01-01

    Radioactive short-chain fatty acids preferentially label glutamine relative to glutamate in brain due to compartmentation of glutamine and glutamate. To determine whether this phenomenon occurs in a single cell culture model, we examined the effect of fatty acid chain length on the synthesis as well as pool size of selected amino acids in rat pheochromocytoma PC12 cells, a cell culture model of the large glutamate compartment in neurons. Intracellular 14C-amino acids were quantitated by HPLC, and the incorporation of [U-14C]-glucose, [1-14C]-butyrate, [1-14C]-octanoate, and [1-14C]-palmitate into five amino acids was measured in native and NGF-treated PC12 cells. NGF pretreatment decreased the intracellular concentration of amino acids as did addition of fatty acids but these effects were not additive. Specific activities of amino acids in native cells labelled by 14C-octanoate were 1,300 DPM/nmol, 490 DPM/nmol, 200 DPM/nmol, and 110 DPM/nmol for glutamate, aspartate, glutamine, and serine, respectively. No radioactivity was detected in alanine. Similar specific activities were noted when 14C-butyrate was the precursor; however, there was at least 5-fold less if 14C-palmitate was the precursor. Pretreatment of cells with NGF decreased the specific activity of amino acids by 25-65%. Specific activities of amino acids synthesized from 14C-glucose decreased in the following order: glutamate, 1,640 DPM/nmol; aspartate, 1,210 DPM/nmol; alanine, 580 DPM/nmol; glutamine, 275 DPM/nmol; and serine, 80 DPM/nmol for native cells. NGF pretreatment decreased the specific activities of glutamate and glutamine, but not of the other 3 amino acids. The preferred precursor for glutamate synthesis in native PC12 cells was glucose followed by octanoate, butyrate and palmitate (16:6:3:1)

  6. Deoxyribonucleic acid synthesis in synchronized mammalian KB cells infected with herpes simplex virus.

    Science.gov (United States)

    Cohen, G H; Vaughan, R K; Lawrence, W C

    1971-06-01

    We examined the patterns of host cell and virus deoxyribonucleic acid (DNA) synthesis in synchronized cultures of KB cells infected at different stages of the cell cycle with herpes simplex virus (HSV). We found that the initiation of HSV DNA synthesis, we well as the production of new infectious virus, is independent of the S, G1, and G2 phases of the mitotic cycle of the host cell. This is in contrast to data previously found with equine abortion virus. Because HSV replicates independently of the cell cycle, we were able to establish conditions that would permit the study of rates of HSV DNA synthesized in logarithmically growing cells in the virtual absence of cellular DNA synthesis. This eliminates the need for separation of viral and cellular DNA by isopycnic centrifugation in CsCl. We found that HSV DNA synthesis was initiated between 2 to 3 hr after infection. The rate of DNA synthesis increased rapidly, reaching a maximum 4 hr after infection, and decreased to 50% of maximum by 8 hr. Evidence is also presented which suggests that HSV infection can inhibit both the ongoing synthesis of host DNA as well as the initiation of the S phase.

  7. Synthesis of Novel Piperazine-linked Anthranilic Acids as Potential ...

    African Journals Online (AJOL)

    NICO

    being that they would exhibit biochemical activity as small molecule kinase inhibitors. The synthesized anthranilamide- piperazine compounds were subsequently tested against a panel of kinases including EGFR, Abl, Akt and Aurora B. KEYWORDS. Small molecule kinase inhibitors, anthranilic acid, piperazines, EGFR. 1.

  8. Exploring the Potential of Fungal Arylacetonitrilases in Mandelic Acid Synthesis

    Czech Academy of Sciences Publication Activity Database

    Veselá, Alicja Barbara; Křenková, Alena; Martínková, Ludmila

    2015-01-01

    Roč. 57, č. 5 (2015), s. 466-474 ISSN 1073-6085 R&D Projects: GA ČR(CZ) GAP504/11/0394 Institutional support: RVO:61388971 Keywords : Fungal arylacetonitrilases * (R)-Mandelic acid manufacture * (R,S)-Mandelonitrile hydrolysis Subject RIV: CE - Biochemistry Impact factor: 1.752, year: 2015

  9. Synthesis of copolymer from lactic acid-polyethylene terephthalate ...

    African Journals Online (AJOL)

    Bio-plastic has been a need of the hour for the past few decades and the usage of lactic acid (LA) in the production of bio plastic opens a new window to the field. Polyethylene terephthalate (PET) thermoplastic polyester with excellent tensile and impact strength, chemical resistance, clarity, process ability, and transparency ...

  10. Reaction of Hydrazine Hydrate with Oxalic Acid: Synthesis and ...

    African Journals Online (AJOL)

    The reaction of oxalic acid with hydrazine hydrate (in appropriate mole ratio) forms the dihydrazinium oxalate under specific experimental condition. The title compound is a molecular salt containing two discrete hydrazinium cations and an oxalate anion. The oxalate anion is perfectly planar and there is a crystallographic ...

  11. Synthesis and Biological Evaluation of some Anthranilic Acid and 2 ...

    African Journals Online (AJOL)

    In the present investigation a novel series of N-(phenyl) chalconyl anthranilic acids containing pyrazolines (4a–j), tetrahydropyrimidines (4k–o), tetrahydrothiopyrimidines (4p–t) and 2-phenylquinazolin-4(3H)-ones containing pyrazolines (8a–f), isoxazolines (8g–l), tetrahydropyrimidines (8m–r) and tetrahydrothiopyrimidines ...

  12. Synthesis and Biological Evaluation of some Anthranilic Acid and 2 ...

    African Journals Online (AJOL)

    NJD

    In the present investigation a novel series of N-(phenyl) chalconyl anthranilic acids containing pyrazolines (4a–j), tetra- hydropyrimidines (4k–o), tetrahydrothiopyrimidines (4p–t) and 2-phenylquinazolin-4(3H)-ones containing pyrazolines (8a–f), isoxazolines (8g–l), tetrahydropyrimidines (8m–r) and ...

  13. Pyrene appended bile acid conjugates: Synthesis and a structure ...

    Indian Academy of Sciences (India)

    us to connect the existing gelator motifs into hybrid structures and study their gelation properties in solu- tion. We envisioned that by adding a pyrene moiety ...... seen with the simplest pyrene molecule 1-pyrene car- boxylic acid (19) or its mixture with 1-aminopyrene. (20) (prepared by heating the 1:1 mixture of the amine.

  14. Synthesis of New L-Ascorbic Ferulic Acid Hybrids

    Directory of Open Access Journals (Sweden)

    Sylvain Rault

    2007-11-01

    Full Text Available A feasibility and chemical study of the coupling conditions of L-ascorbic acidwith ferulic acid derivatives are described on the basis of the known synergistic effects ofmixtures of various antioxidants. Novel L-ascorbic ferulic hybrids linked at the C-3hydroxyl group were prepared with the aim to protect the alcohol function and the enediolsystem.

  15. Iodophilic polysaccharide synthesis, acid production and growth in oral streptococci

    NARCIS (Netherlands)

    Houte, J. van; Winkler, K.C.; Jansen, H.M.

    The relation between iodophilic polysaccharide formation, acid production and growth in α-haemolytic streptococci, isolated from human dental plaque, was studied. In experiments with resting cell suspensions, or with cells growing at a low rate, all strains synthesizing iodophilic polysaccharide

  16. Synthesis of Novel Piperazine-linked Anthranilic Acids as Potential ...

    African Journals Online (AJOL)

    Substituted anthranilic acid and piperazines were used as building blocks to prepare two libraries of compounds, with the aim being that they would exhibit biochemical activity as small molecule kinase inhibitors. The synthesized anthranilamidepiperazine compounds were subsequently tested against a panel of kinases ...

  17. Synthesis of azido derivatives of mucobromic acid | D. Jumbam ...

    African Journals Online (AJOL)

    Mucobromic acid is a highly reactive multicentered molecule. It was converted to its corresponding but unstable diazido derivative by reaction with two equivalents of sodium azide. The resultant 3,4-diazido-5-hydroxyfuran-2(5H)-one was obtained in moderate yield (42%) but decomposed readily even at low temperatures.

  18. Synthesis and characterization of ultraviolet light-emitting organic acids.

    Science.gov (United States)

    An, Chun-Ai; Guo, Yanchao; Si, Zhenjun; Duan, Qian

    2014-05-01

    Three ultraviolet light-emitting organic acids of 3,3'-(4-phenyl-4H-1,2,4-triazole-3,5-diyl)dibenzoic acid (Tz-1), 4,4',4″-(4H-1,2,4-triazole-3,4,5-triyl)tribenzoic acid (Tz-2), and 4,4'-(4-(4'-carboxy-[1,1'-biphenyl]-4-yl)-4H-1,2,4-triazole-3,5-diyl)dibenzoic acid (Tz-3) were successfully synthesized and fully characterized by the (1)H NMR, the IR absorption spectra, and the X-ray single crystal diffraction. It was found that Tz-1, Tz-2, and Tz-3 could give out the ultraviolet photoluminescent spectra centered at 369 nm, 365 nm and 350 nm, respectively. The luminescence quantum yields of Tz-1 and Tz-2 were measured to be 0.20 and 0.14, respectively. Additionally, the density functional theory (DFT) and the time-dependent DFT calculations were also carried out for Tz-1, Tz-2, and Tz-3.

  19. Vapour phase synthesis of salol over solid acids via transesterification

    Indian Academy of Sciences (India)

    The catalytic materials were prepared and characterized for their total surface acidity, BET surface area and powder XRD patterns. The effect of mole-ratio of the reactants, catalyst bed temperature, catalyst weight, flowrate of reactants, WHSV and time-on-stream on the conversion (%) of phenol and selectivity (%) of salol ...

  20. Total synthesis of five lipoteichoic acids of Clostridium difficile

    DEFF Research Database (Denmark)

    Hogendorf, Wouter Frederik Johan; Gisch, Nicolas; Schwudke, Dominik

    2014-01-01

    The emergence of hypervirulent resistant strains have made Clostridium difficile a notorious nosocomial pathogen and has resulted in a renewed interest in preventive strategies, such as vaccines based on (synthetic) cell wall antigens. Recently, the structure of the lipoteichoic acid (LTA...

  1. Synthesis of dopamine analogue containing benzeneboronic acid group, a target compound for BNCT

    Energy Technology Data Exchange (ETDEWEB)

    Mizuno, T.; Yoshino, K. [Shinshu Univ., Faculty of Science, Matsumoto, Nagano (Japan); Hiratsuka, J. [Kawasaki Medical School, Dept. of Radiation Oncology, Kurashiki, Okayama (Japan); Ichihashi, M. [Kobe Univ. (Japan). School of Medicine

    2000-10-01

    Melanin synthesis is accentuated in the melanoma cells. DOPA is one of the melanin precursors, and has been found to be the substrates for tyrosinase. Since Dopamine has the similar structure to DOPA, we have thought that the Dopamine containing boron atom has a possibility to be incorporated into the melanin synthesis pathway, resulting in both higher {sup 10}B-delivery and long lasting {sup 10}B-accumulation in melanoma. Thus, we tried to synthesize a new amide compound between Dopamine and p-carboxybenzeneboronic acid (PCBA). (author)

  2. Convenient and Scalable Synthesis of Fmoc-Protected Peptide Nucleic Acid Backbone

    Directory of Open Access Journals (Sweden)

    Trevor A. Feagin

    2012-01-01

    Full Text Available The peptide nucleic acid backbone Fmoc-AEG-OBn has been synthesized via a scalable and cost-effective route. Ethylenediamine is mono-Boc protected, then alkylated with benzyl bromoacetate. The Boc group is removed and replaced with an Fmoc group. The synthesis was performed starting with 50 g of Boc anhydride to give 31 g of product in 32% overall yield. The Fmoc-protected PNA backbone is a key intermediate in the synthesis of nucleobase-modified PNA monomers. Thus, improved access to this molecule is anticipated to facilitate future investigations into the chemical properties and applications of nucleobase-modified PNA.

  3. Automated synthesis system with computer control for the production of [1-11C]fatty acids

    International Nuclear Information System (INIS)

    Takahashi, Toshihiro; Ido, Tatsuo; Iwata, Ren; Hatano, Kentaro; Nakanishi, Hiroaki; Shinohara, Makoto; Iida, Shigenori

    1988-01-01

    To accommodate the increasing need for [1- 11 C]fatty acids for use in routine medical studies and the large amounts of radioactivity required, a more advanced automated synthesis system for the preparation of [1- 11 C]fatty acids has been constructed. The synthesis of [1- 11 C]fatty acids has been completely automated using a new separation unit (isobaric Sepaltor) for the extraction procedure, which had caused some difficulties with automation. The yield of [1- 11 C]palmitic acid was 20-30 mCi, and that of 3-methyl [1- 11 C]heptadecanoic acid was 2-7 mCi. The time required for the synthesis was less than 30 min from the start of the 11 CO 2 trapping. This system has been used for more than 20 preparations of [1- 11 C]palmitic acid and more than 20 preparations of 3-methyl [1- 11 C]heptadecanoic acid. (author)

  4. Synthesis, characterisation and some chemistry of C- and B-substituted carboxylic acids of cobalt bis(dicarbollide)

    Czech Academy of Sciences Publication Activity Database

    Nekvinda, Jan; Šícha, Václav; Hnyk, Drahomír; Grüner, Bohumír

    2014-01-01

    Roč. 43, č. 13 (2014), s. 5106-5120 ISSN 1477-9226 R&D Projects: GA AV ČR IAAX00320901 Institutional support: RVO:61388980 Keywords : BORON-CLUSTER COMPOUNDS * EFFICIENT EXTRACTANTS * ACTINIDE EXTRACTIONS Subject RIV: CA - Inorganic Chemistry Impact factor: 4.197, year: 2014

  5. Synthesis of hydroxymethylfurfural from sucrose using brönsted-lewis acidic ionic liquid

    Directory of Open Access Journals (Sweden)

    L. Yao

    2016-08-01

    Full Text Available The synthesis of 5-hydroxymethylfurfural (HMF from sucrose was investigated in the presence of the Brönsted-Lewis acidic ionic liquids (ILs. It was concluded that IL 1-(3-sulfonic acid-propyl-3-methylimidazole chlorochrominate [HO3S-(CH23-mim]Cl-CrCl3 (molar fraction of CrCl3x = 0.55 had a good catalytic performance with 78.8% yield of HMF. The acid type of IL played a significant role in the reaction. Lewis acid site acted more effectively than its Brönsted counterpart and a synergetic effect of Brönsted and Lewis acid sites enhanced the IL catalytic performance. The reusability of IL was good.

  6. Synthesis of glycerol mono-laurate from lauric acid and glycerol for food antibacterial additive

    Science.gov (United States)

    Setianto, W. B.; Wibowo, T. Y.; Yohanes, H.; Illaningtyas, F.; Anggoro, D. D.

    2017-05-01

    Synthesis of glycerol mono-laurate (GML) has been performed using esterification reaction of glycerol and lauric acid. The reaction was performed at the condition of temperature of 120-140 °C within 7 hour, variation of molar ratio of glycerol - lauric acid, and was using heterogeneous catalyst of zeolist Y. Without catalyst dealumination the maximum acid conversion was 78%, with GML contained in the sample was 38.6%, and it was obtained at the reaction condition of 140 oC, 15wt% catalyst, and 8:1 molar ratio of glycerol - lauric acid. At the same condition, using dealuminated catalyst, the maximum acid conversion was increased up to 98%, with GML contained in the sample was 50.4%. The GML antibacterial activity was examined. It was observed that the GML has antibacterial activity against gram positive bacterial such as B. cereus and S. aureus.

  7. Convergent synthesis of degradable dendrons based on L-malic acid

    DEFF Research Database (Denmark)

    Meyhoff, Ulrich; Riber, Ulla; Boas, Ulrik

    2015-01-01

    New degradable polyester dendrons based on the cellular tricarboxylic acid cycle component L-malic acid were synthesized up to the third generation by convergent synthesis. The dendron wedges could be introduced in a stepwise, highly regioselective fashion. HMBC-NMR revealed that the C1-carbonyl...... on malic acid was exclusively esterified, before the reaction of the second dendron wedge at C4 took place. Degradation studies on a first generation dendron analyzed by HPLC showed that hydrolytic degradation of the dendron most profoundly takes place at pH 4 and pH 9 with the highest degradation rate...... at alkaline pH. NMR shows that the dendron degrades to malic acid and fumaric acid derivatives. Preliminary studies performed in the cell culture show low toxicity of the dendrons in concentrations of up to 50 μg mL-1....

  8. Recent Advances in Substrate-Controlled Asymmetric Induction Derived from Chiral Pool α-Amino Acids for Natural Product Synthesis.

    Science.gov (United States)

    Paek, Seung-Mann; Jeong, Myeonggyo; Jo, Jeyun; Heo, Yu Mi; Han, Young Taek; Yun, Hwayoung

    2016-07-21

    Chiral pool α-amino acids have been used as powerful tools for the total synthesis of structurally diverse natural products. Some common naturally occurring α-amino acids are readily available in both enantiomerically pure forms. The applications of the chiral pool in asymmetric synthesis can be categorized prudently as chiral sources, devices, and inducers. This review specifically examines recent advances in substrate-controlled asymmetric reactions induced by the chirality of α-amino acid templates in natural product synthesis research and related areas.

  9. Synthesis and curing of alkyd enamels based on ricinoleic acid

    Directory of Open Access Journals (Sweden)

    Jovičić Mirjana C.

    2010-01-01

    Full Text Available A combination of an alkyd resin with a melamine-formaldehyde resin gives a cured enamel film with the flexibility of the alkyd constituent and the high chemical resistance and hardness of the melamine resin at the same time. The melamine resin is a minor constituent and plays the role of a crosslinking agent. In this paper, alkyd resins of high hydroxyl numbers based on trimethylolpropane, ricinoleic acid and phthalic anhydride were synthesized. Two alkyds having 30 and 40 wt% of ricinoleic acid were formulated by calculation on alkyd constant. Alkyds were characterized by FTIR and by the determination of acid and hydroxyl numbers. Then synthesized alkyds were made into baking enamels by mixing with melamine-formaldehyde resins (weight ratio of 70:30 based on dried mass. Two types of commercial melamine resins were used: threeisobutoxymethyl melamine-formaldehyde resin (TIMMF and hexamethoxymethyl melamine resin (HMMMF. Prepared alkyd/melamine resin mixtures were cured in a differential scanning calorimeter (DSC under non-isothermal mode. Apparent degree of curing as a function of temperature was calculated from the curing enthalpies. Kinetic parameters of curing were calculated using Freeman-Carroll method. TIMMF resin is more reactive with synthesized alkyds than HMMMF resin what was expected. Alkyd resin with 30 wt% of ricinoleic acid is slightly more reactive than alkyd with 40 wt% of ricinoleic acid, probably because it has the high contents of free hydroxyl and acid groups. The gel content, Tg, thermal stability, hardness, elasticity and impact resistance of coated films cured at 150°C for 60 min were measured. Cured films show good thermal stability since the onset of films thermal degradation determined by thermogravimetric analysis (TGA is observed at the temperatures from 281 to 329°C. Films based on alkyd 30 are more thermal stable than those from alkyd 40, with the same melamine resin. The type of alkyd resin has no significant

  10. Synthesis of novel adamantyl and homoadamantyl-substituted β-hydroxybutyric acids.

    Science.gov (United States)

    Matković, Marija; Vukelić, Stella; Cirimotić, Ružica; Kragol, Goran; Molčanov, Krešimir; Mlinarić-Majerski, Kata

    2013-11-01

    Several new adamantyl and homoadamantyl-substituted [Formula: see text]-hydroxybutyric acids, 2-[2-(1-adamantyl)ethyl]-3-hydroxybutyric acid (2), 2-(3-homoadamantyl)-3-hydroxybutyric acid (3), and 2-(1-homoadamantyl)-3-hydroxybutyric acid (4), analogues of the 2-(1-adamantyl)-3-hydroxybutyric acid (1), have been prepared as mixtures of diastereoisomers using selective reduction of corresponding [Formula: see text]-keto esters or aldol condensation of the corresponding carboxylic acid and acetaldehyde. The rearrangement of adamantylmethyl and 3-homoadamantyl groups provided entry to both 3-homoadamantyl and 1-homoadamantyl-substituted hydroxy acids 3 and 4, respectively. The relative configurations of diastereoisomers 3 and 4 have been determined by NMR spectroscopy comparing the values of coupling constants. Adamantyl-substituted [Formula: see text]-hydroxybutyric acid 2 has also been prepared in enantiomerically pure form by Evan's asymmetric synthesis and the absolute configuration has been determined by X-ray crystallography. Contrary to the long-chain acid 2, the attempt to prepare short-chain hydroxy acids 1 and 4 by the same method failed indicating pronounced sensitivity of the used method to the vicinity of the bulky cage group.

  11. Synthesis, antimicrobial evaluation and QSAR studies of propionic acid derivatives

    Directory of Open Access Journals (Sweden)

    Sanjiv Kumar

    2017-02-01

    Full Text Available A series of Schiff bases (1–17 and esters (18–24 of propionic acid was synthesized in appreciable yield and characterized by physicochemical as well as spectral means. The synthesized compounds were evaluated in vitro for their antimicrobial activity against Gram-positive bacteria Staphylococcus aureus, Bacillus subtilis, Gram negative bacterium Escherichia coli and fungal strains Candida albicans and Aspergillus niger by tube dilution method. Results of antimicrobial screening indicated that besides having good antibacterial activity, the synthesized compounds also displayed appreciable antifungal activity and compound 10 emerged as the most active antifungal agent (pMICca and pMICan = 1.93. The results of QSAR studies demonstrated that antibacterial, antifungal and overall antimicrobial activities of synthesized propionic acid derivatives were governed by the topological parameters, Kier’s alpha first order shape index (κα1 and valence first order molecular connectivity index (1χv.

  12. Synthesis of new fatty acids amides from aminolysis of fatty acid methyl esters (FAMEs); Sintese de novas amidas graxas a partir da aminolise de esteres metilicos

    Energy Technology Data Exchange (ETDEWEB)

    Lopes, Carolina R.; Montes D' Oca, Caroline da Ros; Duarte, Rodrigo da C.; Kurz, Marcia H.S.; Primel, Ednei G.; Clementin, Rosilene M.; Villarreyes, Joaquin Ariel M.; Montes D' Oca, Marcelo G., E-mail: dqmdoca@furg.b [Universidade Federal do Rio Grande, RS (Brazil). Escola de Quimica e Alimentos

    2010-07-01

    Recent biochemical and pharmacological studies have led to the characterization of different fatty acid amides as a new family of biologically active lipids. Here, we describe the synthesis of new amides from C16:0, 18:0, 18:1 and 18:1, OH fatty acids (FFA) families with cyclic and acyclic amines and demonstrate for the first time that these compounds produce cytotoxic effects. Application of this method to the synthesis of fatty acid amides was performed using the esters aminolysis as a key step and various carboxylic amides were prepared in good yield from fatty acid methyl esters (FAMEs). (author)

  13. Synthesis and curing of alkyd enamels based on ricinoleic acid

    OpenAIRE

    Jovičić Mirjana C.; Radičević Radmila Ž.; Simendić Vesna B.

    2010-01-01

    A combination of an alkyd resin with a melamine-formaldehyde resin gives a cured enamel film with the flexibility of the alkyd constituent and the high chemical resistance and hardness of the melamine resin at the same time. The melamine resin is a minor constituent and plays the role of a crosslinking agent. In this paper, alkyd resins of high hydroxyl numbers based on trimethylolpropane, ricinoleic acid and phthalic anhydride were synthesized. Two alkyds having 30 and 40 wt% of ricino...

  14. Synthesis, antimicrobial evaluation and QSAR studies of propionic acid derivatives

    OpenAIRE

    Kumar, Sanjiv; Kumar, Pradeep; Marwaha, Rakesh Kumar; Narasimhan, Balasubramanian

    2012-01-01

    A series of Schiff bases (1–17) and esters (18–24) of propionic acid was synthesized in appreciable yield and characterized by physicochemical as well as spectral means. The synthesized compounds were evaluated in vitro for their antimicrobial activity against Gram-positive bacteria Staphylococcus aureus, Bacillus subtilis, Gram negative bacterium Escherichia coli and fungal strains Candida albicans and Aspergillus niger by tube dilution method. Results of antimicrobial screening indicated th...

  15. Tuning of acyl-ACP thioesterase activity directed for tailored fatty acid synthesis.

    Science.gov (United States)

    Feng, Yanbin; Zhang, Yunxiu; Wang, Yayue; Liu, Jiao; Liu, Yinghui; Cao, Xupeng; Xue, Song

    2018-04-01

    Medium-chain fatty acids have attracted significant attention as sources of biofuels in recent years. Acyl-ACP thioesterase, which is considered as the key enzyme to determine the carbon chain length, catalyzes the termination of de novo fatty acid synthesis. Although recombinant medium-chain acyl-ACP thioesterase (TE) affects the fatty acid profile in heterologous cells, tailoring of the fatty acid composition merely by engineering a specific TE is still intractable. In this study, the activity of a C8-C10-specific thioesterase FatB2 from Cuphea hookeriana on C10-ACP was quantified twice as high as that on C8-ACP based on a synthetic C8-C16 acyl-ACP pool in vitro. Whereas in vivo, it was demonstrated that ChFatB2 preferred to accumulate C8 fatty acids with 84.9% composition in the ChFatB2-engineered E. coli strain. To achieve C10 fatty acid production, ChFatB2 was rationally tuned based on structural investigation and enzymatic analysis. An I198E mutant was identified to redistribute the C8-ACP flow, resulting in C10 fatty acid being produced as the principal component at 57.6% of total fatty acids in vivo. It was demonstrated that the activity of TE relative to β-ketoacyl-ACP synthases (KAS) directly determined the fatty acid composition. Our results provide a prospective strategy in tailoring fatty acid synthesis by tuning of TE activities based on TE-ACP interaction.

  16. Increase of uric acid synthesis in irradiated chicken's embryos

    International Nuclear Information System (INIS)

    Loyda, H.J.

    1984-01-01

    Several important intermediate and end products of uric acid metabolism as well as their corresponding enzymatic reactions were studied in 16 day-old chicken embryos which had been one or more times irradiated or respectively treated with ammonium chloride. After sublethal X-irradiation and at the time of the second irradiation with 800 R, the activity of the glutamine synthetase and the xanthin dehydrogenase in the kidneys of the embryos was increased. In contrast to this the glutamate dehydrogenase activity was moderately decreased. Two hours after the main irradiation the uric acid values as well as the amount of fixed nitrogen in the blood serum of previously-irradiated embryos are noticeably higher than the comparative data in non-previously irradiated animals. The glutamic acid values increase after the second irradiation, but still remain lower than with the non-previously irradiated animals. I achieved concuring ressults when I treated the embryos with ammonium chloride instead of radiation. (orig./MG) [de

  17. Mig-6 plays a critical role in the regulation of cholesterol homeostasis and bile acid synthesis.

    Directory of Open Access Journals (Sweden)

    Bon Jeong Ku

    Full Text Available The disruption of cholesterol homeostasis leads to an increase in cholesterol levels which results in the development of cardiovascular disease. Mitogen Inducible Gene 6 (Mig-6 is an immediate early response gene that can be induced by various mitogens, stresses, and hormones. To identify the metabolic role of Mig-6 in the liver, we conditionally ablated Mig-6 in the liver using the Albumin-Cre mouse model (Alb(cre/+Mig-6(f/f; Mig-6(d/d. Mig-6(d/d mice exhibit hepatomegaly and fatty liver. Serum levels of total, LDL, and HDL cholesterol and hepatic lipid were significantly increased in the Mig-6(d/d mice. The daily excretion of fecal bile acids was significantly decreased in the Mig-6(d/d mice. DNA microarray analysis of mRNA isolated from the livers of these mice showed alterations in genes that regulate lipid metabolism, bile acid, and cholesterol synthesis, while the expression of genes that regulate biliary excretion of bile acid and triglyceride synthesis showed no difference in the Mig-6(d/d mice compared to Mig-6(f/f controls. These results indicate that Mig-6 plays an important role in cholesterol homeostasis and bile acid synthesis. Mice with liver specific conditional ablation of Mig-6 develop hepatomegaly and increased intrahepatic lipid and provide a novel model system to investigate the genetic and molecular events involved in the regulation of cholesterol homeostasis and bile acid synthesis. Defining the molecular mechanisms by which Mig-6 regulates cholesterol homeostasis will provide new insights into the development of more effective ways for the treatment and prevention of cardiovascular disease.

  18. Synthesis, physicochemical properties, and biological activity of bile acids 3-glucuronides: Novel insights into bile acid signalling and detoxification.

    Science.gov (United States)

    Mostarda, Serena; Passeri, Daniela; Carotti, Andrea; Cerra, Bruno; Colliva, Carolina; Benicchi, Tiziana; Macchiarulo, Antonio; Pellicciari, Roberto; Gioiello, Antimo

    2018-01-20

    Glucuronidation is considered an important detoxification pathway of bile acids especially in cholestatic conditions. Glucuronides are less toxic than the parent free forms and are more easily excreted in urine. However, the pathophysiological significance of bile acid glucuronidation is still controversial and debated among the scientific community. Progress in this field has been strongly limited by the lack of appropriate methods for the preparation of pure glucuronides in the amount needed for biological and pharmacological studies. In this work, we have developed a new synthesis of bile acid C3-glucuronides enabling the convenient preparation of gram-scale quantities. The synthesized compounds have been characterized in terms of physicochemical properties and abilities to modulate key nuclear receptors including the farnesoid X receptor (FXR). In particular, we found that C3-glucuronides of chenodeoxycholic acid and lithocholic acid, respectively the most abundant and potentially cytotoxic species formed in patients affected by cholestasis, behave as FXR agonists and positively regulate the gene expression of transporter proteins, the function of which is critical in human conditions related to imbalances of bile acid homeostasis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  19. Synthesis and pharmacology of 3-isoxazolol amino acids as selective antagonists at group I metabotropic glutamic acid receptors

    DEFF Research Database (Denmark)

    Madsen, U; Bräuner-Osborne, H; Frydenvang, Karla Andrea

    2001-01-01

    GluRs), the few analogues of (RS)-2-amino-3-(3-hydroxy-5-isoxazolyl)propionic acid [HIBO, (RS)-4] so far known typically interact with iGluRs as well as metabotropic Glu receptors (mGluRs). We here report the synthesis and pharmacology of a series of 4-substituted analogues of HIBO. The hexyl analogue 9 was shown......Using ibotenic acid (2) as a lead, two series of 3-isoxazolol amino acid ligands for (S)-glutamic acid (Glu, 1) receptors have been developed. Whereas analogues of (RS)-2-amino-3-(3-hydroxy-5-methyl-4-isoxazolyl)propionic acid [AMPA, (RS)-3] interact selectively with ionotropic Glu receptors (i...... to originate in (S)-11 (EC(50) = 395 microM, K(b) = 86 and 90 microM, respectively). Compound 9, administered icv, but not sc, was shown to protect mice against convulsions induced by N-methyl-D-aspartic acid (NMDA). Compounds 9 and 11 were resolved using chiral HPLC, and the configurational assignments...

  20. Synthesis and pharmacology of 3-isoxazolol amino acids as selective antagonists at group I metabotropic glutamic acid receptors

    DEFF Research Database (Denmark)

    Madsen, U; Bräuner-Osborne, H; Frydenvang, Karla Andrea

    2001-01-01

    Using ibotenic acid (2) as a lead, two series of 3-isoxazolol amino acid ligands for (S)-glutamic acid (Glu, 1) receptors have been developed. Whereas analogues of (RS)-2-amino-3-(3-hydroxy-5-methyl-4-isoxazolyl)propionic acid [AMPA, (RS)-3] interact selectively with ionotropic Glu receptors (i......GluRs), the few analogues of (RS)-2-amino-3-(3-hydroxy-5-isoxazolyl)propionic acid [HIBO, (RS)-4] so far known typically interact with iGluRs as well as metabotropic Glu receptors (mGluRs). We here report the synthesis and pharmacology of a series of 4-substituted analogues of HIBO. The hexyl analogue 9 was shown...... to originate in (S)-11 (EC(50) = 395 microM, K(b) = 86 and 90 microM, respectively). Compound 9, administered icv, but not sc, was shown to protect mice against convulsions induced by N-methyl-D-aspartic acid (NMDA). Compounds 9 and 11 were resolved using chiral HPLC, and the configurational assignments...

  1. Enzymatic synthesis of arbutin undecylenic acid ester and its inhibitory effect on melanin synthesis.

    Science.gov (United States)

    Tokiwa, Yutaka; Kitagawa, Masaru; Raku, Takao; Yanagitani, Shusaku; Yoshino, Kenji

    2007-06-01

    Transesterification of arbutin and undecylenic acid vinyl ester was catalyzed by alkaline protease, Bioprase, in dimethylformamide to get arbutin derivative having undecylenic acid at 6-position of glucose moiety, 6-O-undecylenoyl p-hydroxyphenyl beta-D-glucopyranoside. The reaction rate increased with increase of arbutin concentration, and when its concentration was 0.9 M, the conversion rate was more than 90% under addition of 2 M undecylenic acid vinyl ester. The obtained arbutin ester significantly suppressed melanin production in murine B16 melanoma cells.

  2. Characterisation of weak magnetic field effects in an aqueous glutamic acid solution by nonlinear dielectric spectroscopy and voltammetry

    Science.gov (United States)

    Pazur, Alexander

    2004-01-01

    Background Previous reports indicate altered metabolism and enzyme kinetics for various organisms, as well as changes of neuronal functions and behaviour of higher animals, when they were exposed to specific combinations of weak static and alternating low frequency electromagnetic fields. Field strengths and frequencies, as well as properties of involved ions were related by a linear equation, known as the formula of ion cyclotron resonance (ICR, abbreviation mentioned first by Liboff). Under certain conditions already a aqueous solution of the amino acid and neurotransmitter glutamate shows this effect. Methods An aqueous solution of glutamate was exposed to a combination of a static magnetic field of 40 μT and a sinusoidal electromagnetic magnetic field (EMF) with variable frequency (2–7 Hz) and an amplitude of 50 nT. The electric conductivity and dielectric properties of the solution were investigated by voltammetric techniques in combination with non linear dielectric spectroscopy (NLDS), which allow the examination of the dielectric properties of macromolecules and molecular aggregates in water. The experiments target to elucidate the biological relevance of the observed EMF effect on molecular level. Results An ion cyclotron resonance (ICR) effect of glutamate previously reported by the Fesenko laboratory 1998 could be confirmed. Frequency resolution of the sample currents was possible by NLDS techniques. The spectrum peaks when the conditions for ion cyclotron resonance (ICR) of glutamate are matched. Furthermore, the NLDS spectra are different under ICR- and non-ICR conditions: NLDS measurements with rising control voltages from 100–1100 mV show different courses of the intensities of the low order harmonics, which could possibly indicate "intensity windows". Furthermore, the observed magnetic field effects are pH dependent with a narrow optimum around pH 2.85. Conclusions Data will be discussed in the context with recent published models for the

  3. Activities of Heterogeneous Acid-Base Catalysts for Fragrances Synthesis: A Review

    Directory of Open Access Journals (Sweden)

    Hartati Hartati

    2013-06-01

    Full Text Available This paper reviews various types of heterogeneous acid-base catalysts for fragrances preparation. Catalytic activities of various types of heterogeneous acid and base catalysts in fragrances preparation, i.e. non-zeolitic, zeolitic, and mesoporous molecular sieves have been reported. Generally, heterogeneous acid catalysts are commonly used in fragrance synthesis as compared to heterogeneous base catalysts. Heteropoly acids and hydrotalcites type catalysts are widely used as heterogeneous acid and base catalysts, respectively. © 2013 BCREC UNDIP. All rights reservedReceived: 20th January 2013; Revised: 31st March 2013; Accepted: 1st April 2013[How to Cite: Hartati, H., Santoso, M., Triwahyono, S., Prasetyoko, D. (2013. Activities of Heterogeneous Acid-Base Catalysts for Fragrances Synthesis: A Review. Bulletin of Chemical Reaction Engineering & Catalysis, 8 (1: 14-33. (doi:10.9767/bcrec.8.1.4394.14-33][Permalink/DOI: http://dx.doi.org/10.9767/bcrec.8.1.4394.14-33] | View in  |

  4. Role of ferrocyanides in the prebiotic synthesis of α-amino acids.

    Science.gov (United States)

    Ruiz-Bermejo, Marta; Osuna-Esteban, Susana; Zorzano, María-Paz

    2013-06-01

    We investigated the synthesis of α-amino acids under possible prebiotic terrestrial conditions in the presence of dissolved iron (II) in a simulated prebiotic ocean. An aerosol-liquid cycle with a prebiotic atmosphere is shown to produce amino acids via Strecker synthesis with relatively high yields. However, in the presence of iron, the HCN was captured in the form of a ferrocyanide, partially inhibiting the formation of amino acids. We showed how HCN captured as Prussian Blue (or another complex compound) may, in turn, have served as the HCN source when exposed to UV radiation, allowing for the sustained production of amino acids in conjunction with the production of oxyhydroxides that precipitate as by-products. We conclude that ferrocyanides and related compounds may have played a significant role as intermediate products in the prebiotic formation of amino acids and oxyhydroxides, such as those that are found in iron-containing soils and that the aerosol cycle of the primitive ocean may have enhanced the yield of the amino acid production.

  5. Squalene mono-oxygenase, a key enzyme in cholesterol synthesis, is stabilized by unsaturated fatty acids.

    Science.gov (United States)

    Stevenson, Julian; Luu, Winnie; Kristiana, Ika; Brown, Andrew J

    2014-08-01

    SM (squalene mono-oxygenase) catalyses the first oxygenation step in cholesterol synthesis, immediately before the formation of the steroid backbone at lanosterol. SM is an important control point in the pathway, and is regulated at the post-translational level by accelerated cholesterol-dependent ubiquitination and proteasomal degradation, which is associated with the accumulation of squalene. Using model cell systems, we report that SM is stabilized by unsaturated fatty acids. Treatment with unsaturated fatty acids such as oleate, but not saturated fatty acids, increased protein levels of SM or SM-N100-GFP (the first 100 amino acids of SM fused to GFP) at the post-translational level and partially overcame cholesterol-dependent degradation, as well as reversing cholesterol-dependent squalene accumulation. Maximum stabilization required activation of fatty acids, but not triacylglycerol or phosphatidylcholine synthesis. The mechanism of oleate-mediated stabilization appeared to occur through reduced ubiquitination by the E3 ubiquitin ligase MARCH6. Stabilization of a cholesterol biosynthetic enzyme by unsaturated fatty acids may help maintain a constant cholesterol/phospholipid ratio.

  6. Aspergillus niger whole-cell catalyzed synthesis of caffeic acid phenethyl ester in ionic liquids.

    Science.gov (United States)

    Rajapriya, Govindaraju; Morya, Vivek Kumar; Mai, Ngoc Lan; Koo, Yoon-Mo

    2018-04-01

    Synthesis of caffeic acid ester essentially requires an efficient esterification process to produce various kinds of medicinally important ester derivatives. In the present study, a comprehensive and comparative analysis of whole-cell catalyzed caffeic acid esters production in ionic liquids (ILs) media was performed. Olive oil induced mycelial mass of halotolerant Aspergillus niger (A.niger) EXF 4321 was freeze dried and used as a catalyst. To ensure maximum solubilization of caffeic acid for highest substrate loading several ILs were screened and 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide ([Emim][Tf 2 N]) was found to have the maximum solubility and favoured for enzymatic activity of freeze dried mycelia. The whole-cell catalyzed synthesis of caffeic acid phenethyl ester (CAPE) conditions were optimized and bioconversion up to 84% was achieved at a substrate molar ratio of 1:20 (caffeic acid:2-phenyl ethanol), 30°C for 12h. Results obtained during this study were encouraging and helpful to design a bioreactor system to produce caffeic acid derived esters. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Synthesis, characterization and corrosion inhibition properties of benzamide-2-chloro-4-nitrobenzoic acid and anthranilic acid-2-chloro-4-nitrobenzoic acid for mild steel corrosion in acidic medium

    Science.gov (United States)

    Pandey, Archana; Verma, Chandrabhan; Singh, B.; Ebenso, Eno E.

    2018-03-01

    The present study deals with the synthesis of two new compounds namely, benzamide - 2-chloro-4-nitrobenzoic acid (BENCNBA) and anthranilic acid-2-chloro-4-nitrobenzoic acid (AACNBA) using solid phase reactions. The phase diagram studies revealed that formation of the investigated compounds occurs in 1:1 molar ratio. The synthesized compounds were characterized using several spectral techniques such as FT-IR, 1H and 13C NMR, UV-Vis, powder X-ray diffraction (PXRD). Single crystal XRD (SCXRD) study showed that both BENCNBA and AACNBA compounds crystallize in triclinic crystal system with P-1 space group. Further, the presence of intermolecular hydrogen bonding between the constituent components was also supported by single crystal X-ray diffraction (SCXRD) method. Heat of mixing, entropy of fusion, roughness parameter, interfacial energy and excess thermodynamic functions have also been computed using the enthalpy of fusion values derived from differential scanning calorimeter (DSC) study. The inhibition effect of BENCNBA and AACNBA on the mild steel corrosion in hydrochloric acid solution was tested using electrochemical methods. Electrochemical impedance spectroscopy (EIS) study revealed that both BENCNBA and AACNBA behaved as interface corrosion inhibitors and showed maximum inhibition efficiencies of 95.71% and 96.42%, respectively at 400 ppm (1.23 × 10-3 M) concentration. Potentiodynamic polarization (PDP) measurements suggested that BENCNBA and AACNBA acted as mixed type corrosion inhibitors. EIS and PDP results showed that BENCNBA and AACNBA act as efficient corrosion inhibitors for mild steel and their inhibition efficiencies enhances on increasing their concentrations.

  8. Concise synthesis of the A/BCD-ring fragment of gambieric acid A

    Science.gov (United States)

    Fuwa, Haruhiko; Fukazawa, Ryo; Sasaki, Makoto

    2014-12-01

    Gambieric acid A (GAA) and its congeners belong to the family of marine polycyclic ether natural products. Their highly complex molecular architecture and unique biological activities have been of intense interest within the synthetic community. We have previously reported the first total synthesis, stereochemical reassignment, and preliminary structure-activity relationships of GAA. Here we disclose a concise synthesis of the A/BCD-ring fragment of GAA. The synthesis started from our previously reported synthetic intermediate that represents the A/B-ring. The C-ring was synthesized via an oxiranyl anion coupling and a 6-endo cyclization, and the D-ring was forged by means of an oxidative lactonization and subsequent palladium-catalyzed functionalization of the lactone ring. In this manner, the number of linear synthetic steps required for the construction of the C- and D-rings was reduced from 22 to 11.

  9. Ribonucleic Acid Synthesis Associated with a Developmental Change in the Gametophyte of Pteridium aquilinum.

    Science.gov (United States)

    Sobota, A E

    1972-06-01

    When bacteria are subjected to step-down conditions, there is an enhanced production of a messenger-type of RNA for a short time after the shift. A cultural shift, which appears to be similar to step-down, is described for gametophytes of Pteridium aquilinum. When the cultures are grown in white light, a population of rapidly dividing cells is produced, whereas in red light cell elongation predominates. If the cultures growing in white light are shifted to red light, a transition occurs which involves a rapid decrease in growth and nucleic acid synthesis. In particular, there is a marked decline in RNA synthesis for a short time following the shift and prior to the initiation of the new mode of growth. It appears that this observed change in RNA synthesis is related to the initiation of the new mode of growth.

  10. Improved conventional synthesis for 14C-labeled polyglutamates of folic acid

    International Nuclear Information System (INIS)

    Ferenz, C.R.; Graham, D.Y.

    1989-01-01

    The majority of folates existing in nature are of the pteroylpolyglutamyl form and are unable to support Lactobacillus casei growth until the γ-linked glutamyls are digested by conjugase enzymes. Most studies involving folate absorption have utilized monoglutamyl forms of folate, primarily folic acid. Synthetic pteroylpolyglutamates prepared by solid phase or conventional synthesis provided conjugated materials with which to study the absorption and metabolism of natural derivatives; however, the synthetic hepataglutamates support microbiological growth prior to enzymatic hydrolysis whereas the natural conjugates do not. Incomplete purification of intermediate peptides during the synthesis would be the most likely explanation of this growth phenomenon. A modified solution synthesis has been developed which improves upon intermediate peptide condensations, increases product yields, and provides a heptapeptide which does not support microbiological growth until after enzymatic hydrolysis. (author)

  11. Sodium iron (III) ethylenediaminetetraacetic acid synthesis to reduce iron deficiency globally.

    Science.gov (United States)

    Loots, Du T; van Lieshout, M; Lieshout, M V; Lachmann, G

    2007-02-01

    Despite major interest in sodium iron (III) ethylenediaminetetraacetic acid's (EDTA) potential use in food fortification programs in potentially curbing the global problem of iron deficiency and its anemia, synthesis methods of stable isotope-labeled sodium iron (III) EDTA for use in human bioavailability studies are incomplete, incorrect or totally lacking. Owing to a number of clinical research groups requiring this compound in bioavailability studies, in both developing and already developed countries, we simplified and optimized the synthesis of sodium iron (III) EDTA from a block of isotopically enriched iron metal, in order that it be easily reproduced, cheaply, using simple basic laboratory apparatus. The resulting product is of high purity (>99.0%), and may be used for human stable isotope bioavailability studies. The simplicity of this method allows for the many research groups, currently doing such studies, to perform their own syntheses. Additionally, more uniformity in this synthesis will reduce the variation observed between such studies.

  12. Gamma-amino butyric acid (GABA) synthesis of Lactobacillus in fermentation of defatted rice bran extract

    Science.gov (United States)

    Dat, Lai Quoc; Ngan, Tran Thi Kim; Nu, Nguyen Thi Xuan

    2017-09-01

    This research focused on the synthesis of GABA by Lactobacillus bacteria in fermentation of defatted rice bran extract without adding glutamate. Two strains of Lactobacillus were investigated into capacity of GABA synthesis. Result indicates that, Lactobacillus brevis VTCC - B - 454 exhibited the higher capacity of GABA synthesis in fermentation of defatted rice bran extract than that of Lactobacillus plantarum VTCC - B - 890. Total dissolved solid (TDS), free amino acids (AA) and reducing sugar (RS) contents in fermentation of defatted rice bran extract with two strains also significantly decreased. At pH 5 and 9 %w/w of TDS content in defatted rice bran extract, Lactobacillus brevis VTCC - B - 454 accumulated 2,952 ppm of GABA in 24 hours of fermentation. The result implies that fermentation with Lactobacillus brevis VTCC - B - 454 can be applied for GABA production from defatted rice bran extract.

  13. Liquid-Phase Synthesis of Cyanuric Acid from Urea

    Directory of Open Access Journals (Sweden)

    Fen-Ming Li

    2010-03-01

    Full Text Available The focus of this paper was to identify a cheaper solvent from among diesel fuel, kerosene, sulfolane or a mixture of sulfolane and cyclohexanol for the preparation of cyanuric acid heterocyclization of urea. To obtain a higher yield, the effects of catalyst (sodium, ammonium, calcium and zinc salts and temperature (160 °C to 220 °C on the trimerization of urea were also carefully studied. We established the optimal reaction conditions and further validated them in our scale-up experiments.

  14. Synthesis, Preliminary Bioevaluation and Computational Analysis of Caffeic Acid Analogues

    Directory of Open Access Journals (Sweden)

    Zhiqian Liu

    2014-05-01

    Full Text Available A series of caffeic acid amides were designed, synthesized and evaluated for anti-inflammatory activity. Most of them exhibited promising anti-inflammatory activity against nitric oxide (NO generation in murine macrophage RAW264.7 cells. A 3D pharmacophore model was created based on the biological results for further structural optimization. Moreover, predication of the potential targets was also carried out by the PharmMapper server. These amide analogues represent a promising class of anti-inflammatory scaffold for further exploration and target identification.

  15. Synthesis of Ethylene diamine tetra methylene phosphonic acid EDTMP

    International Nuclear Information System (INIS)

    Assaad, Th.

    2009-06-01

    Ethylenediamine tetramethylene phosphonic acid (EDTMP) is one of the most widely used ligands which forms stable complexes with various radionuclides all of which have shown high bone affinity and other favorable pharmacological characteristics in biodistribution studies. The EDTMP is very important precursor in the preparation of radiopharmaceutical kits which is used in the applications for bone diagnosis and therapy was synthesized in one step with Mannich type reaction. The obtained product was fully characterized by its multi-nuclear NMR and IR spectroscopy. The purity of the product was confirmed by HPLC. (author)

  16. Synthesis and preliminary biological evaluation of beta-carotene and retinoic acid oxidation products.

    Science.gov (United States)

    Kithsiri Wijeratne, E M; Liu, Manping X; Kantipudi, Narendra B; Brochini, Claudia B; Leslie Gunatilaka, A A; Canfield, Louise M

    2006-12-01

    Synthesis of the beta-carotene oxidation product, 2,3-dihydro-5,8-endoperoxy-beta-apo-carotene-13-one (1) was achieved in six steps starting from beta-ionone. Photo-oxygenation of all trans-retinoic acid (8) and 13-cis-retinoic acid (9) produced a mixture of 5S*,8S*-epidioxy-5,8-dihydroretinoic acid (10) and 13-cis-5S*,8S*-epidioxy-5,8-dihydroretinoic acid (11). Methylation of the crude photo-oxygenation mixture afforded the corresponding methyl esters 12 and 13, respectively, both of which underwent ready aerial oxidation yielding hitherto unknown oxidation products of retinoic acid identified as methyl 5S*,8S*-epidioxy-9,10beta-epoxy-5,8,9,10-tetrahydroretinoate (14) and methyl 13-cis-5S*,8S*-epidioxy-9,10beta-epoxy-5,8,9,10-tetrahydroretinoate (15). Evaluation of 1, all trans-retinoic acid (8), 13-cis-retinoic acid (9), and the photo-oxygenation products 10-15 in a panel of five cancer cell lines showed 1 to be inactive and that 11 is significantly cytotoxic compared with the other retinoic acid analogs suggesting the requirement of the carboxylic acid moiety and the cis-geometry of the 13(14) double bond for cytotoxic activity.

  17. Effects of Long Chain Fatty Acid Synthesis and Associated Gene Expression in Microalga Tetraselmis sp.

    Directory of Open Access Journals (Sweden)

    T. Catalina Adarme-Vega

    2014-06-01

    Full Text Available With the depletion of global fish stocks, caused by high demand and effective fishing techniques, alternative sources for long chain omega-3 fatty acids are required for human nutrition and aquaculture feeds. Recent research has focused on land-based cultivation of microalgae, the primary producers of omega-3 fatty acids in the marine food web. The effect of salinity on fatty acids and related gene expression was studied in the model marine microalga, Tetraselmis sp. M8. Correlations were found for specific fatty acid biosynthesis and gene expression according to salinity and the growth phase. Low salinity was found to increase the conversion of C18:4 stearidonic acid (SDA to C20:4 eicosatetraenoic acid (ETA, correlating with increased transcript abundance of the Δ-6-elongase-encoding gene in salinities of 5 and 10 ppt compared to higher salinity levels. The expression of the gene encoding β-ketoacyl-coenzyme was also found to increase at lower salinities during the nutrient deprivation phase (Day 4, but decreased with further nutrient stress. Nutrient deprivation also triggered fatty acids synthesis at all salinities, and C20:5 eicosapentaenoic acid (EPA increased relative to total fatty acids, with nutrient starvation achieving a maximum of 7% EPA at Day 6 at a salinity of 40 ppt.

  18. Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives

    Directory of Open Access Journals (Sweden)

    José Luis Viveros-Ceballos

    2016-08-01

    Full Text Available α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed.

  19. Glutamic Acid - Amino Acid, Neurotransmitter, and Drug - Is Responsible for Protein Synthesis Rhythm in Hepatocyte Populations in vitro and in vivo.

    Science.gov (United States)

    Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K

    2016-08-01

    Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.

  20. Synthesis of a nano-crystalline solid acid catalyst from fly ash and its catalytic performance

    Energy Technology Data Exchange (ETDEWEB)

    Chitralekha Khatri; Ashu Rani [Government P.G. College, Kota (India). Environmental Chemistry Laboratory

    2008-10-15

    The synthesis of nano-crystalline activated fly ash catalyst (AFAC) with crystallite size of 12 nm was carried out by chemical and thermal treatment of fly ash, a waste material generated from coal-burning power plants. Fly ash was chemically activated using sulfuric acid followed by thermal activation at 600{sup o}C. The variation of surface and physico-chemical properties of the fly ash by activation methods resulted in improved acidity and therefore, catalytic activity for acid catalyzed reactions. The AFAC was characterized by X-ray diffraction, FT-IR spectroscopy, N{sub 2}-adsorption-desorption isotherm, scanning electron microscopy, flame atomic absorption spectrophotometry and sulfur content by CHNS/O elemental analysis. It showed amorphous nature due to high silica content (81%) and possessed high BET surface area (120 m{sup 2}/g). The catalyst was found to be highly active solid acid catalyst for liquid phase esterification of salicylic acid with acetic anhydride and methanol giving acetylsalicylic acid and methyl salicylate respectively. A maximum yield of 97% with high purity of acetylsalicylic acid (aspirin) and a very high conversion 87% of salicylic acid to methyl salicylate (oil of wintergreen) was obtained with AFAC. The surface acidity and therefore, catalytic activity in AFAC was originated by increased silica content, hydroxyl content and higher surface area as compared to fly ash. The study shows that coal generated fly ash can be converted into potential solid acid catalyst for acid catalyzed reactions. Furthermore, this catalyst may replace conventional environmentally hazardous homogeneous liquid acids making an ecofriendly; solvent free, atom efficient, solid acid based catalytic process. 27 refs., 5 figs., 2 tabs.

  1. Green Chemistry in the Organic Teaching Laboratory: An Environmentally Benign Synthesis of Adipic Acid

    Science.gov (United States)

    Reed, Scott M.; Hutchison, James E.

    2000-12-01

    Environmentally benign ("green") chemical techniques are growing in importance in academic and industrial research laboratories. Such chemistry has been slow to appear in teaching laboratories, owing in part to a lack of published material on this subject. Recent developments in green synthesis provide opportunities to introduce this material in teaching laboratories. We present a synthesis of adipic acid that utilizes green reagents (hydrogen peroxide as the oxidant), solvents (water), and methods (phase-transfer catalysis, catalyst recycling). The synthesis works well and provides an excellent forum for emphasizing green chemical concepts while teaching laboratory skills. It demonstrates reuse of a product, synthesis using a nonhazardous solvent, elimination of deleterious by-products, and use of a recyclable catalyst. It can be carried out on either the macroscale or microscale and generates little waste if the catalyst solution is recycled. This experiment fits well in a sophomore organic sequence; it covers the topics of oxidation, phase-transfer catalysis, and the technique of recrystallization, reinforces lecture topics such as alkene synthesis and reactivity, and provides an opportunity to introduce polymer chemistry.

  2. Correction: Synthesis of pyrrolidine-3-carboxylic acid derivatives via asymmetric Michael addition reactions of carboxylate-substituted enones.

    Science.gov (United States)

    Yin, Feng; Garifullina, Ainash; Tanaka, Fujie

    2018-04-25

    Correction for 'Synthesis of pyrrolidine-3-carboxylic acid derivatives via asymmetric Michael addition reactions of carboxylate-substituted enones' by Feng Yin et al., Org. Biomol. Chem., 2017, 15, 6089-6092.

  3. Amino acids attached to 2'-amino-LNA: Synthesis of DNA mixmer oligonucleotides with increased duplex stability

    DEFF Research Database (Denmark)

    Johannsen, Marie Willaing; Wengel, Jesper; Wamberg, Michael Chr.

    2010-01-01

    -LNA nucleosides derivatized with amino acids have been synthesized and incorporated into DNA oligonucleotides. Following oligonucleotide synthesis, peptides have been added using solid phase peptide coupling chem. Modification of oligonucleotides with pos. charged residues greatly improves thermal stability....

  4. Synthesis of labelled compound of ferulic acid and caffeic acid with tritium

    International Nuclear Information System (INIS)

    Yi Mingguang; Wang Caiyun

    1986-01-01

    Effective components of Chinese traditional herbs consist of many compounds, but some of the compounds usually contain unsaturated carbon-carbon double bonds. The unsaturated organic compounds 3 H-Ferulic acid and 3 H-Caffeic acid are prepared with their tritiated intermediates made by electric-dischange exposure method, which ensures the compounds contaning double bonds not hydrogenated. The 3 H-Ferulic acid is composed of 3 H-vanillin and Malonic acid. The 3 H-Caffeic acid is composed of 3 H-protocatechuyl aldehyde and Malonic acid and the specific activity of the products is 0.2 mCi/mg. The radiochemicaly purity is greater than 90%

  5. NOVEL 3-ACETYLCOUMARIN SCHIFF’S BASE SYNTHESIS FROM DIFFERENT ACID HYDRAZIDE

    OpenAIRE

    Anees Pangal; Javed A. Shaikh; Gazge Muiz; Vijay Mane; Khursheed Ahmed

    2013-01-01

    A new series of Schiff’s bases, SB1, SB2 and SB3 were synthesized from 3-acetylcoumarin and different acid hydrazides. The 3-acetyl coumarin was synthesized starting from salicylaldehyde and ethylacetoacetate. The structures of the synthesized compounds have been established on the basis of physical and spectral data. They shows a prominent absorption of -(C=N-) in FTIR. A survey of existing literature revealed that there are no reports describing the synthesis of such hydrazones.

  6. Lewis acid free high speed synthesis of nimesulide-based novel N-substituted cyclic imides

    Energy Technology Data Exchange (ETDEWEB)

    Kankanala, Kavitha; Mukkanti, Khagga [JNT University Hyderabad, Kukatpally (India); Pal, Sarbani, E-mail: sarbani277@yahoo.co [MNR Degree and PG College, Kukatpally, Hyderabad (India). Dept. of Chemistry; Reddy, Vangala Ranga [Dr. Reddy' s Laboratories Ltd. Integrated Product Development, Bachupally, Hyderabad (India)

    2010-07-01

    The first synthesis of nimesulide-based novel cyclic imides has been accomplished via the reaction of an amine prepared from nimesulide with appropriate anhydrides in the presence of sodium acetate. Using this process a variety of N-substituted cyclic imides was prepared in good yields in glacial acetic acid. Some of the compounds synthesized showed anti-inflammatory activities when tested in vivo. (author)

  7. Synthesis of 2-(6-Acetamidobenzothiazolethioacetic Acid Esters as Photosynthesis Inhibitors

    Directory of Open Access Journals (Sweden)

    Dusan Loos

    1998-04-01

    Full Text Available The synthesis and photosynthesis-inhibiting activity of 13 new 2-(6-acetamidobenzothiazolethioacetic acid esters are reported. The new compounds were prepared by acetylation of 2-(alkoxycarbonylmethylthio-6-aminobenzothiazoles with acetic anhydride. The structure of the compounds was verified by 1H NMR spectra. The compounds inhibit photosynthetic electron transfer in spinach chloroplasts. The structure - activity relation was studied. Lipophilicity was found to influence substantially photosynthetic electron transfer.

  8. Synthesis and Application of Phenyl Nitrone Derivatives as Acidic and Microbial Corrosion Inhibitors

    OpenAIRE

    Chen, Shijun; Zhao, Kang; Chen, Gang

    2015-01-01

    Nitrone has drawn great attention due to its wide applications as a 1,3-dipole in heterocyclic compounds synthesis and the bioactivities. With the special structure, nitrone can also be used as ligand in inorganic chemistry. Based on the current research, the nitrones are anticipated to be effective inhibitors against acidic and microbial corrosion. The aim of this work is to investigate the inhibitory action of nitrones. In this work, a series of phenyl nitrone derivatives (PN) was synthesiz...

  9. Amino Acid Based Synthesis of Chiral Long Chain Diamines and Tetramines

    Directory of Open Access Journals (Sweden)

    George Kokotos

    2002-10-01

    Full Text Available A method for the synthesis of long chain diamines and tetramines starting from natural α-amino acids is reported. Diamines and tetramines were prepared through the Wittig olefination reaction of N-protected amino aldehydes obtained from phenylalanine and lysine. A 1,2,17,18-tetramine was synthesized using (2S-1-azido-2-[bis(tert-butoxycarbonyl-amino]-5-oxopentane as key-intermediate compound.

  10. Synthesis and radioiodinated labelling of ω-p-iodophenyl pentadecanoic acid

    International Nuclear Information System (INIS)

    Ji Shuren; Wu Chunying; Fang Ping

    1997-01-01

    A method different from literature has been developed for the preparation of ω-p-iodophenyl pentadecanoic acid (IPPA). The synthesis and physical properties of IPPA is described. It is characterized by IR, 1 HNMR, elementary analysis and MS. 125 I-IPPA can be easily prepared by two methods: direct labelling and iodo-exchange labelling, the yields of labelling are 80% and 65% respectively confirmed by TLC and HPLC. The radiochemical purity are higher than 95% after extraction

  11. Synthesis and 125I labelling of β-methyl-p-iodophenyl pentadecanoic acid

    International Nuclear Information System (INIS)

    Ji Shuren; Wu Chunying; Lu Chunxiong; Fang Ping

    1999-01-01

    The method of the preparation of β-methyl-p-iodophenyl pentadecanoic acid (BMIPP) is developed. The synthesis and physical properties of BMIPP are described. BMIPP is characterized by IR, HNMR, elementary analysis and MS. 125 I-BMIPP can be easily prepared by two methods: direct labelling and iodo-exchange labelling. The labelling yield is 80% confirmed by TLC, and the radiochemical purity is higher than 98% after extraction

  12. Influence of peroxometallic intermediaries present on polyoxometalates nanoparticles surface on the adipic acid synthesis

    OpenAIRE

    Alcañiz Monge, Juan; Trautwein, Guido; García García, Avelina

    2014-01-01

    The cyclohexene oxidation by hydrogen peroxide catalysed by polyoxometalates (POM) has been shown as an adequate green route for the adipic acid synthesis. In this study, it has been demonstrated that POM's salts are effective catalysts for this reaction and how peroxopolyoxometalates intermediaries are the truly responsible species of the POM's salts catalytic activity and solubility. However, the latter can be reduced by calcining the catalyst previously. Polyoxomolybdates salts generally p...

  13. Aqueous citric acid as green reaction media for the synthesis of octahydroxanthenes

    Directory of Open Access Journals (Sweden)

    Camilo A. Navarro D.

    2013-08-01

    Full Text Available A simple, convenient and environmentally friendly one-pot procedure for the synthesis of 1,8-dioxo-octahydroxanthenes by the reaction of dimedone and aromatic aldehydes in aqueous citric acid is described. In this green synthetic protocol promoted by the reaction media, the use of any other catalysts and hazardous organic solvents are avoided, making the work up procedure greener and easier. The isolation of the products, obtained in good yields, is readily performed by filtration and crystallization from ethanol when required and the aqueous acidic media can be easily recycled and reused several times without significant loss of catalytic activity.

  14. ENANTIOPURE R(--3-AMINOISOBUTYRIC ACID SYNTHESIS USING Pseudomonas aeruginosa AS ENANTIOSPECIFIC BIOCATALYST

    Directory of Open Access Journals (Sweden)

    M. V. C. B. Cortes

    2015-03-01

    Full Text Available Abstract The main goal of this research was the synthesis of enantiopure R(--3-aminoisobutyric acid from dihydrothymine with good yield, high stereospecificity and relative simplicity. Seventy two percent yield of the product was obtained in three steps. Step one consisted of dihydrothymine racemization. Step two was a dihydropyrimidinase reaction involving the Pseudomonas aeruginosa 10145 bacterial strain as the biocatalyst. Step three was performed with a diazotization reaction. The bacteria's enzymes determined the stereochemistry of the process since the diazotization reaction did not interfere at this point. The results of this work provide an interesting method for the production of commercial β-amino acids from other substituteddihydrothymines.

  15. Concise and Straightforward Asymmetric Synthesis of a Cyclic Natural Hydroxy-Amino Acid

    Directory of Open Access Journals (Sweden)

    Mario J. Simirgiotis

    2014-11-01

    Full Text Available An enantioselective total synthesis of the natural amino acid (2S,4R,5R-4,5-di-hydroxy-pipecolic acid starting from D-glucoheptono-1, 4-lactone is presented. The best sequence employed as a key step the intramolecular nucleophilic displacement by an amino function of a 6-O-p-toluene-sulphonyl derivative of a methyl D-arabino-hexonate and involved only 12 steps with an overall yield of 19%. The structures of the compounds synthesized were elucidated on the basis of comprehensive spectroscopic (NMR and MS and computational analysis.

  16. Synthesis and bioactivity of analogues of the marine antibiotic tropodithietic acid

    DEFF Research Database (Denmark)

    Rabe, Patrick; Klapschinski, Tim A.; Brock, Nelson L.

    2014-01-01

    aureus and Vibrio anguillarum for a structure-activity relationship (SAR) study, revealing that the sulfur-free analogue of TDA, tropone-2-carboxylic acid, has an antibiotic activity that is even stronger than the bioactivity of the natural product. The synthesis of this compound and of several analogues......Tropodithietic acid (TDA) is a structurally unique sulfur-containing antibiotic from the Roseobacter clade bacterium Phaeobacter inhibens DSM 17395 and a few other related species. We have synthesised several structural analogues of TDA and used them in bioactivity tests against Staphylococcus...... is presented and the bioactivity of the synthetic compounds is discussed....

  17. Total synthesis of leopolic acid A, a natural 2,3-pyrrolidinedione with antimicrobial activity

    Directory of Open Access Journals (Sweden)

    Atul A. Dhavan

    2016-07-01

    Full Text Available The first total synthesis of leopolic acid A, a fungal metabolite with a rare 2,3-pyrrolidinedione nucleus linked to an ureido dipeptide, was designed and carried out. Crucial steps for the strategy include a Dieckmann cyclization to obtain the 2,3-pyrrolidinedione ring and a Wittig olefination to install the polymethylene chain. An oxazolidinone-containing leopolic acid A analogue was also synthesized. The antibacterial activity showed by both compounds suggests that they could be considered as promising candidates for future developments.

  18. Integrated process of distillation with side reactors for synthesis of organic acid esters

    Energy Technology Data Exchange (ETDEWEB)

    Panchal, Chandrakant B; Prindle, John C; Kolah, Aspri; Miller, Dennis J; Lira, Carl T

    2015-11-04

    An integrated process and system for synthesis of organic-acid esters is provided. The method of synthesizing combines reaction and distillation where an organic acid and alcohol composition are passed through a distillation chamber having a plurality of zones. Side reactors are used for drawing off portions of the composition and then recycling them to the distillation column for further purification. Water is removed from a pre-reactor prior to insertion into the distillation column. An integrated heat integration system is contained within the distillation column for further purification and optimizing efficiency in the obtaining of the final product.

  19. Synthesis of gamma-aminobutyric acid analogs based on carbohydrate scaffolds.

    Science.gov (United States)

    Zhong, Ming; Meng, Xiang-Bao; Li, Zhong-Jun

    2010-06-16

    Gamma-aminobutyric acid analogs based on sugar scaffolds were prepared in six to nine steps starting from D-glucal and D-galactal. The key step in the synthesis is the Vilsmeier-Haack reaction that affords the corresponding 2-C-formyl glycal on treatment with DMF and POCl(3). Oxidation of the aldehyde and reduction of the 4-azido group provided the corresponding GABA analog. Acylamide and tetrazole analogs were also prepared as the bioisosteres of the carboxylic acid. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  20. Oxidation-resistant acidic resins prepared by partial carbonization as cocatalysts in synthesis of adipic acid.

    Science.gov (United States)

    Wei, Huijuan; Li, Hongbian; Liu, Yangqing; Jin, Peng; Wang, Xiangyu; Li, Baojun

    2012-08-01

    The oxidation-resistant acidic resins are of great importance for the catalytic oxidation systems. In this paper, the oxidatively stable acidic resins are obtained from the cation ion exchange resins (CIERs) through the thermal treatment in N(2) atmosphere. The structure and properties of the thermally treated CIERs were characterized by chemical analysis, Fourier transform infrared (FT-IR) spectra, acid capacity measurement and scanning electron microscope (SEM). The thermally treated CIERs possess high acid capacity up to 4.09 mmol g(-1). A partial carbonization is observed in the thermal treatment process of CIERs, but the morphology of resin spheres maintains well. The as-prepared CIERs are used as solid acids to assist the hydrogen peroxide oxidation of cyclohexene to adipic acid (ADA) with tungstic acid as the catalyst precursor. The improved yields of ADA in the recycling reaction are obtained in the presence of acidic CIERs. Meanwhile, the unproductive decomposition of H(2)O(2) is effectively suppressed. The high yields of ADA (about 81%) are kept by the thermally treated CIERs even after the fifth cycle. The thermally treated CIERs exhibit excellent acid-catalytic performance and possess remarkable oxidation-resistant capability.

  1. Green synthesis of carbon dots from pork and application as nanosensors for uric acid detection

    Science.gov (United States)

    Zhao, Chunxi; Jiao, Yang; Hu, Feng; Yang, Yaling

    2018-02-01

    In this work, a green, simple, economical method was developed in the synthesis of fluorescent carbon dots using pork as carbon source. The as-prepared carbon dots exhibit exceptional advantages including high fluorescent quantum yield (17.3%) and satisfactory chemical stability. The fluorescence of carbon dots based nanosensor can be selectively and efficiently quenched by uric acid. This phenomenon was used to develop a fluorescent method for facile detection of uric acid within a linear range of 0.1-100 μM and 100-500 μM, with a detection limit of 0.05 μM (S/N = 3). Finally, the proposed method was successfully applied in the determination of uric acid in human serum and urine samples with satisfactory recoveries, which suggested that the new nanosensors have great prospect toward the detection of uric acid in human fluids.

  2. Synthesis and pharmacology of 3-hydroxy-delta2-isoxazoline-cyclopentane analogues of glutamic acid

    DEFF Research Database (Denmark)

    Conti, P; De Amici, M; Bräuner-Osborne, Hans

    2002-01-01

    The synthesis and pharmacology of two potential glutamic acid receptor ligands are described. Preparation of the bicyclic 3-hydroxy-delta2-isoxazoline-cyclopentane derivatives (+/-)-7 and (+/-)-8 was accomplished via 1,3-dipolar cycloaddition of bromonitrile oxide to suitably protected 1-amino......-cyclopent-3-enecarboxylic acids. Their structure was established using a combination of 1H NMR spectroscopy and molecular mechanics calculations carried out on the intermediate cycloadducts (+/-)-11 and (+/-)-12. Amino acid derivatives (+/-)-7 and (+/-)-8 were assayed at ionotropic and metabotropic glutamic...... acid receptor subtypes and their activity compared with that of trans-ACPD and cis-ACPD. The results show that the replacement of the omega-carboxylic group of the model compounds with the 3-hydroxy-delta2-isoxazoline moiety abolishes or reduces drastically the activity at the metabotropic glutamate...

  3. A new synthesis of [3-11C]pyruvic acid using alanine racemase

    International Nuclear Information System (INIS)

    Ikemoto, M.; Okamoto, E.; Sasaki, M.; Haradahira, T.; Omura, H.; Furuya, Y.; Suzuki, K.; Watanabe, Y.

    1998-01-01

    The synthesis of [3- 11 C]pyruvic acid was attempted by two reaction systems (A: alanine racemase and D-amino acid oxidase, B: alanine racemase and L-alanine dehydrogenase) utilizing a new thermostable enzyme, alanine racemase. Conversion rates from D,L-[3- 11 C]alanine to [3- 11 C]pyruvic acid were almost 100% in both methods. Similar results were obtained with immobilized enzymes packed in a single column. Furthermore, the same column could be used repeatedly without a remarkable decrease of the [3- 11 C]pyruvic acid yield. Various matrices were tested for the immobilizing enzyme, and Aminopropyl-CPG was concluded to be the most suitable since the loss of the enzyme activity was the least in the studied matrices

  4. A Novel and Highly Regioselective Synthesis of New Carbamoylcarboxylic Acids from Dianhydrides

    Science.gov (United States)

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A.; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario

    2014-01-01

    A regioselective synthesis has been developed for the preparation of a series of N,N′-disubstituted 4,4′-carbonylbis(carbamoylbenzoic) acids and N,N′-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3′,4,4′-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT). All products were characterized by NMR, FTIR, and MS. PMID:24511299

  5. A Novel and Highly Regioselective Synthesis of New Carbamoylcarboxylic Acids from Dianhydrides

    Directory of Open Access Journals (Sweden)

    Adrián Ochoa-Terán

    2014-01-01

    Full Text Available A regioselective synthesis has been developed for the preparation of a series of N,N′-disubstituted 4,4′-carbonylbis(carbamoylbenzoic acids and N,N′-disubstituted bis(carbamoyl terephthalic acids by treatment of 3,3′,4,4′-benzophenonetetracarboxylic dianhydride (1 and 1,2,4,5-benzenetetracarboxylic dianhydride (2 with arylalkyl primary amines (A-N. The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT. All products were characterized by NMR, FTIR, and MS.

  6. Selective conversion of cellulose to levulinic acid via microwave-assisted synthesis in ionic liquids.

    Science.gov (United States)

    Ren, Huifang; Zhou, Yonggui; Liu, Li

    2013-02-01

    A highly selective approach to produce levulinic acid from cellulose was developed via microwave-assisted synthesis in SO3H-functionalized ionic liquids (SFILs). The effects of reaction conditions and ionic liquid structures on the yield of levulinic acid have been investigated, where the highest yield of 55.0% was obtained. The catalytic activities of SFILs depend on the anions and decrease in the order: HSO4->CH3SO3->H2PO4-, which is in good agreement with their acidity order. The SFILs are efficient catalysts for cellulose conversion into levulinic acid and the subsequent esterification, which facilitates the separation of product and reuse of ionic liquids. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. Effect of amino acids on the repression of alkaline protease synthesis in haloalkaliphilic Nocardiopsis dassonvillei

    Directory of Open Access Journals (Sweden)

    Amit K. Sharma

    2016-12-01

    Full Text Available A newly isolated salt-tolerant alkaliphilic actinomycete, Nocardiopsis dassonvillei strain OK-18 grows on mineral salts medium with glucose as carbon source. It also grows and produces protease with amino acids as sole carbon source. The synthesis of extracellular alkaline protease parallel to growth was repressible by substrate concentrations. The absolute production of the protease was delinked with growth under nutritional stress, as protease production was high, despite poor growth. When amino acids served as the sole source of carbon and nitrogen, the enzyme production was significantly controlled by the number of amino acids. Maximal protease production was achieved with proline, asparagine, tyrosine, alanine, methionine and valine as sole source of carbon and nitrogen in minimal medium. With the increasing number of different amino acids in the presence and absence of glucose, the protease production was synergistically lower as compared to complex medium.

  8. Synthesis of nalidixic acid based hydrazones as novel pesticides.

    Science.gov (United States)

    Aggarwal, Nisha; Kumar, Rajesh; Srivastva, Chitra; Dureja, Prem; Khurana, J M

    2010-03-10

    Thirty-one substituted hydrazones of nalidixic acid hydrazide were synthesized and characterized by spectral techniques. These compounds were evaluated for various biological activities, namely, fungicidal, insecticidal, and nitrification inhibitory activities. The antifungal activity was evaluated against five pathogenic fungi, namely, Rhizoctonia bataticola , Sclerotium rolfsii , Rhizoctonia solani , Fusarium oxysporum , and Alternaria porii . They showed maximum inihibition against A. porii with ED(50) = 34.2-151.3 microg/mL. The activity was comparable to that of a commercial fungicide, hexaconazole (ED(50) = 25.4 microg/mL). They were also screened for insecticidal activity against third-instar larvae of Spodoptera litura and adults of Callosobruchus maculatus and Tribollium castaneum . Most of them showed 70-100% mortality against S. litura through feeding method at 0.1% dose. These compounds were not found to be effective nitrification inhibitors.

  9. Insulin-independent regulation of hepatic triglyceride synthesis by fatty acids.

    Science.gov (United States)

    Vatner, Daniel F; Majumdar, Sachin K; Kumashiro, Naoki; Petersen, Max C; Rahimi, Yasmeen; Gattu, Arijeet K; Bears, Mitchell; Camporez, João-Paulo G; Cline, Gary W; Jurczak, Michael J; Samuel, Varman T; Shulman, Gerald I

    2015-01-27

    A central paradox in type 2 diabetes is the apparent selective nature of hepatic insulin resistance--wherein insulin fails to suppress hepatic glucose production yet continues to stimulate lipogenesis, resulting in hyperglycemia, hyperlipidemia, and hepatic steatosis. Although efforts to explain this have focused on finding a branch point in insulin signaling where hepatic glucose and lipid metabolism diverge, we hypothesized that hepatic triglyceride synthesis could be driven by substrate, independent of changes in hepatic insulin signaling. We tested this hypothesis in rats by infusing [U-(13)C] palmitate to measure rates of fatty acid esterification into hepatic triglyceride while varying plasma fatty acid and insulin concentrations independently. These experiments were performed in normal rats, high fat-fed insulin-resistant rats, and insulin receptor 2'-O-methoxyethyl chimeric antisense oligonucleotide-treated rats. Rates of fatty acid esterification into hepatic triglyceride were found to be dependent on plasma fatty acid infusion rates, independent of changes in plasma insulin concentrations and independent of hepatocellular insulin signaling. Taken together, these results obviate a paradox of selective insulin resistance, because the major source of hepatic lipid synthesis, esterification of preformed fatty acids, is primarily dependent on substrate delivery and largely independent of hepatic insulin action.

  10. Δ(9)-Tetrahydrocannabinolic acid synthase production in Pichia pastoris enables chemical synthesis of cannabinoids.

    Science.gov (United States)

    Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K

    2015-10-10

    Δ(9)-Tetrahydrocannabinol (THC) is of increasing interest as a pharmaceutical and bioactive compound. Chemical synthesis of THC uses a laborious procedure and does not satisfy the market demand. The implementation of biocatalysts for specific synthesis steps might be beneficial for making natural product availability independent from the plant. Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from C. sativa L. catalyzes the cyclization of cannabigerolic acid (CBGA) to Δ(9)-tetrahydrocannabinolic acid (THCA), which is non-enzymatically decarboxylated to THC. We report the preparation of THCAS in amounts sufficient for the biocatalytic production of THC(A). Active THCAS was most efficiently obtained from Pichia pastoris. THCAS was produced on a 2L bioreactor scale and the enzyme was isolated by single-step chromatography with a specific activity of 73Ug(-1)total protein. An organic/aqueous two-liquid phase setup for continuous substrate delivery facilitated in situ product removal. In addition, THCAS activity in aqueous environments lasted for only 20min whereas the presence of hexane stabilized the activity over 3h. In conclusion, production of THCAS in P. pastoris Mut(S) KM71 KE1, subsequent isolation, and its application in a two-liquid phase setup enables the synthesis of THCA on a mg scale. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. The effects of borate minerals on the synthesis of nucleic acid bases, amino acids and biogenic carboxylic acids from formamide.

    Science.gov (United States)

    Saladino, Raffaele; Barontini, Maurizio; Cossetti, Cristina; Di Mauro, Ernesto; Crestini, Claudia

    2011-08-01

    The thermal condensation of formamide in the presence of mineral borates is reported. The products afforded are precursors of nucleic acids, amino acids derivatives and carboxylic acids. The efficiency and the selectivity of the reaction was studied in relation to the elemental composition of the 18 minerals analyzed. The possibility of synthesizing at the same time building blocks of both genetic and metabolic apparatuses, along with the production of amino acids, highlights the interest of the formamide/borate system in prebiotic chemistry.

  12. Sequential enzymatic synthesis and separation of 13N-L-glutamic acid and 13N-L-alanine

    International Nuclear Information System (INIS)

    Cohen, M.B.; Spolter, L.; MacDonald, M.; Chang, C.C.; Takahashi, J.

    1975-01-01

    The sequential enzymatic synthesis and separation of 13 N-L-glutamic acid and 13 N-L-alanine are described. Basically, that involves the synthesis of 13 N-L-glutamic acid by one enzyme, the transamination of the labeled glutamic acid to form 13 N-L-alanine by a second enzyme, and the separation of the two amino acids by rapid column chromatography. The 13 N-L-alanine was evaluated in animals by imaging and tissue distribution studies and showed good potential as a pancreatic imaging agent

  13. Characterisation of an Arabidopsis-Leptosphaeria maculans pathosystem: resistance partially requires camalexin biosynthesis and is independent of salicylic acid, ethylene and jasmonic acid signalling.

    Science.gov (United States)

    Bohman, Svante; Staal, Jens; Thomma, Bart P H J; Wang, Maolin; Dixelius, Christina

    2004-01-01

    Out of 168 Arabidopsis accessions screened with isolates of Leptosphaeria maculans, one (An-1) showed clear disease symptoms. In order to identify additional components involved in containment of L. maculans in Arabidopsis, a screen for L. maculans-susceptible (lms) mutants was performed. Eleven lms mutants were isolated, which displayed differential susceptibility responses to L. maculans. lms1 was crossed with Columbia (Col-0) and Ws-0, and mapping data for both populations showed the highest linkage to a region on chromosome 2. Reduced levels of PR-1 and PDF1.2 expression were found in lms1 compared to wild-type plants 48 h after pathogen inoculation. In contrast, the lms1 mutant displayed upregulation of either marker gene upon chemical treatment, possibly as an effect of an altered ethylene (ET) response. To assess the contribution of different defence pathways, genotypes implicated in salicylic acid (SA) signalling plants expressing the bacterial salicylate hydroxylase (nahG) gene, non-expressor of PR1 (npr1)-1 and phytoalexin-deficient (pad4-1), jasmonic acid (JA) signalling (coronatine insensitive (coi)1-16, enhanced disease susceptibility (eds)8-1 and jasmonic acid resistant (jar)1-1) and ET signalling (eds4-1, ethylene insensitive (ein)2, ein3-1 and ethylene resistant (etr)1-1) were screened. All the genotypes screened were as resistant as wild-type plants, demonstrating the dispensability of the pathways in L. maculans resistance. When mutants implicated in cell death responses were assayed, responsive to antagonist 1 (ran1)-1 exhibited a weak susceptible phenotype, whereas accelerated cell death (acd)1-20 showed a rapid lesion development. Camalexin is only partially responsible for L. maculans containment in Arabidopsis, as pad3-1 and enhanced susceptibility to Alternaria (esa)1 clearly showed a susceptible response while wild-type levels of camalexin were present in An-1 and lms1. The data presented point to the existence of multiple defence

  14. Oxidative cleavage of erucic acid for the synthesis of brassylic acid

    Energy Technology Data Exchange (ETDEWEB)

    Mohammed J. Nasrullah; Pooja Thapliyal; Erica N. Pfarr; Nicholas S. Dusek; Kristofer L. Schiele; James A. Bahr

    2010-10-29

    The main focus of this work is to synthesize Brassylic Acid (BA) using oxidative cleavage of Erucic Acid (EA). Crambe (Crambe abyssinica) is an industrial oilseed grown in North Dakota. Crambe has potential as an industrial fatty acid feedstock as a source of Erucic acid (EA). It has approximately 50-60 % of EA, a C{sub 22} monounsaturated fatty acid. Oxidative cleavage of unsaturated fatty acids derived from oilseeds produces long chain (9, 11, and 13 carbon atoms) dibasic and monobasic acids. These acids are known commercial feedstocks for the preparation of nylons, polyesters, waxes, surfactants, and perfumes. Other sources of EA are Rapeseed seed oil which 50-60 % of EA. Rapeseed is grown outside USA. The oxidative cleavage of EA was done using a high throughput parallel pressure reactor system. Kinetics of the reaction shows that BA yields reach a saturation at 12 hours. H{sub 2}WO{sub 4} was found to be the best catalyst for the oxidative cleavage of EA. High yields of BA were obtained at 80 C with bubbling of O{sub 2} or 10 bar of O{sub 2} for 12 hours.

  15. Ionotropic excitatory amino acid receptor ligands. Synthesis and pharmacology of a new amino acid AMPA antagonist

    DEFF Research Database (Denmark)

    Madsen, U; Sløk, F A; Stensbøl, T B

    2000-01-01

    We have previously described the potent and selective (RS)-2-amino-3-(3-hydroxy-5-methyl-4-isoxazolyl)propionic acid (AMPA) receptor agonist, (RS)-2-amino-3-(3-carboxy-5-methyl-4-isoxazolyl)propionic acid (ACPA), and the AMPA receptor antagonist (RS)-2-amino-3-[3-(carboxymethoxy)-5-methyl-4......-isoxazolyl]propionic acid (AMOA). Using these AMPA receptor ligands as leads, a series of compounds have been developed as tools for further elucidation of the structural requirements for activation and blockade of AMPA receptors. The synthesized compounds have been tested for activity at ionotropic...... excitatory amino acid (EAA) receptors using receptor binding and electrophysiological techniques, and for activity at metabotropic EAA receptors using second messenger assays. Compounds 1 and 4 were essentially inactive. (RS)-2-Amino-3-[3-(2-carboxyethyl)-5-methyl-4-isoxazolyl]propionic acid (ACMP, 2...

  16. Synthesis of (S)-2-Boc-Amino-8-(R)-(tert-butyldimethylsilanyloxy) decanoic acid, a Precursor to the Unusual Amino Acid Residue of the Anticancer Agent Microsporin B

    OpenAIRE

    Gu, Wenxin; Silverman, Richard B.

    2011-01-01

    (S)-2-Boc-Amino-8-(R)-(tert-butyldimethylsilanyloxy) decanoic acid, the Boc-protected precursor of an unusual amino acid residue for the synthesis of microsporin B, was synthesized. The key steps include a Suzuki coupling followed by asymmetric homogeneous hydrogenation.

  17. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    Science.gov (United States)

    Moens, Luc

    1999-01-01

    A process of preparing an acid addition salt of delta-aminolevulinic acid comprising: dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures thereof to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing said alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  18. Neptunium salts with certain acetic acid derivatives, synthesis and properties

    International Nuclear Information System (INIS)

    Charushnikova, I.A.; Afonas'eva, T.V.; Krot, N.N.

    1995-01-01

    A study was performed to develop preparation of neptunium (V) salts with aminoacetic, glycolic, and trichloroacetic acids. Crystalline NpO 2 (CH 2 OHCOO). H 2 O (I) and NpO 2 (CC1 3 COO).H 2 O (II) were synthesized. Their lattice parameters [I: rhombic, a = 13.440(2), b = 8.755(2), c = 5.711(1) Angstrom; II; monoclinic, a - 12.836(4), b = 11.308(3), c = 5.875(1) Angstrom,β - 99.83(4)degrees] were determined, and IR and electronic absorption spectra were measured. The main band of NpO + 2 ion (980 nm) is electronic absorption spectra of I and II is shifted toward longer waves by 16 and 21 nm, indicating cation-cation interactions in the lattice. Behavior of the compounds at heating in air was studied. Compound I loses water in the 200-350 degrees C range with simultaneous decomposition to NpO 2 . At 210 degrees C, compound II is converted into intermediate NpOC1 2 , which then decomposes to NpO 2 . Main physiochemical properties of I and II were compared with properties of Np(V) acetate

  19. A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid

    Energy Technology Data Exchange (ETDEWEB)

    Arceo, Elena; Ellman, Jonathan; Bergman, Robert

    2010-05-03

    An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

  20. Increasing the fidelity of noncanonical amino acid incorporation in cell-free protein synthesis.

    Science.gov (United States)

    Gan, Qinglei; Fan, Chenguang

    2017-11-01

    Cell-free protein synthesis provides a robust platform for co-translational incorporation of noncanonical amino acid (ncAA) into proteins to facilitate biological studies and biotechnological applications. Recently, eliminating the activity of release factor 1 has been shown to increase ncAA incorporation in response to amber codons. However, this approach could promote mis-incorporation of canonical amino acids by near cognate suppression. We performed a facile protocol to remove near cognate tRNA isoacceptors of the amber codon from total tRNAs, and used the phosphoserine (Sep) incorporation system as validation. By manipulating codon usage of target genes and tRNA species introduced into the cell-free protein synthesis system, we increased the fidelity of Sep incorporation at a specific position. By removing three near cognate tRNA isoacceptors of the amber stop codon [tRNA Lys , tRNA Tyr , and tRNA Gln (CUG)] from the total tRNA, the near cognate suppression decreased by 5-fold without impairing normal protein synthesis in the cell-free protein synthesis system. Mass spectrometry analyses indicated that the fidelity of ncAA incorporation was improved. Removal of near cognate tRNA isoacceptors of the amber codon could increase ncAA incorporation fidelity towards the amber stop codon in release factor deficiency systems. We provide a general strategy to improve fidelity of ncAA incorporation towards stop, quadruplet and sense codons in cell-free protein synthesis systems. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2016 Elsevier B.V. All rights reserved.